WorldWideScience

Sample records for aga khan university

  1. Urinary tract infections at aga Khan University hospital nairobi - a ...

    African Journals Online (AJOL)

    2013-06-11

    Jun 11, 2013 ... (Uti) are normally treated empirically and urine culture is usual ordered for as a last ... symptomatic Uti in patients at aga Khan University hospital by looking at the trends of Uti ... in the context of pyelonephritis in pregnancy(9).

  2. Stapled hemorrhoidopexy: The Aga Khan University Hospital Experience

    International Nuclear Information System (INIS)

    Athar, Ali; Chawla, Tabish; Turab, Pishori

    2009-01-01

    Stapled hemorrhoidopexy for prolapsing hemorrhoids is conceptually different from excision hemorrhoidectomy. It does not accompany the pain that usually occurs after resection of the sensitive anoderm. This study was carried out to evaluate the clinical outcome of stapled hemorrhoidopexy at The Aga Khan University Hospital. A sample of 140 patients with symptomatic second-, third-, and fourth-degree hemorrhoids and circumferential mucosal prolapse underwent stapled hemorrhoidopexy from July 2002 to July 2007. They were evaluated for postoperative morbidity, analgesic requirement, and recurrence. Seventy-eight percent were males and the mean age was 45 (range 16-90) years. The mean operative time was 35 (15-78) min. The mean parenteral analgesic doses during the first 24 h were 2.1. All patients received oral analgesics alone after 24 h. No significant postoperative morbidity was observed. The mean in-patient hospital stay was 1.3 (0-5) days. Patients were followed-up for 24 (range, 2-48) months. Minor local recurrence of hemorrhoids was seen in four patients and was managed by band ligation. Stapled hemorrhoidopexy procedure was found safe, well tolerated by patients with minimal parenteral analgesic use and early discharge from the hospital. (author)

  3. The effect of a knowledge-based ergonomic intervention amongst administrators at Aga Khan University Hospital, Nairobi.

    Science.gov (United States)

    Wanyonyi, Nancy; Frantz, Jose; Saidi, Hassan

    2015-01-01

    Low back pain (LBP) and neck pain are part of the common work-related musculoskeletal disorders with a large impact on the affected person. Despite having a multifactorial aetiology, ergonomic factors play a major role thus necessitating workers' education. To determine the prevalence of ergonomic-related LBP and neck pain, and describe the effect of a knowledge-based ergonomic intervention amongst administrators in Aga Khan University Hospital, Nairobi. This study applied a mixed method design utilizing a survey and two focus group discussions (FGD). A self-administered questionnaire was distributed to 208 participants through systematic sampling. A one hour knowledge-based ergonomic session founded on the survey results was thereafter administered to interested participants, followed by two FGDs a month later with purposive selection of eight participants to explore their experience of the ergonomic intervention. Quantitative data was captured and analyzed using SPSS by means of descriptive and inferential statistics, whereas thematic content analysis was used for qualitative data. Most participants were knowledgeable about ergonomic-related LBP and neck pain with a twelve month prevalence of 75.5% and 67.8% respectively. Continual ergonomic education is necessary for adherence to health-related behaviours that will preventwork-related LBP and neck pain.

  4. Bone marrow examination findings at Aga Khan University Hospital ...

    African Journals Online (AJOL)

    Nutritional anaemia as a group was the most common haematological disorder ... examination in our patients with megaloblastic anaemia predominating. ... indication for bone marrow examination was anaemia followed by diagnostic work up ...

  5. Scaling Value: Transnationalism and the Aga Khan's English as a "Second Language" Policy

    Science.gov (United States)

    Bolander, Brook

    2018-01-01

    Against the backdrop of growing sociolinguistic interest in transnationalism, this paper uses the notion of "scale" as an "ideological project" (Irvine in "Scale. Discourse and dimensions of social life," University of California Press, California, 2016: 214) to study situated discursive performances of…

  6. Screening strategies for gestational diabetes mellitus at the Aga ...

    African Journals Online (AJOL)

    Background: Universal screening strategy for gestational diabetes mellitus offers biochemical screening to all women irrespective of risk factor status while selective strategy screens only those with risk factors. The Aga Khan University Hospital adopted a selective screening protocol by consensus. This study compares both ...

  7. Validation of acute physiologic and chronic health evaluation II scoring system software developed at The Aga Khan University, Pakistan.

    Science.gov (United States)

    Hashmi, M; Asghar, A; Shamim, F; Khan, F H

    2016-01-01

    To assess the predictive performance of Acute Physiologic and Chronic Health Evaluation II (APACHE II) software available on the hospital intranet and analyze interrater reliability of calculating the APACHE II score by the gold standard manual method or automatically using the software. An expert scorer not involved in the data collection had calculated APACHE II score of 213 patients admitted to surgical Intensive Care Unit using the gold standard manual method for a previous study performed in the department. The same data were entered into the computer software available on the hospital intranet (http://intranet/apacheii) to recalculate the APACHE II score automatically along with the predicted mortality. Receiver operating characteristic curve (ROC), Hosmer-Lemeshow goodness-of-fit statistical test and Pearson's correlation coefficient was computed. The 213 patients had an average APACHE II score of 17.20 ± 8.24, the overall mortality rate was 32.8% and standardized mortality ratio was 1.00. The area under the ROC curve of 0.827 was significantly >0.5 (P test showed a good calibration (H = 5.46, P = 0.71). Interrater reliability using Pearson's product moment correlations demonstrated a strong positive relationship between the computer and the manual expert scorer (r = 0.98, P = 0.0005). APACHE II software available on the hospital's intranet has satisfactory calibration and discrimination and interrater reliability is good when compared with the gold standard manual method.

  8. Validation of acute physiologic and chronic health evaluation II scoring system software developed at The Aga Khan University, Pakistan

    Directory of Open Access Journals (Sweden)

    M Hashmi

    2016-01-01

    Conclusion: APACHE II software available on the hospital′s intranet has satisfactory calibration and discrimination and interrater reliability is good when compared with the gold standard manual method.

  9. Saleem Khan

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science. Saleem Khan. Articles written in Bulletin of Materials Science. Volume 36 Issue 4 August 2013 pp 535-539. Synthesis of copper telluride nanowires using template-based electrodeposition method as chemical sensor · Sandeep Arya Saleem Khan Suresh Kumar Rajnikant ...

  10. (AGA) Pre Term Babies

    African Journals Online (AJOL)

    Haematological Indices in Healthy Appropriate For-Gestational-Age (AGA) Pre Term Babies. ... International Journal of Medicine and Health Development. Journal Home ... Patient and Methods: All consecutive healthy pre-term new born babies delivered at UNTH and admitted into the hospital NBSCU were included.

  11. Bhatti, Hamid Khan

    Indian Academy of Sciences (India)

    Home; Fellowship. Fellow Profile. Elected: 1940 Section: Animal Sciences. Bhatti, Hamid Khan Ph.D. (Cantab). Date of birth: 7 February 1895. Date of death: 14 December 1980. Specialization: Ichthyology. YouTube; Twitter; Facebook; Blog. Academy News. IAS Logo. 29th Mid-year meeting. Posted on 19 January 2018.

  12. saleem a khan

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science. SALEEM A KHAN. Articles written in Bulletin of Materials Science. Volume 40 Issue 6 October 2017 pp 1105-1110. Structural, elastic, optoelectronic and magnetic properties of CdHo 2 S 4 spinel: a first-principle study · I HATRAF O MERABIHA T SEDDIK H BALTACHE R ...

  13. A Letter to Ahmad Khan

    Directory of Open Access Journals (Sweden)

    I.M. Mirgaleev

    2016-12-01

    Full Text Available We bring to attention of specialists an undated letter of Ottoman ruler Mehmed II Fatih to the Great Horde khan Ahmad from the collection of famous collector of Ottoman charters Feridun-bey [1, S. 289]. The addressee is the famous ruler of the Great Horde, khan Ahmad. Daulat Khan mentioned in the letter is Nur-Davlet. He was connected with khan Ahmad, and, as indicated by the letter, he had also set in close contact with the Ottomans whose ruler openly declares in a letter that “our sight of benevolence and patronage is directed toward him”. Thereby the Sultan made it clear to the “principal” Tatar khan Akhmad that Nur-Davlet was under the patronage of the Ottoman Empire. Considering the period of activity of Nur-Davlet in Crimea, presumably the letter was written in 1477. Famous researcher of the Crimean Khanate V.D. Smirnov had already examined the letter and the question of why Ahmad Khan was named the Crimean khan in the title of the letter [2, p. 221–222].

  14. Janybek Khan and Prince Liubartas-Dmitry

    Directory of Open Access Journals (Sweden)

    Ya.V. Pilipchuk

    2013-11-01

    Full Text Available This study focuses on the relations between the Volyn principality of Liubartas-Dmitry and the Ulus of Jochi under the rule of Janybek Khan. Liubartas-Dmitry ascended the throne of the Eastern Volyn largely due to the will of Uzbek Khan. The Land of Berestia together with the Eastern Volyn was the Liubartas’ appanage land in Volyn. As Boleslaw-Yuri II, Liubartas-Dmitry was compelled to pay tribute to the Tatars. During the War of the Galicia-Volyn legacy, Liubartas acted as a vassal of the Ulus of Jochi and ally of Uzbek Khan. Liubartas’ relations with Janybek Khan were fundamentally different from his previous relations with Uzbek Khan. Casimir III enjoyed greater sympathy of the Golden Horde khan due to the payment of tribute. Except for the campaign of 1351–1352, Janybek was hostile towards Lithuania. Only the common hostility of the Poles and Hungarians towards the Volyn and Podolia forced the khan of Ulus of Jochi to intervene on the side of the Lithuanians. For Janibek the western vector of his foreign policy was not a priority. He could accept the loss of a tribute from several Slavic principalities in exchange for success on other fronts, more profitable in terms of the spoils of war. Unlike the Koriatoviches and Olelkoviches, the Gediminoviches of Volyn were more peacefully disposed towards the Tatars since during the “Great Disorder” their land-holdings did not increase at the expense of Jochid possessions.

  15. N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Muhammad Afzal

    2016-09-01

    Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.

  16. PEMANFAATAN WEB KHAN ACADEMY DALAM PEMBELAJARAN MATEMATIKA

    Directory of Open Access Journals (Sweden)

    Joko Soebagyo

    2016-02-01

    Full Text Available Artikel ini bertujuan untuk mengobservasi pemanfaatan web Khan Academy siswa SMK Swasta di Jakarta Utara. Observasi dilakukan untuk mengamati aktivitas siswa dalam menggunakan web khan academy selama proses pembelajaran matematika. Pemanfaatan teknologi dalam proses pembelajaran matematika sudah sepatutnya dilakukan oleh pihak-pihak yang ikut bertanggungjawab atas keberhasilan belajar matematika perserta didik.  Teknologi merupakan hal yang tidak bisa dipisahkan dalam kehidupan sehari-hari dan salah satu bentuk teknologi yang sering dimanfaatkan saat ini adalah website dimana akitifitas pekerjaan, pendidikan, hiburan dan hubungan  sosial, semuanya dapat dialami melalui website.  Dibutuhkan sebuah website yang bias mengakomodir siswa dalam proses pembelajaran matematika baik di dalam kelas maupun di luar kelas.  Kriteria web yang baik haruslah memberikan kemudahan dalam pemanfaatannya, salah satu web tersebut adalah web khan academy.   This paper aims to observe the use of web Khan Academy Private vocational students in North Jakarta. Observations carried out to observe the activities of the students in using web khan academy during the learning process of mathematics. The use of technology in the learning process of mathematics has been duly carried out by parties who share responsibility for the success of students studying mathematics participants. Technology is something that can not be separated in everyday life and one form of technology that is often used today is a website where the activity, employment, education, entertainment and social relationships, all of which can be experienced through the website. It takes a biased website to accommodate students in mathematics learning process both in the classroom and outside the classroom. Criteria for good web should provide ease of use, one of the web is a web khan academy.

  17. Surgical wisdom and Genghis Khan's Pax Mongolica.

    Science.gov (United States)

    Köstenbauer, Jakob

    2017-03-01

    The unrivalled conquests of Genghis Khan (CE c.1162-1227) led to the establishment of the Greater Mongolian Empire. By 1279, the Mongol dynasty controlled a vast Empire which, for the first time in history, unified Europe and China via the famous Silk Road. The ensuing century of peace and stability is referred to by historians as the Pax Mongolica, which facilitated Europe's renaissance and remarkably contributed to the rise of modern medicine and surgery. Secondary sources from published literature, primary sources from manuscripts and illustrations courtesy of universities, museum libraries and archives. There is ample evidence detailing the Mongol Empire's power during the thirteenth century and the Silk Road's role as a vehicle of commercial, cultural and scientific exchange. Advances in medical knowledge and surgical skills were made in all parts of the Empire and exchanged from China to Constantinople and back. Prominent medical figures traversed these centres, and no doubt contributed to the spread of surgical science, including Rashid al-Din and Mansur Ibn Ilyas. Their works, it is argued, enriched the practice of surgery and may have indirectly ushered-in the rise of modern surgery in the early medical schools at Salerno, Bologna, Pavia, Oxford, Montpellier and Constantinople to name but a few. The blossoming and diversification of medical and surgical knowledge was an integral part of the great cultural exchange facilitated by the Pax Mongolica. This enhanced surgical practice in China, Persia and Arabia, while coinciding with the renaissance of surgical teaching in Europe. © 2017 Royal Australasian College of Surgeons.

  18. AGA answers complaints on burner tip prices

    International Nuclear Information System (INIS)

    Anon.

    1992-01-01

    This paper reports that the American Gas Association has rebutted complaints that natural gas prices have dropped at the wellhead but not at the burner tip. AGA Pres. Mike Baly the an association study of the issue found that all classes of customers paid less for gas in 1991 than they did in 1984, when gas prices were at their peak. He the, the study also shows that 100% of the wellhead price decline has been passed through to natural gas consumers in the form of lower retail prices. Baly the the average cost of gas delivered to all customers classes fell by $1.12/Mcf from 1984 to 1991, which exceeds the $1.10/Mcf decline in average wellhead prices during the same period

  19. The A.Q. Khan case, two years later

    International Nuclear Information System (INIS)

    Tertrais, Bruno

    2005-01-01

    Two years after the first public revelations on the importance of Pakistani nuclear trades, the author proposes a critical comment of the so-called A.Q. Khan case. He outlines that making A.Q. Khan the father of the Pakistani atomic bomb is exaggerated, indicates what Khan actually exported (some know-how on head militarization, and on uranium centrifugation). He identifies Khan's motivations and outlines the different situations and relationships associated with the different concerned countries (Iran, North Korea, Libya)

  20. A.Q. Khan Nuclear Smuggling Network

    Directory of Open Access Journals (Sweden)

    Molly MacCalman

    2016-03-01

    Full Text Available Abdul Qadeer Khan, widely viewed as the father of Pakistan’s nuclear weapons program, was arrested on January 31, 2004 for his key role in the black market sale of nuclear technology and equipment to Iran, North Korea, Libya, and possibly others. A.Q. Khan’s nuclear smuggling network prospered throughout the 1980s and 1990s and was linked to middlemen and businesses in over 20 countries. The network offered buyers a menu of both technical expertise and materials with prices ranging from millions to hundreds of millions of dollars. The Khan network was ultimately exposed largely due to years of intelligence gathering by the United States and the United Kingdom. However, very few of the network’s members have been successfully prosecuted and the demand for nuclear material by both state and non-state actors continues. The exposure of Khan’s network confirmed that a non-state actor could procure and sell a turnkey nuclear weapons program to willing buyers.

  1. Can Khan Move the Bell Curve to the Right?

    Science.gov (United States)

    Kronholz, June

    2012-01-01

    More than 1 million people have watched the online video in which Salman Khan--a charming MIT math whiz, Harvard Business School graduate, and former Boston hedge-fund analyst--explains how he began tutoring his cousins in math by posting short lessons for them on YouTube. Other people began watching the lessons and sending Khan adulatory notes.…

  2. Can Khan Move the Bell Curve to the Right?

    Science.gov (United States)

    Kronholz, June

    2012-01-01

    This article features Khan Academy which offers an online math program and short video lectures embedded in the "module", or math concept, that fit students' goals. By now, more than 1 million people have watched the online video in which Salman Khan--a charming MIT math whiz, Harvard Business School graduate, and former Boston hedge-fund…

  3. AGA predicts winter jump in residential gas price

    International Nuclear Information System (INIS)

    Anon.

    1992-01-01

    The American Gas Association predicts the average heating bill for residential gas consumers could increase by as much as 18% this winter. AGA Pres. Mike Baly said, Last year's winter was warmer than normal. If the 1992-93 winter is similar, AGA projects that residential natural gas heating bills will go up about 6%. If we see a return to normal winter weather, our projection show the average bill could rise by almost 18%

  4. Medicinal folk recipes used as traditional phyto therapies in district Dera Ismail Khan, KPK, Pakistan

    International Nuclear Information System (INIS)

    Marwat, S.K.; Rehman, F.; Khan, M.A.; Ahmad, M.

    2011-01-01

    This paper is based on the results of an ethno medicinal research work conducted in Dera Ismail Khan (D.I. Khan) District, Khyber Pakhtun Khwa (KPK), Pakistan, during May 2006 to March 2007. The study was focused for documentation of traditional knowledge of local people about the use of medicinal folk recipes of native plants. During field survey, questionnaires were used to interview the local inhabitants, older people including men and women both, who were familiar with traditional uses of indigenous plants. In total 40 new medicinal folk recipes of 26 plant species, belonging to 19 families were recorded. These folk recipes are used as traditional phyto therapies in the area. Plant specimens were identified, preserved and vouchers were deposited in the Department of Botany, Quaid-i-University Islamabad for future references. Results were systematically arranged by alphabetic order of botanical names followed by medicinal folk recipes. English name, local name, family name and voucher no., were listed. (author)

  5. Khan Academy ehk Kuidas õppeaineid integreeriti / Kärt Matiisen

    Index Scriptorium Estoniae

    Matiisen, Kärt

    2012-01-01

    Kose gümnaasiumi 7. klassi matemaatikarühma uute õppemeetodite leidmise projektist ja erinevate õppeainete integreerimisest, mille käigus loodi subtiitrid Khan Academy ingliskeelsetele matemaatika õppetükkidele

  6. Chinggis Khan: Ancestor, Buddha or Shaman? : On the uses and abuses of the portrait of Chinggis Khan

    OpenAIRE

    Charleux, Isabelle

    2009-01-01

    International audience; This article explores some past and present visual images of Chinggis Khan in order to better understand how religious and lay authorities manipulated and distorted his image to make it serve ritual purposes that bolstered their power.

  7. HARMONIZING GLOBAL EDUCATION-FROM GENGHIS KHAN TO FACEBOOK

    Directory of Open Access Journals (Sweden)

    Jon Baggaley reviewed by Wolfram LAASER

    Full Text Available The book starts with the optimistic definition of the Maastricht 2002 declaration about global education claiming that it should open people´s minds to the realities of the globalized world and bring about greater justice, equity and human rights. He then traces back the history of global communication to Denghis Khan and his arrow riders to end up with the modern forms developed by the different generations of distance education with special emphasis on the mega universities . Although communication is dominated today by iPads and smart phones Baggaley points out that important concepts how to bring online media to the population and to convert the recipients of that information into contributors (user generated content have been developed much earlier e.g. by the Polish filmmaker Dziga Vertov about one hundred years ago. So Baggaley always tries to put actual media development into a historical context that includes parallel developments and trends in music or painting as well.

  8. KONFLIK LINGKUNGAN DI KAMPUNG AGAS, TANJUNG UMA, BATAM (Environmental Conflict in Kampung Agas, Tanjung Uma, Batam

    Directory of Open Access Journals (Sweden)

    Saprial Saprial

    2004-11-01

    Full Text Available ABSTRAK Perkembangan kota Batam sebagai kawasan industri, perdagangan, pelabuhan, dan pariwisata, membawa tidak saja dampak positip, melainkan juga dampak negatif. Salah satu dampak negatif yang muncul adalah konffik lingkungan dalam bentuk pencemaran air di sungai Jodoh yang menganggu pemukiman liar di Kampung Agas, Tanjung Uma. Penelitian ini bertujuan untuk mengkaji akar masalah konflik dan resolusinya. Penelitian ini merupakan studi deskriptif-kualitatip, dengan data yang dikumpulkan melalui wawancara mendalam dengan pihak-pihak yang terlibat dalam konflik. Penelitian ini menemukan bahwa akar masalah konffik adalah konflik spasial antara permukiman liar dan pembangunan ruko yang menimbulkan limbah di sekitar permukiman liar. Tidak dibangunnya IPAL memicu protes warga di permukiman liar dan terjadilah konflik. Penelitian ini melihat bahwa penyelesaian konflik dalam bentuk kompensasi atau “sagu hati" tidak menyelesaikan akar masalah konflik. Walaupun begitu, penyelesaian ini dipandang oleh pihak-pihak yang berkonflik sebagai hasil mufakat yang dimungkinkan untuk menghindari konflik sosial yang lebih besar. Penelitian ini juga menemukan bahwa bentuk penyelesaian konflik melalui musyawarah dan mufakat dapat dilakukan secara efektif sejauh ada mediator yang dipercaya oleh pihak-pihak yang bersengketa.   ABSTRACT The development of Batam City as an area for industry, trade, ship transit, and tourism activities brings not only positive impacts, but negative impact as well. One of the negative impacts is environmental conflict in the form of water pollution in Sei Jodoh downstream which affected informal settlement in Kampung Agas, Tanjung Uma. This research aimed to study the roots of the conflict and evaluated the resolution. It adopted a descriptive, qualitative research method. Data were collected through in-depth interviews with parties involved in the conflict. The research founded that the root causes of the environmental conflict was the

  9. Fictional Marriage Proposal of Anonymous Astrakhan Khan

    Directory of Open Access Journals (Sweden)

    Roman Hautala

    2017-03-01

    Full Text Available The following text is reproduced from a handwritten copy of the letter made by the Italian humanist Gian Vincenzo Pinelli (1535–1601 and contained in one codex of Ambrosiana Library in Milan (R 104 sup., fol. 194r [see the description of the codex in: 3, no. 341. p. 125]. This codex (588 folios contains Italian and Latin texts of the 16th century of extremely diverse content, which does not allow to determe neither the name of the author of the reproduced letter, nor the date of its writing. Nevertheless, a reference to the name of “Luther” in the letter suggests that it must have been written in the 16th century and an indication of the main purpose of the letter – matchmaking to anonymous queen – makes it possible to put forward quite a bold (but, for now, unproven hypothesis that this letter might be addressed to approximates of the Polish Queen Bona Sforza and the widow of King Sigismund I the Old starting with the April 1, 1548. Following this hypothesis, the alleged author of the letter could be the ruler of Astrakhan Yamgurchi or the Crimean khan Sahib Giray. However, this assumption remains only a hypothesis, and the author of this article hopes that future researchers will be able to identify both the author of the letter and its recipients. Be that as it may, this letter is of undoubtedly fictitious character since it does not indicate the name of its author and the date of writing and obviously differs from official form of the Tatar rulers’ letters. Undoubtedly, this letter refers to the literary genre of fictional letters of the rulers, which became extremely popular in Europe since the second half of the 15th century. As an illustration of this genre, the author of this article presents a “letter” of the Turkish sultan to the Tatars and their “response” from the fictional collection of “Letters of the Great Turk” [1, fol. 18r] of Laudivius Hierosolymitanus, which was a relatively widespread in Europe in the

  10. Mehmed Senai: A Crimean Historian at Sarai of Khan Islam Giray »

    Directory of Open Access Journals (Sweden)

    Refat Rustem ogly Abduzhemilev

    2015-09-01

    Full Text Available The article is devoted to the creative work of Mehmed Senai – the Crimean chronicler at the serai of the khan Islam Geray III, as well as his chronicle “Tarih-i Islam Geray khan” (“History of the khan Islam Geray III”, 1651. The researcher gives biographical information about the author and a brief description of the source. The identity of the writer is defined and based on the text of the Preface to the Chronicle: background, education, position, religious status. The meaning of the pseudonym of Senai is under the study, the text of the chronogram in which it occurs is reproduced. Especially noted thing is the originality of the artistic structure of the Chronicle “Tarih-i Islam Geray khan”.The Chronicle “Tarih-i Islam Geray khan” is the panegyric to the Crimean khan Islam Geray whose reign represents the brilliant epoch in the history of the Crimean Khanate. The writing consists of the ceremonies of public appointments, episodes of military campaigns and making treaties, the text of khan Islam Geray’s pedigree (shejere, construction and repair of buildings. There is the brief information about the Chronicle and about M. Senai in “Catalogue of the Turkish Manuscripts in the British Museum” (1888. The primary work on writing was conducted by Polish orientalists who prepared the edition of the original text, its translation and processing, backed with comments. At the time of writing the Chronicle, Mehmed Senai was in his old age, he served as the kadi (religious judge. In his youth he worked as munshi (decorator of papers in the khan’s office. He got education in the Ottoman Empire, and was engaged in the implementation of diplomatic correspondence. The prospect of identification of the author on the basis of other sources is important to clarify the hypothesis of identifying M. Senai with such Crimean Tatar author as Dzhanmuhammed. The Chronıcle’s plot consists of the diary notes on the military expeditions

  11. AFJU OFC 18(3).indd

    African Journals Online (AJOL)

    imac-3

    a Department of Radiology, Aga Khan Medical University, Karachi, Pakistan b Rhode Island Hospital, Brown University, Providence, RI 02912, USA c Department of Surgery, Aga .... In defense of IVU, Saeed et al. [12] noted that the addition of ...

  12. Commentary: The Khan Academy and the Day-Night Flipped Classroom

    Science.gov (United States)

    Parslow, Graham R.

    2012-01-01

    Teaching by night and reflecting on a subject by day is the way that Salman Khan sees education evolving in the age of online lectures. Khan believes he is onto something in what he styles the "flipped classroom." In Khan's view, there is no need for students to be divided into grades by age. Instead, they should learn at their own pace, moving on…

  13. Effects of intravenous diclofenac on postoperative sore throat in ...

    African Journals Online (AJOL)

    Effects of intravenous diclofenac on postoperative sore throat in patients undergoing laparoscopic surgery at Aga Khan University Hospital, Nairobi: A prospective, randomized, double blind controlled trial.

  14. 78 FR 48539 - Designation of Bahawal Khan, Also Known as Salahuddin Ayubi, Also Known as Bahwal Khan, as a...

    Science.gov (United States)

    2013-08-08

    ... DEPARTMENT OF STATE [Public Notice 8415] Designation of Bahawal Khan, Also Known as Salahuddin... committing, acts of terrorism that threaten the security of U.S. nationals or the national security, foreign policy, or economy of the United States. Consistent with the determination in section 10 of Executive...

  15. Aga sellepärast, et on po... / Aleksandr Astrov

    Index Scriptorium Estoniae

    Astrov, Aleksandr

    2005-01-01

    Arutledes venekeelse valija hääletuskäitumise ümber juhib autor tähelepanu, et Eestis sätestab üks konkreetne seadus venelastele valimisõiguse, andes neile reaalse poliitilise jõu, teine aga piirab nende juurdepääsu ainult keele kaudu ligipääsetavatele eetikaressurssidele, mis võimaldaksid teha teadlikku valikut

  16. STRATEGI PEMBANGUNAN EKONOMI YANG ISLAMI MENURUT FAHIM KHAN

    Directory of Open Access Journals (Sweden)

    Ali Murtadho

    2016-10-01

    Full Text Available Several theories about the development strategy formulated by the most conventional neo-classical economists much criticized. Fahim Khan including contemporary Islamic economic thinkers who criticize conventional economic development strategy with alternative bids from the Islamic economics perspective. Their thinking is exciting to examined substance and its correlation with the economic development of contemporary Islamic discourse that dominated the development of financial institutions/syariah banking. The creation of entrepreneurial opportunities made Fahim Khan as a keyword in the concept of criticizing conventional strategy and supporting the Islamic economic development strategy. Strategy opened and graced this productive creative independent businesses are deemed appropriate and supported by the Islamic economic system based on profit and loss sharing partnership (profit-loss sharing. The idea is to promote excellence banking system of sharing based on the conventional interest-based banking system in spurring economic development suplus to enliven the entrepreneurial workforce.

  17. STRATEGI PEMBANGUNAN EKONOMI YANG ISLAMI MENURUT FAHIM KHAN

    OpenAIRE

    Ali Murtadho

    2017-01-01

    Several theories about the development strategy formulated by the most conventional neo-classical economists much criticized. Fahim Khan including contemporary Islamic economic thinkers who criticize conventional economic development strategy with alternative bids from the Islamic economics perspective. Their thinking is exciting to examined substance and its correlation with the economic development of contemporary Islamic discourse that dominated the development of financial institutions/sy...

  18. 76 FR 69318 - In the Matter of the Designation of Mali Khan also known as Madi Khan as a Specially Designated...

    Science.gov (United States)

    2011-11-08

    ... DEPARTMENT OF STATE [Public Notice 7681] In the Matter of the Designation of Mali Khan also known... Khan, committed, or poses a significant risk of committing, acts of terrorism that threaten the security of U.S. nationals or the national security, foreign policy, or economy of the United States...

  19. Khan's lectures handbook of the physics of radiation therapy

    CERN Document Server

    Khan, Faiz M; Mihailidis, Dimitris

    2011-01-01

    Khan's Lectures: Handbook of the Physics of Radiation Therapy will provide a digest of the material contained in The Physics of Radiation Therapy. Lectures will be presented somewhat similar to a PowerPoint format, discussing key points of individual chapters. Selected diagrams from the textbook will be used to initiate the discussion. New illustrations will used, wherever needed, to enhance the understanding of important concepts. Discussion will be condensed and often bulleted. Theoretical details will be referred to the textbook and the cited literature. A problem set (practice questions) w

  20. Khan Academy as Supplemental Instruction: A Controlled Study of a Computer-Based Mathematics Intervention

    Science.gov (United States)

    Kelly, Daniel P.; Rutherford, Teomara

    2017-01-01

    Khan Academy is a large and popular open educational resource (OER) with little empirical study into its impact on student achievement in mathematics when used in schools. In this study, we examined the use of Khan Academy as a mathematics intervention among seventh grade students over a 4-week period versus a control group. We also compared…

  1. Comparison of Patent Claim Construction between Netherlands and Germany on Basis of AGA v. Occlutech

    NARCIS (Netherlands)

    Tsoutsanis, A.; Kau, C.

    2013-01-01

    This article provides a brief overview on how the Dutch and German courts interpret the claims of a patent. It briefly compares each national approach on the basis of the recent AGA v Occlutech litigation in both countries. The dispute between AGA and Occlutech involved socalled ‘‘occluders’’, a

  2. The role of anthropometric, growth and maturity index (AGaMI) influencing youth soccer relative performance

    Science.gov (United States)

    Bisyri Husin Musawi Maliki, Ahmad; Razali Abdullah, Mohamad; Juahir, Hafizan; Muhamad, Wan Siti Amalina Wan; Afiqah Mohamad Nasir, Nur; Muazu Musa, Rabiu; Musliha Mat-Rasid, Siti; Adnan, Aleesha; Azura Kosni, Norlaila; Abdullah, Farhana; Ain Shahirah Abdullah, Nurul

    2018-04-01

    The main purpose of this study was to develop Anthropometric, Growth and Maturity Index (AGaMI) in soccer and explore its differences to soccer player physical attributes, fitness, motivation and skills. A total 223 adolescent soccer athletes aged 12 to 18 years old were selected as respondent. AGaMI was develop based on anthropometric components (bicep, tricep, subscapular, suprailiac, calf circumference and muac) with growth and maturity component using tanner scale. Meanwhile, relative performance namely physical, fitness, motivation and skills attributes of soccer were measured as dependent variables. The Principal Component Analysis (PCA) and Analysis of Variance (ANOVA) are used to achieve the objective in this study. AGaMI had categorized players into three different groups namely; high (5 players), moderate (88 players) and low (91 players). PCA revealed a moderate to very strong dominant range of 0.69 to 0.90 of factor loading on AGaMI. Further analysis assigned AGaMI groups as treated as independent variables (IV) and physical, fitness, motivation and skills attributes were treated as dependent variables (DV). Finally, ANOVA showed that flexibility, leg power, age, weight, height, sitting height, short and long pass are the most significant parameters statistically differentiate by the groups of AGaMI (p<0.05). As a summary, body fat mass, growth and maturity are an essential component differentiating the output of the soccer players relative performance. In future, information of the AGaMI model are useful to the coach and players for identifying the suitable biological and physiological demand reflects more comprehensive means of youth soccer relative performance. This study further highlights the importance of assessing AGaMI when identifying soccer relative performance.

  3. Crowdsourcing the unknown: the satellite search for Genghis Khan.

    Directory of Open Access Journals (Sweden)

    A Y M Lin

    Full Text Available Massively parallel collaboration and emergent knowledge generation is described through a large scale survey for archaeological anomalies within ultra-high resolution earth-sensing satellite imagery. Over 10K online volunteers contributed 30K hours (3.4 years, examined 6,000 km², and generated 2.3 million feature categorizations. Motivated by the search for Genghis Khan's tomb, participants were tasked with finding an archaeological enigma that lacks any historical description of its potential visual appearance. Without a pre-existing reference for validation we turn towards consensus, defined by kernel density estimation, to pool human perception for "out of the ordinary" features across a vast landscape. This consensus served as the training mechanism within a self-evolving feedback loop between a participant and the crowd, essential driving a collective reasoning engine for anomaly detection. The resulting map led a National Geographic expedition to confirm 55 archaeological sites across a vast landscape. A increased ground-truthed accuracy was observed in those participants exposed to the peer feedback loop over those whom worked in isolation, suggesting collective reasoning can emerge within networked groups to outperform the aggregate independent ability of individuals to define the unknown.

  4. Cartographic Anxieties in Mongolia: The Bogd Khan's Picture-Map

    Directory of Open Access Journals (Sweden)

    Uranchimeg Tsultemin,

    2016-12-01

    Full Text Available This article extends cartography into ethnographic and representational practices for territorial inclusion (Hostetler 2005 and nation building (Krishna 1994. Outer Mongolia, a vassal state of the Qing Empire until 1911, produced ethnographic paintings intended as new cartographic visuals around the time of its independence. Mongolia’s last ruler, the Bogd Khan (1870–1924 commissioned the artist Balduugin Sharav to produce a large painting of the Mongol countryside titled Daily Events, a work that constitutes an unusual cartographic “picture-map” (Paul Harvey 1980 intended for a special public display. The work (now known as One Day in Mongolia depicts the Mongolian people as a distinct ethnic group in quotidian scenes of Central Mongolian (Khalkha nomadic life. This article demonstrates how the covert connections between the scenes together construct a Buddhist didactic narrative of the Wheel of Life, and argues that this picture-map was the result of the Tibetan-born ruler’s anxieties over ethnic identity, national unity, and the survival of his people, who strove for independence from the Qing, as well as their safe positioning vis-à-vis new political neighbors.

  5. The Representation of Muslim American in Karan Johar's Movie My Name is Khan

    OpenAIRE

    PUTRI, SARAH WIDITA

    2015-01-01

    Keywords: Representation, Muslim American, My Name is Khan. Literature always appear with the story about something that reflects or describes the human life. Movie can be a medium of communication. Movie is one of mass media that deliver some minds, aspiration, and controversial issue. My Name is Khan presents the reflection in United States about how American treat Muslim unfairly where the United States is the country of various religion, ethnics, and uphold the human rights. Directed by ...

  6. Yarlyk of Uzbek Khan Granted to the Franciscans of the Golden Horde in 1314: The Latin Text, Russian Translation, and Commentary

    Directory of Open Access Journals (Sweden)

    Roman Hautala

    2014-09-01

    Full Text Available The present article contains the Latin text, Russian translation, and commentary to the yarlyk of Uzbek khan (1312/13–1341. Uzbek khan granted this yarlyk to the Franciscans of the Golden Horde 20th March, 1314. Apparently, the original text of yarlyk was written in the Khwarezmian idiom of the Kipchak language. However, the original text of yarlyk has not been preserved as well as a number of other yarlyks of the Golden Horde khans, which survived only in the late Russian translation. Fortunately, this yarlyk was translated into Latin and, subsequently, this translation was rewritten by anonymous British copyist in the first half of the 14th century. Arthur Christopher Moule discovered this medieval copy of yarlyk along with several other Franciscan documents in one of the codices (D. Ii. 3.7. stored in the Cambridge University Library. In 1924, Moule published the first and only edition of the yarlyk’s copy together with other Franciscan sources, provided with a thorough preface of Michael Bihl. The text of this Uzbek’s yarlyk have never been translated into modern languages. For this reason, the content of yarlyk has been known only to a narrow circle of specialists studying the Catholic missionary activity in the Mongol Empire. In turn, the scholars of the Golden Horde history, including researchers of the Jochid official documentation, have been unaware of this important legal document up to the present time. The content of Uzbek khan’s yarlyk points out that this document was based on the previous yarlyks of khan Mengu-Timur (1267–1282 and khan Tokhta (1291–1312. Thus, the content of yarlyk allows us to define the time of an emergence and future activities of the Franciscans in the territory of the Golden Horde. Furthermore, this information provide further evidence on the religious tolerance practice of the Jochid khans. In this context, the most significant is an indication of the Uzbek khan’s tolerant attitude toward

  7. [Distribution of the male lineages of Genghis Khan's descendants in northern Eurasian populations].

    Science.gov (United States)

    Derenko, M V; Maliarchuk, B A; Wozniak, M; Denisova, G A; Dambueva, I K; Dorzhu, C M; Grzybowski, T; Zakharov, I A

    2007-03-01

    Data on the variation of 12 microsatellite loci of Y-chromosome haplogroup C3 were used to screen lineages included in the cluster of Genghis Khan's descendants in 18 northern Eurasian populations (Altaian Kazakhs, Altaians-Kizhi, Teleuts, Khakassians, Shorians, Tyvans, Todjins, Tofalars, Sojots, Buryats, Khamnigans, Evenks, Mongols, Kalmyks, Tajiks, Kurds, Persians, and Russians; the total sample size was 1437 people). The highest frequency of haplotypes from the cluster of the Genghis Khan's descendants was found in Mongols (34.8%). In Russia, this cluster was found in Altaian Kazakhs (8.3%), Altaians (3.4%), Buryats (2.3%), Tyvans (1.9%), and Kalmyks (1.7%).

  8. Shaping Influences on the Leadership of Genghis Khan, George Washington, and Nelson Mandela: Applications for Educators

    Science.gov (United States)

    Bongila, Jean-Pierre

    2011-01-01

    Using a prosopographical methodology this study examines common leadership influences that might have existed among Genghis Khan, George Washington, and Nelson Mandela. Shoup (2005) suggests that the following seven influences have contributed to nurturing the leadership of 12 renowned individuals: involved parents, happy childhood, formal,…

  9. Khan et al., Afr J Tradit Complement Altern Med. (2015) 12(2):60-64 ...

    African Journals Online (AJOL)

    cadewumi

    alkalinity, chronic catarrh, renal disorders, dyspepsia, bloody dysentery and coronary (Madhavashetty et al., 2008), vomiting (Khan et al., 2013), leucoderma, antiviral, lymphatic glyndular system disease, antidiabetic, rectal prolapsus, aphrodisiac, anti-cholesterol, impetigo and carbubuncles (Nardkarnis, 2008; Pullaiah and ...

  10. Research

    African Journals Online (AJOL)

    abp

    2016-03-30

    Mar 30, 2016 ... 1School of Public Health, University of Alberta, Edmonton, Alberta, Canada, 2Aga Khan .... “Focus on Opportunity, Ability and Motivation” (FOAM) framework ... children (-28%), before eating (-4%), and after attending to a child.

  11. Original Article Surgical Margin Status after Breast Conservation ...

    African Journals Online (AJOL)

    KIGZ

    analysis of breast surgery for breast cancer patients was done from 2008 to 2011 at Aga Khan. University ... early breast cancer, thus breast conservation therapy is becoming more available. Excision of the ... palpable nodes. Histology was ...

  12. Cordylobia Anthropophaga: Furuncular Myiasis in a Family of 3

    African Journals Online (AJOL)

    Department of Surgery, Aga Khan University Hospital, Nairobi. Correspondence ... the need for a detailed travel history in such a presentation. ... factors for myiasis (5). The adult .... myiasis in a young male presenting as fungating rectal mass: ...

  13. Hassan Aga and his Government in Algiers. The Consolidation of a Mediterranean Myth

    Directory of Open Access Journals (Sweden)

    Fernando FERNÁNDEZ LANZA

    2014-12-01

    Full Text Available This work tries to describe graphically the consolidation of a social myth in the unsettled Mediterranean of the 16th century, through a personage: the Spanish convert to Islam Hassan Aga (Azan Aga, the Sardinian renegade who succeeded Hayreddin Barbarrosa at the helms of Algiers from 1533 till his death ten years later. This was a period of intense activity, with the climax that came with the expedition of Charles to Algiers in 1541, whose spectacular defeat can be considered as the principal nucleus of the myth of this popular personage who as a Sardinian slave came to defeat the Emperor. A myth of social ascension with maquiavelical profiles of a new prince of the frontiers.

  14. Molecular Genealogy of a Mongol Queen's Family and Her Possible Kinship with Genghis Khan.

    Science.gov (United States)

    Lkhagvasuren, Gavaachimed; Shin, Heejin; Lee, Si Eun; Tumen, Dashtseveg; Kim, Jae-Hyun; Kim, Kyung-Yong; Kim, Kijeong; Park, Ae Ja; Lee, Ho Woon; Kim, Mi Jin; Choi, Jaesung; Choi, Jee-Hye; Min, Na Young; Lee, Kwang-Ho

    2016-01-01

    Members of the Mongol imperial family (designated the Golden family) are buried in a secret necropolis; therefore, none of their burial grounds have been found. In 2004, we first discovered 5 graves belonging to the Golden family in Tavan Tolgoi, Eastern Mongolia. To define the genealogy of the 5 bodies and the kinship among them, SNP and/or STR profiles of mitochondria, autosomes, and Y chromosomes were analyzed. Four of the 5 bodies were determined to carry the mitochondrial DNA haplogroup D4, while the fifth carried haplogroup CZ, indicating that this individual had no kinship with the others. Meanwhile, Y-SNP and Y-STR profiles indicate that the males examined belonged to the R1b-M343 haplogroup. Thus, their East Asian D4 or CZ matrilineal and West Eurasian R1b-M343 patrilineal origins reveal genealogical admixture between Caucasoid and Mongoloid ethnic groups, despite a Mongoloid physical appearance. In addition, Y chromosomal and autosomal STR profiles revealed that the four D4-carrying bodies bore the relationship of either mother and three sons or four full siblings with almost the same probability. Moreover, the geographical distribution of R1b-M343-carrying modern-day individuals demonstrates that descendants of Tavan Tolgoi bodies today live mainly in Western Eurasia, with a high frequency in the territories of the past Mongol khanates. Here, we propose that Genghis Khan and his family carried Y-haplogroup R1b-M343, which is prevalent in West Eurasia, rather than the Y-haplogroup C3c-M48, which is prevalent in Asia and which is widely accepted to be present in the family members of Genghis Khan. Additionally, Tavan Tolgoi bodies may have been the product of marriages between the lineage of Genghis Khan's Borjigin clan and the lineage of either the Ongud or Hongirad clans, indicating that these individuals were members of Genghis Khan's immediate family or his close relatives.

  15. Parents’ Attitude toward Daughters’ Education in Tribal Area of Dera Ghazi Khan (Pakistan)

    OpenAIRE

    Muhammad Ayub Buzdar; Akhtar Ali

    2011-01-01

    The paper aimed to investigate the parents’ attitudes toward their daughters’ education in tribal areas of district Dera Ghazi Khan (Pakistan). To achieve the objectives four research questions were established. Focus of the questions was to examine the significance of girls’ education for tribal parents. Existing and expected role of tribal parents as well as contribution from government and community for girls’ education was also aimed to explore in research questions. Sample comprised thir...

  16. The Christian Nobles at the Court of Great Khan, as Described in Mediaeval European Sources

    Czech Academy of Sciences Publication Activity Database

    Liščák, Vladimír

    2017-01-01

    Roč. 5, č. 2 (2017), s. 276-289 ISSN 2308-152X Institutional support: RVO:68378009 Keywords : religion in mediaeval China * Yuan Dynasty China * Christianity in the Great Khan court * Franciscan missions * Christian Alan nobility * Western mediaeval sources Subject RIV: AB - History OBOR OECD: History (history of science and technology to be 6.3, history of specific sciences to be under the respective headings)

  17. A novel base change leading to Hb Vanderbilt [β89(F5)Ser→Arg, AGT>AGA].

    Science.gov (United States)

    Goodyer, Matthew J; Elhassadi, Ezzat I; Percy, Melanie J; McMullin, Mary F

    2011-01-01

    We describe a high oxygen affinity hemoglobin (Hb) variant (Hb Vanderbilt) as a result of a heterozygous novel base change from T to A at codon 89 (AGT>AGA) leading to an amino acid change from serine to arginine.

  18. Ex-vivo assessment and non-invasive in vivo imaging of internal hemorrhages in Aga2/+ mutant mice

    Energy Technology Data Exchange (ETDEWEB)

    Ermolayev, Vladimir [Institute for Biological and Medical Imaging, Helmholtz Zentrum München, Building 56, Ingolstädter Landstraße 1, D-85764 Neuherberg (Germany); Cohrs, Christian M. [Institute for Experimental Genetics, Helmholtz Zentrum München, Ingolstädter Landstraße 1, D-85764 Neuherberg (Germany); Mohajerani, Pouyan; Ale, Angelique [Institute for Biological and Medical Imaging, Helmholtz Zentrum München, Building 56, Ingolstädter Landstraße 1, D-85764 Neuherberg (Germany); Hrabé de Angelis, Martin [Institute for Experimental Genetics, Helmholtz Zentrum München, Ingolstädter Landstraße 1, D-85764 Neuherberg (Germany); Ntziachristos, Vasilis, E-mail: v.ntziachristos@tum.de [Institute for Biological and Medical Imaging, Helmholtz Zentrum München, Building 56, Ingolstädter Landstraße 1, D-85764 Neuherberg (Germany)

    2013-03-08

    Highlights: ► Aga2/+ mice, model for Osteogenesis imperfecta, have type I collagen mutation. ► Aga2/+ mice display both moderate and severe phenotypes lethal 6–11th postnatal. ► Internal hemorrhages studied in Aga2/+ vs. control mice at 6 and 9 days postnatal. ► Anatomical and functional findings in-vivo contrasted to the ex-vivo appearance. -- Abstract: Mutations in type I collagen genes (COL1A1/2) typically lead to Osteogenesis imperfecta, the most common heritable cause of skeletal fractures and bone deformation in humans. Heterozygous Col1a1{sup Aga2/+}, animals with a dominant mutation in the terminal C-propeptide domain of type I collagen develop typical skeletal hallmarks and internal hemorrhages starting from 6 day after birth. The disease progression for Aga2/+ mice, however, is not uniform differing between severe phenotype lethal at the 6–11th day of life, and moderate-to-severe one with survival to adulthood. Herein we investigated whether a new modality that combines X-ray computer tomography with fluorescence tomography in one hybrid system can be employed to study internal bleedings in relation to bone fractures and obtain insights into disease progression. The disease phenotype was characterized on Aga2/+ vs. wild type mice between 6 and 9 days postnatal. Anatomical and functional findings obtained in-vivo were contrasted to the ex-vivo appearance of the same tissues under cryo-slicing.

  19. Ex-vivo assessment and non-invasive in vivo imaging of internal hemorrhages in Aga2/+ mutant mice

    International Nuclear Information System (INIS)

    Ermolayev, Vladimir; Cohrs, Christian M.; Mohajerani, Pouyan; Ale, Angelique; Hrabé de Angelis, Martin; Ntziachristos, Vasilis

    2013-01-01

    Highlights: ► Aga2/+ mice, model for Osteogenesis imperfecta, have type I collagen mutation. ► Aga2/+ mice display both moderate and severe phenotypes lethal 6–11th postnatal. ► Internal hemorrhages studied in Aga2/+ vs. control mice at 6 and 9 days postnatal. ► Anatomical and functional findings in-vivo contrasted to the ex-vivo appearance. -- Abstract: Mutations in type I collagen genes (COL1A1/2) typically lead to Osteogenesis imperfecta, the most common heritable cause of skeletal fractures and bone deformation in humans. Heterozygous Col1a1 Aga2/+ , animals with a dominant mutation in the terminal C-propeptide domain of type I collagen develop typical skeletal hallmarks and internal hemorrhages starting from 6 day after birth. The disease progression for Aga2/+ mice, however, is not uniform differing between severe phenotype lethal at the 6–11th day of life, and moderate-to-severe one with survival to adulthood. Herein we investigated whether a new modality that combines X-ray computer tomography with fluorescence tomography in one hybrid system can be employed to study internal bleedings in relation to bone fractures and obtain insights into disease progression. The disease phenotype was characterized on Aga2/+ vs. wild type mice between 6 and 9 days postnatal. Anatomical and functional findings obtained in-vivo were contrasted to the ex-vivo appearance of the same tissues under cryo-slicing

  20. "Parim" on subjektiivne, aga kõhutundest ka ei piisa / Inga Kuusik

    Index Scriptorium Estoniae

    Kuusik, Inga, 1961-

    2007-01-01

    Ilmunud ka: Finansovõi Menedzhment : infovõpusk nr. 13 apr. lk. 6-7. Saku Õlletehase uus finantsjuht oma tööst tubakatootja Imperial Tobacco Grupi Kesk-Aasia regiooni finantsdirektorina Kõrgõzstanis, Saku Õlletehase kapitali struktuurist, finantsdirektori rollist ettevõttes ja tööjõu värbamisest Saku Õlletehases. Lisad: Saku Õlletehas 2006: mõõdukas käibe-, aga suur kasumikasv; Tabel: Saku Õlletehase dividendimaksed 1997-2007

  1. The Christian Nobles at the Court of Great Khan, as Described in Mediaeval European Sources

    Directory of Open Access Journals (Sweden)

    Vladimír Liščák

    2017-06-01

    Full Text Available Research objectives: “Moreover, the chief princes of his whole empire, more than thirty thousand in number, who are called Alans, and govern the whole Orient, are Christians either in fact or in name, calling themselves the Pope’s slaves, and ready to die for the Franks.” With these words John of Marignola, a notable traveller to the Far East in the fourteenth century and a legate to the Great Khan of Cathay, attested in his Cronica Boemorum the presence of certain Christian nobles of the Alan race in the service of the Mongol-Chinese emperor. The immediate impetus for Marignola’s mission was that in 1336 the Great Khan Ukhaghatu Toghon-Temür sent a delegation of sixteen “Franks” (Franquis, as the Mongols called Europeans, ad Papam, Dominum Christianorum in Franchiam. They brought two letters to the pope: one purporting to be from the Great Khan himself, and the other from certain princes of the Christian Alans in his service. By the coming of the Mongolian legation in Avignon in 1338, we are informed, among others, that the successor of John of Montecorvino, the first archbishop in Khanbalik, had never reached his destination, as well as the other succeeding archbishops to Khanbalik. Research materials: Marignola’s mission was important not only with its spiritual message, but rather with an excellent choice of gift for the Great Khan. Western messengers brought with them, among the gifts from the Pope in Rome, a singularly auspicious present: a magnificent black horse with white hind hooves. Marignola, in his Cronica Boemorum, identifies the Christian dignitaries at the court of the Great Khan as the Alans. We know of them from earlier sources, but mostly under the generic name “Christians” or “Nestorian Christians”. John of Montecorvino reportedly converted many Alans (he did not mention their name to Roman Catholic Christianity in addition to Armenians in China. According to the Annals of the Yuan Dynasty, in 1229 and

  2. VIDEO PRIKAZ VIZUALIZACIJE DOŽIVLJAJA ENGLESKE PJESME KUBLA KHAN UZ POMOĆ ALATA ZA OBRADU MULTIMEDIJE

    OpenAIRE

    Stojaković, Biljana; Popović, Mihaela

    2017-01-01

    U radu je prikazan način na koji je uz pomoć alata multimedije postignuta vizualizacija doživljaja poznate engleske pjesme Kubla Khan, osebujnog autora Samuela Taylora Coleridgea. Izrađen je video kojim se dočarao subjektivni doživljaj pjesme, predstavljeni su opisani dijelove pjesme i usklađeni ritam kitica, slika i animacije. Korišteni su programi Adobe Photoshop, Adobe Flash i Adobe Illustrator.. Video je doprinos aplikaciji LEO (Learning English Online) koju stu...

  3. Effect of different plant spacing on the production of cauliflower (Brassica oleraceae var. Botrytis) under the agro-climatic conditions of D.I. Khan.

    Science.gov (United States)

    Mujeeb-ur-Rahman; Iqbal, Muhammad; Jilani, Muhammad Saleem; Waseem, Kashif

    2007-12-15

    A research project to evaluate the effect of different plant spacing on the production of cauliflower was conducted at Horticulture Research Area, Faculty of Agriculture, Gomal University, Dera Ismail Khan, NWFP, Pakistan. Six different plant spacing viz., 30, 35, 40, 45, 50 and 55 cm were used. The results revealed significant variations in all the parameters and amongst various plant spacing, 45 cm spacing showed the best response for all the parameters. Maximum plant height (49.33 cm), curd diameter (19.13 cm), maximum curd weight (1.23 kg plant(-1)) and yield (30.77 t ha(-1)) were recorded in the plots where the plants were spaced 45 cm apart.

  4. AGA: Interactive pipeline for reproducible gene expression and DNA methylation data analyses [version 2; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Michael Considine

    2015-10-01

    Full Text Available Automated Genomics Analysis (AGA is an interactive program to analyze high-throughput genomic data sets on a variety of platforms. An easy to use, point and click, guided pipeline is implemented to combine, define, and compare datasets, and customize their outputs. In contrast to other automated programs, AGA enables flexible selection of sample groups for comparison from complex sample annotations. Batch correction techniques are also included to further enable the combination of datasets from diverse studies in this comparison. AGA also allows users to save plots, tables and data, and log files containing key portions of the R script run for reproducible analyses. The link between the interface and R supports collaborative research, enabling advanced R users to extend preliminary analyses generated from bioinformatics novices.

  5. Incidence and review of hydatidiform mole; chorioadenoma, destruens and chorio carcinoma in Mirza Kochek Khan Hospita

    Directory of Open Access Journals (Sweden)

    Ghaffari V

    1995-04-01

    Full Text Available Initial management, incidence and review of hydatidiform mole, chorioadenoma and destruens and chorio carcinoma in Mirza Kochek khan hospital department of ob.gyn and gynecology oncology of women's hospital Tehran-Iran school of medicin from September 1985 to March 1990, 209 patients received primary management for hydatidiform mole at oncology department of Mirza Kochek Khan hospital medical school of Tehran Iran. All of these women HAD complete record available for analysis, of these, 167 women bydatidiform mole, 12 patients chorioadenoma-destruens 30 patients chorio carcinoma a survey was made of factors likely to provide an important clinical perspective patient aye and the status of pregnancy were noted. 41 patient only sharp curettage and 55 patients suction curettage to remove the hydatidiform mole. 97 patient require chemo terapy, suction curettage of the uterus is clearly the best means of management in the most cases their eyperince documents that hydatidiform mole is an high risk pregnancy that requires prompt and in tensive management.

  6. An analysis of Canada-US natural gas trade using the AGAS energy model

    International Nuclear Information System (INIS)

    Quon, D.; Wong, S.

    1989-01-01

    The strength of AGAS is that it was structurally designed to address the primary issue of EMF9, namely the medium and long-term prospects for Canada-US natural gas trade. Consequently, it is one of the very few models with the following necessary features: (1) it treats all the regions of Canada and the United States as one continental entity, both with respect to demand and supply; (2) All regional supplies and demands are integrated. Hence, regional gas prices are endogenous; inter-regional gas flows, including Canadian-US gas exchanges, are endogenous. Models that do not have both of these features require that the answers that are being sought have to be specified exogenously. An iterative procedure can be used to reconcile unrealistic results but only with difficulty

  7. Cardiopulmonary dysfunction in the Osteogenesis imperfecta mouse model Aga2 and human patients are caused by bone-independent mechanisms.

    Science.gov (United States)

    Thiele, Frank; Cohrs, Christian M; Flor, Armando; Lisse, Thomas S; Przemeck, Gerhard K H; Horsch, Marion; Schrewe, Anja; Gailus-Durner, Valerie; Ivandic, Boris; Katus, Hugo A; Wurst, Wolfgang; Reisenberg, Catherine; Chaney, Hollis; Fuchs, Helmut; Hans, Wolfgang; Beckers, Johannes; Marini, Joan C; Hrabé de Angelis, Martin

    2012-08-15

    Osteogenesis imperfecta (OI) is an inherited connective tissue disorder with skeletal dysplasia of varying severity, predominantly caused by mutations in the collagen I genes (COL1A1/COL1A2). Extraskeletal findings such as cardiac and pulmonary complications are generally considered to be significant secondary features. Aga2, a murine model for human OI, was systemically analyzed in the German Mouse Clinic by means of in vivo and in vitro examinations of the cardiopulmonary system, to identify novel mechanisms accounting for perinatal lethality. Pulmonary and, especially, cardiac fibroblast of perinatal lethal Aga2/+ animals display a strong down-regulation of Col1a1 transcripts in vivo and in vitro, resulting in a loss of extracellular matrix integrity. In addition, dysregulated gene expression of Nppa, different types of collagen and Agt in heart and lung tissue support a bone-independent vicious cycle of heart dysfunction, including hypertrophy, loss of myocardial matrix integrity, pulmonary hypertension, pneumonia and hypoxia leading to death in Aga2. These murine findings are corroborated by a pediatric OI cohort study, displaying significant progressive decline in pulmonary function and restrictive pulmonary disease independent of scoliosis. Most participants show mild cardiac valvular regurgitation, independent of pulmonary and skeletal findings. Data obtained from human OI patients and the mouse model Aga2 provide novel evidence for primary effects of type I collagen mutations on the heart and lung. The findings will have potential benefits of anticipatory clinical exams and early intervention in OI patients.

  8. 76 FR 42159 - Lifting of Sanctions on Person Associated With the A.Q. Khan Nuclear Procurement Network

    Science.gov (United States)

    2011-07-18

    ... DEPARTMENT OF STATE [Public Notice: 7525] Lifting of Sanctions on Person Associated With the A.Q. Khan Nuclear Procurement Network AGENCY: Bureau of International Security and Nonproliferation... the Foreign Relations Authorization Act for Fiscal Years 1994-1995 (22 U.S.C. 6301), the Export-Import...

  9. Investigating the Use of the Khan Academy and Mathematics Software with a Flipped Classroom Approach in Mathematics Teaching

    Science.gov (United States)

    Zengin, Yilmaz

    2017-01-01

    The purpose of this study was to determine the effect of the flipped classroom approach designed by using Khan Academy and free open source software on students' academic achievement and to examine students' views about this approach. The research was evaluated in the light of both qualitative and quantitative data. Twenty-eight students studying…

  10. Research on efficiency test of a turbine in Khan Khwar hydropower station

    International Nuclear Information System (INIS)

    Zhang, H K; Liang, Z; Deng, M G; Liu, X B; Wang, H Y; Liu, D M

    2012-01-01

    The efficiency test is an important indicator to evaluate the energy conversion performance of a hydraulic turbine. For hydropower stations which do not have the direct flow measurement conditions, whether the characteristic curve of a turbine obtained through similarity theory conversion by using the comprehensive characteristic curve of the turbine can correctly reflect the operating performance of the prototype unit is a key issue in this industry. By taking the No.1 unit of Khan Khwar hydropower station as the example, the efficiency test of this turbine was studied on the site, including the measurement method of test parameters, the configuration of the computer test system, as well as the processing and analysis of test data.

  11. A.G.A. program gives utilities a leg up on benchmarking

    International Nuclear Information System (INIS)

    Share, J.

    1997-01-01

    In this era of downsizing, distribution companies are banding together under the aegis of the American Gas Association to improve their performance, ultimately saving money and jobs. The Best Practice Benchmarking program began in 1990 when New Orleans Public Service coordinated an effort by several utilities wanting to compare practices and data. It is not benchmarking in the traditional sense. Best Practices stresses functional rather than competitive or numerical benchmarking by focusing on what utilities have done to improve their operations. In a report on Best Practices, John Bayko, Director of System Operations for Consumers Gas in Toronto, noted these success stories: Building odorant storage and transport facilities were found to save one company $17,500 annually because it could buy odorant in bulk as opposed to 55-gallon drums. Upgrading its cathodic protection system helped a company realize a 40 percent reduction in corrosion leaks over a two-year period, saving $200,000 a year. Another company began studying partnering with contractors which would eliminate the need of a pipeline inspector in each crew. Those potential savings are over $2 million. This paper describes three other Best Practices related to worker safety, system mapping, and activity-based accounting. A.G.A.'s role is briefly discussed

  12. Morbility, clinical data and proteomic analysis of IUGR and AGA newborns at different gestational ages

    Directory of Open Access Journals (Sweden)

    M.D. Ruiz-González

    2016-12-01

    Full Text Available The data are related to the proteomic analysis of 43 newborns with intrauterine growth retardation (IUGR and 45 newborns with appropriate weight for gestational age (AGA carried out by separation via 2DE and analyzed by MS–TOF/TOF. All newborns were separated into three gestational age groups, "Very Preterm" 29–32 weeks, "Moderate Preterm" 33–36 weeks, and, "Term" ≥37weeks. From each newborn, blood was drawn three times from birth to 1 month life. High-abundant serum proteins were depleted, and the minority ones were separated by 2DE and analyzed for significant expression differences. The data reflect analytic and clinic variables analyzed globally and categorized by gestational age in relation to IUGR and the optimization of conditions for 2-DE separation. The data from this study are related to the research article entitled "Alterations of Protein Expression in Serum of Infants with Intrauterine Growth Restriction and Different Gestational Ages" (M.D. Ruis-González, M.D. Cañete, J.L. Gómez-Chaparro, N. Abril, R. Cañete, J. López-Barea, 2015 [1]. The present dataset of serum IUGR newborn proteome can be used as a reference for any study involving intrauterine growth restriction during the first month of life.

  13. Molecular Genealogy of a Mongol Queen’s Family and Her Possible Kinship with Genghis Khan

    Science.gov (United States)

    Lkhagvasuren, Gavaachimed; Shin, Heejin; Lee, Si Eun; Tumen, Dashtseveg; Kim, Jae-Hyun; Kim, Kyung-Yong; Kim, Kijeong; Park, Ae Ja; Lee, Ho Woon; Kim, Mi Jin; Choi, Jaesung; Choi, Jee-Hye; Min, Na Young

    2016-01-01

    Members of the Mongol imperial family (designated the Golden family) are buried in a secret necropolis; therefore, none of their burial grounds have been found. In 2004, we first discovered 5 graves belonging to the Golden family in Tavan Tolgoi, Eastern Mongolia. To define the genealogy of the 5 bodies and the kinship among them, SNP and/or STR profiles of mitochondria, autosomes, and Y chromosomes were analyzed. Four of the 5 bodies were determined to carry the mitochondrial DNA haplogroup D4, while the fifth carried haplogroup CZ, indicating that this individual had no kinship with the others. Meanwhile, Y-SNP and Y-STR profiles indicate that the males examined belonged to the R1b-M343 haplogroup. Thus, their East Asian D4 or CZ matrilineal and West Eurasian R1b-M343 patrilineal origins reveal genealogical admixture between Caucasoid and Mongoloid ethnic groups, despite a Mongoloid physical appearance. In addition, Y chromosomal and autosomal STR profiles revealed that the four D4-carrying bodies bore the relationship of either mother and three sons or four full siblings with almost the same probability. Moreover, the geographical distribution of R1b-M343-carrying modern-day individuals demonstrates that descendants of Tavan Tolgoi bodies today live mainly in Western Eurasia, with a high frequency in the territories of the past Mongol khanates. Here, we propose that Genghis Khan and his family carried Y-haplogroup R1b-M343, which is prevalent in West Eurasia, rather than the Y-haplogroup C3c-M48, which is prevalent in Asia and which is widely accepted to be present in the family members of Genghis Khan. Additionally, Tavan Tolgoi bodies may have been the product of marriages between the lineage of Genghis Khan’s Borjigin clan and the lineage of either the Ongud or Hongirad clans, indicating that these individuals were members of Genghis Khan’s immediate family or his close relatives. PMID:27627454

  14. Latin Sources on the Religious Situation in the Golden Horde in the Early Reign of Uzbek Khan »

    Directory of Open Access Journals (Sweden)

    R. Hautala

    2016-07-01

    Full Text Available The author of this article presents the content of selected Latin sources on the Franciscan missionary activity on the territory of the Golden Horde in the 14th century. These sources are of particular interest for the study of the history of the ulus of Jochi since they were written within the Golden Horde during the reign of khan Uzbek (1312–1341. In particular, these sources contain valuable information about religious policy of the rulers of the ulus of Jochi, which allows us to re-evaluate the process of the spread of Islam in the Golden Horde and the degree of Islamization of nomads during the reign of khan Uzbek. First, the author presents the yarlyk that khan Uzbek granted to the Minorites of Kaffa in 1314. The author points to specific conformity of its content with well-known yarlyks granted by the Golden Horde khans to the metropolitans of the Orthodox Church of Rus’. This yarlyk of Uzbek is essential for clarifying the nature of Uzbek’s religious policy in the initial period of his reign. Its information allows us to review the accuracy of the information contained in the well-known Muslim sources. Further, the author points to the importance of the information contained in a later letter by the Franciscans of Caffa, sent by them to the West in 1323. This letter mentions the substantial proselytizing successes of the Franciscans and, more importantly, indicates that Uzbek’s administration did not obstruct the Minorites’ missionary activities deployed by them among the nomads of the ulus of Jochi. At the end of the article, the author pays attention to frequent conflicts between the Catholics and Muslim residents of the Golden Horde and focuses on the information of the Latin sources, which allows us to determine the reasons for these conflicts.

  15. Parents’ Attitude toward Daughters’ Education in Tribal Area of Dera Ghazi Khan (Pakistan

    Directory of Open Access Journals (Sweden)

    Muhammad Ayub Buzdar

    2011-01-01

    Full Text Available The paper aimed to investigate the parents’ attitudes toward their daughters’ education in tribal areas of district Dera Ghazi Khan (Pakistan. To achieve the objectives four research questions were established. Focus of the questions was to examine the significance of girls’ education for tribal parents. Existing and expected role of tribal parents as well as contribution from government and community for girls’ education was also aimed to explore in research questions. Sample comprised thirty parents and five teachers/educational workers. The data was collected through semi-structured interviews and was analyzed using content analysis approach. The findings disclosed the parents’ positive perceptions toward their daughters’ education but at the same time severe scarcity of human and physical infrastructure for girls’ education was also presented in the area. The paper recommended several empirical steps to overcome these problems including provision of new school locations and ensuring the availability of school buildings, supporting infrastructure and teachers for already functioning schools in the area. Financial aid for poor students was also proposed in the study

  16. Parents’ Attitude toward Daughters’ Education in Tribal Area of Dera Ghazi Khan (Pakistan

    Directory of Open Access Journals (Sweden)

    Akhtar Ali

    2011-01-01

    Full Text Available The paper aimed to investigate the parents’ attitudes toward their daughters’ education in tribal areas of district Dera Ghazi Khan (Pakistan. To achieve the objectives four research questions were established. Focus of the questions was to examine the significance of girls’ education for tribal parents. Existing and expected role of tribal parents as well as contribution from government and community for girls’ education was also aimed to explore in research questions. Sample comprised thirty parents and five teachers/educational workers. The data was collected through semi-structured interviews and was analyzed using content analysis approach. The findings disclosed the parents’ positive perceptions toward their daughters’ education but at the same time severe scarcity of human and physical infrastructure for girls’ education was also presented in the area. The paper recommended several empirical steps to overcome these problems including provision of new school locations and ensuring the availability of school buildings, supporting infrastructure and teachers for already functioning schools in the area. Financial aid for poor students was also proposed in the study.

  17. Environmental geochemistry of surface and subsurface water from Dera Ismail Khan Division, Khyber Pakhtunkhwa, Pakistan

    International Nuclear Information System (INIS)

    Shah, M.T.; Alizai, A.H.; Khan, S.D.

    2012-01-01

    The Dera Ismail Khan division is situated in the southern most part of the Khyber-Pakhtunkhwa province in Pakistan. Majority of population in this region obtain domestic water from tube wells, dug wells, ponds, stored run off of the Indus and Gomal rivers and perennial streams. This study is aimed to determine the physio-chemical contaminants in the surface and subsurface water which could cause environmental problem. For this purpose, representative water sample were collected from tube wells, dug wells, streams and rivers. These analyses were performed using Hach DR/2000 spectrophotometer and graphite furnace atomic absorption spectrometer. Chemically both surface and subsurface water samples of the area were classified as alkaline fresh water. The comparison of the data with standard limits set by Word Health Organization (WHO) for drinking water suggested that in certain areas of the division, the drinking water samples have high concentrations of Total Dissolved Solids, NO/sub 3//sup 2-/, SO/sub 4//sup 2-/, F-, Cl-, Fe/sup 2+/, Ca/sup 2+/, Mg/sup 2+/, Pb/sup 2+/, Ni/sup 2+/ and Cd/sup 2+/ while pH, EC, HCO/sub 3/-, PO/sub 4//sup 3-/, Na/sup +/, Mn/sup 2+/, K/sup +/, Cr/sup 3+/ and Zn/sup 2+/ were within the permissible limits. These contaminations could be attributed to the geogenic sources which might be responsible for the health related problems in certain areas of the division. (author)

  18. Natural radioactivity, dose assessment and uranium uptake by agricultural crops at Khan Al-Zabeeb, Jordan

    Energy Technology Data Exchange (ETDEWEB)

    Al-Kharouf, Samer J. [Royal Scientific Society, Amman 11941 (Jordan); Al-Hamarneh, Ibrahim F. [Prince Abdullah Bin Ghazi Faculty of Science and IT, Al-Balqa Applied University (BAU), Salt 19117 (Jordan)], E-mail: hamarnehibrahim@yahoo.com; Dababneh, Munir [Prince Abdullah Bin Ghazi Faculty of Science and IT, Al-Balqa Applied University (BAU), Salt 19117 (Jordan)

    2008-07-15

    Khan Al-Zabeeb, an irrigated cultivated area lies above a superficial uranium deposits, is regularly used to produce vegetables and fruits consumed by the public. Both soil and plant samples collected from the study area were investigated for their natural radioactivity to determine the uranium uptake by crops and hence to estimate the effective dose equivalent to human consumption. Concentrations of {sup 238}U, {sup 235}U, {sup 232}Th, {sup 226}Ra, {sup 222}Rn, {sup 137}Cs and {sup 40}K in nine soil profiles were measured by gamma-ray spectrometry whereas watermelon and zucchini crops were analyzed for their uranium content by means of alpha spectrometry after radiochemical separation. Correlations between measured radionuclides were made and their activity ratios were determined to evaluate their geochemical behavior in the soil profiles. Calculated soil-plant transfer factors indicate that the green parts (leaves, stems and roots) of the studied crops tend to accumulate uranium about two orders of magnitude higher than the fruits. The maximum dose from ingestion of 1 kg of watermelon pulp was estimated to be 3.1 and 4.7 nSv y{sup -1} for {sup 238}U and {sup 234}U, respectively. Estimations of the annual effective dose equivalent due to external exposure showed extremely low values. Radium equivalent activity and external hazard index were seen to exceed the permissible limits of 370 Bq kg{sup -1} and 1, respectively.

  19. Natural radioactivity, dose assessment and uranium uptake by agricultural crops at Khan Al-Zabeeb, Jordan

    International Nuclear Information System (INIS)

    Al-Kharouf, Samer J.; Al-Hamarneh, Ibrahim F.; Dababneh, Munir

    2008-01-01

    Khan Al-Zabeeb, an irrigated cultivated area lies above a superficial uranium deposits, is regularly used to produce vegetables and fruits consumed by the public. Both soil and plant samples collected from the study area were investigated for their natural radioactivity to determine the uranium uptake by crops and hence to estimate the effective dose equivalent to human consumption. Concentrations of 238 U, 235 U, 232 Th, 226 Ra, 222 Rn, 137 Cs and 40 K in nine soil profiles were measured by gamma-ray spectrometry whereas watermelon and zucchini crops were analyzed for their uranium content by means of alpha spectrometry after radiochemical separation. Correlations between measured radionuclides were made and their activity ratios were determined to evaluate their geochemical behavior in the soil profiles. Calculated soil-plant transfer factors indicate that the green parts (leaves, stems and roots) of the studied crops tend to accumulate uranium about two orders of magnitude higher than the fruits. The maximum dose from ingestion of 1 kg of watermelon pulp was estimated to be 3.1 and 4.7 nSv y -1 for 238 U and 234 U, respectively. Estimations of the annual effective dose equivalent due to external exposure showed extremely low values. Radium equivalent activity and external hazard index were seen to exceed the permissible limits of 370 Bq kg -1 and 1, respectively

  20. Climate change, poverty and agricultural resource degradation: a case study of district d.g. khan

    International Nuclear Information System (INIS)

    Imran, M.; Bano, S.; Dawood, M.; Tarar, M.A.; Ali, A.

    2012-01-01

    Global development agendas are now being bonded with adaptation to climate change. Sustainable biodiversity and community adaptation to climate change are closely associated as depletion of natural resources adversely affects the living standard of people. Rapid climatic changes and intervention to regulate water resources in Indus delta of Pakistan have put the lives of millions of people residing near the Indus river belt at the stake of climate change. Therefore, this study was designed to inquire the socio-economic conditions of the people residing near the Indus river bank and the perceived impact of climate change on river belt agricultural resources specifically in district D. G. Khan. Based on primary data study employed univariate and bivariate analysis which suggested flood, wind storm and temperature as the significant climate change parameters affecting the land fertility, forest and fisheries. The Foster Greer and Thorbeck technique for calculating the poverty indicated that majority (82%) of population was below poverty line and most of them entirely depend on river belt agricultural resources which were found to be depleting due to rapid climate change. (author)

  1. Geographical information system based model of land suitability for good yield of rice in prachuap khiri khan province, thailand

    International Nuclear Information System (INIS)

    Hussain, W.; Sohaib, O.

    2012-01-01

    Correct assessment of land is a major issue in agricultural sector to use possible capability of any land, to raise cultivation and production of rice. Geographical Information System (GIS) provides broad techniques for suitable land classifications. This study is GIS based on land suitability analysis for rice farming in Prachuap Khiri Khan Province, Thailand, where the main livelihood of people is rice farming. This analysis was conducted considering the relationship of rice production with various data layers of elevation, slope, soil pH, rainfall, fertilizer use and land use. ArcView GIS 3.2 software is used to consider each layer according to related data to weight every coefficient, ranking techniques are used. It was based on determining correlation of rice production and these variables. This analysis showed a positive correlation with these variables in varying degrees depending on the magnitude and quality of these factors. By combining both data layers of GIS and weighted linear combination, various suitable lands have been developed for cultivation of rice. Integrated suitable assessment map and current land were compared to find suitable land in Prachuap Khiri Khan Province of Thailand. As a result of this comparison, we get a land which is suitable for optimum utilization for rice production in Prachuap Khiri Khan Province. (author)

  2. Abdulgaffar Qyrymi. Excerpt from “Umdet ul-Ahbar”. From the History of Crimean Khans »

    Directory of Open Access Journals (Sweden)

    Nariman Seitametovich Seyityahya

    2015-12-01

    Full Text Available This publication contains a fragment about the history of Crimean khans from the historical work “Umdet al-Akhbar” written by a Crimean author Abdulgaffar Kyrymi. In particular, this publication contains a translation of the story about the descendants of Bash-Timur (Tash-Timur according to another version. In this story, Abdulgaffar Kyrymi thoroughly reveals the history of the descendants of Bash-Timur – Gyyaseddin and Devlet-Berdi. He also tells how Haji Giray, Devlet-Berdi’s son, became Khan. In addition, he provides information about khan Ulugh Muhammad, Bash-Timur’s cousin. The author provides us with a very interesting and supporting information in a separate addition to the margins of the manuscript. In particular, this addition contains a brief history of the Turkic tribes and inhabitants of Tataristan, birthplace of the Seljuks and Osman family from the Kayi clan. It also tells how the Ottomans took control of Crimea, examines in detail the reasons for this event, it speaks both about Mengli Giray’s education together with Ottoman princes and on the establishment of relations with Emenek-Bek Shirinsky, Chief Karachi of the Khanate. Then it tells about the rule of Muhammad Giray and his death in the war against the Nogays, about the reign of Saadet Giray, a son of Mengli Giray, during whose reign the uprising of Islam Giray took place.

  3. Managing Tourism in the Greater Mekong Region (GMS: A Case Study of Chiang Khan Community, Northeast Thailand

    Directory of Open Access Journals (Sweden)

    Rawee Hanpachern

    2014-05-01

    Full Text Available This study aims to examine complex ‘sustainability’ aspects of the Community-based tourism concept in tourism and destination management in the Greater Mekong Sub-region (GMS. This research is conceptualized in assessing the potential for Community-Based Tourism (CBT development in Chiang Khan, a small village by the Mekong River in the Northeast of Thailand. For collecting data, semi-interviews questions are designed. Focus-group discussion and indepth interviews are carried to include tourism stakeholders of the destination. This study argues that although a community may contain many tourism assets, it is not the only factor necessary for a ‘sustainable’ tourism to be developed in that community. Through a case study, its natural features, cultural activities, local lifestyle and the serene landscape of its location are exemplified as the important community-based tourism assets. However, a number of complex components and holistic approaches that worked well together Chiang Khan becoming a sustainable tourism destination. There elements and approaches that contribute to starting up Chiang Khan as a sustainable tourist destination include: its unique features of recreational activities and local businesses, knowledge and skills of the locals to develop tourism related businesses, and direct proper marketing strategies.

  4. Body mass status of school children of Dera Ismail Khan, Pakistan.

    Science.gov (United States)

    Ramzan, Muhammad; Ali, Irshad; Khan, Abdus Salam

    2008-01-01

    Childhood obesity is a global epidemic involving both developed and developing countries. It is a stare of over-nutrition with long-term complications such as dyslipidemia, hypertension, and coronary artery disease and type-2 diabetes. Underweight is the result of under nutrition leading to reduction in growth and development of every body organ especially the Central Nervous System. Long-term under-nutrition causes failure in linear growth (height) of the child. Growth is further retarded by the repeated attacks of respiratory infections, diarrhea and anemia as a result of reduced immunity. This study was carried, out eight primary schools of Dera Ismail Khan (Private, semi government organizations, and welfare foundations) having mixed population with some of the wards belonging to high socioeconomic group. Thorough clinical examination excluded those suffering from chronic heath problems. Height and weight of each one was taken body mass index of determined according to 'Quatelet's' index. Body mass index number was plotted on the CDC S age and gender specific growth charts 2-20 years for BMI-for age percentile and body mass status (underweight, normal weight, overweight/at the risk of overweight and obese/overweight. Total 1338 school going children (6-11 years) were examined with 865 (67.75%) boys and 471 (35.25%) as girls. 13.39%, 72.15%, 8.83% and 5.61% as underweight, normal weight, overweight and obese respectively. Percentage of underweight was higher in girls (25%) than boys (13.22). Percentage of obesity was higher (5.17%) in boys than girls (1.39%). Awareness about balanced diet, improvement in the level of education and socioeconomic conditions, easy access to health facilities and prevention of the gender discrimination, are the remedial measures to be taken to redress the situation.

  5. Khan Krum - ʺThe Fearsomeʺ: A Noble Bulgarian with Iris-Fibroma?

    Directory of Open Access Journals (Sweden)

    Georgi Tchernev

    2017-08-01

    Full Text Available A 40-year-old Caucasian, the otherwise healthy male patient, presented with 3-years history of a prominent tumor-like formation, located on his back, without subjective complaints. Initially, the lesion was 1-2 cm in size but gradually increased to a visible-pronounced tumor-like formation. No other dermatologic diseases, neither other known abnormalities were reported for the medical and family history.  Softly-elastic on palpation tumor-like formation was established in the left infrascapular area of the back, measuring 8/9 cm in diameter. The lesion was clinically suspected for lipoma or another soft-tissue tumour with benign nature, so the patient underwent planned surgical excision under local anaesthesia. A tumour was excited with deep elliptical excision and furthered for histological evaluation, while the wound edges were sutured with single cutaneous stitches. Additionally, a large black-colored tattoo of the Bulgarian historical noble Khan Krum was also observed within the clinical examination, covering almost the whole upper 1/3 part of the patient’s back Within the careful clinical observation of the tattoo, we noticed a fibroma-like lesion, affecting the noble’s right iris. Fibromas are common benign tumours in Caucasians, composed of fibrous or connective tissue. They can be seen in all organs from mesenchymal tissue, in varies size. Eyelids are often commonly affected in elderly. Although very commonly seen in every day dermatological practice, fibromas have been never reported, located in the iris. In the presented case, a small ʺiris-fibromaʺ, hidden within a black-colored tattoo was diagnosed in a patient with lipoma, as a sporadic clinical finding.

  6. An Assessment of the AGA and CCFA Quality Indicators in a Sample of Patients Diagnosed with Inflammatory Bowel Disease.

    Science.gov (United States)

    Tkacz, Joseph; Brady, Brenna L; Meyer, Roxanne; Lofland, Jennifer H; Ruetsch, Charles; Coelho-Prabhu, Nayantara

    2015-11-01

    Inflammatory bowel disease (IBD) is a chronic relapsing disease characterized by activation of the mucosal immune system and inflammation of the gastrointestinal tract. Management of IBD places a significant burden on the health care system because of the complexity of treatment, variability in patient outcomes, and chronic nature of the disease.  To investigate the American Gastroenterological Association (AGA) and Crohn's and Colitis Foundation of America's (CCFA) quality measurement sets in a sample of IBD patients. Fourteen quality measures were restated for application to a claims database and calculated using Optum Clinformatics DataMart database. Selected measures were calculated over calendar year 2011. Performance measures ranged from 0.4% for AGA measure 9, prophylaxis for venous thromboembolism, to 66.9% for AGA measure 8, testing for Clostridium difficile. CCFA outcome measures ranged from 0.6% qualifying for CCFA O10, report of fecal incontinence, to 32.9% for CCFA O1, prednisone usage. In addition to Clostridium difficile testing, the use of appropriate corticosteroid-sparing therapy (51.1%) and testing for latent tuberculosis before initiating anti-tumor necrosis factor therapy (45.0%) were the highest achieved measures. This is the first examination of IBD quality measures using administrative claims. Rates of achievement across measures were variable and likely affected by the ability to calculate certain measures with claims data. Future studies should further examine measurement of IBD quality indicators in claims data to assess the validity of claims-based analyses and to ascertain whether measure attainment translates into better overall health or IBD-related outcomes.

  7. Does gender affect career satisfaction and advancement in gastroenterology? Results of an AGA institute-sponsored survey.

    Science.gov (United States)

    Gerson, Lauren B; Twomey, Kay; Hecht, Gail; Lee, Linda; McQuaid, Ken; Pizarro, Theresa T; Street, Sarah; Yoshida, Cynthia; Early, Dayna

    2007-04-01

    Women comprise 19% of the American Gastroenterological Association (AGA) membership. We performed a prospective study to determine whether female gastroenterologists were less likely to achieve career advancement and satisfaction. We administered an online survey to AGA members from 2004-2006. The survey contained questions regarding effects of gender on career advancement, satisfaction with career, promotional policies, and integration of family and career. A total of 457 individuals (response rate 9% after 2 major invitations) completed the survey, including 262 (57%) women (20% in private practice, 53% in academic careers, and 27% trainees) and 195 men (23% in private practice, 58% in academic careers, and 19% trainees). The male gastroenterologists were significantly older (P careers for significantly more years (P = .002). There were no significant differences with respect to marital status, number of children, or number of hours worked between the genders. Men were more likely to achieve the rank of full professor (P = .035), and significantly more women reported that gender affected their career advancement (47% vs 9%; P careers reported less satisfaction with their careers (P = .01) and perceived more difficulty in achieving promotion and tenure. Women were more likely to choose private practice careers because of part-time options (P = .025). Equal numbers of men and women in practice reported difficulty balancing work and family life. Significantly more female than male gastroenterologists perceive that gender has affected their career advancement. Female academic gastroenterologists reported less overall career satisfaction and promotion than male academic gastroenterologists.

  8. Les transformations d'un mythe d'origine L'exemple de Gengis Khan et de Tamerlan

    Directory of Open Access Journals (Sweden)

    Denise Aigle

    2009-05-01

    Full Text Available La figure de Gengis Khan, grand conquérant et fondateur de dynastie, correspond étroitement à la figure du héros. Sa vie est jalonnée des signes d'un destin extraordinaire, en particulier sa naissance présentée comme miraculeuse, dont le récit a été transformé à mesure que ses descendants puis ses épigones s'éloignaient des origines mongoles chamaniques du grand ancêtre. Le récit de la naissance de Gengis Khan se rattache d'abord au mythe d'origine des Mongols qui descendraient de « Loup-bleu » et de « Biche-Fauve », récit lui-même visiblement inspiré du mythe des Turcs. Selon {'Histoire secrète des Mongols, de peu postérieure à la mort de Gengis Khan, l'ancêtre de celui-ci, Alan-Qo'a, veuve, aurait été fécondée par un être « qui sortait en rampant tel un chien jaune ». Ce rôle joué par un animal est conforme au chamanisme, qui repose sur un système d'échange entre le monde animal et celui des humains. Quelques décennies plus tard, le Jàmi' al-tawârikh de Rashïd al-dïn reprend la même légende, mais ne parle que d'un « être de couleur fauve ». Par la suite, les références animales disparaissent totalement dans un contexte musulman complètement détaché des repères chamaniques. Dans la première moitié du XVe siècle, les inscriptions relevées dans le mausolée de Tamerlan, mentionnent un rayon lumineux qui se manifeste sous la forme d'un « mortel accompli " descendant de 'Ali. Dans l'Inde moghole, enfin, Gengis Khan se trouve rapproché de Jésus puisque l'auteur de l'Akbar-nâma écrit que son ancêtre est devenue enceinte de la même manière que Maryam.

  9. Mentoring the modern African surgeon: A call to arms!

    African Journals Online (AJOL)

    2011-01-16

    Jan 16, 2011 ... Hospital, Nairobi, 2-University of Nairobi, Kenya, 3-King Khalid University, UAE. Correspondence: Dr. Miriam Mutebi, Aga Khan. University Hospital. P.O. Bx 30270 .... Galukande M, Kijjambu S, Luboga S Improving recruitment of surgical trainees and training of surgeons in Uganda. East. Cent Afr J Surg.

  10. Investigating Learning Strategies for Vocabulary Development: A Comparative Study of Two Universities of Quetta, Pakistan

    Science.gov (United States)

    Fatima, Irum; Pathan, Zahid Hussain

    2016-01-01

    The primary purpose of this research is to investigate the vocabulary learning strategies employed by the undergraduate students of Sardar Bahadur Khan Women's University (SBKWU) and University of Balochistan (UOB), Quetta, Pakistan. A quantitative design was employed in this study to answer the two research questions of the present study. The…

  11. Universe

    CERN Document Server

    2009-01-01

    The Universe, is one book in the Britannica Illustrated Science Library Series that is correlated to the science curriculum in grades 5-8. The Britannica Illustrated Science Library is a visually compelling set that covers earth science, life science, and physical science in 16 volumes.  Created for ages 10 and up, each volume provides an overview on a subject and thoroughly explains it through detailed and powerful graphics-more than 1,000 per volume-that turn complex subjects into information that students can grasp.  Each volume contains a glossary with full definitions for vocabulary help and an index.

  12. Andiroxylon Thanobolensis Sp.Nov. A New Species of Fossil Wood of Family Fabaceae from Manchar Formation Exposed Near Thanobola Khan, District Jamshoro, Sindh, Pakistan

    International Nuclear Information System (INIS)

    Khan, S. A.; Ahmed, B.; Tahir, S. S.

    2016-01-01

    Andiroxylon thanobolensis sp. nov., a new silicified wood has been described and identified from Tertiary Manchar formation exposed near Thanobola Khan, district Jamshoro, Sindh, Pakistan. The xylotomical features of present fossil shows close resemblance with the genus Andira of the Family Fabaceae. The absence of growth ring indicated that plants were growing in tropical type of climate. (author)

  13. The Early Khans of Crimea: the Chronology of the Turmoil in the Ac-counts of the Genoese Treasury of Caffa, 1420s

    Directory of Open Access Journals (Sweden)

    A.L. Ponomarev

    2013-11-01

    Full Text Available Four account books of the Genoese colony in Caffa kept in 1420–1426 by its treasurers (massarii are still unpublished as a whole. Almost four hundreds records in these manuscripts deal with the Tartar-Genoese relations and the political situation in Crimea. Combined with the numismatic data and evidences from chronicles and state correspondence they let the author to ascertain up to weeks and days the chronology of khans’ reign. After the death of the first Crimean khan Bek Sufi in 1421 his brother Dawlat Berdi (the kinship became evident from these records struggled for power with his cousin Ulugh Muhammed, khan of the Golden Horde, for six years and climbed to the Solhat throne four times. The newly obtained information proves that neither Bek Sufi nor Dawlat Berdi, cannot be treated as the khans of the Golden Horde. They were two of the first members of the Tukatimurid dynasty which came to power in Crimea. The separatism and the might of the Crimean tribal beks were a real reason and basis for forming this independent khanate. The same beks reestablished the dynasty in 1441 having invited to the throne Haji Giray, nephew of both khans, who gave his name to the dynasty of the state, established in 1419. It was necessary to use original Latin texts to understand the history that accompaied the research.

  14. The German Working Group of Obesity in Childhood and Adolescence (AGA): improving the quality of care for overweight and obese children in Germany.

    Science.gov (United States)

    Reinehr, Thomas; Holl, Reinhard W; Wabitsch, Martin

    2008-01-01

    The Working Group of Obesity in Childhood and Adolescence (AGA) comprises scientists, clinicians, and therapists dealing with obesity in children and adolescents. More than 250 pediatricians, psychiatrics, dieticians, psychologists and sports therapists are integrated. On an international level, the AGA cooperates with the European Childhood Obesity Group and the International Obesity Taskforce (IOTF) for Childhood Obesity. The aims of the AGA are to initiate clinical and scientific studies, to join diagnostic, therapeutic and scientific centers, to improve the education, to support self-help groups, and to standardize diagnostic and therapeutic procedures in the field of obesity in childhood and adolescence. The milestones in the history of the AGA are the consensus process to define overweight and obesity in Germany, the development of guidelines for diagnostic procedures and treatment of obesity in childhood and adolescence, the determination of all therapy centers for obese children and adolescents in Germany, the development of a PC software (APV) to document longitudinally diagnostic and therapeutic procedures as well as outcomes by a quality management program, the certification of therapeutic institutions, and the implementation of prevention and treatment studies. As effect of these initiatives, the quality of care in overweight children has been improved in the last years. For example, the APV quality program demonstrated an increase of diagnostic procedures such as blood pressure measurement in the last 4 years. Copyright 2008 S. Karger AG, Basel.

  15. Studies on Plant Population and Stand Establishment Techniques for Increasing Productivity of Rice in Dera Ismail Khan, Pakistan

    Directory of Open Access Journals (Sweden)

    Mohammad Safdar BALOCH

    2007-06-01

    Full Text Available Rice production in Pakistan is constraint by many factors pertaining to prevalent planting techniques. A research on the feasibility of new planting techniques (direct seeding on flat, transplanting on flat, direct seeding on ridges, transplanting on ridges and parachute planting in transplanted and direct wet-seeded rice was undertaken at Dera Ismail Khan region of Pakistan's North West Frontier Province during 2002 and 2003. Among the planting techniques, the best performance for the yield formation and economic evaluation was noted for transplanting on flat during both years. Chinese parachute planting technology also showed very promising results in most of the parameters. Direct seeding on ridges could not excel transplanting on flat and parachute planting during both cropping seasons. The findings concluded the feasibility of parachute planting technology along with traditional rice transplanting on flat over all other planting techniques being practiced in the area.

  16. Genotype-by-sowing date interaction effects on cotton yield and quality in irrigated condition of dera ismail khan, pakistan

    International Nuclear Information System (INIS)

    Usman, K.; Khan, S.; Ayatullah, A.

    2016-01-01

    Cotton is a major export commodity of Pakistan. It is affected by variable environmental conditions throughout the country which limits its production. A 2-year field study was conducted in 2012 and 2013 at Cotton Research Station, Dera Ismail Khan, Pakistan to evaluate the effects of six sowing dates on yield and quality attributes of four cotton genotypes. The experiments were laid out in split-plot within a randomized complete block design with three replications. Main plots treatments were six sowing dates, namely March 20, April 4, April 19, May 4, May 19, and June 3 while subplots treatments were four approved transgenic varieties of cotton (CIM-598, CIM-599, CIM-602, and Ali Akber-703). Results revealed that earlier planting produced more vegetative growth rather than lint yield while late planting induced flowering and boll formation when temperature was much cold that adversely affected cotton yield and quality. The results further indicate that the genotype CIM-599 scored first rank in number of bolls plant-1, boll weight, seed cotton yield, ginning out turn, fiber length, fiber strength, fiber fineness, and fiber uniformity when sown on April 19. CIM-598 was the next suitable genotype after CIM-599 which produced higher yield and quality traits in April 19 sowing. Earlier and later sowing than April 19 resulted in lower cotton yield and quality characters due to unfavorable environmental conditions and shorter growth period, respectively. Thus it is concluded that the genotype, CIM-599 sown on April 19 suits well to the study area and had the potential to optimize cotton yield and quality in irrigated condition of Dera Ismail Khan, Pakistan. (author)

  17. Neoplasia yield and colonoscopic workload of surveillance regimes for colorectal cancer in colitis patients: a retrospective study comparing the performance of the updated AGA and BSG guidelines.

    Science.gov (United States)

    Mooiweer, Erik; van der Meulen, Andrea E; van Bodegraven, Adriaan A; Jansen, Jeroen M; Mahmmod, Nofel; Nijsten, Joyce; van Oijen, Martijn G H; Siersema, Peter D; Oldenburg, Bas

    2013-11-01

    Due to the increased risk of colorectal cancer, colonoscopic surveillance is recommended for patients with ulcerative and Crohn's colitis. Because surveillance intervals differ considerably between the recently updated American Gastroenterological Association (AGA) and British Society of Gastroenterology (BSG) guidelines, we compared the neoplasia yield and colonoscopic workload of these guidelines. Patients with inflammatory bowel disease undergoing surveillance were identified using medical records. Patients were stratified according to the BSG and AGA guidelines, and corresponding colonoscopic workload was calculated based on the risk factors present during follow-up. The incidence of colitis-associated neoplasia (CAN), defined as a low-grade dysplasia in flat mucosa or a non-adenoma-like mass, high-grade dysplasia, or colorectal cancer was compared between the risk groups of either guidelines. In total, 1018 patients with inflammatory bowel disease who underwent surveillance were identified. Using the AGA surveillance intervals, 64 patients (6%) were assigned to annual and 954 patients (94%) to biannual surveillance, resulting in 541 colonoscopies per year. The yield of CAN was 5.3% and 20.3% in the low- and high-risk groups, respectively (P = 0.02). Using the BSG surveillance intervals, 204 patients received surveillance annually (20%), 393 patients every 3 years (39%), and 421 patients every 5 years (41%), resulting in 420 colonoscopies per year, which is 22% lower than the AGA guidelines. The yield of CAN was 3.6%, 6.9%, and 10.8%, for the low-, intermediate-, and high-risk groups, respectively (P = 0.26). Although the BSG surveillance intervals offer the advantage of a lower colonoscopic workload, the risk stratification of the AGA seems superior in distinguishing patients at higher risk of CAN.

  18. Derin Paşaoǧlu D. Genealogy of the Crimean Khans according to “Umdet al-Akhbar” by Abdulgaffar Kyrymi

    Directory of Open Access Journals (Sweden)

    Derya Derin Paşaoǧlu

    2017-03-01

    Full Text Available The article considers the genealogy of the Girayids contained in “Umdet al-Akhbar” by Abdulgaffar Kyrymi. Abdulgaffar Kyrymi was a great connoisseur of the Turkic-Tatar history. He wrote his historical work in 1747 according to the Ottoman-Turkish tradition, that is, the author gave detailed information about the history of the prophets since Adam, the history of Islam, Islamic Turkic states, the State of Seljuks and the Ottoman State, Chinggis Khan and his sons. Moreover, he collected most of the information from local sources of that period. But the main part of the work contains the history of Juchi Khan, his children and the history of the Crimea. It is for this reason that Abdulgaffar Kyrymi gives such a detailed genealogy of the Girayids and the sequence of their rules in the Crimean Khanate. Abdulgaffar Kyrymi’s genealogy begins with Chinggis Khan and his daughters (Kuchi Bike, Chechgan Bigim, Tumalyn Bigim, Elyatun Bigim, Turaly Bigim as well as with his 500 wives. But only five of them were respected: Borte Kuchin Biim, Kulan Bigim, Suyugan Khatun Bigim, Kökchi Bigim, Jeksulu Bigim. List of the Crimean dynasty of the Girayids is offered here to specialists, beginning with Haji Giray to Arslan Giray. Comparison of the list of the Girayid khans contained in “Umdet al-Akhbar” with researches on this topic reveals some differences. In the opinion of the author, to solve these problems, along with genealogical and other narrative sources, it is also necessary to use the numismatics data and a large corpus of letters of the Crimean khans to the rulers of various countries.

  19. Mobile Sensor System AGaMon for Breath Control: Numerical Signal Analysis of Ternary Gas Mixtures and First Field Tests

    Directory of Open Access Journals (Sweden)

    Rolf Seifert

    2018-01-01

    Full Text Available An innovative mobile sensor system for breath control in the exhaled air is introduced. In this paper, the application of alcohol control in the exhaled air is considered. This sensor system operates semiconducting gas sensor elements with respect to the application in a thermo-cyclic operation mode. This operation mode leads to so-called conductance-over-time-profiles (CTPs, which are fingerprints of the gas mixture under consideration and can be used for substance identification and concentration determination. Especially for the alcohol control in the exhaled air, ethanol is the leading gas component to be investigated. But, there are also other interfering gas components in the exhaled air, like H2 and acetone, which may influence the measurement results. Therefore, a ternary ethanol-H2-acetone gas mixture was investigated. The establishing of the mathematical calibration model and the data analysis was performed with a newly developed innovative calibration and evaluation procedure called ProSens 3.0. The analysis of ternary ethanol-H2-acetone gas samples with ProSens 3.0 shows a very good substance identification performance and a very good concentration determination of the leading ethanol component. The relative analysis errors for the leading component ethanol were in all considered samples less than 9 %. First field test performed with the sensor system AGaMon shows very promising results.

  20. Ureteric injuries following laparoscopic hysterectomy: A report of ...

    African Journals Online (AJOL)

    The incidence of ureteric injuries following hysterectomy varies. Raut et al in 1991 documented 12 ureteric injuries (1.34%) following 892 gynaecological procedures (2) while Nawaz et al reported a rate of 0.6% following gynaecological procedures over a 20 year period at the Aga Khan University Hospital,. Karachi (2).

  1. Single voxel magnetic resonance spectroscopy in distinguishing ...

    African Journals Online (AJOL)

    Objective: Assess diagnostic utility of combined magnetic resonance imaging and magnetic resonance spectroscopy (MRI, MRS) in differentiating focal neoplastic lesions from focal non- neoplastic (infective or degenerative) brain lesions. Design: Descriptive, analytical - prospective study. Setting: The Aga Khan University ...

  2. Author Details

    African Journals Online (AJOL)

    Incidence of post dural puncture headache following Caesarean section under spinal anaesthesia at the Aga Khan University Hospital, Nairobi Abstract PDF · Vol 87, No 8 (2010) - Articles Conformity to the Surviving Sepsis Campaign International Guidelines among Physicians in a general Inensive care unit in Nairobi

  3. Enzymatic liquefaction of agarose above the sol-gel transition temperature using a thermostable endo-type β-agarase, Aga16B.

    Science.gov (United States)

    Kim, Jung Hyun; Yun, Eun Ju; Seo, Nari; Yu, Sora; Kim, Dong Hyun; Cho, Kyung Mun; An, Hyun Joo; Kim, Jae-Han; Choi, In-Geol; Kim, Kyoung Heon

    2017-02-01

    The main carbohydrate of red macroalgae is agarose, a heterogeneous polysaccharide composed of D-galactose and 3,6-anhydro-L-galactose. When saccharifying agarose by enzymes, the unique physical properties of agarose, namely the sol-gel transition and the near-insolubility of agarose in water, limit the accessibility of agarose to the enzymes. Due to the lower accessibility of agarose to enzymes in the gel state than to the sol state, it is important to prevent the sol-gel transition by performing the enzymatic liquefaction of agarose at a temperature higher than the sol-gel transition temperature of agarose. In this study, a thermostable endo-type β-agarase, Aga16B, originating from Saccharophagus degradans 2-40 T , was characterized and introduced in the liquefaction process. Aga16B was thermostable up to 50 °C and depolymerized agarose mainly into neoagarooligosaccharides with degrees of polymerization 4 and 6. Aga16B was applied to enzymatic liquefaction of agarose at 45 °C, which was above the sol-gel transition temperature of 1 % (w/v) agarose (∼35 °C) when cooling agarose. This is the first systematic demonstration of enzymatic liquefaction of agarose, enabled by determining the sol-gel temperature of agarose under specific conditions and by characterizing the thermostability of an endo-type β-agarase.

  4. MEASUREMENT OF RADON EXHALATION RATE, RADIUM ACTIVITY AND ANNUAL EFFECTIVE DOSE FROM BRICKS AND CEMENT SAMPLES COLLECTED FROM DERA ISMAIL KHAN

    OpenAIRE

    Nisar Ahmad; Mohamad Suhaimi Jaafar; Sohail Aziz Khan; Tabassum Nasir; Sajjad Ahmad; Muhammad Rahim

    2014-01-01

    Radon concentration, exhalation rate, radium activity and annual effective dose have been measured from baked and unbaked bricks and cement samples commonly used as construction material in the dwellings of Dera Ismail Khan City, Pakistan. CR-39 based NRPB radon dosimeters and RAD7 have been used as passive and active devises. The values of radon concentration for baked, unbaked bricks and cements obtained from passive and active techniques were found in good agreement. Average values of rado...

  5. Microbial contamination of the drinking water distribution system and its impact on human health in Khan Yunis Governorate, Gaza Strip: seven years of monitoring (2000-2006).

    Science.gov (United States)

    Abu Amr, S S; Yassin, M M

    2008-11-01

    To assess total and faecal coliform contamination in water wells and distribution networks over the past 7 years, and their association with human health in Khan Yunis Governorate, Gaza Strip. Historical data and interview questionnaire. Data were obtained from the Palestinian Ministry of Health on total and faecal coliform contamination in water wells and distribution networks, and on the incidence of water-related diseases in Khan Yunis Governorate. An interview questionnaire was conducted with 210 residents of Khan Yunis Governorate. Total and faecal coliform contamination exceeded the World Health Organization's limit for water wells and networks. However, the contamination percentages were higher in networks than in wells. Diarrhoeal diseases were strongly correlated with faecal coliform contamination in water networks (r=0.98). This is consistent with the finding that diarrhoeal diseases were the most common self-reported diseases among the interviewees. Such diseases were more prevalent among subjects who drank municipal water than subjects who drank desalinated or home-filtered water (odds ratio=2.03). Intermittent water supply, insufficient chlorination and sewage flooding seem to be associated with self-reported diseases. Residents in the Gaza Strip have a good level of knowledge about drinking water contamination, and this is reflected in good practice. Water quality has deteriorated in the Gaza Strip, and this may contribute to the prevalence of water-related diseases. Self-reported diseases among interviewees in Khan Yunis Governorate were associated with source of drinking water, intermittent water supply, insufficient chlorination, sewage flooding and age of water networks.

  6. Pesticides in shallow groundwater of Bahawalnagar, Muzafargarh, D.G. Khan and Rajan Pur districts of Punjab, Pakistan.

    Science.gov (United States)

    Tariq, Muhammad Ilyas; Afzal, Shahzad; Hussain, Ishtiaq

    2004-06-01

    In Pakistan there is little data on environmental contamination of rural water sources by pesticides. This study evaluated pesticide contamination of groundwater in four intensive cotton growing districts. Water samples were collected from 37 rural open wells in the areas of Bahwalnagar, Muzafargarh, D.G. Khan and Rajan Pur districts of Punjab and analysed for eight pesticides which are mostly used. Information on types of pesticide used and distance to nearest pesticide mixing area and application areas was obtained for each site. From the eight pesticides analysed, six pesticides were detected in the water samples. Only cypermethrin and cabosulfan were not detected. The percentage of detection of bifenthrin, lambda-cyhalothrin, carbofuran, endosulfan, methyl parathion and monocrotophos was, respectively 13.5%, 5.4%, 59.4%, 8%, 5.4% and 35.1% in July; 16.2%, 13.55%, 43.2%, 8%, N.D. (not detected) and 24.3% in October. Maximum contamination levels (MCLs) established by the U.S. Environmental Protection Agency for drinking water were not exceeded. The study has shown the need for monitoring pesticide contamination in rural water resources, and the development of drinking water quality standards for specific pesticides in Pakistan. The conclusions and recommendations will be disseminated to senior decision makers in central and local governments, extension agents and farmers.

  7. Investigating Potential Artesian Aquifers in Rod-Kohi Area of DI Khan, NWFP using GIS and Geo-Processing Techniques

    Directory of Open Access Journals (Sweden)

    Arshad Ashraf

    2012-07-01

    Full Text Available The artesian aquifers provide economical and sustainable source of groundwater for irrigation and domestic use. GIS (Geographic Information System was used for development and integration of spatial databases, analysis and visualization of spatial data in two- and three-dimensional views. The aquifer system of Daraban Rod-Kohi area of DI Khan was analyzed to identify potential artesian aquifers using geological sections of the observation wells representing detail of subsurface lithology and strata encountered. According to an estimate, about 1,700 million m3 of extractable volume of groundwater exists in this part of rod-kohi area. Different profile sections were drawn to analyze the subsurface condition of the study area using Rockworks GIS-based software. The geo-processing technique of horizontal litho-blending was utilized for lithological modeling. Based on stratigraphic information of the area, three distinct aquifers were identified down to a depth of about 200 meters among which two are semi-confined to confined having prospects of artesian water. The 2D and 3D analysis show that characteristics of the confined aquifers vary spatially with the subsurface lithology and structural setup of the area. The depth range of confined layer-1 is found between 118 and 133 meters while of confined layer-2 between 182 and 195 meters. The output data indicated a close agreement with the observed data of the artesian wells. The study results can provide base for detail investigation of artesian resource and selection of potential sites for installation of artesian wells in the target area.

  8. Measurement of waterborne radon in the drinking water of the Dera Ismail Khan city using active and passive techniques

    Directory of Open Access Journals (Sweden)

    Nasir Tabassum

    2015-01-01

    Full Text Available Groundwater is considered to be the second largest contributor to the indoor radon concentration after soil. Therefore, measurement of waterborne radon has remained a point of interest for many researchers. The main objective of this study is to study waterborne radon activity in the city of Dera Ismail Khan. In this context, water samples were collected from different locations of the city and waterborne radon was measured using a pylon vacuum water degassing system and CR-39 based radon detectors. The pylon system measured waterborne radon activities in samples of hand pumps and motor driven pumps varying from 0.015 to 0.066 Bq/L and 0.021 to 0.145 Bq/L with average values of 0.041 ± 0.015 Bq/L and 0.076 ± 0.024 Bq/L, respectively. Whereas CR-39 based measured values ranged from 0.042 to 0.125 Bq/L and 0.075 to 0.158 Bq/L with average values of 0.081 ± 0.021 Bq/L and 0.120 ± 0.020 Bq/L, respectively. The estimated average annual effective dose due to ingestion of radon from drinking water using pylon and CR-39 based radon detectors for hand and motor pump samples was found to be 1.055×10-4 mSv and 1.947×10-4 mSv, and 2.067×10-4 mSv and 3.058×10-4 mSv, respectively. The waterborne radon concentrations and as a result the annual effective dose expected to be received from it are within the recommended safe limits.

  9. Water-right and water-allocation procedures of farmers' managed perennial spate irrigation systems of mithawan watershed, D.G. Khan, Pakistan

    International Nuclear Information System (INIS)

    Ahmad, M.; Ahmad, S.

    2007-01-01

    A study was conducted on water rights, water allocation and local institutions prevailing in the perennial spate irrigation systems of Mithawan watershed o D.G. Khan District of Punjab. The Study Area was selected is the Mthawan watershed on the D.G. Khan-Quetta Road almost 70 kms from D.G. Khan and 10 km away from the road, representing real-life operating systems. Small-scale isolated and large-scale contiguous perennial spate irrigation systems were selected for study. A three-prong methodology was designed covering (a) interactive dialogue of the focus groups to document the community-perceptions regarding systems water-rights, water allocation and local institution prevailing in the area; (b) structured interviews to document systematic data regarding some of the study-aspects; and (c) diagnostic surveys to document some of the measured data regarding scheme performance. Water rights and allocation procedures both in small-scale isolated and large-scale Contiguous perennial spate irrigation-system are very clearly defined and do not change with time and space. Local institutions like Biradri and Muchi take care of just allocation of water. An irrigator is deputed who takes care of allocated time among various tribes. At the same time, the community is bringing more area under irrigation. Obviously it has increased water-requirements and in turn management of irrigation system. Previously they were reconstructing the diversion structure only. Present expansion in irrigated area has increased the necessity of maintaining the water-conveyance network more frequently, particularly at critical sections. However, the realization regarding water-losses still needs to be promoted. The linkages of resource-management with water-productivity are going to be the future area of consideration in theses systems, due to expansion of the system largely because of increased population and urge to increase their livelihood. (author)

  10. The Math of Khan

    Science.gov (United States)

    Schaffhauser, Dian

    2013-01-01

    It's like a dream come true for educators: free resources available wherever a web browser can operate and with nary an iota of advertising. What's not to like? What is it about this organization, whose mission is "to provide a free, world-class education for anyone anywhere," that has provoked such vitriol? Part of it is that when its videos have…

  11. Evaluation of lipid and glucose metabolism and cortisol and thyroid hormone levels in obese appropriate for gestational age (AGA) born and non-obese small for gestational age (SGA) born prepubertal Slovak children.

    Science.gov (United States)

    Blusková, Zuzana; Koštálová, Ludmila; Celec, Peter; Vitáriušová, Eva; Pribilincová, Zuzana; Maršálková, Marianna; Šemberová, Jana; Kyselová, Tatiana; Hlavatá, Anna; Kovács, László

    2014-07-01

    Obesity is the major determinant of metabolic syndrome. Being born small for gestational age (SGA) may be co-responsible. We aimed at evaluating the association between 1. obesity and 2. being born SGA and the presence of endocrine-metabolic abnormalities in prepubertal Slovak children. The study included 98 children, aged 3-10.9 years: 36 AGA-born obese children (OB), 31 SGA-born children (SGA) and 31 appropriate for gestational age born non-obese children (AGA). Fasting serum levels of glucose, total cholesterol, LDL, HDL, triglycerides, fT4, TSH, cortisol and insulin were determined. HOMA-IR was calculated. Personal data about birth weight and length and family history were collected. Actual anthropometric measurement was done. In every group, high prevalence of positive family history of metabolic disorder was found. In comparison with AGA children, OB children were taller (plevels and homeostasis model assessment for insulin resistance (HOMA-IR) (pcortisol levels (p=0.069) was noted. SGA-born children were shorter (plevels (plevels (p=0.085) and increased fT4 levels (pobese children and twice more metabolic abnormalities were present in SGA-born children in comparison with AGA-born children. SGA-born children are more prone to developing endocrine-metabolic abnormalities than non-obese children born AGA, but they are at less risk than obese AGA-born children. We should provide specialized care for obese children already in prepubertal age and pay attention to SGA-born children.

  12. Validation of the Arabic Version of the Group Personality Projective Test among university students in Bahrain.

    Science.gov (United States)

    Al-Musawi, Nu'man M

    2003-04-01

    Using confirmatory factor analytic techniques on data generated from 200 students enrolled at the University of Bahrain, we obtained some construct validity and reliability data for the Arabic Version of the 1961 Group Personality Projective Test by Cassel and Khan. In contrast to the 5-factor model proposed for the Group Personality Projective Test, a 6-factor solution appeared justified for the Arabic Version of this test, suggesting some variance between the cultural groups in the United States and in Bahrain.

  13. Review of the Monograph: Seleznev Yu.V. Russkie knyaz’ya pri dvore khanov Zolotoy Ordy (Russian Princes at the Court of the Golden Horde Khans

    Directory of Open Access Journals (Sweden)

    Nesin M.A.

    2017-12-01

    Full Text Available This article contains a review of the monograph by Yu.V. Seleznev published in early 2017 and dedicated to the relations of Russian princes with the Golden Horde’s khans and their status among the Golden Horde’s nobility. This work is the first comprehensive study in the historiography of this issue for all two and a half centuries of the Tartar domination. The monograph was published for the first time in 2013 and served as the basis for a doctoral dissertation, which Seleznev defended in 2015. The book was reprinted with certain changes in 2017. The book commendably contains an abundance of factual material through the use of diverse sources and strands of historiography. Seleznev examines the social terminology of Golden Horde-Russian relations, the structure of the Golden Horde’s nobility and the trips of princes to the Horde, drawing attention not only to the status of the great Vladimir and Moscow princes, but also that of other great and appanage princes. He makes a significant contribution to the resolving the debate regarding the nature of the Golden Horde’s domination in Rus’ by examining in detail the relationship of the Russian princes with the Golden Horde’s authorities in different years. The book’s author proposed to divide the Golden Horde’s “yoke” into seven periods characterized by “changes in the degree of sovereignty and jurisdiction of the khan in relation to Russian principalities”. The author of this review agrees with the main conclusions of the book under review, but at the same time he notes some reservations and criticisms, which do not, however, reduce the academic caliber of the monograph.

  14. BIBLIOMETRICS ON ONE OF THE LARGEST TERMITE INVENTORIES IN THE CERRADO: "STUDIES ON TERMITES FROM THE MATO GROSSO STATE, BRAZIL BY AGA MATHEWS 1977"

    Directory of Open Access Journals (Sweden)

    HÉLIDA FERREIRA DA CUNHA

    2015-01-01

    Full Text Available ABSTRACT This paper consists on a bibliometric analysis of the international influences of the book "Studies on termites from the Mato Grosso State, Brazil", by AGA Mathews (1977. The number of citations has increased over the years after the first citation. Mathews book was cited in articles, reviews, theses, dissertations, books, book chapters, abstracts in conference proceedings, comments and scientific notes. Most these studies are empirical and descriptive. The studies were conducted in 35 countries of the Neotropical, Palearctic, Afrotropical, Nearctic, Australasia and Indomalaya regions. 55% of the studies were carried out in Brazil. The journals Sociobiology and Insectes Sociaux, have social insect studies within its scope, and the highest number of articles citing Mathews. Most of the 71 authors that cited Mathews more than twice are Brazilian. Constrictotermes cyphergaster was the most studied in over 80% of the studies addressing Isoptera. The most frequent keywords were termite, Isoptera and taxonomy, generalist terms indexed in most publications carried out in different countries. Most of the research studies were carried out in laboratories and native vegetation areas. Studies in agroecosystems were implemented predominantly in Brazil. This study shows the diversity of application (citations of Mathews' book, and that the number of citations will continue to increase due to the large amount of information presented by the author.

  15. Clinical Practice Update: The Use of Per-Oral Endoscopic Myotomy in Achalasia: Expert Review and Best Practice Advice From the AGA Institute.

    Science.gov (United States)

    Kahrilas, Peter J; Katzka, David; Richter, Joel E

    2017-11-01

    The purpose of this review is to describe a place for per-oral endoscopic myotomy (POEM) among the currently available robust treatments for achalasia. The recommendations outlined in this review are based on expert opinion and on relevant publications from PubMed and EMbase. The Clinical Practice Updates Committee of the American Gastroenterological Association proposes the following recommendations: 1) in determining the need for achalasia therapy, patient-specific parameters (Chicago Classification subtype, comorbidities, early vs late disease, primary or secondary causes) should be considered along with published efficacy data; 2) given the complexity of this procedure, POEM should be performed by experienced physicians in high-volume centers because an estimated 20-40 procedures are needed to achieve competence; 3) if the expertise is available, POEM should be considered as primary therapy for type III achalasia; 4) if the expertise is available, POEM should be considered as treatment option comparable with laparoscopic Heller myotomy for any of the achalasia syndromes; and 5) post-POEM patients should be considered high risk to develop reflux esophagitis and advised of the management considerations (potential indefinite proton pump inhibitor therapy and/or surveillance endoscopy) of this before undergoing the procedure. Copyright © 2017 AGA Institute. Published by Elsevier Inc. All rights reserved.

  16. Critique of An Analysis of the Blast Overpressure Study Data Comparing Three Exposure Criteria, by Murphy, Khan, and Shaw

    Science.gov (United States)

    2010-08-01

    actual determination of a risk threshold and (2) the article has laid the groundwork for such a determination. These statements misrepresent what...applied as a limit. This is a small point, but one that pervades the article and leads the authors to miss their main finding— namely, that an LAEQ8 of...WESTERN MICHIGAN UNIVERSITY G A FLAMME ASSOCIATE PROFESSOR DEPARTMENT OF SPEECH PATHOLOGY AND AUDIOLOGY 1903 W MICHIGAN AVE

  17. Erratum: Erratum to: "New Data on the Age and Nature of the Khan-Bogd Alkaline Granites, Mongolia"

    Science.gov (United States)

    Gerdes, A.; Kogarko, L. N.; Vladykin, N. V.

    2018-01-01

    The list of authors and their affiliations should read as follows: A. Gerdes a , Academician L. N. Kogarko b,*, and N. V. Vladykin c a Institute of Earth Sciences, Goethe University, Frankfurt, Germany b Vernadsky Institute of Geochemistry and Analytical Chemistry, Russian Academy of Sciences, Moscow, 119991 Russia c Vinogradov Institute of Geochemistry, Siberian Branch, Russian Academy of Sciences, Irkutsk, 664033 Russia * e-mail: kogarko@geochi.ru

  18. Maslyuzhenko D.N. Turko-Mongol Traditions in the “State of Nomadic Uzbeks” of Abu al-Khair Khan

    Directory of Open Access Journals (Sweden)

    D.N. Maslyuzhenko

    2014-09-01

    Full Text Available The author of this article identifies the daily and political traditions in the Khanate of Abu al-Khair, which researchers traditionally call the “State of nomadic Uzbeks”. This State was created in the south of Western Siberia in the 1430’s and annexed by military means to the land of Shiban’s (the younger brother of Batu descendants. The overwhelming majority of researchers consider it as a Muslim State since its very foundation, substantiating their allegations by indication both on the reading of khutba in honor of Khan after he took the “throne of Sain Khan” and on the presence of the sheikhs and Sufis in his entourage. At the same time, the authority of Abu al-Khair had the strong support of nomadic elite of more than twenty tribes. Precisely this elite, its inquiries and interests, which were advocated on the nobility councils, formed the existing political and daily traditions. These traditions reflect the preservation of Turko-Mongol customs among nomadic populations. We can find analogies of these practices in the earlier customs among the precursors of post-Golden Horde State, i.e., in the Mongol Empire and the ulus of Jochi. Traditions of the Abu al-Khair’s Khanate represented a phenomenon of cultural inertia, which were restored in the conditions of Islamization and could become the adats. This effect is particularly significant in view of the specific attitude of Sufi tariqats to the phenomena of social life. In political terms, of particular importance among these was the restoration of the Toy and the related kurultay that could take place in accordance with the existing steppe (animals calendar. The khans restored the ritual of robes and belts’ distribution as the main mechanism for redeployment of posts and responsibilities among the steppe aristocracy. Military tradition was also focused on samples of the previous time, which was particularly manifested in the selection of wings and avant-garde. In the course

  19. Writeshops: An effective tool to enable African academics to publish

    CSIR Research Space (South Africa)

    Vincent, K

    2012-08-01

    Full Text Available -1 Writeshops: An effective tool to enable African academics to publish Vincent*, K., T. Cull, (Kulima Integrated Development Solutions, South Africa) E. Archer van Garderen, (CSIR, South Africa) and A. Awiti, (Aga Khan University, Kenya) * Corresponding... Seipt, Lisa Schipper and Richard J. T. Klein for their commitment to writeshops, and for various discussions on improving the accessibility of developing country researchers to the peer-reviewed literature. ...

  20. THE TURKIC WORLD OF THE RUSSIAN WRITER: “LEGEND ABOUT THE SIBERIAN KHAN, OLD KUCHUM” BY D. N. MAMIN-SIBIRYAK

    Directory of Open Access Journals (Sweden)

    Valentina I. Gabdullina

    2017-06-01

    Full Text Available The article studies the special aspects of the author’s conception of the East and the principles of the reconstruction of the way of life and mentality of the Turks in “Eastern legends” by D. N. Mamin-Sibiryak within the context of the general interest the Russian literature of the turn of the 19th and 20th centuries experienced toward orientalism. Based on the “Legend of the Siberian Khan, Old Kuchum” the process of evolution of the poetic stylization into an individual and author’s version of the genre form is analyzed, as a result of comprehension, aesthetic mastering and the embodiment of the culture of another nation, folkloristic and mythological figurativeness in the artistic text of the Russian writer. In the “Legend…” there is clearly seen the aspiration of the author to show life of the nomadic people “internally”, to look beyond the existing estimative stereotypes about Siberian peoples set in the perception of the Russian in the period of the conquest of Siberia by the troops of the Russian Tsar with ataman Yermak at the head. For the purpose of a comparative analysis the annalistic sources are used (the Esipovsky chronicle. The research is conducted from the perspective of cultural and historical, imagological and motive approaches.

  1. Evaluation of radon induced lung cancer risk in occupants of the old and new dwellings of the Dera Ismail Khan City, Pakistan

    International Nuclear Information System (INIS)

    Tabassum Nasir; Muhammad Khalil; Naveed Anwar; Matiullah; Muhammad Rafique; Saeed Ur Rahman

    2014-01-01

    In order to carry out indoor radon measurement in new and old buildings of the Dera Ismail Khan city, CR-39 based radon detectors were installed in bed rooms and sitting rooms/TV lounges in 25 (each) old and new houses and were exposed to indoor radon for 90 days. After processing, mean weighted average indoor radon concentrations in old and new houses were found to be 275 ± 33 and 86 ± 18 Bq m -3 whereas mean annual effective doses expected to be received by the occupants were 6.86 ± 0.79 and 2.1 ± 0.43 mSv year -1 , respectively. From the measured weighted average indoor radon concentration, excess relative risk factor was calculated using the risk model of BEIR VI for the age group of 35 and 55 years. Average excess lung cancer risk was found to be 1.63 ± 0.19 and 1.35 ± 0.16 and 0.5 ± 0.10 and 0.4 ± 0.08 for old and new houses, respectively. (author)

  2. Evaluation of radon induced lung cancer risk in occupants of the old and new dwellings of the Dera Ismail Khan City, Pakistan

    Energy Technology Data Exchange (ETDEWEB)

    Nasir, Tabassum; Khalil, Muhammad; Anwar, Naveed [Gomal University, Dera Ismail Khan (Pakistan). Department of Physics; Matiullah, [PINSTECH, Islamabad (Pakistan). Directorate of Systems and Services; Rafique, Muhammad [University of Azad Jammu and Kashmir, Azad Kashmir (Pakistan). Department of Physics; Rahman, Saeed Ur [Nuclear Medicine, Oncology and Radiotherapy Institute, Islamabad (Pakistan). Department of Medical Physics

    2014-06-15

    In order to carry out indoor radon measurement in new and old buildings of the Dera Ismail Khan city, CR-39 based radon detectors were installed in bed rooms and sitting rooms/TV lounges in 25 (each) old and new houses and were exposed to indoor radon for 90 days. After processing, mean weighted average indoor radon concentrations in old and new houses were found to be 275 ± 33 and 86 ± 18 Bq m{sup -3} whereas mean annual effective doses expected to be received by the occupants were 6.86 ± 0.79 and 2.1 ± 0.43 mSv year{sup -1}, respectively. From the measured weighted average indoor radon concentration, excess relative risk factor was calculated using the risk model of BEIR VI for the age group of 35 and 55 years. Average excess lung cancer risk was found to be 1.63 ± 0.19 and 1.35 ± 0.16 and 0.5 ± 0.10 and 0.4 ± 0.08 for old and new houses, respectively. (author)

  3. Management of Clostridium difficile Infection in Inflammatory Bowel Disease: Expert Review from the Clinical Practice Updates Committee of the AGA Institute.

    Science.gov (United States)

    Khanna, Sahil; Shin, Andrea; Kelly, Ciarán P

    2017-02-01

    The purpose of this expert review is to synthesize the existing evidence on the management of Clostridium difficile infection in patients with underlying inflammatory bowel disease. The evidence reviewed in this article is a summation of relevant scientific publications, expert opinion statements, and current practice guidelines. This review is a summary of expert opinion in the field without a formal systematic review of evidence. Best Practice Advice 1: Clinicians should test patients who present with a flare of underlying inflammatory bowel disease for Clostridium difficile infection. Best Practice Advice 2: Clinicians should screen for recurrent C difficile infection if diarrhea or other symptoms of colitis persist or return after antibiotic treatment for C difficile infection. Best Practice Advice 3: Clinicians should consider treating C difficile infection in inflammatory bowel disease patients with vancomycin instead of metronidazole. Best Practice Advice 4: Clinicians strongly should consider hospitalization for close monitoring and aggressive management for inflammatory bowel disease patients with C difficile infection who have profuse diarrhea, severe abdominal pain, a markedly increased peripheral blood leukocyte count, or other evidence of sepsis. Best Practice Advice 5: Clinicians may postpone escalation of steroids and other immunosuppression agents during acute C difficile infection until therapy for C difficile infection has been initiated. However, the decision to withhold or continue immunosuppression in inflammatory bowel disease patients with C difficile infection should be individualized because there is insufficient existing robust literature on which to develop firm recommendations. Best Practice Advice 6: Clinicians should offer a referral for fecal microbiota transplantation to inflammatory bowel disease patients with recurrent C difficile infection. Copyright © 2017 AGA Institute. Published by Elsevier Inc. All rights reserved.

  4. Rõve kuubis, aga... / Tiit Tuumalu

    Index Scriptorium Estoniae

    Tuumalu, Tiit, 1971-

    2006-01-01

    Dokumentaalfilm "Aristokraadid", kus ühte roppu habemega anekdooti jutustavad meelelahutustööstusest tuntud tegijad : režissöör Paul Provenza : Ameerika Ühendriigid 2006. Filmi näitab Tallinna Kinomaja

  5. Usalda, aga kontrolli / Manuela Pihlap

    Index Scriptorium Estoniae

    Pihlap, Manuela

    2008-01-01

    Uuest isikuandmete kaitse seadusest. Ilmunud ka Harju Ekspress 22. veeb. 2008, lk. 6 ; Meie Maa 26. veeb. 2008, lk. 2 ; Pärnu Postimees 28. veeb. 2008, lk. 15 ; LõunaLeht 28. veeb. 2008, lk. 4 ; Valgamaalane 28. veeb. 2008, lk. 2

  6. Meeting the Challenges of Personal Development and Character Building in University Students

    OpenAIRE

    Chong, Yen Wan; Hamid, Siti Norasyikin Binti Abdul

    2016-01-01

    Graduate unemployment and corruption are two major challenges faced by Malaysia. One of the top reasons for graduate unemployment in Malaysia, according to a recent survey of Malaysian employers, is poor character or attitude among university graduates. Despite intensifying anti-corruption efforts, corruption in Malaysia has remained a serious challenge. Character education and personal development programs which instil good values in our future leaders can be effective tools in the fight aga...

  7. Distribution and interannual variability of supraglacial lakes on debris-covered glaciers in the Khan Tengri-Tumor Mountains, Central Asia

    International Nuclear Information System (INIS)

    Qiao, Liu; Mayer, Christoph; Liu, Shiyin

    2015-01-01

    Supraglacial lakes are widely formed on debris-covered glaciers in the Khan Tengri-Tumor Mountains (KTTM), Tianshan, Central Asia. Study of their distribution characters based on regional-wide remote sensing investigations is still lacking, but it can promote our understanding about the influence of supraglacial lakes on the surface melting, hydrology and dynamics of debris-covered glaciers in this region. This study presents results of the supraglacial lake inventory in the KTTM region, based on multi-year Landsat images. We focus on the glacio-geomorphological characters of the supraglacial lakes and their late summer conditions, since all suitable Landsat images were acquired between August and September during 1990–2011. With a minimum threshold extent of 3600 m 2 for conservative mapping results, we totally mapped 775 supraglacial lakes and 38 marginal glacial lakes on eight huge debris-covered glaciers. Supraglacial lakes are concentrated on the Tumor Glacier and the South Inylchek Glacier, two biggest glaciers in this region. Although most supraglacial lakes are short-lived, a number of lakes can be repeatedly identified between different Landsat images. Detailed investigation of these ‘perennial’ lakes on the Tumor Glacier indicates that their filling frequency and area contributions have increased since 2005. Analysis of the area-elevation distributions for all mapped supraglacial lakes shows that they predominantly occur close to the altitude of 3250 m a.s.l., as high as the lowest reach of clean ice where surface debris begins to appear, and can further develop upglacier to a limit of about 3950 m a.s.l.. Total and mean area of supraglacial lakes in the KTTM region during the late summer seasons show great variability between years. Correlation analysis between the annual lake area and the observed nearby meteorological conditions suggests that warmer springs seem related to the draining of some supraglacial lakes during the following seasons, due

  8. Russian Chronicles on the Religious Policy of Uzbek Khan (1313–1341 and His Relations with the Principalities of the North-Eastern Rus’.

    Directory of Open Access Journals (Sweden)

    Hautala R.

    2017-12-01

    Full Text Available Research objectives: The author of present article examines the overall response of Russian medieval scribes to the ascension to power of Uzbek Khan – the Golden Horde’s Muslim ruler who made a major effort to spread Islam in the Jochid Empire. Analyzing Russian sources, the author tries to answer the question regarding to what extent we can trust the reliability of their information about the impact of Uzbek’s religious affiliation on the anticipated change in his relations with the Russian principalities. Research materials: Russian sources are of paramount importance for the study of the Golden Horde’s history. On the one hand, Russian chronicles contain a wealth of relevant factual material. The abundance of this material can be explained by the fact that medieval Rus’ was subordinated to the Golden Horde, although its numerous and disjointed princes enjoyed considerable autonomy within the Jochid Empire. On the other hand, the accuracy of Russian chronicles’ information should not be overestimated for several reasons. The preserved chronicle collections were often composed several centuries after the described events. Therefore, their information underwent the influence of significant ideological changes. In addition, the authors of Russian chronicles focused on the description of only those events that were directly related to the Russian principalities and their rulers. The novelty of this study emerges from a comparison of the Russian chronicles’ content with information found in little-known written sources. In particular, Latin sources compiled within the ulus of Jochi in a relatively large amount exactly during the period under study compensate to some extent for the complete absence of Jochid written sources. In this case, the content of the Latin sources will allow us to reconsider the established opinion about the total Islamization of the ulus of Jochi during Uzbek’s reign. Research results: The use of

  9. Quaternary selenostannates Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6} and AGaSnSe{sub 4} (A=K, Rb, and Cs) through rapid cooling of melts. Kinetics versus thermodynamics in the polymorphism of AGaSnSe{sub 4}

    Energy Technology Data Exchange (ETDEWEB)

    Hwang, S -J; Iyer, R G; Kanatzidis, M G

    2004-10-01

    The quaternary alkali-metal gallium selenostannates, Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6} and AGaSnSe{sub 4} (A=K, Rb, and Cs), were synthesized by reacting alkali-metal selenide, Ga, Sn, and Se with a flame melting-rapid cooling method. Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6} crystallizes in the non-centrosymmetric space group C2 with cell constants a=13.308(3) A, b=7.594(2) A, c=13.842(3) A, {beta}=118.730(4) deg., V=1226.7(5) A{sup 3}. {alpha}-KGaSnSe{sub 4} crystallizes in the tetragonal space group I4/mcm with a=8.186(5) A and c=6.403(5) A, V=429.1(5) A{sup 3}. {beta}-KGaSnSe{sub 4} crystallizes in the space group P2{sub 1}/c with cell constants a=7.490(2) A, b=12.578(3) A, c=18.306(5) A, {beta}=98.653(5) deg., V=1705.0(8) A{sup 3}. The unit cell of isostructural RbGaSnSe{sub 4} is a=7.567(2) A, b=12.656(3) A, c=18.277(4) A, {beta}=95.924(4) deg., V=1741.1(7) A{sup 3}. CsGaSnSe{sub 4} crystallizes in the orthorhombic space group Pmcn with a=7.679(2) A, b=12.655(3) A, c=18.278(5) A, V=1776.1(8) A{sup 3}. The structure of Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6} consists of a polar three-dimensional network of trimeric (Sn,Ga){sub 3}Se{sub 9} units with Na atoms located in tunnels. The AGaSnSe{sub 4} possess layered structures. The compounds show nearly the same Raman spectral features, except for Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6}. Optical band gaps, determined from UV-Vis spectroscopy, range from 1.50 eV in Na{sub 2-x}Ga{sub 2-x}Sn{sub 1+x}Se{sub 6} to 1.97 eV in CsGaSnSe{sub 4}. Cooling of the melts of KGaSnSe{sub 4} and RbGaSnSe{sub 4} produces only kinetically stable products. The thermodynamically stable product is accessible under extended annealing, which leads to the so-called {gamma}-form (BaGa{sub 2}S{sub 4}-type) of these compounds.

  10. Tire Kutu Khan Excavation, Principalities And Ottoman Periods Ceramics / Tire Kutu Han Kazısı, Beylikler Ve Osmanlı Dönemi Seramikleri

    Directory of Open Access Journals (Sweden)

    Hasan UÇAR

    2018-04-01

    Full Text Available Tire is a city, which was the capital city of Aydınoğulları Principality. The development of the city, which started to become a Turk-Islam settlement in this period, accelerated in the Ottoman period. The numerous religious, social and civil architectural structures built in those days in the city have reached the present day with great preservation of their originality. Kutu Khan, which carries the unique characteristics of the Ottoman city-inns, dating back to 1429. It was a remarkable structure in Ottoman trade life and it continued its function for centuries. Recently, excavations were carried out in the courtyard and barn area of the inn for restoration. A large number of ceramics reflecting the characteristics of both the Principalities and the Ottoman period were brought to the surface from underground. The presentations and evaluations of the red dough ceramics of both periods during the excavations are the contents of this article. When the ceramic finds are classified in chronological order, it is understood that the ones dated to the first half of the 14th-15th C. and those dated to the 18th-19th C. are high in number. The number of ceramics dated between these two periods is rather limited. This leads to different results. The first is that the area where the inn was built was also a settlement area in the Principalities Period; secondly, from the date of its construction until 18th-19th C., the inn was regularly operated; the third is that the centuries the cleaning work in the inn has not been given much importance and the broken ceramics have been sprinkled on the floor. Ceramics spreading for about 600 years were evaluated in two main groups; glazed and unglazed. All lined ceramics belonging to glazed ceramics belong to Ottoman period and these ceramics are similar to those ceramics produced in Eyüp and Çanakkale. Underglazed painted ceramics belong to both periods. In these ceramics, in which style differences are observed

  11. White Paper AGA: An Episode-of-Care Framework for the Management of Obesity-Moving Toward High Value, High Quality Care: A Report From the American Gastroenterological Association Institute Obesity Episode of Care and Bundle Initiative Work Group.

    Science.gov (United States)

    Brill, Joel V; Ashmore, Jamile A; Brengman, Matthew L; Buffington, Daniel E; Feldshon, S David; Friedman, Kelli E; Margolis, Peter S; Markus, Danielle; Narramore, Leslie; Rastogi, Amita; Starpoli, Anthony A; Strople, Kenneth; White, Jane V; Streett, Sarah E

    2017-05-01

    The American Gastroenterological Association acknowledges the need for gastroenterologists to participate in and provide value-based care for both cognitive and procedural conditions. Episodes of care are designed to engage specialists in the movement toward fee for value, while facilitating improved outcomes and patient experience and a reduction in unnecessary services and overall costs. The episode of care model puts the patient at the center of all activity related to their particular diagnosis, procedure, or health care event, rather than on a physician's specific services. It encourages and incents communication, collaboration, and coordination across the full continuum of care and creates accountability for the patient's entire experience and outcome. This paper outlines a collaborative approach involving multiple stakeholders for gastrointestinal practices to assess their ability to participate in and implement an episode of care for obesity and understand the essentials of coding and billing for these services. Copyright © 2017 AGA Institute. Published by Elsevier Inc. All rights reserved.

  12. Information on Genghis Khan, Berke, and Khan Uzbek in Bibliographic Collection of al-Safadi, Salah al-Din Khalil (d. 764 AH. Al-Wafi bi al-vafiyat (الوافي بالوفياب أو تاريخ الصفدي (Complete collection of biographies of deceased persons or the history of al-Safadi »

    Directory of Open Access Journals (Sweden)

    D.R. Zaynuddinov

    2015-09-01

    biographical dictionary “Complete Collection of Biographies of Deceased Persons” written by Mamluk historian al-Safadi (696 AH / 1297 – 764 AH / 1363. This article contains: I a brief examination of the life and creative activities of the historian and description of his works; II description of biographical collection “Al-Wafi bi al-vafiyat” (الوافي بالوفياب أو تاريخ الصفدي (Complete Collection of Biographies of Deceased Persons or the History of al-Safadi; III translation and facsimiles of biographies of such khans as Genghis Khan, khan Berke, and khan Uzbek.

  13. ELT in a changing world innovative approaches to new challenges

    CERN Document Server

    Ahmed, Azra; Saleem, Faiza; Cane, Graeme

    2013-01-01

    A novel ELT resource for language specialists and teachers across the world, this selection of papers is a collection of the most compelling and innovative ideas presented at a seminar hosted by the Centre of English Language, Aga Khan University, Pakistan, in January 2011, entitled 'ELT in a Changing World: Innovative Approaches to New Challenges'.The book is divided into three sections, the first of which is 'Global change and language learning'. This section offers a guided tour of language teaching evolution, highlighting the merits of enhanced language awareness, self-immersive and input/

  14. Aga miks mitte panustada teraviljale? / Tarvo Vaarmets

    Index Scriptorium Estoniae

    Vaarmets, Tarvo

    2007-01-01

    Üha populaarsust koguvate ETFide ehk börsil kaubeldavate fondide hulka on lisandunud ka viimaste variatsioonid ETCd ehk börsil kaubeldavad toorained, nende perspektiivikust tõstab tarbimise kasv maailmas. Tabel: Millistel börsidel tehakse tehinguid ETF-idega

  15. Hiilgav, aga... / Alar Niineväli

    Index Scriptorium Estoniae

    Niineväli, Alar

    2008-01-01

    Ameerika telesarjad, mis on heatasemelised, kuid tootjate poolt liiga vara ära lõpetatud, enamasti kasumlikkusest lähtudes : "Earth 2" (1994), "EZ Streets" (1996), "Profit" (1996), "Strange World" (1999), "The Inside" (2005), "Drive" (2007), "Aliens in America" (2007)

  16. Edasi loodusesse! Aga kuhu? / Riina Oruaas

    Index Scriptorium Estoniae

    Oruaas, Riina

    2007-01-01

    Tantsulavastustest: Oksana Titova, Päär Pärenson ja Juhan Ulfsak "Roots", Kaja Kanni sooloetendus "There are Laika dogs living in Estonia", Tiina Mölder, Kaja Kann ja Bush Hartshor "Naine ja Hunt"

  17. University Internationalization and University Autonomy

    DEFF Research Database (Denmark)

    Turcan, Romeo V.; Gulieva, Valeria

    2016-01-01

    Turcan and Gulieva deepen our theoretical understanding of the process of university internationalisation by exploring the relationship between university internationalisation and university autonomy. They conjecture that the process of university internationalisation and its sustainability are d......, dissimilar, and sometimes conflicting dimensions of the financial, legal, organisational, staffing, and academic autonomy of the host country, are compromising key aspects of their own autonomy and core mission?......Turcan and Gulieva deepen our theoretical understanding of the process of university internationalisation by exploring the relationship between university internationalisation and university autonomy. They conjecture that the process of university internationalisation and its sustainability...... are determined by the structure and exercise of university autonomy settings at home and in the host countries, and that the process itself cannot be successfully achieved and maintained without changes in the autonomy settings. The key question the authors ask is to what degree universities, in embracing new...

  18. The Mongols: Early Practitioners of Maneuver Warfare

    Science.gov (United States)

    2012-05-17

    Robert Marshall , Storm From the East: from Genghis Khan to Khubilai Khan (Berkeley: University of California Press, 1993); Douglas Benson, Mongol...craftsman, merchants, Chinese artisans, leather workers, goldsmiths and silversmiths. In the fields beyond the city walls aubergines and melons... Marshall , Storm from the East: from Genghis Khan to Khubilai Khan (Berkeley: University of California Press, 1993), 49. 42 All troops strengths are

  19. Universe symmetries

    International Nuclear Information System (INIS)

    Souriau, J.M.

    1984-01-01

    The sky uniformity can be noticed in studying the repartition of objects far enough. The sky isotropy description uses space rotations. The group theory elements will allow to give a meaning at the same time precise and general to the word a ''symmetry''. Universe models are reviewed, which must have both of the following qualities: - conformity with the physic known laws; - rigorous symmetry following one of the permitted groups. Each of the models foresees that universe evolution obeys an evolution equation. Expansion and big-bang theory are recalled. Is universe an open or closed space. Universe is also electrically neutral. That leads to a work hypothesis: the existing matter is not given data of universe but it appeared by evolution from nothing. Problem of matter and antimatter is then raised up together with its place in universe [fr

  20. Mermaid baby | Khan | SA Journal of Radiology

    African Journals Online (AJOL)

    We were recently intrigued by a baby born at Kalafong Hospital with fused lower extremities resembling a mermaid, which caused us to search for the background and origin of this entity called sirenomelia. Full Text: EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT.

  1. Pakistan: Preliminary National Greenhouse Gas Inventory | KHAN ...

    African Journals Online (AJOL)

    PROMOTING ACCESS TO AFRICAN RESEARCH ... The gases covered in the inventory are the direct greenhouse gases (carbon ... Industrial processes, Agriculture, Land?use change and forestry and Waste (guided by Intergovernmental Panel on Climate Change). ... EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT

  2. case study: khan school in shiraz

    African Journals Online (AJOL)

    J. MahdiNejad, A. Sadeghi HabibAbad

    2016-09-01

    Sep 1, 2016 ... This paper, while examining the impact of Islamic thought .... Today, it is proven in psychology and sociology that nature as a ... Colors and other patterns in decorations in Islamic art have certain implications, and applied.

  3. Pakistan: Preliminary National Greenhouse Gas Inventory | KHAN ...

    African Journals Online (AJOL)

    Journal of Applied Sciences and Environmental Management. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home > Vol 7, No 2 (2003) >. Log in or Register to get access to full text downloads.

  4. Changing trends of hepatitis b seromarkers amongst pakistani population: a laboratory-based review

    International Nuclear Information System (INIS)

    Zafar, A.; Khan, E.; Khan, M.S.; Moiz, B.; Jafri, W.

    2013-01-01

    Objective: To study the changing trends of hepatitis B markers tested at Aga Khan University Hospital clinical laboratory according to the internationally recognised classification of hepatitis B profile. Methods: The retrospective study involved analysis of laboratory records of hepatitis B profiles of all patients collected from January 2001 to December 2008 at the Aga Khan University Hospital's clinical laboratory. Patients with complete profile tested were categorised according to the Centre for Diseases Control classification of hepatitis B profile. SPSS 16 was used for statistical analysis. Results: A total of 185,825 patients had serological markers for hepatitis B tested. Mean-age of reactive hepatitis B surface antigen (HBsAg) patients was 30+-12.5 years. HBsAg reactivity was significantly higher in males than females (34% vs 12%; p <0.0001). HBsAg showed a slight decline in the percentage reactivity during the 8-year study period, while a gradual increase in hepatitis B surface antibody (HBsAb) reactivity was observed. Of the total, 23% patients belonged to the 'susceptible to infection' category; 39% patients were classified as 'chronically-ill'; 12% patients were categorised as 'immune due to hepatitis B vaccination'. 3% patients were classed as 'acutely infected'. Overall, samples received from Peshawar, Quetta and Larkana showed very high reactivity rates. Conclusion: The study substantiated the general perception that levels of HBsAg is showing a decreasing trend, while levels of HBsAb are increasing perhaps due to better vaccination of population. (author)

  5. Clinical, biochemical and ultrasonographic features of infertile women with polycystic ovarian syndrome

    International Nuclear Information System (INIS)

    Haq, F.; Rizvi, J.

    2007-01-01

    To evaluate and compare the clinical, biochemical and ultrasonic features of infertile women with PCOS from the two infertility centers of Karachi, The Aga Khan University Hospital and Concept Fertility Centre. Patients attending the Infertility Clinics of Aga Khan University Hospital, Karachi and Concept Fertility Centre, Karachi, were evaluated for their clinical features. Complete biochemical evaluation was performed by day 2 FSH, LH, serum prolactin, serum testosterone and fasting serum insulin determination. These results were recorded on the data collection form. Ultrasonic evaluation was performed with transvaginal ultrasound to check the morphological appearance of ovaries. A total of 508 patients were evaluated for epidemiological features of PCOS. Frequency of PCOS in the infertility clinic was 17.6% with high rate of obesity (68.5%) and hyperinsulinemia (59%). The highest rate of abnormal clinical, biochemical features were seen above BMI of 30. High rates of obesity, hyperinsulinemia and impaired glycemic control were seen in this series. It was demonstrated that high BMI had an association and correlation with abnormal clinical and biochemical features. Obese women with PCOS need more attention for their appropriate management. (author)

  6. Diagnosis of hepatoma using grayscale and Doppler ultrasound in patients with chronic liver disease

    Directory of Open Access Journals (Sweden)

    Idris S

    2011-10-01

    Full Text Available Wasim A Memon, Zishan Haider, Mirza Amanullah Beg, Muhammad Idris, Tanveer-ul-Haq, Waseem Akhtar, Sidra IdrisRadiology Department, Aga Khan University Hospital, Karachi, Pakistan Every author contributed equally to the workObjective: To determine the diagnostic accuracy of liver ultrasound for the detection of hepatoma in chronic liver disease (CLD patients by either taking histopathology or serum α-fetoprotein levels or a biphasic computed tomography (CT scan (whichever is available as the gold standard.Study design: Cross-sectional.Place and duration of study: Radiology Department, The Aga Khan University Hospital, Karachi, Pakistan, from January 2007 to January 2010.Methods: A total of 239 patients (156 males and 83 females with clinical suspicion or surveillance of hepatoma in CLD referred to the radiology department for ultrasound evaluation followed by either liver biopsy and histopathology or serum α-fetoprotein level or biphasic CT scan.Results: The sensitivity of ultrasound for hepatoma detection in CLD was 65%, specificity was 85%, and accuracy was 70%, and positive predictive value and negative predictive value were 92% and 45%, respectively.Conclusion: Ultrasound is a relatively quick, safe, reasonably accurate, and noninvasive imaging modality for the detection of hepatoma in CLD and can be complemented with clinical assessment of screening high-risk patients.Keywords: hepatoma, ultrasound, radiology, chronic liver disease

  7. Clinical and Biochemical Characteristics of Children with Juvenile Idiopathic Arthritis

    International Nuclear Information System (INIS)

    Ahmed, S.; Ali, S. R.; Ishaque, S.

    2014-01-01

    Objective: To determine the clinical and biochemical characteristics of children with Juvenile Idiopathic Arthritis (JIA) at a tertiary care centre in Karachi, Pakistan. Study Design: A descriptive study. Place and Duration of Study: Paediatric Rheumatology Clinic of The Aga Khan University Hospital (AKUH), Karachi, from January 2008 to December 2011. Methodology: Clinical and laboratory profile and outcome of children less than 15 years of age attending the Paediatric Rheumatology Clinic of the Aga Khan University, Karachi with the diagnosis of Juvenile Idiopathic Arthritis according to International League against Rheumatism were studied. These children were classified into different types of JIA; their clinical and laboratory characteristics, response to therapy and outcome was evaluated. Results: Sixty eight patients satisfying the criteria of International League against Rheumatism (ILAR) for Juvenile Idiopathic Arthritis were enrolled during the study period of four consecutive years, their age ranged from 9 months to 15 years. Mean age at onset was 6.45 +- 4.03 years while mean age at diagnosis was 7.60 +- 3.93 years. Polyarticular was the most predominant subtype with 37 (54%) patients, out of these, 9 (24%) were rheumatoid factor positive. An almost equal gender predisposition was observed. Fever and arthritis were the most common presenting symptoms, with only 2 patients presenting with uveitis. Conclusion: The clinico-biochemical characteristics of JIA at the study centre showed a pattern distinct with early onset of disease, high frequency of polyarticular type and a higher rheumatoid factor (QRA) and ANA positivity in girls. (author)

  8. Our Universe

    Science.gov (United States)

    Stern, Alan

    2001-03-01

    The Universe in which we live is unimaginably vast and ancient, with countless star systems, galaxies, and extraordinary phenomena such as black holes, dark matter, and gamma ray bursts. What phenomena remain mysteries, even to seasoned scientists? Our Universe is a fascinating collection of essays by some of the world's foremost astrophysicists. Some are theorists, some computational modelers, some observers, but all offer their insights into the most cutting-edge, difficult, and curious aspects of astrophysics. Compiled, the essays describe more than the latest techniques and findings. Each of the ten contributors offers a more personal perspective on their work, revealing what motivates them and how their careers and lives have been shaped by their desire to understand our universe. S. Alan Stern is Director of the Department of Space Studies at Southwest Research Institute in Boulder, Colorado. He is a planetary scientist and astrophysicist with both observational and theoretical interests. Stern is an avid pilot and a principal investigator in NASA's planetary research program, and he was selected to be a NASA space shuttle mission specialist finalist. He is the author of more than 100 papers and popular articles. His most recent book is Pluto & Charon (Wiley, 1997). Contributors: Dr. John Huchra, Harvard University Dr. Esther Hu, University of Hawaii, Honolulu Dr. John Mather, NASA Goddard Space Flight Center Dr. Nick Gnedin, University of Colorado, Boulder Dr. Doug Richstone, University of Michigan, Ann Arbor Dr. Bohdan Paczynski, Princeton University, NJ Dr. Megan Donahue, Space Telescope Science Institute, Baltimore, MD Dr. Jerry Ostriker, Princeton University, New Jersey G. Bothun, University of Oregon, Eugene

  9. N-acetylgalatosamine-Mediated Regulation of the aga Operon by AgaR in Streptococcus pneumoniae

    NARCIS (Netherlands)

    Afzal, Muhammad; Shafeeq, Sulman; Ahmed, Hifza; Kuipers, Oscar P

    2016-01-01

    Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa). Transcriptome comparison of S. pneumoniae D39 grown in NAGaM17 (0.5% NAGa + M17) to that grown in GM17 (0.5% Glucose + M17) revealed the elevated expression of various carbon metabolic

  10. Intelligent Universe

    Energy Technology Data Exchange (ETDEWEB)

    Hoyle, F

    1983-01-01

    The subject is covered in chapters, entitled: chance and the universe (synthesis of proteins; the primordial soup); the gospel according to Darwin (discussion of Darwin theory of evolution); life did not originate on earth (fossils from space; life in space); the interstellar connection (living dust between the stars; bacteria in space falling to the earth; interplanetary dust); evolution by cosmic control (microorganisms; genetics); why aren't the others here (a cosmic origin of life); after the big bang (big bang and steady state); the information rich universe; what is intelligence up to; the intelligent universe.

  11. USAID University

    Data.gov (United States)

    US Agency for International Development — USAID University is USAID's learning management system. Features include 1) Access online courses 2) Register for instructor-led courses 3)Access your student...

  12. Runaway universe

    Energy Technology Data Exchange (ETDEWEB)

    Davies, P

    1978-01-01

    The subject is covered in chapters entitled: the emerging universe (general introduction, history of astronomical and cosmological research, origins, the expanding universe, stars, galaxies, electromagnetic radiation); primeval fire (the big bang model, origin of the elements, properties of the elements and of sub-atomic particles); order out of chaos (galactic evolution, star formation, nuclear fusion, the solar system, origin of life on Earth); a star called Sol (properties of the sun and of other stars); life in the universe; the catastrophe principle (the rise and fall of cosmic order); stardoom (star evolution, neutron stars); black holes and superholes (gravitational collapse); technology and survival; the dying universe (second law of thermodynamics); worlds without end (cosmological models).

  13. Rhodes University

    African Journals Online (AJOL)

    Samridhi Sharma

    2013-10-29

    Oct 29, 2013 ... been taken may improve the reception, by the target audience, of the intended communication. This may ... alcohol marketing. Similarly .... of the intended users (Rhodes University support staff ..... Digital Human Modeling and.

  14. Undulant Universe

    Energy Technology Data Exchange (ETDEWEB)

    Barenboim, Gabriela; /Valencia U.; Mena, Olga; Quigg, Chris; /Fermilab

    2004-12-01

    If the equation of state for ''dark energy'' varies periodically, the expansion of the Universe may have undergone alternating eras of acceleration and deceleration. We examine a specific form that survives existing observational tests, does not single out the present state of the Universe as exceptional, and suggests a future much like the matter-dominated past: a smooth expansion without a final inflationary epoch.

  15. Plasma universe

    International Nuclear Information System (INIS)

    Alfven, H.

    1986-04-01

    Traditionally the views in our cosmic environment have been based on observations in the visual octave of the electromagnetic spectrum, during the last half-century supplemented by infrared and radio observations. Space research has opened the full spectrum. Of special importance are the X-ray-gamma-ray regions, in which a number of unexpected phenomena have been discovered. Radiations in these regions are likely to originate mainly from magnetised cosmic plasma. Such a medium may also emit synchrotron radiation which is observable in the radio region. If we try to base a model of the universe on the plasma phenomena mentioned we find that the plasma universe is drastically different from the traditional visual universe. Information about the plasma universe can also be obtained by extrapolation of laboratory experiments and magnetospheric in situ measurements of plasma. This approach is possible because it is likely that the basic properties of plasma are the same everywhere. In order to test the usefulness of the plasma universe model we apply it to cosmogony. Such an approach seems to be rather successful. For example, the complicated structure of the Saturnian C ring can be accounted for. It is possible to reconstruct certain phenomena 4-5 bilions years ago with an accuracy of better than 1 percent

  16. Maternal genital tract colonisation by group-b streptococcus: a hospital based study

    International Nuclear Information System (INIS)

    Najmi, N.; Sikandar, R.; Zuberi, N.F.

    2013-01-01

    Objectives: To determine the prevalence of Group B Streptococcus genital tract infection in pregnant women and to determine the risk factors for its colonisation. Methods: The cross-sectional study was conducted at the Aga Khan University Hospital, Karachi and Sobhraj Hospital, Karachi, from May to August 2007. Pregnant women at 35-37 weeks gestation attending antenatal clinic at these hospitals constituted the study population. Based on stratified sampling, 405 patients were recruited. High vaginal swabs of these patients were taken in order to calculate the prevalence of infection at each hospital. Logistic regression was used to evaluate the risk factor association. SPSS 11.5 was used for statistical analysis. Results: The overall prevalence of colonisation was 17% (n=69) (95% CI: 13.4-20.7). Of the 155(38.27%) women at the Aga Khan Hospital, 35(22.6%) were positive, while among the 250 (61.72%) women at Sobhraj Hospital, the prevalence was 13.6% (n=34). The colonisation was found to be significantly associated inversely with the body mass index of the patient (OR 0.91; 95% CI: 0.08-1.0). Conclusion: Group B Streptococcus screening should be an integral part of antenatal care and should be offered to all pregnant women. (author)

  17. Baby universes

    International Nuclear Information System (INIS)

    Strominger, A.

    1988-01-01

    This paper discusses how the subject of baby universes and their effects on spacetime coupling constants is in its infancy and rapidly developing. The subject is based on the non-existent (even by physicists' standards) Euclidean formulation of quantum gravity, and it is therefore necessary to make a number of assumptions in order to proceed. Nevertheless, the picture which has emerged is quite appealing: all spacetime coupling constants become dynamical variables when the effects of baby universes are taken into account. This fact might even solve the puzzle of the cosmological constant. The subject therefore seems worth further investigation

  18. Stiegler's University

    Science.gov (United States)

    Featherstone, Mark

    2017-01-01

    In this article, Mark Featherstone proposes to explore Bernard Stiegler's work through the lens of the politics of education and in particular the idea of the university, which becomes a pharmacological space of, on the one hand, utopian possibility, and, on the other hand, dystopian limitation, destruction, and death in his recent "States of…

  19. University writing

    Directory of Open Access Journals (Sweden)

    Miguel Zabalza Beraza

    2013-01-01

    Full Text Available Writing in the University is a basic necessity and a long-range educational purpose. One of the basic characteristics of the university context is that it requires writing both as a tool of communication and as a source of intellectual stimulation. After establishing the basic features of academic writing, this article analyzes the role of writing for students (writing to learn and for teachers (write to plan, to reflect, to document what has been done. The article also discusses the contributions of writing for both students and teachers together: writing to investigate. Finally, going beyond what writing is as academic tool, we conclude with a more playful and creative position: writing for pleasure and enjoyment.

  20. Universe unfolding

    International Nuclear Information System (INIS)

    King, I.R.

    1976-01-01

    Topics covered the setting; looking at the stars; the earth; time, place and the sky; our satellite, the moon; orbits and motion; the motions of the planets; the Copernican revolution; the planets; the other bodies of the solar system; ages, origins, and life; introducing the stars; sorting out the stars; binary stars--two are better than one; variable stars--inconstancy as a virtue; the secrets of starlight--unraveling the spectrum; the sun--our own star; the structure of a star; interstellar material; the Milky Way, our home galaxy; galaxies--the stellar continents; cosmic violence--from radio galaxies to quasars; the universe; and epilogue. The primary emphasis is on how we have come to know what we know about the universe. Star maps are included

  1. University physics

    CERN Document Server

    Arfken, George

    1984-01-01

    University Physics provides an authoritative treatment of physics. This book discusses the linear motion with constant acceleration; addition and subtraction of vectors; uniform circular motion and simple harmonic motion; and electrostatic energy of a charged capacitor. The behavior of materials in a non-uniform magnetic field; application of Kirchhoff's junction rule; Lorentz transformations; and Bernoulli's equation are also deliberated. This text likewise covers the speed of electromagnetic waves; origins of quantum physics; neutron activation analysis; and interference of light. This publi

  2. Human universe

    CERN Document Server

    Cox, Brian

    2014-01-01

    Human life is a staggeringly strange thing. On the surface of a ball of rock falling around a nuclear fireball in the blackness of a vacuum the laws of nature conspired to create a naked ape that can look up at the stars and wonder where it came from. What is a human being? Objectively, nothing of consequence. Particles of dust in an infinite arena, present for an instant in eternity. Clumps of atoms in a universe with more galaxies than people. And yet a human being is necessary for the question itself to exist, and the presence of a question in the universe - any question - is the most wonderful thing. Questions require minds, and minds bring meaning. What is meaning? I don't know, except that the universe and every pointless speck inside it means something to me. I am astonished by the existence of a single atom, and find my civilisation to be an outrageous imprint on reality. I don't understand it. Nobody does, but it makes me smile. This book asks questions about our origins, our destiny, and our place i...

  3. Sustainable Universities

    DEFF Research Database (Denmark)

    Grindsted, Thomas Skou

    2011-01-01

    Declarations on Sustainability in Higher Education (SHE) can be viewed as a piece of international regulation. Over the past 30 years research at universities has produced convincing data to warn about deterioration of the environment, resource scarcity and the need for sustainability. This in turn....... Declarations tend to have impact on three trends. Firstly, there is emerging international consensus on the university’s role and function in relation to sustainable development; secondly, the emergence of national legislation, and thirdly, an emerging international competition to be leader in sustainable...

  4. Open University

    CERN Multimedia

    Pentz,M

    1975-01-01

    Michel Pentz est née en Afrique du Sud et venu au Cern en 1957 comme physicien et président de l'associaion du personnel. Il est également fondateur du mouvement Antiapartheid de Genève et a participé à la fondation de l'Open University en Grande-Bretagne. Il nous parle des contextes pédagogiques, culturels et nationaux dans lesquels la méthode peut s'appliquer.

  5. Geneva University

    CERN Multimedia

    2009-01-01

    École de physique - Département de physique nucléaire et corspusculaire 24, quai Ernest-Ansermet 1211 GENÈVE 4 Tél: (022) 379 62 73 - Fax: (022) 379 69 92 Monday 9 March 2009 COLLOQUIUM at 17:00 – Stückelberg Auditorium Are We Descended From Heavy Neutrinos? Prof. Boris Kayser / Fermilab (Fermi National Accelerator Center, Geneva, Illinois, USA) Neutrinos are among the most abundant particles in the universe. The discovery that they have nonzero masses has raised a number of very interesting questions about them, and about their connections to other areas of physics and to cosmology. After briefly reviewing what has been learned about the neutrinos so far, we will identify the major open questions, explain why they are interesting, and discuss ideas and plans for answering them through future experiments. We will highlight a particularly intriguing question: Are neutrinos the key to understanding why the universe contains matter but almost no antimatter, making it s...

  6. Geneva University

    CERN Multimedia

    2009-01-01

    École de physique - Département de physique nucléaire et corpusculaire 24, quai Ernest-Ansermet 1211 GENÈVE 4 Tél: (022) 379 62 73 - Fax: (022) 379 69 92 Wednesday 13 May 2009 PARTICLE PHYSICS SEMINAR at 17:00 – Stückelberg Auditorium Observing the extreme universe with the Fermi Gamma-ray Space Telescope Prof. Olaf Reimer / Stanford University The Fermi Gamma-ray Space Telescope (FGST, formerly GLAST) is an international observatory-type satellite mission with a physics program spanning from gamma-ray astronomy to particle astrophysics and cosmology. FGST was launched on June 11, 2008 and is successfully conducting science observations of the high-energy gamma-ray sky since August 2008. A varienty of discoveries has been made already, including monitoring rapid blazar variability, the existence of GeV gamma-ray bursts, and numerous new gamma-ray sources of different types, including those belonging to previously unknown gamma-ray source classes like msPSRs, globula...

  7. Geneva University

    CERN Multimedia

    École de physique - Département de physique nucléaire et corspusculaire 24, quai Ernest-Ansermet 1211 GENÈVE 4 Tél: (022) 379 62 73 - Fax: (022) 379 69 92 Monday 7 December 2009 PHYSICS COLLOQUIUM at 17:00 – Stückelberg Auditorium Topological insulators and topological superconductors Professor Shoucheng Zhang Department of Physics, Stanford University, CA   Recently, a new class of topological states has been theoretically predicted and experimentally realized. The topological insulators have an insulating gap in the bulk, but have topologically protected edge or surface states due to the time reversal symmetry. In two dimensions the edge states give rise to the quantum spin Hall (QSH) effect, in the absence of any external magnetic field. I shall review the theoretical prediction of the QSH state in HgTe/CdTe semiconductor quantum wells, and its recent experimental observation. The edge states of the QSH state supports fr...

  8. Geneva University

    CERN Multimedia

    École de physique - Département de physique nucléaire et corspusculaire 24, quai Ernest-Ansermet 1211 GENÈVE 4 Tél: (022) 379 62 73 - Fax: (022) 379 69 92 Wednesday 18 November  2009 PARTICLE PHYSICS SEMINAR at 17:00 – Stückelberg Auditorium Highlights of the European Strategy Workshop for Future Neutrino Physics Dr Ilias Efthymiopoulos, CERN   Seminar cancelled! Information Organizer : J.-S. Graulich Monday 7 December 2009 PHYSICS COLLOQUIUM at 17:00 – Stückelberg Auditorium Topological insulators and topological superconductors Professor Shoucheng Zhang Department of Physics, Stanford University, CA   Recently, a new class of topological states has been theoretically predicted and experimentally realized. The topological insulators have an insulating gap in the bulk, but have topologically protected edge or surface states due to the time reversal symmetry. In two dimensions the edge s...

  9. Geneva University

    CERN Multimedia

    2008-01-01

    Ecole de physique - Département de physique nucléaire et corpusculaire 24, Quai Ernest-Ansermet 1211 GENEVE 4 Tél: (022) 379 62 73 Fax: (022) 379 69 92 Monday 28 April 2008 PHYSICS COLLOQUIUM at 17.00 – Stückelberg Auditorium Gravity : an Emergent Perspective by Prof. Thanu Padmanabhan, Pune University Dean, Ganeshkhind, Pune, India I will motivate and describe a novel perspective in which gravity arises as an emergent phenomenon, somewhat like elasticity. This perspective throws light on several issues which are somewhat of a mystery in the conventional approach. Moreover it provides new insights on the dark energy problem. In fact, I will show that it is necessary to have such an alternative perspective in order to solve the cosmological constant problem.Information: http://theory.physics.unige.ch/~fiteo/seminars/COL/collist.html

  10. Universal Alienation

    Directory of Open Access Journals (Sweden)

    David Harvey

    2018-05-01

    Full Text Available This article is part of a debate between David Harvey, Michael Hardt and Toni Negri. It takes Marx’s bicentenary as occasion for an update of his concept of alienation. The paper asks: how are we to interpret universal alienation and from whence does it come? Marx radically reformulated the concept of alienation in the Grundrisse. The humanism of the early Marx can be re-rooted and reconceptualised in the scientific mode proposed in the Grundrisse. In the Grundrisse, the universality of alienation is specific to capitalism’s historical evolution. Today, alienation exists almost everywhere. It exists at work in production, at home in consumption, and it dominates much of politics and daily life. Such trends intensify through the application of information technologies and artificial intelligence. Widespread alienation has resulted in Occupy movements as well as right-wing populism and bigoted nationalist and racist movements. Donald Trump is the President of alienation. The circulation of capital as totality consists of the three key moments of production, circulation and distribution. A lot of contemporary economic struggles are now occurring at the point of realisation rather than at the point of production. Protests are therefore today often expressions of broad-based discontent. Our future is dictated by the need to redeem our debts. Under such conditions democracy becomes a sham. The big question is what forms of social movement can help us get out of the state-finance nexus. The theory of objective alienation along with an understanding of its subjective consequences is one vital key to unlock the door of a progressive politics for the future.

  11. Fourth-generation spinal instrumentation: experience with adolescent idiopathic scoliosis at a tertiary care hospital in Pakistan

    Directory of Open Access Journals (Sweden)

    Fazal A

    2012-02-01

    Full Text Available Akil Fazal1, Riaz H Lakdawala21Hospital for Joint Disease, New York University, New York, USA; 2Section of Orthopaedics, Department of Surgery, The Aga Khan University Hospital, Karachi, PakistanObjective: To evaluate the radiological and functional outcome of surgical treatment of adolescent idiopathic scoliosis using fourth-generation posterior spinal instrumentation at The Aga Khan University, Karachi, Pakistan.Design: Case series.Place and duration of study: The Aga Khan University Hospital after a minimum of 2 years postoperatively.Patients and methods: A total of 20 patients with adolescent idiopathic scoliosis were recruited into the study and evaluated for radiological and functional outcome. The study period was from 2000 to 2005. Radiological outcome was assessed using Cobb angle measurement pre and postoperatively, hence assessing percentage correction. The lower instrumented vertebra was taken as the neutral vertebra and the level was recorded. Functional outcome was determined using the Scoliosis Research Society patient administered questionnaire. All patients were called to the clinic and asked to fill in the form. Those patients who were out of the city were mailed the forms and requested via telephone to complete and return.Results: Of the 20 patients operated on, twelve were female and eight were male. The average age at operation was 12.7 years. The mean Cobb angle was 69° preoperatively and 20° postoperatively, representing a percentage correction of 71%. The average duration of follow-up was 3.6 years. There was one major complication involving neurological injury post-op and two minor complications involving wound infection. The average Scoliosis Research Society score (on a scale of 1–5, with 5 being best for pain was 4.5, self-image was 4.2, functional status was 4.1, mental status was 3.8, and satisfaction was 4.4. There was no relationship between the percentage correction of scoliosis and the functional outcome

  12. Geneva University

    CERN Multimedia

    2009-01-01

    École de physique - Département de physique nucléaire et corpusculaire 24, quai Ernest-Ansermet 1211 GENÈVE 4 Tél: (022) 379 62 73 - Fax: (022) 379 69 92 Wednesday 25 March 2009 PARTICLE PHYSICS SEMINAR at 17:00 – Stückelberg Auditorium Hunting for the Higgs with D0 at the Tevatron Prof. Gustaaf Brooijmans / Columbia University The search for the Higgs boson is one of the most important endeavors in current experimental particle physics. At the eve of the LHC start, the Tevatron is delivering record luminosity allowing both CDF and D0 to explore a new region of possible Higgs masses. In this seminar, the techniques used to search for the Higgs boson at the Tevatron will be explained, limiting factors will be examined, and the sensitivity in the various channels will be reviewed. The newly excluded values of the standard model Higgs mass will be presented. Information : http://dpnc.unige.ch/seminaire/annonce.html Organizer : J.-S. Graulich

  13. Geneva University

    CERN Multimedia

    2009-01-01

    École de physique - Département de physique nucléaire et corpusculaire 24, quai Ernest-Ansermet 1211 GENÈVE 4 Tél: (022) 379 62 73 - Fax: (022) 379 69 92 Lundi 6 avril 2009 PARTICLE PHYSICS SEMINAR àt 17:00 – Auditoire Stückelberg Hospital superbugs, nanomechanics and statistical physics Prof. Dr G. Aeppli / University College London The alarming growth of the antibiotic-resistant superbug, methicillin-resistant Staphylococcus aureus (MRSA) is driving the development of new technologies to investigate antibiotics and their modes of action. We report silicon cantilever based studies of self-assembled monolayers of mucopeptides which model drug-sensitive and resistant bacterial walls. The underlying concepts needed to understand the measurements will simplify the design of cantilevers and coatings for biosensing and could even impact our understanding of drug action on bacteria themselves. (Une verrée en compagnie du conférencier sera offerte après le colloque.) Organizer : Prof. Markus Büttiker ...

  14. Geneva University

    CERN Multimedia

    2008-01-01

    Ecole de physique - Département de physique nucléaire et corpusculaire 24, Quai Ernest-Ansermet 1211 GENEVE 4 Tél: (022) 379 62 73 Fax: (022) 379 69 92 Wednesday 29 October 2008 PARTICLE PHYSICS SEMINAR at 17.00 – Stückelberg Auditorium Precision measurements of low-energy neutrino-nucleus interactions with the SciBooNE experiment at Fermilab by Dr Michel Sorel, IFIC (CSIC and University of Valencia) «Do all modern accelerator-based neutrino experiments need to make use of kiloton-scale detectors and decade-long exposure times? In order to study the full pattern of neutrino mixing via neutrino oscillation experiments, the answer is probably yes, together with powerful proton sources. Still, to push the sensitivity of future neutrino oscillation searches into unchartered territory, those are necessary, but not sufficient, ingredients. In addition, accurate knowledge of neutrino interactions and neutrino production is mandatory. This knowledge can be acquired via small-scale and short-term dedicated n...

  15. Geneva University

    CERN Multimedia

    2010-01-01

    Ecole de physique Département de physique nucléaire et corspusculaire 24, quai Ernest-Ansermet 1211 GENEVE 4 Tel: (022) 379 62 73 Fax: (022) 379 69 92 Wednesday 14 April 2010 PARTICLE PHYSICS SEMINAR at 17.00 hrs – Stückelberg Auditorium Dark Matter and the XENON Experiment By Dr. Marc Schumann, Physik Institut, Universität Zürich There is convincing astrophysical and cosmological evidence that most of the matter in the Universe is dark: It is invisible in every band of the electromagnetic spectrum. Weakly interacting massive particles (WIMPs) are promising Dark Matter candidates that arise naturally in many theories beyond the Standard Model. Several experiments aim to directly detect WIMPs by measuring nuclear recoils from WIMPs scattered on target nuclei. In this talk, I will give an overview on Dark Matter and direct Dark Matter detection. Then I will focus on the XENON100 experiment, a 2-phase liquid/gas time projection chamber (TPC) that ...

  16. Geneva University

    CERN Multimedia

    2009-01-01

    École de physique - Département de physique nucléaire et corspusculaire 24, quai Ernest-Ansermet 1211 Genève 4 Tél. 022 379 62 73 - Fax: (022) 379 69 92 Wednesday 14 October 2009 PARTICLE PHYSICS SEMINAR at 17:00 – Stückelberg Auditorium Long-lived particle searches at colliders Dr. Philippe Mermod / Oxford University The discovery of exotic long-lived particles would address a number of important questions in modern physics such as the origin and composition of dark matter and the unification of the fundamental forces. This talk will focus on searches for long-lived charged massive particles, where "charged" refers to the magnetic, electric or colour charge. Previous searches at the LEP and Tevatron Colliders allowed to put mass and cross section limits on various kinds of long-lived particles, such as Magnetic Monopoles and metastable leptons and up-type quarks. The new energy regime made available at the LHC will probe physics regions well beyond these limits. F...

  17. Universal algebra

    CERN Document Server

    Grätzer, George

    1979-01-01

    Universal Algebra, heralded as ". . . the standard reference in a field notorious for the lack of standardization . . .," has become the most authoritative, consistently relied on text in a field with applications in other branches of algebra and other fields such as combinatorics, geometry, and computer science. Each chapter is followed by an extensive list of exercises and problems. The "state of the art" account also includes new appendices (with contributions from B. Jónsson, R. Quackenbush, W. Taylor, and G. Wenzel) and a well-selected additional bibliography of over 1250 papers and books which makes this a fine work for students, instructors, and researchers in the field. "This book will certainly be, in the years to come, the basic reference to the subject." --- The American Mathematical Monthly (First Edition) "In this reviewer's opinion [the author] has more than succeeded in his aim. The problems at the end of each chapter are well-chosen; there are more than 650 of them. The book is especially sui...

  18. Geneva University

    CERN Multimedia

    2009-01-01

    École de physique - Département de physique nucléaire et corpusculaire 24, quai Ernest-Ansermet 1211 GENÈVE 4Tél: (022) 379 62 73 - Fax: (022) 379 69 92 Wednesday 29 April 2009 PARTICLE PHYSICS SEMINAR at 17:00 - Stückelberg Auditorium Search for spin-1 excited bosons at the LHC Mihail V. Chizhov (Physics Department, Sofia University, Bulgaria) I will discuss the resonance production of new type spin-1 excited bosons, Z*, at hadron colliders. They can be observed as a Breit-Wigner resonance peak in the invariant dilepton mass distribution in the same way as the well-known hypothetical gauge bosons, Z�. This makes them very interesting objects for early searches with the LHC first data. Moreover, they have unique signatures in transverse momentum and angular distributions, which allow to distinguish them from other resonances. Information : http://dpnc.unige.ch/seminaire/annonce.html Organizer: J.-S. Graulich

  19. Musculoskeletal imaging insight 2015: Kenya

    Energy Technology Data Exchange (ETDEWEB)

    Stevens, Kathryn J. [Stanford University School of Medicine, Department of Radiology, Stanford, CA (United States); Mutiso, Kavulani [Aga Khan University Hospital, Department of Radiology, Nairobi (Kenya); Sconfienza, Luca Maria [University of Milan, Department of Biomedical Sciences for Health, Milan (Italy); IRCCS Istituto Ortopedico Galeazzi, Unit of Radiology, Milan (Italy); Monu, Johnny [University of Rochester Medical Center, Rochester, NY (United States)

    2016-07-15

    Over the past 6 years the International Skeletal Society (ISS) outreach programs have become popular amongst the various radiology organizations in sub-Saharan Africa. So much so that that the ISS outreach is now routinely expected to participate in many of the international radiology conferences in that part of the world. The organizational planning for an outreach visit to Kenya took place over a 3-year period. Eventually a double-headed event; the seventh and eighth sub-Saharan outreach efforts were organized in Nairobi and in Mombasa, Kenya. The Nairobi outreach was an educational course on musculoskeletal imaging at the University of Nairobi and the Aga Khan University in Nairobi from 26 to 28 May 2015. The Mombasa outreach was organized in collaboration with the African Society of Radiology (ASR) at their annual meeting in Mombasa from 30 May to 2 June 2015. (orig.)

  20. Musculoskeletal imaging insight 2015: Kenya

    International Nuclear Information System (INIS)

    Stevens, Kathryn J.; Mutiso, Kavulani; Sconfienza, Luca Maria; Monu, Johnny

    2016-01-01

    Over the past 6 years the International Skeletal Society (ISS) outreach programs have become popular amongst the various radiology organizations in sub-Saharan Africa. So much so that that the ISS outreach is now routinely expected to participate in many of the international radiology conferences in that part of the world. The organizational planning for an outreach visit to Kenya took place over a 3-year period. Eventually a double-headed event; the seventh and eighth sub-Saharan outreach efforts were organized in Nairobi and in Mombasa, Kenya. The Nairobi outreach was an educational course on musculoskeletal imaging at the University of Nairobi and the Aga Khan University in Nairobi from 26 to 28 May 2015. The Mombasa outreach was organized in collaboration with the African Society of Radiology (ASR) at their annual meeting in Mombasa from 30 May to 2 June 2015. (orig.)

  1. Tezkire-i Buğra Han’ın Çağatayca Yazılmış Bir Nüshası Metin- Dil İncelemesi- Tıpkıbasım A Manuscript Of Tazkira-i Bughra Khan Written In Chagatay Turkısh Texte- Grammar Notes- Facsimile

    Directory of Open Access Journals (Sweden)

    B. Erdem DAĞISTANLIOĞLU

    2012-12-01

    Full Text Available The information is quite restricted which is about the first periodsof Islamic adoption by Turks. Unknown counterparts about this periodare the same with Satuq Bughra Khan who is in the huge role ofdiffusion of Islam between Turks and has legendary singularity.This article includes the translation and the examination of thelanguage of the transcript of Tazkira-i Bughra Khan which is indited in19th century in Chagatay Turkish and recounts Turkish people’sembracing İslam in indiscrete and the legendary lives of the first MuslimTurkish emperor.The artifact that in our labour not only has the feature of thelanguage of Classical Chagatay Turkish, but has the feature ofphonetics and grammatical structure of Uzbek and Modern Uigur. Thebook of Tazkira-i Bughra Khan includes examples of archaic pre-Chagatay Turkish either phonetics or grammatical structure. Theartifact attracts attention with these features not only representspassage from Chagatay Turkish to modern Turk idioms, but alsoincludes archaic structures.The writing gets the most of language features of Modern Uigurapart from Chagatay Turkish. The statements are written comlicatedand we could spot that are in the first page of the book, tārįħķa bir min giki yüz yėtmiş ….. inal aķsuluķ taĥrįri āħ ir boldı, also explain, thissentence is related with the Modern Uigur.The paper gives information about the whole text, writer, thecentury it is written in, and the other copies of the written work; alsothe translation of the written text about the legand of Satuq BughraKhan is given. Beside, the facsimile of the part inspected is attached tothe end of the article.Altough grounded on the Satuq Bughra Khan narrative whichtakes place in British Library in the Or. 8161 numbered text betweenthe 83a-102b pages; also, when examination of the language is needed,some explanations are given considering the whole text. Türklerin İslamiyet’e intisaplarının ilk dönemleri hakk

  2. The Learning University.

    Science.gov (United States)

    Patterson, Glenys

    1999-01-01

    As universities make cross-sectoral alliances, various models for integrating postsecondary education into universities arise: contract, brokerage, collaborative, validation, joint program, dual-sector institution, tertiary university, metaphoric, and federal. The integrated, comprehensive university is the learning university of the 21st century.…

  3. Towards excellence in cardiac surgery: experience from a developing country.

    Science.gov (United States)

    Saifuddin, Aamir; Shahabuddin, Syed; Perveen, Shazia; Furnaz, Shumaila; Sharif, Hasanat

    2015-08-01

    The objective of this study is an attempt to measure the performance in terms of comparing results with a large internationally recognized database used as a benchmark. Cross-sectional (prospectively collected data analysed and compared retrospectively). Aga Khan University Hospital, Karachi, Pakistan. From January 2006 to December 2010, information of the 2198 CABGs performed at Aga Khan University Hospital (AKU) was collected prospectively. This included patient characteristics and specific intra- and post-operative outcomes and compared with findings from the American Society of Thoracic Surgeons' National Cardiac Database (STS-NCD). There were more male patients in the AKU cohort and more diabetics. In AKU, more cases involved three or more grafts (85 vs. 78%), and in both groups, an internal mammary artery graft was used over 90% of the time. The overall 30-day mortality was 2.7% at AKU, compared with 1.5% in the STS-NCD data. AKU had a lower incidence of permanent stroke (0.5 vs. 1.2%), prolonged ventilation (10.5 vs. 11.0%), deep sternal wound infection (0.2 vs. 0.4%) and reoperation (4.0 vs. 4.7%). It had more cases of renal failure (5.4 vs. 3.6%). Readmission rates within 30 days were also less in AKU (3.9 vs. 9.1%). The outcomes of this study compare very favourably with the benchmark (STS). This demonstrates that high level of quality care can be achieved in this part of the world. © The Author 2015. Published by Oxford University Press in association with the International Society for Quality in Health Care; all rights reserved.

  4. Peroneal island flap for wound coverage in complex injuries of the lower extremity

    Directory of Open Access Journals (Sweden)

    Fazal A

    2012-01-01

    Full Text Available Akil Fazal1, Haroon-ur-Rashid1, Tahseen Cheema21Section of Orthopedics, Department of Surgery, Aga Khan University, Karachi, Pakistan; 2Department of Orthopedics and Rehabilitation, University of New Mexico, Albuquerque, NM, USABackground: Complex injuries of the lower extremity pose a therapeutic challenge owing to limited availability of local soft tissue for coverage. One option in this region is the pedicled fasciocutaneous flap based on perforators of the peroneal artery. In this case series, we present our experience of the peroneal island pedicled flap for reconstruction of lower extremity wounds.Methods: Records of 18 cases of peroneal island flap admitted consecutively to the Section of Orthopedics at Aga Khan University Hospital from January 1996 to December of 2009 were studied and their outcomes determined.Results: The most common indication for coverage was open wounds due to a road traffic accident (n = 10, followed by burns (n = 3. The most common area exposed was the lower third of the leg followed by the middle third. The tibia was exposed in 11 patients. The flaps ranged in size from 35 cm2 to over 200 cm2. In 13 patients, the flaps healed uneventfully, while in the remaining five there was partial flap necrosis. In four of the latter patients, the residual wound healed with conservative measures only, but the fifth patient required further surgery to achieve acceptable coverage.Conclusion: The peroneal artery flap appears to be a simple, useful, and reliable flap in the armamentarium of the surgeon when planning soft tissue coverage of the lower extremity.Keywords: leg injuries, surgical flaps, lower extremity

  5. Rotational Mal-Alignment after Reamed Intramedullary Nailing for tibial shaft fracture.

    Science.gov (United States)

    Khan, Sher Baz; Mohib, Yasir; Rashid, Rizwan Haroon; Rashid, Haroonur

    2016-10-01

    Intra-medullary (IM) nailing is standard of care for unstable tibial shaft fractures. Malrotation is very common but it is under-recognised, inpart because of variation in normal anatomy and partly due to difficulty in accurately assessing rotation. This study was planned to evaluate the frequency of rotational mal-alignment after reamed tibia IMnailing. This cross-sectional study was conducted at Aga khan University Hospital, Karachi, and comprised patients with tibia shaft fractures managed with IMnailing from January to December 2014. All the patients were assessed intra-operatively for rotational alignment using the knee and ankle fluoroscopic images. There were 81 patients with a mean age of 38±16.9 years. There were 64(79%) male patients. Overall the incidence of malrotation was in 20(24.7%) cases. Rotational mal-alignment is one of the preventable complications after IMnailing which can be assesed intra-operatively under fluoroscope.

  6. RADIOLOGY EDUCATION: A PILOT STUDY TO ASSESS KNOWLEDGE OF MEDICAL STUDENTS REGARDING IMAGING IN TRAUMA.

    Science.gov (United States)

    Siddiqui, Saad; Saeed, Muhammad Anwar; Shah, Noreen; Nadeem, Naila

    2015-01-01

    Trauma remains one of the most frequent presentations in emergency departments. Imaging has established role in setting of acute trauma with ability to identify potentially fatal conditions. Adequate knowledge of health professionals regarding trauma imaging is vital for improved healthcare. In this work we try to assess knowledge of medical students regarding imaging in trauma as well as identify most effective way of imparting radiology education. This cross-sectional pilot study was conducted at Aga Khan University Medical College & Khyber Girls Medical College, to assess knowledge of medical students regarding imaging protocols practiced in initial management of trauma patients. Only 40 & 20% respectively were able to identify radiographs included in trauma series. Very few had knowledge of correct indication for Focused abdominal sonography in trauma. Clinical radiology rotation was reported as best way of learning radiology. Change in curricula & restructuring of clinical radiology rotation structure is needed to improve knowledge regarding Trauma imaging.

  7. Westgate Shootings: An Emergency Department Approach to a Mass-casualty Incident.

    Science.gov (United States)

    Wachira, Benjamin W; Abdalla, Ramadhani O; Wallis, Lee A

    2014-10-01

    At approximately 12:30 pm on Saturday September 21, 2013, armed assailants attacked the upscale Westgate shopping mall in the Westlands area of Nairobi, Kenya. Using the seven key Major Incident Medical Management and Support (MIMMS) principles, command, safety, communication, assessment, triage, treatment, and transport, the Aga Khan University Hospital, Nairobi (AKUH,N) emergency department (ED) successfully coordinated the reception and care of all the casualties brought to the hospital. This report describes the AKUH,N ED response to the first civilian mass-casualty shooting incident in Kenya, with the hope of informing the development and implementation of mass-casualty emergency preparedness plans by other EDs and hospitals in Kenya, appropriate for the local health care system.

  8. Unusual Presentation of Dengue Fever; A child with acute myocarditis

    Directory of Open Access Journals (Sweden)

    Moaz Aslam

    2016-02-01

    Full Text Available Dengue fever (DF is an acute febrile illness that follows a self-limiting course. However, some patients suffer from complications, including myocarditis, due to the involvement of other organs. A child presented at the Aga Khan University Hospital in Karachi, Pakistan, in June 2013 with a high-grade fever, malaise and epigastric pain radiating to the chest. Positive DF antigen and immunoglobulin M assays confirmed the diagnosis of DF. Persistent bradycardia with low blood pressure led to further cardiac investigations which showed a decreased ejection fraction and raised serum cardiac enzymes, indicating myocardial damage. With supportive care and use of inotropes, the spontaneous normalisation of cardiac enzyme levels and ejection fraction was observed. The child was discharged five days after admission. This case highlights the importance of identifying myocarditis in DF patients suffering from cardiac symptoms that are not explained by other potential aetiologies. Awareness, early suspicion and supportive care are essential to ensure favourable outcomes.

  9. Content Validity of a Tool Measuring Medication Errors.

    Science.gov (United States)

    Tabassum, Nishat; Allana, Saleema; Saeed, Tanveer; Dias, Jacqueline Maria

    2015-08-01

    The objective of this study was to determine content and face validity of a tool measuring medication errors among nursing students in baccalaureate nursing education. Data was collected from the Aga Khan University School of Nursing and Midwifery (AKUSoNaM), Karachi, from March to August 2014. The tool was developed utilizing literature and the expertise of the team members, expert in different areas. The developed tool was then sent to five experts from all over Karachi for ensuring the content validity of the tool, which was measured on relevance and clarity of the questions. The Scale Content Validity Index (S-CVI) for clarity and relevance of the questions was found to be 0.94 and 0.98, respectively. The tool measuring medication errors has an excellent content validity. This tool should be used for future studies on medication errors, with different study populations such as medical students, doctors, and nurses.

  10. Frequency of thyroid peroxidase antibody and its association with miscarriages among pregnant women

    International Nuclear Information System (INIS)

    Iqbal, S.; Ghani, F.

    2016-01-01

    To measure the frequency of thyroid peroxidase antibody (TPO Ab) among clinically euthyroid pregnant women during first trimester and determine its association with pregnancy outcome as miscarriage or live birth by estimating the relative risk. Study Design: Cohort study. Place and Duration of Study: Section of Chemical Pathology, Department of Pathology and Laboratory Medicine and the Gynaecology and Obstetric outpatient clinics of the Aga Khan University Hospital, Karachi, from July to December 2012. Methodology: The study subjects comprised of apparently euthyroid pregnant women, who were tested for TPO Ab during first trimester of pregnancy and followed till pregnancy outcomes. Pregnancy outcome was noted and relative risk was determined. Results: TPO Ab was found positive in 127 (13.5%) pregnant women from a cohort of 943 subjects. A 2.03% increased risk of miscarriages was observed in TPO Ab positive subjects. Conclusion: There was a positive association of presence of presence of TPO Ab with loss pregnancy. (author)

  11. Feminist pedagogy: a framework for nursing education?

    Science.gov (United States)

    Hezekiah, J

    1993-02-01

    This article describes the feminist pedagogical strategies used in a nursing course in the post-RN Bachelor of Science in Nursing (BScN) program, Aga Khan University, Karachi, Pakistan. A variety of concepts that have direct relevance for nurses were discussed within small groups. These settings provided the venue for an examination of the issues that nurses, as primarily female, face in a patriarchal Muslim society and an androcentric health care system. Emphasis is on the process used in terms of feminist pedagogical practices and its relationship to feminist theory and critical pedagogy. The five process goals suggested by Schniedewind (1983) formed the basis for an exploration of this relationship through an analysis of the content and practices used in the course. It is demonstrated that the teaching practices advocated by feminist pedagogy hold much promise for nursing education to empower nurses and to make an impact on the health care system.

  12. Remission of Grave's disease after oral anti-thyroid drug treatment.

    Science.gov (United States)

    Ishtiaq, Osama; Waseem, Sabiha; Haque, M Naeemul; Islam, Najmul; Jabbar, Abdul

    2009-11-01

    To evaluate remission rate of anti-thyroid drug treatment in patients with Grave's disease, and to study the factors associated with remission. A cross sectional study. The Endocrine Department of the Aga Khan University Hospital, Karachi from 1999 to 2000. Seventy four patients of Grave's disease were recruited who were prescribed medical treatment. Grave's disease was diagnosed in the presence of clinical and biochemical hyperthyroidism along with anti-microsomal (AMA) and anti-thyroglobulin antibodies (ATA) and thyroid scan. These patients were prescribed oral anti-thyroid drugs using titration regime and followed at 3, 6, 12 and 18 months. Patients were categorized into two groups: "remission group" and "treatment failure group" and results were compared using a chi-square test, t-test and logistic regression model with significance at p disease on initial presentation.

  13. Viagens, tremores e conchas: aspectos da natureza da América em escritos de José Bonifácio de Andrada e Silva, José Hipólito Unanúe e Dámaso Antonio Larrañaga

    Directory of Open Access Journals (Sweden)

    Maria Margaret Lopes

    Full Text Available Este artigo apresenta aspectos da produção científica de três ilustrados que atuaram na América do Sul: José Bonifácio de Andrada e Silva (1763-1838, José Hipólito Unanúe (1755-1833 e Dámaso Antonio Larrañaga (1771-1848. Os três naturalistas - de trajetórias, territórios e crenças diferenciadas - construíram suas versões sobre aspectos da natureza da América. Em comum, contribuíram com seus trabalhos científicos para a construção da geohistória americana. Foram escolhidos para análise por critérios de dispersão territorial e por suas diferentes abordagens sobre aspectos específicos das Ciências da Terra - temas que ainda hoje têm merecido menor atenção, mesmo entre os historiadores latino-americanos das ciências. Este artigo argumenta que estes personagens não só construíram seus próprios conhecimentos sobre temperamentos (climas e territórios, como também utilizaram seu conhecimento científico no implemento de ações políticas para os seus respectivos países em conformação.

  14. Pola Spasial Permukiman Tradisional Bali Aga di Desa Sekardadi, Kintamani

    Directory of Open Access Journals (Sweden)

    Ni Ketut Agusintadewi

    2017-03-01

    Full Text Available The Bayung Gede village has derived smaller traditional settlements around Kintamani. Sekardadi is one of these settlements that has an inherent consociates with the village of origin, or the Bayung Gede. Despite the fact that the Sekardadi has a uniqueness on spatial pattern and house lay out, this village has not been welldocumented as an old village in Bali. These uniqueness are interesting to be indepth explored. It is not only on the basic philosophy of the house pattern, but also how this pattern to be physical implemented. This study aims to describe some characteristics of the village, both physical and nonphysical aspects, through the way of descriptive exploratory qualitative approach. According to the theory housing pattern of Habraken (1978 and Turgut (2001, research variables are determined into three variables: 1 Cultural setting; 2 Behavioural setting; and 3 Spatial setting. The result shows that macro spatial pattern of the Sekardadi village is divided into three zones: 1 Utama Mandala locates in the north of the village; 2 Madya Mandala is in the middle of the village, and 3 Nista Mandala in the south. Spatial pattern follows the hulu-teben conception or linear pattern with the main road as a cardinal orientation. Higher land means a sacred area (parahyangan that is characterized by the existence of Pura Puseh. Meanwhile, the opposite is defined as a profane area (palemahan with the presence of graves; and in the middle is the settlement (pawongan. Keywords: spatial pattern; traditional settlement; Sekardadi village

  15. Elu on muinasjutuline, aga muinasjutt ei ole / Neeme Korv

    Index Scriptorium Estoniae

    Korv, Neeme, 1974-

    2005-01-01

    Koguperefilm "Lemony Snicket sari õnnetuid lugusid" ("Lemony Snicket's A Series of Unfortunate Events") : režissöör Brad Silberling : Ameerika Ühendriigid 2004. Lisatud kommentaarid kirjastaja Leelo Märjamaalt ja toimetaja Rein Põderilt

  16. Efektiivne, aga mitte väga innovatiivne / Villu Zirnask

    Index Scriptorium Estoniae

    Zirnask, Villu, 1966-

    2006-01-01

    World Economic Forumi (WEF) hinnangul kuulub Eesti nende üheksa riigi hulka, mis on teel efektiivsusel põhinevast arengustaadiumist innovatsioonil põhinevasse staadiumi. Eesti kohast WEF-i konkurentsivõime edetabelis. Lisad: Eesti innovatsiooninäitajad võrreldes Euroopa Liidu keskmise tasemega; Innovatsioon: Eesti 2014. aasta eesmärgid. Tabel

  17. Mazda6 - moodne, aga kisub riidu / Taivo Paju

    Index Scriptorium Estoniae

    Paju, Taivo, 1968-

    2003-01-01

    Suur osa Mazda6 edus on kindlasti reklaamiagentuuri Rapp Collins turunduskampaanial, leiab autor. Artikli aluseks on Rapp Collins Eesti tegevdirektori Anu Brümmeli ettekanne turunduskonverentsil Password 2003.

  18. Optimism kasvab, aga head ajad ei tule tagasi? / Stan Nahkor

    Index Scriptorium Estoniae

    Nahkor, Stan

    2011-01-01

    Heaoluühiskondadesse jõuab üha selgemini arusaamine, et eluiga pikeneb ja rahvastik vananeb, levib ka ebakindlus riiklike pensionide jätkusuutlikkuse suhtes. Seda ilmestab hoiuste mahu järjekindel kasv. Pankade probleemiks on peale vähenevate tulude ka suurenev valitsussektori sekkumine

  19. Hiilgav, aga... vol.2 / Alar Niineväli

    Index Scriptorium Estoniae

    Niineväli, Alar

    2008-01-01

    Ameerika telesarjad, mis on heatasemelised, kuid tootjate poolt liiga vara ära lõpetatud, enamasti kasumlikkusest lähtudes : "Action" (1999), "Now and Again" (1999), "Firefly" (2002), "Freaks and Geeks" (1999), "Undeclared" (2001)

  20. Pension tõuseb - aga edasi? / Eiki Nestor

    Index Scriptorium Estoniae

    Nestor, Eiki, 1953-

    2008-01-01

    Pensionide uuest indekseerimise korrast. Ilmunud ka Nädaline 20. märts 2008, lk. 4 ; Valgamaalane 20. märts 2008, lk. 2 ; LõunaLeht 20. märts 2008, lk. 4 ; Põhjarannik 20. märts 2008, lk. 4 ; Võrumaa Teataja 25. märts 2008, lk. 2 ; Vali Uudised 26. märts 2008, lk. 2 ; Sõnumitooja 26. märts 2008, lk. 6 ; Meie Maa 25. märts 2008, lk. 2 ; Lääne Elu 25. märts 2008, lk. 2 ; Kuulutaja 28. märts 2008, lk. 4 ; Türi Rahvaleht 28. märts 2008, lk. 4 ; Oma Saar 28. märts 2008, lk. 5 ; Vooremaa 22. märts 2008, lk. 2 ; Pärnu Postimees 27. märts 2008, lk. 15 ; Narva Postiljon 5. aprill 2008, lk. 2 ; Videvik 3. aprill 2008, lk. 2 ; Virumaa Teataja 8. aprill 2008, lk. 11 ; Nädalaleht 20. märts 2008, lk. 5

  1. Kõik, millest on raske loobuda (aga peab) / Mark Earls

    Index Scriptorium Estoniae

    Earls, Mark

    2003-01-01

    Katkend raamatust "Welcome to creative age. Bananas, Business and Death of Marketing", milles autor seab kahtluse alla mitmed turundusega seotud käibetõed, kutsub üles neist loobuma ja võtma suuna loovusele. Vt. ka: Sissejuhatuse asemel

  2. Õõvafilm on fun, aga mitte ainult / Tiina Lokk

    Index Scriptorium Estoniae

    Lokk, Tiina, 1955-

    2006-01-01

    PÖFF-i abiga toimub Haapsalus õudusfilmide festival. Selle sissejuhatuseks annab T. Lokk pikema sissevaate õudusfilmi kui žanri kujunemisse ja väärtustesse. Lisatud festivalil näidatavate filmide nimekiri

  3. Breast imaging reports for malignant lesions: are we maintaining recommended BI-RADS® lexicon standards?

    International Nuclear Information System (INIS)

    Masroor, Imrana; Azeemuddin, Muhammad; Sakhawat, Saima; Beg, Madiha; Sohail, Saba; Ahmed, Rashid; Irfan-Ul-Haq; Mehboob, Javed

    2012-01-01

    The purpose of this study was to evaluate mammography reports for diagnosed breast cancer cases in major government and private centers in Karachi, Pakistan, with respect to concordance with the Breast Imaging Reports And Data System (BI-RADS ® ) lexicon. A prospective, descriptive, multicenter study was conducted in the radiology sections of the Aga Khan University Hospital, Pakistan Naval Station Shifa Hospital, Advanced Radiology Clinic, Karachi Institute of Radiotherapy and Nuclear Medicine, and Civil Hospital Karachi between May and October 2010 after approval from the ethical review committee of Aga Khan University. Mammograms reported as BI-RADS category 4 and 5 were included in the study. Mammograms reported as BI-RADS category 0, 1, 2 and 3 were excluded. Fifty reports were collected from each center. Data were collected about the clinical indication, breast density, location and description of the lesion, calcification, and comments on axillary lymph nodes. This description was compared with the BI-RADS lexicon. The mean age of the patients was 50 ± 12 years. The clinical indication, breast parenchymal density, lesion location, and presence of calcification were better described by the private centers, while description of lymph node status was better stated by the government centers. This difference was statistically significant, except for lesion description. The description of masses by the two reporting groups was comparable. Mammographic reporting of malignant breast lesions in the private sector is more in line with the BI-RADS lexicon, as compared with government sector hospitals in Karachi, Pakistan. Lymph node documentation was better in government sector reports

  4. Fourth-generation spinal instrumentation: experience with adolescent idiopathic scoliosis at a tertiary care hospital in Pakistan.

    Science.gov (United States)

    Fazal, Akil; Lakdawala, Riaz H

    2012-01-01

    To evaluate the radiological and functional outcome of surgical treatment of adolescent idiopathic scoliosis using fourth-generation posterior spinal instrumentation at The Aga Khan University, Karachi, Pakistan. Case series. The Aga Khan University Hospital after a minimum of 2 years postoperatively. A total of 20 patients with adolescent idiopathic scoliosis were recruited into the study and evaluated for radiological and functional outcome. The study period was from 2000 to 2005. Radiological outcome was assessed using Cobb angle measurement pre and postoperatively, hence assessing percentage correction. The lower instrumented vertebra was taken as the neutral vertebra and the level was recorded. Functional outcome was determined using the Scoliosis Research Society patient administered questionnaire. All patients were called to the clinic and asked to fill in the form. Those patients who were out of the city were mailed the forms and requested via telephone to complete and return. Of the 20 patients operated on, twelve were female and eight were male. The average age at operation was 12.7 years. The mean Cobb angle was 69° preoperatively and 20° postoperatively, representing a percentage correction of 71%. The average duration of follow-up was 3.6 years. There was one major complication involving neurological injury post-op and two minor complications involving wound infection. The average Scoliosis Research Society score (on a scale of 1-5, with 5 being best) for pain was 4.5, self-image was 4.2, functional status was 4.1, mental status was 3.8, and satisfaction was 4.4. There was no relationship between the percentage correction of scoliosis and the functional outcome. Those patients with a high preoperative Cobb angle tended to have a better outcome for functional and mental status postoperatively. There was no relation between the lower instrumented vertebra and functional outcome. In the correct indications, fourth-generation posterior instrumentation

  5. Frequency of colistin and fosfomycin resistance in carbapenem-resistant Enterobacteriaceae from a tertiary care hospital in Karachi

    Directory of Open Access Journals (Sweden)

    Qamar S

    2017-07-01

    Full Text Available Salima Qamar, Najma Shaheen, Sadia Shakoor, Joveria Farooqi, Kauser Jabeen, Rumina Hasan Clinical Microbiology, Department of Pathology And Laboratory Medicine, Aga Khan University Hospital, Karachi, Pakistan Introduction: Management of infections with carbapenem-resistant Enterobacteriaceae (CRE is challenging. In recent times, agents such as colistin and fosfomycin have been used in combination with other antibiotics to treat such infections. In this study, we aim to seek frequency of colistin and fosfomycin resistance in CRE from Pakistan.Methods: This study was conducted at clinical laboratories, Aga Khan University Hospital. In total, 251 CRE were included in the study. Colistin minimum inhibitory concentrations (MICs were performed using broth microdilution (BMD method and VITEK® 2 system, whereas fosfomycin susceptibility was performed using Kirby–Bauer method. MIC50 and MIC90 were calculated for colistin and agreement between VITEK and BMD was also calculated.Results: Out of 251 strains colistin MIC of ≥4 µg/mL was seen in 40 (15.9%. Of these strains 20 (50% were Klebsiella pneumoniae. Colistin MIC50 and MIC90 were found to be 0.5 and 16 µg/mL, respectively. BMD and VITEK 2 showed 100% categorical agreement. Essential agreement was 88.5% with kappa score 0.733 indicating strong agreement between VITEK and BMD. 31 out of 251 (12.3% CREs were resistant to fosfomycin.Conclusion: Study shows frequency of colistin and fosfomycin resistance to be 15.9% and 12.3%, respectively. In countries where rate of CREs is high, emerging resistance against these last resort antibiotics is alarming as it leaves clinicians with almost no options to manage such multidrug resistant and extensively drug resistant infections. Keywords: emerging drug resistance, colistin resistance, fosfomycin resistance, carbapenam resistant enterobacteriaceae, salvage antibiotics 

  6. The Global University Press

    Science.gov (United States)

    Dougherty, Peter J.

    2012-01-01

    The modern world's understanding of American university press has long been shaped by university-press books. American university-press books are good international advertisements for the universities whose logos grace their spines. The growth of transnational scholarship and the expansion of digital communications networks are converging in ways…

  7. Enlistment Propensities of University Students

    National Research Council Canada - National Science Library

    Moskos, Charles

    2004-01-01

    Enlistment propensities of undergraduates were assessed through surveys conducted at Northwestern University, University of Arizona, University of California-Los Angeles, and University of Illinois-Chicago...

  8. Religious Citizenship: The Case of the Globalised Khoja

    African Journals Online (AJOL)

    based economic development in emerging economies. ... also as the 'Aga Khan'; at stake was access to the caste's extensive trading networks and .... the Khōjā represent a new facet of Muslim global citizenship through the continuing evolution ..... The rise of HIV-AIDS epidemic in Tanzania in 1990s was quickly responded.

  9. Improving Early-Grade Literacy in East Africa: Experimental Evidence from Kenya and Uganda

    Science.gov (United States)

    Lucas, Adrienne M.; McEwan, Patrick J.; Ngware, Moses; Oketch, Moses

    2014-01-01

    Primary school enrollments have increased rapidly in sub-Saharan Africa, spurring concerns about low levels of learning. We analyze field experiments in Kenya and Uganda that assessed whether the Reading to Learn intervention, implemented by the Aga Khan Foundation in both countries, improved early-grade literacy as measured by common assessments.…

  10. Antisecretory and analgesic activities of Terminalia bellerica

    African Journals Online (AJOL)

    STORAGESEVER

    2010-05-03

    May 3, 2010 ... medicine to treat asthma, cancer, colic, diarrhea, dysuria, headache, hypertension ... mice (20 - 25 g) of either sex and local breed were housed at the animal house of the Aga Khan .... J. Food Drug Anal. 16: 6-14. Koster R ...

  11. Endoscopic variceal band ligation: a local experience | Jani | East ...

    African Journals Online (AJOL)

    Objective: To evaluate the results of endoscopic variceal band ligation (EVBL) in the local set-up. Design: Retrospective analysis of data of all patients who had EVBL. Setting: Patients having EVBL at the office endoscopy suite. The Nairobi Hospital, the Aga Khan Hospital and M.P Shah Hospital. Methods: The varices were ...

  12. Managing opium: Policy choices for Afghanistan | IDRC ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    2011-01-27

    Jan 27, 2011 ... The role of the International Development Research Centre (IDRC) is not ... Under the sponsorship of various agencies, including Aga Khan Development Network and ... busy in the poppy fields, were free to seek wage labour in the city. ... producing opium for medicinal purposes — Australia, France, India, ...

  13. Whither the African University

    African Journals Online (AJOL)

    Sam

    reform. 1. Associate Professor, Department of Philosophy, Addis Ababa University ..... reduce African universities to virtually vocational schools. The World ..... theories, established institutions, and widely held beliefs according to the cannons ...

  14. Origin (?) of the Universe

    Indian Academy of Sciences (India)

    cal models of the universe are based on the idea, which is supported by ... Only the continuous distribution was clearly ... displaced from their natural locations, their observed wave- .... universe? Mathematical Models: Basic Assumptions.

  15. The Alien University

    DEFF Research Database (Denmark)

    Bengtsen, Søren Smedegaard

    2018-01-01

    - they are alien. The conditions of universities today is not one of crisis and upheaval, as with the postmodern universities, it is one of night travel and exile. The alien university leaves behind the epistemological skirmishes of the postmodern university with all its rhetoric and knowledge activism. Thinking...... in the alien university is a move into a whirlpool of nothingness, a “nocturnal space”, where “[d]arkness fills it like a content; it is full, but full of the nothingness of everything.” (Levinas, 2001, p.53). In the alien university thinking is not situated, and instead of rhizomes, and assemblages of thought......, there is merely an imposing and nightly “swarming of points.” (ibid.). There is no place for the alien university, and exactly this exile of thought makes possible the move beyond postmodernism and the mentality of political crisis. The alien university is not in the future as such, but it is not entirely...

  16. Gambling with the Universe

    Science.gov (United States)

    Hawking, Stephen

    2002-05-01

    This is an excerpt from Stephen Hawking's book The Universe in a Nutshell. Roger Penrose and Stephen Hawking, Lucasian Professor of Mathematics at the University of Cambridge, were able to show that Einstein's General Theory of Relativity implied that the universe and time itself must have had a beginning in a tremendous explosion. The discovery of the expansion of the universe is one of the great intellectual revolutions of the twentieth century.

  17. Inflation in the Universe

    International Nuclear Information System (INIS)

    Barrow, J.D.; California Univ., Berkeley; Turner, M.S.; Chicago Univ., IL

    1981-01-01

    The problems of explaining the observed isotropy, homogeneity, flatness and specific entropy of the Universe are discussed in the context of an inflationary Universe which has recently been suggested. It is shown that the isotropy cannot be ignored as a Universe with a large amount of anisotropy will not undergo the inflationary phase. A Universe with only moderate anistropy will undergo inflation and will be rapidly isotropized. (U.K.)

  18. Entrepreneurship in Finnish Universities

    Science.gov (United States)

    Nurmi, Piia; Paasio, Kaisu

    2007-01-01

    Purpose: The purpose of this paper is to discuss the role of universities in fostering and promoting entrepreneurship in Finland. In particular it seeks to examine the university-entrepreneurship relationship: its nature and how universities are addressing the entrepreneurship agenda. Design/methodology/approach: The paper is based on a large…

  19. Our Particle Universe

    Indian Academy of Sciences (India)

    and “why is the universe the way it is?” Not long before ... to each other. The interactions of particles in the universe ... theory by Jean Perrin in 1908 convinced people that atoms and ..... ing the origin and evolution of our universe13. This is an ...

  20. Hybrid Universities in Malaysia

    Science.gov (United States)

    Lee, Molly; Wan, Chang Da; Sirat, Morshidi

    2017-01-01

    Are Asian universities different from those in Western countries? Premised on the hypothesis that Asian universities are different because of hybridization between Western academic models and local traditional cultures, this paper investigates the hybrid characteristics in Malaysian universities resulting from interaction between contemporary…

  1. Establishing a University Foundation.

    Science.gov (United States)

    Lemish, Donald L.

    A handbook on how to establish a university foundation is presented. It presupposes that a foundation will be used as the umbrella organization for receiving all private gifts, restricted and unrestricted, for the benefit of a public college or university; and hence it chiefly addresses readers from public colleges and universities. Information is…

  2. The University Culture

    Science.gov (United States)

    Simplicio, Joseph

    2012-01-01

    In this article the author discusses the role university culture can play on a campus and how it can impact policy and practice. The article explores how a university's history, values, and vision form its culture and how this culture in turn affects its stability and continuity. The article discusses how newcomers within the university are…

  3. Motivating University Researchers

    NARCIS (Netherlands)

    Hendriks, P.H.J.; Alves de Sousa, C.A.

    2008-01-01

    This paper presents an empirical investigation into how universities approach the need and means for motivating university researchers through their management practices. The role of work motivation for this group deserves attention because pressures from outside and within the universities are said

  4. A Universal Reactive Machine

    DEFF Research Database (Denmark)

    Andersen, Henrik Reif; Mørk, Simon; Sørensen, Morten U.

    1997-01-01

    Turing showed the existence of a model universal for the set of Turing machines in the sense that given an encoding of any Turing machine asinput the universal Turing machine simulates it. We introduce the concept of universality for reactive systems and construct a CCS processuniversal...

  5. The early universe

    International Nuclear Information System (INIS)

    Steigman, G.

    1989-01-01

    The author discusses the physics of the early universe: the production and survival of relics from the big bang. The author comments on relic WIMPs as the dark matter in the universe. The remainder of this discussion is devoted to a review of the status of the only predictions from the early evolution of the universe that are accessible to astronomical observation: primordial nucleosynthesis

  6. Dropout Phenomena at Universities

    DEFF Research Database (Denmark)

    Larsen, Michael Søgaard; Kornbeck, Kasper Pihl; Kristensen, Rune

    Dropout from university studies comprises a number of complex phenomena with serious complex consequences and profound political attention. Further analysis of the field is, therefore, warranted. Such an analysis is offered here as a systematic review which gives answers based on the best possible...... such dropout phenomena occur at universities? What can be done by the universities to prevent or reduce such dropout phenomena?...

  7. Antimatter in the universe

    Science.gov (United States)

    Stigman, G.

    1973-01-01

    The means of detecting the presence of antimatter in the universe are discussed. Both direct, annihilation processes, and indirect, cosmic ray particles, were analyzed. All results were negative and it was concluded that no antimatter exists, if the universe is in fact symmetric. If the universe is not symmetric then matter and antimatter are well separated from each other.

  8. Universities as Development Hubs

    DEFF Research Database (Denmark)

    Hansen, Jens Aage; Lindegaard, Klaus; Lehmann, Martin

    2005-01-01

    Capacity-building in environment and development has been implemented and tested over the last decade through university and university consortia networking. Universities from Africa (Botswana and South Africa), Asia (Malaysia and Thailand), Central America (Costa Rica, El Salvador and Nicaragua...

  9. The inflationary universe

    International Nuclear Information System (INIS)

    Guth, A.; Steinhardt, P.

    1993-01-01

    According to the inflationary model, the universe had a brief period of extraordinary rapid expansion, or inflation, during which its diameter increased by a factor at least 10 25 times larger (and perhaps much larger still) than had been previously thought. All the matter and energy in the universe could have been created from virtually nothing. Features of this article are: comparison of standard and inflationary modes, the horizon problem, the geometry of the universe, spontaneous symmetry breaking and the Higgs mechanism (energy density of the Higgs fields), the flatness problem, the new inflationary universe (new Higgs fields and false vacuum), conserved quantities in the universe. 12 figs., 11 refs

  10. The inflationary universe

    International Nuclear Information System (INIS)

    Linde, A.D.

    1984-01-01

    According to the inflationary universe scenario the universe in the very early stages of its evolution was exponentially expanding in the unstable vacuum-like state. At the end of the exponential expansion the energy of the unstable vacuum transforms into the energy of hot dense matter. Recently it was realised that the exponential expansion of the universe naturally occurs in a wide class of realistic theories of elementary particles. The inflationary universe scenario makes it possible to obtain a simple solution to many longstanding cosmological problems and leads to a crucial modification of the standard point of view of the large-scale structure of the universe. (author)

  11. The expanding universe

    CERN Document Server

    Lew, Kristi

    2011-01-01

    People have always been fascinated with the stars above and the universe that contains them. Over the years, astronomers have developed numerous theories to explain how the universe began, how it works, and what its ultimate fate will be. But all of the scientists' questions are far from answered. The Expanding Universe goes beyond the creation of the universe to explain how scientists think the universe works, grows, and changes, including what great thinkers Isaac Newton and Albert Einstein had to say about its fate. Readers will also learn about how researchers are slowly shedding light on

  12. The universe a biography

    CERN Document Server

    Gribbin, John

    2008-01-01

    The Universe: A Biography makes cosmology accessible to everyone. John Gribbin navigates the latest frontiers of scientific discovery to tell us what we really know about the history of the universe. Along the way, he describes how the universe began; what the early universe looked like; how its structure developed; and what emerged to hold it all together. He describes where the elements came from; how stars and galaxies formed; and the story of how life emerged. He even looks to the future: is the history of the universe going to end with a Big Crunch or a Big Rip.

  13. A lightweight universe?

    Science.gov (United States)

    Bahcall, Neta A.; Fan, Xiaohui

    1998-01-01

    How much matter is there in the universe? Does the universe have the critical density needed to stop its expansion, or is the universe underweight and destined to expand forever? We show that several independent measures, especially those utilizing the largest bound systems known—clusters of galaxies—all indicate that the mass-density of the universe is insufficient to halt the expansion. A promising new method, the evolution of the number density of clusters with time, provides the most powerful indication so far that the universe has a subcritical density. We show that different techniques reveal a consistent picture of a lightweight universe with only ∼20–30% of the critical density. Thus, the universe may expand forever. PMID:9600898

  14. Antisecretory and analgesic activities of Terminalia bellerica | Khan ...

    African Journals Online (AJOL)

    This study describes the antisecretory and analgesic activities of the crude extract of Terminalia bellerica (Tb.Cr). T. bellerica extract inhibited the castor oil-induced intestinal fluid secretion in mice at the dose range of 300 - 1000 mg/kg. The extract also dose-dependently (50 - 100 mg/kg) reduced the numbers of acetic ...

  15. Current trends in chloroplast genome research | Khan | African ...

    African Journals Online (AJOL)

    comprise of DOGMA for annotation, SCAN-SE, ARAGON and PREP suit for RNA analyses and CG viewer for circular map construction/comparative analysis. Faster algorithms for gene-order based phylogenetic reconstruction and bootstrap analysis have attracted the attention of research community. Current trends in ...

  16. Multi-phase alternative current machine winding design | Khan ...

    African Journals Online (AJOL)

    ... single-phase to 18-phase excitation. Experimental results of a five-phase induction machine supplied from a static five-phase supply are provided to support the proposed design. Keywords: AC machine, Multi-phase machine, Stator winding, Five-phase. International Journal of Engineering, Science and Technology, Vol.

  17. On a Theorem of Khan in a Generalized Metric Space

    Directory of Open Access Journals (Sweden)

    Jamshaid Ahmad

    2013-01-01

    Full Text Available Existence and uniqueness of fixed points are established for a mapping satisfying a contractive condition involving a rational expression on a generalized metric space. Several particular cases and applications as well as some illustrative examples are given.

  18. A case of extensive synovial involvement by tophaceous gout | Khan ...

    African Journals Online (AJOL)

    Gout is the most common form of microcrystal arthropathy that results in deposition of uric acid crystals in and around the joints and soft tissues. The most common cause is decreased uric acid clearance by the kidneys. The radiological manifestations of gout are generally well known and have remained unchanged.

  19. The A. Q. Khan Network: Causes and Implications

    National Research Council Canada - National Science Library

    Clary, Christopher O

    2005-01-01

    .... For the first time in history, all of the keys to a nuclear weapon -- the supplier networks, the material, the enrichment technology, and the warhead designs -- were outside of state oversight and control...

  20. Pleural Tuberculosis and its Treatment Outcomes | Khan | Tropical ...

    African Journals Online (AJOL)

    Purpose: To evaluate the incidence, treatment and clinical outcomes of tuberculosis pleuritis at a hospital in the state of Penang, Malaysia. Methods: A retrospective study was conducted in Hospital of Penang, Malaysia. Patient records were reviewed retrospectively to identify patients with confirmed diagnosis of tuberculous ...

  1. Letter to the Editor | Khan | Annals of Pediatric Surgery

    African Journals Online (AJOL)

    Annals of Pediatric Surgery. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home > Vol 12, No 4 (2016) >. Log in or Register to get access to full text downloads. Username, Password, Remember me, or Register · Download this PDF file. The PDF file you selected should load ...

  2. Universities scale like cities.

    Directory of Open Access Journals (Sweden)

    Anthony F J van Raan

    Full Text Available Recent studies of urban scaling show that important socioeconomic city characteristics such as wealth and innovation capacity exhibit a nonlinear, particularly a power law scaling with population size. These nonlinear effects are common to all cities, with similar power law exponents. These findings mean that the larger the city, the more disproportionally they are places of wealth and innovation. Local properties of cities cause a deviation from the expected behavior as predicted by the power law scaling. In this paper we demonstrate that universities show a similar behavior as cities in the distribution of the 'gross university income' in terms of total number of citations over 'size' in terms of total number of publications. Moreover, the power law exponents for university scaling are comparable to those for urban scaling. We find that deviations from the expected behavior can indeed be explained by specific local properties of universities, particularly the field-specific composition of a university, and its quality in terms of field-normalized citation impact. By studying both the set of the 500 largest universities worldwide and a specific subset of these 500 universities--the top-100 European universities--we are also able to distinguish between properties of universities with as well as without selection of one specific local property, the quality of a university in terms of its average field-normalized citation impact. It also reveals an interesting observation concerning the working of a crucial property in networked systems, preferential attachment.

  3. Universities scale like cities.

    Science.gov (United States)

    van Raan, Anthony F J

    2013-01-01

    Recent studies of urban scaling show that important socioeconomic city characteristics such as wealth and innovation capacity exhibit a nonlinear, particularly a power law scaling with population size. These nonlinear effects are common to all cities, with similar power law exponents. These findings mean that the larger the city, the more disproportionally they are places of wealth and innovation. Local properties of cities cause a deviation from the expected behavior as predicted by the power law scaling. In this paper we demonstrate that universities show a similar behavior as cities in the distribution of the 'gross university income' in terms of total number of citations over 'size' in terms of total number of publications. Moreover, the power law exponents for university scaling are comparable to those for urban scaling. We find that deviations from the expected behavior can indeed be explained by specific local properties of universities, particularly the field-specific composition of a university, and its quality in terms of field-normalized citation impact. By studying both the set of the 500 largest universities worldwide and a specific subset of these 500 universities--the top-100 European universities--we are also able to distinguish between properties of universities with as well as without selection of one specific local property, the quality of a university in terms of its average field-normalized citation impact. It also reveals an interesting observation concerning the working of a crucial property in networked systems, preferential attachment.

  4. University of Maryland MRSEC - Collaborations

    Science.gov (United States)

    . University of Maryland Materials Research Science and Engineering Center Home About Us Leadership , National Nanotechnology Lab, Neocera, NIST, Rowan University, Rutgers University, Seagate, Tokyo Tech

  5. Rectors of European universities

    CERN Multimedia

    Maximilien Brice

    2003-01-01

    Several rectors of European universities visited CERN recently while in Geneva for a conference on coordination between their institutions. The visit began with a welcome by Roger Cashmore, CERN Director of Collider Programmes,and continued with tours of CMS, ALICE and the LHC magnet assembly hall. Photos 01, 02: The visitors in the ALICE assembly hall: (left to right) Dr. Raymond Werlen, Deputy Secretary-General of the Conference of Rectors of Swiss Universities; visit guide Prof. Alain Blondel, Department of Nuclear and Corpuscular Physics, University of Geneva; Prof. Adriano Pimpão, Rector of the University of Algarve, President of the Council of Rectors of Portuguese Universities; Prof. Jean-Pierre Finance, Conference of University Presidents, France; Prof. Jean-Paul Lehners, Vice-President of the Centre Universitaire, Luxemburg.

  6. Universities as Research Partners

    OpenAIRE

    Hall, Bronwyn; Link, Albert; Scott, John

    2010-01-01

    Universities are a key institution in the U.S. innovation system, and an important aspect of their involvement is the role they play in public-private partnerships. This note offers insights into the performance of industry-university research partnerships, using a survey of precommercial research projects funded by the Advanced Technology Program. Although results must be interpreted cautiously because of the small size of the sample, the study finds that projects with university involvement...

  7. Geometry of the Universe

    International Nuclear Information System (INIS)

    Gurevich, L.Eh.; Gliner, Eh.B.

    1978-01-01

    Problems of investigating the Universe space-time geometry are described on a popular level. Immediate space-time geometries, corresponding to three cosmologic models are considered. Space-time geometry of a closed model is the spherical Riemann geonetry, of an open model - is the Lobachevskij geometry; and of a plane model - is the Euclidean geometry. The Universe real geometry in the contemporary epoch of development is based on the data testifying to the fact that the Universe is infinitely expanding

  8. University Advertising and Universality in Messaging

    Science.gov (United States)

    Diel, Stan R.; Katsinas, Stephen

    2018-01-01

    University and college institutional advertisements, which typically are broadcast as public service announcements during the halftime of football games, were the subject of a quantitative analysis focused on commonality in messaging and employment of the semiotic theory of brand advertising. Findings indicate advertisements focus on students'…

  9. From Universal Access to Universal Proficiency.

    Science.gov (United States)

    Lewis, Anne C.

    2003-01-01

    Panel of five education experts--Elliot Eisner, John Goodlad, Patricia Graham, Phillip Schlechty, and Warren Simons--answer questions related to recent school reform efforts, such as the No Child Left Behind Act, aimed at achieving universal educational proficiency. (PKP)

  10. Imagining the Future University

    DEFF Research Database (Denmark)

    Bengtsen, Søren Smedegaard; Barnett, Ronald

    'Imagining the Future University' is a special issue in the journal Philosophy and Theory in Higher Education, published by Peter Lang. Editor in Chief of the journal is John Petrovic, University of Alabama. The speciale issue is edited by Søren Bengtsen and Ronald Barnett.......'Imagining the Future University' is a special issue in the journal Philosophy and Theory in Higher Education, published by Peter Lang. Editor in Chief of the journal is John Petrovic, University of Alabama. The speciale issue is edited by Søren Bengtsen and Ronald Barnett....

  11. Mathematics at University

    DEFF Research Database (Denmark)

    Winsløw, Carl

    2015-01-01

    Mathematics is studied in universities by a large number of students. At the same time it is a field of research for a (smaller) number of university teachers. What relations, if any, exist between university research and teaching of mathematics? Can research “support” teaching? What research...... and what teaching? In this presentation we propose a theoretical framework to study these questions more precisely, based on the anthropological theory of didactics. As a main application, the links between the practices of mathematical research and university mathematics teaching are examined...

  12. University of Washington

    Data.gov (United States)

    Federal Laboratory Consortium — The theme of the University of Washington based Center for Child Environmental Health Risks Research (CHC) is understanding the biochemical, molecular and exposure...

  13. University Technology Transfer

    Directory of Open Access Journals (Sweden)

    Mike Cox

    2004-09-01

    Full Text Available This article describes the experiences and general observations of the author at Heriot-Watt University and concerns the transfer of university technology for the purposes of commercialisation. Full commercial exploitation of a university invention generally requires transferring that technology into the industrial arena, usually either by formation of a new company or licensing into an existing company. Commercialisation activities need to be carried out in unison with the prime activities of the university of research and teaching. Responsibility for commercialising university inventions generally rests with a specific group within the university, typically referred to as the technology transfer group. Each technology transfer should be considered individually and appropriate arrangements made for that particular invention. In general, this transfer process involves four stages: identification, evaluation, protection and exploitation. Considerations under these general headings are outlined from a university viewpoint. A phased approach is generally preferred where possible for the evaluation, protection and exploitation of an invention to balance risk with potential reward. Evaluation of the potential opportunity for a university invention involves essentially the same considerations as for an industrial invention. However, there are a range of commercial exploitation routes and potential deals so that only general guidelines can be given. Naturally, the final deal achieved is that which can be negotiated. The potential rewards for the university and inventor are both financial (via licensing income and equity realisation and non-financial.

  14. Universality in heterogeneous catalysis

    DEFF Research Database (Denmark)

    Nørskov, Jens Kehlet; Pedersen, Thomas Bligaard; Logadottir, Ashildur

    2002-01-01

    Based on an extensive set of density functional theory calculations it is shown that for a class of catalytic reactions there is a universal, reactant independent relation between the reaction activation energy and the stability of reaction intermediates. This leads directly to a universal relati...

  15. Regionalism in Scottish Universities

    Science.gov (United States)

    Hutchison, Dougal

    1976-01-01

    It is well-known that Scottish universities are highly local institutions and that over two-fifth of Scottish university students live at home. Attempts to ascertain if this regionalism has relaxed over the past twenty years with student grant regulations, improvement in communications and the increasing affluence of today's society. (Author/RK)

  16. Reeducation at Heidelberg University.

    Science.gov (United States)

    Giles, Geoffrey J.

    1997-01-01

    Utilizes German archival records to illuminate crucial post-war events at Heidelberg University. The university became the focal point of attempts to define the theoretical and practical meaning of "geistige Umerziehung" (spiritual reeducation). Discusses the conflict between U.S. authorities and such esteemed German scholars as Karl…

  17. Marketing University Outreach Programs.

    Science.gov (United States)

    Foster, Ralph S., Jr., Ed.; And Others

    A collection of 12 essays and model program descriptions addresses issues in the marketing of university extension, outreach, and distance education programs. They include: (1) "Marketing and University Outreach: Parallel Processes" (William I. Sauser, Jr. and others); (2) "Segmenting and Targeting the Organizational Market"…

  18. Universe of constant

    Science.gov (United States)

    Yongquan, Han

    2016-10-01

    The ideal gas state equation is not applicable to ordinary gas, it should be applied to the Electromagnetic ``gas'' that is applied to the radiation, the radiation should be the ultimate state of matter changes or initial state, the universe is filled with radiation. That is, the ideal gas equation of state is suitable for the Singular point and the universe. Maybe someone consider that, there is no vessel can accommodate radiation, it is because the Ordinary container is too small to accommodate, if the radius of your container is the distance that Light through an hour, would you still think it can't accommodates radiation? Modern scientific determinate that the radius of the universe now is about 1027 m, assuming that the universe is a sphere whose volume is approximately: V = 4.19 × 1081 cubic meters, the temperature radiation of the universe (cosmic microwave background radiation temperature of the universe, should be the closest the average temperature of the universe) T = 3.15k, radiation pressure P = 5 × 10-6 N / m 2, according to the law of ideal gas state equation, PV / T = constant = 6 × 1075, the value of this constant is the universe, The singular point should also equal to the constant Author: hanyongquan

  19. Knowledge and the University

    DEFF Research Database (Denmark)

    Barnett, Ronald; Bengtsen, Søren Smedegaard

    for the university and the university’s place in the world. However, that presupposition has taken a battering recently from many directions. With the incorporation of the university more fully into the world, knowledge is no longer seen as valuable in-itself but now is viewed only instrumentally, and has to have...

  20. The deep universe

    CERN Document Server

    Sandage, AR; Longair, MS

    1995-01-01

    Discusses the concept of the deep universe from two conflicting theoretical viewpoints: firstly as a theory embracing the evolution of the universe from the Big Bang to the present; and secondly through observations gleaned over the years on stars, galaxies and clusters.

  1. Understanding University Technology Transfer

    Science.gov (United States)

    Association of American Universities, 2011

    2011-01-01

    Federal government agencies provide about $33 billion a year to universities to conduct scientific research. That continuing investment expands human knowledge and helps educate the next generation of science and technology leaders. New discoveries from university research also form the basis for many new products and processes that benefit the…

  2. Talent Management for Universities

    Science.gov (United States)

    Bradley, Andrew P.

    2016-01-01

    This paper explores human resource management practices in the university sector with a specific focus on talent pools and talent management more generally. The paper defines talent management in the context of the university sector and then explores its interdependence with organisational strategy, the metrics used to measure academic performance…

  3. General Topology of the Universe

    OpenAIRE

    Pandya, Aalok

    2002-01-01

    General topology of the universe is descibed. It is concluded that topology of the present universe is greater or stronger than the topology of the universe in the past and topology of the future universe will be stronger or greater than the present topology of the universe. Consequently, the universe remains unbounded.

  4. The university with conditions

    Directory of Open Access Journals (Sweden)

    José María Ripalda Crespo

    2013-03-01

    Full Text Available The model of the national university is being substituted by that of the global university. At the same time, new dogmas that appear with economic labels are being imposed. All this is accompanied by important cultural changes. The Spanish university was one of the instances that was taken care of by the post-Francoist regime. Now, this regime feels strong against it, and on the other hand this university – as the whole of the productive structure – requires a reform. It is not expected that this reform will go in the direction of the university having more social presence, but rather more presence of companies. It is neither expected that it will imply more internal democracy, but more discipline. All resistance or alternative has to take into account the new situation and join the still dispersed forces that still have, however, a constitutive capacity.

  5. The holographic universe

    CERN Document Server

    Talbot, Michael

    1991-01-01

    'There is evidence to suggest that our world and everything in it - from snowflakes to maple trees to falling stars and spinning electrons - are only ghostly images, projections from a level of reality literally beyond both space and time.' This is the astonishing idea behind the holographic theory of the universe, pioneered by two eminent thinkers: physicist David Bohm, a former protege of Albert Einstein, and quantum physicist Karl Pribram. The holographic theory of the universe encompasses consciousness and reality as we know them, but can also explain such hitherto unexplained phenomena as telepathy, out-of-body experiences and even miraculous healing. In this remarkable book, Michael Talbot reveals the extraordinary depth and power of the holographic theory of the universe, illustrating how it makes sense of the entire range of experiences within our universe - and in other universes beyond our own.

  6. The rotating universe

    International Nuclear Information System (INIS)

    Ruben, G.; Treder, H.J.

    1987-01-01

    For a long time the question whether the universe rotates or not is discussed. Aspects of Huygens, Newton, Mach and other important historical scientists in this field are reported. The investigations of the mathematician Kurt Groedel in order to prove the rotation of the universe are illustrated. Kurt Groedel has shown that Einstein's gravitational equations of general relativity theory and the cosmological postulate of global homogeneity of cosmic matter (that is the Copernical principle) are not contradictionary to a rotating universe. Abberation measurements, position determination by means of radiointerferometry and methods for the determination of the rotation of the universe from the isotropy of the background radiation are presented. From these experiments it can be concluded that the universe seems not to rotate as already Einstein expected

  7. University Performance Management

    DEFF Research Database (Denmark)

    For the last two decades the Danish Universities have felt the impact of the international trend towards implementation of New Public Management. The results are seen in the implementation of new hierarchical governance structures and contractual governance system including market based quantitat......For the last two decades the Danish Universities have felt the impact of the international trend towards implementation of New Public Management. The results are seen in the implementation of new hierarchical governance structures and contractual governance system including market based...... quantitative measurement systems for resource allocation and performance evaluation. Compared to other countries the changes in performance measurements and governance of the Danish universities are radical and the Minister of Science heralded them as "the greatest change in university management since...... the founding of Copenhagen University in 1479". The changes took place with surprisingly little resistance from university scholars. The articles in this anthology investigate the origins and rationales for the silent managerial revolution at Danish Universities and the radical implications for the identity...

  8. Age of the universe

    International Nuclear Information System (INIS)

    Parker, B.

    1981-01-01

    The age of the universe is the time that has elapsed since the Big Bang. To calculate the age, the expansion rate of the universe and distance to the galaxies must be determined. Unfortunately, it appears that the expansion rate is not constant but is decelerating. In the 1920's and 30's, Edwin Hubble set out to estimate the age of universe based on the expansion rate and distance to the galaxies. His method is described along with its flaw. Since that time several others have estimated the age of the universe. Their methods as well as results vary. These are discussed in the article. The ages determined from the various methods range from 10 to 20 billion years. There are two independent ways to determine the age of the universe. What they actually do is determine the age of our galaxy which would give a lower limit to the age of the universe. The first method calculates age of globular clusters which yields as age range from 8 to 18 billion years. The second method involves observing the speed at which radioactive substances decay. This also yields and age greater than 10 billion years. It is clear that there is still a lot of work to do before the true age of the universe can be determied

  9. On universal partial words

    OpenAIRE

    Chen, Herman Z. Q.; Kitaev, Sergey; Mütze, Torsten; Sun, Brian Y.

    2016-01-01

    A universal word for a finite alphabet $A$ and some integer $n\\geq 1$ is a word over $A$ such that every word in $A^n$ appears exactly once as a subword (cyclically or linearly). It is well-known and easy to prove that universal words exist for any $A$ and $n$. In this work we initiate the systematic study of universal partial words. These are words that in addition to the letters from $A$ may contain an arbitrary number of occurrences of a special `joker' symbol $\\Diamond\

  10. Consciousness in the Universe

    Directory of Open Access Journals (Sweden)

    Khalil Chamcham

    2013-07-01

    Full Text Available So far we can identify at least three concepts within modern cosmology that bring into debate the question of consciousness in the universe: 1 Fine Tuning; 2 The Anthropic Principle and 3 The Multiverse. This does not exclude the question of the role of observer (i.e. consciousness in cosmology as developed within Quantum Physics: we observe the universe through quanta and any breakthrough in understanding the origin and nature of the universe will come only through a quantum theory of gravity […

  11. Possible physical universes

    Directory of Open Access Journals (Sweden)

    Gordon McCabe

    2005-12-01

    Full Text Available The purpose of this paper is to discuss the various types of physical universe which could exist according to modern mathematical physics. The paper begins with an introduction that approaches the question from the viewpoint of ontic structural realism. Section 2 takes the case of the 'multiverse' of spatially homogeneous universes, and analyses the famous Collins-Hawking argument, which purports to show that our own universe is a very special member of this collection. Section 3 considers the multiverse of all solutions to the Einstein field equations, and continues the discussion of whether the notions of special and typical can be defined within such a collection.

  12. Universal (Global Evolutionism

    Directory of Open Access Journals (Sweden)

    Arkady Ursul

    2018-02-01

    Full Text Available In this article investigate a general scientific concept of a global (universal evolution, in which selforganization of the material systems acts as a common ground and a permanent process of progressive development in the visible Universe. The main problem of research of this type of evolution is seen as a superhighway trajectory of evolutionary processes in the Universe, in which there is a continuous selforganization of the material systems, ranging from the Big Bang and to the social level of evolution, which may have an indefinite continuation of society and nature

  13. Interaction university and school

    Directory of Open Access Journals (Sweden)

    Gionara Tauchen

    2016-05-01

    Full Text Available Considering that the interaction between universities and middle schools is fundamental for organization and the qualification of the education system, we conducted a qualitative study on twenty public municipal schools of Rio Grande, RS, designed to investigate and understand the effectiveness of university activities (teaching, research and extension in regard to the promotion and strengthening of the interactions between these institutions. We highlight the activities related to Pibid, the Education Observatory, extension, supervised internships, and to undergraduate and postgraduate research. From comprehensions about these activities, we discuss the interaction between school and university.

  14. The intelligent Universe

    International Nuclear Information System (INIS)

    Hoyle, F.

    1983-01-01

    The subject is covered in chapters, entitled: chance and the universe (synthesis of proteins; the 'primordial soup'); the gospel according to Darwin (discussion of Darwin theory of evolution); life did not originate on earth (fossils from space; life in space); the interstellar connection (living dust between the stars; bacteria in space falling to the earth; interplanetary dust); evolution by cosmic control (microorganisms; genetics); why aren't the others here (a cosmic origin of life); after the big bang (big bang and steady state); the information rich universe; what is intelligence up to; the intelligent universe. (U.K.)

  15. ULTRA: Universal Grammar as a Universal Parser.

    Science.gov (United States)

    Medeiros, David P

    2018-01-01

    A central concern of generative grammar is the relationship between hierarchy and word order, traditionally understood as two dimensions of a single syntactic representation. A related concern is directionality in the grammar. Traditional approaches posit process-neutral grammars, embodying knowledge of language, put to use with infinite facility both for production and comprehension. This has crystallized in the view of Merge as the central property of syntax, perhaps its only novel feature. A growing number of approaches explore grammars with different directionalities, often with more direct connections to performance mechanisms. This paper describes a novel model of universal grammar as a one-directional, universal parser. Mismatch between word order and interpretation order is pervasive in comprehension; in the present model, word order is language-particular and interpretation order (i.e., hierarchy) is universal. These orders are not two dimensions of a unified abstract object (e.g., precedence and dominance in a single tree); rather, both are temporal sequences, and UG is an invariant real-time procedure (based on Knuth's stack-sorting algorithm) transforming word order into hierarchical order. This shift in perspective has several desirable consequences. It collapses linearization, displacement, and composition into a single performance process. The architecture provides a novel source of brackets (labeled unambiguously and without search), which are understood not as part-whole constituency relations, but as storage and retrieval routines in parsing. It also explains why neutral word order within single syntactic cycles avoids 213-like permutations. The model identifies cycles as extended projections of lexical heads, grounding the notion of phase. This is achieved with a universal processor, dispensing with parameters. The empirical focus is word order in noun phrases. This domain provides some of the clearest evidence for 213-avoidance as a cross

  16. Risk management at university

    OpenAIRE

    Ivanova, H.; Abramovich, S.

    2013-01-01

    This article observes the basic recommendations for the risk management system in higher education as an example Yanka Kupala State University of Grodno. Consider the risk-management standard that based in a process approach

  17. The hidden universe

    International Nuclear Information System (INIS)

    Disney, M.

    1985-01-01

    Astronomer Disney has followed a somewhat different tack than that of most popular books on cosmology by concentrating on the notion of hidden (as in not directly observable by its own radiation) matter in the universe

  18. Is our Universe typical?

    International Nuclear Information System (INIS)

    Gurzadyan, V.G.

    1988-01-01

    The problem of typicalness of the Universe - as a dynamical system possessing both regular and chaotic regions of positive measure of phase space, is raised and discussed. Two dynamical systems are considered: 1) The observed Universe as a hierarchy of systems of N graviting bodies; 2) (3+1)-manifold with matter evolving to Wheeler-DeWitt equation in superspace with Hawking boundary condition of compact metrics. It is shown that the observed Universe is typical. There is no unambiguous answer for the second system yet. If it is typical too then the same present state of the Universe could have been originated from an infinite number of different initial conditions the restoration of which is practically impossible at present. 35 refs.; 2 refs

  19. The Universe and Life

    Directory of Open Access Journals (Sweden)

    Eduard Kazantsev

    2016-02-01

    Full Text Available This article discusses some of the unsolved problems of modern cosmology, which lead to the need to consider the role of living matter in the evolution of the universe. The author proposes the hy- pothesis of the emergence, in the process of evolution of the universe, “biological vacuum” (physical antipode, which has a purpose of improving physical matter until the appearance of living matter. Substantiates the idea that the “biological vacuum” in the “live” dark matter with the participation of a living organism as an intermediary. The model of a stationary universe, as the local group of galaxies, placed in a halo of “live” dark matter. At the end of the article the author predicts the final evolution of the physical universe (after the collapse of the physical fields and particles as the begin- ning of a new stage of evolution of the “live” dark matter.

  20. Origin (?) of the Universe

    Indian Academy of Sciences (India)

    light nuclei and the microwave background. ... tested by more sophisticated observations. This is what we ... of the universe so long as the observational tests do not disprove it. ... Naturally, in the six and a half decades since Hubble's observa-.

  1. University Presidents: Academic Chameleons

    Science.gov (United States)

    Buxton, Thomas H.; And Others

    1976-01-01

    Sampling the opinions of at least one college or university president in each state and at schools of all sizes, the authors measure the degree of job satisfaction experienced by presidents. (Editor/LBH)

  2. The accidental universe

    International Nuclear Information System (INIS)

    Davies, P.C.W.

    1982-01-01

    Is our universe an accident of nature. The mysterious coincidences underlying the structure and properties of the universe that we inhabit are examined. This is the first book for the non-specialist reader to present in depth the provocative hypothesis that the structure of the physical world is exceedingly contrived in its appearance. A survey is presented of the range of apparently miraculous accidents of nature that have enabled the universe to evolve its familiar structures: atoms, stars, galaxies, and life itself. This book concludes with an investigation of the so-called 'anthropic principle' which postulates that 'miraculous coincidences' are inevitable in any universe containing conscious observers. This thesis of a cosmic biological selection effect will both reassure and enrage readers, the very existence of whom may be related to fine tuning in the laws of physics. (author)

  3. The isotropic Universe

    International Nuclear Information System (INIS)

    Raine, D.J.

    1981-01-01

    This introduction to contemporary ideas in cosmology differs from other books on the 'expanding Universe' in its emphasis on physical cosmology and on the physical basis of the general theory of relativity. It is considered that the remarkable degree of isotropy, rather than the expansion, can be regarded as the central observational feature of the Universe. The various theories and ideas in 'big-bang' cosmology are discussed, providing an insight into current problems. Chapter headings are: quality of matter; expanding Universe; quality of radiation; quantity of matter; general theory of relativity; cosmological models; cosmological tests; matter and radiation; limits of isotropy; why is the Universe isotropic; singularities; evolution of structure. (U.K.)

  4. University of Southern California

    Data.gov (United States)

    Federal Laboratory Consortium — The focus of the University of Southern California (USC) Children''s Environmental Health Center is to develop a better understanding of how host susceptibility and...

  5. The universe strikes back

    International Nuclear Information System (INIS)

    Steigman, G.

    1983-01-01

    The approach to particle physics via cosmology may meet with an obstacle in a series of cosmological puzzles studied in this paper: the flatness-longevity puzzle, the horizon-homogenity puzzle, and the cosmological constant puzzle. An analysis of the geometry and dynamics of the universe leads to an understanding (but not solution) of the flatness-longevity puzzle: possible universes are distinguished by the value of the dimensionless quantity N, the coordinate density of ER particles, such that the longevity of the universe is fixed by N. Universes where nonrelativistic particles dominate are then studied. An inflationary scenario proposed as a solution to these puzzles is studied, but found to have some difficulties

  6. Perelman's Universal Audience.

    Science.gov (United States)

    Ray, John W.

    1978-01-01

    Examines the concept of the universal audience as the basic factor of Chaim Perelman's rhetorical theory and concludes that it is subject to the same criticism as Rousseau's general will and Kant's categorical imperative. (JMF)

  7. Performance Measurement at Universities

    DEFF Research Database (Denmark)

    Lueg, Klarissa

    2014-01-01

    This paper proposes empirical approaches to testing the reliability, validity, and organizational effectiveness of student evaluations of teaching (SET) as a performance measurement instrument in knowledge management at the institutional level of universities. Departing from Weber’s concept...

  8. University related studies

    International Nuclear Information System (INIS)

    Anon.

    1976-01-01

    Over the years, opportunities for terrestrial ecology studies have attracted student researchers associated with Pacific Northwest colleges and universities. During the past year, four students have been involved with undergraduate or graduate thesis projects. Brief descriptions of these studies are included in this section. It is expected that university participation will be enhanced by designating parts of the Hanford Reservation as a National Environmental Research Park (NERP)

  9. Mapping the early Universe

    International Nuclear Information System (INIS)

    Anon.

    1991-01-01

    From its unique vantage point 900 kilometres above the earth's surface, NASA's Cosmic Background Explorer (COBE) satellite has a privileged view of cosmic background radiation - the remnants of the early (radiation-dominated) Universe which followed the Big Bang some ten Gigayears ago, and possibly some subsequent history. In this way astroparticle physicists get a first peek at the quantum cosmology which moulded the infant Universe

  10. The Bright Universe Cosmology

    International Nuclear Information System (INIS)

    Surdin, M.

    1980-01-01

    It is shown that viewed from the 'outside', our universe is a black hole. Hence the 'inside' cosmology considered is termed as the Bright Universe Cosmology. The model proposed avoids the singularities of cosmologies of the Big Bang variety, it gives a good account of the redshifts, the cosmic background radiation, the number counts; it also gives a satisfactory explanation of the 'large numbers coincidence' and of the variation in time of fundamental constants. (Auth.)

  11. The universal access handbook

    CERN Document Server

    Stephanidis, Constantine

    2009-01-01

    In recent years, the field of Universal Access has made significant progress in consolidating theoretical approaches, scientific methods and technologies, as well as in exploring new application domains. Increasingly, professionals in this rapidly maturing area require a comprehensive and multidisciplinary resource that addresses current principles, methods, and tools. Written by leading international authorities from academic, research, and industrial organizations and nonmarket institutions, The Universal Access Handbook covers the unfolding scientific, methodological, technological, and pol

  12. Rotating universe models

    International Nuclear Information System (INIS)

    Tozini, A.V.

    1984-01-01

    A review is made of some properties of the rotating Universe models. Godel's model is identified as a generalized filted model. Some properties of new solutions of the Einstein's equations, which are rotating non-stationary Universe models, are presented and analyzed. These models have the Godel's model as a particular case. Non-stationary cosmological models are found which are a generalization of the Godel's metrics in an analogous way in which Friedmann is to the Einstein's model. (L.C.) [pt

  13. Universal computer interfaces

    CERN Document Server

    Dheere, RFBM

    1988-01-01

    Presents a survey of the latest developments in the field of the universal computer interface, resulting from a study of the world patent literature. Illustrating the state of the art today, the book ranges from basic interface structure, through parameters and common characteristics, to the most important industrial bus realizations. Recent technical enhancements are also included, with special emphasis devoted to the universal interface adapter circuit. Comprehensively indexed.

  14. Mapping the early Universe

    Energy Technology Data Exchange (ETDEWEB)

    Anon.

    1991-06-15

    From its unique vantage point 900 kilometres above the earth's surface, NASA's Cosmic Background Explorer (COBE) satellite has a privileged view of cosmic background radiation - the remnants of the early (radiation-dominated) Universe which followed the Big Bang some ten Gigayears ago, and possibly some subsequent history. In this way astroparticle physicists get a first peek at the quantum cosmology which moulded the infant Universe.

  15. Cultural universals: So what?

    Directory of Open Access Journals (Sweden)

    M. Elaine Botha

    1989-03-01

    Full Text Available The search for the elusive "cultural universal s” in a variety of academic disciplines has been motivated b y the spectre of relativism in its diverse guises. The problem of relativism has been thrust upon us inter alia by the inability of our epistemological models to account for social and cultural, moral and cognitive diversity and to provide us with criteria by means of which to judge aberrations like ideologies. Contrary to the general trend I would like to argue that it is not the spectre of relativism in its various guises which necessitates the search for cultural universals, nor is this the only motivation for a Christian to argue in favour of the recognition of cultural universals. Various authors have suggested that such universal structures do exist; that they condition human and societal behaviour and that it would in principle be possible to construct a theory of these structural universals or a "biogrammar" or "geography ” of the universal cultural acquisition device of humankind (cf. Harre,1976, 32; Johnson, 1987: xxxvii ; Tige r and Fox, 1974:17,30. Cross -cu ltural research in both psychology and anthropology has pointed to the existence of such traits, and in recent philosophical discussions Apel and others have pointed to the necessity of recognizing the existence of some sort of " transcendentalia" . These arguments emphasize elements that are common to diverse approaches to the problem of cultural universals. Christian scholars could accept most of these arguments as valid and yet argue in favour of a very specifically modified version of the notion of cultural universals. This essay attempts to develop such a position.

  16. University contracts summary book

    Energy Technology Data Exchange (ETDEWEB)

    None

    1980-08-01

    The principal objectives of the Fossil Energy Program are to seek new ideas, new data, fundamental knowledge that will support the ongoing programs, and new processes to better utilize the nation's fossil energy resources with greater efficiency and environmental acceptability. Toward this end, the Department of Energy supports research projects conducted by universities and colleges to: Ensure a foundation for innovative technology through the use of the capabilities and talents in our academic institutions; provide an effective, two-way channel of communication between the Department of Energy and the academic community; and ensure that trained technical manpower is developed to carry out basic and applied research in support of DOE's mission. Fossil Energy's university activities emphasize the type of research that universities can do best - research to explore the potential of novel process concepts, develop innovative methods and materials for improving existing processes, and obtain fundamental information on the structure of coal and mechanisms of reactions of coal, shale oil, and other fossil energy sources. University programs are managed by different Fossil Energy technical groups; the individual projects are described in greater detail in this book. It is clear that a number of research areas related to the DOE Fossil Energy Program have been appropriate for university involvement, and that, with support from DOE, university scientific and technical expertise can be expected to continue to play a significant role in the advancement of fossil energy technology in the years to come.

  17. Universal Majorana thermoelectric noise

    Science.gov (United States)

    Smirnov, Sergey

    2018-04-01

    Thermoelectric phenomena resulting from an interplay between particle flows induced by electric fields and temperature inhomogeneities are extremely insightful as a tool providing substantial knowledge about the microscopic structure of a given system. By tuning, e.g., parameters of a nanoscopic system coupled via tunneling mechanisms to two contacts, one may achieve various situations where the electric current induced by an external bias voltage competes with the electric current excited by the temperature difference of the two contacts. Even more exciting physics emerges when the system's electronic degrees freedom split to form Majorana fermions which make the thermoelectric dynamics universal. Here, we propose revealing these unique universal signatures of Majorana fermions in strongly nonequilibrium quantum dots via noise of the thermoelectric transport beyond linear response. It is demonstrated that whereas mean thermoelectric quantities are only universal at large-bias voltages, the noise of the electric current excited by an external bias voltage and the temperature difference of the contacts is universal at any bias voltage. We provide truly universal, i.e., independent of the system's parameters, thermoelectric ratios between nonlinear response coefficients of the noise and mean current at large-bias voltages where experiments may easily be performed to uniquely detect these truly universal Majorana thermoelectric signatures.

  18. University students' mental health: Aksaray University example

    Directory of Open Access Journals (Sweden)

    Rezzan Gündoğdu

    2013-11-01

    Full Text Available This study examines whether mental health scores of the university students differ based on gender, whether they study in their ideal majors, whether they are contended with their majors, economic condition perceived and perceptions on employment opportunity after graduation. The sample group of the study constituted 3492 students comprising 2037 female students and 1455 male students attending Faculty of Education (634, Engineering Faculty (1582, Economic and Administrative Sciences Faculty (1097, Faculty of Science and Letters (762, Medical Vocational College (540, Physical Training and Sports College (443 and Aksaray Vocational College (1452 of Aksaray University in 2010-2011 Academic Year. Symptom Checklist (SCL 90-R developed by Deragotis, (1983; eg Öner, 1997 has been used to collect data on mental health level of the students involved in the study. Statistical analysis of the data collected has been carried out using t Test, One-way Analysis of Variance (ANOVA. Significant differences have been found in students in terms of independent variants according to the general symptom average score and numerous sub-scale scores.

  19. University Reactor Instrumentation Program

    International Nuclear Information System (INIS)

    Vernetson, W.G.

    1992-11-01

    Recognizing that the University Reactor Instrumentation Program was developed in response to widespread needs in the academic community for modernization and improvement of research and training reactors at institutions such as the University of Florida, the items proposed to be supported by this grant over its two year period have been selected as those most likely to reduce foreed outages, to meet regulatory concerns that had been expressed in recent years by Nuclear Regulatory Commission inspectors or to correct other facility problems and limitations. Department of Energy Grant Number DE-FG07-90ER129969 was provided to the University of Florida Training Reactor(UFTR) facility through the US Department of Energy's University Reactor Instrumentation Program. The original proposal submitted in February, 1990 requested support for UFTR facility instrumentation and equipment upgrades for seven items in the amount of $107,530 with $13,800 of this amount to be the subject of cost sharing by the University of Florida and $93,730 requested as support from the Department of Energy. A breakdown of the items requested and total cost for the proposed UFTR facility instrumentation and equipment improvements is presented

  20. Recipes for the Universe

    CERN Multimedia

    2005-01-01

    As part of the World Year of Physics, the Physics Section of the University of Geneva is organising a series of conferences for the uninitiated. Each of the conferences will begin with a demonstration in the auditorium of the detection of cosmic rays and, in collaboration with Professor E. Ellberger of the Conservatoire de Musique de Genève, of how these signals from the farthest reaches of the Universe can be used to create "cosmic music". The third conference in the series, "How to build a universe?", will take place on Tuesday 15 March 2005 and the speaker will be the CERN theoretical physicist, John Ellis. A tiny number of elementary particles are responsible for the very diverse universe that surrounds us. These basic building blocks of matter interact by exchanging photons and other similar particles. After summing up what we know about these fundamental building blocks, their role in the history of the universe will be discussed. Where does matter come from? Where do the structures that ...

  1. Quantum and Universe

    International Nuclear Information System (INIS)

    Uiler, Dzh.

    1982-01-01

    General approach to the structure of the Universe is discussed. Two properties of physical laws: symmetry and changeability are considered from this view point. Each physical law permits simpler formulation in the notion of symmetry. But the simplicity of this description conceals interval mechanisms which make up the base of the physical law. The problem of physical law stability is analyzed. It is concluded that unrestricted changeability is the main property of physics. Primary attention is paid to the problem of ''quantum and Universe''. The effect of measuring process on the experimental results is the most difficult problem of quantum mechanisms. The quantum principle rejected an attempt to conceptually present the reality as it is pictured independently from its observation and it made the description of the Universe structure still more complicated and confused

  2. Armored glass university ceilings

    Directory of Open Access Journals (Sweden)

    Ana Guil Bozal

    2016-12-01

    Full Text Available The barriers that women face to occupy the highest professional positions are well studied, yet they persist. The employment situation of women has improved, but the positions of power are still predominantly in male hands, as if men continually seek new mechanisms to keep, like viruses that change every year to survive the way vaccines. Barriers persist, although in recent decades women have managed to overcome in quantity and quality to men among university students. Women are still unable to access the best academic positions. Among university faculty only reach 40% and full professor position remain masculinized, having managed to reach the women -after many efforts and some policies- measures only 20%, which is seen clearly insufficient given their greater training. Against this background, the future is difficult, unless the university decided to endorse the cause of equality, going to assume its role of reference for the new generations and to other organizations and society in general.

  3. Baby universe theory

    International Nuclear Information System (INIS)

    Nielsen, H.B.; Ninomiya, Masao

    1989-12-01

    We give an elementary review of the so called 'the theory of baby universes' which is a series of ideas or speculations about some effects in quantum gravity, viz. the effect of a certain type of wormholes, representing the exchange of small 3-space universes called baby universes. We consider this 'theory' as being physically and scientifically a very promising candidate for a theory of everything. It is, however, mathematically lacking any strong foundation at all. It solves several fine-tuning problems: First of all the cosmological constant problem, and also the strong CP-problem and the hierarchy problem. We also speculate that it might predict the possibility of influencing the probability distributions of the outcome of quantum mechanical measurements at one time by acts at a later time. (orig.)

  4. Phonology without universal grammar.

    Science.gov (United States)

    Archangeli, Diana; Pulleyblank, Douglas

    2015-01-01

    The question of identifying the properties of language that are specific human linguistic abilities, i.e., Universal Grammar, lies at the center of linguistic research. This paper argues for a largely Emergent Grammar in phonology, taking as the starting point that memory, categorization, attention to frequency, and the creation of symbolic systems are all nonlinguistic characteristics of the human mind. The articulation patterns of American English rhotics illustrate categorization and systems; the distribution of vowels in Bantu vowel harmony uses frequencies of particular sequences to argue against Universal Grammar and in favor of Emergent Grammar; prefix allomorphy in Esimbi illustrates the Emergent symbolic system integrating phonological and morphological generalizations. The Esimbi case has been treated as an example of phonological opacity in a Universal Grammar account; the Emergent analysis resolves the pattern without opacity concerns.

  5. Electromagnetic Gowdy universe

    International Nuclear Information System (INIS)

    Charach, C.

    1979-01-01

    Following Gowdy and Berger we construct an inhomogeneous closed electromagnetic universe with three-torus topology. This model is obtained as a result of the homogeneity breaking in the electromagnetic Bianchi type-I universe and contains interacting gravitational and electromagnetic waves. This cosmological solution provides an exactly solvable model for the study of the nonlinear fully relativistic regime of coupled electromagnetic and gravitational fields in the early universe. The asymptotic behavior is considered (i) in the vicinity of the initial singularity and (ii) in the high-frequency limit. It is shown that the effects of coupling between electromagnetic and gravitational waves cause an evolution which is significantly different from that of the vacuum model. The influence of the primordial homogeneous electromagnetic field on the dynamics of the model is also discussed

  6. The anamorphic universe

    Science.gov (United States)

    Ijjas, Anna; Steinhardt, Paul J.

    2015-10-01

    We introduce ``anamorphic'' cosmology, an approach for explaining the smoothness and flatness of the universe on large scales and the generation of a nearly scale-invariant spectrum of adiabatic density perturbations. The defining feature is a smoothing phase that acts like a contracting universe based on some Weyl frame-invariant criteria and an expanding universe based on other frame-invariant criteria. An advantage of the contracting aspects is that it is possible to avoid the multiverse and measure problems that arise in inflationary models. Unlike ekpyrotic models, anamorphic models can be constructed using only a single field and can generate a nearly scale-invariant spectrum of tensor perturbations. Anamorphic models also differ from pre-big bang and matter bounce models that do not explain the smoothness. We present some examples of cosmological models that incorporate an anamorphic smoothing phase.

  7. The anamorphic universe

    International Nuclear Information System (INIS)

    Ijjas, Anna; Steinhardt, Paul J.

    2015-01-01

    We introduce ''anamorphic'' cosmology, an approach for explaining the smoothness and flatness of the universe on large scales and the generation of a nearly scale-invariant spectrum of adiabatic density perturbations. The defining feature is a smoothing phase that acts like a contracting universe based on some Weyl frame-invariant criteria and an expanding universe based on other frame-invariant criteria. An advantage of the contracting aspects is that it is possible to avoid the multiverse and measure problems that arise in inflationary models. Unlike ekpyrotic models, anamorphic models can be constructed using only a single field and can generate a nearly scale-invariant spectrum of tensor perturbations. Anamorphic models also differ from pre-big bang and matter bounce models that do not explain the smoothness. We present some examples of cosmological models that incorporate an anamorphic smoothing phase

  8. The anamorphic universe

    Energy Technology Data Exchange (ETDEWEB)

    Ijjas, Anna; Steinhardt, Paul J., E-mail: aijjas@princeton.edu, E-mail: steinh@princeton.edu [Princeton Center for Theoretical Science, Princeton University, Princeton, NJ, 08544 (United States)

    2015-10-01

    We introduce ''anamorphic'' cosmology, an approach for explaining the smoothness and flatness of the universe on large scales and the generation of a nearly scale-invariant spectrum of adiabatic density perturbations. The defining feature is a smoothing phase that acts like a contracting universe based on some Weyl frame-invariant criteria and an expanding universe based on other frame-invariant criteria. An advantage of the contracting aspects is that it is possible to avoid the multiverse and measure problems that arise in inflationary models. Unlike ekpyrotic models, anamorphic models can be constructed using only a single field and can generate a nearly scale-invariant spectrum of tensor perturbations. Anamorphic models also differ from pre-big bang and matter bounce models that do not explain the smoothness. We present some examples of cosmological models that incorporate an anamorphic smoothing phase.

  9. Southern Universities Nuclear Institute

    International Nuclear Information System (INIS)

    Anon.

    1977-01-01

    The Southern Universities Nuclear Institute was created in 1961 to provide postgraduate research and teaching facilities for the universities of Cape Town and Stellenbosch. The main research tool is the 6,0 MV Van de Graaff accelerator installed in 1964. Developments and improvements over the years have maintained the Institute's research effectiveness. The work of local research groups has led to a large number of M Sc and doctorate degrees and numerous publications in international journals. Research at the Institute includes front-line studies of basic nuclear and atomic physics, the development and application of nuclear analytical techniques and the application of radioisotope tracers to problems in science, industry and medicine. The Institute receives financial support from the two southern universities, the Department of National Education, the CSIR and the Atomic Energy Board

  10. An eternal universe

    International Nuclear Information System (INIS)

    Novello, M.; Heintzmann, H.

    1983-01-01

    A new generalized solution of Maxwell-Einstein equations (which are non-minimally coupled) which leads to some fascinating aspects of the Universe is presented. The Cosmos has no singularity due to the coupling of longitudinal electromagnetism with space-time. It contains the Milne-Schucking cosmos as a limiting case. This model contains a free parameter (the longitudinal electromagnetic field) which allows one to fix the density of highest compression of the Cosmos. Alternativelly the parameter allows one to adjust our cosmos to the presently observed Hubble constant and the deceleration parameter. The model seems to be a viable candidate for our real cosmos as it allows one to extend the time scale of the Universe to arbitrarily large values i.e., it is able to provide the necessary time scale for the origin of life. It is speculated that the entropy is finite but intelligence in the Universe may be infinite. (Author) [pt

  11. The Worldhood university

    DEFF Research Database (Denmark)

    Bengtsen, Søren Smedegaard; Nørgård, Rikke Toft

    Universities and higher education today are sites for entanglement of multiple forms of agency and lifeworlds. Enhanced focus is given to higher education strategies and frameworks that integrate more traditional forms of higher education curriculum with moral and political awareness, social agency...... the mode 2 university, where the university is ‘for sale’ (Shumar, 1997) and where higher education curricula are being defined and shaped by the needs and current drivers of the job market and the shifting neoliberalist company strategies. As Ronald Barnett underlines “the contemporary vocabulary...... politically, socially, ethically, and philosophically. It requires, among other things, new conceptions of academic citizenship, belonging in higher education, and what we have called ‘placeful universities’ where “academic citizenship emerges through dialogical integration and ‘Mitsein’ in the critically...

  12. Supercomplexity and the university

    DEFF Research Database (Denmark)

    Bengtsen, Søren Smedegaard

    2018-01-01

    Ronald Barnett’s modern classic Realizing the University in an Age of Supercomplexity (published December 1999), has had a crucial impact internationally on the field of Higher Education research and develop- ment since the book was published now nearly 20 years ago. Bridging an academic oeuvre...... across almost 30 years with close to 30 published volumes, Realizing the University in an Age of Supercomplexity plays an important role in the development and transformation of Barnett’s social theory of Higher Education into a social philosophy of Higher Education. In the book Barnett performs...... and vision that fully embraces the future of Higher Education. This way, Realizing the University in an Age of Supercomplexity has not only paved the way for Barnett’s own devel- opment of a social philosophy of Higher Education, but also contributed invaluably to the rise and maturing of philosophy...

  13. A unified universe

    DEFF Research Database (Denmark)

    Codello, Alessandro; Jain, Rajeev Kumar

    2018-01-01

    We present a unified evolution of the universe from very early times until the present epoch by including both the leading local correction R2 and the leading non-local term R1□2R to the classical gravitational action. We find that the inflationary phase driven by R2 term gracefully exits...... in a transitory regime characterized by coherent oscillations of the Hubble parameter. The universe then naturally enters into a radiation dominated epoch followed by a matter dominated era. At sufficiently late times after radiation–matter equality, the non-local term starts to dominate inducing an accelerated...... expansion of the universe at the present epoch. We further exhibit the fact that both the leading local and non-local terms can be obtained within the covariant effective field theory of gravity. This scenario thus provides a unified picture of inflation and dark energy in a single framework by means...

  14. Radioprotection in Brazilian universities

    International Nuclear Information System (INIS)

    Caballero, K.C.; Borges, J.C.

    1992-01-01

    The purpose of this work was to obtain a broad knowledge of the circumstances under which activities involving ionizing radiations are held at brazilian academic institutions. Around 90 institutions (universities and isolated schools of both public and private sectors) were invited, by mail, to answer an inquiry with questions from technical to legal aspects of their activities with radiations. Information received from 2/3 of institutions contacted, permitted conclusions as: there is a wide ignorance about radioprotection procedures and legislation, although few universities maintain some efficient radioprotection staff; there is a need for the establishment of a standard radioprotection text dedicated to those specific activities of the sector. (author)

  15. Universal Lyndon Words

    OpenAIRE

    Carpi, Arturo; Fici, Gabriele; Holub, Stepan; Oprsal, Jakub; Sciortino, Marinella

    2014-01-01

    A word $w$ over an alphabet $\\Sigma$ is a Lyndon word if there exists an order defined on $\\Sigma$ for which $w$ is lexicographically smaller than all of its conjugates (other than itself). We introduce and study \\emph{universal Lyndon words}, which are words over an $n$-letter alphabet that have length $n!$ and such that all the conjugates are Lyndon words. We show that universal Lyndon words exist for every $n$ and exhibit combinatorial and structural properties of these words. We then defi...

  16. Building the universe

    International Nuclear Information System (INIS)

    Sutton, Christine

    1985-01-01

    The book 'In Building the Universe' contains a collection of articles from the magazine 'New Scientist', compiled and edited to provide an overview of the field of particle physics. A picture of the basic constituents of matter (quarks and leptons) is given, together with the four fundamental forces that hold them together. The operation of these forces in the first instance of the hot young Universe is described. Also, the development of the accelerators and detectors used in elementary particle physics, is discussed. (UK)

  17. The 4-percent universe

    CERN Document Server

    Panek, Richard

    2012-01-01

    It is one of the most disturbing aspects of our universe: only four per cent of it consists of the matter that makes up every star, planet, and every book. The rest is completely unknown. Acclaimed science writer Richard Panek tells the story of the handful of scientists who have spent the past few decades on a quest to unlock the secrets of “dark matter" and the even stranger substance called “dark energy". These are perhaps the greatest mysteries in science,and solving them will reshape our understanding of the universe and our place in it. The stakes could not be higher. Panek's fast-paced

  18. The missing universe

    International Nuclear Information System (INIS)

    Springel, V.; Taillet, R.; Deffayet, C.

    2014-01-01

    According to the Big Bang model, ordinary matter would play a second role in the universe compared to 2 mysterious components: dark matter and dark energy. Although the nature of both components is unknown, observational hints for their existence pile up but the direct detection of both has been unsuccessful so far. New ways have been explored to do without the concepts of dark matter and dark energy. This document that is divided into 3 parts presents the observational data that back the idea of dark matter and dark energy, the experimental effort made worldwide to detect dark matter particles, and the other ways to explain universe expansion

  19. Models of the universe

    International Nuclear Information System (INIS)

    Dirac, P.A.M.

    1981-01-01

    Most models of the universe are dependent on the assumption of a uniform distribution of matter, and thus are rather crude, due to the nonlinear nature of Einstein's field equations. Here, a model is proposed which avoids this smoothing-out process. A metric is obtained which is consistent with the assumption that the matter of the universe is concentrated mainly in stars, moving with the velocity of recession implied by Hubble's law. The solution obtained gives results comparable to those obtainable by Schwarzchild metric, suitably adjusted to agree with the Einstein-DeSitter model at large distances

  20. Exponential Cardassian universe

    International Nuclear Information System (INIS)

    Liu Daojun; Sun Changbo; Li Xinzhou

    2006-01-01

    The expectation of explaining cosmological observations without requiring new energy sources is forsooth worthy of investigation. In this Letter, a new kind of Cardassian models, called exponential Cardassian models, for the late-time universe are investigated in the context of the spatially flat FRW universe scenario. We fit the exponential Cardassian models to current type Ia supernovae data and find they are consistent with the observations. Furthermore, we point out that the equation-of-state parameter for the effective dark fluid component in exponential Cardassian models can naturally cross the cosmological constant divide w=-1 that observations favor mildly without introducing exotic material that destroy the weak energy condition

  1. Fundamentals of university mathematics

    CERN Document Server

    McGregor, C M; Stothers, W W

    2010-01-01

    The third edition of this popular and effective textbook provides in one volume a unified treatment of topics essential for first year university students studying for degrees in mathematics. Students of computer science, physics and statistics will also find this book a helpful guide to all the basic mathematics they require. It clearly and comprehensively covers much of the material that other textbooks tend to assume, assisting students in the transition to university-level mathematics.Expertly revised and updated, the chapters cover topics such as number systems, set and functions, differe

  2. Bootstrap, universality and horizons

    Energy Technology Data Exchange (ETDEWEB)

    Chang, Chi-Ming [Center for Theoretical Physics and Department of Physics,University of California, Berkeley, CA 94704 (United States); Lin, Ying-Hsuan [Jefferson Physical Laboratory, Harvard University,Cambridge, MA 02138 (United States)

    2016-10-13

    We present a closed form expression for the semiclassical OPE coefficients that are universal for all 2D CFTs with a “weak” light spectrum, by taking the semiclassical limit of the fusion kernel. We match this with a properly regularized and normalized bulk action evaluated on a geometry with three conical defects, analytically continued in the deficit angles beyond the range for which a metric with positive signature exists. The analytically continued geometry has a codimension-one coordinate singularity surrounding the heaviest conical defect. This singularity becomes a horizon after Wick rotating to Lorentzian signature, suggesting a connection between universality and the existence of a horizon.

  3. The plasma universe

    International Nuclear Information System (INIS)

    Faelthammar, C.G.

    1989-12-01

    The term 'Plasma Universe', coined by Hannes Alfven, emphasices the fact that plasma phenomena discovered in the laboratory and in accessible regions of space. must be important also in the rest of the universe, which consists almost entirely of matter in the plasma state. Relevant aspect of this concept will be discussed. They include the response of the plasma to electric currents, the support of magnetic-field aligned electric fields, violation of the frozen-field condition, rapid release of magnetically stored energy, acceleration of charged particles, chemical separation, and filamentary and cellular structures. (authors)

  4. University-Community Engagement: Case Study of University Social Responsibility

    Science.gov (United States)

    Chile, Love M.; Black, Xavier M.

    2015-01-01

    Corporatisation of universities has drawn parallels between contemporary universities and business corporations, and extended analysis of corporate social responsibility to universities. This article reports on a case study of university-community engagement with schools and school communities through youth engagement programmes to enhance…

  5. Study of university students' attitudes toward office space at universities

    Directory of Open Access Journals (Sweden)

    S.M. Eteadifard

    2017-06-01

    Full Text Available Office space is the space where students first experience the university. In this paper, the attitude of students toward office space in the public sphere of university is discussed. This article is the result of the research conducted for the “Institute for Social and Cultural Studies” by the author. The main issues in this paper are: university students' attitudes towards quality office space at the universities and mental basis of common issues among students at the universities. Data were collected through individual and group interviews. More than eighty interviews with activists and students of University of Tehran, Shahid Beheshti University, Allameh Tabataba’i University, Sharif University of Technology and Kharazmi University were done. The main indicators of office space in this study include: students’ satisfaction of office space, students’ welfare affairs and students’ feedback about this space. Problems and obstacles relating to the office space and their solutions were also studied in this paper.

  6. Universal Precautions: A Review

    African Journals Online (AJOL)

    DATONYE ALASIA

    and hazards could cause devastating effects on. 2 health and ... (splash of blood or other body fluids into the eyes, nose or ... nurses, laboratory staff and aides who work in .... electric hand dryers are available which is ideal. ... self, patient and co-workers from infection. All ... with universal precautions include the absence of ...

  7. Ranganathan : A Universal Librarian

    Directory of Open Access Journals (Sweden)

    Abulfazale M. Fazle Kabir

    2003-06-01

    Full Text Available In formulating Five Laws of Library Science Ranganathan has made a lasting and fundamental contribution to the philosophy of library patron service. His Colon Classification has provided a scheme for hierarchical design of faceted subject classification. For such valuable contribution to the profession he has been acclaimed as a universal librarian.

  8. Universal and Relative Rationality

    Directory of Open Access Journals (Sweden)

    Nathaniel Goldberg

    2009-01-01

    Full Text Available In this paper I illustrate how a basic kind of universal rationality can be profitably combined with undeniable instances of relativism. I do so by engaging Michael Friedman’s recent response to a challenge from Thomas Kuhn.

  9. Entrepreneurship and University Licensing

    NARCIS (Netherlands)

    Brouwer, M.

    2005-01-01

    Outside invention has gained in importance as universities are actively seeking commercialization of their inventions since the passage of the Bayh-Dole Act. The paper analyzes the incentives to invent for outside and inside inventors. It is shown that outside inventors have greater incentives to

  10. Explore Your Universe

    Energy Technology Data Exchange (ETDEWEB)

    Lloyd-Ronning, Nicole Marie [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-05-01

    This warm-up lab is intended to get students familiar with the large numbers encountered in astronomy (e.g. distances, times, numbers of stars and galaxies in the universe). Students will measure the dimensions of the classroom and/or the distance between objects in the classroom, and report their findings in units of millimeters, micrometers and nanometers.

  11. Origin (?) of the Universe

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 1; Issue 3. Origin (?) of the Universe The Big Bang. Jayant V Narlikar. Series Article Volume 1 Issue 3 March 1996 pp 6-12. Fulltext. Click here to view fulltext PDF. Permanent link: https://www.ias.ac.in/article/fulltext/reso/001/03/0006-0012 ...

  12. Discrete bipolar universal integrals

    Czech Academy of Sciences Publication Activity Database

    Greco, S.; Mesiar, Radko; Rindone, F.

    2014-01-01

    Roč. 252, č. 1 (2014), s. 55-65 ISSN 0165-0114 R&D Projects: GA ČR GAP402/11/0378 Institutional support: RVO:67985556 Keywords : bipolar integral * universal integral * Choquet integral Subject RIV: BA - General Mathematics Impact factor: 1.986, year: 2014 http://library.utia.cas.cz/separaty/2014/E/mesiar-0432224.pdf

  13. Universal decoherence in solids.

    Science.gov (United States)

    Chudnovsky, Eugene M

    2004-03-26

    Symmetry implications for the decoherence of quantum oscillations of a two-state system in a solid are studied. When the oscillation frequency is small compared to the Debye frequency, the universal lower bound on the decoherence due to the atomic environment is derived in terms of the macroscopic parameters of the solid, with no unknown interaction constants.

  14. Origin(?) of the Universe

    Indian Academy of Sciences (India)

    weaknesses of the big bang cosmology, conceptual as well as observational. ... They argue that this event marks the origin of the ... a change of the lowest energy state of matter, normally designated as ... Rapid expansion of this kind produces some lasting effects in the universe. .... This attitude coupled with attempted ...

  15. A Universal Phylogenetic Tree.

    Science.gov (United States)

    Offner, Susan

    2001-01-01

    Presents a universal phylogenetic tree suitable for use in high school and college-level biology classrooms. Illustrates the antiquity of life and that all life is related, even if it dates back 3.5 billion years. Reflects important evolutionary relationships and provides an exciting way to learn about the history of life. (SAH)

  16. Telecommunications and Universal Service

    International Development Research Centre (IDRC) Digital Library (Canada)

    The book is intended to provide valuable input to the Universal Service Agency .... Figure 1 is not, of course, drawn to scale for South Africa. .... Such uneconomic customers and areas are mainly found in rural, peripheral, and less favoured regions. ... The United Kingdom is a good example of the enduring nature of this task.

  17. Universities in Transition

    International Development Research Centre (IDRC) Digital Library (Canada)

    The use in this publication of trade names, trademarks, service marks, and similar .... 13 Germany: The Role of Universities in the Learning Economy ... and that there exist good opportunities for learning from each other's experiences. ...... to sell on credit, and/or provide access to markets, introducing the firms to customers.

  18. The Classification of Universes

    International Nuclear Information System (INIS)

    Bjorken, J

    2004-01-01

    We define a universe as the contents of a spacetime box with comoving walls, large enough to contain essentially all phenomena that can be conceivably measured. The initial time is taken as the epoch when the lowest CMB modes undergo horizon crossing, and the final time taken when the wavelengths of CMB photons are comparable with the Hubble scale, i.e. with the nominal size of the universe. This allows the definition of a local ensemble of similarly constructed universes, using only modest extrapolations of the observed behavior of the cosmos. We then assume that further out in spacetime, similar universes can be constructed but containing different standard model parameters. Within this multiverse ensemble, it is assumed that the standard model parameters are strongly correlated with size, i.e. with the value of the inverse Hubble parameter at the final time, in a manner as previously suggested. This allows an estimate of the range of sizes which allow life as we know it, and invites a speculation regarding the most natural distribution of sizes. If small sizes are favored, this in turn allows some understanding of the hierarchy problems of particle physics. Subsequent sections of the paper explore other possible implications. In all cases, the approach is as bottoms up and as phenomenological as possible, and suggests that theories of the multiverse so constructed may in fact lay some claim of being scientific

  19. Earth and Universe

    Energy Technology Data Exchange (ETDEWEB)

    Kosygin, Yu A

    1986-12-01

    Rocks, the age of which according to certain data exceeds considerably the recognized age of the Earth and approximates the age of the Universe, have been detected on the Earth. There is a necessity to coordinate the geological data with cosmological structures.

  20. Organizing University Marketing.

    Science.gov (United States)

    Taylor, Thomas E.

    During a period of projected declining enrollments some years ago, colleges and universities began looking to business and industry for models and methods to achieve stability and exhibit accountability. Zero-based budgeting, computerized record keeping, and planned-programmed-budgeting systems found their way to college campuses. A trend to…

  1. Romanians decipher the Universe

    CERN Multimedia

    Balan, Sorin

    2007-01-01

    We are at the European Nuclear Research Center, the greatest partcile accelerator in the world. Approximately 50 people work here. Thanks to them, Romania can be proud of taking part in the greatest experiment in the world that tries to find an explanation for the ofrmation of the Universe. (1,5 page)

  2. Towards Universal Semantic Tagging

    NARCIS (Netherlands)

    Abzianidze, Lasha; Bos, Johan

    2017-01-01

    The paper proposes the task of universal semantic tagging---tagging word tokens with language-neutral, semantically informative tags. We argue that the task, with its independent nature, contributes to better semantic analysis for wide-coverage multilingual text. We present the initial version of

  3. Parallel universes beguile science

    CERN Multimedia

    2007-01-01

    A staple of mind-bending science fiction, the possibility of multiple universes has long intrigued hard-nosed physicists, mathematicians and cosmologists too. We may not be able -- as least not yet -- to prove they exist, many serious scientists say, but there are plenty of reasons to think that parallel dimensions are more than figments of eggheaded imagination.

  4. Universities and National Laboratories

    Indian Academy of Sciences (India)

    knowledge, etc. in the curriculum of the Institute of Technology at Kharagpur. The. University of ... Nothing can be farther from reality. If the powers that can ... have moved and mixed and have had my being in the student community. I claim that.

  5. The Classification of Universes

    Energy Technology Data Exchange (ETDEWEB)

    Bjorken, J

    2004-04-09

    We define a universe as the contents of a spacetime box with comoving walls, large enough to contain essentially all phenomena that can be conceivably measured. The initial time is taken as the epoch when the lowest CMB modes undergo horizon crossing, and the final time taken when the wavelengths of CMB photons are comparable with the Hubble scale, i.e. with the nominal size of the universe. This allows the definition of a local ensemble of similarly constructed universes, using only modest extrapolations of the observed behavior of the cosmos. We then assume that further out in spacetime, similar universes can be constructed but containing different standard model parameters. Within this multiverse ensemble, it is assumed that the standard model parameters are strongly correlated with size, i.e. with the value of the inverse Hubble parameter at the final time, in a manner as previously suggested. This allows an estimate of the range of sizes which allow life as we know it, and invites a speculation regarding the most natural distribution of sizes. If small sizes are favored, this in turn allows some understanding of the hierarchy problems of particle physics. Subsequent sections of the paper explore other possible implications. In all cases, the approach is as bottoms up and as phenomenological as possible, and suggests that theories of the multiverse so constructed may in fact lay some claim of being scientific.

  6. PBL at Aalborg university

    DEFF Research Database (Denmark)

    From the preface: "All the articles in this book have been presented at the International Conference PBL 2006 ABP, that was held in Lima, Peru, July 19th-21th 2006. This conference is part of a series of Pan-American conferences. It is the first time that Aalborg University has participated...

  7. Teaching Geomorphology at University

    Science.gov (United States)

    Sugden, David; Hamilton, Patrick

    1978-01-01

    Geomorphology courses in British universities emphasize the main landform/process systems rather than more abstract concepts. Recommends a more theoretical focus on fundamental geomorphic processes and methodological problems. Available from: Faculty of Modern Studies, Oxford Polytechnic, Headington, Oxford OX3 OBP, England. (Author/AV)

  8. Universal Cable Brackets

    Science.gov (United States)

    Vanvalkenburgh, C.

    1985-01-01

    Concept allows routing easily changed. No custom hardware required in concept. Instead, standard brackets cut to length and installed at selected locations along cable route. If cable route is changed, brackets simply moved to new locations. Concept for "universal" cable brackets make it easy to route electrical cable around and through virtually any structure.

  9. A Universe of Questions.

    Science.gov (United States)

    Zeldovich, Yakov

    1992-01-01

    Reprinted from the original Russian manuscript of Yakov Zeldovich, this article chronicles his studies of the universe and his attempts to construct a theory of its evolution. He provides the high school student with compelling cosmological discussions about uniformity, galactic clusters, radiation, evolution, the big bang, and gravitational…

  10. Universe opacity and EBL

    Czech Academy of Sciences Publication Activity Database

    Vavryčuk, Václav

    2017-01-01

    Roč. 465, č. 2 (2017), s. 1532-1542 ISSN 0035-8711 Institutional support: RVO:67985530 Keywords : cosmic background radiation * dust, extinction * early Universe * galaxies: high redshift * galaxies: ISM * intergalactic medium Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics OBOR OECD: Astronomy (including astrophysics,space science) Impact factor: 4.961, year: 2016

  11. University of Maryland MRSEC

    Science.gov (United States)

    operation. This site remains as a history of the center, but will not be actively maintained. University of . Crystals are made up of layers, or "planes" of atoms, perfectly stacked in an ordered pattern . Because this surface has been cut at a slight angle to the crystal planes, it appears "stepped"

  12. Empirically sampling Universal Dependencies

    DEFF Research Database (Denmark)

    Schluter, Natalie; Agic, Zeljko

    2017-01-01

    Universal Dependencies incur a high cost in computation for unbiased system development. We propose a 100% empirically chosen small subset of UD languages for efficient parsing system development. The technique used is based on measurements of model capacity globally. We show that the diversity o...

  13. University Student Online Plagiarism

    Science.gov (United States)

    Wang, Yu-mei

    2008-01-01

    This article reports a study investigating university student online plagiarism. The following questions are investigated: (a) What is the incidence of student online plagiarism? (b) What are student perceptions regarding online plagiarism? (c) Are there any differences in terms of student perceptions of online plagiarism and print plagiarism? (d)…

  14. Chaotic universe model.

    Science.gov (United States)

    Aydiner, Ekrem

    2018-01-15

    In this study, we consider nonlinear interactions between components such as dark energy, dark matter, matter and radiation in the framework of the Friedman-Robertson-Walker space-time and propose a simple interaction model based on the time evolution of the densities of these components. By using this model we show that these interactions can be given by Lotka-Volterra type equations. We numerically solve these coupling equations and show that interaction dynamics between dark energy-dark matter-matter or dark energy-dark matter-matter-radiation has a strange attractor for 0 > w de  >-1, w dm  ≥ 0, w m  ≥ 0 and w r  ≥ 0 values. These strange attractors with the positive Lyapunov exponent clearly show that chaotic dynamics appears in the time evolution of the densities. These results provide that the time evolution of the universe is chaotic. The present model may have potential to solve some of the cosmological problems such as the singularity, cosmic coincidence, big crunch, big rip, horizon, oscillation, the emergence of the galaxies, matter distribution and large-scale organization of the universe. The model also connects between dynamics of the competing species in biological systems and dynamics of the time evolution of the universe and offers a new perspective and a new different scenario for the universe evolution.

  15. 9. Universality and Incomputability

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 2; Issue 10. Algorithms - Universality and Incomputability. R K Shyamasundar. Series Article ... Author Affiliations. R K Shyamasundar1. Computer Science Group, Tata Institute of Fundamental Research, Homi Bhabha Road, Mumbai 400 005, India ...

  16. Type II universal spacetimes

    Czech Academy of Sciences Publication Activity Database

    Hervik, S.; Málek, Tomáš; Pravda, Vojtěch; Pravdová, Alena

    2015-01-01

    Roč. 32, č. 24 (2015), s. 245012 ISSN 0264-9381 R&D Projects: GA ČR GA13-10042S Institutional support: RVO:67985840 Keywords : einstein spacetimes * generalized gravities * universal spacetimes Subject RIV: BA - General Mathematics Impact factor: 2.837, year: 2015 http://iopscience.iop.org/article/10.1088/0264-9381/32/24/245012

  17. The Universe's First Fireworks

    Science.gov (United States)

    2006-01-01

    [figure removed for brevity, see original site] [figure removed for brevity, see original site] [figure removed for brevity, see original site] Poster VersionFigure 1Figure 2 This is an image from NASA's Spitzer Space Telescope of stars and galaxies in the Ursa Major constellation. This infrared image covers a region of space so large that light would take up to 100 million years to travel across it. Figure 1 is the same image after stars, galaxies and other sources were masked out. The remaining background light is from a period of time when the universe was less than one billion years old, and most likely originated from the universe's very first groups of objects -- either huge stars or voracious black holes. Darker shades in the image on the left correspond to dimmer parts of the background glow, while yellow and white show the brightest light. Brief History of the Universe In figure 2, the artist's timeline chronicles the history of the universe, from its explosive beginning to its mature, present-day state. Our universe began in a tremendous explosion known as the Big Bang about 13.7 billion years ago (left side of strip). Observations by NASA's Cosmic Background Explorer and Wilkinson Anisotropy Microwave Probe revealed microwave light from this very early epoch, about 400,000 years after the Big Bang, providing strong evidence that our universe did blast into existence. Results from the Cosmic Background Explorer were honored with the 2006 Nobel Prize for Physics. A period of darkness ensued, until about a few hundred million years later, when the first objects flooded the universe with light. This first light is believed to have been captured in data from NASA's Spitzer Space Telescope. The light detected by Spitzer would have originated as visible and ultraviolet light, then stretched, or redshifted, to lower-energy infrared wavelengths during its long voyage to reach us across expanding space. The light detected by the Cosmic Background Explorer and the

  18. Exploring the relationship between university internationalization and university autonomy

    DEFF Research Database (Denmark)

    Turcan, Romeo V.; Gullieva, Valeria

    This paper explores a research gap at the intersection of university internationalization and university autonomy. A process model of university internationalization is put forward whereby the process of university internationalization is mediated by university internationalization capacity...... and moderated by target country institutional autonomy and globalization; and entry modes, timing and pace, as well as product mix of internationalization define university’s internationalization pattern. A systematic review is conducted to identify empirical studies at this intersection. One of the questions...

  19. The Artful Universe Expanded

    Science.gov (United States)

    Barrow, John D.

    2005-07-01

    Our love of art, writes John Barrow, is the end product of millions of years of evolution. How we react to a beautiful painting or symphony draws upon instincts laid down long before humans existed. Now, in this enhanced edition of the highly popular The Artful Universe , Barrow further explores the close ties between our aesthetic appreciation and the basic nature of the Universe. Barrow argues that the laws of the Universe have imprinted themselves upon our thoughts and actions in subtle and unexpected ways. Why do we like certain types of art or music? What games and puzzles do we find challenging? Why do so many myths and legends have common elements? In this eclectic and entertaining survey, Barrow answers these questions and more as he explains how the landscape of the Universe has influenced the development of philosophy and mythology, and how millions of years of evolutionary history have fashioned our attraction to certain patterns of sound and color. Barrow casts the story of human creativity and thought in a fascinating light, considering such diverse topics as our instinct for language, the origins and uses of color in nature, why we divide time into intervals as we do, the sources of our appreciation of landscape painting, and whether computer-generated fractal art is really art. Drawing on a wide variety of examples, from the theological questions raised by St. Augustine and C.S. Lewis to the relationship between the pure math of Pythagoras and the music of the Beatles, The Artful Universe Expanded covers new ground and enters a wide-ranging debate about the meaning and significance of the links between art and science.

  20. Universe or Multiverse?

    Science.gov (United States)

    Carr, Bernard

    2009-08-01

    Part I. Overviews: 1. Introduction and overview Bernard Carr; 2. Living in the multiverse Steven Weinberg; 3. Enlightenment, knowledge, ignorance, temptation Frank Wilczek; Part II. Cosmology and Astrophysics: 4. Cosmology and the multiverse Martin J. Rees; 5. The anthropic principle revisited Bernard Carr; 6. Cosmology from the top down Stephen Hawking; 7. The multiverse hierarchy Max Tegmark; 8. The inflationary universe Andrei Linde; 9. A model of anthropic reasoning: the dark to ordinary matter ratio Frank Wilczek; 10. Anthropic predictions: the case of the cosmological constant Alexander Vilenkin; 11. The definition and classification of universes James D. Bjorken; 12. M/string theory and anthropic reasoning Renata Kallosh; 13. The anthropic principle, dark energy and the LHC Savas Dimopoulos and Scott Thomas; Part III. Particle Physics and Quantum Theory: 14. Quarks, electrons and atoms in closely related universes Craig J. Hogan; 15. The fine-tuning problems of particle physics and anthropic mechanisms John F. Donoghue; 16. The anthropic landscape of string theory Leonard Susskind; 17. Cosmology and the many worlds interpretation of quantum mechanics Viatcheslav Mukhanov; 18. Anthropic reasoning and quantum cosmology James B. Hartle; 19. Micro-anthropic principle for quantum theory Brandon Carter; Part IV. More General Philosophical Issues: 20. Scientific alternatives to the anthropic principle Lee Smolin; 21. Making predictions in a multiverse: conundrums, dangers, coincidences Anthony Aguirre; 22. Multiverses: description, uniqueness and testing George Ellis; 23. Predictions and tests of multiverse theories Don N. Page; 24. Observation selection theory and cosmological fine-tuning Nick Bostrom; 25. Are anthropic arguments, involving multiverses and beyond, legitimate? William R. Stoeger; 26. The multiverse hypothesis: a theistic perspective Robin Collins; 27. Living in a simulated universe John D. Barrow; 28. Universes galore: where will it all end? Paul

  1. Life at a Teaching University

    Science.gov (United States)

    Marineau, Josiah F.

    2018-01-01

    Many new political science faculty at teaching universities are recent PhD recipients, and are coming to these institutions from research-oriented universities. There are considerable differences between the training for graduate students received at research universities and the expectations for faculty at teaching universities. This essay…

  2. Universities Venture into Venture Capitalism.

    Science.gov (United States)

    Desruisseaux, Paul

    2000-01-01

    Reports that some universities are starting their own venture-capital funds to develop campus companies, or are investing endowment funds with established venture-capital firms inclined to finance potential spinoffs from campus research. Examples cited are from the University of Alabama, Vanderbilt University (Tennessee), University of…

  3. The future of the universe

    CERN Document Server

    Meadows, AJ

    2007-01-01

    Many books have described how the universe became the way it is today. But what about the future of the universe? How long might the universe as we recognize it survive? The Future of the Universe takes the reader on a journey through space and time, beginning with a long look at the Earth and solar system, voyaging to the outermost galaxies, and finishing with speculations about the life and fate of the entire universe.

  4. The universal Higgs fit

    DEFF Research Database (Denmark)

    Giardino, P. P.; Kannike, K.; Masina, I.

    2014-01-01

    We perform a state-of-the-art global fit to all Higgs data. We synthesise them into a 'universal' form, which allows to easily test any desired model. We apply the proposed methodology to extract from data the Higgs branching ratios, production cross sections, couplings and to analyse composite...... Higgs models, models with extra Higgs doublets, supersymmetry, extra particles in the loops, anomalous top couplings, and invisible Higgs decays into Dark Matter. Best fit regions lie around the Standard Model predictions and are well approximated by our 'universal' fit. Latest data exclude the dilaton...... as an alternative to the Higgs, and disfavour fits with negative Yukawa couplings. We derive for the first time the SM Higgs boson mass from the measured rates, rather than from the peak positions, obtaining M-h = 124.4 +/- 1.6 GeV....

  5. Universality of accelerating change

    Science.gov (United States)

    Eliazar, Iddo; Shlesinger, Michael F.

    2018-03-01

    On large time scales the progress of human technology follows an exponential growth trend that is termed accelerating change. The exponential growth trend is commonly considered to be the amalgamated effect of consecutive technology revolutions - where the progress carried in by each technology revolution follows an S-curve, and where the aging of each technology revolution drives humanity to push for the next technology revolution. Thus, as a collective, mankind is the 'intelligent designer' of accelerating change. In this paper we establish that the exponential growth trend - and only this trend - emerges universally, on large time scales, from systems that combine together two elements: randomness and amalgamation. Hence, the universal generation of accelerating change can be attained by systems with no 'intelligent designer'.

  6. Pythagorean Philolaus’ Pyrocentric Universe

    Directory of Open Access Journals (Sweden)

    Maniatis, Yiorgo

    2009-06-01

    Full Text Available In this work, first, I reexamine the pyrocentric universe of the Pythagorean, Philolaus, who emphatically propounded that the center of the cosmos is neither the earth nor the sun, but a central fiery hearth that stands in the middle of the spherical universe. Second, I attempt to demonstrate the value and significance of this pyrocentric cosmic model by elaborating its novel revolutionary elements and its contribution to astronomy. Third, by underlining the diachroneity and timeliness of this cosmic model, I try to establish as to how the model served as a precursor to not only the ancient and modern heliocentric models, as widely believed, but also as much to the contemporary cosmic models and theories of astrophysics.

  7. Universality for quintessence

    Energy Technology Data Exchange (ETDEWEB)

    Cicciarella, F. [Dipartimento di Fisica, Università di Pisa, Largo Bruno Pontecorvo 3, 56127 Pisa (Italy); Pieroni, M., E-mail: f.cicciarella1@gmail.com, E-mail: mauro.pieroni@apc.in2p3.fr [AstroParticule et Cosmologie, Université Paris Diderot, CNRS, CEA, Observatoire de Paris, Sorbonne Paris Cité, 10, rue Alice Domon et Léonie Duquet, F-75205 Paris Cedex 13 (France)

    2017-08-01

    Several recent works suggested the possibility of describing inflation by means of a renormalization group equation. In this paper we discuss the application of these methods to models of quintessence. In this framework a period of exponential expansion corresponds to the slow evolution of the scalar field in the neighborhood of a fixed point. A minimal set of universality classes for models of quintessence is defined and the transition from a matter dominated to quintessence dominated universe is studied. Models in which quintessence is non-minimally coupled with gravity are also discussed. We show that the formalism proves to be extremely convenient to describe quintessence and moreover we find that in most of the models discussed in this work quintessence naturally takes over ordinary matter.

  8. Improving University Research Value

    Directory of Open Access Journals (Sweden)

    Kelley O’Reilly

    2012-07-01

    Full Text Available This article investigates the current data management practices of university researchers at an Intermountain West land-grant research university in the United States. Key findings suggest that researchers are primarily focused on the collection and housing of research data. However, additional research value exists within the other life cycle stages for research data—specifically in the stages of delivery and maintenance. These stages are where most new demands and requirements exist for data management plans and policies that are conditional for external grant funding; therefore, these findings expose a “gap” in current research practice. These findings should be of interest to academics and practitioners alike as findings highlight key management gaps in the life cycle of research data. This study also suggests a course of action for academic institutions to coalesce campus-wide assets to assist researchers in improving research value.

  9. Atoms against the universe

    International Nuclear Information System (INIS)

    Senovilla, J.; Raul Vera, M.M.

    1999-01-01

    In Woody Allen's masterpiece Annie Hall the main character is worried about the expansion of the universe. Indeed, during a childhood visit to his psychiatrist, his mother admonishes him: ''You're here in Brooklyn! Brooklyn is not expanding!''. But is that really true? Relativists have attacked this naive question many times and have arrived at different answers. New light has now been thrown on the subject by William Bonnor from Queen Mary and Westfield College in London by considering the influence of the expanding universe on the size of the hydrogen atom (Class. Quantum Grav. 1999 16 1313). According to Bonner's calculations we can conclude that the cosmic expansion does not affect human-scale objects like laboratories and our bodies. In this article the authors explain the reasoning behind this research and its thought provoking consequences. (UK)

  10. Universal quantum interfaces

    International Nuclear Information System (INIS)

    Lloyd, Seth; Landahl, Andrew J.; Slotine, Jean-Jacques E.

    2004-01-01

    To observe or control a quantum system, one must interact with it via an interface. This article exhibits simple universal quantum interfaces--quantum input/output ports consisting of a single two-state system or quantum bit that interacts with the system to be observed or controlled. It is shown that under very general conditions the ability to observe and control the quantum bit on its own implies the ability to observe and control the system itself. The interface can also be used as a quantum communication channel, and multiple quantum systems can be connected by interfaces to become an efficient universal quantum computer. Experimental realizations are proposed, and implications for controllability, observability, and quantum information processing are explored

  11. Universal Test Facility

    Science.gov (United States)

    Laughery, Mike

    A universal test facility (UTF) for Space Station Freedom is developed. In this context, universal means that the experimental rack design must be: automated, highly marketable, and able to perform diverse microgravity experiments according to NASA space station requirements. In order to fulfill these broad objectives, the facility's customers, and their respective requirements, are first defined. From these definitions, specific design goals and the scope of the first phase of this project are determined. An examination is first made into what types of research are most likely to make the UTF marketable. Based on our findings, the experiments for which the UTF would most likely be used included: protein crystal growth, hydroponics food growth, gas combustion, gallium arsenide crystal growth, microorganism development, and cell encapsulation. Therefore, the UTF is designed to fulfill all of the major requirements for the experiments listed above. The versatility of the design is achieved by taking advantage of the many overlapping requirements presented by these experiments.

  12. Mapping the universe.

    Science.gov (United States)

    Geller, M J; Huchra, J P

    1989-11-17

    Maps of the galaxy distribution in the nearby universe reveal large coherent structures. The extent of the largest features is limited only by the size of the survey. Voids with a density typically 20 percent of the mean and with diameters of 5000 km s(-1) are present in every survey large enough to contain them. Many galaxies lie in thin sheet-like structures. The largest sheet detected so far is the "Great Wall" with a minimum extent of 60 h(-1) Mpc x 170 h(-1) Mpc, where h is the Hubble constant in units of 100 km s(-1) Mpc(-1). The frequent occurrence of these structures is one of several serious challenges to our current understanding of the origin and evolution of the large-scale distribution of matter in the universe.

  13. Life in the Universe

    Science.gov (United States)

    2001-10-01

    Live Webcast from Europe's Leading Research Organisations Summary Is there life elsewhere in the Universe? Are we alone? These questions have always fascinated humanity and for more than 50 years, physicists, biologists, chemists, cosmologists, astronomers and other scientists have worked tirelessly to answer these fundamental questions. And now this November via webcast, all the world will have the opportunity to see and hear the latest news on extraterrestrial life from the most prestigious research centers and how for the past three months, European students have had the chance to jump into the scientists' shoes and explore these questions for themselves. The event is being sponsored by the European Organisation for Nuclear Research (CERN) , the European Space Agency (ESA) and the European Southern Observatory (ESO) , in cooperation with the European Molecular Biology Laboratory (EMBL) and the European Synchrotron Radiation Facility (ESRF) and the European Association for Astronomy Education (EAAE). "Life in the Universe" is being mounted in collaboration with the Research Directorate-General of the European Commission for the European Week of Science and Technology in November 2001 . "Life in the Universe" competitions are already underway in 23 European countries to find the best projects from school students between 14 and 18. Two winning teams from each country will be invited to a final event at CERN in Geneva on 8-11 November 2001 to present their projects and discuss them with a panel of International Experts at a special three-day event. They will also compete for the "Super Prize" - a free visit to ESA's and ESO's research and technology facilities at Kourou and Paranal in South America. Students participating in the programme are encouraged to present their views on extraterrestrial life creatively. The only requirement is that the views be based upon scientific evidence. Many projects are being submitted just now - among them are scientific essays

  14. University Reactor Sharing Program

    International Nuclear Information System (INIS)

    Reese, W.D.

    2004-01-01

    Research projects supported by the program include items such as dating geological material and producing high current super conducting magnets. The funding continues to give small colleges and universities the valuable opportunity to use the NSC for teaching courses in nuclear processes; specifically neutron activation analysis and gamma spectroscopy. The Reactor Sharing Program has supported the construction of a Fast Neutron Flux Irradiator for users at New Mexico Institute of Mining and Technology and the University of Houston. This device has been characterized and has been found to have near optimum neutron fluxes for A39/Ar 40 dating. Institution final reports and publications resulting from the use of these funds are on file at the Nuclear Science Center

  15. Geneva University - Cancelled

    CERN Multimedia

    Université de Genève

    2010-01-01

    École de physique - Département de physique nucléaire et corspusculaire 24, quai Ernest-Ansermet 1211 GENEVA 4 Tel: (022) 379 62 73 - Fax: (022) 379 69 92 Monday 19 April 2010 17h00 - Stückelberg Auditorium Into the darkness: Simulating the distribution of dark matter in our Universe Prof. Volker Springel - Heidelberg Institute for Theoretical Studies   THE COLLOQUIUM IS CANCELLED. Prof. Markus Büttiker

  16. Building baby universes

    Science.gov (United States)

    Coles, Peter

    2017-08-01

    The thought of a scientist trying to design a laboratory experiment in which to create a whole new universe probably sounds like it belongs in the plot of a science-fiction B-movie. But as author Zeeya Merali explains in her new book A Big Bang in a Little Room, there are more than a few eminent physicists who think that this is theoretically possible.

  17. Dark matter universe

    Science.gov (United States)

    Bahcall, Neta A.

    2015-01-01

    Most of the mass in the universe is in the form of dark matter—a new type of nonbaryonic particle not yet detected in the laboratory or in other detection experiments. The evidence for the existence of dark matter through its gravitational impact is clear in astronomical observations—from the early observations of the large motions of galaxies in clusters and the motions of stars and gas in galaxies, to observations of the large-scale structure in the universe, gravitational lensing, and the cosmic microwave background. The extensive data consistently show the dominance of dark matter and quantify its amount and distribution, assuming general relativity is valid. The data inform us that the dark matter is nonbaryonic, is “cold” (i.e., moves nonrelativistically in the early universe), and interacts only weakly with matter other than by gravity. The current Lambda cold dark matter cosmology—a simple (but strange) flat cold dark matter model dominated by a cosmological constant Lambda, with only six basic parameters (including the density of matter and of baryons, the initial mass fluctuations amplitude and its scale dependence, and the age of the universe and of the first stars)—fits remarkably well all the accumulated data. However, what is the dark matter? This is one of the most fundamental open questions in cosmology and particle physics. Its existence requires an extension of our current understanding of particle physics or otherwise point to a modification of gravity on cosmological scales. The exploration and ultimate detection of dark matter are led by experiments for direct and indirect detection of this yet mysterious particle. PMID:26417091

  18. The Modern University, Ltd.

    OpenAIRE

    Frost, Tom

    2015-01-01

    Today, the university in the United Kingdom (UK) appears to be being led far from its educational, egalitarian roots. It appears to be a corporate beast, increasingly marketised, commodified and commercialised. In recent years, many words have been written on this matter. In this article, I wish to consider how these perceived changes could affect a cherished notion for academics – academic freedom. I connect the marketisation of UK higher education to the (comparatively) recent economic chan...

  19. State of the universe

    Energy Technology Data Exchange (ETDEWEB)

    Bath, G [ed.

    1980-01-01

    A survey is presented of the history of the universe, its origin, the structure and evolution of galaxies, the origin of the chemical elements, determination of the fundamental properties of stars, the properties of black holes, x-ray observations of galactic and extragalactic x-ray sources, exploration of the planets by planetary fly-bys and probes, and a survey of the whole electromagnetic spectrum which emphasizes the importance of each spectral region. (GHT)

  20. For information: Geneva University

    CERN Multimedia

    2005-01-01

    Ecole de physique Département de physique nucléaire et corspusculaire 24, Quai Ernest-Ansermet 1211 GENEVE 4 TéL: (022) 379 62 73 Fax: (022) 379 69 92 Lundi 5 décembre COLLOQUE DE PHYSIQUE at 17:00 - Stückelberg Auditorium ARCHEOLOGY OF THE UNIVERSE WITH THE COSMIC MICROWAVE BACKGROUND by Prof. Paolo de Bernardis / Université de Rome 'La Sapienza'

  1. Life In The Universe!

    CERN Multimedia

    2001-01-01

    Is there life elsewhere in the Universe? Are we alone? These questions have always fascinated humanity and for more than 30 years, physicists, biologists, chemists, cosmologists and astronomers have worked tirelessly to answer these questions. Yet just this past week at CERN students from all over Europe came to present their ideas on the subject and listen to the latest on extraterrestrial life from some of the world's most prestigious researchers.

  2. Dark matter universe.

    Science.gov (United States)

    Bahcall, Neta A

    2015-10-06

    Most of the mass in the universe is in the form of dark matter--a new type of nonbaryonic particle not yet detected in the laboratory or in other detection experiments. The evidence for the existence of dark matter through its gravitational impact is clear in astronomical observations--from the early observations of the large motions of galaxies in clusters and the motions of stars and gas in galaxies, to observations of the large-scale structure in the universe, gravitational lensing, and the cosmic microwave background. The extensive data consistently show the dominance of dark matter and quantify its amount and distribution, assuming general relativity is valid. The data inform us that the dark matter is nonbaryonic, is "cold" (i.e., moves nonrelativistically in the early universe), and interacts only weakly with matter other than by gravity. The current Lambda cold dark matter cosmology--a simple (but strange) flat cold dark matter model dominated by a cosmological constant Lambda, with only six basic parameters (including the density of matter and of baryons, the initial mass fluctuations amplitude and its scale dependence, and the age of the universe and of the first stars)--fits remarkably well all the accumulated data. However, what is the dark matter? This is one of the most fundamental open questions in cosmology and particle physics. Its existence requires an extension of our current understanding of particle physics or otherwise point to a modification of gravity on cosmological scales. The exploration and ultimate detection of dark matter are led by experiments for direct and indirect detection of this yet mysterious particle.

  3. Intimate partner violence in urban Pakistan: prevalence, frequency, and risk factors

    Directory of Open Access Journals (Sweden)

    Tazeen S Ali

    2011-03-01

    Full Text Available Tazeen S Ali1,2, Nargis Asad3, Ingrid Mogren4, Gunilla Krantz51School of Nursing, Aga Khan University, Karachi, Pakistan; 2Department of Public Health Sciences, Division of Global Health, Karolinska Institutet, Stockholm, Sweden; 3Department of Psychiatry, Aga Khan University, Karachi, Pakistan; 4Department of Clinical Science, Obstetrics and Gynecology, Umeå University, Umeå, Sweden; 5Department of Public Health and Community Medicine/Social Medicine, The Sahlgrenska Academy at University of Gothenburg, Göteborg, SwedenBackground: Intimate partner violence (IPV is an important public health issue with severe adverse consequences. Population-based data on IPV from Muslim societies are scarce, and Pakistan is no exception. This study was conducted among women residing in urban Karachi, to estimate the prevalence and frequency of different forms of IPV and their associations with sociodemographic factors.Methods: This cross-sectional community-based study was conducted using a structured questionnaire developed by the World Health Organisation for research on violence. Community midwives conducted face-to-face interviews with 759 married women aged 25–60 years.Results: Self-reported past-year and lifetime prevalence of physical violence was 56.3 and 57.6%, respectively; the corresponding figures for sexual violence were 53.4% and 54.5%, and for psychological abuse were 81.8% and 83.6%. Violent incidents were mostly reported to have occurred on more than three occasions during the lifetime. Risk factors for physical violence related mainly to the husband, his low educational attainment, unskilled worker status, and five or more family members living in one household. For sexual violence, the risk factors were the respondent’s low educational attainment, low socioeconomic status of the family, and five or more family members in one household. For psychological violence, the risk factors were the husband being an unskilled worker and low

  4. Universe opacity and CMB

    Science.gov (United States)

    Vavryčuk, Václav

    2018-04-01

    A cosmological model, in which the cosmic microwave background (CMB) is a thermal radiation of intergalactic dust instead of a relic radiation of the Big Bang, is revived and revisited. The model suggests that a virtually transparent local Universe becomes considerably opaque at redshifts z > 2 - 3. Such opacity is hardly to be detected in the Type Ia supernova data, but confirmed using quasar data. The opacity steeply increases with redshift because of a high proper density of intergalactic dust in the previous epochs. The temperature of intergalactic dust increases as (1 + z) and exactly compensates the change of wavelengths due to redshift, so that the dust radiation looks apparently like the radiation of the blackbody with a single temperature. The predicted dust temperature is TD = 2.776 K, which differs from the CMB temperature by 1.9% only, and the predicted ratio between the total CMB and EBL intensities is 13.4 which is close to 12.5 obtained from observations. The CMB temperature fluctuations are caused by EBL fluctuations produced by galaxy clusters and voids in the Universe. The polarization anomalies of the CMB correlated with temperature anisotropies are caused by the polarized thermal emission of needle-shaped conducting dust grains aligned by large-scale magnetic fields around clusters and voids. A strong decline of the luminosity density for z > 4 is interpreted as the result of high opacity of the Universe rather than of a decline of the global stellar mass density at high redshifts.

  5. The Flying University

    Science.gov (United States)

    Friesen, Catherine

    The Flying University is solo theater performance framed as an academic lecture about Marie Curie and her discovery of radium, delivered to a group of women who have gathered in secret to further their education. As the lecture proceeds, the professor brings in her own research based on a study of Esther Horsch (1905-1991) who lived on a farm in central Illinois. She introduces data from Esther's journals, personal memories, and dreams about Esther's life. The professor's investigation of radium plays at the intersections of magical and mundane, decay and the transformation of life, and the place of ambition in these two women's lives. The intention of this piece is to explore these themes, which are full of mystery, through the traces of the daily lives of Mme. Curie and Esther. Their words and photos are used as roots from which to imagine the things that echo beyond their familiar work; elemental and also fantastically radiant. The Flying University was written and performed by Catherine Friesen April 27-29, 2012 in the Center for Performance Experiment at Hamilton College as part of the University of South Carolina MFA Acting Class of 2013 showcase, Pieces of Eight.

  6. The inflationary universe

    International Nuclear Information System (INIS)

    Guth, A.; Steinhardt, P.

    1989-01-01

    The new inflationary cosmological model discussed here in terms of grand unified theories (GUTs) seems to offer solutions to all the problems associated with the big bang model, such as the existence of magnetic monopoles. Before the first 10 -30 s of the existence of the universe, a brief period of extraordinarily rapid expansion occurred according to the ''inflation'' model. Successes of the big bang model include the three standard testable predictions, but relate to time a second or two after the big bang, namely red-shifts of distant, receding galaxies, measured in the 1920s, the existence of a microwave background radiation, confirmed in 1964, and the abundance of light atomic nuclei such as Helium, Hydrogen and Lithium. Two problems posed by the big bang theory are the horizon problem which seeks an answer to the large-scale uniformity of the universe and the question of energy density which leads to questions about whether the universe is closed, open, or flat. In this new inflationary model the phase transition is driven by random fluctuations of the Higgs fields, thus overcoming the flaw in the original model. (U.K.)

  7. [Universal electrogustometer EG-2].

    Science.gov (United States)

    Wałkanis, Andrzej; Czesak, Michał; Pleskacz, Witold A

    2011-01-01

    Electrogustometry is a method for taste diagnosis and measurement. The EG-2 project is being developed in cooperation between Warsaw University of Technology and Military institute of Medicine in Warsaw. The device is an evolution of the recent universal electrogustometer EG-1 prototype. Due to considerations and experiences acquired during prototype usage, many enhancements have been incorporated into device. The aim was to create an easy-to-use, portable, battery powered device, enabled for fast measurements. Developed electrogustometer is using innovative, low-power microprocessor system, which control whole device. User interface is based on 5.7" graphical LCD (Liquid Crystal Display) and touchscreen. It can be directly operated by finger or with optional stylus. Dedicated GUI (Graphical User Interface) offers simple, predefined measurements and advance settings of signal parameters. It is also possible to store measurements results and patients data in an internal memory. User interface is multilanguage. Signals for patients examinations, supplied with bipolar electrode, are generated by an on-board circuit using DDS (Direct-Digital Synthesis) and DAC (Digital-to-Analog Converter). Electrogustometer is able to generate DC, sinus, triangle or rectangle signals with current amplitude from 0 to 500 pA and frequency form 0 to 500 Hz. Device is designed for manual and automeasurement modes. By using USB (Universal Serial Bus) port it is possible to retrieve data stored in internal memory and charging of built-in Li-lon battery as a source of power.

  8. Universal elements of fragmentation

    International Nuclear Information System (INIS)

    Yanovsky, V. V.; Tur, A. V.; Kuklina, O. V.

    2010-01-01

    A fragmentation theory is proposed that explains the universal asymptotic behavior of the fragment-size distribution in the large-size range, based on simple physical principles. The basic principles of the theory are the total mass conservation in a fragmentation process and a balance condition for the energy expended in increasing the surface of fragments during their breakup. A flux-based approach is used that makes it possible to supplement the basic principles and develop a minimal theory of fragmentation. Such a supplementary principle is that of decreasing fragment-volume flux with increasing energy expended in fragmentation. It is shown that the behavior of the decreasing flux is directly related to the form of a power-law fragment-size distribution. The minimal theory is used to find universal asymptotic fragment-size distributions and to develop a natural physical classification of fragmentation models. A more general, nonlinear theory of strong fragmentation is also developed. It is demonstrated that solutions to a nonlinear kinetic equation consistent with both basic principles approach a universal asymptotic size distribution. Agreement between the predicted asymptotic fragment-size distributions and experimental observations is discussed.

  9. Antimatter in the universe

    International Nuclear Information System (INIS)

    Papini, P.; Spillantini, P.

    1996-01-01

    In this paper, the present knowledge on the study of antimatter in the universe is summarized. From the theoretical point of view, both baryon symmetric and asymmetric cosmologies are possible in the framework of big-bang theories. With the three 'Sakharov's conditions', it is possible to imagine an evolution from the big bang toward a universe with 'all matter' inside or toward a symmetric universe with matter and antimatter separated in domains. Measurement of the γ ray cosmic background implies only a local asymmetry and does not rule out the possibility of a symmetry on a large scale. Observations of the antiproton spectrum and antinuclei in cosmic rays are useful tools for studying the possible existence of an antigalaxy. The number and quality of the present data are poor, and no data are available at high energy, where the presence of an antigalaxy must be revealable owing to a large amount of antiprotons and antinuclei. In this paper, the future experimental projects to measure the antiproton flux at high energies and to search for antinuclei in cosmic rays are briefly presented

  10. How much we know about university internationalization and university autonomy

    DEFF Research Database (Denmark)

    Turcan, Romeo V.; Gullieva, Valeria

    2013-01-01

    in their mission statements and strategic plans. Conventional wisdom suggests that universities should adapt their strategies, resources, and structures and organizations to international environments. However, recent examples of university internationalization failures and withdrawals from international markets...

  11. University Pedagogy for Assistant Professors at Aalborg University (Part 1)

    DEFF Research Database (Denmark)

    Kolmos, Anette; Krogh, Lone

    2003-01-01

    The article describes a course for assistant professors within the University Teacher Education at Aalborg University. The course focus is to develop knowledge, skills and methods from within the didactic, pedagogical, and learning theory-based fields....

  12. Georgetown University and Hampton University Prostate Cancer Undergraduate Fellowship Program

    Science.gov (United States)

    2018-01-01

    goals. The first goal was to integrate upper level undergraduate students from Hampton University into the Georgetown Lombardi Comprehensive Cancer...upper level undergraduate Biology and Biochemistry Majors from Hampton University to work throughout the summer participating in prostate cancer...Dominican Republic summer 2017 Marissa Willis HU-GU Fellow Summer 2016 (Notario lab) Biology Major Hampton University, class of 2018, Math and

  13. University IPRs and knowledge transfer : is university ownership more efficient?

    NARCIS (Netherlands)

    Crespi, G.A.; Geuna, A.; Nomaler, Z.O.; Verspagen, B.

    2010-01-01

    This paper addresses an issue that has been largely ignored so far in the empirical literature on the role of patents in university-industry knowledge transfer: does it matter who owns the patents on university research? We observe that especially in Europe, many patents in which university

  14. University Pedagogy for Assistant Professors at Aalborg University (Part 2)

    DEFF Research Database (Denmark)

    Kolmos, Anette; Krogh, Lone

    2003-01-01

    In issue 1-2003, Anette Kolmos and Lone Krogh reported on the two-semester study course " University Pedagogy for Assistant Professors at Aalborg University (DK)". Now, in part 2, they are adressing guidelines for supervison and advising of assistant professors in the university teacher education...

  15. Private Universities in Zimbabwe: The Case of Africa University ...

    African Journals Online (AJOL)

    Whilst many of these challenges are shared with other private universities in Zimbabwe, a few are peculiar to Africa University. This paper discusses Africa University's experience with regard to establishment, nature, institutional marketing and student recruitment, programmes, governance, finding and other external factors ...

  16. The Necessary University

    Directory of Open Access Journals (Sweden)

    Jorge Luis Ibarra Mendívil

    2003-05-01

    Full Text Available Because of the complex scenarios brought about by globalization, the necessary university will require flexible models oriented toward problem solving and collaborative work, which will also allow students to enter and leave the institution at different times during their training. Among its main features, there will be collegial work, in the sense of collective teaching experimentation; active follow up of students’ progress; trust in the students’ potential; a close relationship of headmasters, teachers and students; and rules that provide certainty to institutional life.

  17. The relational universe

    International Nuclear Information System (INIS)

    Magnon, A.

    1998-01-01

    A relational approach to be observable universe is proposed, which precludes the concept of absolute background. Space-time events emerge as dynamical entities which owe their existence to a memorization process, itself inter wind with the availability of cosmological horizons (screening from totality) sourcing long-range correlations. The resulting (and relational) mode of description sheds light on various paradoxes (EPR, Foucault pendolum, light beam effect, etc.), on the problem of instantaneous and global influences (quark deconfinement) as related to the interconnectedness of our cosmos. This scenario leads to comment on living systems vs. robots, and on non-recursive and global aspects of the mathematical intuition

  18. The Artful Universe Expanded

    International Nuclear Information System (INIS)

    Bassett, B A

    2005-01-01

    The cosmos is an awfully big place and there is no better guide to its vast expanse and fascinating nooks and crannies than John Barrow. A professor of mathematical sciences at Cambridge University, Barrow embodies that rare combination of highly polished writer and expert scientist. His deft touch brings together the disparate threads of human knowledge and weaves them into a tapestry as rich and interesting for the expert as it is for the layperson. The Artful Universe Expanded is an updated edition of this popular book first published in 1995. It explores the deeply profound manner in which natural law and the nature of the cosmos have moulded and shaped us, our cultures and the very form of our arts and music-a new type of 'cosmic' anthropology. The main themes Barrow chooses for revealing this new anthropology are the subjects of evolution, the size of things, the heavens and the nature of music. The book is a large, eclectic repository of knowledge often unavailable to the layperson, hidden in esoteric libraries around the world. It rivals The Da Vinci Code for entertainment value and insights, but this time it is Nature's code that is revealed. It is rare indeed to find common threads drawn through topics as diverse as The Beetles, Bach and Beethoven or between Jackson Pollock, the Aztecs, Kant, Picasso, Byzantine mosaics, uranium-235 and the helix nebula. Barrow unerringly binds them together, presenting them in a stimulating, conversational style that belies the amount of time that must have gone into researching this book. Dip into it at random, or read it from cover to cover, but do read it. The Artful Universe Expanded is an entertaining antidote to the oft-lamented pressures to know more and more about less and less and the apparently inexorable march of specialization. On reading this book one can, for a short time at least, hold in one's mind a vision that unifies science, art and culture and glimpse a universal tapestry of great beauty. (book review)

  19. Status Report Jilin University

    Energy Technology Data Exchange (ETDEWEB)

    Dong, Yang; Huo Junde, E-mail: huojd@jlu.edu.cn

    2013-08-15

    Status of mass chain evaluation: Jilin University (JLU) group is responsible for nuclear structure and decay data evaluation of mass chains: A=52, 53, 54, 55, 56, and 63. (1) Status of publication in Nuclear Data Sheets (NDS): 52 - NDS, 106, 773 (2007); 53 - NDS, 110, 2689 (2009); 54 - NDS, 107, 1393 (2006); 55 - NDS, 109, 787 (2008); 56 - NDS, 112, 1513 (2011); 63 - NDS, 92, 147 (2001); ENSDF (2009) (2) Evaluation since last meeting (2011). A=54 in review (since 26-Dec-2012) A=52 evaluating A=63 evaluating. Other activities are briefly presented.

  20. Physics of the universe

    CERN Document Server

    Sachs, Mendel

    2010-01-01

    This book presents a new approach to the subject of cosmology. It fully exploits Einstein's theory of general relativity. It is found that the most general formal expression of the theory replaces the (10-component) tensor formalism with a (16-component) quaternion formalism. This leads to a unified field theory, where one field incorporates gravitation and electromagnetism. The theory predicts an oscillating universe cosmology with a spiral configuration. Dark matter is explained in terms of a sea of particle-antiparticle pairs, each in a particular (derived) ground state. This leads to an ex

  1. Attractors, universality, and inflation

    Science.gov (United States)

    Downes, Sean; Dutta, Bhaskar; Sinha, Kuver

    2012-11-01

    Studies of the initial conditions for inflation have conflicting predictions from exponential suppression to inevitability. At the level of phase space, this conflict arises from the competing intuitions of CPT invariance and thermodynamics. After reviewing this conflict, we enlarge the ensemble beyond phase space to include scalar potential data. We show how this leads to an important contribution from inflection point inflation, enhancing the likelihood of inflation to a power law, 1/Ne3. In the process, we emphasize the attractor dynamics of the gravity-scalar system and the existence of universality classes from inflection point inflation. Finally, we comment on the predictivity of inflation in light of these results.

  2. Cyclotron to Oslo University

    International Nuclear Information System (INIS)

    Sandstad, J.

    1978-01-01

    The new cyclotron was delivered to Oslo University on September 21st 1978, and was mannfactured by A/B Scandtronix of Uppsala, Sweden. The contract price was 6,8 million Norwegian kroner and installation will cost a further 4 million. The main specifications are given. The energy will be 36 MeV for protons and alpha particles, 18 MeV deuterons and 48 MeV for helium 3. The principle of a cyclotron is briefly described. While the primary purpose of the machine is nuclear research it is also planned to produce short-lived radioisotopes, primarily iodine 123. (JIW)

  3. The Artful Universe Expanded

    Energy Technology Data Exchange (ETDEWEB)

    Bassett, B A [Institute of Cosmology and Gravitation, University of Portsmouth (United Kingdom)

    2005-07-29

    The cosmos is an awfully big place and there is no better guide to its vast expanse and fascinating nooks and crannies than John Barrow. A professor of mathematical sciences at Cambridge University, Barrow embodies that rare combination of highly polished writer and expert scientist. His deft touch brings together the disparate threads of human knowledge and weaves them into a tapestry as rich and interesting for the expert as it is for the layperson. The Artful Universe Expanded is an updated edition of this popular book first published in 1995. It explores the deeply profound manner in which natural law and the nature of the cosmos have moulded and shaped us, our cultures and the very form of our arts and music-a new type of 'cosmic' anthropology. The main themes Barrow chooses for revealing this new anthropology are the subjects of evolution, the size of things, the heavens and the nature of music. The book is a large, eclectic repository of knowledge often unavailable to the layperson, hidden in esoteric libraries around the world. It rivals The Da Vinci Code for entertainment value and insights, but this time it is Nature's code that is revealed. It is rare indeed to find common threads drawn through topics as diverse as The Beetles, Bach and Beethoven or between Jackson Pollock, the Aztecs, Kant, Picasso, Byzantine mosaics, uranium-235 and the helix nebula. Barrow unerringly binds them together, presenting them in a stimulating, conversational style that belies the amount of time that must have gone into researching this book. Dip into it at random, or read it from cover to cover, but do read it. The Artful Universe Expanded is an entertaining antidote to the oft-lamented pressures to know more and more about less and less and the apparently inexorable march of specialization. On reading this book one can, for a short time at least, hold in one's mind a vision that unifies science, art and culture and glimpse a universal tapestry of great

  4. Messengers of the universe

    International Nuclear Information System (INIS)

    Becker, J.K.; Spurio, M.

    2011-01-01

    The observation of the solar neutrinos and of a neutrino burst from the supernova explosion 1987A opened a new observation field which in the next years could be complemented with the detection of astrophysical highenergy neutrinos. Neutrino astronomy is a young discipline derived from the fundamental necessity of extending conventional astronomy beyond the usual electro-magnetic messengers. This is a summary of recent results on those new 'messengers of the universe', based on the presentations in Branch IV of the Neutrino Oscillation Workshop 2010 (NOW2010).

  5. Understanding Our Only Universe

    Directory of Open Access Journals (Sweden)

    Valerio Marra

    2017-09-01

    Full Text Available In an imaginary dialogue between a professor and a layman about the future of cosmology, the said professor relates the paradoxical story of scientist Zee Prime, a bold thinker of a future civilization, stuck in a lonely galaxy, forever unaware of the larger universe. Zee Prime comes to acknowledge his position and shows how important it is to question standard models and status quo, as only the most imaginative ideas give us the chance to understand what he calls “our only universe” — the special place and time in which we live.

  6. Conformally connected universes

    International Nuclear Information System (INIS)

    Cantor, M.; Piran, T.

    1983-01-01

    A well-known difficulty associated with the conformal method for the solution of the general relativistic Hamiltonian constraint is the appearance of an aphysical ''bag of gold'' singularity at the nodal surface of the conformal factor. This happens whenever the background Ricci scalar is too large. Using a simple model, it is demonstrated that some of these singular solutions do have a physical meaning, and that these can be considered as initial data for Universe containing black holes, which are connected, in a conformally nonsingular way with each other. The relation between the ADM mass and the horizon area in this solution supports the cosmic censorship conjecture. (author)

  7. On universal procrastination

    Science.gov (United States)

    Eliazar, Iddo

    2017-09-01

    This paper presents a general stochastic model for procrastination with respect to a deadline. The model establishes a universal procrastination pattern that follows an inverse power-law: if the time remaining to the deadline is r then the response is 1/rε , where ɛ is a positive exponent. The model further establishes that the exponent value ε =1 , which yields the harmonic response 1/r , stands out as special and distinguishable. The theoretical results of the model are shown to be in perfect accord with recent empirical findings.

  8. QANU - Quality Assurance Netherlands Universities

    DEFF Research Database (Denmark)

    Jensen, Henrik Toft; Maria E., Weber; Vyt, André

    The Quality Assurance Netherlands Universities (QANU) underwent an ENQA-coordinated external review in 2016. The review was chaired by Henrik Toft Jensen, Research fellow at Roskilde University (RUC), Denmark....

  9. Qualitative analysis of homogeneous universes

    International Nuclear Information System (INIS)

    Novello, M.; Araujo, R.A.

    1980-01-01

    The qualitative behaviour of cosmological models is investigated in two cases: Homogeneous and isotropic Universes containing viscous fluids in a stokesian non-linear regime; Rotating expanding universes in a state which matter is off thermal equilibrium. (Author) [pt

  10. For information: Geneva University

    CERN Multimedia

    2005-01-01

    SECTION DE PHYSIQUEDépartement de physique de la matière condensée Quai Ernest-Ansermet 24CH-1211 Genève 4Tél. 022 379 65 11 - Fax 022 379 68 69 Mercredi 14 décembre Colloque exceptionnel 17h00 - Auditoire: Grand Auditoire A Possible Solution to the High Temperature Superconducivity Phenomena Professor Chandra Varma / Department of physics, University of California Riverside The intense effort on the solution of the high Tc problem (over 105 papers in 18 years) has led to remarkable new ideas which will affect future developments not just in condensed matter physics but all of physics. There may now exist a consistent microscopic theory which explains the universal features of the phase diagram of the Cuprates and whose principal predictions have been experimentally verified. This theory draws on an assimilation of the wide ranging experiments on the Cuprates to formulate a phenomenology. The phenomenology is used to formulate a microscopic theory which in turn draws on aspects ranging from solid ...

  11. Universal Image Steganalytic Method

    Directory of Open Access Journals (Sweden)

    V. Banoci

    2014-12-01

    Full Text Available In the paper we introduce a new universal steganalytic method in JPEG file format that is detecting well-known and also newly developed steganographic methods. The steganalytic model is trained by MHF-DZ steganographic algorithm previously designed by the same authors. The calibration technique with the Feature Based Steganalysis (FBS was employed in order to identify statistical changes caused by embedding a secret data into original image. The steganalyzer concept utilizes Support Vector Machine (SVM classification for training a model that is later used by the same steganalyzer in order to identify between a clean (cover and steganographic image. The aim of the paper was to analyze the variety in accuracy of detection results (ACR while detecting testing steganographic algorithms as F5, Outguess, Model Based Steganography without deblocking, JP Hide and Seek which represent the generally used steganographic tools. The comparison of four feature vectors with different lengths FBS (22, FBS (66 FBS(274 and FBS(285 shows promising results of proposed universal steganalytic method comparing to binary methods.

  12. Carbon in the Universe

    Science.gov (United States)

    Allamandola, Louis J.

    2013-01-01

    Over the past few decades, NASA missions have revealed that we live in a Universe that is not a hydrogen-dominated, physicist's paradise, but in a molecular Universe with complex molecules directly interwoven into its fabric. These missions have shown that molecules are an abundant and important component of astronomical objects at all stages of their evolution and that they play a key role in many processes that dominate the structure and evolution of galaxies. Closer to home in our galaxy, the Milky Way, they have revealed a unique and complex organic inventory of regions of star and planet formation that may well represent some of the prebiotic roots to life. Astrobiology emerges from the great interest in understanding astrochemical evolution from simple to complex molecules, especially those with biogenic potential and the roles they may play as primordial seeds in the origin of life on habitable worlds. The first part of this talk will highlight how infrared spectroscopic studies of interstellar space, combined with dedicated laboratory simulations, have revealed the widespread presence of complex organics across deep space. The remainder of the presentation will focus on the evolution of these materials and astrobiology.

  13. Universality of fragment shapes.

    Science.gov (United States)

    Domokos, Gábor; Kun, Ferenc; Sipos, András Árpád; Szabó, Tímea

    2015-03-16

    The shape of fragments generated by the breakup of solids is central to a wide variety of problems ranging from the geomorphic evolution of boulders to the accumulation of space debris orbiting Earth. Although the statistics of the mass of fragments has been found to show a universal scaling behavior, the comprehensive characterization of fragment shapes still remained a fundamental challenge. We performed a thorough experimental study of the problem fragmenting various types of materials by slowly proceeding weathering and by rapid breakup due to explosion and hammering. We demonstrate that the shape of fragments obeys an astonishing universality having the same generic evolution with the fragment size irrespective of materials details and loading conditions. There exists a cutoff size below which fragments have an isotropic shape, however, as the size increases an exponential convergence is obtained to a unique elongated form. We show that a discrete stochastic model of fragmentation reproduces both the size and shape of fragments tuning only a single parameter which strengthens the general validity of the scaling laws. The dependence of the probability of the crack plan orientation on the linear extension of fragments proved to be essential for the shape selection mechanism.

  14. Universal Payload Information Management

    Science.gov (United States)

    Elmore, Ralph B.

    2003-01-01

    As the overall manager and integrator of International Space Station (ISS) science payloads, the Payload Operations Integration Center (POIC) at Marshall Space Flight Center has a critical need to provide an information management system for exchange and control of ISS payload files as well as to coordinate ISS payload related operational changes. The POIC's information management system has a fundamental requirement to provide secure operational access not only to users physically located at the POIC, but also to remote experimenters and International Partners physically located in different parts of the world. The Payload Information Management System (PIMS) is a ground-based electronic document configuration management and collaborative workflow system that was built to service the POIC's information management needs. This paper discusses the application components that comprise the PIMS system, the challenges that influenced its design and architecture, and the selected technologies it employs. This paper will also touch on the advantages of the architecture, details of the user interface, and lessons learned along the way to a successful deployment. With PIMS, a sophisticated software solution has been built that is not only universally accessible for POIC customer s information management needs, but also universally adaptable in implementation and application as a generalized information management system.

  15. History of the Universe Poster

    Science.gov (United States)

    History of the Universe Poster You are free to use these images if you give credit to: Particle Data Group at Lawrence Berkeley National Lab. New Version (2014) History of the Universe Poster Download: JPEG version PDF version Old Version (2013) History of the Universe Poster Download: JPEG version

  16. How to Run a University

    Science.gov (United States)

    Evans, G. R.

    2006-01-01

    The Lambert Review of Business-University Collaboration proposed a business model for universities in 2003. Pressure to change university governance to make it match the business model remains strong, and it is being most actively applied to Oxford and Cambridge. The Oxford and Cambridge governance debates (which began in the 1990s) open up the…

  17. Collapse of simple harmonic universe

    International Nuclear Information System (INIS)

    Mithani, Audrey T.; Vilenkin, Alexander

    2012-01-01

    In a recent paper Graham et al constructed oscillating and static universe models which are stable with respect to all classical perturbations. Here we show that such universes are quantum-mechanically unstable and can collapse by quantum tunneling to zero radius. We also present instantons describing nucleation of oscillating and static universes from nothing

  18. The RAE and University Efficiency.

    Science.gov (United States)

    Mace, John

    2000-01-01

    Evaluates effects of the new British funding formula for universities, based on the research assessment exercise (RAE). Compares effects of the RAE on two contrasting universities and finds the RAE has dramatically affected university organization, teaching, and research. RAE may have increased efficiency in teaching and research but encourages…

  19. Universal service policy in Vietnam

    DEFF Research Database (Denmark)

    Do Manh, Thai; Falch, Morten; Von Salakpi, Simeon

    2016-01-01

    Universal service provision is a key to bridge the digital divide. This paper provides an empirical examination of the Vietnamese universal policy introduced in 2015 for implementation up to 2020. Using the framework of King et al. (1994) the paper analyses the universal services policy in Vietna...

  20. From Traditional to Modern Universities

    DEFF Research Database (Denmark)

    Nielsen, Anja Birch; Sort, Jesper Chrautwald; Nielsen, Christian

    concludes that the performance management used today in universities in form of publications is overlooking the industries’ need of growth from the university knowledge. Hence motivating the scientists to engage in collaborations only from the university point of view and only to a limited extent concerning...... about the companies....

  1. Imagine the Universe!

    Science.gov (United States)

    White, N.

    2003-01-01

    Welcome to the 2004 edition of the education CD from the Laboratory for High Energy Astrophysics at NASA Goddard Space Flight Center. We hope that you will find it to be an exciting and fun learning experience. We have tried very hard to make this CD as user-friendly as possible and along the way we have discovered some things that every user may need to know. Please read the README file found on the CD if you have any questions or problems using the disk. Then, after that, if you still have problems, email us at itu@athena.gsfc.nasa.gov. We will be happy to help you 'get going'! Below are links to all of the sites included on the CD. You will also find the addresses for the on-line version of each of these sites. If you have a good Internet connection available, we recommend that you view the sites on-line. There you will find the latest updated information, interactive activities, and active links to other sites. Included on the disk are: Imagine The Universe! This site is dedicated to a discussion about our Universe... what we know about it, how it is evolving, and the kinds of objects and phenomena it contains. Emphasizing the X-ray and gamma-ray parts of the electromagnetic spectrum, it also discusses how scientists know what they know, what mysteries remain, and how the answers to remaining mysteries may one day be found. Lots of movies, quizzes, and a special section for educators. Geared for ages 14 and up. This site can be viewed on-line at http://imagine.gsfc.nasa.gov/. StarChild: A learning center for young astronomers The 1998 Webby Award Winner for Best Education Website, StarChild is aimed at ages 4-14. It contains easy-to-understand information about our Solar System, the Universe, and space exploration. There are also activities, songs, movies, and puzzles! This site can be viewed on-line at http://starchild.gsfc.nasa.gov/. Astronomy Picture of the Day APOD offers a new astronomical image and caption each calendar day. We have captured the year 2003

  2. University autonomy as sensemaking

    DEFF Research Database (Denmark)

    Lind, Jonas Krog

    The formal autonomy of universities in Europe has generally increased over recent decades. However, new forms of accountability measures and more indirect state steering have accompanied this development, making it difficult to assess the actual autonomy. The article addresses this problem...... by applying the sensemaking approach to the study of organizational autonomy. Enacted autonomy is suggested as a new conceptualization that challenges the basic assumption in studies on formal autonomy that autonomy is only about external constraints on action. It does so by insisting on the active subjects...... in the enactment of the environment, thereby questioning the validity of a clear distinction between what is internal and what is external to an organization. By acknowledging the subjective dimension of autonomy, a set of stylized identities is developed as a tool for understanding the enactment of autonomy...

  3. Universal leakage elimination

    International Nuclear Information System (INIS)

    Byrd, Mark S.; Lidar, Daniel A.; Wu, L.-A.; Zanardi, Paolo

    2005-01-01

    'Leakage' errors are particularly serious errors which couple states within a code subspace to states outside of that subspace, thus destroying the error protection benefit afforded by an encoded state. We generalize an earlier method for producing leakage elimination decoupling operations and examine the effects of the leakage eliminating operations on decoherence-free or noiseless subsystems which encode one logical, or protected qubit into three or four qubits. We find that by eliminating a large class of leakage errors, under some circumstances, we can create the conditions for a decoherence-free evolution. In other cases we identify a combined decoherence-free and quantum error correcting code which could eliminate errors in solid-state qubits with anisotropic exchange interaction Hamiltonians and enable universal quantum computing with only these interactions

  4. The International Space University

    Science.gov (United States)

    Davidian, Kenneth J.

    1990-01-01

    The International Space University (ISU) was founded on the premise that any major space program in the future would require international cooperation as a necessary first step toward its successful completion. ISU is devoted to being a leading center for educating future authorities in the world space industry. ISU's background, goals, current form, and future plans are described. The results and benefits of the type of education and experience gained from ISU include technical reports describing the design projects undertaken by the students, an exposure to the many different disciplines which are a part of a large space project, an awareness of the existing activities from around the world in the space community, and an international professional network which spans all aspects of space activities and covers the globe.

  5. Teaching Function at University

    Directory of Open Access Journals (Sweden)

    Alma Elena Figueroa Rubalcava

    2008-08-01

    Full Text Available A peremptory change in education and the higher education at universities is occurriyng. Since 60´s to date theoretical issues on the role of education are continuously on modification more rapidly than the teaching and learning practices that need more time to be realized. In this paper is presented a broad scope of main national and international organizations that propose, promote and systematize those educational changes since a half century ago and specially, those that impact the formation tendency based on competences. On other side, and not pretending be exhaustive, in this paper is highlighted a list of educational competences that teachers need to develop if they pretend to realize their teaching functions with high quality standards, mainly those related with velocity involvement as curriculum constructor.

  6. Universal mesoscopic conductance fluctuations

    International Nuclear Information System (INIS)

    Evangelou, S.N.

    1992-01-01

    The theory of conductance fluctuations in disordered metallic systems with size large compared to the mean free path of the electron but small compared to localization length is considered. It is demonstrates that fluctuations have an universal character and are due to repulsion between levels and spectral rigidity. The basic fluctuation measures for the energy spectrum in the mesoscopic regime of disordered systems are consistent with the Gaussian random matrix ensemble predictions. Although our disordered electron random matrix ensemble does not belong to the Gaussian ensemble the two ensembles turn out to be essentially similar. The level repulsion and the spectral rigidity found in nuclear spectra should also be observed in the metallic regime of Anderson localization. 7 refs. (orig.)

  7. External conference: Geneva University

    CERN Multimedia

    2006-01-01

    ECOLE DE PHYSIQUE Département de physique nucléaire et corspusculaire 24, Quai Ernest-Ansermet 1211 GENEVE 4 - Tél : 022 379 62 73 - Fax: 022 379 69 92 Monday 12 June 2006 PARTICLE PHYSICS COLLOQUIUM at 17:00 - Stückelberg Auditorium Quantum computers - dream and realization Prof. R. Blatt / University of Innsbruck, Austria Computational operations always rely on real physical processes, which are data input, data representation in a memory, data manipulation using algorithms and finally, the data output. With conventional computers all the processes are classical processes and can be described accordingly. Theoretically, it is known for several years now that certain computations could be processed much more efficiently using quantum mechanical operations. This requires the implementation of quantum bits (qubits), quantum registers and quantum gates and the development of quantum algorithms. Several approaches for the implementation of quantum computers will be presented, with special emphasis o...

  8. FOR INFORMATION: Geneva University

    CERN Multimedia

    2005-01-01

    Ecole de physique Département de physique nucléaire et corspusculaire 24, Quai Ernest-Ansermet 1211 GENEVE 4 TéL: (022) 379 62 73 Fax: (022) 379 69 92 Wednesday 30 November PARTICLE PHYSICS SEMINAR at 17:00 - Stückelberg Auditorium CVD Diamond Radiation Sensors For Application In Very High Radiation Environments by Prof. Peter Weilhammer / University and INFN Perugia and CERN After an introduction into the basic properties and operating principles of CVD diamond radiation sensor material, measurements of charge carrier collection and leakage currents in single crystal and polycrystalline CVD diamonds will be presented. Results from measurements of the effective mobilities and carrier lifetime of electrons and holes, using the Transient Current Technique (TCT), will be shown. Radiation hardness of CVD polycrystalline diamonds will be discussed. A summary of radiation hardness measurements, carried out over several years, will be presented for polycrystalline material. Performance of diamond trackin...

  9. Radioecology. University textbook

    International Nuclear Information System (INIS)

    Toelgyessy, J.; Harangozo, M.

    2000-01-01

    This textbook of radioecology for university students consists of next chapters: (1) Radioecology as special part of ecology; (2) Radionuclides in the biosphere; (3) Radioactivity of atmosphere an factors influenced its value; (4) Radioactivity of waters and factors influenced its value; (5) Radioactivity of soil and its connection with mechanical structure and chemical composition of soil as well ass with used agricultural-technical and agricultural-chemical procedures; (6) Radioactivity of plants and factors influenced its value; (7) Radioactivity of animals and animal organs and factors influenced its value; (8) Ionisation radiation and human organism. Radioactivity of human tissues; (9) Behaviour of individual groups of radionuclide in the environment; (10) Determination of radionuclides in components of the environment; (11) Radioactive wastes; (12) Nullification of nuclear reactors; (13) Radionuclides in medicine; (14) Radionuclides in vegetal production and food processing; (15) Safety of work in nuclear scientific and technological disciplines; (16) Assessment and regulation of radiation risks for the environment

  10. Plasma and the universe

    International Nuclear Information System (INIS)

    Falthammar, C.G.

    1988-01-01

    Hannes Alfven has enjoyed a long and spectacular career in which he has time and again pioneered the path that other workers were able fruitfully to exploit. One thinks of the Alven waves, the concept of gyrocenter drift and the perturbation theory based on it, and the critical velocity phenomenon in the interaction of a plasma with a neutral gas. All of these discoveries have been of fundamental importance. By no means content to rest on his laurels, Alfven has, during the last decade, contributed to science in a major sense, especially in the field of cosmogeny. For example, he has used the latest data from the Voyager spacecraft to test his detailed predictions of the structure of the Saturnian rings. Alfven's current preoccupation is with the Plasma Universe and, as may be expected, some of his concepts are receiving observational support, while others are still controversial

  11. Life In The Universe!

    CERN Multimedia

    2001-01-01

    An alien invasion of CERN? Is there life elsewhere in the Universe? Are we alone? These questions have always fascinated humanity and for more than 30 years, physicists, biologists, chemists, cosmologists and astronomers have worked tirelessly to answer these questions. Yet just this past week at CERN students from all over Europe came to present their ideas on the subject and listen to the latest on extraterrestrial life from some of the world's most prestigious researchers. Students participating in the programme were encouraged to present their views on extraterrestrial life creatively and boy did they! The team from Portugal ran performances of Greek Theatre, the team from Hungary created a board game, while the team from Belgium recited poetry questioning the existence of extraterrestrials. But all was not light hearted, there were touching presentations of violin and piano by the French team and a very thought provoking theatre performance by the German team contrasting the search for extraterrestrial...

  12. Fred Hoyle's Universe

    Science.gov (United States)

    Gregory, Jane

    2005-08-01

    Fred Hoyle was a Yorkshire truant who became the voice of British astronomy. For fifty years, he spoke out for astronomy in the newspapers, on government committees, at scientific meetings, in popular books and on the radio. He devised a never-ending history of the universe, and worked out how the elements were made. He founded a prestigious institute for theoretical astronomy and built a giant telescope, and if it rained on his summer holiday, he sat in his caravan and wrote science fiction novels for his legions of fans around the world. Fred Hoyle also claimed that diseases fall from the sky, that the big bang never happened, and that the Astronomer Royal should be abolished. When the outspoken Fred Hoyle spoke out for astronomy, some astronomers really wished he had kept his mouth shut. This book tells the behind-the-scenes story of Hoyle's widely acclaimed and deeply controversial role in the ideas, organization and public face of astronomy in post-war Britain. It chronicles the triumphs, acrimony, jealousies, rewards and bitter feuds of a field in turmoil, and meets the astronomers, contemplating cosmic questions, keeping secrets, losing their tempers, winkling information out of distant stars and, over tea on the lawn, discussing the finer points of libel law. Fred Hoyle's Universe draws on previously confidential government documents, recently released personal correspondence and interviews with Hoyle's friends, colleagues and critics, as well as with Hoyle himself, to bring you the man, the science, and the scandal behind the genial and genteel facade of the most exciting period in the history of astronomy.

  13. Wikipedia ranking of world universities

    Science.gov (United States)

    Lages, José; Patt, Antoine; Shepelyansky, Dima L.

    2016-03-01

    We use the directed networks between articles of 24 Wikipedia language editions for producing the wikipedia ranking of world Universities (WRWU) using PageRank, 2DRank and CheiRank algorithms. This approach allows to incorporate various cultural views on world universities using the mathematical statistical analysis independent of cultural preferences. The Wikipedia ranking of top 100 universities provides about 60% overlap with the Shanghai university ranking demonstrating the reliable features of this approach. At the same time WRWU incorporates all knowledge accumulated at 24 Wikipedia editions giving stronger highlights for historically important universities leading to a different estimation of efficiency of world countries in university education. The historical development of university ranking is analyzed during ten centuries of their history.

  14. (Re)Discovering University Autonomy

    DEFF Research Database (Denmark)

    This book challenges traditional approach to university autonomy which is based on four pillars: organisational, financial, human resource, and academic. The main thesis is that a fuller understanding of university autonomy can only be obtained through a more holistic view of the complex inter......-relationships between stakeholders and policies which can reinforce and equally pull in opposite directions. The holistic view is expressed in a model of institutional university autonomy that brings together the traditional basic four pillars of autonomy, and five interfaces: government–university; university......–university staff; academic staff–students; university–business; and university–internationalisation. This model is explored through international case studies that give new insights and reinforce our understanding that the issues relating to institutional university autonomy are complex, interactive and genuinely...

  15. Sheet universes and the shapes of Friedmann universes

    International Nuclear Information System (INIS)

    Lynden-Bell, D.; Redmount, I.H.

    1989-01-01

    Unless Ω>1,the Big Bang did not start from a point. Consideration shows sheet universes in which matter is confined to a homogeneous universe. Sheet universes and the corresponding embeddings of FRW universes into Minkowski space are drawn. Their initial singularities are shown to be point-like for the 'closed' case, line-like for the 'flat' (Ω=1) case and surface-like for the 'open' case. In contrast to the cross-sections at constant comoving proper time, typical spacelike cross-sections of the 'flat' universes are closed and encounter their extensive singularities. All cross-sections of the 'closed' universe are closed and only very special cross-sections encounter the point singularities at the Big Bang or the Big Crunch. (author)

  16. Behavioral medicine in Teikyo University and Toho University

    OpenAIRE

    Takeuchi, Takeaki; Hashizume, Masahiro

    2016-01-01

    Behavioral medicine has increased in importance to become a promising field in medical education. The Teikyo University Graduate School of Public Health and Toho University School of Medicine were evaluated in terms of their educational emphasis on behavioral medicine. The Teikyo University Graduate School of Public Health has the following five core requirements, as in the global standards: behavioral medicine, biostatistics, epidemiology, occupational health, and health policy management. B...

  17. Postmodernity and the university

    Directory of Open Access Journals (Sweden)

    Peter Scott

    2012-09-01

    Full Text Available The utility of post-modernism as an interpretative framework for understanding the development of contemporary higher education systems is sharply contested. Critics argue that post-modernism is, at best, a set of ideas in aesthetics, literature and critical theory with limited relevance outside these domains and, at worst, a passing intellectual fashion that is now out-of-date. However, post-modernity —or, as some would prefer, late modernity or ‘fluid’ modernity — is perhaps a more useful idea. In 21stcentury society there are a number of trends, some structural such as the growth of a knowledge-based economy and development of new patterns of knowledge production; and some conceptual such as the reconfiguration of time and space and the recognition of ‘difference’ (and risk? as key factor in the constitution of social life (and individual identity, which have a direct impact on the university. This impact is felt in two ways — first, the university is a primary engine of these transformations. Secondly, the university is shaped by these transformations (both normatively and cognitively in terms of teaching and research and structurally in terms of its organisational characteristics, governance and managementLa utilidad del postmodernismo como marco interpretativo para comprender el desarrollo de los sistemas contemporáneos de educación superior ha sido severamente contestada. Los críticos argumentan que el postmodernismo es, como mucho, un conjunto de ideas en los ámbitos de la estética, literatura y teoría crítica con relevancia limitada fuera de esos campos y, a lo peor, una moda intelectual pasajera que actualmente está caducada. No obstante, la postmodernidad —o, como algunos preferirían, la modernidad tardía o modernidad «fluida»— es quizá una idea más útil. En la sociedad del siglo XXI hay un cúmulo de tendencias, algunas estructurales, como el crecimiento de la economía basada en el conocimiento y el

  18. Our Astounding Universe

    Science.gov (United States)

    Mishra, Monika

    2016-04-01

    The philosophy of my life is to keep encouraging children to think beyond they could achieve easily. I understand children are adaptive to change and take things with an open mind. They are ready to experiment with new things and dare to dream big. I am fortunate to being a teacher by profession and thus I always attempt experimenting, observing, and participating with other children and adults. Children learn through play. From birth, children are active participants in building their own understanding. Teachers prepare the environment to help each child build on what they already know. It is such a great pleasure to observe every young kid that becomes excited and curious to know when we show them the Universe pictures and tell them about the strange objects in our Universe. So my aim is to keep them ignited by doing different activities throughout the year related to Space. I am always a firm believer of: Creativity is the key to success in the future, and primary education is where teachers can bring creativity in children at that level. One of my main ways of teaching is to conduct various presentations on The Solar System and beyond and debates on Space explorations. A Planet making project is one of the all-time favorite project for my students where they dare to dream to fly in the universe, and with their imagination, kids make different celestial objects and present them. To inculcate scientific attitude I arrange film screening, simulation exercises and quizzes on various topics of astronomy. Every year we celebrate World Space Week 4th to 10th of Oct. The motivation among all came through different hands-on activities like-painting, slogan competition, topics related to space, poetry and essay writing on various topics related to astronomy, assembly presentations in school. I am indeed overwhelmed when I started the very special Space and Astronomy club where young toddlers are involved in different activities like a star gazing program, conducting

  19. Patellar resurfacing versus nonresurfacing in total knee arthroplasty for osteoarthritis: experience at a tertiary care institution in Pakistan

    Directory of Open Access Journals (Sweden)

    Lakdawala RH

    2012-02-01

    Full Text Available Akil Fazal1, Riaz H Lakdawala21Clinical Fellow, NYU Hospital for Joint Disease, New York, US; 2Associate Professor and Chief, Section of Orthopedics, Department of Surgery, The Aga Khan University Hospital, Karachi, PakistanObjective: To determine the effect of patellar resurfacing in patients offered total knee arthroplasty for osteoarthritis.Design: Randomized control study.Place and duration of study: The Aga Khan University Hospital, Karachi, Pakistan from January 3, 2005 to January 9, 2010.Patients and methods: Patients undergoing primary total knee arthroplasty for osteoarthritis were assigned to either the patellar resurfacing or nonresurfacing arm using systematic sampling. This consisted of patients undergoing unilateral and bilateral knee arthroplasty. Preoperatively, Knee Society Knee and Function Scores were calculated. After a minimum of 3 years postoperatively Knee Society Knee and Function Scores as well as the Clinical Anterior Knee Pain Rating were calculated and analysis done to check for differences.Results: Seventy-five patients were recruited in each arm; 135 patients had bilateral and 15 had unilateral knee arthroplasty. The mean preoperative knee score was 40.4 for the resurfacing group and 40.60 for the nonresurfacing group (P = 0.45. This improved postoperatively to 93.67 and 94.23 respectively, with no difference between the two groups (P = 0.67. The mean preoperative function score was 45.50 for resurfaced patellae and 45.83 for nonresurfaced. This improved to 89.67 and 90.50, respectively, again with no difference (P = 0.51. Postoperative Clinical Anterior Knee Pain Rating was a mean of 0.1 for resurfaced and 0.13 for nonresurfaced patellas, with no difference on analysis (P = 0.06. However, patients who had bilateral knee arthroplasty had a slightly higher Clinical Anterior Knee Pain Rating than those who had single knee surgery (P = 0.046 irrespective of whether the patellar was resurfaced or not.Conclusion: In

  20. Perception and knowledge about dietary intake in patients with liver cirrhosis and its relationship with the level of education

    International Nuclear Information System (INIS)

    Khan, R.; Ahmed, A.; Ismail, F.W.; Abid, S.; Awan, S.

    2012-01-01

    Objective: To determine patients perception and knowledge regarding diet in cirrhosis and its relationship with the level of patients education. Study Design: Cross-sectional observational study. Place and Duration of Study: This study was conducted at Gastroenterology Outpatient Clinics at the Aga Khan University Hospital, Karachi, the Aga Khan Health Services, Malir, Karachi and Hamdard University, Karachi, from January to December 2010. Methodology: Consecutive adult patients with compensated cirrhosis were enrolled. Demographic data, level of education, type and reason of food restriction as well as the source of dietary information was asked. Baseline laboratory test were performed, and nutritional status was assessed by BMI normogram. Results: Ninety patients, 58% male were enrolled. Mean age of the patient was 49 +- 11 years. Overall 73% of the patients were restricting fat, meat, fish and eggs in their diet; 53% were in uneducated group and 47% were in educated group (CI, 0.24-1.62, p-0.34). Twenty two patients (62.8%) in uneducated and 21 in educated group (68%) were restricting diet on the advice of their doctors, whereas 13 in uneducated group (37%) and 11 in educated group (32%) believed these dietary components to be harmful for the liver. Thirty two of uneducated patient (71.1%) and 28 of educated patients (62.2%) believed that vegetables, fruits and sugarcane had a beneficial effect on the liver. Main source of dietary information to the patients was the doctor. On sub-group analysis those who restricted diet irrespective of their educational level, had more patients with BMI less than 18.5 kg/m/sup 2/, (CI 0.01-0.94, p-0.001), haemoglobin less than 12 g/dl (CI 0- 0.03, p-0.001) and serum albumin less than 3 g/dl (CI 0.1- 03, p-0.001). Conclusion: Both educated and uneducated classes of the patients have improper knowledge and perception of diet in cirrhosis. Patients with cirrhosis who restricted diet, had relatively low BMI, haemoglobin and albumin

  1. Short-Term Neonatal Outcome in Late Preterm vs. Term Infants

    International Nuclear Information System (INIS)

    Haroon, A.; Ali, S. R.; Ahmed, S.; Maheen, H.

    2014-01-01

    Objective: To determine the short-term neonatal outcomes in late preterm infants (LPIs) as compared to term infants and their association with maternal risk factors. Study Design: A case control, descriptive study. Place and Duration of Study: The Aga Khan University Hospital, Karachi, Pakistan, from January to December 2009. Methodology: The study included 326 late preterm babies (defined as those born between 34 to 37 weeks of gestation) and equal number of term control babies at the Aga Khan University Hospital, Karachi, Pakistan. Data, including obstetric history, maternal complications, neonatal morbidities, etc., was retrieved from patients medical records. The data was compared with the control group for complications, fetal morbidity and maternal morbidity. Results: Late preterm infants constituted 10.6% of all deliveries and 77% of all live preterm births during the study period. Respiratory distress syndrome (RDS) (16.5% vs. 0.3%, p < 0.001), growth retardation (24.8% vs. 4%, p < 0.001), hyperbilirubinemia requiring phototherapy (37.9% vs. 11%, p < 0.001), and sepsis (4.9% vs. 0.3%, p < 0.001) were found to be the major morbidities in the study group. The need for resuscitation was 12.7 times higher in the study group as compared to the term babies (21.4% vs. 1.2%, p < 0.001). NICU admissions in the study group were also higher (18.8% vs. 2.4%, p < 0.001). Hypertension (12.5% vs. 1.5%, p < 0.001), diabetes (12.5% vs. 9.2%, p < 0.001), antenatal history of UTI (1.5% vs. 0.3%, p < 0.001), and prolong rupture of membrane (8.9% vs. 4%, p < 0.001) were significant maternal morbidities in the late preterm group. Conclusion: The late preterm group had greater morbidity, compared to term neonates. Prior awareness of the morbidities associated with late preterm babies is helpful for the health care providers to anticipate and manage potential complications in late preterm infants. (author)

  2. Attitudes towards child restrains and seat belts usage in the learned population of Karachi, Pakistan.

    Science.gov (United States)

    Siddiqui, Emaduddin; Ejaz, Kiran; Waheed, Shahan; Kazi, Ghazala Irfan; Khursheed, Munawar

    2014-01-01

    Motor vehicles crashes (MVCs) are the leading cause of injury related morbidity and mortality in developed countries. Recent evidence proves that properly used child seat belts can dramatically reduce the risk of severe and life-threatening injury from MVCs. There are rarities of thought and inspiration regarding the use of child seat belts in our society and region, therefore we lack of data regarding factors and paucity of usage of child seat belts in motor vehicles. This study aimed to assess the knowledge and attitudes of child seat belt usage among the educated population in Karachi, Pakistan. Altogether 304 employees were investigated. They were employees of Aga Khan University who were using their cars and having children younger than 10 years old. A cross sectional observational study was designed, and a 36-item questionnaire in English was used to collect data on participants' demographic details, designation, educational level, economic status, validity of driving license, number of children and cars, availability of adult seat belts and child seat belts along with their functionality, awareness, knowledge and attitude toward its use, and reason of not using these devices. SPSS version 20 for Windows was used to analyze the data and the Chi-square test was used. Totally 290 participants were recruited with a response rate of 72% (212). Of 212 participants, 126 (59%) were male. 154 (72.6%) participants had valid driver licenses, and 154 (72.6%) had adult seat belts in their vehicles. Only 32 (15%) reported regular use of adult seat belts. Although 168 (79.2%) participants had some knowledge about child restrains (CRs), only 65 (22%) had CRs in their cars. Eighty-two (38.7%) participants got the knowledge about CRs and seat belts from media. Mothers were more concerned about the use of CRs than fathers. Only 14 (6.6%) parents were found to use both adult and child seat belts all the time. Of the 157 parents who did not us use CRs, 42 considered unnecessary

  3. The last universal physicist

    Energy Technology Data Exchange (ETDEWEB)

    Coccia, Eugenio [Gran Sasso National Laboratory, University of Rome ' Tor Vergata' (Italy)]. E-mail coccia@lngs.infn.it

    2005-04-01

    Born in Rome in 1901, Fermi was the last universal physicist - the most extraordinary of his century. He was at home in the workshop, the laboratory and among theoretical physicists. For the theorists he was a great theorist, and for the experimentalists he was a great experimentalist. What made Fermi so special as a physicist was his universality and versatility; what made him so special as a person was his modesty, realism and frugal lifestyle. This book, which describes Fermi's contributions to physics and the US period of his life, originated from a symposium that was held in Chicago in 2001 to commemorate the centenary of his birth. But it is not merely a volume of reminiscences. It combines essays, specially commissioned articles, as well as private material from Fermi's research notebooks, correspondence and speeches. Together the material highlights the breadth of his impact on physics. A classic biographical introduction by Emilio Segre is followed by an article in which Frank Wilczek, who shared the Nobel Prize for Physics last year, puts into perspective Fermi's huge contributions to physics. The list of his achievements is impressive. They include the introduction of Fermi statistics for half-integer-spin particles (1925) - now called fermions - that led to the concept of the 'Fermi surface' in condensed-matter and nuclear physics; the vector-coupling theory for beta-decay (1933), which formulated the proper structure of the weak interaction where the 'Fermi constant' measures the strength of the coupling; and the introduction, with his Rome group, of neutron-induced radioactivity and the study of slow-neutron interactions (1934). As a researcher and a teacher, Fermi inspired two generations and two continents - a man whose charismatic nature attracted many talented scientists and students to Chicago. What emerges from this book is the gratitude of so many extraordinary physicists to their master, who instilled in them

  4. Between universalism and regionalism: universal systematics from imperial Japan.

    Science.gov (United States)

    Lee, Jung

    2015-12-01

    Historiographic discussions of the universality and regionality of science have to date focused on European cases for making regional science universal. This paper presents a new perspective by moving beyond European origins and illuminating a non-European scientist's engagement with the universality and regionality of science. It will examine the case of the Japanese botanist Nakai Takenoshin (1882-1952), an internationally recognized authority on Korean flora based at Tokyo Imperial University. Serving on the International Committee on Botanical Nomenclature in 1926, Nakai endorsed and acted upon European claims of universal science, whilst simultaneously unsettling them with his regionally shaped systematics. Eventually he came to promote his own systematics, built regionally on Korean flora, as the new universal. By analysing his shifting claims in relation to those of other European and non-European botanists, this paper makes two arguments. First, universalism and regionalism were not contradictory foundations of scientific practice but useful tools used by this non-European botanist in maintaining his scientific authority as a representative Japanese systematist. Second, his claims to universality and regionalism were both imperially charged. An imperially monopolized study of Korean plants left a regional imprint on Nakai's systematics. In order to maintain his scientific authority beyond its region of origin he had to assert either the expanding regionalism of 'East Asia' or universalism.

  5. Water in the Universe

    CERN Document Server

    Hanslmeier, Arnold

    2011-01-01

    Due to its specific chemical and physical properties, water is essential for life on Earth. And it is assumed that this would be the case for extraterrestrial life as well. Therefore it is important to investigate where water can be found in the Universe. Although there are places that are completely dry, places where the last rainfall happened probably several 100 million years ago, surprisingly this substance is quite omnipresent. In the outer solar system the large satellites of Jupiter and Saturn are covered by a thick layer of ice that could be hiding a liquid ocean below. This of course brings up the question of whether the recently detected extrasolar planets could have some water on their surfaces and how we can detect this. Water molecules are also found in interstellar gas and dust clouds. This book begins with an introductory chapter reviewing the physical and chemical properties of water. Then it illuminates the apparent connection between water and life. This is followed by chapters dealing with ...

  6. A World Nuclear University

    International Nuclear Information System (INIS)

    Yanev, Y.

    2004-01-01

    The paper discusses the mission and tasks of the World Nuclear University (WNU) established to build worldwide knowledge and support the effective use of nuclear techniques for solving the global human and environmental problems of 21 century and thereby support the global sustainable development. In this respect the WNU would build Human resources, Technical knowledge and Public Support. A Network of educational and research institutions with strong programmes in nuclear science and engineering will be created. The WNU Head quarters and Regional Centers will: 1) Facilitate agreement on curriculum and WNU certification curriculum 2) Develop and administer scholarships; 3) Foster educational exchanges within WNU family institutions; 4) Build core faculty for summer 1/2 year Masters degrees; 5) Co-ordinate research, grants and knowledge management research; 6) Operate think tank and public information service; 7) Emphasise key areas such as safeguards systems and the nuclear-renewable-hydrogen economy; 8) Oversee world-wide human resources pool; 9) Orchestrate alumni support for nuclear technology. The possible participants and possible location of the Regional Centres are given

  7. COMPLEXITY AND UNIVERSITY

    Directory of Open Access Journals (Sweden)

    Edna Lemes Martins Pereira

    2013-12-01

    Full Text Available Economic globalization affects different countries on the globe, has positive effects mainly related to access to communication, which promotes the exchange of ideas, information, products and quality of life. However, extends numerous negative aspects such as marginalization, economic dependencies, political, cultural, scientific, educational accentuate social inequalities and cultural conflicts and territorial. In this article it is a dialogue with authors (Cunha 2009; BARNETT 2005; MORIN 1999, 2006, among others, who understand these changes in society from the contemporary world as conceived as the "Complexity era" or "supercomplexity". To understand and cope with this reality, they propose a paradigm that is able to overcome the fragmentation and reductionism of knowledge and to relate the multiple approaches and visions to meet the complexity of reality. Although this paper presents proposals to the aforementioned authors point to education and the university found in this tangle of interconnected global transformations, given the need to be subject to act in a complex reality that requires critical and self-critical professionals, able to think about their own ability to think, understand and act within this complex context.

  8. Hydrogen fuel - Universal energy

    Science.gov (United States)

    Prince, A. G.; Burg, J. A.

    The technology for the production, storage, transmission, and consumption of hydrogen as a fuel is surveyed, with the physical and chemical properties of hydrogen examined as they affect its use as a fuel. Sources of hydrogen production are described including synthesis from coal or natural gas, biomass conversion, thermochemical decomposition of water, and electrolysis of water, of these only electrolysis is considered economicially and technologically feasible in the near future. Methods of production of the large quantities of electricity required for the electrolysis of sea water are explored: fossil fuels, hydroelectric plants, nuclear fission, solar energy, wind power, geothermal energy, tidal power, wave motion, electrochemical concentration cells, and finally ocean thermal energy conversion (OTEC). The wind power and OTEC are considered in detail as the most feasible approaches. Techniques for transmission (by railcar or pipeline), storage (as liquid in underwater or underground tanks, as granular metal hydride, or as cryogenic liquid), and consumption (in fuel cells in conventional power plants, for home usage, for industrial furnaces, and for cars and aircraft) are analyzed. The safety problems of hydrogen as a universal fuel are discussed, noting that they are no greater than those for conventional fuels.

  9. The Politics of Universalism

    DEFF Research Database (Denmark)

    Simonsen, Karen-Margrethe

    2013-01-01

    This article investigates the political function of human rights in the 16th Century in Spain just after the conquest of America. It claims that the study of this period of early globalization is relevant for the understanding of the function of human rights discourses to day, at the ‘end...... discourses is split down the middle: it serves both as a critique of power and as an extension of power, and the disclosure of this split helps us understand the inner politics of human rights. The article discusses the trial in Valladolid in 1550 when the rights of the barbarian Indians of America were put...... on trial. It focuses mainly on the arguments made by Bartolomé de las Casas and on the reasons why the King allowed las Casas’ fierce critique of the conquest to be published in a period of otherwise severe censorship. The article is inspired by Etienne Balibar’s idea of ‘politics of universalism...

  10. university 2012 / krasnoyarsk

    Directory of Open Access Journals (Sweden)

    Elena Grigoryeva

    2012-09-01

    Full Text Available This issue consists of two parts. Both parts are connected with the upcoming review competition of graduation projects, which will be held in Krasnoyarsk in the second half of September.Konstantin Kiyanenko has sent us a map of Russia with architecture schools densely marked in the European part, in the west, and with a decreasing number of such schools further to the east. It is in direct ratio to the population. There are so few (and fewer and fewer of us… The more crucial it is that Krasnoyarsk, the biggest city of Eastern Siberia, was chosen to conduct the review competition.This issue contains a catalogue of the annual East-Siberian Zodchestvo Festival and the winning works from Krasnoyarsk presented in detail.The projects for the Ergaki by Alexei Myakota will show us the mountains, which are also visible in the city. Together with the guests, we will have a walk around the two central squares in Krasnoyarsk, along the embankment that connects those squares, and on the islands. Olga Smirnova, a graduate of Leningrad Engineering Construction Institute and a landscape architect, who has been working in Krasnoyarsk for a long time, expresses her love to the city in her frank and sincere talk with her colleagues.The city’s beautiful things are made by those who graduated from Russian, Soviet and again Russian Universities. And the mistakes are also made by us.

  11. External conference: Geneva University

    CERN Multimedia

    2007-01-01

    ECOLE DE PHYSIQUE Département de physique nucléaire et corspusculaire 24, Quai Ernest-Ansermet 1211 GENEVE 4 - Tél : 022 379 62 73 - Fax: 022 379 69 92 Monday 11 June 2007 COLLOQUE DE LA SECTION DE PHYSIQUE at 17:00 - Stückelberg Auditorium The CERN Axion Solar Telescope (CAST). Motivation, concept, results and potential implications Prof. Konstantin ZIOUTAS / University of Patras/Greece & CERN and CAST-spokesperson Axion is one of the leading dark matter particle candidates. The last few years axion searches are in the spotlight. The physics motivation will be presented. Particles like the axions should be produced also in Stars like our Sun. In magnetic fields axions can coherently oscillate to photons and vice versa (Primakoff effect). CAST searches for solar axions pointing a recycled LHC magnet towards the Sun, and, it provides new results since 2002. Its working principle might well be already at work in outer space, asking for an alternative, though exotic, point of view for certain myst...

  12. Two Belgian University Hospitals

    Directory of Open Access Journals (Sweden)

    M. Huylebrouck

    2012-01-01

    Full Text Available Background. Bevacizumab (BEV, a humanized immunoglobulin G1 monoclonal antibody that inhibits VEGF has demonstrated activity against recurrent high-grade gliomas (HGG in phase II clinical trials. Patients and Methods. Data were collected from patients with recurrent HGG who initiated treatment with BEV outside a clinical trial protocol at two Belgian university hospitals. Results. 19 patients (11 M/8 F were administered a total of 138 cycles of BEV (median 4, range 1–31. Tumor response assessment by MRI was available for 15 patients; 2 complete responses and 3 partial responses for an objective response rate of 26% for the intent to treat population were observed on gadolinium-enhanced T1-weighted images; significant regressions on T2/FLAIR were documented in 10 out of 15 patients (67%. A reduced uptake on PET was documented in 3 out of 4 evaluable patients. The six-month progression-free survival was 21% (95% CI 2.7–39.5. Two patients had an ongoing tumor response and remained free from progression after 12 months of BEV treatment. Conclusions. The activity and tolerability of BEV were comparable to results from previous prospective phase II trials. Reduced uptake on PET suggests a metabolic response in addition to an antiangiogenic effect in some cases with favorable clinical outcome.

  13. Universal mechatronics coordinator

    Science.gov (United States)

    Muir, Patrick F.

    1999-11-01

    Mechatronic systems incorporate multiple actuators and sensor which must be properly coordinated to achieve the desired system functionality. Many mechatronic systems are designed as one-of-a-kind custom projects without consideration for facilitating future system or alterations and extensions to the current syste. Thus, subsequent changes to the system are slow, different, and costly. It has become apparent that manufacturing processes, and thus the mechatronics which embody them, need to be agile in order to more quickly and easily respond to changing customer demands or market pressures. To achieve agility, both the hardware and software of the system need to be designed such that the creation of new system and the alteration and extension of current system is fast and easy. This paper describes the design of a Universal Mechatronics Coordinator (UMC) which facilitates agile setup and changeover of coordination software for mechatronic systems. The UMC is capable of sequencing continuous and discrete actions that are programmed as stimulus-response pairs, as state machines, or a combination of the two. It facilitates the modular, reusable programing of continuous actions such as servo control algorithms, data collection code, and safety checking routines; and discrete actions such as reporting achieved states, and turning on/off binary devices. The UMC has been applied to the control of a z- theta assembly robot for the Minifactory project and is applicable to a spectrum of widely differing mechatronic systems.

  14. External meeting: Geneva University

    CERN Multimedia

    2006-01-01

    Université de Genève Ecole de physique 24 quai Ernest Ansermet 1211 Genève 4 Tél : + 41 22 379 63 83 (secrétariat) Tél : + 41 22 379 62 56 (réception) Fax: + 41 22 379 69 22 Lundi 20 novembre 2006 COLLOQUIUM 17:00 - Auditoire Stückelberg Electrical correlation measurements in quantum nano-structures Dr. Stefan Oberholzer / Basel University Measuring the current-voltage characteristics of small conductors is widely used to characterize their electronic transport properties. In addition to such time-averaged measurements, correlation measurements between temporal fluctuations (noise) around the time-averaged mean current provide us with very important supplementary information about electrical transport. In this talk, I review our experimental work on shot noise, noise which originates from the granularity of charge and the diffraction of the electronic wave-function, and especially address the fundamental relation between electronic scattering experiments and the statistical properties of indist...

  15. Benchmarking in University Toolbox

    Directory of Open Access Journals (Sweden)

    Katarzyna Kuźmicz

    2015-06-01

    Full Text Available In the face of global competition and rising challenges that higher education institutions (HEIs meet, it is imperative to increase innovativeness and efficiency of their management. Benchmarking can be the appropriate tool to search for a point of reference necessary to assess institution’s competitive position and learn from the best in order to improve. The primary purpose of the paper is to present in-depth analysis of benchmarking application in HEIs worldwide. The study involves indicating premises of using benchmarking in HEIs. It also contains detailed examination of types, approaches and scope of benchmarking initiatives. The thorough insight of benchmarking applications enabled developing classification of benchmarking undertakings in HEIs. The paper includes review of the most recent benchmarking projects and relating them to the classification according to the elaborated criteria (geographical range, scope, type of data, subject, support and continuity. The presented examples were chosen in order to exemplify different approaches to benchmarking in higher education setting. The study was performed on the basis of the published reports from benchmarking projects, scientific literature and the experience of the author from the active participation in benchmarking projects. The paper concludes with recommendations for university managers undertaking benchmarking, derived on the basis of the conducted analysis.

  16. On universality in ergoregion mergers

    International Nuclear Information System (INIS)

    Elvang, Henriette; Figueras, Pau; Hubeny, Veronika E; Rangamani, Mukund; Horowitz, Gary T

    2009-01-01

    We study non-dynamical mergers of ergoregions in d + 1-dimensional vacuum gravity. At the merger point, where the ergosurfaces bounding each ergoregion just touch, solutions exhibit universal behavior when there is rotation only in one plane: the angle between the merging ergosurfaces depends only on the symmetries of the solution, not on any other details of the configuration. We show that universality follows from the fact that the relevant component of Einstein's equation reduces to Laplace's equation at the point of merger. Thus ergoregion mergers mimic mergers of Newtonian equipotentials and have similar universal behavior. For solutions with rotation in more than one plane, universality is lost. We demonstrate universality and non-universality in several explicit examples.

  17. Oscillating universe with quintom matter

    International Nuclear Information System (INIS)

    Xiong Huahui; Cai Yifu; Qiu Taotao; Piao Yunsong; Zhang Xinmin

    2008-01-01

    In this Letter, we study the possibility of building a model of the oscillating universe with quintom matter in the framework of 4-dimensional Friedmann-Robertson-Walker background. Taking the two-scalar-field quintom model as an example, we find in the model parameter space there are five different types of solutions which correspond to: (I) a cyclic universe with the minimal and maximal values of the scale factor remaining the same in every cycle, (II) an oscillating universe with its minimal and maximal values of the scale factor increasing cycle by cycle, (III) an oscillating universe with its scale factor always increasing, (IV) an oscillating universe with its minimal and maximal values of the scale factor decreasing cycle by cycle, and (V) an oscillating universe with its scale factor always decreasing

  18. Inter-Universal Quantum Entanglement

    Science.gov (United States)

    Robles-Pérez, S. J.; González-Díaz, P. F.

    2015-01-01

    The boundary conditions to be imposed on the quantum state of the whole multiverse could be such that the universes would be created in entangled pairs. Then, interuniversal entanglement would provide us with a vacuum energy for each single universe that might be fitted with observational data, making testable not only the multiverse proposal but also the boundary conditions of the multiverse. Furthermore, the second law of the entanglement thermodynamics would enhance the expansion of the single universes.

  19. Neutrinos in an expanding Universe

    International Nuclear Information System (INIS)

    Wigmans, Richard

    2015-01-01

    The Universe contains several billion neutrinos for each nucleon. In this paper, we follow the history of these relic neutrinos as the Universe expanded. At present, their typical velocity is a few hundred km/s and, therefore, their spectra are affected by gravitational forces. This may have led to a phenomenon that could explain two of todays great mysteries: The large-scale structure of the Universe and the increasing rate at which it expands. (paper)

  20. Taiwan Universities: Where to Go?

    Directory of Open Access Journals (Sweden)

    Yu-Ying Kuo

    2016-02-01

    Full Text Available The dramatic expansion of Taiwan universities/colleges from about 100 to 160 from the late 1980s has encountered problems due to social and global changes. What should Taiwan universities move toward and how? This research relies on secondary data to explore the issues Taiwan universities currently face—a low birth rate and global competition. The decreasing number of incoming students will result in a lower registration rate and less tuition revenue, which will make some universities struggle to survive. Hence, government policies, proposed by the Ministry of Education, have been implemented to assist Taiwan universities to adjust to external changes. The Innovative Transformation Policy, adopted in 2015, consists of strategies for university–industry cooperation, university mergers, university closures, and a re-shaping of the university paradigm. This policy has begun to be implemented and its initial outcome will be continually evaluated. In accordance with the Innovative Transformation Policy, this study encourages Taiwan universities to improve governance, set prominent unique characteristics of development, and enhance global competitiveness.

  1. Miniature JPL Universal Instrument Bus

    Data.gov (United States)

    National Aeronautics and Space Administration — Develop a Universal Digital Processor Bus architecture using state of the art commercial packaging technologies. This work will transition commercial advanced- yet...

  2. Mach's principle and rotating universes

    International Nuclear Information System (INIS)

    King, D.H.

    1990-01-01

    It is shown that the Bianchi 9 model universe satisfies the Mach principle. These closed rotating universes were previously thought to be counter-examples to the principle. The Mach principle is satisfied because the angular momentum of the rotating matter is compensated by the effective angular momentum of gravitational waves. A new formulation of the Mach principle is given that is based on the field theory interpretation of general relativity. Every closed universe with 3-sphere topology is shown to satisfy this formulation of the Mach principle. It is shown that the total angular momentum of the matter and gravitational waves in a closed 3-sphere topology universe is zero

  3. Peculiarities of the early Universe (Universes) birth and positron annihilation

    International Nuclear Information System (INIS)

    Svetlov-Prokop'ev, E.P.

    2003-01-01

    Works on the problem of quantum birth of the Universe are reviewed. Possible peculiarities of electron-positron annihilation at the early stages of the Universe (s) birth in connection with black holes are considered. Possible concept of Eternity is discussed. (author)

  4. Building Effective Community-University Partnerships: Are Universities Truly Ready?

    Science.gov (United States)

    Curwood, Susan Eckerle; Munger, Felix; Mitchell, Terry; Mackeigan, Mary; Farrar, Ashley

    2011-01-01

    Community service learning and community-based research necessitate the development of strong community-university partnerships. In this paper, students, faculty, and a community partner critically reflect upon the process of establishing a long-term community-university partnership through the integration of a community service learning component…

  5. [Universal electrogustometer EG-1].

    Science.gov (United States)

    Pleskacz, Witold A; Wałkanis, Andrzej; Rapiejko, Piotr; Jurkiewicz, Dariusz

    2009-01-01

    Electrogustometry has been used as a clinical tool for diagnosis and assessment of a variety of conditions. Since the lack of versatile electrogustometer for research and diagnosis, the new electrogustometer EG-1 was developed in 2006. It was done in cooperation between Warsaw University of Technology and Military Institute of Medicine in Warsaw. EG-1 allows quantitative estimation of taste perception threshold using both static and impulse electrogustometry with bipolar electrode. It is a fully autonomous, battery powered and portable instrument. Because of small size and weight, it can be easily placed in any environment. Microprocessor controlled measurement system and user-friendly interface (LCD display with simple keyboard) make EG-1 electrogustometer very handy and flexible in operation. Data obtained during measurements is stored in the internal device memory. After taste examinations measurement data can be transferred to a personal computer via inbuilt USB port for further analysis and storage. EG-1 can generate three predefined variously shaped current impulses: sinus-, saw- and rectangle-shaped. There is an optional possibility of creating own shapes of stimulus puls by the user. The electrical parameters of generated pulses are as follow: current amplitude 1-2000 microA regulated with 1 microA step, stimulus frequency 0(DC)-500 Hz regulated with 5 Hz step, controlable fulfillment factor and signal rise time (optional for automatic measurements). The operator can trigger the stimuli via a hand switch on the bipolar electrode (with gold-plated endings), via keyboard or via additional independent hand switch. Three years of experience collected during EG-1 exploitation allowed to design a new version of electrogustometer EG-2 with a touch panel and color graphical display.

  6. Universal tritium transmitter

    International Nuclear Information System (INIS)

    Cordaro, J. V.; Wood, M.

    2008-01-01

    sufficient time to thermally equilibrate. Amplifiers, transistors, resistors all need time to stabilize before the electrometer circuit will measure accurately in the 10 -15 and 10 -14 ampere range. Existing electrometers give the user no indication when the unit has stabilized and is acceptable for low level measurements. Savannah River National Laboratory (SRNL) funded through the NNSA Plant Directed Research and Development (PDRD) program, has developed a truly Universal Tritium Transmitter (UTT) capable of solving many known problems with existing commercial electrometers. This UTT pushes the state-of-the-art in electrometer design and incorporates solutions to deficiencies found in commercial electrometers. (authors)

  7. Ebooks at Bergen University Library?

    OpenAIRE

    Landøy, Ane; Mikki, Susanne; Skagen, Therese; Stangeland, Elin

    2004-01-01

    The ongoing quality reform in academia in Norway leads to changing user needs for Bergen University Library. This article discusses advantages and disadvantages of ebooks in an academic institution like the University of Bergen (UiB). Strategies for procurement, presentation and use are considered.

  8. University involvement in sustainability initiatives

    DEFF Research Database (Denmark)

    Lehmann, Martin; Christensen, Per; Thrane, Mikkel

    2007-01-01

    With an outset in the case of Aalborg University, the linkages (actual, potential and missing) between academic work in research & education and sustainability initiatives are explored. The focus is both on the university's core activities as a provider of research and education and on the univer......With an outset in the case of Aalborg University, the linkages (actual, potential and missing) between academic work in research & education and sustainability initiatives are explored. The focus is both on the university's core activities as a provider of research and education...... and on the university's activities as an organisation, i.e. its own operation and its accounting for this. Sustainability is defined as a continuous process requiring balance between (the emergence of) problems and our ability and capability to solve them. Some core questions that this paper seeks to answer are: "How...... is Sustainable Development understood at executive level at the university? How (if at all) is sustainable development integrated in the core activities of the university? How is the university attached to ‘real life outside the ivory tower', e.g. through the establishing of Public-Private-Academic Partnerships...

  9. Plausibility Arguments and Universal Gravitation

    Science.gov (United States)

    Cunha, Ricardo F. F.; Tort, A. C.

    2017-01-01

    Newton's law of universal gravitation underpins our understanding of the dynamics of the Solar System and of a good portion of the observable universe. Generally, in the classroom or in textbooks, the law is presented initially in a qualitative way and at some point during the exposition its mathematical formulation is written on the blackboard…

  10. The University and the Community.

    Science.gov (United States)

    Campbell, Duncan

    This paper presented views on the role of the university, and particularly the University of Alberta, in the community in the 1970s. Such indicators as population growth, income growth, rising level of education, rising levels of taxation, the rapidity of technological advance, shifts in social pattern, all pointed to a rapidly growing demand on…

  11. Managing University Research Microdata Collections

    Science.gov (United States)

    Woolfrey, Lynn; Fry, Jane

    2015-01-01

    This article examines the management of microdata collections in a university context. It is a cross-country analysis: Collection management at data services in Canada and South Africa are considered. The case studies are of two university sub-contexts: One collection is located in a library; the other at a Faculty-based Data Service. Stages in…

  12. Desktop Publishing in the University.

    Science.gov (United States)

    Burstyn, Joan N., Ed.

    Highlighting changes in the work of people within the university, this book presents nine essays that examine the effects of desktop publishing and electronic publishing on professors and students, librarians, and those who work at university presses and in publication departments. Essays in the book are: (1) "Introduction: The Promise of Desktop…

  13. Growing an Emerging Research University

    Science.gov (United States)

    Birx, Donald L.; Anderson-Fletcher, Elizabeth; Whitney, Elizabeth

    2013-01-01

    The emerging research college or university is one of the most formidable resources a region has to reinvent and grow its economy. This paper is the first of two that outlines a process of building research universities that enhance regional technology development and facilitate flexible networks of collaboration and resource sharing. Although the…

  14. Baryogenesis in an inflationary universe

    International Nuclear Information System (INIS)

    Dodelson, S.

    1988-01-01

    The existence of matter in our universe today is a result of fundamental processes in the early universe. This matter is the remnant of an asymmetry between matter and anti-matter. How that asymmetry developed is the focus of this thesis. A statistical mechanical analysis is given of baryogenesis after an inflationary era

  15. Universality of the Unruh effect

    Science.gov (United States)

    Modesto, Leonardo; Myung, Yun Soo; Yi, Sang-Heon

    2018-02-01

    In this paper we prove the universal nature of the Unruh effect in a general class of weakly nonlocal field theories. At the same time we solve the tension between two conflicting claims published in literature. Our universality statement is based on two independent computations based on the canonical formulation as well as path integral formulation of the quantum theory.

  16. Quantum entanglement of baby universes

    International Nuclear Information System (INIS)

    Aganagic, Mina; Okuda, Takuya; Ooguri, Hirosi

    2007-01-01

    We study quantum entanglements of baby universes which appear in non-perturbative corrections to the OSV formula for the entropy of extremal black holes in type IIA string theory compactified on the local Calabi-Yau manifold defined as a rank 2 vector bundle over an arbitrary genus G Riemann surface. This generalizes the result for G=1 in hep-th/0504221. Non-perturbative terms can be organized into a sum over contributions from baby universes, and the total wave-function is their coherent superposition in the third quantized Hilbert space. We find that half of the universes preserve one set of supercharges while the other half preserve a different set, making the total universe stable but non-BPS. The parent universe generates baby universes by brane/anti-brane pair creation, and baby universes are correlated by conservation of non-normalizable D-brane charges under the process. There are no other source of entanglement of baby universes, and all possible states are superposed with the equal weight

  17. Beyond QCD: A Composite Universe

    DEFF Research Database (Denmark)

    Sannino, Francesco

    Strong dynamics constitutes one of the pillars of the standard model of particle interactions, and it accounts for the bulk of the visible matter in the universe. It is therefore a well posed question to ask if the rest of the universe can be described in terms of new highly natural four...

  18. Baby universes with induced gravity

    International Nuclear Information System (INIS)

    Gao Yihong; Gao Hongbo

    1989-01-01

    In this paper some quantum effects of baby universes with induced gravity are discussed. It is proved that the interactions between the baby-parent universes are non-local, and argue that the induced low-energy cosmological constant is zero. This argument does not depend on the detail of the induced potential

  19. Quantum entanglement of baby universes

    International Nuclear Information System (INIS)

    Essman, Eric P.; Aganagic, Mina; Okuda, Takuya; Ooguri, Hirosi

    2006-01-01

    We study quantum entanglements of baby universes which appear in non-perturbative corrections to the OSV formula for the entropy of extremal black holes in type IIA string theory compactified on the local Calabi-Yau manifold defined as a rank 2 vector bundle over an arbitrary genus G Riemann surface. This generalizes the result for G=1 in hep-th/0504221. Non-perturbative terms can be organized into a sum over contributions from baby universes, and the total wave-function is their coherent superposition in the third quantized Hilbert space. We find that half of the universes preserve one set of supercharges while the other half preserve a different set, making the total universe stable but non-BPS. The parent universe generates baby universes by brane/anti-brane pair creation, and baby universes are correlated by conservation of non-normalizable D-brane charges under the process. There are no other source of entanglement of baby universes, and all possible states are superposed with the equal weight

  20. Psychiatric Epidemiology: The University Paradigm

    Science.gov (United States)

    Favazza, Armando R.

    1976-01-01

    In an effort to provide a meaningful didactic experience within the constraint of limited teaching hours, the author searched for a "community" which might be examined. A community fulfilling the established criteria for trainees in a university training program is the university itself. Its use is described. (LBH)

  1. The Expanding Universe: Dark Energy

    Energy Technology Data Exchange (ETDEWEB)

    Lincoln, Don [Fermilab; Nord, Brian [Fermilab

    2014-09-01

    In 1998, observations of distant supernovae led physicists that not only was the universe expanding, but the expansion was speeding up. In this article, we describe the evidence for an expanding universe and describe what physicists and cosmologists have learned in the intervening years. The target audience for this article is high school physics teachers and college physics professors at teaching institutions.

  2. University Rankings: The Web Ranking

    Science.gov (United States)

    Aguillo, Isidro F.

    2012-01-01

    The publication in 2003 of the Ranking of Universities by Jiao Tong University of Shanghai has revolutionized not only academic studies on Higher Education, but has also had an important impact on the national policies and the individual strategies of the sector. The work gathers the main characteristics of this and other global university…

  3. University Rankings and Social Science

    Science.gov (United States)

    Marginson, Simon

    2014-01-01

    University rankings widely affect the behaviours of prospective students and their families, university executive leaders, academic faculty, governments and investors in higher education. Yet the social science foundations of global rankings receive little scrutiny. Rankings that simply recycle reputation without any necessary connection to real…

  4. Maritime Cyber Security University Research

    Science.gov (United States)

    2016-05-01

    i Classification | CG-926 RDC | author | audience | month year Maritime Cyber Security University Research Phase I - Final Report...Distribution Statement A: Approved for public release; distribution is unlimited. May 2016 Report No. CG-D-06-16 Maritime Cyber Security...Director United States Coast Guard Research & Development Center 1 Chelsea Street New London, CT 06320 Maritime Cyber Security University

  5. The Philosophy of University Housing

    Science.gov (United States)

    Wallace, James A.

    2012-01-01

    This article examines a stated philosophy of university housing and the philosophy's effect on the facilitation of the personal and intellectual growth of students residing in the residence halls and the development of a sense of community. This particular philosophy governs the housing operations at Southern Illinois University at Carbondale.…

  6. Language Alternation in University Classrooms

    Science.gov (United States)

    Taha, T. A.

    2008-01-01

    This paper examines the alternate use of Arabic and English in the context of a university classroom, where a policy to use the former language in place of the latter was being implemented. Analysis of a sample of recorded university lectures of English and Arabic medium classes in sciences and humanities reveals that teachers use code switching,…

  7. (Re)Discovering University Autonomy

    DEFF Research Database (Denmark)

    This book challenges traditional approach to university autonomy which is based on four pillars: organisational, financial, human resource, and academic. The main thesis is that a fuller understanding of university autonomy can only be obtained through a more holistic view of the complex inter-re...

  8. Universities: Engaging with Local Communities

    Science.gov (United States)

    Universities UK, 2010

    2010-01-01

    This leaflet illustrates the many ways in which universities impact on the local area. Universities are a major contributor to the economy in their own right, both as employers and purchasers of goods. Their social and cultural influence is also felt through their provision of: (1) art galleries, museums and exhibitions; (2) cinemas and theatres;…

  9. The expanding universe: an introduction

    OpenAIRE

    Pössel, Markus

    2017-01-01

    An introduction to the physics and mathematics of the expanding universe, using no more than high-school level / undergraduate mathematics. Covered are the basics of scale factor expansion, the dynamics of the expanding universe, various distance concepts and the generalized redshift-luminosity relation, among other topics.

  10. University Teaching around the World.

    Science.gov (United States)

    Ballantine, Jeanne

    1989-01-01

    Explores the concept of good teaching in universities worldwide by interviewing professors and exchange students from USSR, England, Spain, Yugoslavia, the Soviet Union, Turkey, India, Malaysia, the Philippines, China, Hong Kong, Taiwan, and Japan. Finds that teaching receives low priority in elite institutions while universities with open access…

  11. Water Recycling in Schools & Universities

    Science.gov (United States)

    Meeten, Nick

    2013-01-01

    Consider the waste streams generated in schools and universities. So what is in the typical used water generated in schools and universities? It is typically about 99 percent water, with the remaining 1 percent mainly made up of organic compounds. Used water contains nutrients such as nitrogen and phosphorous. When one judges it on its quality, it…

  12. University Satellite Campus Management Models

    Science.gov (United States)

    Fraser, Doug; Stott, Ken

    2015-01-01

    Among the 60 or so university satellite campuses in Australia are many that are probably failing to meet the high expectations of their universities and the communities they were designed to serve. While in some cases this may be due to the demand driven system, it may also be attributable in part to the ways in which they are managed. The…

  13. Report on the International Workshop “The Golden Horde in a Global Perspective: Imperial Strategies”, Leiden University, May 7–8, 2015 »

    Directory of Open Access Journals (Sweden)

    Roman Hautala

    2015-09-01

    Full Text Available This article contains a report on the international conference organized by the University of Leiden in May 2015. According to its organizers, this conference has become the first Western European symposium dedicated to the study of the long history of the Golden Horde. The conference became a fruitful meeting place of the leading Russian and Tatar historians and archaeologists with their Western colleagues from the Netherlands, United Kingdom, United States of America, Hungary, Poland, and Finland. International participants of the Leiden conference discussed the most topical issues of historiography associated with eventful history of the Golden Horde. In particular, the conference participants paid special attention to the study of the administration of the ulus of Jochi that naturally combined governmental models of the Mongol Empire of the Chingizids with local administrative elements. A separate section of the conference was devoted to the analysis of the religious policy of the Golden Horde khans, where special attention was paid to the historiographical debate on the Islamization of the ulus of Jochi. The conference participants also paid considerable attention to the consideration of the material culture of the Golden Horde known both from written sources and, above all, from the materials of archaeological findings. Also, a number of reports of the confe­rence was devoted to foreign and domestic policies of the Golden Horde rulers, at the same time reflecting the central geopolitical role of the ulus of Jochi on the Eurasian continent and the high level of civilization of the Golden Horde. The main achievement of the Leiden conference was a statement on the need of deeper study of the Golden Horde history in order to overcome a number of stereotypes regarding misconceptions of the ulus of Jochi represented as backward and parasitic State formation. The conference participants agreed in general opinion about the necessity of similar

  14. A Model of Nonsingular Universe

    Directory of Open Access Journals (Sweden)

    Changjun Gao

    2012-07-01

    Full Text Available In the background of Friedmann–Robertson–Walker Universe, there exists Hawking radiation which comes from the cosmic apparent horizon due to quantum effect. Although the Hawking radiation on the late time evolution of the universe could be safely neglected, it plays an important role in the very early stage of the universe. In view of this point, we identify the temperature in the scalar field potential with the Hawking temperature of cosmic apparent horizon. Then we find a nonsingular universe sourced by the temperature-dependent scalar field. We find that the universe could be created from a de Sitter phase which has the Planck energy density. Thus the Big-Bang singularity is avoided.

  15. The Challenge of University Autonomy

    DEFF Research Database (Denmark)

    Reilly, John; Turcan, Romeo V.; Bugaian, Larisa

    2016-01-01

    The authors introduce the reader to the book, providing a historical perspective and a current understanding of university autonomy. While appreciating the central role of the four dimensions of university autonomy – organisational, financial, human resource, and academic – the authors conjecture...... that a fuller understanding of university autonomy can only be obtained through a holistic view of the complex inter-relationships between stakeholders and policies which can reinforce and, equally, pull in opposite directions. This holistic view is represented in a model of institutional university autonomy......, which is discussed at length in the chapter. The authors conclude by presenting international case studies that give new insights and reinforce our understanding that the issues relating to institutional university autonomy are genuinely global....

  16. [Changes in body weight of the university students at university].

    Science.gov (United States)

    Soto Ruiz, María Nelia; Aguinaga Ontonso, Inés; Canga Armayor, Navidad; Guillén-Grima, Francisco; Hermoso de Mendoza, Juana; Serrano Monzo, Inmaculada; Marín Fernández, Blanca

    2015-06-01

    One of the strategies for the prevention of the obesity is the identification of critical periods of gain weight. Some studies confirm gain weight during the university period. The purpose of the present study was to determine the changes in the body weight of the university students in Navarre. Prospective cohort study. Public University of Navarre and the University of Navarre, in Pamplona. Study examined weight change among 452 students attending at university in Pamplona, during first and third course. Four hundred and fifty two students completed the questionnaire. Weight and height were measures and body mass index was calculated. The mean body weight increased 0,600 kg, 1,8 kg for males and no change in body weight was observed in female. 44,7 % of students gained weight (60,8 % of men and 36,8 % of women), and the gain weight was of 3,4 kg. University years are a critical factor for the gain weight, particularly males. Consideration of this, is necessary the development of effective weight gain prevention strategies during the university. Copyright AULA MEDICA EDICIONES 2014. Published by AULA MEDICA. All rights reserved.

  17. Kyoto University-National Taiwan University International Symposium "Social Cognitive Biology on Representation of Environment

    OpenAIRE

    Saiki, Jun

    2016-01-01

    Sponsored by Kyoto University, National Taiwan University; Cosponsored by Unit for Advanced Studies of the Human Mind, Kyoto University, Kokoro Research Center, Kyoto University, Supported by Supporting Program for InteRaction-based Initiative Team Studies (SPIRITS), Kyoto University

  18. Sustaining Community-University Collaborations: The Durham University Model

    Directory of Open Access Journals (Sweden)

    Andrew Russell

    2011-11-01

    Full Text Available Durham University has initiated a community outreach and engagement program based on an evolving multifaceted model. This article analyses the components of the model and looks at how our work at Durham has become increasingly embedded in the structures and processes of the university as it has developed. The strengths and weaknesses in what has been achieved are highlighted, as is the future vision for the further development of this innovative community-university program. Keywords Public engagement; community partnerships; employer supported volunteering; corporate social responsibility

  19. Acceleration of black hole universe

    Science.gov (United States)

    Zhang, T. X.; Frederick, C.

    2014-01-01

    Recently, Zhang slightly modified the standard big bang theory and developed a new cosmological model called black hole universe, which is consistent with Mach's principle, governed by Einstein's general theory of relativity, and able to explain all observations of the universe. Previous studies accounted for the origin, structure, evolution, expansion, and cosmic microwave background radiation of the black hole universe, which grew from a star-like black hole with several solar masses through a supermassive black hole with billions of solar masses to the present state with hundred billion-trillions of solar masses by accreting ambient matter and merging with other black holes. This paper investigates acceleration of the black hole universe and provides an alternative explanation for the redshift and luminosity distance measurements of type Ia supernovae. The results indicate that the black hole universe accelerates its expansion when it accretes the ambient matter in an increasing rate. In other words, i.e., when the second-order derivative of the mass of the black hole universe with respect to the time is positive . For a constant deceleration parameter , we can perfectly explain the type Ia supernova measurements with the reduced chi-square to be very close to unity, χ red˜1.0012. The expansion and acceleration of black hole universe are driven by external energy.

  20. Tools to probe the universe

    International Nuclear Information System (INIS)

    Lagage, P.O.; Augueres, J.L.; Amiaux, J.; Cara, Ch.; Fontignie, J.; Rio, Y.; Fermon, C.; Pannetier-Lecoeur, M.; De Vismes, A.; Cordier, B.; Fesquet, M.; Ferrando, Ph.; Authier, M.; Pantin, E.; Glicenstein, J.F.; Boulade, O.; Refregier, A.; Stolarczyk, Th.; Agnese, P.; Rodriguez, L.; Agnese, P.; Pigot, C.; Duband, L.; Limousin, O.; Delagnes, E.; Turck-Chieze, S.; Carton, P.H.; Starck, J.L.; Bournaud, F.; Teyssier, R.; Audit, E.; Brun, A.S.; Leca, P.; Menache, Ch.; Pomarede, D.; Thooris, B.; Meis, C.

    2009-01-01

    This special issue of Clefs CEA journal is entirely devoted to astrophysics and to the exploration and probing of the Universe. The second part of this dossier, described here, makes a status of the tools used to probe the universe: telescopes, imaging spectrometers, data processing and simulation. Content: A - Telescopes of the future: 1. Seeing further out: JWST: looking back on a past 13 billion years old, Space specifics: the learning curve to know-how, Fabricating a corona-graph mask, SVOM, a satellite to detect the explosions of the first stars to be formed in the Universe; 2. Seeing more precisely: SIMBOL-X, pioneering formation flying, ELT/METIS, a 42-meter giant, One hundred telescopes for the CTA arrays; 3. Seeing wider: Euclid, mapping the extragalactic sky, ANTARES: the neutrino, another cosmic messenger; B - The new generation of imaging spectrometers: Observing the Universe in the submillimeter spectral region, The X-ray Universe, Space cryo-coolers, Out in the extreme, tumultuous Universe, Probing the Sun with GOLF-NG, Focus: From light to imagery; C - Data analysis in astrophysics; D - Numerical simulation in astrophysics: Information technology and theoretical predictions in astrophysics, Supercomputers for a better understanding of the Universe, The visualization of astrophysical simulations, Godunov, a numerical platform for education and research