WorldWideScience

Sample records for aldo-keto reductase 1c

  1. Berberine inhibits androgen synthesis by interaction with aldo-keto reductase 1C3 in 22Rv1 prostate cancer cells.

    Science.gov (United States)

    Tian, Yuantong; Zhao, Lijing; Wang, Ye; Zhang, Haitao; Xu, Duo; Zhao, Xuejian; Li, Yi; Li, Jing

    2016-01-01

    Aldo-keto reductase family 1 member C3 has recently been regarded as a potential therapeutic target in castrate-resistant prostate cancer. Herein, we investigated whether berberine delayed the progression of castrate-resistant prostate cancer by reducing androgen synthesis through the inhibition of Aldo-keto reductase family 1 member C3. Cell viability and cellular testosterone content were measured in prostate cancer cells. Aldo-keto reductase family 1 member C3 mRNA and protein level were detected by RT-PCR and Western bolt analyses, respectively. Computer analysis with AutoDock Tools explored the molecular interaction of berberine with Aldo-keto reductase family 1 member C3. We found that berberine inhibited 22Rv1 cells proliferation and decreased cellular testosterone formation in a dose-dependent manner. Berberine inhibited Aldo-keto reductase family 1 member C3 enzyme activity, rather than influenced mRNA and protein expressions. Molecular docking study demonstrated that berberine could enter the active center of Aldo-keto reductase family 1 member C3 and form p-p interaction with the amino-acid residue Phe306 and Phe311. In conclusion, the structural interaction of berberine with Aldo-keto reductase family 1 member C3 is attributed to the suppression of Aldo-keto reductase family 1 member C3 enzyme activity and the inhibition of 22Rv1 prostate cancer cell growth by decreasing the intracellular androgen synthesis. Our result provides the experimental basis for the design, research, and development of AKR1C3 inhibitors using berberine as the lead compound. PMID:26698234

  2. Pyrithione-based ruthenium complexes as inhibitors of aldo-keto reductase 1C enzymes and anticancer agents.

    Science.gov (United States)

    Kljun, Jakob; Anko, Maja; Traven, Katja; Sinreih, Maša; Pavlič, Renata; Peršič, Špela; Ude, Žiga; Codina, Elisa Esteve; Stojan, Jure; Lanišnik Rižner, Tea; Turel, Iztok

    2016-08-01

    Four ruthenium complexes of clinically used zinc ionophore pyrithione and its oxygen analog 2-hydroxypyridine N-oxide were prepared and evaluated as inhibitors of enzymes of the aldo-keto reductase subfamily 1C (AKR1C). A kinetic study assisted with docking simulations showed a mixed type of inhibition consisting of a fast reversible and a slow irreversible step in the case of both organometallic compounds 1A and 1B. Both compounds also showed a remarkable selectivity towards AKR1C1 and AKR1C3 which are targets for breast cancer drug design. The organoruthenium complex of ligand pyrithione as well as pyrithione itself also displayed toxicity on the hormone-dependent MCF-7 breast cancer cell line with EC50 values in the low micromolar range. PMID:27357845

  3. Characterization of the aldo-keto reductase 1C gene cluster on pig chromosome 10: possible associations with reproductive traits

    OpenAIRE

    Nonneman Dan J; Wise Tommy H; Ford J Joe; Kuehn Larry A; Rohrer Gary A

    2006-01-01

    Abstract Background The rate of pubertal development and weaning to estrus interval are correlated and affect reproductive efficiency of swine. Quantitative trait loci (QTL) for age of puberty, nipple number and ovulation rate have been identified in Meishan crosses on pig chromosome 10q (SSC10) near the telomere, which is homologous to human chromosome 10p15 and contains an aldo-keto reductase (AKR) gene cluster with at least six family members. AKRs are tissue-specific hydroxysteroid dehydr...

  4. Anthracycline resistance mediated by reductive metabolism in cancer cells: The role of aldo-keto reductase 1C3

    Energy Technology Data Exchange (ETDEWEB)

    Hofman, Jakub; Malcekova, Beata; Skarka, Adam; Novotna, Eva; Wsol, Vladimir, E-mail: wsol@faf.cuni.cz

    2014-08-01

    Pharmacokinetic drug resistance is a serious obstacle that emerges during cancer chemotherapy. In this study, we investigated the possible role of aldo-keto reductase 1C3 (AKR1C3) in the resistance of cancer cells to anthracyclines. First, the reducing activity of AKR1C3 toward anthracyclines was tested using incubations with a purified recombinant enzyme. Furthermore, the intracellular reduction of daunorubicin and idarubicin was examined by employing the transfection of A549, HeLa, MCF7 and HCT 116 cancer cells with an AKR1C3 encoding vector. To investigate the participation of AKR1C3 in anthracycline resistance, we conducted MTT cytotoxicity assays with these cells, and observed that AKR1C3 significantly contributes to the resistance of cancer cells to daunorubicin and idarubicin, whereas this resistance was reversible by the simultaneous administration of 2′-hydroxyflavanone, a specific AKR1C3 inhibitor. In the final part of our work, we tracked the changes in AKR1C3 expression after anthracycline exposure. Interestingly, a reciprocal correlation between the extent of induction and endogenous levels of AKR1C3 was recorded in particular cell lines. Therefore, we suggest that the induction of AKR1C3 following exposure to daunorubicin and idarubicin, which seems to be dependent on endogenous AKR1C3 expression, eventually might potentiate an intrinsic resistance given by the normal expression of AKR1C3. In conclusion, our data suggest a substantial impact of AKR1C3 on the metabolism of daunorubicin and idarubicin, which affects their pharmacokinetic and pharmacodynamic behavior. In addition, we demonstrate that the reduction of daunorubicin and idarubicin, which is catalyzed by AKR1C3, contributes to the resistance of cancer cells to anthracycline treatment. - Highlights: • Metabolism of anthracyclines by AKR1C3 was studied at enzyme and cellular levels. • Anthracycline resistance mediated by AKR1C3 was demonstrated in cancer cells. • Induction of AKR1C3

  5. Anthracycline resistance mediated by reductive metabolism in cancer cells: The role of aldo-keto reductase 1C3

    International Nuclear Information System (INIS)

    Pharmacokinetic drug resistance is a serious obstacle that emerges during cancer chemotherapy. In this study, we investigated the possible role of aldo-keto reductase 1C3 (AKR1C3) in the resistance of cancer cells to anthracyclines. First, the reducing activity of AKR1C3 toward anthracyclines was tested using incubations with a purified recombinant enzyme. Furthermore, the intracellular reduction of daunorubicin and idarubicin was examined by employing the transfection of A549, HeLa, MCF7 and HCT 116 cancer cells with an AKR1C3 encoding vector. To investigate the participation of AKR1C3 in anthracycline resistance, we conducted MTT cytotoxicity assays with these cells, and observed that AKR1C3 significantly contributes to the resistance of cancer cells to daunorubicin and idarubicin, whereas this resistance was reversible by the simultaneous administration of 2′-hydroxyflavanone, a specific AKR1C3 inhibitor. In the final part of our work, we tracked the changes in AKR1C3 expression after anthracycline exposure. Interestingly, a reciprocal correlation between the extent of induction and endogenous levels of AKR1C3 was recorded in particular cell lines. Therefore, we suggest that the induction of AKR1C3 following exposure to daunorubicin and idarubicin, which seems to be dependent on endogenous AKR1C3 expression, eventually might potentiate an intrinsic resistance given by the normal expression of AKR1C3. In conclusion, our data suggest a substantial impact of AKR1C3 on the metabolism of daunorubicin and idarubicin, which affects their pharmacokinetic and pharmacodynamic behavior. In addition, we demonstrate that the reduction of daunorubicin and idarubicin, which is catalyzed by AKR1C3, contributes to the resistance of cancer cells to anthracycline treatment. - Highlights: • Metabolism of anthracyclines by AKR1C3 was studied at enzyme and cellular levels. • Anthracycline resistance mediated by AKR1C3 was demonstrated in cancer cells. • Induction of AKR1C3

  6. Characterization of the aldo-keto reductase 1C gene cluster on pig chromosome 10: possible associations with reproductive traits

    Directory of Open Access Journals (Sweden)

    Nonneman Dan J

    2006-09-01

    Full Text Available Abstract Background The rate of pubertal development and weaning to estrus interval are correlated and affect reproductive efficiency of swine. Quantitative trait loci (QTL for age of puberty, nipple number and ovulation rate have been identified in Meishan crosses on pig chromosome 10q (SSC10 near the telomere, which is homologous to human chromosome 10p15 and contains an aldo-keto reductase (AKR gene cluster with at least six family members. AKRs are tissue-specific hydroxysteroid dehydrogenases that interconvert weak steroid hormones to their more potent counterparts and regulate processes involved in development, homeostasis and reproduction. Because of their location in the swine genome and their implication in reproductive physiology, this gene cluster was characterized and evaluated for effects on reproductive traits in swine. Results Screening the porcine CHORI-242 BAC library with a full-length AKR1C4 cDNA identified 7 positive clones and sample sequencing of 5 BAC clones revealed 5 distinct AKR1C genes (AKR1CL2 and AKR1C1 through 4, which mapped to 126–128 cM on SSC10. Using the IMpRH7000rad and IMNpRH212000rad radiation hybrid panels, these 5 genes mapped between microsatellite markers SWR67 and SW2067. Comparison of sequence data with the porcine BAC fingerprint map show that the cluster of genes resides in a 300 kb region. Twelve SNPs were genotyped in gilts observed for age at first estrus and ovulation rate from the F8 and F10 generations of one-quarter Meishan descendants of the USMARC resource population. Age at puberty, nipple number and ovulation rate data were analyzed for association with genotypes by MTDFREML using an animal model. One SNP, a phenylalanine to isoleucine substitution in AKR1C2, was associated with age of puberty (p = 0.07 and possibly ovulation rate (p = 0.102. Two SNP in AKR1C4 were significantly associated with nipple number (p ≤ 0.03 and another possibly associated with age at puberty (p = 0

  7. Characterization of hamster NAD+-dependent 3(17)β-hydroxysteroid dehydrogenase belonging to the aldo-keto reductase 1C subfamily.

    Science.gov (United States)

    Endo, Satoshi; Noda, Misato; Ikari, Akira; Tatematsu, Kenjiro; El-Kabbani, Ossama; Hara, Akira; Kitade, Yukio; Matsunaga, Toshiyuki

    2015-11-01

    The cDNAs for morphine 6-dehydrogenase (AKR1C34) and its homologous aldo-keto reductase (AKR1C35) were cloned from golden hamster liver, and their enzymatic properties and tissue distribution were compared. AKR1C34 and AKR1C35 similarly oxidized various xenobiotic alicyclic alcohols using NAD(+), but differed in their substrate specificity for hydroxysteroids and inhibitor sensitivity. While AKR1C34 showed 3α/17β/20α-hydroxysteroid dehydrogenase activities, AKR1C35 efficiently oxidized various 3β- and 17β-hydroxysteroids, including biologically active 3β-hydroxy-5α/β-dihydro-C19/C21-steroids, dehydroepiandrosterone and 17β-estradiol. AKR1C35 also differed from AKR1C34 in its high sensitivity to flavonoids, which inhibited competitively with respect to 17β-estradiol (Ki 0.11-0.69 μM). The mRNA for AKR1C35 was expressed liver-specific in male hamsters and ubiquitously in female hamsters, whereas the expression of the mRNA for AKR1C34 displayed opposite sexual dimorphism. Because AKR1C35 is the first 317Β-HYDROXYSTEROID DEHYDROGENASE IN THE AKR SUPERFAMILY: , we also investigated the molecular determinants for the 3β-hydroxysteroid dehydrogenase activity by replacement of Val54 and Cys310 in AKR1C35 with the corresponding residues in AKR1C34, Ala and Phe, respectively. The mutation of Val54Ala, but not Cys310Phe, significantly impaired this activity, suggesting that Val54 plays a critical role in recognition of the steroidal substrate. PMID:26002966

  8. Aldo-keto reductase (AKR) superfamily: Genomics and annotation

    OpenAIRE

    Mindnich Rebekka D; Penning Trevor M

    2009-01-01

    Abstract Aldo-keto reductases (AKRs) are phase I metabolising enzymes that catalyse the reduced nicotinamide adenine dinucleotide (phosphate) (NAD(P)H)-dependent reduction of carbonyl groups to yield primary and secondary alcohols on a wide range of substrates, including aliphatic and aromatic aldehydes and ketones, ketoprostaglan-dins, ketosteroids and xenobiotics. In so doing they functionalise the carbonyl group for conjugation (phase II enzyme reactions). Although functionally diverse, AK...

  9. Expression of aldo-keto reductase family 1 member C1 (AKR1C1 gene in porcine ovary and uterine endometrium during the estrous cycle and pregnancy

    Directory of Open Access Journals (Sweden)

    Hwang Sue-Yun

    2011-10-01

    Full Text Available Abstract Background The aldo-keto reductase family 1 member C1 (AKR1C1 belongs to a superfamily of NADPH-dependent reductases that convert a wide range of substrates, including carbohydrates, steroid hormones, and endogenous prostaglandins. The 20alpha-hydroxysteroid dehydrogenase (20alpha-HSD is a member of AKR family. The aims of this study were to determine its expression in the ovary and uterus endometrium during the estrous cycle and pregnancy. Methods Rapid amplification of cDNA ends (RACE experiments were performed to obtain the 5' and 3' ends of the porcine 20alpha-HSD cDNA. Reverse-transcriptase-PCR (RT-PCR, real-time PCR, northern blot analysis, and western blot analysis were performed to examine the expression of porcine 20alpha-HSD. Immunohistochemical analysis was also performed to determine the localization in the ovary. Results The porcine 20alpha-HSD cDNA is 957 bp in length and encodes a protein of 319 amino acids. The cloned cDNA was virtually the same as the porcine AKR1C1 gene (337 amino acids reported recently, and only differed in the C-terminal region (the AKR1C1 gene has a longer C-terminal region than our sequence. The 20alpha-HSD gene (from now on referred to as AKR1C1 cloned in this paper encodes a deletion of 4 amino acids, compared with the C-terminal region of AKR1C1 genes from other animals. Porcine AKR1C1 mRNA was expressed on day 5, 10, 12, 15 of the cycle and 0-60 of pregnancy in the ovary. The mRNA was also specifically detected in the uterine endometrium on day 30 of pregnancy. Western blot analysis indicated that the pattern of AKR1C1 protein in the ovary during the estrous cycle and uterus during early pregnancy was similar to that of AKR1C1 mRNA expression. The recombinant protein produced in CHO cells was detected at approximately 37 kDa. Immunohistochemical analysis also revealed that pig AKR1C1 protein was localized in the large luteal cells in the early stages of the estrous cycle and before parturition

  10. Aldo-keto reductase (AKR) superfamily: genomics and annotation.

    Science.gov (United States)

    Mindnich, Rebekka D; Penning, Trevor M

    2009-07-01

    Aldo-keto reductases (AKRs) are phase I metabolising enzymes that catalyse the reduced nicotinamide adenine dinucleotide (phosphate) (NAD(P)H)-dependent reduction of carbonyl groups to yield primary and secondary alcohols on a wide range of substrates, including aliphatic and aromatic aldehydes and ketones, ketoprostaglandins, ketosteroids and xenobiotics. In so doing they functionalise the carbonyl group for conjugation (phase II enzyme reactions). Although functionally diverse, AKRs form a protein superfamily based on their high sequence identity and common protein fold, the (alpha/beta) 8 -barrel structure. Well over 150 AKR enzymes, from diverse organisms, have been annotated so far and given systematic names according to a nomenclature that is based on multiple protein sequence alignment and degree of identity. Annotation of non-vertebrate AKRs at the National Center for Biotechnology Information or Vertebrate Genome Annotation (vega) database does not often include the systematic nomenclature name, so the most comprehensive overview of all annotated AKRs is found on the AKR website (http://www.med.upenn.edu/akr/). This site also hosts links to more detailed and specialised information (eg on crystal structures, gene expression and single nucleotide polymorphisms [SNPs]). The protein-based AKR nomenclature allows unambiguous identification of a given enzyme but does not reflect the wealth of genomic and transcriptomic variation that exists in the various databases. In this context, identification of putative new AKRs and their distinction from pseudogenes are challenging. This review provides a short summary of the characteristic features of AKR biochemistry and structure that have been reviewed in great detail elsewhere, and focuses mainly on nomenclature and database entries of human AKRs that so far have not been subject to systematic annotation. Recent developments in the annotation of SNP and transcript variance in AKRs are also summarised. PMID:19706366

  11. Aldo-keto reductase (AKR superfamily: Genomics and annotation

    Directory of Open Access Journals (Sweden)

    Mindnich Rebekka D

    2009-07-01

    Full Text Available Abstract Aldo-keto reductases (AKRs are phase I metabolising enzymes that catalyse the reduced nicotinamide adenine dinucleotide (phosphate (NAD(PH-dependent reduction of carbonyl groups to yield primary and secondary alcohols on a wide range of substrates, including aliphatic and aromatic aldehydes and ketones, ketoprostaglan-dins, ketosteroids and xenobiotics. In so doing they functionalise the carbonyl group for conjugation (phase II enzyme reactions. Although functionally diverse, AKRs form a protein superfamily based on their high sequence identity and common protein fold, the (α/(β8-barrel structure. Well over 150 AKR enzymes, from diverse organisms, have been annotated so far and given systematic names according to a nomenclature that is based on multiple protein sequence alignment and degree of identity. Annotation of non-vertebrate AKRs at the National Center for Biotechnology Information or Vertebrate Genome Annotation (vega database does not often include the systematic nomenclature name, so the most comprehensive overview of all annotated AKRs is found on the AKR website (http://www.med.upenn.edu/akr/. This site also hosts links to more detailed and specialised information (eg on crystal structures, gene expression and single nucleotide polymorphisms [SNPs]. The protein-based AKR nomenclature allows unambiguous identification of a given enzyme but does not reflect the wealth of genomic and transcriptomic variation that exists in the various databases. In this context, identification of putative new AKRs and their distinction from pseudogenes are challenging. This review provides a short summary of the characteristic features of AKR biochemistry and structure that have been reviewed in great detail elsewhere, and focuses mainly on nomenclature and database entries of human AKRs that so far have not been subject to systematic annotation. Recent developments in the annotation of SNP and transcript variance in AKRs are also summarised.

  12. BIOLOGICAL ROLE OF ALDO-KETO REDUCTASES IN RETINOIC ACID BIOSYNTHESIS AND SIGNALING

    Directory of Open Access Journals (Sweden)

    F. Xavier eRuiz

    2012-04-01

    Full Text Available Several aldo-keto reductase (AKR enzymes from subfamilies 1B and 1C show retinaldehyde reductase activity, having low Km and kcat values. Only AKR1B10 and 1B12, with all-trans-retinaldehyde, and AKR1C3, with 9-cis-retinaldehyde, display high catalytic efficiency. Major structural determinants for retinaldehyde isomer specificity are located in the external loops (A and C for AKR1B10, and B for AKR1C3, as assessed by site-directed mutagenesis and molecular dynamics. Cellular models have shown that AKR1B and 1C enzymes are well suited to work in vivo as retinaldehyde reductases and to regulate retinoic acid (RA biosynthesis at hormone pre-receptor level. An additional physiological role for the retinaldehyde reductase activity of these enzymes, consistent with their tissue localization, is their participation in β-carotene absorption. Retinaldehyde metabolism may be subjected to subcellular compartmentalization, based on enzyme localization. While retinaldehyde oxidation to RA takes place in the cytosol, reduction to retinol could take place in the cytosol by AKRs or in the membranes of endoplasmic reticulum by microsomal retinaldehyde reductases. Upregulation of some AKR1 enzymes in different cancer types may be linked to their induction by oxidative stress and to their participation in different signaling pathways related to cell proliferation. AKR1B10 and AKR1C3, through their retinaldehyde reductase activity, trigger a decrease in the RA biosynthesis flow, resulting in RA deprivation and consequently lower differentiation, with an increased cancer risk in target tissues. Rational design of selective AKR inhibitors could lead to development of novel drugs for cancer treatment as well as reduction of chemotherapeutic drug resistance.

  13. Aldo keto reductases 1B in endocrinology and metabolism

    Directory of Open Access Journals (Sweden)

    AntoineMartinez

    2012-08-01

    Full Text Available The aldose reductase (human AKR1B1/mouse Akr1b3 has been the focus of many research because of its role in diabetic complications. The starting point of these alterations is the massive entry of glucose in polyol pathway where it is converted into sorbitol by this enzyme. However, the issue of aldose reductase function in non-diabetic condition remains unresolved. Aldose reductase-like enzymes (AKR1B10, Akr1b7 and Akr1b8 are highly related isoforms often co-expressed with bona fide aldose reductase, making functional analysis of one or the other isoform a challenging task. AKR1B/Akr1b members share at least 65% protein identity and the general ability to reduce many redundant substrates such as aldehydes provided from lipid peroxidation, steroids and their by-products and xenobiotics in vitro. Based on these properties, AKR1B/Akr1b are generally considered as detoxifying enzymes. Considering that divergences should be more informative than similarities to help understanding their physiological functions, we chose to review specific hallmarks of each human/mouse isoforms by focusing on tissue distribution and specific mechanisms of gene regulation. Indeed, although the aldose reductase shows ubiquitous expression, aldose reductase-like proteins exhibit tissue-specific patterns of expression. We focused on 3 organs where certain isoforms are enriched, the adrenal gland, enterohepatic and adipose tissues and tried to connect recent enzymatic and regulation data with endocrine and metabolic functions of these organs. We presented recent mouse models showing unsuspected physiological functions in the regulation of glucido-lipidic metabolism and adipose tissue homeostasis. Beyond the widely accepted idea that AKR1B/Akr1b are detoxification enzymes, these recent reports provide growing evidences that they are able to modify or generate signal molecules. This conceptually shifts this class of enzymes from unenviable status of scavenger to upper class of

  14. Putative Role of the Aldo-Keto Reductase from Trypanosoma cruzi in Benznidazole Metabolism.

    Science.gov (United States)

    Garavaglia, Patricia Andrea; Laverrière, Marc; Cannata, Joaquín J B; García, Gabriela Andrea

    2016-05-01

    Benznidazole (Bz), the drug used for treatment of Chagas' disease (caused by the protozoan Trypanosoma cruzi), is activated by a parasitic NADH-dependent type I nitroreductase (NTR I). However, several studies have shown that other enzymes are involved. The aim of this study was to evaluate whether the aldo-keto reductase from T. cruzi (TcAKR), a NADPH-dependent oxido-reductase previously described by our group, uses Bz as the substrate. We demonstrated that both recombinant and native TcAKR enzymes reduce Bz by using NADPH, but not NADH, as a cofactor. TcAKR-overexpressing epimastigotes showed higher NADPH-dependent Bz reductase activity and a 50% inhibitory concentration (IC50) value for Bz 1.8-fold higher than that of the controls, suggesting that TcAKR is involved in Bz detoxification instead of activation. To understand the role of TcAKR in Bz metabolism, we studied TcAKR expression and NADPH/NADH-dependent Bz reductase activities in two T. cruzi strains with differential susceptibility to Bz: CL Brener and Nicaragua. Taking into account the results obtained with TcAKR-overexpressing epimastigotes, we expected the more resistant strain, Nicaragua, to have higher TcAKR levels than CL Brener. However, the results were the opposite. CL Brener showed 2-fold higher TcAKR expression and 5.7-fold higher NADPH-Bz reduction than the Nicaragua strain. In addition, NADH-dependent Bz reductase activity, characteristic of NTR I, was also higher in CL Brener than in Nicaragua. We conclude that although TcAKR uses Bz as the substrate, TcAKR activity is not a determinant of Bz resistance in wild-type strains and may be overcome by other enzymes involved in Bz activation, such as NADPH- and NADH-dependent reductases. PMID:26856844

  15. Role of aldo-keto reductases and other doxorubicin pharmacokinetic genes in doxorubicin resistance, DNA binding, and subcellular localization

    International Nuclear Information System (INIS)

    Since proteins involved in chemotherapy drug pharmacokinetics and pharmacodynamics have a strong impact on the uptake, metabolism, and efflux of such drugs, they likely play critical roles in resistance to chemotherapy drugs in cancer patients. To investigate this hypothesis, we conducted a whole genome microarray study to identify difference in the expression of genes between isogenic doxorubicin-sensitive and doxorubicin-resistant MCF-7 breast tumour cells. We then assessed the degree of over-representation of doxorubicin pharmacokinetic and pharmacodynamic genes in the dataset of doxorubicin resistance genes. Of 27,958 Entrez genes on the array, 7.4 per cent or 2,063 genes were differentially expressed by ≥ 2-fold between wildtype and doxorubicin-resistant cells. The false discovery rate was set at 0.01 and the minimum p value for significance for any gene within the “hit list” was 0.01. Seventeen and 43 per cent of doxorubicin pharmacokinetic genes were over-represented in the hit list, depending upon whether the gene name was identical or within the same gene family, respectively. The most over-represented genes were within the 1C and 1B families of aldo-keto reductases (AKRs), which convert doxorubicin to doxorubicinol. Other genes convert doxorubicin to other metabolites or affect the influx, efflux, or cytotoxicity of the drug. In further support of the role of AKRs in doxorubicin resistance, we observed that, in comparison to doxorubicin, doxorubincol exhibited dramatically reduced cytotoxicity, reduced DNA-binding activity, and strong localization to extra nuclear lysosomes. Pharmacologic inhibition of the above AKRs in doxorubicin-resistant cells increased cellular doxorubicin levels, restored doxorubicin cytotoxicity and re-established doxorubicin localization to the nucleus. The properties of doxorubicinol were unaffected. These findings demonstrate the utility of using curated pharmacokinetic and pharmacodynamic knowledge bases to identify

  16. Long-term In Vitro Treatment of Human Glioblastoma Cells with Temozolomide Increases Resistance In Vivo through Up-regulation of GLUT Transporter and Aldo-Keto Reductase Enzyme AKR1C Expression

    Directory of Open Access Journals (Sweden)

    Benjamin Le Calvé

    2010-09-01

    Full Text Available Glioblastoma (GBM is the most frequent malignant glioma. Treatment of GBM patients is multimodal with maximum surgical resection, followed by concurrent radiation and chemotherapy with the alkylating drug temozolomide (TMZ. The present study aims to identify genes implicated in the acquired resistance of two human GBM cells of astrocytic origin, T98G and U373, to TMZ. Resistance to TMZ was induced by culturing these cells in vitro for months with incremental TMZ concentrations up to 1 mM. Only partial resistance to TMZ has been achieved and was demonstrated in vivo in immunocompromised mice bearing orthotopic U373 and T98G xenografts. Our data show that long-term treatment of human astroglioma cells with TMZ induces increased expression of facilitative glucose transporter/solute carrier GLUT/SLC2A family members, mainly GLUT-3, and of the AKR1C family of proteins. The latter proteins are phase 1 drug-metabolizing enzymes involved in the maintenance of steroid homeostasis, prostaglandin metabolism, and metabolic activation of polycyclic aromatic hydrocarbons. GLUT-3 has been previously suggested to exert roles in GBM neovascularization processes, and TMZ was found to exert antiangiogenic effects in experimental gliomas. AKR1C1 was previously shown to be associated with oncogenic potential, with proproliferative effects similar to AKR1C3 in the latter case. Both AKR1C1 and AKR1C2 proteins are involved in cancer pro-proliferative cell chemoresistance. Selective targeting of GLUT-3 in GBM and/or AKR1C proteins (by means of jasmonates, for example could thus delay the acquisition of resistance to TMZ of astroglioma cells in the context of prolonged treatment with this drug.

  17. Aldo-keto reductase 1B10 and its role in proliferation capacity of drug-resistant cancers

    Directory of Open Access Journals (Sweden)

    Toshiyuki eMatsunaga

    2012-01-01

    Full Text Available The human aldo-keto reductase AKR1B10, originally identified as an aldose reductase-like protein and human small intestine aldose reductase, is a cytosolic NADPH-dependent reductase that metabolizes a variety of endogenous compounds, such as aromatic and aliphatic aldehydes and dicarbonyl compounds, and some drug ketones. The enzyme is highly expressed in solid tumors of several tissues including lung and liver, and as such has received considerable interest as a relevant biomarker for the development of those tumors. In addition, AKR1B10 has been recently reported to be significantly up-regulated in some cancer cell lines (medulloblastoma D341 and colon cancer HT29 acquiring resistance towards chemotherapeutic agents (cyclophosphamide and mitomycin c, suggesting the validity of the enzyme as a chemoresistance marker. Although the detailed information on the AKR1B10-mediated mechanisms leading to the drug resistance process is not well understood so far, the enzyme has been proposed to be involved in functional regulations of cell proliferation and metabolism of drugs and endogenous lipids during the development of chemoresistance. This article reviews the current literature focusing mainly on expression profile and roles of AKR1B10 in the drug resistance of cancer cells. Recent developments of AKR1B10 inhibitors and their usefulness in restoring sensitivity to anticancer drugs are also reviewed.

  18. Gene expression and promoter analysis of a novel tomato aldo-keto reductase in response to environmental stresses.

    Science.gov (United States)

    Suekawa, Marina; Fujikawa, Yukichi; Inada, Shuhei; Murano, Asako; Esaka, Muneharu

    2016-08-01

    The functional role of an uncharacterized tomato (Solanum lycopersicum) aldo-keto reductase 4B, denoted as SlAKR4B, was investigated. The gene expression of tomato SlAKR4B was detected at a high level in the senescent leaves and the ripening fruits of tomato. Although d-galacturonic acid reductase activities tended to be higher in tomato SlAKR4B-overexpressing transgenic tobacco BY-2 cell lines than those in control cell lines, SlAKR4B gene expression was not well correlated with l-ascorbic acid content among the cell lines. The analysis of the transgenic cell lines showed that tomato SlAKR4B has enzyme activities toward d-galacturonic acid as well as glyceraldehyde and glyoxal, suggesting that the SlAKR4B gene encodes a functional enzyme in tomato. Gene expression of SlAKR4B was induced by NaCl, H2O2, and plant hormones such as salicylic acid and jasmonic acid, suggesting that SlAKR4B is involved in the stress response. The transient expression assay using protoplasts showed the promoter activity of the SlAKR4B gene was as high as that of the cauliflower mosaic virus 35S promoter. Also, the promoter region of the SlAKR4B gene was suggested to contain cis-element(s) for abiotic stress-inducible expression. PMID:27337067

  19. cDNA cloning, expression and activity of a second human aflatoxin B1-metabolizing member of the aldo-keto reductase superfamily, AKR7A3.

    Science.gov (United States)

    Knight, L P; Primiano, T; Groopman, J D; Kensler, T W; Sutter, T R

    1999-07-01

    The aflatoxin B1 (AFB1) aldehyde metabolite of AFB1 may contribute to the cytotoxicity of this hepatocarcinogen via protein adduction. Aflatoxin B1 aldehyde reductases, specifically the NADPH-dependent aldo-keto reductases of rat (AKR7A1) and human (AKR7A2), are known to metabolize the AFB1 dihydrodiol by forming AFB1 dialcohol. Using a rat AKR7A1 cDNA, we isolated and characterized a distinct aldo-keto reductase (AKR7A3) from an adult human liver cDNA library. The deduced amino acid sequence of AKR7A3 shares 80 and 88% identity with rat AKR7A1 and human AKR7A2, respectively. Recombinant rat AKR7A1 and human AKR7A3 were expressed and purified from Escherichia coli as hexa-histidine tagged fusion proteins. These proteins catalyzed the reduction of several model carbonyl-containing substrates. The NADPH-dependent formation of AFB1 dialcohol by recombinant human AKR7A3 was confirmed by liquid chromatography coupled to electrospray ionization mass spectrometry. Rabbit polyclonal antibodies produced using recombinant rat AKR7A1 protein were shown to detect nanogram amounts of rat and human AKR7A protein. The amount of AKR7A-related protein in hepatic cytosols of 1, 2-dithiole-3-thione-treated rats was 18-fold greater than in cytosols from untreated animals. These antibodies detected AKR7A-related protein in normal human liver samples ranging from 0.3 to 0.8 microg/mg cytosolic protein. Northern blot analysis showed varying levels of expression of AKR7A RNA in human liver and in several extrahepatic tissues, with relatively high levels in the stomach, pancreas, kidney and liver. Based on the kinetic parameters determined using recombinant human AKR7A3 and AFB1 dihydrodiol at pH 7.4, the catalytic efficiency of this reaction (k2/K, per M/s) equals or exceeds those reported for other enzymes, for example cytochrome P450s and glutathione S-transferases, known to metabolize AFB1 in vivo. These findings indicate that, depending on the extent of AFB1 dihydrodiol formation, AKR

  20. Expression, purification, crystallization and preliminary X-ray analysis of perakine reductase, a new member of the aldo-keto reductase enzyme superfamily from higher plants

    International Nuclear Information System (INIS)

    Perakine reductase, a novel member of the aldo-keto reductase enzyme superfamily of higher plants, is involved in the biosynthesis of monoterpenoid indole alkaloids in the Indian medicinal plant Rauvolfia serpentina. The enzyme has been crystallized in C-centered orthorhombic space group and diffracts to 2.0 Å resolution. Perakine reductase (PR) is a novel member of the aldo-keto reductase enzyme superfamily from higher plants. PR from the plant Rauvolfia serpentina is involved in the biosynthesis of monoterpenoid indole alkaloids by performing NADPH-dependent reduction of perakine, yielding raucaffrinoline. However, PR can also reduce cinnamic aldehyde and some of its derivatives. After heterologous expression of a triple mutant of PR in Escherichia coli, crystals of the purified and methylated enzyme were obtained by the hanging-drop vapour-diffusion technique at 293 K with 100 mM sodium citrate pH 5.6 and 27% PEG 4000 as precipitant. Crystals belong to space group C2221 and diffract to 2.0 Å, with unit-cell parameters a = 58.9, b = 93.0, c = 143.4 Å

  1. A pathogenesis related-10 protein CaARP functions as aldo/keto reductase to scavenge cytotoxic aldehydes.

    Science.gov (United States)

    Jain, Deepti; Khandal, Hitaishi; Khurana, Jitendra Paul; Chattopadhyay, Debasis

    2016-01-01

    Pathogenesis related-10 (PR-10) proteins are present as multigene family in most of the higher plants. The role of PR-10 proteins in plant is poorly understood. A sequence analysis revealed that a large number of PR-10 proteins possess conserved motifs found in aldo/keto reductases (AKRs) of yeast and fungi. We took three PR-10 proteins, CaARP from chickpea, ABR17 from pea and the major pollen allergen Bet v1 from silver birch as examples and showed that these purified recombinant proteins possessed AKR activity using various cytotoxic aldehydes including methylglyoxal and malondialdehyde as substrates and the reduced form of nicotinamide adenine dinucleotide phosphate (NADPH) as co-factor. Essential amino acids for this catalytic activity were identified by substitution with other amino acids. CaARP was able to discriminate between the reduced and oxidized forms of NADP independently of its catalytic activity and underwent structural change upon binding with NADPH. CaARP protein was preferentially localized in cytosol. When expressed in bacteria, yeast or plant, catalytically active variants of CaARP conferred tolerance to salinity, oxidative stress or cytotoxic aldehydes. CaARP-expressing plants showed lower lipid peroxidation product content in presence or absence of stress suggesting that the protein functions as a scavenger of cytotoxic aldehydes produced by metabolism and lipid peroxidation. Our result proposes a new biochemical property of a PR-10 protein. PMID:26577640

  2. Expression of the Aldo-Keto Reductases AKR1B1 and AKR1B10 in Human Cancers.

    Directory of Open Access Journals (Sweden)

    BrianLaffin

    2012-06-01

    Full Text Available The American Cancer Society estimates that there will be more than 1.5 million new cases of cancer in 2011, underscoring the need for identification of new therapeutic targets and development of novel cancer therapies. Previous studies have implicated the human aldo-keto reductases AKR1B1 and AKR1B10 in cancer, and therefore we examined AKR1B1 and AKR1B10 expression across all major human cancer types using the Oncomine cancer gene expression database (Compendia Biosciences, www.oncomine.com. Using this database, we found that expression of of AKR1B1 and AKR1B10 varies greatly by cancer type and tissue of origin, including agreement with previous reports that AKR1B10 is significantly over-expressed in cancers of the lungs and liver. AKR1B1 is more broadly over-expressed in human cancers than AKR1B10, albeit at a generally lower magnitude. AKR1B1 over-expression was found to be associated with shortened patient survival in acute myelogenous leukemias and multiple myelomas. High AKR1B10 expression tends to predict less aggressive clinical course generally, notably within lung cancers, where it tends to be highly over-expressed compared to normal tissue. These findings suggest that AKR1B1 inhibitors in particular hold great potential as novel cancer therapeutics.

  3. The Aldo-Keto Reductase Akr1b7 Gene Is a Common Transcriptional Target of Xenobiotic Receptors Pregnane X Receptor and Constitutive Androstane Receptor

    OpenAIRE

    Liu, Ming-Jie; Takahashi, Yuki; Wada, Taira; He, Jinhan; Gao, Jie; Tian, Yanan; Li, Song; Xie, Wen

    2009-01-01

    Aldo-keto reductase (AKR) family 1, member 7 (AKR1B7), a member of the AKR superfamily, has been suggested to play an important role in the detoxification of lipid peroxidation by-products. The nuclear receptors pregnane X receptor (PXR) and constitutive androstane receptor (CAR) are xenosensors postulated to alleviate xeno- and endobiotic chemical insults. In this study, we show that the mouse Akr1b7 is a shared transcriptional target of PXR and CAR in the liver and i...

  4. A novel aldo-keto reductase from Jatropha curcas L. (JcAKR) plays a crucial role in the detoxification of methylglyoxal, a potent electrophile.

    Science.gov (United States)

    Mudalkar, Shalini; Sreeharsha, Rachapudi Venkata; Reddy, Attipalli Ramachandra

    2016-05-20

    Abiotic stress leads to the generation of reactive oxygen species (ROS) which further results in the production of reactive carbonyls (RCs) including methylglyoxal (MG). MG, an α, β-dicarbonyl aldehyde, is highly toxic to plants and the mechanism behind its detoxification is not well understood. Aldo-keto reductases (AKRs) play a role in detoxification of reactive aldehydes and ketones. In the present study, we cloned and characterised a putative AKR from Jatropha curcas (JcAKR). Phylogenetically, it forms a small clade with AKRs of Glycine max and Rauwolfia serpentina. JcAKR was heterologously expressed in Escherichia coli BL-21(DE3) cells and the identity of the purified protein was confirmed through MALDI-TOF analysis. The recombinant protein had high enzyme activity and catalytic efficiency in assays containing MG as the substrate. Protein modelling and docking studies revealed MG was efficiently bound to JcAKR. Under progressive drought and salinity stress, the enzyme and transcript levels of JcAKR were higher in leaves compared to roots. Further, the bacterial and yeast cells expressing JcAKR showed more tolerance towards PEG (5%), NaCl (200mM) and MG (5mM) treatments compared to controls. In conclusion, our results project JcAKR as a possible and potential target in crop improvement for abiotic stress tolerance. PMID:26995646

  5. Overexpression of Aldo-Keto-Reductase in Azole-resistant Clinical Isolates of Candida Glabrata Determined by cDNA-AFLP

    Directory of Open Access Journals (Sweden)

    Mansour Heidari

    2013-01-01

    Full Text Available Background: Candida glabrata causes significant medical problems in immunocompromised patients. Many strains of this yeast are intrinsically resistant to azole antifungal agents, and treatment is problematic, leading to high morbidity and mortality rates in immunosuppressed individuals. The primary goal of this study was to investigate the genes involved in the drug resistance of clinical isolates of C. glabrata.Methods: The clinical isolates of C. glabrata were collected in an epidemiological survey of candidal infection inimmunocompromised patients and consisted of four fluconazole and itraconazole resistant isolates, two fluconazoleand itraconazole sensitive isolates, and C. glabrata CBS 138 as reference strain. Antifungal susceptibility patterns ofthe organisms were determined beforehand by the Clinical and Laboratory Standards Institute (CLSI. The potentialgene(s implicated in antifungal resistance were investigated using complementary DNA- Amplified Fragment Length Polymorphism (cDNA-AFLP. Semi-quantitative RT-PCR was carried out to evaluate the expression of gene(s in resistant isolates as compared to sensitive and reference strains.Results and conclusions: The aldo-keto-reductase superfamily (AKR gene was upregulated in the resistant clinicalisolates as assessed by cDNA-AFLP. Semi-quantitative RT-PCR revealed AKR mRNA expression approximately twice that seen in the sensitive isolates. Overexpression of the AKR gene was associated with increased fluconazole and itraconazole resistance in C. glabrata. The data suggest that upregulation of the AKR gene might give a new insight into the mechanism of azole resistance.

  6. The Aldo-Keto Reductase AKR1B10 Is Up-Regulated in Keloid Epidermis, Implicating Retinoic Acid Pathway Dysregulation in the Pathogenesis of Keloid Disease.

    Science.gov (United States)

    Jumper, Natalie; Hodgkinson, Tom; Arscott, Guyan; Har-Shai, Yaron; Paus, Ralf; Bayat, Ardeshir

    2016-07-01

    Keloid disease is a recurrent fibroproliferative cutaneous tumor of unknown pathogenesis for which clinical management remains unsatisfactory. To obtain new insights into hitherto underappreciated aspects of keloid pathobiology, we took a laser capture microdissection-based, whole-genome microarray analysis approach to identify distinct keloid disease-associated gene expression patterns within defined keloid regions. Identification of the aldo-keto reductase enzyme AKR1B10 as highly up-regulated in keloid epidermis suggested that an imbalance of retinoic acid metabolism is likely associated with keloid disease. Here, we show that AKR1B10 transfection into normal human keratinocytes reproduced the abnormal retinoic acid pathway expression pattern we had identified in keloid epidermis. Cotransfection of AKR1B10 with a luciferase reporter plasmid showed reduced retinoic acid response element activity, supporting the hypothesis of retinoic acid synthesis deficiency in keloid epidermis. Paracrine signals released by AKR1B10-overexpressing keratinocytes into conditioned medium resulted in up-regulation of transforming growth factor-β1, transforming growth factor-β2, and collagens I and III in both keloid and normal skin fibroblasts, mimicking the typical profibrotic keloid profile. Our study results suggest that insufficient retinoic acid synthesis by keloid epidermal keratinocytes may contribute to the pathogenesis of keloid disease. We refocus attention on the role of injured epithelium in keloid disease and identify AKR1B10 as a potential new target in future management of keloid disease. PMID:27025872

  7. Overexpression of aldo-keto-reductase in azole-resistant clinical isolates of Candida glabrata determined by cDNA-AFLP

    Directory of Open Access Journals (Sweden)

    Farahyar Shirin

    2013-01-01

    Full Text Available Abstract Background Candida glabrata causes significant medical problems in immunocompromised patients. Many strains of this yeast are intrinsically resistant to azole antifungal agents, and treatment is problematic, leading to high morbidity and mortality rates in immunosuppressed individuals. The primary goal of this study was to investigate the genes involved in the drug resistance of clinical isolates of C. glabrata. Methods The clinical isolates of C. glabrata were collected in an epidemiological survey of candidal infection in immunocompromised patients and consisted of four fluconazole and itraconazole resistant isolates, two fluconazole and itraconazole sensitive isolates, and C. glabrata CBS 138 as reference strain. Antifungal susceptibility patterns of the organisms were determined beforehand by the Clinical and Laboratory Standards Institute (CLSI. The potential gene(s implicated in antifungal resistance were investigated using complementary DNA- Amplified Fragment Length Polymorphism (cDNA-AFLP. Semi-quantitative RT-PCR was carried out to evaluate the expression of gene(s in resistant isolates as compared to sensitive and reference strains. Results and conclusions The aldo-keto-reductase superfamily (AKR gene was upregulated in the resistant clinical isolates as assessed by cDNA-AFLP. Semi-quantitative RT-PCR revealed AKR mRNA expression approximately twice that seen in the sensitive isolates. Overexpression of the AKR gene was associated with increased fluconazole and itraconazole resistance in C. glabrata. The data suggest that upregulation of the AKR gene might give a new insight into the mechanism of azole resistance.

  8. Aldo-keto reductase family 1 B10 protein detoxifies dietary and lipid-derived alpha, beta-unsaturated carbonyls at physiological levels

    International Nuclear Information System (INIS)

    Alpha, beta-unsaturated carbonyls are highly reactive mutagens and carcinogens to which humans are exposed on a daily basis. This study demonstrates that aldo-keto reductase family 1 member B10 (AKR1B10) is a critical protein in detoxifying dietary and lipid-derived unsaturated carbonyls. Purified AKR1B10 recombinant protein efficiently catalyzed the reduction to less toxic alcohol forms of crotonaldehyde at 0.90 μM, 4-hydroxynonenal (HNE) at 0.10 μM, trans-2-hexanal at 0.10 μM, and trans-2,4-hexadienal at 0.05 μM, the concentrations at or lower than physiological exposures. Ectopically expressed AKR1B10 in 293T cells eliminated immediately HNE at 1 (subtoxic) or 5 μM (toxic) by converting to 1,4-dihydroxynonene, protecting the cells from HNE toxicity. AKR1B10 protein also showed strong enzymatic activity toward glutathione-conjugated carbonyls. Taken together, our study results suggest that AKR1B10 specifically expressed in the intestine is physiologically important in protecting the host cell against dietary and lipid-derived cytotoxic carbonyls.

  9. Exposure to 9,10-phenanthrenequinone accelerates malignant progression of lung cancer cells through up-regulation of aldo-keto reductase 1B10

    International Nuclear Information System (INIS)

    Inhalation of 9,10-phenanthrenequinone (9,10-PQ), a major quinone in diesel exhaust, exerts fatal damage against a variety of cells involved in respiratory function. Here, we show that treatment with high concentrations of 9,10-PQ evokes apoptosis of lung cancer A549 cells through production of reactive oxygen species (ROS). In contrast, 9,10-PQ at its concentrations of 2 and 5 μM elevated the potentials for proliferation, invasion, metastasis and tumorigenesis, all of which were almost completely inhibited by addition of an antioxidant N-acetyl-L-cysteine, inferring a crucial role of ROS in the overgrowth and malignant progression of lung cancer cells. Comparison of mRNA expression levels of six aldo-keto reductases (AKRs) in the 9,10-PQ-treated cells advocated up-regulation of AKR1B10 as a major cause contributing to the lung cancer malignancy. In support of this, the elevation of invasive, metastatic and tumorigenic activities in the 9,10-PQ-treated cells was significantly abolished by the addition of a selective AKR1B10 inhibitor oleanolic acid. Intriguingly, zymographic and real-time PCR analyses revealed remarkable increases in secretion and expression, respectively, of matrix metalloproteinase 2 during the 9,10-PQ treatment, and suggested that the AKR1B10 up-regulation and resultant activation of mitogen-activated protein kinase cascade are predominant mechanisms underlying the metalloproteinase induction. In addition, HPLC analysis and cytochrome c reduction assay in in vitro 9,10-PQ reduction by AKR1B10 demonstrated that the enzyme catalyzes redox-cycling of this quinone, by which ROS are produced. Collectively, these results suggest that AKR1B10 is a key regulator involved in overgrowth and malignant progression of the lung cancer cells through ROS production due to 9,10-PQ redox-cycling. - Highlights: • 9,10-PQ promotes invasion, metastasis and tumorigenicity in lung cancer cells. • The 9,10-PQ-elicited promotion is possibly due to AKR1B10 up

  10. Exposure to 9,10-phenanthrenequinone accelerates malignant progression of lung cancer cells through up-regulation of aldo-keto reductase 1B10

    Energy Technology Data Exchange (ETDEWEB)

    Matsunaga, Toshiyuki, E-mail: matsunagat@gifu-pu.ac.jp [Laboratory of Biochemistry, Gifu Pharmaceutical University, Gifu 501-1196 (Japan); Morikawa, Yoshifumi; Haga, Mariko; Endo, Satoshi [Laboratory of Biochemistry, Gifu Pharmaceutical University, Gifu 501-1196 (Japan); Soda, Midori; Yamamura, Keiko [Laboratory of Clinical Pharmacy, School of Pharmacy, Aichi Gakuin University, Nagoya 464-8650 (Japan); El-Kabbani, Ossama [Monash Institute of Pharmaceutical Sciences, Monash University, Victoria 3052 (Australia); Tajima, Kazuo [Faculty of Pharmaceutical Sciences, Hokuriku University, Kanazawa 920-1181 (Japan); Ikari, Akira [Laboratory of Biochemistry, Gifu Pharmaceutical University, Gifu 501-1196 (Japan); Hara, Akira [Faculty of Engineering, Gifu University, Gifu 501-1193 (Japan)

    2014-07-15

    Inhalation of 9,10-phenanthrenequinone (9,10-PQ), a major quinone in diesel exhaust, exerts fatal damage against a variety of cells involved in respiratory function. Here, we show that treatment with high concentrations of 9,10-PQ evokes apoptosis of lung cancer A549 cells through production of reactive oxygen species (ROS). In contrast, 9,10-PQ at its concentrations of 2 and 5 μM elevated the potentials for proliferation, invasion, metastasis and tumorigenesis, all of which were almost completely inhibited by addition of an antioxidant N-acetyl-L-cysteine, inferring a crucial role of ROS in the overgrowth and malignant progression of lung cancer cells. Comparison of mRNA expression levels of six aldo-keto reductases (AKRs) in the 9,10-PQ-treated cells advocated up-regulation of AKR1B10 as a major cause contributing to the lung cancer malignancy. In support of this, the elevation of invasive, metastatic and tumorigenic activities in the 9,10-PQ-treated cells was significantly abolished by the addition of a selective AKR1B10 inhibitor oleanolic acid. Intriguingly, zymographic and real-time PCR analyses revealed remarkable increases in secretion and expression, respectively, of matrix metalloproteinase 2 during the 9,10-PQ treatment, and suggested that the AKR1B10 up-regulation and resultant activation of mitogen-activated protein kinase cascade are predominant mechanisms underlying the metalloproteinase induction. In addition, HPLC analysis and cytochrome c reduction assay in in vitro 9,10-PQ reduction by AKR1B10 demonstrated that the enzyme catalyzes redox-cycling of this quinone, by which ROS are produced. Collectively, these results suggest that AKR1B10 is a key regulator involved in overgrowth and malignant progression of the lung cancer cells through ROS production due to 9,10-PQ redox-cycling. - Highlights: • 9,10-PQ promotes invasion, metastasis and tumorigenicity in lung cancer cells. • The 9,10-PQ-elicited promotion is possibly due to AKR1B10 up

  11. The Role of Human Aldo-Keto Reductases (AKRs in the Metabolic Activation and Detoxication of Polycyclic Aromatic Hydrocarbons: Interconversion of PAH-catechols and PAH o-Quinones

    Directory of Open Access Journals (Sweden)

    LiZhang

    2012-11-01

    Full Text Available Polycyclic aromatic hydrocarbons (PAH are ubiquitous environmental pollutants. They are procarcinogens requiring metabolic activation to elicit their deleterious effects. Aldo-keto reductases (AKR catalyze the oxidation of proximate carcinogenic PAH trans-dihydrodiols to yield electrophilic and redox-active PAH o-quiniones. AKRs are also found to be capable of reducing PAH o-quinones to form PAH catechols. The interconversion of o-quinones and catechols results in the redox cycling of PAH o-quinones to give rise to the generation of reactive oxygen species and subsequent oxidative DNA damage. On the other hand, PAH catechols can be intercepted through phase II metabolism by which PAH o-quinones could be detoxified and eliminated. The aim of the present review is to summarize the role of human AKRs in the metabolic activation/detoxication of PAH and the relevance of phase II conjugation reactions to human lung carcinogenesis.

  12. Aldo-keto reductase 1B10 promotes development of cisplatin resistance in gastrointestinal cancer cells through down-regulating peroxisome proliferator-activated receptor-γ-dependent mechanism.

    Science.gov (United States)

    Matsunaga, Toshiyuki; Suzuki, Ayaka; Kezuka, Chihiro; Okumura, Naoko; Iguchi, Kazuhiro; Inoue, Ikuo; Soda, Midori; Endo, Satoshi; El-Kabbani, Ossama; Hara, Akira; Ikari, Akira

    2016-08-25

    Cisplatin (cis-diamminedichloroplatinum, CDDP) is one of the most effective chemotherapeutic drugs that are used for treatment of patients with gastrointestinal cancer cells, but its continuous administration often evokes the development of chemoresistance. In this study, we investigated alterations in antioxidant molecules and functions using a newly established CDDP-resistant variant of gastric cancer MKN45 cells, and found that aldo-keto reductase 1B10 (AKR1B10) is significantly up-regulated with acquisition of the CDDP resistance. In the nonresistant MKN45 cells, the sensitivity to cytotoxic effect of CDDP was decreased and increased by overexpression and silencing of AKR1B10, respectively. In addition, the AKR1B10 overexpression markedly suppressed accumulation and cytotoxicity of 4-hydroxy-2-nonenal that is produced during lipid peroxidation by CDDP treatment, suggesting that the enzyme acts as a crucial factor for facilitation of the CDDP resistance through inhibiting induction of oxidative stress by the drug. Transient exposure to CDDP and induction of the CDDP resistance decreased expression of peroxisome proliferator-activated receptor-γ (PPARγ) in MKN45 and colon cancer LoVo cells. Additionally, overexpression of PPARγ in the cells elevated the sensitivity to the CDDP toxicity, which was further augmented by concomitant treatment with a PPARγ ligand rosiglitazone. Intriguingly, overexpression of AKR1B10 in the cells resulted in a decrease in PPARγ expression, which was recovered by addition of an AKR1B10 inhibitor oleanolic acid, inferring that PPARγ is a downstream target of AKR1B10-dependent mechanism underlying the CDDP resistance. Combined treatment with the AKR1B10 inhibitor and PPARγ ligand elevated the CDDP sensitivity, which was almost the same level as that in the parental cells. These results suggest that combined treatment with the AKR1B10 inhibitor and PPARγ ligand is an effective adjuvant therapy for overcoming CDDP resistance of

  13. Aldo-keto synthesis effect on Eu3+fluorescence in YBO3 compared with solid state diffusion

    Institute of Scientific and Technical Information of China (English)

    K.A. Koparkar; N.S. Bajaj; S.K. Omanwar

    2015-01-01

    The red-orange emitting phosphor YBO3:Eu3+was prepared by aldo-keto method and solid state diffusion. Aldo-keto method implied to decrease the processing time and heating temperature. The red-orange emitting phosphor was characterized by X-ray diffraction (XRD), scanning electron microscopy (SEM), as well as emission and excitation photoluminescence spectra re-corded at room temperature. The result of aldo-keto method showed that the phosphor YBO3:Eu3+could be obtained at 900 °C in less time~60%as compared to solid state diffusion (SSD). The material showed that the strongest emission peak at 595 nm under excitation at 233 nm was only due to forced magnetic dipole 5D0→7F1 transition of Eu3+ions. Significantly, the emission inten-sity of YBO3:Eu3+phosphor prepared by aldo-keto method was relatively higher as compared to that obtained by the solid state diffusion.

  14. Hepatitis B Virus X Protein Up-Regulates AKR1C1 Expression Through Nuclear Factor-Y in Human Hepatocarcinoma Cells

    OpenAIRE

    Kai LI; Ding, Shijia; Chen, Ke; Qin, Dongdong; Qu, Jialin; Wang, Sen; Sheng, Yanrui; Zou, Chengcheng; Chen, Limin; Tang, Hua

    2013-01-01

    Background The hepatitis B virus X (HBx) protein has long been recognized as an important transcriptional transactivator of several genes. Human aldo-keto reductase family 1, member C1 (AKR1C1), a member of the family of AKR1CS, is significantly increased in HBx-expressed cells. Objectives This study aimed to investigate the possible mechanism of HBx in regulating AKR1C1 expression in HepG2.2.15 cells and the role of AKR1C1 for HBV-induced HCC. Materials and Methods RT-PCR was performed to de...

  15. Substrate Specificity, Inhibitor Selectivity and Structure-Function Relationships of Aldo-Keto Reductase 1B15: A Novel Human Retinaldehyde Reductase

    Czech Academy of Sciences Publication Activity Database

    Giménez-Dejoz, J.; Kolář, Michal H.; Ruiz, F. X.; Crespo, I.; Cousido-Siah, A.; Podjarny, A.; Barski, O. A.; Fanfrlík, Jindřich; Parés, X.; Farrés, J.; Porté, S.

    2015-01-01

    Roč. 10, č. 7 (2015), e0134506/1-e0134506/19. E-ISSN 1932-6203 Institutional support: RVO:61388963 Keywords : retinoic acid biosynthesis * site-directed mutagenesis * tumor marker AKR1B15 Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.234, year: 2014 http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0134506

  16. ClEST cluster :Cl_singleton0763 [ClEST

    Lifescience Database Archive (English)

    Full Text Available Cl_singleton0763 aldo-keto reductase Cimex lectularius nuclear gene 591 CACCGGGTAGG...GTGAATAAAGGCTTAGTTAGGTCAATCGGACTATCCAATTTCAACAAAAGACAGATCGAAGATGTTT fs09012 1 aldo-keto reductase [Gl

  17. Induction of quinone reductase activity by stilbene analogs in mouse Hepa 1c1c7 cells.

    Science.gov (United States)

    Heo, Y H; Kim, S; Park, J E; Jeong, L S; Lee, S K

    2001-12-01

    Based on the potential cancer chemopreventive activity of resveratrol, a trihydroxystilbene with the induction of quinone reductase activity, this study was designed to determine if stilbene-related compounds were inducers of phase II detoxifying metabolic enzyme quinone reductase (QR) in the mouse hepatoma Hepa 1c1c7 cells. Among the thirteen compounds tested, several compounds including 3,4,5,3',5'-pentamethoxy-trans-stilbene were found to potentially induce QR activity in this cell line. In addition, substitution with 3-thiofurane ring instead of phenyl ring in the stilbene skeleton also exhibited potential induction of QR activity. This result will give primary information to design the potential inducers of QR activity in the stilbene analogs. PMID:11794542

  18. Prenylated chalcones and flavanones as inducers of quinone reductase in mouse Hepa 1c1c7 cells.

    Science.gov (United States)

    Miranda, C L; Aponso, G L; Stevens, J F; Deinzer, M L; Buhler, D R

    2000-02-28

    The objective of this study was to determine if prenylchalcones (open C-ring flavonoids) and prenylflavanones from hops and beer are inducers of quinone reductase (QR) in the mouse hepatoma Hepa 1c1c7 cell line. All the prenylchalcones and prenylflavanones tested were found to induce QR but not CYP1A1 in this cell line. In contrast, the synthetic chalcone, chalconaringenin, and the flavanone, naringenin, with no prenyl or geranyl groups, were ineffective in inducing QR. The hop chalcones, xanthohumol and dehydrocycloxanthohumol hydrate, also induced QR in the Ah-receptor-defective mutant cell line, Hepa 1c1c7 bp(r)c1. Thus, the prenylflavonoids represent a new class of monofunctional inducers of QR. PMID:10737704

  19. Induction of quinone reductase activity by psoralidin isolated from Psoralea corylifolia in mouse hepa 1c1c7 cells.

    Science.gov (United States)

    Lee, Sung-Jin; Nam, Kung-Woo; Mar, Woongchon

    2009-07-01

    Quinone reductase (QR) is a protective phase II enzyme against mutagens and carcinogens which is inducible by a number of chemical compounds in plants. This study was carried out to investigate effects of the fractions from the seeds of Psoralea corylifolia on the induction of QR with Hepa 1c1c7 murine hepatoma cell line. The ethyl acetate-soluble fraction of the methanolic extract from the seeds was found to induce QR and the concentration of 1.5 fold QR induction (1.5 FIC) was 1.2 mug/mL. We obtained as an active compound, psoralidin, isolated from the ethyl acetate-soluble fraction after further sequential fractionation with column chromatography and 1.5 FIC of psoralidin was 0.5 mug/mL. The seeds of Psoralea corylifolia and psoralidin might be a candidate for developing QR inducers. PMID:19641888

  20. Enzymes of the AKR1B and AKR1C subfamilies and uterine diseases

    Directory of Open Access Journals (Sweden)

    Tea eLanisnik Rizner

    2012-03-01

    Full Text Available Endometrial and cervical cancers, uterine myoma, and endometriosis are very common uterine diseases. Worldwide, more than 800,000 women are affected annually by gynecological cancers, as a result of which, more than 360,000 die. During their reproductive age, about 70% of women develop uterine myomas, 10% to 15% suffer from endometriosis, and 35% to 50% from infertility associated with endometriosis. Uterine diseases are associated with aberrant inflammatory responses and concomitant increased production of prostaglandins (PG. They are also related to decreased differentiation, due to low levels of protective progesterone and retinoic acid, and to enhanced proliferation, due to high local concentrations of estrogens. The pathogenesis of these diseases can thus be attributed to disturbed PG, estrogen and retinoid metabolism and actions. Five human members of the aldo-keto reductase 1B (AKR1B and 1C (AKR1C superfamilies, i.e., AKR1B1, AKR1B10, AKR1C1, AKR1C2 and AKR1C3, have roles in these processes and can thus be implicated in uterine diseases. AKR1B1 and AKR1C3 catalyze the formation of PGF2alpha which stimulates cell proliferation. AKR1C3 converts PGD2 to 9alpha,11beta-PGF2, and thus counteracts the formation of 15deoxy-PGJ2, which can activate pro-apoptotic peroxisome-proliferator-activated receptor beta. AKR1B10 catalyzes the reduction of retinal to retinol, and in thus lessens the formation of retinoic acid, with potential pro-differentiating actions. The AKR1C1-AKR1C3 enzymes also act as 17-keto- and 20-ketosteroid reductases to varying extents, and are implicated in increased estradiol and decreased progesterone levels. This review comprises a short introduction to uterine diseases, followed by an overview of the current literature on the AKR1B and AKR1C expression in the uterus and in uterine diseases. The potential implications of the AKR1B and AKR1C enzymes and their pathophysiologies are then discussed, followed by conclusions and

  1. Genetic variation of Aflatoxin B(1) aldehyde reductase genes (AFAR) in human tumour cells

    DEFF Research Database (Denmark)

    Praml, Christian; Schulz, Wolfgang; Claas, Andreas;

    2008-01-01

    AFAR genes play a key role in the detoxification of the carcinogen Aflatoxin B(1) (AFB(1)). In the rat, Afar1 induction can prevent AFB(1)-induced liver cancer. It has been proposed that AFAR enzymes can metabolise endogenous diketones and dialdehydes that may be cytotoxic and/or genotoxic. Furth...... many aldo-keto reductases. This polarity change may have an effect on the proposed substrate binding amino acids nearby (Met(47), Tyr(48), Asp(50)). Further population analyses and functional studies of the nine variants detected may show if these variants are disease-related....

  2. Elevated AKR1C3 expression promotes prostate cancer cell survival and prostate cell-mediated endothelial cell tube formation: implications for prostate cancer progressioan

    International Nuclear Information System (INIS)

    Aldo-keto reductase (AKR) 1C family member 3 (AKR1C3), one of four identified human AKR1C enzymes, catalyzes steroid, prostaglandin, and xenobiotic metabolism. In the prostate, AKR1C3 is up-regulated in localized and advanced prostate adenocarcinoma, and is associated with prostate cancer (PCa) aggressiveness. Here we propose a novel pathological function of AKR1C3 in tumor angiogenesis and its potential role in promoting PCa progression. To recapitulate elevated AKR1C3 expression in cancerous prostate, the human PCa PC-3 cell line was stably transfected with an AKR1C3 expression construct to establish PC3-AKR1C3 transfectants. Microarray and bioinformatics analysis were performed to identify AKR1C3-mediated pathways of activation and their potential biological consequences in PC-3 cells. Western blot analysis, reverse transcription-polymerase chain reaction (RT-PCR), enzyme-linked immunosorbent assay (ELISA), and an in vitro Matrigel angiogenesis assays were applied to validate the pro-angiogenic activity of PC3-AKR1C3 transfectants identified by bioinformatics analysis. Microarray and bioinformatics analysis suggested that overexpression of AKR1C3 in PC-3 cells modulates estrogen and androgen metabolism, activates insulin-like growth factor (IGF)-1 and Akt signaling pathways, as well as promotes tumor angiogenesis and aggressiveness. Levels of IGF-1 receptor (IGF-1R) and Akt activation as well as vascular endothelial growth factor (VEGF) expression and secretion were significantly elevated in PC3-AKR1C3 transfectants in comparison to PC3-mock transfectants. PC3-AKR1C3 transfectants also promoted endothelial cell (EC) tube formation on Matrigel as compared to the AKR1C3-negative parental PC-3 cells and PC3-mock transfectants. Pre-treatment of PC3-AKR1C3 transfectants with a selective IGF-1R kinase inhibitor (AG1024) or a non-selective phosphoinositide 3-kinases (PI3K) inhibitor (LY294002) abolished ability of the cells to promote EC tube formation. Bioinformatics

  3. Crystallization and preliminary X-ray diffraction analysis of maize aldose reductase

    Energy Technology Data Exchange (ETDEWEB)

    Kiyota, Eduardo [Laboratório de Biologia Estrutural, Instituto de Química, Universidade Estadual de Campinas, CP 6154, 13083-970 Campinas-SP (Brazil); Centro de Biologia Molecular e Engenharia Genética, Universidade Estadual de Campinas, Campinas-SP (Brazil); Sousa, Sylvia Morais de [Centro de Biologia Molecular e Engenharia Genética, Universidade Estadual de Campinas, Campinas-SP (Brazil); Santos, Marcelo Leite dos; Costa Lima, Aline da [Laboratório de Biologia Estrutural, Instituto de Química, Universidade Estadual de Campinas, CP 6154, 13083-970 Campinas-SP (Brazil); Menossi, Marcelo [Departamento de Genética e Evolução, Instituto de Biologia, Universidade Estadual de Campinas, Campinas-SP (Brazil); Yunes, José Andrés [Laboratório de Biologia Molecular, Centro Infantil Boldrini, Campinas-SP (Brazil); Aparicio, Ricardo, E-mail: aparicio@iqm.unicamp.br [Laboratório de Biologia Estrutural, Instituto de Química, Universidade Estadual de Campinas, CP 6154, 13083-970 Campinas-SP (Brazil)

    2007-11-01

    Preliminary X-ray diffraction studies of apo maize aldose reductase at 2.0 Å resolution are reported. Maize aldose reductase (AR) is a member of the aldo-keto reductase superfamily. In contrast to human AR, maize AR seems to prefer the conversion of sorbitol into glucose. The apoenzyme was crystallized in space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 47.2, b = 54.5, c = 100.6 Å and one molecule in the asymmetric unit. Synchrotron X-ray diffraction data were collected and a final resolution limit of 2.0 Å was obtained after data reduction. Phasing was carried out by an automated molecular-replacement procedure and structural refinement is currently in progress. The refined structure is expected to shed light on the functional/enzymatic mechanism and the unusual activities of maize AR.

  4. Crystallization and preliminary X-ray diffraction analysis of maize aldose reductase

    International Nuclear Information System (INIS)

    Preliminary X-ray diffraction studies of apo maize aldose reductase at 2.0 Å resolution are reported. Maize aldose reductase (AR) is a member of the aldo-keto reductase superfamily. In contrast to human AR, maize AR seems to prefer the conversion of sorbitol into glucose. The apoenzyme was crystallized in space group P212121, with unit-cell parameters a = 47.2, b = 54.5, c = 100.6 Å and one molecule in the asymmetric unit. Synchrotron X-ray diffraction data were collected and a final resolution limit of 2.0 Å was obtained after data reduction. Phasing was carried out by an automated molecular-replacement procedure and structural refinement is currently in progress. The refined structure is expected to shed light on the functional/enzymatic mechanism and the unusual activities of maize AR

  5. Baicalin induces NAD(P)H:quinone reductase through the transactivation of AP-1 and NF-kappaB in Hepa 1c1c7 cells.

    Science.gov (United States)

    Park, H J; Lee, Y W; Lee, S K

    2004-12-01

    Baicalin (5,6,7-trihydroxyflavone-7-O-D-glucuronic acid, BA) is a flavone isolated from Scutellariae radix. In our previous report BA was a major active principle of NAD(P)H:quinone reductase (QR) induction mediated by Scutellariae radix extract and the induction was related to the transcriptional activation of the QR gene in Hepa 1c1c7 cells. The primary aim of the present study was to determine the molecular mechanism of QR gene expression by baicalin. The antioxidant or electrophile response element (ARE/EpRE) found at the 5'-flanking region of phase II genes may play an important role in mediating their induction by xenobiotics, including chemopreventive agents. In accordance, to study the molecular mechanisms of QR gene expression by BA, electrophoretic mobility shift assay (EMSA), using nuclear extracts of treated and untreated cells against ARE, activator protein-1 (AP-1) or nuclear factor-kappaB (NF-kappaB) binding sites, showed that BA increased the binding levels of the parameters in a dose-dependent manner. Further, Hepa 1c1c7 cells were transiently transfected with a plasmid containing three copies of the AP-1- or NF-kappaB-binding site linked to a chloramphenicol acetyltransferase (CAT) reporter gene. Using the CAT reporter gene assay, a dose-dependent transactivation of AP-1- or NF-kappaB-mediated CAT expression was observed with the treatment of BA. These results clearly indicate that BA induces the QR gene expression and activity by transactivation of AP-1 and NF-kappaB, and thus BA may be considered as a potential cancer chemopreventive agent with the induction of phase II detoxification enzyme. PMID:15548947

  6. Conversion of Human Steroid 5[beta]-Reductase (AKR1D1) into 3[beta]-Hydroxysteroid Dehydrogenase by Single Point Mutation E120H: Example of Perfect Enzyme Engineering

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Mo; Drury, Jason E.; Christianson, David W.; Penning, Trevor M. (UPENN)

    2012-10-10

    Human aldo-keto reductase 1D1 (AKR1D1) and AKR1C enzymes are essential for bile acid biosynthesis and steroid hormone metabolism. AKR1D1 catalyzes the 5{beta}-reduction of {Delta}{sup 4}-3-ketosteroids, whereas AKR1C enzymes are hydroxysteroid dehydrogenases (HSDs). These enzymes share high sequence identity and catalyze 4-pro-(R)-hydride transfer from NADPH to an electrophilic carbon but differ in that one residue in the conserved AKR catalytic tetrad, His120 (AKR1D1 numbering), is substituted by a glutamate in AKR1D1. We find that the AKR1D1 E120H mutant abolishes 5{beta}-reductase activity and introduces HSD activity. However, the E120H mutant unexpectedly favors dihydrosteroids with the 5{alpha}-configuration and, unlike most of the AKR1C enzymes, shows a dominant stereochemical preference to act as a 3{beta}-HSD as opposed to a 3{alpha}-HSD. The catalytic efficiency achieved for 3{beta}-HSD activity is higher than that observed for any AKR to date. High resolution crystal structures of the E120H mutant in complex with epiandrosterone, 5{beta}-dihydrotestosterone, and {Delta}{sup 4}-androstene-3,17-dione elucidated the structural basis for this functional change. The glutamate-histidine substitution prevents a 3-ketosteroid from penetrating the active site so that hydride transfer is directed toward the C3 carbonyl group rather than the {Delta}{sup 4}-double bond and confers 3{beta}-HSD activity on the 5{beta}-reductase. Structures indicate that stereospecificity of HSD activity is achieved because the steroid flips over to present its {alpha}-face to the A-face of NADPH. This is in contrast to the AKR1C enzymes, which can invert stereochemistry when the steroid swings across the binding pocket. These studies show how a single point mutation in AKR1D1 can introduce HSD activity with unexpected configurational and stereochemical preference.

  7. Soy isoflavones increase quinone reductase in hepa-1c1c7 cells via estrogen receptor beta and nuclear factor erythroid 2-related factor 2 binding to the antioxidant response element.

    Science.gov (United States)

    Froyen, Erik B; Steinberg, Francene M

    2011-09-01

    Soy protein and isoflavones (genistein and daidzein) have been demonstrated to increase quinone reductase (QR) activity, protein, and mRNA in animal and cell culture models. However, their mechanism of action has not been completely characterized. Additionally, it has not been determined if equol, a daidzein metabolite, can modulate QR activity and expression. Estrogen receptor beta (ERβ) is thought to be involved in stimulating QR gene transcription by anti-estrogens and phytoestrogens, along with nuclear factor erythroid 2-related factor 2 (Nrf2). This study tested the hypothesis that genistein, daidzein and equol increase quinone reductase activity, protein and mRNA via ERβ and Nrf2 binding to the QR antioxidant response element (ARE). QR expression and activity were determined using TaqMan polymerase chain reaction, protein immunoblots and activity assays. Molecular events were investigated using luciferase reporter gene assays and chromatin immunoprecipitation (ChIP). Hepa-1c1c7 cells were treated with control [0.1% (v:v) dimethyl sulfoxide (DMSO)]; 1 μmol/L β-naphthoflavone (positive control); 5 μmol/L resveratrol (ChIP positive control for ERβ binding) and 1, 5 and 25 μmol/L genistein, daidzein or equol. Treatment durations were 1 h (ChIP), 24 h (mRNA and luciferase assays) and 24 and 48 h (protein and activity). Genistein, daidzein and equol increased QR activity, protein and mRNA, with daidzein and equol having more of an impact at physiologic concentrations (1 and 5 μmol/L) compared to genistein. Furthermore, the study results demonstrate that genistein, daidzein and equol interact with the QR ARE and that daidzein and equol act via both ERβ and Nrf2 binding strongly to the QR ARE. PMID:21167702

  8. Aqueous extracts of selenium-fertilized broccoli increase selenoprotein activity and inhibit DNA single-strand breaks, but decrease the activity of quinone reductase in Hepa 1c1c7 cells.

    Science.gov (United States)

    Keck, Anna-Sigrid; Finley, John W

    2006-05-01

    Depending on growth conditions, broccoli may be enriched in the isothiocyanate sulforaphane and/or the mineral selenium (Se); both compounds may play an important role in the reduction of intracellular oxidative stress and chronic disease prevention. Sulforaphane up-regulates transcription of Phase II detoxification proteins (e.g. quinone reductase [QR]), whereas Se is needed for the production of thioredoxin reductase (TR) and glutathione peroxidase-1 (GPx1), both of which exhibit antioxidant activity. The objective of the present study was to determine whether the fertilization of broccoli with Se increases the antioxidant ability of broccoli. Hydrogen peroxide-induced DNA single-strand breaks (measured by single cell electrophoresis, Comet assay) and activity of antioxidant enzymes (GPx, TR and QR) were measured in mouse hepatoma cells (Hepa 1c1c7 cells) treated with purified sulforaphane, sodium selenite or extracts of selenized broccoli. When supplied separately as chemically pure substances, sodium selenite was more effective than sulforaphane for reduction of single-strand breaks. Se-fertilized broccoli extracts were the most effective for reduction of DNA single-strand breaks, and extracts that contained 0.71 microM Se and 0.08 microM sulforaphane inhibited 94% of DNA single-strand breaks. A significant positive association (r = 0.81, p = 0.009) between GPx1 activity and inhibition of DNA single-strand breaks as well as a 24h lag time between addition of Se, sulforaphane or broccoli extract and inhibition of single-strand breaks suggests that some of the antioxidant protection is mediated through selenoproteins. Conversely, fertilization of broccoli with Se decreased the ability of broccoli extract to induce QR activity. These results demonstrate that Se and sulforaphane, alone or as a component of broccoli, may help decrease oxidative stress. They further suggest that Se is the most important for decreasing oxidative stress, but maximizing the Se content

  9. Expression, purification, crystallization and preliminary X-ray analysis of conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708

    International Nuclear Information System (INIS)

    Conjugated polyketone reductase C2 from C. parapsilosis IFO 0708 was expressed, purified and crystallized by the sitting-drop vapour-diffusion method. The crystal belonged to space group P212121 and diffracted X-rays to 1.7 Å resolution. Conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708 is a member of the NADPH-dependent aldo-keto reductase (AKR) superfamily and catalyzes the stereospecific reduction of ketopantoyl lactone to d-pantoyl lactone. A diffraction-quality crystal of recombinant CPR-C2 was obtained by the sitting-drop vapour-diffusion method using PEG 3350 as the precipitant. The crystal diffracted X-rays to 1.7 Å resolution on beamline NW12A of the Photon Factory-Advanced Ring (Tsukuba, Japan). The crystal belonged to space group P212121, with unit-cell parameters a = 55.02, b = 68.30, c = 68.93 Å. The Matthews coefficient (VM = 1.76 Å3 Da−1) indicated that the crystal contained one CPR-C2 molecule per asymmetric unit

  10. Induction and inhibition of NAD(P)H: quinone reductase in murine and human skin.

    Science.gov (United States)

    Merk, H; Jugert, F; Bonnekoh, B; Mahrle, G

    1991-01-01

    The purpose of this study was to characterize the human cutaneous NAD(P)H: quinone reductase (NQR) activity by known inhibitors of different reductases and to compare it with the murine skin and liver NQR activity. This enzyme plays a major role in the defence of cells against oxygen stress because it inhibits the 1-electron reduction of quinones to semiquinones and their subsequent oxidation to quinones termed as quinone redox cycle. It belongs to the aromatic hydrocarbon-responsive (Ah) battery. This gene battery includes Cyp1a1 (cytochrome P-450 IA1), Cyp1a2 (cytochrome P-450 IA2) and Nmo-1 [NAD(P)H: quinone reductase]. In the skin cytochrome P-450 IA1-dependent activity is about 1-5% compared to the corresponding activity in the liver, whereas NQR has the same activity in skin and liver. NQR was determined in the cytoplasm of murine skin, liver, and human keratinocytes using 2,6-dichlorophenolindophenol as the substrate. The Ah-receptor binding compounds, such as coal tar constituents, or 3-methylcholanthrene induce cytochrome P-450-dependent activities such as aryl hydrocarbon hydroxylase or 7-ethoxyresorufin-O-de-ethylase and NQR, whereas butyl hydroxytoluol, which does not bind to the Ah receptor, induces only NQR. For inhibition studies several known inhibitors of dihydrodiol dehydrogenase, aldo-keto and carbonyl reductase activities were used. There was a similar pattern of inhibition of the basal and induced activity in all tissues investigated. Pyrazole, progesterone and phenobarbital did not inhibit, whereas dicoumarol, rutin and indomethacin inhibited NQR activity in murine skin and liver as well as in human keratinocytes.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:1768430

  11. High-resolution neutron protein crystallography with radically small crystal volumes: Application of perdeuteration to human aldose reductase

    International Nuclear Information System (INIS)

    Neutron diffraction data have been collected to 2.2 (angstrom) resolution from a small (0.15 mm3) crystal of perdeuterated human aldose reductase (h-AR; MW = 36 kDa) in order to help to determine the protonation state of the enzyme. h-AR belongs to the aldo-keto reductase family and is implicated in diabetic complications. Its ternary complexes (h-AR-coenzyme NADPH-selected inhibitor) provide a good model to study both the enzymatic mechanism and inhibition. Here, the successful production of fully deuterated human aldose reductase (h-AR(D)), subsequent crystallization of the ternary complex h-AR(D)-NADPH-IDD594 and neutron Laue data collection at the LADI instrument at ILL using a crystal volume of just 0.15 mm3 are reported. Neutron data were recorded to 2 (angstrom) resolution, with subsequent data analysis using data to 2.2 (angstrom). This is the first fully deuterated enzyme of this size (36 kDa) to be solved by neutron diffraction and represents a milestone in the field, as the crystal volume is at least one order of magnitude smaller than those usually required for other high-resolution neutron structures determined to date. This illustrates the significant increase in the signal-to-noise ratio of data collected from perdeuterated crystals and demonstrates that good-quality neutron data can now be collected from more typical protein crystal volumes. Indeed, the signal-to-noise ratio is then dominated by other sources of instrument background, the nature of which is under investigation. This is important for the design of future instruments, which should take maximum advantage of the reduction in the intrinsic diffraction pattern background from fully deuterated samples.

  12. Induction of NAD(P)H: quinone reductase by rutaecarpine isolated from the fruits of Evodia rutaecarpa in the murine hepatic Hepa-1c1c7 cell line.

    Science.gov (United States)

    Ahn, Hyunjin; Nam, Joo-Won; Seo, Eun-Kyoung; Mar, Woongchon

    2008-09-01

    Rutaecarpine is a quinazolinocarboline alkaloid isolated from Evodia rutaecarpa (Juss.), which has been used in traditional Chinese medicine. The bioactivity-guided fractionation has led to the isolation of rutaecarpine from the extract of the fruits of E. rutaecarpa as the major component possessing NAD(P)H:quinone reductase (QR) activity. The activator protein-1 (AP-1), a transcriptional factor, in the antioxidant response element (ARE) region plays an important role in mediating induction of the target genes by xenobiotics, including chemopreventive agents. The present study demonstrates that rutaecarpine induces QR activity and gene expression by transactivation of AP-1. To study the induction of QR activity and AP-1-mediated QR gene expression by rutaecarpine, we performed enzyme and reporter gene assays. This compound markedly induced the enzyme activity and mRNA expression levels of QR in a dose-dependent manner. Using the luciferase reporter gene assay, a dose-dependent transactivation of AP-1-mediated luciferase expression was observed upon treatment of rutaecarpine. These results suggest that rutaecarpine induces QR gene expression and activity through an increase in AP-1 activation. PMID:18729042

  13. Modulation of cell metabolic pathways and oxidative stress signaling contribute to acquired melphalan resistance in multiple myeloma cells

    DEFF Research Database (Denmark)

    Zub, Kamila Anna; Sousa, Mirta Mittelstedt Leal de; Sarno, Antonio;

    2015-01-01

    of the AKR1C family involved in prostaglandin synthesis contribute to the resistant phenotype. Finally, selected metabolic and oxidative stress response enzymes were targeted by inhibitors, several of which displayed a selective cytotoxicity against the melphalan-resistant cells and should be further...... and pathways not previously associated with melphalan resistance in multiple myeloma cells, including a metabolic switch conforming to the Warburg effect (aerobic glycolysis), and an elevated oxidative stress response mediated by VEGF/IL8-signaling. In addition, up-regulated aldo-keto reductase levels...

  14. EST data: 8680 [RED

    Lifescience Database Archive (English)

    Full Text Available ST3645 D41273 AU174297 DPlate 090 H05 AAAAGCCCCCATTATTGTTC AGGAGGAGAGATTGCAGGAG >AGU83687_1(U836 ... 835701) Apium graveolens NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  15. EST data: 8002 [RED

    Lifescience Database Archive (English)

    Full Text Available SS4252 D48175 AU032804 S14252 4 G DPlate 083 B05 CGCAAATACACGAAATATAG TGCTTGATGAATTATGAGTC >AGU8 ... 835701) Apium graveolens NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  16. EST data: 8329 [RED

    Lifescience Database Archive (English)

    Full Text Available ST0625 AU163183 AU163184 S00625 4 G DPlate 086 A10 ACTTGGCAGGCTGGTTGGTG GAGTGGTTTGGGTCCGTTTC >AG ... 835701) Apium graveolens NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  17. Probe data: 5652 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-002330-1AR RED D41273 AU174297 ST3645 >AGU83687_1(U83687|pid:g1835701) Apium graveolens NADP ... H-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  18. The role of aryl hydrocarbon receptor in regulation of enzymes involved in metabolic activation of polycyclic aromatic hydrocarbons in a model of rat liver progenitor cells

    Czech Academy of Sciences Publication Activity Database

    Vondráček, Jan; Krčmář, P.; Procházková, Jiřina; Trilecová, L.; Gavelová, M.; Skálová, L.; Szotáková, B.; Bunček, M.; Radilová, H.; Kozubík, Alois; Machala, M.

    2009-01-01

    Roč. 180, č. 2 (2009), s. 226-237. ISSN 0009-2797 R&D Projects: GA ČR(CZ) GA524/06/0517 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : cytochromes P450 * PAHs * aldo-keto reductases Subject RIV: BO - Biophysics Impact factor: 2.457, year: 2009

  19. A1C test

    Science.gov (United States)

    HbA1C test; Glycated hemoglobin test; Glycosylated hemoglobin test; Hemoglobin glycosylated test; Glycohemoglobin test ... have recently eaten does not affect the A1C test, so you do not need to fast to ...

  20. Probe data: 3426 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-002330-1AR RED C26646 AU108627 C12762 CB2762 >AGU83687_1(U83687|pid:g1835701) Apium graveole ... ns NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  1. Probe data: 779 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-002330-1AR RED D48175 AU032804 S14252 SS4252 >AGU83687_1(U83687|pid:g1835701) Apium graveole ... ns NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  2. Probe data: 3773 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-002330-1AR RED AU163183 AU163184 S00625 ST0625 >AGU83687_1(U83687|pid:g1835701) Apium graveo ... lens NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  3. EST data: 731 [RED

    Lifescience Database Archive (English)

    Full Text Available CB2762 C26646 AU108627 C12762 4 G DPlate 008 C08 5' AAC AAT AAT GGG GGC TTT TC 3' 5' TTA TTG ATT ... 835701) Apium graveolens NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  4. A1C Test

    Science.gov (United States)

    ... to minimize the complications caused by chronically elevated glucose levels, such as progressive damage to body organs like the kidneys, eyes, cardiovascular system, and nerves. The A1c test result ...

  5. High-resolution structure of AKR1a4 in the apo form and its interaction with ligands

    International Nuclear Information System (INIS)

    Despite its high affinity for NADPH, AKR1a4 crystallized in the apo form, which is very rare for aldo-keto reductase enzymes. Aldo-keto reductase 1a4 (AKR1a4; EC 1.1.1.2) is the mouse orthologue of human aldehyde reductase (AKR1a1), the founding member of the AKR family. As an NADPH-dependent enzyme, AKR1a4 catalyses the conversion of d-glucuronate to l-gulonate. AKR1a4 is involved in ascorbate biosynthesis in mice, but has also recently been found to interact with SMAR1, providing a novel mechanism of ROS regulation by ATM. Here, the crystal structure of AKR1a4 in its apo form at 1.64 Å resolution as well as the characterization of the binding of AKR1a4 to NADPH and P44, a peptide derived from SMAR1, is presented

  6. Structure-function of human 3 alpha-hydroxysteroid dehydrogenases: genes and proteins.

    Science.gov (United States)

    Penning, T M; Jin, Y; Steckelbroeck, S; Lanisnik Rizner, T; Lewis, M

    2004-02-27

    Four soluble human 3 alpha-hydroxysteroid dehydrogenase (HSD) isoforms exist which are aldo-keto reductase (AKR) superfamily members. They share 86% sequence identity and correspond to: AKR1C1 (20 alpha(3 alpha)-HSD); AKR1C2 (type 3 3 alpha-HSD and bile-acid binding protein); AKR1C3 (type 2 3 alpha-HSD and type 5 17 beta-HSD); and AKR1C4 (type 1 3 alpha-HSD). Each of the homogeneous recombinant enzymes are plastic and display 3-, 17- and 20-ketosteroid reductase and 3 alpha- 17 beta- and 20 alpha-hydroxysteroid oxidase activities with different k(cat)/K(m) ratios in vitro. The crystal structure of the AKR1C2.NADP(+).ursodeoxycholate complex provides an explanation for this functional plasticity. Ursodeoxycholate is bound backwards (D-ring in the A-ring position) and upside down (beta-face of steroid inverted) relative to the position of 3-ketosteroids in the related rat liver 3 alpha-HSD (AKR1C9) structure. Transient transfection indicates that in COS-1 cells, AKR1C enzymes function as ketosteroid reductases due to potent inhibition of their oxidase activity by NADPH. By acting as ketosteroid reductases they may regulate the occupancy of the androgen, estrogen and progesterone receptors. RT-PCR showed that AKRs are discretely localized. AKR1C4 is virtually liver specific, while AKR1C2 and AKR1C3 are dominantly expressed in prostate and mammary gland. AKR1C genes are highly conserved in structure and may be transcriptionally regulated by steroid hormones and stress. PMID:15026176

  7. Sulforaphane promotes murine hair growth by accelerating the degradation of dihydrotestosterone.

    Science.gov (United States)

    Sasaki, Mari; Shinozaki, Shohei; Shimokado, Kentaro

    2016-03-25

    Dihydrotestosterone (DHT) causes the regression of human hair follicles in the parietal scalp, leading to androgenic alopecia (AGA). Sulforaphane (SFN) increases the expression of DHT degrading enzymes, such as 3α-hydroxysteroid dehydrogenases (3α-HSDs), and, therefore, SFN treatment may improve AGA. To determine the effects of SFN on hair growth, we administered SFN (10 mg/kg BW, IP) or vehicle (DMSO) to ob/ob mice for six weeks and examined hair regeneration and the plasma levels of testosterone and DHT. We also tested the effects of SFN on the expression of two forms of 3α-HSD, aldo-keto reductase 1c21 and dehydrogenase/reductase (SDR family) member 9, both in vitro and in vivo. SNF significantly enhanced hair regeneration in ob/ob mice. The mice treated with SFN showed lower plasma levels of testosterone and DHT than those treated with vehicle. SFN increased the mRNA and protein levels of the two forms of 3α-HSD in the liver of the mice and in cultured murine hepatocyte Hepa1c1c7 cells. These results suggest that SFN treatment increases the amount of 3α-HSDs in the liver, accelerates the degradation of blood DHT, and subsequently blocks the suppression of hair growth by DHT. PMID:26923074

  8. Depressed Levels of Prostaglandin F2α in Mice Lacking Akr1b7 Increase Basal Adiposity and Predispose to Diet-Induced Obesity

    OpenAIRE

    Volat, Fanny E.; Pointud, Jean-Christophe; Pastel, Emilie; Morio, Béatrice; Sion, Benoit; Hamard, Ghislaine; Guichardant, Michel; Colas, Romain; Lefrançois-Martinez, Anne-Marie; Martinez, Antoine

    2012-01-01

    Negative regulators of white adipose tissue (WAT) expansion are poorly documented in vivo. Prostaglandin F2α (PGF2α) is a potent antiadipogenic factor in cultured preadipocytes, but evidence for its involvement in physiological context is lacking. We previously reported that Akr1b7, an aldo-keto reductase enriched in adipose stromal vascular fraction but absent from mature adipocytes, has antiadipogenic properties possibly supported by PGF2α synthase activity. To test whether lack of Akr1b7 c...

  9. Utilization of digital differential display to identify differentially expressed genes related to rumen development.

    Science.gov (United States)

    Kato, Daichi; Suzuki, Yutaka; Haga, Satoshi; So, KyoungHa; Yamauchi, Eri; Nakano, Miwa; Ishizaki, Hiroshi; Choi, Kichoon; Katoh, Kazuo; Roh, Sang-Gun

    2016-04-01

    This study aimed to identify the genes associated with the development of the rumen epithelium by screening for candidate genes by digital differential display (DDD) in silico. Using DDD in NCBI's UniGene database, expressed sequence tag (EST)-based gene expression profiles were analyzed in rumen, reticulum, omasum, abomasum and other tissues in cattle. One hundred and ten candidate genes with high expression in the rumen were derived from a library of all tissues. The expression levels of 11 genes in all candidate genes were analyzed in the rumen, reticulum, omasum and abomasum of nine Japanese Black male calves (5-week-old pre-weaning: n = 3; 15-week-old weaned calves: n = 6). Among the 11 genes, only 3-hydroxy-3-methylglutaryl-CoA synthase 2 (HMGCS2), aldo-keto reductase family 1, member C1-like (AKR1C1), and fatty acid binding protein 3 (FABP3) showed significant changes in the levels of gene expression in the rumen between the pre- and post-weaning of calves. These results indicate that DDD analysis in silico can be useful for screening candidate genes related to rumen development, and that the changes in expression levels of three genes in the rumen may have been caused by weaning, aging or both. © 2015 Japanese Society of Animal Science. PMID:26388291

  10. A1C Test and Diabetes

    Science.gov (United States)

    ... Prediabetes The A1C Test and Diabetes The A1C Test and Diabetes What is the A1C test? The A1C test is a blood test that ... management and diabetes research. How does the A1C test work? The A1C test is based on the ...

  11. Effects of rutaecarpine on hydrogen peroxide-induced apoptosis in murine hepa-1c1c7 cells.

    Science.gov (United States)

    Lee, Sung-Jin; Ahn, Hyunjin; Nam, Kung-Woo; Kim, Kyeong Ho; Mar, Woongchon

    2012-09-01

    The aim of this study was to investigate the inhibitory effects of rutaecarpine on DNA strand breaks and apoptosis induced by hydrogen peroxide (H2O2) in murine Hepa-1c1c7 cells. Oxidative DNA damage was estimated by nuclear condensation assessment, fluorescence-activated cell sorting analysis, and Comet assay. Rutaecarpine inhibited cell death induced by 500 μM H2O2, as assessed by 4',6-diamidino-2-phenylindole (DAPI) staining. Treatment with rutaecarpine reduced the number of DNA strand breaks induced by H2O2, as assessed by DAPI staining and Comet assay, and increased quinone reductase, phosphatidylinositol 3-kinase, and pAkt protein levels, as assessed by western blotting. PMID:24009839

  12. Human brain aldehyde reductases: relationship to succinic semialdehyde reductase and aldose reductase.

    Science.gov (United States)

    Hoffman, P L; Wermuth, B; von Wartburg, J P

    1980-08-01

    Human brain contains multiple forms of aldehyde-reducing enzymes. One major form (AR3), as previously shown, has properties that indicate its identity with NADPH-dependent aldehyde reductase isolated from brain and other organs of various species; i.e., low molecular weight, use of NADPH as the preferred cofactor, and sensitivity to inhibition by barbiturates. A second form of aldehyde reductase ("SSA reductase") specifically reduces succinic semialdehyde (SSA) to produce gamma-hydroxybutyrate. This enzyme form has a higher molecular weight than AR3, and uses NADH as well as NADPH as cofactor. SSA reductase was not inhibited by pyrazole, oxalate, or barbiturates, and the only effective inhibitor found was the flavonoid quercetine. Although AR3 can also reduce SSA, the relative specificity of SSA reductase may enhance its in vivo role. A third form of human brain aldehyde reductase, AR2, appears to be comparable to aldose reductases characterized in several species, on the basis of its activity pattern with various sugar aldehydes and its response to characteristic inhibitors and activators, as well as kinetic parameters. This enzyme is also the most active in reducing the aldehyde derivatives of biogenic amines. These studies suggest that the various forms of human brain aldehyde reductases may have specific physiological functions. PMID:6778961

  13. Sulforaphane Preconditioning Sensitizes Human Colon Cancer Cells towards the Bioreductive Anticancer Prodrug PR-104A.

    Science.gov (United States)

    Erzinger, Melanie M; Bovet, Cédric; Hecht, Katrin M; Senger, Sabine; Winiker, Pascale; Sobotzki, Nadine; Cristea, Simona; Beerenwinkel, Niko; Shay, Jerry W; Marra, Giancarlo; Wollscheid, Bernd; Sturla, Shana J

    2016-01-01

    The chemoprotective properties of sulforaphane (SF), derived from cruciferous vegetables, are widely acknowledged to arise from its potent induction of xenobiotic-metabolizing and antioxidant enzymes. However, much less is known about the impact of SF on the efficacy of cancer therapy through the modulation of drug-metabolizing enzymes. To identify proteins modulated by a low concentration of SF, we treated HT29 colon cancer cells with 2.5 μM SF. Protein abundance changes were detected by stable isotope labeling of amino acids in cell culture. Among 18 proteins found to be significantly up-regulated, aldo-keto reductase 1C3 (AKR1C3), bioactivating the DNA cross-linking prodrug PR-104A, was further characterized. Preconditioning HT29 cells with SF reduced the EC50 of PR-104A 3.6-fold. The increase in PR-104A cytotoxicity was linked to AKR1C3 abundance and activity, both induced by SF in a dose-dependent manner. This effect was reproducible in a second colon cancer cell line, SW620, but not in other colon cancer cell lines where AKR1C3 abundance and activity were absent or barely detectable and could not be induced by SF. Interestingly, SF had no significant influence on PR-104A cytotoxicity in non-cancerous, immortalized human colonic epithelial cell lines expressing either low or high levels of AKR1C3. In conclusion, the enhanced response of PR-104A after preconditioning with SF was apparent only in cancer cells provided that AKR1C3 is expressed, while its expression in non-cancerous cells did not elicit such a response. Therefore, a subset of cancers may be susceptible to combined food-derived component and prodrug treatments with no harm to normal tissues. PMID:26950072

  14. Drug interaction of boceprevir and amlodipine in a patient with hepatitis C: A cardiovascular follow-up

    Directory of Open Access Journals (Sweden)

    Çiğdem Kader

    2015-03-01

    Full Text Available Boceprevir is a NS3/4A hepatitis C virus (HCV protease inhibitor, used in combination with peginterferon and ribavirin to treat HCV. Boceprevir undergoes extensive metabolism via cytochrome P450-mediated oxidation and ketoreduction by cytosolic aldo-keto reductases. Amlodipine has been used for the treatment of patients with hypertension and also metabolised through cytochrome P450 pathway. Here, we presented a case of boceprevir and amlodipine interaction in a patient with chronic HCV and her echocardiography and electrocardiographic follow-up results. J Microbiol Infect Dis 2015;5(1: 32-35

  15. 7 CFR 1c.114 - Cooperative research.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 1 2010-01-01 2010-01-01 false Cooperative research. 1c.114 Section 1c.114 Agriculture Office of the Secretary of Agriculture PROTECTION OF HUMAN SUBJECTS § 1c.114 Cooperative research. Cooperative research projects are those projects covered by this policy which involve more than...

  16. Genetics Home Reference: sepiapterin reductase deficiency

    Science.gov (United States)

    Skip to main content Your Guide to Understanding Genetic Conditions Enable Javascript for addthis links to activate. ... Conditions Genes Chromosomes & mtDNA Resources Help Me Understand Genetics Home Health Conditions sepiapterin reductase deficiency sepiapterin reductase ...

  17. Led Astray by Hemoglobin A1c

    Science.gov (United States)

    Chen, Jean; Diesburg-Stanwood, Amy; Bodor, Geza; Rasouli, Neda

    2016-01-01

    Hemoglobin A1c (A1c) is used frequently to diagnose and treat diabetes mellitus. Therefore, it is important be aware of factors that may interfere with the accuracy of A1c measurements. This is a case of a rare hemoglobin variant that falsely elevated a nondiabetic patient’s A1c level and led to a misdiagnosis of diabetes. A 67-year-old male presented to endocrine clinic for further management after he was diagnosed with diabetes based on an elevated A1c of 10.7%, which is approximately equivalent to an average blood glucose of 260 mg/dL. Multiple repeat A1c levels remained >10%, but his home fasting and random glucose monitoring ranged from 92 to 130 mg/dL. Hemoglobin electrophoresis and subsequent genetic analysis diagnosed the patient with hemoglobin Wayne, a rare hemoglobin variant. This variant falsely elevates A1c levels when A1c is measured using cation-exchange high-performance liquid chromatography. When the boronate affinity method was applied instead, the patient’s A1c level was actually 4.7%. Though hemoglobin Wayne is clinically silent, this patient was erroneously diagnosed with diabetes and started on an antiglycemic medication. Due to this misdiagnosis, the patient was at risk of escalation in his “diabetes management” and hypoglycemia. Therefore, it is important that providers are aware of factors that may result in hemoglobin A1c inaccuracy including hemoglobin variants. PMID:26848480

  18. A1C Test and Diabetes

    Science.gov (United States)

    ... of Diabetes Educators American Diabetes Association JDRF MedlinePlus Diabetes Disease Organizations ​There are many organizations who provide ... KB). Alternate Language URL The A1C Test and Diabetes Page Content On this page: What is the ...

  19. Fatty acyl-CoA reductase

    Energy Technology Data Exchange (ETDEWEB)

    Reiser, Steven E.; Somerville, Chris R.

    1998-12-01

    The present invention relates to bacterial enzymes, in particular to an acyl-CoA reductase and a gene encoding an acyl-CoA reductase, the amino acid and nucleic acid sequences corresponding to the reductase polypeptide and gene, respectively, and to methods of obtaining such enzymes, amino acid sequences and nucleic acid sequences. The invention also relates to the use of such sequences to provide transgenic host cells capable of producing fatty alcohols and fatty aldehydes.

  20. Combined bezafibrate and medroxyprogesterone acetate: potential novel therapy for acute myeloid leukaemia.

    Directory of Open Access Journals (Sweden)

    Farhat L Khanim

    Full Text Available BACKGROUND: The majority of acute myeloid leukaemia (AML patients are over sixty years of age. With current treatment regimens, survival rates amongst these, and also those younger patients who relapse, remain dismal and novel therapies are urgently required. In particular, therapies that have anti-leukaemic activity but that, unlike conventional chemotherapy, do not impair normal haemopoiesis. PRINCIPAL FINDINGS: Here we demonstrate the potent anti-leukaemic activity of the combination of the lipid-regulating drug bezafibrate (BEZ and the sex hormone medroxyprogesterone acetate (MPA against AML cell lines and primary AML cells. The combined activity of BEZ and MPA (B/M converged upon the increased synthesis and reduced metabolism of prostaglandin D(2 (PGD(2 resulting in elevated levels of the downstream highly bioactive, anti-neoplastic prostaglandin 15-deoxy Delta(12,14 PGJ(2 (15d-PGJ(2. BEZ increased PGD(2 synthesis via the generation of reactive oxygen species (ROS and activation of the lipid peroxidation pathway. MPA directed prostaglandin synthesis towards 15d-PGJ(2 by inhibiting the PGD(2 11beta -ketoreductase activity of the aldo-keto reductase AKR1C3, which metabolises PGD(2 to 9alpha11beta-PGF(2alpha. B/M treatment resulted in growth arrest, apoptosis and cell differentiation in both AML cell lines and primary AML cells and these actions were recapitulated by treatment with 15d-PGJ(2. Importantly, the actions of B/M had little effect on the survival of normal adult myeloid progenitors. SIGNIFICANCE: Collectively our data demonstrate that B/M treatment of AML cells elevated ROS and delivered the anti-neoplastic actions of 15d-PGJ(2. These observations provide the mechanistic rationale for the redeployment of B/M in elderly and relapsed AML.

  1. Radioimmunological determination of hemoglobin Asub(1c)

    International Nuclear Information System (INIS)

    The antibodies fighting human haemaglobin A sub(1c) to diagnose diabetes is obtained by immunisation of cats, goats or sheep. The acquisition of antigen antibody complexes in a blood sample is done by radioimmunological determination using antigen labelled with I 125 (several examples). (DG)

  2. A1C Test and Diabetes

    Science.gov (United States)

    ... Top ] Will the A1C test show changes in blood glucose levels? Large changes in a person’s blood glucose levels ... test that provides information about a person’s average levels of blood glucose, also called blood sugar, over the past 3 ...

  3. Cancer stem cell-related marker expression in lung adenocarcinoma and relevance of histologic subtypes based on IASLC/ATS/ERS classification

    Directory of Open Access Journals (Sweden)

    Shimada Y

    2013-11-01

    Full Text Available Yoshihisa Shimada,1 Hisashi Saji,3 Masaharu Nomura,1,2 Jun Matsubayashi,2 Koichi Yoshida,1 Masatoshi Kakihana,1 Naohiro Kajiwara,1 Tatsuo Ohira,1 Norihiko Ikeda11Department of Surgery I, 2Department of Anatomic Pathology, Tokyo Medical University Hospital, Tokyo, Japan; 3Department of Chest Surgery, St Marianna University School of Medicine, Kawasaki, JapanBackground: The cancer stem cell (CSC theory has been proposed to explain tumor heterogeneity and the carcinogenesis of solid tumors. The aim of this study was to clarify the clinical role of CSC-related markers in patients with lung adenocarcinoma and to determine whether each CSC-related marker expression correlates with the histologic subtyping proposed by the International Association for the Study of Lung Cancer (IASLC, the American Thoracic Society (ATS, and the European Respiratory Society (ERS classifications.Methods: We reviewed data for all 103 patients in whom complete resection of adenocarcinoma had been performed. Expression of CSC-related markers, ie, aldehyde dehydrogenase 1A1 (ALDH1A1, aldo-keto reductase 1C family member 1 (AK1C1, and 1C family member 3 (AK1C3, was examined using immunostaining on whole-mount tissue slides, and the tumors were reclassified according to the IASLC/ATS/ERS classification.Results: ALDH1A1 expression was observed in 66.0% of tumors, AK1C1 in 62.7%, and AK1C3 in 86.1%. Immunoreactivities with the frequency of mean expression of ALDH1A1 in papillary predominant adenocarcinoma were significantly higher than those of solid predominant adenocarcinoma (P<0.05. Papillary predominant adenocarcinoma had significantly lower expression of AK1C1 when compared with noninvasive or solid predominant adenocarcinomas (P<0.05. On multivariate analysis, larger tumor size (hazards ratio 1.899, P=0.044, lymph node metastasis (hazards ratio 2.702, P=0.005, and low expression of ALDH1A1 (hazards ratio 3.218, P<0.001 were shown to be independently associated with an

  4. Calmodulin binding to recombinant myosin-1c and myosin-1c IQ peptides

    Directory of Open Access Journals (Sweden)

    Cyr Janet L

    2002-11-01

    Full Text Available Abstract Background Bullfrog myosin-1c contains three previously recognized calmodulin-binding IQ domains (IQ1, IQ2, and IQ3 in its neck region; we identified a fourth IQ domain (IQ4, located immediately adjacent to IQ3. How calmodulin binds to these IQ domains is the subject of this report. Results In the presence of EGTA, calmodulin bound to synthetic peptides corresponding to IQ1, IQ2, and IQ3 with Kd values of 2–4 μM at normal ionic strength; the interaction with an IQ4 peptide was much weaker. Ca2+ substantially weakened the calmodulin-peptide affinity for all of the IQ peptides except IQ3. To reveal how calmodulin bound to the linearly arranged IQ domains of the myosin-1c neck, we used hydrodynamic measurements to determine the stoichiometry of complexes of calmodulin and myosin-1c. Purified myosin-1c and T701-Myo1c (a myosin-1c fragment with all four IQ domains and the C-terminal tail each bound 2–3 calmodulin molecules. At a physiologically relevant temperature (25°C and under low-Ca2+ conditions, T701-Myo1c bound two calmodulins in the absence and three calmodulins in the presence of 5 μM free calmodulin. Ca2+ dissociated nearly all calmodulins from T701-Myo1c at 25°C; one calmodulin was retained if 5 μM free calmodulin was present. Conclusions We inferred from these data that at 25°C and normal cellular concentrations of calmodulin, calmodulin is bound to IQ1, IQ2, and IQ3 of myosin-1c when Ca2+ is low. The calmodulin bound to one of these IQ domains, probably IQ2, is only weakly associated. Upon Ca2+ elevation, all calmodulin except that bound to IQ3 should dissociate.

  5. Identification, Characterization, and Classification of Genes Encoding Perchlorate Reductase

    OpenAIRE

    Bender, Kelly S.; Shang, Ching; Chakraborty, Romy; Belchik, Sara M.; Coates, John D.; Achenbach, Laurie A.

    2005-01-01

    The reduction of perchlorate to chlorite, the first enzymatic step in the bacterial reduction of perchlorate, is catalyzed by perchlorate reductase. The genes encoding perchlorate reductase (pcrABCD) in two Dechloromonas species were characterized. Sequence analysis of the pcrAB gene products revealed similarity to α- and β-subunits of microbial nitrate reductase, selenate reductase, dimethyl sulfide dehydrogenase, ethylbenzene dehydrogenase, and chlorate reductase, all of which are type II m...

  6. Sepiapterin Reductase Deficiency: Mimic of Cerebral Palsy

    OpenAIRE

    J Gordon Millichap

    2012-01-01

    Researchers at University of California at San Diego, and 22 other US national and international centers studied the clinical, biochemical, and molecular findings in a cohort of 38 patients with sepiapterin reductase deficiency (SRD).

  7. Multiple aldehyde reductases of human brain.

    Science.gov (United States)

    Hoffman, P L; Wermuth, B; von Wartburg, J P

    1980-01-01

    Human brain contains four forms of aldehyde reducing enzymes. One major activity, designated AR3, has properties indicating its identity with the NADPH-dependent aldehyde reductase, EC 1.1.1.2. The other major form of human brain enzyme, AR1, which is also NADPH-dependent, reduces both aldehyde and ketone-containing substrates, including vitamin K3 (menadione) and daunorubicin, a cancer chemotherapeutic agent. This enzyme is very sensitive to inhibition by the flavonoids quercitrin and quercetine, and may be analogous to a daunorubicin reductase previously described in liver of other species. One minor form of human brain aldehyde reductase, AR2, demonstrates substrate specificity and inhibitor sensitivity which suggest its similarity to aldose reductases found in lens and other tissues of many species. This enzyme, which can also use NADH as cofactor to some extent, is the most active in reducing the aldehyde derivatives of the biogenic amines. The fourth human brain enzyme ("SSA reductase") differs from the other forms in its ability to use NADH as well as or better than NADPH as cofactor, and in its molecular weight, which is nearly twice that of the other forms. It is quite specific for succinic semialdehyde (SSA) as substrate, and was found to be significantly inhibited only by quercetine and quercitrin. AR3 can also reduce SSA, and both enzymes may contribute to the production of gamma-hydroxybutyric acid in vivo. These results indicate that the human brain aldehyde reductases can play relatively specific physiologic roles. PMID:7424738

  8. Enzymatic syntheses of (1-(C-11))pyruvic acid and L-(1-(C-11))lactic acid via DL-(1-(C-11))alanine

    Energy Technology Data Exchange (ETDEWEB)

    Ropchan, J.R.; Barrio, J.R.

    1984-01-01

    L-(1-(C-11)) Lactic acid was prepared in three steps using a remote, semi-automated procedure: (1) production of DL-(1-(C-11)) alanine (2) enzymatic conversion of DL (1-(C-11)) alanine to (1-(C-11)) pyruvate and (3) enzymatic transformation of (1-(C-11)) pyruvate to L-(1-(C-11)) lactic acid. DL-(1-(C-11)) Alanine was synthesized from NCA C-11 HCN using a modification of the Bucherer-Strecker reaction. The DL-isomers were converted to (1-(C-11)) pyruvate by passage through (1) immobilized D-amino acid oxidase enzyme column followed by (2) immobilized L-alanine dehydrogenase (l-ADH) enzyme column. (1-(C-11)) Pyruvate was then transformed to L-(1-(C-11)) lactic acid by elution through a L-lactic dehydrogenase enzyme column. These enzyme columns are reusable beyond three months, give high radiochemical purity (>98%), eliminate the possibility of protein contamination, assure sterile, pyrogen-free products and allow rapid separation and quantitative conversion of DL-isomers to the desired products. Typically the synthesis required 30-40 min after cyclotron production of NCA C-11 HCN with radiochemical yields of 15-25 mCi (23%) of L-(1-(C-11)) lactic acid and 20-35 mCi (33%) of (l-(C-11)) pyruvic acid starting with 250-400 mCi of C-11 HCN. Also 10-20 mCi (19%) of L-(1-(C-11)) alanine was produced by resin separation (AG50W-X8), H/sup +/ form of (1-(C-11)) pyruvate and L-(1-(C-11)) alanine following elution through D-AAO enzyme column. The radiochemical purities of (1-(C-11)) pyruvic acid, L-(1-(C-11)) lactic acid and L-(1-(C-11)) alanine were verified routinely by reversed-phase HPLC.

  9. Structural and mechanistic insights on nitrate reductases.

    Science.gov (United States)

    Coelho, Catarina; Romão, Maria João

    2015-12-01

    Nitrate reductases (NR) belong to the DMSO reductase family of Mo-containing enzymes and perform key roles in the metabolism of the nitrogen cycle, reducing nitrate to nitrite. Due to variable cell location, structure and function, they have been divided into periplasmic (Nap), cytoplasmic, and membrane-bound (Nar) nitrate reductases. The first crystal structure obtained for a NR was that of the monomeric NapA from Desulfovibrio desulfuricans in 1999. Since then several new crystal structures were solved providing novel insights that led to the revision of the commonly accepted reaction mechanism for periplasmic nitrate reductases. The two crystal structures available for the NarGHI protein are from the same organism (Escherichia coli) and the combination with electrochemical and spectroscopic studies also lead to the proposal of a reaction mechanism for this group of enzymes. Here we present an overview on the current advances in structural and functional aspects of bacterial nitrate reductases, focusing on the mechanistic implications drawn from the crystallographic data. PMID:26362109

  10. Analysis list: Myo1c [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Myo1c Embryonic fibroblast + mm9 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/target/My...o1c.1.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/target/Myo1c.5.tsv http://dbarchive.bioscienc...edbc.jp/kyushu-u/mm9/target/Myo1c.10.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/colo/Myo1c.Embryonic

  11. Analysis list: Jmjd1c [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Jmjd1c Pluripotent stem cell + mm9 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/target/Jmj...d1c.1.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/target/Jmjd1c.5.tsv http://dbarchive.biosc...iencedbc.jp/kyushu-u/mm9/target/Jmjd1c.10.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/colo/Jmjd1c.Plu

  12. Respiratory arsenate reductase as a bidirectional enzyme

    International Nuclear Information System (INIS)

    The haloalkaliphilic bacterium Alkalilimnicola ehrlichii is capable of anaerobic chemolithoautotrophic growth by coupling the oxidation of arsenite (As(III)) to the reduction of nitrate and carbon dioxide. Analysis of its complete genome indicates that it lacks a conventional arsenite oxidase (Aox), but instead possesses two operons that each encode a putative respiratory arsenate reductase (Arr). Here we show that one homolog is expressed under chemolithoautotrophic conditions and exhibits both arsenite oxidase and arsenate reductase activity. We also demonstrate that Arr from two arsenate respiring bacteria, Alkaliphilus oremlandii and Shewanella sp. strain ANA-3, is also biochemically reversible. Thus Arr can function as a reductase or oxidase. Its physiological role in a specific organism, however, may depend on the electron potentials of the molybdenum center and [Fe-S] clusters, additional subunits, or constitution of the electron transfer chain. This versatility further underscores the ubiquity and antiquity of microbial arsenic metabolism.

  13. Respiratory arsenate reductase as a bidirectional enzyme

    Science.gov (United States)

    Richey, C.; Chovanec, P.; Hoeft, S.E.; Oremland, R.S.; Basu, P.; Stolz, J.F.

    2009-01-01

    The haloalkaliphilic bacterium Alkalilimnicola ehrlichii is capable of anaerobic chemolithoautotrophic growth by coupling the oxidation of arsenite (As(III)) to the reduction of nitrate and carbon dioxide. Analysis of its complete genome indicates that it lacks a conventional arsenite oxidase (Aox), but instead possesses two operons that each encode a putative respiratory arsenate reductase (Arr). Here we show that one homolog is expressed under chemolithoautotrophic conditions and exhibits both arsenite oxidase and arsenate reductase activity. We also demonstrate that Arr from two arsenate respiring bacteria, Alkaliphilus oremlandii and Shewanella sp. strain ANA-3, is also biochemically reversible. Thus Arr can function as a reductase or oxidase. Its physiological role in a specific organism, however, may depend on the electron potentials of the molybdenum center and [Fe–S] clusters, additional subunits, or constitution of the electron transfer chain. This versatility further underscores the ubiquity and antiquity of microbial arsenic metabolism.

  14. 21 CFR 864.7375 - Glutathione reductase assay.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Glutathione reductase assay. 864.7375 Section 864... reductase assay. (a) Identification. A glutathione reductase assay is a device used to determine the... fluorescence and photometry. The results of this assay are used in the diagnosis of liver disease,...

  15. Characterization of the chlorate reductase from Pseudomonas chloritidismutans

    NARCIS (Netherlands)

    Wolterink, A.F.W.M.; Schiltz, E.; Hagedoorn, P.L.; Hagen, W.R.; Kengen, S.W.M.; Stams, A.J.M.

    2003-01-01

    A chlorate reductase has been purified from the chlorate-reducing strain Pseudomonas chloritidismutans. Comparison with the periplasmic (per)chlorate reductase of strain GR-1 showed that the cytoplasmic chlorate reductase of P. chloritidismutans reduced only chlorate and bromate. Differences were al

  16. 7 CFR 1c.112 - Review by institution.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 1 2010-01-01 2010-01-01 false Review by institution. 1c.112 Section 1c.112 Agriculture Office of the Secretary of Agriculture PROTECTION OF HUMAN SUBJECTS § 1c.112 Review by institution... review and approval or disapproval by officials of the institution. However, those officials may...

  17. Calmodulin binding to recombinant myosin-1c and myosin-1c IQ peptides

    OpenAIRE

    Cyr Janet L; Gillespie Peter G

    2002-01-01

    Abstract Background Bullfrog myosin-1c contains three previously recognized calmodulin-binding IQ domains (IQ1, IQ2, and IQ3) in its neck region; we identified a fourth IQ domain (IQ4), located immediately adjacent to IQ3. How calmodulin binds to these IQ domains is the subject of this report. Results In the presence of EGTA, calmodulin bound to synthetic peptides corresponding to IQ1, IQ2, and IQ3 with Kd values of 2–4 μM at normal ionic strength; the interaction with an IQ4 peptide was much...

  18. Analysis list: JMJD1C [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available JMJD1C Blood + hg19 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/target/JMJD1C.1....tsv http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/target/JMJD1C.5.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/target/JM...JD1C.10.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/JMJD1C.Blood.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/colo/Blood.gml ...

  19. Expression of progesterone metabolizing enzyme genes (AKR1C1, AKR1C2, AKR1C3, SRD5A1, SRD5A2) is altered in human breast carcinoma

    International Nuclear Information System (INIS)

    Recent evidence suggests that progesterone metabolites play important roles in regulating breast cancer. Previous studies have shown that tumorous tissues have higher 5α-reductase (5αR) and lower 3α-hydroxysteroid oxidoreductase (3α-HSO) and 20α-HSO activities. The resulting higher levels of 5α-reduced progesterone metabolites such as 5α-pregnane-3,20-dione (5αP) in tumorous tissue promote cell proliferation and detachment, whereas the 4-pregnene metabolites, 4-pregnen-3α-ol-20-one (3αHP) and 4-pregnen-20α-ol-3-one (20αDHP), more prominent in normal tissue, have the opposite (anti-cancer-like) effects. The aim of this study was to determine if the differences in enzyme activities between tumorous and nontumorous breast tissues are associated with differences in progesterone metabolizing enzyme gene expression. Semi-quantitative RT-PCR was used to compare relative expression (as a ratio of 18S rRNA) of 5αR type 1 (SRD5A1), 5αR type 2 (SRD5A2), 3α-HSO type 2 (AKR1C3), 3α-HSO type 3 (AKR1C2) and 20α-HSO (AKR1C1) mRNAs in paired (tumorous and nontumorous) breast tissues from 11 patients, and unpaired tumor tissues from 17 patients and normal tissues from 10 reduction mammoplasty samples. Expression of 5αR1 and 5αR2 in 11/11 patients was higher (mean of 4.9- and 3.5-fold, respectively; p < 0.001) in the tumor as compared to the paired normal tissues. Conversely, expression of 3α-HSO2, 3α-HSO3 and 20α-HSO was higher (2.8-, 3.9- and 4.4-fold, respectively; p < 0.001) in normal than in tumor sample. The mean tumor:normal expression ratios for 5αR1 and 5αR2 were about 35–85-fold higher than the tumor:normal expression ratios for the HSOs. Similarly, in the unmatched samples, the tumor:normal ratios for 5αR were significantly higher than the ratios for the HSOs. The study shows changes in progesterone metabolizing enzyme gene expression in human breast carcinoma. Expression of SRD5A1 (5αR1) and SRD5A2 (5αR2) is elevated, and expression of AKR1C1

  20. Dicty_cDB: Contig-U15201-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available . 117 4e-52 BT038384_1( BT038384 |pid:none) Zea mays full-length cDNA clone ZM... 110 5e-52 BC095647_1( BC095647 |pid:none) Danio...dium phytofermentans ISD... 100 9e-40 CP000764_2653( CP000764 |pid:none) Bacillus cer...ne) Pediococcus pentosaceus ATCC 2574... 103 7e-33 AB014493_1( AB014493 |pid:none) Gibberella zeae gen...base: CSM 8402 sequences; 8,075,542 total letters Score E Sequences producing significant al...e 2 ... 114 2e-53 BC092808_1( BC092808 |pid:none) Danio rerio aldo-keto reductase

  1. Fundamental roles of reactive oxygen species and protective mechanisms in the female reproductive system

    Directory of Open Access Journals (Sweden)

    Okada Futoshi

    2005-09-01

    Full Text Available Abstract Controlled oxidation, such as disulfide bond formation in sperm nuclei and during ovulation, plays a fundamental role in mammalian reproduction. Excess oxidation, however, causes oxidative stress, resulting in the dysfunction of the reproductive process. Antioxidation reactions that reduce the levels of reactive oxygen species are of prime importance in reproductive systems in maintaining the quality of gametes and support reproduction. While anti-oxidative enzymes, such as superoxide dismutase and peroxidase, play a central role in eliminating oxidative stress, reduction-oxidation (redox systems, comprised of mainly glutathione and thioredoxin, function to reduce the levels of oxidized molecules. Aldo-keto reductase, using NADPH as an electron donor, detoxifies carbonyl compounds resulting from the oxidation of lipids and proteins. Thus, many antioxidative and redox enzyme genes are expressed and aggressively protect gametes and embryos in reproductive systems.

  2. SCREENING OF HMG CO A REDUCTASE INHIBITOR PRODUCING MARINE ACTINOMYCETES

    OpenAIRE

    SRINU, PHANI BHUSHAN,MOGES, SRILAKSHMI, SANKAR, PRABHAKAR,LAKSHMINARAYANA

    2013-01-01

    The objective of the present study was screening of 3-hydroxy-3- methyl glutaryl Co A (HMG CoA) reductase inhibitor producing marine actinomycetes. A total of 65 morphologically different actinomycetes were screened for HMG CoA reductase inhibitor production in a two stage submerged fermentation and evaluated for HMG CoA reductase inhibitor activity by agar diffusion and thin layer chromatography technique using lovostatin as a control. Among 65 marine Actinomycete strains, only one strain pr...

  3. Characterization of the chlorate reductase from Pseudomonas chloritidismutans

    OpenAIRE

    Wolterink, A.F.W.M.; Schiltz, E; Hagedoorn, P.L.; Hagen, W.R.; Kengen, S.W.M.; Stams, A.J.M.

    2003-01-01

    A chlorate reductase has been purified from the chlorate-reducing strain Pseudomonas chloritidismutans. Comparison with the periplasmic (per)chlorate reductase of strain GR-1 showed that the cytoplasmic chlorate reductase of P. chloritidismutans reduced only chlorate and bromate. Differences were also found in N-terminal sequences, molecular weight, and subunit composition. Metal analysis and electron paramagnetic resonance measurements showed the presence of iron and molybdenum, which are al...

  4. Characterization of the Chlorate Reductase from Pseudomonas chloritidismutans

    OpenAIRE

    2003-01-01

    A chlorate reductase has been purified from the chlorate-reducing strain Pseudomonas chloritidismutans. Comparison with the periplasmic (per)chlorate reductase of strain GR-1 showed that the cytoplasmic chlorate reductase of P. chloritidismutans reduced only chlorate and bromate. Differences were also found in N-terminal sequences, molecular weight, and subunit composition. Metal analysis and electron paramagnetic resonance measurements showed the presence of iron and molybdenum, which are al...

  5. Structure and mechanism of dimethylsulfoxide reductase, a molybdopterin-containing enzyme of DMSO reductase family

    International Nuclear Information System (INIS)

    Full text: Apart from nitrogenase, enzymes containing molybdenum are members of a superfamily, the molybdopterin-containing enzymes. Most of these enzymes catalyse an oxygen atom transfer and two electron transfer reaction. During catalysis the Mo at the active site cycles between the Mo(VI) and Mo(IV) states. The DMSO reductase family of molybdopterin-containing enzymes all contain a bis(molybdopterin guanine dinucleotide)Mo cofactor and over thirty examples have now been described. Over the last five years crystal structures of dimethylsulfoxide (DMSO) reductase and four other enzymes of the DMSO reductase family have revealed that enzymes of this family have a similar tertiary structure. The Mo atom at the active site is coordinated by four thiolate ligands provided by the dithiolene side chains of the two MGD molecules of the bis(MGD)Mo cofactor as well as a ligand provided by an amino acid side chain. In addition, an oxygen atom in the form of an oxo, hydroxo or aqua group is also coordinated to the Mo atom. In the case of dimethylsulfoxide reductase X-ray crystallography of the product-reduced species and Raman spectroscopy has demonstrated that the enzyme contains a single exchangeable oxo group that is H-bonded to W116

  6. Structure and function of NADPH-cytochrome P450 reductase and nitric oxide synthase reductase domain

    International Nuclear Information System (INIS)

    NADPH-cytochrome P450 reductase (CPR) and the nitric oxide synthase (NOS) reductase domains are members of the FAD-FMN family of proteins. The FAD accepts two reducing equivalents from NADPH (dehydrogenase flavin) and FMN acts as a one-electron carrier (flavodoxin-type flavin) for the transfer from NADPH to the heme protein, in which the FMNH ·/FMNH2 couple donates electrons to cytochrome P450 at constant oxidation-reduction potential. Although the interflavin electron transfer between FAD and FMN is not strictly regulated in CPR, electron transfer is activated in neuronal NOS reductase domain upon binding calmodulin (CaM), in which the CaM-bound activated form can function by a similar mechanism to that of CPR. The oxygenated form and spin state of substrate-bound cytochrome P450 in perfused rat liver are also discussed in terms of stepwise one-electron transfer from CPR. This review provides a historical perspective of the microsomal mixed-function oxidases including CPR and P450. In addition, a new model for the redox-linked conformational changes during the catalytic cycle for both CPR and NOS reductase domain is also discussed

  7. Genetic identification of a respiratory arsenate reductase

    OpenAIRE

    Saltikov, Chad W.; Newman, Dianne K.

    2003-01-01

    For more than a decade, it has been recognized that arsenate [H2AsO41-; As(V)] can be used by microorganisms as a terminal electron acceptor in anaerobic respiration. Given the toxicity of arsenic, the mechanistic basis of this process is intriguing, as is its evolutionary origin. Here we show that a two-gene cluster (arrAB; arsenate respiratory reduction) in the bacterium Shewanella sp. strain ANA-3 specifically confers respiratory As(V) reductase activity. Mutants with in-frame deletions of...

  8. MUC1-C drives MYC in multiple myeloma.

    Science.gov (United States)

    Tagde, Ashujit; Rajabi, Hasan; Bouillez, Audrey; Alam, Maroof; Gali, Reddy; Bailey, Shannon; Tai, Yu-Tzu; Hideshima, Teru; Anderson, Kenneth; Avigan, David; Kufe, Donald

    2016-05-26

    Multiple myeloma (MM) cell lines and primary tumor cells are addicted to the MYC oncoprotein for survival. Little is known, however, about how MYC expression is upregulated in MM cells. The mucin 1 C-terminal subunit (MUC1-C) is an oncogenic transmembrane protein that is aberrantly expressed in MM cell lines and primary tumor samples. The present studies demonstrate that targeting MUC1-C with silencing by clustered regularly interspaced short palindromic repeat (CRISPR)/CRISPR-associated protein 9 editing or with the GO-203 inhibitor is associated with downregulation of MYC messenger RNA and protein. The results show that MUC1-C occupies the MYC promoter and thereby activates the MYC gene by a β-catenin/transcription factor 4 (TCF4)-mediated mechanism. In this way, MUC1-C (1) increases β-catenin occupancy on the MYC promoter, (2) forms a complex with β-catenin and TCF4, and, in turn, (3) drives MYC transcription. Analysis of MM cells using quantitative real-time reverse transcription polymerase chain reaction arrays further demonstrated that silencing MUC1-C is associated with downregulation of MYC target genes, including CCND2, hTERT, and GCLC Analysis of microarray data sets further demonstrated that MUC1 levels positively correlate with MYC expression in MM progression and in primary cells from over 800 MM patients. These findings collectively provide convincing evidence that MUC1-C drives MYC expression in MM. PMID:26907633

  9. Carnitine palmitoyltransferase 1C deficiency causes motor impairment and hypoactivity.

    Science.gov (United States)

    Carrasco, Patricia; Jacas, Jordi; Sahún, Ignasi; Muley, Helena; Ramírez, Sara; Puisac, Beatriz; Mezquita, Pau; Pié, Juan; Dierssen, Mara; Casals, Núria

    2013-11-01

    Carnitine palmitoyltransferase 1c (CPT1C), a brain-specific protein localized in the endoplasmic reticulum of neurons, is expressed in almost all brain regions, but its only known functions to date are involved in the hypothalamic control of energy homeostasis and in hippocampus-dependent spatial learning. To identify other physiological and behavioral functions of this protein, we performed a battery of neurological tests on Cpt1c-deficient mice. The animals showed intact autonomic and sensory systems, but some motor disturbances were observed. A more detailed study of motor function revealed impaired coordination and gait, severe muscle weakness, and reduced daily locomotor activity. Analysis of motor function in these mice at ages of 6-24 weeks showed that motor disorders were already present in young animals and that impairment increased progressively with age. Analysis of CPT1C expression in different motor brain areas during development revealed that CPT1C levels were low from birth to postnatal day 10 and then rapidly increased peaking at postnatal day 21, which suggests that CPT1C plays a relevant role in motor function during and after weaning. As CPT1C is known to regulate ceramide levels, we measured these biolipids in different motor areas in adult mice. Cerebellar, striatum, and motor cortex extracts from Cpt1c knockout mice showed reduced levels of ceramide and its derivative sphingosine when compared to wild-type animals. Our results indicate that altered ceramide metabolism in motor brain areas induced by Cpt1c deficiency causes progressive motor dysfunction from a young age. PMID:23973755

  10. Membrane-associated chromate reductase activity from Enterobacter cloacae.

    OpenAIRE

    P. C. Wang; Mori, T.; Toda, K.; Ohtake, H

    1990-01-01

    Washed cells of Enterobacter cloacae HO1 reduced hexavalent chromium (chromate: CrO4(2-) anaerobically. Chromate reductase activity was preferentially associated with the membrane fraction of the cells. Right-side-out membrane vesicles prepared from E. cloacae cells showed high chromate reductase activities when ascorbate-reduced phenazine methosulfate was added as an electron donor.

  11. Canopy and seasonal profiles of nitrate reductase in soybeans

    Energy Technology Data Exchange (ETDEWEB)

    Harper, J.E.; Hageman, R.H.

    1972-01-01

    Nitrate reductase activity of soybeans (Glycine max L. Merr.) was evaluated in soil plots and outdoor hydroponic gravel culture systems throughout the growing season. Nitrate reductase profiles within the plant canopy were also established. Mean activity per gram fresh weight per hour of the entire plant canopy was highest in the seedling stage while total activity (activity per gram fresh weight per hour times the total leaf weight) reached a maximum when plants were in the full bloom to midpod fill stage. Nitrate reductase activity per gram fresh weight per hour was highest in the uppermost leaf just prior to full expansion and declined with leaf positions lower in the canopy. Total nitrate reductase activity per leaf was also highest in the uppermost fully expanded leaf during early growth stages. Maximum total activity shifted to leaf positions lower in the plant canopy with later growth stages. Nitrate reductase activity of soybeans grown in hydroponic systems was significantly higher than activity of adjacent soil grown plants at later growth stages, which suggested that under normal field conditions the potential for nitrate utilization may not be realized. Nitrate reductase activity per gram fresh weight per hour and nitrate content were positively correlated over the growing season with plants grown in either soil or solution culture. Computations based upon the nitrate reductase assay of plants grown in hydroponics indicated that from 1.7 to 1.8 grams N could have been supplied to the plant via the nitrate reductase process. 11 references, 9 figures, 3 tables.

  12. Diabetes in Pregnancy and Hemoglobin A1c

    OpenAIRE

    Carocha, A; Rijo, C; Amaral, N; Aleixo, F; Rocha, T

    2012-01-01

    Introdução: Há estudos que revelam que a Hemoglobina A1c (HbA1c) é um indicador confiável do controlo glicémico em grávidas com diabetes gestacional (DG). Objetivo: Relacionar os níveis de HbA1c no terceiro trimestre e o prognóstico materno-fetal. Tipo de estudo: Retrospetivo. População: Quatrocentos e setenta e quatro mulheres vigiadas na consulta de diabetes e gravidez com o diagnóstico de DG. Métodos: Dividiu-se a população em dois grupos: HbA1c

  13. Carnitine palmitoyltransferase 1C: From cognition to cancer.

    Science.gov (United States)

    Casals, Núria; Zammit, Victor; Herrero, Laura; Fadó, Rut; Rodríguez-Rodríguez, Rosalía; Serra, Dolors

    2016-01-01

    Carnitine palmitoyltransferase 1 (CPT1) C was the last member of the CPT1 family of genes to be discovered. CPT1A and CPT1B were identified as the gate-keeper enzymes for the entry of long-chain fatty acids (as carnitine esters) into mitochondria and their further oxidation, and they show differences in their kinetics and tissue expression. Although CPT1C exhibits high sequence similarity to CPT1A and CPT1B, it is specifically expressed in neurons (a cell-type that does not use fatty acids as fuel to any major extent), it is localized in the endoplasmic reticulum of cells, and it has minimal CPT1 catalytic activity with l-carnitine and acyl-CoA esters. The lack of an easily measurable biological activity has hampered attempts to elucidate the cellular and physiological role of CPT1C but has not diminished the interest of the biomedical research community in this CPT1 isoform. The observations that CPT1C binds malonyl-CoA and long-chain acyl-CoA suggest that it is a sensor of lipid metabolism in neurons, where it appears to impact ceramide and triacylglycerol (TAG) metabolism. CPT1C global knock-out mice show a wide range of brain disorders, including impaired cognition and spatial learning, motor deficits, and a deregulation in food intake and energy homeostasis. The first disease-causing CPT1C mutation was recently described in humans, with Cpt1c being identified as the gene causing hereditary spastic paraplegia. The putative role of CPT1C in the regulation of complex-lipid metabolism is supported by the observation that it is highly expressed in certain virulent tumor cells, conferring them resistance to glucose- and oxygen-deprivation. Therefore, CPT1C may be a promising target in the treatment of cancer. Here we review the molecular, biochemical, and structural properties of CPT1C and discuss its potential roles in brain function, and cancer. PMID:26708865

  14. Dibenzanthracenes and benzochrysenes elicit both genotoxic and nongenotoxic events in rat liver 'stem-like' cells

    International Nuclear Information System (INIS)

    Polycyclic aromatic hydrocarbons (PAHs) with molecular weight 278 are a group of PAHs that are mostly not covered by the current monitoring programs, despite their relative abundance in environmental samples and possible carcinogenicity. Although benzo[g]chrysene (BgChry) and dibenz[a,h]anthracene (DBahA) have been for a long time studied as genotoxic, tumour-initiating compounds, little is known about the potential tumour-promoting effects of this group of PAHs. In the present study, we investigated their impact on activation of the aryl hydrocarbon receptor (AhR), induction of enzymes involved in metabolic activation of PAHs, disruption of cell cycle control in confluent cell population and inhibition of gap junctional intercellular communication (GJIC), using the rat liver epithelial cell line WB-F344 as a model of liver progenitor cells. We found that BgChry was the weakest inducer of the AhR-mediated activity, while relative potencies of benzo[b]chrysene (BbChry) and benzo[c]chrysene (BcChry) were comparable to the previously reported values for dibenzanthracenes. All compounds increased expression of cytochromes P450 1A1 and 1B1, and aldo-keto reductase 1C9. BgChry was found to induce high amounts of DNA adducts, which corresponded with induction of p53 phosphorylation at Ser15, apoptosis and accumulation of cells in S-phase of cell cycle, leading to a decrease in cell numbers. All other compounds were found to stimulate cell proliferation in contact-inhibited WB-F344 cells in a dose-dependent manner. We found that only BgChry, and to a lesser extent also BcChry, inhibited GJIC at high concentrations. Taken together, dibenzanthracenes and benzochrysenes, with exception of BgChry, seem to act primarily through deregulation of cell proliferation in liver epithelial cells, which is related to their relatively high AhR-mediated activity. The disruption of cell cycle control might contribute to their carcinogenic effects, as well as to carcinogenicity of complex

  15. Trimester-specific reference intervals for haemoglobin A(1c) (HbA(1c)) in pregnancy.

    LENUS (Irish Health Repository)

    O'Connor, Catherine

    2011-11-26

    Abstract Background: Diabetes in pregnancy imposes additional risks to both mother and infant. These increased risks are considered to be primarily related to glycaemic control which is monitored by means of glycated haemoglobin (HbA(1c)). The correlation of HbA(1c) with clinical outcomes emphasises the need to measure HbA(1c) accurately, precisely and for correct interpretation, comparison to appropriately defined reference intervals. Since July 2010, the HbA(1c) assay in Irish laboratories is fully metrologically traceable to the IFCC standard. The objective was to establish trimester-specific reference intervals in pregnancy for IFCC standardised HbA(1c) in non-diabetic Caucasian women. Methods: The authors recruited 311 non-diabetic Caucasian pregnant (n=246) and non-pregnant women (n=65). A selective screening based on risk factors for gestational diabetes was employed. All subjects had a random plasma glucose <7.7 mmol\\/L and normal haemoglobin level. Pregnancy trimester was defined as trimester 1 (T1, n=40) up to 12 weeks +6 days, trimester 2 (T2, n=106) 13-27 weeks +6 days, trimester 3 (T3, n=100) >28 weeks to term. Results: The normal HbA(1c) reference interval for Caucasian non-pregnant women was 29-37 mmol\\/mol (Diabetes Control and Complications Trial; DCCT: 4.8%-5.5%), T1: 24-36 mmol\\/mol (DCCT: 4.3%-5.4%), T2: 25-35 mmol\\/mol (DCCT: 4.4%-5.4%) and T3: 28-39 mmol\\/mol (DCCT: 4.7%-5.7%). HbA(1c) was significantly decreased in trimesters 1 and 2 compared to non-pregnant women. Conclusions: HbA(1c) trimester-specific reference intervals are required to better inform the management of pregnancies complicated by diabetes.

  16. Structure and expression of human dihydropteridine reductase

    International Nuclear Information System (INIS)

    Dihydropteridine reductase catalyzes the NADH-mediated reduction of quinonoid dihydrobiopterin and is an essential component of the pterindependent aromatic amino acid hydroxylating systems. A cDNA for human DHPR was isolated from a human liver cDNA library in the vector λgt11 using a monospecific antibody against sheep DHPR. The nucleic acid sequence and amino acid sequence of human DHPR were determined from a full-length clone. A 112 amino acid sequence of sheep DHPR was obtained by sequencing purified sheep DHPR. This sequence is highly homologous to the predicted amino acid sequence of the human protein. Gene transfer of the recombinant human DHPR into COS cells leads to expression of DHPR enzymatic activity. These results indicate that the cDNA clone identified by antibody screening is an authentic and full-length cDNA for human DHPR

  17. Nitrite Reductase Activity in Engineered Azurin Variants.

    Science.gov (United States)

    Berry, Steven M; Strange, Jacob N; Bladholm, Erika L; Khatiwada, Balabhadra; Hedstrom, Christine G; Sauer, Alexandra M

    2016-05-01

    Nitrite reductase (NiR) activity was examined in a series of dicopper P.a. azurin variants in which a surface binding copper site was added through site-directed mutagenesis. Four variants were synthesized with copper binding motifs inspired by the catalytic type 2 copper binding sites found in the native noncoupled dinuclear copper enzymes nitrite reductase and peptidylglycine α-hydroxylating monooxygenase. The four azurin variants, denoted Az-NiR, Az-NiR3His, Az-PHM, and Az-PHM3His, maintained the azurin electron transfer copper center, with the second designed copper site located over 13 Å away and consisting of mutations Asn10His,Gln14Asp,Asn16His-azurin, Asn10His,Gln14His,Asn16His-azurin, Gln8Met,Gln14His,Asn16His-azurin, and Gln8His,Gln14His,Asn16His-azurin, respectively. UV-visible absorption spectroscopy, EPR spectroscopy, and electrochemistry of the sites demonstrate copper binding as well as interaction with small exogenous ligands. The nitrite reduction activity of the variants was determined, including the catalytic Michaelis-Menten parameters. The variants showed activity (0.34-0.59 min(-1)) that was slower than that of native NiRs but comparable to that of other model systems. There were small variations in activity of the four variants that correlated with the number of histidines in the added copper site. Catalysis was found to be reversible, with nitrite produced from NO. Reactions starting with reduced azurin variants demonstrated that electrons from both copper centers were used to reduce nitrite, although steady-state catalysis required the T2 copper center and did not require the T1 center. Finally, experiments separating rates of enzyme reduction from rates of reoxidation by nitrite demonstrated that the reaction with nitrite was rate limiting during catalysis. PMID:27055058

  18. Characterization of two alkyl hydroperoxide reductase C homologs alkyl hydroperoxide reductase C_H1 and alkyl hydroperoxide reductase C_H2 in Bacillus subtilis

    Institute of Scientific and Technical Information of China (English)

    Mee-Kyung; Cha; Yoo-Jeen; Bae; Kyu-Jeong; Kim; Byung-Joon; Park; Il-Han; Kim

    2015-01-01

    AIM: To identify alkyl hydroperoxide reductase subunit C(AhpC) homologs in Bacillus subtilis(B. subtilis) and to characterize their structural and biochemical properties. AhpC is responsible for the detoxification of reactive oxygen species in bacteria.METHODS: Two AhpC homologs(AhpC_H1 and AhpC_H2) were identified by searching the B. subtilis database; these were then cloned and expressed in Escherichia coli. AhpC mutants carrying substitutions of catalytically important Cys residues(C37S, C47 S, C166 S, C37/47 S, C37/166 S, C47/166 S, and C37/47/166 S for AhpC_H1; C52 S, C169 S, and C52/169 S for AhpC_H2) were obtained by site-directed mutagenesis and purified, and their structure-function relationship was analyzed. The B. subtilis ahp C genes were disrupted by the short flanking homology method, and the phenotypes of the resulting AhpC-deficient bacteria were examined.RESULTS: Comparative characterization of AhpC homologs indicates that AhpC_H1 contains an extra C37, which forms a disulfide bond with the peroxidatic C47, and behaves like an atypical 2-Cys AhpC, while AhpC_H2 functions like a typical 2-Cys AhpC. Tryptic digestion analysis demonstrated the presence of intramolecular Cys37-Cys47 linkage, which could be reduced by thioredoxin, resulting in the association of the dimer into higher-molecular-mass complexes. Peroxidase activity analysis of Cys→Ser mutants indicated that three Cys residues were involved in the catalysis. AhpC_H1 was resistant to inactivation by peroxide substrates, but had lower activity at physiological H2O2 concentrations compared to AhpC_H2, suggesting that in B. subtilis, the enzymes may be physiologically functional at different substrate concentrations. The exposure to organic peroxides induced AhpC_H1 expression, while AhpC_H1-deficient mutants exhibited growth retardation in the stationary phase, suggesting the role of AhpC_H1 as an antioxidant scavenger of lipid hydroperoxides and a stress-response factor in B. subtilis

  19. The arsenic hyperaccumulating Pteris vittata expresses two arsenate reductases

    OpenAIRE

    Patrizia Cesaro; Chiara Cattaneo; Elisa Bona; Graziella Berta; Maria Cavaletto

    2015-01-01

    Enzymatic reduction of arsenate to arsenite is the first known step in arsenate metabolism in all organisms. Although the presence of one mRNA arsenate reductase (PvACR2) has been characterized in gametophytes of P. vittata, no arsenate reductase protein has been directly observed in this arsenic hyperaccumulating fern, yet. In order to assess the possible presence of arsenate reductase in P. vittata, two recombinant proteins, ACR2-His6 and Trx-His6-S-Pv2.5–8 were prepared in Escherichia coli...

  20. CACNA1C hypermethylation is associated with bipolar disorder.

    Science.gov (United States)

    Starnawska, A; Demontis, D; Pen, A; Hedemand, A; Nielsen, A L; Staunstrup, N H; Grove, J; Als, T D; Jarram, A; O'Brien, N L; Mors, O; McQuillin, A; Børglum, A D; Nyegaard, M

    2016-01-01

    The CACNA1C gene, encoding a subunit of the L-type voltage-gated calcium channel is one of the best-supported susceptibility genes for bipolar disorder (BD). Genome-wide association studies have identified a cluster of non-coding single-nucleotide polymorphisms (SNPs) in intron 3 to be highly associated with BD and schizophrenia. The mechanism by which these SNPs confer risk of BD appears to be through an altered regulation of CACNA1C expression. The role of CACNA1C DNA methylation in BD has not yet been addressed. The aim of this study was to investigate if CACNA1C DNA methylation is altered in BD. First, the methylation status of five CpG islands (CGIs) across CACNA1C in blood from BD subjects (n=40) and healthy controls (n=38) was determined. Four islands were almost completely methylated or completely unmethylated, while one island (CGI 3) in intron 3 displayed intermediate methylation levels. In the main analysis, the methylation status of CGI 3 was analyzed in a larger sample of BD subjects (n=582) and control individuals (n=319). Out of six CpG sites that were investigated, five sites showed significant hypermethylation in cases (lowest P=1.16 × 10(-7) for CpG35). Nearby SNPs were found to influence the methylation level, and we identified rs2238056 in intron 3 as the strongest methylation quantitative trait locus (P=2.6 × 10(-7)) for CpG35. In addition, we found an increased methylation in females, and no difference between bipolar I and II. In conclusion, we find that CACNA1C methylation is associated with BD and suggest that the regulatory effect of the non-coding risk variants involves a shift in DNA methylation. PMID:27271857

  1. Genetic and bibliographic information: CACNA1C [GenLibi

    Lifescience Database Archive (English)

    Full Text Available CACNA1C calcium channel, voltage-dependent, L type, alpha 1C subunit human Long QT Syndrome... (MeSH) Cardiovascular Diseases (C14) > Heart Diseases (C14.280) > Arrhythmias, Cardiac (C14.280.067) > Long QT Syndrome...) > Heart Defects, Congenital (C16.131.240.400) > Long QT Syndrome (C16.131.240.400.715) Pathological Condit...ions, Signs and Symptoms (C23) > Pathologic Processes (C23.550) > Arrhythmias, Cardiac (C23.550.073) > Long QT Syndrome (C23.550.073.547) 02A0514005 ...

  2. The effect of oxidative stress on human red cells glutathione peroxidase, glutathione reductase level, and prevalence of anemia among diabetics

    Directory of Open Access Journals (Sweden)

    Hisham Waggiallah

    2011-01-01

    Full Text Available Background: The oxidative stress is considered as major consequence of diabetes mellitus affecting red cell antioxidant enzymes. Aim: The present study was conducted to assess the impact of oxidative stress (reduced glutathione on glutathione peroxidase, and glutathione reductse and prevalence of anemia among diabetic patients. Materials and Methods: The study involved 100 adult patients attending Buraidah Central Hospital and 30 healthy controls. Blood samples were collected and analyzed for glutathione (GSH concentration, glutathione peroxidase (GPO, glutathione reductase (GR, fasting blood sugar (RBS, hemoglobin (HGB, red cell count (RBCs hematocrit (HCT mean cell volume (MCV mean cell hemoglobin (MCH and mean cell hemoglobin concentration (MCHC and hemoglobin A1c. Blood urea, serum creatinine, and microalbuminuria were measured to exclude diabetes mellitus nephropathy. Results : were obtained showed significant correlation between deficiency of glutathione peroxidase, glutathione reductase and deficient of glutathione among diabetics, which has significant correlation between low hemoglobin concentration (females <120 g/L, males <130 g/L, also there is low concentration of red cell count and red cell indices (MCV, MCH and MCHC. The prevalence of anemia was 22% in diabetes patients. Conclusion: It can be concluded that there is strong significant effect of oxidative stress (reduced glutathione on glutathione peroxidase, glutathione reductase level these may reduce hemoglobin concentration in diabetic patients. This means oxidative stress of diabetes mellitus is the possible cause of anemia in diabetics without nephropathy.

  3. CACNA1C hypermethylation is associated with bipolar disorder

    DEFF Research Database (Denmark)

    Starnawska, A; Demontis, D; Pen, A;

    2016-01-01

    The CACNA1C gene, encoding a subunit of the L-type voltage-gated calcium channel is one of the best-supported susceptibility genes for bipolar disorder (BD). Genome-wide association studies have identified a cluster of non-coding single-nucleotide polymorphisms (SNPs) in intron 3 to be highly...

  4. Protective effect of Porphyra yezoensis glycoprotein on D-galactosamine‑induced cytotoxicity in Hepa 1c1c7 cells.

    Science.gov (United States)

    Choi, Jeong-Wook; Kim, Young-Min; Park, Su-Jin; Kim, In-Hye; Nam, Taek-Jeong

    2015-05-01

    The present study aimed to examine the signaling pathways and enzyme activity associated with the protective effect of Porphyra yezoensis glycoprotein (PYGP) on D‑galactosamine (D‑GaIN)‑induced cytotoxicity in Hepa 1c1c7 cells. D‑GaIN is commonly used to induce hepatic injury models in vivo as well as in vitro. PYGP was extracted from Porphyra yezoensis, a red algae distributed along the coasts of Republic of Korea, China and Japan. In the present study, Hepa 1c1c7 cells were pre‑treated with PYGP (20 and 40 µg/ml) for 24 h and then the media was replaced with D‑GaIN (20 mM) and PYGP (20 and 40 µg/ml). The results demonstrated that D‑GaIN induced Hepa 1c1c7 cell death and pretreatment with PYGP was found to attenuate D‑GaIN toxicity. In addition, D‑GaIN decreased the antioxidant activity and increased lipid peroxidation processes; however, pre‑treatment with PYGP reduced the generation of lipid peroxidation products, such as thiobarbituric acid reactive substances, as well as increased the activity of antioxidant enzymes, including superoxide dismutase, catalase and glutathione‑s‑transferase (GST). PYGP was shown to suppress the overexpression of extracellular signal‑regulated kinase, c‑jun N‑terminal kinase and p38 mitogen‑activated protein kinase (MAPK) phosphorylation induced by D‑GaIN. Furthermore, PYGP increased the protein expression of nuclear factor erythroid 2‑related factor 2 (Nrf2), quinine oxidoreductase 1, GST and heme oxygenase 1 protein expression. These results suggested that PYGP had cytoprotective effects against D‑GaIN‑induced cell damage, which may be associated with MAPKs and the Nrf2 signaling pathway. PMID:25626067

  5. Regulation of ribonucleotide reductase by Spd1 involves multiple mechanisms

    DEFF Research Database (Denmark)

    Nestoras, Konstantinos; Mohammed, Asma Hadi; Schreurs, Ann-Sofie; Fleck, Oliver; Watson, Adam T; Poitelea, Marius; O'Shea, Charlotte; Chahwan, Charly; Holmberg, Christian; Kragelund, Birthe B; Nielsen, Olaf; Osborne, Mark; Carr, Antony M; Liu, Cong

    2010-01-01

    The correct levels of deoxyribonucleotide triphosphates and their relative abundance are important to maintain genomic integrity. Ribonucleotide reductase (RNR) regulation is complex and multifaceted. RNR is regulated allosterically by two nucleotide-binding sites, by transcriptional control, and...

  6. Structural features of the ribonucleotide reductase of Aujeszky's disease virus.

    Science.gov (United States)

    Kaliman, A V; Boldogköi, Z; Fodor, I

    1994-01-01

    A gene construct of the Aujeszky's disease virus (ADV) genome was prepared and the DNA fragment encoding the ribonucleotide reductase was structurally characterized. We determined the entire DNA sequence of two adjacent open reading frames of the ribonucleotide reductase genes with the intergenic sequence of nine base pairs. From the sequence analysis we predict that Aujeszky's disease virus encodes a ribonucleotide reductase which comprises two polypeptides--large and small subunits, with sizes of 835 and 303 amino acids, respectively. Nucleotide and amino acid sequences of the large and small subunits of the Aujeszky's disease virus ribonucleotide reductase have been compared with that of other herpesviruses, and structural features of both proteins have been characterized. PMID:7810419

  7. Effects of Rutaecarpine on Hydrogen Peroxide-Induced Apoptosis in Murine Hepa-1c1c7 Cells

    OpenAIRE

    Lee, Sung-Jin; Ahn, Hyunjin; Nam, Kung-Woo; Kim, Kyeong Ho; Mar, Woongchon

    2012-01-01

    The aim of this study was to investigate the inhibitory effects of rutaecarpine on DNA strand breaks and apoptosis induced by hydrogen peroxide (H2O2) in murine Hepa-1c1c7 cells. Oxidative DNA damage was estimated by nuclear condensation assessment, fluorescence-activated cell sorting analysis, and Comet assay. Rutaecarpine inhibited cell death induced by 500 μM H2O2, as assessed by 4',6-diamidino-2-phenylindole (DAPI) staining. Treatment with rutaecarpine reduced the number of DNA strand bre...

  8. Aldose reductase inhibitory activity and antioxidant capacity of pomegranate extracts

    OpenAIRE

    Karasu, Çimen; CUMAOĞLU, Ahmet; Gürpinar, Ali Rifat; Kartal, Murat; Kovacikova, Lucia; Milackova, Ivana; Stefek, Milan

    2012-01-01

    The pomegranate, Punica granatum L., has been the subject of current interest as a medicinal agent with wide-ranging therapeutic indications. In the present study, pomegranate ethanolic seed and hull extracts were tested, in comparison with a commercial sample, for the inhibition of aldose reductase, an enzyme involved in the etiology of diabetic complications. In vitro inhibition of rat lens aldose reductase was determined by a conventional method. Pomegranate ethanolic hull extract and comm...

  9. An overview on 5alpha-reductase inhibitors.

    Science.gov (United States)

    Aggarwal, Saurabh; Thareja, Suresh; Verma, Abhilasha; Bhardwaj, Tilak Raj; Kumar, Manoj

    2010-02-01

    Benign prostatic hyperplasia (BPH) is the noncancerous proliferation of the prostate gland associated with benign prostatic obstruction and lower urinary tract symptoms (LUTS) such as frequency, hesitancy, urgency, etc. Its prevalence increases with age affecting around 70% by the age of 70 years. High activity of 5alpha-reductase enzyme in humans results in excessive dihydrotestosterone levels in peripheral tissues and hence suppression of androgen action by 5alpha-reductase inhibitors is a logical treatment for BPH as they inhibit the conversion of testosterone to dihydrotestosterone. Finasteride (13) was the first steroidal 5alpha-reductase inhibitor approved by U.S. Food and Drug Administration (USFDA). In human it decreases the prostatic DHT level by 70-90% and reduces the prostatic size. Dutasteride (27) another related analogue has been approved in 2002. Unlike Finasteride, Dutasteride is a competitive inhibitor of both 5alpha-reductase type I and type II isozymes, reduced DHT levels >90% following 1 year of oral administration. A number of classes of non-steroidal inhibitors of 5alpha-reductase have also been synthesized generally by removing one or more rings from the azasteroidal structure or by an early non-steroidal lead (ONO-3805) (261). In this review all categories of inhibitors of 5alpha-reductase have been covered. PMID:19879888

  10. Suppression of CYP1A1 expression by naringenin in murine Hepa-1c1c7 cells.

    Science.gov (United States)

    Kim, Ji Young; Han, Eun Hee; Shin, Dong Weon; Jeong, Tae Cheon; Lee, Eung Seok; Woo, Eun-Rhan; Jeong, Hye Gwang

    2004-08-01

    Naringenin, dietary flavonoid, is antioxidant constituents of many citrus fruits. In the present study, we investigated the effect of naringenin on 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)-inducible CYP1A1 gene expression in mouse hepatoma Hepa-1c1c7 cells. Naringenin alone did not affect CYP1A1-specific 7-ethoxyresorufin O-deethylase (EROD) activity. In contrast, the TCDD-inducible EROD activities were markedly reduced upon concomitant treatment with TCDD and naringenin in a dose dependent manner. TCDD-induced CYP1A1 mRNA level was also markedly suppressed by naringenin. A transient transfection assay using dioxin-response element (DRE)-linked luciferase and electrophoretic mobility shift assay revealed that naringenin reduced transformation of the aryl hydrocarbons receptor(AhR) to a form capable of specifically binding to the DRE sequence in the promoter of the CYP1A1 gene. These results suggest the down regulation of the CYP1A1 gene expression by either naringenin in Hepa-1c1c7 cells might be antagonism of the DRE binding potential of nuclear AhR. PMID:15460448

  11. Suppression of CYP1A1 expression by 4-nonylphenol in murine Hepa-1c1c7 cells.

    Science.gov (United States)

    Jeong, H G; Kim, J Y; Choi, C Y; You, H J; Hahm, K

    2001-04-10

    This study investigated the effects that 4-nonylphenol (NP) has on CYP1A1 expression in Hepa-1c1c7 cell cultures. NP alone did not affect CYP1A1-specific 7-ethoxyresorufin-O-deethylase (EROD) activity. In contrast, the 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)-inducible EROD activities were markedly reduced upon concomitant treatment with TCDD and NP in a dose-dependent manner. Treatment with tamoxifen, an anti-estrogen that acts through the estrogen receptor, did not affect the suppressive effects that NP has on TCDD-inducible EROD activity. The TCDD-inducible CYP1A1 mRNA levels were markedly suppressed upon concomitant treatment with TCDD and NP that is consistent with their effects on EROD activity. A transient transfection assay using dioxin-response element (DRE)-linked luciferase and an electrophoretic mobility shift assay revealed that NP reduced the transformation of the aryl hydrocarbon (Ah) receptor to a form capable of binding specifically to the DRE sequence of the CYP1A1 gene promoter. These results suggest that the down-regulation of CYP1A1 gene expression by NP in Hepa-1c1c7 cells might be an antagonism of the DRE-binding potential of the nuclear Ah receptor, but is not mediated through the estradiol receptor. PMID:11248424

  12. Binding of Fidarestat Stereoisomers with Aldose Reductase

    Directory of Open Access Journals (Sweden)

    Dae-Sil Lee

    2006-11-01

    Full Text Available The stereospecificity in binding to aldose reductase (ALR2 of two fidarestat {6-fluoro-2',5'-dioxospiro[chroman-4,4'-imidazolidine]-2-carboxamide} stereoisomers [(2S,4Sand (2R,4S] has been investigated by means of molecular dynamics simulations using freeenergy integration techniques. The difference in the free energy of binding was found to be2.0 ± 1.7 kJ/mol in favour of the (2S,4S-form, in agreement with the experimentalinhibition data. The relative mobilities of the fidarestats complexed with ALR2 indicate alarger entropic penalty for hydrophobic binding of (2R,4S-fidarestat compared to (2S,4S-fidarestat, partially explaining its lower binding affinity. The two stereoisomers differmainly in the orientation of the carbamoyl moiety with respect to the active site and rotationof the bond joining the carbamoyl substituent to the ring. The detailed structural andenergetic insights obtained from out simulations allow for a better understanding of thefactors determining stereospecific inhibitor-ALR2 binding in the EPF charges model.

  13. Aldose reductase inhibitory compounds from Xanthium strumarium.

    Science.gov (United States)

    Yoon, Ha Na; Lee, Min Young; Kim, Jin-Kyu; Suh, Hong-Won; Lim, Soon Sung

    2013-09-01

    As part of our ongoing search for natural sources of therapeutic and preventive agents for diabetic complications, we evaluated the inhibitory effects of components of the fruit of Xanthium strumarium (X. strumarium) on aldose reductase (AR) and galactitol formation in rat lenses with high levels of glucose. To identify the bioactive components of X. strumarium, 7 caffeoylquinic acids and 3 phenolic compounds were isolated and their chemical structures were elucidated on the basis of spectroscopic evidence and comparison with published data. The abilities of 10 X. strumarium-derived components to counteract diabetic complications were investigated by means of inhibitory assays with rat lens AR (rAR) and recombinant human AR (rhAR). From the 10 isolated compounds, methyl-3,5-di-O-caffeoylquinate showed the most potent inhibition, with IC₅₀ values of 0.30 and 0.67 μM for rAR and rhAR, respectively. In the kinetic analyses using Lineweaver-Burk plots of 1/velocity and 1/substrate, methyl-3,5-di-O-caffeoylquinate showed competitive inhibition of rhAR. Furthermore, methyl-3,5-di-O-caffeoylquinate inhibited galactitol formation in the rat lens and in erythrocytes incubated with a high concentration of glucose, indicating that this compound may be effective in preventing diabetic complications. PMID:23604720

  14. Aldose reductase mediates retinal microglia activation.

    Science.gov (United States)

    Chang, Kun-Che; Shieh, Biehuoy; Petrash, J Mark

    2016-04-29

    Retinal microglia (RMG) are one of the major immune cells in charge of surveillance of inflammatory responses in the eye. In the absence of an inflammatory stimulus, RMG reside predominately in the ganglion layer and inner or outer plexiform layers. However, under stress RMG become activated and migrate into the inner nuclear layer (INL) or outer nuclear layer (ONL). Activated RMG in cell culture secrete pro-inflammatory cytokines in a manner sensitive to downregulation by aldose reductase inhibitors. In this study, we utilized CX3CR1(GFP) mice carrying AR mutant alleles to evaluate the role of AR on RMG activation and migration in vivo. When tested on an AR(WT) background, IP injection of LPS induced RMG activation and migration into the INL and ONL. However, this phenomenon was largely prevented by AR inhibitors or in AR null mice, or was exacerbated in transgenic mice that over-express AR. LPS-induced increases in ocular levels of TNF-α and CX3CL-1 in WT mice were substantially lower in AR null mice or were reduced by AR inhibitor treatment. These studies demonstrate that AR expression in RMG may contribute to the proinflammatory phenotypes common to various eye diseases such as uveitis and diabetic retinopathy. PMID:27033597

  15. Design and Analysis of HJ-1-C Satellite SAR Antenna

    Directory of Open Access Journals (Sweden)

    Zheng Shi-kun

    2014-06-01

    Full Text Available With truss deployable mesh parabolic reflector, the HJ-1-C SAR antenna has complex structure and multiple steps during the deployed processing. The design of the antenna is difficult in terms of deployed reliability and electrical performance. This paper makes intensive research on system, structure and electrical design, and the analysis of mechanical and thermal performance in the actual space conditions is also presented. The successful deploying in orbit and high image quality of the HJ-1-C satellite indicate that the mechanical, electronic, thermal and reliability design of the antenna satisfy the project requirement, and these research provides valuable experience for the design of the centralized mesh parabolic SAR antenna.

  16. Transcripts of Anthocyanidin Reductase and Leucoanthocyanidin Reductase and Measurement of Catechin and Epicatechin in Tartary Buckwheat

    Directory of Open Access Journals (Sweden)

    Yeon Bok Kim

    2014-01-01

    Full Text Available Anthocyanidin reductase (ANR and leucoanthocyanidin reductase (LAR play an important role in the monomeric units biosynthesis of proanthocyanidins (PAs such as catechin and epicatechin in several plants. The aim of this study was to clone ANR and LAR genes involved in PAs biosynthesis and examine the expression of these two genes in different organs under different growth conditions in two tartary buckwheat cultivars, Hokkai T8 and T10. Gene expression was carried out by quantitative real-time RT-PCR, and catechin and epicatechin content was analyzed by high performance liquid chromatography. The expression pattern of ANR and LAR did not match the accumulation pattern of PAs in different organs of two cultivars. Epicatechin content was the highest in the flowers of both cultivars and it was affected by light in only Hokkai T8 sprouts. ANR and LAR levels in tartary buckwheat might be regulated by different mechanisms for catechin and epicatechin biosynthesis under light and dark conditions.

  17. Equine 5α-reductase activity and expression in epididymis.

    Science.gov (United States)

    Corbin, C J; Legacki, E L; Ball, B A; Scoggin, K E; Stanley, S D; Conley, A J

    2016-10-01

    The 5α-reductase enzymes play an important role during male sexual differentiation, and in pregnant females, especially equine species where maintenance relies on 5α-reduced progesterone, 5α-dihydroprogesterone (DHP). Epididymis expresses 5α-reductases but was not studied elaborately in horses. Epididymis from younger and older postpubertal stallions was divided into caput, corpus and cauda and examined for 5α-reductase activity and expression of type 1 and 2 isoforms by quantitative real-time polymerase chain reaction (qPCR). Metabolism of progesterone and testosterone to DHP and dihydrotestosterone (DHT), respectively, by epididymal microsomal protein was examined by thin-layer chromatography and verified by liquid chromatography tandem mass spectrometry (LC-MS/MS). Relative inhibitory potencies of finasteride and dutasteride toward equine 5α-reductase activity were investigated. Pregnenolone was investigated as an additional potential substrate for 5α-reductase, suggested previously from in vivo studies in mares but never directly examined. No regional gradient of 5α-reductase expression was observed by either enzyme activity or transcript analysis. Results of PCR experiments suggested that type 1 isoform predominates in equine epididymis. Primers for the type 2 isoform were unable to amplify product from any samples examined. Progesterone and testosterone were readily reduced to DHP and DHT, and activity was effectively inhibited by both inhibitors. Using epididymis as an enzyme source, no experimental evidence was obtained supporting the notion that pregnenolone could be directly metabolized by equine 5α-reductases as has been suggested by previous investigators speculating on alternative metabolic pathways leading to DHP synthesis in placenta during equine pregnancies. PMID:27466384

  18. Differential regulation of polysome mRNA levels in mouse Hepa-1C1C7 cells exposed to dioxin.

    Science.gov (United States)

    Thornley, Jessica A; Trask, Heidi W; Ridley, Christian J A; Korc, Murray; Gui, Jiang; Ringelberg, Carol S; Wang, Sinny; Tomlinson, Craig R

    2011-10-01

    The environmental agent 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD or dioxin) causes a multitude of human illnesses. In order to more fully understand the underlying biology of TCDD toxicity, we tested the hypothesis that new candidate genes could be identified using polysome RNA from TCDD-treated mouse Hepa-1c1c7 cells. We found that (i) differentially expressed whole cell and cytoplasm RNA levels are both poor predictors of polysome RNA levels; (ii) for a majority of RNAs, differential RNA levels are regulated independently in the nucleus, cytoplasm, and polysomes; (iii) for the remaining polysome RNAs, levels are regulated via several different mechanisms, including a "tagging" of mRNAs in the nucleus for immediate polysome entry; and (iv) most importantly, a gene list derived from differentially expressed polysome RNA generated new genes and cell pathways potentially related to TCDD biology. PMID:21570461

  19. The role of biliverdin reductase in colorectal cancer

    International Nuclear Information System (INIS)

    In recent years, the effects of biliverdin and bilirubin have been studied extensively, and an inhibitory effect of bile pigments in cancer progression has been proposed. In this study we focused on the effects of biliverdin reductase, the enzyme that converts biliverdin to bilirubin, in colorectal cancer. For in vitro experiments we used a human colorectal carcinoma cell line and transfected it with an expression construct of shRNA specific for biliverdin reductase, to create cells with stable knock-down of enzyme expression. Cell proliferation was analyzed using the CASY model TT cell counting device. Western blot protein analysis was performed to study intracellular signaling cascades. Samples of human colorectal cancer were analyzed using immunohistochemistry. We were able to confirm the antiproliferative effects of bile pigments on cancer cells in vitro. However, this effect was attenuated in biliverdin reductase knock down cells. ERK and Akt activation seen under biliverdin and bilirubin treatment was also reduced in biliverdin reductase deficient cells. Immunohistochemical analysis of tumor samples from patients with colorectal cancer showed elevated biliverdin reductase levels. High enzyme expression was associated with lower overall and disease free patient survival. We conclude that BVR is required for bile pigment mediated effects regarding cancer cell proliferation and modulation of intracellular signaling cascades. The role of BVR overexpression in vivo and its exact influence on cancer progression and patient survival need to be further investigated. (author)

  20. Internal Calibration of HJ-1-C Satellite SAR System

    Directory of Open Access Journals (Sweden)

    Yang Zhen

    2014-06-01

    Full Text Available The HJ-1-C satellite is a Synthetic Aperture Radar (SAR satellite of a small constellation for environmental and disaster monitoring. At present, it is in orbit and working well. The SAR system uses a mesh reflector antenna and centralized power amplifier, and has an internal calibration function in orbit. This study introduces the internal calibration modes and signal paths. The design and realization of the internal calibrator are discussed in detail. Finally, the internal calibration data acquired in orbit are also analyzed.

  1. Level-1C Product from AIRS: Principal Component Filtering

    Science.gov (United States)

    Manning, Evan M.; Jiang, Yibo; Aumann, Hartmut H.; Elliott, Denis A.; Hannon, Scott

    2012-01-01

    The Atmospheric Infrared Sounder (AIRS), launched on the EOS Aqua spacecraft on May 4, 2002, is a grating spectrometer with 2378 channels in the range 3.7 to 15.4 microns. In a grating spectrometer each individual radiance measurement is largely independent of all others. Most measurements are extremely accurate and have very low noise levels. However, some channels exhibit high noise levels or other anomalous behavior, complicating applications needing radiances throughout a band, such as cross-calibration with other instruments and regression retrieval algorithms. The AIRS Level-1C product is similar to Level-1B but with instrument artifacts removed. This paper focuses on the "cleaning" portion of Level-1C, which identifies bad radiance values within spectra and produces substitute radiances using redundant information from other channels. The substitution is done in two passes, first with a simple combination of values from neighboring channels, then with principal components. After results of the substitution are shown, differences between principal component reconstructed values and observed radiances are used to investigate detailed noise characteristics and spatial misalignment in other channels.

  2. GPM Level 1C R Common Calibrated Brightness Temperatures Collocated VV03B

    Data.gov (United States)

    National Aeronautics and Space Administration — All 1C products have a common L1C data structure, simple and generic. Each L1C swath includes scan time, latitude and longitude, scan status, quality, incidence...

  3. GPM, NOAA-19 MHS Level 1C Common Calibrated Brightness Temperatures VV02A

    Data.gov (United States)

    National Aeronautics and Space Administration — All 1C products have a common L1C data structure, simple and generic. Each L1C swath includes scan time, latitude and longitude, scan status, quality, incidence...

  4. GPM Level 1C R Common Calibrated Brightness Temperatures Collocated VV03A

    Data.gov (United States)

    National Aeronautics and Space Administration — All 1C products have a common L1C data structure, simple and generic. Each L1C swath includes scan time, latitude and longitude, scan status, quality, incidence...

  5. GPM, SSMI F18 Level 1C Common Calibrated Brightness Temperatures VV02A

    Data.gov (United States)

    National Aeronautics and Space Administration — All 1C products have a common L1C data structure, simple and generic. Each L1C swath includes scan time, latitude and longitude, scan status, quality, incidence...

  6. GPM, NOAA-18 MHS Level 1C Common Calibrated Brightness Temperatures VV02A

    Data.gov (United States)

    National Aeronautics and Space Administration — All 1C products have a common L1C data structure, simple and generic. Each L1C swath includes scan time, latitude and longitude, scan status, quality, incidence...

  7. GPM GMI Level 1C Common Calibrated Brightness Temperatures Collocated VV03B

    Data.gov (United States)

    National Aeronautics and Space Administration — All 1C products have a common L1C data structure, simple and generic. Each L1C swath includes scan time, latitude and longitude, scan status, quality, incidence...

  8. GPM GMI Level 1C Common Calibrated Brightness Temperatures Collocated VV03A

    Data.gov (United States)

    National Aeronautics and Space Administration — All 1C products have a common L1C data structure, simple and generic. Each L1C swath includes scan time, latitude and longitude, scan status, quality, incidence...

  9. GPM, METOPA MHS Level 1C Common Calibrated Brightness Temperatures VV02A

    Data.gov (United States)

    National Aeronautics and Space Administration — All 1C products have a common L1C data structure, simple and generic. Each L1C swath includes scan time, latitude and longitude, scan status, quality, incidence...

  10. GPM, MT1 SAPHIR Level 1C Common Calibrated Brightness Temperatures VV02A

    Data.gov (United States)

    National Aeronautics and Space Administration — All 1C products have a common L1C data structure, simple and generic. Each L1C swath includes scan time, latitude and longitude, scan status, quality, incidence...

  11. GPM, SSMI F17 Level 1C Common Calibrated Brightness Temperatures VV02A

    Data.gov (United States)

    National Aeronautics and Space Administration — All 1C products have a common L1C data structure, simple and generic. Each L1C swath includes scan time, latitude and longitude, scan status, quality, incidence...

  12. GPM, METOPB MHS Level 1C Common Calibrated Brightness Temperatures VV02A

    Data.gov (United States)

    National Aeronautics and Space Administration — All 1C products have a common L1C data structure, simple and generic. Each L1C swath includes scan time, latitude and longitude, scan status, quality, incidence...

  13. GPM, SSMI F16 Level 1C Common Calibrated Brightness Temperatures VV02A

    Data.gov (United States)

    National Aeronautics and Space Administration — All 1C products have a common L1C data structure, simple and generic. Each L1C swath includes scan time, latitude and longitude, scan status, quality, incidence...

  14. GPM, TRMM TMI Level 1C Common Calibrated Brightness Temperatures VV02A

    Data.gov (United States)

    National Aeronautics and Space Administration — All 1C products have a common L1C data structure, simple and generic. Each L1C swath includes scan time, latitude and longitude, scan status, quality, incidence...

  15. Intramolecular electron transfer in Pseudomonas aeruginosa cd(1) nitrite reductase

    DEFF Research Database (Denmark)

    Farver, Ole; Brunori, Maurizio; Cutruzzolà, Francesca;

    2009-01-01

    The cd(1) nitrite reductases, which catalyze the reduction of nitrite to nitric oxide, are homodimers of 60 kDa subunits, each containing one heme-c and one heme-d(1). Heme-c is the electron entry site, whereas heme-d(1) constitutes the catalytic center. The 3D structure of Pseudomonas aeruginosa...... nitrite reductase has been determined in both fully oxidized and reduced states. Intramolecular electron transfer (ET), between c and d(1) hemes is an essential step in the catalytic cycle. In earlier studies of the Pseudomonas stutzeri enzyme, we observed that a marked negative cooperativity is...... controlling this internal ET step. In this study we have investigated the internal ET in the wild-type and His369Ala mutant of P. aeruginosa nitrite reductases and have observed similar cooperativity to that of the Pseudomonas stutzeri enzyme. Heme-c was initially reduced, in an essentially diffusion...

  16. Expression and site-directed mutagenesis of human dihydrofolate reductase

    International Nuclear Information System (INIS)

    A procaryotic high-level expression vector for human dihydrofolate reductase has been constructed and the protein characterized as a first step toward structure-function studies of this enzyme. A vector bearing the tac promoter, four synthetic oligodeoxynucleotides, and a restriction fragment from the dihydrofolate reductase cDNA were ligated in a manner which optimized the transcriptional and translational frequency of the enzyme mRNA. The reductase, comprising ca. 17% of the total soluble protein in the host bacteria, was purified to apparent homogeneity as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and characterized by amino acid composition, partial amino acid sequence, and steady-sate kinetic analysis. This expression vector has been used as a template for double-stranded plasmid DNA site-specific mutagenesis. Functional studies on a Cys-6 → Ser-6 mutant enzyme support the contention that Cys-6 is obligatory for organomercurial activation of human dihydrofolate reductase. The Ser-6 mutant enzyme was not activated to any extent following a 24-h incubation with p-(hydroxymercuri)benzoate and nicotinamide adenine dinucleotide phosphate (reduced) (NADPH), whereas the k/sub cat/ for Cys-6 reductase increased 2-fold under identical conditions. The specific activities of the Cys-6 and Ser-6 enzymes were virtually identical as determined by methotrexate titration as were the K/sub m/ values for both dihydrofolate and NADPH. The Ser-6 mutant showed a decreased temperature stability and was more sensitive to inactivation by α-chymotrypsin when compared to the wild-type enzyme. These results suggest that the Ser-6 mutant reductase is conformationally altered relative to the Cys-6 native enzyme

  17. Effect of vanadium on nitrate reductase activity in tomato leaves

    OpenAIRE

    J. Buczek

    2015-01-01

    The activity of nitrate reductase in cell-free extracts from tomato leaves is completely inhibited by 100 μM NaVO3 or VOCl2. In experiments in vivo vanadium ions inhibit the activity of the enzyme in 50 to 60 per cent. Addition of l mM vanadium to the medium on which tomato seedlings are grown causes after 24 h almost complete inhibition of nitrate reductase activity in cell-free extracts of the enzyme. Inhibition with vanadium may be abolished in experiments in vitro if the extract is treate...

  18. The intramolecular electron transfer between copper sites of nitrite reductase

    DEFF Research Database (Denmark)

    Farver, O; Eady, R R; Abraham, Z H;

    1998-01-01

    The intramolecular electron transfer (ET) between the type 1 Cu(I) and the type 2 Cu(II) sites of Alcaligenes xylosoxidans dissimilatory nitrite reductase (AxNiR) has been studied in order to compare it with the analogous process taking place in ascorbate oxidase (AO). This internal process is......(I) and the trinuclear copper centre in ascorbate oxidase, and the characteristics of the internal ET processes of these enzymes are compared. The data are consistent with the faster ET observed in nitrite reductase arising from a more advantageous entropy of activation when compared with ascorbate...

  19. DECOVALEX ll PROJECT. Technical Report Task 1C

    Energy Technology Data Exchange (ETDEWEB)

    Jing, L.; Stephansson, O. [Royal Inst. of Tech., Stockholm (Sweden). Dept. of Civil and Environmental Engineering; Knight, L.J. [United Kingdom Nirex Ltd., Harwell (United Kingdom); Kautsky, F. [Swedish Nuclear Power Inspectorate, Stockholm (Sweden); Tsang, C-F. [Lawrence Berkeley National Lab., Berkeley, CA (United States). Earth Science Division

    1999-05-01

    The DECOVALEX II project is an international co-operative research project supported by eleven funding organizations from seven countries. The project studied four tasks: Task 1: numerical simulation of the RCF3 pump test at Sellafield, UK; Task 2: numerical simulation if the in situ T-H-M experiment at Kamaishi Mine, Japan; Task 3: monitoring of current development in rock fracture research; and Task 4: report on treatment of T-H-M processes in Performance Assessment works for nuclear waste repositories. The project started in 1995 and is scheduled to be finalised in June 1999. This report concerns the Task 1 of the DECOVALEX 11 project. Task 1 consists of three subtasks: i) Task 1 A - the blind numerical prediction to the hydraulic response of the rock mass of the in-situ RCF3 pump test in the Borrowdale Volcanic Group (BVG) at Sellafield, UK; ii) Task 1B -calibration of the numerical models of Task 1A against measured results of the RCF3 pump test; iii) Task 1C - the numerical predictions of the hydro-mechanical effects of the BVG rock mass to the excavation of a shaft along the axis of the RCF3 borehole, without actual excavation of the shaft and associated experiments and measurements. The aim of the subtasks 1 (A+B) was to characterise the hydro-mechanical property field of the fractured rock mass at the RCF3 test site, which could then be used to predict the hydro-mechanical responses of the rock mass to the excavation of a shaft centred on the RCF3 borehole. Task 1C involves a numerical simulation of an assumed excavation of a single shaft on the line of the RCF3 borehole used for Task 1 (A+B). The subtask is basically a generic prediction, with realistic site geology and hydrogeology data but without feedback from an actual excavation of the shaft and associated measurements. A model calibration is not possible due to lack of measured results. On the other hand, some additional components were introduced into the subtask, such as studies of EDZ formation

  20. DECOVALEX ll PROJECT. Technical Report Task 1C

    International Nuclear Information System (INIS)

    The DECOVALEX II project is an international co-operative research project supported by eleven funding organizations from seven countries. The project studied four tasks: Task 1: numerical simulation of the RCF3 pump test at Sellafield, UK; Task 2: numerical simulation if the in situ T-H-M experiment at Kamaishi Mine, Japan; Task 3: monitoring of current development in rock fracture research; and Task 4: report on treatment of T-H-M processes in Performance Assessment works for nuclear waste repositories. The project started in 1995 and is scheduled to be finalised in June 1999. This report concerns the Task 1 of the DECOVALEX 11 project. Task 1 consists of three subtasks: i) Task 1 A - the blind numerical prediction to the hydraulic response of the rock mass of the in-situ RCF3 pump test in the Borrowdale Volcanic Group (BVG) at Sellafield, UK; ii) Task 1B -calibration of the numerical models of Task 1A against measured results of the RCF3 pump test; iii) Task 1C - the numerical predictions of the hydro-mechanical effects of the BVG rock mass to the excavation of a shaft along the axis of the RCF3 borehole, without actual excavation of the shaft and associated experiments and measurements. The aim of the subtasks 1 (A+B) was to characterise the hydro-mechanical property field of the fractured rock mass at the RCF3 test site, which could then be used to predict the hydro-mechanical responses of the rock mass to the excavation of a shaft centred on the RCF3 borehole. Task 1C involves a numerical simulation of an assumed excavation of a single shaft on the line of the RCF3 borehole used for Task 1 (A+B). The subtask is basically a generic prediction, with realistic site geology and hydrogeology data but without feedback from an actual excavation of the shaft and associated measurements. A model calibration is not possible due to lack of measured results. On the other hand, some additional components were introduced into the subtask, such as studies of EDZ formation

  1. Artificial electron donors for nitrate and nitrite reductases usable as mediators in amperometric biosensors

    Energy Technology Data Exchange (ETDEWEB)

    Strehlitz, B. (Umweltforschungszentrum Leipzig-Halle GmbH, Leipzig (Germany)); Gruendig, B. (Institut fuer Chemo- und Biosensorik, Muenster-Roxel (Germany)); Vorlop, K.D. (Bundesforschungsanstalt fuer Landwirtschaft, Braunschweig (Germany). Inst. fuer Technologie); Bartholmes, P. (Witten-Herdecke Univ., Witten (Germany). Inst. fuer Biochemie); Kotte, H. (Umweltforschungszentrum Leipzig-Halle GmbH, Leipzig (Germany)); Stottmeister, U. (Umweltforschungszentrum Leipzig-Halle GmbH, Leipzig (Germany))

    1994-07-01

    Various nitrate and nitrite reductases are capable of accepting electrons from artificial donors. Combining these redox active donors with an amperometric redox electrode which is covered with an immobilized layer of such a nitrate or nitrite reductase, new enzyme sensors can be created for the detection of nitrate or nitrite, respectively. A range of suitable electron donors for nitrate reductases and nitrite reductase from different sources have been selected and characterized by electrochemical methods. (orig.)

  2. Inhibition of Albendazole and Oxfendazole on the Activity of Fumaric Reductase in Cysticercus cellulosae

    Institute of Scientific and Technical Information of China (English)

    GAO Xue-jun; LI Qing-zhang; LI Xia

    2004-01-01

    The activity of fumaric reductase in Cysticercus cellulosae tissue homogenate with albendazole and oxfendazole individually was detected. Results showed that the two kinds of drugs both could inhabite the activity of fumaric reductase. The results indicate that the mechanism of action of benzimidazole carbamate drugs is probably inhabiting the complex of fumaric reductase noncompetently, thus lead to the exhaostion of energy and death.

  3. Sepiapterin reductase deficiency an autosomal recessive DOPA-responsive dystonia

    NARCIS (Netherlands)

    N.G. Abeling; M. Duran; H.D. Bakker; L. Stroomer; B. Thony; N. Blau; J. Booij; B.T. Poll-The

    2006-01-01

    The diagnosis of a 14-year-old girl with a new homoallelic mutation in the sepiapterin reductase (SR) gene is reported. Initially she presented at the age of 2 with hypotonia and mild cognitive developmental delay, and was diagnosed as having mild methylmalonic aciduria, which was recently identifie

  4. Thioredoxin and NADP-thioredoxin reductase from cultured carrot cells

    Science.gov (United States)

    Johnson, T. C.; Cao, R. Q.; Kung, J. E.; Buchanan, B. B.

    1987-01-01

    Dark-grown carrot (Daucus carota L.) tissue cultures were found to contain both protein components of the NADP/thioredoxin system--NADP-thioredoxin reductase and the thioredoxin characteristic of heterotrophic systems, thioredoxin h. Thioredoxin h was purified to apparent homogeneity and, like typical bacterial counterparts, was a 12-kdalton (kDa) acidic protein capable of activating chloroplast NADP-malate dehydrogenase (EC 1.1.1.82) more effectively than fructose-1,6-bisphosphatase (EC 3.1.3.11). NADP-thioredoxin reductase (EC 1.6.4.5) was partially purified and found to be an arsenite-sensitive enzyme composed of two 34-kDa subunits. Carrot NADP-thioredoxin reductase resembled more closely its counterpart from bacteria rather than animal cells in acceptor (thioredoxin) specificity. Upon greening of the cells, the content of NADP-thioredoxin-reductase activity, and, to a lesser extent, thioredoxin h decreased. The results confirm the presence of a heterotrophic-type thioredoxin system in plant cells and raise the question of its physiological function.

  5. Bidirectional catalysis by copper-containing nitrite reductase

    NARCIS (Netherlands)

    Wijma, HJ; Canters, GW; de Vries, S; Verbeet, MP

    2004-01-01

    The copper-containing nitrite reductase from Alcaligenes faecalis S-6 was found to catalyze the oxidation of nitric oxide to nitrite, the reverse of its physiological reaction. Thermodynamic and kinetic constants with the physiological electron donor pseudoazurin were determined for both directions

  6. Thioredoxin reductase from s. Coelicolor as a drug target

    Czech Academy of Sciences Publication Activity Database

    Koháryová, M.; Brynda, Jiří; Řezáčová, Pavlína; Kollárová, M.

    2015-01-01

    Roč. 282, Suppl 1 (2015), s. 396. ISSN 1742-464X. [Congress of the Federation of European Biochemical Societies (FEBS) - The Biochemical Basis of Life /40./. 04.07.2015-09.07.2015, Berlin] Institutional support: RVO:61388963 ; RVO:68378050 Keywords : thioredoxin reductase * protein structure * drugs Subject RIV: CE - Biochemistry

  7. Isolation and expression of the Pneumocystis carinii dihydrofolate reductase gene

    DEFF Research Database (Denmark)

    Edman, J C; Edman, U; Cao, Mi-Mi;

    1989-01-01

    Pneumocystis carinii dihydrofolate reductase (DHFR; 5,6,7,8-tetrahydrofolate: NADP+ oxidoreductase, EC 1.5.1.3) cDNA sequences have been isolated by their ability to confer trimethoprim resistance to Escherichia coli. Consistent with the recent conclusion that P. carinii is a member of the Fungi...

  8. Fatty Acyl-CoA Reductase 1 Deficiency

    Directory of Open Access Journals (Sweden)

    Charles N Swisher

    2015-01-01

    Full Text Available Investigators from Erlangen, Germany; Calgary, CA; and Kafranbel, Syria, identified mutations in the gene, fatty acyl-CoA reductase 1 (FAR1 deficiency, adding to three other genes involved in plasmalogen biosynthesis, in two families affected by severe intellectual disability, early-onset epilepsy, microcephaly, congenital cataracts, growth retardation, and spasticity.

  9. 3-Nitrobenzanthrone and 3-aminobenzanthrone induce DNA damage and cell signalling in Hepa1c1c7 cells

    Energy Technology Data Exchange (ETDEWEB)

    Landvik, N.E. [Division of Environmental Medicine, Norwegian Institute of Public Health, P.O. Box 404 Torshov N-4303 Oslo (Norway); Arlt, V.M.; Nagy, E. [Section of Molecular Carcinogenesis, Institute of Cancer Research, Brookes Lawley Building, Sutton, Surrey SM2 5NG (United Kingdom); Solhaug, A. [Section for Toxicology, Department of Feed and Food Safety, National Veterinary Institute Pb 750 Sentrum, N-0106 Oslo (Norway); Tekpli, X. [EA SeRAIC, Equipe labellisee Ligue contre le Cancer, IFR 140, Universite de Rennes 1, Rennes (France); Schmeiser, H.H. [Research Group Genetic Alteration in Carcinogenesis, German Cancer Research Center, Im Neuenheimer Feld 280, 69120 Heidelberg (Germany); Refsnes, M. [Division of Environmental Medicine, Norwegian Institute of Public Health, P.O. Box 404 Torshov N-4303 Oslo (Norway); Phillips, D.H. [Section of Molecular Carcinogenesis, Institute of Cancer Research, Brookes Lawley Building, Sutton, Surrey SM2 5NG (United Kingdom); Lagadic-Gossmann, D. [EA SeRAIC, Equipe labellisee Ligue contre le Cancer, IFR 140, Universite de Rennes 1, Rennes (France); Holme, J.A., E-mail: jorn.holme@fhi.no [Division of Environmental Medicine, Norwegian Institute of Public Health, P.O. Box 404 Torshov N-4303 Oslo (Norway)

    2010-02-03

    3-Nitrobenzanthrone (3-NBA) is a mutagenic and carcinogenic environmental pollutant found in diesel exhaust and urban air pollution. In the present work we have characterised the effects of 3-NBA and its metabolite 3-aminobenzanthrone (3-ABA) on cell death and cytokine release in mouse hepatoma Hepa1c1c7 cells. These effects were related to induced DNA damage and changes in cell signalling pathways. 3-NBA resulted in cell death and caused most DNA damage as judged by the amount of DNA adducts ({sup 32}P-postlabelling assay), single strand (ss)DNA breaks and oxidative DNA lesions (comet assay) detected. An increased phosphorylation of H2AX, chk1, chk2 and partly ATM was observed using flow cytometry and/or Western blotting. Both compounds increased phosphorylation of p53 and MAPKs (ERK, p38 and JNK). However, only 3-NBA caused an accumulation of p53 in the nucleus and a translocation of Bax to the mitochondria. The p53 inhibitor pifithrin-alpha inhibited 3-NBA-induced apoptosis, indicating that cell death was a result of the triggering of DNA signalling pathways. The highest phosphorylation of Akt and degradation of I{kappa}B-{alpha} (suggesting activation of NF-{kappa}B) were also seen after treatment with 3-NBA. In contrast 3-ABA increased IL-6 release, but caused little or no toxicity. Cytokine release was inhibited by PD98059 and curcumin, suggesting that ERK and NF-{kappa}B play a role in this process. In conclusion, 3-NBA seems to have a higher potency to induce DNA damage compatible with its cytotoxic effects, while 3-ABA seems to have a greater effect on the immune system.

  10. 3-Nitrobenzanthrone and 3-aminobenzanthrone induce DNA damage and cell signalling in Hepa1c1c7 cells

    International Nuclear Information System (INIS)

    3-Nitrobenzanthrone (3-NBA) is a mutagenic and carcinogenic environmental pollutant found in diesel exhaust and urban air pollution. In the present work we have characterised the effects of 3-NBA and its metabolite 3-aminobenzanthrone (3-ABA) on cell death and cytokine release in mouse hepatoma Hepa1c1c7 cells. These effects were related to induced DNA damage and changes in cell signalling pathways. 3-NBA resulted in cell death and caused most DNA damage as judged by the amount of DNA adducts (32P-postlabelling assay), single strand (ss)DNA breaks and oxidative DNA lesions (comet assay) detected. An increased phosphorylation of H2AX, chk1, chk2 and partly ATM was observed using flow cytometry and/or Western blotting. Both compounds increased phosphorylation of p53 and MAPKs (ERK, p38 and JNK). However, only 3-NBA caused an accumulation of p53 in the nucleus and a translocation of Bax to the mitochondria. The p53 inhibitor pifithrin-alpha inhibited 3-NBA-induced apoptosis, indicating that cell death was a result of the triggering of DNA signalling pathways. The highest phosphorylation of Akt and degradation of IκB-α (suggesting activation of NF-κB) were also seen after treatment with 3-NBA. In contrast 3-ABA increased IL-6 release, but caused little or no toxicity. Cytokine release was inhibited by PD98059 and curcumin, suggesting that ERK and NF-κB play a role in this process. In conclusion, 3-NBA seems to have a higher potency to induce DNA damage compatible with its cytotoxic effects, while 3-ABA seems to have a greater effect on the immune system.

  11. The biomechanical properties of F1C pili

    CERN Document Server

    Castelain, Mickaël; Klinth, Jeanna; Lindberg, Stina; Andersson, Magnus; Uhlin, Bernt Eric; Axner, Ove

    2014-01-01

    Uropathogenic Escherichia coli (UPEC) express various kinds of organelles, so-called pili or fimbriae, that mediate adhesion to host tissue in the urinary tract through specific receptor-adhesin interactions. The biomechanical properties of these pili have been considered important for the ability of bacteria to withstand shear forces from rinsing urine flows. Force measuring optical tweezers have been used to characterize individual organelles of F1C type expressed by UPEC bacteria with respect to such properties. Qualitatively, the force-vs.-elongation response was found to be similar to that of other types of helix-like pili expressed by UPEC, i.e. type 1, P, and S, with force-induced elongation in three regions of which one represents the important uncoiling mechanism of the helix-like quaternary structure. Quantitatively, the steady-state uncoiling force was assessed to 26.4(1.4) pN, which is similar to those of other pili (which range from 21 pN for SI to 30 pN for type 1). The corner velocity for dynam...

  12. SMOS L1C and L2 Validation in Australia

    Science.gov (United States)

    Rudiger, Christoph; Walker, Jeffrey P.; Kerr, Yann H.; Mialon, Arnaud; Merlin, Olivier; Kim, Edward J.

    2012-01-01

    Extensive airborne field campaigns (Australian Airborne Cal/val Experiments for SMOS - AACES) were undertaken during the 2010 summer and winter seasons of the southern hemisphere. The purpose of those campaigns was the validation of the Level 1c (brightness temperature) and Level 2 (soil moisture) products of the ESA-led Soil Moisture and Ocean Salinity (SMOS) mission. As SMOS is the first satellite to globally map L-band (1.4GHz) emissions from the Earth?s surface, and the first 2-dimensional interferometric microwave radiometer used for Earth observation, large scale and long-term validation campaigns have been conducted world-wide, of which AACES is the most extensive. AACES combined large scale medium-resolution airborne L-band and spectral observations, along with high-resolution in-situ measurements of soil moisture across a 50,000km2 area of the Murrumbidgee River catchment, located in south-eastern Australia. This paper presents a qualitative assessment of the SMOS brightness temperature and soil moisture products.

  13. Black Hole Collapse in the 1/c Expansion

    CERN Document Server

    Anous, Tarek; Rovai, Antonin; Sonner, Julian

    2016-01-01

    We present a first-principles CFT calculation corresponding to the spherical collapse of a shell of matter in three dimensional quantum gravity. In field theory terms, we describe the equilibration process, from early times to thermalization, of a CFT following a sudden injection of energy at time t=0. By formulating a continuum version of Zamolodchikov's monodromy method to calculate conformal blocks at large central charge c, we give a framework to compute a general class of probe observables in the collapse state, incorporating the full backreaction of matter fields on the dual geometry. This is illustrated by calculating a scalar field two-point function at time-like separation and the time-dependent entanglement entropy of an interval, both showing thermalization at late times. The results are in perfect agreement with previous gravity calculations in the AdS$_3$-Vaidya geometry. Information loss appears in the CFT as an explicit violation of unitarity in the 1/c expansion, restored by nonperturbative co...

  14. Black hole collapse in the 1 /c expansion

    Science.gov (United States)

    Anous, Tarek; Hartman, Thomas; Rovai, Antonin; Sonner, Julian

    2016-07-01

    We present a first-principles CFT calculation corresponding to the spherical collapse of a shell of matter in three dimensional quantum gravity. In field theory terms, we describe the equilibration process, from early times to thermalization, of a CFT following a sudden injection of energy at time t = 0. By formulating a continuum version of Zamolodchikov's monodromy method to calculate conformal blocks at large central charge c, we give a framework to compute a general class of probe observables in the collapse state, incorporating the full backreaction of matter fields on the dual geometry. This is illustrated by calculating a scalar field two-point function at time-like separation and the time-dependent entanglement entropy of an interval, both showing thermalization at late times. The results are in perfect agreement with previous gravity calculations in the AdS3-Vaidya geometry. Information loss appears in the CFT as an explicit violation of unitarity in the 1 /c expansion, restored by nonperturbative corrections.

  15. Location of the redox-active thiols of ribonucleotide reductase: sequences similarity between the Escherichia coli and Lactobacillus leichmannii enzymes

    International Nuclear Information System (INIS)

    The redox-active thiols of Escherichia coli ribonucleoside diphosphate reductase and of Lactobacillus leichmannii ribonucleoside triphosphate reductase have been located by a procedure involving (1) prereduction of enzyme with dithiothreitol, (2) specific oxidation of the redox-active thiols by treatment with substrate in the absence of exogenous reductant, (3) alkylation of other thiols with iodoacetamide, and (4) reduction of the disulfides with dithiothreitol and alkylation with [1-14C]iodoacetamide. The dithiothreitol-reduce E. coli B1 subunit is able to convert 3 equiv of CDP to dCDP and is labeled with 5.4 equiv of 14C. Sequencing of tryptic peptides shows that 2.8 equiv of 14C is on cysteines-752 and -757 at the C-terminus of B1, while 1.0-1.5 equiv of 14C is on cysteines-222 and -227. It thus appears that two sets of redox-active dithiols are involved in substrate reduction. The L. leichmannii reductase is able to convert 1.1 equiv of CTP to dCTP and is labeled with 2.1 equiv of 14C. Sequencing of tryptic peptides shows that 1.4 equiv of 14C is located on the two cysteines of C-E-G-G-A-C-P-I-K. This peptide shows remarkable and unexpected similarity to the thiol-containing region of the C-terminal peptide of E. coli B1, C-E-S-G-A-C-K-I

  16. Crystal structures of pinoresinol-lariciresinol and phenylcoumaran benzylic ether reductases and their relationship to isoflavone reductases

    Science.gov (United States)

    Min, Tongpil; Kasahara, Hiroyuki; Bedgar, Diana L.; Youn, Buhyun; Lawrence, Paulraj K.; Gang, David R.; Halls, Steven C.; Park, HaJeung; Hilsenbeck, Jacqueline L.; Davin, Laurence B.; Lewis, Norman G.; Kang, ChulHee

    2003-01-01

    Despite the importance of plant lignans and isoflavonoids in human health protection (e.g. for both treatment and prevention of onset of various cancers) as well as in plant biology (e.g. in defense functions and in heartwood development), systematic studies on the enzymes involved in their biosynthesis have only recently begun. In this investigation, three NADPH-dependent aromatic alcohol reductases were comprehensively studied, namely pinoresinol-lariciresinol reductase (PLR), phenylcoumaran benzylic ether reductase (PCBER), and isoflavone reductase (IFR), which are involved in central steps to the various important bioactive lignans and isoflavonoids. Of particular interest was in determining how differing regio- and enantiospecificities are achieved with the different enzymes, despite each apparently going through similar enone intermediates. Initially, the three-dimensional x-ray crystal structures of both PLR_Tp1 and PCBER_Pt1 were solved and refined to 2.5 and 2.2 A resolutions, respectively. Not only do they share high gene sequence similarity, but their structures are similar, having a continuous alpha/beta NADPH-binding domain and a smaller substrate-binding domain. IFR (whose crystal structure is not yet obtained) was also compared (modeled) with PLR and PCBER and was deduced to have the same overall basic structure. The basis for the distinct enantio-specific and regio-specific reactions of PCBER, PLR, and IFR, as well as the reaction mechanism and participating residues involved (as identified by site-directed mutagenesis), are discussed.

  17. Glycogen synthase kinase-3-mediated phosphorylation of serine 73 targets sterol response element binding protein-1c (SREBP-1c) for proteasomal degradation.

    Science.gov (United States)

    Dong, Qingming; Giorgianni, Francesco; Beranova-Giorgianni, Sarka; Deng, Xiong; O'Meally, Robert N; Bridges, Dave; Park, Edwards A; Cole, Robert N; Elam, Marshall B; Raghow, Rajendra

    2016-01-01

    Sterol regulatory element binding protein-1c (SREBP-1c) is a key transcription factor that regulates genes involved in the de novo lipid synthesis and glycolysis pathways. The structure, turnover and transactivation potential of SREBP-1c are regulated by macronutrients and hormones via a cascade of signalling kinases. Using MS, we have identified serine 73 as a novel glycogen synthase kinase-3 (GSK-3) phosphorylation site in the rat SREBP-1c purified from McA-RH7777 hepatoma cells. Our site-specific mutagenesis strategy revealed that the turnover of SREBP-1c, containing wild type, phospho-null (serine to alanine) or phospho-mimetic (serine to aspartic acid) substitutions, was differentially regulated. We show that the S73D mutant of pSREBP-1c, that mimicked a state of constitutive phosphorylation, dissociated from the SREBP-1c-SCAP complex more readily and underwent GSK-3-dependent proteasomal degradation via SCF(Fbw7) ubiquitin ligase pathway. Pharmacologic inhibition of GSK-3 or knockdown of GSK-3 by siRNA prevented accelerated degradation of SREBP-1c. As demonstrated by MS, SREBP-1c was phosphorylated in vitro by GSK-3β at serine 73. Phosphorylation of serine 73 also occurs in the intact liver. We propose that GSK-3-mediated phosphorylation of serine 73 in the rat SREBP-1c and its concomitant destabilization represents a novel mechanism involved in the inhibition of de novo lipid synthesis in the liver. PMID:26589965

  18. Rapid Identification of Aldose Reductase Inhibitory Compounds from Perilla frutescens

    OpenAIRE

    Soon Sung Lim; Ji Hun Paek; Kuk Hyun Shin; Young-Hee Kang; Jae-Yong Lee

    2013-01-01

    The ethyl acetate (EtOAc) soluble fraction of methanol extracts of Perilla frutescens (P. frutescens) inhibits aldose reductase (AR), the key enzyme in the polyol pathway. Our investigation of inhibitory compounds from the EtOAc soluble fraction of P. frutescens was followed by identification of the inhibitory compounds by a combination of HPLC microfractionation and a 96-well enzyme assay. This allowed the biological activities to be efficiently matched with selected HPLC peaks. Structural a...

  19. Determination of plasma gluthatione reductase enzyme activity in osteoporotic women

    OpenAIRE

    Sadeghi N; Oveisi M.R.; Jannat B.; Hajimahmoodi M; Jamshidi A.R; Sajadian Z.

    2008-01-01

    Background: Osteoporosis is a disease of high prevalence with increased bone loss. Free radicals have been proved to be involved in bone resorption. Glutathione reductase (GR) plays an essential role in cell defense against reactive oxygen metabolites by sustaining the reduced status of an important antioxidant, glutathione. In the present study GR activity of plasma as an antioxidant enzyme in relation to Bone Mineral Density (BMD) was investigated.Material and Method: GR activity was measur...

  20. Glutathione reductase: solvent equilibrium and kinetic isotope effects

    International Nuclear Information System (INIS)

    Glutathione reductase catalyzes the NADPH-dependent reduction of oxidized glutathione (GSSG). The kinetic mechanism is ping-pong, and we have investigated the rate-limiting nature of proton-transfer steps in the reactions catalyzed by the spinach, yeast, and human erythrocyte glutathione reductases using a combination of alternate substrate and solvent kinetic isotope effects. With NADPH or GSSG as the variable substrate, at a fixed, saturating concentration of the other substrate, solvent kinetic isotope effects were observed on V but not V/K. Plots of Vm vs mole fraction of D2O (proton inventories) were linear in both cases for the yeast, spinach, and human erythrocyte enzymes. When solvent kinetic isotope effect studies were performed with DTNB instead of GSSG as an alternate substrate, a solvent kinetic isotope effect of 1.0 was observed. Solvent kinetic isotope effect measurements were also performed on the asymmetric disulfides GSSNB and GSSNP by using human erythrocyte glutathione reductase. The Km values for GSSNB and GSSNP were 70 microM and 13 microM, respectively, and V values were 62 and 57% of the one calculated for GSSG, respectively. Both of these substrates yield solvent kinetic isotope effects greater than 1.0 on both V and V/K and linear proton inventories, indicating that a single proton-transfer step is still rate limiting. These data are discussed in relationship to the chemical mechanism of GSSG reduction and the identity of the proton-transfer step whose rate is sensitive to solvent isotopic composition. Finally, the solvent equilibrium isotope effect measured with yeast glutathione reductase is 4.98, which allows us to calculate a fractionation factor for the thiol moiety of GSH of 0.456

  1. Internal electron transfer within mitochondrial succinate-cytochrome C reductase

    International Nuclear Information System (INIS)

    Internal electron transfer within succinate-cytochrome C reductase from pigeon breast muscle mitochondria was followed by the pulse radiolytic technique. The electron equivalent is transferred from an unknown donor to b type cytochrome(s), in a first order process with a rate constant of: 660 +- 150s-1. This process might be the rate determining step of electron transfer in mitochondria, since it is similar in rate to the turnover number of the mitochondrial respiratory chain

  2. Phosphoglycerate kinase acts in tumour angiogenesis as a disulphide reductase

    Science.gov (United States)

    Lay, Angelina J.; Jiang, Xing-Mai; Kisker, Oliver; Flynn, Evelyn; Underwood, Anne; Condron, Rosemary; Hogg, Philip J.

    2000-12-01

    Disulphide bonds in secreted proteins are considered to be inert because of the oxidizing nature of the extracellular milieu. An exception to this rule is a reductase secreted by tumour cells that reduces disulphide bonds in the serine proteinase plasmin. Reduction of plasmin initiates proteolytic cleavage in the kringle 5 domain and release of the tumour blood vessel inhibitor angiostatin. New blood vessel formation or angiogenesis is critical for tumour expansion and metastasis. Here we show that the plasmin reductase isolated from conditioned medium of fibrosarcoma cells is the glycolytic enzyme phosphoglycerate kinase. Recombinant phosphoglycerate kinase had the same specific activity as the fibrosarcoma-derived protein. Plasma of mice bearing fibrosarcoma tumours contained several-fold more phosphoglycerate kinase, as compared with mice without tumours. Administration of phosphoglycerate kinase to tumour-bearing mice caused an increase in plasma levels of angiostatin, and a decrease in tumour vascularity and rate of tumour growth. Our findings indicate that phosphoglycerate kinase not only functions in glycolysis but is secreted by tumour cells and participates in the angiogenic process as a disulphide reductase.

  3. Perchlorate Reductase Is Distinguished by Active Site Aromatic Gate Residues.

    Science.gov (United States)

    Youngblut, Matthew D; Tsai, Chi-Lin; Clark, Iain C; Carlson, Hans K; Maglaqui, Adrian P; Gau-Pan, Phonchien S; Redford, Steven A; Wong, Alan; Tainer, John A; Coates, John D

    2016-04-22

    Perchlorate is an important ion on both Earth and Mars. Perchlorate reductase (PcrAB), a specialized member of the dimethylsulfoxide reductase superfamily, catalyzes the first step of microbial perchlorate respiration, but little is known about the biochemistry, specificity, structure, and mechanism of PcrAB. Here we characterize the biophysics and phylogeny of this enzyme and report the 1.86-Å resolution PcrAB complex crystal structure. Biochemical analysis revealed a relatively high perchlorate affinity (Km = 6 μm) and a characteristic substrate inhibition compared with the highly similar respiratory nitrate reductase NarGHI, which has a relatively much lower affinity for perchlorate (Km = 1.1 mm) and no substrate inhibition. Structural analysis of oxidized and reduced PcrAB with and without the substrate analog SeO3 (2-) bound to the active site identified key residues in the positively charged and funnel-shaped substrate access tunnel that gated substrate entrance and product release while trapping transiently produced chlorate. The structures suggest gating was associated with shifts of a Phe residue between open and closed conformations plus an Asp residue carboxylate shift between monodentate and bidentate coordination to the active site molybdenum atom. Taken together, structural and mutational analyses of gate residues suggest key roles of these gate residues for substrate entrance and product release. Our combined results provide the first detailed structural insight into the mechanism of biological perchlorate reduction, a critical component of the chlorine redox cycle on Earth. PMID:26940877

  4. Cloning and sequence of the human adrenodoxin reductase gene

    International Nuclear Information System (INIS)

    Adrenodoxin reductase is a flavoprotein mediating electron transport to all mitochondrial forms of cytochrome P450. The authors cloned the human adrenodoxin reductase gene and characterized it by restriction endonuclease mapping and DNA sequencing. The entire gene is approximately 12 kilobases long and consists of 12 exons. The first exon encodes the first 26 of the 32 amino acids of the signal peptide, and the second exon encodes the remainder of signal peptide and the apparent FAD binding site. The remaining 10 exons are clustered in a region of only 4.3 kilobases, separated from the first two exons by a large intron of about 5.6 kilobases. Two forms of human adrenodoxin reductase mRNA, differing by the presence or absence of 18 bases in the middle of the sequence, arise from alternate splicing at the 5' end of exon 7. This alternately spliced region is directly adjacent to the NADPH binding site, which is entirely contained in exon 6. The immediate 5' flanking region lacks TATA and CAAT boxes; however, this region is rich in G+C and contains six copies of the sequence GGGCGGG, resembling promoter sequences of housekeeping genes. RNase protection experiments show that transcription is initiated from multiple sites in the 5' flanking region, located about 21-91 base pairs upstream from the AUG translational initiation codon

  5. Changing from glucose to HbA1c for diabetes diagnosis

    DEFF Research Database (Denmark)

    Nielsen, Aneta Aleksandra; Petersen, Per Hyltoft; Green, Anders;

    2014-01-01

    BACKGROUND: In Denmark, the use of HbA1c in the diagnosis of diabetes was adopted from March 2012. We evaluated the change in the number of diabetes cases diagnosed by haemoglobin A1c (HbA1c) versus fasting venous plasma glucose (FPG), and estimated the influence of analytical variation and bias ...

  6. File list: Oth.ALL.20.JMJD1C.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.ALL.20.JMJD1C.AllCell hg19 TFs and others JMJD1C All cell types SRX1304576,SRX1...304581,SRX1304579,SRX763970 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.20.JMJD1C.AllCell.bed ...

  7. File list: Oth.ALL.10.JMJD1C.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.ALL.10.JMJD1C.AllCell hg19 TFs and others JMJD1C All cell types SRX1304576,SRX1...304581,SRX1304579,SRX763970 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.ALL.10.JMJD1C.AllCell.bed ...

  8. File list: Oth.Bld.10.JMJD1C.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Bld.10.JMJD1C.AllCell hg19 TFs and others JMJD1C Blood SRX1304576,SRX1304581,SR...X1304579,SRX763970 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Bld.10.JMJD1C.AllCell.bed ...

  9. File list: Oth.Bld.20.JMJD1C.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Bld.20.JMJD1C.AllCell hg19 TFs and others JMJD1C Blood SRX1304576,SRX1304581,SR...X1304579,SRX763970 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Bld.20.JMJD1C.AllCell.bed ...

  10. File list: Oth.Bld.05.JMJD1C.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Bld.05.JMJD1C.AllCell hg19 TFs and others JMJD1C Blood SRX1304576,SRX1304581,SR...X1304579,SRX763970 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Bld.05.JMJD1C.AllCell.bed ...

  11. Immunological comparison of the NADH:nitrate reductase from different cucumber tissues

    OpenAIRE

    Jolanta Marciniak; Grażyna Kłobus; Józef Buczek; Tadeusz Stefaniak; Jarosław Mazur

    2014-01-01

    Soluble nitrate reductase from cucumber roots (Cucumis sativus L.) was isolated and purified with blue-Sepharose 4B. Specific antibodies against the NR protein were raised by immunization of a goat. Using polyclonal antibodies anti-NR properties of the nitrate reductase from various cucumber tissues were examined. Experiments showed difference in immuno-logical properties of nitrate reductase (NR) from cotyledon roots and leaves.

  12. Immunological comparison of the NADH:nitrate reductase from different cucumber tissues

    Directory of Open Access Journals (Sweden)

    Jolanta Marciniak

    2014-02-01

    Full Text Available Soluble nitrate reductase from cucumber roots (Cucumis sativus L. was isolated and purified with blue-Sepharose 4B. Specific antibodies against the NR protein were raised by immunization of a goat. Using polyclonal antibodies anti-NR properties of the nitrate reductase from various cucumber tissues were examined. Experiments showed difference in immuno-logical properties of nitrate reductase (NR from cotyledon roots and leaves.

  13. Histochemical Localization of Glutathione Dependent NBT-Reductase in Mouse Skin

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Objective Localization of the glutathione dependent Nitroblue tetrazolium (NBT) reductase in fresh frozen sections of mouse skin and possible dependence of NBT reductase on tissue thiol levels has been investigated. Methods The fresh frozen tissue sections (8m thickness) were prepared and incubated in medium containing NBT, reduced glutathione (GSH) and phosphate buffer. The staining for GSH was performed with mercury orange. Results  The activity of the NBT-reductase in mouse skin has been found to be localized in the areas rich in glutathione and actively proliferating area of the skin. Conclusion The activity of the NBT-reductase seems to be dependent on the glutathione contents.

  14. Relationship of HbA1c variability, absolute changes in HbA1c, and all-cause mortality in type 2 diabetes

    DEFF Research Database (Denmark)

    Skriver, Mette Vinther; Sandbæk, Annelli; Kristensen, Jette Kolding;

    2015-01-01

    was defined as the mean absolute residual around the line connecting index value with closing value. Cox proportional hazard models with restricted cubic splines were used, with all-cause mortality as the outcome. RESULTS: Variability between 0 and 0.5 HbA1c percentage point was not associated with......OBJECTIVE: We assessed the relationship of mortality with glycated hemoglobin (HbA1c) variability and with absolute change in HbA1c. DESIGN: A population-based prospective observational study with a median follow-up time of 6 years. METHODS: Based on a validated algorithm, 11 205 Danish individuals...

  15. Carnitine palmitoyltransferase-1c gain-of-function in the brain results in postnatal microencephaly.

    Science.gov (United States)

    Reamy, Amanda A; Wolfgang, Michael J

    2011-08-01

    Carnitine palmitoyltransferase-1c (CPT1c) is a newly identified and poorly understood brain-specific CPT1 homologue. Here, we have generated a new animal model that allows the conditional expression of CPT1c in a tissue specific and/or temporal manner via Cre-lox mediated recombination. Brain-specific, exogenous expression of CPT1c was achieved by crossing transgenic CPT1c mice to Nestin-Cre mice. The resulting double transgenic mice (CPT1c-TgN) displayed severe growth retardation in the postnatal period with a stunted development at 2 weeks of age. CPT1c-TgN mice had a greater than 2.3-fold reduction in brain weight. Even with this degree of microencephaly, CPT1c-TgN mice were viable and fertile and exhibited normal post-weaning growth. When fed a high fat diet CPT1c-TgN mice were protected from weight gain and the difference in body weight between CPT1c-TgN and control mice was further exaggerated. Conversely, low fat, high carbohydrate feeding partially reversed the body weight defects in CPT1c-TgN mice. Analysis of total brain lipids of low fat fed mice revealed a depletion of total very long chain fatty acids in adult CPT1c-TgN mice which was not evident in high fat fed CPT1c-TgN mice. These data show that CPT1c can elicit profound effects on brain physiology and total fatty acid profiles, which can be modulated by the nutritional composition of the diet. PMID:21592121

  16. The synthetic retinoid AGN 193109 but not retinoic acid elevates CYP1A1 levels in mouse embryos and Hepa-1c1c7 cells.

    Science.gov (United States)

    Soprano, D R; Gambone, C J; Sheikh, S N; Gabriel, J L; Chandraratna, R A; Soprano, K J; Kochhar, D M

    2001-07-15

    The synthetic retinoid AGN 193109 is a potent pan retinoic acid receptor (RAR) antagonist. Treatment of pregnant mice with a single oral 1 mg/kg dose of this antagonist on day 8 postcoitum results in severe craniofacial (median cleft face or frontonasal deficiency) and eye malformations in virtually all exposed fetuses. Using differential display analysis, we have determined that CYP1A1 mRNA levels are elevated in mouse embryos 6 h following treatment with AGN 193109. Similarly, an elevation in CYP1A1 mRNA levels, protein levels, and aryl hydrocarbon hydoxylase activity occurs in Hepa-1c1c7 cells, with the maximal elevation observed when the cells were treated with 10(-5) M AGN 193109 for 4 to 8 h. Elevation in CYP1A1 mRNA levels in mouse embryos and Hepa-1c1c7 cells does not occur upon treatment with the natural retinoid, all-trans-retinoic acid. Finally, elevation in CYP1A1 mRNA levels was not observed when mutant Hepa-1c1c7 cells, which are defective in either the aryl hydrocarbon receptor (AhR) or aryl hydrocarbon receptor nuclear translocator (ARNT), were treated with AGN 193109. This suggests that the AhR/ARNT pathway and not the RAR/RXR pathway is mediating the elevation of CYP1A1 mRNA levels by AGN 193109, at least in the Hepa-1c1c7 cells. This is the first example of a retinoid that displays the abililty to regulate both the RAR/RXR and AhR/ARNT transcriptional regulatory pathways. PMID:11446831

  17. The effect of copper and gallium compounds on ribonucleotide reductase

    Energy Technology Data Exchange (ETDEWEB)

    Narasimhan, J.

    1992-01-01

    The mode of action of copper complexes (CuL and CuKTS) and gallium compounds (gallium nitrate and citrate) in cytotoxicity was studied. The effects of these agents on the enzyme ribonucleotide reductase was investigated by monitoring the tyrosyl free radical present in the active site of the enzyme through electron spin resonance (ESR) spectroscopy. Ribonucleotide reductase, a key enzyme in cellular proliferation, consists of two subunits. M1, a dimer of molecular weight 170,000 contains the substrate and effector binding sites. M2, a dimer of molecular weight 88,000, contains non-heme iron and tyrosyl free radical essential for the activity of the enzyme. In studies using copper complexes, the cellular oxidative chemistry was examined by ESR studies on adduct formation with membranes, and oxidation of thiols. Membrane thiols were oxidized through the reduction of the ESR signal of the thiol adduct and the analysis of sulfhydryl content. Using the radiolabel [sup 59]Fe, the inhibitory action of copper thiosemicarbazones on cellular iron uptake was shown. The inhibitory action of CuL on ribonucleotide reductase was shown by the quenching of the tyrosyl free radical on the M2 subunit. The hypothesis that gallium directly interacts with the M2 subunit of the enzyme and displaces the iron from it was proven. The tyrosyl free radical signal from cell lysates was inhibited by the direct addition of gallium compounds. Gallium content in the cells was measured by a fluorimetric method, to ensure the presence of sufficient amounts of gallium to compete with the iron in the M2 subunit. The enzyme activity, measured by the conversion of [sup 14]C-CDP to the labeled deoxy CDP, was inhibited by the addition of gallium nitrate in a cell free assay system. The immunoprecipitation studies of the [sup 59]Fe labeled M2 protein using the monoclonal antibody directed against this subunit suggested that gallium releases iron from the M2 subunit.

  18. biliverdin. Is there a role for biliverdin reductase?

    Directory of Open Access Journals (Sweden)

    AndreasDaiber

    2012-03-01

    Full Text Available Reactive oxygen species (ROS and signaling events are involved in the pathogenesis of endothelial dysfunction and represent a major contribution to vascular regulation. Molecular signaling is highly dependent on reactive oxygen species. But depending on the amount of ROS production it might have toxic or protective effects. Despite a large number of negative outcomes in large clinical trials (e.g. HOPE, HOPE-TOO, antioxidant molecules and agents are important players to influence the critical balance between production and elimination of RONS. However, chronic systemic antioxidant therapy lacks clinical efficacy, probably by interfering with important physiological redox signaling pathways. Therefore, it may be a much more promising attempt to induce intrinsic antioxidant pathways in order to increase the antioxidants not systemically but at the place of oxidative stress and complications. Among others, heme oxygenase (HO has been shown to be important for attenuating the overall production of ROS in a broad range of disease states through its ability to degrade heme and to produce carbon monoxide (CO, biliverdin/bilirubin, and the release of free iron with subsequent ferritin induction. With the present review we would like to highlight the important antioxidant role of the heme oxygenase system and especially discuss the contribution of the biliverdin, bilirubin and biliverdin reductase to these beneficial effects. The bilierdin reductase was reported to confer an antioxidant redox amplification cycle by which low, physiological bilirubin concentrations confer potent antioxidant protection via recycling of biliverdin from oxidized bilirubin by the biliverdin reductase, linking this sink for oxidants to the NADPH pool. To date the existence and role of this antioxidant redox cycle is still under debate and we present and discuss the pros and cons as well as our own findings on this topic.

  19. Carnitine palmitoyltransferase 1C promotes cell survival and tumor growth under conditions of metabolic stress.

    Science.gov (United States)

    Zaugg, Kathrin; Yao, Yi; Reilly, Patrick T; Kannan, Karuppiah; Kiarash, Reza; Mason, Jacqueline; Huang, Ping; Sawyer, Suzanne K; Fuerth, Benjamin; Faubert, Brandon; Kalliomäki, Tuula; Elia, Andrew; Luo, Xunyi; Nadeem, Vincent; Bungard, David; Yalavarthi, Sireesha; Growney, Joseph D; Wakeham, Andrew; Moolani, Yasmin; Silvester, Jennifer; Ten, Annick You; Bakker, Walbert; Tsuchihara, Katsuya; Berger, Shelley L; Hill, Richard P; Jones, Russell G; Tsao, Ming; Robinson, Murray O; Thompson, Craig B; Pan, Guohua; Mak, Tak W

    2011-05-15

    Tumor cells gain a survival/growth advantage by adapting their metabolism to respond to environmental stress, a process known as metabolic transformation. The best-known aspect of metabolic transformation is the Warburg effect, whereby cancer cells up-regulate glycolysis under aerobic conditions. However, other mechanisms mediating metabolic transformation remain undefined. Here we report that carnitine palmitoyltransferase 1C (CPT1C), a brain-specific metabolic enzyme, may participate in metabolic transformation. CPT1C expression correlates inversely with mammalian target of rapamycin (mTOR) pathway activation, contributes to rapamycin resistance in murine primary tumors, and is frequently up-regulated in human lung tumors. Tumor cells constitutively expressing CPT1C show increased fatty acid (FA) oxidation, ATP production, and resistance to glucose deprivation or hypoxia. Conversely, cancer cells lacking CPT1C produce less ATP and are more sensitive to metabolic stress. CPT1C depletion via siRNA suppresses xenograft tumor growth and metformin responsiveness in vivo. CPT1C can be induced by hypoxia or glucose deprivation and is regulated by AMPKα. Cpt1c-deficient murine embryonic stem (ES) cells show sensitivity to hypoxia and glucose deprivation and altered FA homeostasis. Our results indicate that cells can use a novel mechanism involving CPT1C and FA metabolism to protect against metabolic stress. CPT1C may thus be a new therapeutic target for the treatment of hypoxic tumors. PMID:21576264

  20. Transgenic restorer rice line T1c-19 with stackedcry1C*/bargenes has low weediness potential without selection pressure

    Institute of Scientific and Technical Information of China (English)

    HUANG Yao; LI Ji-kun; QIANG Sheng; DAI Wei-min; SONG Xiao-ling

    2016-01-01

    Stacked (insect and herbicide resistant) transgenic rice T1c-19 withcry1C*/bargenes, its receptor rice Minghui 63 (herein MH63) and a local two-line hybridindica rice Fengliangyou Xiang 1 (used as a control) were compared for agronomic performance under ifeld conditions without the relevant selection pressures. Agronomic traits (plant height, tiler number, and aboveground dry biomass), reproductive ability (polen viability, panicle length, and ifled grain number of main pani-cles, seed set, and grain yield), and weediness characteristics (seed shattering, seed overwintering ability, and volunteer seedling recruitment) were used to assess the potential weediness without selection pressure of stacked transgene rice T1c-19. In wet direct-seeded and transplanted rice ifelds, T1c-19 and its receptor MH63 performed similarly regarding vegetative growth and reproductive ability, but both of them were signiifcantly inferior to the control. T1c-19 did not display weed characteristics; it had weak overwintering ability, low seed shattering and failed to establish volunteers. Exogenous insect and herbicide resistance genes did not confer competitive advantage to transgenic rice T1c-19 grown in the ifeld without the relevant selection pressures.

  1. Ceramide levels regulated by carnitine palmitoyltransferase 1C control dendritic spine maturation and cognition.

    Science.gov (United States)

    Carrasco, Patricia; Sahún, Ignasi; McDonald, Jerome; Ramírez, Sara; Jacas, Jordi; Gratacós, Esther; Sierra, Adriana Y; Serra, Dolors; Herrero, Laura; Acker-Palmer, Amparo; Hegardt, Fausto G; Dierssen, Mara; Casals, Núria

    2012-06-15

    The brain-specific isoform carnitine palmitoyltransferase 1C (CPT1C) has been implicated in the hypothalamic regulation of food intake and energy homeostasis. Nevertheless, its molecular function is not completely understood, and its role in other brain areas is unknown. We demonstrate that CPT1C is expressed in pyramidal neurons of the hippocampus and is located in the endoplasmic reticulum throughout the neuron, even inside dendritic spines. We used molecular, cellular, and behavioral approaches to determine CPT1C function. First, we analyzed the implication of CPT1C in ceramide metabolism. CPT1C overexpression in primary hippocampal cultured neurons increased ceramide levels, whereas in CPT1C-deficient neurons, ceramide levels were diminished. Correspondingly, CPT1C knock-out (KO) mice showed reduced ceramide levels in the hippocampus. At the cellular level, CPT1C deficiency altered dendritic spine morphology by increasing immature filopodia and reducing mature mushroom and stubby spines. Total protrusion density and spine head area in mature spines were unaffected. Treatment of cultured neurons with exogenous ceramide reverted the KO phenotype, as did ectopic overexpression of CPT1C, indicating that CPT1C regulation of spine maturation is mediated by ceramide. To study the repercussions of the KO phenotype on cognition, we performed the hippocampus-dependent Morris water maze test on mice. Results show that CPT1C deficiency strongly impairs spatial learning. All of these results demonstrate that CPT1C regulates the levels of ceramide in the endoplasmic reticulum of hippocampal neurons, and this is a relevant mechanism for the correct maturation of dendritic spines and for proper spatial learning. PMID:22539351

  2. Ceramide Levels Regulated by Carnitine Palmitoyltransferase 1C Control Dendritic Spine Maturation and Cognition*

    Science.gov (United States)

    Carrasco, Patricia; Sahún, Ignasi; McDonald, Jerome; Ramírez, Sara; Jacas, Jordi; Gratacós, Esther; Sierra, Adriana Y.; Serra, Dolors; Herrero, Laura; Acker-Palmer, Amparo; Hegardt, Fausto G.; Dierssen, Mara; Casals, Núria

    2012-01-01

    The brain-specific isoform carnitine palmitoyltransferase 1C (CPT1C) has been implicated in the hypothalamic regulation of food intake and energy homeostasis. Nevertheless, its molecular function is not completely understood, and its role in other brain areas is unknown. We demonstrate that CPT1C is expressed in pyramidal neurons of the hippocampus and is located in the endoplasmic reticulum throughout the neuron, even inside dendritic spines. We used molecular, cellular, and behavioral approaches to determine CPT1C function. First, we analyzed the implication of CPT1C in ceramide metabolism. CPT1C overexpression in primary hippocampal cultured neurons increased ceramide levels, whereas in CPT1C-deficient neurons, ceramide levels were diminished. Correspondingly, CPT1C knock-out (KO) mice showed reduced ceramide levels in the hippocampus. At the cellular level, CPT1C deficiency altered dendritic spine morphology by increasing immature filopodia and reducing mature mushroom and stubby spines. Total protrusion density and spine head area in mature spines were unaffected. Treatment of cultured neurons with exogenous ceramide reverted the KO phenotype, as did ectopic overexpression of CPT1C, indicating that CPT1C regulation of spine maturation is mediated by ceramide. To study the repercussions of the KO phenotype on cognition, we performed the hippocampus-dependent Morris water maze test on mice. Results show that CPT1C deficiency strongly impairs spatial learning. All of these results demonstrate that CPT1C regulates the levels of ceramide in the endoplasmic reticulum of hippocampal neurons, and this is a relevant mechanism for the correct maturation of dendritic spines and for proper spatial learning. PMID:22539351

  3. Autoimmunity in Membranous Nephropathy Targets Aldose Reductase and SOD2

    OpenAIRE

    Prunotto, Marco; Carnevali, Maria Luisa; Candiano, Giovanni; Murtas, Corrado; Bruschi, Maurizio; Corradini, Emilia; Trivelli, Antonella; Magnasco, Alberto; Petretto, Andrea; Santucci, Laura; Mattei, Silvia; Gatti, Rita; Scolari, Francesco; Kador, Peter; Allegri, Landino

    2010-01-01

    Glomerular targets of autoimmunity in human membranous nephropathy are poorly understood. Here, we used a combined proteomic approach to identify specific antibodies against podocyte proteins in both serum and glomeruli of patients with membranous nephropathy (MN). We detected specific anti–aldose reductase (AR) and anti–manganese superoxide dismutase (SOD2) IgG4 in sera of patients with MN. We also eluted high titers of anti-AR and anti-SOD2 IgG4 from microdissected glomeruli of three biopsi...

  4. Applications of Carboxylic Acid Reductases in Oleaginous Microbes

    Energy Technology Data Exchange (ETDEWEB)

    Resch, Michael G.; Linger, Jeffrey; McGeehan, John; Tyo, Keith; Beckham, Gregg

    2016-04-24

    Carboxylic acid reductases (CARs) are recently emerging reductive enzymes for the direct production of aldehydes from biologically-produced carboxylic acids. Recent work has demonstrated that these powerful enzymes are able to reduce a very broad range of volatile- to long-chain fatty acids as well as aromatic acids. Here, we express four CAR enzymes from different fungal origins to test their activity against fatty acids commonly produced in oleaginous microbes. These in vitro results will inform metabolic engineering strategies to conduct mild biological reduction of carboxylic acids in situ, which is conventionally done via hydrotreating catalysis at high temperatures and hydrogen pressures.

  5. Mediated electrochemistry of dimethyl sulfoxide reductase promoted by carbon nanotubes

    Institute of Scientific and Technical Information of China (English)

    BERNHARDT; Paul; V

    2010-01-01

    Mediated electrochemistry of dimethyl sulfoxide reductase from Rhodobacter capsulatus (DMSOR) which is immobilized on a bare glassy carbon (GC) electrode and a carbon nanotube (CNT)-modified GC electrode was studied using the Co complex (trans-6,13-dimethyl-1,4,8,11-tetraazacyclotetradecane-6,13-diamine)cobalt(III) ([Co(trans-diammac)] +) as a mediator.The cyclic voltammograms of different electrodes were carried out at different substrate (DMSO) concentrations.The results demonstrated that the catalytic current was increased by employing CNT as a promoter.

  6. Vibrio harveyi Nitroreductase Is Also a Chromate Reductase

    OpenAIRE

    Kwak, Young Hak; Lee, Dong Seok; Kim, Han Bok

    2003-01-01

    The chromate reductase purified from Pseudomonas ambigua was found to be homologous with several nitroreductases. Escherichia coli DH5α and Vibrio harveyi KCTC 2720 nitroreductases were chosen for the present study, and their chromate-reducing activities were determined. A fusion between glutathione S-transferase (GST) and E. coli DH5α NfsA (GST-EcNfsA), a fusion between GST and E. coli DH5α NfsB (GST-EcNfsB), and a fusion between GST and V. harveyi KCTC 2720 NfsA (GST-VhNfsA) were prepared f...

  7. Pulse radiolysis studies on superoxide reductase from Treponema pallidum.

    OpenAIRE

    Nivière, V; Lombard, M.; Fontecave, M.; Houée-Levin, C

    2001-01-01

    Superoxide reductases (SORs) are small metalloenzymes, which catalyze reduction of O2*- to H2O2. The reaction of the enzyme from Treponema pallidum with superoxide was studied by pulse radiolysis methods. The first step is an extremely fast bi-molecular reaction of the ferrous center with O2, with a rate constant of 6 x 10 (8) M(-1) s(-1). A first intermediate is formed which is converted to a second one with a slower rate constant of 4800 s(-1). This latter value is 10 times higher than the ...

  8. Methylenetetrahydrofolate reductase (MTHFR) deficiency presenting as a rash.

    LENUS (Irish Health Repository)

    Crushell, Ellen

    2012-09-01

    We report on the case of a 2-year-old girl recently diagnosed with Methylenetetrahydrofolate reductase (MTHFR) deficiency who originally presented in the neonatal period with a distinctive rash. At 11 weeks of age she developed seizures, she had acquired microcephaly and developmental delay. The rash deteriorated dramatically following commencement of phenobarbitone; both rash and seizures abated following empiric introduction of pyridoxine and folinic acid as treatment of possible vitamin responsive seizures. We postulate that phenobarbitone in combination with MTHFR deficiency may have caused her rash to deteriorate and subsequent folinic acid was helpful in treating the rash and preventing further acute neurological decline as commonly associated with this condition.

  9. Synthesis of New Pyrazolo[5,1-c]triazine, Triazolo[5,1-c]triazine, Triazino[4,3-b]indazole and Benzimidazo[2,1-c]triazine Derivatives Incorporating Chromen-2-one Moiety

    International Nuclear Information System (INIS)

    The versatile, hitherto unreported 3-(4-(2-phenyldiazenyl)-2-oxo-2H-chromen-3-yl)-3-oxopropanenitrile 3 was prepared by two convenient routes: either by the reaction of ethyl 4-(2-phenyldiazenyl)-2-oxo-2H-chromen-3-carboxylate 2 with acetonitrile in the presence of sodium hydride or by treatment of 4-(2-phenyldiazenyl)-3-(2-bromoacetyl)-2H-chromen-2-one 5 with potassium cyanide. Reaction of 3 with heterocyclic diazonium salts 6, 7, 14 and 17 furnished the corresponding hydrazones 8, 9, 15 and 18. The latter hydrazones underwent intramolecular cyclization into the corresponding pyrazolo[5,1-c]-1,2,4-triazine 10, 1,2,4-triazolo[5,1-c]-1,2,4-triazine 11, 1,2,4-triazino[4,3-b]indazole 16 and imidazo[2,1-c]-1,2,4-triazine 19 derivatives, respectively upon refluxing in pyridine

  10. Synthesis of New Pyrazolo[5,1-c]triazine, Triazolo[5,1-c]triazine, Triazino[4,3-b]indazole and Benzimidazo[2,1-c]triazine Derivatives Incorporating Chromen-2-one Moiety

    Energy Technology Data Exchange (ETDEWEB)

    Khalil, Mohamed A.; Sayed, Samia M.; Raslan, Mohamed A. [Aswan Univ., Aswan (Egypt)

    2013-10-15

    The versatile, hitherto unreported 3-(4-(2-phenyldiazenyl)-2-oxo-2H-chromen-3-yl)-3-oxopropanenitrile 3 was prepared by two convenient routes: either by the reaction of ethyl 4-(2-phenyldiazenyl)-2-oxo-2H-chromen-3-carboxylate 2 with acetonitrile in the presence of sodium hydride or by treatment of 4-(2-phenyldiazenyl)-3-(2-bromoacetyl)-2H-chromen-2-one 5 with potassium cyanide. Reaction of 3 with heterocyclic diazonium salts 6, 7, 14 and 17 furnished the corresponding hydrazones 8, 9, 15 and 18. The latter hydrazones underwent intramolecular cyclization into the corresponding pyrazolo[5,1-c]-1,2,4-triazine 10, 1,2,4-triazolo[5,1-c]-1,2,4-triazine 11, 1,2,4-triazino[4,3-b]indazole 16 and imidazo[2,1-c]-1,2,4-triazine 19 derivatives, respectively upon refluxing in pyridine.

  11. A phase I trial of PR-104, a pre-prodrug of the bioreductive prodrug PR-104A, given weekly to solid tumour patients

    International Nuclear Information System (INIS)

    The phosphate ester PR-104 is rapidly converted in vivo to the alcohol PR-104A, a nitrogen mustard prodrug that is metabolised to hydroxylamine (PR-104H) and amine (PR-104M) DNA crosslinking agents by one-electron reductases in hypoxic cells and by aldo-keto reductase 1C3 independently of oxygen. In a previous phase I study using a q 3 week schedule of PR-104, the maximum tolerated dose (MTD) was 1100 mg/m2 and fatigue, neutropenic fever and infection were dose-limiting. The primary objective of the current study was to determine the dose-limiting toxicity (DLT) and MTD of weekly PR-104. Patients with advanced solid tumours received PR-104 as a 1-hour intravenous infusion on days 1, 8 and 15 every 28 days with assessment of pharmacokinetics on cycle 1 day 1. Twenty-six patients (pts) were enrolled (16 male/10 female; median age 58 yrs, range 30 to 70 yrs) who had received a median of two prior chemotherapy regimens (range, 0 to 3) for melanoma (8 pts), colorectal or anal cancer (3 pts), NSCLC (3 pts), sarcoma (3 pts), glioblastoma (2 pts), salivary gland tumours (2 pts) or other solid tumours (5 pts). PR-104 was administered at 135 mg/m2 (3 pts), 270 mg/m2 (6 pts), 540 mg/m2 (6 pts), 675 mg/m2 (7 pts) and 900 mg/m2 (4 pts) for a median of two treatment cycles (range, 1 to 7 cycles) and five infusions (range, 1 to 18) per patient. Dose-limiting toxicities (DLTs) during cycle one included grade four thrombocytopenia at 540 mg/m2 (1 of 6 pts) and grade four thrombocytopenia and neutropenia at 900 mg/m2 (2 of 4 pts). At an intermediate dose of 675 mg/m2, there were no DLTs among a total of seven patients given 12 treatment cycles but all experienced moderate to severe (grade 2 to 4) haematological toxicity. Thrombocytopenia was delayed in its onset and nadir, and its recovery was protracted and incomplete in many patients. There were no complete or partial tumour responses. PR-104-induced thrombocytopenia and neutropenia correlated with plasma AUC of PR-104, PR-104A

  12. Multiple abiotic stress tolerance in Vigna mungo is altered by overexpression of ALDRXV4 gene via reactive carbonyl detoxification.

    Science.gov (United States)

    Singh, Preeti; Kumar, Deepak; Sarin, Neera Bhalla

    2016-06-01

    Vigna mungo (blackgram) is an important leguminous pulse crop, which is grown for its protein rich edible seeds. Drought and salinity are the major abiotic stresses which adversely affect the growth and productivity of crop plants including blackgram. The ALDRXV4 belongs to the aldo-keto reductase superfamily of enzymes that catalyze the reduction of carbonyl metabolites in the cells and plays an important role in the osmoprotection and detoxification of the reactive carbonyl species. In the present study, we developed transgenic plants of V. mungo using Agrobacterium mediated transformation. The transgene integration was confirmed by Southern blot analysis whereas the expression was confirmed by RT-PCR, Western blot and enzyme activity. The T1 generation transgenic plants displayed improved tolerance to various environmental stresses, including drought, salt, methyl viologen and H2O2 induced oxidative stress. The increased aldose reductase activity, higher sorbitol content and less accumulation of the toxic metabolite, methylglyoxal in the transgenic lines under non-stress and stress (drought and salinity) conditions resulted in increased protection through maintenance of better photosynthetic efficiency, higher relative water content and less photooxidative damage. The accumulation of reactive oxygen species was remarkably decreased in the transgenic lines as compared with the wild type plants. This study of engineering multiple stress tolerance in blackgram, is the first report to date and this strategy for trait improvement is proposed to provide a novel germplasm for blackgram production on marginal lands. PMID:26956699

  13. Characterization of Emodin as a Therapeutic Agent for Diabetic Cataract.

    Science.gov (United States)

    Chang, Kun-Che; Li, Linfeng; Sanborn, Theresa M; Shieh, Biehuoy; Lenhart, Patricia; Ammar, David; LaBarbera, Daniel V; Petrash, J Mark

    2016-05-27

    Aldose reductase (AR) in the lens plays an important role in the pathogenesis of diabetic cataract (DC) by contributing to osmotic and oxidative stress associated with accelerated glucose metabolism through the polyol pathway. Therefore, inhibition of AR in the lens may hold the key to prevent DC formation. Emodin, a bioactive compound isolated from plants, has been implicated as a therapy for diabetes. However, its inhibitory activity against AR remains unclear. Our results showed that emodin has good selectively inhibitory activity against AR (IC50 = 2.69 ± 0.90 μM) but not other aldo-keto reductases and is stable at 37 °C for at least 7 days. Enzyme kinetic studies demonstrated an uncompetitive inhibition against AR with a corresponding inhibition constant of 2.113 ± 0.095 μM. In in vivo studies, oral administration of emodin reduced the incidence and severity of morphological markers of cataract in lenses of AR transgenic mice. Computational modeling of the AR-NADP(+)-emodin ternary complex indicated that the 3-hydroxy group of emodin plays an essential role by interacting with Ser302 through hydrogen bonding in the specificity pocket of AR. All the findings above provide encouraging evidence for emodin as a potential therapeutic agent to prevent cataract in diabetic patients. PMID:27140653

  14. The Glucose Measurement Industry and Hemoglobin A1c: An Opportunity for Creative Destruction.

    Science.gov (United States)

    Cembrowski, George

    2016-01-01

    The MyStar Extra self-monitoring blood glucose (SMBG) system provides moving estimates of the patient's hemoglobin A1c (HbA1c). There is a treasure trove of highly accurate glucose data available from highly accurate SMBG, CGM and FGM along with highly accurate HPLC HbA1c. If Nathan's criteria are used to select subjects whose glucoses can be correlated to the HbA1c, then algorithms can be developed for robustly transforming glucose into HbA1c. These algorithms can then be implemented in any SMBG or with the CGM and FGM software. This calculated HbA1c would even be accurate with Nathan's excluded population thus reducing the use of fructosamine and glycated protein. Finally, the developer of these new algorithms is advised to use a specific approach for testing her algorithm. PMID:26481643

  15. Evaluation of 5α-reductase inhibitory activity of certain herbs useful as antiandrogens.

    Science.gov (United States)

    Nahata, A; Dixit, V K

    2014-08-01

    This study demonstrates 5α-reductase inhibitory activity of certain herbs useful in the management of androgenic disorders. Ganoderma lucidum (Curtis) P. Karst (GL), Urtica dioica Linn. (UD), Caesalpinia bonducella Fleming. (CB), Tribulus terrestris Linn. (TT), Pedalium murex Linn. (PM), Sphaeranthus indicus Linn. (SI), Cuscuta reflexa Roxb. (CR), Citrullus colocynthis Schrad. (CC), Benincasa hispida Cogn. (BH), Phyllanthus niruri Linn. (PN) and Echinops echinatus Linn. (EE) were included in the study. Petroleum ether, ethanol and aqueous extracts of these herbs were tested for their 5α-reductase inhibitory activity against the standard 5α-reductase inhibitor, finasteride. A biochemical method to determine the activity of 5α-reductase was used to evaluate the inhibition of different extracts to the enzyme. The optical density (OD) value of each sample was measured continuously with ultraviolet spectrophotometer for the reason that the substrate NADPH has a specific absorbance at 340 nm. As the enzyme 5α-reductase uses NADPH as a substrate, so in the presence of 5α-reductase inhibitor, the NADPH concentration will increase with the function of time. This method thus implicates the activity of 5α-reductase. The method proved to be extremely useful to screen the herbs for their 5α-reductase inhibitory potential. GL, UD, BH, SI and CR came out to be promising candidates for further exploring their antiandrogenic properties. PMID:23710567

  16. Determination of the specific activities of methionine sulfoxide reductase A and B by capillary electrophoresis

    Science.gov (United States)

    A capillary electrophoresis (CE) method for the determination of methionine sulfoxide reductase A and methionine sulfoxide reductase B activities in mouse liver is described. The method is based on detection of the 4-(dimethylamino)azobenzene-4’-sulfonyl derivative of L-methionine (dabsyl Met), the ...

  17. Sucrose mimics the light induction of Arabidopsis nitrate reductase gene transcription

    DEFF Research Database (Denmark)

    Cheng, Chi-Lien; Acedo, Gregoria N; Kristensen, Michael;

    1992-01-01

    Nitrate reductase, the first enzyme in nitrate assimilation, is located at the crossroad of two energy-consuming pathways: nitrate assimilation and carbon fixation. Light, which regulates the expression of many higher-plant carbon fixation genes, also regulates nitrate reductase gene expression. ...

  18. RASSF1C modulates the expression of a stem cell renewal gene, PIWIL1

    Directory of Open Access Journals (Sweden)

    Reeves Mark E

    2012-05-01

    Full Text Available Abstract Background RASSF1A and RASSF1C are two major isoforms encoded by the Ras association domain family 1 (RASSF1 gene through alternative promoter selection and mRNA splicing. RASSF1A is a well established tumor suppressor gene. Unlike RASSF1A, RASSF1C appears to have growth promoting actions in lung cancer. In this article, we report on the identification of novel RASSF1C target genes in non small cell lung cancer (NSCLC. Methods Over-expression and siRNA techniques were used to alter RASSF1C expression in human lung cancer cells, and Affymetrix-microarray study was conducted using NCI-H1299 cells over-expressing RASSF1C to identify RASSF1C target genes. Results The microarray study intriguingly shows that RASSF1C modulates the expression of a number of genes that are involved in cancer development, cell growth and proliferation, cell death, and cell cycle. We have validated the expression of some target genes using qRT-PCR. We demonstrate that RASSF1C over-expression increases, and silencing of RASSF1C decreases, the expression of PIWIL1 gene in NSCLC cells using qRT-PCR, immunostaining, and Western blot analysis. We also show that RASSF1C over-expression induces phosphorylation of ERK1/2 in lung cancer cells, and inhibition of the MEK-ERK1/2 pathway suppresses the expression of PIWIL1 gene expression, suggesting that RASSF1C may exert its activities on some target genes such as PIWIL1 through the activation of the MEK-ERK1/2 pathway. Also, PIWIL1 expression is elevated in lung cancer cell lines compared to normal lung epithelial cells. Conclusions Taken together, our findings provide significant data to propose a model for investigating the role of RASSF1C/PIWIL1 proteins in initiation and progression of lung cancer.

  19. Hemoglobin A1c May Be an Inadequate Diagnostic Tool for Diabetes Mellitus in Anemic Subjects

    Directory of Open Access Journals (Sweden)

    Jung Il Son

    2013-10-01

    Full Text Available BackgroundRecently, a hemoglobin A1c (HbA1c level of 6.5% has been determined to be a criterion for diabetes mellitus (DM, and it is a widely used marker for the diagnosis of DM. However, HbA1c may be influenced by a number of factors. Anemia is one of the most prevalent diseases with an influence on HbA1c; however, its effect on HbA1c varies based on the variable pathophysiology of anemia. The aim of this study was to determine the effect of anemia on HbA1c levels.MethodsAnemic subjects (n=112 and age- and sex-matched controls (n=217 who were drug naive and suspected of having DM were enrolled. The subjects underwent an oral glucose tolerance test and HbA1c simultaneously. We compared mean HbA1c and its sensitivity and specificity for diagnosing DM between each subgroup.ResultsClinical characteristics were found to be similar between each subgroup. Also, when glucose levels were within the normal range, the difference in mean HbA1c was not significant (P=0.580. However, when plasma glucose levels were above the diagnostic cutoff for prediabetes and DM, the mean HbA1c of the anemic subgroup was modestly higher than in the nonanemic group. The specificity of HbA1c for diagnosis of DM was significantly lower in the anemic subgroup (P<0.05.ConclusionThese results suggest that the diagnostic significance of HbA1c might be limited in anemic patients.

  20. Functions of Flavin Reductase and Quinone Reductase in 2,4,6-Trichlorophenol Degradation by Cupriavidus necator JMP134▿

    OpenAIRE

    Belchik, Sara Mae; Xun, Luying

    2007-01-01

    The tcpRXABCYD operon of Cupriavidus necator JMP134 is involved in the degradation of 2,4,6-trichlorophenol (2,4,6-TCP), a toxic pollutant. TcpA is a reduced flavin adenine dinucleotide (FADH2)-dependent monooxygenase that converts 2,4,6-TCP to 6-chlorohydroxyquinone. It has been implied via genetic analysis that TcpX acts as an FAD reductase to supply TcpA with FADH2, whereas the function of TcpB in 2,4,6-TCP degradation is still unclear. In order to provide direct biochemical evidence for t...

  1. MEK2 regulates ribonucleotide reductase activity through functional interaction with ribonucleotide reductase small subunit p53R2

    OpenAIRE

    Piao, Chunmei; Youn, Cha-Kyung; Jin, Min; Yoon, Sang Pil; Chang, In-Youb; Lee, Jung Hee; You, Ho Jin

    2012-01-01

    The p53R2 protein, a newly identified member of the ribonucleotide reductase family that provides nucleotides for DNA damage repair, is directly regulated by p53. We show that p53R2 is also regulated by a MEK2 (ERK kinase 2/MAP kinase kinase 2)-dependent pathway. Increased MEK1/2 phosphorylation by serum stimulation coincided with an increase in the RNR activity in U2OS and H1299 cells. The inhibition of MEK2 activity, either by treatment with a MEK inhibitor or by transfection with MEK2 siRN...

  2. The effect of ionic and non-ionic surfactants on the growth, nitrate reductase and nitrite reductase activities of Spirodela polyrrhiza (L. Schleiden

    Directory of Open Access Journals (Sweden)

    Józef Buczek

    2014-02-01

    Full Text Available Inclusion into the medium of 5 mg•dm-3 of non-ionic (ENF or ionic (DBST surfactant caused 50-60% inhibition of nitrite reductase MR activity in S. polyrrhiza. At the same time, increased accumulation of NO2- in the plant tissues and lowering of the total and soluble protein contents were found. DBST also lowered the nitrate reductase (NR activity and the dry mass of the plants.

  3. Co-Expression of Monodehydroascorbate Reductase and Dehydroascorbate Reductase from Brassica rapa Effectively Confers Tolerance to Freezing-Induced Oxidative Stress

    OpenAIRE

    Shin, Sun-Young; Kim, Myung-Hee; Kim, Yul-Ho; Park, Hyang-Mi; Yoon, Ho-Sung

    2013-01-01

    Plants are exposed to various environmental stresses and have therefore developed antioxidant enzymes and molecules to protect their cellular components against toxicity derived from reactive oxygen species (ROS). Ascorbate is a very important antioxidant molecule in plants, and monodehydroascorbate reductase (MDHAR; EC 1.6.5.4) and dehydroascorbate reductase (DHAR; EC 1.8.5.1) are essential to regeneration of ascorbate for maintenance of ROS scavenging ability. The MDHAR and DHAR genes from ...

  4. The brain-specific carnitine palmitoyltransferase-1c regulates energy homeostasis

    Science.gov (United States)

    Wolfgang, Michael J.; Kurama, Takeshi; Dai, Yun; Suwa, Akira; Asaumi, Makoto; Matsumoto, Shun-ichiro; Cha, Seung Hun; Shimokawa, Teruhiko; Lane, M. Daniel

    2006-01-01

    Fatty acid synthesis in the central nervous system is implicated in the control of food intake and energy expenditure. An intermediate in this pathway, malonyl-CoA, mediates these effects. Malonyl-CoA is an established inhibitor of carnitine palmitoyltransferase-1 (CPT1), an outer mitochondrial membrane enzyme that controls entry of fatty acids into mitochondria and, thereby, fatty acid oxidation. CPT1c, a brain-specific enzyme with high sequence similarity to CPT1a (liver) and CPT1b (muscle) was recently discovered. All three CPTs bind malonyl-CoA, and CPT1a and CPT1b catalyze acyl transfer from various fatty acyl-CoAs to carnitine, whereas CPT1c does not. These findings suggest that CPT1c has a unique function or activation mechanism. We produced a targeted mouse knockout (KO) of CPT1c to investigate its role in energy homeostasis. CPT1c KO mice have lower body weight and food intake, which is consistent with a role as an energy-sensing malonyl-CoA target. Paradoxically, CPT1c KO mice fed a high-fat diet are more susceptible to obesity, suggesting that CPT1c is protective against the effects of fat feeding. CPT1c KO mice also exhibit decreased rates of fatty acid oxidation, which may contribute to their increased susceptibility to diet-induced obesity. These findings indicate that CPT1c is necessary for the regulation of energy homeostasis. PMID:16651524

  5. HbA1c in Nondiabetic Dutch Infants Aged 8–12 Months

    OpenAIRE

    Jansen, Hanneke; Huiting, Haika G.; Scholtens, Salome; Sauer, Pieter J.J.; Stolk, Ronald P

    2011-01-01

    OBJECTIVE An international committee of experts recommended using HbA1c for diagnostic testing for diabetes. Little is known about normal values of HbA1c in infants. The aim of this study is to describe the distribution of HbA1c in 8- to 12-month-old nondiabetic infants. RESEARCH DESIGN AND METHODS HbA1c was measured in 86 infants participating in the Groningen Expert Center for Kids with Obesity (GECKO)-Drenthe birth cohort study. Anthropometric measurements were performed at Well Baby Clini...

  6. Methods, units and quality requirements for the analysis of haemoglobin A1c in diabetes mellitus

    Science.gov (United States)

    Penttilä, Ilkka; Penttilä, Karri; Holm, Päivi; Laitinen, Harri; Ranta, Päivi; Törrönen, Jukka; Rauramaa, Rainer

    2016-01-01

    The formation of glycohemoglobin, especially the hemoglobin A1c (HbA1c) fraction, occurs when glucose becomes coupled with the amino acid valine in the β-chain of Hb; this reaction is dependent on the plasma concentration of glucose. Since the early 1970s it has been known that diabetics display higher values OF HbA1C because they have elevated blood glucose concentrations. Thus HbA1c has acquired a very important role in the treatment and diagnosis of diabetes mellitus. After the introduction of the first quantitative measurement OF HbA1C, numerous methods for glycohemoglobin have been introduced with different assay principles: From a simple mini-column technique to the very accurate automated high-pressure chromatography and lastly to many automated immunochemical or enzymatic assays. In early days, the results of the quality control reports for HbA1c varied extensively between laboratories, therefore in United States and Canada working groups (WG) of the Diabetes Controls and Complications Trial (DCCT) were set up to standardize the HbA1c assays against the DCCT/National Glycohemoglobin Standardization Program reference method based on liquid chromatography. In the 1990s, the International Federation of Clinical Chemistry and Laboratory Medicine (IFCC) appointed a new WG to plan a reference preparation and method for the HBA1c measurement. When the reference procedures were established, in 2004 IFCC recommended that all manufacturers for equipment used in HbA1c assays should calibrate their methods to their proposals. This led to an improvement in the coefficient of variation (CV%) associated with the assay. In this review, we describe the glycation of Hb, methods, standardization of the HbA1c assays, analytical problems, problems with the units in which HbA1c values are expressed, reference values, quality control aspects, target requirements for HbA1c, and the relationship of the plasma glucose values to HbA1c concentrations. We also note that the acceptance

  7. Recent Progress in Electrochemical HbA1c Sensors: A Review

    Directory of Open Access Journals (Sweden)

    Baozhen Wang

    2015-03-01

    Full Text Available This article reviews recent progress made in the development of electrochemical glycated hemoglobin (HbA1c sensors for the diagnosis and management of diabetes mellitus. Electrochemical HbA1c sensors are divided into two categories based on the detection protocol of the sensors. The first type of sensor directly detects HbA1c by binding HbA1c on the surface of an electrode through bio-affinity of antibody and boronic acids, followed by an appropriate mode of signal transduction. In the second type of sensor, HbA1c is indirectly determined by detecting a digestion product of HbA1c, fructosyl valine (FV. Thus, the former sensors rely on the selective binding of HbA1c to the surface of the electrodes followed by electrochemical signaling in amperometric, voltammetric, impedometric, or potentiometric mode. Redox active markers, such as ferrocene derivatives and ferricyanide/ferrocyanide ions, are often used for electrochemical signaling. For the latter sensors, HbA1c must be digested in advance by proteolytic enzymes to produce the FV fragment. FV is electrochemically detected through catalytic oxidation by fructosyl amine oxidase or by selective binding to imprinted polymers. The performance characteristics of HbA1c sensors are discussed in relation to their use in the diagnosis and control of diabetic mellitus.

  8. Methods, units and quality requirements for the analysis of haemoglobin A1c in diabetes mellitus.

    Science.gov (United States)

    Penttilä, Ilkka; Penttilä, Karri; Holm, Päivi; Laitinen, Harri; Ranta, Päivi; Törrönen, Jukka; Rauramaa, Rainer

    2016-06-26

    The formation of glycohemoglobin, especially the hemoglobin A1c (HbA1c) fraction, occurs when glucose becomes coupled with the amino acid valine in the β-chain of Hb; this reaction is dependent on the plasma concentration of glucose. Since the early 1970s it has been known that diabetics display higher values OF HbA1C because they have elevated blood glucose concentrations. Thus HbA1c has acquired a very important role in the treatment and diagnosis of diabetes mellitus. After the introduction of the first quantitative measurement OF HbA1C, numerous methods for glycohemoglobin have been introduced with different assay principles: From a simple mini-column technique to the very accurate automated high-pressure chromatography and lastly to many automated immunochemical or enzymatic assays. In early days, the results of the quality control reports for HbA1c varied extensively between laboratories, therefore in United States and Canada working groups (WG) of the Diabetes Controls and Complications Trial (DCCT) were set up to standardize the HbA1c assays against the DCCT/National Glycohemoglobin Standardization Program reference method based on liquid chromatography. In the 1990s, the International Federation of Clinical Chemistry and Laboratory Medicine (IFCC) appointed a new WG to plan a reference preparation and method for the HBA1c measurement. When the reference procedures were established, in 2004 IFCC recommended that all manufacturers for equipment used in HbA1c assays should calibrate their methods to their proposals. This led to an improvement in the coefficient of variation (CV%) associated with the assay. In this review, we describe the glycation of Hb, methods, standardization of the HbA1c assays, analytical problems, problems with the units in which HbA1c values are expressed, reference values, quality control aspects, target requirements for HbA1c, and the relationship of the plasma glucose values to HbA1c concentrations. We also note that the acceptance

  9. Improvements in or relating to antibodies active against human hemoglobin Asub(1C)

    International Nuclear Information System (INIS)

    A method is described for preparing an antibody against human hemoglobin Asub(1c) which is substantially free of cross-reactivity against the human hemoglobins A0, Asub(1a) and Asub(1b). The antibodies are collected from cats, goats or sheep following injections of purified hemoglobin Asub(1c) antigen since these animals do not naturally produce hemoglobin Asub(1c). A radioimmunoassay method is also described whereby these antibodies are used to determine the quantity of hemoglobin Asub(1c) in blood samples. This is a useful technique in the diagnosis of diabetes mellitus. (U.K.)

  10. Optimisation of nitrate reductase enzyme activity to synthesise silver nanoparticles.

    Science.gov (United States)

    Khodashenas, Bahareh; Ghorbani, Hamid Reza

    2016-06-01

    Today, the synthesis of silver nanoparticles (Ag NPs) is very common since it has many applications in different areas. The synthesis of these nanoparticles is done by means of physical, chemical, or biological methods. However, due to its inexpensive and environmentally friendly features, the biological method is more preferable. In the present study, using nitrate reductase enzyme available in the Escherichia coli (E. coli) bacterium, the biosynthesis of Ag NPs was investigated. In addition, the activity of the nitrate reductase enzyme was optimised by changing its cultural conditions, and the effects of silver nitrate (AgNO3) concentration and enzyme amount on nanoparticles synthesis were studied. Finally, the produced nanoparticles were studied using ultraviolet -visible (UV-Vis) spectrophotometer, dynamic light scattering technique, and transmission electron microscopy. UV-Visible spectrophotometric study showed the characteristic peak for Ag NPs at wavelength 405-420 nm for 1 mM metal precursor solution (AgNO3) with 1, 5, 10, and 20 cc supernatant and 435 nm for 0.01M AgNO3 with 20 cc supernatant. In this study, it was found that there is a direct relationship between the AgNO3 concentration and the size of produced Ag NPs. PMID:27256897

  11. Azotobacter vinelandii NADPH:ferredoxin reductase cloning, sequencing, and overexpression.

    Science.gov (United States)

    Isas, J M; Yannone, S M; Burgess, B K

    1995-09-01

    Azotobacter vinelandii ferredoxin I (AvFdI) controls the expression of another protein that was originally designated Protein X. Recently we reported that Protein X is a NADPH-specific flavoprotein that binds specifically to FdI (Isas, J.M., and Burgess, B.K. (1994) J. Biol. Chem. 269, 19404-19409). The gene encoding this protein has now been cloned and sequenced. Protein X is 33% identical and has an overall 53% similarity with the fpr gene product from Escherichia coli that encodes NADPH:ferredoxin reductase. On the basis of this similarity and the similarity of the physical properties of the two proteins, we now designate Protein X as A. vinelandii NADPH:ferredoxin reductase and its gene as the fpr gene. The protein has been overexpressed in its native background in A. vinelandii by using the broad host range multicopy plasmid, pKT230. In addition to being regulated by FdI, the fpr gene product is overexpressed when A. vinelandii is grown under N2-fixing conditions even though the fpr gene is not preceded by a nif specific promoter. By analogy to what is known about fpr expression in E. coli, we propose that FdI may exert its regulatory effect on fpr by interacting with the SoxRS regulon. PMID:7673160

  12. Nitrate metabolism in tobacco leaves overexpressing Arabidopsis nitrite reductase.

    Science.gov (United States)

    Davenport, Susie; Le Lay, Pascaline; Sanchez-Tamburrrino, Juan Pablo

    2015-12-01

    Primary nitrogen assimilation in plants includes the reduction of nitrite to ammonium in the chloroplasts by the enzyme nitrite reductase (NiR EC:1.7.7.1) or in the plastids of non-photosynthetic organs. Here we report on a study overexpressing the Arabidopsis thaliana NiR (AtNiR) gene in tobacco plants under the control of a constitutive promoter (CERV - Carnation Etched Ring Virus). The aim was to overexpress AtNiR in an attempt to alter the level of residual nitrite in the leaf which can act as precursor to the formation of nitrosamines. The impact of increasing the activity of AtNiR produced an increase in leaf protein and a stay-green phenotype in the primary transformed AtNiR population. Investigation of the T1 homozygous population demonstrated elevated nitrate reductase (NR) activity, reductions in leaf nitrite and nitrate and the amino acids proline, glutamine and glutamate. Chlorophyl content of the transgenic lines was increased, as evidenced by the stay-green phenotype. This reveals the importance of NiR in primary nitrogen assimilation and how modification of this key enzyme affects both the nitrogen and carbon metabolism of tobacco plants. PMID:26447683

  13. Pinpointing a Mechanistic Switch Between Ketoreduction and "Ene" Reduction in Short-Chain Dehydrogenases/Reductases.

    Science.gov (United States)

    Lygidakis, Antonios; Karuppiah, Vijaykumar; Hoeven, Robin; Ní Cheallaigh, Aisling; Leys, David; Gardiner, John M; Toogood, Helen S; Scrutton, Nigel S

    2016-08-01

    Three enzymes of the Mentha essential oil biosynthetic pathway are highly homologous, namely the ketoreductases (-)-menthone:(-)-menthol reductase and (-)-menthone:(+)-neomenthol reductase, and the "ene" reductase isopiperitenone reductase. We identified a rare catalytic residue substitution in the last two, and performed comparative crystal structure analyses and residue-swapping mutagenesis to investigate whether this determines the reaction outcome. The result was a complete loss of native activity and a switch between ene reduction and ketoreduction. This suggests the importance of a catalytic glutamate vs. tyrosine residue in determining the outcome of the reduction of α,β-unsaturated alkenes, due to the substrate occupying different binding conformations, and possibly also to the relative acidities of the two residues. This simple switch in mechanism by a single amino acid substitution could potentially generate a large number of de novo ene reductases. PMID:27411040

  14. Trypanothione Reductase: A Viable Chemotherapeutic Target for Antitrypanosomal and Antileishmanial Drug Design

    Directory of Open Access Journals (Sweden)

    M. Omar F. Khan

    2007-01-01

    Full Text Available Trypanosomiasis and leishmaniasis are two debilitating disease groups caused by parasites of Trypanosoma and Leishmania spp. and affecting millions of people worldwide. A brief outline of the potential targets for rational drug design against these diseases are presented, with an emphasis placed on the enzyme trypanothione reductase. Trypanothione reductase was identified as unique to parasites and proposed to be an effective target against trypanosomiasis and leishmaniasis. The biochemical basis of selecting this enzyme as a target, with reference to the simile and contrast to human analogous enzyme glutathione reductase, and the structural aspects of its active site are presented. The process of designing selective inhibitors for the enzyme trypanothione reductase has been discussed. An overview of the different chemical classes of inhibitors of trypanothione reductase with their inhibitory activities against the parasites and their prospects as future chemotherapeutic agents are briefl y revealed.

  15. Superoxide reductase from the syphilis spirochete Treponema pallidum: crystallization and structure determination using soft X-rays

    Energy Technology Data Exchange (ETDEWEB)

    Santos-Silva, Teresa; Trincão, José; Carvalho, Ana L.; Bonifácio, Cecília; Auchère, Françoise; Moura, Isabel; Moura, José J. G.; Romão, Maria J., E-mail: mromao@dq.fct.unl.pt [REQUIMTE Departamento de Química, Faculdade de Ciências e Tecnologia, Universidade Nova de Lisboa, 2829-516 Caparica (Portugal)

    2005-11-01

    Superoxide reductase is a non-haem iron-containing protein involved in resistance to oxidative stress. The oxidized form of the protein has been crystallized and its three-dimensional structure solved. A highly redundant X-ray diffraction data set was collected on a rotating-anode generator using Cu Kα X-ray radiation. Four Fe atoms were located in the asymmetric unit corresponding to four protein molecules arranged as a dimer of homodimers. Superoxide reductase is a 14 kDa metalloprotein containing a catalytic non-haem iron centre [Fe(His){sub 4}Cys]. It is involved in defence mechanisms against oxygen toxicity, scavenging superoxide radicals from the cell. The oxidized form of Treponema pallidum superoxide reductase was crystallized in the presence of polyethylene glycol and magnesium chloride. Two crystal forms were obtained depending on the oxidizing agents used after purification: crystals grown in the presence of K{sub 3}Fe(CN){sub 6} belonged to space group P2{sub 1} (unit-cell parameters a = 60.3, b = 59.9, c = 64.8 Å, β = 106.9°) and diffracted beyond 1.60 Å resolution, while crystals grown in the presence of Na{sub 2}IrCl{sub 6} belonged to space group C2 (a = 119.4, b = 60.1, c = 65.6 Å, β = 104.9°) and diffracted beyond 1.55 Å. A highly redundant X-ray diffraction data set from the C2 crystal form collected on a copper rotating-anode generator (λ = 1.542 Å) clearly defined the positions of the four Fe atoms present in the asymmetric unit by SAD methods. A MAD experiment at the iron absorption edge confirmed the positions of the previously determined iron sites and provided better phases for model building and refinement. Molecular replacement using the P2{sub 1} data set was successful using a preliminary trace as a search model. A similar arrangement of the four protein molecules could be observed.

  16. Superoxide reductase from the syphilis spirochete Treponema pallidum: crystallization and structure determination using soft X-rays

    International Nuclear Information System (INIS)

    Superoxide reductase is a non-haem iron-containing protein involved in resistance to oxidative stress. The oxidized form of the protein has been crystallized and its three-dimensional structure solved. A highly redundant X-ray diffraction data set was collected on a rotating-anode generator using Cu Kα X-ray radiation. Four Fe atoms were located in the asymmetric unit corresponding to four protein molecules arranged as a dimer of homodimers. Superoxide reductase is a 14 kDa metalloprotein containing a catalytic non-haem iron centre [Fe(His)4Cys]. It is involved in defence mechanisms against oxygen toxicity, scavenging superoxide radicals from the cell. The oxidized form of Treponema pallidum superoxide reductase was crystallized in the presence of polyethylene glycol and magnesium chloride. Two crystal forms were obtained depending on the oxidizing agents used after purification: crystals grown in the presence of K3Fe(CN)6 belonged to space group P21 (unit-cell parameters a = 60.3, b = 59.9, c = 64.8 Å, β = 106.9°) and diffracted beyond 1.60 Å resolution, while crystals grown in the presence of Na2IrCl6 belonged to space group C2 (a = 119.4, b = 60.1, c = 65.6 Å, β = 104.9°) and diffracted beyond 1.55 Å. A highly redundant X-ray diffraction data set from the C2 crystal form collected on a copper rotating-anode generator (λ = 1.542 Å) clearly defined the positions of the four Fe atoms present in the asymmetric unit by SAD methods. A MAD experiment at the iron absorption edge confirmed the positions of the previously determined iron sites and provided better phases for model building and refinement. Molecular replacement using the P21 data set was successful using a preliminary trace as a search model. A similar arrangement of the four protein molecules could be observed

  17. Functional complementation of a nitrate reductase defective mutant of a green alga Dunaliella viridis by introducing the nitrate reductase gene.

    Science.gov (United States)

    Sun, Yu; Gao, Xiaoshu; Li, Qiyun; Zhang, Qingqi; Xu, Zhengkai

    2006-08-01

    Nitrate reductase (NR) catalyzes NAD (P) H dependent reduction of nitrate to nitrite. Transformation systems have been established in several species of green algae by nitrate reductase gene functional complementation. In this report, an endogenous NR cDNA (3.4 kb) and a genomic fragment (14.6 kb) containing the NR gene (DvNIA1) were isolated from the D. viridis cDNA and genomic libraries respectively. Southern blot and Northern blot analyses showed that this gene exists as a single copy in D. viridis and is induced by nitrate. To obtain a NR defective mutant as a recipient strain, D. viridis cells were treated with a chemical mutagen and then cultured on a chlorate-containing plate to enrich chlorate tolerant mutants. Southern analysis showed that one isolate, B14, had a deletion in the DvNIA1 gene region. Using electroporation conditions determined in this laboratory, plasmid pDVNR containing the intact DvNIA1 gene has been electroporated into the defective mutant B14. Strains retaining a nitrate assimilation phenotype were obtained from nitrate plates after spreading the electroporated cells. In some individual strains, transcription of the introduced gene was detected. NR activity in these strains was slightly higher than that in the defective B14 cell, but excretion of nitrite into culture media was almost as high as that of the wild-type cell. Possible episomal presence of the introduced DNA in D. viridis is discussed. PMID:16797881

  18. Apoptosis in murine hepatoma hepa 1c1c7 wild-type, C12, and C4 cells mediated by bilirubin.

    Science.gov (United States)

    Seubert, John M; Darmon, Alison J; El-Kadi, Ayman O S; D'Souza, Sudhir J A; Bend, John R

    2002-08-01

    Elevated serum and tissue bilirubin concentrations that occur in pathological conditions such as cholestasis, jaundice, and other liver diseases are known to stimulate cytotoxic responses. In preliminary studies, we noted that bilirubin seemed to cause apoptosis in murine hepatoma Hepa 1c1c7 wild-type (WT) cells. Consequently, we investigated apoptosis caused by bilirubin in WT, mutant C12 [aryl hydrocarbon receptor (AHR)-deficient], and C4 (AHR nuclear translocator-deficient) Hepa 1c1c7 cells. Three independent measures of apoptosis were used to quantify the effects of exogenous bilirubin (0, 1, 10, 25, 50, or 100 microM). Caspase-3 activity and cytochrome c release from mitochondria increased at 3 h post-treatment, before increased caspase-8 activity at 6 h, and nuclear condensation by 24 h after treatment with bilirubin. No differences in whole-cell lipid peroxidation were observed between the cell types; however, intracellular reactive oxygen species (ROS) production was greater in WT cells than C12 or C4 cells 3 h after bilirubin exposure. Pretreatment of cells for 1 h with 1 or 10 microM alpha-naphthoflavone, an AHR antagonist, before bilirubin exposure resulted in decreased caspase-3 activity at 6 h and nuclear condensation at 24 h in WT cells. These results indicate that bilirubin, a potential AHR ligand, causes apoptosis in murine Hepa 1c1c7 WT cells by a mechanism(s) partially involving the AHR, disruption of membrane integrity, and increased intracellular ROS production. PMID:12130676

  19. Tumor Necrosis Factor-alpha Potentiates the Cytotoxicity of Amiodarone in Hepa1c1c7 Cells: Roles of Caspase Activation and Oxidative Stress

    OpenAIRE

    Lu, Jingtao; Miyakawa, Kazuhisa; Roth, Robert A.; Ganey, Patricia E.

    2012-01-01

    Amiodarone (AMD), a class III antiarrhythmic drug, causes idiosyncratic hepatotoxicity in human patients. We demonstrated previously that tumor necrosis factor-alpha (TNF-α) plays an important role in a rat model of AMD-induced hepatotoxicity under inflammatory stress. In this study, we developed a model in vitro to study the roles of caspase activation and oxidative stress in TNF potentiation of AMD cytotoxicity. AMD caused cell death in Hepa1c1c7 cells, and TNF cotreatment potentiated its t...

  20. Information Management System training in the conditions of application configurations "1C: Enterprise"

    OpenAIRE

    Sergei Bogatenkov; Dmitrii Bogatenkov

    2014-01-01

    Introduction of information technology increases the efficiency of solving professional problems and to increase the role of information training. The article describes a system of information training in the conditions of application configurations "1C: Enterprise" based on the classification of staff according to their level of training and quality requirements, including the availability of appropriate certificates of 1C.

  1. Hb A1c Separation by High Performance Liquid Chromatography in Hemoglobinopathies

    Directory of Open Access Journals (Sweden)

    Vani Chandrashekar

    2016-01-01

    Full Text Available Hb A1c measurement is subject to interference by hemoglobin traits and this is dependent on the method used for determination. In this paper we studied the difference between Hb A1c measured by HPLC in hemoglobin traits and normal chromatograms. We also studied the correlation of Hb A1c with age. Hemoglobin analysis was carried out by high performance liquid chromatography. Spearman’s rank correlation was used to study correlation between A1c levels and age. Mann-Whitney U test was used to study the difference in Hb A1c between patients with normal hemoglobin and hemoglobin traits. A total of 431 patients were studied. There was positive correlation with age in patients with normal chromatograms only. No correlation was seen in Hb E trait or beta thalassemia trait. No significant difference in Hb A1c of patients with normal chromatograms and patients with hemoglobin traits was seen. There is no interference by abnormal hemoglobin in the detection of A1c by high performance liquid chromatography. This method cannot be used for detection of A1c in compound heterozygous and homozygous disorders.

  2. Admissible ŝl (2|1; C) k characters and parafermions

    Science.gov (United States)

    Hayes, M.; Taormina, A.

    1998-10-01

    The branching functions of a particular subclass of characters of the affine superalgebra ŝl(2|1;( C) k into characters of the subalgebra ŝl(2|1;( C) k are calculated for fractional levels k = /1 u - 1, u ɛ N. They involve rational torus A u(u-1)andZu-1 parafermion characters.

  3. Elevated third-trimester haemoglobin A 1c predicts preterm delivery in type 1 diabetes

    DEFF Research Database (Denmark)

    Ekbom, Pia; Damm, Peter; Feldt-Rasmussen, Bo;

    2008-01-01

    The prevalence of preterm delivery is considerably elevated in women with type 1 diabetes. The aim of the study was to evaluate haemoglobin A(1c) (HbA(1c)) as a predictor of preterm delivery. Two hundred thirteen consecutive pregnant women with type 1 diabetes and normal urinary albumin excretion...

  4. Information Management System training in the conditions of application configurations "1C: Enterprise"

    Directory of Open Access Journals (Sweden)

    Sergei Bogatenkov

    2014-04-01

    Full Text Available Introduction of information technology increases the efficiency of solving professional problems and to increase the role of information training. The article describes a system of information training in the conditions of application configurations "1C: Enterprise" based on the classification of staff according to their level of training and quality requirements, including the availability of appropriate certificates of 1C.

  5. shRNA screening identifies JMJD1C as being required for leukemia maintenance

    DEFF Research Database (Denmark)

    Sroczynska, Patrycja; Cruickshank, V Adam; Bukowski, John-Paul;

    2014-01-01

    Epigenetic regulatory mechanisms are implicated in the pathogenesis of acute myeloid and lymphoid leukemia (AML and ALL). Recent progress suggests that proteins involved in epigenetic control are amenable to drug intervention, but little is known about the cancer-specific dependency on epigenetic...... candidate drug targets identified in these screens was Jmjd1c. Depletion of Jmjd1c impairs growth and colony formation of mouse MLL-AF9 cells in vitro, as well as establishment of leukemia after transplantation. Depletion of JMJD1C impairs expansion and colony formation of human leukemic cell lines, with...... the strongest effect observed in the MLL-rearranged ALL cell line, SEM. In both mouse and human leukemic cells, the growth defect upon JMJD1C depletion appears to be primarily due to increased apoptosis, which implicates JMJD1C as a potential therapeutic target in leukemia....

  6. Vibrio harveyi Nitroreductase Is Also a Chromate Reductase

    Science.gov (United States)

    Kwak, Young Hak; Lee, Dong Seok; Kim, Han Bok

    2003-01-01

    The chromate reductase purified from Pseudomonas ambigua was found to be homologous with several nitroreductases. Escherichia coli DH5α and Vibrio harveyi KCTC 2720 nitroreductases were chosen for the present study, and their chromate-reducing activities were determined. A fusion between glutathione S-transferase (GST) and E. coli DH5α NfsA (GST-EcNfsA), a fusion between GST and E. coli DH5α NfsB (GST-EcNfsB), and a fusion between GST and V. harveyi KCTC 2720 NfsA (GST-VhNfsA) were prepared for their overproduction and easy purification. GST-EcNfsA, GST-EcNFsB, and GST-VhNFsA efficiently reduced nitrofurazone and 2,4,6-trinitrotoluene (TNT) as their nitro substrates. The Km values for GST-EcNfsA, GST-EcNfsB, and GST-VhNfsA for chromate reduction were 11.8, 23.5, and 5.4 μM, respectively. The Vmax values for GST-EcNfsA, GST-EcNfsB, and GST-VhNfsA were 3.8, 3.9, and 10.7 nmol/min/mg of protein, respectively. GST-VhNfsA was the most effective of the three chromate reductases, as determined by each Vmax/Km value. The optimal temperatures of GST-EcNfsA, GST-EcNfsB, and GST-VhNfsA for chromate reduction were 55, 30, and 30°C, respectively. Thus, it is confirmed that nitroreductase can also act as a chromate reductase. Nitroreductases may be used in chromate remediation. GST-EcNfsA, GST-EcNfsB, and GST-VhNfsA have a molecular mass of 50 kDa and exist as a monomer in solution. Thin-layer chromatography showed that GST-EcNfsA, GST-EcNfsB, and GST-VhNfsA contain FMN as a cofactor. GST-VhNfsA reduced Cr(VI) to Cr(III). Cr(III) was much less toxic to E. coli than Cr(VI). PMID:12902220

  7. Separation and conductimetric detection of C1-C7 aliphatic monocarboxylic acids and C1-C7 aliphatic monoamines on unfunctionized polymethacrylate resin columns.

    Science.gov (United States)

    Ohta, Kazutoku; Towata, Atsuya; Ohashi, Masayoshi; Takeuchi, Toyohide

    2004-06-11

    The application of unfunctionized polymethacrylate resin (TSKgel G3000PWXL) as a stationary phase in liquid chromatography with conductimetric detection for C1-C7 aliphatic monocarboxylic acids (formic acid, acetic acid, propionic acid, butyric acid, isovaleric acid, valeric acid, 3,3-dimethylbutyric acid, 4-methylvaleric acid, hexanoic acid, 2-methylhexanoic acid, 5-methylhexanoic acid and heptanoic acid) and C1-C7 aliphatic monoamines (methylamine, ethylamine, propylamine, isobutylamine, butylamine, isoamylamine, amylamine, 1,3-dimethylbutylamine, hexylamine, 2-heptylamine and heptylamine) was attempted with C8 aliphatic monocarboxylic acids (2-propylvaleric acid, 2-ethylhexanoic acid, 2-methylheptanoic acid and octanoic acid) and C8 aliphatic monoamines (1,5-dimethylhexylamine, 2-ethylhexylamine, 1-methylheptylamine and octylamine) as eluents, respectively. Using 1 mM 2-methylheptanoic acid at pH 4.0 as the eluent, excellent separation and relatively high sensitive detection for these C1-C7 carboxylic acids were achieved on a TSKgel G3000PWXL column (150 mm x 6 mm i.d.) in 60 min. Using 2 mM octylamine at pH 11.0 as the eluent, excellent separation and relatively high sensitive detection for these C1-C7 amines were also achieved on the TSKgel G3000PWXL column in 60 min. PMID:15250420

  8. Differences in TCDD-elicited gene expression profiles in human HepG2, mouse Hepa1c1c7 and rat H4IIE hepatoma cells

    Directory of Open Access Journals (Sweden)

    Burgoon Lyle D

    2011-04-01

    Full Text Available Abstract Background 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD is an environmental contaminant that elicits a broad spectrum of toxic effects in a species-specific manner. Current risk assessment practices routinely extrapolate results from in vivo and in vitro rodent models to assess human risk. In order to further investigate the species-specific responses elicited by TCDD, temporal gene expression responses in human HepG2, mouse Hepa1c1c7 and rat H4IIE cells were compared. Results Microarray analysis identified a core set of conserved gene expression responses across species consistent with the role of AhR in mediating adaptive metabolic responses. However, significant species-specific as well as species-divergent responses were identified. Computational analysis of the regulatory regions of species-specific and -divergent responses suggests that dioxin response elements (DREs are involved. These results are consistent with in vivo rat vs. mouse species-specific differential gene expression, and more comprehensive comparative DRE searches. Conclusions Comparative analysis of human HepG2, mouse Hepa1c1c7 and rat H4IIE TCDD-elicited gene expression responses is consistent with in vivo rat-mouse comparative gene expression studies, and more comprehensive comparative DRE searches, suggesting that AhR-mediated gene expression is species-specific.

  9. Structure of a bacterial homologue of vitamin K epoxide reductase

    Energy Technology Data Exchange (ETDEWEB)

    Li, Weikai; Schulman, Sol; Dutton, Rachel J.; Boyd, Dana; Beckwith, Jon; Rapoport, Tom A. (Harvard-Med); (HHMI)

    2010-03-19

    Vitamin K epoxide reductase (VKOR) generates vitamin K hydroquinone to sustain {gamma}-carboxylation of many blood coagulation factors. Here, we report the 3.6 {angstrom} crystal structure of a bacterial homologue of VKOR from Synechococcus sp. The structure shows VKOR in complex with its naturally fused redox partner, a thioredoxin-like domain, and corresponds to an arrested state of electron transfer. The catalytic core of VKOR is a four transmembrane helix bundle that surrounds a quinone, connected through an additional transmembrane segment with the periplasmic thioredoxin-like domain. We propose a pathway for how VKOR uses electrons from cysteines of newly synthesized proteins to reduce a quinone, a mechanism confirmed by in vitro reconstitution of vitamin K-dependent disulphide bridge formation. Our results have implications for the mechanism of the mammalian VKOR and explain how mutations can cause resistance to the VKOR inhibitor warfarin, the most commonly used oral anticoagulant.

  10. Aspects of Ribonucleotide Reductase Regulation and Genome Stability

    DEFF Research Database (Denmark)

    Nielsen, Helena Berner Nedergaard

    In all living cells, synthesis of the DNA building blocks, deoxyribonucleoside triphosphates (dNTPs), is tightly regulated to ensure a precise DNA replication to maintain genomic stability. Ribonucleotide reductase (RNR) is the enzyme responsible for reducing ribonucleotides to their deoxy forms....... RNR consists of two subunits: R1 and R2, both of which are essential. The activity of RNR is strictly regulated to control the dNTP pool, both by allosteric feedback control and transcriptional and translational controls. Four inhibitory proteins of RNR have been identified in yeast: Spd1 in fission...... yeast, and Sml1, Hug1, and Dif1 in budding yeast. An elevated, as well as a reduced dNTP pool is shown to lead to an increase in spontaneous mutation rates, hence regulation of RNR is very important in order to maintain genomic stability. No human inhibitory proteins have yet been identified to regulate...

  11. Two methylenetetrahydrofolate reductase gene (MTHFR) polymorphisms, schizophrenia and bipolar disorder

    DEFF Research Database (Denmark)

    Jönsson, Erik G; Larsson, Kristina; Vares, Maria;

    2008-01-01

    disorder. In a replication attempt the MTHFR C677T and A1298C SNPs were analyzed in three Scandinavian schizophrenia case-control samples. In addition, Norwegian patients with bipolar disorder were investigated. There were no statistically significant allele or genotype case-control differences. The...... present Scandinavian results do not verify previous associations between the putative functional MTHFR gene polymorphisms and schizophrenia or bipolar disorder. However, when combined with previous studies in meta-analyses there is still evidence for association between the MTHFR C677T polymorphism and......Recent meta-analyses of the methylenetetrahydrofolate reductase gene (MTHFR) have suggested association between two of its functional single gene polymorphisms (SNPs; C677T and A1298C) and schizophrenia. Studies have also suggested association between MTHFR C677T and A1298C variation and bipolar...

  12. Crystal structure of isoflavone reductase from alfalfa (Medicago sativa L.).

    Science.gov (United States)

    Wang, Xiaoqiang; He, Xianzhi; Lin, Jianqiao; Shao, Hui; Chang, Zhenzhan; Dixon, Richard A

    2006-05-19

    Isoflavonoids play important roles in plant defense and exhibit a range of mammalian health-promoting activities. Isoflavone reductase (IFR) specifically recognizes isoflavones and catalyzes a stereospecific NADPH-dependent reduction to (3R)-isoflavanone. The crystal structure of Medicago sativa IFR with deletion of residues 39-47 has been determined at 1.6A resolution. Structural analysis, molecular modeling and docking, and comparison with the structures of other NADPH-dependent enzymes, defined the putative binding sites for co-factor and substrate and potential key residues for enzyme activity and substrate specificity. Further mutagenesis has confirmed the role of Lys144 as a catalytic residue. This study provides a structural basis for understanding the enzymatic mechanism and substrate specificity of IFRs as well as the functions of IFR-like proteins. PMID:16600295

  13. Pulse radiolysis studies on superoxide reductase from Treponema pallidum

    CERN Document Server

    Nivière, V; Fontecave, M; Houée-Levin, C

    2015-01-01

    Superoxide reductases (SORs) are small metalloenzymes, which catalyze reduction of O2*- to H2O2. The reaction of the enzyme from Treponema pallidum with superoxide was studied by pulse radiolysis methods. The first step is an extremely fast bi-molecular reaction of the ferrous center with O2, with a rate constant of 6 x 10 (8) M(-1) s(-1). A first intermediate is formed which is converted to a second one with a slower rate constant of 4800 s(-1). This latter value is 10 times higher than the corresponding one previously reported in the case of SOR from Desulfoarculus baarsii. The reconstituted spectra for the two intermediates are consistent with formation of transient iron-peroxide species.

  14. Two methylenetetrahydrofolate reductase gene (MTHFR) polymorphisms, schizophrenia and bipolar disorder

    DEFF Research Database (Denmark)

    Jönsson, Erik G; Larsson, Kristina; Vares, Maria; Hansen, Thomas; Wang, August G; Djurovic, Srdjan; Rønningen, Kjersti S; Andreassen, Ole A; Agartz, Ingrid; Werge, Thomas; Terenius, Lars; Hall, Håkan

    disorder. In a replication attempt the MTHFR C677T and A1298C SNPs were analyzed in three Scandinavian schizophrenia case-control samples. In addition, Norwegian patients with bipolar disorder were investigated. There were no statistically significant allele or genotype case-control differences. The...... present Scandinavian results do not verify previous associations between the putative functional MTHFR gene polymorphisms and schizophrenia or bipolar disorder. However, when combined with previous studies in meta-analyses there is still evidence for association between the MTHFR C677T polymorphism and......Recent meta-analyses of the methylenetetrahydrofolate reductase gene (MTHFR) have suggested association between two of its functional single gene polymorphisms (SNPs; C677T and A1298C) and schizophrenia. Studies have also suggested association between MTHFR C677T and A1298C variation and bipolar...

  15. Calculation of the phase diagrams of ferrimagnetic alloys A cB 1- c and application to transition metal-rare-earth Fe cGd 1- c and Fe cTb 1- c materials

    Science.gov (United States)

    Fresneau, M.; Virlouvet, A.; Khater, A.

    1999-07-01

    A theoretical model is presented for the calculation of the magnetic properties of generalised spin ferrimagnetic random substitutional alloys A cB 1- c with antiferromagnetic coupling between the A and B spin species. In particular, we study in an effective field method the phase diagrams of these systems as a function of the alloy concentration c, for given magnetic exchange constants. The model is applied with no adjustable parameters to the transition metal-rare-earth Fe cGd 1- c and Fe cTb 1- c alloys, using the appropriate spins for the Fe, Gd and Tb ions. We report a coherent and an overall qualitative agreement between theory and experiment in the complete range of concentrations 1⩾ c⩾0, for the first time to our knowledge, and determine consequently for these materials a set of ionic exchange constants that are invariant with respect to the alloy concentration. To our knowledge this is the first time that approximate but seemingly reliable exchange constants for the two alloys have been derived.

  16. Isolation and characterization of nitric oxide reductase from Paracoccus halodenitrificans.

    Science.gov (United States)

    Sakurai, N; Sakurai, T

    1997-11-11

    Nitric oxide reductase was isolated from the membrane fraction of a denitrifying bacterium, Paracoccus halodenitrificans, in the presence of n-dodecyl beta-D-maltoside. A relatively simple and effective procedure to purify NO reductase using DEAE-Toyopearl and hydroxyapatite (ceramic) chromatographies has been developed. The enzyme consisted of two subunits with molecular masses of 20 and 42 kDa associated with the c-type heme and two b-type hemes, respectively. The optical and magnetic circular dichroism (MCD) spectra of the oxidized (as isolated) and reduced enzymes indicated that the heme c is in the low-spin state and the hemes b are in the high- and low-spin states. The EPR spectrum also showed the presence of the split high-spin component (g perpendicular = 6.6, 6.0) and two low spin components (gz,y,x = 2.96, 2.26, 1.46, gz = 3.59). Although the presence of an extra iron was suggested from atomic absorption spectroscopy, a non-heme iron could not be detected by colorimetric titrations using ferene and 2-(5-nitro-2-pyridylazo)- 5-(N-propyl-N-sulfopropylamino)phenolate (PAPS). One of the extra signals at g = 4.3 and 2.00 might come from a non-heme iron, while they may originate from an adventitious iron and a certain nonmetallic radical, respectively. When CO acted on the reduced enzyme, both of the low-spin hemes were not affected, and when NO acted on the reduced enzyme, the optical and MCD spectra were of a mixture of the oxidized and reduced enzymes. Consequently, the reduction of NO was supposed to take place at the high-spin heme b. The heme c and the low-spin heme b centers were considered to function as electron mediators during the intermolecular and intramolecular processes. PMID:9374857

  17. Identification of imine reductase-specific sequence motifs.

    Science.gov (United States)

    Fademrecht, Silvia; Scheller, Philipp N; Nestl, Bettina M; Hauer, Bernhard; Pleiss, Jürgen

    2016-05-01

    Chiral amines are valuable building blocks for the production of a variety of pharmaceuticals, agrochemicals and other specialty chemicals. Only recently, imine reductases (IREDs) were discovered which catalyze the stereoselective reduction of imines to chiral amines. Although several IREDs were biochemically characterized in the last few years, knowledge of the reaction mechanism and the molecular basis of substrate specificity and stereoselectivity is limited. To gain further insights into the sequence-function relationships, the Imine Reductase Engineering Database (www.IRED.BioCatNet.de) was established and a systematic analysis of 530 putative IREDs was performed. A standard numbering scheme based on R-IRED-Sk was introduced to facilitate the identification and communication of structurally equivalent positions in different proteins. A conservation analysis revealed a highly conserved cofactor binding region and a predominantly hydrophobic substrate binding cleft. Two IRED-specific motifs were identified, the cofactor binding motif GLGxMGx5 [ATS]x4 Gx4 [VIL]WNR[TS]x2 [KR] and the active site motif Gx[DE]x[GDA]x[APS]x3 {K}x[ASL]x[LMVIAG]. Our results indicate a preference toward NADPH for all IREDs and explain why, despite their sequence similarity to β-hydroxyacid dehydrogenases (β-HADs), no conversion of β-hydroxyacids has been observed. Superfamily-specific conservations were investigated to explore the molecular basis of their stereopreference. Based on our analysis and previous experimental results on IRED mutants, an exclusive role of standard position 187 for stereoselectivity is excluded. Alternatively, two standard positions 139 and 194 were identified which are superfamily-specifically conserved and differ in R- and S-selective enzymes. Proteins 2016; 84:600-610. © 2016 Wiley Periodicals, Inc. PMID:26857686

  18. Fatty acyl-CoA reductases of birds

    Directory of Open Access Journals (Sweden)

    Hellenbrand Janine

    2011-12-01

    Full Text Available Abstract Background Birds clean and lubricate their feathers with waxes that are produced in the uropygial gland, a holocrine gland located on their back above the tail. The type and the composition of the secreted wax esters are dependent on the bird species, for instance the wax ester secretion of goose contains branched-chain fatty acids and unbranched fatty alcohols, whereas that of barn owl contains fatty acids and alcohols both of which are branched. Alcohol-forming fatty acyl-CoA reductases (FAR catalyze the reduction of activated acyl groups to fatty alcohols that can be esterified with acyl-CoA thioesters forming wax esters. Results cDNA sequences encoding fatty acyl-CoA reductases were cloned from the uropygial glands of barn owl (Tyto alba, domestic chicken (Gallus gallus domesticus and domestic goose (Anser anser domesticus. Heterologous expression in Saccharomyces cerevisiae showed that they encode membrane associated enzymes which catalyze a NADPH dependent reduction of acyl-CoA thioesters to fatty alcohols. By feeding studies of transgenic yeast cultures and in vitro enzyme assays with membrane fractions of transgenic yeast cells two groups of isozymes with different properties were identified, termed FAR1 and FAR2. The FAR1 group mainly synthesized 1-hexadecanol and accepted substrates in the range between 14 and 18 carbon atoms, whereas the FAR2 group preferred stearoyl-CoA and accepted substrates between 16 and 20 carbon atoms. Expression studies with tissues of domestic chicken indicated that FAR transcripts were not restricted to the uropygial gland. Conclusion The data of our study suggest that the identified and characterized avian FAR isozymes, FAR1 and FAR2, can be involved in wax ester biosynthesis and in other pathways like ether lipid synthesis.

  19. Evidence for a hexaheteromeric methylenetetrahydrofolate reductase in Moorella thermoacetica.

    Science.gov (United States)

    Mock, Johanna; Wang, Shuning; Huang, Haiyan; Kahnt, Jörg; Thauer, Rudolf K

    2014-09-01

    Moorella thermoacetica can grow with H₂ and CO₂, forming acetic acid from 2 CO₂ via the Wood-Ljungdahl pathway. All enzymes involved in this pathway have been characterized to date, except for methylenetetrahydrofolate reductase (MetF). We report here that the M. thermoacetica gene that putatively encodes this enzyme, metF, is part of a transcription unit also containing the genes hdrCBA, mvhD, and metV. MetF copurified with the other five proteins encoded in the unit in a hexaheteromeric complex with an apparent molecular mass in the 320-kDa range. The 40-fold-enriched preparation contained per mg protein 3.1 nmol flavin adenine dinucleotide (FAD), 3.4 nmol flavin mononucleotide (FMN), and 110 nmol iron, almost as predicted from the primary structure of the six subunits. It catalyzed the reduction of methylenetetrahydrofolate with reduced benzyl viologen but not with NAD(P)H in either the absence or presence of oxidized ferredoxin. It also catalyzed the reversible reduction of benzyl viologen with NADH (diaphorase activity). Heterologous expression of the metF gene in Escherichia coli revealed that the subunit MetF contains one FMN rather than FAD. MetF exhibited 70-fold-higher methylenetetrahydrofolate reductase activity with benzyl viologen when produced together with MetV, which in part shows sequence similarity to MetF. Heterologously produced HdrA contained 2 FADs and had NAD-specific diaphorase activity. Our results suggested that the physiological electron donor for methylenetetrahydrofolate reduction in M. thermoacetica is NADH and that the exergonic reduction of methylenetetrahydrofolate with NADH is coupled via flavin-based electron bifurcation with the endergonic reduction of an electron acceptor, whose identity remains unknown. PMID:25002540

  20. Nitrite and nitrous oxide reductase regulation by nitrogen oxides in Rhodobacter sphaeroides f. sp. denitrificans IL106.

    Science.gov (United States)

    Sabaty, M; Schwintner, C; Cahors, S; Richaud, P; Verméglio, A

    1999-10-01

    We have cloned the nap locus encoding the periplasmic nitrate reductase in Rhodobacter sphaeroides f. sp. denitrificans IL106. A mutant with this enzyme deleted is unable to grow under denitrifying conditions. Biochemical analysis of this mutant shows that in contrast to the wild-type strain, the level of synthesis of the nitrite and N(2)O reductases is not increased by the addition of nitrate. Growth under denitrifying conditions and induction of N oxide reductase synthesis are both restored by the presence of a plasmid containing the genes encoding the nitrate reductase. This demonstrates that R. sphaeroides f. sp. denitrificans IL106 does not possess an efficient membrane-bound nitrate reductase and that nitrate is not the direct inducer for the nitrite and N(2)O reductases in this species. In contrast, we show that nitrite induces the synthesis of the nitrate reductase. PMID:10498715

  1. Interference of the Hope Hemoglobin With Hemoglobin A1c Results.

    Science.gov (United States)

    Chakraborty, Sutirtha; Chanda, Dalia; Gain, Mithun; Krishnan, Prasad

    2015-01-01

    Hemoglobin A1c (HbA1c) is now considered to be the marker of choice in diagnosis and management of diabetes mellitus, based on the results of certain landmark clinical trials. Herein, we report the case of a 52-year-old ethnic Southeast Asian Indian man with impaired glucose tolerance whose glycated hemoglobin (ie, HbA1c) levels, as measured via Bio-Rad D10 high-performance liquid chromatography (HPLC) and Roche Tina-quant immunoassay were 47.8% and 44.0%, respectively. No variant hemoglobin (Hb) peak was observed via the D10 chromatogram. We assayed the patient specimen on the Sebia MINICAP capillary electrophoresis platform; the HbA1c level was 6.8%, with a large variant Hb peak of 42.0%. This finding suggested the possible presence of the heterozygous Hb Hope, which can result in spuriously elevated HbA1c results on HPLC and turbidimetric immunoassays. Although the capillary electrophoresis system was able to identify the variant, the A1c results should not be considered accurate due to overlapping of the variant and adult Hb peaks on the electrophoretogram reading. Hb Hope is usually clinically silent but can present such analytical challenges. Through this case study, we critically discuss the limitations of various HbA1c assay methods, highlighting the fact that laboratory professionals need to be aware of occurrences of Hb Hope, to help ensure patient safety. PMID:26199262

  2. Thyroid hormone transport and metabolism by OATP1C1 and consequences of genetic variation

    DEFF Research Database (Denmark)

    van der Deure, Wendy M; Hansen, Pia Skov; Peeters, Robin P;

    2008-01-01

    OATP1C1 has been characterized as a specific thyroid hormone transporter. Based on its expression in capillaries in different brain regions, OATP1C1 is thought to play a key-role in transporting thyroid hormone across the blood-brain barrier. For this reason, we studied the specificity of...... iodothyronine transport by OATP1C1 in detail by analysis of thyroid hormone uptake in OATP1C1-transfected COS1 cells. Furthermore, we examined whether OATP1C1 is rate-limiting in subsequent thyroid hormone metabolism in cells co-transfected with deiodinases. We also studied the effect of genetic variation in...... the OATP1C1 gene: polymorphisms were determined in 155 blood donors and 1192 Danish twins, and related to serum thyroid hormone levels. In vitro effects of the polymorphisms were analyzed in cells transfected with the variants. Cells transfected with OATP1C1 showed increased transport of T4 and T4...

  3. The use of 5-alpha reductase inhibitors for the prevention of prostate cancer.

    Science.gov (United States)

    Yu, Eun-mi; El-Ayass, Walid; Aragon-Ching, Jeanny B

    2010-07-01

    The use of 5-alpha-reductase inhibitors has been studied not only in benign prostatic hyperplasia, but as a chemopreventive strategy in prostate cancer. Both finasteride and dutasteride, 5 alpha-reductase inhibitors (5ARI), have been shown to decrease the risk of prostate cancer. The results of the REDUCE trial using the dual alpha-reductase isoenzyme inhibitor dutasteride, has recently been published by Andriole et al. in the New England Journal of Medicine. Certain considerations regarding its use and applicability to men with high risk of developing prostate cancer are herein discussed. PMID:20574153

  4. Characterization and regulation of Leishmania major 3-hydroxy-3-methylglutaryl-CoA reductase

    DEFF Research Database (Denmark)

    Montalvetti, A; Pena Diaz, Javier; Hurtado, R;

    2000-01-01

    In eukaryotes the enzyme 3-hydroxy-3-methylglutaryl CoA (HMG-CoA) reductase catalyses the synthesis of mevalonic acid, a common precursor to all isoprenoid compounds. Here we report the isolation and overexpression of the gene coding for HMG-CoA reductase from Leishmania major. The protein from...... Leishmania lacks the membrane domain characteristic of eukaryotic cells but exhibits sequence similarity with eukaryotic reductases. Highly purified protein was achieved by ammonium sulphate precipitation followed by chromatography on hydroxyapatite. Kinetic parameters were determined for the protozoan...

  5. Virtual screening of plant derived compounds for aldose reductase inhibition using molecular docking.

    Science.gov (United States)

    Muppalaneni, Naresh Babu; Rao, Allam Appa

    2012-01-01

    The role of the aldose reductase in type 2 diabetes is widely described. Therefore, it is of interest to identify plant derived compounds to inhibit its activity. We studied the protein-ligand interaction of 267 compounds from different parts of seven plants (Allium sativum, Coriandrum sativum, Dacus carota, Murrayyakoneigii, Eucalyptus, Calendula officinalis and Lycopersicon esculentum) with aldose reductase as the target protein. Molecular docking and re-scoring of top ten compounds (using GOLD, AutoDock Vina, eHiTS, PatchDock and MEDock) followed by rank-sum technique identified compound allium38 with high binding affinity for aldose reductase. PMID:23275691

  6. Steroidal pyrazolines evaluated as aromatase and quinone reductase-2 inhibitors for chemoprevention of cancer.

    Science.gov (United States)

    Abdalla, Mohamed M; Al-Omar, Mohamed A; Bhat, Mashooq A; Amr, Abdel-Galil E; Al-Mohizea, Abdullah M

    2012-05-01

    The aromatase and quinone reductase-2 inhibition of synthesized heterocyclic pyrazole derivatives fused with steroidal structure for chemoprevention of cancer is reported herein. All compounds were interestingly less toxic than the reference drug (Cyproterone(®)). The aromatase inhibitory activities of these compounds were much more potent than the lead compound resveratrol, which has an IC(50) of 80 μM. In addition, all the compounds displayed potent quinone reductase-2 inhibition. Initially the acute toxicity of the compounds was assayed via the determination of their LD(50). The aromatase and quinone reductase-2 inhibitors resulting from this study have potential value in the treatment and prevention of cancer. PMID:22361454

  7. The Role of Homer1c in Metabotropic Glutamate Receptor-dependent Long-Term Potentiation

    Science.gov (United States)

    O’Riordan, Kenneth; Gerstein, Hilary; Hullinger, Rikki; Burger, Corinna

    2016-01-01

    Group I metabotropic glutamate receptors (mGluR1/5) play a role in synaptic plasticity and they demonstrate direct interactions with the neuronal Homer1c protein. We have previously shown that Homer1c can restore the plasticity deficits in Homer1 knockout mice (H1-KO). Here, we investigated the role of Homer1c in mGluR-dependent synaptic plasticity in wild-type mice, H1-KO, and H1-KO mice overexpressing Homer1c (KO+H1c). We used a form of plasticity induced by activation of mGluR1/5 that transforms short-term potentiaion (STP) induced by a subthreshold theta burst stimulation into long-term potentiation (LTP). We have shown that although acute hippocampal slices from wild-type animals can induce LTP using this stimulation protocol, H1-KO only show STP. Gene delivery of Homer1c into the hippocampus of H1-KO mice rescued LTP to wild-type levels. This form of synaptic plasticity was dependent on mGluR5 but not mGluR1 activation both in wild-type mice and in KO+H1c. mGluR1/5-dependent LTP was blocked with inhibitors of the MEK-ERK and PI3K-mTOR pathways in KO+H1c mice. Moreover, blocking Homer1c–mGluR5 interactions prevented the maintenance of LTP in acute hippocampal slices from KO+H1c. These data indicate that Homer1c–mGluR5 interactions are necessary for mGluR-dependent LTP, and that mGluR1/5-dependent LTP involves PI3K and ERK activation. PMID:24167026

  8. Utility of hemoglobin A1c to screen for impaired glucose tolerance

    Directory of Open Access Journals (Sweden)

    Edy K. Ginting

    2014-07-01

    Full Text Available Background Childhood obesity is associated with an increased likelihood for having impaired glucose tolerance, dyslipidemia, and diabetes. Hemoglobin A1c (HbA1c has emerged as a recommended diagnostic tool for identifying diabetes and persons at risk for the disease. This recommendation was based on data in adults, showing the relationship between HbA1C and the future development of diabetes. However, studies in the pediatric population have been limited and no standard values of HbA1c levels in children have been established. Objective To evaluate HbA1c as a test for impaired glucose tolerance in obese children and adolescents and to identify the optimal HbA1c threshold level (cut off point. Methods We studied 65 obese and 4 overweight children (BMI ≥ +2 SD for age and gender aged 10-15 years in Palembang. All subjects underwent HbA1c and oral glucose tolerance tests. Results Nineteen out of 69 subjects (28% had impaired glucose tolerance. Based on the receiver operating characteristic curve, the optimal cut off point of HbA1c related to impaired glucose tolerance as diagnosed by oral glucose tolerance test was found to be 5.25%, with 63% sensitivity and 64% specificity, 40% positive predictive value, and 82% negative predictive value. The area under the receiver operating characteristic curve was 0.687 (95%CI 0.541–0.833; P < 0.001. Conclusion A HbA1c cut off value of 5.25% may be used as a screening tool to identify children and adolescents with impaired glucose tolerance. [Paediatr Indones. 2014;54:223-6.].

  9. Atlantoaxial arthrodesis using C1-C2 transarticular screw fixation in a case of Morquio syndrome

    Directory of Open Access Journals (Sweden)

    Arvind G Kulkarni

    2011-01-01

    Full Text Available Prophylactic or therapeutic arthrodesis is recommended for atlantoaxial instability in Morquio syndrome. Occipitocervical fusion, the common approach for upper cervical fusion in Morquio syndrome sacrifices the movements at the occipitoatlantal joints. The use of C1-C2 transarticular screws for achieving C1-C2 arthrodesis, without compromising mobility at the occipitoatlantal joint in Morquio syndrome has not been reported. We report a case of Morquio syndrome with atlantoaxial instability and odontoid hypoplasia, where we successfully achieved C1-C2 arthrodesis using transarticular screws and bone graft. The advantages of this method over other methods of atlantoaxial arthrodesis in Morquio syndrome have also been discussed.

  10. Myo1c is designed for the adaptation response in the inner ear

    OpenAIRE

    Batters, Christopher; Arthur, Christopher P.; Lin, Abel; Porter, Jessica; Geeves, Michael A.; Milligan, Ronald A.; Molloy, Justin E.; Coluccio, Lynne M.

    2004-01-01

    The molecular motor, Myo1c, a member of the myosin family, is widely expressed in vertebrate tissues. Its presence at strategic places in the stereocilia of the hair cells in the inner ear and studies using transgenic mice expressing a mutant Myo1c that can be selectively inhibited implicate it as the mediator of slow adaptation of mechanoelectrical transduction, which is required for balance. Here, we have studied the structural, mechanical and biochemical properties of Myo1c to gain an insi...

  11. Significance of HbA1c Test in Diagnosis and Prognosis of Diabetic Patients

    OpenAIRE

    Sherwani, Shariq I.; Khan, Haseeb A.; Ekhzaimy, Aishah; Masood, Afshan; Sakharkar, Meena K

    2016-01-01

    Diabetes is a global endemic with rapidly increasing prevalence in both developing and developed countries. The American Diabetes Association has recommended glycated hemoglobin (HbA1c) as a possible substitute to fasting blood glucose for diagnosis of diabetes. HbA1c is an important indicator of long-term glycemic control with the ability to reflect the cumulative glycemic history of the preceding two to three months. HbA1c not only provides a reliable measure of chronic hyperglycemia but al...

  12. Neue biosensorische Prinzipien für die Hämoglobin-A1c Bestimmung

    OpenAIRE

    Stöllner, Daniela

    2005-01-01

    Hämoglobin-A1c (HbA1c) ist ein Hämoglobin (Hb)-Subtypus, der durch nicht-enzymatische Glykierung des N-terminalen Valinrestes der Hämoglobin-beta-Kette entsteht. Das gemessene Verhältnis von HbA1c zum Gesamt-Hämoglobin (5-20 % bei Diabetikern) repräsentiert den Mittelwert der Blutglucosekonzentration über einen zweimonatigen Zeitraum und stellt zur Beurteilung der diabetischen Stoffwechsellage eine Ergänzung zur Akutkontrolle der Glukosekonzentration dar. Ziel der vorliegenden Arbeit war es, ...

  13. NOAA Climate Data Record (CDR) of MSU Level 1c Brightness Temperature, Version 1.0

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset contains Level 1c inter-calibrated brightness temperatures from the Microwave Sounding Unit (MSU) sensors onboard nine polar orbiting satellites...

  14. Stereocontrolled Synthesis of the C(1)-C(11) Subunit of the Iejimalides

    DEFF Research Database (Denmark)

    Mendlik, Matthew T.; Cottard, Muriel; Rein, Tobias;

    1997-01-01

    An enantioselective synthesis of the C(1)-C(11) subunit of the iejimalides has been accomplished through a combination of an asymmetric Homer-Wadsworth-Emmons condensation and a chiral pool approach. (C) 1997 Elsevier Science Ltd....

  15. Association of the rs3743205 variant of DYX1C1 with dyslexia in Chinese children

    OpenAIRE

    Waye Mary MY; Chou Crystal HN; Ho Connie SH; Lim Cadmon KP

    2011-01-01

    Abstract Background Dyslexia is a learning disability that is characterized by difficulties in the acquisition of reading and spelling skills independent of intelligence, motivation or schooling. Studies of western populations have suggested that DYX1C1 is a candidate gene for dyslexia. In view of the different languages used in Caucasian and Chinese populations, it is therefore worthwhile to investigate whether there is an association of DYX1C1 in Chinese children with dyslexia. Method and R...

  16. Atlantoaxial arthrodesis using C1-C2 transarticular screw fixation in a case of Morquio syndrome

    OpenAIRE

    Kulkarni, Arvind G; Siddharth M Shah

    2011-01-01

    Prophylactic or therapeutic arthrodesis is recommended for atlantoaxial instability in Morquio syndrome. Occipitocervical fusion, the common approach for upper cervical fusion in Morquio syndrome sacrifices the movements at the occipitoatlantal joints. The use of C1-C2 transarticular screws for achieving C1-C2 arthrodesis, without compromising mobility at the occipitoatlantal joint in Morquio syndrome has not been reported. We report a case of Morquio syndrome with atlantoaxial instability an...

  17. Fusion Rules for Affine sl(2|1;C) at Fractional Level k=-1/2

    OpenAIRE

    Johnstone, Gavin

    2001-01-01

    We calculate fusion rules for the admissible representations of the affine superalgebra sl(2|1;C) at fractional level k=-1/2 in the Ramond sector. By representing 3-point correlation functions involving a singular vector as the action of differential operators on the sl(2|1;C) invariant 3-point function, we obtain conditions on permitted quantum numbers involved. We find that in this case the primary fields close under fusion.

  18. Applications of Environmental Remote Sensing by HJ-1C SAR Imageries

    OpenAIRE

    Tian Wei; Xu Xu; Bian Xiao-lin; Chai Xun; Wang Shi-ang; Gong Hua-ze; Xiong Wen-cheng; Shao Yun

    2014-01-01

    The HJ-1C satellite was successfully launched in November 19, 2012. The HJ-1C and HJ-1A/1B satellites, which were launched in September 06, 2008, constitute the “2+1” small satellite constellation for environmental and disaster monitoring. This study focuses on the analysis and evaluation of the satellite performance with respect to environmental remote sensing, including land use interpretation, land cover classification, oil spill identification, retrieval of sea waves, and monitoring of...

  19. Lack of integrase inhibitors associated resistance mutations among HIV-1C isolates

    OpenAIRE

    Mulu, Andargachew; Maier, Melanie; Liebert, Uwe Gerd

    2015-01-01

    Background Although biochemical analysis of HIV-1 integrase enzyme suggested the use of integrase inhibitors (INIs) against HIV-1C, different viral subtypes may favor different mutational pathways potentially leading to varying levels of drug resistance. Thus, the aim of this study was to search for the occurrence and natural evolution of integrase polymorphisms and/or resistance mutations in HIV-1C Ethiopian clinical isolates prior to the introduction of INIs. Methods Plasma samples from chr...

  20. Carnitine palmitoyltransferase 1C promotes cell survival and tumor growth under conditions of metabolic stress

    OpenAIRE

    Zaugg, K; Yao, Y.; Reilly, P T; K. Kannan; Kiarash, R; Mason, J.; Huang, P.; Sawyer, S K; Fuerth, B.; Faubert, B; Kalliomäki, T; Elia, A J; Luo, X.; Nadeem, V; Bungard, D

    2011-01-01

    Tumor cells gain a survival/growth advantage by adapting their metabolism to respond to environmental stress, a process known as metabolic transformation. The best-known aspect of metabolic transformation is the Warburg effect, whereby cancer cells up-regulate glycolysis under aerobic conditions. However, other mechanisms mediating metabolic transformation remain undefined. Here we report that carnitine palmitoyltransferase 1C (CPT1C), a brain-specific metabolic enzyme, may participate in met...

  1. Characters of admissible representations of the affine superalgebra ŝl(2|1; C) k

    Science.gov (United States)

    Bowcock, P.; Hayes, M.; Taormina, A.

    1998-02-01

    We calculate characters and supercharacters for irreducible, admissible representations of the affine superalgebra ŝl(2|1; C) k in both the Ramond and Neveu-Schwarz sectors and discuss their modular properties in the special case of level k = - {1}/{2}. We also show that the non-degenerate integrable ŝl(2|1; C) k characters coincide with some N = 4 superconformal characters.

  2. Utility of “1”1C -methionine PET/CT in neuro-oncology

    International Nuclear Information System (INIS)

    Positron emission tomography (PET) with “1”1C-methionine (“1”1C-methionine PET/CT) is a new technique used to evaluate primary central nervous system (CNS) tumors. We describe our experience regarding the first 4 patients with glial tumors and “1”1C-methionine PET/CT. This is a descriptive, observational and prospective study of 4 patients between 38-50 years of age, with different gliomas (WHO classification). MRI and “1”1C-methionine PET/CT were performed in all cases. Case 1, gliomatosis cerebri grade II post-radiotherapy. Case 2, oligodendroglioma grade II diagnosed and treated with radiotherapy in 1993. Case 3, glioblastoma grade IV post-radiotherapy + temozolomide. Case 4, anaplastic oligoastrocytoma grade III post-radiotherapy + temozolomide. The pattern of “1”1C-methionine uptake compared with MRI showed tumor progression in cases 1, 3 and 4, and in case 2 showed uptake although the final diagnosis was pseudoprogression. Unlike “1”8fluordeoxiglucose PET/TC, “1”1C-methionine uptake in normal brain tissue and pseudoprogression is low, and gliomas are displayed as metabolically active areas. The “1”1C-methionine PET/CT provided valuable information on the tumoral behavior and extension, although in one case presented did not differentiate tumor progression from pseudoprogression. “1”1C-methionine PET/CT could be a useful tool in the study and follow-up to patients with gliomas. (authors)

  3. Comparison of Hemoglobin A1c assay performance on two different commercial systems

    Directory of Open Access Journals (Sweden)

    Jozo Ćorić

    2015-04-01

    Full Text Available Introduction: Glycated hemoglobin (HbA1c is formed by non-enzymatic binding of glucose to the free amino group of the N-terminal end of the ß-chain of hemoglobin A. HbA1c is representative of the mean blood glucose level over three months. The aim of the study was to evaluate the Hemoglobin A1c immunoturbidimetric assay performance on two different commercial systems.Methods: We evaluated the precision and trueness for determination of HbA1c in whole blood. Concentrations of total hemoglobin and HbA1c were evaluated on Dimension Xpand (Siemens and Cobas 501 (Roche analyzers. HbA1c was measured in a latex agglutination inhibition test. Commercial controls Liquichek Diabetes Control Level 1 and Liquichek Diabetes Control Level 2 (Bio Rad at two levels were used for quality control. Analytical validation of HbA1c included: within-run imprecision, between-day imprecision, inaccuracy and comparison determination on the human samples on 2 systems: Dimension Xpand and Cobas 501 analyzers. Results: Within-run imprecision on the commercially controls for Level 1 is 4.5% and Level 2 is 3.2% between-day imprecision on commercially controls is 6.1% Level 1 and 5.1% Level 2 for respectively inac- curacy on commercially controls for Level 1 is 1.8% and Level 2 is 4.8%. Method comparison on human samples shows the correlation coefficient of 0.99.Conclusion: The presented results of the analytical evaluation methods for the determination of HbA1c showed an acceptable accuracy and precision.

  4. Challenges in HbA1c Analysis and Reporting in Patients with Variant Hemoglobins.

    Science.gov (United States)

    Sultana, T A; Sheme, Z A; Sultana, G S; Sultana, B; Mishu, F A; Khan, N Z; Sarkar, B C; Muttalib, M A; Khan, S A; Choudhury, S; Mahtab, H

    2016-04-01

    Hemoglobin A1c (HbA1c) is a well-established indicator of mean glycemia. The presence of genetic variants of hemoglobin can profoundly affect the accuracy of HbA1c measurements. Variants of hemoglobin especially Hemoglobin E (HbE) is prevalent in South East Asia including Bangladesh. The objective of our study is to compare the HbA1c values measured on high performance liquid chromatography (HPLC) and Turbidimetric Inhibition Immunoassay (TINIA) in diabetic patients with variant hemoglobins including HbE. A total of 7595 diabetic patients receiving treatment at BIRDEM General Hospital were analyzed for HbA1c results within a period of two months from December 2013 to January 2014. Seventy two cases out of 7595 (0.95%) had either undetectable or below normal HbA1c levels (males-33 and females-39; ratio = 0.82:1) by HPLC method. In 34(0.45%) cases, HbA1c value was undetectable by HPLC method but was in the reportable range by TINIA method. In the other 38 (0.55%) cases, HbA1c levels were below the reportable range (levels, [Mean bias -5.2(-9.3 to 1.0), 95% CI] but agreed very well [mean bias -0.21 (-0.84 to 0.42), y=1.1037+0.776X; r2=0.30, pblood sugar levels of all the 72 cases correlated strongly with TINIA method (r2 =0.75, plevel is essential. MCV of 80fl or below may serve as a rough guide to select samples that require analysis by TINIA method. Moreover, HPLC may be a convenient and inexpensive tool for screening of hemoglobinopathies especially among diabetic population in Bangladesh. It may therefore be helpful in improving management of complications related to both anaemia and iron overload. PMID:27277356

  5. The SWITCH study (sensing with insulin pump therapy to control HbA(1c))

    DEFF Research Database (Denmark)

    Conget, Ignacio; Battelino, Tadej; Giménez, Marga;

    2011-01-01

    injections. However, there is still a proportion of subjects using continuous subcutaneous insulin infusion in whom goals for metabolic control are far from achieved or benefits of this type of insulin therapy are transient. The SWITCH (Sensing With Insulin pump Therapy to Control HbA(1c) [hemoglobin A1c......]) study is a multicenter, randomized, controlled, crossover study to evaluate if adding CGM to experienced pump patients with suboptimal metabolic control will provide additional insight enabling clinical and therapeutic benefit....

  6. CACNA1C risk variant affects facial emotion recognition in healthy individuals

    OpenAIRE

    Vanessa Nieratschker; Christof Brückmann; Christian Plewnia

    2015-01-01

    Recognition and correct interpretation of facial emotion is essential for social interaction and communication. Previous studies have shown that impairments in this cognitive domain are common features of several psychiatric disorders. Recent association studies identified CACNA1C as one of the most promising genetic risk factors for psychiatric disorders and previous evidence suggests that the most replicated risk variant in CACNA1C (rs1006737) is affecting emotion recognition and processing...

  7. Association between methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism and age of onset in schizophrenia

    DEFF Research Database (Denmark)

    Vares, Maria; Saetre, Peter; Deng, Hong;

    2010-01-01

    Different lines of evidence indicate that methylenetetrahydrofolate reductase (MTHFR) functional gene polymorphisms, causative in aberrant folate-homocysteine metabolism, are associated with increased vulnerability to several heritable developmental disorders. Opposing views are expressed...

  8. Histochemical Localization of Glutathione Dependent NBT—Reductase in Mouse Skin

    Institute of Scientific and Technical Information of China (English)

    YOESHWERSHUKLA

    2001-01-01

    Objective:Localization of the glutathione dependent Nitroblue tetrazolium(NBT) reductase in fresh frozen sections of mouse skin and possible dependence of NBT reductase on tissue thiol levels has been investigated.Methods:The fresh frozen tissue sections(8m thickness)were prepared and incuated in medium containing NBT,reduced glutathione(GSH) and Phosphate uffer,The staining for GSH was performed with mercury orange.Results:The activity of the NBT-reductase in mouse skin has een found to be localized in the areas rich in glutatione and actively proliferating area of the skin.Conclusion:The activity of the NBT-reductase seems to be dependent on the glutatione contents.

  9. Redesigning alcohol dehydrogenases/reductases for more efficient biosynthesis of enantiopure isomers.

    Science.gov (United States)

    Zhang, Rongzhen; Xu, Yan; Xiao, Rong

    2015-12-01

    Alcohol dehydrogenases/reductases predominantly catalyze the asymmetric biosynthesis of optically pure stereoisomers because of their unique chiral constitutions. The enantioselectivities of alcohol dehydrogenases/reductases are substrate- and cofactor-dependent, and therefore they usually catalyze specific reactions with high enantioselectivity under physiological conditions; this may not be suitable for asymmetric biosynthesis with non-natural substrates or non-natural cofactors, and under nonphysiological conditions. It is therefore necessary to modify alcohol dehydrogenases/reductases using various redesigning tools such as directed evolution and rational design, and their combinations, as well as engineering enzyme modules for more efficient production of "non-natural" products. In this article, progress in these aspects of alcohol dehydrogenase/reductase design is reviewed, and future challenges are discussed. PMID:26320091

  10. 5α-reductase inhibitors, antiviral and anti-tumor activities of some steroidal cyanopyridinone derivatives.

    Science.gov (United States)

    Al-Mohizea, Abdullah M; Al-Omar, Mohamed A; Abdalla, Mohamed M; Amr, Abdel-Galil E

    2012-01-01

    We herein report the 5α-reductase inhibitors, antiviral and anti-tumor activities of some synthesized heterocyclic cyanopyridone and cyanothiopyridone derivatives fused with steroidal structure. Initially the acute toxicity of the compounds was assayed via the determination of their LD(50). All the compounds, except 3b, were interestingly less toxic than the reference drug (Prednisolone(®)). Seventeen heterocyclic derivatives containing a cyanopyridone or cyanothiopyridone rings fused to a steroidal moiety were synthesized and screened for their 5α-reductase inhibitors, antiviral and anti-tumor activities comparable to that of Anastrozole, Bicalutamide, Efavirenz, Capravirine, Ribavirin, Oseltamivir and Amantadine as the reference drugs. Some of the compounds exhibited better 5α-reductase inhibitors, antiviral and anti-tumor activities than the reference drugs. The detailed 5α-reductase inhibitors, antiviral and anti-tumor activities of the synthesized compounds were reported. PMID:22057085

  11. Transcript level of AKR1C3 is down-regulated in gastric cancer.

    Science.gov (United States)

    Frycz, Bartosz Adam; Murawa, Dawid; Borejsza-Wysocki, Maciej; Wichtowski, Mateusz; Spychała, Arkadiusz; Marciniak, Ryszard; Murawa, Paweł; Drews, Michał; Jagodziński, Paweł Piotr

    2016-04-01

    Steroid hormones have been shown to play a role in gastric carcinogenesis. Large amounts of steroid hormones are locally produced in the peripheral tissues of both genders. Type 5 of 17β-hydroxysteroid dehydrogenase, encoded by the AKR1C3 gene, plays a pivotal role in both androgen and estrogen metabolism, and its expression was found to be deregulated in different cancers. In this study we measured AKR1C3 transcript and protein levels in nontumoral and primary tumoral gastric tissues, and evaluated their association with some clinicopathological features of gastric cancer (GC). We found decreased levels of AKR1C3 transcript (p T3, T4, and G3 grades. We also determined the effect of the histone deacetylase inhibitor sodium butyrate (NaBu) on AKR1C3 expression in EPG 85-257 and HGC-27 GC cell lines. We found that NaBu elevates the levels of both AKR1C3 transcript and protein in the cell lines we investigated. Together, our results suggest that decreased expression of AKR1C3 may be involved in development of GC and can be restored by NaBu. PMID:27019068

  12. Lipid and liver abnormalities in haemoglobin A1c-defined prediabetes and type 2 diabetes

    DEFF Research Database (Denmark)

    Calanna, S; Scicali, R; Di Pino, A;

    2014-01-01

    .7 to 6.4% (39-46 mmol/mol), 50 newly diagnosed patients with HbA1c-defined type 2 diabetes (HbA1c ≥6.5% [≥48 mmol/mol]), and 67 controls with HbA1c lower than 5.7% (<39 mmol/mol), were studied. Fasting blood samples for lipid profiles, fatty liver index (FLI), bioimpedance analysis, ultrasound scan of......BACKGROUND AND AIMS: We aimed to investigate lipid abnormalities and liver steatosis in patients with HbA1c-defined prediabetes and type 2 diabetes compared to individuals with HbA1c-defined normoglycaemia. METHODS AND RESULTS: Ninety-one subjects with prediabetes according to HbA1c, i.e. from 5...... the liver, and BARD (body mass index, aspartate aminotransferase/alanine aminotransferase ratio, diabetes) score for evaluation of liver fibrosis, were performed in all subjects. In comparison to controls, subjects with prediabetes were characterised by: lower apolipoprotein AI and HDL cholesterol...

  13. Applications of Environmental Remote Sensing by HJ-1C SAR Imageries

    Directory of Open Access Journals (Sweden)

    Tian Wei

    2014-06-01

    Full Text Available The HJ-1C satellite was successfully launched in November 19, 2012. The HJ-1C and HJ-1A/1B satellites, which were launched in September 06, 2008, constitute the “2+1” small satellite constellation for environmental and disaster monitoring. This study focuses on the analysis and evaluation of the satellite performance with respect to environmental remote sensing, including land use interpretation, land cover classification, oil spill identification, retrieval of sea waves, and monitoring of coastal mariculture. The data used in this study cover the city of Beijing and the sea of the Fujian Province. Nine HJ-1C satellite images (level-2, S band, VV Pol, strip mode, 5 m resolution from December 2012 to January 2013 are used. The conclusions are as follows: (1 the HJ-1C SAR images can be used to manually identify farmland, woodland, roads, rivers, urban construction, and rural residential areas; (2 the accuracy of the automatic land cover classification increased significantly when the HJ-1C SAR and HJ-1B CCD fusion images are used; (3 the HJ-1C satellite can be used to identify oil spills, to invert wave parameters, and to extract information regarding inshore aquaculture.

  14. What is the Role of HbA1c in Diabetic Hemodialysis Patients?

    Science.gov (United States)

    Coelho, Silvia

    2016-01-01

    The definition of a good glycemic control in patients with diabetes mellitus on hemodialysis is far from settled. In the general population, hemoglobin A1c is highly correlated with the average glycemia of the last 8-12 weeks. However, in hemodialysis patients, the correlation of hbA1c with glycemia is weaker as it also reflects changes in hemoglobin characteristics and red blood cells half-life. As expected, studies show that the association between HbA1c and outcomes in these patients differ from the general population. Therefore, the value of HbA1c in the treatment of hemodialysis patients has been questioned. Guidelines are generally cautious in their recommendations about possible targets of HbA1c in this population. Indeed, the risk of not treating hyperglycemia should be weighed against the particularly high risk of precipitating hypoglycemia in dialysis patients. In this review, a critical analysis of the current role of HbA1c in the care of hemodialysis patients is presented. PMID:26138753

  15. Protein kinase Cbeta mediates hepatic induction of sterol-regulatory element binding protein-1c by insulin

    OpenAIRE

    Yamamoto, Takashi; Watanabe, Kazuhisa; Inoue, Noriyuki; Nakagawa, Yoshimi; Ishigaki, Naomi; Matsuzaka, Takashi; Takeuchi, Yoshinori; Kobayashi, Kazuto; Yatoh, Shigeru; Takahashi, Akimitsu; Suzuki, Hiroaki; Yahagi, Naoya; Gotoda, Takanari; Yamada, Nobuhiro; Shimano, Hitoshi

    2010-01-01

    Sterol-regulatory element binding protein-1c (SREBP-1c) is a transcription factor that controls lipogenesis in the liver. Hepatic SREBP-1c is nutritionally regulated, and its sustained activation causes hepatic steatosis and insulin resistance. Although regulation of SREBP-1c is known to occur at the transcriptional level, the precise mechanism by which insulin signaling activates SREBP-1c promoter remains to be elucidated. Here we show that protein kinase C beta (PKCbeta) is a key mediator o...

  16. Comparison of the Stereospecificity and Immunoreactivity of NADH-Ferricyanide Reductases in Plant Membranes

    OpenAIRE

    Fredlund, Kenneth M.; Struglics, André; Widell, Susanne; ASKERLUND, Per; Kader, Jean-Claude; Møller, Ian M.

    1994-01-01

    The substrate stereospecificity of NADH-ferricyanide reductase activities in the inner mitochondrial membrane and peroxisomal membrane of potato (Solanum tuberosum L.) tubers, spinach (Spinacea oleracea L.) leaf plasma membrane, and red beetroot (Beta vulgaris L.) tonoplast were all specific for the [beta]-hydrogen of NADH, whereas the reductases in wheat root (Triticum aestivum L.) endoplasmic reticulum and potato tuber outer mitochondrial membrane were both [alpha]-hydrogen specific. In all...

  17. Nucleotide sequence of a cyanobacterial nifH gene coding for nitrogenase reductase

    OpenAIRE

    Mevarech, Moshe; Rice, Douglas; Haselkorn, Robert

    1980-01-01

    The nucleotide sequence of nifH, the structural gene for nitrogenase reductase (component II or Fe protein of nitrogenase) from the cyanobacterium Anabaena 7120 has been determined. Also reported are 194 bases of the 5′-flanking sequence and 170 bases of the 3′-flanking sequence. The predicted amino acid sequence was compared with that determined for the complete nitrogenase reductase of Clostridium pasteurianum and the cysteine-containing peptides of the protein from Azotobacter vinelandii. ...

  18. Overexpression of Soybean Isoflavone Reductase (GmIFR) Enhances Resistance to Phytophthora sojae in Soybean

    OpenAIRE

    Cheng, Qun; Li, Ninghui; Dong, Lidong; Zhang, Dayong; Fan, Sujie; Jiang, Liangyu; Wang, Xin; Xu, Pengfei; Zhang, Shuzhen

    2015-01-01

    Isoflavone reductase (IFR) is an enzyme involved in the biosynthetic pathway of isoflavonoid phytoalexin in plants. IFRs are unique to the plant kingdom and are considered to have crucial roles in plant response to various biotic and abiotic environmental stresses. Here, we report the characterization of a novel member of the soybean isoflavone reductase gene family GmIFR. Overexpression of GmIFR transgenic soybean exhibited enhanced resistance to Phytophthora sojae. Following stress treatmen...

  19. Design and synthesis of hepatoselective, pyrrole-based HMG-CoA reductase inhibitors.

    Science.gov (United States)

    Pfefferkorn, Jeffrey A; Song, Yuntao; Sun, Kuai-Lin; Miller, Steven R; Trivedi, Bharat K; Choi, Chulho; Sorenson, Roderick J; Bratton, Larry D; Unangst, Paul C; Larsen, Scott D; Poel, Toni-Jo; Cheng, Xue-Min; Lee, Chitase; Erasga, Noe; Auerbach, Bruce; Askew, Valerie; Dillon, Lisa; Hanselman, Jeffrey C; Lin, Zhiwu; Lu, Gina; Robertson, Andrew; Olsen, Karl; Mertz, Thomas; Sekerke, Catherine; Pavlovsky, Alexander; Harris, Melissa S; Bainbridge, Graeme; Caspers, Nicole; Chen, Huifen; Eberstadt, Matthias

    2007-08-15

    This manuscript describes the design and synthesis of a series of pyrrole-based inhibitors of HMG-CoA reductase for the treatment of hypercholesterolemia. Analogs were optimized using structure-based design and physical property considerations resulting in the identification of 44, a hepatoselective HMG-CoA reductase inhibitor with excellent acute and chronic efficacy in a pre-clinical animal models. PMID:17574412

  20. Protein Method for Investigating Mercuric Reductase Gene Expression in Aquatic Environments

    OpenAIRE

    Ogunseitan, O A

    1998-01-01

    A colorimetric assay for NADPH-dependent, mercuric ion-specific oxidoreductase activity was developed to facilitate the investigation of mercuric reductase gene expression in polluted aquatic ecosystems. Protein molecules extracted directly from unseeded freshwater and samples seeded with Pseudomonas aeruginosa PU21(Rip64) were quantitatively assayed for mercuric reductase activity in microtiter plates by stoichiometric coupling of mercuric ion reduction to a colorimetric redox chain through ...

  1. Molecular pharmacology and antitumor activity of palmarumycin based inhibitors of thioredoxin reductase.

    OpenAIRE

    Powis, Garth; Wipf, Peter; Lynch, Stephen M.; Birmingham, Anne; Kirkpatrick, D. Lynn

    2006-01-01

    The cytosolic thioredoxin (Trx) redox system comprising Trx-1 and the NADPH dependent thioredoxin reductase -1 reductase (TrxR-1) is an important regulator of cell growth and survival. Trx-1 is overexpressed in many human tumors where it is associated with increased cell proliferation, decreased apoptosis and decreased patient survival. We hypothesized that TrxR-1 provides a target to inhibit the activity of overexpressed Trx-1 for the development of novel anticancer agents. We found that the...

  2. Soil acidity as affecting micronutrients concentration, nitrato reductase enzyme activity and yield in upland rice plants

    OpenAIRE

    Edemar Moro; Carlos Alexandre Costa Crusciol; Heitor Cantarella; Adriano Stephan Nascente; Adriana Lima Moro; Fernando Broetto

    2013-01-01

    The lowest grain yield of rice under no-tillage system (NTS) in relation to the conventional system may be due to the predominance nitrate in the soil and the low nitrate reductase activity. Another reason may be caused by micronutrient deficiency because of superficially soil acidity corrections. Therefore, the objective of this study was to evaluate the changes caused by soil pH in the N forms in the soil, micronutrients concentration in rice plants, nitrate reductase activity, yield of ric...

  3. INHIBITORY ACTIVITY OF FLAVONOIDS ON THE LENS ALDOSE REDUCTASE OF HEALTHY AND DIABETIC RATS

    OpenAIRE

    M.T. Goodarzi; Zal, F; M. Malakooti; M. R. Safari S. Sadeghian

    2006-01-01

    Aldose reductase is a critical enzyme in the polyol pathway that plays an important role in diabetes mellitus. Inhibition of the activity of this enzyme can prevent cataract in diabetic patients’lenses. In this study the inhibitory effect of two flavonoids, quercetin and naringin, in the activity of aldose reductase in streptozotocin-induced diabetic and healthy rats were investigated. Thirty male rats were divided in six groups. The first, second and third group were healthy rats that receiv...

  4. Glutathione Reductase/Glutathione Is Responsible for Cytotoxic Elemental Sulfur Tolerance via Polysulfide Shuttle in Fungi*

    OpenAIRE

    Sato, Ikuo; Shimatani, Kanami; Fujita, Kensaku; Abe, Tsuyoshi; Shimizu, Motoyuki; Fujii, Tatsuya; Hoshino, Takayuki; Takaya, Naoki

    2011-01-01

    Fungi that can reduce elemental sulfur to sulfide are widely distributed, but the mechanism and physiological significance of the reaction have been poorly characterized. Here, we purified elemental sulfur-reductase (SR) and cloned its gene from the elemental sulfur-reducing fungus Fusarium oxysporum. We found that NADPH-glutathione reductase (GR) reduces elemental sulfur via glutathione as an intermediate. A loss-of-function mutant of the SR/GR gene generated less sulfide from elemental sulf...

  5. Expression of the mouse dihydrofolate reductase complementary deoxyribonucleic acid in simian virus 40 vectors.

    OpenAIRE

    Subramani, S.; Mulligan, R.; Berg, P

    1981-01-01

    A mouse complementary deoxyribonucleic acid segment coding for the enzyme dihydrofolate reductase has been cloned in two general classes of vectors containing simian virus 40 deoxyribonucleic acid: (i) those that can be propagated as virions in permissive cells and (ii) those that can be introduced into and maintained stably in various mammalian cells. Both types of vectors express the mouse dihydrofolate reductase by using signals supplied by simian virus 40 deoxyribonucleic acid sequences. ...

  6. Interaction of Product Analogs with the Active Site of Rhodobacter sphaeroides Dimethylsulfoxide Reductase

    OpenAIRE

    George, Graham N.; Nelson, Kimberly Johnson; Harris, Hugh H.; Doonan, Christian J.; Rajagopalan, K V

    2007-01-01

    We report a structural characterization using X-ray absorption spectroscopy of Rhodobacter sphaeroides dimethylsulfoxide (DMSO) reductase reduced with trimethylarsine, and show that this is structurally analogous to the physiologically relevant dimethylsulfide-reduced DMSO reductase. Our data unambiguously indicate that these species should be regarded as formal MoIV species, and indicate a classical coordination complex of trimethylarsine oxide, with no special structural distortions. The si...

  7. In Silico Docking studies of Aldose Reductase Inhibitory activity of selected Flavonoids

    OpenAIRE

    Muthuswamy Umamaheswari; C. S. Aji; Kuppusamy Asokkumar; Thirumalaisamy Sivashanmugam; Varadharajan Subhadradevi; Puliyath Jagannath; Arumugam Madeswaran

    2012-01-01

    New drugs for the inhibition of the enzyme aldose reductase are in development and they have to be screened before being considered for preclinical and clinical evaluation. The current study deals with the evaluation of the cyclooxygenase inhibitory activity of flavonoids using in silico docking studies. In this perspective, flavonoids like Farobin-A, Gericudranin- B, Glaziovianin-A, Rutin, and Xanthotoxin were selected. Epalrestat, a known aldose reductase inhibitor was used as the standard....

  8. Virtual screening of plant derived compounds for aldose reductase inhibition using molecular docking

    OpenAIRE

    Muppalaneni, Naresh Babu; Rao, Allam Appa

    2012-01-01

    The role of the aldose reductase in type 2 diabetes is widely described. Therefore, it is of interest to identify plant derived compounds to inhibit its activity. We studied the protein-ligand interaction of 267 compounds from different parts of seven plants (Allium sativum, Coriandrum sativum, Dacus carota, Murrayyakoneigii, Eucalyptus, Calendula officinalis and Lycopersicon esculentum) with aldose reductase as the target protein. Molecular docking and re-scoring of top ten compounds (using ...

  9. Cooperative function of antioxidant and redox systems against oxidative stress in male reproductive tissues

    Institute of Scientific and Technical Information of China (English)

    JunichiFujii; YoshihitoIuchi; ShingoMatsuki; TatsuyaIshii

    2003-01-01

    Reactive oxygen species (ROS) are produced under oxidative stress, such as high oxygen concentration and during the metabolic consumption of oxygen molecules. Male reproductive tissues appear to be continuously exposed to ROS produced by active metabolism. In addition, spermatozoa must pass through a high oxygen environ-ment during the mating process. Thus, to maintain viable reproductive ability, a protective mechanism against oxida-tive stress is of importance. Here, we overview our current understanding of the cooperative function of antioxidative and redox systems that are involved in male fertility. Superoxide dismutase and glutathione peroxidase are major enzymes that scavenge harmful ROS in male reproductive organs. In turn, glutathione and thioredoxin systems constitute the main redox systems that repair oxidized and damaged molecules and also play a role in regulating a variety of cellular functions. While glutathione functions as an antioxidant by donating electrons to glutathione peroxidase and thioredoxin donates electrons to peroxiredoxin as a counterpart of glutathione peroxidase. In addition,aldo-keto reductases, which detoxify carbonyl compounds produced by oxidative stress, are present at high levels in the epithelia of the genital tract and Sertoli cells of the testis. Since these systems are involved in cross-talk, a comprehensive understanding will be required to maintain the physiological functions of male reproductive system.( Asian J Andro12003 Sep; 5: 231-242)

  10. DIFFERENTIAL PROTEOME ANALYSIS OF THE MALE AND FEMALE ANTENNAE FROM Holotrichia parallela.

    Science.gov (United States)

    Zhang, Ju-Hong; Wang, Shang; Yang, Shuang; Yi, Jiankun; Liu, Yan; Xi, Jing-Hui

    2016-08-01

    To understand the olfactory mechanisms of Holotrichia parallela antennae in detecting volatile compounds in the environment, protein profiles of H. parallela antennae were analyzed using two-dimensional electrophoresis followed by mass spectrometry and bioinformatics analyses. Approximately 1,100 protein spots in silver staining gel were detected. Quantitative image analysis revealed that in total 47 protein spots showed significant changes in different genders of adult antennae. Thirty-five differentially expressed proteins were identified by Matrix assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF/TOF) tandem mass spectrometer, among which 65.7% are involved in carbohydrate and energy metabolism, antioxidant system, transport, and amino acid/nucleotide metabolism. Some proteins identified here have not been reported previously in insect antennae. Identified male-biased proteins included odorant-binding protein 4, pheromone-binding protein-related protein 2, odorant-binding protein 14, prophenoloxidase-I, acyl-CoA dehydrogenase, aldo-keto reductase-like, carbamoyl phosphate synthetase, etc. whereas some proteins are female biased, such as antennae-rich cytochrome P450, aldehyde dehydrogenase, and putative glutamine synthetase. Alterations in the levels of some proteins were further confirmed by real time polymerase chain reaction (RT-PCR). The proteomic resources displayed here are valuable for the discovery of proteins from H. parallela antennae. PMID:27396371

  11. Facile fabrication of CdSe/CdS quantum dots and their application on the screening of colorectal cancer

    Energy Technology Data Exchange (ETDEWEB)

    Cao, Hongfeng; Dong, Quanjin, E-mail: qjdong1508@163.com [Zhejiang Provincial People’s Hospital, Department of Colorectal Surgery (China); Hu, Li [Nanjing University of Science and Technology, School of Environmental and Biological Engineering (China); Tu, Shiliang; Chai, Rui; Dai, Qiaoqiong [Zhejiang Provincial People’s Hospital, Department of Colorectal Surgery (China)

    2015-11-15

    In this paper, a facile aqueous route to water-soluble CdSe/CdS quantum dots (QDs) under mild conditions has been developed. The samples were characterized by means of transmission electron microscopy, energy-dispersive X-ray spectroscopy, and photoluminescence (PL) spectroscopy. The PL property of the QDs can be controlled by adjusting the reaction time. The CdSe/CdS QDs after 48-h reaction with size of 5 nm have the strongest PL intensity located at 553 nm, and the highest quantum yield of 19.9 %. The obtained QDs were applied for the colorectal cancer screening. The QDs could be conjugated with antibody of aldo-keto reductase family 1, member B10 (AKR1B10) for the detection of AKR1B10. The AKR1B10 in PBS/5 % serum solution with concentration of 1 ng/mL could be well calibrated, and the limit of detection could be lower than 0.05 ng/mL.

  12. Methyl Jasmonate: Putative Mechanisms of Action on Cancer Cells Cycle, Metabolism, and Apoptosis

    Directory of Open Access Journals (Sweden)

    Italo Mario Cesari

    2014-01-01

    Full Text Available Methyl jasmonate (MJ, an oxylipid that induces defense-related mechanisms in plants, has been shown to be active against cancer cells both in vitro and in vivo, without affecting normal cells. Here we review most of the described MJ activities in an attempt to get an integrated view and better understanding of its multifaceted modes of action. MJ (1 arrests cell cycle, inhibiting cell growth and proliferation, (2 causes cell death through the intrinsic/extrinsic proapoptotic, p53-independent apoptotic, and nonapoptotic (necrosis pathways, (3 detaches hexokinase from the voltage-dependent anion channel, dissociating glycolytic and mitochondrial functions, decreasing the mitochondrial membrane potential, favoring cytochrome c release and ATP depletion, activating pro-apoptotic, and inactivating antiapoptotic proteins, (4 induces reactive oxygen species mediated responses, (5 stimulates MAPK-stress signaling and redifferentiation in leukemia cells, (6 inhibits overexpressed proinflammatory enzymes in cancer cells such as aldo-keto reductase 1 and 5-lipoxygenase, and (7 inhibits cell migration and shows antiangiogenic and antimetastatic activities. Finally, MJ may act as a chemosensitizer to some chemotherapics helping to overcome drug resistant. The complete lack of toxicity to normal cells and the rapidity by which MJ causes damage to cancer cells turn MJ into a promising anticancer agent that can be used alone or in combination with other agents.

  13. Oxidative Stress and Carbonyl Lesions in Ulcerative Colitis and Associated Colorectal Cancer

    Directory of Open Access Journals (Sweden)

    Zhiqi Wang

    2016-01-01

    Full Text Available Oxidative stress has long been known as a pathogenic factor of ulcerative colitis (UC and colitis-associated colorectal cancer (CAC, but the effects of secondary carbonyl lesions receive less emphasis. In inflammatory conditions, reactive oxygen species (ROS, such as superoxide anion free radical (O2∙-, hydrogen peroxide (H2O2, and hydroxyl radical (HO∙, are produced at high levels and accumulated to cause oxidative stress (OS. In oxidative status, accumulated ROS can cause protein dysfunction and DNA damage, leading to gene mutations and cell death. Accumulated ROS could also act as chemical messengers to activate signaling pathways, such as NF-κB and p38 MAPK, to affect cell proliferation, differentiation, and apoptosis. More importantly, electrophilic carbonyl compounds produced by lipid peroxidation may function as secondary pathogenic factors, causing further protein and membrane lesions. This may in turn exaggerate oxidative stress, forming a vicious cycle. Electrophilic carbonyls could also cause DNA mutations and breaks, driving malignant progression of UC. The secondary lesions caused by carbonyl compounds may be exceptionally important in the case of host carbonyl defensive system deficit, such as aldo-keto reductase 1B10 deficiency. This review article updates the current understanding of oxidative stress and carbonyl lesions in the development and progression of UC and CAC.

  14. De Novo Sequencing and Analysis of Lemongrass Transcriptome Provide First Insights into the Essential Oil Biosynthesis of Aromatic Grasses

    Science.gov (United States)

    Meena, Seema; Kumar, Sarma R.; Venkata Rao, D. K.; Dwivedi, Varun; Shilpashree, H. B.; Rastogi, Shubhra; Shasany, Ajit K.; Nagegowda, Dinesh A.

    2016-01-01

    Aromatic grasses of the genus Cymbopogon (Poaceae family) represent unique group of plants that produce diverse composition of monoterpene rich essential oils, which have great value in flavor, fragrance, cosmetic, and aromatherapy industries. Despite the commercial importance of these natural aromatic oils, their biosynthesis at the molecular level remains unexplored. As the first step toward understanding the essential oil biosynthesis, we performed de novo transcriptome assembly and analysis of C. flexuosus (lemongrass) by employing Illumina sequencing. Mining of transcriptome data and subsequent phylogenetic analysis led to identification of terpene synthases, pyrophosphatases, alcohol dehydrogenases, aldo-keto reductases, carotenoid cleavage dioxygenases, alcohol acetyltransferases, and aldehyde dehydrogenases, which are potentially involved in essential oil biosynthesis. Comparative essential oil profiling and mRNA expression analysis in three Cymbopogon species (C. flexuosus, aldehyde type; C. martinii, alcohol type; and C. winterianus, intermediate type) with varying essential oil composition indicated the involvement of identified candidate genes in the formation of alcohols, aldehydes, and acetates. Molecular modeling and docking further supported the role of identified protein sequences in aroma formation in Cymbopogon. Also, simple sequence repeats were found in the transcriptome with many linked to terpene pathway genes including the genes potentially involved in aroma biosynthesis. This work provides the first insights into the essential oil biosynthesis of aromatic grasses, and the identified candidate genes and markers can be a great resource for biotechnological and molecular breeding approaches to modulate the essential oil composition. PMID:27516768

  15. De Novo Sequencing and Analysis of Lemongrass Transcriptome Provide First Insights into the Essential Oil Biosynthesis of Aromatic Grasses.

    Science.gov (United States)

    Meena, Seema; Kumar, Sarma R; Venkata Rao, D K; Dwivedi, Varun; Shilpashree, H B; Rastogi, Shubhra; Shasany, Ajit K; Nagegowda, Dinesh A

    2016-01-01

    Aromatic grasses of the genus Cymbopogon (Poaceae family) represent unique group of plants that produce diverse composition of monoterpene rich essential oils, which have great value in flavor, fragrance, cosmetic, and aromatherapy industries. Despite the commercial importance of these natural aromatic oils, their biosynthesis at the molecular level remains unexplored. As the first step toward understanding the essential oil biosynthesis, we performed de novo transcriptome assembly and analysis of C. flexuosus (lemongrass) by employing Illumina sequencing. Mining of transcriptome data and subsequent phylogenetic analysis led to identification of terpene synthases, pyrophosphatases, alcohol dehydrogenases, aldo-keto reductases, carotenoid cleavage dioxygenases, alcohol acetyltransferases, and aldehyde dehydrogenases, which are potentially involved in essential oil biosynthesis. Comparative essential oil profiling and mRNA expression analysis in three Cymbopogon species (C. flexuosus, aldehyde type; C. martinii, alcohol type; and C. winterianus, intermediate type) with varying essential oil composition indicated the involvement of identified candidate genes in the formation of alcohols, aldehydes, and acetates. Molecular modeling and docking further supported the role of identified protein sequences in aroma formation in Cymbopogon. Also, simple sequence repeats were found in the transcriptome with many linked to terpene pathway genes including the genes potentially involved in aroma biosynthesis. This work provides the first insights into the essential oil biosynthesis of aromatic grasses, and the identified candidate genes and markers can be a great resource for biotechnological and molecular breeding approaches to modulate the essential oil composition. PMID:27516768

  16. The role of glutathione reductase and related enzymes on cellular redox homoeostasis network.

    Science.gov (United States)

    Couto, Narciso; Wood, Jennifer; Barber, Jill

    2016-06-01

    In this review article we examine the role of glutathione reductase in the regulation, modulation and maintenance of cellular redox homoeostasis. Glutathione reductase is responsible for maintaining the supply of reduced glutathione; one of the most abundant reducing thiols in the majority of cells. In its reduced form, glutathione plays key roles in the cellular control of reactive oxygen species. Reactive oxygen species act as intracellular and extracellular signalling molecules and complex cross talk between levels of reactive oxygen species, levels of oxidised and reduced glutathione and other thiols, and antioxidant enzymes such as glutathione reductase determine the most suitable conditions for redox control within a cell or for activation of programmed cell death. Additionally, we discuss the translation and expression of glutathione reductase in a number of organisms including yeast and humans. In yeast and human cells, a single gene expresses more than one form of glutathione reductase, destined for residence in the cytoplasm or for translocation to different organelles; in plants, however, two genes encoding this protein have been described. In general, insects and kinetoplastids (a group of protozoa, including Plasmodia and Trypanosoma) do not express glutathione reductase or glutathione biosynthetic enzymes. Instead, they express either the thioredoxin system or the trypanothione system. The thioredoxin system is also present in organisms that have the glutathione system and there may be overlapping functions with cross-talk between the two systems. Finally we evaluate therapeutic targets to overcome oxidative stress associated cellular disorders. PMID:26923386

  17. INHIBITION OF TYPE I 5α-REDUCTASE BY MEDICINAL PLANT EXTRACTS

    Directory of Open Access Journals (Sweden)

    Patil Vijaya

    2011-03-01

    Full Text Available Type I 5α-reductase has been implicated in skin disorders such as acne, hirsutism and male pattern baldness and its inhibition offers a potential treatment for these disorders. The aim of this study was to investigate the inhibition of type I 5α-reductase activity by extracts from Indian medicinal plants. Plant extracts were screened and selected based on their ability to inhibit Propionibacterium acnes and Staphylococcus epidermidis. Since type I 5α-reductase metabolises testosterone to Δ4-androstene-3, 17-dione, the activity of enzyme was determined using RIA for testosterone and Δ4-androstene-3, 17-dione. It was found that methanolic extract of Embelia ribes was a potent inhibitor of type I 5α-reductase (IC50:100μg/mL. Extracts of Vitex negundo, Terminalia chebula, and Terminalia bellerica which also inhibited type I 5α-reductase (IC50: 200-390 μg /mL. Therefore herbal formulation of these plant extracts may be used in the treatment of skin disorders involving type I 5α-reductase.

  18. Nitrate reductase activity and its relationship with applied nitrogen in soybean

    International Nuclear Information System (INIS)

    Field experiments were conducted to study the nitrate reductase activity and its relationship to nitrogen by using frame tests (pot without bottom), sand culture and 15N-urea at transplanting in soybean variety Suinong 14. Results showed that the activity of nitrate reductase in leaf changed as a signal peak curve with the soybean growth, lower in vegetative growth phase, higher in reproductive growth period and reached the peak in blooming period, then decreased gradually. Nitrogen application showed obvious effect on the nitrate reductase activity. The activities of nitrate reductase in leaves followed the order of N135 > N90 > N45 > N0 in vegetative growth stage, no clear regularity was found during the whole reproductive growth period. The activities of nitrate reductase in leaves were accorded with the order of upper leaves > mid leaves > lower leaves, and it was very significant differences (P15N labeling method during beginning seed stage and full seed stage shown that 15N abundance in various organs at different node position also followed the same order, suggesting that high level of nitrate reductase activity at upper leaves of soybean promoted the assimilation of NO3-. (authors)

  19. Prevalence of Diabetes and Prediabetes according to Fasting Plasma Glucose and HbA1c

    Directory of Open Access Journals (Sweden)

    Ja Young Jeon

    2013-10-01

    Full Text Available BackgroundDue to the inconvenience of performing oral glucose tolerance tests and day to day variability in glucose level, glycated hemoglobin (HbA1c has been recommended by the American Diabetes Association as a method to diagnose diabetes. In addition, the Korean Diabetes Association has also recommended the use of HbA1c as a diagnostic test for diabetes. In this study, we evaluated the prevalence of diabetes according to fasting plasma glucose (FPG level only or the combination of FPG and HbA1c tests.MethodsData from the 2011 Korea National Health and Nutrition Examination Survey (KNHANES were analyzed. Among 5,811 subjects aged 30 years or older, 5,020 were selected after excluding the data of fasting time <8 hours, missing values from fasting glucose or HbA1c level, previous diagnosis of diabetes made by physicians, or current use of antidiabetic medications. Diabetes was defined as FPG ≥126 mg/dL, previous diagnosis of diabetes made by a medical doctor, current use of antidiabetic medications, and/or HbA1c ≥6.5%. Prediabetes was defined as FPG of 100 to 125 mg/dL and/or HbA1c of 5.7% to 6.4%.ResultsWhen we used FPG only, the prevalence of diabetes and prediabetes were 10.5% (men, 12.6%; women, 8.5% and 19.3% (men, 23.8%; women, 14.9%, respectively. When HbA1c was included as a diagnostic test, the prevalence of diabetes and prediabetes increased to 12.4% (men, 14.5%; women, 10.4% and 38.3% (men, 41%; women, 35.7%, respectively. Participants with HbA1c ≥6.5% and fasting glucose level <126 mg/dL were older and had lower estimated glomerular filtration rate.ConclusionWe concluded that using fasting glucose level only may result in an underestimation of diabetes and prediabetes. HbA1c is an acceptable complementary diagnostic test for diabetes in Korean patients. However, national standardization is needed to order to use HbA1c as a diagnostic method of diabetes and prediabetes.

  20. Isobutyraldehyde production from Escherichia coli by removing aldehyde reductase activity

    Directory of Open Access Journals (Sweden)

    Rodriguez Gabriel M

    2012-06-01

    Full Text Available Abstract Background Increasing global demand and reliance on petroleum-derived chemicals will necessitate alternative sources for chemical feedstocks. Currently, 99% of chemical feedstocks are derived from petroleum and natural gas. Renewable methods for producing important chemical feedstocks largely remain unaddressed. Synthetic biology enables the renewable production of various chemicals from microorganisms by constructing unique metabolic pathways. Here, we engineer Escherichia coli for the production of isobutyraldehyde, which can be readily converted to various hydrocarbons currently derived from petroleum such as isobutyric acid, acetal, oxime and imine using existing chemical catalysis. Isobutyraldehyde can be readily stripped from cultures during production, which reduces toxic effects of isobutyraldehyde. Results We adopted the isobutanol pathway previously constructed in E. coli, neglecting the last step in the pathway where isobutyraldehyde is converted to isobutanol. However, this strain still overwhelmingly produced isobutanol (1.5 g/L/OD600 (isobutanol vs 0.14 g/L/OD600 (isobutyraldehyde. Next, we deleted yqhD which encodes a broad-substrate range aldehyde reductase known to be active toward isobutyraldehyde. This strain produced isobutanol and isobutyraldehyde at a near 1:1 ratio, indicating further native isobutyraldehyde reductase (IBR activity in E. coli. To further eliminate isobutanol formation, we set out to identify and remove the remaining IBRs from the E. coli genome. We identified 7 annotated genes coding for IBRs that could be active toward isobutyraldehyde: adhP, eutG, yiaY, yjgB, betA, fucO, eutE. Individual deletions of the genes yielded only marginal improvements. Therefore, we sequentially deleted all seven of the genes and assessed production. The combined deletions greatly increased isobutyraldehyde production (1.5 g/L/OD600 and decreased isobutanol production (0.4 g/L/OD600. By assessing production by

  1. Iodine-123-metaiodobenzylguanidine cardiac scintigraphy in patients with diabetes mellitus. Therapeutic effects of aldose reductase inhibitor and vitamin B12

    International Nuclear Information System (INIS)

    Twenty normal volunteers (C group) and 56 patients with non-insulin-dependent diabetes mellitus (NIDDM) who did not have ischemic heart diseases (DM group), were evaluated by means of iodine-123-metaiodobenzylguanidine (MIBG) scintigraphy. The uptake ratio between the cardiac muscle and the upper mediastinum was calculated. The ratio determined from the initial I-123-MIBG scintigraphy image was expressed as HMi, and that determined from the delayed image was expressed as HMd. The washout rate percentage (%WR) was calculated. At least one instance of either the HMi, the HMd, or %WR was outside the mean±1 standard deviation of C group in 34 DM group patients. Aldose reductase inhibitor (ARI) was administered to 17 of the 34 patients and Vitamin B12 (VB12) to the remaining 17 patients, for 3 to 5 months. Before and after treatment, scintigraphic studies with I-123-MIBG were carried out, and the HMi, HMd, and %WR were calculated. There were no significant differences found in FBG, HbA1c, or 1.5-AG levels after treatment with either drug, when compared to the pretreatment values. Both HMi and HMd in the DM group were significantly lower, and %WR was significantly higher than in the C group. The changes in HMi, HMd, and %WR after treatment with ARI were not significant. After treatment with VB12, the HMi and HMd levels were significantly increased (p12 was shown to be effective for improvement of HMi and HMd in NIDDM. (author)

  2. Characterization, solubilization and partial purification of serotonin 5-HT1C receptors

    International Nuclear Information System (INIS)

    125I-Lysergic acid diethylamide (125I-LSD) binds with high affinity to a unique serotonergic site on rat choroid plexus. These sites were localized to choroid plexus epithelial cells using a novel high resolution autoradiographic technique. In membrane preparations, the serotonergic site density was 3100 fmol/mg protein, which is 10 fold higher than the density of any other serotonergic site in brain homogenates. The pharmacology of this site, termed the 5-HT1c site, does not match that of 5-Ht1a, 5-HT1b or 5HT2 serotonergic sites. 5-Ht1c sites were solubilized from pig choroid plexus using the zwitterionic detergent, CHAPS. High affinity labelling of the solubilized site was obtained using the serotonergic radioligand, N1-methyl-2-[125I]lysergic acid diethylamide (125I-MIL). Choroid plexus tumors obtained from transgenic mice were examined for the presence of serotonin 5-HT1c receptors. 125I-LSD binding to choroid plexus tumors displays a pharmacological profile that matches the properties of 5-HT1c receptors in normal choroid plexus. The tumor exhibits the highest site density of serotonin receptors (6600 fmol/mg protein) found in any tissue. 125I-LSD autoradiography of brain sections from transgenic mice shows high levels of specific labelling over the tumor. The affinities of various indolealkyl, phenlakyl and beta-carboline derivatives for the serotonin 5-HT1c receptor were measured in pig choroid plexus using 125I-MIL. Serotonin precursors and metabolites were all very weak inhibitors of specific 125I-MIL binding. Structure-affinity relationships were determined for a number of indolealkylamine analogues. Only serotonin is present in cerebrospinal fluid at concentrations near its 5-HT1c inhibition constant, suggesting that serotonin is the natural 5-HT1c agonist

  3. Overexpression of AtBMI1C, a polycomb group protein gene, accelerates flowering in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Wei Li

    Full Text Available Polycomb group protein (PcG-mediated gene silencing is emerging as an essential developmental regulatory mechanism in eukaryotic organisms. PcGs inactivate or maintain the silenced state of their target chromatin by forming complexes, including Polycomb Repressive Complex 1 (PRC1 and 2 (PRC2. Three PRC2 complexes have been identified and characterized in Arabidopsis; of these, the EMF and VRN complexes suppress flowering by catalyzing the trimethylation of lysine 27 on histone H3 of FLOWER LOCUS T (FT and FLOWER LOCUS C (FLC. However, little is known about the role of PRC1 in regulating the floral transition, although AtRING1A, AtRING1B, AtBMI1A, and AtBMI1B are believed to regulate shoot apical meristem and embryonic development as components of PRC1. Moreover, among the five RING finger PcGs in the Arabidopsis genome, four have been characterized. Here, we report that the fifth, AtBMI1C, is a novel, ubiquitously expressed nuclear PcG protein and part of PRC1, which is evolutionarily conserved with Psc and BMI1. Overexpression of AtBMI1C caused increased H2A monoubiquitination and flowering defects in Arabidopsis. Both the suppression of FLC and activation of FT were observed in AtBMI1C-overexpressing lines, resulting in early flowering. No change in the H3K27me3 level in FLC chromatin was detected in an AtBMI1C-overexpressing line. Our results suggest that AtBMI1C participates in flowering time control by regulating the expression of FLC; moreover, the repression of FLC by AtBMI1C is not due to the activity of PRC2. Instead, it is likely the result of PRC1 activity, into which AtBMI1C is integrated.

  4. Diabetes and Hemoglobin A1c as Risk Factors for Nosocomial Infections in Critically Ill Patients

    Directory of Open Access Journals (Sweden)

    Eirini Tsakiridou

    2013-01-01

    Full Text Available Objective. To evaluate whether diabetes mellitus (DM and hemoglobin A1c (HbA1c are risk factors for ventilator-associated pneumonia (VAP and bloodstream infections (BSI in critically ill patients. Methods. Prospective observational study; patients were recruited from the intensive care unit (ICU of a general district hospital between 2010 and 2012. Inclusion criteria: ICU hospitalization >72 hours and mechanical ventilation >48 hours. HbA1c was calculated for all participants. DM, HbA1c, and other clinical and laboratory parameters were assessed as risk factors for VAP or BSI in ICU. Results. The overall ICU incidence of VAP and BSI was 26% and 30%, respectively. Enteral feeding OR (95%CI 6.20 (1.91–20.17; P=0.002 and blood transfusion 3.33 (1.23–9.02; P=0.018 were independent risk factors for VAP. BSI in ICU (P=0.044 and ICU mortality (P=0.038 were significantly increased in diabetics. Independent risk factors for BSI in ICU included BSI on admission 2.45 (1.14–5.29; P=0.022 and stroke on admission2.77 (1.12–6.88; P=0.029. Sepsis 3.34 (1.47–7.58; P=0.004 and parenteral feeding 6.29 (1.59–24.83; P=0.009 were independently associated with ICU mortality. HbA1c ≥ 8.1% presented a significant diagnostic performance in diagnosing repeated BSI in ICU. Conclusion. DM and HbA1c were not associated with increased VAP or BSI frequency. HbA1c was associated with repeated BSI episodes in the ICU.

  5. Neue biosensorische Prinzipien für die Hämoglobin-A1c Bestimmung

    Science.gov (United States)

    Stöllner, Daniela

    2002-06-01

    Hämoglobin-A1c (HbA1c) ist ein Hämoglobin (Hb)-Subtypus, der durch nicht-enzymatische Glykierung des N-terminalen Valinrestes der Hämoglobin-beta-Kette entsteht. Das gemessene Verhältnis von HbA1c zum Gesamt-Hämoglobin (5-20 % bei Diabetikern) repräsentiert den Mittelwert der Blutglucosekonzentration über einen zweimonatigen Zeitraum und stellt zur Beurteilung der diabetischen Stoffwechsellage eine Ergänzung zur Akutkontrolle der Glukosekonzentration dar. Ziel der vorliegenden Arbeit war es, einen amperometrischen Biosensor für die Bestimmung des medizinisch relevanten Parameters HbA1c zu entwickeln. Durch Selektion geeigneter Bioerkennungselemente und deren Immobilisierung unter Erhalt der Bindungsfunktion für die Zielmoleküle Hämoglobin bzw. HbA1c wurden spezifische, hochaffine und regenerationsstabile Sensoroberflächen geschaffen. Für die Entwicklung des HbA1c-Biosensors wurden zwei Konzepte - Enzymsensor und Immunosensor - miteinander verglichen. Die enzymatische Umsetzung von HbA1c erfolgte mit der Fructosylamin Oxidase (FAO) aus Pichia pastoris N 1-1 unter Freisetzung von H2O2, welches sowohl optisch über eine Indikatorreaktion als auch elektrochemisch nach Einschluss der FAO in PVA-SbQ und Fixierung des Immobilisats vor einer H2O2-Elektrode nachgewiesen wurde. Die Kalibration des Enzymsensors mit der HbA1c-Modellsubstanz Fructosyl-Valin ergab Nachweisgrenzen, die ausserhalb des physiologisch relevanten HbA1c-Konzentrationsbereich lagen. Aus der Umsetzung von glykierten Peptiden mit einer nicht HbA1c analogen Aminosäurensequenz, z.B. Fructosyl-Valin-Glycin wurde zudem eine geringe HbA1c-Spezifität abgeleitet. Für den Immunosensor wurden zwei heterogene Immunoassay-Formate unter Verwendung von hochaffinen und spezifischen Antikörpern in Kombination mit Glucose Oxidase (GOD) als Markerenzym zum Nachweis von HbA1c untersucht. Beim indirekt-kompetitiven Immunoassay wurde anstelle des kompletten HbA1c-Moleküls das glykierte Pentapeptid

  6. Binding of Natural and Synthetic Polyphenols to Human Dihydrofolate Reductase

    Directory of Open Access Journals (Sweden)

    José Neptuno Rodríguez-López

    2009-12-01

    Full Text Available Dihydrofolate reductase (DHFR is the subject of intensive investigation since it appears to be the primary target enzyme for antifolate drugs. Fluorescence quenching experiments show that the ester bond-containing tea polyphenols (--epigallocatechin gallate (EGCG and (--epicatechin gallate (ECG are potent inhibitors of DHFR with dissociation constants (KD of 0.9 and 1.8 μM, respectively, while polyphenols lacking the ester bound gallate moiety [e.g., (--epigallocatechin (EGC and (--epicatechin (EC] did not bind to this enzyme. To avoid stability and bioavailability problems associated with tea catechins we synthesized a methylated derivative of ECG (3-O-(3,4,5-trimethoxybenzoyl-(--epicatechin; TMECG, which effectively binds to DHFR (KD = 2.1 μM. In alkaline solution, TMECG generates a stable quinone methide product that strongly binds to the enzyme with a KD of 8.2 nM. Quercetin glucuronides also bind to DHFR but its effective binding was highly dependent of the sugar residue, with quercetin-3-xyloside being the stronger inhibitor of the enzyme with a KD of 0.6 μM. The finding that natural polyphenols are good inhibitors of human DHFR could explain the epidemiological data on their prophylactic effects for certain forms of cancer and open a possibility for the use of natural and synthetic polyphenols in cancer chemotherapy.

  7. Rapid identification of aldose reductase inhibitory compounds from Perilla frutescens.

    Science.gov (United States)

    Paek, Ji Hun; Shin, Kuk Hyun; Kang, Young-Hee; Lee, Jae-Yong; Lim, Soon Sung

    2013-01-01

    The ethyl acetate (EtOAc) soluble fraction of methanol extracts of Perilla frutescens (P. frutescens) inhibits aldose reductase (AR), the key enzyme in the polyol pathway. Our investigation of inhibitory compounds from the EtOAc soluble fraction of P. frutescens was followed by identification of the inhibitory compounds by a combination of HPLC microfractionation and a 96-well enzyme assay. This allowed the biological activities to be efficiently matched with selected HPLC peaks. Structural analyses of the active compounds were performed by LC-MS(n). The main AR inhibiting compounds were tentatively identified as chlorogenic acid and rosmarinic acid by LC-MS(n). A two-step high speed counter current chromatography (HSCCC) isolation method was developed with a solvent system of n-hexane-ethyl acetate-methanol-water at 1.5:5:1:5, v/v and 3:7:5:5, v/v. The chemical structures of the isolated compounds were determined by (1)H- and (13)C-nuclear magnetic resonance spectrometry (NMR). The main compounds inhibiting AR in the EtOAc fraction of methanol extracts of P. frutescens were identified as chlorogenic acid (2) (IC50 = 3.16 μ M), rosmarinic acid (4) (IC50 = 2.77 μ M), luteolin (5) (IC50 = 6.34 μ M), and methyl rosmarinic acid (6) (IC50 = 4.03 μ M). PMID:24308003

  8. Expression analysis of dihydroflavonol 4-reductase genes in Petunia hybrida.

    Science.gov (United States)

    Chu, Y X; Chen, H R; Wu, A Z; Cai, R; Pan, J S

    2015-01-01

    Dihydroflavonol 4-reductase (DFR) genes from Rosa chinensis (Asn type) and Calibrachoa hybrida (Asp type), driven by a CaMV 35S promoter, were integrated into the petunia (Petunia hybrida) cultivar 9702. Exogenous DFR gene expression characteristics were similar to flower-color changes, and effects on anthocyanin concentration were observed in both types of DFR gene transformants. Expression analysis showed that exogenous DFR genes were expressed in all of the tissues, but the expression levels were significantly different. However, both of them exhibited a high expression level in petals that were starting to open. The introgression of DFR genes may significantly change DFR enzyme activity. Anthocyanin ultra-performance liquid chromatography results showed that anthocyanin concentrations changed according to DFR enzyme activity. Therefore, the change in flower color was probably the result of a DFR enzyme change. Pelargonidin 3-O-glucoside was found in two different transgenic petunias, indicating that both CaDFR and RoDFR could catalyze dihydrokaempferol. Our results also suggest that transgenic petunias with DFR gene of Asp type could biosynthesize pelargonidin 3-O-glucoside. PMID:25966276

  9. 5alpha-reductase: history and clinical importance.

    Science.gov (United States)

    Marks, Leonard S

    2004-01-01

    The treatment of men with symptomatic benign prostatic hyperplasia (BPH) has shifted dramatically from surgery to drug therapy over the past decade. The revolution in BPH treatment began with the discovery of congenital 5alpha-reductase (5AR) deficiency, leading to the appreciation of 2 different androgenic hormones: testosterone, which mediates overt masculinization in the adult male, and dihydrotestosterone (DHT), which mediates prostatic growth, acne, facial beard, and male pattern baldness. Inhibition of DHT in adults results in prostatic shrinkage and symptomatic relief in many men, without the side effects seen with conventional androgen-deprivation therapy. The 5AR inhibitor drugs (finasteride and the dual inhibitor, dutasteride) are able to ablate the accumulation of intraprostatic DHT, the mechanism most responsible for prostate growth and maintenance. Not only may these drugs relieve symptoms, but they may also alter the natural history of the BPH process. Future indications for the 5ARI drugs could include chemoprevention of prostate cancer, prophylaxis of BPH-related complications, and treatment of BPH-associated hematuria. PMID:16985920

  10. Regulation and degradation of HMGCo-A reductase.

    Science.gov (United States)

    Panda, T; Devi, V Amutha

    2004-12-01

    The enzyme, 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR) controls the biosynthesis of cholesterol. Hypercholesterolemia and atherosclerosis are critical health risk factors. One way of controlling these risk factors is to manipulate regulation as well as degradation of HMGR. At present, a class of compounds called statins, which are HMGR inhibitors, are used for the treatment of hypercholesterolemia. However, statins suffer major setbacks as their use produces more adverse reactions than the desirable one of inhibiting the enzyme. Genetically engineered forms of HMGR are also studied in primitive life forms like bacteria, but detailed investigation of this enzyme in human systems is certainly required. Extensive studies have been made on the regulatory aspects of this enzyme, but no breakthrough is conspicuous in the clinical background to find an alternative treatment for hypercholesterolemia. The immediate need is to find an alternate way of regulating degradation of the enzyme. This review presents the importance of regulation and degradation of the HMGR enzyme in different systems to gain possible insight into alternative schemes for regulating this enzyme and, if these exist, the feasibility of extending them same to studies in mammalian systems. A high degree of similarity exists between mammalian and yeast HMGR. Detailed studies reported on the regulation and degradation of the yeast enzyme also throw more light on the mammalian system, leading to a better understanding of ways of controlling hypercholesterolemia. PMID:15558272

  11. Methylenetetrahydrofolate Reductase Genotypes, Dietary Habits and Susceptibility to Stomach Cancer

    Institute of Scientific and Technical Information of China (English)

    ChangmingGao; TakezakiToshiro; JianzhongWu; JianhuoDing; YantingLiu; SupingLi; PingSu; XuHu; TianliongXu; HamajimaNobuyuki; TajimaKazuo

    2004-01-01

    OBJECTIVE To study the relation among methylenetetrahydrofolate reductase (MTHFR) C677T genotypes, dietary habits and the risk of stomach cancer (SC).METHODS A case-control study was conducted with 107 cases of SC and 200 population-based controls in Chuzhou district, Huaian, Jiangsu province, China. The epidemiological data were collected, and DNA of peripheral blood leukocytes was obtained from all of the subjects..MTHFR genotypes were detected by PCR-RFLP. RESULTS (1) The prevalence of the MTHFR C/T or T/T genotypes was found to be significantly different between controls (68.5%) and SC cases (79.4%,P=0.0416), the increased risk had an adjusted OR of 1.79 (95%C1:1.01-3.19). (2) Among subjects who had a low intake of garlic or Chinese onion, MTHFR C/T or T/T genotypes significantly increased the risk of developing SC. Among non-tea drinkers or among subjects who had a frequent intakeof meat, the carriers of the MTHFR C/T or T/T genotypes had a higher risk of SC than individuals with the C/C type MTHFR. CONCLUSION The polymorphism of MTHFR C677T was associated with increased risk of developing SC, and that individuals with differing genotypes may have different susceptibilities to SC, based on their exposure level to environmental factors.

  12. Ribonucleotide reductase and cancer: biological mechanisms and targeted therapies.

    Science.gov (United States)

    Aye, Y; Li, M; Long, M J C; Weiss, R S

    2015-04-16

    Accurate DNA replication and repair is essential for proper development, growth and tumor-free survival in all multicellular organisms. A key requirement for the maintenance of genomic integrity is the availability of adequate and balanced pools of deoxyribonucleoside triphosphates (dNTPs), the building blocks of DNA. Notably, dNTP pool alterations lead to genomic instability and have been linked to multiple human diseases, including mitochondrial disorders, susceptibility to viral infection and cancer. In this review, we discuss how a key regulator of dNTP biosynthesis in mammals, the enzyme ribonucleotide reductase (RNR), impacts cancer susceptibility and serves as a target for anti-cancer therapies. Because RNR-regulated dNTP production can influence DNA replication fidelity while also supporting genome-protecting DNA repair, RNR has complex and stage-specific roles in carcinogenesis. Nevertheless, cancer cells are dependent on RNR for de novo dNTP biosynthesis. Therefore, elevated RNR expression is a characteristic of many cancers, and an array of mechanistically distinct RNR inhibitors serve as effective agents for cancer treatment. The dNTP metabolism machinery, including RNR, has been exploited for therapeutic benefit for decades and remains an important target for cancer drug development. PMID:24909171

  13. Alkyl hydroperoxide reductase: a candidate Helicobacter pylori vaccine.

    Science.gov (United States)

    O'Riordan, Avril A; Morales, Veronica Athie; Mulligan, Linda; Faheem, Nazia; Windle, Henry J; Kelleher, Dermot P

    2012-06-01

    Helicobacter pylori (H. pylori) is the most important etiological agent of chronic active gastritis, peptic ulcer disease and gastric cancer. The aim of this study was to evaluate the efficacy of alkyl hydroperoxide reductase (AhpC) and mannosylated AhpC (mAhpC) as candidate vaccines in the C57BL/6J mouse model of H. pylori infection. Recombinant AhpC was cloned, over-expressed and purified in an unmodified form and was also engineered to incorporate N and C-terminal mannose residues when expressed in the yeast Pichia pastoris. Mice were immunized systemically and mucosally with AhpC and systemically with mAhpC prior to challenge with H. pylori. Serum IgG responses to AhpC were determined and quantitative culture was used to determine the efficacy of vaccination strategies. Systemic prophylactic immunization with AhpC/alum and mAhpC/alum conferred protection against infection in 55% and 77.3% of mice, respectively. Mucosal immunization with AhpC/cholera toxin did not protect against infection and elicited low levels of serum IgG in comparison with systemic immunization. These data support the use of AhpC as a potential vaccine candidate against H. pylori infection. PMID:22512976

  14. Loss of quinone reductase 2 function selectively facilitates learning behaviors.

    Science.gov (United States)

    Benoit, Charles-Etienne; Bastianetto, Stephane; Brouillette, Jonathan; Tse, YiuChung; Boutin, Jean A; Delagrange, Philippe; Wong, TakPan; Sarret, Philippe; Quirion, Rémi

    2010-09-22

    High levels of reactive oxygen species (ROS) are associated with deficits in learning and memory with age as well as in Alzheimer's disease. Using DNA microarray, we demonstrated the overexpression of quinone reductase 2 (QR2) in the hippocampus in two models of learning deficits, namely the aged memory impaired rats and the scopolamine-induced amnesia model. QR2 is a cytosolic flavoprotein that catalyzes the reduction of its substrate and enhances the production of damaging activated quinone and ROS. QR2-like immunostaining is enriched in cerebral structures associated with learning behaviors, such as the hippocampal formation and the temporofrontal cortex of rat, mouse, and human brains. In cultured rat embryonic hippocampal neurons, selective inhibitors of QR2, namely S26695 and S29434, protected against menadione-induced cell death by reversing its proapoptotic action. S26695 (8 mg/kg) also significantly inhibited scopolamine-induced amnesia. Interestingly, adult QR2 knock-out mice demonstrated enhanced learning abilities in various tasks, including Morris water maze, object recognition, and rotarod performance test. Other behaviors related to anxiety (elevated plus maze), depression (forced swim), and schizophrenia (prepulse inhibition) were not affected in QR2-deficient mice. Together, these data suggest a role for QR2 in cognitive behaviors with QR2 inhibitors possibly representing a novel therapeutic strategy toward the treatment of learning deficits especially observed in the aged brain. PMID:20861374

  15. Determination of Nitrate Reductase Assay Depending on the Microbial Growth

    International Nuclear Information System (INIS)

    A rapid micro-dilution assay for determination of the antimicrobial susceptibility of different bacterial isolates was developed. This assay is based on the ability of the most of viable organisms to reduce nitrates. The MIC or MBC could be determined by nitrate reductase (NR) only after 30 to 90 min of incubation depending on the behaviour of microbial growth. Bacterial viability is detected by a positive nitrite reduction rather than visible turbidity. The nitrate reduction assay was compared with standard micro-assay using 250 isolates of different taxa against 10 antibiotics belonging to different classes. An excellent agreement of 82.5 % was found between the two methods and only 17.5 % of 1794 trials showed difference in the determined MIC by tow-dilution interval above or below the MIC determined by the turbidimetric method under the same test conditions. However, the nitrate reduction assay was more rapid and sensitive in detecting viable bacteria and so, established an accurate estimate of the minimal inhibitory concentration (MIC) or the minimal bacterial concentration (MBC). The nitrate reduction assay offers the additional advantage that it could be used to determine the MBC without having to subculture the broth. 232 cases of resistance were detected by NR and 4 different media were tested for susceptibility test. The bacterial isolates were exposed to ultra violet (UV) light for different period

  16. Aldose reductase inhibition improves nerve conduction velocity in diabetic patients.

    Science.gov (United States)

    Judzewitsch, R G; Jaspan, J B; Polonsky, K S; Weinberg, C R; Halter, J B; Halar, E; Pfeifer, M A; Vukadinovic, C; Bernstein, L; Schneider, M; Liang, K Y; Gabbay, K H; Rubenstein, A H; Porte, D

    1983-01-20

    To assess the potential role of polyol-pathway activity in diabetic neuropathy, we measured the effects of sorbinil--a potent inhibitor of the key polyol-pathway enzyme aldose reductase--on nerve conduction velocity in 39 stable diabetics in a randomized, double-blind, cross-over trial. During nine weeks of treatment with sorbinil (250 mg per day), nerve conduction velocity was greater than during a nine-week placebo period for all three nerves tested: the peroneal motor nerve (mean increase [+/- S.E.M.], 0.70 +/- 0.24 m per second, P less than 0.008), the median motor nerve (mean increase, 0.66 +/- 0.27, P less than 0.005), and the median sensory nerve (mean increase, 1.16 +/- 0.50, P less than 0.035). Conduction velocity for all three nerves declined significantly within three weeks after cessation of the drug. These effects of sorbinil were not related to glycemic control, which was constant during the study. Although the effect of sorbinil in improving nerve conduction velocity in diabetics was small, the findings suggest that polyol-pathway activity contributes to slowed nerve conduction in diabetics. The clinical applicability of these observations remains to be determined, but they encourage further exploration of this approach to the treatment or prevention of diabetic neuropathy. PMID:6401351

  17. Glyoxalase 1 and glutathione reductase 1 regulate anxiety in mice.

    Science.gov (United States)

    Hovatta, Iiris; Tennant, Richard S; Helton, Robert; Marr, Robert A; Singer, Oded; Redwine, Jeffrey M; Ellison, Julie A; Schadt, Eric E; Verma, Inder M; Lockhart, David J; Barlow, Carrolee

    2005-12-01

    Anxiety and fear are normal emotional responses to threatening situations. In human anxiety disorders--such as panic disorder, obsessive-compulsive disorder, post-traumatic stress disorder, social phobia, specific phobias and generalized anxiety disorder--these responses are exaggerated. The molecular mechanisms involved in the regulation of normal and pathological anxiety are mostly unknown. However, the availability of different inbred strains of mice offers an excellent model system in which to study the genetics of certain behavioural phenotypes. Here we report, using a combination of behavioural analysis of six inbred mouse strains with quantitative gene expression profiling of several brain regions, the identification of 17 genes with expression patterns that correlate with anxiety-like behavioural phenotypes. To determine if two of the genes, glyoxalase 1 and glutathione reductase 1, have a causal role in the genesis of anxiety, we performed genetic manipulation using lentivirus-mediated gene transfer. Local overexpression of these genes in the mouse brain resulted in increased anxiety-like behaviour, while local inhibition of glyoxalase 1 expression by RNA interference decreased the anxiety-like behaviour. Both of these genes are involved in oxidative stress metabolism, linking this pathway with anxiety-related behaviour. PMID:16244648

  18. Low HbA1c and Increased Mortality Risk-is Frailty a Confounding Factor?

    Science.gov (United States)

    Abdelhafiz, Ahmed H; Sinclair, Alan J

    2015-01-01

    Diabetes mellitus is increasingly becoming an older person disease due to the increased survival and aging of the population. Previous studies which showed benefits of tight glycemic control and a linear relationship between HbA1c and mortality have largely included younger patients newly diagnosed with diabetes and with less comorbidities. Recent studies, which included older population with diabetes, have shown a U-shaped relationship of increased mortality associated with low HbA1c. The mechanism of such relationship is unclear. There was no direct causal link between low HbA1c and mortality. It appears that malnutrition, inflammation and functional decline are characteristics shared by the populations that showed increased mortality and low HbA1c. In these studies functional status, disability or frailty was not routinely measured. Therefore, although adjustment for comorbidities was made there may be a residual confounding by unmeasured factors such as frailty. Thus, frailty or decline in functional reserve may be the main confounding factor explaining the relationship between increased mortality risk and low HbA1c. PMID:26236548

  19. Grain refinement of an AZ63B magnesium alloy by an Al-1C master alloy

    Energy Technology Data Exchange (ETDEWEB)

    Yichuan Pan; Xiangfa Liu; Hua Yang [The Key Lab. of Liquid Structure and Heredity of Materials, Shandong Univ., Jinan (China)

    2005-12-01

    In order to develop a refiner of Mg-Al alloys, an Al-1C (in wt.%) master alloy was synthesized using a casting method. The microstructure and grain-refining performance of the Al-1C master alloy were investigated using X-ray diffraction (XRD), electron probe microanalysis (EPMA) and a grain-refining test. The microstructure of the Al-1C master alloy is composed of {alpha}-Al solid solution, Al{sub 4}C{sub 3} particles, and graphite phases. After grain refinement of AZ63B alloy by the Al-1C master alloy, the mean grain size reached a limit when 2 wt.% Al-C master alloy was added at 800 C and held for 20 min in the melt before casting. The minimum mean grain size is approximately 48 {mu}m at the one-half radius of the ingot and is about 17% of that of the unrefined alloy. The Al-1C master alloy results in better grain refinement than C{sub 2}Cl{sub 6} and MgCO{sub 3} carbon-containing refiners. (orig.)

  20. Inhibition of LXRα/SREBP-1c-Mediated Hepatic Steatosis by Jiang-Zhi Granule

    Directory of Open Access Journals (Sweden)

    Miao Wang

    2013-01-01

    Full Text Available Nonalcoholic fatty liver (NAFL is increasingly recognized as one of the most common causes of chronic liver disease worldwide. Traditional Chinese medicine (TCM, as the alternative and complementary medicine, may provide some profound health benefit. “Jiang-Zhi” Granule (JZG was composed based on TCM pathogenesis of NAFL: the retention of inner dampness, heat and blood stasis. This study investigated effects of JZG on liver X receptor-α (LXRα/sterol regulatory element binding protein-1c (SREBP-1c pathway in high-fat-diet-(HFD-induced hepatic steatosis, as well as in free-fatty-acid-(FFA-and T0901317-treated HepG2 cells. The results showed that JZG had an antisteatotic effect on HFD-fed rats. JZG decreased the activation of SREBP-1c through inhibiting LXRα-mediated SREBP-1c transcription, as well as through inhibiting the maturation of SREBP-1c independent of LXRα. These findings may provide molecular evidence for the use of JZG as a promising therapeutic option for NAFL and support us to continue JZG treatment in NAFL. For JZG treatment to be widely accepted, a randomized, double-blind, multicenter, placebo-controlled, phase III trial is ongoing.

  1. CACNA1C risk variant affects facial emotion recognition in healthy individuals.

    Science.gov (United States)

    Nieratschker, Vanessa; Brückmann, Christof; Plewnia, Christian

    2015-01-01

    Recognition and correct interpretation of facial emotion is essential for social interaction and communication. Previous studies have shown that impairments in this cognitive domain are common features of several psychiatric disorders. Recent association studies identified CACNA1C as one of the most promising genetic risk factors for psychiatric disorders and previous evidence suggests that the most replicated risk variant in CACNA1C (rs1006737) is affecting emotion recognition and processing. However, studies investigating the influence of rs1006737 on this intermediate phenotype in healthy subjects at the behavioral level are largely missing to date. Here, we applied the "Reading the Mind in the Eyes" test, a facial emotion recognition paradigm in a cohort of 92 healthy individuals to address this question. Whereas accuracy was not affected by genotype, CACNA1C rs1006737 risk-allele carries (AA/AG) showed significantly slower mean response times compared to individuals homozygous for the G-allele, indicating that healthy risk-allele carriers require more information to correctly identify a facial emotion. Our study is the first to provide evidence for an impairing behavioral effect of the CACNA1C risk variant rs1006737 on facial emotion recognition in healthy individuals and adds to the growing number of studies pointing towards CACNA1C as affecting intermediate phenotypes of psychiatric disorders. PMID:26611642

  2. Association of CACNA1C Variants with Bipolar Disorder in the Korean Population

    Science.gov (United States)

    Kim, Soojin; Cho, Chul-Hyun; Geum, Dongho

    2016-01-01

    Objective Previous studies have suggested an association between CACNA1C and susceptibility of bipolar disorder. In this study, we examined the association of CACNA1C variants with bipolar disorder in the Korean population. Methods We selected 2 CACNA1C single nucleotide polymorphisms (SNPs), namely, rs723672 and rs1051375, based on their functions and minor allele frequencies described in previous studies. Genotypes of these 2 SNPs were analyzed by extracting DNA from blood samples collected from 287 patients with bipolar disorder and 340 healthy controls. Results Genotype frequencies of both rs723672 and rs1051375 SNPs were significantly different in patients and controls (p=0.0462 and 1.732E-14, respectively). Dominant, recessive, and allele models showed significant differences between patients and controls with respect to the rs1051375 SNP (p=1.72E-11, 4.17E-10, 4.95E-16, respectively). Conclusion Our results suggested that CACNA1C SNPs rs723672 and rs1051375 were associated with bipolar disorder in the Korean population. In addition, our results highlighted the importance of CACNA1C in determining susceptibility to bipolar disorder. PMID:27482248

  3. Ammonia oxidation is not required for growth of Group 1.1c soil Thaumarchaeota.

    Science.gov (United States)

    Weber, Eva B; Lehtovirta-Morley, Laura E; Prosser, James I; Gubry-Rangin, Cécile

    2015-03-01

    Thaumarchaeota are among the most abundant organisms on Earth and are ubiquitous. Within this phylum, all cultivated representatives of Group 1.1a and Group 1.1b Thaumarchaeota are ammonia oxidizers, and play a key role in the nitrogen cycle. While Group 1.1c is phylogenetically closely related to the ammonia-oxidizing Thaumarchaeota and is abundant in acidic forest soils, nothing is known about its physiology or ecosystem function. The goal of this study was to perform in situ physiological characterization of Group 1.1c Thaumarchaeota by determining conditions that favour their growth in soil. Several acidic grassland, birch and pine tree forest soils were sampled and those with the highest Group 1.1c 16S rRNA gene abundance were incubated in microcosms to determine optimal growth temperature, ammonia oxidation and growth on several organic compounds. Growth of Group 1.1c Thaumarchaeota, assessed by qPCR of Group 1.1c 16S rRNA genes, occurred in soil, optimally at 30°C, but was not associated with ammonia oxidation and the functional gene amoA could not be detected. Growth was also stimulated by addition of organic nitrogen compounds (glutamate and casamino acids) but not when supplemented with organic carbon alone. This is the first evidence for non-ammonia oxidation associated growth of Thaumarchaeota in soil. PMID:25764563

  4. Regulators of ribonucleotide reductase inhibit Ty1 mobility in saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    O'Donnell John P

    2010-11-01

    Full Text Available Abstract Background Ty1 is a long terminal repeat retrotransposon of Saccharomyces cerevisiae, with a replication cycle similar to retrovirus replication. Structurally, Ty1 contains long terminal repeat (LTR regions flanking the gag and pol genes that encode for the proteins that enable Ty1 mobility. Reverse transcriptase produces Ty1 complementary (cDNA that can either be integrated back into the genome by integrase or recombined into the yeast genome through homologous recombination. The frequency of Ty1 mobility is temperature sensitive, with optimum activity occurring at 24-26°C. Results In this study, we identified two host genes that when deleted allow for high temperature Ty1 mobility: RFX1 and SML1. The protein products of these genes are both negative regulators of the enzyme ribonucleotide reductase, a key enzyme in regulating deoxyribonucleotide triphosphate (dNTP levels in the cell. Processing of Ty1 proteins is defective at high temperature, and processing is not improved in either rfx1 or sml1 deletion strains. Ty1 mobility at high temperature is mediated by homologous recombination of Ty1 cDNA to Ty1 elements within the yeast genome. We quantified cDNA levels in wild type, rfx1 and sml1 deletion background strains at different temperatures. Southern blot analysis demonstrated that cDNA levels were not markedly different between the wild type and mutant strains as temperatures increased, indicating that the increased Ty1 mobility is not a result of increased cDNA synthesis in the mutant strains. Homologous recombination efficiency was increased in both rfx1 and sml1 deletion strains at high temperatures; the rfx1 deletion strain also had heightened homologous recombination efficiency at permissive temperatures. In the presence of the dNTP reducing agent hydroxyurea at permissive temperatures, Ty1 mobility was stimulated in the wild type and sml1 deletion strains but not in the rfx1 deletion strain. Mobility frequency was greatly

  5. Feed-forward control of prostate growth: dihydrotestosterone induces expression of its own biosynthetic enzyme, steroid 5 alpha-reductase.

    OpenAIRE

    George, F W; Russell, D.W.; Wilson, J. D.

    1991-01-01

    Dihydrotestosterone, the primary mediator of prostate growth, is synthesized in target tissues from the circulating androgen testosterone through the action of steroid 5 alpha-reductase (EC 1.3.99.5). The expression of 5 alpha-reductase and the level of 5 alpha-reductase messenger RNA in rat ventral prostate are regulated by androgens. To determine whether this control is mediated by dihydrotestosterone or testosterone, we investigated the effect of finasteride, a potent inhibitor of steroid ...

  6. Nitrite and Nitrous Oxide Reductase Regulation by Nitrogen Oxides in Rhodobacter sphaeroides f. sp. denitrificans IL106

    OpenAIRE

    Sabaty, Monique; Schwintner, Carole; Cahors, Sandrine; Richaud, Pierre; Verméglio, Andre

    1999-01-01

    We have cloned the nap locus encoding the periplasmic nitrate reductase in Rhodobacter sphaeroides f. sp. denitrificans IL106. A mutant with this enzyme deleted is unable to grow under denitrifying conditions. Biochemical analysis of this mutant shows that in contrast to the wild-type strain, the level of synthesis of the nitrite and N2O reductases is not increased by the addition of nitrate. Growth under denitrifying conditions and induction of N oxide reductase synthesis are both restored b...

  7. Allelic variants of DYX1C1 are not associated with dyslexia in India

    Directory of Open Access Journals (Sweden)

    Saviour Pushpa

    2008-01-01

    Full Text Available Dyslexia is a hereditary neurological disorder that manifests as an unexpected difficulty in learning to read despite adequate intelligence, education, and normal senses. The prevalence of dyslexia ranges from 3 to 15% of the school aged children. Many genetic studies indicated that loci on 6p21.3, 15q15-21, and 18p11.2 have been identified as promising candidate gene regions for dyslexia. Recently, it has been suggested that allelic variants of gene, DYX1C1 influence dyslexia. In the present study, exon 2 and 10 of DYX1C1 has been analyzed to verify whether these single nucleotide polymorphisms (SNPs influence dyslexia, in our population. Our study identified 4 SNPs however, none of these SNPS were found to be significantly associated with dyslexia suggesting DYX1C1 allelic variants are not associated with dyslexia.

  8. HIGH MATERNAL HbA1c IS ASSOCIATED WITH NEONATAL HYPOCALCEMIA

    Directory of Open Access Journals (Sweden)

    Abdul Tawab

    2014-10-01

    Full Text Available INTRODUCTION: Hypocalcemia occurs within the first 72 hours of birth in up to 50% of IDMs. The objective of the study was to compare the incidence of hypocalcemia in Infants of Pre-Gestational Diabetic & Gestational Diabetic mothers and to find the association of hypocalcemia and maternal diabetic control. MATERIAL AND METHODS: A tertiary care teaching hospital based prospective study over a period of 2 years. 40 Cases were included in the study 20 breast fed full term infants of Gestational diabetic mothers and 20 breastfed full term infants of Pre-Gestational diabetic mothers were enrolled in the study. Serum calcium of neonates in both groups was sent at 48 hours of life. Mean maternal HbA1c level was used to access maternal diabetic control. OBSERVATION AND RESULTS: Neonates of GDM showed statistically significant change in the serum calcium levels (Mean calcium level 9.055 mg/dl and maternal HBA1c levels (mean HbA1c level 5.85% an compared to neonates of PGDM (Mean calcium level 8.015 mg/dl, mean HbA1c level 6.75% (p=0.0001. 7 out of 20 neonates (35 % of Pre Gestational Diabetic mothers had hypocalcemia at 48 hour postnatal age and 3 out of 20 neonates (15% of Gestational Diabetic mothers had hypocalcemia at 48 hour postnatal age. Incidence of hypocalcemia is more when diabetes is poorly controlled [HbA1C>6%] in both groups and it was statistically significant. CONCLUSION: Infants born to Pre-Gestational diabetic mothers are at a higher risk of developing hypocalcemia than infants of gestational diabetic mothers. Incidence of hypocalcemia can be predicted with diabetic control [maternal HbA1c levels]. Studies with larger sample size will give more definitive results on this issue.

  9. Study of Recessive Deafness Locus (DFNB18/USH1C by Linkage Analysis in Local Population

    Directory of Open Access Journals (Sweden)

    Rafiullah

    2012-03-01

    Full Text Available The objective of this study was to search for known syndromic recessive loci of deafness in local population of Balochistan. Hearing impairment is an extremely heterogeneous disorder that affects about 1 in 2000 newborns. Genetic hearing loss is most often monogenic. Hereditary hearing loss can be classified as syndromic (SHL or non-syndromic (NSHL. Usher syndrome type IC (USH1C, is an autosomal recessive disorder characterized by profound hearing impairment, early onset of retinitis pigmentosa, and vestibular dysfunction, caused by mutations in USH1C. The USH1C locus mapped to chromosome 11p15.1.During this study, six families were enrolled with at least three affected individuals for linkage analysis studies. The families are collected from different areas of Balochistan province, i.e. Quetta, Sibi, Mastung and Pishin. Detailed history was taken from each family member for confirmation of consanguineous marriages and pedigree drawing. Blood samples from all participants were obtained for genetic analysis by genotyping; haplotype analysis was constructed. Out of six families, results of linkage analysis studies showed that haplotype of family BUITMS-17 were found linked with DFNB18/USH1C locus with D11S902, D11S4138 and D11S921 marker. Gene USH1C/DFNB18 responsible for Harmonin was sequenced and sequencing of all the exons and adjacent splice sites, identified already known homozygous frame shift mutation c238_239insC in affected members of the family BUITMS-17. Our results showed present study is the first report of a family with Usher1C linkage and mutation in Balochistan; further study is needed to explore the mutations and Usher loci prevalent in Balochistan population.

  10. Hemoglobin A1c and arterial and ventricular stiffness in older adults.

    Directory of Open Access Journals (Sweden)

    Susan J Zieman

    Full Text Available OBJECTIVE: Arterial and ventricular stiffening are characteristics of diabetes and aging which confer significant morbidity and mortality; advanced glycation endproducts (AGE are implicated in this stiffening pathophysiology. We examined the association between HbA(1c, an AGE, with arterial and ventricular stiffness measures in older individuals without diabetes. RESEARCH DESIGN & METHODS: Baseline HbA(1c was measured in 830 participants free of diabetes defined by fasting glucose or medication use in the Cardiovascular Health Study, a population-based cohort study of adults aged ≥ 65 years. We performed cross-sectional analyses using baseline exam data including echocardiography, ankle and brachial blood pressure measurement, and carotid ultrasonography. We examined the adjusted associations between HbA(1c and multiple arterial and ventricular stiffness measures by linear regression models and compared these results to the association of fasting glucose (FG with like measures. RESULTS: HbA(1c was correlated with fasting and 2-hour postload glucose levels (r = 0.21; p<0.001 for both and positively associated with greater body-mass index and black race. In adjusted models, HbA(1c was not associated with any measure of arterial or ventricular stiffness, including pulse pressure (PP, carotid intima-media thickness, ankle-brachial index, end-arterial elastance, or left ventricular mass (LVM. FG levels were positively associated with systolic, diastolic and PP and LVM. CONCLUSIONS: In this sample of older adults without diabetes, HbA(1c was not associated with arterial or ventricular stiffness measures, whereas FG levels were. The role of AGE in arterial and ventricular stiffness in older adults may be better assessed using alternate AGE markers.

  11. Are prostate carcinoma clinical stages T1C and T2 similar?

    Directory of Open Access Journals (Sweden)

    Athanase Billis

    2006-04-01

    Full Text Available PURPOSE: A recent study has found that PSA recurrence rate for clinical T1c tumors is similar to T2 tumors, indicating a need for further refinement of clinical staging system. To test this finding we compared clinicopathologic characteristics and the time to PSA progression following radical retropubic prostatectomy of patients with clinical stage T1c tumors to those with stage T2, T2a or T2b tumors. MATERIALS AND METHODS: From a total of 186 consecutive patients submitted to prostatectomy, 33.52% had clinical stage T1c tumors, 45.45% stage T2a tumors and 21.02% stage T2b tumors. The variables studied were age, preoperative PSA, prostate weight, Gleason score, tumor extent, positive surgical margins, extraprostatic extension (pT3a, seminal vesicle invasion (pT3b, and time to PSA progression. Tumor extent was evaluated by a point-count method. RESULTS: Patients with clinical stage T1c were younger and had the lowest mean preoperative PSA. In the surgical specimen, they had higher frequency of Gleason score < 7 and more organ confined cancer. In 40.54% of the patients with clinical stage T2b tumors, there was extraprostatic extension (pT3a. During the study period, 54 patients (30.68% developed a biochemical progression. Kaplan-Meier product-limit analysis revealed no significant difference in the time to PSA progression between men with clinical stage T1c versus clinical stage T2 (p = 0.7959, T2a (p = 0.6060 or T2b (p = 0.2941 as well as between men with clinical stage T2a versus stage T2b (p = 0.0994. CONCLUSION: Clinicopathological features are not similar considering clinical stage T1c versus clinical stages T2, T2a or T2b.

  12. Accuracy of hemoglobin A1c imputation using fasting plasma glucose in diabetes research using electronic health records data

    Directory of Open Access Journals (Sweden)

    Stanley Xu

    2014-05-01

    Full Text Available In studies that use electronic health record data, imputation of important data elements such as Glycated hemoglobin (A1c has become common. However, few studies have systematically examined the validity of various imputation strategies for missing A1c values. We derived a complete dataset using an incident diabetes population that has no missing values in A1c, fasting and random plasma glucose (FPG and RPG, age, and gender. We then created missing A1c values under two assumptions: missing completely at random (MCAR and missing at random (MAR. We then imputed A1c values, compared the imputed values to the true A1c values, and used these data to assess the impact of A1c on initiation of antihyperglycemic therapy. Under MCAR, imputation of A1c based on FPG 1 estimated a continuous A1c within ± 1.88% of the true A1c 68.3% of the time; 2 estimated a categorical A1c within ± one category from the true A1c about 50% of the time. Including RPG in imputation slightly improved the precision but did not improve the accuracy. Under MAR, including gender and age in addition to FPG improved the accuracy of imputed continuous A1c but not categorical A1c. Moreover, imputation of up to 33% of missing A1c values did not change the accuracy and precision and did not alter the impact of A1c on initiation of antihyperglycemic therapy. When using A1c values as a predictor variable, a simple imputation algorithm based only on age, sex, and fasting plasma glucose gave acceptable results.

  13. Sanger Sequencing for BRCA1 c.68_69del, BRCA1 c.5266dup and BRCA2 c.5946del Mutation Screen on Pap Smear Cytology Samples

    Directory of Open Access Journals (Sweden)

    Sin Hang Lee

    2016-02-01

    Full Text Available Three sets of polymerase chain reaction (PCR primers were designed for heminested PCR amplification of the target DNA fragments in the human genome which include the site of BRCA1 c.68_69del, BRCA1 c.5266dup and BRCA2 c.5946del respectively, to prepare the templates for direct Sanger sequencing screen of these three founder mutations. With a robust PCR mixture, crude proteinase K digestate of the fixed cervicovaginal cells in the liquid-based Papanicolaou (Pap cytology specimens can be used as the sample for target DNA amplification without pre-PCR DNA extraction, purification and quantitation. The post-PCR products can be used directly as the sequencing templates without further purification or quantitation. By simplifying the frontend procedures for template preparation, the cost for screening these three founder mutations can be reduced to about US $200 per test when performed in conjunction with human papillomavirus (HPV assays now routinely ordered for cervical cancer prevention. With this projected price structure, selective patients in a high-risk population can be tested and each provided with a set of DNA sequencing electropherograms to document the absence or presence of these founder mutations in her genome to help assess inherited susceptibility to breast and ovarian cancer in this era of precision molecular personalized medicine.

  14. Cloning and expression of HSF1 cDNA from Hainan Eld's deer%海南坡鹿HSF1cDNA的克隆与表达

    Institute of Scientific and Technical Information of China (English)

    成鹰; 林杰材; 满初日嘎; 杜丽; 王凤阳; 刘涛; 李治深; 许世英; 符运南; 林贤梅; 吴科榜

    2009-01-01

    采用RT-PCR和RACE方法扩增海南坡鹿热休克转录调节因子1(Heat shock transcription factor 1,HSF1)cDNA全长,将扩增产物与pMD20-T载体连接,重组质粒经PCR、酶切鉴定后测序并进行生物信息学分析;构建pET28a-hdHSF1表达载体,经IPTG诱导表达后,进行SDS-PAGE和Western blot分析.结果显示,海南坡鹿HSF1cDNA全长为2 036 bp,含有1个1 578 bp的开放阅读框,编码525个氨基酸.经生物信息学分析,HSF1是一个等电点为4.93的亲水性蛋白.经IPTG诱导表达后,得到一个带组氨酸标签的约62 kD的融合蛋白,用抗His单克隆抗体进行Western blot,得到一条约62 kD特异性抗体结合带,表明海南坡鹿HSF1原核表达载体成功构建并表达.

  15. The Effect of Aromatic Hydrocarbon Receptor on the Phenotype of the Hepa 1c1c7 Murine Hepatoma Cells in the Absence of Dioxin

    Directory of Open Access Journals (Sweden)

    Feng Wang

    2007-01-01

    Full Text Available The aromatic hydrocarbon receptor (AhR mediates biological responses to certain exogenous ligands, such as the environmental contaminant 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD, and has also been demonstrated to modulate the cell cycle and differentiated state of several cell lines independently of exogenous ligands. In this study, we used DNA micorarray analysis to elucidate the profile of genes responsive to the expression of unliganded AhR by re-introducing AhR into an AhR-deficient mouse derivative (c19 of the mouse hepatoma cell line Hepa1c1c7. 22 gene products were up-regulated and 8 were down-regulated two-fold or more in c19 cells infected with a retroviral vector expressing mouse AhR. Surprisingly, expression of genes involved in cell proliferation or differentiation were not affected by introduction of AhR. AhR also did not restore expression of the albumin gene in c19 cells. Introduction of AhR into c12, a similar AhRdefective mouse hepatoma cell line, also did not restore albumin expression, and furthermore, did not lead to changes in cellular morphology or cell cycle parameters. These observations fail to support the notion that unliganded AhR regulates proliferation and differentiation of liver-derived cells.

  16. 3-Nitrofluoranthene (3-NF) but not 3-aminofluoranthene (3-AF) elicits apoptosis as well as programmed necrosis in Hepa1c1c7 cells

    International Nuclear Information System (INIS)

    In this study, we show that the environmental pollutant, 3-nitrofluoranthene (3-NF) but not its amine form, 3-aminofluoranthene (3-AF), induces apoptosis as well as regulated necrosis with necroptotic features in Hepa1c1c7 cells. Upon exposure to 3-NF, both typical apoptotic and necrotic cells were observed. A large number of the cells exhibited a characteristic partial nuclear chromatin condensation. Cycloheximide completely attenuated 3-NF-induced cell death. Activation of caspase-8, -9, and -3 were observed. Moreover, Z-VAD-FMK decreased the apoptotic cells, whereas the number of propidium iodide (PI)-positive cells with partial chromatin condensation was reduced by Nec-1, an inhibitor of receptor interacting protein (RIP-1). Cyp1a1, but not nitric oxide synthase (NOS), appears to be involved in activation of 3-NF to reactive metabolites. Increase in the number as well as size of lysosomes, myelinosomes, and activation of autophagy were also observed. 3-NF induced phosphorylation of ERK1/2, JNK and p38 MAPKs. Interestingly, while inhibitors of ERK1/2 and JNK reduced apoptotic as well as necrotic cell death, the p38 inhibitor, SB202190 reduced only the necrotic cell death. Taken together, 3-NF elicits both apoptosis and a caspase-independent programmed cell death (PCD) with autophagic characteristics. Conversely, with 3-AF, no apparent cytotoxic effects besides a reduction in cell proliferation was observed

  17. Sanger Sequencing for BRCA1 c.68_69del, BRCA1 c.5266dup and BRCA2 c.5946del Mutation Screen on Pap Smear Cytology Samples.

    Science.gov (United States)

    Lee, Sin Hang; Zhou, Shaoxia; Zhou, Tianjun; Hong, Guofan

    2016-01-01

    Three sets of polymerase chain reaction (PCR) primers were designed for heminested PCR amplification of the target DNA fragments in the human genome which include the site of BRCA1 c.68_69del, BRCA1 c.5266dup and BRCA2 c.5946del respectively, to prepare the templates for direct Sanger sequencing screen of these three founder mutations. With a robust PCR mixture, crude proteinase K digestate of the fixed cervicovaginal cells in the liquid-based Papanicolaou (Pap) cytology specimens can be used as the sample for target DNA amplification without pre-PCR DNA extraction, purification and quantitation. The post-PCR products can be used directly as the sequencing templates without further purification or quantitation. By simplifying the frontend procedures for template preparation, the cost for screening these three founder mutations can be reduced to about US $200 per test when performed in conjunction with human papillomavirus (HPV) assays now routinely ordered for cervical cancer prevention. With this projected price structure, selective patients in a high-risk population can be tested and each provided with a set of DNA sequencing electropherograms to document the absence or presence of these founder mutations in her genome to help assess inherited susceptibility to breast and ovarian cancer in this era of precision molecular personalized medicine. PMID:26867194

  18. The effect of aromatic hydrocarbon receptor on the phenotype of the Hepa 1c1c7 murine hepatoma cells in the absence of dioxin.

    Science.gov (United States)

    Wang, Feng; Zhang, Ruixue; Shi, Shengli; Hankinson, Oliver

    2007-01-01

    The aromatic hydrocarbon receptor (AhR) mediates biological responses to certain exogenous ligands, such as the environmental contaminant 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), and has also been demonstrated to modulate the cell cycle and differentiated state of several cell lines independently of exogenous ligands. In this study, we used DNA microarray analysis to elucidate the profile of genes responsive to the expression of unliganded AhR by re-introducing AhR into an AhR-deficient mouse derivative (c19) of the mouse hepatoma cell line Hepa 1c1c7. 22 gene products were up-regulated and 8 were down-regulated two-fold or more in c19 cells infected with a retroviral vector expressing mouse AhR. Surprisingly, expression of genes involved in cell proliferation or differentiation were not affected by introduction of AhR. AhR also did not restore expression of the albumin gene in c19 cells. Introduction of AhR into c12, a similar AhR-defective mouse hepatoma cell line, also did not restore albumin expression, and furthermore, did not lead to changes in cellular morphology or cell cycle parameters. These observations fail to support the notion that unliganded AhR regulates proliferation and differentiation of liver-derived cells. PMID:19936078

  19. MUC1-C ONCOPROTEIN INDUCES TAMOXIFEN RESISTANCE IN HUMAN BREAST CANCER CELLS

    OpenAIRE

    Kharbanda, Akriti; Rajabi, Hasan; Jin, Caining; Raina, Deepak; Kufe, Donald

    2013-01-01

    Resistance of estrogen receptor positive (ER+) breast cancer cells to tamoxifen has been linked in part to activation of (i) certain receptor tyrosine kinases, such as HER2, and (ii) the PI3K→AKT pathway. Mucin 1 (MUC1) is aberrantly overexpressed in about 90% of human breast cancers and the oncogenic MUC1-C subunit associates with ERα. The present studies using HER2 overexpressing BT-474 breast cancer cells, which are constitutively resistant to tamoxifen, demonstrate that silencing MUC1-C i...

  20. Role of human heterogeneous nuclear ribonucleoprotein C1/C2 in dengue virus replication

    OpenAIRE

    Dechtawewat, Thanyaporn; Songprakhon, Pucharee; Limjindaporn, Thawornchai; Puttikhunt, Chunya; Kasinrerk, Watchara; Saitornuang, Sawanan; Yenchitsomanus, Pa-Thai; Noisakran, Sansanee

    2015-01-01

    Background Host and viral proteins are involved in dengue virus (DENV) replication. Heterogeneous ribonucleoprotein (hnRNP) C1/C2 are abundant host cellular proteins that exhibit RNA binding activity and play important roles in the replication of positive-strand RNA viruses such as poliovirus and hepatitis C virus. hnRNP C1/C2 have previously been shown to interact with vimentin and viral NS1 in DENV-infected cells; however, their functional role in DENV replication is not clearly understood....

  1. ADD1/SREBP1c activates the PGC1-alpha promoter in brown adipocytes

    DEFF Research Database (Denmark)

    Hao, Qin; Hansen, Jacob B; Petersen, Rasmus K;

    2010-01-01

    Cold adaptation elicits a paradoxical simultaneous induction of fatty acid synthesis and beta-oxidation in brown adipose tissue. We show here that cold exposure coordinately induced liver X receptor alpha (LXRalpha), adipocyte determination and differentiation-dependent factor 1 (ADD1)/sterol...... regulatory element-binding protein-1c (SREBP1c) and peroxisome proliferator-activated receptor gamma coactivator-1alpha (PGC1alpha) in brown and inguinal white adipose tissues, but not in epididymal white adipose tissue. Using in vitro models of white and brown adipocytes we demonstrate that beta...... regulator of PGC1alpha expression in brown adipose tissue....

  2. Prevalence of Diabetes and Prediabetes according to Fasting Plasma Glucose and HbA1c

    OpenAIRE

    Ja Young Jeon; Seung-Hyun Ko; Hyuk-Sang Kwon; Nan Hee Kim; Jae Hyeon Kim; Chul Sik Kim; Kee-Ho Song; Jong Chul Won; Soo Lim; Sung Hee Choi; Myoung-jin Jang; Yuna Kim; Kyungwon Oh; Dae Jung Kim; Bong-Yun Cha

    2013-01-01

    Background Due to the inconvenience of performing oral glucose tolerance tests and day to day variability in glucose level, glycated hemoglobin (HbA1c) has been recommended by the American Diabetes Association as a method to diagnose diabetes. In addition, the Korean Diabetes Association has also recommended the use of HbA1c as a diagnostic test for diabetes. In this study, we evaluated the prevalence of diabetes according to fasting plasma glucose (FPG) level only or the combination of FPG a...

  3. Podosome-regulating kinesin KIF1C translocates to the cell periphery in a CLASP-dependent manner

    Science.gov (United States)

    Efimova, Nadia; Grimaldi, Ashley; Bachmann, Alice; Frye, Keyada; Zhu, Xiaodong; Feoktistov, Alexander; Straube, Anne; Kaverina, Irina

    2014-01-01

    ABSTRACT The kinesin KIF1C is known to regulate podosomes, actin-rich adhesion structures that remodel the extracellular matrix during physiological processes. Here, we show that KIF1C is a player in the podosome-inducing signaling cascade. Upon induction of podosome formation by protein kinase C (PKC), KIF1C translocation to the cell periphery intensifies and KIF1C accumulates both in the proximity of peripheral microtubules that show enrichment for the plus-tip-associated proteins CLASPs and around podosomes. Importantly, without CLASPs, both KIF1C trafficking and podosome formation are suppressed. Moreover, chimeric mitochondrially targeted CLASP2 recruits KIF1C, suggesting a transient CLASP–KIF1C association. We propose that CLASPs create preferred microtubule tracks for KIF1C to promote podosome induction downstream of PKC. PMID:25344256

  4. Methylenetetrahydrofolate reductase gene polymorphism in Indian stroke patients

    Directory of Open Access Journals (Sweden)

    Kalita J

    2006-01-01

    Full Text Available Background and Aims: In view of the prevailing controversy about the role of Methylenetetrahydrofolate reductase (MTHFR C677T mutation in stroke and paucity of studies from India, this study has been undertaken to evaluate MTHFR C677T gene polymorphism in consecutive ischemic stroke patients and correlate these with folic acid, homocysteine (Hcy and conventional risk factors. Settings and Design: Ischemic stroke patients prospectively evaluated in a tertiary care teaching hospital. Materials and Methods: Computerized tomography proven ischemic stroke patients were prospectively evaluated including clinical, family history of stroke, dietary habits and addictions. Their fasting and postprandial blood sugar, lipid profile, vitamin B12, folic acid and MTHFR gene analysis were done. Statistical Analysis: MTHFR gene polymorphism was correlated with serum folic acid, Vitamin B12 and Hcy levels; family history of stroke in first-degree relatives; and dietary habits; employing Chi-square test. Results: There were 58 patients with ischemic stroke, whose mean age was 50 (4-79 years; among them, 10 were females. MTHFR gene polymorphism was present in 19 (32.8% patients, 3 were homozygous and 16 were heterozygous. Both serum folate and B12 levels were low in 29 (50% patients and Hcy in 48 (83%. Hypertension was present in 28 (48% patients, diabetes in 12 (21%, hyperlipidemia in 52 (90%, smoking in 17 (29%, obesity in 1 (1.7% and family history of stroke in first-degree relatives in 13 (22.4%. There was no significant relationship of MTHFR gene polymorphism with folic acid, B12, Hcy levels, dietary habits and number of risk factors. Vitamin B12 level was low in vegetarians ( P Conclusion: MTHFR gene polymorphism was found in one-third of patients with ischemic stroke and was insignificantly associated with higher frequency of elevated Hcy.

  5. Metabolism of bupropion by carbonyl reductases in liver and intestine.

    Science.gov (United States)

    Connarn, Jamie N; Zhang, Xinyuan; Babiskin, Andrew; Sun, Duxin

    2015-07-01

    Bupropion's metabolism and the formation of hydroxybupropion in the liver by cytochrome P450 2B6 (CYP2B6) has been extensively studied; however, the metabolism and formation of erythro/threohydrobupropion in the liver and intestine by carbonyl reductases (CR) has not been well characterized. The purpose of this investigation was to compare the relative contribution of the two metabolism pathways of bupropion (by CYP2B6 and CR) in the subcellular fractions of liver and intestine and to identify the CRs responsible for erythro/threohydrobupropion formation in the liver and the intestine. The results showed that the liver microsome generated the highest amount of hydroxybupropion (Vmax = 131 pmol/min per milligram, Km = 87 μM). In addition, liver microsome and S9 fractions formed similar levels of threohydrobupropion by CR (Vmax = 98-99 pmol/min per milligram and Km = 186-265 μM). Interestingly, the liver has similar capability to form hydroxybupropion (by CYP2B6) and threohydrobupropion (by CR). In contrast, none of the intestinal fractions generate hydroxybupropion, suggesting that the intestine does not have CYP2B6 available for metabolism of bupropion. However, intestinal S9 fraction formed threohydrobupropion to the extent of 25% of the amount of threohydrobupropion formed by liver S9 fraction. Enzyme inhibition and Western blots identified that 11β-dehydrogenase isozyme 1 in the liver microsome fraction is mainly responsible for the formation of threohydrobupropion, and in the intestine AKR7 may be responsible for the same metabolite formation. These quantitative comparisons of bupropion metabolism by CR in the liver and intestine may provide new insight into its efficacy and side effects with respect to these metabolites. PMID:25904761

  6. Short-chain dehydrogenases/reductases in cyanobacteria.

    Science.gov (United States)

    Kramm, Anneke; Kisiela, Michael; Schulz, Rüdiger; Maser, Edmund

    2012-03-01

    The short-chain dehydrogenases/reductases (SDRs) represent a large superfamily of enzymes, most of which are NAD(H)-dependent or NADP(H)-dependent oxidoreductases. They display a wide substrate spectrum, including steroids, alcohols, sugars, aromatic compounds, and xenobiotics. On the basis of characteristic sequence motifs, the SDRs are subdivided into two main (classical and extended) and three smaller (divergent, intermediate, and complex) families. Despite low residue identities in pairwise comparisons, the three-dimensional structure among the SDRs is conserved and shows a typical Rossmann fold. Here, we used a bioinformatics approach to determine whether and which SDRs are present in cyanobacteria, microorganisms that played an important role in our ecosystem as the first oxygen producers. Cyanobacterial SDRs could indeed be identified, and were clustered according to the SDR classification system. Furthermore, because of the early availability of its genome sequence and the easy application of transformation methods, Synechocystis sp. PCC 6803, one of the most important cyanobacterial strains, was chosen as the model organism for this phylum. Synechocystis sp. SDRs were further analysed with bioinformatics tools, such as hidden Markov models (HMMs). It became evident that several cyanobacterial SDRs show remarkable sequence identities with SDRs in other organisms. These so-called 'homologous' proteins exist in plants, model organisms such as Drosophila melanogaster and Caenorhabditis  elegans, and even in humans. As sequence identities of up to 60% were found between Synechocystis and humans, it was concluded that SDRs seemed to have been well conserved during evolution, even after dramatic terrestrial changes such as the conversion of the early reducing atmosphere to an oxidizing one by cyanobacteria. PMID:22251568

  7. Expression of 5α-Reductase Type 2 Gene in Human Testis, Epididymis and Vas Deferens

    Institute of Scientific and Technical Information of China (English)

    刘德瑜; 吴燕婉; 罗宏志; 张桂元

    2002-01-01

    Objectives To study the expression pattern of 5α-reductase type 2 gene in human malereproductive organsMethods The expression level of 5α-reductase type 2 gene inhuman testis, epididymisand vas deferens tissues was determined by in situ hybridization using Digoxin labeled5α-reductase type 2 cRNA probe.Results The brown granules of hybridizing signals distributed in the cytoplasm ofSertoli and Leydig cells of the testis, the principle cells of epididymis and the epithe-lial cells of vas deferens, but there was no positive signal in the nuclei of above-men-tioned cells. No positive signal was observed in germ cells, basement of the testis,interstium of epididymis and basement, as well as smooth muscle of vas deferens.Conclusion This study confirmed that the 5α-reductase type 2 gene expressed in Ser-toli, Leydig cells of the testis, and the principle cells of epididymis. The expressionpattern of the gene in these cells in human was similar to that of rat and monkey. Thepresence of 5a-reductase type 2 gene in epithelial cells of the vas deferens suggested itmight possess an important physiological role in human reproduction.

  8. Pseudomonas stutzeri N2O reductase contains CuA-type sites

    International Nuclear Information System (INIS)

    N2O reductase (N2O → N2) is the terminal enzyme in the energy-conserving denitrification pathway of soil and marine denitrifying bacteria. The protein is composed of two identical subunits and contains eight copper ions per enzyme molecule. The magnetic circular dichroism spectrum of resting (oxidized) N2O reductase is strikingly similar to the magnetic circular dichroism spectrum of the CuA site in mammalian cytochrome c oxidase and is unlike the magnetic circular dichroism spectra of all other biological copper chromophores obtained to data. Sulfur (or chlorine) scatterers are required to fit the copper extended x-ray absorption fine structure data of both the oxidized and reduced forms of N2O reductase. Satisfactory fits require a Cu-N or Cu-O interaction at 2.0 angstrom, a Cu-(S, Cl) interaction at 2.3 angstrom and an additional Cu-(S, Cl) interaction at ∼ 2.6 angstrom (oxidized) or ∼ 2.7 angstrom (reduced). Comparison of the N2O reductase sequence, determined by translating the structural NosZ gene, with cytochrome c oxidase subunit II sequences from several sources indicates that a Gly-Xaa-Xaa-Xaa-Xaa-Xaa-Cys-Ser-Xaa-Xaa-Cys-Xaa-Xaa-Xaa-Xaa-Xaa-His stretch if high conserved. This sequence contains three of the probable ligands in a CuA-type site Collectively these data establish that Pseudomonas stutzeri N2O reductase contains CuA-type sites

  9. INHIBITORY ACTIVITY OF FLAVONOIDS ON THE LENS ALDOSE REDUCTASE OF HEALTHY AND DIABETIC RATS

    Directory of Open Access Journals (Sweden)

    M. T. Goodarzi

    2006-05-01

    Full Text Available Aldose reductase is a critical enzyme in the polyol pathway that plays an important role in diabetes mellitus. Inhibition of the activity of this enzyme can prevent cataract in diabetic patients’lenses. In this study the inhibitory effect of two flavonoids, quercetin and naringin, in the activity of aldose reductase in streptozotocin-induced diabetic and healthy rats were investigated. Thirty male rats were divided in six groups. The first, second and third group were healthy rats that received water,quercetin and naringin, respectively. The fourth, fifth and sixth groups were streptozocin-induced diabetic rats that received water, quercetin and naringin, respectively. These rats were fed orally in a definite dose from each substance for 12 days. After this period rats were scarified and their lenses were separated and homogenized. The activity of aldose reductase was measured in each homogenized sample separately. The effect of feeding of these substances in blood sugar was also determined. Aldose reductase activity was reduced 73 and 69 percent in diabetic rats fed by quercetin and naringin, respectively, and the difference compared to control group was significant. In healthy rats this reduction was 63 and 59 percent, respectively, and the difference was significant compared to those who did not receive flavonoids. It was concluded that these substances were effective in reduction of aldose reductase activity in vivo and consequently could delay the progress of cataract.

  10. Current status of 5α-reductase inhibitors in the treatment of benign hyperplasia of prostate

    Directory of Open Access Journals (Sweden)

    Kumar Vijay

    2008-04-01

    Full Text Available Benign prostatic hyperplasia (BPH is a common problem in aging men, which is associated with lower urinary tract symptoms. This condition is dependent on the presence of androgens for its progression, and medical therapy is the first-line treatment for BPH patients with moderate-to-severe symptoms and includes the use of either alpha 1-adrenergic blockers or 5α-reductase inhibitors. Adrenergic blocking drugs reduce the dynamic component while the 5α-reductase inhibitors reduce the static component of bladder outlet obstruction in BPH. By inhibiting the generation of active form of testosterone, viz., dihydrotestosterone, the 5α-reductase inhibitors not only reduce the symptoms of BPH but also decrease the need for surgery and further progression of BPH. Besides, prolonged use of combination of 5α-reductase inhibitors and alpha 1-adrenergic blockers has been found to be more beneficial than either of the two drugs given alone. This review gives a brief account of rationale and efficacy of treatment by 5α-reductase inhibitors in the management of BPH.

  11. Structural and biochemical properties of cloned and expressed human and rat steroid 5α-reductases

    International Nuclear Information System (INIS)

    The microsomal enzyme steroid 5α-reductase is responsible for the conversion of testosterone into the more potent androgen dihydrotestosterone. In man, this steroid acts on a variety of androgen-responsive target tissues to mediate such diverse endocrine processes as male sexual differentiation in the fetus and prostatic growth in men. Here we describe the isolation, structure, and expression of a cDNA encoding the human steroid 5α-reductase. A rat cDNA was used as a hybridization probe to screen a human prostate cDNA library. A 2.1-kilobase cDNA was identified and DNA sequence analysis indicated that the human steroid 5α-reductase was a hydrophobic protein of 259 amino acids with a predicted molecular weight of 29,462. A comparison of the human and rat protein sequences revealed a 60% identity. Transfection of expression vectors containing the human and rat cDNAs into simian COS cells resulted in the synthesis of high levels of steroid 5α-reductase enzyme activity. Both enzymes expressed in COS cells showed similar substrate specificities for naturally occurring steroid hormones. However, synthetic 4-azasteroids demonstrated marked differences in their abilities to inhibit the human and rat steroid 5α-reductases

  12. Magnetic properties of (Ho 1-cGd c) Co 2 compounds

    Science.gov (United States)

    Tari, A.; Keith, V.; Hwang, J. S.

    1994-02-01

    E.S.R., magnetisation and susceptibility measurements have been carried out on the series (Ho 1-cGd c)Co 2. In compounds with c≤ 0.40 we find evidence of spin reorientation. In the three most dilute compounds a g-value of about four is obtained which increases with increasing Gd content.

  13. IGF-1 C Domain-Modified Hydrogel Enhances Cell Therapy for AKI.

    Science.gov (United States)

    Feng, Guowei; Zhang, Jimin; Li, Yang; Nie, Yan; Zhu, Dashuai; Wang, Ran; Liu, Jianfeng; Gao, Jie; Liu, Na; He, Ningning; Du, Wei; Tao, Hongyan; Che, Yongzhe; Xu, Yong; Kong, Deling; Zhao, Qiang; Li, Zongjin

    2016-08-01

    Low cell retention and engraftment after transplantation limit the successful application of stem cell therapy for AKI. Engineered microenvironments consisting of a hydrogel matrix and growth factors have been increasingly successful in controlling stem cell fate by mimicking native stem cell niche components. Here, we synthesized a bioactive hydrogel by immobilizing the C domain peptide of IGF-1 (IGF-1C) on chitosan, and we hypothesized that this hydrogel could provide a favorable niche for adipose-derived mesenchymal stem cells (ADSCs) and thereby enhance cell survival in an AKI model. In vitro studies demonstrated that compared with no hydrogel or chitosan hydrogel only, the chitosan-IGF-1C hydrogel increased cell viability through paracrine effects. In vivo, cotransplantation of the chitosan-IGF-1C hydrogel and ADSCs in ischemic kidneys ameliorated renal function, likely by the observed promotion of stem cell survival and angiogenesis, as visualized by bioluminescence imaging and attenuation of fibrosis. In conclusion, IGF-1C immobilized on a chitosan hydrogel provides an artificial microenvironment for ADSCs and may be a promising therapeutic approach for AKI. PMID:26869006

  14. On the causes of compositional order in the NicPt(1-c) alloys

    International Nuclear Information System (INIS)

    We review, briefly, the arguments which gave rise to the current controversy concerning the origin of compositional order in NicPt1-c alloys. We note that strain fluctuations play an important role in determining the state of compositional order in this system and outline a theoretical framework that takes account of them. 29 refs., 4 figs

  15. Dynamic life-time assessing method for the N1C700 turbine's rotor

    International Nuclear Information System (INIS)

    The N1C700 turbine's rotor subject to different sorts of stress variations was investigated through dynamic life-time assessing method. To obtain the temperature fields at different steam parameters inside the turbine components, a computer code named DENOPAR was developed

  16. C1-C2 rotary subluxation following posterior stabilization for congenital atlantoaxial dislocation.

    Directory of Open Access Journals (Sweden)

    Behari S

    2000-04-01

    Full Text Available The authors report a rare complication of C1-C2 rotary subluxation in two children following posterior stabilization for congenital atlantoaxial dislocation (AAD. A patient, with mobile AAD, underwent Brook′s C1-C2 fusion while the other, with fixed AAD, underwent transoral decompression followed by Jain′s occipitocervical fusion. A pre-existing ligamentous laxity associated with an asymmetrical wire tightening or slippage of the wires due to rotation of the neck in the former, and the drilling of the C1-C2 lateral joints during the transoral procedure in the latter, could have contributed to the rotary subluxation. Both patients presented with persistent torticollis due to fusion in an asymmetrical position with dislocated facet joints. Rotary C1-C2 subluxation, when coexisting with anterior dislocation, has the potential to cause severe and occasionally fatal cord compression. Well defined criteria to diagnose this entity by conventional radiology exist, however, due to the overlap of anatomy, the condition is often overlooked. In the present study, three dimensional reconstruction images using helical computerized tomography were very useful in delineating the subluxation and in planning its surgical reduction and arthrodesis.

  17. Measurement of the figure of merit M for 1-C3F6/SF6 mixtures

    DEFF Research Database (Denmark)

    Christensen, Jørn Erik Berril; McAllister, Iain Wilson

    1997-01-01

    High precision measurements of the linear part of the Paschen curve are reported for 1-C3F6/SF6 mixtures. From these measurements, values for the pressure-reduced limiting electric field strength (E/p)lim and the associated figure of merit M are derived. These two parameters can be used to...

  18. On the causes of compositional order in the Ni sub c Pt sub (1-c) alloys

    Energy Technology Data Exchange (ETDEWEB)

    Gyorffy, B.L. (Bristol Univ. (United Kingdom). H.H. Wills Physics Lab.); Pinski, F.J. (Cincinnati Univ., OH (United States). Dept. of Physics); Ginatempo, B. (Messina Univ. (Italy). Ist. di Fisica Teorica); Johnson, D.D. (Sandia National Labs., Albuquerque, NM (United States)); Staunton, J.B. (Warwick Univ., Coventry (United Kingdom). Dept. of Physics); Shelton, W.A.; Stocks, G.M.; Nicholson, D.M.

    1991-01-01

    We review, briefly, the arguments which gave rise to the current controversy concerning the origin of compositional order in Ni{sub c}Pt{sub 1-c} alloys. We note that strain fluctuations play an important role in determining the state of compositional order in this system and outline a theoretical framework that takes account of them. 29 refs., 4 figs.

  19. Software selection based on analysis and forecasting methods, practised in 1C

    Science.gov (United States)

    Vazhdaev, A. N.; Chernysheva, T. Y.; Lisacheva, E. I.

    2015-09-01

    The research focuses on the problem of a “1C: Enterprise 8” platform inboard mechanisms for data analysis and forecasting. It is important to evaluate and select proper software to develop effective strategies for customer relationship management in terms of sales, as well as implementation and further maintenance of software. Research data allows creating new forecast models to schedule further software distribution.

  20. Baseline haemoglobin A1c influences retinal function after long-term insulin pump therapy

    DEFF Research Database (Denmark)

    Klefter, Oliver N; Holfort, Stig K; Larsen, Michael

    2016-01-01

    eye per patient. Procedures included full-field electroretinography (ERG), dark adaptometry, optical coherence tomography, and fundus photography. RESULTS: Mean ERG amplitudes 3.5 years after initiation of CSII were 15-43 % lower than at baseline (all p < 0.05) and 21-45 % lower than after 1 year on...... CSII. The mean rate of dark adaptation had returned to baseline after a transient 13 % (p = 0.0024) acceleration at the 1-year visit. Reduction of ERG amplitudes between 1 and 3.5 years was statistically associated predominantly with baseline haemoglobin A1c (HbA1c) ≥ 8.7 % and, to a smaller extent......, with HbA1c reductions larger than 1.9 % after initiation of CSII. No significant changes in ERG amplitudes were found in patients with baseline HbA1c < 8.7 % and HbA1c reductions smaller than 1.9 %. CONCLUSIONS: Deterioration of subclinical retinal function from 1 to 3.5 years after initiation of CSII...

  1. Hemoglobin A1c measurement for the diagnosis of Type 2 diabetes in children

    Directory of Open Access Journals (Sweden)

    Kapadia Chirag

    2012-12-01

    Full Text Available Abstract Laboratory measurements of hemoglobin A1c above 6.5% were approved as an additional diagnostic criteria for diabetes mellitus by the American Diabetes Association in 2010. Several recent pediatric studies have cast HbA1c measurement in children in an unfavorable light in the pediatric population, by comparing HbA1c measurements to results on oral glucose tolerance test (OGTT or fasting plasma glucose (FPG. However, many of these studies do not recognize that diabetes diagnostic criteria are based upon long-term health outcomes. In this sense, OGTT and FPG have themselves never been validated in the pediatric population. Studies to validate diagnostic tests for diabetes in pediatric populations may take a substantial period of time, and may prove unfeasible. However, studies that tie diagnostic results as a child to diagnostic results as an adult may be more feasible and may provide the data needed to determine which pediatric diagnostic criteria to use. Thus, for the time being, except for cases of hemoglobinopathy, cystic fibrosis, and a few other exceptions, describing HbA1c as ‘lacking in sensitivity or specificity’ in the pediatric population because of lack of correlation with OGTT is not scientifically sound.

  2. Synthesis of 1-C2H3 theophylline and 3-C2H3 theophylline

    International Nuclear Information System (INIS)

    This article describes a three step-selective deuteration method of 1-methyl and 3-methylxanthine, after protection of the N-7 position by chloromethylpivalate and alkylation by trideuteromethyl iodide ; yielding 1-C2H3 and 3-C2H3 theophylline. (author)

  3. The Load Design and Implementation of HJ-1-C Space-borne SAR

    Directory of Open Access Journals (Sweden)

    Yu Wei-dong

    2014-06-01

    Full Text Available HJ-1-C is a Synthetic Aperture Radar (SAR satellite in the Constellation of “2+1” for China environment and disaster monitoring. It works at S-band with a resolution of 5 m. SAR payload uses a reflector antenna and a high-power concentrated transmitter. Its light weight and high efficiency is very suitable for a small satellite platform. Now HJ-1-C satellite has been launched into orbit and has acquired Chinese first S-band SAR images from space, which demonstrate excellent quality and rich information about scenes imaged. This success verifies our design, testing and experiment work on the payload. With its following operation, HJ-1-C satellite is expected to make a great contribution to the applications of environment protection and disaster monitoring in China. This paper introduces the design and development of HJ-1-C SAR payload, present its main parameters and performance, describes its device details and its manufacture, testing and experiment process. Some images acquired in the orbit are showed.

  4. Neutron Crystal-Field Spectroscopy and Susceptibility in ErcY1-cA1

    DEFF Research Database (Denmark)

    Heer, H.; Furrer, A.; Walker, E.; Treyvand, A.; Purwins, H. -G.; Kjems, Jørgen

    1974-01-01

    Inelastic neutron scattering experiments and susceptibility measurements have been carried out on polycrystalline ErcY1-cAl2. A least-squares fitting procedure has been applied to the neutron data which favours four sets of crystal-field parameters. The results are compared with the measured...

  5. Spirastrellolide E: Synthesis of an advanced C(1)-C(24) southern hemisphere

    Science.gov (United States)

    Sokolsky, Alexander; Wang, Xiaozhao; Smith, Amos B.

    2014-01-01

    The synthesis of a C(1)-C(24) advanced southern hemisphere fragment towards the total synthesis of spirastrellolide E has been achieved. Highlights of the route include a highly convergent Type I Anion Relay Chemistry (ARC) tactic for fragment assembly, in conjunction with a directed, regioselective gold-catalyzed alkyne functionalization to generate the central unsaturated [6,6]-spiroketal. PMID:26097261

  6. Association of the rs3743205 variant of DYX1C1 with dyslexia in Chinese children

    Directory of Open Access Journals (Sweden)

    Waye Mary MY

    2011-05-01

    Full Text Available Abstract Background Dyslexia is a learning disability that is characterized by difficulties in the acquisition of reading and spelling skills independent of intelligence, motivation or schooling. Studies of western populations have suggested that DYX1C1 is a candidate gene for dyslexia. In view of the different languages used in Caucasian and Chinese populations, it is therefore worthwhile to investigate whether there is an association of DYX1C1 in Chinese children with dyslexia. Method and Results Eight single nucleotide polymorphisms (SNPs were genotyped from three hundred and ninety three individuals from 131 Chinese families with two which have been reported in the literature and six tag SNPs at DYX1C1. Analysis for allelic and haplotypic associations was performed with the UNPHASED program and multiple testing was corrected using false discovery rates. We replicated the previously reported association of rs3743205 in Chinese children with dyslexia (pcorrected = 0.0072. This SNP was also associated with rapid naming, phonological memory and orthographic skills in quantitative trait analysis. Conclusion Our findings suggest that DYX1C1 is associated with dyslexia in people of Chinese ethnicity in Hong Kong.

  7. Software selection based on analysis and forecasting methods, practised in 1C

    OpenAIRE

    Vazhdaev, Andrey Nikolaevich; Chernysheva, Tatiana Yurievna; Lisacheva, E. I.

    2015-01-01

    The research focuses on the problem of a "1C: Enterprise 8" platform inboard mechanisms for data analysis and forecasting. It is important to evaluate and select proper software to develop effective strategies for customer relationship management in terms of sales, as well as implementation and further maintenance of software. Research data allows creating new forecast models to schedule further software distribution.

  8. CLINICAL CORRELATION OF HBA1C AND DIABETIC NEPHROPATHY WITH DIABETIC RETINOPATHY

    Directory of Open Access Journals (Sweden)

    Niveditha

    2013-12-01

    Full Text Available ABSTRACT: To establish a r elation between diabetic retinopathy and diabetic nephropathy in type II diabetes mellitus. To find out the relation between level of glycosylated haemoglobin (HbA1c with diabetic retinopathy and diabetic nephropathy. An observational clinical study where 50 patients with diabetic retinopathy included. HbA1C, blood urea and serum creatinine levels of these patients were measured and the correlation between these values with the severity of retinopathy was assessed. Among 50 patients, 31 were males and 19 f emales. Mean age of patients was 62 years. Mean duration of diabetes mellitus was 6.9 years. None of the patients with severe NPDR and PDR had HbA1C under very good control. 64.3% with mild NPDR, 78.2% with moderate NPDR, 87.5% with severe NPDR and 100% pa tients with PDR had HbA1C under poor control. In mild NPDR group 14.3%, in severe NPDR group 50% and in PDR group 40% had blood urea >40. In mild NPDR group 14.3%, in severe NPDR group 50% and in PDR group 60% had serum creatinine>1. Glycosylated haemoglob in showed increasing trend as severity of diabetic retinopathy increased. Blood urea and serum creatinine also showed a positive correlation with diabetic retinopathy

  9. Shiga toxin 1c-producing Escherichia coli strains : phenotypic and genetic characterization and association with human disease

    NARCIS (Netherlands)

    Friedrich, Alexander W; Borell, Julia; Bielaszewska, Martina; Fruth, Angelika; Tschäpe, Helmut; Karch, Helge

    2003-01-01

    The distribution of the stx(1c) allele among Shiga toxin (Stx)-producing Escherichia coli (STEC) and the virulence characteristics of stx(1c)-harboring STEC are unknown. In this study, we identified stx(1c) in 76 (54.3%) of 140 eae-negative, but in none of 155 eae-positive, human STEC isolates (P <

  10. Common variants in CACNA1C and MDD susceptibility: A comprehensive meta-analysis.

    Science.gov (United States)

    Rao, Shuquan; Yao, Yao; Zheng, Chuan; Ryan, Joanne; Mao, Canquan; Zhang, Fuquan; Meyre, David; Xu, Qi

    2016-09-01

    Major depressive disorder (MDD) is one of the most common psychiatric disorders with a relatively high heritability (35-40%). Though rs1006737 in the CACNA1C gene showed significant association with MDD in a British large-scale candidate association study, most of the replication analyses with relatively small sample size reported negative association. Moreover, this locus has never been identified in previous genome-wide association studies (GWAS) for MDD. Here, we conducted a comprehensive meta-analysis of the association between CACNA1C variants and MDD risk by combining all published data. Genetic data from one European GWAS and five individual follow-up studies, which include up to 12,629 patients of MDD and 28,653 controls, that is, the largest sample size on CACNA1C to date, were collected. Rs1006737 showed significant association with MDD in the fixed-effect model (Z = 2.56, P = 0.011, OR = 1.08, 95%CI = 1.04-1.12) and the association remained after reanalyzing the data according to ethnicity. We additionally analyzed other 25 SNPs, genotyped in only one replication study, across the CACNA1C locus, and found that two SNPs, rs4765905 (P = 0.041, OR = 1.05, 95%CI 1.00-1.09) and rs4765937 (P = 0.025, OR = 1.05, 95%CI 1.01-1.09) showed nominal association with MDD, while rs2239073 (P = 0.002, OR = 1.07, 95%CI 1.02-1.11) exhibited significant association with MDD, which survived from multiple corrections. Our study provides support for positive association between CACNA1C and MDD; however, the current data suggest the necessity of replication analyses in a larger-scale sample. © 2016 Wiley Periodicals, Inc. PMID:27260792

  11. Association between high risk foot, retinopathy and HBA1c in Saudi diabetic population

    International Nuclear Information System (INIS)

    Background: One of the important complications of diabetes is diabetic-foot-ulcer, also reported in Saudi Arabia, like other countries. Similarly, the complications, like retinopathy and nephropathy are also occurring in diabetic patients of this region. Apart from the care and monitoring of these patients, it is important to find out association between these complications and their relation with common factors, like HbA1c levels. Such relation is not yet reported in literature. Objective: Therefore, this study was planned to find out association between neuropathy (leading to high risk foot) and retinopathy by the estimation of HbA1c levels in Saudi population. Methods: After exclusion of the cases of gestational diabetes and children with type-1 diabetes, 333 Patients having age 21 to 97 years were examined in the Diabetology Clinic of Diabetes Centre, Aseer Central Hospital, Abha. All patients were screened for neuropathy (High risk of the foot) and retinopathy (by Fundus Photography). HbA1c levels were determined, using standardised procedure. The obtained data was analysed statistically by SPSS-12 for Windows. Results: HbA1c levels of less than or equal to have been found to be associated with neuropathy, high risk foot, and as well as non- proliferative and proliferative retinopathy. Pearson chi square test has demonstrated association between progressive retinopathy and development of high risk foot. Conclusion: The observed data indicate poor glycemic or diabetes control on the basis of higher HbA1c levels and strong association between high risk foot and the development of progressive retinopathy. (author)

  12. 1-Nitropyrene (1-NP) induces apoptosis and apparently a non-apoptotic programmed cell death (paraptosis) in Hepa1c1c7 cells

    International Nuclear Information System (INIS)

    Mechanistic studies of nitro-PAHs (polycyclic aromatic hydrocarbons) of interest might help elucidate which chemical characteristics are most important in eliciting toxic effects. 1-Nitropyrene (1-NP) is the predominant nitrated PAH emitted in diesel exhaust. 1-NP-exposed Hepa1c1c7 cells exhibited marked changes in cellular morphology, decreased proliferation and different forms of cell death. A dramatic increase in cytoplasmic vacuolization was observed already after 6 h of exposure and the cells started to round up at 12 h. The rate of cell proliferation was markedly reduced at 24 h and apoptotic as well as propidium iodide (PI)-positive cells appeared. Electron microscopic examination revealed that the vacuolization was partly due to mitochondria swelling. The caspase inhibitor Z-VAD-FMK inhibited only the apoptotic cell death and Nec-1 (an inhibitor of necroptosis) exhibited no inhibitory effects on either cell death or vacuolization. In contrast, cycloheximide markedly reduced both the number of apoptotic and PI-positive cells as well as the cytoplasmic vacuolization, suggesting that 1-NP induced paraptotic cell death. All the MAPKs; ERK1/2, p38 and JNK, appear to be involved in the death process since marked activation was observed upon 1-NP exposure, and their inhibitors partly reduced the induced cell death. The ERK1/2 inhibitor PD 98057 completely blocked the induced vacuolization, whereas the other MAPKs inhibitors only had minor effects on this process. These findings suggest that 1-NP may cause apoptosis and paraptosis. In contrast, the corresponding amine (1-aminopyrene) elicited only minor apoptotic and necrotic cell death, and cells with characteristics typical of paraptosis were absent

  13. Down-regulation of the detoxifying enzyme NAD(P)H:quinone oxidoreductase 1 by vanadium in Hepa 1c1c7 cells.

    Science.gov (United States)

    Anwar-Mohamed, Anwar; El-Kadi, Ayman O S

    2009-05-01

    Recent data suggest that vanadium (V5+) compounds exert protective effects against chemical-induced carcinogenesis, mainly through modifying various xenobiotic metabolizing enzymes. In fact, we have shown that V5+ down-regulates the expression of Cyp1a1 at the transcriptional level through an ATP-dependent mechanism. However, incongruously, there is increasing evidence that V5+ is found in higher amounts in cancer cells and tissues than in normal cells or tissues. Therefore, the current study aims to address the possible effect of this metal on the regulation of expression of an enzyme that helps maintain endogenous antioxidants used to protect tissues/cells from mutagens, carcinogens, and oxidative stress damage, NAD(P) H:quinone oxidoreductase 1 (Nqo1). In an attempt to examine these effects, Hepa 1c1c7 cells and its AhRdeficient version, c12, were treated with increasing concentrations of V5+ in the presence of two distinct Nqo1 inducers, the 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) and isothiocyanate sulforaphane (SUL). Our results showed that V5+ inhibits the TCDD- and SUL-mediated induction of Nqo1 at mRNA, protein, and catalytic activity levels. At transcriptional level, V5+ was able to decrease the TCDD- and SUL-induced nuclear accumulation of Nrf2 and the subsequent binding to antioxidant responsive element (ARE) without affecting Nrf2 protein levels. Looking at post-transcriptional level; we found that V5+ did not affect Nqo1 mRNA transcripts turn-over rates. However, at the post-translational level V5+ increased Nqo1 protein half-life. In conclusion, the present study demonstrates that V5+ down-regulates Nqo1 at the transcriptional level, possibly through inhibiting the ATP-dependent activation of Nrf2. PMID:19367690

  14. Induction of cytochrome P450 1A1 gene expression by a vitamin K3 analog in mouse hepatoma Hepa-1c1c7 cells.

    Science.gov (United States)

    Chun, Y J; Lee, B Y; Yang, S A; Ryu, C K; Kim, M Y

    2001-10-31

    Nine vitamin K3 analogs were compared with respect to the induction of the cytochrome P450 1A1 (CYP1A1) expression in mouse hepatoma Hepa-1c1c7 cells. 6-(4-Diethylamino)phenyl-7-chloro-5,8-quinolinedione (EA4) caused a significant induction of the CYP1A1-mediated ethoxyresorufin O-deethylase activity in a time- and concentration-dependent manner. The induction was accompanied by an increase of the Cyp1a1 mRNA transcription. The transient expression of the mouse Cyp1a1-CAT gene into cells showed that EA4 induced CAT activity. However, the aryl hydrocarbon receptor and its nuclear partner, aryl hydrocarbon receptor nuclear translocator mRNA transcription, were unaffected by the EA4 treatment. When the cells were incubated with EA4 in the presence of 1 nM TCDD, the ethoxyresorufin O-deethylase activity that was induced by TCDD was significantly suppressed by EA4. Inhibition of protein synthesis by cycloheximide strongly enhanced the EA4-dependent Cyp1a1 mRNA expression. Up-regulation of protein kinase C by a 2 h preincubation with phorbol 12-myristate 13-acetate increased the EA4-dependent expression of the Cyp1a1 gene. In human cells, such as HepG2 (human hepatocarcinoma), MCF-7 (human breast adenocarcinoma cell line), and HL-60 (human promyelocytic cell line), the expression of CYP1A1 mRNA was also induced by EA4 treatment. Moreover, CYP1B1 mRNA was increased by EA4 in MCF-7 cells. These results indicate that EA4 modulates CYP1A1 and CYP1B1 expressions by transcriptional activation. Also, protein kinase C may be involved in the induction mechanism of CYP1A1 by EA4. PMID:11710520

  15. Down-regulation of aryl hydrocarbon receptor-regulated genes by tumor necrosis factor-alpha and lipopolysaccharide in murine hepatoma Hepa 1c1c7 cells.

    Science.gov (United States)

    Gharavi, Negar; El-Kadi, Ayman O S

    2005-03-01

    Although much is known concerning the effects of inflammation and oxidative stress on the cytochrome P450 1A1 (CYP1A1), little is known about the modulation of other aryl hydrocarbon receptor (AHR)-regulated genes such as glutathione-S-transferase Ya (GST Ya) and NAD(P)H:quinone oxidoreductase (QOR) by inflammation. In the present study, the effect of tumor necrosis factor (TNF)-alpha and lipopolysaccharides (LPS) on the constitutive and inducible expression of the AHR-regulated genes cyp1a1, GST Ya, and QOR was determined in murine hepatoma Hepa 1c1c7 (WT), AHR-deficient (C12), and AHR nuclear translocator protein (ARNT)-deficient (C4) cells. We found that both TNF-alpha and LPS strongly repressed the constitutive expression and the beta-naphthoflavone-mediated induction of cyp1a1, GST Ya, and QOR in WT but not in C12 and C4 cells. The induction of GST Ya and QOR activities and mRNA levels by phenolic antioxidant, tert-butylhydroquinone, through the antioxidant response element was not significantly affected by TNF-alpha or LPS. In addition, a significant increase in reactive oxygen species was observed in WT, C12, and C4 cells treated with TNF-alpha or LPS which was completely prevented by tert-butylhydroquinone. These results show that the down-regulation of AHR-regulated genes by TNF-alpha and LPS is dependent on the presence of both heterodimeric transcription factors, AHR and ARNT. Furthermore, reactive oxygen species may be involved in the down-regulation of AHR-regulated genes. PMID:15627257

  16. MEK2 regulates ribonucleotide reductase activity through functional interaction with ribonucleotide reductase small subunit p53R2.

    Science.gov (United States)

    Piao, Chunmei; Youn, Cha-Kyung; Jin, Min; Yoon, Sang Pil; Chang, In-Youb; Lee, Jung Hee; You, Ho Jin

    2012-09-01

    The p53R2 protein, a newly identified member of the ribonucleotide reductase family that provides nucleotides for DNA damage repair, is directly regulated by p53. We show that p53R2 is also regulated by a MEK2 (ERK kinase 2/MAP kinase kinase 2)-dependent pathway. Increased MEK1/2 phosphorylation by serum stimulation coincided with an increase in the RNR activity in U2OS and H1299 cells. The inhibition of MEK2 activity, either by treatment with a MEK inhibitor or by transfection with MEK2 siRNA, dramatically decreased the serum-stimulated RNR activity. Moreover, p53R2 siRNA, but not R2 siRNA, significantly inhibits serum-stimulated RNR activity, indicating that p53R2 is specifically regulated by a MEK2-dependent pathway. Co-immunoprecipitation analyses revealed that the MEK2 segment comprising amino acids 65-171 is critical for p53R2-MEK2 interaction, and the binding domain of MEK2 is required for MEK2-mediated increased RNR activity. Phosphorylation of MEK1/2 was greatly augmented by ionizing radiation, and RNR activity was concurrently increased. Ionizing radiation-induced RNR activity was markedly attenuated by transfection of MEK2 or p53R2 siRNA, but not R2 siRNA. These data show that MEK2 is an endogenous regulator of p53R2 and suggest that MEK2 may associate with p53R2 and upregulate its activity. PMID:22895183

  17. Discovery and characterization of a xylose reductase from Zymomonas mobilis ZM4.

    Science.gov (United States)

    Agrawal, Manoj; Chen, Rachel Ruizhen

    2011-11-01

    Formation of xylitol, a byproduct from xylose fermentation, is a major limiting factor in ethanol production from xylose in engineered Zymomonas strains, yet the postulated xylose reductase remains elusive. We report here the discovery of xylose reductase in Zymomonas mobilis and, for the first time, to associate the enzyme function with its gene. Besides xylose and xylulose, the enzyme was active towards benzaldehyde, furfural, 5-hydroxymethyl furfural, and acetaldehyde, exhibiting nearly 150-times higher affinity with benzaldehyde than xylose. The discovery of xylose reductase paves the way for further improvement of xylose fermentation in Z. mobilis. The enzyme may also be used to mitigate toxicity of furfural and other inhibitors from plant biomass. PMID:21720846

  18. Biochemical predetermination of the NO synthase and nitrite reductase components of the nitric oxide cycle.

    Science.gov (United States)

    Reutov, V P

    1999-05-01

    This review presents some aspects of a concept of cellular evolution bearing a relationship to nitrate--nitrite respiration, the endosymbiosis theory, and the origin of NO synthase and nitrite reductase activity in heme-containing proteins. Analysis of structural and functional unity of the NO synthase and nitrite reductase systems suggests that these systems did not arise without any relation to evolutionarily ancient energetic systems of cells. The use of symmetry principles reveals commonalities among many electron transport chains which in the language of physics is called "invariance". This work also comparatively analyzes the nitric oxide cycle and the known nitrogen cycle. The ideas about evolution of the NO synthase and nitrite reductase systems developed here are clearly compatible with the endosymbiotic theory and the hypothesis that nitrate--nitrite respiration was a precursor of oxygen-dependent respiration. PMID:10381613

  19. Crystallization and preliminary X-ray crystallographic studies of pig heart carbonyl reductase

    International Nuclear Information System (INIS)

    Pig heart carbonyl reductase has been crystallized in the presence of NADPH. Diffraction data have been collected using synchrotron radiation. Pig heart carbonyl reductase (PHCR), which belongs to the short-chain dehydrogenase/reductase (SDR) family, has been crystallized by the hanging-drop vapour-diffusion method. Two crystal forms (I and II) have been obtained in the presence of NADPH. Form I crystals belong to the tetragonal space group P42, with unit-cell parameters a = b = 109.61, c = 94.31 Å, and diffract to 1.5 Å resolution. Form II crystals belong to the tetragonal space group P41212, with unit-cell parameters a = b = 120.10, c = 147.00 Å, and diffract to 2.2 Å resolution. Both crystal forms are suitable for X-ray structure analysis at high resolution

  20. Synthetic and Crystallographic Studies of a New Inhibitor Series Targeting Bacillus anthracis Dihydrofolate Reductase

    Energy Technology Data Exchange (ETDEWEB)

    Beierlein, J.; Frey, K; Bolstad, D; Pelphrey, P; Joska, T; Smith, A; Priestley, N; Wright, D; Anderson, A

    2008-01-01

    Bacillus anthracis, the causative agent of anthrax, poses a significant biodefense danger. Serious limitations in approved therapeutics and the generation of resistance have produced a compelling need for new therapeutic agents against this organism. Bacillus anthracis is known to be insensitive to the clinically used antifolate, trimethoprim, because of a lack of potency against the dihydrofolate reductase enzyme. Herein, we describe a novel lead series of B. anthracis dihydrofolate reductase inhibitors characterized by an extended trimethoprim-like scaffold. The best lead compound adds only 22 Da to the molecular weight and is 82-fold more potent than trimethoprim. An X-ray crystal structure of this lead compound bound to B. anthracis dihydrofolate reductase in the presence of NADPH was determined to 2.25 A resolution. The structure reveals several features that can be exploited for further development of this lead series.

  1. Alpha 1-blockers vs 5 alpha-reductase inhibitors in benign prostatic hyperplasia. A comparative review

    DEFF Research Database (Denmark)

    Andersen, J T

    1995-01-01

    During recent years, pharmacological treatment of symptomatic benign prostatic hyperplasia (BPH) has become the primary treatment choice for an increasing number of patients. The 2 principal drug classes employed are alpha 1-blockers and 5 alpha-reductase inhibitors. Current information from...... patients who will respond well to alpha 1-blockers have yet to be identified, and data concerning the long term effects of these drugs are not yet available. 5 alpha-Reductase inhibitors have a slow onset of effect, but treatment leads to improvement in symptoms, reduction of the size of the prostate gland...... and improvement in objective parameters for bladder outflow obstruction. Approximately 30 to 50% of patients will respond to treatment with 5 alpha-reductase inhibitors. The definitive role of pharmacological treatment in symptomatic BPH remains to be established, although it seems that patients unfit...

  2. Local population characteristics and hemoglobin A1c testing rates among diabetic medicare beneficiaries.

    Directory of Open Access Journals (Sweden)

    Laura C Yasaitis

    Full Text Available BACKGROUND: Proposed payment reforms in the US healthcare system would hold providers accountable for the care delivered to an assigned patient population. Annual hemoglobin A1c (HbA1c tests are recommended for all diabetics, but some patient populations may face barriers to high quality healthcare that are beyond providers' control. The magnitude of fine-grained variations in care for diabetic Medicare beneficiaries, and their associations with local population characteristics, are unknown. METHODS: HbA1c tests were recorded for 480,745 diabetic Medicare beneficiaries. Spatial analysis was used to create ZIP code-level estimated testing rates. Associations of testing rates with local population characteristics that are outside the control of providers--population density, the percent African American, with less than a high school education, or living in poverty--were assessed. RESULTS: In 2009, 83.3% of diabetic Medicare beneficiaries received HbA1c tests. Estimated ZIP code-level rates ranged from 71.0% in the lowest decile to 93.1% in the highest. With each 10% increase in the percent of the population that was African American, associated HbA1c testing rates were 0.24% lower (95% CI -0.32--0.17; for identical increases in the percent with less than a high school education or the percent living in poverty, testing rates were 0.70% lower (-0.95--0.46 and 1.6% lower (-1.8--1.4, respectively. Testing rates were lowest in the least and most densely populated ZIP codes. Population characteristics explained 5% of testing rate variations. CONCLUSIONS: HbA1c testing rates are associated with population characteristics, but these characteristics fail to explain the vast majority of variations. Consequently, even complete risk-adjustment may have little impact on some process of care quality measures; much of the ZIP code-related variations in testing rates likely result from provider-based differences and idiosyncratic local factors not related to

  3. An Analysis of the FY-1C, Iridium 33, and Cosmos 2251 Fragments

    Science.gov (United States)

    Liou, J.-C.

    2014-01-01

    The beginning of the year 2013 marks the sixth anniversary of the destruction of the Fengyun-1C (FY-1C) weather satellite as the result of an anti-satellite test conducted by China in January 2007 and the fourth anniversary of the accidental collision between Cosmos 2251 and the operational Iridium 33 in February 2009. These two events represent the worst satellite breakups in history. A total of 5579 fragments have been cataloged by the U.S. Space Surveillance Network (SSN), and almost 5000 of them were still in orbit in January 2013. In addition to these cataloged objects, hundreds of thousands (or more) of fragments down to the millimeter size regime were also generated during the breakups. These fragments are too small to be tracked by the SSN, but are large enough to be a safety concern for human space activities and robotic missions in low Earth orbit (LEO, the region below 2000 km altitude). Like their cataloged siblings, many of them remain in orbit today. These two breakup events dramatically changed the landscape of the orbital debris environment in LEO. The spatial density of the cataloged population in January 2013 is shown as the top blue curve. The combined FY-1C, Iridium 33, and Cosmos 2251 fragments (black curve) account for about 50 percent of the cataloged population below an altitude of 1000 km. They are also responsible for the concentrations at 770 km and 850 km, altitudes at which the collisions occurred. The effects of the FY-1C, Iridium 33, and Cosmos 2251 fragments will continue to be felt for decades to come. For example, approximately half of the generated FY-1C fragments will remain in orbit 20 years from now. In general, the Iridium 33 and Cosmos 2251 fragments will decay faster than the FY-1C fragments because of their lower altitudes. Of the Iridium 33 and Cosmos 2251 fragments, the former have much shorter orbital lifetimes than the latter, because lightweight composite materials were heavily used in the construction of the Iridium

  4. Characterisation of a desmosterol reductase involved in phytosterol dealkylation in the silkworm, Bombyx mori.

    Directory of Open Access Journals (Sweden)

    Leonora F Ciufo

    Full Text Available Most species of invertebrate animals cannot synthesise sterols de novo and many that feed on plants dealkylate phytosterols (mostly C(29 and C(28 yielding cholesterol (C(27. The final step of this dealkylation pathway involves desmosterol reductase (DHCR24-catalysed reduction of desmosterol to cholesterol. We now report the molecular characterisation in the silkworm, Bombyx mori, of such a desmosterol reductase involved in production of cholesterol from phytosterol, rather than in de novo synthesis of cholesterol. Phylogenomic analysis of putative desmosterol reductases revealed the occurrence of various clades that allowed for the identification of a strong reductase candidate gene in Bombyx mori (BGIBMGA 005735. Following PCR-based cloning of the cDNA (1.6 kb and its heterologous expression in Saccharomyces cerevisae, the recombinant protein catalysed reduction of desmosterol to cholesterol in an NADH- and FAD-dependent reaction.Conceptual translation of the cDNA, that encodes a 58.9 kDa protein, and database searching, revealed that the enzyme belongs to an FAD-dependent oxidoreductase family. Western blotting revealed reductase protein expression exclusively in the microsomal subcellular fraction and primarily in the gut. The protein is peripherally associated with microsomal membranes. 2D-native gel and PAGE analysis revealed that the reductase is part of a large complex with molecular weight approximately 250 kDa. The protein occurs in midgut microsomes at a fairly constant level throughout development in the last two instars, but is drastically reduced during the wandering stage in preparation for metamorphosis. Putative Broad Complex transcription factor-binding sites detectable upstream of the DHCR24 gene may play a role in this down-regulation.

  5. Aldose reductase inhibition prevents metaplasia of airway epithelial cells.

    Directory of Open Access Journals (Sweden)

    Umesh C S Yadav

    Full Text Available BACKGROUND: Goblet cell metaplasia that causes mucus hypersecretion and obstruction in the airway lumen could be life threatening in asthma and chronic obstructive pulmonary disease patients. Inflammatory cytokines such as IL-13 mediate the transformation of airway ciliary epithelial cells to mucin-secreting goblet cells in acute as well as chronic airway inflammatory diseases. However, no effective and specific pharmacologic treatment is currently available. Here, we investigated the mechanisms by which aldose reductase (AR regulates the mucus cell metaplasia in vitro and in vivo. METHODOLOGY/FINDINGS: Metaplasia in primary human small airway epithelial cells (SAEC was induced by a Th2 cytokine, IL-13, without or with AR inhibitor, fidarestat. After 48 h of incubation with IL-13 a large number of SAEC were transformed into goblet cells as determined by periodic acid-schiff (PAS-staining and immunohistochemistry using antibodies against Mucin5AC. Further, IL-13 significantly increased the expression of Mucin5AC at mRNA and protein levels. These changes were significantly prevented by treatment of the SAEC with AR inhibitor. AR inhibition also decreased IL-13-induced expression of Muc5AC, Muc5B, and SPDEF, and phosphorylation of JAK-1, ERK1/2 and STAT-6. In a mouse model of ragweed pollen extract (RWE-induced allergic asthma treatment with fidarestat prevented the expression of IL-13, phosphorylation of STAT-6 and transformation of epithelial cells to goblet cells in the lung. Additionally, while the AR-null mice were resistant, wild-type mice showed goblet cell metaplasia after challenge with RWE. CONCLUSIONS: The results show that exposure of SAEC to IL-13 caused goblet cell metaplasia, which was significantly prevented by AR inhibition. Administration of fidarestat to mice prevented RWE-induced goblet cell metaplasia and AR null mice were largely resistant to allergen induced changes in the lung. Thus our results indicate that AR inhibitors

  6. GENERATION OF THE GLYCYL RADICAL OF THE ANAEROBIC ESCHERICHIA-COLI RIBONUCLEOTIDE REDUCTASE REQUIRES A SPECIFIC ACTIVATING ENZYME

    NARCIS (Netherlands)

    SUN, XY; ELIASSON, R; PONTIS, E; ANDERSSON, J; BUIST, G; SJOBERG, BM; REICHARD, P

    1995-01-01

    The anaerobic ribonucleotide reductase from Escherichia coli contains a glycyl radical as part of its polypeptide structure. The radical is generated by an enzyme system present in E. coli. The reductase is coded for by the nrdD gene located at 96 min. Immediately downstream, we now find an open rea

  7. Direct enzyme assay evidence confirms aldehyde reductase function of Ydr541cp and Ygl039wp from Saccharomyces cerevisiae

    Science.gov (United States)

    Aldehyde reductase gene ARI1 is a recently characterized member of intermediate subfamily under SDR (short-chain dehydrogenase/reductase) superfamily that revealed mechanisms of in situ detoxification of furfural and HMF for tolerance of Saccharomyces cerevisiae. Uncharacterized open reading frames ...

  8. Feedback regulation of cholesterol synthesis:sterol-accelerated ubiquitination and degradation of HMG CoA reductase

    Institute of Scientific and Technical Information of China (English)

    Russell A DeBose-Boyd

    2008-01-01

    3Hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase produces mevalonate,an important intermediate in the synthesis of cholesterol and essential nonsterol isoprenoids.The reductase is subject to an exorbitant amount of feedback control through multiple mechanisms that are mediated by sterol and nonsterol end-products of mevalonate metabolism.Here,Ⅰwill discuss recent advances that shed light on one mechanism for control of reductase,which involves rapid degradation of the enzyme.Accumulation of certain sterols triggers binding of reductase to endoplasmic reticulum (ER) membrane proteins called Insig-1 and Insig-2.Reductase-Insig binding results in recruitment of a membrane-associated ubiquitin ligase called gp78,which initiates ubiquitination of reductase.This ubiquitination is an obligatory reaction for recognition and degradation of reductase from ER membranes by cytosolic 26S proteasomes.Thus,sterol-accelerated degradation of reductase represents an example of how a general cellular process (ER-associated degradation) is used to control an important metabolic pathway (cholesterol synthesis).

  9. Multiple Types of 8-Vinyl Reductases for (Bacterio)Chlorophyll Biosynthesis Occur in Many Green Sulfur Bacteria ▿

    OpenAIRE

    Liu, Zhenfeng; Bryant, Donald A.

    2011-01-01

    Two 8-vinyl reductases, BciA and BciB, have been identified in chlorophototrophs. The bciA gene of Chlorobaculum tepidum was replaced with genes similar to bciB from other green sulfur bacteria. Pigment analyses of the complemented strains showed that the bciB homologs encode 8-vinyl reductases similar to those of cyanobacteria.

  10. Studies on some characteristics of nitrate reductase from sugar beet (Beta vulgaris L.)leaves

    Institute of Scientific and Technical Information of China (English)

    LiWenhua; YanGuiping; 等

    1994-01-01

    Some characteristics of nitrate reductase from sugar beet leaves shown in this paper were as follows:The nitrate reductase from sugar beet leaves required NADH as an electron donor.Accordingly,the nitrate reductase was classified as NADH-dependent(E.C.1.6.61).The Km value of the nitrate reductase for NADH and NO3- were 0.86m mol and 0.18μ mol respectively.The optimum pH in reaction mixture solution for nitrate reduction activity was 7.5.The effect of variable concentrations of inorganic phosphorus in the reaction buffer on nitrate reductase activity was investigated.When the inorganic phosphorus concentration was below 35m mol,the nitrate reductase activity was increased with increase of inorganic phosphorus concentration.Conversely,when the inorganic phosphorus concentration was over 35m mol,the nitrate reductase activity was inhibited.The nitrate reductase activity assayed in vitro was 3.2 and 5.6times of that assayed in vivo under the condition of exogenous and endogenous ground substance respectively.

  11. The role of 5'-adenylylsulfate reductase in the sulfur assimilation pathway of soybean: molecular cloning, kinetic characterization, and gene expression

    Science.gov (United States)

    Soybean seeds are a major source of protein, but contain low levels of sulfur-containing amino acids. With the objective of studying the sulfur assimilation pathway of soybean, a full-length cDNA clone for 5’-adenylylsulfate reductase (APS reductase) was isolated and characterized. The cDNA clone ...

  12. Inverse relationship between age-dependent erythrocyte activity of methaemoglobin reductase and prilocaine-induced methaemoglobinaemia during infancy

    DEFF Research Database (Denmark)

    Nilsson, A; Engberg, G; Henneberg, S; Danielson, K; De Verdier, C H

    1990-01-01

    concentrations of local anaesthetics were low (maximum values: prilocaine 78 ng ml-1, lignocaine 412 ng ml-1). The activity of erythrocyte MetHb reductase (cytochrome b5 reductase) was analysed. Data from a previously studied group of infants aged 3-12 months were included also. Enzyme activity did not reach...

  13. Identification of the bchP gene, encoding geranylgeranyl reductase in Chlorobaculum tepidum

    DEFF Research Database (Denmark)

    Gomez Maqueo Chew, Aline; Frigaard, Niels-Ulrik; Bryant, Donald A

    2008-01-01

    The Chlorobaculum tepidum genome contains two paralogous genes, CT2256 and CT1232, whose products are members of the FixC dehydrogenase superfamily and have sequence similarity to geranylgeranyl reductases. Each gene was insertionally inactivated, and the resulting mutants were characterized. CT2......2256 encodes geranylgeranyl reductase (BchP); CT1232 is not involved in bacteriochlorophyll or chlorophyll biosynthesis....

  14. Synthesis and degradation of nitrate reductase during the cell cycle of Chlorella sorokiniana

    Science.gov (United States)

    Velasco, P. J.; Tischner, R.; Huffaker, R. C.; Whitaker, J. R.

    1989-01-01

    Studies on the diurnal variations of nitrate reductase (NR) activity during the life cycle of synchronized Chlorella sorokiniana cells grown with a 7:5 light-dark cycle showed that the NADH:NR activity, as well as the NR partial activities NADH:cytochrome c reductase and reduced methyl viologen:NR, closely paralleled the appearance and disappearance of NR protein as shown by sodium dodecyl sulfate gel electrophoresis and immunoblots. Results of pulse-labeling experiments with [35S]methionine further confirmed that diurnal variations of the enzyme activities can be entirely accounted for by the concomitant synthesis and degradation of the NR protein.

  15. Affinity purifications of aldose reductase and xylitol dehydrogenase from the xylose-fermenting yeast Pachysolen tannophilus

    Energy Technology Data Exchange (ETDEWEB)

    Bolen, P.L.; Roth, K.A.; Freer, S.N.

    1986-10-01

    Although xylose is a major product of hydrolysis of lignocellulosic materials, few yeasts are able to convert it to ethanol. In Pachysolen tannophilus, one of the few xylose-fermenting yeasts found, aldose reductase and xylitol dehydrogenase were found to be key enzymes in the metabolic pathway for xylose fermentation. This paper presents a method for the rapid and simultaneous purification of both aldose reductase and xylitol dehydrogenase from P. tannophilus. Preliminary studies indicate that this method may be easily adapted to purify similar enzymes from other xylose-fermenting yeasts.

  16. Glyphosate inhibition of ferric reductase activity in iron deficient sunflower roots

    OpenAIRE

    Öztürk, Levent; Ozturk, Levent; Yazıcı, Mustafa Atilla; Yazici, Mustafa Atilla; Eker, Selim; Gökmen, Özay Özgür; Gokmen, Ozay Ozgur; Römheld, Volker; Romheld, Volker; ÇAKMAK, İsmail; Cakmak, Ismail

    2007-01-01

    Iron (Fe) deficiency is increasingly being observed in cropping systems with frequent glyphosate applications. A likely reason for this is that glyphosate interferes with root uptake of Fe by inhibiting ferric reductase in roots required for Fe acquisition by dicot and nongrass species. This study investigated the role of drift rates of glyphosate (0.32, 0.95 or 1.89 mM glyphosate corresponding to 1, 3 and 6% of the recommended herbicidal dose, respectively) on ferric reductase activity of...

  17. Mutational analysis of the nor gene cluster which encodes nitric-oxide reductase from Paracoccus denitrificans.

    Science.gov (United States)

    de Boer, A P; van der Oost, J; Reijnders, W N; Westerhoff, H V; Stouthamer, A H; van Spanning, R J

    1996-12-15

    The genes that encode the hc-type nitric-oxide reductase from Paracoccus denitrificans have been identified. They are part of a cluster of six genes (norCBQDEF) and are found near the gene cluster that encodes the cd1-type nitrite reductase, which was identified earlier [de Boer, A. P. N., Reijnders, W. N. M., Kuenen, J. G., Stouthamer, A. H. & van Spanning, R. J. M. (1994) Isolation, sequencing and mutational analysis of a gene cluster involved in nitrite reduction in Paracoccus denitrificans, Antonie Leeu wenhoek 66, 111-127]. norC and norB encode the cytochrome-c-containing subunit II and cytochrome b-containing subunit I of nitric-oxide reductase (NO reductase), respectively. norQ encodes a protein with an ATP-binding motif and has high similarity to NirQ from Pseudomonas stutzeri and Pseudomonas aeruginosa and CbbQ from Pseudomonas hydrogenothermophila. norE encodes a protein with five putative transmembrane alpha-helices and has similarity to CoxIII, the third subunit of the aa3-type cytochrome-c oxidases. norF encodes a small protein with two putative transmembrane alpha-helices. Mutagenesis of norC, norB, norQ and norD resulted in cells unable to grow anaerobically. Nitrite reductase and NO reductase (with succinate or ascorbate as substrates) and nitrous oxide reductase (with succinate as substrate) activities were not detected in these mutant strains. Nitrite extrusion was detected in the medium, indicating that nitrate reductase was active. The norQ and norD mutant strains retained about 16% and 23% of the wild-type level of NorC, respectively. The norE and norF mutant strains had specific growth rates and NorC contents similar to those of the wild-type strain, but had reduced NOR and NIR activities, indicating that their gene products are involved in regulation of enzyme activity. Mutant strains containing the norCBQDEF region on the broad-host-range vector pEG400 were able to grow anaerobically, although at a lower specific growth rate and with lower

  18. Properties of a Thermostable Nitrate Reductase from the Hyperthermophilic Archaeon Pyrobaculum aerophilum

    OpenAIRE

    Afshar, Sepideh; Johnson, Eric; de Vries, Simon; Schröder, Imke

    2001-01-01

    The nitrate reductase of the hyperthermophilic archaeon Pyrobaculum aerophilum was purified 137-fold from the cytoplasmic membrane. Based on sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis, the enzyme complex consists of three subunits with apparent molecular weights of 130,000, 52,000, and 32,000. The enzyme contained molybdenum (0.8-mol/mol complex), iron (15.4-mol/mol complex) and cytochrome b (0.49-mol/mol complex) as cofactors. The P. aerophilum nitrate reductase disti...

  19. Imaging the activity of nitrate reductase by means of a scanning electrochemical microscope.

    Science.gov (United States)

    Zaumseil, J; Wittstock, G; Bahrs, S; Steinrücke, P

    2000-06-01

    Scanning electrochemical microscopy (SECM) was used to characterize immobilized nitrate reductase (NaR) from Pseudonomonas stutzeri (E.C. 1.7.99.4). Nitrate reductase with membrane fragment was embedded in a polyurethane hydrogel in a capillary and solubilized NaR without membrane fragment was covalently coupled to a diaminoethyl-cellulose-carbamitate film on glass. After systematic studies of possible mediators, SECM feedback imaging of both forms of immobilized NaR was accomplished with methylviologen as redox mediator. PMID:11225859

  20. Crystallization and preliminary X-ray diffraction studies of ferredoxin reductase from Leptospira interrogans

    Energy Technology Data Exchange (ETDEWEB)

    Nascimento, Alessandro S.; Ferrarezi, Thiago [Instituto de Física de São Carlos, Universidade de São Paulo, Av. Trabalhador Saocarlense 400, São Carlos, SP, 13560-970 (Brazil); Catalano-Dupuy, Daniela L.; Ceccarelli, Eduardo A. [Facultad de Ciencias Bioquímicas y Farmacéuticas, Molecular Biology Division, Instituto de Biología Molecular y Celular de Rosario (IBR), CONICET, Universidad Nacional de Rosario, Suipacha 531, S2002LRK Rosario (Argentina); Polikarpov, Igor, E-mail: ipolikarpov@if.sc.usp.br [Instituto de Física de São Carlos, Universidade de São Paulo, Av. Trabalhador Saocarlense 400, São Carlos, SP, 13560-970 (Brazil)

    2006-07-01

    Crystals adequate for X-ray diffraction analysis have been prepared from L. interrogans ferredoxin-NADP{sup +} reductase. Ferredoxin-NADP{sup +} reductase (FNR) is an FAD-containing enzyme that catalyzes electron transfer between NADP(H) and ferredoxin. Here, results are reported of the recombinant expression, purification and crystallization of FNR from Leptospira interrogans, a parasitic bacterium of animals and humans. The L. interrogans FNR crystals belong to a primitive monoclinic space group and diffract to 2.4 Å resolution at a synchrotron source.

  1. Crystallization and preliminary X-ray diffraction studies of ferredoxin reductase from Leptospira interrogans

    International Nuclear Information System (INIS)

    Crystals adequate for X-ray diffraction analysis have been prepared from L. interrogans ferredoxin-NADP+ reductase. Ferredoxin-NADP+ reductase (FNR) is an FAD-containing enzyme that catalyzes electron transfer between NADP(H) and ferredoxin. Here, results are reported of the recombinant expression, purification and crystallization of FNR from Leptospira interrogans, a parasitic bacterium of animals and humans. The L. interrogans FNR crystals belong to a primitive monoclinic space group and diffract to 2.4 Å resolution at a synchrotron source

  2. Cloning, Expression, and Purification of Histidine-Tagged Escherichia coli Dihydrodipicolinate Reductase

    OpenAIRE

    Trigoso, Yvonne D.; Russell C Evans; Karsten, William E.; Lilian Chooback

    2016-01-01

    The enzyme dihydrodipicolinate reductase (DHDPR) is a component of the lysine biosynthetic pathway in bacteria and higher plants. DHDPR catalyzes the NAD(P)H dependent reduction of 2,3-dihydrodipicolinate to the cyclic imine L-2,3,4,5,-tetrahydropicolinic acid. The dapB gene that encodes dihydrodipicolinate reductase has previously been cloned, but the expression of the enzyme is low and the purification is time consuming. Therefore the E. coli dapB gene was cloned into the pET16b vector to i...

  3. Novel Regulation of the Synthesis of α-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic Acid (AMPA) Receptor Subunit GluA1 by Carnitine Palmitoyltransferase 1C (CPT1C) in the Hippocampus.

    Science.gov (United States)

    Fadó, Rut; Soto, David; Miñano-Molina, Alfredo J; Pozo, Macarena; Carrasco, Patricia; Yefimenko, Natalia; Rodríguez-Álvarez, José; Casals, Núria

    2015-10-16

    The regulation of AMPA-type receptor (AMPAR) abundance in the postsynaptic membrane is an important mechanism involved in learning and memory formation. Recent data suggest that one of the constituents of the AMPAR complex is carnitine palmitoyltransferase 1C (CPT1C), a brain-specific isoform located in the endoplasmic reticulum of neurons. Previous results had demonstrated that CPT1C deficiency disrupted spine maturation in hippocampal neurons and impaired spatial learning, but the role of CPT1C in AMPAR physiology had remained mostly unknown. In the present study, we show that CPT1C binds GluA1 and GluA2 and that the three proteins have the same expression profile during neuronal maturation. Moreover, in hippocampal neurons of CPT1C KO mice, AMPAR-mediated miniature excitatory postsynaptic currents and synaptic levels of AMPAR subunits GluA1 and GluA2 are significantly reduced. We show that AMPAR expression is dependent on CPT1C levels because total protein levels of GluA1 and GluA2 are decreased in CPT1C KO neurons and are increased in CPT1C-overexpressing neurons, whereas other synaptic proteins remain unaltered. Notably, mRNA levels of AMPARs remained unchanged in those cultures, indicating that CPT1C is post-transcriptionally involved. We demonstrate that CPT1C is directly involved in the de novo synthesis of GluA1 and not in protein degradation. Moreover, in CPT1C KO cultured neurons, GluA1 synthesis after chemical long term depression was clearly diminished, and brain-derived neurotrophic factor treatment was unable to phosphorylate the mammalian target of rapamycin (mTOR) and stimulate GluA1 protein synthesis. These data newly identify CPT1C as a regulator of AMPAR translation efficiency and therefore also synaptic function in the hippocampus. PMID:26338711

  4. Posterior C1-C2 calcium pyrophosphate dihydrate crystal deposition disease.

    Science.gov (United States)

    Ng, Isaac Bing-Yi; Arkun, Knarik; Riesenburger, Ron I

    2016-01-01

    Calcium pyrophosphate dihydrate (CPPD) crystal deposition disease rarely occurs in the posterior aspect of the craniocervical junction (CCJ). To the best of our knowledge, there have been only 2 previously reported cases of patients with posterior CPPD lesions in this region that have led to cervical myelopathy. We report the case of a 70-year-old man presenting with neck pain and cervical myelopathy with multilevel stenosis from C1-C6. The stenosis was worst at C1-C2, secondary to compression by a CPPD lesion posterior to the spinal cord. The patient underwent a C2-C6 laminectomy and fusion with resection of the CPPD lesion. In this report, we discuss the patient and present a novel theory to explain the preponderance of CPPD lesions in the CCJ occurring anteriorly and not posteriorly to the spinal cord. PMID:26976840

  5. Postoperative spinal alignment remodeling in Lenke 1C scoliosis treated with selective thoracic fusion

    DEFF Research Database (Denmark)

    Wang, Yu; Bünger, Cody; Zhang, Yanqun;

    2012-01-01

    BACKGROUND CONTEXT: Selective thoracic fusion may cause spinal imbalance in certain patients; how the spinal alignment changes over time after surgery is highly correlated with the final spinal balance. PURPOSE: To investigate how spinal alignment changes over time after selective thoracic fusion...... immediately after surgery. Although some patients regained spinal balance through postoperative spinal alignment remodeling, 11 patients remained imbalanced at 2-year follow-up. CONCLUSIONS: Selective thoracic fusion is prone to cause leftward spinal imbalance in Lenke 1C scoliosis patients. Postoperative...... spinal alignment remodeling can facilitate recovery of spinal balance in some patients. Postoperative spinal imbalance in Lenke 1C scoliosis patients could be prevented by selecting stable vertebra or the vertebrae above as LIV, checking the balance condition during surgery, or considering ratio criteria...

  6. Pinpointing a Mechanistic Switch Between Ketoreduction and “Ene” Reduction in Short‐Chain Dehydrogenases/Reductases

    Science.gov (United States)

    Lygidakis, Antonios; Karuppiah, Vijaykumar; Hoeven, Robin; Ní Cheallaigh, Aisling; Leys, David; Gardiner, John M.; Toogood, Helen S.

    2016-01-01

    Abstract Three enzymes of the Mentha essential oil biosynthetic pathway are highly homologous, namely the ketoreductases (−)‐menthone:(−)‐menthol reductase and (−)‐menthone:(+)‐neomenthol reductase, and the “ene” reductase isopiperitenone reductase. We identified a rare catalytic residue substitution in the last two, and performed comparative crystal structure analyses and residue‐swapping mutagenesis to investigate whether this determines the reaction outcome. The result was a complete loss of native activity and a switch between ene reduction and ketoreduction. This suggests the importance of a catalytic glutamate vs. tyrosine residue in determining the outcome of the reduction of α,β‐unsaturated alkenes, due to the substrate occupying different binding conformations, and possibly also to the relative acidities of the two residues. This simple switch in mechanism by a single amino acid substitution could potentially generate a large number of de novo ene reductases. PMID:27411040

  7. Isolation, modification, and aldose reductase inhibitory activity of rosmarinic acid derivatives from the roots of Salvia grandifolia.

    Science.gov (United States)

    Kang, Jie; Tang, Yanbo; Liu, Quan; Guo, Nan; Zhang, Jian; Xiao, Zhiyan; Chen, Ruoyun; Shen, Zhufang

    2016-07-01

    To find aldose reductase inhibitors, two previously unreported compounds, grandifolias H and I, and five known compounds, including rosmarinic acid and rosmarinic acid derivatives, were isolated from the roots of Salvia grandifolia. A series of rosmarinic acid derivatives was obtained from rosmarinic acid using simple synthetic methods. The aldose reductase inhibitory activity of the isolated and synthesized compounds was assessed. Seven of the tested compounds showed moderate aldose reductase inhibition (IC50=0.06-0.30μM). The structure-activity relationship of aldose reductase inhibitory activity of rosmarinic acid derivatives was discussed for the first time. This study provided useful information that will facilitate the development of aldose reductase inhibitors. PMID:27233987

  8. Tomographic correlation for Magerl's technique in C1-C2 arthrodesis in children

    OpenAIRE

    Chiaramonti, Bárbara Camargo; Kim, So Yeon; Marchese, Luiz Roberto Delboni; Letaif, Olavo Biraghi; Marcon, Raphael Martus; Cristante, Alexandre Fogaça

    2013-01-01

    OBJECTIVE: To analyze through tomographic studies, the morphology and dimensions of the C1-C2 vertebrae in pediatric patients, to evaluate the possibility of application of Magerl's technique in these patients, and to contribute with data for the usage of the technique in safety. METHOD: Forty normal cervical tomographies, from patients at an age range of 24-120 months of age and from both genders, were retrospectively analyzed. Data was statistically analyzed to obtain mean value and variati...

  9. Functional characterization of human CRN2 (coronin-1C) in normal and disease conditions

    OpenAIRE

    Xavier, Charles-Peter

    2009-01-01

    Coronins are in general versatile actin filament-crosslinking and bundling proteins. In human, seven subfamilies of coronins are identified. One of these proteins found ubiquitously expressed in human tissues is CRN2 (synonyms: coronin-1C, coronin-3). Here, we study in vivo and in vitro F-actin associated properties of CRN2. Using different GFP tagged structural domain proteins and RNAi mediated knock down of CRN2, we studied the role of these domains in various cellular activities like wound...

  10. What Should the Hemoglobin A1c Level Goal be in Diabetics?

    OpenAIRE

    Aronow WS

    2015-01-01

    An increased hemoglobin A1c level in patients with diabetes mellitus is associated with an increased incidence of ischemic stroke, increased severity of coronary artery disease, and an increased severity of peripheral arterial disease. Results from 5 prospective clinical trials which randomized diabetics to intensive blood glucose control or to standard blood glucose control and one retrospective observational study of 26,673 diabetics are discussed. The 5 clinical trials were ...

  11. ER sheet persistence is coupled to myosin 1c-regulated dynamic actin filament arrays.

    Science.gov (United States)

    Joensuu, Merja; Belevich, Ilya; Rämö, Olli; Nevzorov, Ilya; Vihinen, Helena; Puhka, Maija; Witkos, Tomasz M; Lowe, Martin; Vartiainen, Maria K; Jokitalo, Eija

    2014-04-01

    The endoplasmic reticulum (ER) comprises a dynamic three-dimensional (3D) network with diverse structural and functional domains. Proper ER operation requires an intricate balance within and between dynamics, morphology, and functions, but how these processes are coupled in cells has been unclear. Using live-cell imaging and 3D electron microscopy, we identify a specific subset of actin filaments localizing to polygons defined by ER sheets and tubules and describe a role for these actin arrays in ER sheet persistence and, thereby, in maintenance of the characteristic network architecture by showing that actin depolymerization leads to increased sheet fluctuation and transformations and results in small and less abundant sheet remnants and a defective ER network distribution. Furthermore, we identify myosin 1c localizing to the ER-associated actin filament arrays and reveal a novel role for myosin 1c in regulating these actin structures, as myosin 1c manipulations lead to loss of the actin filaments and to similar ER phenotype as observed after actin depolymerization. We propose that ER-associated actin filaments have a role in ER sheet persistence regulation and thus support the maintenance of sheets as a stationary subdomain of the dynamic ER network. PMID:24523293

  12. Engineering human interferon α1c/86D with phage display technology

    Institute of Scientific and Technical Information of China (English)

    马学军; 胡荣; 吕海; 魏开坤; 张丽兰; 薛水星; 侯云德

    1999-01-01

    Human interferon-α1c/86D (IFNα1c/86D) was functionally displayed on the surface of the filamentous bacteriophage using a phagemid vector system (pCANTAB5E). The key amino acid residues involved in the receptor binding were further defined with phage displayed 6-mer peptide library and two neutralizing antibodies against linear epitopes on the IFN-α1b, indicating that residues 30, 33, 34, (AB-loop) and residues 124, 126, 127 (D helix, DE-loop) were more critical than the adjacent residues for recognition of receptor. In addition, a cassette mutagenesis library was generated by fully randomizing the sequence of the four positions 29, 31, 32 and 35 in AB-loop, and used to select phage-IFN variants with WISH-hased panning method. Three phage-IFN variants were isolated to possess more antiviral activity in the range of 4—16-fold than parental phage-IFN after IPTG-induced soluble expression. The results suggest that phage displayed phage-IFN α1c/86D variants with increased specific activity might be obta

  13. Development of electron beam welding procedure for Nb-1Zr-0.1C alloy

    International Nuclear Information System (INIS)

    Niobium is one of the most useful and widely used refractory metals. It can be worked to achieve a wide range of strength and elasticity, has the least density among refractory metals and possess superconducting and nuclear properties. Because of such properties, it finds applications in electrolytic capacitors, superconducting alloys, aircraft gas turbines, vacuum tubes and structural material in nuclear reactors. Refractory metals and alloys are capable of withstanding environments that are aggressive in terms of radiation, temperature, corrosion and stress for prolonged period of time. Nb-1Zr- 0.1C is one of the most promising refractory metal alloys having an excellent combination of high temperature properties like, high melting point (∼2500 °C), adequate high temperature strength (∼200 MPa) and creep strength for long duration, better compatibility for alkali liquid metal, resistance to thermal shock and radiation and low DBTT. This paper describes the development of electron beam welding procedure for Nb-1Zr-0.1C alloy. Welding parameters were developed by taking number of bead on plate welding trials. Weld bead was characterized by metallography and different zones of the weld bead were identified and studied. Weld quality was evaluated by both optical and electron microscopy. Microhardness profile across the width of the weld was generated. The results of the welding trials and the tests performed on the welds and the major observations and conclusions drawn from the experience of welding Nb-1Zr-0.1C alloy will also be discussed in this paper

  14. Feature Fusion Based Road Extraction for HJ-1-C SAR Image

    Directory of Open Access Journals (Sweden)

    Lu Ping-ping

    2014-06-01

    Full Text Available Road network extraction in SAR images is one of the key tasks of military and civilian technologies. To solve the issues of road extraction of HJ-1-C SAR images, a road extraction algorithm is proposed based on the integration of ratio and directional information. Due to the characteristic narrow dynamic range and low signal to noise ratio of HJ-1-C SAR images, a nonlinear quantization and an image filtering method based on a multi-scale autoregressive model are proposed here. A road extraction algorithm based on information fusion, which considers ratio and direction information, is also proposed. By processing Radon transformation, main road directions can be extracted. Cross interferences can be suppressed, and the road continuity can then be improved by the main direction alignment and secondary road extraction. The HJ-1-C SAR image acquired in Wuhan, China was used to evaluate the proposed method. The experimental results show good performance with correctness (80.5% and quality (70.1% when applied to a SAR image with complex content.

  15. Coherent Performance Analysis of the HJ-1-C Synthetic Aperture Radar

    Directory of Open Access Journals (Sweden)

    Li Hai-ying

    2014-06-01

    Full Text Available Synthetic Aperture Radar (SAR is a coherent imaging radar. Hence, coherence is critical in SAR imaging. In a coherent system, several sources can degrade performance. Based on the HJ-1-C SAR system implementation and sensor characteristics, this study evaluates the effect of frequency stability and pulse-to-pulse timing jitter on the SAR coherent performance. A stable crystal oscillator with short-term stability of 10×1.0−10 / 5 ms is used to generate the reference frequency by using a direct multiplier and divider. Azimuth ISLR degradation owing to the crystal oscillator phase noise is negligible. The standard deviation of the pulse-to-pulse timing jitter of HJ-1-C SAR is lower than 2ns (rms and the azimuth random phase error in the synthetic aperture time slightly degrades the side lobe of the azimuth impulse response. The mathematical expressions and simulation results are presented and suggest that the coherent performance of the HJ-1-C SAR system meets the requirements of synthetic aperture radar imaging.

  16. Evidence that RASSF1C stimulation of lung cancer cell proliferation depends on IGFBP-5 and PIWIL1 expression levels.

    Directory of Open Access Journals (Sweden)

    Mark E Reeves

    Full Text Available RASSF1C is a major isoform of the RASSF1 gene, and is emerging as an oncogene. This is in contradistinction to the RASSF1A isoform, which is an established tumor suppressor. We have previously shown that RASSF1C promotes lung cancer cell proliferation and have identified RASSF1C target genes with growth promoting functions. Here, we further report that RASSF1C promotes lung cancer cell migration and enhances lung cancer cell tumor sphere formation. We also show that RASSF1C over-expression reduces the inhibitory effects of the anti-cancer agent, betulinic acid (BA, on lung cancer cell proliferation. In previous work, we demonstrated that RASSF1C up-regulates piwil1 gene expression, which is a stem cell self-renewal gene that is over-expressed in several human cancers, including lung cancer. Here, we report on the effects of BA on piwil1 gene expression. Cells treated with BA show decreased piwil1 expression. Also, interaction of IGFBP-5 with RASSF1C appears to prevent RASSF1C from up-regulating PIWIL1 protein levels. These findings suggest that IGFBP-5 may be a negative modulator of RASSF1C/ PIWIL1 growth-promoting activities. In addition, we found that inhibition of the ATM-AMPK pathway up-regulates RASSF1C gene expression.

  17. Effects of Sleep Disorders on Hemoglobin A1c Levels in Type 2 Diabetic Patients

    Institute of Scientific and Technical Information of China (English)

    Ahmet Keskin; Murat (ü)nalacak; U(g)ur Bilge; Pinar Yildiz; Seda Güler; Engin Burak Sel(c)uk; Muzaffer Bilgin

    2015-01-01

    Background: Studies have reported the presence of sleep disorders in approximately 50-70% of diabetic patients, and these may contribute to poor glycemic control, diabetic neuropathy, and overnight hypoglycemia.The aim of this study was to determine the frequency of sleep disorders in diabetic patients, and to investigate possible relationships between scores of these sleep disorders and obstructive sleep apnea syndrome (OSAS) and diabetic parameters (fasting blood glucose, glycated hemoglobin A1c [HbA1c], and lipid levels).Methods: We used the Berlin questionnaire (BQ) for OSAS, the Epworth Sleepiness Scale (ESS), and the Pittsburgh Sleep Quality Index (PSQI) to determine the frequency of sleep disorders and their possible relationships with fasting blood glucose, HbA1c, and lipid levels.Results: The study included 585 type 2 diabetic patients admitted to family medicine clinics between October and December 2014.Sleep, sleep quality, and sleep scores were used as the dependent variables in the analysis.The ESS scores showed that 54.40% of patients experienced excessive daytime sleepiness, and according to the PSQI, 64.30% experienced poor-quality sleep.The BQ results indicated that 50.20% of patients were at high-risk of OSAS.HbA 1 c levels correlated significantly with the ESS and PSQI results (r =0.23, P < 0.001 and r =0.14, P =0.001, respectively), and were significantly higher in those with high-risk of OSAS as defined by the BQ (P < 0.001).These results showed that HbA 1 c levels were related to sleep disorders.Conclusions: Sleep disorders are common in diabetic patients and negatively affect the control of diabetes.Conversely, poor diabetes control is an important factor disturbing sleep quality.Addressing sleep disturbances in patients who have difficulty controlling their blood glucose has dual benefits: Preventing diabetic complications caused by sleep disturbance and improving diabetes control.

  18. Characterization of inhibitors of phosphodiesterase 1C on a human cellular system.

    Science.gov (United States)

    Dunkern, Torsten R; Hatzelmann, Armin

    2007-09-01

    Different inhibitors of the Ca(2+)/calmodulin-stimulated phosphodiesterase 1 family have been described and used for the examination of phosphodiesterase 1 in cellular, organ or animal models. However, the inhibitors described differ in potency and selectivity for the different phosphodiesterase family enzymes, and in part exhibit additional pharmacodynamic actions. In this study, we demonstrate that phosphodiesterase 1C is expressed in the human glioblastoma cell line A172 with regard to mRNA, protein and activity level, and that lower activities of phosphodiesterase 2, phosphodiesterase 3, phosphodiesterase 4 and phosphodiesterase 5 are also present. The identity of the phosphodiesterase 1C activity detected was verified by downregulation of the mRNA and protein through human phosphodiesterase 1C specific small interfering RNA. In addition, the measured K(m) values (cAMP, 1.7 microm; cGMP, 1.3 microm) are characteristic of phosphodiesterase 1C. We demonstrate that treatment with the Ca(2+) ionophore ionomycin increases intracellular Ca(2+) in a concentration-dependent way without affecting cell viability. Under conditions of enhanced intracellular Ca(2+) concentration, a rapid increase in cAMP levels caused by the adenylyl cyclase activator forskolin was abolished, indicating the involvement of Ca(2+)-activated phosphodiesterase 1C. The reduction of forskolin-stimulated cAMP levels was reversed by phosphodiesterase 1 inhibitors in a concentration-dependent way. Using this cellular system, we compared the cellular potency of published phosphodiesterase 1 inhibitors, including 8-methoxymethyl-3-isobutyl-1-methylxanthine, vinpocetine, SCH51866, and two established phosphodiesterase 1 inhibitors developed by Schering-Plough (named compounds 31 and 30). We demonstrate that up to 10 microm 8-methoxymethyl-3-isobutyl-1-methylxanthine and vinpocetine had no effect on the reduction of forskolin-stimulated cAMP levels by ionomycin, whereas the more selective and up to 10

  19. Protective role of glutathione reductase in paraquat induced neurotoxicity.

    Science.gov (United States)

    Djukic, Mirjana M; Jovanovic, Marina D; Ninkovic, Milica; Stevanovic, Ivana; Ilic, Katarina; Curcic, Marijana; Vekic, Jelena

    2012-08-30

    Paraquat (PQ), a widely used herbicide is a well-known free radical producing agent. The mechanistic pathways of PQ neurotoxicity were examined by assessing oxidative/nitrosative stress markers. Focus was on the role of glutathione (GSH) cycle and to examine whether the pre-treatment with enzyme glutathione reductase (GR) could protect the vulnerable brain regions (VBRs) against harmful oxidative effect of PQ. The study was conducted on Wistar rats, randomly divided in five groups: intact-control group, (n = 8) and four experimental groups (n = 24). All tested compounds were administered intrastriatally (i.s.) in one single dose. The following parameters of oxidative status were measured in the striatum, hippocampus and cortex, at 30 min, 24 h and 7 days post treatment: superoxide anion radical (O₂·⁻), nitrate (NO₃⁻), malondialdehyde (MDA), superoxide dismutase (SOD), total GSH (tGSH) and its oxidized, disulfide form (GSSG) and glutathione peroxidase (GPx). Results obtained from the intact and the sham operated groups were not statistically different, confirming that invasive i.s. route of administration would not influence the reliability of results. Also, similar pattern of changes were observed between ipsi- and contra- lateral side of examined VBRs, indicating rapid spatial spreading of oxidative stress. Mortality of the animals (10%), within 24h, along with symptoms of Parkinsonism, after awakening from anesthesia for 2-3 h, were observed in the PQ group, only. Increased levels of O₂·⁻, NO₃⁻ and MDA, increased ratio of GSSG/GSH and considerably high activity of GPx were measured at 30 min after the treatment. Cytotoxic effect of PQ was documented by drastic drop of all measured parameters and extremely high peak of the ratio GSSG/GSH at 24th hrs after the PQ i.s. injection. In the GR+PQ group, markedly low activity of GPx and low content of NO₃⁻ (in striatum and cortex) were measured during whole experiment, while increase value was

  20. Identification and characterization of an inborn error of metabolism caused by dihydrofolate reductase deficiency

    NARCIS (Netherlands)

    Banka, S.; Blom, H.J.; Walter, J.; Aziz, M.; Urquhart, J.; Clouthier, C.M.; Rice, G.I.; Brouwer, A.P.M. de; Hilton, E.; Vassallo, G.; Will, A.; Smith, D.E.; Smulders, Y.M.; Wevers, R.A.; Steinfeld, R.; Heales, S.; Crow, Y.J.; Pelletier, J.N.; Jones, S.; Newman, W.G.

    2011-01-01

    Dihydrofolate reductase (DHFR) is a critical enzyme in folate metabolism and an important target of antineoplastic, antimicrobial, and antiinflammatory drugs. We describe three individuals from two families with a recessive inborn error of metabolism, characterized by megaloblastic anemia and/or pan

  1. Direct demonstration of genetic alterations at the dihydrofolate reductase locus after gamma irradiation.

    OpenAIRE

    Graf, L. H.; Chasin, L A

    1982-01-01

    Gamma ray-induced mutants of Chinese hamster ovary cells lacking dihydrofolate reductase activity were screened for DNA sequence changes at the locus specifying this activity by using a cloned cDNA probe. Two of nine mutants screened displayed an altered restriction fragment pattern suggesting the occurrence of DNA deletions or rearrangements.

  2. Low activity of superoxide dismutase and high activity of glutathione reductase in erythrocytes from centenarians

    DEFF Research Database (Denmark)

    Andersen, Helle Raun; Jeune, B; Nybo, H;

    1998-01-01

    aged between 60 and 79 years. MEASUREMENTS: enzyme activities of superoxide dismutase (CuZn-SOD), glutathione peroxidase, catalase and glutathione reductase (GR) in erythrocytes. Functional capacity among the centenarians was evaluated by Katz' index of activities of daily living, the Physical...

  3. A soluble 3-hydroxy-3-methylglutaryl-CoA reductase in the protozoan Trypanosoma cruzi

    DEFF Research Database (Denmark)

    Pena Diaz, Javier; Montalvetti, A; Camacho, A;

    1997-01-01

    We report the isolation and characterization of a genomic clone containing the open reading frame sequence for 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) reductase from Trypanosoma cruzi, the causative agent of Chagas' disease. The protozoan gene encoded for a smaller polypeptide than the rest of the...

  4. Novel bacterial sulfur oxygenase reductases from bioreactors treating gold-bearing concentrates

    DEFF Research Database (Denmark)

    Chen, Z-W; Liu, Y-Y; Wu, J-F;

    2007-01-01

    The microbial community and sulfur oxygenase reductases of metagenomic DNA from bioreactors treating gold-bearing concentrates were studied by 16S rRNA library, real-time polymerase chain reaction (RT-PCR), conventional cultivation, and molecular cloning. Results indicated that major bacterial sp...... SOR gene in bioleaching reactors and Acidithiobacillus species....

  5. A Rational Approach to Identify Inhibitors of Mycobacterium tuberculosis Enoyl Acyl Carrier Protein Reductase

    Czech Academy of Sciences Publication Activity Database

    Chhabria, M. T.; Parmar, K. B.; Brahmkshatriya, Pathik

    2013-01-01

    Roč. 19, č. 21 (2013), s. 3878-3883. ISSN 1381-6128 Institutional support: RVO:61388963 Keywords : mycobacterium tuberculosis * enoyl acyl carrier protein reductase * pharmacophore modeling * molecular docking * binding interactions Subject RIV: FR - Pharmacology ; Medidal Chemistry Impact factor: 3.288, year: 2013

  6. Relationships between nitrate uptake and nitrate reductase activity in Cucumis sativus L.

    Directory of Open Access Journals (Sweden)

    Grażyna Kłobus

    2014-02-01

    Full Text Available Anti-NR IgG fragments obtained after papain digestion of polyclonal antibodies gave the positive immunological reaction with both, a soluble and plasma membrane-bound nitrate reductase. Anti-NR antibody as well as IgG fragments almost totally inhibited the nitrate reductase activity in cytosol proving a crossreaction of antibody with the catalytic site of a soluble NR. Anti-NR IgG fragments, but not undigested polyclonal antibodies affected the activity of the nitrate reductase associated with plasma membranes. Discrepancy in the action of intact antibodies and fragments obtained after they digestion were interpreted as a consequence of same differences in the ability of those molecules to the penetration through the membrane. Undigested anti-NR antibody have no effect on the nitrate uptake by intact plants, as well as by the right-side plasma membrane vesicles. On the other hand, IgG fragments of polyclonal antibodies abolished almost totally the nitrate uptake in the case of intact seedlings, but have only slight effect on the N03 uptake in plasma membranes. On the basis of above findings, some relations between nitrate uptake and its assimilation inside the cell are suggested. Since IgG fragments only slightly changed the N03 absorption in vesicles whereas the activity of plasmalemma associated nitrate reductase was strongly repressed, we concluded that the PM-NR is not structurally involved in the nitrate transport through the membrane.

  7. Prevention of hemodynamic and vascular albumin filtration changes in diabetic rats by aldose reductase inhibitors

    International Nuclear Information System (INIS)

    This study investigated hemodynamic changes in diabetic rats and their relationship to changes in vascular albumin permeation and increased metabolism of glucose to sorbitol. The effects of 6 wk of streptozocin-induced diabetes and three structurally different inhibitors of aldose reductase were examined on (1) regional blood flow (assessed with 15-microns 85Sr-labeled microspheres) and vascular permeation by 125I-labeled bovine serum albumin (BSA) and (2) glomerular filtration rate (assessed by plasma clearance of 57Co-labeled EDTA) and urinary albumin excretion (determined by radial immunodiffusion assay). In diabetic rats, blood flow was significantly increased in ocular tissues (anterior uvea, posterior uvea, retina, and optic nerve), sciatic nerve, kidney, new granulation tissue, cecum, and brain. 125I-BSA permeation was increased in all of these tissues except brain. Glomerular filtration rate and 24-h urinary albumin excretion were increased 2- and 29-fold, respectively, in diabetic rats. All three aldose reductase inhibitors completely prevented or markedly reduced these hemodynamic and vascular filtration changes and increases in tissue sorbitol levels in the anterior uvea, posterior uvea, retina, sciatic nerve, and granulation tissue. These observations indicate that early diabetes-induced hemodynamic changes and increased vascular albumin permeation and urinary albumin excretion are aldose reductase-linked phenomena. Discordant effects of aldose reductase inhibitors on blood flow and vascular albumin permeation in some tissues suggest that increased vascular albumin permeation is not entirely attributable to hemodynamic change

  8. Purification and characterization of a novel carbonyl reductase isolated from Rhodococcus erythropolis.

    Science.gov (United States)

    Zelinski, T; Peters, J; Kula, M R

    1994-04-15

    During growth on n-tetradecane a novel NADH-dependent carbonyl reductase is induced in the Gram-positive bacterium Rhodococcus erythropolis (Peters, P., Zelinski, T. and Kula, M.R. (1992) Appl. Microbiol. Biotechnol. 38, 334-340). The enzyme has been purified to homogeneity using fractional pH precipitation, anion exchange chromatography and affinity chromatography. The isoelectric point of the oxidoreductase is 4.4. The apparent molecular mass of the native enzyme is 161 kDa, that of the subunits 40 kDa as determined by SDS gel electrophoresis. A tetrameric structure of the carbonyl reductase is consistent with these results. Important biochemical data concerning the application of the reductase are: a broad pH-optimum, temperature optimum at 40 degrees C and stability at room temperature for more than 5 days. The oxidoreductase accepted as substrate aliphatic and aromatic ketones, keto esters (esters of keto carboxylic acids) and halogenated carbonyl compounds and reduced them to the corresponding hydroxyl compounds with (S)-configuration with more than 98% enantiomeric excess. The NAD(+)-dependent oxidation of primary alcohols was not catalyzed by the carbonyl reductase, whereas secondary alcohols and hydroxy acid esters were oxidized to the corresponding carbonyl compounds at about 10-fold slower reaction rates compared to the reduction. PMID:7764739

  9. Design and synthesis of novel, conformationally restricted HMG-CoA reductase inhibitors.

    Science.gov (United States)

    Pfefferkorn, Jeffrey A; Choi, Chulho; Song, Yuntao; Trivedi, Bharat K; Larsen, Scott D; Askew, Valerie; Dillon, Lisa; Hanselman, Jeffrey C; Lin, Zhiwu; Lu, Gina; Robertson, Andrew; Sekerke, Catherine; Auerbach, Bruce; Pavlovsky, Alexander; Harris, Melissa S; Bainbridge, Graeme; Caspers, Nicole

    2007-08-15

    Using structure-based design, a novel series of conformationally restricted, pyrrole-based inhibitors of HMG-CoA reductase were discovered. Leading analogs demonstrated potent inhibition of cholesterol synthesis in both in vitro and in vivo models and may be useful for the treatment of hypercholesterolemia and related lipid disorders. PMID:17574411

  10. Cloning and expression of Candida guilliermondii xylose reductase gene (xyl1) in Pichia pastoris.

    Science.gov (United States)

    Handumrongkul, C; Ma, D P; Silva, J L

    1998-04-01

    A xylose reductase gene (xyl1) of Candida guilliermondii ATCC 20118 was cloned and characterized. The open reading frame of xyl1 contained 954 nucleotides encoding a protein of 317 amino acids with a predicted molecular mass of 36 kDa. The derived amino acid sequence of C. guilliermondii xylose reductase was 70.4% homologous to that of Pichia stipitis. The gene was placed under the control of an alcohol oxidase promoter (AOX1) and integrated into the genome of a methylotrophic yeast, Pichia pastoris. Methanol induced the expression of the 36-kDa xylose reductase in both intracellular and secreted expression systems. The expressed enzyme preferentially utilized NADPH as a cofactor and was functional both in vitro and in vivo. The different cofactor specificity between P. pastoris and C. guilliermondii xylose reductases might be due to the difference in the numbers of histidine residues and their locations between the two proteins. The recombinant was able to ferment xylose, and the maximum xylitol accumulation (7.8 g/l) was observed when the organism was grown under aerobic conditions. PMID:9615481

  11. HMG-coenzyme A reductase inhibition, type 2 diabetes, and bodyweight

    DEFF Research Database (Denmark)

    Swerdlow, Daniel I; Preiss, David; Kuchenbaecker, Karoline B;

    2015-01-01

    BACKGROUND: Statins increase the risk of new-onset type 2 diabetes mellitus. We aimed to assess whether this increase in risk is a consequence of inhibition of 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR), the intended drug target. METHODS: We used single nucleotide polymorphisms in the HMGCR...

  12. Thioredoxin reductase is a key factor in the oxidative stress response of Lactobacillus plantarum WCFS1

    NARCIS (Netherlands)

    Mariela Serrano, L.; Molenaar, D.; Wels, M.; Teusink, B.; Bron, P.A.; Vos, W.M. de; Smid, E.J.

    2007-01-01

    ABSTRACT: BACKGROUND: Thioredoxin (TRX) is a powerful disulfide oxido-reductase that catalyzes a wide spectrum of redox reactions in the cell. The aim of this study is to elucidate the role of the TRX system in the oxidative stress response in Lactobacillus plantarum WCFS1. RESULTS: We have identifi

  13. The 5,10-methylenetetrahydrofolate reductase C677T polymorphism interacts with smoking to increase homocysteine.

    NARCIS (Netherlands)

    Brown, K.S.; Kluijtmans, L.A.J.; Young, I.S.; Murray, L.; McMaster, D.; Woodside, J.; Yarnell, J.W.; Boreham, C.A.; McNulty, H.; Strain, J.J.; McPartlin, J.; Scott, J.M.; Mitchell, L.E.; Whitehead, A.S.

    2004-01-01

    Elevated homocysteine is a risk marker for several human pathologies. Risk factors for elevated homocysteine include low folate and homozygosity for the T allele of the 5,10-methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism. Because nitric oxide may inhibit folate catabolism and endothe

  14. REGULATION OF NITRATE REDUCTASE ACTIVITY IN RICE (ORYZA SATIVA L. BY GROWTH REGULATORS

    Directory of Open Access Journals (Sweden)

    S HEMALATHA

    2002-12-01

    Full Text Available The effect of three growth regulators, namely kinetin, 6 benzyl adenine, 2 chloro ethyl trimethyl ammonium chloride at three concentrations (10-6 M, 5 x 10-5 M 10-4 M was studied on the catalytic activity of nitrate reductase in green and etiolated seedlings. A concentration of 5 x 10-5 M was optimal for all the growth regulators treatments. All the growth regulators stimulated nitrate reductase activity effectively at 5 x 10-5M concentration in both etiolated and green seedlings and had an additive effect when supplemented by NO-3 up to 140% to 160%. The 99.2% and 93.4% inhibition of nitrate reductase activity resulted in development of etiolated and green seedlings, respectively when treated with eukaryotic 80S ribosome protein synthesis inhibitor cycloheximide. Prokaryotic 70S inhibitor chloromphenicol did not have any effect on measured parameters. Actinomycin D, a RNA synthesis inhibitor also inhibited the enzyme activity as 80s inhibitors (Green 80%, etiolated 98%. One may suggest from this that both DNA and protein synthesis are involved in the induction of nitrate reductase activity. The differential effect of aminoacids was observed on enzyme activity in combination with growth regulators.

  15. NADPH-dependent D-aldose reductases and xylose fermentation in Fusarium oxysporum

    DEFF Research Database (Denmark)

    Panagiotou, Gianni; Christakopoulos, P.

    2004-01-01

    Two aldose (xylose) reductases (ARI and ARII) from Fusarium oxysporum were purified and characterized. The native ARI was a monomer with M-r 41000, pI 5.2 and showed a 52-fold preference for NADPH over NADH, while ARII was homodimeric with a subunit of M-r 37000, pI 3.6 and a 60-fold preference...

  16. Sensing nitrite through a pseudoazurin-nitrite reductase electron transfer relay

    NARCIS (Netherlands)

    Astier, Y; Canters, GW; Davis, JJ; Hill, HAO; Verbeet, MP; Wijma, HJ

    2005-01-01

    Nitrite is converted to nitric oxide by haem or copper-containing enzymes in denitrifying bacteria during the process of denitrification. In designing an efficient biosensor, this enzymic turnover must be quantitatively assessed. The enzyme nitrite reductase from Alcaligenes faecalis contains a redo

  17. Allosteric control of internal electron transfer in cytochrome cd1 nitrite reductase

    DEFF Research Database (Denmark)

    Farver, Ole; Kroneck, Peter M H; Zumft, Walter G;

    2003-01-01

    Cytochrome cd1 nitrite reductase is a bifunctional multiheme enzyme catalyzing the one-electron reduction of nitrite to nitric oxide and the four-electron reduction of dioxygen to water. Kinetics and thermodynamics of the internal electron transfer process in the Pseudomonas stutzeri enzyme have...

  18. Kinetic properties and inhibition of Trypanosoma cruzi 3-hydroxy-3-methylglutaryl CoA reductase

    DEFF Research Database (Denmark)

    Hurtado-Guerrrero, Ramón; Pena Diaz, Javier; Montalvetti, Andrea; Ruiz-Pérez, Luis M; González-Pacanowska, Dolores

    2002-01-01

    A detailed kinetic analysis of the recombinant soluble enzyme 3-hydroxy-3-methylglutaryl CoA reductase (HMGR) from Trypanosoma cruzi has been performed. The enzyme catalyzes the normal anabolic reaction and the reductant is NADPH. It also catalyzes the oxidation of mevalonate but at a lower propo...

  19. In Silico Docking studies of Aldose Reductase Inhibitory activity of selected Flavonoids

    Directory of Open Access Journals (Sweden)

    Muthuswamy Umamaheswari

    2012-09-01

    Full Text Available New drugs for the inhibition of the enzyme aldose reductase are in development and they have to be screened before being considered for preclinical and clinical evaluation. The current study deals with the evaluation of the cyclooxygenase inhibitory activity of flavonoids using in silico docking studies. In this perspective, flavonoids like Farobin-A, Gericudranin- B, Glaziovianin-A, Rutin, and Xanthotoxin were selected. Epalrestat, a known aldose reductase inhibitor was used as the standard. Docking results showed that all the selected flavonoids showed binding energy ranging between -7.91 kcal/mol to - 5.08 kcal/mol when compared with that of the standard (-5.59 kcal/mol. Intermolecular energy (- 9.11 kcal/mol to -8.66 kcal/mol and inhibition constant (1.58 μM to 187.37 μM of the ligands also coincide with the binding energy. Xanthotoxin contributed better aldose reductase inhibitory activity because of its structural parameters. Further studies are required to develop potent aldose reductase inhibitors for the treatment of diabetes.

  20. EFFECT OF LINDANE ON INTESTINAL NITROREDUCTASE, AZO REDUCTASE, B-GLUCURONIDASE, DECHLORINASE AND DEHYDROCHLORINASE ACTIVITY

    Science.gov (United States)

    The effect of daily p.o. injections of 20 mg/kg lindane on nitroreductase, azo reductase, B-glucuronidase, dechlorinase and dehydrochlorinase enzyme activity in the rat intestinal tract vas investigated after 2 weeks and 5 weeks of treatment. Antibiotics were administered to half...

  1. Calorimetric and spectroscopic investigations of the thermal denaturation of wild type nitrite reductase

    NARCIS (Netherlands)

    Stirpe, A; Guzzi, R; Wijma, H; Verbeet, MP; Canters, GW; Sportelli, L

    2005-01-01

    Nitrite reductase (NiR) is a multicopper protein, with a trimeric structure containing two types of copper site: type I is present in each subunit whereas type 2 is localized at the subunits interface. The paper reports on the thermal behaviour of wild type NiR from Alcaligenes faecalis S-6. The tem

  2. Structural and transcriptional analysis of plant genes encoding the bifunctional lysine ketoglutarate reductase saccharopine dehydrogenase enzyme

    Science.gov (United States)

    The analysis of a wheat lysine ketoglutarate reductase – saccharopine dehydrogenase (LKR/SDH) gene and comparative structural and functional analyses among available plant genes provides new information on this important gene. Both the structure of the LKR/SDH gene and the immediately adjacent genes...

  3. Transcriptional Regulation of Cytosolic Sulfotransferase 1C2 by Vitamin D Receptor in LS180 Human Colorectal Adenocarcinoma Cells.

    Science.gov (United States)

    Barrett, Kathleen G; Fang, Hailin; Kocarek, Thomas A; Runge-Morris, Melissa

    2016-08-01

    The factors that regulate expression of genes in the 1C family of human cytosolic sulfotransferases (SULT1C) are not well understood. In a recent study evaluating the effects of a panel of transcription factor activators on SULT1C family member expression in LS180 human colorectal adenocarcinoma cells, we found that SULT1C2 expression was significantly increased by 1α,25-dihydroxyvitamin D3 (VitD3) treatment. The objective of our current study was to identify the mechanism responsible for VitD3-mediated activation of SULT1C2 transcription. VitD3 treatment of LS180 cells activated transcription of a transfected luciferase reporter plasmid that contained ∼5 kilobase pairs (kbp) of the SULT1C2 gene, which included 402 nucleotides (nt) of the noncoding exon 1, all of intron 1, and 21 nt of exon 2. Although computational analysis of the VitD3-responsive region of the SULT1C2 gene identified a pregnane X receptor (PXR)-binding site within exon 1, the transfected 5 kbp SULT1C2 reporter was not activated by treatment with rifampicin, a prototypical PXR agonist. However, deletion or mutation of the predicted PXR-binding site abolished VitD3-mediated SULT1C2 transcriptional activation, identifying the site as a functional vitamin D response element (VDRE). We further demonstrated that vitamin D receptor (VDR) can interact directly with the SULT1C2 VDRE sequence using an enzyme-linked immunosorbent assay-based transcription factor binding assay. In conclusion, VitD3-inducible SULT1C2 transcription is mediated through a VDRE in exon 1. These results suggest a role for SULT1C2 in VitD3-regulated physiologic processes in human intestine. PMID:27130351

  4. Biliverdin Reductase-A correlates with inducible nitric oxide synthasein in atorvastatin treated aged canine brain

    Institute of Scientific and Technical Information of China (English)

    Fabio Di Domenico; Marzia Perluigi; Eugenio Barone

    2013-01-01

    Alzheimer’s disease is a neurodegenerative disorder characterized by progressive cognitive impairment and neuropathology. Recent preclinical and epidemiological studies proposed statins as a possible therapeutic drug for Alzheimer’s disease, but the exact mechanisms of action are stil unknown. Biliverdin reductase-A is a pleiotropic enzyme involved in cel ular stress responses. It not only transforms biliverdin-IX alpha into the antioxidant bilirubin-IX alpha but its serine/threonine/tyrosine kinase activity is able to modulate cel signaling networks. We previously reported the beneficial effects of atorvastatin treatment on biliverdin reductase-A and heme oxygenase-1 in the brains of a well characterized pre-clinical model of Alzheimer’s disease, aged beagles, together with observed improvement in cognition. Here we extend our knowledge of the effects of atorvastatin on inducible nitric oxide synthase in parietal cortex, cerebel um and liver of the same animals. We demonstrated that atorvastatin treatment (80 mg/day for 14.5 months) to aged beagles selectively increased inducible nitric oxide synthase in the parietal cortex but not in the cerebel um. In contrast, inducible nitric oxide synthase protein levels were significantly decreased in the liver. Significant positive correlations were found between biliverdin reductase-A and inducible nitric oxide synthase as wel as heme oxygenase-1 protein levels in the parietal cortex. The opposite was observed in the liver. Inducible nitric oxide synthase up-regulation in the parietal cortex was positively associated with improved biliverdin reductase-A functions, whereas the oxidative-induced impairment of biliverdin reductase-A in the liver negatively affected inducible nitric oxide synthase expression, thus suggesting a role for biliverdin reductase-A in atorvastatin-dependent inducible nitric oxide synthase changes. Interestingly, increased inducible nitric oxide synthase levels in the parietal cortex were not

  5. Blood glucose self-monitoring and internet diabetes management on A1C outcomes in patients with type 2 diabetes

    Science.gov (United States)

    Chow, Nelson; Shearer, Daniel; Aydin Plaa, Jessica; Pottinger, Betty; Pawlowska, Monika; White, Adam; Tildesley, Hugh D

    2016-01-01

    Objectives The purpose of this study was to determine any correlation between frequency of self-monitoring of blood glucose (SMBG), frequency of patient-provider communication of SMBG (reporting), and hemoglobin A1C for patients with non-insulin-dependent diabetes solely on oral medications. Research design and methods 191 charts of patients with type 2 diabetes treated solely with oral hypoglycemic agents were reviewed retrospectively. A1C, SMBG frequency, and frequency of online communication with an endocrinologist within the most recent 6-month period were used in the analyses. Regression analysis was used to determine correlations to A1C. For subsequent subgroup analysis, patients were separated into infrequent and frequent SMBG groups, defined as those who test on average once or less per day or twice or more per day. Results Although testing frequency did not correlate with A1C, higher reporting frequency correlated with lower A1C. Subgroup analysis of the frequent SMBG group showed a significantly lower A1C in frequent reporters when compared to infrequent reporters (N=118, p<0.05). This trend was not observed in the infrequent SMBG group (N=73, p=0.161). Conclusions The inverse correlation between reporting frequency and A1C, as well as the significant difference in A1C only for the frequent testers, suggests that frequent SMBG has an effect on reducing A1C only when combined with regular, frequent communication of SMBG with a healthcare provider. PMID:27158516

  6. Rev-erb beta regulates the Srebp-1c promoter and mRNA expression in skeletal muscle cells

    International Nuclear Information System (INIS)

    The nuclear hormone receptor, Rev-erb beta operates as a transcriptional silencer. We previously demonstrated that exogenous expression of Rev-erbβΔE in skeletal muscle cells increased Srebp-1c mRNA expression. We validated these in vitro observations by injection of an expression vector driving Rev-erbβΔE expression into mouse tibialis muscle that resulted in increased Srebp-1c mRNA expression. Paradoxically, Rev-erbβ siRNA expression in skeletal muscle cells repressed Srebp-1c expression, and indicated that Rev-erbβ expression was necessary for Srebp-1c expression. ChIP analysis demonstrated that Rev-erbβ was recruited to the Srebp-1c promoter. Moreover, Rev-erbβ trans-activated the Srebp-1c promoter, in contrast, Rev-erbβ efficiently repressed the Rev-erbα promoter, a previously characterized target gene. Finally, treatment with the Rev-erb agonist (hemin) (i) increased the trans-activation of the Srebp-1c promoter by Rev-erbβ; and (ii) increased Rev-erbβ and Srebp-1c mRNA expression. These data suggest that Rev-erbβ has the potential to activate gene expression, and is a positive regulator of Srebp-1c, a regulator of lipogenesis.

  7. Alpha- and beta-cell abnormalities in haemoglobin A1c-defined prediabetes and type 2 diabetes

    DEFF Research Database (Denmark)

    Calanna, Salvatore; Scicali, Roberto; Di Pino, Antonino;

    2014-01-01

    , respectively. Ten subjects with HbA1c-defined prediabetes, i.e. HbA1c from 5.7 to 6.4 % (39-46 mmol/mol), eight newly diagnosed patients with HbA1c-defined type 2 diabetes [HbA1c ≥6.5 % (≥48 mmol/mol)], and ten controls with HbA1c lower than 5.7 % (<39 mmol/mol), were studied. Blood was sampled over 4 h on two......New recommendations for the use of glycated haemoglobin A1c (HbA1c) to diagnose prediabetes and type 2 diabetes have changed the constitution of the two populations. We aimed to investigate the pathophysiological characteristics of individuals with HbA1c-defined prediabetes and type 2 diabetes......-diagnosed type 2 diabetic patients. The patients with type 2 diabetes showed lower insulinogenic index (P = 0.0003), disposition index (P < 0.0001), and glucagon suppression compared with the controls. The incretin effect was significantly (P < 0.05) reduced in patients with HbA1c-defined type 2 diabetes...

  8. The Relationship Between Fasting, Postprandial Glucose Levels and HbA1c in Patients with Type 1 Diabetes

    OpenAIRE

    Timuçin Çil; Davut Akın; Yekta Tüzün; Deniz Gökalp; Ramazan Danış

    2008-01-01

    Several previous studies investigated the relationship between plasma glucose and HbA1c. We aimed to evaluate the relationship between HbA(1c) and fasting plasma glucose (FPG) and postprandial plasma glucose (PPG) levels in type 1 diabetic subjects 86 Type 1 diabetic patients admitted to our department were included. FPG, PPG and HbA1c values were recorded. Pearson’s correlation was used between FPG, PPG and HbA1c.The mean age was 26.8±8.4 years, and mean duration of diabetes was 6.9±4.2 year...

  9. High-Normal HbA1c Is a Strong Predictor of Type 2 Diabetes in the General Population

    OpenAIRE

    Bonora, Enzo; Kiechl, Stefan; Mayr, Agnes; Zoppini, Giacomo; Targher, Giovanni; Bonadonna, Riccardo C.; Willeit, Johann

    2011-01-01

    OBJECTIVE Glycosylated hemoglobin (HbA1c) recently has been recommended for the diagnosis of diabetes by the American Diabetes Association, but its value in the prediction of type 2 diabetes is poorly understood. In this study we evaluated how high-normal HbA1c levels predict type 2 diabetes. RESEARCH DESIGN AND METHODS We measured HbA1c in 919 Caucasian subjects, aged 40–79 years, and recorded new cases of type 2 diabetes in the following 15 years. Diabetes was diagnosed with HbA1c. RESULTS ...

  10. Mechanism of progestin resistance in endometrial precancer/cancer through Nrf2-AKR1C1 pathway.

    Science.gov (United States)

    Wang, Yiying; Wang, Yue; Zhang, Zhenbo; Park, Ji-Young; Guo, Donghui; Liao, Hong; Yi, Xiaofang; Zheng, Yu; Zhang, Donna; Chambers, Setsuko K; Zheng, Wenxin

    2016-03-01

    Progestin resistance is a main obstacle for endometrial precancer/cancer conservative therapy. Therefore, biomarkers to predict progestin resistance and studies to gain a more detailed understanding of the mechanism are needed. The antioxidant Nrf2-AKR1C1 signal pathway exerts chemopreventive activity. However whether it plays a role in progestin resistance has not been explored. In this study, elevated levels of AKR1C1 and Nrf2 were found in progestin-resistant endometrial epithelia, but not in responsive endometrial glands. Exogenous overexpression of Nrf2/AKR1C1 resulted in progestin resistance. Inversely, silencing of Nrf2 or AKR1C1 rendered endometrial cancer cells more susceptible to progestin treatment. Moreover, medroxyprogesterone acetate withdrawal resulted in suppression of Nrf2/AKR1C1 expression accompanied by a reduction of cellular proliferative activity. In addition, brusatol and metformin overcame progestin resistance by down-regulating Nrf2/AKR1C1 expression. Our findings suggest that overexpression of Nrf2 and AKR1C1 in endometrial precancer/cancer may be part of the molecular mechanisms underlying progestin resistance. If validated in a larger cohort, overexpression of Nrf2 and AKR1C1 may prove to be useful biomarkers to predict progestin resistance. Targeting the Nrf2/AKR1C1 pathway may represent a new therapeutic strategy for treatment of endometrial hyperplasia/cancer. PMID:26824415

  11. Radiometric uncertainty per pixel for the Sentinel-2 L1C products

    Science.gov (United States)

    Gorroño, Javier; Gascon, Ferran; Fox, Nigel P.

    2015-10-01

    In the framework of the European Union Copernicus programme, the European Space Agency (ESA) has launched the Sentinel-2 (S2) Earth Observation (EO) mission which provides optical high spatial resolution imagery. Here is presented a tool, S2-RUT, (Sentinel-2 Radiometric Uncertainty Tool) allowing estimation of the radiometric uncertainties associated to each pixel using as input the top-of-atmosphere (TOA) reflectance images provided by ESA. The Sentinel-2 radiometric analysis focuses on the review of the pre- and post-launch characterisations in order to specify the uncertainty contributors at a pixel level and allow changes to be proposed in the uncertainty contributors where necessary. The identified uncertainty contributors are combined using a metrological Guide to Expression of Uncertainty in Measurement' (GUM) model that is validated by comparing the results to a multivariate Monte Carlo Method (MCM). Specific contributors of the TOA reflectance are initially characterised and its future integration in the tool is discussed. The software implementation of the S2-RUT tool relies on the flexibility of the JPEG2000 standard using partial decoding. Auxiliary information for the uncertainty calculation is extracted from the metadata and quality masks integrated in the L1C product. In addition, using the detector footprint mask it is possible to account for parameters dependent on the neighbouring pixels and/or detector module. The L1C uncertainty is coded using 1 byte with an extra optional byte for complementary information. The resulting images and the metadata are directly appended to the original L1C product.

  12. Global modeling of the C1-C3 alkyl nitrates using STOCHEM-CRI

    Science.gov (United States)

    Khan, M. A. H.; Cooke, M. C.; Utembe, S. R.; Morris, W. C.; Archibald, A. T.; Derwent, R. G.; Jenkin, M. E.; Orr-Ewing, A. J.; Higgins, C. M.; Percival, C. J.; Leather, K. E.; Shallcross, D. E.

    2015-12-01

    The atmospheric global budget and distribution of C1-C3 alkyl nitrates have been investigated using a global three-dimensional chemistry transport model, STOCHEM-CRI. Alkyl nitrates (RONO2) are significant NOx reservoir species and the more detailed VOC oxidation mechanism (CRI v2-R5) leads to greater photochemical production. RONO2 are significant sources of NOx in regions remote from NOx sources. The study shows that the global burden and the atmospheric life-time of C1-C3 alkyl nitrates are 113 Gg and 9-10 days, respectively, which are in excellent agreement with estimates established by previous studies. The abundance of alkyl nitrates have been found to be higher in the continental atmosphere, with CH3ONO2 mixing ratios up to 20 ppt over the Amazon rainforest. Up to 15, 10, 2, and 5 ppt of modelled CH3ONO2, C2H5ONO2, n-C3H7ONO2 and i-C3H7ONO2 have been found in the northern hemisphere over regions with large anthropogenic emissions of NOx and VOCs. The combination of atmospheric production and long-range transport led to high alkyl nitrate levels at high latitudes. The model performance for C1-C3 alkyl nitrates was established using observations from nine flights and nine field campaigns. The comparison shows a tendency towards model under-prediction of the observations, particularly in the southern hemispheric marine boundary layer, possibly due to the absence of oceanic production mechanisms and air-sea exchange processes in the model. The discrepancies between model and observed seasonal cycles, especially of CH3ONO2, in both hemispheres are discussed.

  13. Structural studies of δ-endotoxin Cry 1 C from Bacillus thuringiensis

    International Nuclear Information System (INIS)

    Full text. The δ-endotoxins are a family of crystal protein by a soil bacterium, Bacillus thuringiensis. The study of these proteins has been of great interest due to their highly specific activity against insects of the orders Lepidoptera, Diptera and Coleoptera. Thus, the δa-endotoxins have been used for more than two decades as biological insecticides to control agricultural pests and, more recently, insects vectors of some diseases. The knowledge of their three-dimensional structures is very important to understand their mechanism of action and their high specificity. To date, the structure of only three proteins of the δ-endotoxins family have been reported: Cry3A, a coleopteran-specific toxin (beetle toxin)1, Cry1Aa, a lepidopteran-specific toxin (butterfly toxin)2 and CytB, a dipteran-specific toxin (mosquito toxin)3 Our work is aimed at the determination of the crystallographic structure by X-ray diffraction of δ-endotoxin Cry1C, also toxic to insects of the Lepidoptera order but towards families other than those affected by Cry1Aa. A comparison between these structures may lead to important conclusions about the reasons for the specificity and would allow the planning of mutants with more efficient activity. The cry1C gene was cloned into an adequate vector and expressed in an acrystalliferous B. thuringiensis strain. After cell culture and sporulation the microcrystals of Cry1C were separated by ultra-centrifugation in sacharose. The protoxin inclusion bodies were activated by commercial trpsin and the protease-resistant core was purified by anion-exchange chromatography. Crystallization experiments are being conducted in order to obtain single crystals suitable for diffraction measurements. We intend to use the Protein Crystallograph Station of the LNLS to collect data as soon as it is available and we have suitable crystals. (author)

  14. Implementation of the high-order schemes QUICK and LECUSSO in the COMMIX-1C Program

    International Nuclear Information System (INIS)

    Multidimensional analysis computer programs based on the finite volume method, such as COMMIX-1C, have been commonly used to simulate thermal-hydraulic phenomena in engineering systems such as nuclear reactors. In COMMIX-1C, the first-order schemes with respect to both space and time are used. In many situations such as flow recirculations and stratifications with steep gradient of velocity and temperature fields, however, high-order difference schemes are necessary for an accurate prediction of the fields. For these reasons, two second-order finite difference numerical schemes, QUICK (Quadratic Upstream Interpolation for Convective Kinematics) and LECUSSO (Local Exact Consistent Upwind Scheme of Second Order), have been implemented in the COMMIX-1C computer code. The formulations were derived for general three-dimensional flows with nonuniform grid sizes. Numerical oscillation analyses for QUICK and LECUSSO were performed. To damp the unphysical oscillations which occur in calculations with high-order schemes at high mesh Reynolds numbers, a new FRAM (Filtering Remedy and Methodology) scheme was developed and implemented. To be consistent with the high-order schemes, the pressure equation and the boundary conditions for all the conservation equations were also modified to be of second order. The new capabilities in the code are listed. Test calculations were performed to validate the implementation of the high-order schemes. They include the test of the one-dimensional nonlinear Burgers equation, two-dimensional scalar transport in two impinging streams, von Karmann vortex shedding, shear driven cavity flow, Couette flow, and circular pipe flow. The calculated results were compared with available data; the agreement is good

  15. Biochemical and antitumor activity of trimidox, a new inhibitor of ribonucleotide reductase.

    Science.gov (United States)

    Szekeres, T; Gharehbaghi, K; Fritzer, M; Woody, M; Srivastava, A; van't Riet, B; Jayaram, H N; Elford, H L

    1994-01-01

    Trimidox (3,4,5-trihydroxybenzamidoxime), a newly synthesized analog of didox (N,3,4-trihydroxybenzamide) reduced the activity of ribonucleotide reductase (EC 1.17.4.1) in extracts of L1210 cells by 50% (50% growth-inhibitory concentration, IC50) at 5 microM, whereas hydroxyurea, the only ribonucleotide reductase inhibitor in clinical use, exhibited an IC50 of 500 microM. Ribonucleotide reductase activity was also measured in situ by incubating L1210 cells for 24 h with trimidox at 7.5 microM, a concentration that inhibits cell proliferation by 50% (IC50) or at 100 microM for 2 h; these concentrations resulted in a decrease in enzyme activity to 22% and 50% of the control value, respectively. Trimidox and hydroxyurea were cytotoxic to L1210 cells with IC50 values of 7.5 and 50 microM, respectively. Versus ribonucleotide reductase, trimidox and hydroxyurea yielded IC50 values of 12 and 87 microM, respectively. A dose-dependent increase in life span was observed in mice bearing intraperitoneally transplanted L1210 tumors. Trimidox treatment (200 mg/kg; q1dx9) significantly increased the life span of mice bearing L1210 leukemia (by 82% in male mice and 112% in female mice). The anti-tumor activity appeared more pronounced in female mice than in male mice. Viewed in concert, these findings suggest that trimidox is a new and potent inhibitor of ribonucleotide reductase and that it is a promising candidate for the chemotherapy of cancer in humans. PMID:8174204

  16. Respiratory detoxification of nitric oxide by the cytochrome c nitrite reductase of Escherichia coli.

    Science.gov (United States)

    Poock, Susannah R; Leach, Emily R; Moir, James W B; Cole, Jeffrey A; Richardson, David J

    2002-06-28

    Nitric oxide is a key element in host defense against invasive pathogens. The periplasmic cytochrome c nitrite reductase (NrfA) of Escherichia coli catalyzes the respiratory reduction of nitrite, but in vitro studies have shown that it can also reduce nitric oxide. The physiological significance of the latter reaction in vivo has never been assessed. In this study the reduction of nitric oxide by Escherichia coli was measured in strains active or deficient in periplasmic nitrite reduction. Nrf(+) cells, harvested from cultures grown anaerobically, possessed a nitric-oxide reductase activity with physiological electron donation of 60 nmol min(-1) x mg dry wt(-1), and an in vivo turnover number of NrfA of 390 NO* s(-1) was calculated. Nitric-oxide reductase activity could not be detected in Nrf(-) strains. Comparison of the anaerobic growth of Nrf(+) and Nrf(-) strains revealed a higher sensitivity to nitric oxide in the NrfA(-) strains. A higher sensitivity to the nitrosating agent S-nitroso-N-acetyl penicillamine (SNAP) was also observed in agar plate disk-diffusion assays. Oxygen respiration by E. coli was also more sensitive to nitric oxide in the Nrf(-) strains compared with the Nrf(+) parent strain. The results demonstrate that active periplasmic cytochrome c nitrite reductase can confer the capacity for nitric oxide reduction and detoxification on E. coli. Genomic analysis of many pathogenic enteric bacteria reveals the presence of nrf genes. The present study raises the possibility that this reflects an important role for the cytochrome c nitrite reductase in nitric oxide management in oxygen-limited environments. PMID:11960983

  17. Conversion of NfsA, the Major Escherichia coli Nitroreductase, to a Flavin Reductase with an Activity Similar to That of Frp, a Flavin Reductase in Vibrio harveyi, by a Single Amino Acid Substitution

    Science.gov (United States)

    Zenno, Shuhei; Kobori, Toshiro; Tanokura, Masaru; Saigo, Kaoru

    1998-01-01

    NfsA is the major oxygen-insensitive nitroreductase of Escherichia coli, similar in amino acid sequence to Frp, a flavin reductase of Vibrio harveyi. Here, we show that a single amino acid substitution at position 99, which may destroy three hydrogen bonds in the putative active center, transforms NfsA from a nitroreductase into a flavin reductase that is as active as the authentic Frp and a tartrazine reductase that is 30-fold more active than wild-type NfsA. PMID:9440535

  18. Involvement of nitrate reductase and pyoverdine in competitiveness of Pseudomonas fluorescens strain C7R12 in soil.

    Science.gov (United States)

    Mirleau, P; Philippot, L; Corberand, T; Lemanceau, P

    2001-06-01

    Involvement of nitrate reductase and pyoverdine in the competitiveness of the biocontrol strain Pseudomonas fluorescens C7R12 was determined, under gnotobiotic conditions, in two soil compartments (bulk and rhizosphere soil), with the soil being kept at two different values of matric potential (-1 and -10 kPa). Three mutants affected in the synthesis of either the nitrate reductase (Nar(-)), the pyoverdine (Pvd(-)), or both (Nar(-) Pvd(-)) were used. The Nar(-) and Nar(-) Pvd(-) mutants were obtained by site-directed mutagenesis of the wild-type strain and of the Pvd(-) mutant, respectively. The selective advantage given by nitrate reductase and pyoverdine to the wild-type strain was assessed by measuring the dynamic of each mutant-to-total-inoculant (wild-type strain plus mutant) ratio. All three mutants showed a lower competitiveness than the wild-type strain, indicating that both nitrate reductase and pyoverdine are involved in the fitness of P. fluorescens C7R12. The double mutant presented the lowest competitiveness. Overall, the competitive advantages given to C7R12 by nitrate reductase and pyoverdine were similar. However, the selective advantage given by nitrate reductase was more strongly expressed under conditions of lower aeration (-1 kPa). In contrast, the selective advantage given by nitrate reductase and pyoverdine did not differ in bulk and rhizosphere soil, indicating that these bacterial traits are not specifically involved in the rhizosphere competence but rather in the saprophytic ability of C7R12 in soil environments. PMID:11375173

  19. Magnetic and electron spin resonance studies of (Ce 1-cGd c)Rh 2

    Science.gov (United States)

    Tari, A.

    1990-08-01

    Magnetic and ESR measurements have been performed on several samples of the (Ce 1-cGd c)Rh 2 series in the interval 0 ≦ c ≦ 1. It is found that only those Ce atoms with at least 3nn Gd atoms are magnetic. The cerium sublattice appears to reach the magnetic percolation limit at about c=0.3. Using the lattice parameters and the RKKY model a value of 0.19eV is computed for the effective exchange integral Jo at the GdRh 2 end of the series.

  20. Allelic variants of DYX1C1 are not associated with dyslexia in India

    OpenAIRE

    Saviour, Pushpa; Kumar, Satish; Kiran, U; Ravuri, Rajasekhara Reddy; Rao, V R; Ramachandra, Nallur Basappa

    2008-01-01

    Dyslexia is a hereditary neurological disorder that manifests as an unexpected difficulty in learning to read despite adequate intelligence, education, and normal senses. The prevalence of dyslexia ranges from 3 to 15% of the school aged children. Many genetic studies indicated that loci on 6p21.3, 15q15-21, and 18p11.2 have been identified as promising candidate gene regions for dyslexia. Recently, it has been suggested that allelic variants of gene, DYX1C1 influence dyslexia. In the present...

  1. Allelic variants of DYX1C1 are not associated with dyslexia in India

    OpenAIRE

    Saviour Pushpa; Kumar Satish; Kiran U; Ravuri Rajasekhara; Rao V.; Ramachandra Nallur

    2008-01-01

    Dyslexia is a hereditary neurological disorder that manifests as an unexpected difficulty in learning to read despite adequate intelligence, education, and normal senses. The prevalence of dyslexia ranges from 3 to 15% of the school aged children. Many genetic studies indicated that loci on 6p21.3, 15q15-21, and 18p11.2 have been identified as promising candidate gene regions for dyslexia. Recently, it has been suggested that allelic variants of gene, DYX1C1 influence dyslexia. In the ...

  2. Implementation of an anisotropic turbulence model in the COMMIX- 1C/ATM computer code

    International Nuclear Information System (INIS)

    The computer code COMMIX-1C/ATM, which describes single-phase, three-dimensional transient thermofluiddynamic problems, has provided the framework for the extension of the standard k-var-epsilon turbulence model to a six-equation model with additional transport equations for the turbulence heat fluxes and the variance of temperature fluctuations. The new, model, which allows simulation of anisotropic turbulence in stratified shear flows, is referred to as the Anisotropic Turbulence Model (ATM) has been verified with numerical computations of stable and unstable stratified shear flow between parallel plates

  3. The brain-specific carnitine palmitoyltransferase-1c regulates energy homeostasis

    OpenAIRE

    Wolfgang, Michael J.; Kurama, Takeshi; Dai, Yun; Suwa, Akira; Asaumi, Makoto; Matsumoto, Shun-ichiro; Cha, Seung Hun; Shimokawa, Teruhiko; Lane, M. Daniel

    2006-01-01

    Fatty acid synthesis in the central nervous system is implicated in the control of food intake and energy expenditure. An intermediate in this pathway, malonyl-CoA, mediates these effects. Malonyl-CoA is an established inhibitor of carnitine palmitoyltransferase-1 (CPT1), an outer mitochondrial membrane enzyme that controls entry of fatty acids into mitochondria and, thereby, fatty acid oxidation. CPT1c, a brain-specific enzyme with high sequence similarity to CPT1a (liver) and CPT1b (muscle)...

  4. A rare case of type 1 C split cord malformation with single dural sheath

    OpenAIRE

    Garg, Kanwaljeet; Ashok K Mahapatra; Tandon, Vivek

    2015-01-01

    Split cord malformation (SCM) is a rare congenital anomaly in which the cord is split over a portion of its length to form double dural tubes (SCM type I) or two hemicords in a single dural sheath (SCM type II). Dachling Pang classified SCM into 2 types with type I SCM consisting of two hemicords, each contained within its own dural sheath and separated by rigid osseocartilaginous median septum. We report a rare case of SCM type 1 c in which there was a single dural sheath.

  5. Study of the physiological function of carnitine palmitoyltransferase 1C enzyme

    OpenAIRE

    Carrasco Rodríguez, Patricia

    2012-01-01

    Carnitine palmitoyl transferase 1 (CPT1) enzymes catalyze the conversion of long-chain acyl-CoA to acyl-carnitines, thus facilitating the entry of long-chain fatty acids to the mitochondria, where they undergo β-oxidation. There are three isoforms: the liver isoform CPT1A (Esser, V. 1993), the muscle isoform CPT1B (Yamazaki, N. 1995) and the brain-specific isoform CPT1C (Price, N. 2002). CPT1A and CPT1B are localized in the outer mitochondrial membrane and are rate-limiting enzymes in fatty-a...

  6. On schizosymmetric superfields and sl(2/1, C)R supersymmetry

    International Nuclear Information System (INIS)

    Superfield expansions over four-dimensional graded spacetime (xμ, θν), with Minkowski coordinates x extended by vector Grassmann variables θ, are investigated. By appropriate identification of the physical Lorentz algebra in the even and odd parts of the superfield, a typology of 'schizofields' containing both integer and half-integer spin fields is established. For two of these types, identified as 'gauge potential'-like and 'field strength'-like schizofields, an sl(2/1, C)R supersymmetry at the component field level is demonstrated. Prospects for a schizofield calculus, and application of these types of field to the particle spectrum, are adumbrated. (author)

  7. In vivo – in vitro toxicogenomic comparison of TCDD-elicited gene expression in Hepa1c1c7 mouse hepatoma cells and C57BL/6 hepatic tissue

    Directory of Open Access Journals (Sweden)

    Boverhof Darrell R

    2006-04-01

    Full Text Available Abstract Background In vitro systems have inherent limitations in their ability to model whole organism gene responses, which must be identified and appropriately considered when developing predictive biomarkers of in vivo toxicity. Systematic comparison of in vitro and in vivo temporal gene expression profiles were conducted to assess the ability of Hepa1c1c7 mouse hepatoma cells to model hepatic responses in C57BL/6 mice following treatment with 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD. Results Gene expression analysis and functional gene annotation indicate that Hepa1c1c7 cells appropriately modeled the induction of xenobiotic metabolism genes in vivo. However, responses associated with cell cycle progression and proliferation were unique to Hepa1c1c7 cells, consistent with the cell cycle arrest effects of TCDD on rapidly dividing cells. In contrast, lipid metabolism and immune responses, representative of whole organism effects in vivo, were not replicated in Hepa1c1c7 cells. Conclusion These results identified inherent differences in TCDD-mediated gene expression responses between these models and highlighted the limitations of in vitro systems in modeling whole organism responses, and additionally identified potential predictive biomarkers of toxicity.

  8. Recessive mutations in POLR1C cause a leukodystrophy by impairing biogenesis of RNA polymerase III

    Science.gov (United States)

    Thiffault, Isabelle; Wolf, Nicole I.; Forget, Diane; Guerrero, Kether; Tran, Luan T.; Choquet, Karine; Lavallée-Adam, Mathieu; Poitras, Christian; Brais, Bernard; Yoon, Grace; Sztriha, Laszlo; Webster, Richard I.; Timmann, Dagmar; van de Warrenburg, Bart P.; Seeger, Jürgen; Zimmermann, Alíz; Máté, Adrienn; Goizet, Cyril; Fung, Eva; van der Knaap, Marjo S.; Fribourg, Sébastien; Vanderver, Adeline; Simons, Cas; Taft, Ryan J.; Yates III, John R.; Coulombe, Benoit; Bernard, Geneviève

    2015-01-01

    A small proportion of 4H (Hypomyelination, Hypodontia and Hypogonadotropic Hypogonadism) or RNA polymerase III (POLR3)-related leukodystrophy cases are negative for mutations in the previously identified causative genes POLR3A and POLR3B. Here we report eight of these cases carrying recessive mutations in POLR1C, a gene encoding a shared POLR1 and POLR3 subunit, also mutated in some Treacher Collins syndrome (TCS) cases. Using shotgun proteomics and ChIP sequencing, we demonstrate that leukodystrophy-causative mutations, but not TCS mutations, in POLR1C impair assembly and nuclear import of POLR3, but not POLR1, leading to decreased binding to POLR3 target genes. This study is the first to show that distinct mutations in a gene coding for a shared subunit of two RNA polymerases lead to selective modification of the enzymes' availability leading to two different clinical conditions and to shed some light on the pathophysiological mechanism of one of the most common hypomyelinating leukodystrophies, POLR3-related leukodystrophy. PMID:26151409

  9. Castor-1C spent fuel storage cask decay heat, heat transfer, and shielding analyses

    International Nuclear Information System (INIS)

    This report documents the decay heat, heat transfer, and shielding analyses of the Gesellschaft fuer Nuklear Services (GNS) CASTOR-1C cask used in a spent fuel storage demonstration performed at Preussen Elektra's Wurgassen nuclear power plant. The demonstration was performed between March 1982 and January 1984, and resulted in cask and fuel temperature data and cask exterior surface gamma-ray and neutron radiation dose rate measurements. The purpose of the analyses reported here was to evaluate decay heat, heat transfer, and shielding computer codes. The analyses consisted of (1) performing pre-look predictions (predictions performed before the analysts were provided the test data), (2) comparing ORIGEN2 (decay heat), COBRA-SFS and HYDRA (heat transfer), and QAD and DOT (shielding) results to data, and (3) performing post-test analyses if appropriate. Even though two heat transfer codes were used to predict CASTOR-1C cask test data, no attempt was made to compare the two codes. The codes are being evaluated with other test data (single-assembly data and other cask data), and to compare the codes based on one set of data may be premature and lead to erroneous conclusions

  10. Evaluation of IRS-1C LISS-3 satellite data for Norway spruce defoliation assessment

    Energy Technology Data Exchange (ETDEWEB)

    Falkenstroem, H.

    1999-02-01

    Satellite based remote sensing supported by air photo and field surveys, provide a means to area covering forest health assessment on a regional scale. Landsat TM data has been extensively used in studies of spruce and fir defoliation in Europe and North America. The temporal coverage of Landsat TM in combination with cloudiness however restrict the availability of data. In this study the LISS-3 sensor onboard the Indian Resource Satellite, IRS-1C, was evaluated for defoliation assessments in Norway spruce (Picea abies) in the central part of Sweden. The near infrared wavelength band proved to be best correlated with mean stand defoliation. After normalisation of satellite data for topographic conditions, the correlation coefficient increased from -0,19 to -0,83. Normalising satellite data for species composition did not improve the results though. The correction coefficients involved in the procedure were originally developed for Landsat TM, and proved to be inadequate for the LISS-3 data set. A thorough examination of the effects of species composition on LISS-3 data is needed to yield better results. The correlation between observed defoliation in the verification stands and predicted (based on the inverse regression function between corrected NIR values and defoliation in reference stands) was 0,70, despite a very limited range of defoliation in the verification set. IRS-1C LISS-3 is fully comparable to Landsat TM for spruce defoliation studies, although the results would probably not be significantly improved 49 refs, 7 figs, 10 tabs

  11. Subcellular localization and regulation of type-1C and type-5 phosphodiesterases

    International Nuclear Information System (INIS)

    We investigated the subcellular localization of PDE5 in in vitro human myometrial cells. We demonstrated for First time that PDE5 is localized in discrete cytoplasmic foci and vesicular compartments corresponding to centrosomes. We also found that PDE5 intracellular localization is not cell- or species-specific, as it is conserved in different animal and human cells. PDE5 protein levels are strongly regulated by the mitotic activity of the smooth muscle cells (SMCs), as they were increased in quiescent, contractile myometrial cultures, and conditions in which proliferation was inhibited. In contrast, PDE1C levels decreased in all conditions that inhibited proliferation. This mirrored the enzymatic activity of both PDE5 and PDE1C. Increasing cGMP intracellular levels by dbcGMP or sildenafil treatments did not block proliferation, while dbcAMP inhibited myometrial cell proliferation. Together, these results suggest that PDE5 regulation of cGMP intracellular levels is not involved in the control of SMC cycle progression, but may represent one of the markers of the contractile phenotype

  12. Role of HbA1c in post-partum screening of women with gestational diabetes mellitus

    Directory of Open Access Journals (Sweden)

    Rickard Claesson

    2015-03-01

    Conclusion: Proposed thresholds of HbA1c had low diagnostic sensitivity. Combined with a fasting glucose test, the performance was no better than with using a fasting glucose test alone. Combining a fasting glucose test with a lower HbA1c cut-point may be an alternative approach for selection of women for an OGTT.

  13. Hemoglobin A1c as a tool for the diagnosis of type 2 diabetes in 208 premenopausal women with polycystic ovary syndrome

    DEFF Research Database (Denmark)

    Magnussen, Line Velling; Mumm, Hanne; Andersen, Marianne;

    2011-01-01

    To study hemoglobin A1c (HbA1c) as a tool for diagnosing diabetes and to study HbA1c as a cardiovascular risk marker in patients with polycystic ovary syndrome (PCOS).......To study hemoglobin A1c (HbA1c) as a tool for diagnosing diabetes and to study HbA1c as a cardiovascular risk marker in patients with polycystic ovary syndrome (PCOS)....

  14. The relationship between HbA(1c) and fasting plasma glucose in patients with increased plasma liver enzyme measurements

    DEFF Research Database (Denmark)

    Christiansen, R; Rasmussen, L Melholt; Nybo, H;

    2012-01-01

    Background:  HbA(1c) is currently being introduced for diagnostic purpose in diabetes. Previous studies have, however, indicated that patients with liver disease have false low HbA(1c) levels. We therefore investigated the correlation between HbA(1c) and plasma glucose in patients with different...... levels of increased liver enzyme concentrations. Methods:  Data from 10 065 patients with simultaneous measurement of HbA(1c) , venous fasting plasma glucose, alanine aminotransferase and γ-glutamyl transferase were extracted from our laboratory database. Correlations were investigated in four patient...... groups divided according to their liver enzyme concentrations. Results:  The correlation between HbA(1c) and plasma glucose was high in all groups, with r = 0.77 for men and r = 0.78 for women (P ...

  15. The SHIP2 interactor Myo1c is required for cell migration in 1321 N1 glioblastoma cells.

    Science.gov (United States)

    Edimo, William's Elong; Ramos, Ana Raquel; Ghosh, Somadri; Vanderwinden, Jean-Marie; Erneux, Christophe

    2016-08-01

    The phosphoinositide 5-phosphatases consist of several enzymes that have been shown to modulate cell migration and invasion. SHIP2, one family member, is known to interact with growth factor receptors and cytoskeletal proteins. In a human model of glioblastoma 1321 N1 cells, we recently identified Myo1c as a new interactor of SHIP2. This was shown in a complex of proteins also containing filamin A. We show here that SHIP2 localization at lamellipodia and ruffles is impaired in Myo1c depleted cells. In the absence of Myo1c, N1 cells tend to associate to form clusters. Cell migration is very much reduced in Myo1c depleted cells, concomitantly with a decrease in FAK Tyr397 phosphorylation, focal adhesion length and PI(4,5)P2 immunostaining. In N1 cells, Myo1c is thus important for lamellipodia formation to assemble a protein complex containing SHIP2 to facilitate cell migration. PMID:27246739

  16. Glutathione Reductase of Vacuole. Comparison of Glutathione Reductase Activity of Vacuole and Tissue Extract of Red Beet Root (Beta vulgaris L.

    Directory of Open Access Journals (Sweden)

    E.V. Pradedova

    2016-02-01

    Full Text Available Glutathione reductase (GR, EC 1.8.1.7 is the enzyme that reduces oxidized glutathione (GSSG and thus regulates the redox state of glutathione (GSH/GSSG. GR has been studied in most plants. This enzyme has been identified in chloroplasts and cytosol, so these cellular compartments are considered to be the main place of the enzyme localization. In the same time, just a little is known about GR vacuoles. There are no conclusive evidences to prove the presence or absence of this enzyme in the vacuoles. GR activity was found in the vacuoles of red beet root cells (Beta vulgaris L.. The level of activity, the optimum pH and isoenzyme composition of GR were compared in the vacuoles and tissue extract of beet root. Vacuolar GR activity was quite high, it was 1.5-2 times higher than the activity of the tissue extract. Enzyme pH optimum of all the objects were identical. pH-optimum depend on the pyridine nucleotide nature: pH 7.0-8.0 was an optimal range with NADPH; pH 5.0 – with NADH. GR activity of the vacuoles and tissue extracts decreased in the presence of a noncompetitive inhibitor 1-chloro-2.4-dinitrobenzene (CDNB, indicating the specificity of this enzymatic reaction. Two bands with glutathione reductase activity have been identified in the vacuoles and tissue extracts using zymography method to determine the enzymatic activity in PAAG after electrophoresis of proteins. Belonging to the GR isoforms of these bands was confirmed by enzyme immunoassay (Western blotting. The electric mobility of isoforms of the study objects did not differ significantly. It is concluded that the biochemical characteristics of vacuolar glutathione reductase were substantially identical to the biochemical characteristics of other localization GR.

  17. Coenzyme A disulfide reductase, the primary low molecular weight disulfide reductase from Staphylococcus aureus. Purification and characterization of the native enzyme.

    Science.gov (United States)

    delCardayre, S B; Stock, K P; Newton, G L; Fahey, R C; Davies, J E

    1998-03-01

    The human pathogen Staphylococcus aureus does not utilize the glutathione thiol/disulfide redox system employed by eukaryotes and many bacteria. Instead, this organism produces CoA as its major low molecular weight thiol. We report the identification and purification of the disulfide reductase component of this thiol/disulfide redox system. Coenzyme A disulfide reductase (CoADR) catalyzes the specific reduction of CoA disulfide by NADPH. CoADR has a pH optimum of 7.5-8.0 and is a dimer of identical subunits of Mr 49,000 each. The visible absorbance spectrum is indicative of a flavoprotein with a lambdamax = 452 nm. The liberated flavin from thermally denatured enzyme was identified as flavin adenine dinucleotide. Steady-state kinetic analysis revealed that CoADR catalyzes the reduction of CoA disulfide by NADPH at pH 7.8 with a Km for NADPH of 2 muM and for CoA disulfide of 11 muM. In addition to CoA disulfide CoADR reduces 4,4'-diphosphopantethine but has no measurable ability to reduce oxidized glutathione, cystine, pantethine, or H2O2. CoADR demonstrates a sequential kinetic mechanism and employs a single active site cysteine residue that forms a stable mixed disulfide with CoA during catalysis. These data suggest that S. aureus employs a thiol/disulfide redox system based on CoA/CoA-disulfide and CoADR, an unorthodox new member of the pyridine nucleotide-disulfide reductase superfamily. PMID:9488707

  18. Significance of HbA1c and its measurement in the diagnosis of diabetes mellitus: US experience.

    Science.gov (United States)

    Juarez, Deborah Taira; Demaris, Kendra M; Goo, Roy; Mnatzaganian, Christina Louise; Wong Smith, Helen

    2014-01-01

    The 2014 American Diabetes Association guidelines denote four means of diagnosing diabetes. The first of these is a glycosylated hemoglobin (HbA1c) >6.5%. This literature review summarizes studies (n=47) in the USA examining the significance, strengths, and limitations of using HbA1c as a diagnostic tool for diabetes, relative to other available means. Due to the relatively recent adoption of HbA1c as a diabetes mellitus diagnostic tool, a hybrid systematic, truncated review of the literature was implemented. Based on these studies, we conclude that HbA1c screening for diabetes has been found to be convenient and effective in diagnosing diabetes. HbA1c screening is particularly helpful in community-based and acute care settings where tests requiring fasting are not practical. Using HbA1c to diagnose diabetes also has some limitations. For instance, HbA1c testing may underestimate the prevalence of diabetes, particularly among whites. Because this bias differs by racial group, prevalence and resulting estimates of health disparities based on HbA1c screening differ from those based on other methods of diagnosis. In addition, existing evidence suggests that HbA1c screening may not be valid in certain subgroups, such as children, women with gestational diabetes, patients with human immunodeficiency virus, and those with prediabetes. Further guidelines are needed to clarify the appropriate use of HbA1c screening in these populations. PMID:25349480

  19. Significance of HbA1c and its measurement in the diagnosis of diabetes mellitus: US experience

    Directory of Open Access Journals (Sweden)

    Juarez DT

    2014-10-01

    Full Text Available Deborah Taira Juarez, Kendra M Demaris, Roy Goo, Christina Louise Mnatzaganian, Helen Wong SmithDaniel K Inouye College of Pharmacy, University of Hawaii at Hilo, Honolulu, HI, USAAbstract: The 2014 American Diabetes Association guidelines denote four means of diagnosing diabetes. The first of these is a glycosylated hemoglobin (HbA1c >6.5%. This literature review summarizes studies (n=47 in the USA examining the significance, strengths, and limitations of using HbA1c as a diagnostic tool for diabetes, relative to other available means. Due to the relatively recent adoption of HbA1c as a diabetes mellitus diagnostic tool, a hybrid systematic, truncated review of the literature was implemented. Based on these studies, we conclude that HbA1c screening for diabetes has been found to be convenient and effective in diagnosing diabetes. HbA1c screening is particularly helpful in community-based and acute care settings where tests requiring fasting are not practical. Using HbA1c to diagnose diabetes also has some limitations. For instance, HbA1c testing may underestimate the prevalence of diabetes, particularly among whites. Because this bias differs by racial group, prevalence and resulting estimates of health disparities based on HbA1c screening differ from those based on other methods of diagnosis. In addition, existing evidence suggests that HbA1c screening may not be valid in certain subgroups, such as children, women with gestational diabetes, patients with human immunodeficiency virus, and those with prediabetes. Further guidelines are needed to clarify the appropriate use of HbA1c screening in these populations.Keywords: diabetes mellitus, diagnosis, glycosylated hemoglobin, USA

  20. A lateral flow immunosensor for direct, sensitive, and highly selective detection of hemoglobin A1c in whole blood.

    Science.gov (United States)

    Ang, Shu Hwang; Thevarajah, T Malathi; Woi, Pei Meng; Alias, Yatimah Binti; Khor, Sook Mei

    2016-03-15

    An immunosensor that operates based on the principles of lateral flow was developed for direct detection of hemoglobin A1c (HbA1c) in whole blood. We utilized colloidal gold-functionalized antibodies to transduce the specific signal generated when sandwich immuno-complexes were formed on the strip in the presence of HbA1c. The number and intensity of the test lines on the strips indicate normal, under control, and elevated levels of HbA1c. In addition, a linear relationship between HbA1c levels and immunosensor signal intensity was confirmed, with a dynamic range of 4-14% (20-130mmolmol(-1)) HbA1c. Using this linear relationship, we determined the HbA1c levels in blood as a function of the signal intensity on the strips. Measurements were validated using the Bio-Rad Variant II HPLC and DCA Vantage tests. Moreover, the immunosensor was verified to be highly selective for detection of HbA1c against HbA0, glycated species of HbA0, and HbA2. The limit of detection was found to be 42.5μgmL(-1) (1.35mmolmol(-1)) HbA1c, which is reasonably sensitive compared to the values reported for microarray immunoassays. The shelf life of the immunosensor was estimated to be 1.4 months when stored at ambient temperature, indicating that the immunoassay is stable. Thus, the lateral flow immunosensor developed here was shown to be capable of performing selective, accurate, rapid, and stable detection of HbA1c in human blood samples. PMID:26927875