WorldWideScience

Sample records for agamous controls giant

  1. Exon: CBRC-AGAM-01-0035 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-01-0035 ctccacagtcttctggaatcgattccggatagtaggtccggaatcagtttccggaatcgattccggaatcggctccggaatcggaatcg...actccggaattggttccggaatcgaaacagaatcggaactggctcccgaattgattccagaatcggctccggaattgaaatctgttccggaatcgtctccggaatcg...gatctataattgattccggaatcggctccggaatcgactccagaatcgactccggaatcggctccggaatcggaatcgattccagcgtcggaatcggctccggaattgattccgaacacggaatcggaatcgg ...

  2. Exon: CBRC-AGAM-07-0046 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0046 tcaacaccggaatcggctccggagccaactccggaatcggctccgaaatcggctccggaatcggttccggaatcggctccggaatcg...gctccggaatcgactccggaatcggctccggaatcgactccggaatcggctccggaatcggctccggaatcggaatcgattccagcatcggaatcggctccggAATTGATTCCCAACACGGAATCGGAATCGG ...

  3. Efficacy of glyphosate and five surfactants for controlling giant salvinia

    Science.gov (United States)

    Fairchild, J.F.; Allert, A.L.; Riddle, J.S.; Gladwin, D.R.

    2002-01-01

    Giant salvinia (Salvinia molesta Mitchell) is a non-native, invasive aquatic fern that was recently introduced to the southern United States. The aggressive nature of the species has led to concerns over its potential adverse impacts to native plants, fish, and invertebrates. We conducted a study to determine the efficacy of glyphosate [isopropylamine salt of N-(phosphono-methyl)glycine] and several surfactants for control of giant salvinia. Studies were conducted over a 42-day period using static renewals (twice weekly) with 4% Hoagland's medium (10 mg/L N equivalent) in replicated 2-L containers. Five concentrations of glyphosate (0, 0.45, 0.91, 1.82, and 3.60% v:v) and five surfactants (0.25% concentration, v:v; Optima???, Kinetic???, Mon 0818???, Cygnet Plus???, and LI-700???) were applied with a pressurized sprayer as a single surface application in a fully nested experimental design. Untreated giant salvinia grew rapidly and exhibited an increase of 800% wet weight biomass over the 42-day test duration. Glyphosate, with and without surfactants, exhibited efficacy at concentrations as low as 0.45% of the commercial formulation. Glyphosate with Optima was the only mixture that resulted in complete mortality of plants with no regrowth.

  4. Research on Simulation of Giant Forging Hydraulic Press Decoupling Control for Synchronous Control System

    OpenAIRE

    Xinliang Liu; Yingjian Deng; Zhongwei Liu

    2013-01-01

    A giant forging hydraulic press active synchronous control system is a mutually-coupled multi-input and multi-output system. To solve the elimination of the multi-channel interference, a multiple-input and multiple-output mathematical model center on active-beam is established; multi-channel synchronous decoupling control strategy is studied. The simulation results show that: the system eliminates the role of strong interference between multi-channel accesses to very good inhibitory effect of...

  5. DEVELOPMENT OF THE CONTROL METHODOLOGY OF THE GIANT MAGNETOSTRICTIVE ACTUATOR BASED ON MAGNETIC FLUX DENSITY

    Institute of Scientific and Technical Information of China (English)

    Jia Zhenyuan; Yang Xing; Shi Chun; Guo Dongming

    2003-01-01

    According to the principle of the magnetostriction generating mechanism, the control model of giant magnetostriction material based on magnetic field and the control method with magnetic flux density are developed. Furthermore, this control method is used to develop a giant magnetostrictive micro-displacement actuator (GMA) and its driving system. Two control methods whose control variables are current intensity and magnetic flux density are compared with each other by experimental studies. Finally, effective methods on improving the linearity and control precision of micro-displacement actuator and reducing the hysteresis based on the controlling magnetic flux density are obtained.

  6. Research on Simulation of Giant Forging Hydraulic Press Decoupling Control for Synchronous Control System

    Directory of Open Access Journals (Sweden)

    Xinliang Liu

    2013-06-01

    Full Text Available A giant forging hydraulic press active synchronous control system is a mutually-coupled multi-input and multi-output system. To solve the elimination of the multi-channel interference, a multiple-input and multiple-output mathematical model center on active-beam is established; multi-channel synchronous decoupling control strategy is studied. The simulation results show that: the system eliminates the role of strong interference between multi-channel accesses to very good inhibitory effect of synchronization error, eliminating the system's external disturbance on the synchronization precision control impact.

  7. Research on Giant Magnetostrictive Actuator for Turning Vibration Control

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    Magnetostriction is a phenomenon in which a magneti c field is used to produce a change in size of some materials. This property has b een known in elements such as nickel, iron and cobalt. Because the rare-ear th alloy Terfenol-D can offer much larger strains than nickel, iron, cobalt, an d other smart materials such as piezoelectric materials, it is called giant magn etostrictive material. Making use of the giant magnetostrictive material, the gi ant magnetostrictive actuator has higher bandwidth and r...

  8. Selective assemblies of giant tetrahedra via precisely controlled positional interactions

    Science.gov (United States)

    Huang, Mingjun; Hsu, Chih-Hao; Wang, Jing; Mei, Shan; Dong, Xuehui; Li, Yiwen; Li, Mingxuan; Liu, Hao; Zhang, Wei; Aida, Takuzo; Zhang, Wen-Bin; Yue, Kan; Cheng, Stephen Z. D.

    2015-04-01

    Self-assembly of rigid building blocks with explicit shape and symmetry is substantially influenced by the geometric factors and remains largely unexplored. We report the selective assembly behaviors of a class of precisely defined, nanosized giant tetrahedra constructed by placing different polyhedral oligomeric silsesquioxane (POSS) molecular nanoparticles at the vertices of a rigid tetrahedral framework. Designed symmetry breaking of these giant tetrahedra introduces precise positional interactions and results in diverse selectively assembled, highly ordered supramolecular lattices including a Frank-Kasper A15 phase, which resembles the essential structural features of certain metal alloys but at a larger length scale. These results demonstrate the power of persistent molecular geometry with balanced enthalpy and entropy in creating thermodynamically stable supramolecular lattices with properties distinct from those of other self-assembling soft materials.

  9. Giant Controllable Magnetization Changes Induced by Structural Phase Transitions in a Metamagnetic Artificial Multiferroic

    OpenAIRE

    Bennett, S. P.; A. T. Wong; Glavic, A.; Herklotz, A.; Urban, C; Valmianski, I.; Biegalski, M. D.; Christen, H. M.; Ward, T. Z.; Lauter, V.

    2016-01-01

    The realization of a controllable metamagnetic transition from AFM to FM ordering would open the door to a plethora of new spintronics based devices that, rather than reorienting spins in a ferromagnet, harness direct control of a materials intrinsic magnetic ordering. In this study FeRh films with drastically reduced transition temperatures and a large magneto-thermal hysteresis were produced for magnetocaloric and spintronics applications. Remarkably, giant controllable magnetization change...

  10. Design and Application of a DSP Controller for Giant Magnetostrictive Smart Structure

    Institute of Scientific and Technical Information of China (English)

    ZHANG Wen-guang; Mao Jian-qin

    2006-01-01

    It is proposed a digital signal processing (DSP) controller used in the control system of six degree-of-freedom (DOF) giant magnetostrictive smart structure (GMSS). Also are presented the controller design and its implementation, the embedded adaptive least mean-square (LMS) control algorithm and the real-time experiments of GMSS. Three programs are embedded in this controller. Of them are the adaptive LMS control algorithm and the other two which are used to search for the optimal values for the initial weight vectors. Moreover, the work flow and the control approach of the GMSS with the DSP controller are introduced. The experimental results indicate that the DSP controller has better control precision and real-time property, and the damping effect is up to 20 dB-30 dB.

  11. ANALISIS POTENSI EKONOMI DAERAH DALAM PENGEMBANGAN KOMODITI UNGGULAN KABUPATEN AGAM

    OpenAIRE

    Yolamalinda

    2014-01-01

    Globalization requires areas within the national territory to compete in the free trade competitively with products from countries all over the world. Regional economic development is expected to produce superior quality products that can compete in competition, both domestically and abroad. Agam as areas that have the potential of tourism and culture has the potential to perform on the world market with superior commodity sub-sectors of the manufacturing industry. This article analyzes the e...

  12. Dual Control of Giant Field-like Spin Torque in Spin Filter Tunnel Junctions

    Science.gov (United States)

    Tang, Y.-H.; Chu, F.-C.; Kioussis, Nicholas

    2015-06-01

    We predict a giant field-like spin torque, , in spin-filter (SF) barrier tunnel junctions in sharp contrast to existing junctions based on nonmagnetic passive barriers. We demonstrate that has linear bias behavior, is independent of the SF thickness, and has odd parity with respect to the SF’s exchange splitting. Thus, it can be selectively controlled via external bias or external magnetic field which gives rise to sign reversal of via magnetic field switching. The underlying mechanism is the interlayer exchange coupling between the noncollinear magnetizations of the SF and free ferromagnetic electrode via the nonmagnetic insulating (I) spacer giving rise to giant spin-dependent reflection at the SF/I interface. These findings suggest that the proposed field-like-spin-torque MRAM may provide promising dual functionalities for both ‘reading’ and ‘writing’ processes which require lower critical current densities and faster writing and reading speeds.

  13. Using giant scarlet runner bean embryos to uncover regulatory networks controlling suspensor gene activity

    Directory of Open Access Journals (Sweden)

    Kelli F. Henry

    2015-02-01

    Full Text Available One of the major unsolved issues in plant development is understanding the regulatory networks that control the differential gene activity that is required for the specification and development of the two major embryonic regions, the embryo proper and suspensor. Historically, the giant embryo of scarlet runner bean (SRB, Phaseolus coccineus, has been used as a model system to investigate the physiological events that occur early in embryogenesis – focusing on the question of what role the suspensor region plays. A major feature distinguishing SRB embryos from those of other plants is a highly enlarged suspensor containing at least 200 cells that synthesize growth regulators required for subsequent embryonic development. Recent studies have exploited the giant size of the SRB embryo to micro-dissect the embryo proper and suspensor regions in order to use genomics-based approaches to identify regulatory genes that may be involved in controlling suspensor and embryo proper differentiation, as well as the cellular processes that may be unique to each embryonic region. Here we review the current genomics resources that make SRB embryos a compelling model system for studying the early events required to program embryo development.

  14. ANALISIS POTENSI EKONOMI DAERAH DALAM PENGEMBANGAN KOMODITI UNGGULAN KABUPATEN AGAM

    Directory of Open Access Journals (Sweden)

    Yolamalinda

    2014-10-01

    Full Text Available Globalization requires areas within the national territory to compete in the free trade competitively with products from countries all over the world. Regional economic development is expected to produce superior quality products that can compete in competition, both domestically and abroad. Agam as areas that have the potential of tourism and culture has the potential to perform on the world market with superior commodity sub-sectors of the manufacturing industry. This article analyzes the election of regional commodity Agam using LQ analysis, specialization index, Shift share and SWOT analysis. The analysis finds that subsekctor processing industry has a competitive advantage and thus likely to be developed to increase the region's economy. Commodity embroidery as a creative industry is a commodity that is mapped able to compete on the sub-sectors of the processing industry because the rich local cultural values and Islamic values. A variety of programs and government policies are needed to support these commodities to appear on the international market.

  15. Performance of orange oil in the control of carmine cochineal in giant cactus pear.

    Directory of Open Access Journals (Sweden)

    Ivanildo Cavalcanti de Albuquerque

    2009-03-01

    Full Text Available Since its introduction, in 2001, the carmine cochineal (Dactylopius opuntiae already decimated some 100.000 hectares of giant cactus pear (Opuntia ficus-indica in semi-arid region of Paraiba. This study aimed to evaluate the behavior of five concentrations of orange oil, applied in cladodes on the death of D. opuntiae in field conditions. The research was carried out in a field of giant cactus pear infested by carmine cochineal on the site rigideira, Monteiro County, State of Paraíba. The trial design used was blocks at random (DBR composed of six treatments [doses of 0.3, 0.4, 0.5, 0.6, and 0.7% of orange oil (Prev-am] and water as control and five repetitions. The orange oil known like Prev-Am (Sodium tetraborohydrate decahydrate was effective against to carmine cochineal as early as the dose of 0.3% and higher potential for efficiency were observed at doses of 0.6 and 0.7%. After 48 hours of application of the product, which was observed at doses applied adults and nymphs of the insect, was dried according to the product action that acts by contact. The product had no lethal effect on ladybugs (Cycloneda sanguinea and Scymnus intrusus, but was lethal to larvae of Baccha sp. at a dose of 0.7%.

  16. Control of giant pulse duration in neodymium mini lasers with controllable cavity length and pulsed pumping

    International Nuclear Information System (INIS)

    In a solid-state laser incident on aLiNdP4O12 crystal, pumped by a short light pulse, giant pulse oscillation without the use of resonator Q switching is realized. Tuning of the oscillation pulse duration from 2 up to 20 ns is achieved by changing the cavity length from 24 to 3 mm, respectively. Our analysis of this mode of laser radiation is made on the basis of the rate equations. The factors influencing oscillation pulse duration a reinvestigated. It is shown that in a limiting case the minimal value of the pulse duration is limited by only the rate of excitation transfer from the pumping band to the metastable level

  17. Magnetic-flux-controlled giant Fano factor for the coherent tunneling through a parallel double-quantum-dot

    OpenAIRE

    Dong, Bing; Lei, X. L.

    2006-01-01

    We report our studies of zero-frequency shot noise in tunneling through a parallel-coupled quantum dot interferometer by employing number-resolved quantum rate equations. We show that the combination of quantum interference effect between two pathways and strong Coulomb repulsion could result in a giant Fano factor, which is controllable by tuning the enclosed magnetic flux.

  18. Magnetic-Flux-Controlled Giant Fano Factor for Coherent Tunneling Through a Parallel Double-Quantum-Dot

    International Nuclear Information System (INIS)

    We report our studies of zero-frequency shot noise in tunneling through a parallel-coupled quantum dot interferometer by employing number-resolved quantum rate equations. We show that the combination of quantum interference effect between two pathways and strong Coulomb repulsion could result in a giant Fano factor, which is controllable by tuning the enclosed magnetic flux

  19. Magnetic-Flux-Controlled Giant Fano Factor for Coherent Tunneling Through a Parallel Double-Quantum-Dot

    Institute of Scientific and Technical Information of China (English)

    DONG Bing; LEI Xiao-Lin; CUI Hong-Liang

    2008-01-01

    We report our studies of zero-frequency shot noise in tunneling through a parallel-coupled quantum dot interferometer by employing number-resolved quantum rate equations. We show that the combination of quantum interference effect between two pathways and strong Coulomb repulsion could result in a giant Fano factor, which is controllable by tuning the enclosed magnetic flux.

  20. Giant Controllable Magnetization Changes Induced by Structural Phase Transitions in a Metamagnetic Artificial Multiferroic.

    Science.gov (United States)

    Bennett, S P; Wong, A T; Glavic, A; Herklotz, A; Urban, C; Valmianski, I; Biegalski, M D; Christen, H M; Ward, T Z; Lauter, V

    2016-01-01

    The realization of a controllable metamagnetic transition from AFM to FM ordering would open the door to a plethora of new spintronics based devices that, rather than reorienting spins in a ferromagnet, harness direct control of a materials intrinsic magnetic ordering. In this study FeRh films with drastically reduced transition temperatures and a large magneto-thermal hysteresis were produced for magnetocaloric and spintronics applications. Remarkably, giant controllable magnetization changes (measured to be as high has ~25%) are realized by manipulating the strain transfer from the external lattice when subjected to two structural phase transitions of BaTiO3 (001) single crystal substrate. These magnetization changes are the largest seen to date to be controllably induced in the FeRh system. Using polarized neutron reflectometry we reveal how just a slight in plane surface strain change at ~290C results in a massive magnetic transformation in the bottom half of the film clearly demonstrating a strong lattice-spin coupling in FeRh. By means of these substrate induced strain changes we show a way to reproducibly explore the effects of temperature and strain on the relative stabilities of the FM and AFM phases in multi-domain metamagnetic systems. This study also demonstrates for the first time the depth dependent nature of a controllable magnetic order using strain in an artificial multiferroic heterostructure. PMID:26940159

  1. Giant Controllable Magnetization Changes Induced by Structural Phase Transitions in a Metamagnetic Artificial Multiferroic

    Science.gov (United States)

    Bennett, S. P.; Wong, A. T.; Glavic, A.; Herklotz, A.; Urban, C.; Valmianski, I.; Biegalski, M. D.; Christen, H. M.; Ward, T. Z.; Lauter, V.

    2016-03-01

    The realization of a controllable metamagnetic transition from AFM to FM ordering would open the door to a plethora of new spintronics based devices that, rather than reorienting spins in a ferromagnet, harness direct control of a materials intrinsic magnetic ordering. In this study FeRh films with drastically reduced transition temperatures and a large magneto-thermal hysteresis were produced for magnetocaloric and spintronics applications. Remarkably, giant controllable magnetization changes (measured to be as high has ~25%) are realized by manipulating the strain transfer from the external lattice when subjected to two structural phase transitions of BaTiO3 (001) single crystal substrate. These magnetization changes are the largest seen to date to be controllably induced in the FeRh system. Using polarized neutron reflectometry we reveal how just a slight in plane surface strain change at ~290C results in a massive magnetic transformation in the bottom half of the film clearly demonstrating a strong lattice-spin coupling in FeRh. By means of these substrate induced strain changes we show a way to reproducibly explore the effects of temperature and strain on the relative stabilities of the FM and AFM phases in multi-domain metamagnetic systems. This study also demonstrates for the first time the depth dependent nature of a controllable magnetic order using strain in an artificial multiferroic heterostructure.

  2. Photoresponsive carbohydrate-based giant surfactants: automatic vertical alignment of nematic liquid crystal for the remote-controllable optical device.

    Science.gov (United States)

    Kim, Dae-Yoon; Lee, Sang-A; Kang, Dong-Gue; Park, Minwook; Choi, Yu-Jin; Jeong, Kwang-Un

    2015-03-25

    Photoresponsive carbohydrate-based giant surfactants (abbreviated as CELAnD-OH) were specifically designed and synthesized for the automatic vertical alignment (VA) layer of nematic (N) liquid crystal (LC), which can be applied for the fabrication of remote-controllable optical devices. Without the conventional polymer-based LC alignment process, a perfect VA layer was automatically constructed by directly adding the 0.1 wt % CELA1D-OH in the N-LC media. The programmed CELA1D-OH giant surfactants in the N-LC media gradually diffused onto the substrates of LC cell and self-assembled to the expanded monolayer structure, which can provide enough empty spaces for N-LC molecules to crawl into the empty zones for the construction of VA layer. On the other hand, the CELA3D-OH giant surfactants forming the condensed monolayer structure on the substrates exhibited a planar alignment (PA) rather than a VA. Upon tuning the wavelength of light, the N-LC alignments were reversibly switched between VA and PA in the remote-controllable LC optical devices. Based on the experimental results, it was realized that understanding the interactions between N-LC molecules and amphiphilic giant surfactants is critical to design the suitable materials for the automatic LC alignment.

  3. Wavefront control simulations for the Giant Magellan Telescope: Field-dependent segment piston control

    OpenAIRE

    Quiros-Pacheco, Fernando; Conan, Rod; McLeod, Brian; Irarrazaval, Ben; Bouchez, Antonin

    2015-01-01

    We present in this paper preliminary simulation results aimed at validating the GMT piston control strategy. Wewill in particular consider an observing mode in which an Adaptive Optics (AO) system is providing fast on-axisWF correction with the Adaptive Secondary Mirror (ASM), while the phasing system using multiple SegmentPiston Sensors (SPS) makes sure that the seven GMT segments remain phased. Simulations have been performedwith the Dynamic Optical Simulation (DOS) tool developed at the GM...

  4. Giant tunneling electroresistance effect driven by an electrically controlled spin valve at a complex oxide interface.

    Science.gov (United States)

    Burton, J D; Tsymbal, E Y

    2011-04-15

    A giant tunneling electroresistance effect may be achieved in a ferroelectric tunnel junction by exploiting the magnetoelectric effect at the interface between the ferroelectric barrier and a magnetic La(1-x)Sr(x)MnO3 electrode. Using first-principles density-functional theory we demonstrate that a few magnetic monolayers of La(1-x)Sr(x)MnO3 near the interface act, in response to ferroelectric polarization reversal, as an atomic-scale spin valve by filtering spin-dependent current. This produces more than an order of magnitude change in conductance, and thus constitutes a giant resistive switching effect. PMID:21568608

  5. NCBI nr-aa BLAST: CBRC-AGAM-01-0038 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-01-0038 ref|NP_938793.1| Putative cytochrome C biogenesis protein [Corynebacterium diphtheria...e NCTC 13129] emb|CAE48916.1| Putative cytochrome C biogenesis protein [Corynebacterium diphtheriae] NP_938793.1 1.6 24% ...

  6. NCBI nr-aa BLAST: CBRC-AGAM-07-0027 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0027 ref|ZP_00232264.1| conserved hypothetical protein [Listeria monoc...ytogenes str. 4b H7858] gb|EAL07894.1| conserved hypothetical protein [Listeria monocytogenes str. 4b H7858] ZP_00232264.1 1e-07 38% ...

  7. NCBI nr-aa BLAST: CBRC-AGAM-04-0117 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-04-0117 ref|YP_761365.1| acyltransferase family protein [Hyphomonas neptun...ium ATCC 15444] gb|ABI76943.1| acyltransferase family protein [Hyphomonas neptunium ATCC 15444] YP_761365.1 1.4 24% ...

  8. NCBI nr-aa BLAST: CBRC-AGAM-07-0038 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0038 ref|ZP_01121627.1| hypothetical protein RB2501_11202 [Robiginital...ea biformata HTCC2501] gb|EAR14889.1| hypothetical protein RB2501_11202 [Robiginitalea biformata HTCC2501] ZP_01121627.1 1e-62 41% ...

  9. NCBI nr-aa BLAST: CBRC-AGAM-07-0041 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0041 ref|ZP_01120431.1| hypothetical protein RB2501_08655 [Robiginital...ea biformata HTCC2501] gb|EAR16959.1| hypothetical protein RB2501_08655 [Robiginitalea biformata HTCC2501] ZP_01120431.1 4e-31 32% ...

  10. NCBI nr-aa BLAST: CBRC-AGAM-02-0156 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-02-0156 ref|XP_234385.3| PREDICTED: similar to pecanex homolog [Rattus no...rvegicus] ref|XP_001055794.1| PREDICTED: similar to pecanex homolog [Rattus norvegicus] XP_234385.3 1e-94 39% ...

  11. NCBI nr-aa BLAST: CBRC-AGAM-02-0087 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-02-0087 ref|NP_731674.1| Calphotin CG4795-PB, isoform B [Drosophila melan...ogaster] sp|Q02910|CPN_DROME Calphotin gb|AAF54754.1| CG4795-PB, isoform B [Drosophila melanogaster] NP_731674.1 0.006 28% ...

  12. NCBI nr-aa BLAST: CBRC-AGAM-05-0030 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-05-0030 ref|NP_731674.1| Calphotin CG4795-PB, isoform B [Drosophila melan...ogaster] sp|Q02910|CPN_DROME Calphotin gb|AAF54754.1| CG4795-PB, isoform B [Drosophila melanogaster] NP_731674.1 5e-08 31% ...

  13. NCBI nr-aa BLAST: CBRC-AGAM-01-0080 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-01-0080 ref|ZP_01467057.1| conserved hypothetical protein [Stigmatella au...rantiaca DW4/3-1] gb|EAU62171.1| conserved hypothetical protein [Stigmatella aurantiaca DW4/3-1] ZP_01467057.1 4e-06 30% ...

  14. NCBI nr-aa BLAST: CBRC-AGAM-07-0038 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0038 ref|ZP_01688972.1| ABC transporter, permease protein, putative [Microscilla marina... ATCC 23134] gb|EAY29695.1| ABC transporter, permease protein, putative [Microscilla marina ATCC 23134] ZP_01688972.1 4e-61 37% ...

  15. NCBI nr-aa BLAST: CBRC-AGAM-07-0040 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0040 ref|ZP_01687956.1| mate efflux family protein [Microscilla marina... ATCC 23134] gb|EAY31163.1| mate efflux family protein [Microscilla marina ATCC 23134] ZP_01687956.1 2e-50 42% ...

  16. NCBI nr-aa BLAST: CBRC-AGAM-07-0034 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0034 ref|YP_752172.1| major facilitator superfamily MFS_1 [Shewanella frigidimarina... NCIMB 400] gb|ABI73333.1| major facilitator superfamily MFS_1 [Shewanella frigidimarina NCIMB 400] YP_752172.1 2e-55 45% ...

  17. NCBI nr-aa BLAST: CBRC-AGAM-05-0031 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-05-0031 ref|YP_294122.1| hypothetical protein EhV364 [Emiliania huxleyi v...irus 86] emb|CAI65791.1| putative membrane protein [Emiliania huxleyi virus 86] YP_294122.1 8e-16 44% ...

  18. NCBI nr-aa BLAST: CBRC-AGAM-02-0138 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-02-0138 ref|ZP_02029487.1| hypothetical protein BIFADO_01945 [Bifidobacterium adolescent...is L2-32] gb|EDN81820.1| hypothetical protein BIFADO_01945 [Bifidobacterium adolescentis L2-32] ZP_02029487.1 3e-07 24% ...

  19. NCBI nr-aa BLAST: CBRC-AGAM-07-0028 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0028 ref|YP_001193977.1| hypothetical protein Fjoh_1626 [Flavobacterium john...soniae UW101] gb|ABQ04658.1| hypothetical protein Fjoh_1626 [Flavobacterium johnsoniae UW101] YP_001193977.1 5e-72 44% ...

  20. NCBI nr-aa BLAST: CBRC-AGAM-07-0041 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0041 ref|YP_001193736.1| UbiA prenyltransferase [Flavobacterium johnso...niae UW101] gb|ABQ04417.1| UbiA prenyltransferase [Flavobacterium johnsoniae UW101] YP_001193736.1 4e-31 33% ...

  1. NCBI nr-aa BLAST: CBRC-AGAM-07-0045 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0045 ref|YP_001192547.1| heavy metal translocating P-type ATPase [Flavobacterium john...soniae UW101] gb|ABQ03228.1| heavy metal translocating P-type ATPase [Flavobacterium johnsoniae UW101] YP_001192547.1 1e-129 62% ...

  2. NCBI nr-aa BLAST: CBRC-AGAM-05-0050 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-05-0050 ref|NP_965518.1| hypothetical protein LJ1711 [Lactobacillus johns...onii NCC 533] gb|AAS09484.1| hypothetical protein LJ_1711 [Lactobacillus johnsonii NCC 533] NP_965518.1 3e-35 42% ...

  3. NCBI nr-aa BLAST: CBRC-AGAM-07-0072 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0072 ref|YP_129371.1| putative transport ATP-binding protein CydD [Photobacterium profund...um SS9] emb|CAG19569.1| putative transport ATP-binding protein CydD [Photobacterium profundum SS9] YP_129371.1 1e-112 63% ...

  4. NCBI nr-aa BLAST: CBRC-AGAM-07-0016 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0016 ref|YP_128354.1| putative multidrug resistance protein [Photobacterium profund...um SS9] emb|CAG18552.1| putative multidrug resistance protein [Photobacterium profundum SS9] YP_128354.1 3e-54 55% ...

  5. NCBI nr-aa BLAST: CBRC-AGAM-07-0004 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0004 ref|YP_128755.1| chloride channel protein [Photobacterium profund...um SS9] emb|CAG18953.1| putative chloride channel protein EriC [Photobacterium profundum SS9] YP_128755.1 2e-88 60% ...

  6. NCBI nr-aa BLAST: CBRC-AGAM-07-0016 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0016 ref|ZP_01220770.1| putative multidrug resistance protein [Photobacterium profund...um 3TCK] gb|EAS42763.1| putative multidrug resistance protein [Photobacterium profundum 3TCK] ZP_01220770.1 2e-54 55% ...

  7. NCBI nr-aa BLAST: CBRC-AGAM-01-0097 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-01-0097 ref|YP_001263414.1| major facilitator superfamily MFS_1 [Sphingomonas... wittichii RW1] gb|ABQ69276.1| major facilitator superfamily MFS_1 [Sphingomonas wittichii RW1] YP_001263414.1 4.6 27% ...

  8. NCBI nr-aa BLAST: CBRC-AGAM-07-0044 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0044 ref|ZP_01302230.1| putative manganese transport protein MntH [Sphingomonas... sp. SKA58] gb|EAT10059.1| putative manganese transport protein MntH [Sphingomonas sp. SKA58] ZP_01302230.1 1e-100 52% ...

  9. NCBI nr-aa BLAST: CBRC-AGAM-02-0168 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-02-0168 ref|YP_001263414.1| major facilitator superfamily MFS_1 [Sphingomonas... wittichii RW1] gb|ABQ69276.1| major facilitator superfamily MFS_1 [Sphingomonas wittichii RW1] YP_001263414.1 0.77 31% ...

  10. NCBI nr-aa BLAST: CBRC-AGAM-01-0050 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-01-0050 ref|XP_001657779.1| D7 protein, putative [Aedes aegypti] gb|EAT41...994.1| D7 protein, putative [Aedes aegypti] gb|ABM68616.1| AAEL006424-PA [Aedes aegypti] XP_001657779.1 7e-19 27% ...

  11. NCBI nr-aa BLAST: CBRC-AGAM-04-0002 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-04-0002 ref|XP_001658302.1| sodium/solute symporter [Aedes aegypti] gb|EA...T47697.1| sodium/solute symporter [Aedes aegypti] gb|ABM68585.1| AAEL001198-PA [Aedes aegypti] XP_001658302.1 1e-143 68% ...

  12. NCBI nr-aa BLAST: CBRC-AGAM-01-0100 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-01-0100 ref|XP_001653866.1| ultraviolet-sensitive opsin [Aedes aegypti] g...b|ABF18478.1| ultraviolet-sensitive opsin [Aedes aegypti] gb|EAT38511.1| ultraviolet-sensitive opsin [Aedes aegypti] XP_001653866.1 2e-60 37% ...

  13. NCBI nr-aa BLAST: CBRC-AGAM-01-0040 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-01-0040 ref|XP_001653866.1| ultraviolet-sensitive opsin [Aedes aegypti] g...b|ABF18478.1| ultraviolet-sensitive opsin [Aedes aegypti] gb|EAT38511.1| ultraviolet-sensitive opsin [Aedes aegypti] XP_001653866.1 1e-178 80% ...

  14. NCBI nr-aa BLAST: CBRC-AGAM-07-0045 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0045 ref|ZP_01051647.1| Heavy metal translocating P-type ATPase [Tenac...ibaculum sp. MED152] gb|EAQ41075.1| Heavy metal translocating P-type ATPase [Polaribacter dokdonensis MED152] ZP_01051647.1 1e-132 63% ...

  15. NCBI nr-aa BLAST: CBRC-AGAM-07-0010 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0010 ref|ZP_01435324.1| amino acid permease-associated region [Shewanella baltica... OS195] gb|EAU26628.1| amino acid permease-associated region [Shewanella baltica OS195] ZP_01435324.1 1e-127 91% ...

  16. NCBI nr-aa BLAST: CBRC-AGAM-07-0010 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0010 ref|YP_001051439.1| amino acid permease-associated region [Shewanella baltica... OS155] gb|ABN62570.1| amino acid permease-associated region [Shewanella baltica OS155] YP_001051439.1 1e-127 91% ...

  17. NCBI nr-aa BLAST: CBRC-AGAM-07-0010 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0010 ref|ZP_01842482.1| amino acid permease-associated region [Shewanella baltica... OS223] gb|EDK49834.1| amino acid permease-associated region [Shewanella baltica OS223] ZP_01842482.1 1e-127 91% ...

  18. NCBI nr-aa BLAST: CBRC-AGAM-07-0010 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0010 ref|YP_001367293.1| amino acid permease-associated region [Shewanella baltica... OS185] gb|ABS09230.1| amino acid permease-associated region [Shewanella baltica OS185] YP_001367293.1 1e-126 91% ...

  19. NCBI nr-aa BLAST: CBRC-AGAM-07-0007 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0007 ref|YP_001099812.1| putative Urea transporter [Herminiimonas arsenico...xydans] emb|CAL61685.1| putative Urea transporter [Herminiimonas arsenicoxydans] YP_001099812.1 4e-36 33% ...

  20. NCBI nr-aa BLAST: CBRC-AGAM-02-0071 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-02-0071 ref|NP_001035057.1| pteropsin [Apis mellifera] tpg|DAA05735.1| TP...A_exp: pteropsin [Apis mellifera] tpg|DAA05736.1| TPA_exp: pteropsin [Apis mellifera] NP_001035057.1 3e-73 46% ...

  1. NCBI nr-aa BLAST: CBRC-AGAM-07-0042 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0042 ref|ZP_00591264.1| Potassium efflux system protein [Prosthecochlo...ris aestuarii DSM 271] gb|EAN23634.1| Potassium efflux system protein [Prosthecochloris aestuarii DSM 271] ZP_00591264.1 1e-75 46% ...

  2. NCBI nr-aa BLAST: CBRC-AGAM-07-0040 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0040 ref|ZP_01882627.1| multidrug resistance protein [Pedobacter sp. B...AL39] gb|EDM38378.1| multidrug resistance protein [Pedobacter sp. BAL39] ZP_01882627.1 3e-50 42% ...

  3. NCBI nr-aa BLAST: CBRC-AGAM-07-0044 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0044 ref|ZP_01884120.1| Mn2+/Fe2+ transporter, NRAMP family protein [Pedo...bacter sp. BAL39] gb|EDM36559.1| Mn2+/Fe2+ transporter, NRAMP family protein [Pedobacter sp. BAL39] ZP_01884120.1 1e-119 55% ...

  4. NCBI nr-aa BLAST: CBRC-AGAM-07-0073 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0073 ref|ZP_01886744.1| hypothetical protein PBAL39_17149 [Pedobacter ...sp. BAL39] gb|EDM34019.1| hypothetical protein PBAL39_17149 [Pedobacter sp. BAL39] ZP_01886744.1 1e-114 75% ...

  5. NCBI nr-aa BLAST: CBRC-AGAM-01-0070 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-01-0070 ref|NP_476722.1| shotgun CG3722-PA [Drosophila melanogaster] sp|Q...24298|CADE_DROME DE-cadherin precursor (Protein shotgun) gb|AAF46659.1| CG3722-PA [Drosophila melanogaster] NP_476722.1 0.0 42% ...

  6. NCBI nr-aa BLAST: CBRC-AGAM-02-0044 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-02-0044 ref|ZP_01559561.1| conserved hypothetical protein [Burkholderia a...mbifaria MC40-6] gb|EAV47895.1| conserved hypothetical protein [Burkholderia ambifaria MC40-6] ZP_01559561.1 0.83 27% ...

  7. NCBI nr-aa BLAST: CBRC-AGAM-03-0021 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-03-0021 ref|YP_331887.1| Planctomycete extracellular domain protein [Burkholder...ia pseudomallei 1710b] gb|ABA51048.1| Planctomycete extracellular domain protein [Burkholderia pseudomallei 1710b] YP_331887.1 0.005 31% ...

  8. NCBI nr-aa BLAST: CBRC-AGAM-02-0064 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-02-0064 ref|YP_335617.1| haemagluttinin family protein [Burkholderia pseu...domallei 1710b] gb|ABA51851.1| haemagluttinin family protein [Burkholderia pseudomallei 1710b] YP_335617.1 0.0 31% ...

  9. NCBI nr-aa BLAST: CBRC-AGAM-04-0021 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-04-0021 ref|ZP_01571862.1| 200 kDa antigen p200, putative [Burkholderia m...ultivorans ATCC 17616] gb|EAV64386.1| 200 kDa antigen p200, putative [Burkholderia multivorans ATCC 17616] ZP_01571862.1 0.82 25% ...

  10. NCBI nr-aa BLAST: CBRC-AGAM-01-0052 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-01-0052 ref|YP_333983.1| hypothetical protein BURPS1710b_2591 [Burkholder...ia pseudomallei 1710b] gb|ABA48937.1| hypothetical protein BURPS1710b_2591 [Burkholderia pseudomallei 1710b] YP_333983.1 5e-11 27% ...

  11. NCBI nr-aa BLAST: CBRC-AGAM-07-0060 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0060 ref|YP_553299.1| Putative diguanylate cyclase (GGDEF domain) [Burkholder...ia xenovorans LB400] gb|ABE33949.1| Putative diguanylate cyclase (GGDEF domain) [Burkholderia xenovorans LB400] YP_553299.1 3e-20 29% ...

  12. NCBI nr-aa BLAST: CBRC-AGAM-01-0094 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-01-0094 ref|XP_001650650.1| rab6 gtpase activating protein, gapcena (rabgap...1 protein) [Aedes aegypti] gb|EAT48196.1| rab6 gtpase activating protein, gapcena (rabgap1 protein) [Aedes aegypti] XP_001650650.1 1e-172 69% ...

  13. NCBI nr-aa BLAST: CBRC-AGAM-01-0094 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-01-0094 ref|XP_001650651.1| rab6 gtpase activating protein, gapcena (rabgap...1 protein) [Aedes aegypti] gb|EAT48197.1| rab6 gtpase activating protein, gapcena (rabgap1 protein) [Aedes aegypti] XP_001650651.1 1e-172 69% ...

  14. NCBI nr-aa BLAST: CBRC-AGAM-02-0141 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-02-0141 ref|ZP_01444683.1| tail fiber protein, putative [Roseovarius sp. ...HTCC2601] gb|EAU45064.1| tail fiber protein, putative [Roseovarius sp. HTCC2601] ZP_01444683.1 0.038 24% ...

  15. NCBI nr-aa BLAST: CBRC-AGAM-05-0028 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-05-0028 ref|NP_309677.1| putative tail fiber protein [Escherichia coli O1...57:H7 str. Sakai] dbj|BAB35073.1| putative tail fiber protein [Escherichia coli O157:H7 str. Sakai] NP_309677.1 3e-18 34% ...

  16. NCBI nr-aa BLAST: CBRC-AGAM-01-0088 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-01-0088 sp|P82149|NT53_DROME Lethal(2)neighbour of tid protein 2 (NOT53) ...emb|CAA64533.1| Not53 protein [Drosophila melanogaster] emb|CAA71168.1| lethal(2)neighbour of tid [Drosophila melanogaster] P82149 1e-123 61% ...

  17. NCBI nr-aa BLAST: CBRC-AGAM-02-0168 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-02-0168 ref|YP_710943.1| Putative ABC transporter integral membrane protein [Frank...ia alni ACN14a] emb|CAJ59337.1| Putative ABC transporter integral membrane protein [Frankia alni ACN14a] YP_710943.1 0.20 26% ...

  18. NCBI nr-aa BLAST: CBRC-AGAM-07-0044 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0044 ref|YP_001193285.1| Mn2+/Fe2+ transporter, NRAMP family [Flavobac...terium johnsoniae UW101] gb|ABQ03966.1| Mn2+/Fe2+ transporter, NRAMP family [Flavobacterium johnsoniae UW101] YP_001193285.1 1e-123 62% ...

  19. NCBI nr-aa BLAST: CBRC-AGAM-07-0041 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0041 ref|YP_001295245.1| Prenyltransferase family protein [Flavobacter...ium psychrophilum JIP02/86] emb|CAL42427.1| Prenyltransferase family protein [Flavobacterium psychrophilum JIP02/86] YP_001295245.1 4e-31 34% ...

  20. NCBI nr-aa BLAST: CBRC-AGAM-07-0028 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0028 ref|YP_001295229.1| hypothetical protein FP0297 [Flavobacterium p...sychrophilum JIP02/86] emb|CAL42411.1| Protein of unknown function [Flavobacterium psychrophilum JIP02/86] YP_001295229.1 4e-70 43% ...

  1. NCBI nr-aa BLAST: CBRC-AGAM-07-0028 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0028 ref|ZP_01734073.1| hypothetical protein FBBAL38_06975 [Flavobacte...ria bacterium BAL38] gb|EAZ95423.1| hypothetical protein FBBAL38_06975 [Flavobacteria bacterium BAL38] ZP_01734073.1 5e-72 44% ...

  2. NCBI nr-aa BLAST: CBRC-AGAM-07-0038 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0038 ref|ZP_01732766.1| ABC transporter, permease protein, putative [Flavob...acteria bacterium BAL38] gb|EAZ95835.1| ABC transporter, permease protein, putative [Flavobacteria bacterium BAL38] ZP_01732766.1 9e-60 41% ...

  3. NCBI nr-aa BLAST: CBRC-AGAM-07-0035 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0035 ref|YP_001296724.1| Protein of unknown function YfkH [Flavobacter...ium psychrophilum JIP02/86] emb|CAL43921.1| Protein of unknown function YfkH [Flavobacterium psychrophilum JIP02/86] YP_001296724.1 3e-31 32% ...

  4. NCBI nr-aa BLAST: CBRC-AGAM-07-0028 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0028 ref|ZP_01105157.1| hypothetical protein FB2170_03125 [Flavobacter...iales bacterium HTCC2170] gb|EAR02242.1| hypothetical protein FB2170_03125 [Flavobacteriales bacterium HTCC2170] ZP_01105157.1 1e-68 43% ...

  5. NCBI nr-aa BLAST: CBRC-AGAM-07-0035 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0035 ref|ZP_01732843.1| hypothetical protein FBBAL38_00795 [Flavobacte...ria bacterium BAL38] gb|EAZ95912.1| hypothetical protein FBBAL38_00795 [Flavobacteria bacterium BAL38] ZP_01732843.1 7e-31 30% ...

  6. NCBI nr-aa BLAST: CBRC-AGAM-07-0034 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0034 ref|YP_001193612.1| major facilitator superfamily MFS_1 [Flavobac...terium johnsoniae UW101] gb|ABQ04293.1| major facilitator superfamily MFS_1 [Flavobacterium johnsoniae UW101] YP_001193612.1 3e-63 49% ...

  7. NCBI nr-aa BLAST: CBRC-AGAM-07-0007 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0007 ref|YP_001197147.1| Urea transporter [Flavobacterium johnsoniae U...W101] gb|ABQ07828.1| Urea transporter [Flavobacterium johnsoniae UW101] YP_001197147.1 4e-69 48% ...

  8. NCBI nr-aa BLAST: CBRC-AGAM-07-0045 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0045 ref|YP_001195410.1| heavy metal translocating P-type ATPase [Flavob...acterium johnsoniae UW101] gb|ABQ06091.1| heavy metal translocating P-type ATPase [Flavobacterium johnsoniae UW101] YP_001195410.1 1e-129 64% ...

  9. NCBI nr-aa BLAST: CBRC-AGAM-07-0043 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0043 ref|YP_001297326.1| hypothetical protein FP2472 [Flavobacterium p...sychrophilum JIP02/86] emb|CAL44525.1| Hypothetical protein [Flavobacterium psychrophilum JIP02/86] YP_001297326.1 2e-06 24% ...

  10. NCBI nr-aa BLAST: CBRC-AGAM-07-0073 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0073 ref|YP_001195652.1| protein of unknown function DUF81 [Flavobacte...rium johnsoniae UW101] gb|ABQ06333.1| protein of unknown function DUF81 [Flavobacterium johnsoniae UW101] YP_001195652.1 4e-97 65% ...

  11. NCBI nr-aa BLAST: CBRC-AGAM-07-0040 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0040 ref|YP_001197343.1| MATE efflux family protein [Flavobacterium jo...hnsoniae UW101] gb|ABQ08024.1| MATE efflux family protein [Flavobacterium johnsoniae UW101] YP_001197343.1 6e-52 43% ...

  12. NCBI nr-aa BLAST: CBRC-AGAM-07-0040 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0040 ref|ZP_01732967.1| multidrug resistance protein [Flavobacteria ba...cterium BAL38] gb|EAZ96036.1| multidrug resistance protein [Flavobacteria bacterium BAL38] ZP_01732967.1 9e-51 38% ...

  13. NCBI nr-aa BLAST: CBRC-AGAM-07-0040 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0040 ref|ZP_01203383.1| multidrug efflux pump, matE family [Flavobacte...ria bacterium BBFL7] gb|EAS18538.1| multidrug efflux pump, matE family [Flavobacteria bacterium BBFL7] ZP_01203383.1 3e-50 43% ...

  14. NCBI nr-aa BLAST: CBRC-AGAM-07-0041 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0041 ref|ZP_01107412.1| hypothetical protein FB2170_08224 [Flavobacter...iales bacterium HTCC2170] gb|EAR00476.1| hypothetical protein FB2170_08224 [Flavobacteriales bacterium HTCC2170] ZP_01107412.1 2e-32 36% ...

  15. NCBI nr-aa BLAST: CBRC-AGAM-04-0109 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-04-0109 ref|YP_001430593.1| Adenylosuccinate synthase [Roseiflexus castenholz...ii DSM 13941] gb|ABU56575.1| Adenylosuccinate synthase [Roseiflexus castenholzii DSM 13941] YP_001430593.1 4.6 27% ...

  16. NCBI nr-aa BLAST: CBRC-AGAM-01-0097 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-01-0097 ref|YP_001433581.1| protein of unknown function DUF296 [Roseiflexus castenholz...ii DSM 13941] gb|ABU59563.1| protein of unknown function DUF296 [Roseiflexus castenholzii DSM 13941] YP_001433581.1 0.11 35% ...

  17. NCBI nr-aa BLAST: CBRC-AGAM-05-0046 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-05-0046 ref|YP_001348737.1| probable MFS transporter [Pseudomonas aerugino...sa PA7] gb|ABR81205.1| probable MFS transporter [Pseudomonas aeruginosa PA7] YP_001348737.1 1.6 29% ...

  18. NCBI nr-aa BLAST: CBRC-AGAM-07-0056 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0056 ref|YP_001345790.1| polyamine transport protein PotI [Pseudomonas aerugino...sa PA7] gb|ABR82934.1| polyamine transport protein PotI [Pseudomonas aeruginosa PA7] YP_001345790.1 1e-127 83% ...

  19. NCBI nr-aa BLAST: CBRC-AGAM-01-0071 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-01-0071 ref|NP_476722.1| shotgun CG3722-PA [Drosophila melanogaster] sp|Q...24298|CADE_DROME DE-cadherin precursor (Protein shotgun) gb|AAF46659.1| CG3722-PA [Drosophila melanogaster] NP_476722.1 0.0 40% ...

  20. NCBI nr-aa BLAST: CBRC-AGAM-04-0107 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-04-0107 ref|YP_001112131.1| protein of unknown function UPF0118 [Desulfotomaculum reduce...ns MI-1] gb|ABO49306.1| protein of unknown function UPF0118 [Desulfotomaculum reducens MI-1] YP_001112131.1 1.8 23% ...

  1. NCBI nr-aa BLAST: CBRC-AGAM-01-0085 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-01-0085 ref|XP_626647.1| hypothetical protein with signal peptide [Cryptosporidium parvum... Iowa II] gb|EAK89294.1| hypothetical protein with signal peptide [Cryptosporidium parvum Iowa II] XP_626647.1 4e-05 38% ...

  2. NCBI nr-aa BLAST: CBRC-AGAM-02-0138 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-02-0138 ref|XP_001645325.1| hypothetical protein Kpol_1058p4 [Vanderwalto...zyma polyspora DSM 70294] gb|EDO17467.1| hypothetical protein Kpol_1058p4 [Vanderwaltozyma polyspora DSM 70294] XP_001645325.1 9e-06 24% ...

  3. NCBI nr-aa BLAST: CBRC-AGAM-07-0008 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0008 ref|XP_001645325.1| hypothetical protein Kpol_1058p4 [Vanderwalto...zyma polyspora DSM 70294] gb|EDO17467.1| hypothetical protein Kpol_1058p4 [Vanderwaltozyma polyspora DSM 70294] XP_001645325.1 0.0 46% ...

  4. NCBI nr-aa BLAST: CBRC-AGAM-03-0043 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-03-0043 ref|XP_001642520.1| hypothetical protein Kpol_325p1 [Vanderwaltoz...yma polyspora DSM 70294] gb|EDO14662.1| hypothetical protein Kpol_325p1 [Vanderwaltozyma polyspora DSM 70294] XP_001642520.1 1.3 25% ...

  5. NCBI nr-aa BLAST: CBRC-AGAM-03-0087 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-03-0087 ref|XP_001643844.1| hypothetical protein Kpol_499p14 [Vanderwalto...zyma polyspora DSM 70294] gb|EDO15986.1| hypothetical protein Kpol_499p14 [Vanderwaltozyma polyspora DSM 70294] XP_001643844.1 4e-20 23% ...

  6. NCBI nr-aa BLAST: CBRC-AGAM-07-0045 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0045 ref|ZP_01061096.1| copper/silver efflux P-type ATPase [Flavobacte...rium sp. MED217] gb|EAQ49147.1| copper/silver efflux P-type ATPase [Leeuwenhoekiella blandensis MED217] ZP_01061096.1 1e-128 60% ...

  7. NCBI nr-aa BLAST: CBRC-AGAM-07-0041 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0041 ref|YP_863633.1| prenyltransferase family protein [Gramella forse...tii KT0803] emb|CAL68566.1| prenyltransferase family protein [Gramella forsetii KT0803] YP_863633.1 8e-30 31% ...

  8. NCBI nr-aa BLAST: CBRC-AGAM-07-0045 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0045 ref|YP_862949.1| copper-translocating P-type ATPase [Gramella for...setii KT0803] emb|CAL67882.1| copper-translocating P-type ATPase [Gramella forsetii KT0803] YP_862949.1 1e-135 66% ...

  9. NCBI nr-aa BLAST: CBRC-AGAM-07-0040 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0040 ref|YP_860564.1| NorM-like multidrug efflux protein [Gramella for...setii KT0803] emb|CAL65497.1| NorM-like multidrug efflux protein [Gramella forsetii KT0803] YP_860564.1 3e-53 43% ...

  10. NCBI nr-aa BLAST: CBRC-AGAM-07-0028 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0028 ref|YP_956869.1| conserved hypothetical protein, membrane [Gramel...la forsetii KT0803] emb|CAL65134.1| conserved hypothetical protein, membrane [Gramella forsetii KT0803] YP_956869.1 3e-65 41% ...

  11. NCBI nr-aa BLAST: CBRC-AGAM-07-0045 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0045 ref|YP_861225.1| copper-translocating P-type ATPase [Gramella for...setii KT0803] emb|CAL66158.1| copper-translocating P-type ATPase [Gramella forsetii KT0803] YP_861225.1 1e-132 64% ...

  12. NCBI nr-aa BLAST: CBRC-AGAM-07-0045 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0045 ref|YP_861383.1| copper-translocating P-type ATPase [Gramella for...setii KT0803] emb|CAL66316.1| copper-translocating P-type ATPase [Gramella forsetii KT0803] YP_861383.1 1e-129 62% ...

  13. NCBI nr-aa BLAST: CBRC-AGAM-03-0026 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-03-0026 ref|XP_001659082.1| substance P receptor (long form), putative [A...edes aegypti] gb|EAT39962.1| substance P receptor (long form), putative [Aedes aegypti] XP_001659082.1 6e-92 51% ...

  14. NCBI nr-aa BLAST: CBRC-AGAM-03-0077 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-03-0077 ref|XP_001659082.1| substance P receptor (long form), putative [A...edes aegypti] gb|EAT39962.1| substance P receptor (long form), putative [Aedes aegypti] XP_001659082.1 1e-141 74% ...

  15. NCBI nr-aa BLAST: CBRC-AGAM-07-0002 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0002 ref|YP_050752.1| hypothetical protein ECA2661 [Erwinia carotovora subsp. atroseptic...a SCRI1043] emb|CAG75561.1| putative membrane protein [Erwinia carotovora subsp. atroseptica SCRI1043] YP_050752.1 2e-66 53% ...

  16. NCBI nr-aa BLAST: CBRC-AGAM-07-0060 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0060 ref|YP_521030.1| hypothetical protein DSY4797 [Desulfitobacterium... hafniense Y51] dbj|BAE86586.1| hypothetical protein [Desulfitobacterium hafniense Y51] YP_521030.1 1e-19 24% ...

  17. NCBI nr-aa BLAST: CBRC-AGAM-02-0020 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-02-0020 ref|NP_822673.1| integral membrane protein [Streptomyces avermitil...is MA-4680] dbj|BAC69208.1| putative integral membrane protein [Streptomyces avermitilis MA-4680] NP_822673.1 2e-04 24% ...

  18. NCBI nr-aa BLAST: CBRC-AGAM-07-0049 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0049 ref|ZP_01274777.1| Surface protein from Gram-positive cocci, anch...or region [Lactobacillus reuteri 100-23] gb|EAS88254.1| Surface protein from Gram-positive cocci, anchor region [Lactobacillus reuteri 100-23] ZP_01274777.1 2e-39 52% ...

  19. NCBI nr-aa BLAST: CBRC-AGAM-04-0123 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-04-0123 ref|XP_973273.1| PREDICTED: similar to Putative gustatory receptor 21a [Tribolium... castaneum] emb|CAL23143.2| gustatory receptor candidate 10 [Tribolium castaneum] emb|CAL231...72.3| gustatory receptor candidate 39 [Tribolium castaneum] XP_973273.1 1e-135 60% ...

  20. NCBI nr-aa BLAST: CBRC-AGAM-02-0026 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-02-0026 ref|NP_001076809.1| adipokinetic hormone receptor [Tribolium cast...aneum] gb|ABE02225.1| adipokinetic hormone receptor [Tribolium castaneum] gb|ABN79650.1| adipokinetic hormone receptor [Tribolium castaneum] NP_001076809.1 5e-71 44% ...

  1. NCBI nr-aa BLAST: CBRC-AGAM-03-0064 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-03-0064 ref|XP_974025.1| PREDICTED: similar to CG13788-PB, isoform B [Tribolium... castaneum] emb|CAL23157.2| gustatory receptor candidate 24 [Tribolium castaneum] XP_974025.1 0.002 20% ...

  2. NCBI nr-aa BLAST: CBRC-AGAM-01-0059 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-01-0059 ref|XP_968580.1| PREDICTED: hypothetical protein [Tribolium casta...neum] emb|CAL23149.2| gustatory receptor candidate 16 [Tribolium castaneum] XP_968580.1 0.11 22% ...

  3. NCBI nr-aa BLAST: CBRC-AGAM-02-0045 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-02-0045 ref|NP_001076796.1| cardioactive peptide receptor 1 [Tribolium ca...staneum] gb|ABN79651.1| cardioactive peptide receptor 1 [Tribolium castaneum] NP_001076796.1 1e-111 66% ...

  4. NCBI nr-aa BLAST: CBRC-AGAM-02-0115 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-02-0115 ref|XP_973273.1| PREDICTED: similar to Putative gustatory receptor 21a [Tribolium... castaneum] emb|CAL23143.2| gustatory receptor candidate 10 [Tribolium castaneum] emb|CAL231...72.3| gustatory receptor candidate 39 [Tribolium castaneum] XP_973273.1 9e-83 40% ...

  5. NCBI nr-aa BLAST: CBRC-AGAM-02-0045 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-02-0045 ref|NP_001076795.1| cardioactive peptide receptor 2 [Tribolium ca...staneum] gb|ABN79652.1| cardioactive peptide receptor 2 [Tribolium castaneum] NP_001076795.1 1e-113 68% ...

  6. NCBI nr-aa BLAST: CBRC-AGAM-02-0098 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-02-0098 ref|NP_001076793.1| ecdysis triggering hormone receptor isoform B [Tribolium... castaneum] gb|ABN79654.1| ecdysis triggering hormone receptor isoform B [Tribolium castaneum] NP_001076793.1 1e-114 62% ...

  7. NCBI nr-aa BLAST: CBRC-AGAM-02-0046 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-02-0046 ref|NP_001076796.1| cardioactive peptide receptor 1 [Tribolium ca...staneum] gb|ABN79651.1| cardioactive peptide receptor 1 [Tribolium castaneum] NP_001076796.1 1e-121 68% ...

  8. NCBI nr-aa BLAST: CBRC-AGAM-02-0098 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-02-0098 ref|NP_001076792.1| ecdysis triggering hormone receptor isoform A [Tribolium... castaneum] gb|ABN79653.1| ecdysis triggering hormone receptor isoform A [Tribolium castaneum] NP_001076792.1 1e-121 67% ...

  9. NCBI nr-aa BLAST: CBRC-AGAM-02-0128 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-02-0128 ref|XP_972629.1| PREDICTED: similar to Probable gustatory receptor 64e [Tribolium... castaneum] emb|CAL23162.2| gustatory receptor candidate 29 [Tribolium castaneum] emb|CAL231...40.2| gustatory receptor candidate 7 [Tribolium castaneum] XP_972629.1 4e-42 29% ...

  10. NCBI nr-aa BLAST: CBRC-AGAM-02-0099 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-02-0099 ref|NP_001076793.1| ecdysis triggering hormone receptor isoform B [Tribolium... castaneum] gb|ABN79654.1| ecdysis triggering hormone receptor isoform B [Tribolium castaneum] NP_001076793.1 4e-47 44% ...

  11. NCBI nr-aa BLAST: CBRC-AGAM-02-0065 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-02-0065 ref|XP_975520.1| PREDICTED: similar to CG13788-PB, isoform B [Tribolium... castaneum] emb|CAL23188.2| gustatory receptor candidate 55 [Tribolium castaneum] XP_975520.1 9e-17 31% ...

  12. NCBI nr-aa BLAST: CBRC-AGAM-07-0052 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0052 ref|XP_972629.1| PREDICTED: similar to Probable gustatory receptor 64e [Tribolium... castaneum] emb|CAL23162.2| gustatory receptor candidate 29 [Tribolium castaneum] emb|CAL231...40.2| gustatory receptor candidate 7 [Tribolium castaneum] XP_972629.1 4e-42 29% ...

  13. NCBI nr-aa BLAST: CBRC-AGAM-04-0044 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-04-0044 ref|XP_001549758.1| predicted protein [Botryotinia fuckeliana B05....10] gb|EDN32955.1| predicted protein [Botryotinia fuckeliana B05.10] XP_001549758.1 2e-71 88% ...

  14. NCBI nr-aa BLAST: CBRC-AGAM-04-0090 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-04-0090 ref|XP_001549758.1| predicted protein [Botryotinia fuckeliana B05....10] gb|EDN32955.1| predicted protein [Botryotinia fuckeliana B05.10] XP_001549758.1 1e-71 90% ...

  15. NCBI nr-aa BLAST: CBRC-AGAM-05-0023 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-05-0023 ref|XP_001551790.1| predicted protein [Botryotinia fuckeliana B05....10] gb|EDN30435.1| predicted protein [Botryotinia fuckeliana B05.10] XP_001551790.1 2e-62 91% ...

  16. NCBI nr-aa BLAST: CBRC-AGAM-01-0000 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-01-0000 ref|XP_001549758.1| predicted protein [Botryotinia fuckeliana B05....10] gb|EDN32955.1| predicted protein [Botryotinia fuckeliana B05.10] XP_001549758.1 3e-65 86% ...

  17. NCBI nr-aa BLAST: CBRC-AGAM-01-0031 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-01-0031 ref|XP_001549758.1| predicted protein [Botryotinia fuckeliana B05....10] gb|EDN32955.1| predicted protein [Botryotinia fuckeliana B05.10] XP_001549758.1 4e-55 88% ...

  18. NCBI nr-aa BLAST: CBRC-AGAM-04-0046 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-04-0046 ref|XP_001551790.1| predicted protein [Botryotinia fuckeliana B05....10] gb|EDN30435.1| predicted protein [Botryotinia fuckeliana B05.10] XP_001551790.1 2e-69 95% ...

  19. NCBI nr-aa BLAST: CBRC-AGAM-05-0052 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-05-0052 ref|XP_001551790.1| predicted protein [Botryotinia fuckeliana B05....10] gb|EDN30435.1| predicted protein [Botryotinia fuckeliana B05.10] XP_001551790.1 2e-53 84% ...

  20. NCBI nr-aa BLAST: CBRC-AGAM-03-0052 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-03-0052 ref|XP_001551790.1| predicted protein [Botryotinia fuckeliana B05....10] gb|EDN30435.1| predicted protein [Botryotinia fuckeliana B05.10] XP_001551790.1 1e-46 81% ...

  1. NCBI nr-aa BLAST: CBRC-AGAM-05-0020 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-05-0020 ref|XP_001551790.1| predicted protein [Botryotinia fuckeliana B05....10] gb|EDN30435.1| predicted protein [Botryotinia fuckeliana B05.10] XP_001551790.1 3e-52 73% ...

  2. NCBI nr-aa BLAST: CBRC-AGAM-04-0127 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-04-0127 ref|XP_001549758.1| predicted protein [Botryotinia fuckeliana B05....10] gb|EDN32955.1| predicted protein [Botryotinia fuckeliana B05.10] XP_001549758.1 5e-66 80% ...

  3. NCBI nr-aa BLAST: CBRC-AGAM-03-0000 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-03-0000 ref|XP_001549758.1| predicted protein [Botryotinia fuckeliana B05....10] gb|EDN32955.1| predicted protein [Botryotinia fuckeliana B05.10] XP_001549758.1 2e-66 88% ...

  4. NCBI nr-aa BLAST: CBRC-AGAM-04-0046 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-04-0046 ref|XP_001549758.1| predicted protein [Botryotinia fuckeliana B05....10] gb|EDN32955.1| predicted protein [Botryotinia fuckeliana B05.10] XP_001549758.1 2e-74 96% ...

  5. NCBI nr-aa BLAST: CBRC-AGAM-05-0049 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-05-0049 ref|XP_001551790.1| predicted protein [Botryotinia fuckeliana B05....10] gb|EDN30435.1| predicted protein [Botryotinia fuckeliana B05.10] XP_001551790.1 3e-64 95% ...

  6. NCBI nr-aa BLAST: CBRC-AGAM-04-0035 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-04-0035 ref|NP_937902.1| NADH dehydrogenase subunit 5 [Strongyloides stercoral...is] emb|CAD90562.1| NADH dehydrogenase subunit 5 [Strongyloides stercoralis] NP_937902.1 0.009 23% ...

  7. NCBI nr-aa BLAST: CBRC-AGAM-01-0017 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-01-0017 ref|XP_001649245.1| UDP-sugar transporter UST74c (fringe connection... protein), putative [Aedes aegypti] gb|EAT33098.1| UDP-sugar transporter UST74c (fringe connection protein), putative [Aedes aegypti] XP_001649245.1 1e-150 80% ...

  8. NCBI nr-aa BLAST: CBRC-AGAM-01-0017 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-01-0017 ref|NP_524126.1| fringe connection CG3874-PA [Drosophila melanoga...ster] sp|Q95YI5|US74C_DROME UDP-sugar transporter UST74c (Protein fringe connection) gb|AAF49343.1| CG3874-P

  9. NCBI nr-aa BLAST: CBRC-AGAM-01-0017 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-01-0017 ref|XP_001649246.1| UDP-sugar transporter UST74c (fringe connection... protein), putative [Aedes aegypti] gb|EAT33099.1| UDP-sugar transporter UST74c (fringe connection protein), putative [Aedes aegypti] XP_001649246.1 1e-150 80% ...

  10. NCBI nr-aa BLAST: CBRC-AGAM-02-0048 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-02-0048 ref|XP_001352669.1| GA20395-PA [Drosophila pseudoobscura] gb|EAL3...0167.1| GA20395-PA [Drosophila pseudoobscura] gb|AAV40852.1| Rh-like protein [Drosophila pseudoobscura] XP_001352669.1 3e-96 67% ...

  11. NCBI nr-aa BLAST: CBRC-AGAM-02-0187 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-02-0187 ref|XP_001648623.1| dopamine receptor, invertebrate [Aedes aegypt...i] gb|EAT33346.1| dopamine receptor, invertebrate [Aedes aegypti] XP_001648623.1 1e-112 63% ...

  12. NCBI nr-aa BLAST: CBRC-AGAM-07-0068 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0068 ref|YP_574435.1| flavin-containing monooxygenase FMO [Chromohalobacter sale...xigens DSM 3043] gb|ABE59736.1| flavin-containing monooxygenase FMO [Chromohalobacter salexigens DSM 3043] YP_574435.1 7.1 30% ...

  13. NCBI nr-aa BLAST: CBRC-AGAM-02-0155 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-02-0155 ref|ZP_00373744.1| SD27140p [Wolbachia endosymbiont of Drosophila... ananassae] gb|EAL58741.1| SD27140p [Wolbachia endosymbiont of Drosophila ananassae] ZP_00373744.1 0.0 39% ...

  14. NCBI nr-aa BLAST: CBRC-AGAM-04-0091 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-04-0091 ref|ZP_00373744.1| SD27140p [Wolbachia endosymbiont of Drosophila... ananassae] gb|EAL58741.1| SD27140p [Wolbachia endosymbiont of Drosophila ananassae] ZP_00373744.1 1e-163 38% ...

  15. NCBI nr-aa BLAST: CBRC-AGAM-02-0094 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-02-0094 ref|ZP_00373744.1| SD27140p [Wolbachia endosymbiont of Drosophila... ananassae] gb|EAL58741.1| SD27140p [Wolbachia endosymbiont of Drosophila ananassae] ZP_00373744.1 0.0 39% ...

  16. NCBI nr-aa BLAST: CBRC-AGAM-03-0010 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-03-0010 ref|ZP_00373744.1| SD27140p [Wolbachia endosymbiont of Drosophila... ananassae] gb|EAL58741.1| SD27140p [Wolbachia endosymbiont of Drosophila ananassae] ZP_00373744.1 0.0 39% ...

  17. NCBI nr-aa BLAST: CBRC-AGAM-04-0093 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-04-0093 ref|ZP_00373744.1| SD27140p [Wolbachia endosymbiont of Drosophila... ananassae] gb|EAL58741.1| SD27140p [Wolbachia endosymbiont of Drosophila ananassae] ZP_00373744.1 0.0 40% ...

  18. NCBI nr-aa BLAST: CBRC-AGAM-05-0053 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-05-0053 ref|ZP_00373744.1| SD27140p [Wolbachia endosymbiont of Drosophila... ananassae] gb|EAL58741.1| SD27140p [Wolbachia endosymbiont of Drosophila ananassae] ZP_00373744.1 0.0 39% ...

  19. NCBI nr-aa BLAST: CBRC-AGAM-03-0057 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-03-0057 ref|ZP_00373744.1| SD27140p [Wolbachia endosymbiont of Drosophila... ananassae] gb|EAL58741.1| SD27140p [Wolbachia endosymbiont of Drosophila ananassae] ZP_00373744.1 0.0 37% ...

  20. NCBI nr-aa BLAST: CBRC-AGAM-03-0087 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-03-0087 ref|XP_843162.1| proteophosphoglycan ppg4 [Leishmania major strain Fried...lin] gb|AAZ14280.1| proteophosphoglycan ppg4 [Leishmania major strain Friedlin] XP_843162.1 1e-23 19% ...

  1. NCBI nr-aa BLAST: CBRC-AGAM-04-0082 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-04-0082 ref|XP_843163.1| proteophosphoglycan 5 [Leishmania major strain Fried...lin] gb|AAZ14281.1| proteophosphoglycan 5 [Leishmania major strain Friedlin] XP_843163.1 0.0 23% ...

  2. NCBI nr-aa BLAST: CBRC-AGAM-02-0064 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-02-0064 ref|XP_843162.1| proteophosphoglycan ppg4 [Leishmania major strain Fried...lin] gb|AAZ14280.1| proteophosphoglycan ppg4 [Leishmania major strain Friedlin] XP_843162.1 0.0 31% ...

  3. NCBI nr-aa BLAST: CBRC-AGAM-03-0087 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-03-0087 ref|XP_843163.1| proteophosphoglycan 5 [Leishmania major strain Fried...lin] gb|AAZ14281.1| proteophosphoglycan 5 [Leishmania major strain Friedlin] XP_843163.1 5e-23 19% ...

  4. NCBI nr-aa BLAST: CBRC-AGAM-03-0081 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-03-0081 ref|XP_843162.1| proteophosphoglycan ppg4 [Leishmania major strain Fried...lin] gb|AAZ14280.1| proteophosphoglycan ppg4 [Leishmania major strain Friedlin] XP_843162.1 3e-14 27% ...

  5. NCBI nr-aa BLAST: CBRC-AGAM-03-0073 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-03-0073 ref|XP_843162.1| proteophosphoglycan ppg4 [Leishmania major strain Fried...lin] gb|AAZ14280.1| proteophosphoglycan ppg4 [Leishmania major strain Friedlin] XP_843162.1 2e-13 29% ...

  6. NCBI nr-aa BLAST: CBRC-AGAM-02-0021 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-02-0021 ref|XP_843163.1| proteophosphoglycan 5 [Leishmania major strain Fried...lin] gb|AAZ14281.1| proteophosphoglycan 5 [Leishmania major strain Friedlin] XP_843163.1 4e-26 26% ...

  7. NCBI nr-aa BLAST: CBRC-AGAM-01-0072 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-01-0072 ref|YP_001034807.1| Platelet-binding glycoprotein [Streptococcus ...sanguinis SK36] gb|ABN44257.1| Platelet-binding glycoprotein [Streptococcus sanguinis SK36] YP_001034807.1 4e-59 30% ...

  8. NCBI nr-aa BLAST: CBRC-AGAM-07-0027 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0027 ref|YP_001034807.1| Platelet-binding glycoprotein [Streptococcus ...sanguinis SK36] gb|ABN44257.1| Platelet-binding glycoprotein [Streptococcus sanguinis SK36] YP_001034807.1 0.001 26% ...

  9. NCBI nr-aa BLAST: CBRC-AGAM-02-0102 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-02-0102 ref|YP_001034807.1| Platelet-binding glycoprotein [Streptococcus ...sanguinis SK36] gb|ABN44257.1| Platelet-binding glycoprotein [Streptococcus sanguinis SK36] YP_001034807.1 1e-11 24% ...

  10. NCBI nr-aa BLAST: CBRC-AGAM-07-0063 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0063 ref|YP_001034807.1| Platelet-binding glycoprotein [Streptococcus ...sanguinis SK36] gb|ABN44257.1| Platelet-binding glycoprotein [Streptococcus sanguinis SK36] YP_001034807.1 2e-30 23% ...

  11. NCBI nr-aa BLAST: CBRC-AGAM-01-0035 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-01-0035 ref|XP_001589660.1| predicted protein [Sclerotinia sclerotiorum 1...980] gb|EDN93515.1| predicted protein [Sclerotinia sclerotiorum 1980] XP_001589660.1 1e-42 90% ...

  12. NCBI nr-aa BLAST: CBRC-AGAM-03-0035 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-03-0035 ref|ZP_02007270.1| protein of unknown function DUF6, transmembrane [Ralstonia pick...ettii 12D] gb|EDN41481.1| protein of unknown function DUF6, transmembrane [Ralstonia pickettii 12D] ZP_02007270.1 0.063 23% ...

  13. NCBI nr-aa BLAST: CBRC-AGAM-04-0130 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-04-0130 ref|NP_001040188.1| KDEL endoplasmic reticulum protein retention ...receptor 2a [Bombyx mori] gb|ABD36213.1| KDEL endoplasmic reticulum protein retention receptor 2a [Bombyx mori] NP_001040188.1 3e-45 47% ...

  14. NCBI nr-aa BLAST: CBRC-AGAM-03-0074 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-03-0074 ref|XP_567974.1| hypothetical protein [Cryptococcus neoformans va...r. neoformans JEC21] gb|AAW46457.1| conserved hypothetical protein [Cryptococcus neoformans var. neoformans JEC21] XP_567974.1 5e-09 58% ...

  15. NCBI nr-aa BLAST: CBRC-AGAM-01-0036 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-01-0036 ref|NP_524202.1| crocodile CG5069-PA [Drosophila melanogaster] sp...|P32027|CROC_DROME Fork head domain-containing protein crocodile (FKH protein FD1) gb|AAB35643.1| crocodile

  16. NCBI nr-aa BLAST: CBRC-AGAM-05-0002 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-05-0002 ref|YP_001477392.1| sugar transporter [Serratia proteamaculans 56...8] gb|ABV40264.1| sugar transporter [Serratia proteamaculans 568] YP_001477392.1 1e-08 25% ...

  17. NCBI nr-aa BLAST: CBRC-AGAM-02-0069 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-02-0069 ref|XP_001652791.1| GDP-fucose transporter, putative [Aedes aegyp...ti] gb|EAT40804.1| GDP-fucose transporter, putative [Aedes aegypti] XP_001652791.1 1e-129 83% ...

  18. NCBI nr-aa BLAST: CBRC-AGAM-07-0062 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available ngiectasia and Rad3-related protein) [Rattus norvegicus] XP_001068985.1 0.0 33% ... ...CBRC-AGAM-07-0062 ref|XP_001068985.1| PREDICTED: similar to Serine/threonine-protein kinase ATR (Ataxia tela

  19. NCBI nr-aa BLAST: CBRC-AGAM-07-0022 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0022 ref|YP_858652.1| O-antigen polymerase [Aeromonas hydrophila subsp. hydrop...hila ATCC 7966] gb|ABK39666.1| O-antigen polymerase [Aeromonas hydrophila subsp. hydrophila ATCC 7966] YP_858652.1 1e-162 84% ...

  20. NCBI nr-aa BLAST: CBRC-AGAM-02-0131 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-02-0131 ref|ZP_01909055.1| hypothetical protein PPSIR1_23714 [Plesiocystis pacific...a SIR-1] gb|EDM78078.1| hypothetical protein PPSIR1_23714 [Plesiocystis pacifica SIR-1] ZP_01909055.1 3e-06 34% ...

  1. NCBI nr-aa BLAST: CBRC-AGAM-01-0038 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-01-0038 ref|ZP_01905410.1| hypothetical protein PPSIR1_21714 [Plesiocystis pacific...a SIR-1] gb|EDM81578.1| hypothetical protein PPSIR1_21714 [Plesiocystis pacifica SIR-1] ZP_01905410.1 1.2 40% ...

  2. NCBI nr-aa BLAST: CBRC-AGAM-03-0072 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-03-0072 ref|ZP_01909055.1| hypothetical protein PPSIR1_23714 [Plesiocystis pacific...a SIR-1] gb|EDM78078.1| hypothetical protein PPSIR1_23714 [Plesiocystis pacifica SIR-1] ZP_01909055.1 5e-05 36% ...

  3. NCBI nr-aa BLAST: CBRC-AGAM-01-0054 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-01-0054 ref|ZP_01909055.1| hypothetical protein PPSIR1_23714 [Plesiocystis pacific...a SIR-1] gb|EDM78078.1| hypothetical protein PPSIR1_23714 [Plesiocystis pacifica SIR-1] ZP_01909055.1 0.006 30% ...

  4. NCBI nr-aa BLAST: CBRC-AGAM-02-0119 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-02-0119 ref|ZP_00982898.1| COG0477: Permeases of the major facilitator su...perfamily [Burkholderia dolosa AUO158] gb|EAY72007.1| Major facilitator superfamily (MFS_1) transporter [Burkholderia dolosa AUO158] ZP_00982898.1 0.36 24% ...

  5. NCBI nr-aa BLAST: CBRC-AGAM-04-0024 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-04-0024 ref|NP_001089174.1| putative transient receptor potential channel... [Xenopus laevis] emb|CAE09056.1| putative transient receptor potential channel [Xenopus laevis] NP_001089174.1 1e-158 42% ...

  6. NCBI nr-aa BLAST: CBRC-AGAM-03-0028 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-03-0028 ref|XP_001652261.1| transient receptor potential cation channel p...rotein painless [Aedes aegypti] gb|EAT41530.1| transient receptor potential cation channel protein painless [Aedes aegypti] XP_001652261.1 1e-102 38% ...

  7. NCBI nr-aa BLAST: CBRC-AGAM-03-0028 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-03-0028 ref|XP_001652262.1| transient receptor potential cation channel p...rotein painless [Aedes aegypti] gb|EAT41531.1| transient receptor potential cation channel protein painless [Aedes aegypti] XP_001652262.1 1e-102 38% ...

  8. NCBI nr-aa BLAST: CBRC-AGAM-07-0029 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0029 ref|ZP_01423834.1| Lanthionine synthetase C-like [Herpetosiphon aura...ntiacus ATCC 23779] gb|EAU19386.1| Lanthionine synthetase C-like [Herpetosiphon aurantiacus ATCC 23779] ZP_01423834.1 2e-20 25% ...

  9. NCBI nr-aa BLAST: CBRC-AGAM-04-0112 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-04-0112 ref|ZP_01465266.1| hypothetical protein STIAU_3860 [Stigmatella aura...ntiaca DW4/3-1] gb|EAU63984.1| hypothetical protein STIAU_3860 [Stigmatella aurantiaca DW4/3-1] ZP_01465266.1 8.6 33% ...

  10. NCBI nr-aa BLAST: CBRC-AGAM-07-0061 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0061 ref|YP_443145.1| fosmidomycin resistance protein [Burkholderia thailand...ensis E264] gb|ABC36646.1| fosmidomycin resistance protein [Burkholderia thailandensis E264] YP_443145.1 1e-117 64% ...

  11. NCBI nr-aa BLAST: CBRC-AGAM-03-0035 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-03-0035 ref|YP_441277.1| hypothetical protein BTH_I0721 [Burkholderia thailand...ensis E264] gb|ABC36322.1| membrane protein, putative [Burkholderia thailandensis E264] YP_441277.1 0.063 24% ...

  12. NCBI nr-aa BLAST: CBRC-AGAM-02-0012 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-02-0012 ref|YP_304864.1| hypothetical protein Mbar_A1321 [Methanosarcina barker...i str. Fusaro] gb|AAZ70284.1| hypothetical protein Mbar_A1321 [Methanosarcina barkeri str. Fusaro] YP_304864.1 0.39 34% ...

  13. NCBI nr-aa BLAST: CBRC-AGAM-04-0028 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-04-0028 ref|YP_305972.1| hypothetical protein Mbar_A2479 [Methanosarcina barker...i str. Fusaro] gb|AAZ71392.1| hypothetical protein Mbar_A2479 [Methanosarcina barkeri str. Fusaro] YP_305972.1 9e-19 35% ...

  14. NCBI nr-aa BLAST: CBRC-AGAM-02-0057 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-02-0057 ref|XP_001526785.1| conserved hypothetical protein [Lodderomyces ...elongisporus NRRL YB-4239] gb|EDK43435.1| conserved hypothetical protein [Lodderomyces elongisporus NRRL YB-4239] XP_001526785.1 5e-07 29% ...

  15. NCBI nr-aa BLAST: CBRC-AGAM-05-0006 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-05-0006 ref|XP_001647749.1| neuropeptide y receptor (npy-r) (pr4 receptor...) [Aedes aegypti] gb|EAT32417.1| neuropeptide y receptor (npy-r) (pr4 receptor) [Aedes aegypti] XP_001647749.1 1e-87 55% ...

  16. NCBI nr-aa BLAST: CBRC-AGAM-05-0017 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-05-0017 ref|XP_001653188.1| neuropeptide y receptor (npy-r) (pr4 receptor...) [Aedes aegypti] gb|EAT39936.1| neuropeptide y receptor (npy-r) (pr4 receptor) [Aedes aegypti] XP_001653188.1 2e-73 55% ...

  17. NCBI nr-aa BLAST: CBRC-AGAM-05-0017 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-05-0017 ref|XP_001647749.1| neuropeptide y receptor (npy-r) (pr4 receptor...) [Aedes aegypti] gb|EAT32417.1| neuropeptide y receptor (npy-r) (pr4 receptor) [Aedes aegypti] XP_001647749.1 1e-64 59% ...

  18. NCBI nr-aa BLAST: CBRC-AGAM-05-0006 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-05-0006 ref|XP_001653188.1| neuropeptide y receptor (npy-r) (pr4 receptor...) [Aedes aegypti] gb|EAT39936.1| neuropeptide y receptor (npy-r) (pr4 receptor) [Aedes aegypti] XP_001653188.1 7e-99 54% ...

  19. NCBI nr-aa BLAST: CBRC-AGAM-07-0020 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0020 ref|YP_001478696.1| major facilitator superfamily MFS_1 [Serratia proteam...aculans 568] gb|ABV41568.1| major facilitator superfamily MFS_1 [Serratia proteamaculans 568] YP_001478696.1 1e-164 82% ...

  20. NCBI nr-aa BLAST: CBRC-AGAM-07-0002 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0002 ref|YP_001477899.1| protein of unknown function DUF340 membrane [Serratia proteam...aculans 568] gb|ABV40771.1| protein of unknown function DUF340 membrane [Serratia proteamaculans 568] YP_001477899.1 4e-67 53% ...

  1. NCBI nr-aa BLAST: CBRC-AGAM-05-0028 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-05-0028 ref|YP_719270.1| possible large adhesin [Haemophilus somnus 129PT...] gb|ABI25333.1| conserved hypothetical protein [Haemophilus somnus 129PT] YP_719270.1 1e-27 34% ...

  2. NCBI nr-aa BLAST: CBRC-AGAM-07-0022 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0022 ref|ZP_01789747.1| hypothetical protein CGSHiAA_08330 [Haemophilus... influenzae PittAA] gb|EDK08473.1| hypothetical protein CGSHiAA_08330 [Haemophilus influenzae PittAA] ZP_01789747.1 2e-14 23% ...

  3. NCBI nr-aa BLAST: CBRC-AGAM-02-0057 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-02-0057 ref|YP_687145.1| hypothetical protein RRC34 [uncultured methanogenic... archaeon RC-I] emb|CAJ37819.1| hypothetical protein [uncultured methanogenic archaeon RC-I] YP_687145.1 2e-10 33% ...

  4. NCBI nr-aa BLAST: CBRC-AGAM-07-0037 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0037 ref|YP_687144.1| hypothetical protein RRC32 [uncultured methanogenic... archaeon RC-I] emb|CAJ37818.1| hypothetical protein [uncultured methanogenic archaeon RC-I] YP_687144.1 2e-10 30% ...

  5. NCBI nr-aa BLAST: CBRC-AGAM-07-0025 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0025 ref|YP_687144.1| hypothetical protein RRC32 [uncultured methanogenic... archaeon RC-I] emb|CAJ37818.1| hypothetical protein [uncultured methanogenic archaeon RC-I] YP_687144.1 2e-31 49% ...

  6. NCBI nr-aa BLAST: CBRC-AGAM-07-0037 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0037 ref|YP_687145.1| hypothetical protein RRC34 [uncultured methanogenic... archaeon RC-I] emb|CAJ37819.1| hypothetical protein [uncultured methanogenic archaeon RC-I] YP_687145.1 5e-11 28% ...

  7. NCBI nr-aa BLAST: CBRC-AGAM-02-0102 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-02-0102 ref|YP_687144.1| hypothetical protein RRC32 [uncultured methanogenic... archaeon RC-I] emb|CAJ37818.1| hypothetical protein [uncultured methanogenic archaeon RC-I] YP_687144.1 7e-12 27% ...

  8. NCBI nr-aa BLAST: CBRC-AGAM-07-0025 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0025 ref|YP_687145.1| hypothetical protein RRC34 [uncultured methanogenic... archaeon RC-I] emb|CAJ37819.1| hypothetical protein [uncultured methanogenic archaeon RC-I] YP_687145.1 7e-31 50% ...

  9. NCBI nr-aa BLAST: CBRC-AGAM-02-0057 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-02-0057 ref|YP_687144.1| hypothetical protein RRC32 [uncultured methanogenic... archaeon RC-I] emb|CAJ37818.1| hypothetical protein [uncultured methanogenic archaeon RC-I] YP_687144.1 9e-11 35% ...

  10. NCBI nr-aa BLAST: CBRC-AGAM-07-0034 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0034 ref|ZP_01539821.1| major facilitator superfamily MFS_1 [Shewanella woody...i ATCC 51908] gb|EAV37712.1| major facilitator superfamily MFS_1 [Shewanella woodyi ATCC 51908] ZP_01539821.1 3e-60 47% ...

  11. NCBI nr-aa BLAST: CBRC-AGAM-07-0032 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0032 ref|ZP_01541738.1| glucose/galactose transporter [Shewanella woody...i ATCC 51908] gb|EAV35787.1| glucose/galactose transporter [Shewanella woodyi ATCC 51908] ZP_01541738.1 5e-28 35% ...

  12. NCBI nr-aa BLAST: CBRC-AGAM-07-0048 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0048 ref|YP_001164099.1| potassium efflux system [Yersinia pestis Pest...oides F] gb|ABP41126.1| potassium efflux system [Yersinia pestis Pestoides F] YP_001164099.1 1e-106 53% ...

  13. NCBI nr-aa BLAST: CBRC-AGAM-03-0082 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-03-0082 ref|XP_001568166.1| proteophosphoglycan ppg4 [Leishmania brazilie...nsis] emb|CAM43270.1| proteophosphoglycan ppg4 [Leishmania braziliensis] XP_001568166.1 6e-15 33% ...

  14. NCBI nr-aa BLAST: CBRC-AGAM-03-0032 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-03-0032 ref|XP_001568167.1| proteophosphoglycan ppg4 [Leishmania brazilie...nsis] emb|CAM43271.1| proteophosphoglycan ppg4 [Leishmania braziliensis] XP_001568167.1 3e-40 29% ...

  15. NCBI nr-aa BLAST: CBRC-AGAM-02-0058 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-02-0058 ref|NP_001076809.1| adipokinetic hormone receptor [Tribolium cast...aneum] gb|ABE02225.1| adipokinetic hormone receptor [Tribolium castaneum] gb|ABN79650.1| adipokinetic hormone receptor [Tribolium castaneum] NP_001076809.1 1e-112 60% ...

  16. The Revitalization of Women’s Entrepreneurship Spirit In Micro Enterprises With Islamic Microfinance Institution (IMI) (Study on The Contribution of BMTs Agam Madani in Agam sub-province, West Sumatra)

    OpenAIRE

    Hesi Eka Puteri

    2014-01-01

    Objective - The objective of this paper is to give an overview of the contribution of Islamic Microfinance Institutions (IMI) in the process of empowerment of women microenterprises, and recommended a related policy.Method – This study is a field research in 2012, which focused in BMTs Agam Madani at Agam district. The data is sourced from the observation, documentation and questionnaires from 60 women micro-entrepreneurs samples who receive working capital financing. This paper uses simple r...

  17. Giant electromechanical coupling of relaxor ferroelectrics controlled by polar nanoregion vibrations

    Science.gov (United States)

    Manley, Michael E.; Abernathy, Douglas L.; Sahul, Raffi; Parshall, Daniel E.; Lynn, Jeffrey W.; Christianson, Andrew D.; Stonaha, Paul J.; Specht, Eliot D.; Budai, John D.

    2016-01-01

    Relaxor-based ferroelectrics are prized for their giant electromechanical coupling and have revolutionized sensor and ultrasound applications. A long-standing challenge for piezoelectric materials has been to understand how these ultrahigh electromechanical responses occur when the polar atomic displacements underlying the response are partially broken into polar nanoregions (PNRs) in relaxor-based ferroelectrics. Given the complex inhomogeneous nanostructure of these materials, it has generally been assumed that this enhanced response must involve complicated interactions. By using neutron scattering measurements of lattice dynamics and local structure, we show that the vibrational modes of the PNRs enable giant coupling by softening the underlying macrodomain polarization rotations in relaxor-based ferroelectric PMN-xPT {(1 − x)[Pb(Mg1/3Nb2/3)O3] – xPbTiO3} (x = 30%). The mechanism involves the collective motion of the PNRs with transverse acoustic phonons and results in two hybrid modes, one softer and one stiffer than the bare acoustic phonon. The softer mode is the origin of macroscopic shear softening. Furthermore, a PNR mode and a component of the local structure align in an electric field; this further enhances shear softening, revealing a way to tune the ultrahigh piezoelectric response by engineering elastic shear softening.

  18. Giant electromechanical coupling of relaxor ferroelectrics controlled by polar nanoregion vibrations

    Science.gov (United States)

    Manley, Michael E.; Abernathy, Douglas L.; Sahul, Raffi; Parshall, Daniel E.; Lynn, Jeffrey W.; Christianson, Andrew D.; Stonaha, Paul J.; Specht, Eliot D.; Budai, John D.

    2016-01-01

    Relaxor-based ferroelectrics are prized for their giant electromechanical coupling and have revolutionized sensor and ultrasound applications. A long-standing challenge for piezoelectric materials has been to understand how these ultrahigh electromechanical responses occur when the polar atomic displacements underlying the response are partially broken into polar nanoregions (PNRs) in relaxor-based ferroelectrics. Given the complex inhomogeneous nanostructure of these materials, it has generally been assumed that this enhanced response must involve complicated interactions. By using neutron scattering measurements of lattice dynamics and local structure, we show that the vibrational modes of the PNRs enable giant coupling by softening the underlying macrodomain polarization rotations in relaxor-based ferroelectric PMN-xPT {(1 − x)[Pb(Mg1/3Nb2/3)O3] – xPbTiO3} (x = 30%). The mechanism involves the collective motion of the PNRs with transverse acoustic phonons and results in two hybrid modes, one softer and one stiffer than the bare acoustic phonon. The softer mode is the origin of macroscopic shear softening. Furthermore, a PNR mode and a component of the local structure align in an electric field; this further enhances shear softening, revealing a way to tune the ultrahigh piezoelectric response by engineering elastic shear softening. PMID:27652338

  19. NCBI nr-aa BLAST: CBRC-AGAM-02-0178 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-02-0178 ref|XP_001651711.1| 5-hydroxytryptamine receptor 1 [Aedes aegypti...] ref|XP_001660238.1| 5-hydroxytryptamine receptor 1 [Aedes aegypti] gb|EAT32550.1| 5-hydroxytryptamine receptor 1 [Aedes aegypt...i] gb|EAT38553.1| 5-hydroxytryptamine receptor 1 [Aedes aegypti] XP_001651711.1 1e-176 74% ...

  20. NCBI nr-aa BLAST: CBRC-AGAM-04-0014 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-04-0014 ref|NP_476702.1| rickets CG8930-PA, isoform A [Drosophila melanog...aster] ref|NP_599102.1| rickets CG8930-PB, isoform B [Drosophila melanogaster] ref|NP_599103.1| rickets CG89...30-PC, isoform C [Drosophila melanogaster] ref|NP_599104.1| rickets CG8930-PD, isoform D [Drosophila melanog

  1. NCBI nr-aa BLAST: CBRC-AGAM-02-0079 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-02-0079 ref|XP_525054.2| PREDICTED: hedgehog acyltransferase isoform 6 [P...an troglodytes] ref|XP_001169314.1| PREDICTED: hedgehog acyltransferase isoform 3 [Pan troglodytes] ref|XP_0...01169359.1| PREDICTED: hedgehog acyltransferase isoform 4 [Pan troglodytes] ref|XP_001169380.1| PREDICTED: hedgehog acyltransferase isoform 5 [Pan troglodytes] XP_525054.2 4e-33 25% ...

  2. NCBI nr-aa BLAST: CBRC-AGAM-02-0116 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-02-0116 ref|YP_081361.1| gluconate permease [Bacillus licheniformis ATCC ...14580] ref|YP_093794.1| GntP [Bacillus licheniformis ATCC 14580] gb|AAU25723.1| gluconate permease [Bacillus lichen...iformis ATCC 14580] gb|AAU43101.1| GntP [Bacillus licheniformis DSM 13] YP_081361.1 1.8 41% ...

  3. NCBI nr-aa BLAST: CBRC-AGAM-01-0038 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-01-0038 ref|NP_824326.1| ABC transporter integral membrane protein BldKA [Streptomyces avermitil...is MA-4680] dbj|BAB69357.1| transport integral membrane protein BldKA [Streptomyces avermitil...is] dbj|BAC70861.1| putative peptide ABC transporter permease protein [Streptomyces avermitilis MA-4680] NP_824326.1 0.94 30% ...

  4. NCBI nr-aa BLAST: CBRC-AGAM-04-0130 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-04-0130 ref|XP_307101.2| AGAP012756-PA [Anopheles gambiae str. PEST] ref|...XP_319412.2| AGAP010224-PA [Anopheles gambiae str. PEST] gb|EAA13938.2| AGAP010224-PA [Anopheles gambiae str. PEST...] gb|EAA02917.2| AGAP012756-PA [Anopheles gambiae str. PEST] XP_307101.2 3e-47 50% ...

  5. NCBI nr-aa BLAST: CBRC-AGAM-02-0019 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-02-0019 ref|NP_725630.1| vegetable CG6657-PA, isoform A [Drosophila melan...ogaster] ref|NP_524685.2| vegetable CG6657-PB, isoform B [Drosophila melanogaster] sp|Q9V7W1|PIGV_DROME GPI ...mannosyltransferase 2 (GPI mannosyltransferase II) (GPI-MT-II) (Protein vegetable) gb|AAF57928.1| CG6657-PA,

  6. NCBI nr-aa BLAST: CBRC-AGAM-04-0111 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-04-0111 ref|NP_001029470.1| non imprinted in Prader-Willi/Angelman syndro...me 2 [Bos taurus] sp|Q3SWX0|NIPA2_BOVIN Non-imprinted in Prader-Willi/Angelman syndrome region protein 2 hom...olog gb|AAI04628.1| Non imprinted in Prader-Willi/Angelman syndrome 2 [Bos taurus] NP_001029470.1 2e-72 51% ...

  7. Giant Planets

    CERN Document Server

    Guillot, Tristan

    2014-01-01

    We review the interior structure and evolution of Jupiter, Saturn, Uranus and Neptune, and giant exoplanets with particular emphasis on constraining their global composition. Compared to the first edition of this review, we provide a new discussion of the atmospheric compositions of the solar system giant planets, we discuss the discovery of oscillations of Jupiter and Saturn, the significant improvements in our understanding of the behavior of material at high pressures and the consequences for interior and evolution models. We place the giant planets in our Solar System in context with the trends seen for exoplanets.

  8. Atomic-scale control of TiO6 octahedra through solution chemistry towards giant dielectric response

    Science.gov (United States)

    Hu, Wanbiao; Li, Liping; Li, Guangshe; Liu, Yun; Withers, Ray L.

    2014-10-01

    The structures of many important functional oxides contain networks of metal-oxygen polyhedral units i.e. MOn. The correlation between the configurations and connectivities of these MOn to properties is essentially important to be well established to conduct the design, synthesis and application of new MOn-based functional materials. In this paper, we report on an atomic-scale solution-chemistry approach that for the first time enables TiO6 octahedral network control starting from metastable brookite TiO2 through simultaneously tuning pH values and interfering ions (Fe3+, Sc3+, and Sm3+). The relationship between solution chemistry and the resultant configuration/connectivity of TiO6 octahedra in TiO2 and lepidocrocite titanate is mapped out. Apart from differing crystalline phases and morphologies, atomic-scale TiO6 octahedral control also endows numerous defect dipoles for giant dielectric responses. The structural and property evolutions are well interpreted by the associated H+/OH- species in solution and/or defect states associated with Fe3+ occupation within TiO6 octahedra. This work therefore provides fundamental new insights into controlling TiO6 octahedral arrangement essential for atomic-scale structure-property design.

  9. Controlled trapping and detection of magnetic particles by a magnetic microactuator and a giant magnetoresistance (GMR) sensor

    KAUST Repository

    Giouroudi, Ioanna

    2014-04-01

    This paper presents the design and testing of an integrated micro-chip for the controlled trapping and detection of magnetic particles (MPs). A unique magnetic micro-actuator consisting of square-shaped conductors is used to manipulate the MPs towards a giant magnetoresistance (GMR) sensing element which rapidly detects the majority of MPs trapped around the square-shaped conductors. The ability to precisely transport a small number of MPs in a controlled manner over long distances by magnetic forces enables the rapid concentration of a majority of MPs to the sensing zone for detection. This is especially important in low concentration samples. The conductors are designed in such a manner so as to increase the capture efficiency as well as the precision and speed of transportation. By switching current to different conductors, MPs can be manipulated and immobilized on the innermost conductor where the GMR sensor is located. This technique rapidly guides the MPs towards the sensing zone. Secondly, for optimum measurement capability with high spatial resolution the GMR sensor is fabricated directly underneath and all along the innermost conductor to detect the stray fields originating from the MPs. Finally, a microfluidic channel is fabricated on top of this micro-chip. Experiments inside the microchannel were carried out and the MPs were successfully trapped at the sensing area. © (2014) Trans Tech Publications.

  10. NCBI nr-aa BLAST: CBRC-AGAM-07-0070 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0070 ref|YP_961710.1| multiple antibiotic resistance (MarC)-related pr...otein [Shewanella sp. W3-18-1] ref|ZP_01705111.1| multiple antibiotic resistance (MarC)-related proteins [Sh...ewanella putrefaciens 200] ref|YP_001181982.1| multiple antibiotic resistance (MarC)-related protein [Shewan...ella putrefaciens CN-32] gb|ABM23156.1| multiple antibiotic resistance (MarC)-rel...ated protein [Shewanella sp. W3-18-1] gb|EAY54633.1| multiple antibiotic resistance (MarC)-related proteins

  11. Multi-petal cyclamen flowers produced by AGAMOUS chimeric repressor expression

    OpenAIRE

    Yuri Tanaka; Yoshimi Oshima; Tomomichi Yamamura; Masao Sugiyama; Nobutaka Mitsuda; Norihiro Ohtsubo; Masaru Ohme-Takagi; Teruhiko Terakawa

    2013-01-01

    Cyclamen persicum (cyclamen) is a commercially valuable, winter-blooming perennial plant. We cloned two cyclamen orthologues of AGAMOUS (AG), CpAG1 and CpAG2, which are mainly expressed in the stamen and carpel, respectively. Cyclamen flowers have 5 petals, but expression of a chimeric repressor of CpAG1 (CpAG1-SRDX) caused stamens to convert into petals, resulting in a flower with 10 petals. By contrast, CpAG2-SRDX only caused incomplete formation of stamens and carpels. Expression in Arabid...

  12. NCBI nr-aa BLAST: CBRC-AGAM-01-0097 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-01-0097 ref|ZP_00970175.1| COG2200: FOG: EAL domain [Pseudomonas aerugino...sa C3719] ref|ZP_01364785.1| hypothetical protein PaerPA_01001897 [Pseudomonas aeruginosa PACS2] ref|YP_7918...19.1| hypothetical protein PA14_45930 [Pseudomonas aeruginosa UCBPP-PA14] gb|ABJ10614.1| conserved hypotheti...cal protein [Pseudomonas aeruginosa UCBPP-PA14] gb|EAZ51974.1| conserved hypothetical protein [Pseudomonas aeruginosa C3719] ZP_00970175.1 4.6 37% ...

  13. NCBI nr-aa BLAST: CBRC-AGAM-07-0007 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-AGAM-07-0007 ref|NP_372811.1| similar to urea transporter [Staphylococcus aureus subsp. aureus... Mu50] ref|NP_375400.1| hypothetical protein SA2081 [Staphylococcus aureus subsp. aureus N31...5] ref|YP_001247667.1| Urea transporter [Staphylococcus aureus subsp. aureus JH9] ref|YP_001317466.1| Urea t...ransporter [Staphylococcus aureus subsp. aureus JH1] ref|YP_001442861.1| hypothet...ical protein SAHV_2271 [Staphylococcus aureus subsp. aureus Mu3] dbj|BAB43379.1| SA2081 [Staphylococcus aureus subsp. aureus

  14. Giant strain control of magnetoelectric effect in Ta|Fe|MgO.

    Science.gov (United States)

    Odkhuu, Dorj

    2016-01-01

    The exploration of electric field controlled magnetism has come under scrutiny for its intriguing magnetoelectric phenomenon as well as technological advances in spintronics. Herein, the tremendous effect of an epitaxial strain on voltage-controlled perpendicular magnetic anisotropy (VPMA) is demonstrated in a transition-metal|ferromagnet|MgO (TM|FM|MgO) heterostructure from first-principles electronic structure computation. By tuning the epitaxial strain in Ta|Fe|MgO as a model system of TM|FM|MgO, we find distinctly different behaviours of VPMA from V- to Λ-shape trends with a substantially large magnetoelectric coefficient, up to an order of 10(3) fJV(-1)m(-1). We further reveal that the VPMA modulation under strain is mainly governed by the inherently large spin-orbit coupling of Ta 5d-Fe 3d hybridized orbitals at the TM|FM interface, although the Fe 3d-O 2p hybridization at the FM|MgO interface is partly responsible in determining the PMA of Ta|Fe|MgO. These results suggest that the control of epitaxial strain enables the engineering of VPMA, and provides physical insights for the divergent behaviors of VPMA and magnetoelectric coefficients found in TM|FM|MgO experiments. PMID:27597448

  15. Giant strain control of magnetoelectric effect in Ta/Fe/MgO

    CERN Document Server

    Odkhuu, Dorj

    2016-01-01

    The exploration of electric field controlled magnetism has come under scrutiny for its intriguing magnetoelectric phenomenon as well as technological advances in spintronics. Herein, the tremendous effect of an epitaxial strain on voltage-controlled perpendicular magnetic anisotropy (VPMA) is demonstrated in a transition-metal/ferromagnet/MgO (TM/FM/MgO) heterostructure from first-principles electronic structure computation. By tuning the epitaxial strain in Ta/Fe/MgO as a model system of TM/FM/MgO, we find distinctly different behaviours of VPMA from V- to {\\Lambda}-shape trends with a substantially large magnetoelectric coefficient, up to an order of 1000 fJ/Vm. We further reveal that the VPMA modulation under strain is mainly governed by the inherently large spin-orbit coupling of Ta 5d-Fe 3d hybridized orbitals at the TM/FM interface, although the Fe 3d-O 2p hybridization at the FM/MgO is partly responsible in determining the PMA of Ta/Fe/MgO. These results suggest that the control of epitaxial strain ena...

  16. Giant strain control of magnetoelectric effect in Ta|Fe|MgO

    Science.gov (United States)

    Odkhuu, Dorj

    2016-01-01

    The exploration of electric field controlled magnetism has come under scrutiny for its intriguing magnetoelectric phenomenon as well as technological advances in spintronics. Herein, the tremendous effect of an epitaxial strain on voltage-controlled perpendicular magnetic anisotropy (VPMA) is demonstrated in a transition-metal|ferromagnet|MgO (TM|FM|MgO) heterostructure from first-principles electronic structure computation. By tuning the epitaxial strain in Ta|Fe|MgO as a model system of TM|FM|MgO, we find distinctly different behaviours of VPMA from V- to Λ-shape trends with a substantially large magnetoelectric coefficient, up to an order of 103 fJV−1m−1. We further reveal that the VPMA modulation under strain is mainly governed by the inherently large spin-orbit coupling of Ta 5d–Fe 3d hybridized orbitals at the TM|FM interface, although the Fe 3d–O 2p hybridization at the FM|MgO interface is partly responsible in determining the PMA of Ta|Fe|MgO. These results suggest that the control of epitaxial strain enables the engineering of VPMA, and provides physical insights for the divergent behaviors of VPMA and magnetoelectric coefficients found in TM|FM|MgO experiments. PMID:27597448

  17. Hypogenic origin, geologic controls and functional organization of a giant cave system in Precambrian carbonates, Brazil

    Science.gov (United States)

    Klimchouk, Alexander; Auler, Augusto S.; Bezerra, Francisco H. R.; Cazarin, Caroline L.; Balsamo, Fabrizio; Dublyansky, Yuri

    2016-01-01

    This study is focused on speleogenesis of the Toca da Boa Vista (TBV) and Toca da Barriguda (TBR), the longest caves in South America occurring in the Neoproterozoic Salitre Formation in the São Francisco Craton, NE Brazil. We employ a multidisciplinary approach integrating detailed speleomorphogenetic, lithostratigraphic and geological structure studies in order to reveal the origin of the caves, their functional organization and geologic controls on their development. The caves developed in deep-seated confined conditions by rising flow. The overall fields of passages of TBV and TBR caves represent a speleogenetically exploited large NE-SW-trending fracture corridor associated with a major thrust. This corridor vertically extends across the Salitre Formation allowing the rise of deep fluids. In the overall ascending flow system, the formation of the cave pattern was controlled by a system of sub-parallel anticlines and troughs with NNE-SSW dominant orientation, and by vertical and lateral heterogeneities in fracture distribution. Three cave-stratigraphic stories reflect the actual hydrostratigraphy during the main phase of speleogenesis. Cavities at different stories are distinct in morphology and functioning. The gross tree-dimensional pattern of the system is effectively organized to conduct rising flow in deep-seated confined conditions. Cavities in the lower story developed as recharge components to the system. A laterally extensive conduit network in the middle story formed because the vertical flow from numerous recharge points has been redirected laterally along the highly conductive unit, occurring below the major seal - a scarcely fractured unit. Rift-like and shaft-like conduits in the upper story developed along fracture-controlled outflow paths, breaching the integrity of the major seal, and served as outlets for the cave system. The cave system represents a series of vertically organized, functionally largely independent clusters of cavities

  18. Role for the banana AGAMOUS-like gene MaMADS7 in regulation of fruit ripening and quality.

    Science.gov (United States)

    Liu, Juhua; Liu, Lin; Li, Yujia; Jia, Caihong; Zhang, Jianbin; Miao, Hongxia; Hu, Wei; Wang, Zhuo; Xu, Biyu; Jin, Zhiqiang

    2015-11-01

    MADS-box transcription factors play important roles in organ development. In plants, most studies on MADS-box genes have mainly focused on flower development and only a few concerned fruit development and ripening. A new MADS-box gene named MaMADS7 was isolated from banana fruit by rapid amplification of cDNA ends (RACE) based on a MADS-box fragment obtained from a banana suppression subtractive hybridization (SSH) cDNA library. MaMADS7 is an AGAMOUS-like MADS-box gene that is preferentially expressed in the ovaries and fruits and in tobacco its protein product localizes to the nucleus. This study found that MaMADS7 expression can be induced by exogenous ethylene. Ectopic expression of MaMADS7 in tomato resulted in broad ripening phenotypes. The expression levels of seven ripening and quality-related genes, ACO1, ACS2, E4, E8, PG, CNR and PSY1 in MaMADS7 transgenic tomato fruits were greatly increased while the expression of the AG-like MADS-box gene TAGL1 was suppressed. Compared with the control, the contents of β-carotene, lycopene, ascorbic acid and organic acid in transformed tomato fruits were increased, while the contents of glucose and fructose were slightly decreased. MaMADS7 interacted with banana 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase gene 1 (MaACO1) and tomato phytoene synthase gene (LePSY1) promoters. Our results indicated that MaMADS7 plays an important role in initiating endogenous ethylene biosynthesis and fruit ripening.

  19. CIRCADIAN CONTROL OF VISUAL INFORMATION-PROCESSING IN THE OPTIC LOBE OF THE GIANT COCKROACH BLABERUS-GIGANTEUS

    NARCIS (Netherlands)

    BULT, R; MASTEBROEK, HAK

    1993-01-01

    Extracellular spike activity from three different types of visual interneurons found in the optic lobe of the giant cockroach Blaberus giganteus was recorded. The spike rate of all three types of neurons fluctuated in a circadian manner in constant darkness (DD). Two types, so-called ''on'' neurons

  20. Driver or coincidence detector: Modal switch of a corticothalamic giant synapse controlled by spontaneous activity and short-term depression

    NARCIS (Netherlands)

    A. Groh (Alexander); C.P.J. de Kock (Christiaan); V.C. Wimmer (Verena); B. Sakmann (Bert); T. Kuner (Thomas)

    2008-01-01

    textabstractGiant synapses between layer 5B (L5B) neurons of somatosensory (barrel) cortex and neurons of the posteromedial nucleus (POm) of thalamus reside in a key position of the cortico-thalamo-cortical (CTC) loop, yet their synaptic properties and contribution to CTC information processing rema

  1. Transcriptional Activity of the MADS Box ARLEQUIN/TOMATO AGAMOUS-LIKE1 Gene Is Required for Cuticle Development of Tomato Fruit.

    Science.gov (United States)

    Giménez, Estela; Dominguez, Eva; Pineda, Benito; Heredia, Antonio; Moreno, Vicente; Lozano, Rafael; Angosto, Trinidad

    2015-07-01

    Fruit development and ripening entail key biological and agronomic events, which ensure the appropriate formation and dispersal of seeds and determine productivity and yield quality traits. The MADS box gene Arlequin/tomato Agamous-like1 (hereafter referred to as TAGL1) was reported as a key regulator of tomato (Solanum lycopersicum) reproductive development, mainly involved in flower development, early fruit development, and ripening. It is shown here that silencing of the TAGL1 gene (RNA interference lines) promotes significant changes affecting cuticle development, mainly a reduction of thickness and stiffness, as well as a significant decrease in the content of cuticle components (cutin, waxes, polysaccharides, and phenolic compounds). Accordingly, overexpression of TAGL1 significantly increased the amount of cuticle and most of its components while rendering a mechanically weak cuticle. Expression of the genes involved in cuticle biosynthesis agreed with the biochemical and biomechanical features of cuticles isolated from transgenic fruits; it also indicated that TAGL1 participates in the transcriptional control of cuticle development mediating the biosynthesis of cuticle components. Furthermore, cell morphology and the arrangement of epidermal cell layers, on whose activity cuticle formation depends, were altered when TAGL1 was either silenced or constitutively expressed, indicating that this transcription factor regulates cuticle development, probably through the biosynthetic activity of epidermal cells. Our results also support cuticle development as an integrated event in the fruit expansion and ripening processes that characterize fleshy-fruited species such as tomato.

  2. Isostasy-controlled thinning-upward cycles in the Mediterranean?; a comparison with the Zechstein salt giant

    Science.gov (United States)

    Van den Belt, Frank J. G.; De Boer, Poppe L.

    2014-05-01

    The desiccated deep-basin model, originally developed for the Mediterranean salt giant, deviated significantly from existing models and it has never been satisfactorily translated into a general concept. With time, however, Mediterranean models evolved towards moderate basin depths and the view that deposition took place in a flooded basin has gained reputation. These new insights have bridged the gap with general evaporite models and open possibilities of integrating concepts developed for other salt giants into the model. Recent modelling work (Van den Belt & De Boer, 2012) based on the Zechstein salt basin has shown that the thickness and composition of subsequent evaporite cycles can be explained by a model that involves a repetition of a three-stage process of 1) progressive narrowing of an ocean corridor in response to sulphate-platform progradation, resulting in 2) brine concentration and rapid infilling of the basin with halite and potash salts, the load of which causes 3) isostatic creation of accommodation space for the next cycle. Isostatic theory predicts that each cycle has approximately half the thickness of the previous one, e.g. 1.0 > 0.50 > 0.25 > 0.125 followed by a number of (coalesced) smaller cycles with a joint thickness of 0.125. The sequence in the basin centre then adds up to 2, which is two times the original basin depth. For the Zechstein case actual cycle thickness well matches these predicted values with cycle thicknesses of about 1.06 > 0.54 > 0.18 > 0.10 and 0.12. The cycle build-up of the Mediterranean salt giant is less well known, because of limited deep drilling. There are at least two cycles, a thin upper overlying a thick lower unit, but comparison of Zechstein patterns with Mediterranean sections has shown that more cycles may be present. Typical cycle boundaries include K/Mg-salt interbeds in halite units, and halite interbeds in sulphate units. Interestingly, analysis has shown that such indicators in Mediterranean sections

  3. The Revitalization of Women’s Entrepreneurship Spirit In Micro Enterprises With Islamic Microfinance Institution (IMI (Study on The Contribution of BMTs Agam Madani in Agam sub-province, West Sumatra

    Directory of Open Access Journals (Sweden)

    Hesi Eka Puteri

    2014-03-01

    Full Text Available Objective - The objective of this paper is to give an overview of the contribution of Islamic Microfinance Institutions (IMI in the process of empowerment of women microenterprises, and recommended a related policy.Method – This study is a field research in 2012, which focused in BMTs Agam Madani at Agam district. The data is sourced from the observation, documentation and questionnaires from 60 women micro-entrepreneurs samples who receive working capital financing. This paper uses simple regression model in order to observe relationship between working capital and the increasing of revenue. This model is to measure the amount of the multiplier effect in working capital-to increasing of revenue.Result – This paper found that IMI is a good model to develop society more prosperous by developing BMTs in each district. These BMT has thousands of micro enterprises member and could revitalized the spirit of entrepreneurship of minangkabau’s women. A research to 60 women’s micro entrepreneur samples showed the positive significant influence between lending to revenue. A multiplier effect equal to 0.068.The small number of multiplier effect implied that many factors determining their revenue, not lending only.Conclusion – This finding could explain that IMI could empower micro entrepreneur woman. This finding also recommend few strategies: 1 Revitalization of BMTs as micro catalyst by revitalization of structure of organization, products variation, human resource compentence, sharia monitoring, public cooperation and implementating local cultural value 2 Revitalization of government role as fasilitator, coordinator, initiator and mediator in developing micro sector. Keywords : Women’s Entrepreneurship, Micro Enterprises, Islamic Microfinance Institution, BMTs Agam Madani 

  4. ANALISIS EFEKTIFITAS PROGRAMPELATIHAN DIKLAT PIM III TERHADAP KOMPETENSI PEJABAT ESELON III DI PEMERINTAH KABUPATEN AGAM

    Directory of Open Access Journals (Sweden)

    Dina Amaluis

    2014-10-01

    Full Text Available In the management of Human Resources, there are several basic functions. The evaluation function is one of them, in addition to planning, organizing and execution. Training programs as one strategy of human resource development requires the evaluation function to determine the effectiveness of ProgramPelatihan.Program Training for Civil Servants aims to improve the ability to lead, work competence and performance. In this study, the training program is intended Leadership Training Level III. This study aims to measure the relationship to increased Competence Training Program. Respondents consisted of 96 graduates of Leadership Training Level III who currently holds the post of structural Echelon III in Agam district government (leader. The approach used is quantitative by distributing a questionnaire to all respondents. Training Program evaluation method using Kirkpatrick & Kirkpatrick. The analysis used is a simple correlation between variables see significant value. The result showed that the training program is significantly correlated to the increased competence. This means that any increase in the value of the variable training program will be followed by a rise in the value of the variable competence. From this research can be concluded that the organizers of the training program is necessary to conduct in-depth Training Needs Analysis

  5. Regulatory elements of the floral homeotic gene AGAMOUS identified by phylogenetic footprinting and shadowing.

    Energy Technology Data Exchange (ETDEWEB)

    Hong, R. L., Hamaguchi, L., Busch, M. A., and Weigel, D.

    2003-06-01

    OAK-B135 In Arabidopsis thaliana, cis-regulatory sequences of the floral homeotic gene AGAMOUS (AG) are located in the second intron. This 3 kb intron contains binding sites for two direct activators of AG, LEAFY (LFY) and WUSCHEL (WUS), along with other putative regulatory elements. We have used phylogenetic footprinting and the related technique of phylogenetic shadowing to identify putative cis-regulatory elements in this intron. Among 29 Brassicaceae, several other motifs, but not the LFY and WUS binding sites previously identified, are largely invariant. Using reporter gene analyses, we tested six of these motifs and found that they are all functionally important for activity of AG regulatory sequences in A. thaliana. Although there is little obvious sequence similarity outside the Brassicaceae, the intron from cucumber AG has at least partial activity in A. thaliana. Our studies underscore the value of the comparative approach as a tool that complements gene-by-gene promoter dissection, but also highlight that sequence-based studies alone are insufficient for a complete identification of cis-regulatory sites.

  6. Giant Cell Arteritis

    Science.gov (United States)

    Giant cell arteritis is a disorder that causes inflammation of your arteries, usually in the scalp, neck, and arms. ... arteries, which keeps blood from flowing well. Giant cell arteritis often occurs with another disorder called polymyalgia ...

  7. Phase control studies in Gd{sub 5}Si{sub 2}Ge{sub 2} giant magnetocaloric compound

    Energy Technology Data Exchange (ETDEWEB)

    Belo, J.H. [IFIMUP and IN-Institute of Nanoscience and Nanotechnology, Departamento de Fisica e Astronomia, Faculdade de Ciencias, Universidade do Porto, Rua do Campo Alegre, 687, 4169-007 Porto (Portugal); Pereira, A.M., E-mail: ampereira@fc.up.pt [IFIMUP and IN-Institute of Nanoscience and Nanotechnology, Departamento de Fisica e Astronomia, Faculdade de Ciencias, Universidade do Porto, Rua do Campo Alegre, 687, 4169-007 Porto (Portugal); Ventura, J.; Oliveira, G.N.P. [IFIMUP and IN-Institute of Nanoscience and Nanotechnology, Departamento de Fisica e Astronomia, Faculdade de Ciencias, Universidade do Porto, Rua do Campo Alegre, 687, 4169-007 Porto (Portugal); Araujo, J.P., E-mail: jearaujo@fc.up.pt [IFIMUP and IN-Institute of Nanoscience and Nanotechnology, Departamento de Fisica e Astronomia, Faculdade de Ciencias, Universidade do Porto, Rua do Campo Alegre, 687, 4169-007 Porto (Portugal); Tavares, P.B.; Fernandes, L. [Departamento de Quimica and CQ-VR, Universidade de Tras-os-Montes e Alto Douro, 5001-801 Vila Real (Portugal); Algarabel, P.A. [Instituto de Ciencia de Materiales de Aragon, Universidad de Zaragoza and Consejo Superior de Investigaciones Cientificas, 50009 Zaragoza (Spain); Magen, C. [Instituto de Nanociencia de Aragon-ARAID, Universidad de Zaragoza, 50009 Zaragoza (Spain); Morellon, L. [Instituto de Ciencia de Materiales de Aragon, Universidad de Zaragoza and Consejo Superior de Investigaciones Cientificas, 50009 Zaragoza (Spain); Instituto de Nanociencia de Aragon, Universidad de Zaragoza, 50009 Zaragoza (Spain); and others

    2012-07-15

    Highlights: Black-Right-Pointing-Pointer Study of time dependence of O(I) to M phase. Black-Right-Pointing-Pointer Determination of the optimal annealing time. Black-Right-Pointing-Pointer New method for phase amount estimation (O(I) and M). Black-Right-Pointing-Pointer Effect of annealing on the MCE. Black-Right-Pointing-Pointer Analysis of the nature of the magnetic transition through the Arrot plot representation. - Abstract: A systematic set of annealings on arc-melted synthesized Gd{sub 5}Si{sub 2}Ge{sub 2} sample was performed. Through powder X-ray diffraction (XRD) and magnetometry measurements we monitored the effect of varying the annealing time with constant temperature (T = 1473 K) on the formation of the monoclinic (M) crystallographic phase fraction, which is the one responsible for the giant magnetocaloric effect (GMCE) in this compound. The conversion of the orthorhombic O(I) crystallographic phase into M was achieved, resulting in a significant increase of the M mass fraction. Such conversion led to a change in the magnetic transition nature, evolving from a second to a first order transition for the as-cast and annealed samples, respectively. An optimal annealing time range for the M phase conversion was identified to be within 80-120 min at T = 1473 K followed by a rapid quenching to liquid N{sub 2}. Furthermore, an increase up to {approx}50% of the magnetocaloric effect was obtained for the sample annealed during 120 min.

  8. DNA Synthesis in the Giant Nuclei of Insects - Control Machinery and Structures Observed in the Silk-Producing Gland of Bombyx Mori

    International Nuclear Information System (INIS)

    The existence in many insect organs of giant nuclei without visible chromosomes raises the question of possible homologies between the chromatin structures of these nuclei and those of polytene nuclei or common euploid cells. Studies have been made of the nuclei in the silk-producing gland of Bombyx mori. The DNA synthesis is cyclic. During the third stage there are three successive synthesis cycles, which appear to be relatively autonomous in the individual nuclei. For more than 24 hours after moulting, however, synthesis is greatly reduced; moulting factors thus cause synchronization of all the nuclei. This leads to the conclusion that the triggering of a synthesis cycle is controlled by general factors external to the cell. At the end of larval development, DNA synthesis is suspended at the moment when large-scale secretion of silk begins. Evaluation of the pool of endogenic precursors of DNA shows that it is considerably reduced at the end of the DNA synthesis period. The hypothesis proposed is that large-scale synthesis of fibroin requires polarization of the metabolism, hence the depletion of the nucleotide pool and the end of DNA synthesis. DNA synthesis within a single nucleus is to some extent asynchronic. In particular, a well-defined, delayed-synthesis structure visible only in the female seems to be a possible homologue of a sex chromosome. Other asynchronisms are also apparent, though less clearly. Functional studies thus allow the supposition that in the giant nucleus replication units retain an individuality comparable to that of a polytene chromosome. These observations together lead to the conclusion that a nucleus in the silk-producing gland has physiological and structural characteristics similar to those of a polytene nucleus, differing from it essentially in the lesser degree of condensation of its structures. (author)

  9. Squashed giants: bound states of giant gravitons

    International Nuclear Information System (INIS)

    We consider giant gravitons in the maximally supersymmetric type IIB plane-wave, in the presence of a constant NSNS B-field background. We show that in response to the background B-field the giant graviton would take the shape of a deformed three-sphere, the size and shape of which depend on the B-field, and that the giant becomes classically unstable once the B-field is larger than a critical value Bcr. In particular, for the B-field which is (anti-)self-dual under the SO(4) isometry of the original giant S3, the closed string metric is that of a round S3, while the open string metric is a squashed three-sphere. The squashed giant can be interpreted as a bound state of a spherical three-brane and circular D-strings. We work out the spectrum of geometric fluctuations of the squashed giant and study its stability. We also comment on the gauge theory which lives on the brane (which is generically a noncommutative theory) and a possible dual gauge theory description of the deformed giant. (author)

  10. Complexity in Climatic Controls on Plant Species Distribution: Satellite Data Reveal Unique Climate for Giant Sequoia in the California Sierra Nevada

    Science.gov (United States)

    Waller, Eric Kindseth

    A better understanding of the environmental controls on current plant species distribution is essential if the impacts of such diverse challenges as invasive species, changing fire regimes, and global climate change are to be predicted and important diversity conserved. Climate, soil, hydrology, various biotic factors fire, history, and chance can all play a role, but disentangling these factors is a daunting task. Increasingly sophisticated statistical models relying on existing distributions and mapped climatic variables, among others, have been developed to try to answer these questions. Any failure to explain pattern with existing mapped climatic variables is often taken as a referendum on climate as a whole, rather than on the limitations of the particular maps or models. Every location has a unique and constantly changing climate so that any distribution could be explained by some aspect of climate. Chapter 1 of this dissertation reviews some of the major flaws in species distribution modeling and addresses concerns that climate may therefore not be predictive of, or even relevant to, species distributions. Despite problems with climate-based models, climate and climate-derived variables still have substantial merit for explaining species distribution patterns. Additional generation of relevant climate variables and improvements in other climate and climate-derived variables are still needed to demonstrate this more effectively. Satellite data have a long history of being used for vegetation mapping and even species distribution mapping. They have great potential for being used for additional climatic information, and for improved mapping of other climate and climate-derived variables. Improving the characterization of cloud cover frequency with satellite data is one way in which the mapping of important climate and climate-derived variables can be improved. An important input to water balance models, solar radiation maps could be vastly improved with a

  11. Stochastic bifurcation and fractal and chaos control of a giant magnetostrictive film-shape memory alloy composite cantilever plate subjected to in-plane harmonic and stochastic excitation

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Zhiwen, E-mail: zhuzhiwentju@163.com [Department of Mechanics, Tianjin University, Tianjin 300072 (China); Tianjin Key Laboratory of Nonlinear Dynamics and Chaos Control, Tianjin 300072 (China); Zhang, Qingxin, E-mail: zqxfirst@163.com; Xu, Jia, E-mail: xujia-ld@163.com [Department of Mechanics, Tianjin University, Tianjin 300072 (China)

    2014-05-07

    Stochastic bifurcation and fractal and chaos control of a giant magnetostrictive film–shape memory alloy (GMF–SMA) composite cantilever plate subjected to in-plane harmonic and stochastic excitation were studied. Van der Pol items were improved to interpret the hysteretic phenomena of both GMF and SMA, and the nonlinear dynamic model of a GMF–SMA composite cantilever plate subjected to in-plane harmonic and stochastic excitation was developed. The probability density function of the dynamic response of the system was obtained, and the conditions of stochastic Hopf bifurcation were analyzed. The conditions of noise-induced chaotic response were obtained in the stochastic Melnikov integral method, and the fractal boundary of the safe basin of the system was provided. Finally, the chaos control strategy was proposed in the stochastic dynamic programming method. Numerical simulation shows that stochastic Hopf bifurcation and chaos appear in the parameter variation process. The boundary of the safe basin of the system has fractal characteristics, and its area decreases when the noise intensifies. The system reliability was improved through stochastic optimal control, and the safe basin area of the system increased.

  12. Studies show giant panda could survive

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    @@ The giant panda (Ailuropoda melanoleuca) is not a relic species, and it can survive, according to scientists. Employing microsatellite and mitochondrial control region (CR) sequences as genetic markers, CAS researchers have obtained some key information about the giant panda and its recent evolution history. Their discovery that the lovely creature still possesses high genetic diversity and evolution potentials challenges the hypothesis suggesting the giant panda is facing an"evolutionary dead-end." The research was reported in a recent issue of Molecular Biology and Evolution by a team of scientists led by Prof.WEI Fuwen of the CAS Institute of Zoology and Prof. Michael W.Bruford of Cardiff University.

  13. Giant Cell Tumor: Role of Conservative Treatment

    Institute of Scientific and Technical Information of China (English)

    Anatolii Diedkov[1; Pavlo Kovalchuk[1; Marija Kukushkina[2; Sergey Bojchuk[1; Viktor Kostyuk[1

    2014-01-01

    Giant cell tumor is aggressive bone tumor. Surgical treatment is considered to be the only effective method of treatment ofthese tumors. The problem of inoperable patients with giant cell tumors is a challenge. A total of 8 patients had giant cell bone tumorsof pelvis and sacrum. 3 patients were treated by bisphosphonates, radiation therapy and embolization of tumor-nutrient arteries. 5patients received denosumab. The efficiency was assessed according to clinical data and CT scan control. Median follow up is 28months. All 8 patients had reduction of pain intensity. Treatment with denosumab demonstrated more than 30% tumor regression. Allof the patients are in remission.

  14. Bridging the ``green gap'' of LEDs: giant light output enhancement and directional control of LEDs via embedded nano-void photonic crystals

    Science.gov (United States)

    Tsai, Yu-Lin; Liu, Che-Yu; Krishnan, Chirenjeevi; Lin, Da-Wei; Chu, You-Chen; Chen, Tzu-Pei; Shen, Tien-Lin; Kao, Tsung-Sheng; Charlton, Martin D. B.; Yu, Peichen; Lin, Chien-Chung; Kuo, Hao-Chung; He-Hau, Jr.

    2015-12-01

    Green LEDs do not show the same level of performance as their blue and red cousins, greatly hindering the solid-state lighting development, which is the so-called ``green gap''. In this work, nano-void photonic crystals (NVPCs) were fabricated to embed within the GaN/InGaN green LEDs by using epitaxial lateral overgrowth (ELO) and nano-sphere lithography techniques. The NVPCs act as an efficient scattering back-reflector to outcouple the guided and downward photons, which not only boost the light extraction efficiency of LEDs with an enhancement of 78% but also collimate the view angle of LEDs from 131.5° to 114.0°. This could be because of the highly scattering nature of NVPCs which reduce the interference giving rise to Fabry-Perot resonance. Moreover, due to the threading dislocation suppression and strain relief by the NVPCs, the internal quantum efficiency was increased by 25% and droop behavior was reduced from 37.4% to 25.9%. The enhancement of light output power can be achieved as high as 151% at a driving current of 350 mA. Giant light output enhancement and directional control via NVPCs point the way towards a promising avenue of solid-state lighting.Green LEDs do not show the same level of performance as their blue and red cousins, greatly hindering the solid-state lighting development, which is the so-called ``green gap''. In this work, nano-void photonic crystals (NVPCs) were fabricated to embed within the GaN/InGaN green LEDs by using epitaxial lateral overgrowth (ELO) and nano-sphere lithography techniques. The NVPCs act as an efficient scattering back-reflector to outcouple the guided and downward photons, which not only boost the light extraction efficiency of LEDs with an enhancement of 78% but also collimate the view angle of LEDs from 131.5° to 114.0°. This could be because of the highly scattering nature of NVPCs which reduce the interference giving rise to Fabry-Perot resonance. Moreover, due to the threading dislocation suppression and

  15. Dynamos of giant planets

    OpenAIRE

    F. H. Busse; Simitev, R.

    2009-01-01

    Possibilities and difficulties of applying the theory of magnetic field generation by convection flows in rotating spherical fluid shells to the Giant Planets are outlined. Recent progress in the understanding of the distribution of electrical conductivity in the Giant Planets suggests that the dynamo process occurs predominantly in regions of semiconductivity. In contrast to the geodynamo the magnetic field generation in the Giant Planets is thus characterized by strong radial conductivity v...

  16. Neglected Giant Scalp Basal Cell Carcinoma

    OpenAIRE

    Anne Kristine Larsen, MD; Waseem-Asim Ghulam El-Charnoubi, MD; Julie Gehl, MD, PhD; Christen Krag, MD, PhD

    2014-01-01

    Summary: Rarely, basal cell carcinoma grows to a giant size, invading the underlying deep tissue and complicating the treatment and reconstruction modalities. A giant basal cell carcinoma on the scalp is in some cases treated with a combination of surgery and radiation therapy, resulting in local control, a satisfactory long-term cosmetic and functional result. We present a case with a neglected basal cell scalp carcinoma, treated with wide excision and postoperative radiotherapy, reconstruct...

  17. Towards an optimal semiquantitative approach in giant cell arteritis: an {sup 18}F-FDG PET/CT case-control study

    Energy Technology Data Exchange (ETDEWEB)

    Besson, Florent L.; Bouvard, Gerard [CHU Caen, Department of Nuclear Medicine, Caen (France); Boysson, Hubert de; Bienvenu, Boris [CHU Caen, Department of Internal Medicine, Caen (France); Parienti, Jean-Jacques [CHU Caen, Department of Biostatistics, Caen (France); Agostini, Denis [CHU Caen, Department of Nuclear Medicine, Caen (France); University of Caen Lower-Normandy, EA 4650, Caen (France)

    2014-01-15

    Giant cell arteritis (GCA) is the most common form of vasculitis in western countries. {sup 18}F-FDG PET has been shown to be a valuable tool for the diagnosis of extracranial GCA, but results of studies are inconsistent due to a lack of standardized {sup 18}F-FDG PET criteria. In this study, we compared different semiquantitative approaches using a controlled design to define the most efficient method. All patients with biopsy-proven GCA who had undergone an {sup 18}F-FDG PET/CT scan in our PET unit were reviewed and matched with a control group based on age and sex. Different semiquantitative arterial (ascending and descending thoracic aorta and aortic arch) to background (liver, lung and venous blood pool) SUV ratios were blindly compared between GCA patients and matched controls. We included 11 patients with biopsy-proven GCA cases and 11 matched controls. There were no differences between the groups with regard to body weight, injected radioactivity, blood glucose level or CRP. The arterial to venous blood pool ratios discriminated the two groups better than other methods when applied to the aortic arch and the descending thoracic aorta (p < 0.015). In particular, the highest aortic to highest blood pool SUV{sub max} ratio, when applied to the aortic arch, provided optimal diagnostic performance (sensitivity 81.8 %, specificity 91 %, AUC 0.87; p < 0.0001) using a cut-off value of 1.53. Among all tested {sup 18}F-FDG PET/CT methods, the aortic to blood pool SUV{sub max} ratio outperformed the liver and lung ratios. We suggest the use of this ratio for the assessment of aortic inflammation in GCA patients. (orig.)

  18. Nanodielectrics with giant permittivity

    Indian Academy of Sciences (India)

    S K Saha

    2008-06-01

    Nanodielectrics is an emerging area of research because of its potential application in energy storage and transducers. One-dimensional metallic nanostructures with localized electronic wave functions show giant dielectric constant. Following the prediction, during the last couple of years we have investigated the effect of giant permittivity in one-dimensional systems of conventional metals and conjugated polymer chains. In this article, we have tried to summarize the works on giant permittivity and finally the fabrication of nanocapacitor using metal nanowires, which shows giant permittivity is also discussed.

  19. Simultaneous measurements of magnesium, calcium and sodium influxes in perfused squid giant axons under membrane potential control.

    Science.gov (United States)

    Rojas, E; Taylor, R E

    1975-10-01

    1. Giant axons from the squids Dosidicus gigas, Loligo forbesi and Loligo vulgaris were internally perfused with 550 or 275 mM KF plus sucrose and bathed in artificial sea water containing 45Ca, 28Mg or mixtures of 45Ca-28Mg or 45Ca-22Na. Resting influxes and extra influxes during voltage-clamp pulses were measured by collecting and counting the internal perfusate. 2. For Dosidicus axons in 10 mM-CaCl2 the resting influx of calcium was 0-016 +/- 0-007 p-mole/cm2 sec and a linear function of external concentration. For two experiments in 10 and 84-7 mM-CaCl2, 100 nM tetrodotoxin had no effect. Resting calcium influx in 10 mM-CaCl2 was 0-017 +/- 0-013 p-mole/cm2 sec for Loligo axons. 3. With 55 mM-MgCl2 outside the average resting magnesium influx was 0-124 +/- 0-080 p-mole/cm2 sec for Loligo axons. Discarding one aberrant point the value is 0-105 +/- 0-046 which is not significantly different from the resting calcium influx for Dosidicus fibres in 55 mM-CaCl2, given as 0-094 p-mole/cm2 sec by the regression line shown in Fig. 1. In two experiments 150 nM tetrodotoxin had no effect. 4. With 430 mM-NaCl outside 100 nM tetrodotoxin reduced the average resting influx of sodium in Dosidicus axon from 27-7 +/- 4-5 to 25-1 +/- 6-2 p-mole/cm2 sec and for Loligo fibres in 460 mM-NaCl from 50-5 +/- 4 to 20 +/- 8 p-mole/cm2 sec. 5. Using depolarizing pulses of various durations, the extra calcium influx occurred in two phases. The early phase was eliminated by external application of tetrodotoxin. The results of analysis are consistent with, but do not rigorously demonstrate, the conclusion that the tetrodotoxin sensitive calcium entry is flowing through the normal sodium channels (cf. Baker, Hodgkin & Ridgway, 1971). 6. Measurements of extra influxes using 22Na and 45Ca simultaneously indicate that the time courses of tetrodotoxin sensitive calcium and sodium entry are similar but not necessarily identical. It is very doubtful that any significant calcium entry occurs before

  20. 超磁致伸缩电液伺服阀驱动机构控制系统设计%Design of Control System of Giant Magnetostrictive Electro-hydraulic Servo Valve Driven Machine

    Institute of Scientific and Technical Information of China (English)

    杨朝舒; 何忠波; 李冬伟; 薛光明

    2014-01-01

    为了实现超磁致伸缩电液伺服阀的快速、准确控制,论述了基于PWM控制的超磁致伸缩电液伺服阀的基本结构和工作原理,设计了基于PicoScope2203数字示波器和STC89C51单片机的超磁致伸缩材料电液伺服阀驱动机构的控制系统。结果表明:该控制系统具有控制精度高、控制迅速、集成度高、操作便捷等特点。%In order to achieve the speedy and precision control of electro⁃hydraulic servo valve based on giant magnetostrictive material, the basic structure and working principle of a kind of Electro⁃hydraulic Servo Valve based on giant magnetostrictive material with PWM control was discussed. A control system for the giant magnetostrictive electro⁃hydraulic servo valve driven machine based on PicoScope2203 Digital Oscilloscope and STC89C51 series MCU was designed. The results show that the control system has properties of high speed and precision, highly integrated and convenient for operation, and etc.

  1. Bridging “green gap” of LEDs: Giant light output enhancement and directional control of LEDs via embedded nano-void photonic crystals

    KAUST Repository

    Tsai, Yu-Lin

    2015-11-23

    Green LEDs do not show the same level of performance as their blue and red cousins, greatly hindering the solid-state lighting development, which is so-called “green gap”. In this work, nano-void photonic crystals (NVPCs) were fabricated to embed within the GaN/InGaN green LEDs by using epitaxial lateral overgrowth (ELO) and nano-sphere lithography techniques. The NVPCs act as an efficient scattering back-reflector to outcouple the guided and downward photons, which not only boosting light extraction efficiency of LEDs with an enhancement of 78% but also collimating the view angle of LEDs from 131.5゜to 114.0゜. This could be because the highly scattering nature of NVPCs which reduce the interference giving rise to Fabry-Perot resonance. Moreover, due to the threading dislocation suppression and strain relief by the NVPCs, the internal quantum efficiency was increased by 25% and droop behavior was reduced from 37.4% to 25.9%. The enhancement of light output power can be achieved as high as 151% at a driving current of 350 mA. Giant light output enhancement and directional control via NVPCs points the way towards a promising avenue of solid-state lighting.

  2. Peripheral giant cell granuloma

    Directory of Open Access Journals (Sweden)

    Padam Narayan Tandon

    2012-01-01

    Full Text Available Peripheral giant cell granuloma or the so-called "giant cell epulis" is the most common oral giant cell lesion. It normally presents as a soft tissue purplish-red nodule consisting of multinucleated giant cells in a background of mononuclear stromal cells and extravasated red blood cells. This lesion probably does not represent a true neoplasm, but rather may be reactive in nature, believed to be stimulated by local irritation or trauma, but the cause is not certainly known. This article reports a case of peripheral giant cell granuloma arising at the maxillary anterior region in a 22-year-old female patient. The lesion was completely excised to the periosteum level and there is no residual or recurrent swelling or bony defect apparent in the area of biopsy after a follow-up period of 6 months.

  3. Giant distal humeral geode

    Energy Technology Data Exchange (ETDEWEB)

    Maher, M.M. [Department of Radiology, Mater Misericordiae Hospital, Dublin (Ireland); Department of Radiology, St. Vincent' s Hospital, Elm Park, Dublin 4 (Ireland); Kennedy, J.; Hynes, D. [Department of Orthopaedics, Mater Misericordiae Hospital, Dublin (Ireland); Murray, J.G.; O' Connell, D. [Department of Radiology, Mater Misericordiae Hospital, Dublin (Ireland)

    2000-03-30

    We describe the imaging features of a giant geode of the distal humerus in a patient with rheumatoid arthritis, which presented initially as a pathological fracture. The value of magnetic resonance imaging in establishing this diagnosis is emphasized. (orig.)

  4. The Giant Cell.

    Science.gov (United States)

    Stockdale, Dennis

    1998-01-01

    Provides directions for the construction of giant plastic cells, including details for building and installing the organelles. Also contains instructions for preparing the ribosomes, nucleolus, nucleus, and mitochondria. (DDR)

  5. Metaphyseal giant cell tumor

    Energy Technology Data Exchange (ETDEWEB)

    Pereira, L.F.; Hemais, P.M.P.G.; Aymore, I.L.; Carmo, M.C.R. do; Cunha, M.E.P.R. da; Resende, C.M.C.

    Three cases of metaphyseal giant cell tumor are presented. A review of the literature is done, demostrating the lesion is rare and that there are few articles about it. Age incidence and characteristics of the tumor are discussed.

  6. Seismology of Giant Planets

    CERN Document Server

    Gaulme, Patrick; Schmider, Francois-Xavier; Guillot, Tristan

    2014-01-01

    Seismology applied to giant planets could drastically change our understanding of their deep interiors, as it has happened with the Earth, the Sun, and many main-sequence and evolved stars. The study of giant planets' composition is important for understanding both the mechanisms enabling their formation and the origins of planetary systems, in particular our own. Unfortunately, its determination is complicated by the fact that their interior is thought not to be homogeneous, so that spectroscopic determinations of atmospheric abundances are probably not representative of the planet as a whole. Instead, the determination of their composition and structure must rely on indirect measurements and interior models. Giant planets are mostly fluid and convective, which makes their seismology much closer to that of solar-like stars than that of terrestrial planets. Hence, helioseismology techniques naturally transfer to giant planets. In addition, two alternative methods can be used: photometry of the solar light ref...

  7. Metaphyseal giant cell tumor

    International Nuclear Information System (INIS)

    Three cases of metaphyseal giant cell tumor are presented. A review of the literature is done, demostrating the lesion is rare and that there are few articles about it. Age incidence and characteristics of the tumor are discussed. (Author)

  8. Giants in Transmedia

    Directory of Open Access Journals (Sweden)

    Mare Kõiva

    2016-06-01

    Full Text Available The purpose of this article is to discuss transmedia narratives based on giant lore, which is described by means of examples from folkloristics and transmedia dissemination. Giant lore, particularly the epic Kalevipoeg, a core text of Estonian culture, has generated numerous transmedially circulating texts and various contemporary forms. Through their connections with media, texts about giants continue to participate in the national cultural space; in previous eras, they have been carriers of Estonian identity or, alternatively, have held an important place in the creation of local identities. The latter can be observed today in printed matter, advertisements, and products marketed to the homeland public. However, texts about giants can also be used as a self-characterising image directed beyond national space. The article provides a closer look at ways in which stories connected with Kalevipoeg and Suur Tõll are engaged in different levels of media, as well as necessary contextual cultural knowledge for understanding contemporary media clips.

  9. Giant peritoneal loose bodies

    Directory of Open Access Journals (Sweden)

    Chris van Zyl

    2015-03-01

    Full Text Available Giant peritoneal loose bodies are rare lesions, originating from auto-amputated appendices epiploicae. They may cause urinary or gastrointestinal obstruction and, should the radiologist not be familiar with the entity, can potentially be confused with malignant or parasitic lesions.Familiarity with their characteristic computed tomographic features is essential to prevent unnecessary surgery in the asymptomatic patient. We present a case of a 70-year-old man diagnosed with two giant peritoneal loose bodies.

  10. Giant magnetostrictive materials

    Institute of Scientific and Technical Information of China (English)

    LIU JingHua; JIANG ChengBao; XU HuiBin

    2012-01-01

    Giant magnetostrictive materials are a kind of functional materials developed since 1970s,known as their large magnetostrain and high energy density.In this paper,an introduction of magnetosttiction and the history of magnetostrictive materials are described firstly.Then we review the recent developments of both rare earth and non-rare earth magnetostrictive materials.Finally,the tendency of developing new giant magnetostrictive materials is presented.

  11. Red giant seismology: Observations

    Directory of Open Access Journals (Sweden)

    Mosser B.

    2013-03-01

    Full Text Available The CoRoT and Kepler missions provide us with thousands of red-giant light curves that allow a very precise asteroseismic study of these objects. Before CoRoT and Kepler, the red-giant oscillation patterns remained obscure. Now, these spectra are much more clear and unveil many crucial interior structure properties. For thousands of red giants, we can derive from seismic data precise estimates of the stellar mass and radius, the evolutionary status of the giants (with a clear difference between clump and RGB stars, the internal differential rotation, the mass loss, the distance of the stars... Analyzing this amount of information is made easy by the identification of the largely homologous red-giant oscillation patterns. For the first time, both pressure and mixed mode oscillation patterns can be precisely depicted. The mixed-mode analysis allows us, for instance, to probe directly the stellar core. Fine details completing the red-giant oscillation pattern then provide further information on the interior structure, including differential rotation.

  12. Thermal Giant Gravitons

    CERN Document Server

    Armas, Jay; Obers, Niels A; Orselli, Marta; Pedersen, Andreas Vigand

    2012-01-01

    We study the giant graviton solution as the AdS_5 X S^5 background is heated up to finite temperature. The analysis employs the thermal brane probe technique based on the blackfold approach. We focus mainly on the thermal giant graviton corresponding to a thermal D3-brane probe wrapped on an S^3 moving on the S^5 of the background at finite temperature. We find several interesting new effects, including that the thermal giant graviton has a minimal possible value for the angular momentum and correspondingly also a minimal possible radius of the S^3. We compute the free energy of the thermal giant graviton in the low temperature regime, which potentially could be compared to that of a thermal state on the gauge theory side. Moreover, we analyze the space of solutions and stability of the thermal giant graviton and find that, in parallel with the extremal case, there are two available solutions for a given temperature and angular momentum, one stable and one unstable. In order to write down the equations of mot...

  13. Rapidly rotating red giants

    CERN Document Server

    Gehan, Charlotte; Michel, Eric

    2016-01-01

    Stellar oscillations give seismic information on the internal properties of stars. Red giants are targets of interest since they present mixed modes, which behave as pressure modes in the convective envelope and as gravity modes in the radiative core. Mixed modes thus directly probe red giant cores, and allow in particular the study of their mean core rotation. The high-quality data obtained by CoRoT and Kepler satellites represent an unprecedented perspective to obtain thousands of measurements of red giant core rotation, in order to improve our understanding of stellar physics in deep stellar interiors. We developed an automated method to obtain such core rotation measurements and validated it for stars on the red giant branch. In this work, we particularly focus on the specific application of this method to red giants having a rapid core rotation. They show complex spectra where it is tricky to disentangle rotational splittings from mixed-mode period spacings. We demonstrate that the method based on the id...

  14. Neglected giant scalp Basal cell carcinoma

    DEFF Research Database (Denmark)

    Larsen, Anne Kristine; El-Charnoubi, Waseem-Asim Ghulam; Gehl, Julie;

    2014-01-01

    SUMMARY: Rarely, basal cell carcinoma grows to a giant size, invading the underlying deep tissue and complicating the treatment and reconstruction modalities. A giant basal cell carcinoma on the scalp is in some cases treated with a combination of surgery and radiation therapy, resulting in local...... control, a satisfactory long-term cosmetic and functional result. We present a case with a neglected basal cell scalp carcinoma, treated with wide excision and postoperative radiotherapy, reconstructed with a free latissimus dorsi flap. The cosmetic result is acceptable and there is no sign of recurrence...

  15. Neglected Giant Scalp Basal Cell Carcinoma

    Directory of Open Access Journals (Sweden)

    Anne Kristine Larsen, MD

    2014-03-01

    Full Text Available Summary: Rarely, basal cell carcinoma grows to a giant size, invading the underlying deep tissue and complicating the treatment and reconstruction modalities. A giant basal cell carcinoma on the scalp is in some cases treated with a combination of surgery and radiation therapy, resulting in local control, a satisfactory long-term cosmetic and functional result. We present a case with a neglected basal cell scalp carcinoma, treated with wide excision and postoperative radiotherapy, reconstructed with a free latissimus dorsi flap. The cosmetic result is acceptable and there is no sign of recurrence 1 year postoperatively.

  16. Giant star seismology

    CERN Document Server

    Hekker, S

    2016-01-01

    The internal properties of stars in the red-giant phase undergo significant changes on relatively short timescales. Long near-interrupted high-precision photometric timeseries observations from dedicated space missions such as CoRoT and Kepler have provided seismic inferences of the global and internal properties of a large number of evolved stars, including red giants. These inferences are confronted with predictions from theoretical models to improve our understanding of stellar structure and evolution. Our knowledge and understanding of red giants have indeed increased tremendously using these seismic inferences, and we anticipate that more information is still hidden in the data. Unraveling this will further improve our understanding of stellar evolution. This will also have significant impact on our knowledge of the Milky Way Galaxy as well as on exo-planet host stars. The latter is important for our understanding of the formation and structure of planetary systems.

  17. Superstars and Giant Gravitons

    CERN Document Server

    Myers, R C; Myers, Robert C.; Tafjord, Oyvind

    2001-01-01

    We examine a family of BPS solutions of ten-dimensional type IIb supergravity. These solutions asymptotically approach AdS_5 X S^5 and carry internal `angular' momentum on the five-sphere. While a naked singularity appears at the center of the anti-de Sitter space, we show that it has a natural physical interpretation in terms of a collection of giant gravitons. We calculate the distribution of giant gravitons from the dipole field induced in the Ramond-Ramond five-form, and show that these sources account for the entire internal momentum carried by the BPS solutions.

  18. Giant perigenital seborrheic keratosis.

    Science.gov (United States)

    Bandyopadhyay, Debabrata; Saha, Abanti; Mishra, Vivek

    2015-01-01

    Seborrheic keratosis (SK) is a very common benign epidermal proliferation that is prevalent in all races. Most commonly occurring on the trunk, face, scalp, and the extremities, they can occur anywhere on the body except the palms and soles. The most common appearance is that of a very superficial verrucous plaque which appears to be stuck on the surface. Giant lesions are very rare, and their location on the genital area is rarer still. We report here a case of multiple giant SK lesions in a 59-year-old man. PMID:25657917

  19. Giant perigenital seborrheic keratosis

    Directory of Open Access Journals (Sweden)

    Debabrata Bandyopadhyay

    2015-01-01

    Full Text Available Seborrheic keratosis (SK is a very common benign epidermal proliferation that is prevalent in all races. Most commonly occurring on the trunk, face, scalp, and the extremities, they can occur anywhere on the body except the palms and soles. The most common appearance is that of a very superficial verrucous plaque which appears to be stuck on the surface. Giant lesions are very rare, and their location on the genital area is rarer still. We report here a case of multiple giant SK lesions in a 59-year-old man.

  20. Giant perigenital seborrheic keratosis

    OpenAIRE

    Debabrata Bandyopadhyay; Abanti Saha; Vivek Mishra

    2015-01-01

    Seborrheic keratosis (SK) is a very common benign epidermal proliferation that is prevalent in all races. Most commonly occurring on the trunk, face, scalp, and the extremities, they can occur anywhere on the body except the palms and soles. The most common appearance is that of a very superficial verrucous plaque which appears to be stuck on the surface. Giant lesions are very rare, and their location on the genital area is rarer still. We report here a case of multiple giant SK lesions in a...

  1. The F-box-containing protein UFO and AGAMOUS participate in antagonistic pathways governing early petal development in Arabidopsis.

    Science.gov (United States)

    Durfee, Tim; Roe, Judith L; Sessions, R Allen; Inouye, Carla; Serikawa, Kyle; Feldmann, Kenneth A; Weigel, Detlef; Zambryski, Patricia C

    2003-07-01

    The UNUSUAL FLORAL ORGANS (UFO) gene is required for multiple processes in the developing Arabidopsis flower, including the proper patterning and identity of both petals and stamens. The gene encodes an F-box-containing protein, UFO, which interacts physically and genetically with the Skp1 homolog, ASK1. In this report, we describe four ufo alleles characterized by the absence of petals, which uncover another role for UFO in promoting second whorl development. This UFO-dependent pathway is required regardless of the second whorl organ to be formed, arguing that it affects a basic process acting in parallel with those establishing organ identity. However, the pathway is dispensable in the absence of AGAMOUS (AG), a known inhibitor of petal development. In situ hybridization results argue that AG is not transcribed in the petal region, suggesting that it acts non-cell-autonomously to inhibit second whorl development in ufo mutants. These results are combined into a genetic model explaining early second whorl initiation/proliferation, in which UFO functions to inhibit an AG-dependent activity. PMID:12826617

  2. The MADS domain protein DIANA acts together with AGAMOUS-LIKE80 to specify the central cell in Arabidopsis ovules.

    Science.gov (United States)

    Bemer, Marian; Wolters-Arts, Mieke; Grossniklaus, Ueli; Angenent, Gerco C

    2008-08-01

    MADS box genes in plants consist of MIKC-type and type I genes. While MIKC-type genes have been studied extensively, the functions of type I genes are still poorly understood. Evidence suggests that type I MADS box genes are involved in embryo sac and seed development. We investigated two independent T-DNA insertion alleles of the Arabidopsis thaliana type I MADS box gene AGAMOUS-LIKE61 (AGL61) and showed that in agl61 mutant ovules, the polar nuclei do not fuse and central cell morphology is aberrant. Furthermore, the central cell begins to degenerate before fertilization takes place. Although pollen tubes are attracted and perceived by the mutant ovules, neither endosperm development nor zygote formation occurs. AGL61 is expressed in the central cell during the final stages of embryo sac development. An AGL61:green fluorescent protein-beta-glucoronidase fusion protein localizes exclusively to the polar nuclei and the secondary nucleus of the central cell. Yeast two-hybrid analysis showed that AGL61 can form a heterodimer with AGL80 and that the nuclear localization of AGL61 is lost in the agl80 mutant. Thus, AGL61 and AGL80 appear to function together to differentiate the central cell in Arabidopsis. We renamed AGL61 DIANA, after the virginal Roman goddess of the hunt.

  3. The F-box-containing protein UFO and AGAMOUS participate in antagonistic pathways governing early petal development in Arabidopsis.

    Science.gov (United States)

    Durfee, Tim; Roe, Judith L; Sessions, R Allen; Inouye, Carla; Serikawa, Kyle; Feldmann, Kenneth A; Weigel, Detlef; Zambryski, Patricia C

    2003-07-01

    The UNUSUAL FLORAL ORGANS (UFO) gene is required for multiple processes in the developing Arabidopsis flower, including the proper patterning and identity of both petals and stamens. The gene encodes an F-box-containing protein, UFO, which interacts physically and genetically with the Skp1 homolog, ASK1. In this report, we describe four ufo alleles characterized by the absence of petals, which uncover another role for UFO in promoting second whorl development. This UFO-dependent pathway is required regardless of the second whorl organ to be formed, arguing that it affects a basic process acting in parallel with those establishing organ identity. However, the pathway is dispensable in the absence of AGAMOUS (AG), a known inhibitor of petal development. In situ hybridization results argue that AG is not transcribed in the petal region, suggesting that it acts non-cell-autonomously to inhibit second whorl development in ufo mutants. These results are combined into a genetic model explaining early second whorl initiation/proliferation, in which UFO functions to inhibit an AG-dependent activity.

  4. Giant urethral calculus

    OpenAIRE

    Kotkar, Kunal; Thakkar, Ravi; Songra, MC

    2011-01-01

    Primary urethral calculus is rarely seen and is usually encountered in men with urethral stricture or diverticulum. We present a case of giant urethral calculus secondary to a urethral stricture in a man. The patient was treated with calculus extraction with end to end urethroplasty.

  5. Finite Size Giant Magnon

    CERN Document Server

    Ramadanovic, Bojan

    2008-01-01

    The quantization of the giant magnon away from the infinite size limit is discussed. We argue that this quantization inevitably leads to string theory on a Z_M-orbifold of S^5. This is shown explicitly and examined in detail in the near plane-wave limit.

  6. Giant solitary trichoepithelioma

    DEFF Research Database (Denmark)

    Jemec, B; Løvgreen Nielsen, P; Jemec, G B;

    1999-01-01

    The giant solitary trichoepithelioma is a rare trichogenic tumor with potential for local recurrence. Only nine cases have been previously described in the literature, and one additional case without recurrence during the first 3.5 years of observation is presented stressing that the rate of...

  7. Multispin giant magnons

    International Nuclear Information System (INIS)

    We investigate giant magnons from classical rotating strings in two different backgrounds. First we generalize the solution of Hofman and Maldacena and investigate new magnon excitations of a spin chain which are dual to a string on RxS5 with two nonvanishing angular momenta. Allowing string dynamics along the third angle in the five sphere, we find a dispersion relation that reproduces the Hofman and Maldacena one and the one found by Dorey for the two spin case. In the second part of the paper we generalize the two 'spin' giant magnon to the case of β-deformed AdS5xS5 background. We find agreement between the dispersion relation of the rotating string and the proposed dispersion relation of the magnon bound state on the spin chain

  8. Giant duodenal ulcers

    Institute of Scientific and Technical Information of China (English)

    Eric Benjamin Newton; Mark R Versland; Thomas E Sepe

    2008-01-01

    Giant duodenal ulcers (GDUs) are a subset of duodenal ulcers that have historically resulted in greater morbidity than usual duodenal ulcers. Until recently,few cases had been successfully treated with medical therapy. However, the widespread use of endoscopy,the introduction of H-2 receptor blockers and proton pump inhibitors, and the improvement in surgical techniques all have revolutionized the diagnosis,treatment and outcome of this condition. Nevertheless,GDUs are still associated with high rates of morbidity,mortality and complications. Thus, surgical evaluation of a patient with a GDU should remain an integral part of patient care. These giant variants, while usually benign, can frequently harbor malignancy. A careful review of the literature highlights the important differences when comparing GDUs to classical peptic ulcers and why they must be thought of differently than their more common counterpart.

  9. Intraoral giant condyloma acuminatum

    Directory of Open Access Journals (Sweden)

    Gupta R

    2001-09-01

    Full Text Available A case of intraoral giant condyloma acuminatum is reported in a 50- year- old Indian. He did not respond to topical application of podophyllin 20% but responded partially to electric cauterisation. Surgical excision was done to get rid of the warty growh completely. Since there were no skin or genital lesions and no history of marital or extramarital sexual contact the lesion was probably acquired from environmental sources. Nonsexual transmission should be considered especially when the lesions are extragenital.

  10. Giant Otters in Peru

    Directory of Open Access Journals (Sweden)

    Schenk C.

    1992-02-01

    Full Text Available We are in the second year of fieldwork surveying for Giant Otters in the southeastern rainforest of Peru, in three areas with differing levels of legal protection. While there is some illegal hunting still happening outside the protected areas, the main threat to the otters is badly-conducted tourism. Well-organised tourism can be a promising argument for establishing protected areas like national parks.

  11. Giant Mediastinal Teratoma

    OpenAIRE

    Ilkay Albayrak

    2013-01-01

    The most of mediastinal germ cell tumors are teratomas. The main purpose of the treatment of immature and mature teratomas is completly resection of the mass. However, surgical problems may be occur due to proximity with vital structures. In this case, subtotal resection can be performed. Recurrence is rare, and the prognosis is usually very good. In this report, a case of the giant mediastinal mature cystic teratoma that applied subtotal resection due to pericardial adhesions is presented.

  12. Ice Giant Exploration

    Science.gov (United States)

    Rymer, A. M.; Arridge, C. S.; Masters, A.; Turtle, E. P.; Simon, A. A.; Hofstadter, M. D.; Turrini, D.; Politi, R.

    2015-12-01

    The Ice Giants in our solar system, Uranus and Neptune, are fundamentally different from their Gas Giant siblings Jupiter and Saturn, from the different proportions of rock and ice to the configuration of their planetary magnetic fields. Kepler space telescope discoveries of exo-planets indicate that planets of this type are among the most ubiquitous universally and therefore a future mission to explore the nature of the Ice Giants in our own solar system will provide insights into the nature of extra-solar system objects in general. Uranus has the smallest self- luminosity of all the planets, potentially related to catastrophic events early in the planet's history, which also may explain Uranus' large obliquity. Uranus' atmosphere is subject to extreme seasonal forcing making it unique in the Solar System. Neptune is also unique in a number of ways, notably its large moon Triton which is likely a captured Kuiper Belt Object and one of only two moons in the solar system with a robustly collisional atmosphere. Similar to Uranus, the angle between the solar wind and the magnetic dipole axis is subject to large-amplitude variations on both diurnal and seasonal timescales, but peculiarly it has one of the quietest magnetospheres of the solar system, at least according to Voyager 2, the only spacecraft to encounter Neptune to date. A comprehensive mission, as advocated in the Decadal Survey, would provide enormous science return but is also challenging and expensive. In this presentation we will discuss mission scenarios and suggest how collaboration between disciplines and internationally can help us to pursue a mission that includes Ice Giant exploration.

  13. Lipomas gigantes Giants lipomas

    Directory of Open Access Journals (Sweden)

    Pietro Accetta

    1998-10-01

    Full Text Available The authors report two cases of giants lipomas in the gluteal region with 3,9 and 3,1 kg. They make a brief epidemiological presentation and consider diagnosis and treatment. They believe that CT scan is the best image method, as it provides more information about size and relationship with surrounding structures. They are against biopsies and lipoaspiration but stand up for the total exeresis as the best option of treatment.

  14. File list: InP.Plc.20.AllAg.Trophoblast_giant_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available InP.Plc.20.AllAg.Trophoblast_giant_cells mm9 Input control Placenta Trophoblast gian...t cells SRX344647,SRX344648 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/InP.Plc.20.AllAg.Trophoblast_giant_cells.bed ...

  15. File list: InP.Plc.05.AllAg.Trophoblast_giant_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available InP.Plc.05.AllAg.Trophoblast_giant_cells mm9 Input control Placenta Trophoblast gian...t cells SRX344647,SRX344648 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/InP.Plc.05.AllAg.Trophoblast_giant_cells.bed ...

  16. File list: InP.Plc.50.AllAg.Trophoblast_giant_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available InP.Plc.50.AllAg.Trophoblast_giant_cells mm9 Input control Placenta Trophoblast gian...t cells SRX344647,SRX344648 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/InP.Plc.50.AllAg.Trophoblast_giant_cells.bed ...

  17. File list: InP.Plc.10.AllAg.Trophoblast_giant_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available InP.Plc.10.AllAg.Trophoblast_giant_cells mm9 Input control Placenta Trophoblast gian...t cells SRX344648,SRX344647 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/InP.Plc.10.AllAg.Trophoblast_giant_cells.bed ...

  18. Giant electric field control of magnetism and narrow ferromagnetic resonance linewidth in FeCoSiB/Si/SiO2/PMN-PT multiferroic heterostructures

    Science.gov (United States)

    Gao, Y.; Wang, X.; Xie, L.; Hu, Z.; Lin, H.; Zhou, Z.; Nan, T.; Yang, X.; Howe, B. M.; Jones, J. G.; Brown, G. J.; Sun, N. X.

    2016-06-01

    It has been challenging to achieve combined strong magnetoelectric coupling and narrow ferromagnetic resonance (FMR) linewidth in multiferroic heterostructures. Electric field induced large effective field of 175 Oe and narrow FMR linewidth of 40 Oe were observed in FeCoSiB/Si/SiO2/PMN-PT heterostructures with substrate clamping effect minimized through removing the Si substrate. As a comparison, FeCoSiB/PMN-PT heterostructures with FeCoSiB film directly deposited on PMN-PT showed a comparable voltage induced effective magnetic field but a significantly larger FMR linewidth of 283 Oe. These multiferroic heterostructures exhibiting combined giant magnetoelectric coupling and narrow ferromagnetic resonance linewidth offer great opportunities for integrated voltage tunable RF magnetic devices.

  19. Giant prolactinomas in women

    DEFF Research Database (Denmark)

    Delgrange, Etienne; Raverot, Gerald; Bex, Marie;

    2014-01-01

    OBJECTIVE: To characterise distinctive clinical features of giant prolactinomas in women. DESIGN: A multicentre, retrospective case series and literature review. METHODS: We collected data from 15 female patients with a pituitary tumour larger than 4 cm and prolactin levels above 1000 μg/l and id......OBJECTIVE: To characterise distinctive clinical features of giant prolactinomas in women. DESIGN: A multicentre, retrospective case series and literature review. METHODS: We collected data from 15 female patients with a pituitary tumour larger than 4 cm and prolactin levels above 1000 μg....../l and identified 19 similar cases from the literature; a gender-based comparison of the frequency and age distribution was obtained from a literature review. RESULTS: The initial PubMed search using the term 'giant prolactinomas' identified 125 patients (13 women) responding to the inclusion criteria. The female......:male ratio was 1:9. Another six female patients were found by extending the literature search, while our own series added 15 patients. The median age at diagnosis was 44 years in women compared with 35 years in men (Pwomen (n=34), we...

  20. The Chinese Giant Solar Telescope

    Science.gov (United States)

    Liu, Zhong; Deng, Yuanyong; Ji, Haisheng

    2014-01-01

    Chinese Giant Solar Telescope is the next generation ground-based solar telescope. The main science task of this telescope is to observe the ultra fine structures of the solar magnetic field and dynamic field. Due to the advantages in polarization detection and thermal controlling with a symmetrical circular system, the current design of CGST is a 6~8 meter circular symmetrical telescope. The results of simulations and analysis showed that the current design could meet the demands of most science cases not only in infrared bands but also in near infrared bands and even in visible bands. The prominences and the filaments are very important science cases of CGST. The special technologies for prominence observation will be developed, including the day time laser guide star and MCAO. CGST is proposed by all solar observatories and several institutes and universities in China. It is supported by CAS and NSFC (National Natural Science Foundation of China) as a long term astronomical project.

  1. Scheme Design for the Giant Forging Hydraulic Press Active Synchronous Control System%巨型模锻液压机主动同步控制方案的设计

    Institute of Scientific and Technical Information of China (English)

    刘忠伟

    2012-01-01

    The synchronous control system is the essential device to the giant forging hydraulic press. Its synchronization control performance will directly determine product quality. The main causes of working cylinder asynchronism and its effect on synchronous control performance were analyzed. According to the practical problems of synchronous control application, an active synchronism control scheme was proposed based on multi-point driver.%同步控制系统是巨型模锻液压机上必备的关键装置,其同步控制性能的好坏将直接决定产品的质量.在分析主工作缸不同步的成因及对同步控制性能影响的基础上,根据巨型模锻液压机同步控制的实际应用问题,提出一种基于多点驱动的主动同步控制方案.

  2. Population genetic structure of Aldabra giant tortoises

    OpenAIRE

    Balmer, Oliver; Ciofi, Claudio; Galbraith, David A.; Swingland, Ian R.; Zug, George R.; Caccone, Adalgisa

    2011-01-01

    Evolution of population structure on islands is the result of physical processes linked to volcanism, orogenic events, changes in sea level, as well as habitat variation. We assessed patterns of genetic structure in the giant tortoise of the Aldabra atoll, where previous ecological studies suggested population subdivisions as a result of landscape discontinuity due to unsuitable habitat and island separation. Analysis of mitochondrial DNA (mtDNA) control region sequences and allelic variation...

  3. Multispin Giant Magnons

    OpenAIRE

    Bobev, N. P.; Rashkov, R. C.

    2006-01-01

    We investigate giant magnons from classical rotating strings in two different backgrounds. First we generalize the solution of Hofman and Maldacena and investigate new magnon excitations of a spin chain which are dual to a string on $R\\times S^5$ with two non-vanishing angular momenta. Alowing string dynamics along the third angle in the five sphere, we find a dispersion relation that reproduces the Hofman and Maldacena and the one found by Dorey for the two spin case. In the second part of t...

  4. Giant Cardiac Cavernous Hemangioma.

    Science.gov (United States)

    Unger, Eric; Costic, Joseph; Laub, Glenn

    2015-07-01

    We report the case of an asymptomatic giant cardiac cavernous hemangioma in a 71-year-old man. The intracardiac mass was discovered incidentally during surveillance for his prostate cancer; however, the patient initially declined intervention. On presentation to our institution 7 years later, the lesion had enlarged significantly, and the patient consented to excision. At surgery, an 8 × 6.5 × 4.8 cm intracardiac mass located on the inferior heart border was excised with an intact capsule through a median sternotomy approach. The patient had an uneventful postoperative course. We discuss the diagnostic workup, treatment, and characteristics of this rare cardiac tumor. PMID:26140782

  5. Rotation of Giant Stars

    OpenAIRE

    Kissin, Yevgeni; Thompson, Christopher

    2015-01-01

    The internal rotation of post-main sequence stars is investigated, in response to the convective pumping of angular momentum toward the stellar core, combined with a tight magnetic coupling between core and envelope. The spin evolution is calculated using model stars of initial mass 1, 1.5 and $5\\,M_\\odot$, taking into account mass loss on the giant branches. We also include the deposition of orbital angular momentum from a sub-stellar companion, as influenced by tidal drag along with the exc...

  6. GIANT PROSTHETIC VALVE THROMBUS

    Directory of Open Access Journals (Sweden)

    Prashanth Kumar

    2015-04-01

    Full Text Available Mechanical prosthetic valves are predisposed to bleeding, thrombosis & thromboembolic complications. Overall incidence of thromboembolic complications is 1% per year who are on oral anticoagulants, whereas bleeding complications incidence is 0.5% to 6.6% per year. 1, 2 Minimization of Scylla of thromboembolic & Charybdis of bleeding complication needs a balancing act of optimal antithrombotic therapy. We are reporting a case of middle aged male patient with prosthetic mitral valve presenting in heart failure. Patient had discontinued anticoagulants, as he had subdural hematoma in the past. He presented to our institute with a giant prosthetic valve thrombus.

  7. Giant Ulcerative Dermatofibroma

    Directory of Open Access Journals (Sweden)

    Turgut Karlidag

    2013-01-01

    Full Text Available Dermatofibroma is a slowly growing common benign cutaneous tumor characterized by hard papules and nodules. The rarely seen erosions and ulcerations may cause difficulties in the diagnosis. Dermatofibrosarcoma protuberans, which is clinically and histopathologically of malignant character, displays difficulties in the diagnosis since it has similarities with basal cell carcinoma, epidermoid carcinoma, and sarcomas. Head and neck involvement is very rare. In this study, a giant dermatofibroma case, which is histopathologically, ulcerative dermatofibroma, the biggest lesion of the head and neck region and seen rarely in the literature that has characteristics similar to dermatofibrosarcoma protuberans, has been presented.

  8. Famine Threatens the Giant Panda

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    Large swathes of arrow bamboo groves at and above 2,700 meters in the Piankou Nature Reserve in Sichuan's Mianyang are producing purple blooms, and some groves have started to wither and die. An absence of bamboo means famine for giant pandas living there. Sichuan has consequently activated its giant panda contingency plan.

  9. Giant Pandas and Their Conservation

    Institute of Scientific and Technical Information of China (English)

    GarethDavey

    2004-01-01

    IT is paradoxical that themost well-known conservation symbol in the world,the giant panda, is a criti-cally endangered species.The estimated 1,600 thatremain live in the high-altitude for-ests of southwest China (within theprovinces of Sichuan, Gansu andShaanxi). Giant pandas are popularand elicit affection and admiration

  10. Rapidly Evolving Giant Dermatofibroma

    Directory of Open Access Journals (Sweden)

    K. J. Lang

    2010-01-01

    Full Text Available Dermatofibroma, also known as “fibrous histiocytoma”, is a benign dermal or subcutaneous poorly circumscribed proliferation of spindle-shaped fibroblasts and macrophages in the dermis. Although it is commonly present as a brownish nodule the legs of females, it may also arise on the upper extremities, trunk, and rarely on the head. The exact pathogenesis is unclear. However, it is widely believed that the originating insult to the dermis is a folliculitis, an arthropod bite, or an unspecified initial inflammatory condition. Giant dermatofibromas of greater than 5 cm in diameter are rare, with only 22 cases reported in the literature. We present a case of a rapidly evolving pedunculated mass in the groin of a male patient. Histological examination confirmed this to be a giant dermatofibroma. Though this specimen cannot is not confirmed as such, the cellular subtype is sometimes present as a larger lesion with anecdotal reports of local recurrence and distant metastases. The clinical and radiological features which were somewhat suspicious of malignancy are considered in the context of the definitive pathological diagnosis of a benign lesion.

  11. Pygmies, Giants, and Skins

    Science.gov (United States)

    Piekarewicz, J.

    2013-03-01

    Understanding the equation of state (EOS) of neutron-rich matter is a central goal of nuclear physics that cuts across a variety of disciplines. Indeed, the limits of nuclear existence, the collision of energetic heavy ions, the structure of neutron stars, and the dynamics of core-collapse supernova all depend critically on the nuclear-matter EOS. In this contribution I focus on the EOS of cold baryonic matter with special emphasis on its impact on the structure, dynamics, and composition of neutron stars. In particular, I discuss how laboratory experiments on neutron skins as well as on Pygmy and Giant resonances can help us elucidate the structure of these fascinating objects.

  12. Pygmies, Giants, and Skins

    CERN Document Server

    Piekarewicz, J

    2012-01-01

    Understanding the equation of state (EOS) of neutron-rich matter is a central goal of nuclear physics that cuts across a variety of disciplines. Indeed, the limits of nuclear existence, the collision of energetic heavy ions, the structure of neutron stars, and the dynamics of core-collapse supernova all depend critically on the nuclear-matter EOS. In this contribution I focus on the EOS of cold baryonic matter with special emphasis on its impact on the structure, dynamics, and composition of neutron stars. In particular, I discuss how laboratory experiments on neutron skins as well as on Pygmy and Giant resonances can help us elucidate the structure of these fascinating objects.

  13. Two giant stellar complexes

    Science.gov (United States)

    Efremov, Yu. N.; Efremov, E. Yu.

    Common star complexes are huge (0.3-1 kpc in diameter) groups of relatively young stars, associations and clusters. The complexes usually form regular chains along spiral arms of grand design galaxies, being evidently formed and supported by magneto- gravitational instability developing along an arm. Special attention is given to a few large complexes which have signatures of gravitational boundness, such as round shape and high central density. Concentrations of stars and clusters in such a complex in M51 galaxy were found in this paper; we concluded it is possible to suggest that the complex is gravitationally bound. It is also stressed that some properties of the giant complex in NGC 6946 (such as its semicircular and sharp Western edge) are still enigmatic.

  14. Giant Congenital Melanocytic Nevus

    DEFF Research Database (Denmark)

    Rasmussen, Bo Sonnich; Henriksen, Trine Foged; Kølle, Stig-Frederik Trojahn;

    2015-01-01

    % versus 44% required unplanned additional surgery, respectively. Complications were noted in 25% and 67% of the patients, respectively. Cosmetic result was satisfying in 76% of patients without difference between the groups. No malignant transformation was found during a mean follow-up of 11 years......Giant congenital melanocytic nevi (GCMN) occur in 1:20,000 livebirths and are associated with increased risk of malignant transformation. The treatment of GCMN from 1981 to 2010 in a tertiary referral center was reviewed evaluating the modalities used, cosmetic results, associated complications......, and malignant transformation. Of 35 patients, 25 underwent surgery. Curettage was most frequently used (64%) followed by excision and tissue expansion (20%). Six percent of the patients treated with curettage, and 78% of the patients who received excision surgery required more than 1 planned procedure, and 25...

  15. Landscape of the lost giants

    Science.gov (United States)

    2013-09-01

    The Pleistocene megafauna extinction erased a group of remarkable animals. Whether humans had a prominent role in the extinction remains controversial, but it is emerging that the disappearance of the giants has markedly affected the environment.

  16. Modeling and Simulation for Giant Forging Hydraulic Press Synchronous Control System%巨型模锻液压机同步控制系统建模及仿真

    Institute of Scientific and Technical Information of China (English)

    刘忠伟; 邓英剑

    2014-01-01

    In order to improve the rapid response of a giant die forging hydraulic press synchronous control system,based on 300 MN die forging hydraulic press,the synchronous control system was re-designed according to the characteristics of 800 MN die forging hydraulic press,and based on hydraulic theory and dynamics theory,a model of the synchronization control system was jointly established when moving beam run.On the basis of that,two kind of schemes were compared through simula-tions,the simulation results show that the new design of 800 MN synchronous control system response characteristics is substantially improved,the response speed and dynamic and static precision are of a large improvement.%为了提高巨型模锻液压机同步控制系统的快速响应性,在300 MN 模锻液压机的基础上,针对800 MN 模锻液压机的特点重新设计了同步控制系统,并基于液压基础理论和动力学理论,联合建立了活动横梁运行时同步控制系统的整体数学模型。将原方案和现有方案进行了对比仿真,结果表明:新设计的800 MN 同步控制系统的响应特性较原方案的响应特性有较大幅度的改善,响应速度和动静态精度均有较大提高。

  17. GIANT MELANOCYTIC NEVUS IN GARMENT

    Directory of Open Access Journals (Sweden)

    González-Coquel Suanny del Carmen

    2015-01-01

    Full Text Available Introduction: the Giant Congenital Melanocytic Nevus (GCMN is a pigmented lesion of great size, usually presented since the birth, although some lesions could appear in the first months of life. It is an atypical benign proliferation of melanocytes in the skin that could have curious morphologies. It is associated in some cases to extracutaneous manifestations and melanoma development. It is characterized by a hyperpigmented lesion in different tones of brown and could affect since the brain until the lower limbs. The most frequent location is the posterior trunk, the face, scalp and extremities. Case report: the case of a young female patient with GCMN «in garment» with several satellite lesions is presented in order to carry out a thematic review and to indicate the importance of the control period and following. Conclusion: the GCMN is a benign cutaneous alteration that implies serious esthetic disorders when it increases its size. The treatment difficulties and the medico-social implications must be kept in mind. Rev.cienc.biomed. 2015;6(1:155-159 KEYWORDS Nevus, Pigmented nevus; Melanoma; Melanocytes.

  18. Effect assessment of Puccinia xanthii f sp ambrosiae-trifidae as a biocontrol agent to control giant ragweed%苍耳柄锈菌三裂叶豚草专化型对三裂叶豚草控制效果评价

    Institute of Scientific and Technical Information of China (English)

    丁建云; 姚丹丹; 陈继东; 崔建臣; 胡冬雪; 张小利

    2014-01-01

    Based on data from systematic investigation of giant ragweed inoculated with Puccinia xanthii f. sp. ambrosiae-trifidae in field in Huairou area in 2011-2013, the occurrence regularity and biocontrol effect of giant ragweed rust were evaluated. The results indicated that giant ragweed rust was natural epidemic in Baoshan Temple area in Huairou. Giant ragweed rust occurred in early June. All the giant ragweed plants were almost infected in the middle of July and some infected plants were died. P.xanthii f. sp. ambrosiae-trifidae exhibits good control effect on growth, seed amount and seed weight of giant ragweed. The death rate of the infected giant ragweed plants was nearly 30% in the end of September and the death plants had no seed.%2011~2013年在北京怀柔宝山寺地区通过野外接菌后定点定株系统调查,探索三裂叶豚草锈病的流行规律,评价苍耳柄锈菌三裂叶豚草专化型对三裂叶豚草的控制效果。结果表明:苍耳柄锈菌三裂叶豚草专化型在北京怀柔宝山寺地区能完成周年侵染循环:6月初三裂叶豚草开始有感染锈病症状,7月中、下旬几乎全部三裂叶豚草植株感病,且开始有整株死亡。苍耳柄锈菌三裂叶豚草专化型对三裂叶豚草有较好的控制效果:该菌抑制三裂叶豚草植株生长,减少种子数量,减轻种子重量,9月末30%左右的感病三裂叶豚草植株死亡,死亡植株不能产生种子。

  19. Giant high occipital encephalocele

    Directory of Open Access Journals (Sweden)

    Agrawal Amit

    2016-03-01

    Full Text Available Encephaloceles are rare embryological mesenchymal developmental anomalies resulting from inappropriate ossification in skull through with herniation of intracranial contents of the sac. Encephaloceles are classified based on location of the osseous defect and contents of sac. Convexity encephalocele with osseous defect in occipital bone is called occipital encephalocele. Giant occipital encephaloceles can be sometimes larger than the size of baby skull itself and they pose a great surgical challenge. Occipital encephaloceles (OE are further classified as high OE when defect is only in occipital bone above the foramen magnum, low OE when involving occipital bone and foramen magnum and occipito-cervical when there involvement of occipital bone, foramen magnum and posterior upper neural arches. Chiari III malformation can be associated with high or low occipital encephaloceles. Pre-operatively, it is essential to know the size of the sac, contents of the sac, relation to the adjacent structures, presence or absence of venous sinuses/vascular structures and osseous defect size. Sometimes it becomes imperative to perform both CT and MRI for the necessary information. Volume rendered CT images can depict the relation of osseous defect to foramen magnum and provide information about upper neural arches which is necessary in classifying these lesions.

  20. Rotation of Giant Stars

    CERN Document Server

    Kissin, Yevgeni

    2015-01-01

    The internal rotation of post-main sequence stars is investigated, in response to the convective pumping of angular momentum toward the stellar core, combined with a tight magnetic coupling between core and envelope. The spin evolution is calculated using model stars of initial mass 1, 1.5 and $5\\,M_\\odot$, taking into account mass loss on the giant branches and the partitioning of angular momentum between the outer and inner envelope. We also include the deposition of orbital angular momentum from a sub-stellar companion, as influenced by tidal drag as well as the excitation of orbital eccentricity by a fluctuating gravitational quadrupole moment. A range of angular velocity profiles $\\Omega(r)$ is considered in the deep convective envelope, ranging from solid rotation to constant specific angular momentum. We focus on the backreaction of the Coriolis force on the inward pumping of angular momentum, and the threshold for dynamo action in the inner envelope. Quantitative agreement with measurements of core ro...

  1. Recurrent renal giant leiomyosarcoma.

    Science.gov (United States)

    Öziş, Salih Erpulat; Gülpınar, Kamil; Şahlı, Zafer; Konak, Baha Burak; Keskin, Mete; Özdemir, Süleyman; Ataoğlu, Ömür

    2016-01-01

    Primary renal leiomyosarcomas are rare, aggressive tumors. They constitute 1-2% of adult malignant renal tumors. Although leiomyosarcomas are the most common histological type (50-60%) of renal sarcomas, information on renal leiomyosarcoma is limited. Local or systemic recurrences are common. The radiological appearance of renal leiomyosarcomas is not specific, therefore renal leiomyosarcoma cannot be distinguished from renal cell carcinoma by imaging methods in all patients. A 74-year-old female patient presented to our clinic complaining of a palpable mass on the right side of her abdomen in November 2012. The abdominal magnetic resonance imaging revealed a mass, 25 × 24 × 23 cm in size. Her past medical history revealed that she has undergone right radical nephrectomy in 2007, due to a 11 × 12 × 13 cm renal mass that was then reported as renal cell carcinoma on abdominal magnetic resonance imaging, but the pathological diagnosis was low-grade renal leiomyosarcoma. The most recent follow-up of the patient was in 2011, with no signs of local recurrence or distant metastases within this four-year period. The patient underwent laparotomy on November 2012, and a 35 cm retroperitoneal mass was excised. The pathological examination of the mass was reported as high-grade leiomyosarcoma. The formation of this giant retroperitoneal mass in 1 year can be explained by the transformation of the lesion's pathology from low-grade to a high-grade tumor. PMID:27436926

  2. Imaging Extrasolar Giant Planets

    CERN Document Server

    Bowler, Brendan P

    2016-01-01

    High-contrast adaptive optics imaging is a powerful technique to probe the architectures of planetary systems from the outside-in and survey the atmospheres of self-luminous giant planets. Direct imaging has rapidly matured over the past decade and especially the last few years with the advent of high-order adaptive optics systems, dedicated planet-finding instruments with specialized coronagraphs, and innovative observing and post-processing strategies to suppress speckle noise. This review summarizes recent progress in high-contrast imaging with particular emphasis on observational results, discoveries near and below the deuterium-burning limit, and a practical overview of large-scale surveys and dedicated instruments. I conclude with a statistical meta-analysis of deep imaging surveys in the literature. Based on observations of 384 unique and single young ($\\approx$5--300~Myr) stars spanning stellar masses between 0.1--3.0~\\Msun, the overall occurrence rate of 5--13~\\Mjup \\ companions at orbital distances ...

  3. Bringing Low the Giants

    CERN Multimedia

    2001-01-01

    Their work goes on unseen, because they a hundred metres beneath your feet. But while the race against the clock to build the LHC has begun on the surface, teams underground are feverishly engaged to dismantle LEP and its experiments. Four months after the start of dismantling, the technical coordinators of the different experiments discuss the progress of work. Little men attack the giant ALEPH. The barrel and its two endcaps have been removed to the end of the cavern and stripped of their cables. The breaking up of the detector can now begin. At ALEPH, counting rooms removed all in one go Jean-Paul Fabre, technical coordinator at ALEPH:'After making safe the structure, the first step was to remove the wiring and cables. Some 210 cubic metres were brought out. Then the counting rooms all round the detector were taken out. They were brought up from the cavern all in one go, up through the shaft, which is 10 metres wide and 150 metres deep. They made it with 15 centimetres to spare. They have been emptied of...

  4. Giant Magellan Telescope: overview

    Science.gov (United States)

    Johns, Matt; McCarthy, Patrick; Raybould, Keith; Bouchez, Antonin; Farahani, Arash; Filgueira, Jose; Jacoby, George; Shectman, Steve; Sheehan, Michael

    2012-09-01

    The Giant Magellan Telescope (GMT) is a 25-meter optical/infrared extremely large telescope that is being built by an international consortium of universities and research institutions. It will be located at the Las Campanas Observatory, Chile. The GMT primary mirror consists of seven 8.4-m borosilicate honeycomb mirror segments made at the Steward Observatory Mirror Lab (SOML). Six identical off-axis segments and one on-axis segment are arranged on a single nearly-paraboloidal parent surface having an overall focal ratio of f/0.7. The fabrication, testing and verification procedures required to produce the closely-matched off-axis mirror segments were developed during the production of the first mirror. Production of the second and third off-axis segments is underway. GMT incorporates a seven-segment Gregorian adaptive secondary to implement three modes of adaptive-optics operation: natural-guide star AO, laser-tomography AO, and ground-layer AO. A wide-field corrector/ADC is available for use in seeing-limited mode over a 20-arcmin diameter field of view. Up to seven instruments can be mounted simultaneously on the telescope in a large Gregorian Instrument Rotator. Conceptual design studies were completed for six AO and seeing-limited instruments, plus a multi-object fiber feed, and a roadmap for phased deployment of the GMT instrument suite is being developed. The partner institutions have made firm commitments for approximately 45% of the funds required to build the telescope. Project Office efforts are currently focused on advancing the telescope and enclosure design in preparation for subsystem- and system-level preliminary design reviews which are scheduled to be completed in the first half of 2013.

  5. Sequencing and analysis of the giant panda genome

    Institute of Scientific and Technical Information of China (English)

    YANG HuanMing

    2010-01-01

    @@ The giant panda (Ailuropoda melanoleuca) is loved all over the world and is considered a symbol of China, as illustrated by its being one of the mascots for the Beijing 2008 Olympic Games.It is also one of the world's most endangered animals and a flagship species for conservation.Using next-generation sequencing technology (Illumina Genome Analyzer) and our in-house assembly software, we have generated the first map of the giant panda genome sequence.This map will provide an unparalleled amount of information to aid in understanding the genetic and biological nature of this unique species and will contribute significantly to disease control and conservation efforts for this endangered species.In March 2008, the giant panda genome sequencing and analysis project was started at the Beijing Genomics Institute (BGI) in Shenzhen with collaborators from the Kunming Institute of Zoology and the Chengdu Research Base of Giant Panda Breeding.On 21 Jan.2010, this collaboration resulted in the publication, as a cover story in the journal Nature, of the sequencing and analysis of the giant panda genome.

  6. Giant myoma and erythrocytosis syndrome.

    Science.gov (United States)

    Ozsaran, A A; Itil, I M; Terek, C; Kazandi, M; Dikmen, Y

    1999-08-01

    The objective of this study is to discuss the myomatous erythrocytosis syndrome in a patient with a giant subserous uterine myoma. She presented with plethora and an abdominal mass. After venesection of 4 units of blood, the preoperative haematocrit value of 53.3% and haemoglobin value of 17.5 g/dL had decreased to 48.6% and 16.8 g/dL levels, respectively. After the operative extraction of the giant subserous myoma with attached uterus weighing 14.2 kg, the haematocrit and the haemoglobin values had regressed to 40.3% and 14.3 g/dL levels, respectively. The findings indicated that the giant subserous myoma was the cause of the myomatous erythrocytosis syndrome in this patient. PMID:10554963

  7. Giant eucalypts - globally unique fire-adapted rain-forest trees?

    Science.gov (United States)

    Tng, D Y P; Williamson, G J; Jordan, G J; Bowman, D M J S

    2012-11-01

    CONTENTS: Summary    1 I. Introduction    1 II. Giant eucalypts in a global context    2 III. Giant eucalypts - taxonomy and distribution    4 IV. Growth of giant eucalypts    6 V. Fire and regeneration of giant eucalypts    8 VI. Are giant eucalypts different from other rain-forest trees?    9 VII. Conclusions 10 Acknowledgements 11 References 11 SUMMARY: Tree species exceeding 70 m in height are rare globally. Giant gymnosperms are concentrated near the Pacific coast of the USA, while the tallest angiosperms are eucalypts (Eucalyptus spp.) in southern and eastern Australia. Giant eucalypts co-occur with rain-forest trees in eastern Australia, creating unique vegetation communities comprising fire-dependent trees above fire-intolerant rain-forest. However, giant eucalypts can also tower over shrubby understoreys (e.g. in Western Australia). The local abundance of giant eucalypts is controlled by interactions between fire activity and landscape setting. Giant eucalypts have features that increase flammability (e.g. oil-rich foliage and open crowns) relative to other rain-forest trees but it is debatable if these features are adaptations. Probable drivers of eucalypt gigantism are intense intra-specific competition following severe fires, and inter-specific competition among adult trees. However, we suggest that this was made possible by a general capacity of eucalypts for 'hyper-emergence'. We argue that, because giant eucalypts occur in rain-forest climates and share traits with rain-forest pioneers, they should be regarded as long-lived rain-forest pioneers, albeit with a particular dependence on fire for regeneration. These unique ecosystems are of high conservation value, following substantial clearing and logging over 150 yr. PMID:23121314

  8. Giant pulses in Millisecond Pulsars

    CERN Document Server

    Joshi, B C; Lyne, A G; McLaughlin, M; Stairs, I H

    2003-01-01

    Giant pulses (GPs), occasional individual pulses with an intensity 100 times the average intensity, have been detected in four pulsars todate. Their origin is not well understood, but studies suggest a connection between the strength of magnetic field at the light cylinder B_lc and the existence of GPs. Here, we report on detection of significant Large Amplitude Pulses (LAPs) in two more pulsars with high values of B_lc, PSRs J0218+4232 and B1957+20, observed using Giant Meterwave Radio Telescope (GMRT).

  9. Imaging of giant pituitary adenomas

    International Nuclear Information System (INIS)

    We present five proven giant pituitary adenomas studied by CT and MRI, and review the clinical and imaging findings. Our aim was to examine the radiologic appearances and to search for criteria useful in distinguishing these tumors from other sellar and suprasellar tumours, mainly craniopharyngioma. The main differences from small adenomas were high prevalence of macrocysts, a more invasive behaviour and a clinical picture dominated by mass effect rather than endocrine disturbance. Factors supporting the diagnosis of pituitary adenoma in a giant intra- and suprasellar mass include: infrasellar extension, absence of calcification and presence of low-signal cysts on T1-weighted images. (orig.) (orig.)

  10. Cabergoline Treatment in Invasive Giant Prolactinoma

    OpenAIRE

    Sadeem Alsubaie; Almalki, Mussa H.

    2014-01-01

    Patients with invasive giant prolactinoma suffer from a constellation of symptoms including headache, blurred vision, lethargy, and sexual dysfunction. Cabergoline, a potent dopamine agonist, is a known medication prescribed for the treatment of invasive giant prolactinoma. Here, we report a case of invasive giant prolactinoma in a 52-year-old Saudi male with dramatic response to cabergoline treatment clinically, biochemically, and radiologically.

  11. The MADS Domain Protein DIANA Acts Together with AGAMOUS-LIKE80 to Specify the Central Cell in Arabidopsis Ovules[W

    Science.gov (United States)

    Bemer, Marian; Wolters-Arts, Mieke; Grossniklaus, Ueli; Angenent, Gerco C.

    2008-01-01

    MADS box genes in plants consist of MIKC-type and type I genes. While MIKC-type genes have been studied extensively, the functions of type I genes are still poorly understood. Evidence suggests that type I MADS box genes are involved in embryo sac and seed development. We investigated two independent T-DNA insertion alleles of the Arabidopsis thaliana type I MADS box gene AGAMOUS-LIKE61 (AGL61) and showed that in agl61 mutant ovules, the polar nuclei do not fuse and central cell morphology is aberrant. Furthermore, the central cell begins to degenerate before fertilization takes place. Although pollen tubes are attracted and perceived by the mutant ovules, neither endosperm development nor zygote formation occurs. AGL61 is expressed in the central cell during the final stages of embryo sac development. An AGL61:green fluorescent protein–β-glucoronidase fusion protein localizes exclusively to the polar nuclei and the secondary nucleus of the central cell. Yeast two-hybrid analysis showed that AGL61 can form a heterodimer with AGL80 and that the nuclear localization of AGL61 is lost in the agl80 mutant. Thus, AGL61 and AGL80 appear to function together to differentiate the central cell in Arabidopsis. We renamed AGL61 DIANA, after the virginal Roman goddess of the hunt. PMID:18713950

  12. Phylogenetic analysis of AGAMOUS sequences reveals the origin of the diploid and tetraploid forms of self-pollinating wild buckwheat, Fagopyrum homotropicum Ohnishi.

    Science.gov (United States)

    Tomiyoshi, Mitsuyuki; Yasui, Yasuo; Ohsako, Takanori; Li, Cheng-Yun; Ohnishi, Ohmi

    2012-09-01

    Fagopyrum homotropicum Ohnishi is a self-pollinating wild buckwheat species indigenous to eastern Tibet and the Yunnan and Sichuan Provinces of China. It is useful breeding material for shifting cultivated buckwheat (F. esculentum ssp. esculentum Moench) from out-crossing to self-pollinating. Despite its importance as a genetic resource in buckwheat breeding, the genetic variation of F. homotropicum is poorly understood. In this study, we investigated the genetic variation and phylogenetic relationships of the diploid and tetraploid forms of F. homotropicum based on the nucleotide sequences of a nuclear gene, AGAMOUS (AG). Neighbor-joining analysis revealed that representative individuals clustered into three large groups (Group I, II and III). Each group contained diploid and tetraploid forms of F. homotropicum. We identified tetraploid plants that had two diverged AG sequences; one belonging to Group I and the other belonging to Group II, or one belonging to Group II and the other belonging to Group III. These results suggest that the tetraploid form originated from at least two hybridization events between deeply differentiated diploids. The results also imply that the genetic diversity contributed by tetraploidization of differentiated diploids may have allowed the distribution range of F. homotropicum to expand to the northern areas of China.

  13. Giant lipomas of the hand

    Directory of Open Access Journals (Sweden)

    Gokce Yildiran

    2015-04-01

    Conclusion: Giant lipomas of the hand are very rare and may cause compressions and other complications. Thus, they require a careful preoperative evaluation in order to make a proper differential diagnosis. [Hand Microsurg 2015; 4(1.000: 8-11

  14. A Giant or a Dwarf?

    DEFF Research Database (Denmark)

    Schmid, Herman

    2005-01-01

    EU may appear to be a giant when it can act on behalf of a united Europe, but usually it is hampered by conflicting member state interests. The EU economic and administrative resources for foreign and trade policy are quite small (on level with one of its major member states) and the hopes in man...

  15. Michigan has a sleeping giant

    CERN Multimedia

    Brock, Raymond; Nichols, Sue

    2007-01-01

    "That giant is 750 miles of fiber optic cable that lassoes its three biggest research universities and Van Andel Institute to the future. Its mission: to uncover the nature of the Big Bang by connecton U.S. physicists to their huge experiment ATLAS in Geneva.." (4 pages)

  16. Damping of multiphonon giant resonances

    CERN Document Server

    Dinh Dang, N; Arima, A

    2000-01-01

    The phonon damping model (PDM) is applied to derive the equations that describe the damping of three-, and n -phonon giant resonances. As examples of the application of this approach, the results of numerical calculations for the double giant resonance (DGDR) (n=2) and triple giant dipole resonance (TGDR) (n=3) in sup 9 sup 0 Zr, sup 1 sup 2 sup 0 Sn and sup 2 sup 0 sup 8 Pb are discussed and compared with those obtained by folding independent giant dipole resonances (GDRs) (the folding results). For the DGDR in the double magic nucleus sup 2 sup 0 sup 8 Pb, we found that these results are very close to the folding results. In the open-shell nuclei sup 9 sup 0 Zr and sup 1 sup 2 sup 0 Sn, a clear deviation from the folding results is observed in calculations in agreement with the experimental trend. The results for the integrated strength and energy of TGDR are found to be much closer to the folding results in all three nuclei. The TGDR widths in the open shell nuclei are found to be larger than the folding r...

  17. Giant magnetoresistance in organic spin-valves.

    Science.gov (United States)

    Xiong, Z H; Wu, Di; Vardeny, Z Valy; Shi, Jing

    2004-02-26

    A spin valve is a layered structure of magnetic and non-magnetic (spacer) materials whose electrical resistance depends on the spin state of electrons passing through the device and so can be controlled by an external magnetic field. The discoveries of giant magnetoresistance and tunnelling magnetoresistance in metallic spin valves have revolutionized applications such as magnetic recording and memory, and launched the new field of spin electronics--'spintronics'. Intense research efforts are now devoted to extending these spin-dependent effects to semiconductor materials. But while there have been noteworthy advances in spin injection and detection using inorganic semiconductors, spin-valve devices with semiconducting spacers have not yet been demonstrated. pi-conjugated organic semiconductors may offer a promising alternative approach to semiconductor spintronics, by virtue of their relatively strong electron-phonon coupling and large spin coherence. Here we report the injection, transport and detection of spin-polarized carriers using an organic semiconductor as the spacer layer in a spin-valve structure, yielding low-temperature giant magnetoresistance effects as large as 40 per cent. PMID:14985756

  18. Crystal and solution studies of the "Plus-C" odorant-binding protein 48 from Anopheles gambiae: control of binding specificity through three-dimensional domain swapping.

    Science.gov (United States)

    Tsitsanou, Katerina E; Drakou, Christina E; Thireou, Trias; Vitlin Gruber, Anna; Kythreoti, Georgia; Azem, Abdussalam; Fessas, Dimitrios; Eliopoulos, Elias; Iatrou, Kostas; Zographos, Spyros E

    2013-11-15

    Much physiological and behavioral evidence has been provided suggesting that insect odorant-binding proteins (OBPs) are indispensable for odorant recognition and thus are appealing targets for structure-based discovery and design of novel host-seeking disruptors. Despite the fact that more than 60 putative OBP-encoding genes have been identified in the malaria vector Anopheles gambiae, the crystal structures of only six of them are known. It is therefore clear that OBP structure determination constitutes the bottleneck for structure-based approaches to mosquito repellent/attractant discovery. Here, we describe the three-dimensional structure of an A. gambiae "Plus-C" group OBP (AgamOBP48), which exhibits the second highest expression levels in female antennae. This structure represents the first example of a three-dimensional domain-swapped dimer in dipteran species. A combined binding site is formed at the dimer interface by equal contribution of each monomer. Structural comparisons with the monomeric AgamOBP47 revealed that the major structural difference between the two Plus-C proteins localizes in their N- and C-terminal regions, and their concerted conformational change may account for monomer-swapped dimer conversion and furthermore the formation of novel binding pockets. Using a combination of gel filtration chromatography, differential scanning calorimetry, and analytical ultracentrifugation, we demonstrate the AgamOBP48 dimerization in solution. Eventually, molecular modeling calculations were used to predict the binding mode of the most potent synthetic ligand of AgamOBP48 known so far, discovered by ligand- and structure-based virtual screening. The structure-aided identification of multiple OBP binders represents a powerful tool to be employed in the effort to control transmission of the vector-borne diseases. PMID:24097978

  19. Microsatellite DNA analysis proves nucleus of interspecies reconstructed blastocyst coming from that of donor giant panda

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    A method for DNA isolation from early development of blastocyst and further analysis of nuclear and mitochondrial DNA was developed in present study. Total DNA was prepared from interspecies reconstructed blastocyst and a giant panda specific microsatellite locus g010 was successfully amplified. DNA sequencing of the PCR product showed that two sequences of reconstructed blastocysts are the same as that of positive control giant panda. Our results prove that the nucleus of interspecies reconstructed blastocyst comes from somatic nucleus of donor giant panda.

  20. [Giant intradiploic infratentorial epidermoid cyst].

    Science.gov (United States)

    Alberione, F; Caire, F; Fischer-Lokou, D; Gueye, M; Moreau, J J

    2007-10-01

    Epidermoid cysts are benign, uncommon lesions (1% of all intracranial tumors). Their localization is intradiploic in 25% of cases, and exceptionally subtentorial. We report here a rare case of giant intradiploic infratentorial epidermoid cyst. A 74-year old patient presented with recent diplopia and sindrome cerebellar. CT scan and MR imaging revealed a giant osteolytic extradural lesion of the posterior fossa (5.2 cm x 3.8 cm) with a small area of peripheral enhancement after contrast injection. Retrosigmoid suboccipital craniectomy allowed a satisfactory removal of the tumor, followed by an acrylic cranioplasty. The outcome was good. Neuropathological examination confirmed an epidermoid cyst. We review the literature and discuss our case. PMID:18008017

  1. Evaluation of stem injection for managing giant reed (Arundo donax).

    Science.gov (United States)

    Spencer, David F

    2014-01-01

    Giant reed is an emergent aquatic plant that may be weedy in riparian habitats. Two herbicides approved for controlling giant reed in the US are glyphosate (N-(phosphonomethyl) glycine) and imazapyr (2-[4,5-dihydro-4-methyl-4-(1-methylethyl)-5-oxo-1H-imidazol-2-yl]-3-pyridinecarboxylic acid). Foliar applications of these herbicides may be restricted in some areas, such as those, which are within the range of threatened or endangered species. We conducted two field experiments at sites in northern and central California. The first experiment evaluated the effects of three aquatic herbicides (glyphosate, imazapyr, and triclopyr [(3,5,6-trichloro-2-pyridinyl)oxy]acetic acid) injected into all of the stems within a giant reed (5 mL stem(-1)). In this experiment, leaf chlorophyll content, the proportion of living stems, and the number of new stems produced during the year after treatment declined (>80%) following injection of either full strength glyphosate or imazapyr. The effects of injecting full strength triclopyr were considerably less. In a second experiment, different proportions (0, 10%, 25%, or 100%) of the stems within a plant were injected with full strength glyphosate. Results indicated that it was necessary to inject all of the stems within a clump to achieve the greatest reduction in the plant growth characteristics measured. These results imply that giant reed may be successfully controlled by injecting full strength glyphosate (5 mL stem(-1)) into all of the stems within a clump. While labor intensive and thus potentially more costly this method, offers a new method for managing giant reed in sensitive sites where foliar spray applications may be restricted.

  2. Evaluation of stem injection for managing giant reed (Arundo donax).

    Science.gov (United States)

    Spencer, David F

    2014-01-01

    Giant reed is an emergent aquatic plant that may be weedy in riparian habitats. Two herbicides approved for controlling giant reed in the US are glyphosate (N-(phosphonomethyl) glycine) and imazapyr (2-[4,5-dihydro-4-methyl-4-(1-methylethyl)-5-oxo-1H-imidazol-2-yl]-3-pyridinecarboxylic acid). Foliar applications of these herbicides may be restricted in some areas, such as those, which are within the range of threatened or endangered species. We conducted two field experiments at sites in northern and central California. The first experiment evaluated the effects of three aquatic herbicides (glyphosate, imazapyr, and triclopyr [(3,5,6-trichloro-2-pyridinyl)oxy]acetic acid) injected into all of the stems within a giant reed (5 mL stem(-1)). In this experiment, leaf chlorophyll content, the proportion of living stems, and the number of new stems produced during the year after treatment declined (>80%) following injection of either full strength glyphosate or imazapyr. The effects of injecting full strength triclopyr were considerably less. In a second experiment, different proportions (0, 10%, 25%, or 100%) of the stems within a plant were injected with full strength glyphosate. Results indicated that it was necessary to inject all of the stems within a clump to achieve the greatest reduction in the plant growth characteristics measured. These results imply that giant reed may be successfully controlled by injecting full strength glyphosate (5 mL stem(-1)) into all of the stems within a clump. While labor intensive and thus potentially more costly this method, offers a new method for managing giant reed in sensitive sites where foliar spray applications may be restricted. PMID:25035911

  3. Idiopathic giant right atrial aneurysm

    International Nuclear Information System (INIS)

    A 2-year-old boy with an incidental finding of massive cardiomegaly on a chest X-ray was diagnosed with a giant right atrial aneurysm upon further investigation with echocardiography. The patient underwent successful surgical reduction of the right atrium and closure of the patent foramen ovale to prevent thromboembolic complications and to lower the risk of atrial arrhythmias. The resected atrium had paper-thin walls and pathological features of interstitial fibrosis with endocardial thickening

  4. Observed Properties of Giant Cells

    Science.gov (United States)

    Hathaway, David H.; Upton, Lisa; Colegrove, Owen

    2014-01-01

    The existence of Giant Cells has been suggested by both theory and observation for over 45 years. We have tracked the motions of supergranules in SDO/HMI Doppler velocity data and find larger (Giant Cell) flows that persist for months. The flows in these cells are clockwise around centers of divergence in the north and counter-clockwise in the south. Equatorward flows are correlated with prograde flows - giving the transport of angular momentum toward the equator that is needed to maintain the Sun's rapid equatorial rotation. The cells are most pronounced at mid- and high-latitudes where they exhibit the rotation rates representative of those latitudes. These are clearly large, long-lived, cellular features, with the dynamical characteristics expected from the effects of the Sun's rotation, but the shapes of the cells are not well represented in numerical models. While the Giant Cell flow velocities are small (<10 m/s), their long lifetimes should nonetheless substantially impact the transport of magnetic flux in the Sun's near surface layers.

  5. KEPLER RAPIDLY ROTATING GIANT STARS

    Energy Technology Data Exchange (ETDEWEB)

    Costa, A. D.; Martins, B. L. Canto; Bravo, J. P.; Paz-Chinchón, F.; Chagas, M. L. das; Leão, I. C.; Oliveira, G. Pereira de; Silva, R. Rodrigues da; Roque, S.; Oliveira, L. L. A. de; Silva, D. Freire da; De Medeiros, J. R., E-mail: renan@dfte.ufrn.br [Departamento de Física Teórica e Experimental, Universidade Federal do Rio Grande do Norte, Campus Universitário, Natal RN (Brazil)

    2015-07-10

    Rapidly rotating giant stars are relatively rare and may represent important stages of stellar evolution, resulting from stellar coalescence of close binary systems or accretion of substellar companions by their hosting stars. In the present Letter, we report 17 giant stars observed in the scope of the Kepler space mission exhibiting rapid rotation behavior. For the first time, the abnormal rotational behavior for this puzzling family of stars is revealed by direct measurements of rotation, namely from photometric rotation period, exhibiting a very short rotation period with values ranging from 13 to 55 days. This finding points to remarkable surface rotation rates, up to 18 times the rotation of the Sun. These giants are combined with six others recently listed in the literature for mid-infrared (IR) diagnostics based on Wide-field Infrared Survey Explorer information, from which a trend for an IR excess is revealed for at least one-half of the stars, but at a level far lower than the dust excess emission shown by planet-bearing main-sequence stars.

  6. Kepler rapidly rotating giant stars

    CERN Document Server

    Costa, A D; Bravo, J P; Paz-Chinchón, F; Chagas, M L das; Leão, I C; de Oliveira, G Pereira; da Silva, R Rodrigues; Roque, S; de Oliveira, L L A; da Silva, D Freire; De Medeiros, J R

    2015-01-01

    Rapidly rotating giant stars are relatively rare and may represent important stages of stellar evolution, resulting from stellar coalescence of close binary systems or accretion of sub-stellar companions by their hosting stars. In the present letter we report 17 giant stars observed in the scope of the Kepler space mission exhibiting rapid rotation behavior. For the first time the abnormal rotational behavior for this puzzling family of stars is revealed by direct measurements of rotation, namely from photometric rotation period, exhibiting very short rotation period with values ranging from 13 to 55 days. This finding points for remarkable surface rotation rates, up to 18 times the Sun rotation. These giants are combined with 6 other recently listed in the literature for mid-IR diagnostic based on WISE information, from which a trend for an infrared excess is revealed for at least a half of the stars, but at a level far lower than the dust excess emission shown by planet-bearing main-sequence stars.

  7. The conjunction of factors that lead to formation of giant gold provinces and deposits in non-arc settings

    Science.gov (United States)

    Groves, David I.; Goldfarb, Richard J.; Santosh, M.

    2016-01-01

    It is quite evident that it is not anomalous metal transport, nor unique depositional conditions, nor any single factor at the deposit scale, that dictates whether a mineral deposit becomes a giant or not. A hierarchical approach thus is required to progressively examine controlling parameters at successively decreasing scales in the total mineral system to understand the location of giant gold deposits in non-arc environments. For giant orogenic, intrusion-related gold systems (IRGS) and Carlin-type gold deposits and iron oxide-copper-gold (IOCG) deposits, there are common factors among all of these at the lithospheric to crustal scale. All are sited in giant gold provinces controlled by complex fundamental fault or shear zones that follow craton margins or, in the case of most Phanerozoic orogenic giants, define the primary suture zones between tectonic terranes. Giant provinces of IRGS, IOCG, and Carlin-type deposits require melting of metasomatized lithosphere beneath craton margins with ascent of hybrid lamprophyric to granitic magmas and associated heat flux to generate the giant province. The IRGS and IOCG deposits require direct exsolution of volatile-rich magmatic-hydrothermal fluids, whereas the association of such melts with Carlin-type ores is more indirect and enigmatic. Giant orogenic gold provinces show no direct relationship to such magmatism, forming from metamorphic fluids, but show an indirect relationship to lamprophyres that reflect the mantle connectivity of controlling first-order structures.

  8. Testing planet formation theories with Giant stars

    OpenAIRE

    Pasquini, Luca; Doellinger, M. P.; Hatzes, A.; Setiawan, J.; Girardi, L.; Da Silva, L.; de Medeiros, J. R.

    2008-01-01

    Planet searches around evolved giant stars are bringing new insights to planet formation theories by virtue of the broader stellar mass range of the host stars compared to the solar-type stars that have been the subject of most current planet searches programs. These searches among giant stars are producing extremely interesting results. Contrary to main sequence stars planet-hosting giants do not show a tendency of being more metal rich. Even if limited, the statistics also suggest a higher ...

  9. Rapid Formation of Ice Giant Planets

    CERN Document Server

    Boss, A P; Haghighipour, N; Boss, Alan P.; Wetherill, George W.; Haghighipour, Nader

    2002-01-01

    The existence of Uranus and Neptune presents severe difficulties for the core accretion model for the formation of ice giant planets. We suggest an alternative mechanism, namely disk instability leading to the formation of gas giant protoplanets, coagulation and settling of dust grains to form ice/rock cores at their centers, and photoevaporation of their gaseous envelopes by a nearby OB star, as a possible means of forming ice giant planets.

  10. Solitary ulcerated congenital giant juvenile xanthogranuloma

    Directory of Open Access Journals (Sweden)

    Su Yuen Ng

    2015-01-01

    Full Text Available A 3-month-old female patient with a giant ulcerated nodule over the back since birth was diagnosed as congenital giant juvenile xanthogranuloma (JXG based on clinical and histopathological examination. Congenital giant JXG with ulceration at birth is a rare presentation of JXG and commonly misdiagnosed. This case emphasizes the importance of being aware of the myriad presentations of JXG in order to make a correct diagnosis and avoid unnecessary investigations or treatment.

  11. The Orbital Evolution of Gas Giant Planets around Giant Stars

    OpenAIRE

    Villaver, Eva; Livio, Mario

    2009-01-01

    Recent surveys have revealed a lack of close-in planets around evolved stars more massive than 1.2 Msun. Such planets are common around solar-mass stars. We have calculated the orbital evolution of planets around stars with a range of initial masses, and have shown how planetary orbits are affected by the evolution of the stars all the way to the tip of the Red Giant Branch (RGB). We find that tidal interaction can lead to the engulfment of close-in planets by evolved stars. The engulfment is...

  12. Experimental Research on Output Performances of Giant Magnetostrictive Actuator

    Institute of Scientific and Technical Information of China (English)

    LI Guo-ping; CHEN Zi-chen

    2007-01-01

    The paper introduces the performances of magnetostrictive actuators and its applications, discusses the design methods for the structure and internal magnetic circuit of a giant magnetostrictive actuator, and makes tests on the output displacement and force characteristics for an actuator using homemade magnetostrictive material. The experimental result shows that the actuator has satisfactory output precisions and ranges in transient and stable states, and can be used in lowfrequency vibration control system of precise equipment.

  13. Giant magneto-resistance devices

    CERN Document Server

    Hirota, Eiichi; Inomata, Koichiro

    2002-01-01

    This book deals with the application of giant magneto-resistance (GMR) effects to electronic devices. It will appeal to engineers and graduate students in the fields of electronic devices and materials. The main subjects are magnetic sensors with high resolution and magnetic read heads with high sensitivity, required for hard-disk drives with recording densities of several gigabytes. Another important subject is novel magnetic random-access memories (MRAM) with non-volatile non-destructive and radiation-resistant characteristics. Other topics include future GMR devices based on bipolar spin transistors, spin field-effect transistors (FETs) and double-tunnel junctions.

  14. Giant bubble pinch-off

    OpenAIRE

    Bergmann, Raymond; Meer, Van Der; Stijnman, Mark; Sandtke, Marijn; Prosperetti, Andrea; Lohse, Detlef

    2006-01-01

    Self-similarity has been the paradigmatic picture for the pinch-off of a drop. Here we will show through high-speed imaging and boundary integral simulations that the inverse problem, the pinch-off of an air bubble in water, is not self-similar in a strict sense: A disk is quickly pulled through a water surface, leading to a giant, cylindrical void which after collapse creates an upward and a downward jet. Only in the limiting case of large Froude numbers does the purely inertial scaling h(-l...

  15. Enhanced recovery after giant ventral hernia repair

    DEFF Research Database (Denmark)

    Jensen, K K; Brøndum, T L; Harling, H.;

    2016-01-01

    PURPOSE: Giant ventral hernia repair is associated with a high risk of postoperative morbidity and prolonged length of stay (LOS). Enhanced recovery (ERAS) measures have proved to lead to decreased morbidity and LOS after various surgical procedures, but never after giant hernia repair. The curre...

  16. Giant Rings in the CMB Sky

    CERN Document Server

    Kovetz, Ely D; Itzhaki, Nissan

    2010-01-01

    We find a unique direction in the CMB sky around which giant rings have an anomalous mean temperature profile. This direction is in very close alignment with the afore measured anomalously large bulk flow direction. We argue that a cosmic defect seeded by a pre-inflationary particle could explain the giant rings, the large bulk flow and their alignment.

  17. Totally thrombosed giant anterior communicating artery aneurysm

    Directory of Open Access Journals (Sweden)

    V R Roopesh Kumar

    2015-01-01

    Full Text Available Giant anterior communicating artery aneurysmsarerare. Apatient presented with visual dysfunction, gait ataxia and urinary incontinence. MRI showed a giant suprasellar mass.At surgery, the lesion was identified as being an aneurysm arising from the anterior communicating artery.The difficulty in preoperative diagnosis and relevant literature are reviewed.

  18. Internal rotation of red giants by asteroseismology

    Directory of Open Access Journals (Sweden)

    Christensen-Dalsgaard J.

    2013-03-01

    Full Text Available We present an asteroseismic approach to study the dynamics of the stellar interior in red giant stars by asteroseismic inversion of the splittings induced by the stellar rotation on the oscillation frequencies. We show preliminary results obtained for the red giant KIC4448777 observed by the space mission Kepler.

  19. Giant Planet Formation, Evolution, and Internal Structure

    CERN Document Server

    Helled, Ravit; Podolak, Morris; Boley, Aaron; Meru, Farzana; Nayakshin, Sergei; Fortney, Jonathan J; Mayer, Lucio; Alibert, Yann; Boss, Alan P

    2013-01-01

    The large number of detected giant exoplanets offers the opportunity to improve our understanding of the formation mechanism, evolution, and interior structure of gas giant planets. The two main models for giant planet formation are core accretion and disk instability. There are substantial differences between these formation models, including formation timescale, favorable formation location, ideal disk properties for planetary formation, early evolution, planetary composition, etc. First, we summarize the two models including their substantial differences, advantages, and disadvantages, and suggest how theoretical models should be connected to available (and future) data. We next summarize current knowledge of the internal structures of solar- and extrasolar- giant planets. Finally, we suggest the next steps to be taken in giant planet exploration.

  20. Mass Transfer from Giant Donors

    CERN Document Server

    Pavlovskii, K

    2014-01-01

    The stability of mass transfer in binaries with convective giant donors remains an open question in modern astrophysics. There is a significant discrepancy between what the existing methods predict for a response to mass loss of the giant itself, as well as for the mass transfer rate during the Roche lobe overflow. Here we show that the recombination energy in the superadiabatic layer plays an important and hitherto unaccounted-for role in he donor's response to mass loss, in particular on its luminosity and effective temperature. Our improved optically thick nozzle method to calculate the mass transfer rate via $L_1$ allows us to evolve binary systems for a substantial Roche lobe overflow. We propose a new, strengthened criterion for the mass transfer instability, basing it on whether the donor experiences overflow through its outer Lagrangian point. We find that with the new criterion, if the donor has a well-developed outer convective envelope, the critical initial mass ratio for which a binary would evolv...

  1. GIANT MAGNETOSTRICTIVE ACTUATOR IN SERVO VALVE AND MICRO PIPE ROBOT

    Institute of Scientific and Technical Information of China (English)

    Wang Chuanli; Ding Fan; Zhang Yongshun; Li Qipeng

    2005-01-01

    Performance of giant magnetostrictive material (GMM) is introduced. Principle of work, basic structure and key techniques of giant magnetostrictive actuator (GMA) are analyzed. Its dynamic models of magneto-mechanical coupling are established. The structure and principle of the pneumatic servo valve and the micro pipe robot with new homemade GMM are presented. The experiment is carried out under typical working conditions. The experiment results show that the GMM pneumatic servo valve has wide pressure control characteristics, good linearity, and fast response speed. The movement principles of the GMM robot system are reliably feasible and its maximal moving speed is about 8 mm/s. It is preferable to the driving frequency of the robot within 100~300 Hz.

  2. Using Onyx in endovascular embolization of internal carotid artery large or giant aneurysms

    International Nuclear Information System (INIS)

    Background and purpose: Internal carotid artery (ICA) large or giant saccular aneurysms is challenging for endovascular coil embolization and surgical clipping with a high recanalization and rebleeding rate. We report our results using Onyx in the endovascular treatment of ICA large or giant saccular aneurysms. Methods: During 2008–2010, 5 patients with 5 large or giant saccular aneurysms in ICA were treated with a liquid embolic agent (Onyx; Micro Therapeutics, Irvine, CA). One aneurysm was small (<10 mm), 2 were large (≥10 mm, <25 mm) and 2 were giant saccular aneurysms (≥25 mm). Of 3 female and 2 male patients, 3 were incidental and 2 had bleeding. Selective embolization was performed with Onyx alone or a combination with coils. Clinical and anatomic outcomes were assessed with the Modified Glasgow Outcome Scale and follow-up angiography was performed at 4–21 months (mean 12.2 months). Results: Complete aneurysm occlusion was obtained in all of the aneurysms on immediate control angiogram. There was not any procedure-related complication. No recanalization was observed at the follow- up periods. There were 2 ICA occlusions in giant ICA aneurysms. The 5 patients were all clinically asymptomatic at follow-up. Conclusion: Endovascular embolization with Onyx is a useful treatment for ICA large or giant aneurysms, which is unsuitable for coiling or surgical treatment.

  3. Aberrant DNA methylation of cancer-related genes in giant breast fibroadenoma: a case report

    Directory of Open Access Journals (Sweden)

    Orozco Javier I

    2011-10-01

    Full Text Available Abstract Introduction Giant fibroadenoma is an uncommon variant of benign breast lesions. Aberrant methylation of CpG islands in promoter regions is known to be involved in the silencing of genes (for example, tumor-suppressor genes and appears to be an early event in the etiology of breast carcinogenesis. Only hypermethylation of p16INK4a has been reported in non-giant breast fibroadenoma. In this particular case, there are no previously published data on epigenetic alterations in giant fibroadenomas. Our previous results, based on the analysis of 49 cancer-related CpG islands have confirmed that the aberrant methylation is specific to malignant breast tumors and that it is completely absent in normal breast tissue and breast fibroadenomas. Case presentation A 13-year-old Hispanic girl was referred after she had noted a progressive development of a mass in her left breast. On physical examination, a 10 × 10 cm lump was detected and axillary lymph nodes were not enlarged. After surgical removal the lump was diagnosed as a giant fibroadenoma. Because of the high growth rate of this benign tumor, we decided to analyze the methylation status of 49 CpG islands related to cell growth control. We have identified the methylation of five cancer-related CpG islands in the giant fibroadenoma tissue: ESR1, MGMT, WT-1, BRCA2 and CD44. Conclusion In this case report we show for the first time the methylation analysis of a giant fibroadenoma. The detection of methylation of these five cancer-related regions indicates substantial epigenomic differences with non-giant fibroadenomas. Epigenetic alterations could explain the higher growth rate of this tumor. Our data contribute to the growing knowledge of aberrant methylation in breast diseases. In this particular case, there exist no previous data regarding the role of methylation in giant fibroadenomas, considered by definition as a benign breast lesion.

  4. Giant cell tumor of the spine.

    Science.gov (United States)

    Ozaki, Toshifumi; Liljenqvist, Ulf; Halm, Henry; Hillmann, Axel; Gosheger, Georg; Winkelmann, Winfried

    2002-08-01

    Six patients with giant cell tumor of the spine had surgery between 1981 and 1995. Three lesions were located in the scrum, two lesions were in the thoracic spine, and one lesion was in the lumbar spine. Preoperatively, all patients had local pain and neurologic symptoms. Two patients had cement implanted after curettage or intralesional excision of the sacral tumor; one patient had a local relapse. After the second curettage and cement implantation, the tumor was controlled. One patient with a sacral lesion had marginal excision and spondylodesis; no relapse developed. Two patients with thoracic lesions had planned marginal excision and spondylodesis; the margins finally became intralesional, but no relapse developed. One patient with a lumbar lesion had incomplete removal of the tumor and received postoperative irradiation. At the final followup (median, 69 months), five of six patients were disease-free and one patient died of disease progression. Two of the five surviving patients had pain after standing or neurologic problems. Although some contamination occurred, planning a marginal excision of the lesion seems beneficial for vertebral lesions above the sacrum. Total sacrectomy of a sacral lesion seems to be too invasive when cement implantation can control the lesion. PMID:12151896

  5. Photophoresis boosts giant planet formation

    CERN Document Server

    Teiser, Jens

    2013-01-01

    In the core accretion model of giant planet formation, a solid protoplanetary core begins to accrete gas directly from the nebula when its mass reaches about 5 earth masses. The protoplanet has at most a few million years to reach runaway gas accretion, as young stars lose their gas disks after 10 million years at the latest. Yet gas accretion also brings small dust grains entrained in the gas into the planetary atmosphere. Dust accretion creates an optically thick protoplanetary atmosphere that cannot efficiently radiate away the kinetic energy deposited by incoming planetesimals. A dust-rich atmosphere severely slows down atmospheric cooling, contraction, and inflow of new gas, in contradiction to the observed timescales of planet formation. Here we show that photophoresis is a strong mechanism for pushing dust out of the planetary atmosphere due to the momentum exchange between gas and dust grains. The thermal radiation from the heated inner atmosphere and core is sufficient to levitate dust grains and to ...

  6. Giant tunneling magnetoresistance in silicene

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Yu, E-mail: ywang@semi.ac.cn [Department of Physics, Faculty of Science, Kunming University of Science and Technology, Kunming, 650500 Yunnan (China); Lou, Yiyi [Yiyuan Student Community, Center of Student Community Education and Management, Kunming University of Science and Technology, Kunming, 650500 Yunnan (China)

    2013-11-14

    We have theoretically studied ballistic electron transport in silicene under the manipulation of a pair of ferromagnetic gate. Transport properties like transmission and conductance have been calculated by the standard transfer matrix method for parallel and antiparallel magnetization configurations. It is demonstrated here that, due to the stray field-induced wave-vector filtering effect, remarkable difference in configuration-dependent transport gives rise to a giant tunneling magnetoresistance. In combination with the peculiar buckled structure of silicene and its electric tunable energy gap, the receiving magnetoresistance can be efficiently modulated by the externally-tunable stray field, electrostatic potential, and staggered sublattice potential, providing some flexible strategies to construct silicene-based nanoelectronic device.

  7. Giant trichobezoar mimicking gastric tumour

    International Nuclear Information System (INIS)

    We present a case of giant gastric trichobezoar retrieved through a long gastrotomy in a 40 years old married women from rural Sindh with unreported psychological disturbance. Trichobezoar almost exclusively occur in females with an underlying psychiatric disorder. It has an insidious development of symptoms which accounts for its delayed presentation and large size at the time of diagnosis. They are associated with trichophagia (habit of compulsive hair eating) and are usually diagnosed on CT Scans or upper GI Endoscopy. They can give rise to complications like gastro-duodenal ulceration, haemorrhage, perforation, peritonitis or obstruction with a high rate of mortality. The treatment is endoscopic, laparoscopic or surgical removal and usually followed by psychiatric opinion. (author)

  8. Mapping Directly Imaged Giant Exoplanets

    CERN Document Server

    Kostov, Veselin B

    2012-01-01

    With the increasing number of directly imaged giant exoplanets the current atmosphere models are often not capable of fully explaining the spectra and luminosity of the sources. A particularly challenging component of the atmosphere models is the formation and properties of condensate cloud layers, which fundamentally impact the energetics, opacity, and evolution of the planets. Here we present a suite of techniques that can be used to estimate the level of rotational modulations these planets may show. We propose that the time--resolved observations of such periodic photometric and spectroscopic variations of extrasolar planets due to their rotation can be used as a powerful tool to probe the heterogeneity of their optical surfaces. We address and discuss the following questions: a) what planet properties can be deduced from the light curve and/or spectra, and in particular can we determine rotation periods, spot--coverage, spot colors, spot spectra; b) what is the optimal configuration of instrument/wavelen...

  9. Giant cell tumor of the mandible

    Directory of Open Access Journals (Sweden)

    G V V Giri

    2015-01-01

    Full Text Available Giant cell tumor (GCT of bone is a distinctive neoplasm characterized by abundance of multinucleated giant cells scattered throughout the stroma of mononuclear cells. Its importance lies in recognizing and differentiating the characteristic histology, which at times may mimic several other bone tumors and endocrine disorders ranging from locally aggressive giant cell granulomas to hyperparathyroidism to malignant tumors. The jaw bones account for less than 1% of the lesion.In a literature search, we found only five cases of GCT of jaw bones based on the new criteria. We present a rare case of GCT of the mandible which occurred in a 12-year-old female.

  10. Giant ureteral stone: a case report

    Directory of Open Access Journals (Sweden)

    Davut Akın

    2009-03-01

    Full Text Available Calculi of urinary system may be detected in ureter, bladder, and urethra. Calculi of ureter are commonly solitary and smaller than 2 cm in length. Giant ureteral stone is rare. We present our case of giant ureteral stone with imaging findings. An approximately 10 cm long stone was detected on direct urinary system graphy and intravenous urography of 28 year-old male admitted with left colic pain. The stone was extracted by open ureterolithotomy. The stone was 10 cm in length. Imaging methods are important to localize the stone, evaluate renal function, stage of hydronephrosis, differentiate acute from chronic, and diagnose predisposing factors in cases with giant ureteral stones.

  11. Giant choledochal calculosis: Surgical treatment

    Directory of Open Access Journals (Sweden)

    Hasan Bektas

    2014-01-01

    Full Text Available Context: Gallstone disease is one of the most common surgical pathologies. Choledocholithiasis may occur in some of these cases and require surgical intervention. Although there are relatively non-invasive procedures such as endoscopic retrograde cholangiopancreatography (ERCP, this technique is usually unsuccessful in patients with stones larger than 10 mm. In our case, we aimed to report a giant choledochal stone (15 cm × 4.5 cm, which is rare in surgical practice and our treatment with open surgery. Case Report: The patient was a 59-year-old woman. Magnetic resonance cholangiopancreatography (MRCP had showed a hydropic gallbladder with an excessively dilated CBD and a 110 mm × 41 mm stone. In the operation, an excessively dilated CBD was seen and after choledochotomy and a very large calculus that filled CBD completely. Choledochotomy incision was carried forward and a T-tube choledochostomy with choledochoduodenostomy (CD was performed. The patient was discharged without any complications on postoperative 8 th day. Conclusion: Benign gallstone disease is a multifactorial process, with risk factors such as obesity, hemolytic diseases, diabetes mellitus, and pregnancy. Risk factors for choledocholithiasis are similar to those for gallstone disease. MRCP is a non-invasive technique in detecting choledocholithiasis. The gold standard intervention for CBD stones is ERCP. Stones in CBD may reach very considerable dimensions without causing serious symptoms. The most common symptom is jaundice. During preoperative radiological examination, giant stones may be interfered with malignancies. Surgeons should obey conventional algorithms in diagnosis and open surgery must be kept in mind in earlier stages without being too insistent on endoscopic interventions.

  12. STUDIES ON THE INGESTION CHARACTERISTICS OF GIANT FRESHWATER PRAWN, CHINESE PRAWN AND GIANT TIGER PRAWN

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    The ingestion of giant freshwater prawn, Chinese prawn and giant tiger prawn had continuity and the ingestion high peak occurred at night. Light and temperature had significant effects on the daily ingestion rate (DIR) of giant freshwater prawn Macrobrachium rosenbergii. Red light and blue light favorably induced favorable ingestion. In the adaptive range of temperature, the DIR increased with rising temperature and feeding frequency, but decreased with rising body weight.

  13. Fatal canine distemper virus infection of giant pandas in China

    OpenAIRE

    Na Feng; Yicong Yu; Tiecheng Wang; Peter Wilker; Jianzhong Wang; Yuanguo Li; Zhe Sun; Yuwei Gao; Xianzhu Xia

    2016-01-01

    We report an outbreak of canine distemper virus (CDV) infection among endangered giant pandas (Ailuropoda melanoleuca). Five of six CDV infected giant pandas died. The surviving giant panda was previously vaccinated against CDV. Genomic sequencing of CDV isolated from one of the infected pandas (giant panda/SX/2014) suggests it belongs to the Asia-1 cluster. The hemagglutinin protein of the isolated virus and virus sequenced from lung samples originating from deceased giant pandas all possess...

  14. Giant planet and brown dwarf formation

    CERN Document Server

    Chabrier, G; Janson, M; Rafikov, R

    2014-01-01

    Understanding the dominant brown dwarf and giant planet formation processes, and finding out whether these processes rely on completely different mechanisms or share common channels represents one of the major challenges of astronomy and remains the subject of heated debates. It is the aim of this review to summarize the latest developments in this field and to address the issue of origin by confronting different brown dwarf and giant planet formation scenarios to presently available observational constraints. As examined in the review, if objects are classified as "Brown Dwarfs" or "Giant Planets" on the basis of their formation mechanism, it has now become clear that their mass domains overlap and that there is no mass limit between these two distinct populations. Furthermore, while there is increasing observational evidence for the existence of non-deuterium burning brown dwarfs, some giant planets, characterized by a significantly metal enriched composition, might be massive enough to ignite deuterium bur...

  15. AFSC/ABL: Female Giant Grenadier maturity

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Giant grenadiers Albatrossia pectoralis are caught as bycatch in deep-sea commercial fisheries in relatively large numbers. The population appears to be stable,...

  16. Giant planets. Holweck prize lecture 1982

    Energy Technology Data Exchange (ETDEWEB)

    Hide, R. (Meteorological Office, Bracknell (UK))

    1982-10-01

    The main characteristics of the giant planets, Jupiter and Saturn, are outlined. Studies which have been made of the circulation of their atmospheres, the structure of their interiors and the origin of their magnetic fields are discussed.

  17. Giant prostatic fossa with misleading radiographic features.

    Science.gov (United States)

    Stenzl, A; Fuchs, G J

    1989-01-01

    The long-term complication of a perforation of the prostatic capsule during transurethral resection of the prostate is described. Calcifications in a giant prostatic fossa led to initially misleading radiologic findings.

  18. Nature of giant pulses in radio pulsars

    CERN Document Server

    Petrova, S A

    2006-01-01

    Formation of giant radio pulses is attributed to propagation effects in the plasma of pulsar magnetosphere. Induced scattering of radio waves by the plasma particles is found to lead to an efficient redistribution of the radio emission in frequency. With the steep spectrum of pulsar radiation, intensity transfer between the widely spaced frequencies may imply significant narrow-band amplification of the radiation. This may give rise to giant pulses. It is demonstrated that the statistics of giant pulse intensities observed can be reproduced if one take into account pulse-to-pulse fluctuations of the plasma number density and the original intensity. Polarization properties of the strongly amplified pulses, their location in the average pulse window and the origin of the nanostructure of giant pulses are discussed as well.

  19. Selecting M-giants with WISE photometry

    Science.gov (United States)

    Li, Jing

    2015-08-01

    We use M-giants, M-dwarfs and QSOs identified by LAMOST to assess how well WISE & 2MASS colour-cuts can separate these populations through photometry. We find that the WISE bands are very efficient to separate M-giants from M-dwarfs, especially for the early-type stars. We derive a new photometric relation to estimate [Fe/H] for M-giants. We show that previous photometric distance relations may be biased and devise a new empirical distance relation. We detect M-giants in the Sagittarius stream from the ALLWISE Source Archive. Our detection shows good agreement with the bright stream, although the leading tail appears to be misaligned by a couple of degrees. We have measured the metallicity distribution at four locations along the stream, finding a clear metallicity offset between the leading and trailing tails.

  20. Genetics Home Reference: giant congenital melanocytic nevus

    Science.gov (United States)

    ... mutation in large congenital melanocytic nevi. J Invest Dermatol. 2014 Apr;134(4):1067-74. doi: 10. ... applied to giant congenital melanocytic nevi. J Invest Dermatol. 2014 Apr;134(4):879-82. doi: 10. ...

  1. Genetics Home Reference: giant axonal neuropathy

    Science.gov (United States)

    ... in giant axonal neuropathy: new insights into disease mechanisms. Muscle Nerve. 2012 Aug;46(2):246-56. ... with a qualified healthcare professional . About Genetics Home Reference Site Map Contact Us Selection Criteria for Links ...

  2. Deformation effects in Giant Monopole Resonance

    CERN Document Server

    Kvasil, J; Repko, A; Bozik, D; Kleinig, W; Reinhard, P -G

    2014-01-01

    The isoscalar giant monopole resonance (GMR) in Samarium isotopes (from spherical $^{144}$Sm to deformed $^{148-154}$Sm) is investigated within the Skyrme random-phase-approximation (RPA) for a variety of Skyrme forces. The exact RPA and its separable version (SRPA) are used for spherical and deformed nuclei, respectively. The quadrupole deformation is shown to yield two effects: the GMR broadens and attains a two-peak structure due to the coupling with the quadrupole giant resonance.

  3. Giant rhinophyma: Excision with coblation assisted surgery

    OpenAIRE

    Caner Sahin; Mesut Turker; Bulent Celasun

    2014-01-01

    An 83-year-old man presented with an unusually severe case of rhinophyma. Giant rhinopyhma is very rare in literature. The giant lesion was widely excised using sharp surgical incision and coblation assisted surgery. Using direct coblation to the nasal dorsum may cause edema in the surrounding tissue. There was minimal edema in surrounding tissue using this technique. A full thickness-skin graft was applied after excision. Cosmetic and functional postoperative results were satisfactory.

  4. Giant rhinophyma: Excision with coblation assisted surgery.

    Science.gov (United States)

    Sahin, Caner; Turker, Mesut; Celasun, Bulent

    2014-01-01

    An 83-year-old man presented with an unusually severe case of rhinophyma. Giant rhinopyhma is very rare in literature. The giant lesion was widely excised using sharp surgical incision and coblation assisted surgery. Using direct coblation to the nasal dorsum may cause edema in the surrounding tissue. There was minimal edema in surrounding tissue using this technique. A full thickness-skin graft was applied after excision. Cosmetic and functional postoperative results were satisfactory.

  5. Giant rhinophyma: Excision with coblation assisted surgery

    Directory of Open Access Journals (Sweden)

    Caner Sahin

    2014-01-01

    Full Text Available An 83-year-old man presented with an unusually severe case of rhinophyma. Giant rhinopyhma is very rare in literature. The giant lesion was widely excised using sharp surgical incision and coblation assisted surgery. Using direct coblation to the nasal dorsum may cause edema in the surrounding tissue. There was minimal edema in surrounding tissue using this technique. A full thickness-skin graft was applied after excision. Cosmetic and functional postoperative results were satisfactory.

  6. The Giant Otter Project In Peru 1995

    Directory of Open Access Journals (Sweden)

    Christof Schenck

    1995-10-01

    Full Text Available Giant Otters (Pteronura brasiliensis are rarely investigated but highly endangered. The project "STATUS, HABITAT AND CONSERVATION OF GIANT OTTERS IN PERU" from the Frankfurt Zoological Society, - Help for Threatened Wildlife - started in 1990 with a two and half year fieldwork period. The project is actually run with a yearly two months fieldwork period in Peru and ongoing analyzing, management and coordination from Germany. Following we give the report for 1995.

  7. AGB [asymptotic giant branch]: Star evolution

    International Nuclear Information System (INIS)

    Asymptotic giant branch stars are red supergiant stars of low-to-intermediate mass. This class of stars is of particular interest because many of these stars can have nuclear processed material brought up repeatedly from the deep interior to the surface where it can be observed. A review of recent theoretical and observational work on stars undergoing the asymptotic giant branch phase is presented. 41 refs

  8. Perianal Giant Condyloma Acuminatum: A Case Report

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    @@ Rare giant condyloma acuminatum (CA) reported by this paper is an interesting unusual case in China. Giant CA is a tumor that primarily affects the genital and perianal areas. Its feature is the high rate of local recurrence and transformation into squamous cell carcinoma. Making choice of wide surgical excision and using interferon as antiviral and immunoenhancement for CA after operation, we obtain satisfactory functional and cosmetic results.

  9. Testing planet formation theories with Giant stars

    CERN Document Server

    Pasquini, Luca; Hatzes, A; Setiawan, J; Girardi, L; da Silva, L; De Medeiros, J R

    2008-01-01

    Planet searches around evolved giant stars are bringing new insights to planet formation theories by virtue of the broader stellar mass range of the host stars compared to the solar-type stars that have been the subject of most current planet searches programs. These searches among giant stars are producing extremely interesting results. Contrary to main sequence stars planet-hosting giants do not show a tendency of being more metal rich. Even if limited, the statistics also suggest a higher frequency of giant planets (at least 10 %) that are more massive compared to solar-type main sequence stars. The interpretation of these results is not straightforward. We propose that the lack of a metallicity-planet connection among giant stars is due to pollution of the star while on the main sequence, followed by dilution during the giant phase. We also suggest that the higher mass and frequency of the planets are due to the higher stellar mass. Even if these results do not favor a specific formation scenario, they su...

  10. Origin of lithium enrichment in K giants

    CERN Document Server

    Kumar, Yerra Bharat; Lambert, David L

    2011-01-01

    In this Letter, we report on a low-resolution spectroscopic survey for Li-rich K giants among 2000 low mass (M = 3.2) were discovered. A significant finding is that there is a concentration of Li-rich K giants at the luminosity of the clump or red horizontal branch. This new finding is partly a consequence of the fact that our low-resolution survey is the first large survey to include giants well below and above the RGB bump and clump locations in the HR diagram. Origin of the lithium enrichment may be plausibly attributed to the conversion of 3He via 7Be to 7Li by the Cameron-Fowler mechanism but the location for onset of the conversion is uncertain. Two possible opportunities to effect this conversion are discussed: the bump in the first ascent of the red giant branch (RGB) and the He-core flash at the tip of the RGB. The finite luminosity spread of the Li-rich giants serves to reject the idea that Li enhancement is, in general, a consequence of a giant swallowing a large planet.

  11. The Giant Magellan Telescope phasing system

    Science.gov (United States)

    Bouchez, Antonin H.; McLeod, Brian A.; Acton, D. Scott; Kanneganti, Srikrishna; Kibblewhite, Edward J.; Shectman, Stephen A.; van Dam, Marcos A.

    2012-07-01

    The 25 m Giant Magellan Telescope consists of seven circular 8.4 m primary mirror segments with matching segmentation of the Gregorian secondary mirror. Achieving the diffraction limit in the adaptive optics observing modes will require equalizing the optical path between pairs of segments to a small fraction of the observing wavelength. This is complicated by the fact that primary mirror segments are separated by up to 40 cm, and composed of borosilicate glass. The phasing system therefore includes both edge sensors to sense high-frequency disturbances, and wavefront sensors to measure their long-term drift and sense atmosphere-induced segment piston errors. The major subsystems include a laser metrology system monitoring the primary mirror segments, capacitive edge sensors between secondary mirror segments, a phasing camera with a wide capture range, and an additional sensitive optical piston sensor incorporated into each AO instrument. We describe in this paper the overall phasing strategy, controls scheme, and the expected performance of the system with respect to the overall adaptive optics error budget. Further details may be found in specific papers on each of the subsystems.

  12. Introduction to the Chinese Giant Solar Telescope

    Science.gov (United States)

    Liu, Z.; Deng, Y.; Ji, H.

    2012-12-01

    In order to detect the fine structures of solar magnetic field and dynamic field, an 8 meter solar telescope has been proposed by Chinese solar community. Due to the advantages of ring structure in polarization detection and thermal control, the current design of CGST (Chinese Giant Solar Telescope) is an 8 meter ring solar telescope. The spatial resolution of CGST is equivalent to an 8 meter diameter telescope, and the light-gathering power equivalent to a 5 meter full aperture telescope. The integrated simulation of optical system and imaging ability such as optical design, MCAO, active maintenance of primary mirror were carried out in this paper. Mechanical system was analyzed by finite element method too. The results of simulation and analysis showed that the current design could meet the demand of most science cases not only in infrared band but also in near infrared band and even in visible band. CGST was proposed by all solar observatories in Chinese Academy of Sciences and several overseas scientists. It is supported by CAS (Chinese Academy of Sciences) and NSFC (National Natural Science Foundation of China) as a long term astronomical project.

  13. Separating gas-giant and ice-giant planets by halting pebble accretion

    CERN Document Server

    Lambrechts, Michiel; Morbidelli, Alessandro

    2014-01-01

    In the Solar System giant planets come in two flavours: 'gas giants' (Jupiter and Saturn) with massive gas envelopes and 'ice giants' (Uranus and Neptune) with much thinner envelopes around their cores. It is poorly understood how these two classes of planets formed. High solid accretion rates, necessary to form the cores of giant planets within the life-time of protoplanetary discs, heat the envelope and prevent rapid gas contraction onto the core, unless accretion is halted. We find that, in fact, accretion of pebbles (~ cm-sized particles) is self-limiting: when a core becomes massive enough it carves a gap in the pebble disc. This halt in pebble accretion subsequently triggers the rapid collapse of the super-critical gas envelope. As opposed to gas giants, ice giants do not reach this threshold mass and can only bind low-mass envelopes that are highly enriched by water vapour from sublimated icy pebbles. This offers an explanation for the compositional difference between gas giants and ice giants in the S...

  14. The Giant Planet Satellite Exospheres

    Science.gov (United States)

    McGrath, Melissa A.

    2014-01-01

    Exospheres are relatively common in the outer solar system among the moons of the gas giant planets. They span the range from very tenuous, surface-bounded exospheres (e.g., Rhea, Dione) to quite robust exospheres with exobase above the surface (e.g., lo, Triton), and include many intermediate cases (e.g., Europa, Ganymede, Enceladus). The exospheres of these moons exhibit an interesting variety of sources, from surface sputtering, to frost sublimation, to active plumes, and also well illustrate another common characteristic of the outer planet satellite exospheres, namely, that the primary species often exists both as a gas in atmosphere, and a condensate (frost or ice) on the surface. As described by Yelle et al. (1995) for Triton, "The interchange of matter between gas and solid phases on these bodies has profound effects on the physical state of the surface and the structure of the atmosphere." A brief overview of the exospheres of the outer planet satellites will be presented, including an inter-comparison of these satellites exospheres with each other, and with the exospheres of the Moon and Mercury.

  15. A giant thunderstorm on Saturn.

    Science.gov (United States)

    Fischer, G; Kurth, W S; Gurnett, D A; Zarka, P; Dyudina, U A; Ingersoll, A P; Ewald, S P; Porco, C C; Wesley, A; Go, C; Delcroix, M

    2011-07-01

    Lightning discharges in Saturn's atmosphere emit radio waves with intensities about 10,000 times stronger than those of their terrestrial counterparts. These radio waves are the characteristic features of lightning from thunderstorms on Saturn, which last for days to months. Convective storms about 2,000 kilometres in size have been observed in recent years at planetocentric latitude 35° south (corresponding to a planetographic latitude of 41° south). Here we report observations of a giant thunderstorm at planetocentric latitude 35° north that reached a latitudinal extension of 10,000 kilometres-comparable in size to a 'Great White Spot'-about three weeks after it started in early December 2010. The visible plume consists of high-altitude clouds that overshoot the outermost ammonia cloud layer owing to strong vertical convection, as is typical for thunderstorms. The flash rates of this storm are about an order of magnitude higher than previous ones, and peak rates larger than ten per second were recorded. This main storm developed an elongated eastward tail with additional but weaker storm cells that wrapped around the whole planet by February 2011. Unlike storms on Earth, the total power of this storm is comparable to Saturn's total emitted power. The appearance of such storms in the northern hemisphere could be related to the change of seasons, given that Saturn experienced vernal equinox in August 2009. PMID:21734705

  16. Endoscopically removed giant submucosal lipoma

    Directory of Open Access Journals (Sweden)

    Jovanović Ivan

    2007-01-01

    Full Text Available Background. Although uncommon, giant submucosal colon lipomas merit attention as they are often presented with dramatic clinical features such as bleeding, acute bowel obstruction, perforation and sometimes may be mistaken for malignancy. There is a great debate in the literature as to how to treat them. Case report. A patient, 67-year old, was admitted to the Clinic due to a constipation over the last several months, increasing abdominal pain mainly localized in the left lower quadrant accompanied by nausea, vomiting and abdominal distension. Physical examination was unremarkable and the results of the detailed laboratory tests and carcinoembryonic antigen remained within normal limits. Colonoscopy revealed a large 10 cm long, and 4 to 5 cm in diameter, mobile lesion in his sigmoid colon. Conventional endoscopic ultrasound revealed 5 cm hyperechoic lesion of the colonic wall. Twenty MHz mini-probe examination showed that lesion was limited to the submucosa. Since polyp appeared too large for a single transaction, it was removed piecemeal. Once the largest portion of the polyp has been resected, it was relatively easy to place the opened snare loop around portions of the residual polyp. Endoscopic resection was carried out safely without complications. Histological examination revealed the common typical histological features of lipoma elsewhere. The patient remained stable and eventually discharged home. Four weeks later he suffered no recurrent symptoms. Conclusion. Colonic lipomas can be endoscopically removed safely eliminating unnecessary surgery.

  17. Giant bubble pinch-off

    CERN Document Server

    Bergmann, R; Prosperetti, A; Sandtke, M; Stijnman, M; Van der Meer, D; Bergmann, Raymond; Lohse, Detlef; Meer, Devaraj van der; Prosperetti, Andrea; Sandtke, Marijn; Stijnman, Mark

    2006-01-01

    Self-similarity has been the paradigmatic picture for the pinch-off of a drop. Here we will show through high-speed imaging and boundary integral simulations that the inverse problem, the pinch-off of an air bubble in water, is not self-similar in a strict sense: A disk is quickly pulled through a water surface, leading to a giant, cylindrical void which after collapse creates an upward and a downward jet. Only in the limiting case of large Froude number the neck radius $h$ scales as $h(-\\log h)^{1/4} \\propto \\tau^{1/2}$, the purely inertial scaling. For any finite Froude number the collapse is slower, and a second length-scale, the curvature of the void, comes into play. Both length-scales are found to exhibit power-law scaling in time, but with different exponents depending on the Froude number, signaling the non-universality of the bubble pinch-off.

  18. ON INFRARED EXCESSES ASSOCIATED WITH Li-RICH K GIANTS

    Energy Technology Data Exchange (ETDEWEB)

    Rebull, Luisa M. [Spitzer Science Center (SSC) and Infrared Science Archive (IRSA), Infrared Processing and Analysis Center - IPAC, 1200 E. California Blvd., California Institute of Technology, Pasadena, CA 91125 (United States); Carlberg, Joleen K. [NASA Goddard Space Flight Center, Code 667, Greenbelt, MD 20771 (United States); Gibbs, John C.; Cashen, Sarah; Datta, Ashwin; Hodgson, Emily; Lince, Megan [Glencoe High School, 2700 NW Glencoe Rd., Hillsboro, OR 97124 (United States); Deeb, J. Elin [Bear Creek High School, 9800 W. Dartmouth Pl., Lakewood, CO 80227 (United States); Larsen, Estefania; Altepeter, Shailyn; Bucksbee, Ethan; Clarke, Matthew [Millard South High School, 14905 Q St., Omaha, NE 68137 (United States); Black, David V., E-mail: rebull@ipac.caltech.edu [Walden School of Liberal Arts, 4230 N. University Ave., Provo, UT 84604 (United States)

    2015-10-15

    Infrared (IR) excesses around K-type red giants (RGs) have previously been discovered using Infrared Astronomy Satellite (IRAS) data, and past studies have suggested a link between RGs with overabundant Li and IR excesses, implying the ejection of circumstellar shells or disks. We revisit the question of IR excesses around RGs using higher spatial resolution IR data, primarily from the Wide-field Infrared Survey Explorer. Our goal was to elucidate the link between three unusual RG properties: fast rotation, enriched Li, and IR excess. Our sample of RGs includes those with previous IR detections, a sample with well-defined rotation and Li abundance measurements with no previous IR measurements, and a large sample of RGs asserted to be Li-rich in the literature; we have 316 targets thought to be K giants, about 40% of which we take to be Li-rich. In 24 cases with previous detections of IR excess at low spatial resolution, we believe that source confusion is playing a role, in that either (a) the source that is bright in the optical is not responsible for the IR flux, or (b) there is more than one source responsible for the IR flux as measured in IRAS. We looked for IR excesses in the remaining sources, identifying 28 that have significant IR excesses by ∼20 μm (with possible excesses for 2 additional sources). There appears to be an intriguing correlation in that the largest IR excesses are all in Li-rich K giants, though very few Li-rich K giants have IR excesses (large or small). These largest IR excesses also tend to be found in the fastest rotators. There is no correlation of IR excess with the carbon isotopic ratio, {sup 12}C/{sup 13}C. IR excesses by 20 μm, though relatively rare, are at least twice as common among our sample of Li-rich K giants. If dust shell production is a common by-product of Li enrichment mechanisms, these observations suggest that the IR excess stage is very short-lived, which is supported by theoretical calculations. Conversely, the

  19. Lithium-Rich Giants in Globular Clusters

    CERN Document Server

    Kirby, Evan N; Zhang, Andrew J; Hong, Jerry; Guo, Michelle; Guo, Rachel; Cohen, Judith G; Cunha, Katia

    2016-01-01

    Although red giants deplete lithium on their surfaces, some giants are Li-rich. Intermediate-mass asymptotic giant branch (AGB) stars can generate Li through the Cameron-Fowler conveyor, but the existence of Li-rich, low-mass red giant branch (RGB) stars is puzzling. Globular clusters are the best sites to examine this phenomenon because it is straightforward to determine membership in the cluster and to identify the evolutionary state of each star. In 72 hours of Keck/DEIMOS exposures in 25 clusters, we found four Li-rich RGB and two Li-rich AGB stars. There were 1696 RGB and 125 AGB stars with measurements or upper limits consistent with normal abundances of Li. Hence, the frequency of Li-richness in globular clusters is (0.2 +/- 0.1)% for the RGB, (1.6 +/- 1.1)% for the AGB, and (0.3 +/- 0.1)% for all giants. Because the Li-rich RGB stars are on the lower RGB, Li self-generation mechanisms proposed to occur at the luminosity function bump or He core flash cannot explain these four lower RGB stars. We propo...

  20. Giant components in directed multiplex networks.

    Science.gov (United States)

    Azimi-Tafreshi, N; Dorogovtsev, S N; Mendes, J F F

    2014-11-01

    We describe the complex global structure of giant components in directed multiplex networks that generalizes the well-known bow-tie structure, generic for ordinary directed networks. By definition, a directed multiplex network contains vertices of one type and directed edges of m different types. In directed multiplex networks, we distinguish a set of different giant components based on the existence of directed paths of different types between their vertices such that for each type of edges, the paths run entirely through only edges of that type. If, in particular, m=2, we define a strongly viable component as a set of vertices in which for each type of edges each two vertices are interconnected by at least two directed paths in both directions, running through the edges of only this type. We show that in this case, a directed multiplex network contains in total nine different giant components including the strongly viable component. In general, the total number of giant components is 3^{m}. For uncorrelated directed multiplex networks, we obtain exactly the size and the emergence point of the strongly viable component and estimate the sizes of other giant components. PMID:25493836

  1. An MHD model for magnetar giant flares

    Energy Technology Data Exchange (ETDEWEB)

    Meng, Y.; Lin, J.; Zhang, Q. S. [Yunnan Observatories, Chinese Academy of Sciences, P.O. Box 110, Kunming, Yunnan 650011 (China); Zhang, L. [Department of Physics, Yunnan University, Kunming, Yunnan 650091 (China); Reeves, K. K. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Yuan, F., E-mail: mengy@ynao.ac.cn, E-mail: jlin@ynao.ac.cn [Key Laboratory for Research in Galaxies and Cosmology, Shanghai Astronomical Observatory, Chinese Academy of Sciences, 80 Nandan Road, Shanghai 200030 (China)

    2014-04-10

    Giant flares on soft gamma-ray repeaters that are thought to take place on magnetars release enormous energy in a short time interval. Their power can be explained by catastrophic instabilities occurring in the magnetic field configuration and the subsequent magnetic reconnection. By analogy with the coronal mass ejection events on the Sun, we develop a theoretical model via an analytic approach for magnetar giant flares. In this model, the rotation and/or displacement of the crust causes the field to twist and deform, leading to flux rope formation in the magnetosphere and energy accumulation in the related configuration. When the energy and helicity stored in the configuration reach a threshold, the system loses its equilibrium, the flux rope is ejected outward in a catastrophic way, and magnetic reconnection helps the catastrophe develop to a plausible eruption. By taking SGR 1806–20 as an example, we calculate the free magnetic energy released in such an eruptive process and find that it is more than 10{sup 47} erg, which is enough to power a giant flare. The released free magnetic energy is converted into radiative energy, kinetic energy, and gravitational energy of the flux rope. We calculated the light curves of the eruptive processes for the giant flares of SGR 1806–20, SGR 0526–66, and SGR 1900+14, and compared them with the observational data. The calculated light curves are in good agreement with the observed light curves of giant flares.

  2. Electrodynamics on extrasolar giant planets

    Energy Technology Data Exchange (ETDEWEB)

    Koskinen, T. T.; Yelle, R. V. [Lunar and Planetary Laboratory, University of Arizona, 1629 East University Boulevard, Tucson, AZ 85721-0092 (United States); Lavvas, P. [Groupe de Spectroscopie Moléculaire et Atmosphérique UMR CNRS 7331, Université Reims Champagne-Ardenne, F-51687 Reims (France); Cho, J. Y-K., E-mail: tommi@lpl.arizona.edu [Astronomy Unit, School of Mathematical Sciences, Queen Mary, University of London, Mile End Road, London E1 4NS (United Kingdom)

    2014-11-20

    Strong ionization on close-in extrasolar giant planets (EGPs) suggests that their atmospheres may be affected by ion drag and resistive heating arising from wind-driven electrodynamics. Recent models of ion drag on these planets, however, are based on thermal ionization only and do not include the upper atmosphere above the 1 mbar level. These models are also based on simplified equations of resistive magnetohydrodynamics that are not always valid in extrasolar planet atmospheres. We show that photoionization dominates over thermal ionization over much of the dayside atmosphere above the 100 mbar level, creating an upper ionosphere dominated by ionization of H and He and a lower ionosphere dominated by ionization of metals such as Na, K, and Mg. The resulting dayside electron densities on close-in exoplanets are higher than those encountered in any planetary ionosphere of the solar system, and the conductivities are comparable to the chromosphere of the Sun. Based on these results and assumed magnetic fields, we constrain the conductivity regimes on close-in EGPs and use a generalized Ohm's law to study the basic effects of electrodynamics in their atmospheres. We find that ion drag is important above the 10 mbar level where it can also significantly alter the energy balance through resistive heating. Due to frequent collisions of the electrons and ions with the neutral atmosphere, however, ion drag is largely negligible in the lower atmosphere below the 10 mbar level for a reasonable range of planetary magnetic moments. We find that the atmospheric conductivity decreases by several orders of magnitude in the night side of tidally locked planets, leading to a potentially interesting large-scale dichotomy in electrodynamics between the day and night sides. A combined approach that relies on UV observations of the upper atmosphere, phase curve and Doppler measurements of global dynamics, and visual transit observations to probe the alkali metals can potentially

  3. [Giant condyloma of the penis with malignant transformation associated with lichen sclerosus et atrophicus].

    Science.gov (United States)

    Wessendorf, U; Bruch-Gerharz, D; Braunstein, S; Braunstein, R; Schulte, K-W; Reifenberger, J

    2009-10-01

    A 72-year old patient presented with a 6 months history of a rapidly growing tumor of the glans and foreskin. He had a long history of phimosis with lichen sclerosus et atrophicus-like lesions on the foreskin which had not been treated. The rest of the personal, family and sexual history was unremarkable. Treatment consists of circumcision and tumor excision. Histopathology confirmed a squamous cell carcinoma within a giant condyloma with a concomitant lichen sclerosus et atrophicus. CT- and ultrasound scans showed no metastases. Giant condylomas are a rare sexually transmitted disease usually caused by human papilloma virus subtypes 6, 11, but also by 16 and 18 among others. They are expansive, cauliflower-like destructive lesions that most frequently affect the anogenital region. In about 30 percent a giant condyloma progresses into a squamous cell carcinoma. Therapy of choice is the histopathologically controlled excision. Recurrences are often seen, so the patients should be monitored frequently after therapy. PMID:19756435

  4. Observations of Radio Giant Pulses with GAVRT

    CERN Document Server

    Jones, Glenn

    2015-01-01

    Radio giant pulses provide a unique opportunity to study the pulsar radio emission mechanism in exquisite detail. Previous studies have revealed a wide range of properties and phenomena, including extraordinarily high brightness temperatures, sub-nanosecond emission features, and banded dynamic spectra. New measurements of giant pulse characteristics can help guide and test theoretical emission models. To this end, an extensive observation campaign has begun which will provide more than 500 hours on the Crab with a 34-meter antenna located in California, USA. The observations are being done as part of an educational outreach program called the Goldstone-Apple Valley Radio Telescope (GAVRT). This antenna has a novel wide bandwidth receiver which provides up to 8 GHz of instantaneous bandwidth in the range of 2.5 to 14 GHz. These observations will provide detailed information about the variability, amplitude distribution, and detailed frequency structure of radio giant pulses. In addition, a database of pulses ...

  5. Geology of giant gas fields in China

    Energy Technology Data Exchange (ETDEWEB)

    Dai, Jinxing [PetroChina Research Institute of Petroleum Exploration and Development, Beijing 100083 (China); Department of Earth Science, Zhejiang University, Hangzhou 310027 (China); Faculty of Natural Resources and Information Technology, University of Petroleum, Beijing 102200 (China); Zou, Caineng; Qin, Shengfei; Tao, Shizhen; Liu, Quanyou [PetroChina Research Institute of Petroleum Exploration and Development, Beijing 100083 (China); Ding, Weiwei [Key Laboratory of Submarine Geoscience of the State Oceanic Administration, Hangzhou 310012 (China); Hu, Anping [Department of Earth Science, Zhejiang University, Hangzhou 310027 (China)

    2008-04-15

    Twenty-five gas fields with recognized ultimate recoveries larger than 25 billion cubic meters have been found in six basins in China. The earliest was found in 1959 and the latest in 2005. Recognition of more recent discoveries as giants will probably further increase the population. Examination of reservoir age, lithology, trap and depositional environment leads to the conclusion that there are no diagnostic characteristics common to all of the giants. However, coaly source rocks, traps in close proximity to major gas kitchens, reservoirs and caprocks with reasonable quality, late gas accumulation and continuous gas supply are the preferred parameters. Uncommonly thick reservoir rocks or unusual development of porosity and permeability are not required. The fact that giant gas fields exist in reasonable numbers and have been discovered steadily through the years suggests that more efforts are needed to find the remaining gas resources in China. (author)

  6. Giant Uterine Leiomyoma. A Case Report

    Directory of Open Access Journals (Sweden)

    Luis Noel Marrero Quiala

    2014-09-01

    Full Text Available Giant uterine fibromyoma is a benign condition which has a very low incidence. Its management poses a challenge for the surgical team due to the volume of the surgical specimen and the variations in the distribution of the intra-abdominal organs caused by the uterine growth. The case of a 29-year-old patient misdiagnosed with giant hepatomegaly at admission is presented. Her symptoms included hard abdomen and feeling of heaviness. Successful completion of the interview, physical examination and imaging studies led to the correct diagnosis of giant uterine fibromyoma. Surgical treatment was applied. A total abdominal hysterectomy was performed with satisfactory results. This case is presented to the medical community for teaching purposes and due to its rarity.

  7. Asymptomatic post-rheumatic giant left atrium.

    Science.gov (United States)

    Özkartal, Tardu; Tanner, Felix C; Niemann, Markus

    2016-06-26

    A 78-year-old asymptomatic woman was referred to our clinic for a second opinion regarding indication for mitral valve surgery. An echocardiogram showed a moderate mitral stenosis with a concomitant severe regurgitation. The most striking feature, however, was a giant left atrium with a parasternal anteroposterior diameter of 79 mm and a left atrial volume index of 364 mL/m². There are various echocardiographic definitions of a giant left atrium, which are mainly based on measurements of the anteroposterior diameter of the left atrium using M-mode in the parasternal long axis view. Since the commonly accepted method for echocardiographic evaluation of left atrial size is left atrial volume index, we propose a cut-off value of 140 mL/m(2) for the definition of a "giant left atrium".

  8. Graphene growth with giant domains using chemical vapor deposition

    OpenAIRE

    Yong, Virginia; Hahn, H. Thomas

    2011-01-01

    We report the first demonstration of the growth of giant graphene domains on platinum (Pt), which results in a uniform bilayer graphene film with domain sizes of millimetre scale. These giant graphene domains are attributed to the giant Pt grains attained in post-deposition annealed Pt thin films that exhibit a strong dependency on the Pt film thickness. Giant grains have been claimed to occur in other metallic materials under appropriate film thicknesses and processing conditions. Our findin...

  9. Kepler Asteroseismology of Red-giant Stars

    DEFF Research Database (Denmark)

    Christensen-Dalsgaard, J.

    2012-01-01

    The Kepler mission, launched in March 2009, has revolutionized asteroseismology, providing detailed observations of thousands of stars. This has allowed in-depth analyses of stars ranging from compact hot subdwarfs to red giants, and including the detection of solar-like oscillations in hundreds...... of stars on or near the main sequence. Here I mainly consider solar-like oscillations in red giants, where Kepler observations are yielding results of a perhaps unexpected richness. In addition to giving a brief overview of the observational and numerical results for these stars, I present a simple...

  10. BPS Electromagnetic Waves on Giant Gravitons

    CERN Document Server

    Kim, S; Kim, Seok; Lee, Kimyeong

    2005-01-01

    We find new 1/8-BPS giant graviton solutions in $AdS_5 \\times S^5$, carrying three angular momenta along $S^5$, and investigate their properties. Especially, we show that nonzero worldvolume gauge fields are admitted preserving supersymmetry. These gauge field modes can be viewed as electromagnetic waves along the compact D3 brane, whose Poynting vector contributes to the BPS angular momenta. We also analyze the (nearly-)spherical giant gravitons with worldvolume gauge fields in detail. Expressing the $S^3$ in Hopf fibration ($S^1$ fibred over $S^2$), the wave propagates along the $S^1$ fiber.

  11. Probing giant magnetoresistance with THz spectroscopy

    DEFF Research Database (Denmark)

    Jin, Zuanming; Tkach, Alexander; Casper, Frederick;

    2014-01-01

    We observe a giant magnetoresistance effect in CoFe/Cu-based multistack using THz time-domain spectroscopy. The magnetic field-dependent dc conductivity, electron scattering time, as well as spin-asymmetry parameter of the structure are successfully determined. © 2014 OSA.......We observe a giant magnetoresistance effect in CoFe/Cu-based multistack using THz time-domain spectroscopy. The magnetic field-dependent dc conductivity, electron scattering time, as well as spin-asymmetry parameter of the structure are successfully determined. © 2014 OSA....

  12. Giant Panda habitat selection in the Foping Nature Reserve, China

    NARCIS (Netherlands)

    Liu, X.; Toxopeus, A.G.; Skidmore, A.K.; Shao, X.; Dang, D.; Wang, T.; Prins, H.H.T.

    2005-01-01

    Little is known about habitat selection of the giant panda (Ailuropoda melanoleuca), especially about the relationship between giant panda presence and bamboo and tree structures. We presented data on giant panda habitat use and selection in Foping Nature Reserve (NR), China. We used 1,066 radiotrac

  13. The Mass-Metallicity Relation for Giant Planets

    CERN Document Server

    Thorngren, Daniel P; Lopez, Eric D

    2015-01-01

    Exoplanet discoveries of recent years have provided a great deal of new data for studying the bulk compositions of giant planets. Here we identify 38 transiting giant planets ($20 M_\\oplus 50 M_\\oplus$) suggest significant amounts of heavy elements in H/He envelopes, rather than cores, such that metal-enriched giant planet atmospheres should be the rule.

  14. Staged Closure of Giant Omphalocele using Synthetic Mesh

    Directory of Open Access Journals (Sweden)

    Lalit Parida

    2014-09-01

    Full Text Available Giant omphalocele is difficult to manage and is associated with a poor outcome. A male newborn presented to our hospital with a giant omphalocele. We performed a staged closure of giant omphalocele using synthetic mesh to construct a silo and then mesh abdominoplasty in the neonatal period that led to a successful outcome within a reasonable period of hospital stay.

  15. Normalized spectra of 82 Kepler red giants (Thygesen+, 2012)

    NARCIS (Netherlands)

    A.O. Thygesen; S. Frandsen; H. Bruntt; T. Kallinger; M.F. Andersen; Y.E. Elsworth; S. Hekker; C. Karoff; D. Stello; K. Brogaard; C. Bruke; D.A. Caldwell; J.L. Christiansen

    2012-01-01

    Normalized spectra of 82 red giants in the Kepler Field. Target names are as found in the Kepler Input Catalogue (Kepler Mission Team 2009) Also included spectra of 10 well-studied bright giants observed for reference. 9 of the reference giants were chosen from the PASTEL catalogue (Soubiran et al.,

  16. The conjunction of factors that lead to formation of giant gold provinces and deposits in non-arc settings

    Institute of Scientific and Technical Information of China (English)

    David I. Groves; Richard J. Goldfarb; M. Santosh

    2016-01-01

    It is quite evident that it is not anomalous metal transport, nor unique depositional conditions, nor any single factor at the deposit scale, that dictates whether a mineral deposit becomes a giant or not. A hierarchical approach thus is required to progressively examine controlling parameters at successively decreasing scales in the total mineral system to understand the location of giant gold deposits in non-arc environments. For giant orogenic, intrusion-related gold systems (IRGS) and Carlin-type gold deposits and iron oxide-copper-gold (IOCG) deposits, there are common factors among all of these at the litho-spheric to crustal scale. All are sited in giant gold provinces controlled by complex fundamental fault or shear zones that follow craton margins or, in the case of most Phanerozoic orogenic giants, define the primary suture zones between tectonic terranes. Giant provinces of IRGS, IOCG, and Carlin-type deposits require melting of metasomatized lithosphere beneath craton margins with ascent of hybrid lamp-rophyric to granitic magmas and associated heat flux to generate the giant province. The IRGS and IOCG deposits require direct exsolution of volatile-rich magmatic-hydrothermal fluids, whereas the associa-tion of such melts with Carlin-type ores is more indirect and enigmatic. Giant orogenic gold provinces show no direct relationship to such magmatism, forming from metamorphic fluids, but show an indirect relationship to lamprophyres that reflect the mantle connectivity of controlling first-order structures. In contrast to their province scale similarities, the different giant gold deposit styles show contrasting critical controls at the district to deposit scale. For orogenic gold deposits, the giants appear to have formed by conjunction of a greater number of parameters to those that control smaller deposits, with resultant geometrical and lithostratigraphic complexity as a guide to their location. There are few giant IRGS due to their inferior fluid

  17. Giant pandas failed to show mirror self-recognition.

    Science.gov (United States)

    Ma, Xiaozan; Jin, Yuan; Luo, Bo; Zhang, Guiquan; Wei, Rongping; Liu, Dingzhen

    2015-05-01

    Mirror self-recognition (MSR), i.e., the ability to recognize oneself in a mirror, is considered a potential index of self-recognition and the foundation of individual development. A wealth of literature on MSR is available for social animals, such as chimpanzees, Asian elephants and dolphins, yet little is known about MSR in solitary mammalian species. We aimed to evaluate whether the giant panda can recognize itself in the mirror, and whether this capacity varies with age. Thirty-four captive giant pandas (F:M = 18:16; juveniles, sub-adults and adults) were subjected to four mirror tests: covered mirror tests, open mirror tests, water mark control tests, and mark tests. The results showed that, though adult, sub-adult and juvenile pandas exposed to mirrors spent similar amounts of time in social mirror-directed behaviors (χ(2) = 0.719, P = 0.698), none of them used the mirror to touch the mark on their head, a self-directed behavior suggesting MSR. Individuals of all age groups initially displayed attacking, threatening, foot scraping and backwards walking behaviors when exposed to their self-images in the mirror. Our data indicate that, regardless of age, the giant pandas did not recognize their self-image in the mirror, but instead considered the image to be a conspecific. Our results add to the available information on mirror self-recognition in large mammals, provide new information on a solitary species, and will be useful for enclosure design and captive animal management. PMID:25609263

  18. Control Effect of Evolution of North Sea Basin on Formation of Giant Oil-Gas Fields%北海盆地形成演化对大油气田的控制作用

    Institute of Scientific and Technical Information of China (English)

    刘政; 何登发; 温志新; 李涤

    2012-01-01

    The North Sea basin underwent eight orogenic stages and gave rise to the frameworks that the metamorphic basement was formed in Caledonian stage; Pangaea following Paleo-Tethys closure shaped in Hercynian, and the coal-measure source rock deposited in the south- em North Sea basin; southern and northern North Sea basin continued subsidence in intra-craton stage, with early arid .climate and late large-scale marine transgression, forming favorable reserv0ir-cap rocks assemblage in south of it; regional extension environment gave rise to Viking, Central and Moray Firth grabens and troughs in rifting stage; uplifting of central North Sea basin e0mpanied with many a volca- nic activity in thermal uplift stage, providing large amount of provenances for development of the northern reservoir rocks; central dome sub- sidence in major rifting stage followed by being submerged, causing premium source rocks development in northern of it; relatively stable sedimentary environment in late rifting state allowed large amount of chalks to develop in the central and deposit marls in the northern, shaping regional cap rocks in the northern of this basin; and in post-rifting stage, Norway-Greenland Sea separation occurred, and sustained and stable deposition under previous structural framework provided favorable environment for oil and gas preservation. Finally, these result- ed in framework as giant gas fields dominantly distributed in the southern and giant oil fields in the northern, and contemporarily, "upper source-lower reservoir" and "lower source-upper reservoir" characteristics were found in Viking graben and Central graben, respectively.%分析了北海盆地的形成演化对大油气田形成的控制作用。研究认为,北海盆地经历了8个构造演化期,加里东运动期形成了主要变质岩基底;海西运动导致古特提斯洋关闭,形成联合古陆,同时沉积了盆地南部重要的煤系烃源岩;陆内克拉通期盆地南、

  19. Dynamo-generated magnetic fields in fast rotating single giants

    CERN Document Server

    Konstantinova-Antova, Renada; Schröder, Klaus-Peter; Petit, Pascal

    2009-01-01

    Red giants offer a good opportunity to study the interplay of magnetic fields and stellar evolution. Using the spectro-polarimeter NARVAL of the Telescope Bernard Lyot (TBL), Pic du Midi, France and the LSD technique, we began a survey of magnetic fields in single G-K-M giants. Early results include 6 MF-detections with fast rotating giants, and for the first time a magnetic field was detected directly in an evolved M-giant: EK Boo. Our results could be explained in the terms of $\\alpha$--$\\omega$ dynamo operating in these giants.

  20. Floret-like multinucleated giant cells in neurofibroma.

    Science.gov (United States)

    Shaktawat, Sameer Singh; Golka, Dariusz

    2007-12-08

    This short report discusses a case of neurofibroma containing floret-like multinucleated giant cells. This being the second such case in the literature. Floret-like multinucleated giant cells have been reported in gynaecomastia and neurofibroma in neurofibromatosis type 1. These cells have been reported in uncommon soft tissue tumours including pleomorphic lipoma, giant cell collagenoma, giant cell fibroblastoma and giant cell angiofibroma. We recommend these cells to be interpreted carefully keeping in mind the rare malignant change in neurofibromas. Immunohistochemistry would help in defining the nature of such cells.

  1. Floret-like multinucleated giant cells in neurofibroma

    Directory of Open Access Journals (Sweden)

    Golka Dariusz

    2007-12-01

    Full Text Available Abstract This short report discusses a case of neurofibroma containing floret-like multinucleated giant cells. This being the second such case in the literature. Floret-like multinucleated giant cells have been reported in gynaecomastia and neurofibroma in neurofibromatosis type 1. These cells have been reported in uncommon soft tissue tumours including pleomorphic lipoma, giant cell collagenoma, giant cell fibroblastoma and giant cell angiofibroma. We recommend these cells to be interpreted carefully keeping in mind the rare malignant change in neurofibromas. Immunohistochemistry would help in defining the nature of such cells.

  2. Reading on the Shoulders of Giants

    Science.gov (United States)

    Ben-Chaim, Michael; Riendeau, Michael

    2012-01-01

    Reflecting on his successful scientific career, Isaac Newton highlighted his intellectual debt to his predecessors. "If I have seen further," he wrote, "it was "only" by standing on the shoulders of giants." The authors have chosen the title of their article as a token of recognition of their debt to the teachings of Newton and other intellectuals…

  3. Caring for the Giant Pandas' Future

    Institute of Scientific and Technical Information of China (English)

    TANG YUANKAI

    2010-01-01

    @@ A long-term partnership was formed in October by American corporation Broadcom, Broadcom Foundation,and the San Diego Zoo, together with China Wolong National Natural Reserve and the Institute of Zoology of the Chinese Academy of Sciences (CAS) to study giant panda protection and breeding.

  4. Rotation Curves of Giant LSB Galaxies

    NARCIS (Netherlands)

    Pickering, T. E.; Impey, C. D.; Navarro, J. F.; van Gorkom, J.; Bothun, G. D.

    1996-01-01

    We present optical and H I rotation curves of a sample of giant, low surface brightness (LSB) galaxies including the prototype, Malin 1. The rotation curves of these diffuse systems are expected to more faithfully reflect the structure of their dark matter halos due to the reduced contribution of th

  5. Probing cosmic plasma with giant radio pulses

    CERN Document Server

    Kondratiev, V I; Soglasnov, V A; Kovalev, Y Y; Bartel, N; Cannon, W; Novikov, A Y

    2007-01-01

    VLBI observations of the Crab pulsar with the 64-m radio telescope at Kalyazin (Russia) and the 46-m radio telescope of the Algonquin Radio Observatory (Canada) at 2.2 GHz and single-dish observations of the millisecond pulsar B1937+21 with the GBT (USA) at 2.1 GHz were conducted to probe the interstellar medium and study the properties of giant pulses. The VLBI data were processed with a dedicated software correlator, which allowed us to obtain the visibility of single giant pulses. Two frequency scales of 50 and 450 kHz were found in the diffraction spectra of giant pulses from the Crab pulsar. The location of the scattering region was estimated to be close to the outer edge of the nebula. No correlation was found between the power spectra of giant pulses at left- and right-hand circular polarization. We explain this lack of correlation through the influence of the strong magnetic field on circularly polarized emission in the region close to the Crab pulsar. Combining the measurement of the decorrelation ba...

  6. Giant Viruses of Amoebas: An Update.

    Science.gov (United States)

    Aherfi, Sarah; Colson, Philippe; La Scola, Bernard; Raoult, Didier

    2016-01-01

    During the 12 past years, five new or putative virus families encompassing several members, namely Mimiviridae, Marseilleviridae, pandoraviruses, faustoviruses, and virophages were described. In addition, Pithovirus sibericum and Mollivirus sibericum represent type strains of putative new giant virus families. All these viruses were isolated using amoebal coculture methods. These giant viruses were linked by phylogenomic analyses to other large DNA viruses. They were then proposed to be classified in a new viral order, the Megavirales, on the basis of their common origin, as shown by a set of ancestral genes encoding key viral functions, a common virion architecture, and shared major biological features including replication inside cytoplasmic factories. Megavirales is increasingly demonstrated to stand in the tree of life aside Bacteria, Archaea, and Eukarya, and the megavirus ancestor is suspected to be as ancient as cellular ancestors. In addition, giant amoebal viruses are visible under a light microscope and display many phenotypic and genomic features not found in other viruses, while they share other characteristics with parasitic microbes. Moreover, these organisms appear to be common inhabitants of our biosphere, and mimiviruses and marseilleviruses were isolated from human samples and associated to diseases. In the present review, we describe the main features and recent findings on these giant amoebal viruses and virophages.

  7. Tuberculosis Detection by Giant African Pouched Rats

    Science.gov (United States)

    Poling, Alan; Weetjens, Bart; Cox, Christophe; Beyene, Negussie; Durgin, Amy; Mahoney, Amanda

    2011-01-01

    In recent years, operant discrimination training procedures have been used to teach giant African pouched rats to detect tuberculosis (TB) in human sputum samples. This article summarizes how the rats are trained and used operationally, as well as their performance in studies published to date. Available data suggest that pouched rats, which can…

  8. Giant viruses of amoebas: an update

    Directory of Open Access Journals (Sweden)

    Sarah eAherfi

    2016-03-01

    Full Text Available During the 12 past years, five new or putative virus families encompassing several members, namely Mimiviridae, Marseilleviridae, pandoraviruses, faustoviruses, and virophages were described. In addition, Pithovirus sibericum and Mollivirus sibericum represent type strains of putative new giant virus families. All these viruses were isolated using amoebal coculture methods. These giant viruses were linked by phylogenomic analyses to other large DNA viruses. They were then proposed to be classified in a new viral order, the Megavirales, on the basis of their common origin, as shown by a set of ancestral genes encoding key viral functions, a common virion architecture, and shared major biological features including replication inside cytoplasmic factories. Megavirales is increasingly demonstrated to stand in the tree of life aside Bacteria, Archaea and Eukarya, and the megavirus ancestor is suspected to be as ancient as cellular ancestors. In addition, giant amoebal viruses are visible under a light microscope and display many phenotypic and genomic features not found in other viruses, while they share other characteristics with parasitic microbes. Moreoever, these organisms appear to be common inhabitants of our biosphere, and mimiviruses and marseilleviruses were isolated from human samples and associated to diseases. In the present review, we describe the main features and recent findings on these giant amoebal viruses and virophages.

  9. Let the giants sleep. Platform technology

    Energy Technology Data Exchange (ETDEWEB)

    Hamlen, Steven

    1997-12-31

    The article relates to offshore platform technology. As the industry generally moves away from creating the lumbering giants that were the original breed of production platforms, operators are seeking more decommissioning-friendly and simple solutions which offer the economic and environmental advantages of being lighter, liftable and reusable on future development projects. 3 figs.

  10. Infrared studies of asymptotic giant branch stars

    International Nuclear Information System (INIS)

    In this thesis studies are presented of asymptotic giant branch stars, which are thought to be an important link in the evolution of the galaxy. The studies were performed on the basis of data collected by the IRAS, the infrared astronomical satelite. 233 refs.; 33 figs.; 16 tabs

  11. Polarization Spectra of Extrasolar Giant Planets

    NARCIS (Netherlands)

    D.M. Stam

    2004-01-01

    We present simulated spectra of the flux and degree of polarization of starlight that is reflected by extrasolar giant planets (EGPs). In particular the polarization depends strongly on the structure of the planetary atmosphere, and appears to be a valuable tool for the characterization of EGPs.

  12. Giant Cystic Retroperitoneal Lymphangioma in an Adult

    Directory of Open Access Journals (Sweden)

    Mary Mathew

    2013-06-01

    Full Text Available Lymphangiomas are uncommon benign neoplasms resulting from malformation of the lymphatic vessels. These lesions usually manifest in young individuals. Retroperitoneal lymphangiomas are very rare and may mimic various benign and malignant tumours. We report a rare case of giant retroperitoneal lymphangioma in a 51 year old male. [J Interdiscipl Histopathol 2013; 1(3.000: 172-174

  13. Chirp-driven giant phase space vortices

    Science.gov (United States)

    Trivedi, Pallavi; Ganesh, Rajaraman

    2016-06-01

    In a collisionless, unbounded, one-dimensional plasma, modelled using periodic boundary conditions, formation of steady state phase space coherent structures or phase space vortices (PSV) is investigated. Using a high resolution one-dimensional Vlasov-Poisson solver based on piecewise-parabolic advection scheme, the formation of giant PSV is addressed numerically. For an infinitesimal external drive amplitude and wavenumber k, we demonstrate the existence of a window of chirped external drive frequency that leads to the formation of giant PSV. The linear, small amplitude, external drive, when chirped, is shown to couple effectively to the plasma and increase both streaming of "untrapped" and "trapped" particle fraction. The steady state attained after the external drive is turned off and is shown to lead to a giant PSV with multiple extrema and phase velocities, with excess density fraction, defined as the deviation from the Maxwellian background, Δ n / n 0 ≃ 20 % - 25 % . It is shown that the process depends on the chirp time duration Δt. The excess density fraction Δn/n0, which contains both trapped and untrapped particle contribution, is also seen to scale with Δt, only inhibited by the gradient of the distribution in velocity space. Both single step drive and multistep chirp processes are shown to lead to steady state giant PSV, with multiple extrema due to embedded holes and clumps, long after the external drive is turned off.

  14. Giant Magnetostrictive Material Exciter for Panel Loudspeaker

    Institute of Scientific and Technical Information of China (English)

    WANG Rui; ZHANG Yong-fa

    2008-01-01

    The exciter component in a panel loudspeaker has a profound effect on the overall performance of the system.The equivalent circuit analysis of the combination of giant magnetostrictive material exciter and distributed mode panel is introduced and how exciter parameters influence panel lffudspeaker's performance is discussed.NumericaI predictions are given in order to show how these influences are manifested.

  15. Giant Viruses of Amoebas: An Update

    Science.gov (United States)

    Aherfi, Sarah; Colson, Philippe; La Scola, Bernard; Raoult, Didier

    2016-01-01

    During the 12 past years, five new or putative virus families encompassing several members, namely Mimiviridae, Marseilleviridae, pandoraviruses, faustoviruses, and virophages were described. In addition, Pithovirus sibericum and Mollivirus sibericum represent type strains of putative new giant virus families. All these viruses were isolated using amoebal coculture methods. These giant viruses were linked by phylogenomic analyses to other large DNA viruses. They were then proposed to be classified in a new viral order, the Megavirales, on the basis of their common origin, as shown by a set of ancestral genes encoding key viral functions, a common virion architecture, and shared major biological features including replication inside cytoplasmic factories. Megavirales is increasingly demonstrated to stand in the tree of life aside Bacteria, Archaea, and Eukarya, and the megavirus ancestor is suspected to be as ancient as cellular ancestors. In addition, giant amoebal viruses are visible under a light microscope and display many phenotypic and genomic features not found in other viruses, while they share other characteristics with parasitic microbes. Moreover, these organisms appear to be common inhabitants of our biosphere, and mimiviruses and marseilleviruses were isolated from human samples and associated to diseases. In the present review, we describe the main features and recent findings on these giant amoebal viruses and virophages. PMID:27047465

  16. Giant omental lipoblastoma and CD56 expression

    Directory of Open Access Journals (Sweden)

    Go Miyano

    2013-01-01

    Full Text Available We report a case of giant omental lipoblastoma in a 13-month-old boy, which was treated successfully by total excision. Tumor cells were positive for S100, CD34 and CD56. This is the first report of lipoblastoma expressing CD56, a fact that could be used to differentiate lipoblastoma from liposarcoma.

  17. Giant Cholesteatoma : Recommendations for Follow-up

    NARCIS (Netherlands)

    Geven, Leontien I.; Mulder, Jef J. S.; Graamans, Kees

    2008-01-01

    This report presents the management of five patients who presented with giant recurrent or residual cholesteatoma after periods of 2 to 50 years. Their case histories are highly diverse, but all provide evidence of the need for long-term follow-up.

  18. Robust giant magnetoresistive effect type multilayer sensor

    NARCIS (Netherlands)

    Lenssen, K.M.H.; Kuiper, A.E.T.; Roozeboom, F.

    2002-01-01

    A robust Giant Magneto Resistive effect type multilayer sensor comprising a free and a pinned ferromagnetic layer, which can withstand high temperatures and strong magnetic fields as required in automotive applications. The GMR multi-layer has an asymmetric magneto-resistive curve and enables sensor

  19. Surgical treatment for giant incisional hernia

    DEFF Research Database (Denmark)

    Eriksson, A; Rosenberg, J; Bisgaard, T

    2014-01-01

    , and the sublay position may have advantages over onlay positioning. To avoid tension, it may be advisable to use a mesh in combination with a component separation technique. Inlay positioning of the mesh and repair without a mesh should be avoided. CONCLUSIONS: Evidence to optimise repair for giant hernias...

  20. Foreign Giants Take Gas Pipeline Stake Equally

    Institute of Scientific and Technical Information of China (English)

    Xie Ye

    2002-01-01

    @@ Oil giants Royal/Dutch, ExxonMobil and Russia's Gazprom have agreed to take 15 percent stakes each in China's US$5.6 billion natural gas pipeline project,clearing away the final obstacles blocking the kickoff of the repeatedly delayed project, according to the latest reports from news media in early July.

  1. Giant rhabdomyoma of the right ventricle

    OpenAIRE

    De Kezel, C.C.A.; Nijveld, A.; Mooyaart, E.L.

    2004-01-01

    A giant intrathoracic mass causing foetal dysrhythmias, polyhydramnios and foetal hydrops necessitated a caesarean section in a male infant of 35 weeks gestation. Despite the benign histology of cardiac rhabdomyomas and the observation of spontaneous regression, there may be significant associated morbidity and mortality, especially in neonates. There is a high incidence of associated tuberous sclerosis.

  2. Modeling Impacts of Climate Change on Giant Panda Habitat

    Directory of Open Access Journals (Sweden)

    Melissa Songer

    2012-01-01

    Full Text Available Giant pandas (Ailuropoda melanoleuca are one of the most widely recognized endangered species globally. Habitat loss and fragmentation are the main threats, and climate change could significantly impact giant panda survival. We integrated giant panda habitat information with general climate models (GCMs to predict future geographic distribution and fragmentation of giant panda habitat. Results support a major general prediction of climate change—a shift of habitats towards higher elevation and higher latitudes. Our models predict climate change could reduce giant panda habitat by nearly 60% over 70 years. New areas may become suitable outside the current geographic range but much of these areas is far from the current giant panda range and only 15% fall within the current protected area system. Long-term survival of giant pandas will require the creation of new protected areas that are likely to support suitable habitat even if the climate changes.

  3. PERIPHERAL GIANT CELL GRANULOMAS OF ORAL CAVITY: OUR EXPERIENCE

    Directory of Open Access Journals (Sweden)

    Kamal

    2015-07-01

    Full Text Available Peripheral giant cell granuloma or the so - called “giant cell epulis” is the most common oral giant cell lesion. Peripheral giant cell granuloma (PGCG is an infrequent exophytic lesion of the oral cavity, also known as giant - cell hyperplasia, osteoclastoma, or giant cell reparative granuloma. Lesions vary in appearance from smooth, regularly outlined masses to irregularly shaped, multilobulated protuberances with surface indentations. Ulcerations of the margin are occasionally seen . This lesion probably does not represent a true neoplasm, but rather may be reactive in nature, believed to be stimulated by local irritation or trauma, but the cause is not certainly known. The aim in publishing this study is to present the clinical, histopathological features and treatment of peripheral giant cell granulomas of various sizes in different age groups in jaws

  4. A desert of gas giant planets beyond tens of au

    CERN Document Server

    Nayakshin, Sergei

    2016-01-01

    Direct imaging observations constrain the fraction of stars orbited by gas giant planets with separations greater than 10 au to about 0.01 only. This is widely believed to indicate that massive protoplanetary discs rarely fragment on planetary mass objects. I use numerical simulations of gas clumps embedded in massive gas discs to show that these observations are consistent with $\\sim 0.2 - 10$ planetary mass clumps per star being born in young gravitationally unstable discs. A trio of processes -- rapid clump migration, tidal disruption and runaway gas accretion -- destroys or transforms all of the simulated clumps into other objects, resulting in a desert of gas giants beyond separation of approximately 10 au. The cooling rate of the disc controls which of the three processes is dominant. For cooling rates faster than a few local dynamical times, clumps always grow rapidly and become massive brown dwarfs or low mass stars. For longer cooling times, post-collapse (high density) planets migrate inward to $\\si...

  5. Enoxaparin-associated giant retroperitoneal hematoma in pulmonary embolism treatment

    Directory of Open Access Journals (Sweden)

    Fahri Halit Besir

    2011-01-01

    Full Text Available Context: Retroperitoneal hematoma may usually occur as a result of trauma. A life threatening retroperitoneal hematoma is not expected complication of anticoagulation treatment and rarely reported. Low molecular weight heparins (Enoxaparin which are used as effective and safe medicine in the venous thromboemboly treatment have some major complications such as hematomas of different organs. We aim to present a giant spontaneous retroperitoneal hematoma after anticoagulant treatment of pulmonary embolism with enoxaparin. Case Report: A 73-year-old male patient with the diagnosis of pulmonary embolism underwent anticoagulant treatment (enoxaparin. In the second day of admission, the patient had an episode of abdominal and back pain. Abdominal ultrasonography and computerized tomographic scan revealed a giant retroperitoneal hematoma. Enoxaparin treatment was then stopped and the supportive treatment was started. In the following days, hemoglobin levels returned to normal and a control CT revealed regression of hematoma size. Conclusion: The anticoagulant treatment with enoxaparin may lead to severe hematomas. Therefore, the clinical suspicion is required especially in elderly patients and patients with impaired renal function for retroperitoneal hematoma, when they suffer from acute abdominal pain.

  6. Effect of Instant Cooked Giant Embryonic Rice on Body Fat Weight and Plasma Lipid Profile in High Fat-Fed Mice

    OpenAIRE

    Soo Im Chung; Tae Hyeong Kim; Rico, Catherine W.; Mi Young Kang

    2014-01-01

    The comparative effects of instant cooked rice made from giant embryo mutant or ordinary normal rice on body weight and lipid profile in high fat-fed mice were investigated. The animals were given experimental diets for seven weeks: normal control (NC), high fat (HF), and HF supplemented with instant normal white (HF-NW), normal brown (HF-NB), giant embryonic white (HF-GW), or giant embryonic brown (HF-GB) rice. The HF group showed markedly higher body weight, body fat, plasma and hepatic tri...

  7. Production of Generation-2 Mekong giant catfish (Pangasinodon gigas cultured with Spirulina sp.

    Directory of Open Access Journals (Sweden)

    Kriangsak Meng-umphan

    2008-11-01

    Full Text Available The purpose of this study is to evaluate the treatment of Spirulina-supplemented pellet feed to 5-year-old F1 groups of Mekong giant catfish (Pangasinodon gigas from the brood stock and intended for use as breeders. The effects on their growth and maturation when cultured in an earthen pond were observed. Results revealed that, compared to control, there was more gain in weight while the feed conversion ratio was lower. The number of red blood cells was also higher while that of white blood cells was lower, compared to control. Out of 18 treated fish (9 males and 9 females, 6 males and 2 females gave sperms and eggs while none from control group did. It was concluded that Spirulina supplemented in pellet feed can improve growth and maturation performance to the brood stock of Mekong giant catfish.

  8. Giant radio galaxies and cosmic web

    Science.gov (United States)

    Heinämäki, Pekka

    2016-10-01

    Giant radio galaxies create the welldistinguishable class of sources.These sources are characterized with edge-brightened radio lobes withhighly collimated radio jets and large linear sizes which make themthe largest individual structures in the Universe. They are also knownto be hosted by elliptical/disturbed host galaxies and avoid clustersand high galaxy density regions. Because of GRG, large linear sizeslobes extend well beyond the interstellar media and host galaxyhalo the evolution of the radio lobes may depend on interactionwith this environment. Using our method to extract filamentarystructure of the galaxies in our local universe we study whetherradio lobe properties in some giant radio galaxies are determinedon an interaction of this filament ambient.

  9. Giant dumbbell tumor of the posterior mediastinum

    Directory of Open Access Journals (Sweden)

    Milosavljević Miloš Z.

    2009-01-01

    Full Text Available Background. Giant dumbbell-shaped tumors are very rare and characterized by intra- and extraspinal propagation of different dimensions. In thoracal localization, invasive growth can lead up to rib and vertebra erosion. Case report. We presented a 54-year-old woman with a giant dumbbell schwannoma in the posterior mediastinum. The tumor was removed by the posterior approach with hemilaminectomy and costotransversectomy. By microscopic examination the diagnosis of benign schwannoma was made. A year after the surgery, the patient was without neurological deficiency and without radiological signs of illness relapse. Conclusion. Treatment of dumbbell schwannoma is surgical, dilemmas of the optimal surgical approach. When it is thoracally located the posterior approach with hemilaminectomy and costotransversectomy is safe and effective for its removal.

  10. Convection and Mixing in Giant Planet Evolution

    CERN Document Server

    Vazan, Allona; Kovetz, Attay; Podolak, Morris

    2015-01-01

    The primordial internal structures of gas giant planets are unknown. Often giant planets are modeled under the assumption that they are adiabatic, convective, and homogeneously mixed, but this is not necessarily correct. In this work, we present the first self-consistent calculation of convective transport of both heat and material as the planets evolve. We examine how planetary evolution depends on the initial composition and its distribution, whether the internal structure changes with time, and if so, how it affects the evolution. We consider various primordial distributions, different compositions, and different mixing efficiencies and follow the distribution of heavy elements in a Jupiter-mass planet as it evolves. We show that a heavy-element core cannot be eroded by convection if there is a sharp compositional change at the core-envelope boundary. If the heavy elements are initially distributed within the planet according to some compositional gradient, mixing occurs in the outer regions resulting in a...

  11. Organ Sparing Surgery for a Giant Liposarcoma

    Directory of Open Access Journals (Sweden)

    Huseyin Ozgur Aytac

    2015-03-01

    Full Text Available Liposarcomas those are malignant soft tissue tumors often occur in large sizes in the retroperitoneum and abdomen due to their silent clinic. Excision with negative margins is the gold standard of treatment. A case operated on for a giant intraabdominal liposarcoma is being reported. A giant soft tissue tumor filling the whole abdomen was determined in the computed tomography scan. Core biopsy was obtained and demonstrated a well-differentiated liposarcoma. A 15 kg of mass 44x30x14 cm in size was excised en-bloc. Pathological examination of this tumor showed a well-differentiated liposarcoma with mixoid parts. No recurrence was observed in two years of follow-up despite any adjuvant therapy. This is to be one of the largest retroperitoneal sarcomas in the literature. [Cukurova Med J 2015; 40(Suppl 1: 136-141

  12. Viral metagenomics: are we missing the giants?

    Science.gov (United States)

    Halary, S; Temmam, S; Raoult, D; Desnues, C

    2016-06-01

    Amoeba-infecting giant viruses are recently discovered viruses that have been isolated from diverse environments all around the world. In parallel to isolation efforts, metagenomics confirmed their worldwide distribution from a broad range of environmental and host-associated samples, including humans, depicting them as a major component of eukaryotic viruses in nature and a possible resident of the human/animal virome whose role is still unclear. Nevertheless, metagenomics data about amoeba-infecting giant viruses still remain scarce, mainly because of methodological limitations. Efforts should be pursued both at the metagenomic sample preparation level and on in silico analyses to better understand their roles in the environment and in human/animal health and disease. PMID:26851442

  13. PERIPHERAL GIANT CELL GRANULOMA- A CASE REPORT

    Directory of Open Access Journals (Sweden)

    Ashutosh Agrawal

    2013-07-01

    Full Text Available The peripheral giant cell granuloma (PGCG is a benign inflammatory hyperplastictype of lesion of unknown etiology occurring in gingiva or alveolar ridge. It normally presentsas a soft tissue purplish-red nodule consisting of multinucleated giant cells in a background ofmononuclear stromal cells and extravasated red blood cells. A 75 years old male patientreported with a chief complaint of pain and swelling in lower right back region of mouth. Onintra-oral examination the swelling was red, firm and sessile with smooth surface texture. Theorthopantomogram (OPG revealed a well-demarcated radiolucency extending from distalaspect of mandibular canine to mesial aspect of mandibular first molar. The cone beamcomputed tomography also showed the features suggestive of soft tissue lesion causingcupping resorption of mandible. Excisional biopsy was performed under local anaesthesiaand tissue was examined histopathologically. The lesion was diagnosed as PGCG afterthorough clinical, radiologic and histopathologic examination.

  14. Study of giant resonances in heavy nuclei

    International Nuclear Information System (INIS)

    The electrodisintegration cross section for181Ta,208Pb and 209Bi was measured by counting the emitted neutrons, with incident electrons in the energy range 8-22 MeV. The data was analysed using the virtual photon method, in order to obtain a multipole decomposition and the intensities of Magnetic Dipole and Electric Quadrupole, isoscalar and isovector, in the Giant Resonance. The results obtained for the isovector Giant Quadrupole Resonance are compared with the measured photodisintegration cross section, using data from Saclay and Livermore. This comparision indicates that the photodisintegration data can be well explained assuming an isovector E2 Resonance located between 120 and 130 A-1/3 MeV, with an intensity of one isovector E2 sum. (author)

  15. Interacting Giant Gravitons from Spin Matrix Theory

    CERN Document Server

    Harmark, Troels

    2016-01-01

    Using the non-abelian DBI action we find an effective matrix model that describes the dynamics of weakly interacting giant gravitons wrapped on three-spheres in the AdS part of AdS_5 x S^5 at high energies with two angular momenta on the S^5. In parallel we consider the limit of \\CN=4 super Yang-Mills theory near a certain unitarity bound where it reduces to the quantum mechanical theory called SU(2) Spin Matrix Theory. We show that the exact same matrix model that describes the giant gravitons on the string theory side also provides the effective description in the strong coupling and large energy limit of the Spin Matrix Theory. Thus, we are able to match non-supersymmetric dynamics of D-branes on AdS_5 x S^5 to a finite-N regime in \\CN=4 super Yang-Mills theory near a unitarity bound.

  16. Giant peripheral osteoma of the mandible

    Directory of Open Access Journals (Sweden)

    Sushil Kachewar

    2012-01-01

    Full Text Available Osseous expansion of any body part is an unwelcome guest and deep are its impacts when it is located on the face. The bigger the lesion, the more bitter is the psycho-social trauma to the affected individual. This article describes the case of a 50 year old female who presented with painless swelling of the right submandibular region manifesting as a dreadful cosmetic disfigurement. The mass had been progressing slowly for the last 15 years. Imaging showed a giant peripheral osteoma of 10.8 cm involving buccal and lingual surface of the body, ramus, angle and inferior border of the right side of mandible. To the best of our knowledge, a giant peripheral osteoma of mandible having size more than 10 cm has never been reported earlier.

  17. Fingering Convection in Red Giants Revisited

    CERN Document Server

    Wachlin, F C; Althaus, L G

    2014-01-01

    Fingering (thermohaline) convection has been invoked for several years as a possible extra-mixing which could occur in Red Giant stars due to the modification of the chemical composition induced by nuclear reactions in the hydrogen burning zone. Recent studies show however that this mixing is not sufficient to account for the needed surface abundances. A new prescription for fingering convection, based on 3D numerical simulations has recently been proposed (BGS). The resulting mixing coefficient is larger than the ones previously given in the literature. We compute models using this new coefficient and compare them to previous studies. We use the LPCODE stellar evolution code with the GNA generalized version of the mixing length theory to compute Red Giant models and we introduce fingering convection using the BGS prescription. The results show that, although the fingering zone now reaches the outer dynamical convective zone, the efficiency of the mixing is not enough to account for the observations. The fing...

  18. A CASE REPORT OF GIANT GENITAL WARTS

    Directory of Open Access Journals (Sweden)

    L. Grimaldi

    2014-12-01

    Full Text Available Giant genital warts (GGW represent a rare form of sexually transmitted disease caused by the human papillomavirus, arising more frequently in the vulvar and perianal regions as large exophytic cauliflower-like mass. Estimated rate of recurrence is 60 to 66%, while malignant transformation is possible and it has been reported in 30 to 56% of cases. A 45- years-old woman was admitted to our Structure of Plastic and Reconstructive Surgery, Siena, Italy with an extensive cauliflower- like masses diffused on vulvar and perianal region. The patient was treated in general anaesthesia, with a wide en bloc excision up to free clinical edges and immediate reconstruction of the vulvar continuity. Buschke Lowenstein tumour or giant genital warts is a sporadic tumour with an elevate local recurrence rate. In some cases, surgery can be very difficult and it must be associated to other strategies. An accurate follow-up is always necessary

  19. Giant colonic diverticulum: radiographic and MDCT characteristics.

    Science.gov (United States)

    Zeina, Abdel-Rauf; Mahamid, Ahmad; Nachtigal, Alicia; Ashkenazi, Itamar; Shapira-Rootman, Mika

    2015-12-01

    Giant colonic diverticulum (GCD), defined as a diverticulum larger than 4 cm, is a rare entity that is generally a manifestation of colonic diverticular disease. Because of its rarity and its variable and non-specific presentation, the diagnosis of GCD depends mainly on imaging findings. Knowledge of the spectrum of radiographic and CT features of the GCD is important in making the correct diagnosis and potentially preventing complications. This review focuses on imaging findings characteristic of GCD as well as its complications and radiographic mimics. Teaching points • Giant colonic diverticulum is a rare complication of diverticulosis.• The most common symptom is abdominal pain presenting in approximately 70 % of patients.• Diagnosis is based on imaging findings with plain abdominal radiographs and MDCT.• Treatment consists of en bloc resection of the diverticulum and affected adjacent colon.

  20. Giant Uterine Fibromyoma. A Case Report

    Directory of Open Access Journals (Sweden)

    Tahiluma Santana Pedraza

    2013-12-01

    Full Text Available The uterus is the common site for multiple benign and malignant conditions. Giant uterine fibromyoma is a benign tumor of low incidence. Its management poses a challenge for the surgical team because of the volume of the surgical specimen and the variations in the distribution of intra-abdominal organs caused by uterine growth. A case of a 43-year-old patient with a history of bronchial asthma and hypertension who presented with enlargement of the abdomen and vaginal bleeding is reported. The patient was attended by the General Surgery Department of the María Genoveva Guerrero Ramos Comprehensive Diagnostic Center in the Libertador Municipality, Capital District, Venezuela. Total abdominal hysterectomy and complementary appendectomy were performed. The histopathological study showed a giant uterine fibromyoma. Postoperative progress was satisfactory. It was decided to present the case due to its rarity.

  1. Giant gravitons in non-supersymmetric backgrounds

    International Nuclear Information System (INIS)

    We consider giant gravitons as probes of a class of ten-dimensional solutions of type-IIB supergravity which arise as lifts of solutions of U(1)3 gauged N=2 supergravity in five-dimensions. Surprisingly it is possible to solve exactly for minimum energy configurations of these spherical D3-brane probes in the compact directions, even in backgrounds which preserve no supersymmetry. The branes behave as massive charged particles in the five non-compact dimensions. As an example we probe geometries which are believed to represent the supergravity background of coherent states of giant gravitons. We comment on the apparently repulsive nature of the naked singularities in these geometries. (author)

  2. Giant intraparenchymal neurocysticercosis: Unusual MRI findings

    Directory of Open Access Journals (Sweden)

    Agarwal Prachi

    2004-04-01

    Full Text Available We report a case of surgically proven giant neurocysticercosis (NCC. MR imaging revealed an unusually large solitary parenchymal cystic lesion showing signal intensity similar to CSF on all pulse sequences, with internal septations and a small nodule in the anterior aspect of this lesion compatible with this diagnosis. Identification of a scolex in a cystic lesion with CSF intensity plays a key role in the diagnosis of NCC. The presence of internal septations is an atypical feature.

  3. Asteroseismic age determination for dwarfs and giants

    CERN Document Server

    Aguirre, V Silva

    2015-01-01

    Asteroseismology can make a substantial contribution to our understanding of the formation history and evolution of our Galaxy by providing precisely determined stellar properties for thousands of stars in different regions of the Milky Way. We present here the different sets of observables used in determining asteroseismic stellar properties, the typical level of precision obtained, the current status of results for ages of dwarfs and giants and the improvements than can be expected in the near future in the context of Galactic archaeology.

  4. Giant Otters and Ecotourism in Peru

    OpenAIRE

    Staib E.; Schenck, C

    1994-01-01

    Giant otters are the most endangered otters in the world, threatened by rainforest destruction, over fishing, the contamination of the water systems with mercury in areas of gold miners, illegal hunting and, possible infections with diseases of domestic animals. Numbers are so low that every otter is valuable. A new and increasing threat is tourism. Tourists find these animals very memorable and attractive, and guides lead their clients to find them. This disturbs otters, especially in places...

  5. Giant eruptions of very massive stars

    CERN Document Server

    Davidson, Kris

    2016-01-01

    Giant eruptions or supernova-impostor events are far more mysterious than true supernovae. An extreme example can release as much radiative energy as a SN, ejecting several M_sun of material. These events involve continuous radiation-driven outflows rather than blast waves. They constitute one of the main unsolved problems in stellar astrophysics, but have received surprisingly little theoretical effort. Here I note some aspects that are not yet familiar to most astronomers.

  6. Giant gastric trichobezoar in a young female.

    Science.gov (United States)

    Ibuowo, Abdulrazaq Akin; Saad, Anwar; Okonkwo, Thomas

    2008-12-01

    Bezoars are concretions of undigested matter in the gastrointestinal tract (GIT), most commonly in the stomach. The main predispositions to bezoar formation are, altered GIT anatomy or disordered GIT motility/physiology. Clinically, bezoars are classified according to their predominant component. Trichobezoars (composed mainly of hair) as a clinical entity are almost always associated with an underlying psychiatric disorder. We present below a case of giant gastric trichobezoar in a young female which was treated by gastrostomy and excision of the mass.

  7. Giant Magneto-Impedance and its Applications

    CERN Document Server

    Tannous, C

    2002-01-01

    The status of Giant Magneto-Impedance effect is reviewed in Wires, Ribbons and Multilayered Soft Ferromagnetic Thin Films. After establishing the theoretical framework for the description of the effect, and the constraints any material should have in order to show the effect, experimental work in Wires, Ribbons and Multilayered Thin Films is described. Existing and potential applications of the effect in Electronics and Sensing are highlighted.

  8. Glucagonoma syndrome demonstrating giant duodenal villi.

    OpenAIRE

    Stevens, F M; Flanagan, R W; O'Gorman, D; Buchanan, K D

    1984-01-01

    A 39 year old man developed an itchy bullous rash in the perineum and on the extremities. Six years later, after giant intestinal villi had been noted at endoscopy, a diagnosis of the glucagonoma syndrome was made. Investigation revealed a large tumour of the pancreatic body and tail. The molecular species of glucagon secreted by the tumour were characterised using the combined purification procedures of immunoaffinity chromatography followed by gel filtration.

  9. Merging Criteria for Giant Impacts of Protoplanets

    OpenAIRE

    Genda, H.; Kokubo, E.; Ida, S.

    2011-01-01

    At the final stage of terrestrial planet formation, known as the giant impact stage, a few tens of Mars-sized protoplanets collide with one another to form terrestrial planets. Almost all previous studies on the orbital and accretional evolution of protoplanets in this stage have been based on the assumption of perfect accretion, where two colliding protoplanets always merge. However, recent impact simulations have shown that collisions among protoplanets are not always merging events, that i...

  10. Giant Myoepithelioma of the Soft Palate

    Directory of Open Access Journals (Sweden)

    Murat Oktay

    2014-01-01

    Full Text Available Myoepitheliomas are benign salivary gland tumors and account for less than 1% of all salivary gland tumors. They are usually located in the parotid gland. The soft palate is very rare affected site. The differential diagnosis of myoepitheliomas should include reactive and neoplastic lesions. The treatment of myoepitheliomas is complete removal of the tumor. Herein, we report a case with giant myoepithelioma of the soft palate, reviewing the related literature.

  11. Giant osteoblastoma of temporal bone: case report

    Directory of Open Access Journals (Sweden)

    FIGUEIREDO EBERVAL GADELHA

    1998-01-01

    Full Text Available Benign osteoblastoma is an uncommon bone tumor accounting for approximately 1% of all bone tumors. There are only 35 cases of skull osteoblastoma reported in the literature. We describe the case of a 23 year old male with a giant osteoblastoma of temporal bone submitted to a total removal of the tumor after an effective embolization of all external carotid branches. The authors discuss diagnostic and management aspects of this uncommon skull tumor.

  12. Giant solitary trichoepithelioma: A Case report

    Directory of Open Access Journals (Sweden)

    Recep Bedir

    2013-03-01

    Full Text Available Trichoepithelioma is a benign cutaneus tumour originatingfrom hair follicles. It is most commonly found on theface and scalp. Histopathologic examination was composedof band-like nests of basaloid cells showing peripheralpalization, abortive hair papilla and horn cysts ina fibrocellular stroma. A 82-year-old woman applied for a10-year old groin mass that recently slowly growing. Thelesion was excised and it was diagnosed as giant solitarytrichoephitelioma.Key words: Groin, hair follicle, skin neoplasms

  13. Giant Intrapulmonary Teratoma: A Rare Case

    OpenAIRE

    Rayees Ahmad Dar; Majid Mushtaque; Sabiya Hamid Wani; Rayees Ahmed Malik

    2011-01-01

    Teratomas are tumors composed of tissues derived from more than one germ cell line. Pulmonary teratomas are rare and commonly involve the upper lobe of the left lung. Criteria for pulmonary origin are the exclusion of a gonadal or other extragonadal primary site and origin entirely within the lung. We report a case of a giant pulmonary teratoma in a 2-year-old male child and review the relevant literature.

  14. Giant Magellan Telescope Site Testing Summary

    OpenAIRE

    Thomas-Osip, Joanna E.; McCarthy, Patrick; Prieto, Gabriel; Phillips, Mark M.; Johns, Matt

    2011-01-01

    Cerro Las Campanas located at Las Campanas Observatory (LCO) in Chile has been selected as the site for the Giant Magellan Telescope. We report results obtained since the commencement, in 2005, of a systematic site testing survey of potential GMT sites at LCO. Meteorological (cloud cover, temperature, pressure, wind, and humidity) and DIMM seeing data have been obtained at three potential sites, and are compared with identical data taken at the site of the twin Magellan 6.5m telescopes. In ad...

  15. Radio Mode Outbursts in Giant Elliptical Galaxies

    CERN Document Server

    Nulsen, Paul; Forman, William; Churazov, Eugene; McNamara, Brian; David, Laurence; Murray, Stephen

    2009-01-01

    Outbursts from active galactic nuclei (AGN) affect the hot atmospheres of isolated giant elliptical galaxies (gE's), as well as those in groups and clusters of galaxies. Chandra observations of a sample of nearby gE's show that the average power of AGN outbursts is sufficient to stop their hot atmospheres from cooling and forming stars, consistent with radio mode feedback models. The outbursts are intermittent, with duty cycles that increases with size.

  16. Numerical Simulations of Ice Giant Interiors with Radially Varying Electrical Conductivity

    Science.gov (United States)

    Soderlund, Krista M.; Featherstone, Nicholas; Heimpel, Moritz; Aurnou, Jonathan

    2016-10-01

    The internal dynamics of giant planets are controlled primarily by the interaction of convection, stratification, rotation, and magnetic fields. Within Uranus and Neptune, the ice giants, convection in the ionic ocean generates the planets' magnetic fields through dynamo action, while convection in the molecular envelope may generate the planets' zonal winds. Previous work has hypothesized the influence of rotation on convection to be relatively weak compared to that of buoyancy, leading to fluctuating fluid motions that are characterized by three-dimensional turbulence instead of columns aligned with the rotation axis (Aurnou et al., Icarus 190, 110-126, 2007; Soderlund et al., Icarus 224, 97-113, 2013). In this regime, convection generates a multipolar dynamo and zonal flows with a retrograde equatorial jet and a prograde high latitude jet in each hemisphere that look similar to those observed on the ice giants. However, the magnetic field strength and zonal wind speeds are overestimated in our models with constant electrical conductivity. Towards resolving this discrepancy, we hypothesize that incorporation of an electrically insulating outer molecular envelope will bring the magnetic field and zonal flows into quantitative agreement. We will present new simulations that include radial variations in electrical conductivity based on internal structure models in combination with material property estimates and will discuss the potential for coupling between dynamo action in the ionic ocean and zonal flow generation in the molecular envelope. In addition, we will highlight how these simulations will both contribute to and benefit from the next mission to an ice giant planet.

  17. Giant fields in the southeast of Mexico

    Energy Technology Data Exchange (ETDEWEB)

    Acevedo, J.S.; Dautt, O.M.

    1980-01-01

    From a geologic and petroliferous point of view, the southeast zone coastal plain of Mexico has been divided into the saline basin of the Isthmus, the Macuspana Basin, and the Chiapas-Tabasco Mesozoic area. In the first 2 basins, there are giant producer fields from tertiary sands. In the saline basin of the Isthmus, production comes from structural traps associated with saline domes. In the Macuspana Basin, production comes from anticlines. The Chiapas-Tabasco Mesozoic area produces from Jurassic, Lower, Middle and Upper Cretaceous dolomitic limestones and dolomites associated with anticlines. The marine platform of Campeche produces from Jurassic and Cretaceous dolomites and lower Paleocene dolomitic Breccias associated with anticlines having numerous normal and thrust faults. A brief description is given of 5 giant fields in the saline basin of the Isthmus and 3 fields in the Macuspana Basin; a more detailed description is given of 4 giant fields in the Chiapas-Tabasco area and 2 in the sound of Campeche.

  18. Two cases of giant serpentine aneurysm.

    Science.gov (United States)

    Kumabe, T; Kaneko, U; Ishibashi, T; Kaneko, K; Uchigasaki, S

    1990-06-01

    Giant serpentine aneurysm (GSA) is an entity defined on radiological and pathological grounds as a giant, partially thrombosed aneurysm containing tortuous vascular channels. We have had the opportunity to study two patients with GSAs, which has allowed for a complete comparative anatomical and radiological study. This report emphasizes the etiology of the GSAs. Twenty-two patients with GSAs have been reported in the literature, of which pathological studies were done in 10. In most of these, the aneurysm was found to be filled with an organized thrombus, but in our patients the aneurysm was filled with relatively new clot. The aneurysm enlarged and a change in the tortuous vascular channel was observed over a period of 1 year in the first patient, whereas a globoid aneurysm developed into a GSA in the brief period of just 2 weeks in the second patient. This rapid transformation of a globoid aneurysm into a GSA is of particular interest when the etiology of GSAs is considered. Our patients therefore shed some interesting light on the possible pathophysiology of GSAs. That is, the bloodstream may change dynamically in a giant aneurysm and may become a serpentine channel under conditions that lead to a "Coanda effect." PMID:2362659

  19. Giant Ureterohydronephrosis Due To A Ureteral Stone

    Directory of Open Access Journals (Sweden)

    Ersagun Karagüzel

    2012-07-01

    Full Text Available A 61-year-old man presented with left renal colic pain within 5 days. He had no history of ureteral colic and no family history of renal stone disease. Physical examination revealed left costovertebral angle tenderness and a palpable mass in the left flank region. Roentgenelogic examination including direct urinary system graphy showed a left pelvic radiopaque nodule (Figure 1. The serum creatinine level was 1.8 mg/dl.  The rest of the laboratory parameters were within normal limits. Computed tomography of the abdomen revealed a left lower ureteral stone (2.5cm and giant ureterohydronephrosis (Figure 2 A, B, C. He received ureteroscopic lithotripsy and placement of a double-J ureteral stent. The most common cause of the giant hydronephrosis is ureteropelvic obstruction, stones, tumors and trauma. Urolithiasis could present asymptomatically and result in a rare condition termed giant hydronephrosis, defined as the presence of more than 1 L of fluid in the collecting system [1]. As in our case the reason of the hydronephrosis and hydroureter is the obstruction caused by a distal ureteral stone. Percutaneous nephrostomy followed by subsequent lithotripsy and even nephrectomy in the case of non-functioning kidney may be the other treatment options.

  20. Silicon abundances in population I giants

    Science.gov (United States)

    Boehm-Vitense, Erika

    1992-01-01

    Silicon to carbon abundance ratios for population I giants were determined from emission lines originating in the transition layers between stellar chromospheres and coronae. For effective temperatures larger than 6200 K we find a group of stars with increased silicon to carbon but normal nitrogen to carbon abundance ratios. These stars are presumably descendents from Ap stars with increased surface silicon to carbon abundance ratios. For G stars this anomaly disappears as is to be expected due to the increased depth of the convection zone and therefore deeper mixing which dilutes the surface overabundances. The disappearance of the abundance anomalies proves that the anomalous abundances observed for the F giants are indeed only a surface phenomenon. It also proves that the same holds for their progenitors, the Ap and Am stars, as has been generally believed. Unexplained is the increased silicon to carbon abundance ratio observed for several stars cooler than 5100 L. RS CVn and related stars do not show this increased abundance ratio. There are also some giants which appear to be enriched in carbon, perhaps due to a helium flash with some mixing if the star is a clump star.

  1. Could Jupiter or Saturn Have Ejected a Fifth Giant Planet?

    CERN Document Server

    Cloutier, Ryan; Valencia, Diana

    2015-01-01

    Models of the dynamical evolution of the early solar system following the dispersal of the gaseous protoplanetary disk have been widely successful in reconstructing the current orbital configuration of the giant planets. Statistically, some of the most successful dynamical evolution simulations have initially included a hypothetical fifth giant planet, of ice giant mass, which gets ejected by a gas giant during the early solar system's proposed instability phase. We investigate the likelihood of an ice giant ejection event by either Jupiter or Saturn through constraints imposed by the current orbits of their wide-separation regular satellites Callisto and Iapetus respectively. We show that planetary encounters that are sufficient to eject an ice giant, often provide excessive perturbations to the orbits of Callisto and Iapetus making it difficult to reconcile a planet ejection event with the current orbit of either satellite. Quantitatively, we compute the likelihood of reconciling a regular Jovian satellite ...

  2. Evolutionary divergency of giant tortoises in Gal?pagos

    Science.gov (United States)

    Fritts, T.H.

    1984-01-01

    The giant tortoises in the Galapagos Archipelago diverge considerably in size, and in shape and other carapace characteristics. The saddleback morphotype is known only from insular faunas lacking large terrestrial predators (i.e. Galapagos and Mauritius) and in Galapagos is associated with xeric habitats where vertical feeding range and vertical reach in agonistic encounters are adaptive. The large domed morphotype is associated with relatively cool, mesic habitats where intraspecific competition for food and other resources may be less intense than in xeric habitats. Other external characteristics that differ between tortoise populations are also correlated with ecological variation. Tortoises have radiated into a mosaic of ecological conditions in the Galapagos but critical data are lacking on the role of genetic and environmental controls on phenotypic variation. Morphological divergence in tortoises is potentially a better indicator of present ecological conditions than of evolutionary relationships.

  3. Salvage surgery for a giant melanoma on the back.

    Science.gov (United States)

    Kruijff, Schelto; Vink, Robert; Klaase, Joost

    2011-07-11

    We report a case of a giant melanoma on the back with a very extreme Breslow thickness. On physical examination a large odorous and ulcerating tumour was seen adjacent to two large crusted lesions, probably in transit metastases. In the right and left axilla enlarged lymph nodes were palpated. The patient underwent salvage surgery consisting of a complete wide excision of the tumors on the back as well as axillary lymph node dissection on both sides. Histopathology showed a malignant melanoma with a Breslow thickness of 48 mm. Four of fifteen nodes in the right axilla and one of nine nodes in the left axilla, were positive for metastatic disease. Also various in transit and subcutaneous metastases were found in the wide excision specimen. The interest of our observation relies in the rarity of a melanoma with such an extreme Breslow thickness and the difficulty in performing adequate palliative therapy that offers quality of life by means of tumor control. PMID:22066035

  4. A Giant Scapular Aneurysmal Bone Cyst in a Child

    Directory of Open Access Journals (Sweden)

    Theodoros Beslikas

    2012-01-01

    Full Text Available Aneurysmal bone cysts (ABCs are rare benign bone tumours. Scapula is a very rare location, and the relative literature is sparse. The purpose of this study is to present a case of a giant aggressive scapular aneurysmal bone cyst in a child. A 7-year-old boy presented to our hospital with pain and a palpated mass on the right scapula. Imaging studies (radiographs computed tomography scintigraphy were indicative of aneurysmal bone cyst. We performed curettage and bone grafting after the diagnosis was set by pathological examination through a posterior shoulder approach. Five years later, the patient has only residual signs of the lesion on radiographic control without signs of recurrence.

  5. Salvage surgery for a giant melanoma on the back

    Directory of Open Access Journals (Sweden)

    Joost Klaase

    2011-07-01

    Full Text Available We report a case of a giant melanoma on the back with a very extreme Breslow thickness. On physical examination a large odorous and ulcerating tumour was seen adjacent to two large crusted lesions, probably in transit metastases. In the right and left axilla enlarged lymph nodes were palpated. The patient underwent salvage surgery consisting of a complete wide excision of the tumors on the back as well as axillary lymph node dissection on both sides. Histopathology showed a malignant melanoma with a Breslow thickness of 48 mm. Four of fifteen nodes in the right axilla and one of nine nodes in the left axilla, were positive for metastatic disease. Also various in transit and subcutaneous metastases were found in the wide excision specimen. The interest of our observation relies in the rarity of a melanoma with such an extreme Breslow thickness and the difficulty in performing adequate palliative therapy that offers quality of life by means of tumor control.

  6. Breast carcinoma with osteoclast-like giant cells

    DEFF Research Database (Denmark)

    Gjerdrum, L M; Lauridsen, M C; Sørensen, Flemming Brandt

    2001-01-01

    Primary carcinoma with osteoclast-like giant cells is a very rare tumour of the female breast. The clinical course, histological, immunohistochemical and ultrastructural features of 61 cases of invasive duct carcinoma with osteoclast-like multinucleated giant cells (OMGCs) are reviewed and a new...... stroma. Immunohistochemical and ultrastructural studies have claimed a benign histiocytic nature of the OMGCs; they may represent a special type of polykaryon, distinct from both osteoclasts and inflammatory giant cells....

  7. Giant arachnoid granulation in a patient with benign intracranial hypertension

    Energy Technology Data Exchange (ETDEWEB)

    Kiroglu, Yilmaz; Yaqci, Baki; Cirak, Bayram; Karabulut, Nevzat [Pamukkale University, Department of Radiology, School of Medicine, Denizli (Turkey)

    2008-10-15

    We report magnetic resonance (MR), computed tomography (CT) and angiographic imaging of an unusual giant arachnoid granulation in the superior sagittal sinus in a man with headache and vertigo. Intrasinus pressure measurements revealed a significant pressure gradient across the lesion. MR imaging is useful to identify giant arachnoid granulation and dural sinus thrombosis, whereas dural sinus pressure measurement in certain cases of giant arachnoid granulations can be used to evaluate the lesion as the cause of the patient's symptoms. (orig.)

  8. Three cases giant panda attack on human at Beijing Zoo

    OpenAIRE

    Zhang, Peixun; Wang, Tianbing; Xiong, Jian; Xue, Feng; Xu, Hailin; Chen, Jianhai; Zhang, Dianying; Fu, Zhongguo; Jiang, Baoguo

    2014-01-01

    Panda is regarded as Chinese national treasure. Most people always thought they were cute and just ate bamboo and had never imagined a panda could be vicious. Giant panda attacks on human are rare. There, we present three cases of giant panda attacks on humans at the Panda House at Beijing Zoo from September 2006 to June 2009 to warn people of the giant panda’s potentially dangerous behavior.

  9. Shoot transcriptome of the giant reed, Arundo donax

    Directory of Open Access Journals (Sweden)

    Roberto A. Barrero

    2015-06-01

    Full Text Available The giant reed, Arundo donax, is a perennial grass species that has become an invasive plant in many countries. Expansive stands of A. donax have significant negative impacts on available water resources and efforts are underway to identify biological control agents against this species. The giant reed grows under adverse environmental conditions, displaying insensitivity to drought stress, flooding, heavy metals, salinity and herbaceous competition, thus hampering control programs. To establish a foundational molecular dataset, we used an llumina Hi-Seq protocol to sequence the transcriptome of actively growing shoots from an invasive genotype collected along the Rio Grande River, bordering Texas and Mexico. We report the assembly of 27,491 high confidence transcripts (≥200 bp with at least 70% coverage of known genes in other Poaceae species. Of these 13,080 (47.58%, 6165 (22.43% and 8246 (30.0% transcripts have sequence similarity to known, domain-containing and conserved hypothetical proteins, respectively. We also report 75,590 low confidence transcripts supported by both trans-ABBySS and Velvet-Oases de novo assembly pipelines. Within the low confidence subset of transcripts we identified partial hits to known (19,021; 25.16%, domain-containing (7093; 9.38% and conserved hypothetical (16,647; 22.02% proteins. Additionally 32,829 (43.43% transcripts encode putative hypothetical proteins unique to A. donax. Functional annotation resulted in 5,550 and 6,070 transcripts with assigned Gene Ontology and KEGG pathway information, respectively. The most abundant KEGG pathways are spliceosome, ribosome, ubiquitin mediated proteolysis, plant–pathogen interaction, RNA degradation and oxidative phosphorylation metabolic pathway. Furthermore, we also found 12, 9, and 4 transcripts annotated as stress-related, heat stress, and water stress proteins, respectively. We envisage that these resources will promote and facilitate studies of the abiotic

  10. Shoot transcriptome of the giant reed, Arundo donax.

    Science.gov (United States)

    Barrero, Roberto A; Guerrero, Felix D; Moolhuijzen, Paula; Goolsby, John A; Tidwell, Jason; Bellgard, Stanley E; Bellgard, Matthew I

    2015-06-01

    The giant reed, Arundo donax, is a perennial grass species that has become an invasive plant in many countries. Expansive stands of A. donax have significant negative impacts on available water resources and efforts are underway to identify biological control agents against this species. The giant reed grows under adverse environmental conditions, displaying insensitivity to drought stress, flooding, heavy metals, salinity and herbaceous competition, thus hampering control programs. To establish a foundational molecular dataset, we used an llumina Hi-Seq protocol to sequence the transcriptome of actively growing shoots from an invasive genotype collected along the Rio Grande River, bordering Texas and Mexico. We report the assembly of 27,491 high confidence transcripts (≥200 bp) with at least 70% coverage of known genes in other Poaceae species. Of these 13,080 (47.58%), 6165 (22.43%) and 8246 (30.0%) transcripts have sequence similarity to known, domain-containing and conserved hypothetical proteins, respectively. We also report 75,590 low confidence transcripts supported by both trans-ABBySS and Velvet-Oases de novo assembly pipelines. Within the low confidence subset of transcripts we identified partial hits to known (19,021; 25.16%), domain-containing (7093; 9.38%) and conserved hypothetical (16,647; 22.02%) proteins. Additionally 32,829 (43.43%) transcripts encode putative hypothetical proteins unique to A. donax. Functional annotation resulted in 5,550 and 6,070 transcripts with assigned Gene Ontology and KEGG pathway information, respectively. The most abundant KEGG pathways are spliceosome, ribosome, ubiquitin mediated proteolysis, plant-pathogen interaction, RNA degradation and oxidative phosphorylation metabolic pathway. Furthermore, we also found 12, 9, and 4 transcripts annotated as stress-related, heat stress, and water stress proteins, respectively. We envisage that these resources will promote and facilitate studies of the abiotic stress

  11. Lithium and magnetic fields in giants. HD 232862 : a magnetic and lithium-rich giant star

    OpenAIRE

    Lèbre, A.; Palacios, A.; Nascimento Jr, J. D. do; Konstantinova-Antova, R.; Kolev, D.; Aurière, M.; de Laverny, P.; de Medeiros, J. R.

    2009-01-01

    We report the detection of an unusually high lithium content in HD 232862, a field giant classified as a G8II star, and hosting a magnetic field. With the spectropolarimeters ESPaDOnS at CFHT and NARVAL at TBL, we have collected high resolution and high signal-to-noise spectra of three giants : HD 232862, KU Peg and HD 21018. From spectral synthesis we have inferred stellar parameters and measured lithium abundances that we have compared to predictions from evolutionary models. We have also a...

  12. Giant Impacts on Earth-Like Worlds

    Science.gov (United States)

    Kohler, Susanna

    2016-05-01

    Earth has experienced a large number of impacts, from the cratering events that may have caused mass extinctions to the enormous impact believed to have formed the Moon. A new study examines whether our planets impact history is typical for Earth-like worlds.N-Body ChallengesTimeline placing the authors simulations in context of the history of our solar system (click for a closer look). [Quintana et al. 2016]The final stages of terrestrial planet formation are thought to be dominated by giant impacts of bodies in the protoplanetary disk. During this stage, protoplanets smash into one another and accrete, greatly influencing the growth, composition, and habitability of the final planets.There are two major challenges when simulating this N-body planet formation. The first is fragmentation: since computational time scales as N^2, simulating lots of bodies that split into many more bodies is very computationally intensive. For this reason, fragmentation is usually ignored; simulations instead assume perfect accretion during collisions.Total number of bodies remaining within the authors simulations over time, with fragmentation included (grey) and ignored (red). Both simulations result in the same final number of bodies, but the ones that include fragmentation take more time to reach that final number. [Quintana et al. 2016]The second challengeis that many-body systems are chaotic, which means its necessary to do a large number of simulations to make statistical statements about outcomes.Adding FragmentationA team of scientists led by Elisa Quintana (NASA NPP Senior Fellow at the Ames Research Center) has recently pushed at these challenges by modeling inner-planet formation using a code that does include fragmentation. The team ran 140 simulations with and 140 without the effects of fragmentation using similar initial conditions to understand how including fragmentation affects the outcome.Quintana and collaborators then used the fragmentation-inclusive simulations to

  13. Giant Planet Observations with the James Webb Space Telescope

    CERN Document Server

    Norwood, James; Fletcher, Leigh N; Orton, Glenn; Irwin, Patrick G J; Atreya, Sushil; Rages, Kathy; Cavalié, Thibault; Sánchez-Lavega, Agustin; Hueso, Ricardo; Chanover, Nancy

    2015-01-01

    This white paper examines the benefit of the upcoming James Webb Space Telescope for studies of the Solar System's four giant planets: Jupiter, Saturn, Uranus, and Neptune. JWST's superior sensitivity, combined with high spatial and spectral resolution, will enable near- and mid-infrared imaging and spectroscopy of these objects with unprecedented quality. In this paper we discuss some of the myriad scientific investigations possible with JWST regarding the giant planets. This discussion is preceded by the specifics of JWST instrumentation most relevant to giant planet observations. We conclude with identification of desired pre-launch testing and operational aspects of JWST that would greatly benefit future studies of the giant planets.

  14. Dynamo-generated magnetic fields in fast rotating single giants

    OpenAIRE

    Konstantinova-Antova, Renada; Aurière, Michel; Schröder, Klaus-Peter; Petit, Pascal

    2009-01-01

    Red giants offer a good opportunity to study the interplay of magnetic fields and stellar evolution. Using the spectro-polarimeter NARVAL of the Telescope Bernard Lyot (TBL), Pic du Midi, France and the LSD technique, we began a survey of magnetic fields in single G-K-M giants. Early results include 6 MF-detections with fast rotating giants, and for the first time a magnetic field was detected directly in an evolved M-giant: EK Boo. Our results could be explained in the terms of $\\alpha$--$\\o...

  15. M-giant star candidates identified in LAMOST DR 1

    Science.gov (United States)

    Zhong, Jing; Lépine, Sébastien; Li, Jing; Chen, Li; Hou, Jin-Liang; Yang, Ming; Li, Guang-Wei; Zhang, Yong; Hou, Yong-Hui

    2015-08-01

    We perform a discrimination procedure with the spectral index diagram of TiO5 and CaH2+CaH3 to separate M giants from M dwarfs. Using the M giant spectra identified from LAMOST DR1 with high signal-to-noise ratio, we have successfully assembled a set of M giant templates, which show more reliable spectral features. Combining with the M dwarf/subdwarf templates in Zhong et al., we present an extended library of M-type templates which includes not only M dwarfs with a well-defined temperature and metallicity grid but also M giants with subtypes from M0 to M6. Then, the template-fitting algorithm is used to automatically identify and classify M giant stars from LAMOST DR1. The resulting catalog of M giant stars is cross-matched with 2MASS JHKs and WISE W1/W2 infrared photometry. In addition, we calculated the heliocentric radial velocity of all M giant stars by using the cross-correlation method with the template spectrum in a zero-velocity rest frame. Using the relationship between the absolute infrared magnitude MJ and our classified spectroscopic subtype, we derived the spectroscopic distance of M giants with uncertainties of about 40%. A catalog of 8639 M giants is provided. As an additional result of this analysis, we also present a catalog of 101 690 M dwarfs/subdwarfs which are processed by our classification pipeline.

  16. Giant Basal Cell Carcinoma of the Forehead: A Case Report

    OpenAIRE

    Rudić, Milan; Kranjčec, Zoran; Lisica-Šikić, Nataša; Kovačić, Marijan

    2012-01-01

    Giant basal cell carcinoma (GBCC) is defined as a tumor 5cm or greater in diameter. They present less than 1% of all basal cell carcinomas. We present a case of an 85-year-old male patient with a giant ulcerating tumor of the left forehead (measuring 7x6cm). Under local anesthesia tumor was surgically excised. No involvement of the underlying periostal or bone structure was noted. Pathohystological exam revealed the giant basal cell carcinoma, with free surgical margins. Giant basal cell carc...

  17. Giant black hole rips star apart

    Science.gov (United States)

    2004-02-01

    Astronomers believe that a doomed star came too close to a giant black hole after a close encounter with another star threw it off course. As it neared the enormous gravity of the black hole, the star was stretched by tidal forces until it was torn apart. This discovery provides crucial information on how these black holes grow and affect the surrounding stars and gas. "Stars can survive being stretched a small amount, as they are in binary star systems, but this star was stretched beyond its breaking point," said Dr Stefanie Komossa of the Max Planck Institute for Extraterrestrial Physics (MPE) in Germany, who led the international team of researchers. "This unlucky star just wandered into the wrong neighbourhood." While other observations have hinted that stars are destroyed by black holes (events known as ‘stellar tidal disruptions’), these new results are the first strong evidence. Observations with XMM-Newton and Chandra, combined with earlier images from the German Roentgensatellite (ROSAT), detected a powerful X-ray outburst from the centre of the galaxy RXJ1242-11. This outburst, one of the most extreme ever detected in a galaxy, was caused by gas from the destroyed star that was heated to millions of degrees before being swallowed by the black hole. The energy liberated in this process is equivalent to that of a supernova. "Now, with all of the data in hand, we have the smoking gun proof that this spectacular event has occurred," said co-author Prof. Guenther Hasinger, also of MPE. The black hole in the centre of RX J1242-11 is estimated to have a mass about 100 million times that of the Sun. By contrast, the destroyed star probably had a mass about equal to that of the Sun, making it a lopsided battle of gravity. "This is the ultimate ‘David versus Goliath’ battle, but here David loses," said Hasinger. The astronomers estimated that about one hundredth of the mass of the star was ultimately consumed, or accreted, by the black hole. This small

  18. File list: His.Plc.10.AllAg.Trophoblast_giant_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available His.Plc.10.AllAg.Trophoblast_giant_cells mm9 Histone Placenta Trophoblast giant cel...//dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/His.Plc.10.AllAg.Trophoblast_giant_cells.bed ...

  19. File list: His.Plc.50.AllAg.Trophoblast_giant_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available His.Plc.50.AllAg.Trophoblast_giant_cells mm9 Histone Placenta Trophoblast giant cel...//dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/His.Plc.50.AllAg.Trophoblast_giant_cells.bed ...

  20. File list: His.Plc.20.AllAg.Trophoblast_giant_cells [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available His.Plc.20.AllAg.Trophoblast_giant_cells mm9 Histone Placenta Trophoblast giant cel...//dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/His.Plc.20.AllAg.Trophoblast_giant_cells.bed ...