DEP and AFO regulate reproductive habit in rice.
Directory of Open Access Journals (Sweden)
Kejian Wang
2010-01-01
Full Text Available Sexual reproduction is essential for the life cycle of most angiosperms. However, pseudovivipary is an important reproductive strategy in some grasses. In this mode of reproduction, asexual propagules are produced in place of sexual reproductive structures. However, the molecular mechanism of pseudovivipary still remains a mystery. In this work, we found three naturally occurring mutants in rice, namely, phoenix (pho, degenerative palea (dep, and abnormal floral organs (afo. Genetic analysis of them indicated that the stable pseudovivipary mutant pho was a double mutant containing both a Mendelian mutation in DEP and a non-Mendelian mutation in AFO. Further map-based cloning and microarray analysis revealed that dep mutant was caused by a genetic alteration in OsMADS15 while afo was caused by an epigenetic mutation in OsMADS1. Thus, OsMADS1 and OsMADS15 are both required to ensure sexual reproduction in rice and mutations of them lead to the switch of reproductive habit from sexual to asexual in rice. For the first time, our results reveal two regulators for sexual and asexual reproduction modes in flowering plants. In addition, our findings also make it possible to manipulate the reproductive strategy of plants, at least in rice.
Lifescience Database Archive (English)
Full Text Available 2Z (Link to Original site) Representative DNA sequence >AFO572 (AFO572Q) /CSM/AF/AFO5-C/AFO572Q.Seq.d/ XXXXXXXXXXGTCCANATTTCCATANA... AFO572Z 3' end seq. >AFO572Z.Seq ----------GTCCANATTTCCATANATGTGTTNAAAAACGTGGNGGNATNTTAAGNTGN GAATTTNANCCNC
Powered AFO for Achilles tendon rupture.
Yoshizawa, Nobuyuki
2008-01-01
This paper proposes a powered ankle foot orthosis (AFO) for the treatment of a ruptured Achilles tendon. Usually, conservative orthosis treatment requires about two months, and a motionless ankle degrades activities of daily living (ADL). It is difficult to go to school or work on foot, and a pair of crutches is needed to go up and down stairs. In order to improve the ADL, an electric powered AFO has been designed to improve the ability to walk with a fixed ankle joint. The sole of the proposed AFO is equipped with an electric actuator. The prototype actuator consists of Nd magnets and electromagnets and is lightweight and battery driven. The actuator can switch the upright posture and the stepped forward posture of the patient. In an experiment, the use of this electric AFO made it possible to walk and to ascend and descend stairs with a fixed ankle joint.
Lifescience Database Archive (English)
Full Text Available GTAACAAAAATTAGTAATTTAAAA AAAAAAAAACCAAAAAAAAAAXXXXXXXXXXTGTCGAATGTCCAGATTTCCATANA...AAAAA---------- Length of 5' end seq. 141 3' end seq. ID AFO146Z 3' end seq. >AFO146Z.Seq ----------TGTCGAATGTCCAGATTTCCATANA...AAAAAAGTTAAAATTAAATTTGTAAAATCAATTTGTAACAAAAATTAGTAATTTAAAA AAAAAAAAACCAAAAAAAAAA----------TGTCGAATGTCCAGATTTCCATANA
What variables influence the ability of an AFO to improve function and when are they indicated?
Malas, Bryan S
2011-05-01
Children with spina bifida often present with functional deficits of the lower limb associated with neurosegmental lesion levels and require orthotic management. The most used orthosis for children with spina bifida is the ankle-foot orthosis (AFO). The AFO improves ambulation and reduces energy cost while walking. Despite the apparent benefits of using an AFO, limited evidence documents the influence of factors predicting the ability of an AFO to improve function and when they are indicated. These variables include AFO design, footwear, AFO-footwear combination, and data acquisition. When these variables are not adequately considered in clinical decision-making, there is a risk the AFO will be abandoned prematurely or the patient's stability, function, and safety compromised. The purposes of this study are to (1) describe the functional deficits based on lesion levels; (2) identify and describe variables that influence the ability of an AFO to control deformities; and (3) describe what variables are indicated for the AFO to control knee flexion during stance, hyperpronation, and valgus stress at the knee. A selective literature review was undertaken searching MEDLINE and Cochrane databases using terms related to "orthosis" and "spina bifida." Based on previous studies and gait analysis data, suggestions can be made regarding material selection/geometric configuration, sagittal alignment, footplate length, and trim lines of an AFO for reducing knee flexion, hyperpronation, and valgus stress at the knee. Further research is required to determine what variables allow an AFO to improve function.
Development of Ankle Foot Orthosis (AFO Using Pneumatic Artificial Muscle for Disabled Children
Directory of Open Access Journals (Sweden)
Ishak N.Z.
2017-01-01
Full Text Available Ankle foot orthosis (AFO are commonly used to correct the instabilities and joint weakness of lower limb. In this research, AFO was developed by using pneumatic artificial muscle (PAM to prevent plantarflexion to occur and also to correct the foot from the inversion syndrome. The research started with designing the AFO by using SolidWorks software based on anthropometry measurement data (n=5, age=12 years old. The mechanical simulation was conducted by using Autodesk Inventor software to obtain a safety factor before the fabrication process was conducted. The AFO was fabricated using 3D printer and the thermoplastic elastomer (TPE rubber was selected as the material. PAM was tested by using test bed machine to generate the force and contraction by muscle. The result shows that the PAM was suitable for low speed as the displacement was greater. The AFO could be valuable for the gait rehabilitation.
The development of the Asian Forum for Polar Sciences (AFoPS)
Kim, Yeadong; Jeong, Jihoon
2015-12-01
The Asian Forum for Polar Sciences (AFoPS), an international forum of Asian polar research institutes, was established for the advancement of polar sciences among its members in 2004. The Forum has served as an important medium of Asian collective endeavors for polar affairs in human and information exchange, research collaboration, and logistics cooperation for the last decade. The historical development of the AFoPS in retrospect can be divided into four phases: inception and establishment (2003-2004), growth and expansion (2005-2007), review and restructuring (2008-2011), and achievements and further measures (2012-2014). The progress of the AFoPS has not been linear and this trend will continue into the next decades. The Forum, however, clearly made achievements in this period of time, realizing multilateral research and logistics cooperation that would have been previously unimaginable; by doing so, it has laid the foundation for the future. Responsible for a great portion of the world's polar activities, the AFoPS will rise to meet the expectations of the world by producing notable research output, initiating international cooperative programs, and supporting non-polar Asian countries with education and research collaboration. These are the tasks of the AFoPS for the next decade and they require strategy that promotes and facilitates collaboration in a practical way and draws attention of non-polar Asian countries to the polar sciences.
Heeren, Gino; Rinnerthaler, Mark; Laun, Peter; von Seyerl, Phyllis; Kössler, Sonja; Klinger, Harald; Hager, Matthias; Bogengruber, Edith; Jarolim, Stefanie; Simon-Nobbe, Birgit; Schüller, Christoph; Carmona-Gutierrez, Didac; Breitenbach-Koller, Lore; Mück, Christoph; Jansen-Dürr, Pidder; Criollo, Alfredo; Kroemer, Guido; Madeo, Frank; Breitenbach, Michael
2009-07-13
Yeast mother cell-specific aging constitutes a model of replicative aging as it occurs in stem cell populations of higher eukaryotes. Here, we present a new long-lived yeast deletion mutation,afo1 (for aging factor one), that confers a 60% increase in replicative lifespan. AFO1/MRPL25 codes for a protein that is contained in the large subunit of the mitochondrial ribosome. Double mutant experiments indicate that the longevity-increasing action of the afo1 mutation is independent of mitochondrial translation, yet involves the cytoplasmic Tor1p as well as the growth-controlling transcription factor Sfp1p. In their final cell cycle, the long-lived mutant cells do show the phenotypes of yeast apoptosis indicating that the longevity of the mutant is not caused by an inability to undergo programmed cell death. Furthermore, the afo1 mutation displays high resistance against oxidants. Despite the respiratory deficiency the mutant has paradoxical increase in growth rate compared to generic petite mutants. A comparison of the single and double mutant strains for afo1 and fob1 shows that the longevity phenotype of afo1 is independent of the formation of ERCs (ribosomal DNA minicircles). AFO1/MRPL25 function establishes a new connection between mitochondria, metabolism and aging.
Public and private regulation of reproductive technologies.
Byk, C
1995-01-01
Human reproduction is interrelated with privacy. However, in most countries where new reproductive technologies are used public regulations have been passed to provide a legal framework for such technologies. This interference in private life can be justified by the need to control medical intervention in the human reproductive process. But in order to find a balance between public regulations and other social regulations, this article analyses the impact private regulation may have on issues raised by reproductive technologies. It also addresses the issue of the influence of private bodies on the drafting of public regulations.
[Advances in the study of neuroendocrinological regulation of kisspeptin in fish reproduction].
Zhuo, Qi
2013-10-01
Kisspeptin, a key factor in the neuroendocrinological regulation of animal reproduction, is a peptide product encoded by kiss genes, which act as the natural ligand of GPR54. Over the last decade, multiple functional molecular forms of kisspeptin have been found in vertebrate species. In fish, the major molecular structural form is kisspeptin-10. The kisspeptin/GPR54 system has multiple important functions in reproduction. This review provides an overview of our current knowledge on kisspeptin and its role in regulating fish reproductive, including the distribution and location of kisspeptin neurons in the brain, the molecular polymorphism of fish kisspeptin, functional diversity, the molecular mechanism of fish reproductive regulation, and the molecular evolution of kisspeptin as well as the co-regulation of fish reproduction by kisspeptin and other functional molecules. Perspectives on the future of kisspeptin regulation in fish reproduction are also highlighted.
Ghrelin: an emerging player in the regulation of reproduction in non-mammalian vertebrates.
Unniappan, Suraj
2010-07-01
The endocrine regulation of vertebrate reproduction is achieved by the coordinated actions of multiple endocrine factors mainly produced from the brain, pituitary, and gonads. In addition to these, several other tissues including the fat and gut produce factors that have reproductive effects. Ghrelin is one such gut/brain hormone with species-specific effects in the regulation of mammalian reproduction. Recent studies have shown that ghrelin and ghrelin receptor mRNAs, and protein are expressed in the ovary and testis of mammals, indicating a direct effect for ghrelin in the control of reproduction. Ghrelin regulates mammalian reproduction by modulating hormone secretion from the brain and pituitary, and by acting directly on the gonads to influence reproductive tissue development and steroid hormone release. Based on the studies reported so far, ghrelin seems to have a predominantly inhibitory role on mammalian reproduction. The presence of ghrelin and ghrelin receptor has been found in the brain, pituitary and gonads of several non-mammalian vertebrates. In contrast to mammals, ghrelin seems to have a stimulatory role in the regulation of non-mammalian reproduction. The main objective of this review is to do a perspective analysis of the comparative aspects of ghrelin regulation of reproduction. (c) 2009 Elsevier Inc. All rights reserved.
Regulation of reproduction by the circadian rhythms.
Zhang, Wen-Xiang; Chen, Si-Yu; Liu, Chang
2016-12-25
Mammals synchronize their circadian activity primarily to the cycles of light and darkness in the environment. Circadian rhythm is controlled by the central clock in the hypothalamic suprachiasmatic nucleus (SCN) and the peripheral clocks in various tissues. More importantly, the central clock can integrate photic/nonphotic signals to generate rhythmic outputs, and then drive the slave oscillators in peripheral tissues through neuroendocrine and behavioral signals. Human reproductive activities, as some other physiological functions, are controlled by the biological clocks. Accumulating lines of epidemiological and genetic evidence indicate that disruption of circadian clock can be directly involved in multiple pathological processes, including infertility. In this review, we mainly discuss the presence of a circadian clock in reproductive tissues and its roles in follicles development, ovulation, spermatogenesis, fertilization and embryo implantation, etc. As the increased shift work and assisted reproductive technologies possibly disrupt circadian rhythmicity to impact reproduction, the importance of circadian rhythms should be highlighted in the regulation of reproductive process.
Heinrich, Ralf; Kunst, Michael; Wirmer, Andrea
2012-01-01
The interplay of neural and hormonal mechanisms activated by entero- and extero-receptors biases the selection of actions by decision making neuronal circuits. The reproductive behavior of acoustically communicating grasshoppers, which is regulated by short-term neural and longer-term hormonal mechanisms, has frequently been used to study the cellular and physiological processes that select particular actions from the species-specific repertoire of behaviors. Various grasshoppers communicate with species- and situation-specific songs in order to attract and court mating partners, to signal reproductive readiness, or to fend off competitors. Selection and coordination of type, intensity, and timing of sound signals is mediated by the central complex, a highly structured brain neuropil known to integrate multimodal pre-processed sensory information by a large number of chemical messengers. In addition, reproductive activity including sound production critically depends on maturation, previous mating experience, and oviposition cycles. In this regard, juvenile hormone released from the corpora allata has been identified as a decisive hormonal signal necessary to establish reproductive motivation in grasshopper females. Both regulatory systems, the central complex mediating short-term regulation and the corpora allata mediating longer-term regulation of reproduction-related sound production mutually influence each other’s activity in order to generate a coherent state of excitation that promotes or suppresses reproductive behavior in respective appropriate or inappropriate situations. This review summarizes our current knowledge about extrinsic and intrinsic factors that influence grasshopper reproductive motivation, their representation in the nervous system and their integrative processing that mediates the initiation or suppression of reproductive behaviors. PMID:22737107
Directory of Open Access Journals (Sweden)
Ralf eHeinrich
2012-06-01
Full Text Available The interplay of neural and hormonal mechanisms activated by entero- and exteroreceptors biases the selection of actions by decision making neuronal circuits. The reproductive behaviour of acoustically communicating grasshoppers, which is regulated by short-term neural and longer-term hormonal mechanisms, has frequently been used to study the cellular and physiological processes that select particular actions from the species-specific repertoire of behaviours. Various grasshoppers communicate with species- and situation-specific songs in order to attract and court mating partners, to signal reproductive readiness or to fend off competitors. Selection and coordination of type, intensity and timing of sound signals is mediated by the central complex, a highly structured brain neuropil known to integrate multimodal pre-processed sensory information by a large number of chemical messengers. In addition, reproductive activity including sound production critically depends on maturation, previous mating experience and oviposition cycles. In this regard, juvenile hormone released from the corpora allata has been identified as a decisive hormonal signal necessary to establish reproductive motivation in grasshopper females. Both regulatory systems, the central complex mediating short-term regulation and the corpora allata mediating longer-term regulation of reproduction related sound production mutually influence each other’s activity in order to generate a coherent state of excitation that promotes or suppresses reproductive behaviour in respective appropriate or inappropriate situations.This review summarizes our current knowledge about extrinsic and intrinsic factors that influence grasshopper reproductive motivation, their representation in the nervous system and their integrative processing that mediates the initiation or suppression of reproductive behaviors.
Patterns of globalized reproduction: Egg cells regulation in Israel and Austria.
Shalev, Carmel; Werner-Felmayer, Gabriele
2012-04-18
Since the successful introduction of in vitro fertilization in 1978, medically assisted reproduction (MAR) has proliferated in multiple clinical innovations. Consequently, egg cells have become an object of demand for both infertility treatment and stem cell research, and this raises complex legal, ethical, social and economic issues.In this paper we compare how the procurement and use of human egg cells is regulated in two countries: Israel and Austria. Israel is known for its scientific leadership, generous public funding, high utilization and liberal regulation of assisted reproductive technology (ART). Austria lies at the other extreme of the regulatory spectrum in terms of restrictions on reproductive interventions.In both countries, however, there is a constant increase in the use of the technology, and recent legal developments make egg cells more accessible. Also, in both countries the scarcity of egg cells in concert with the rising demand for donations has led to the emergence of cross-border markets and global 'reproductive tourism' practices. In Israel, in particular, a scandal known as the 'eggs affair' was followed by regulation that allowed egg cell donations from outside the country under certain conditions.Cross-border markets are developed by medical entrepreneurs, driven by global economic gaps, made possible by trans-national regulatory lacunae and find expression as consumer demand. The transnational practice of egg cell donations indicates the emergence of a global public health issue, but there is a general lack of medical and epidemiological data on its efficacy and safety. We conclude that there is need for harmonisation of domestic laws and formulation of new instruments for international governance.
Patterns of globalized reproduction: Egg cells regulation in Israel and Austria
Directory of Open Access Journals (Sweden)
Shalev Carmel
2012-04-01
Full Text Available Abstract Since the successful introduction of in vitro fertilization in 1978, medically assisted reproduction (MAR has proliferated in multiple clinical innovations. Consequently, egg cells have become an object of demand for both infertility treatment and stem cell research, and this raises complex legal, ethical, social and economic issues. In this paper we compare how the procurement and use of human egg cells is regulated in two countries: Israel and Austria. Israel is known for its scientific leadership, generous public funding, high utilization and liberal regulation of assisted reproductive technology (ART. Austria lies at the other extreme of the regulatory spectrum in terms of restrictions on reproductive interventions. In both countries, however, there is a constant increase in the use of the technology, and recent legal developments make egg cells more accessible. Also, in both countries the scarcity of egg cells in concert with the rising demand for donations has led to the emergence of cross-border markets and global 'reproductive tourism' practices. In Israel, in particular, a scandal known as the 'eggs affair' was followed by regulation that allowed egg cell donations from outside the country under certain conditions. Cross-border markets are developed by medical entrepreneurs, driven by global economic gaps, made possible by trans-national regulatory lacunae and find expression as consumer demand. The transnational practice of egg cell donations indicates the emergence of a global public health issue, but there is a general lack of medical and epidemiological data on its efficacy and safety. We conclude that there is need for harmonisation of domestic laws and formulation of new instruments for international governance.
Galanin-like peptide (GALP) is a hypothalamic regulator of energy homeostasis and reproduction.
Lawrence, Catherine; Fraley, Gregory S
2011-01-01
Galanin-like peptide (GALP) was discovered in 1999 in the porcine hypothalamus and was found to be a 60 amino acid neuropeptide. GALP shares sequence homology to galanin (1-13) in position 9-21 and can bind to, as well as activate, the three galanin receptor subtypes (GalR1-3). GALP-expressing cells are limited, and are mainly found in the arcuate nucleus of the hypothalamus (ARC) and the posterior pituitary. GALP-positive neurons in the ARC project to several brain regions where they appear to make contact with multiple neuromodulators. These neuromodulators are involved in the regulation of energy homeostasis and reproduction, anatomical evidence that suggests a role for GALP in these physiological functions. In support of this idea, GALP gene expression is regulated by several factors that reflect metabolic state including the metabolic hormones leptin and insulin, thyroid hormones, and blood glucose. Considerable evidence now exists to support the hypothesis that GALP has a role in the regulation of energy homeostasis and reproduction; and, that GALP's role may be independent of the known galanin receptors. In this review, we (1) provide an overview of the distribution of GALP, and discuss the potential relationship between GALP and other neuromodulators of energy homeostasis and reproduction, (2) discuss the metabolic factors that regulate GALP expression, (3) review the evidence for the role of GALP in energy homeostasis and reproduction, (4) discuss the potential downstream mediators and mechanisms underlying GALP's effects, and (5) discuss the possibility that GALP may mediate its effects via an as yet unidentified GALP-specific receptor. Copyright © 2010 Elsevier Inc. All rights reserved.
Symbiotic regulation of plant growth, development and reproduction
Rodriguez, R.J.; Freeman, D. Carl; McArthur, E.D.; Kim, Y.-O.; Redman, R.S.
2009-01-01
The growth and development of rice (Oryzae sativa) seedlings was shown to be regulated epigenetically by a fungal endophyte. In contrast to un-inoculated (nonsymbiotic) plants, endophyte colonized (symbiotic) plants preferentially allocated resources into root growth until root hairs were well established. During that time symbiotic roots expanded at five times the rate observed in nonsymbiotic plants. Endophytes also influenced sexual reproduction of mature big sagebrush (Artemisia tridentata) plants. Two spatially distinct big sagebrush subspecies and their hybrids were symbiotic with unique fungal endophytes, despite being separated by only 380 m distance and 60 m elevation. A double reciprocal transplant experiment of parental and hybrid plants, and soils across the hybrid zone showed that fungal endophytes interact with the soils and different plant genotypes to confer enhanced plant reproduction in soil native to the endophyte and reduced reproduction in soil alien to the endophyte. Moreover, the most prevalent endophyte of the hybrid zone reduced the fitness of both parental subspecies. Because these endophytes are passed to the next generation of plants on seed coats, this interaction provides a selective advantage, habitat specificity, and the means of restricting gene flow, thereby making the hybrid zone stable, narrow and potentially leading to speciation. ?? 2009 Landes Bioscience.
Social regulation of male reproductive plasticity in an African cichlid fish.
Maruska, Karen P; Fernald, Russell D
2013-12-01
Social interactions with the outcome of a position in a dominance hierarchy can have profound effects on reproductive behavior and physiology, requiring animals to integrate environmental information with their internal physiological state; but how is salient information from the animal's dynamic social environment transformed into adaptive behavioral, physiological, and molecular-level changes? The African cichlid fish, Astatotilapia burtoni, is ideally suited to understand socially controlled reproductive plasticity because activity of the male reproductive (brain-pituitary-gonad) axis is tightly linked to social status. Males form hierarchies in which a small percentage of brightly colored dominant individuals have an active reproductive axis, defend territories, and spawn with females, while the remaining males are subordinate, drably colored, do not hold a territory, and have a suppressed reproductive system with minimal opportunities for spawning. These social phenotypes are plastic and quickly reversible, meaning that individual males may switch between dominant and subordinate status multiple times within a lifetime. Here, we review the rapid and remarkable plasticity that occurs along the entire reproductive axis when males rise in social rank, a transition that has important implications for the operational sex ratio of the population. When males rise in rank, transformations occur in the brain, pituitary, circulation, and testes over short time-scales (minutes to days). Changes are evident in overt behavior, as well as modifications at the physiological, cellular, and molecular levels that regulate reproductive capacity. Widespread changes triggered by a switch in rank highlight the significance of external social information in shaping internal physiology and reproductive competence.
Brain estrogen receptor-a (ERa) is essential for estrogenic regulation of energy homeostasis and reproduction. We previously showed that ERa expressed by pro-opiomelanocortin (POMC) neurons mediates estrogen's effects on food intake, body weight, negative regulation of hypothalamic–pituitary–gonadal...
Goldfish neurokinin B: Cloning, tissue distribution, and potential role in regulating reproduction.
Qi, Xin; Zhou, Wenyi; Li, Shuisheng; Liu, Yun; Ye, Gang; Liu, Xiaochun; Peng, Chun; Zhang, Yong; Lin, Haoran
2015-09-15
Neurokinin B (NKB) is a member of the tackykinin (TAC) family known to play a critical role in the neuroendocrine regulation of reproduction in mammals. However, its biological functions in teleosts are less clear. The aim of this study was to determine the role of NKB in fish reproduction using goldfish as a model. Two transcripts, TAC3a and TAC3b, which encode several NKBs, including NKBa-13, NKBa-10, NKBb-13, and NKBb-11, were cloned. Phylogenetic analysis revealed that NKBa-10 and NKBb-11 are closely related to mammalian NKB, while NKB-13s are more conserved in teleosts. Quantitative real-time PCR analyses in various tissues showed that TAC3a and TAC3b mRNAs were mainly expressed in the brain. In situ hybridization further detected TAC3a and TAC3b mRNAs in several regions of the brain known to be involved in the regulation of reproduction and metabolism, as well as in the neurohypophysis of the pituitary. To investigate the potential role of NKBs in reproduction, goldfish were injected intraperitoneally with synthetic NKBa-13, -10, NKBb-13, or -11 peptides and the mRNA levels of hypothalamic gonadotropin-releasing hormone (GnRH) and pituitary gonadotropin subunits were measured. NKBa-13, -10, or NKBb-13, but not -11, significantly increased hypothalamic salmon GnRH and pituitary FSHβ and LHβ mRNA levels in both female and male goldfish. Finally, ovariectomy increased, while estradiol replacement reduced, TAC3a mRNA levels without affecting TAC3b expression in the hypothalamus. These data suggest that NKBa-13, -10, and NKBb-13 play a role in mediating the estrogen negative feedback regulation of gonadotropins. Copyright © 2014 Elsevier Inc. All rights reserved.
Stevenson, Tyler J; Ball, Gregory F
2011-08-22
Seasonal breeding in the temperate zone is a dramatic example of a naturally occurring change in physiology and behaviour. Cues that predict periods of environmental amelioration favourable for breeding must be processed by the brain so that the appropriate responses in reproductive physiology can be implemented. The neural integration of several environmental cues converges on discrete hypothalamic neurons in order to regulate reproductive physiology. Gonadotrophin-releasing hormone-1 (GnRH1) and Kisspeptin (Kiss1) neurons in avian and mammalian species, respectively, show marked variation in expression that is positively associated with breeding state. We applied the constancy/contingency model of predictability to investigate how GnRH1 and Kiss1 integrate different environmental cues to regulate reproduction. We show that variation in GnRH1 from a highly seasonal avian species exhibits a predictive change that is primarily based on contingency information. Opportunistic species have low measures of predictability and exhibit a greater contribution of constancy information that is sex-dependent. In hamsters, Kiss1 exhibited a predictive change in expression that was predominantly contingency information and is anatomically localized. The model applied here provides a framework for studies geared towards determining the impact of variation in climate patterns to reproductive success in vertebrate species.
Progressive effects of silver nanoparticles on hormonal regulation of reproduction in male rats
International Nuclear Information System (INIS)
Dziendzikowska, K.; Krawczyńska, A.; Oczkowski, M.; Królikowski, T.; Brzóska, K.; Lankoff, A.; Dziendzikowski, M.; Stępkowski, T.; Kruszewski, M.
2016-01-01
The growing use of silver nanoparticles (AgNPs) in various applications, including consumer, agriculture and medicine products, has raised many concerns about the potential risks of nanoparticles (NPs) to human health and the environment. An increasing body of evidence suggests that AgNPs may have adverse effects of humans, thus the aim of this study was to investigate the effects of AgNPs on the male reproductive system. Silver particles (20 nm AgNPs (groups Ag I and Ag II) and 200 nm Ag sub-micron particles (SPs) (group Ag III)) were administered intravenously to male Wistar rats at a dose of 5 (groups Ag I and Ag III) or 10 (group Ag II) mg/kg of body weight. The biological material was sampled 24 h, 7 days and 28 days after injection. The obtained results revealed that the AgNPs had altered the luteinising hormone concentration in the plasma and the sex hormone concentration in the plasma and testes. Plasma and intratesticular levels of testosterone and dihydrotestosterone were significantly decreased both 7 and 28 days after treatment. No change in the prolactin and sex hormone-binding globulin concentration was observed. Exposure of the animals to AgNPs resulted in a considerable decrease in 5α-reductase type 1 and the aromatase protein level in the testis. Additionally, expression analysis of genes involved in steroidogenesis and the steroids metabolism revealed significant down-regulation of Star, Cyp11a1, Hsd3b1, Hsd17b3 and Srd5a1 mRNAs in AgNPs/AgSPs-exposed animals. The present study demonstrates the potential adverse effect on the hormonal regulation of the male reproductive function following AgNP/AgSP administration, in particular alterations of the sex steroid balance and expression of genes involved in steroidogenesis and the steroids metabolism. - Highlights: • Assessment of the toxic effects of AgNPs/AgSPs on the regulation of male reproductive function • AgNP −/AgSP-induced alterations of sex steroid status in male Wistar rats.
Progressive effects of silver nanoparticles on hormonal regulation of reproduction in male rats
Energy Technology Data Exchange (ETDEWEB)
Dziendzikowska, K., E-mail: k.dziendzikowska@gmail.com [Division of Nutrition Physiology, Department of Dietetics, Faculty of Human Nutrition and Consumer Science, Warsaw University of Life Sciences – SGGW, Nowoursynowska 159C, 02-776 Warsaw (Poland); Krawczyńska, A. [Laboratory of Molecular Biology, The Kielanowski Institute of Animal Physiology and Nutrition, Polish Academy of Sciences, Instytucka 3, 05-110 Jabłonna (Poland); Oczkowski, M.; Królikowski, T. [Division of Nutrition Physiology, Department of Dietetics, Faculty of Human Nutrition and Consumer Science, Warsaw University of Life Sciences – SGGW, Nowoursynowska 159C, 02-776 Warsaw (Poland); Brzóska, K. [Centre for Radiobiology and Biological Dosimetry, Institute of Nuclear Chemistry and Technology, Dorodna 16, 03-195 Warsaw (Poland); Lankoff, A. [Centre for Radiobiology and Biological Dosimetry, Institute of Nuclear Chemistry and Technology, Dorodna 16, 03-195 Warsaw (Poland); Department of Radiobiology and Immunology, Institute of Biology, Jan Kochanowski University, Świetokrzyska 15, 25-406 Kielce (Poland); Dziendzikowski, M. [Airworthiness Division, Air Force Institute of Technology, Ks. Boleslawa 6, 01-494 Warsaw (Poland); Stępkowski, T. [Centre for Radiobiology and Biological Dosimetry, Institute of Nuclear Chemistry and Technology, Dorodna 16, 03-195 Warsaw (Poland); Kruszewski, M. [Department of Medical Biology and Translational Research, Faculty of Medicine, University of Information Technology and Management, Sucharskiego 2, 35-225 Rzeszów (Poland); Department of Molecular Biology and Translational Research, Institute of Rural Health, Jaczewskiego 2, 20-090 Lublin (Poland); and others
2016-12-15
The growing use of silver nanoparticles (AgNPs) in various applications, including consumer, agriculture and medicine products, has raised many concerns about the potential risks of nanoparticles (NPs) to human health and the environment. An increasing body of evidence suggests that AgNPs may have adverse effects of humans, thus the aim of this study was to investigate the effects of AgNPs on the male reproductive system. Silver particles (20 nm AgNPs (groups Ag I and Ag II) and 200 nm Ag sub-micron particles (SPs) (group Ag III)) were administered intravenously to male Wistar rats at a dose of 5 (groups Ag I and Ag III) or 10 (group Ag II) mg/kg of body weight. The biological material was sampled 24 h, 7 days and 28 days after injection. The obtained results revealed that the AgNPs had altered the luteinising hormone concentration in the plasma and the sex hormone concentration in the plasma and testes. Plasma and intratesticular levels of testosterone and dihydrotestosterone were significantly decreased both 7 and 28 days after treatment. No change in the prolactin and sex hormone-binding globulin concentration was observed. Exposure of the animals to AgNPs resulted in a considerable decrease in 5α-reductase type 1 and the aromatase protein level in the testis. Additionally, expression analysis of genes involved in steroidogenesis and the steroids metabolism revealed significant down-regulation of Star, Cyp11a1, Hsd3b1, Hsd17b3 and Srd5a1 mRNAs in AgNPs/AgSPs-exposed animals. The present study demonstrates the potential adverse effect on the hormonal regulation of the male reproductive function following AgNP/AgSP administration, in particular alterations of the sex steroid balance and expression of genes involved in steroidogenesis and the steroids metabolism. - Highlights: • Assessment of the toxic effects of AgNPs/AgSPs on the regulation of male reproductive function • AgNP −/AgSP-induced alterations of sex steroid status in male Wistar rats.
Phenotypic selection and regulation of reproduction in different environments in wild barley
Volis, S.; Verhoeven, K.J.F.; Mendlinger, S.; Ward, D.
2004-01-01
Plasticity of the phenotypic architecture of wild barley, Hordeum spontaneum, was studied in response to water and nutrient stress. Direct and indirect selection on several vegetative and reproductive traits was estimated and path analysis used to reveal how regulating pathways via maternal
Wolfe, Andrew; Divall, Sara; Wu, Sheng
2014-10-01
The mammalian reproductive hormone axis regulates gonadal steroid hormone levels and gonadal function essential for reproduction. The neuroendocrine control of the axis integrates signals from a wide array of inputs. The regulatory pathways important for mediating these inputs have been the subject of numerous studies. One class of proteins that have been shown to mediate metabolic and growth signals to the CNS includes Insulin and IGF-1. These proteins are structurally related and can exert endocrine and growth factor like action via related receptor tyrosine kinases. The role that insulin and IGF-1 play in controlling the hypothalamus and pituitary and their role in regulating puberty and nutritional control of reproduction has been studied extensively. This review summarizes the in vitro and in vivo models that have been used to study these neuroendocrine structures and the influence of these growth factors on neuroendocrine control of reproduction. Copyright © 2014 Elsevier Inc. All rights reserved.
Watts, Heather E.; Hahn, Thomas P.
2012-01-01
In order to time reproduction to coincide with favorable conditions, animals use environmental cues to up- and down-regulate the reproductive axis appropriately. Although photoperiodic cues are one of the best studied of such environmental cues, animals also attend to others such as temperature, food availability, rainfall and social cues. Such non-photic cues are expected to be particularly important for tropical species and temperate-zone species that exhibit flexible or opportunistic breed...
BACKGROUND:Trihalomethanes (THMs) and haloaretic acids (HAAs) are regulated disinfection by-products (DBPs); their joint reproductive toxicity in drinking water is unknown.OBJECTIVE: We aimed to evaluate a drinking water mixture of the four regulated THMs and five regulated HAAs ...
Directory of Open Access Journals (Sweden)
Angela K. Odle
2018-01-01
Full Text Available The adipokine leptin signals the body’s nutritional status to the brain, and particularly, the hypothalamus. However, leptin receptors (LEPRs can be found all throughout the body and brain, including the pituitary. It is known that leptin is permissive for reproduction, and mice that cannot produce leptin (Lep/Lep are infertile. Many studies have pinpointed leptin’s regulation of reproduction to the hypothalamus. However, LEPRs exist at all levels of the hypothalamic–pituitary–gonadal axis. We have previously shown that deleting the signaling portion of the LEPR specifically in gonadotropes impairs fertility in female mice. Our recent studies have targeted this regulation to the control of gonadotropin releasing hormone receptor (GnRHR expression. The hypotheses presented here are twofold: (1 cyclic regulation of pituitary GnRHR levels sets up a target metabolic checkpoint for control of the reproductive axis and (2 multiple checkpoints are required for the metabolic signaling that regulates the reproductive axis. Here, we emphasize and explore the relationship between the hypothalamus and the pituitary with regard to the regulation of GnRHR. The original data we present strengthen these hypotheses and build on our previous studies. We show that we can cause infertility in 70% of female mice by deleting all isoforms of LEPR specifically in gonadotropes. Our findings implicate activin subunit (InhBa mRNA as a potential leptin target in gonadotropes. We further show gonadotrope-specific upregulation of GnRHR protein (but not mRNA levels following leptin stimulation. In order to try and understand this post-transcriptional regulation, we tested candidate miRNAs (identified with in silico analysis that may be binding the Gnrhr mRNA. We show significant upregulation of one of these miRNAs in our gonadotrope-Lepr-null females. The evidence provided here, combined with our previous work, lay the foundation for metabolically regulated post
Heidt-Forsythe, Erin
2017-01-01
The availability of assisted reproductive technologies (ARTs) in the medical marketplace complicates our understanding of reproductive public policy in the United States. Political debates over ARTs often are based on fundamental moral principles of life, reproduction, and kinship, similar to other reproductive policies in the United States. However, ARTs are an important moneymaking private enterprise for the U.S. biotechnology industry. This project investigates how the U.S. states regulate these unique and challenging technologies as either moral policies or economic policies. This study employs ordinary least squares (OLS) regression to estimate the significance of morality and economic policy variables on ART policies at the state level, noting associations between state-level political, economic, and gender variables on restrictive and permissive state-level ART policies. Economic variables (reflecting the biotechnology industry) and advocacy for access to ART on behalf of infertility patients increase the chances of states passing policies that enable consumer use of ARTs. Additionally, individual ART policies are distinct from one another in the ways that morality variables increase the chances of ART regulations. Surprisingly, the role of religious adherence among state residents varied in positive and negative relationships with individual policy passage. In general, these results support the hypothesis that ART laws are associated with economic as well as moral concerns of the states-ARTs lie at the intersection of issues of life and reproduction and of scientific innovation and health. What is most striking about these results is that they do not follow patterns seen in the legislation of abortion, contraception, and sexuality in general-those reproductive policies that are considered "morality policy." Similarly, economic variables are not consistently significant in the expected direction.
ROLE OF SEROTONIN IN FISH REPRODUCTION
Directory of Open Access Journals (Sweden)
Parvathy ePrasad
2015-06-01
Full Text Available The neuroendocrine mechanism regulates reproduction through the hypothalamo-pituitary-gonadal (HPG axis which is evolutionarily conserved in vertebrates. The HPG axis is regulated by a variety of internal as well as external factors. Serotonin, a monoamine neurotransmitter, is involved in a wide range of reproductive functions. In mammals, serotonin regulates sexual behaviours, gonadotropin release and gonadotropin-release hormone (GnRH secretion. However, the serotonin system in teleost may play unique role in the control of reproduction as the mechanism of reproductive control in teleosts is not always the same as in the mammalian models. In fish, the serotonin system is also regulated by natural environmental factors as well as chemical substances. In particular, selective serotonin reuptake inhibitors (SSRIs are commonly detected as pharmaceutical contaminants in the natural environment. Those factors may influence fish reproductive functions via the serotonin system. This review summarizes the functional significance of serotonin in the teleosts reproduction.
Woodworth, Bradley K; Wheelwright, Nathaniel T; Newman, Amy E M; Norris, D Ryan
2017-08-01
Knowledge of the density-dependent processes that regulate animal populations is key to understanding, predicting, and conserving populations. In migratory birds, density-dependence is most often studied during the breeding season, yet we still lack a robust understanding of the reproductive traits through which density influences individual reproductive success. We used 27-yr of detailed, individual-level productivity data from an island-breeding population of Savannah sparrows Passerculus sandwichensis to evaluate effects of local and total annual population density on female reproductive success. Local density (number of neighbors within 50 m of a female's nest) had stronger effects on the number of young fledged than did total annual population density. Females nesting in areas of high local density were more likely to suffer nest predation and less likely to initiate and fledge a second clutch, which led to fewer young fledged in a season. Fledging fewer young subsequently decreased the likelihood of a female recruiting offspring into the breeding population in a subsequent year. Collectively, these results provide insight into the scale and reproductive mechanisms mediating density-dependent reproductive success and fitness in songbirds. © 2017 by the Ecological Society of America.
Kim, Hyun Chul; Lee, Chi Hoon; Hur, Sung Pyu; Kim, Byeong Hoon; Park, Jun Young; Lee, Young Don
2015-03-01
This study investigated possible involvement of photoperiodic regulation in reproductive endocrine system of female olive flounder. To investigate the influence on brain-pituitary axis in endocrine system by regulating photoperiod, compared expression level of Kisspeptin and sbGnRH mRNA in brain and FSH-β, LH-β and GH mRNA in pituitary before and after spawning. Photoperiod was treated natural photoperiod and long photoperiod (15L:9D) conditions from Aug. 2013 to Jun. 2014. Continuous long photoperiod treatment from Aug. (post-spawning phase) was inhibited gonadal development of female olive flounder. In natural photoperiod group, the Kiss2 expression level a significant declined in Mar. (spawning period). And also, FSH-β, LH-β and GH mRNA expression levels were increasing at this period. However, in long photoperiod group, hypothalamic Kiss2, FSH-β, LH-β and GH mRNA expression levels did not show any significant fluctuation. These results suggest that expression of hypothalamic Kiss2, GtH and GH in the pituitary would change in response to photoperiod and their possible involvement of photoperiodic regulation in reproductive endocrine system of the BPG axis.
Gene pathways that delay Caenorhabditis elegans reproductive senescence.
Directory of Open Access Journals (Sweden)
Meng C Wang
2014-12-01
Full Text Available Reproductive senescence is a hallmark of aging. The molecular mechanisms regulating reproductive senescence and its association with the aging of somatic cells remain poorly understood. From a full genome RNA interference (RNAi screen, we identified 32 Caenorhabditis elegans gene inactivations that delay reproductive senescence and extend reproductive lifespan. We found that many of these gene inactivations interact with insulin/IGF-1 and/or TGF-β endocrine signaling pathways to regulate reproductive senescence, except nhx-2 and sgk-1 that modulate sodium reabsorption. Of these 32 gene inactivations, we also found that 19 increase reproductive lifespan through their effects on oocyte activities, 8 of them coordinate oocyte and sperm functions to extend reproductive lifespan, and 5 of them can induce sperm humoral response to promote reproductive longevity. Furthermore, we examined the effects of these reproductive aging regulators on somatic aging. We found that 5 of these gene inactivations prolong organismal lifespan, and 20 of them increase healthy life expectancy of an organism without altering total life span. These studies provide a systemic view on the genetic regulation of reproductive senescence and its intersection with organism longevity. The majority of these newly identified genes are conserved, and may provide new insights into age-associated reproductive senescence during human aging.
Legal regulation of assisted reproduction treatment in Russia.
Svitnev, Konstantin
2010-06-01
Russia remains one of the countries with a most favourable approach towards human reproduction in Europe, allowing almost everybody wanting to have a child of their own through assisted reproduction treatment to fulfill their dream. The legal situation around assisted reproduction treatment in Russia is very favourable; surrogacy, gamete and embryo donation are permitted, even on a commercial level. Gestational surrogacy is an option for heterosexual couples and single women, although a court decision might be needed to register a 'surrogate' child born to a couple who are not officially married or a single woman. However, it is not explicitly allowed nor prohibited for single men. Copyright 2010 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.
Fulicin regulates the female reproductive organs of the snail, Achatina fulica.
Fujisawa, Y; Masuda, K; Minakata, H
2000-08-01
Fulicin is a D-amino acid-containing neuropeptide that has been thought to control male copulatory behavior in the land snail, Achatina fulica. In the present study, we demonstrated that the vagina and the oviduct of Achatina were densely innervated by fulicin-like immunoreactive neuronal fibers. We confirmed that fulicin was actually present in the vagina by mass spectrometry. Furthermore, fulicin showed a profound excitatory effect on contractions of the vagina and the oviduct. These results suggest that fulicin controls female egg-laying behavior as an excitatory neuropeptide regulating the female reproductive organs of the snail.
Baxi, Kunal; Ghavidel, Ata; Waddell, Brandon; Harkness, Troy A; de Carvalho, Carlos E
2017-09-01
Aging in eukaryotes is accompanied by widespread deterioration of the somatic tissue. Yet, abolishing germ cells delays the age-dependent somatic decline in Caenorhabditis elegans In adult worms lacking germ cells, the activation of the DAF-9/DAF-12 steroid signaling pathway in the gonad recruits DAF-16 activity in the intestine to promote longevity-associated phenotypes. However, the impact of this pathway on the fitness of normally reproducing animals is less clear. Here, we explore the link between progeny production and somatic aging and identify the loss of lysosomal acidity-a critical regulator of the proteolytic output of these organelles-as a novel biomarker of aging in C. elegans The increase in lysosomal pH in older worms is not a passive consequence of aging, but instead is timed with the cessation of reproduction, and correlates with the reduction in proteostasis in early adult life. Our results further implicate the steroid signaling pathway and DAF-16 in dynamically regulating lysosomal pH in the intestine of wild-type worms in response to the reproductive cycle. In the intestine of reproducing worms, DAF-16 promotes acidic lysosomes by upregulating the expression of v-ATPase genes. These findings support a model in which protein clearance in the soma is linked to reproduction in the gonad via the active regulation of lysosomal acidification. Copyright © 2017 by the Genetics Society of America.
Kisspeptin and energy balance in reproduction.
De Bond, Julie-Ann P; Smith, Jeremy T
2014-03-01
Kisspeptin is vital for the neuroendocrine regulation of GNRH secretion. Kisspeptin neurons are now recognized as a central pathway responsible for conveying key homeostatic information to GNRH neurons. This pathway is likely to mediate the well-established link between energy balance and reproductive function. Thus, in states of severely altered energy balance (either negative or positive), fertility is compromised, as is Kiss1 expression in the arcuate nucleus. A number of metabolic modulators have been proposed as regulators of kisspeptin neurons including leptin, ghrelin, pro-opiomelanocortin (POMC), and neuropeptide Y (NPY). Whether these regulate kisspeptin neurons directly or indirectly will be discussed. Moreover, whether the stimulatory role of leptin on reproduction is mediated by kisspeptin directly will be questioned. Furthermore, in addition to being expressed in GNRH neurons, the kisspeptin receptor (Kiss1r) is also expressed in other areas of the brain, as well as in the periphery, suggesting alternative roles for kisspeptin signaling outside of reproduction. Interestingly, kisspeptin neurons are anatomically linked to, and can directly excite, anorexigenic POMC neurons and indirectly inhibit orexigenic NPY neurons. Thus, kisspeptin may have a direct role in regulating energy balance. Although data from Kiss1r knockout and WT mice found no differences in body weight, recent data indicate that kisspeptin may still play a role in food intake and glucose homeostasis. Thus, in addition to regulating reproduction, and mediating the effect of energy balance on reproductive function, kisspeptin signaling may also be a direct regulator of metabolism.
TGF-beta Sma/Mab signaling mutations uncouple reproductive aging from somatic aging.
Directory of Open Access Journals (Sweden)
Shijing Luo
2009-12-01
Full Text Available Female reproductive cessation is one of the earliest age-related declines humans experience, occurring in mid-adulthood. Similarly, Caenorhabditis elegans' reproductive span is short relative to its total life span, with reproduction ceasing about a third into its 15-20 day adulthood. All of the known mutations and treatments that extend C. elegans' reproductive period also regulate longevity, suggesting that reproductive span is normally linked to life span. C. elegans has two canonical TGF-beta signaling pathways. We recently found that the TGF-beta Dauer pathway regulates longevity through the Insulin/IGF-1 Signaling (IIS pathway; here we show that this pathway has a moderate effect on reproductive span. By contrast, TGF-beta Sma/Mab signaling mutants exhibit a substantially extended reproductive period, more than doubling reproductive span in some cases. Sma/Mab mutations extend reproductive span disproportionately to life span and act independently of known regulators of somatic aging, such as Insulin/IGF-1 Signaling and Dietary Restriction. This is the first discovery of a pathway that regulates reproductive span independently of longevity and the first identification of the TGF-beta Sma/Mab pathway as a regulator of reproductive aging. Our results suggest that longevity and reproductive span regulation can be uncoupled, although they appear to normally be linked through regulatory pathways.
Deconstructing mammalian reproduction: using knockouts to define fertility pathways.
Roy, Angshumoy; Matzuk, Martin M
2006-02-01
Reproduction is the sine qua non for the propagation of species and continuation of life. It is a complex biological process that is regulated by multiple factors during the reproductive life of an organism. Over the past decade, the molecular mechanisms regulating reproduction in mammals have been rapidly unraveled by the study of a vast number of mouse gene knockouts with impaired fertility. The use of reverse genetics to generate null mutants in mice through targeted disruption of specific genes has enabled researchers to identify essential regulators of spermatogenesis and oogenesis in vivo and model human disorders affecting reproduction. This review focuses on the merits, utility, and the variations of the knockout technology in studies of reproduction in mammals.
32 CFR 2700.43 - Reproduction controls.
2010-07-01
... 32 National Defense 6 2010-07-01 2010-07-01 false Reproduction controls. 2700.43 Section 2700.43... SECURITY INFORMATION REGULATIONS Safeguarding § 2700.43 Reproduction controls. OMSN and SLNO shall maintain records to show the number and distribution of all OMSN originated classified documents. Reproduction of...
[The function of ERα in male reproductive system].
Dong, Yu-Hang; Wei, Jin-Hua; Li, Zhen
2014-12-01
Estrogen receptors (ERs), including two sub-types ERα and ERβ, belong to the steroid hormone superfamily of nuclear receptors. ERα distributes in the male reproductive system and plays a crucial role in the regulation of male reproduction through estrogen-dependent and -independent ways. In this article, we mainly reviewed the molecular structure, mode of action and location of ERα in the male reproductive system, and explored the mechanism of ERα in regulating the male reproductive system by analyzing different animal models of disrupted ERα.
Insulin: its role in the central control of reproduction.
Sliwowska, Joanna H; Fergani, Chrysanthi; Gawałek, Monika; Skowronska, Bogda; Fichna, Piotr; Lehman, Michael N
2014-06-22
Insulin has long been recognized as a key regulator of energy homeostasis via its actions at the level of the brain, but in addition, plays a role in regulating neural control of reproduction. In this review, we consider and compare evidence from animal models demonstrating a role for insulin for physiological control of reproduction by effects on GnRH/LH secretion. We also review the role that insulin plays in prenatal programming of adult reproduction, and consider specific candidate neurons in the adult hypothalamus by which insulin may act to regulate reproductive function. Finally, we review clinical evidence of the role that insulin may play in adult human fertility and reproductive disorders. Overall, while insulin appears to have a significant impact on reproductive neuroendocrine function, there are many unanswered questions regarding its precise sites and mechanisms of action, and their impact on developing and adult reproductive neuroendocrine function. Copyright © 2014 Elsevier Inc. All rights reserved.
Perakakis, Nikolaos; Upadhyay, Jagriti; Ghaly, Wael; Chen, Joyce; Chrysafi, Pavlina; Anastasilakis, Athanasios D; Mantzoros, Christos S
2018-05-09
We have previously demonstrated that the adipose tissue derived hormone leptin controls reproductive function by regulating the hypothalamic-pituitary-gonadal axis in response to energy deficiency. Here, we evaluate the activins-follistatins-inhibins (AFI) axis during acute (short-term fasting in healthy people) and chronic energy deficiency (women with hypothalamic amenorrhea due to strenuous exercise [HA]) and investigate their relation to leptin and reproductive function in healthy subjects and subjects with HA. The AFI axis was investigated in: a) A double-blinded study in healthy subjects having three randomly assigned admissions, each time for four days: in the isocaloric fed state, complete fasting with placebo treatment, complete fasting with leptin replacement, b) A case-control study comparing women with HA vs healthy controls, c) An open-label interventional study investigating leptin treatment in women with HA over a period of up to three months, d) A randomized interventional trial investigating leptin treatment vs placebo in women with HA for nine months. The circulating levels of activin A, activin B, follistatin and follistatin-like 3 change robustly in response to acute and chronic energy deficiency. Leptin replacement in acute energy deprivation does not affect the levels of these hormones suggesting an independent regulation by these two hormonal pathways. In chronic energy deficiency, leptin replacement restores only activin B levels, which are in turn associated with an increase in the number of dominant follicles. We demonstrate for the first time that the AFI axis is affected both by acute and chronic energy deficiency. Partial restoration of a component of the axis, i.e. activin B only, through leptin replacement is associated with improved reproductive function in women with HA. Copyright © 2018. Published by Elsevier Inc.
Social context and reproductive potential affect worker reproductive decisions in a eusocial insect.
Directory of Open Access Journals (Sweden)
Boris Yagound
Full Text Available Context-dependent decision-making conditions individual plasticity and is an integrant part of alternative reproductive strategies. In eusocial Hymenoptera (ants, bees and wasps, the discovery of worker reproductive parasitism recently challenged the view of workers as a homogeneous collective entity and stressed the need to consider them as autonomous units capable of elaborate choices which influence their fitness returns. The reproductive decisions of individual workers thus need to be investigated and taken into account to understand the regulation of reproduction in insect societies. However, we know virtually nothing about the proximate mechanisms at the basis of worker reproductive decisions. Here, we test the hypothesis that the capacity of workers to reproduce in foreign colonies lies in their ability to react differently according to the colonial context and whether this reaction is influenced by a particular internal state. Using the bumble bee Bombus terrestris, we show that workers exhibit an extremely high reproductive plasticity which is conditioned by the social context they experience. Fertile workers reintroduced into their mother colony reverted to sterility, as expected. On the contrary, a high level of ovary activity persisted in fertile workers introduced into a foreign nest, and this despite more frequent direct contacts with the queen and the brood than control workers. Foreign workers' reproductive decisions were not affected by the resident queen, their level of fertility being similar whether or not the queen was removed from the host colony. Workers' physiological state at the time of introduction is also of crucial importance, since infertile workers failed to develop a reproductive phenotype in a foreign nest. Therefore, both internal and environmental factors appear to condition individual reproductive strategies in this species, suggesting that more complex decision-making mechanisms are involved in the regulation
Updates in Reproduction Coming from the Endocannabinoid System
Bradshaw, Heather B.
2014-01-01
The endocannabinoid system (ECS) is an evolutionarily conserved master system deeply involved in the central and local control of reproductive functions in both sexes. The tone of these lipid mediators—deeply modulated by the activity of biosynthetic and hydrolyzing machineries—regulates reproductive functions from gonadotropin discharge and steroid biosynthesis to the formation of high quality gametes and successful pregnancy. This review provides an overview on ECS and reproduction and focuses on the insights in the regulation of endocannabinoid production by steroids, in the regulation of male reproductive activity, and in placentation and parturition. Taken all together, evidences emerge that the activity of the ECS is crucial for procreation and may represent a target for the therapeutic exploitation of infertility. PMID:24550985
Updates in Reproduction Coming from the Endocannabinoid System
Directory of Open Access Journals (Sweden)
Rosaria Meccariello
2014-01-01
Full Text Available The endocannabinoid system (ECS is an evolutionarily conserved master system deeply involved in the central and local control of reproductive functions in both sexes. The tone of these lipid mediators—deeply modulated by the activity of biosynthetic and hydrolyzing machineries—regulates reproductive functions from gonadotropin discharge and steroid biosynthesis to the formation of high quality gametes and successful pregnancy. This review provides an overview on ECS and reproduction and focuses on the insights in the regulation of endocannabinoid production by steroids, in the regulation of male reproductive activity, and in placentation and parturition. Taken all together, evidences emerge that the activity of the ECS is crucial for procreation and may represent a target for the therapeutic exploitation of infertility.
Serotonin Regulates the Feeding and Reproductive Behaviors of Pratylenchus penetrans.
Han, Ziduan; Boas, Stephanie; Schroeder, Nathan E
2017-07-01
The success of all plant-parasitic nematodes is dependent on the completion of several complex behaviors. The lesion nematode Pratylenchus penetrans is an economically important parasite of a diverse range of plant hosts. Unlike the cyst and root-knot nematodes, P. penetrans moves both within and outside of the host roots and can feed from both locations. Adult females of P. penetrans require insemination by actively moving males for reproduction and can lay eggs both within and outside of the host roots. We do not have a complete understanding of the molecular basis for these behaviors. One candidate modulator of these behaviors is the neurotransmitter serotonin. Previous research demonstrated an effect of exogenously applied serotonin on the feeding and male mating behaviors of cyst and root-knot nematodes. However, there are no data on the role of exogenous serotonin on lesion nematodes. Similarly, there are no data on the presence and function of endogenous serotonin in any plant-parasitic nematode. Here, we establish that exogenous serotonin applied to P. penetrans regulates both feeding and sex-specific behaviors. Furthermore, using immunohistochemistry and pharmacological assays, our data suggest that P. penetrans utilizes endogenous serotonin to regulate both feeding and sex-specific behaviors.
Melatonin and female reproduction.
Tamura, Hiroshi; Takasaki, Akihisa; Taketani, Toshiaki; Tanabe, Manabu; Lee, Lifa; Tamura, Isao; Maekawa, Ryo; Aasada, Hiromi; Yamagata, Yoshiaki; Sugino, Norihiro
2014-01-01
Melatonin (N-acetyl-5-methoxytryptamine) is secreted during the dark hours at night by the pineal gland. After entering the circulation, melatonin acts as an endocrine factor and a chemical messenger of light and darkness. It regulates a variety of important central and peripheral actions related to circadian rhythms and reproduction. It also affects the brain, immune, gastrointestinal, cardiovascular, renal, bone and endocrine functions and acts as an oncostatic and anti-aging molecule. Many of melatonin's actions are mediated through interactions with specific membrane-bound receptors expressed not only in the central nervous system, but also in peripheral tissues. Melatonin also acts through non-receptor-mediated mechanisms, for example serving as a scavenger for reactive oxygen species and reactive nitrogen species. At both physiological and pharmacological concentrations, melatonin attenuates and counteracts oxidative stress and regulates cellular metabolism. Growing scientific evidence of reproductive physiology supports the role of melatonin in human reproduction. This review was conducted to investigate the effects of melatonin on female reproduction and to summarize our findings in this field. © 2013 The Authors. Journal of Obstetrics and Gynaecology Research © 2013 Japan Society of Obstetrics and Gynecology.
Sun, Ju; Yang, Yun-Fei
2007-04-01
Puccinellia tenuiflora is a salt-tolerant plant of grass family. By the method of random sampling, big samples of reproductive tillers of P. tenuiflora population on the alkalized meadow in the Songnen Plains of China were collected at early heading, heading, flowering, and milky stages, respectively, and the plasticity of their quantitative characters was analyzed. The results showed that except some fluctuations at flowering stage, the tiller height, tiller biomass, spike length and spike biomass of the reproductive tillers at other three growth stages increased significantly every five days with the increasing time of reproductive growth. At each growth stage, tiller height had a significant positive correlation with spike biomass, but a negative correlation with reproductive allocation. With the time of reproductive growth prolonged, the increasing rate of spike biomass at early heading, flowering and milky stages increased in power function with the increase of tiller height. The reproductive allocation decreased linearly by 43.2% and 44.31% at early heading and heading stages, respectively when the reproductive growth time increased ten days, and by 130% at milky stage when the time increased five days. The regulation of the tiller phenotypic plasticity of P. tenuiflora population at its reproductive growth stage followed definite patterns.
The current state of research in the field of reproductive behavior of spouses’ regulation
Directory of Open Access Journals (Sweden)
Maria M. Danina
2016-06-01
Full Text Available The article provides an overview of the socio-demographic, socio-economic and psychological approaches to the study of reproductive behavior of spouses carried out over the last 30 years. Two categories of concepts that explain the determination of decisions on childbearing are regarded: rational-pragmatic and hedonistic. The trends in the development of this field of knowledge are as follows: 1 overcoming economical-oriented logic in explaining the factors and determinants of the decision making process; 2 individual psychological factors study in addition to the traditional socio-psychological analysis of the determination of childbirth; 3 the transition from studying the context of decisions about childbirth to the analysis of their role and place in the context of the person biography. The analysis of the concepts and empirical studies helps not only to reveal a massive shift of professional interest from economic and demographic factors to psychological ones, but also to have a better understanding of socio-cultural and psychological and value determined roots of that shift. Nowadays, in contrast to biological patterns and established traditions, a personal or family decision about bearing a child is becoming more and more conscious. Particular attention is paid to the concept of mental regulation of reproductive behavior that is developed at the intersection of psychology of reproductive behavior, psychology of parenthood and individual psychology. The supportive argument is that new objects of study are considered, such as voluntarily childless families, parents at risk, same-sex families.
48 CFR 2452.208-71 - Reproduction of reports.
2010-10-01
... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Reproduction of reports... 2452.208-71 Reproduction of reports. As prescribed in 2437.110(b), insert the following clause in... other written materials. Reproduction of Reports (APR 1984) In accordance with Title I of the Government...
Sex-specific inhibition and stimulation of worker-reproductive transition in a termite
Sun, Qian; Haynes, Kenneth F.; Hampton, Jordan D.; Zhou, Xuguo
2017-10-01
In social insects, the postembryonic development of individuals exhibits strong phenotypic plasticity in response to the environment, thus generating the caste system. Different from eusocial Hymenoptera, in which queens dominate reproduction and inhibit worker fertility, the primary reproductive caste in termites (kings and queens) can be replaced by neotenic reproductives derived from functionally sterile individuals. Feedback regulation of nestmate differentiation into reproductives has been suggested, but the sex specificity remains inconclusive. In the eastern subterranean termite, Reticulitermes flavipes, we tested the hypothesis that neotenic reproductives regulate worker-reproductive transition in a sex-specific manner. With this R. flavipes system, we demonstrate a sex-specific regulatory mechanism with both inhibitory and stimulatory functions. Neotenics inhibit workers of the same sex from differentiating into additional reproductives but stimulate workers of the opposite sex to undergo this transition. Furthermore, this process is not affected by the presence of soldiers. Our results highlight the reproductive plasticity of termites in response to social cues and provide insights into the regulation of reproductive division of labor in a hemimetabolous social insect.
Billingsley, Barbara; Caulfield, Timothy
2004-01-01
Non-Reproductive Human Cloning (NRHC) allows researchers to develop and clone cells, including non-reproductive cells, and to research the etiology and transmission of disease. The ability to clone specific stem cells may also allow researchers to clone cells with genetic defects and analyze those cells with more precisions. Despite those potential benefits, Parliament has banned such cloning due to a myriad of social and ethical concerns. In May 2002, the Canadian Government introduced Bill C-13 on assisted human reproductive technologies. Bill C-13 deals with both the scientific and the clinical use of human reproductive materials, and it prohibits a number of other activities, including NRHC. Although the Supreme Court of Canada has never ruled on whether scientific experiments area form of expression, academic support exists for this notion. The authors go through the legal analysis that would be required to find that scientific experiments are expression, focusing in part on whether NRHC could be considered violent and thus fall outside the protection of section 2(b). The latter question is complicated by the ongoing policy debate over whether an "embryonic cell" is property of human life. The authors then consider whether a ban on NRHC could be justified under section 1 of the Charter. They conclude that both the breadth of the legislative purpose and the proportionality of the measure are problematic. Proportionality is a specific concern because the ban could be viewed as an outright denial of scientific freedom of expression. Although consistent with current jurisprudence on freedom of expression, this paper runs against the flow of government policy in the areas of regulation and prohibition of non-reproductive human cloning. As there has been no Charter litigation to date on whether scientific research is a form of expression, the authors introduce a new way of looking at the legality of the regulation of new reproductive technologies.
15 CFR 762.5 - Reproduction of original records.
2010-01-01
... 15 Commerce and Foreign Trade 2 2010-01-01 2010-01-01 false Reproduction of original records. 762... RECORDKEEPING § 762.5 Reproduction of original records. (a) The regulated person may maintain reproductions instead of the original records provided all of the requirements of paragraph (b) of this section are met...
Effect of Shoes on Stiffness and Energy Efficiency of Ankle-Foot Orthosis: Bench Testing Analysis.
Kobayashi, Toshiki; Gao, Fan; LeCursi, Nicholas; Foreman, K Bo; Orendurff, Michael S
2017-12-01
Understanding the mechanical properties of ankle-foot orthoses (AFOs) is important to maximize their benefit for those with movement disorders during gait. Though mechanical properties such as stiffness and/or energy efficiency of AFOs have been extensively studied, it remains unknown how and to what extent shoes influence their properties. The aim of this study was to investigate the effect of shoes on stiffness and energy efficiency of an AFO using a custom mechanical testing device. Stiffness and energy efficiency of the AFO were measured in the plantar flexion and dorsiflexion range, respectively, under AFO-alone and AFO-Shoe combination conditions. The results of this study demonstrated that the stiffness of the AFO-Shoe combination was significantly decreased compared to the AFO-alone condition, but no significant differences were found in energy efficiency. From the results, we recommend that shoes used with AFOs should be carefully selected not only based on their effect on alignment of the lower limb, but also their effects on overall mechanical properties of the AFO-Shoe combination. Further study is needed to clarify the effects of differences in shoe designs on AFO-Shoe combination mechanical properties.
Chen, Chih-Chi; Hong, Wei-Hsien; Wang, Chin-Man; Chen, Chih-Kuang; Wu, Katie Pei-Hsuan; Kang, Chao-Fu; Tang, Simon F
2010-12-01
To evaluate the kinematic features of rear-foot motion during gait in hemiplegic stroke patients, using anterior ankle-foot orthoses (AFOs), posterior AFOs, and no orthotic assistance. Crossover design with randomization for the interventions. A rehabilitation center for adults with neurologic disorders. Patients with hemiplegia due to stroke (n=14) and able-bodied subjects (n=11). Subjects with hemiplegia were measured walking under 3 conditions with randomized sequences: (1) with an anterior AFO, (2) with a posterior AFO, and (3) without an AFO. Control subjects were measured walking without an AFO to provide a normative reference. Rear-foot kinematic change in the sagittal, coronal, and transverse planes. In the sagittal plane, compared with walking with an anterior AFO or without an AFO, the posterior AFO significantly decreased plantar flexion to neutral at initial heel contact (P=.001) and the swing phase (PRehabilitation Medicine. Published by Elsevier Inc. All rights reserved.
Ankle-Foot Orthosis Made by 3D Printing Technique and Automated Design Software
Directory of Open Access Journals (Sweden)
Yong Ho Cha
2017-01-01
Full Text Available We described 3D printing technique and automated design software and clinical results after the application of this AFO to a patient with a foot drop. After acquiring a 3D modelling file of a patient’s lower leg with peroneal neuropathy by a 3D scanner, we loaded this file on the automated orthosis software and created the “STL” file. The designed AFO was printed using a fused filament fabrication type 3D printer, and a mechanical stress test was performed. The patient alternated between the 3D-printed and conventional AFOs for 2 months. There was no crack or damage, and the shape and stiffness of the AFO did not change after the durability test. The gait speed increased after wearing the conventional AFO (56.5 cm/sec and 3D-printed AFO (56.5 cm/sec compared to that without an AFO (42.2 cm/sec. The patient was more satisfied with the 3D-printed AFO than the conventional AFO in terms of the weight and ease of use. The 3D-printed AFO exhibited similar functionality as the conventional AFO and considerably satisfied the patient in terms of the weight and ease of use. We suggest the possibility of the individualized AFO with 3D printing techniques and automated design software.
Reproduction Symposium: developmental programming of reproductive and metabolic health.
Padmanabhan, V; Veiga-Lopez, A
2014-08-01
Inappropriate programming of the reproductive system by developmental exposure to excess steroid hormones is of concern. Sheep are well suited for investigating developmental origin of reproductive and metabolic disorders. The developmental time line of female sheep (approximately 5 mo gestation and approximately 7 mo to puberty) is ideal for conducting sequential studies of the progression of metabolic and/or reproductive disruption from the developmental insult to manifestation of adult consequences. Major benefits of using sheep include knowledge of established critical periods to target adult defects, a rich understanding of reproductive neuroendocrine regulation, availability of noninvasive approaches to monitor follicular dynamics, established surgical approaches to obtain hypophyseal portal blood for measurement of hypothalamic hormones, and the ability to perform studies in natural setting thereby keeping behavioral interactions intact. Of importance is the ability to chronically instrument fetus and mother for determining early endocrine perturbations. Prenatal exposure of the female to excess testosterone (T) leads to an array of adult reproductive disorders that include LH excess, functional hyperandrogenism, neuroendocrine defects, multifollicular ovarian morphology, and corpus luteum dysfunction culminating in early reproductive failure. At the neuroendocrine level, all 3 feedback systems are compromised. At the pituitary level, gonadotrope (LH secretion) sensitivity to GnRH is increased. Multifollicular ovarian morphology stems from persistence of follicles as well as enhanced follicular recruitment. These defects culminate in progressive loss of cyclicity and reduced fecundity. Prenatal T excess also leads to fetal growth retardation, an early marker of adult reproductive and metabolic diseases, insulin resistance, hypertension, and behavioral deficits. Collectively, the reproductive and metabolic deficits of prenatal T-treated sheep provide proof of
Central Pathways Integrating Metabolism and Reproduction in Teleosts
Shahjahan, Md.; Kitahashi, Takashi; Parhar, Ishwar S.
2014-01-01
Energy balance plays an important role in the control of reproduction. However, the cellular and molecular mechanisms connecting the two systems are not well understood especially in teleosts. The hypothalamus plays a crucial role in the regulation of both energy balance and reproduction, and contains a number of neuropeptides, including gonadotropin-releasing hormone (GnRH), orexin, neuropeptide-Y, ghrelin, pituitary adenylate cyclase-activating polypeptide, α-melanocyte stimulating hormone, melanin-concentrating hormone, cholecystokinin, 26RFamide, nesfatin, kisspeptin, and gonadotropin-inhibitory hormone. These neuropeptides are involved in the control of energy balance and reproduction either directly or indirectly. On the other hand, synthesis and release of these hypothalamic neuropeptides are regulated by metabolic signals from the gut and the adipose tissue. Furthermore, neurons producing these neuropeptides interact with each other, providing neuronal basis of the link between energy balance and reproduction. This review summarizes the advances made in our understanding of the physiological roles of the hypothalamic neuropeptides in energy balance and reproduction in teleosts, and discusses how they interact with GnRH, kisspeptin, and pituitary gonadotropins to control reproduction in teleosts. PMID:24723910
Resource allocation to reproduction in animals.
Kooijman, Sebastiaan A L M; Lika, Konstadia
2014-11-01
The standard Dynamic Energy Budget (DEB) model assumes that a fraction κ of mobilised reserve is allocated to somatic maintenance plus growth, while the rest is allocated to maturity maintenance plus maturation (in embryos and juveniles) or reproduction (in adults). All DEB parameters have been estimated for 276 animal species from most large phyla and all chordate classes. The goodness of fit is generally excellent. We compared the estimated values of κ with those that would maximise reproduction in fully grown adults with abundant food. Only 13% of these species show a reproduction rate close to the maximum possible (assuming that κ can be controlled), another 4% have κ lower than the optimal value, and 83% have κ higher than the optimal value. Strong empirical support hence exists for the conclusion that reproduction is generally not maximised. We also compared the parameters of the wild chicken with those of races selected for meat and egg production and found that the latter indeed maximise reproduction in terms of κ, while surface-specific assimilation was not affected by selection. We suggest that small values of κ relate to the down-regulation of maximum body size, and large values to the down-regulation of reproduction. We briefly discuss the ecological context for these findings. © 2014 The Authors. Biological Reviews © 2014 Cambridge Philosophical Society.
Activins in reproductive biology and beyond.
Wijayarathna, R; de Kretser, D M
2016-04-01
Activins are members of the pleiotrophic family of the transforming growth factor-beta (TGF-β) superfamily of cytokines, initially isolated for their capacity to induce the release of FSH from pituitary extracts. Subsequent research has demonstrated that activins are involved in multiple biological functions including the control of inflammation, fibrosis, developmental biology and tumourigenesis. This review summarizes the current knowledge on the roles of activin in reproductive and developmental biology. It also discusses interesting advances in the field of modulating the bioactivity of activins as a therapeutic target, which would undoubtedly be beneficial for patients with reproductive pathology. A comprehensive literature search was carried out using PUBMED and Google Scholar databases to identify studies in the English language which have contributed to the advancement of the field of activin biology, since its initial isolation in 1987 until July 2015. 'Activin', 'testis', 'ovary', 'embryonic development' and 'therapeutic targets' were used as the keywords in combination with other search phrases relevant to the topic of activin biology. Activins, which are dimers of inhibin β subunits, act via a classical TGF-β signalling pathway. The bioactivity of activin is regulated by two endogenous inhibitors, inhibin and follistatin. Activin is a major regulator of testicular and ovarian development. In the ovary, activin A promotes oocyte maturation and regulates granulosa cell steroidogenesis. It is also essential in endometrial repair following menstruation, decidualization and maintaining pregnancy. Dysregulation of the activin-follistatin-inhibin system leads to disorders of female reproduction and pregnancy, including polycystic ovary syndrome, ectopic pregnancy, miscarriage, fetal growth restriction, gestational diabetes, pre-eclampsia and pre-term birth. Moreover, a rise in serum activin A, accompanied by elevated FSH, is characteristic of female
Directory of Open Access Journals (Sweden)
Michael Rosenberg
Full Text Available Passive ankle foot orthoses (AFOs are often prescribed for children with cerebral palsy (CP to assist locomotion, but predicting how specific device designs will impact energetic demand during gait remains challenging. Powered AFOs have been shown to reduce energy costs of walking in unimpaired adults more than passive AFOs, but have not been tested in children with CP. The goal of this study was to investigate the potential impact of powered and passive AFOs on muscle demand and recruitment in children with CP and crouch gait. We simulated gait for nine children with crouch gait and three typically-developing children with powered and passive AFOs. For each AFO design, we computed reductions in muscle demand compared to unassisted gait. Powered AFOs reduced muscle demand 15-44% compared to unassisted walking, 1-14% more than passive AFOs. A slower walking speed was associated with smaller reductions in absolute muscle demand for all AFOs (r2 = 0.60-0.70. However, reductions in muscle demand were only moderately correlated with crouch severity (r2 = 0.40-0.43. The ankle plantarflexor muscles were most heavily impacted by the AFOs, with gastrocnemius recruitment decreasing 13-73% and correlating with increasing knee flexor moments (r2 = 0.29-0.91. These findings support the potential use of powered AFOs for children with crouch gait, and highlight how subject-specific kinematics and kinetics may influence muscle demand and recruitment to inform AFO design.
A role for glucocorticoids in stress-impaired reproduction: beyond the hypothalamus and pituitary.
Whirledge, Shannon; Cidlowski, John A
2013-12-01
In addition to the well-characterized role of the sex steroid receptors in regulating fertility and reproduction, reproductive events are also mediated by the hypothalamic-pituitary-adrenal axis in response to an individual's environment. Glucocorticoid secretion in response to stress contributes to the well-characterized suppression of the hypothalamic-pituitary-gonadal axis through central actions in the hypothalamus and pituitary. However, both animal and in vitro studies indicate that other components of the reproductive system are also regulated by glucocorticoids. Furthermore, in the absence of stress, it appears that homeostatic glucocorticoid signaling plays a significant role in reproduction and fertility in all tissues comprising the hypothalamic-pituitary-gonadal axis. Indeed, as central regulators of the immune response, glucocorticoids are uniquely poised to integrate an individual's infectious, inflammatory, stress, nutritional, and metabolic status through glucocorticoid receptor signaling in target tissues. Endocrine signaling between tissues regulating the immune and stress response and those determining reproductive status provides an evolutionary advantage, facilitating the trade-off between reproductive investment and offspring fitness. This review focuses on the actions of glucocorticoids in tissues important for fertility and reproduction, highlighting recent studies that show glucocorticoid signaling plays a significant role throughout the hypothalamic-pituitary-gonadal axis and characterizing these effects as permissive or inhibitory in terms of facilitating reproductive success.
Xiao, Wei-Yang; Li, Ying-Wen; Chen, Qi-Liang; Liu, Zhi-Hao
2018-07-01
Tributyltin (TBT), an organotin acting as aromatase (Cyp19a1) inhibitor, has been found to disrupt gametogenesis and reproductive behaviors in several fish species. However, few studies addressing the mechanisms underlying the impaired gametogenesis and reproduction have been reported. In this study, female adults of zebrafish (Danio rerio) were continuously exposed to two nominal concentrations of TBT (100 and 500 ng/L, actual concentrations: 90.8 ± 1.3 ng/L and 470.3 ± 2.7 ng/L, respectively) for 28 days. After exposures, TBT decreased the total egg number, reduced the hatchability and elevated the mortality of the larvae. Decreased gonadosomatic index (GSI) and altered percentages of follicles in different developmental stages (increased early-stage follicles and reduced mid/late-stage follicles) were also observed in the ovary of TBT-treated fish. TBT also lowered the plasma level of 17β-estradiol and suppressed the expressions of cyp19a1a in the ovary. In treated fish, up-regulated expressions of aldhla2, sycp3 and dmc1 were present in the ovary, indicating an enhanced level of meiosis. The mRNA level of vtg1 was dramatically suppressed in the liver of TBT-treated fish, suggesting an insufficient synthesis of Vtg protein, consistent with the decreased percentage of mid/late-stage follicles in the ovaries. Moreover, TBT significantly suppressed the reproductive behaviors of the female fish (duration of both sexes simultaneously in spawning area, the frequency of meeting and the visit in spawning area) and down-regulated the mRNA levels of genes involved in the regulation of reproductive behaviors (cyp19a1b, gnrh-3 and kiss 2) in the brain. In addition, TBT significantly suppressed the expressions of serotonin-related genes, such as tph2 (encoding serotonin synthase), pet1 (marker of serotonin neuron) and kiss 1 (the modulator of serotonin synthesis), suggesting that TBT might disrupt the non-reproductive behaviors of zebrafish. The present
Male reproductive health and yoga
Directory of Open Access Journals (Sweden)
Pallav Sengupta
2013-01-01
Full Text Available Now-a-days reproductive health problems along with infertility in male is very often observed. Various Assisted Reproductive Technologies have been introduced to solve the problem, but common people cannot afford the cost of such procedures. Various ayurvedic and other alternative medicines, along with regular yoga practice are proven to be not only effective to enhance the reproductive health in men to produce a successful pregnancy, but also to regulate sexual desire in men who practice celibacy. Yoga is reported to reduce stress and anxiety, improve autonomic functions by triggering neurohormonal mechanisms by the suppression of sympathetic activity, and even, today, several reports suggested regular yoga practice from childhood is beneficial for reproductive health. In this regard the present review is aimed to provide all the necessary information regarding the effectiveness of yoga practice to have a better reproductive health and to prevent infertility.
Aromatase in the brain: not just for reproduction anymore.
Garcia-Segura, L M
2008-06-01
Aromatase, the enzyme that synthesises oestrogens from androgen precursors, is expressed in the brain, where it has been classically associated with the regulation of neuroendocrine events and behaviours linked with reproduction. Recent findings, however, have revealed new unexpected roles for brain aromatase, indicating that the enzyme regulates synaptic activity, synaptic plasticity, neurogenesis and the response of neural tissue to injury, and may contribute to control nonreproductive behaviours, mood and cognition. Therefore, the function of brain aromatase is not restricted to the regulation of reproduction as previously thought.
Induction of Gonadotropins for Reproductive Control
Directory of Open Access Journals (Sweden)
Elza Ibrahim Auerkari
2015-10-01
Full Text Available Much of the recent research on gonadotropin – related control processes of reproduction and reproductive maturation has concentrated on the neuronal and molecular biology of gonadotropin release. The reproductive development of healthy mammals requires appropriate fetal develompment and migration of the neural network controlling and including the gonadotropin releasing hormone (GnRH – producing neurons that are needed to regulate GnRH and luteinizing hormone (LH release. GnRH is also necessary for the development of the gonadotropin – producing pituitary gland. The fetal gonads respon to GnRH – induced LH production by producing the gonadal steroids required for further reproductive differentiation. Pubertal maturation is characterised by increases in LH levels, representing the corresponding pulsatile release of GnRH. This GnRH pulse generator appears to be an intrinsic property of the arcuate nucleus at the medial basal hypothalamus. The generator activity can be mediated by the neurotransmitter aspartate which activates neurons of the hypothalamus, inducing acuate releases of GnRH and hence initiates puberty. A major factor in human reproductive maturation is the decrease in the age of puberty, caused by improvement of nutritional conditions due to the socio – economic development. This implies that the pubertal activation of GnRH secretion depends on metabolic conditions. Of the substances that mediate the metabolic condition to the neuronal network regulating GnRH secretion, the role of the neuropeptide Y (NPY appears instrumental : for healthy mammals less food means more NPY, and accumulated NPY makes food to become sex. NPY does this by regulating the appropriate hypothalamic functions including the neuroendocrine control of gonadotropin release.
Spring-like Ankle Foot Orthoses reduce the energy cost of walking by taking over ankle work.
Bregman, D J J; Harlaar, J; Meskers, C G M; de Groot, V
2012-01-01
In patients with central neurological disorders, gait is often limited by a reduced ability to push off with the ankle. To overcome this reduced ankle push-off, energy-storing, spring-like carbon-composite Ankle Foot Orthoses (AFO) can be prescribed. It is expected that the energy returned by the AFO in late stance will support ankle push-off, and reduce the energy cost of walking. In 10 patients with multiple sclerosis and stroke the energy cost of walking, 3D kinematics, joint power, and joint work were measured during gait, with and without the AFO. The mechanical characteristics of the AFO were measured separately, and used to calculate the contribution of the AFO to the ankle kinetics. We found a significant decrease of 9.8% in energy cost of walking when walking with the AFO. With the AFO, the range of motion of the ankle was reduced by 12.3°, and the net work around the ankle was reduced by 29%. The total net work in the affected leg remained unchanged. The AFO accounted for 60% of the positive ankle work, which reduced the total amount of work performed by the leg by 11.1% when walking with the AFO. The decrease in energy cost when walking with a spring-like energy-storing AFO in central neurological patients is not induced by an augmented net ankle push-off, but by the AFO partially taking over ankle work. Copyright © 2011 Elsevier B.V. All rights reserved.
Neuman-Lee, Lorin; Greives, Timothy; Hopkins, Gareth R; French, Susannah S
2017-03-01
The neuropeptide kisspeptin and its receptor are essential for activation of the hypothalamic-pituitary-gonadal (HPG) axis and regulating reproduction. While the role of kisspeptin in regulating the HPG axis in mammals has been well established, little is known about the functional ability of kisspeptins to activate the HPG axis and associated behavior in non-mammalian species. Here we experimentally examined the effects of kisspeptin on downstream release of testosterone and associated aggression and display behaviors in the side-blotched lizard (Uta stansburiana). We found that exogenous treatment with kisspeptin resulted in an increase in circulating testosterone levels, castration blocked the kisspeptin-induced increase in testosterone, and testosterone levels in kisspeptin-treated animals were positively related to frequency of aggressive behaviors. This evidence provides a clear link between kisspeptin, testosterone, and aggressive behavior in lizards. Thus, it is likely that kisspeptin plays an important role more broadly in non-mammalian systems in the regulation of reproductive physiology and related behaviors. Copyright © 2016 Elsevier Inc. All rights reserved.
Chronobiology of reproduction in garter snakes: neuroendocrine mechanisms and geographic variation.
Lutterschmidt, Deborah I
2012-05-01
The majority of studies on reproductive neuroendocrinology in snakes have focused on one particular snake population in Manitoba, Canada, the red-sided garter snake (Thamnophis sirtalis parietalis). Although traditionally these studies have emphasized its unusual temporal dissociation between mating behavior and peak gonadal activity, current evidence suggests that reproductive regulation in this population may be more similar to the norm than previously thought. Like other ectotherms, temperature plays a critical role in activating reproductive behavior in red-sided garter snakes. Diel melatonin and corticosterone rhythms appear to be important in transducing temperature cues, and it is clear that both hormones regulate courtship behavior during spring. Current evidence also suggests that sex steroid hormones are in fact central to reproductive regulation in males, although the timing of their action occurs during winter dormancy. Whether this is also true for female T. sirtalis parietalis requires further study, but it should be noted that patterns of sex steroid hormones are sexually dimorphic during winter dormancy, as are melatonin rhythms during spring emergence. While continuing to advance our understanding of reproductive regulation in this extremely well-studied population is prudent, future comparative studies are critical for understanding if and how reproductive regulatory mechanisms differ across environments, populations, and phylogenies. For example, melatonin and corticosterone responses to environmental cues vary significantly among populations of T. sirtalis in a common garden, as do male courtship behavior and androgen concentrations. These data support the hypothesis that neuroendocrine-mediated responses to environmental cues underlie phenotypic plasticity in reproductive life history traits. Copyright © 2011 Elsevier Inc. All rights reserved.
Legal aspects of auxillary reproductive technologies in infertility treatment
V.Yu. Albitskiy; N.D. Odinayeva; V.O. Mansimova
2011-01-01
The article presents several aspects of legal regulation of auxillary reproductive technologies in treatment of infertility in Russia and other countries.Key words: auxillary reproductive technologies, method of extracorporeal fertilization, newborn, premature newborn, multiple pregnancy, embryo, infertility, law.
Role of neuropeptide Y (NPY) in the regulation of reproduction: study based on catfish model.
Subhedar, Nishikant; Gaikwad, Archana; Biju, K C; Saha, Subhash
2005-04-01
Significance of NPY in the regulation of GnRH-LH axis was evaluated. Considerable NPY immunoreactivity was seen in the components like olfactory system, basal telencephalon, preoptic and tuberal areas, and the pituitary gland that serve as neuroanatomical substrates for processing reproductive information. Close anatomical association as well as colocalizations of NPY and GnRH were seen in the olfactory receptor neurons, olfactory nerve fibers and their terminals in the glomeruli, ganglion cells of nervus terminalis, medial olfactory tracts, fibers in the ventral telencephalon and pituitary. In the pituitary, NPY fibers seem to innervate the GnRH as well as LH cells. Intracranial administration of NPY resulted in significant increase in the GnRH immunoreactivity in all the components of the olfactory system. In the pituitary, NPY augmented the population of GnRH fibers and LH cells. HPLC analysis showed that salmon GnRH content in the olfactory organ, bulb, preoptic area+telencephalon and pituitary was also significantly increased following NPY treatment. NPY may play a role in positive regulation of GnRH throughout the neuraxis and also up-regulate the LH cells in the pituitary.
Banks, Ruth; Delibegovic, Mirela; Stevenson, Tyler J
2016-06-01
Seasonal trade-offs in reproduction and immunity are ubiquitous in nature. The mechanisms that govern transitions across seasonal physiological states appear to involve reciprocal switches in the local synthesis of thyroid hormone. In long-day (LD) summer-like conditions, increased hypothalamic triiodothyronine (T3) stimulates gonadal development. Alternatively, short-day (SD) winter-like conditions increase peripheral leukocytes and enhance multiple aspects of immune function. These data indicate that the localized effects of T3 in the hypothalamus and leukocytes are photoperiod dependent. We tested the hypothesis that increased peripheral T3 in SD conditions would increase aspects of reproductive physiology and inhibit immune function, whereas T3 injections in LD conditions would facilitate aspects of immune function (i.e., leukocytes). In addition, we also examined whether T3 regulates hypothalamic neuropeptide expression as well as hypothalamic and splenic proinflammatory cytokine expression. Adult male Siberian hamsters were maintained in LD (15L:9D) or transferred to SD (9L:15D) for 8 weeks. A subset of LD and SD hamsters was treated daily with 5 µg T3 for 2 weeks. LD and SD controls were injected with saline. Daily T3 administration in SD hamsters (SD+T3) resulted in a rapid and substantial decrease in peripheral leukocyte concentrations and stimulated gonadal development. T3 treatment in LD (LD+T3) had no effect on testicular volumes but significantly increased leukocyte concentrations. Molecular analyses revealed that T3 stimulated interleukin 1β messenger RNA (mRNA) expression in the spleen and inhibited RFamide Related Peptide-3 mRNA expression in the hypothalamus. Moreover, there was a photoperiod-dependent decrease in splenic tumor necrosis factor-α mRNA expression. These findings reveal that T3 has tissue-specific and photoperiod-dependent regulation of seasonal rhythms in reproduction and immune function. © 2016 The Author(s).
Rasmussen, Colin
2004-01-01
After more than a decade of study, discussion and debate, the Canadian House of Commons and Senate have approved the Assisted Human Reproduction Act. Building on the earlier Bill C-47, which died on the order paper in 1997, the Act bans human cloning for reproductive or therapeutic purposes, payment for surrogacy arrangements, and trading in human reproductive materials or their use without informed consent. In addition, the Act significantly restricts research using human reproductive materials. This article compares the Act to legislative regimes in other nations with advanced human reproductive science. It concludes that while the Act has many laudable goals, it is flawed in that it tries to cover too much legislative ground. As a result it unreasonable impairs the ability of Canadian scientists to compete in areas such as stem cell research, and area that is expected to yield significant new approaches to treating human disease.
Broad support for regulating the clinical implementation of future reproductive techniques.
Hendriks, S; Vliegenthart, R; Repping, S; Dancet, E A F
2018-01-01
the disposal of human embryos. Regulation for out-of-pocket costs and the burden of treatment received little support. The majority of gynaecologists and the general public, but not the patients, requested regulation for the risk of minor congenital abnormalities, the success rates and the naturalness of treatments. Nevertheless, the majority of patients did consider the former two potential negative consequences important. The majority of all groups preferred a national bioethics committee as the regulatory body. This committee should consult with advisors from various backgrounds and should consider the broader context of potential consequences of the stem cell-based fertility treatments. This empirical study focuses on only three stakeholder groups. This study reports on the perspective of the majority and this is not per definition the morally right perspective. The transferability of our findings to other cultures and other techniques remains unclear. A national bioethics committee, consulting with advisors from various backgrounds, should regulate the clinical implementation of future stem cell-based fertility treatments. Whether this broad support for regulation applies to novel techniques from other fields of medicine should be examined. The Young Academy of the Royal Netherlands Academy of Arts and Sciences. None of the authors has any conflict of interest to declare. Not applicable. © The Author 2017. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com
Legal aspects of auxillary reproductive technologies in infertility treatment
Directory of Open Access Journals (Sweden)
V.Yu. Albitskiy
2011-01-01
Full Text Available The article presents several aspects of legal regulation of auxillary reproductive technologies in treatment of infertility in Russia and other countries.Key words: auxillary reproductive technologies, method of extracorporeal fertilization, newborn, premature newborn, multiple pregnancy, embryo, infertility, law.
REPRODUCTIVE SEASONALITY OF SHEEP IN MEXICO
Directory of Open Access Journals (Sweden)
Jaime Arroyo
2011-07-01
Full Text Available In order to discuss and analyze the available information concerning the seasonal breeding behavior of sheep in Mexico, this review was conducted. We analyzed the neuroendocrine basis that modulate the annual reproductive cycle in sheep and then discussed the degree of reproductive seasonality in Creole sheep wool, breeds originating in high latitudes and hair sheep, mainly in Pelibuey ewes. The Creole sheep wool show continuous annual reproductive activity and short seasonal anestrous. The females of northern origin, express seasonal reproductive activity, similar to that observed in individuals geographically located at latitudes above 35º. Pelibuey sheep show variable annual reproductive behavior with reduced anestrus or lack thereof.  It is suggested that the neuroendocrine mechanisms regulating seasonal anestrus in ewes, are active in the sheep of northern origin that live in Mexico, in a manner contrary is not activated in Creole and hair sheep.
Harlaar, Jaap; Brehm, Merel; Becher, Jules G; Bregman, Daan J J; Buurke, Jaap; Holtkamp, Fred; De Groot, Vincent; Nollet, Frans
2010-09-01
Ankle Foot Orthoses (AFOs) to promote walking ability are a common treatment in patients with neurological or muscular diseases. However, guidelines on the prescription of AFOs are currently based on a low level of evidence regarding their efficacy. Recent studies aiming to demonstrate the efficacy of wearing an AFO in respect to walking ability are not always conclusive. In this paper it is argued to recognize two levels of evidence related to the ICF levels. Activity level evidence expresses the gain in walking ability for the patient, while mechanical evidence expresses the correct functioning of the AFO. Used in combination for the purpose of evaluating the efficacy of orthotic treatment, a conjunct improvement at both levels reinforces the treatment algorithm that is used. Conversely, conflicting outcomes will challenge current treatment algorithms and the supposed working mechanism of the AFO. A treatment algorithm must use relevant information as an input, derived from measurements with a high precision. Its result will be a specific AFO that matches the patient's needs, specified by the mechanical characterization of the AFO footwear combination. It is concluded that research on the efficacy of AFOs should use parameters from two levels of evidence, to prove the efficacy of a treatment algorithm, i.e., how to prescribe a well-matched AFO.
Ramsey, Jason Allan
2011-03-01
A non-articulated plantarflexion resist ankle foot orthosis (AFO), commonly known as a posterior leaf spring AFO, is indicated for patients with motor impairment to the dorsiflexors. The AFO is often custom molded to a patient's lower limb anatomy and fabricated from polypropylene. There are no established guidelines for fabricating this type of AFO with predetermined stiffness of the ankle region for normal walking speeds. Therefore an AFO may not meet the biomechanical needs of the patient. Quantify the biomechanical ankle stiffness requirement for an individual with complete dorsiflexor impairment and develop a method for fabricating an AFO with ankle stiffness to meet that requirement. Experimental, bench research. The literature on sagittal biomechanics of non-pathological adults was reviewed to derive the stiffness of the ankle during loading response. Computer models of 144 AFOs were created with geometric variations to account for differences in human anthropometrics. Computer-based finite element analysis was employed to determine the stiffness and safety factor of the models. Stiffness of the AFOs ranged from 0.04 to 1.8 Nm/deg. This ample range is expected to account for the stiffness required for most adults with complete dorsiflexor impairment. At 5° deflection the factor of safety (ratio of strength to stress) ranged from 2.8 to 9.1. A computer program was generated that computes AFO stiffness from user-input variables of AFO geometry. The stiffness is compared to a theoretically appropriate stiffness based on the patient mass. The geometric variables can be modified until there is a close match, resulting in AFO design specification that is appropriate for the patient. Through validation on human subjects, this method may benefit patient outcomes in clinical practice by avoiding the current uncertainty surrounding AFO performance and reducing the labor and time involved in rectifying a custom AFO post-fabrication. This method provides an avenue for
Paullada-Salmerón, José A; Cowan, Mairi; Aliaga-Guerrero, María; Morano, Francesca; Zanuy, Silvia; Muñoz-Cueto, José A
2016-06-01
Gonadotropin-inhibitory hormone (GnIH) inhibits gonadotropin synthesis and release from the pituitary of birds and mammals. However, the physiological role of orthologous GnIH peptides on the reproductive axis of fish is still uncertain, and their actions on the main neuroendocrine systems controlling reproduction (i.e., GnRHs, kisspeptins) have received little attention. In a recent study performed in the European sea bass, we cloned a cDNA encoding a precursor polypeptide that contained C-terminal MPMRFamide (sbGnIH-1) and MPQRFamide (sbGnIH-2) peptide sequences, developed a specific antiserum against sbGnIH-2, and characterized its central and pituitary GnIH projections in this species. In this study, we analyzed the effects of intracerebroventricular injection of sbGnIH-1 and sbGnIH-2 on brain and pituitary expression of reproductive hormone genes (gnrh1, gnrh2, gnrh3, kiss1, kiss2, gnih, lhbeta, fshbeta), and their receptors (gnrhr II-1a, gnrhr II-2b, kiss1r, kiss2r, and gnihr) as well as on plasma Fsh and Lh levels. In addition, we determined the effects of GnIH on pituitary somatotropin (Gh) expression. The results obtained revealed the inhibitory role of sbGnIH-2 on brain gnrh2, kiss1, kiss2, kiss1r, gnih, and gnihr transcripts and on pituitary fshbeta, lhbeta, gh, and gnrhr-II-1a expression, whereas sbGnIH-1 only down-regulated brain gnrh1 expression. However, at different doses, central administration of both sbGnIH-1 and sbGnIH-2 decreased Lh plasma levels. Our work represents the first study reporting the effects of centrally administered GnIH in fish and provides evidence of the differential actions of sbGnIH-1 and sbGnIH-2 on the reproductive axis of sea bass, the main inhibitory role being exerted by the sbGnIH-2 peptide. © 2016 by the Society for the Study of Reproduction, Inc.
19 CFR 122.5 - Reproduction of Customs forms.
2010-04-01
... 19 Customs Duties 1 2010-04-01 2010-04-01 false Reproduction of Customs forms. 122.5 Section 122.5 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY AIR COMMERCE REGULATIONS General Definitions and Provisions § 122.5 Reproduction of Customs forms...
Comparative analysis reveals the underlying mechanism of vertebrate seasonal reproduction.
Ikegami, Keisuke; Yoshimura, Takashi
2016-02-01
Animals utilize photoperiodic changes as a calendar to regulate seasonal reproduction. Birds have highly sophisticated photoperiodic mechanisms and functional genomics analysis in quail uncovered the signal transduction pathway regulating avian seasonal reproduction. Birds detect light with deep brain photoreceptors. Long day (LD) stimulus induces secretion of thyroid-stimulating hormone (TSH) from the pars tuberalis (PT) of the pituitary gland. PT-derived TSH locally activates thyroid hormone (TH) in the hypothalamus, which induces gonadotropin-releasing hormone (GnRH) and hence gonadotropin secretion. However, during winter, low temperatures increase serum TH for adaptive thermogenesis, which accelerates germ cell apoptosis by activating the genes involved in metamorphosis. Therefore, TH has a dual role in the regulation of seasonal reproduction. Studies using TSH receptor knockout mice confirmed the involvement of PT-derived TSH in mammalian seasonal reproduction. In addition, studies in mice revealed that the tissue-specific glycosylation of TSH diversifies its function in the circulation to avoid crosstalk. In contrast to birds and mammals, one of the molecular machineries necessary for the seasonal reproduction of fish are localized in the saccus vasculosus from the photoreceptor to the neuroendocrine output. Thus, comparative analysis is a powerful tool to uncover the universality and diversity of fundamental properties in various organisms. Copyright © 2015 Elsevier Inc. All rights reserved.
Learning from Cross-Border Reproduction
Millbank, Jenni; Karpin, Isabel; Stuhmcke, Anita
2017-01-01
Abstract Drawing upon the preliminary findings of an Australian empirical project on cross-border reproduction (CBR), this article argues that regulators and policymakers could learn from the experiences of those who travel overseas in order to access fertility treatment and surrogacy. It makes four principal observations. First, the distinction between so-called ‘altruistic’ and ‘commercial’ gamete donation and surrogacy is increasingly unsustainable and is not experienced as meaningful by many participants in CBR. Secondly, the status of the law in CBR is profoundly equivocal; for participants it is often there and not there at the same time. Thirdly, self-sourced information, from the internet and more specifically social media such as Facebook, is now the principal source of information and peer support for reproductive travellers. Fourthly, and relatedly, domestic reproductive services providers are often sidestepped. If one of the goals of regulation is to minimise the risk of harm to participants, it is not clear that it is currently achieving this aim, and this article argues that any reforms will only work if they are more responsive to the reality of CBR. PMID:28073821
Learning from Cross-Border Reproduction.
Jackson, Emily; Millbank, Jenni; Karpin, Isabel; Stuhmcke, Anita
2017-02-01
Drawing upon the preliminary findings of an Australian empirical project on cross-border reproduction (CBR), this article argues that regulators and policymakers could learn from the experiences of those who travel overseas in order to access fertility treatment and surrogacy. It makes four principal observations. First, the distinction between so-called 'altruistic' and 'commercial' gamete donation and surrogacy is increasingly unsustainable and is not experienced as meaningful by many participants in CBR. Secondly, the status of the law in CBR is profoundly equivocal; for participants it is often there and not there at the same time. Thirdly, self-sourced information, from the internet and more specifically social media such as Facebook, is now the principal source of information and peer support for reproductive travellers. Fourthly, and relatedly, domestic reproductive services providers are often sidestepped. If one of the goals of regulation is to minimise the risk of harm to participants, it is not clear that it is currently achieving this aim, and this article argues that any reforms will only work if they are more responsive to the reality of CBR. © The Author 2017. Published by Oxford University Press.
Integrative Control of Energy Balance and Reproduction in Females
Garcia-Garcia, R. M.
2012-01-01
There is a strong association between nutrition and reproduction. Chronic dietary energy deficits as well as energy surpluses can impair reproductive capacity. Metabolic status impacts reproductive function at systemic level, modulating the hypothalamic GnRH neuronal network and/or the pituitary gonadotropin secretion through several hormones and neuropeptides, and at the ovarian level, acting through the regulation of follicle growth and steroidogenesis by means of the growth hormone-IGF-ins...
Kerkum, Yvette L; Brehm, Merel-Anne; Buizer, Annemieke I; van den Noort, Josien C; Becher, Jules G; Harlaar, Jaap
2014-12-01
A rigid ventral shelf ankle foot orthosis (AFO) may improve gait in children with spastic cerebral palsy (SCP) whose gait is characterized by excessive knee flexion in stance. However, these AFOs can also impede ankle range of motion (ROM) and thereby inhibit push-off power. A more spring-like AFO can enhance push-off and may potentially reduce walking energy cost. The recent development of an adjustable spring-hinged AFO now allows adjustment of AFO stiffness, enabling tuning toward optimal gait performance. This study aims to quantify the mechanical properties of this spring-hinged AFO for each of its springs and settings. Using an AFO stiffness tester, two AFO hinges and their accompanying springs were measured. The springs showed a stiffness range of 0.01-1.82 N · m · deg(-1). The moment-threshold increased with increasing stiffness (1.13-12.1 N · m), while ROM decreased (4.91-16.5°). Energy was returned by all springs (11.5-116.3 J). These results suggest that the two stiffest available springs should improve joint kinematics and enhance push-off in children with SCP walking with excessive knee flexion.
49 CFR 390.35 - Certificates, reports, and records: Falsification, reproduction, or alteration.
2010-10-01
..., reproduction, or alteration. 390.35 Section 390.35 Transportation Other Regulations Relating to Transportation... § 390.35 Certificates, reports, and records: Falsification, reproduction, or alteration. No motor... requirement of this subchapter or part 325 of subchapter A; or (c) A reproduction, for fraudulent purposes, of...
Physical activity and its effects on reproduction.
Redman, Leanne M
2006-05-01
The reproductive system is tightly coupled with energy balance, and thereby changes in the status of energy balance through changes in physical activity can impact on the reproductive system. In light of the new physical activity for health recommendations, it is therefore important to understand the inherent effects, both positive and negative, of physical activity on the reproductive system. At both extremes of the energy spectrum, disorders of chronic energy excess and energy deficiency are characterized by a wide range of reproductive disorders, including menstrual irregularity, anovulation, polycystic ovarian syndrome, and infertility in women, and erectile dysfunction and altered spermatogenesis in men. Although laboratory research indicates that individuals may be able to prevent or reverse reproductive disruptions, either by increasing energy expenditure in cases of energy excess or by dietary reform in cases of energy deficits, there is an acute need for applied research to confirm this idea and to identify mechanisms by which the availability of energy per se regulates reproductive function in humans.
Marijuana, the Endocannabinoid System and the Female Reproductive System.
Brents, Lisa K
2016-06-01
Marijuana use among women is highly prevalent, but the societal conversation on marijuana rarely focuses on how marijuana affects female reproduction and endocrinology. This article reviews the current scientific literature regarding marijuana use and hypothalamic-pituitary-ovarian (HPO) axis regulation, ovarian hormone production, the menstrual cycle, and fertility. Evidence suggests that marijuana can reduce female fertility by disrupting hypothalamic release of gonadotropin releasing hormone (GnRH), leading to reduced estrogen and progesterone production and anovulatory menstrual cycles. Tolerance to these effects has been shown in rhesus monkeys, but the effects of chronic marijuana use on human female reproduction are largely unknown. Marijuana-induced analgesia, drug reinforcement properties, tolerance, and dependence are influenced by ovarian hormones, with estrogen generally increasing and progesterone decreasing sensitivity to marijuana. Carefully controlled regulation of the Endocannabinoid System (ECS) is required for successful reproduction, and the exogenous cannabinoids in marijuana may disrupt the delicate balance of the ECS in the female reproductive system.
Cakar, E; Durmus, O; Tekin, L; Dincer, U; Kiralp, M Z
2010-09-01
Ankle foot orthoses (AFO) are commonly used orthotic device in order to restore the ankle foot function and to improve the balance and gait in post-stroke hemiparetic patients. However, there remain some discussions about their effectiveness on long term hemiparetic patients who had mild to moderate spasticity. To investigate the relative effect of prefabricated thermoplastic posterior leaf spring AFO (PLS-AFO) on balance and fall risk. A cross-over interventional study The Department of PMR of a tertiary hospital. Twenty-five chronic post-stroke long duration hemiparetic patients who had Ashworth grade 1-2 spasticity at affected calf muscles and lower limb Brunnstrom stage 2-3 and also able to walk independently without an assistive device. Berg Balance Scale (BERG), and the postural stability test (PST) and the fall risk test (FRT) of Biodex balance systems were used for the assessments. All of the patients were assessed with AFO and without AFO. All assessments were made with footwear. The mean post-stroke duration was 20,32±7,46 months. The BERG scores were 42,12±9,05 without AFO and 47,52±7,77 with AFO; the overall stability scores of FRT were 3,35±1,97 without AFO and 2,69±1,65 with AFO (Pbalance and provide fall risk reduction in chronic post-stroke ambulatory hemiparetic patients who had mild to moderate spasticity on their affected lower limb. These results encourage the usage of AFO on long duration hemiparetic patients in order to provide better balance and lesser fall risk.
Zhao, Xiaoke; Xiao, Nong; Li, Hongying; Du, Senjie
2013-10-01
The aim of this study was to compare the effectiveness of treatment with hinged ankle-foot orthoses (AFOs) during the day vs. during both the day and the night in young ambulant children with spastic diplegia. In this prospective randomized controlled trial, 112 ambulatory children (70 boys and 42 girls; mean age, 2 yrs 6.93 mos; range, 1 yr 1 mo to 4 yrs 0 mo) with spastic diplegia participated. Forty-eight were classified at level I of the Gross Motor Function Classification System; the remaining 64 were at level II. Using stratified randomization, all children were assigned to either the day AFO-wearing group (n = 56, wearing AFOs all day) or the day-night AFO-wearing group (n = 56, wearing AFOs all day and all night). The two groups underwent conventional rehabilitative treatments five times a week for 8 wks. The primary outcomes measured were passive ankle dorsiflexion angle and sections D and E of the 66-item Gross Motor Function Measure; the root mean square of surface electromyography in the ventral and dorsal lower limb muscles was compared in a subgroup (ten from each group). Seven children did not complete the full intervention: three in the day AFO-wearing group and four in the day-night AFO-wearing group. Significant baseline-postintervention improvements were found for passive ankle dorsiflexion angle and the 66-item Gross Motor Function Measure in both groups (P day AFO-wearing group (P day AFO-wearing group, whereas the muscles affected in the day-night AFO-wearing group were the gastrocnemius (P day-night use. In addition, the prolonged wearing of AFOs may influence muscle activity, which should be monitored in the clinic.
Directory of Open Access Journals (Sweden)
Yvette L Kerkum
Full Text Available Rigid Ankle-Foot Orthoses (AFOs are commonly prescribed to counteract excessive knee flexion during the stance phase of gait in children with cerebral palsy (CP. While rigid AFOs may normalize knee kinematics and kinetics effectively, it has the disadvantage of impeding push-off power. A spring-like AFO may enhance push-off power, which may come at the cost of reducing the knee flexion less effectively. Optimizing this trade-off between enhancing push-off power and normalizing knee flexion in stance is expected to maximize gait efficiency. This study investigated the effects of varying AFO stiffness on gait biomechanics and efficiency in children with CP who walk with excessive knee flexion in stance. Fifteen children with spastic CP (11 boys, 10±2 years were prescribed with a ventral shell spring-hinged AFO (vAFO. The hinge was set into a rigid, or spring-like setting, using both a stiff and flexible performance. At baseline (i.e. shoes-only and for each vAFO, a 3D-gait analysis and 6-minute walk test with breath-gas analysis were performed at comfortable speed. Lower limb joint kinematics and kinetics were calculated. From the 6-minute walk test, walking speed and the net energy cost were determined. A generalized estimation equation (p<0.05 was used to analyze the effects of different conditions. Compared to shoes-only, all vAFOs improved the knee angle and net moment similarly. Ankle power generation and work were preserved only by the spring-like vAFOs. All vAFOs decreased the net energy cost compared to shoes-only, but no differences were found between vAFOs, showing that the effects of spring-like vAFOs to promote push-off power did not lead to greater reductions in walking energy cost. These findings suggest that, in this specific group of children with spastic CP, the vAFO stiffness that maximizes gait efficiency is primarily determined by its effect on knee kinematics and kinetics rather than by its effect on push-off power
Ethics and regulation of inter-country medically assisted reproduction: a call for action
Shalev, Carmel; Moreno, Adi; Eyal, Hedva; Leibel, Michal; Schuz, Rhona; Eldar-Geva, Talia
2016-01-01
The proliferation of medically assisted reproduction (MAR) for the treatment of infertility has brought benefit to many individuals around the world. But infertility and its treatment continue to be a cause of suffering, and over the past decade, there has been a steady growth in a new global market of inter-country medically assisted reproduction (IMAR) involving ?third-party? individuals acting as surrogate mothers and gamete donors in reproductive collaborations for the benefit of other in...
Gap junction connexins in female reproductive organs: implications for women's reproductive health.
Winterhager, Elke; Kidder, Gerald M
2015-01-01
Connexins comprise a family of ~20 proteins that form intercellular membrane channels (gap junction channels) providing a direct route for metabolites and signalling molecules to pass between cells. This review provides a critical analysis of the evidence for essential roles of individual connexins in female reproductive function, highlighting implications for women's reproductive health. No systematic review has been carried out. Published literature from the past 35 years was surveyed for research related to connexin involvement in development and function of the female reproductive system. Because of the demonstrated utility of genetic manipulation for elucidating connexin functions in various organs, much of the cited information comes from research with genetically modified mice. In some cases, a distinction is drawn between connexin functions clearly related to the formation of gap junction channels and those possibly linked to non-channel roles. Based on work with mice, several connexins are known to be required for female reproductive functions. Loss of connexin43 (CX43) causes an oocyte deficiency, and follicles lacking or expressing less CX43 in granulosa cells exhibit reduced growth, impairing fertility. CX43 is also expressed in human cumulus cells and, in the context of IVF, has been correlated with pregnancy outcome, suggesting that this connexin may be a determinant of oocyte and embryo quality in women. Loss of CX37, which exclusively connects oocytes with granulosa cells in the mouse, caused oocytes to cease growing without acquiring meiotic competence. Blocking of CX26 channels in the uterine epithelium disrupted implantation whereas loss or reduction of CX43 expression in the uterine stroma impaired decidualization and vascularization in mouse and human. Several connexins are important in placentation and, in the human, CX43 is a key regulator of the fusogenic pathway from the cytotrophoblast to the syncytiotrophoblast, ensuring placental growth
Miller, A M
2000-01-01
Although the term "sexual rights" has gained widespread currency, its concrete scope and content have not yet been fully defined. The need for definition is critical not only for promoting governmental accountability but also for ensuring that sexual rights can be claimed by diverse persons around the world. Ironically, the concept of "sexual and reproductive rights" poses a challenge to this effort; practices and people not traditionally addressed by reproductive rights work must be explicitly named and protected. This article considers how international norms have contributed to a gendered regulation of sexuality and of contemporary theories of "socially constructed sexuality," and it proposes a focus on the conditions that contribute to the ability to choose and on the links between sexuality, conduct, identity, social structures, and reproduction. Given the probable politically charged responses, global coalition-building is needed.
Rubinstein, C Dustin; Wolfner, Mariana F
2014-01-01
Seminal proteins are critical for reproductive success in all animals that have been studied. Although seminal proteins have been identified in many taxa, and female reproductive responses to receipt of these proteins have been documented in several, little is understood about the mechanisms by which seminal proteins affect female reproductive physiology. To explore this topic, we investigated how a Drosophila seminal protein, ovulin, increases ovulation rate in mated females. Ovulation is a relatively simple physiological process, with known female regulators: previous studies have shown that ovulation rate is promoted by the neuromodulator octopamine (OA) in D. melanogaster and other insects. We found that ovulin stimulates ovulation by increasing OA signaling in the female. This finding supports a model in which a male seminal protein acts through "hacking" a well-conserved, regulatory system females use to adjust reproductive output, rather than acting downstream of female mechanisms of control or in parallel pathways altogether. We also discuss similarities between 2 forms of intersexual control of behavior through chemical communication: seminal proteins and pheromones.
Cryptococcus neoformans sexual reproduction is controlled by a quorum sensing peptide.
Tian, Xiuyun; He, Guang-Jun; Hu, Pengjie; Chen, Lei; Tao, Changyu; Cui, Ying-Lu; Shen, Lan; Ke, Weixin; Xu, Haijiao; Zhao, Youbao; Xu, Qijiang; Bai, Fengyan; Wu, Bian; Yang, Ence; Lin, Xiaorong; Wang, Linqi
2018-06-01
Bacterial quorum sensing is a well-characterized communication system that governs a large variety of collective behaviours. By comparison, quorum sensing regulation in eukaryotic microbes remains poorly understood, especially its functional role in eukaryote-specific behaviours, such as sexual reproduction. Cryptococcus neoformans is a prevalent fungal pathogen that has two defined sexual cycles (bisexual and unisexual) and is a model organism for studying sexual reproduction in fungi. Here, we show that the quorum sensing peptide Qsp1 serves as an important signalling molecule for both forms of sexual reproduction. Qsp1 orchestrates various differentiation and molecular processes, including meiosis, the hallmark of sexual reproduction. It activates bisexual mating, at least in part through the control of pheromone, a signal necessary for bisexual activation. Notably, Qsp1 also plays a major role in the intercellular regulation of unisexual initiation and coordination, in which pheromone is not strictly required. Through a multi-layered genetic screening approach, we identified the atypical zinc finger regulator Cqs2 as an important component of the Qsp1 signalling cascade during both bisexual and unisexual reproduction. The absence of Cqs2 eliminates the Qsp1-stimulated mating response. Together, these findings extend the range of behaviours governed by quorum sensing to sexual development and meiosis.
Preston, Jill C; Jorgensen, Stacy A; Orozco, Rebecca; Hileman, Lena C
2016-02-01
Duplicated petunia clade-VI SPL genes differentially promote the timing of inflorescence and flower development, and leaf initiation rate. The timing of plant reproduction relative to favorable environmental conditions is a critical component of plant fitness, and is often associated with variation in plant architecture and habit. Recent studies have shown that overexpression of the microRNA miR156 in distantly related annual species results in plants with perennial characteristics, including late flowering, weak apical dominance, and abundant leaf production. These phenotypes are largely mediated through the negative regulation of a subset of genes belonging to the SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) family of transcription factors. In order to determine how and to what extent paralogous SPL genes have partitioned their roles in plant growth and development, we functionally characterized petunia clade-VI SPL genes under different environmental conditions. Our results demonstrate that PhSBP1and PhSBP2 differentially promote discrete stages of the reproductive transition, and that PhSBP1, and possibly PhCNR, accelerates leaf initiation rate. In contrast to the closest homologs in annual Arabidopsis thaliana and Mimulus guttatus, PhSBP1 and PhSBP2 transcription is not mediated by the gibberellic acid pathway, but is positively correlated with photoperiod and developmental age. The developmental functions of clade-VI SPL genes have, thus, evolved following both gene duplication and speciation within the core eudicots, likely through differential regulation and incomplete sub-functionalization.
Poor compliance with ankle-foot-orthoses in Charcot-Marie-Tooth disease.
Vinci, P; Gargiulo, P
2008-03-01
The aim of this study is to evaluate the compliance with ankle-foot orthoses (AFOs) in patients previously prescribed and affected with Charcot-Marie-Tooth disease (CMT). Twenty-five Italian patients (8 males 17 females; mean age: 41.6 years, range 16-54) with severe bilateral footdrop (leg-sole angle alpha >105 degrees ) alone or associated with other problems (rotation, plantarflexor failure, knee flexor failure) were examined by a physiatrist (with measurement of the leg-sole angle alpha' with their footwear) and interviewed by a psychologist. Only 5 patients (20%) used AFOs (3 prefabricated polypropylene AFOs, 2 custom-made short AFOs incorporated in high-top boots) with satisfactory functional results (alpha' <=94 degrees ; reported increased mobility and no more falls). The interview revealed that all patients had a bad relationship with their own body. The 3 subjects using prefabricated AFOs said that they hated them and one of them complained of pain. Patients not using AFOs justified their decision with statements such as: ''I am not yet ready to accept them'' (n=3) or ''I can still manage without them for a while'' (n=2) or both (n=15). Four patients had experienced pain during the trial, 2 had not found proper shoes to accommodate them and 12 were absolutely not interested in AFOs and, therefore, had not gone to an orthotist. Compliance with AFOs is poor. Patients with CMT discard AFOs because they highlight their disability, are not essential for their limited daily walking and are uncomfortable. We suggest that prescription of AFOs be accompanied with psychological support and that research of more comfortable and cosmetically acceptable solutions for the problem of footdrop be stimulated.
Handling the Misalignment of Interests in Assisted Reproductive Technology Practices
Pierson, Anne
2010-01-01
One of the major problems we see in the use of reproductive technology at this time is that there is very little regulation of embryo transfer practices that lead to multigestational pregnancies. While the FDA must approve assisted reproductive technology (ART) devices and drugs that stimulate ovulation, it has no jurisdiction over the practice of medicine, how these drugs and devices are used on the ground, often in off-label procedures. The only current regulation of these practices is at...
Ameloblastic fibro-odontoma: A diagnostic challenge
Directory of Open Access Journals (Sweden)
Abhijeet Alok
2015-01-01
Full Text Available Ameloblastic fibro-odontoma (AFO is a rare mixed odontogenic tumor. It occurs predominantly in children and young adults with no sex predilection, mostly in the mandible posterior region. A painless swelling is the most common clinical sign of AFO. Radiographically, AFO shows a circumscribed radiolucency, which contains radiopaque foci of various sizes and shapes. Histological examination reveals a fibrous soft tissue, islands of odontogenic epithelium, and a disordered mixture of dental tissues. Treatment of AFOs usually consists of enucleation or surgical curettage, which is possible due to their benign biological behavior. Here, we are reporting a case of AFO in a 20-year-old male.
Cuello-Carrión, F Darío; Troncoso, Mariana; Guiñazu, Elina; Valdez, Susana R; Fanelli, Mariel A; Ciocca, Daniel R; Kreimann, Erica L
2010-12-01
In breast cancer cell lines, the Na(+)/H(+) exchanger regulator factor 1 (NHERF1) gene is regulated at the transcriptional level by estrogens, the protein expression levels correlate with the presence of estrogen receptors and the effect is blocked by anti-estrogens. However, there is limited information regarding the regulation of NHERF1 by estrogens in normal colon tissue. The NHERF1 protein has an important role in the maintenance of the intestine ultrastructure. NHERF1-deficient mice showed defects in the intestinal microvilli as well as molecular alterations in brush border membrane proteins. Here, we have studied the expression of NHERF1 in normal rat colon and uterus during the reproductive cycle of Wistar rats. We found that NHERF1 expression in rat colon during the estral cycle is modified by estrogen levels: higher expression of NHERF1 was observed during the proestrous and estrous stages and lower expression in diestrous 1 when estrogen levels decreased. In uterus, NHERF1 was expressed in the apical region of the luminal epithelium and glands in all stages of the estral cycle, and in both colon and uterus, the expression was independent of the proliferation status. Our results show that NHERF1 expression is regulated by estrogens in colon during the rat estral cycle.
Adipokines and the Female Reproductive Tract
Directory of Open Access Journals (Sweden)
Maxime Reverchon
2014-01-01
Full Text Available It is well known that adipose tissue can influence puberty, sexual maturation, and fertility in different species. Adipose tissue secretes molecules called adipokines which most likely have an endocrine effect on reproductive function. It has been revealed over the last few years that adipokines are functionally implicated at all levels of the reproductive axis including the gonad and hypothalamic-pituitary axis. Many studies have shown the presence and the role of the adipokines and their receptors in the female reproductive tract of different species. These adipokines regulate ovarian steroidogenesis, oocyte maturation, and embryo development. They are also present in the uterus and placenta where they could create a favorable environment for embryonic implantation and play a key role in maternal-fetal metabolism communication and gestation. Reproductive functions are strongly dependent on energy balance, and thereby metabolic abnormalities can lead to the development of some pathophysiologies such as polycystic ovary syndrome (PCOS. Adipokines could be a link between reproduction and energy metabolism and could partly explain some infertility related to obesity or PCOS.
Dong, Dujuan; Zhang, Yang; Smykal, Vlastimil; Ling, Lin; Raikhel, Alexander S
2018-05-01
The Aedes aegypti mosquito is the principal vector for many dangerous human viral diseases. Carbohydrate metabolism (CM) is essential for supplying the energy necessary for host seeking, blood digestion and rapid egg development of this vector insect. The steroid hormone 20-hydroxyecdysone (20E) and the ecdysone receptor (EcR) are important regulators of CM, coordinating it with female reproductive events. We report here that the NR4A nuclear receptor AHR38 plays a critical role in mediating these actions of 20E and EcR. AHR38 RNA interference (RNAi) depletion in female mosquitoes blocked the transcriptional activation of CM genes encoding phosphoglucomutase (PGM) and trehalose-6-phophate synthase (TPS); it caused an increase of glycogen accumulation and a decrease of the circulating sugar trehalose. This treatment also resulted in a dramatic reduction in fecundity. Considering that these phenotypes resulting from AHR38 RNAi depletion are similar to those of EcR RNAi, we investigated a possible connection between these transcription factors in CM regulation. EcR RNAi inhibits the AHR38 gene expression. Moreover, the 20E-induced EcR complex directly activates AHR38 by binding to the ecdysone response element (EcRE) in the upstream regulatory region of this gene. The present work has implicated AHR38 in the 20E-mediated control of CM and provided new insight into mechanisms of 20E regulation of metabolism during female mosquito reproduction. © 2018 Published by Elsevier Ltd.
Genetics of reproduction and regulation of honeybee (Apis mellifera L.) social behavior.
Page, Robert E; Rueppell, Olav; Amdam, Gro V
2012-01-01
Honeybees form complex societies with a division of labor for reproduction, nutrition, nest construction and maintenance, and defense. How does it evolve? Tasks performed by worker honeybees are distributed in time and space. There is no central control over behavior and there is no central genome on which selection can act and effect adaptive change. For 22 years, we have been addressing these questions by selecting on a single social trait associated with nutrition: the amount of surplus pollen (a source of protein) that is stored in the combs of the nest. Forty-two generations of selection have revealed changes at biological levels extending from the society down to the level of the gene. We show how we constructed this vertical understanding of social evolution using behavioral and anatomical analyses, physiology, genetic mapping, and gene knockdowns. We map out the phenotypic and genetic architectures of food storage and foraging behavior and show how they are linked through broad epistasis and pleiotropy affecting a reproductive regulatory network that influences foraging behavior. This is remarkable because worker honeybees have reduced reproductive organs and are normally sterile; however, the reproductive regulatory network has been co-opted for behavioral division of labor.
The devil we know: the implications of bill C-38 for assisted human reproduction in Canada.
Cattapan, Alana; Cohen, Sara R
2013-07-01
In June 2012, the Canadian House of Commons passed the so-called omnibus budget bill, making several important changes to the governance of assisted reproduction in Canada. The bill (Bill C-38) was widely criticized for its unwieldy size and rapid passage through Parliament, preventing adequate parliamentary debate and public scrutiny. Given the substantive nature of the amendments to the Assisted Human Reproduction Act made by Bill C-38, and the lack of relevant discussion about these changes both before and following its passage, this commentary is intended to identify how Bill C-38 may alter the governance of reproductive technologies in Canada. In this commentary, we address some of the more significant changes made by Bill C-38 to the regulation of reproductive medicine in Canada. We identify the benefits and challenges of closing Assisted Human Reproduction Canada, noting that doing so eliminates a much-needed forum for stakeholder consultation in this field. Further, we explore the implications of moving the regulation of donor semen from the Food and Drugs Act to the Assisted Human Reproduction Act; these include increased liability for physicians, and opportunities to expand the existing regulations to account for the needs of lesbian, gay, bisexual, trans, and queer Canadians using donor gametes and recent advances in reproductive technologies. Overall, we argue that although the implementation of a policy framework in this field remains highly dependent on yet-to-be written regulations, the changes to the Assisted Human Reproduction Act enabled by Bill C-38 may significantly alter how Canadians interact with reproductive technologies.
Kultursay, Nilgun; Yalaz, Mehmet; Koroglu, Ozge Altun
2015-01-01
In March 2010, a new legislation about assisted reproductive technology (ART) activities, favoring single embryo transfer, was introduced in Turkey. Consequences of new regulations on neonatal outcome have not been evaluated in multicenter studies yet. In this study, our aim was to evaluate neonatal outcome of infants from medically assisted reproduction (MAR) pregnancies in the post-legislation era. A point prevalence study was conducted at 51 centers in Turkey on 1 April 2013. Data about fertility treatments and neonatal characteristics were evaluated for "live births" (Group 1) and "patients being cared in the NICU" (Group 2). Seventeen (4%) of 420 infants in group 1, and 89 (8.1%) of 1094 infants in group 2 were born after MAR pregnancies. The ratio of multiple births in MAR pregnancies was still very high as 47.1% for group 1, 69.1% for group 2 infants. MAR babies constituted 9.9% of infants in Level 3 NICUs and 7.6% infants in Level 2 NICUs. MAR was associated with increased risk of multiple births and prematurity. After the new legislation, multiple birth rates are still high in MAR pregnancies, resulting in unfavorable neonatal outcomes. Efforts to decrease multiple birth rates should be encouraged.
Assessing the relationship between groundwater nitrate and animal feeding operations in Iowa (USA)
Zirkle, Keith W.; Nolan, Bernard T.; Jones, Rena R.; Weyer, Peter J.; Ward, Mary H.; Wheeler, David C.
2016-01-01
Nitrate-nitrogen is a common contaminant of drinking water in many agricultural areas of the United States of America (USA). Ingested nitrate from contaminated drinking water has been linked to an increased risk of several cancers, specific birth defects, and other diseases. In this research, we assessed the relationship between animal feeding operations (AFOs) and groundwater nitrate in private wells in Iowa. We characterized AFOs by swine and total animal units and type (open, confined, or mixed), and we evaluated the number and spatial intensities of AFOs in proximity to private wells. The types of AFO indicate the extent to which a facility is enclosed by a roof. Using linear regression models, we found significant positive associations between the total number of AFOs within 2 km of a well (p trend nitrate concentration. Additionally, we found significant increases in log nitrate in the top quartiles for AFO spatial intensity, open AFO spatial intensity, and mixed AFO spatial intensity compared to the bottom quartile (0.171 log(mg/L), 0.319 log(mg/L), and 0.541 log(mg/L), respectively; all p nitrate-nitrogen in drinking wells and found significant spatial clustering of high-nitrate wells (> 5 mg/L) compared with low-nitrate (≤ 5 mg/L) wells (p = 0.001). A generalized additive model for high-nitrate status identified statistically significant areas of risk for high levels of nitrate. Adjustment for some AFO predictor variables explained a portion of the elevated nitrate risk. These results support a relationship between animal feeding operations and groundwater nitrate concentrations and differences in nitrate loss from confined AFOs vs. open or mixed types.
ATP-binding cassette transporters in reproduction: a new frontier
Bloise, E.; Ortiga-Carvalho, T.M.; Reis, F.M.; Lye, S.J.; Gibb, W.; Matthews, S.G.
2016-01-01
BACKGROUND The transmembrane ATP-binding cassette (ABC) transporters actively efflux an array of clinically relevant compounds across biological barriers, and modulate biodistribution of many physiological and pharmacological factors. To date, over 48 ABC transporters have been identified and shown to be directly and indirectly involved in peri-implantation events and fetal/placental development. They efflux cholesterol, steroid hormones, vitamins, cytokines, chemokines, prostaglandins, diverse xenobiotics and environmental toxins, playing a critical role in regulating drug disposition, immunological responses and lipid trafficking, as well as preventing fetal accumulation of drugs and environmental toxins. METHODS This review examines ABC transporters as important mediators of placental barrier functions and key reproductive processes. Expression, localization and function of all identified ABC transporters were systematically reviewed using PubMed and Google Scholar websites to identify relevant studies examining ABC transporters in reproductive tissues in physiological and pathophysiological states. Only reports written in English were incorporated with no restriction on year of publication. While a major focus has been placed on the human, extensive evidence from animal studies is utilized to describe current understanding of the regulation and function of ABC transporters relevant to human reproduction. RESULTS ABC transporters are modulators of steroidogenesis, fertilization, implantation, nutrient transport and immunological responses, and function as ‘gatekeepers’ at various barrier sites (i.e. blood-testes barrier and placenta) against potentially harmful xenobiotic factors, including drugs and environmental toxins. These roles appear to be species dependent and change as a function of gestation and development. The best-described ABC transporters in reproductive tissues (primarily in the placenta) are the multidrug transporters p-glycoprotein and
Leptin and reproduction: a review.
Moschos, Stergios; Chan, Jean L; Mantzoros, Christos S
2002-03-01
To review recent advances in understanding the role of leptin in the physiology and pathophysiology of reproduction, with a focus on relevant clinical situations. A MEDLINE computer search was performed to identify relevant articles. Leptin, an adipocyte hormone important in regulating energy homeostasis, interacts with the reproductive axis at multiple sites, with stimulatory effects at the hypothalamus and pituitary and inhibitory actions at the gonads. More recently, leptin has been shown to play a role in other target reproductive organs, such as the endometrium, placenta, and mammary gland, with corresponding influences on important physiologic processes such as menstruation, pregnancy, and lactation. As a marker of whether nutritional stores are adequate, leptin may act in concert with gonadotropins and the growth hormone axis to initiate the complex process of puberty. Conditions in which nutritional status is suboptimal, such as eating disorders, exercise-induced amenorrhea, and functional hypothalamic amenorrhea, are associated with low serum leptin levels; and conditions with excess energy stores or metabolic disturbances, such as obesity and polycystic ovarian syndrome, often have elevated serum or follicular fluid leptin levels, raising the possibility that relative leptin deficiency or resistance may be at least partly responsible for the reproductive abnormalities that occur with these conditions. Leptin may act as the critical link between adipose tissue and the reproductive system, indicating whether adequate energy reserves are present for normal reproductive function. Future interventional studies involving leptin administration are expected to further clarify this role of leptin and may provide new therapeutic options for the reproductive dysfunction associated with states of relative leptin deficiency or resistance.
Nikamp-Simons, Corien D.M.; Buurke, Jaap H.; Van Der Palen, Job; Hermens, Hermie J.; Rietman, Johan S.; Ibánez, Jaime; Azorín, José María; Akay, Metin; Pons, José Luis
2017-01-01
Despite frequent application of ankle-foot orthoses (AFOs), little scientific evidence is available to guide AFO-provision early after stroke. A randomized controlled trial was conducted to study the effects of AFO-provision in (sub-) acute stroke patients. Primary aim: to study effects of the
Wohlers, Christina; Hertel, Guido
2017-04-01
Although there is a trend in today's organisations to implement activity-based flexible offices (A-FOs), only a few studies examine consequences of this new office type. Moreover, the underlying mechanisms why A-FOs might lead to different consequences as compared to cellular and open-plan offices are still unclear. This paper introduces a theoretical framework explaining benefits and risks of A-FOs based on theories from work and organisational psychology. After deriving working conditions specific for A-FOs (territoriality, autonomy, privacy, proximity and visibility), differences in working conditions between A-FOs and alternative office types are proposed. Further, we suggest how these differences in working conditions might affect work-related consequences such as well-being, satisfaction, motivation and performance on the individual, the team and the organisational level. Finally, we consider task-related (e.g. task variety), person-related (e.g. personality) and organisational (e.g. leadership) moderators. Based on this model, future research directions as well as practical implications are discussed. Practitioner Summary: Activity-based flexible offices (A-FOs) are popular in today's organisations. This article presents a theoretical model explaining why and when working in an A-FO evokes benefits and risks for individuals, teams and organisations. According to the model, A-FOs are beneficial when management encourages employees to use the environment appropriately and supports teams.
Directory of Open Access Journals (Sweden)
Annette M O'Connor
2010-03-01
Full Text Available A systematic review was conducted for the association between animal feeding operations (AFOs and the health of individuals living near AFOs.The review was restricted to studies reporting respiratory, gastrointestinal and mental health outcomes in individuals living near AFOs in North America, European Union, United Kingdom, and Scandinavia. From June to September 2008 searches were conducted in PUBMED, CAB, Web-of-Science, and Agricola with no restrictions. Hand searching of narrative reviews was also used. Two reviewers independently evaluated the role of chance, confounding, information, selection and analytic bias on the study outcome. Nine relevant studies were identified. The studies were heterogeneous with respect to outcomes and exposures assessed. Few studies reported an association between surrogate clinical outcomes and AFO proximity. A negative association was reported when odor was the measure of exposure to AFOs and self-reported disease, the measure of outcome. There was evidence of an association between self-reported disease and proximity to AFO in individuals annoyed by AFO odor.There was inconsistent evidence of a weak association between self-reported disease in people with allergies or familial history of allergies. No consistent dose response relationship between exposure and disease was observable.
RFRP neurons - the doorway to understanding seasonal reproduction in mammals
Directory of Open Access Journals (Sweden)
Jo Beldring Henningsen
2016-05-01
Full Text Available Seasonal control of reproduction is critical for the perpetuation of species living in temperate zones that display major changes in climatic environment and availability of food resources. In mammals, seasonal cues are mainly provided by the annual change in the 24h light/dark ratio (i.e. photoperiod, which is translated into the nocturnal production of the pineal hormone melatonin. The annual rhythm in this melatonin signal acts as a synchronizer ensuring that breeding occurs when environmental conditions favor survival of the offspring. Although specific mechanisms might vary among seasonal species, the hypothalamic RF (Arg-Phe amide-related peptides (RFRP-1 and -3 are believed to play a critical role in the central control of seasonal reproduction and in all seasonal species investigated, the RFRP system is persistently inhibited in short photoperiod. Central chronic administration of RFRP-3 in short day-adapted male Syrian hamsters fully reactivates the reproductive axis despite photoinhibitory conditions, which highlights the importance of the seasonal changes in RFRP expression for proper regulation of the reproductive axis. The acute effects of RFRP peptides, however, depend on species, photoperiod and recent studies point towards a different role of RFRP in regulating female reproductive activity. In this review we summarize the recent advances made to understand the role and underlying mechanisms of RFRP in the seasonal control of reproduction, primarily focusing on mammalian species.
Bligh, Mark W.; Waite, T. David
2010-10-01
While chemical reactions that take place at the surface of amorphous ferric oxides (AFO) are known to be important in aquatic systems, incorporation of these reactions into kinetic models is hindered by a lack of ability to reliably quantify the reactivity of the surface and the changes in reactivity that occur over time. Long term decreases in the reactivity of iron oxides may be considered to result from changes in the molecular structure of the solid, however, over shorter time scales where substantial aggregation may occur, the mechanisms of reactivity loss are less clear. Precipitation of AFO may be described as a combination of homogeneous and heterogeneous reactions, however, despite its potentially significant role, the latter reaction is usually neglected in kinetic models of aquatic processes. Here, we investigate the role of AFO in scavenging dissolved inorganic ferric (Fe(III)) species (Fe') via the heterogeneous precipitation reaction during the net dissociation of organically complexed Fe(III) in seawater. Using sulfosalicylic acid (SSA) as a model ligand, AFO was shown to play a significant role in inducing the net dissociation of the Fe-SSA complexes with equations describing both the heterogeneous precipitation reaction and the aging of AFO being required to adequately describe the experimental data. An aggregation based mechanism provided a good description of AFO aging over the short time scale of the experiments. The behaviour of AFO described here has implications for the bioavailability of iron in natural systems as a result of reactions involving AFO which are recognised to occur over time scales of minutes, including adsorption of Fe' and AFO dissolution, precipitation and ageing.
Javitt, Gail H; Hudson, Kathy
2003-01-01
The Food and Drug Administration (FDA) has taken the position that human reproductive cloning falls within its regulatory jurisdiction. This position has been subject to criticism on both procedural and substantive grounds. Some have contended that the FDA has failed to follow administrative law principles in asserting its jurisdiction, while others claim the FDA is ill suited to the task of addressing the ethical and social implications of human cloning. This Article argues, that, notwithstanding these criticisms, the FDA could plausibly assert jurisdiction over human cloning as a form of human gene therapy, an area in which the FDA is already regarded as having primary regulatory authority. Such an assertion would require that the FDA's jurisdiction extend to products affecting future persons, i.e., those not yet born. This Article demonstrates, for the first time, that such jurisdiction was implicit in the enactment of the 1962 Kefauver-Harris Amendments to the Federal Food, Drug, and Cosmetic Act and that the FDA has historically relied on such authority in promulgating regulations for drugs and devices.
Directory of Open Access Journals (Sweden)
Kim JH
2015-11-01
Full Text Available Jong Hyun Kim, Woo Sang Sim, Byeong Hee Won Usability Evaluation Technology Center, Advanced Biomedical and Welfare R&D Group, Korea Institute of Industrial Technology, Cheonan-si, Chungcheongnam-do, South Korea Purpose: Poor recovery of postural stability poststroke is the primary cause of impairment in activities and social participation in elderly stroke survivors. The purpose of our study was to experimentally evaluate the effectiveness of our new elastic ankle–foot orthosis (AFO, compared to a traditional AFO fabricated with hard plastic, in improving postural stability in elderly chronic stroke survivors. Patients and methods: Postural stability was evaluated in ten chronic stroke patients, 55.7±8.43 years old. Postural stability was evaluated using the standardized methods of the Biodex Balance System combined with a foot pressure system, under three experimental conditions, no AFO, rigid plastic AFO, and elastic AFO (E-AFO. The following dependent variables of postural stability were analyzed: plantar pressure under the paretic and nonparetic foot, area of the center of balance (COB and % time spent in each location, distance traveled by the COB away from the body center, distance traveled by the center of pressure, and calculated index of overall stability, as well as indices anterior–posterior and medial–lateral stability. Results: Both AFO designs improved all indices of postural stability. Compared to the rigid plastic AFO, the E-AFO produced additional positive effects in controlling anterior–posterior body sway, equalizing weight bearing through the paretic and nonparetic limbs, and restraining the displacement of the center of pressure and of the COB. Conclusion: Based on our outcomes, we recommend the prescription of E-AFOs as part of a physiotherapy rehabilitation program to promote recovery of postural stability poststroke. When possible, therapeutic outcomes should be documented using the Biodex Balance System and
Zmora, Nilli; Stubblefield, John David; Wong, Ten-Tsao; Levavi-Sivan, Berta; Millar, Robert Peter; Zohar, Yonathan
2015-09-01
The importance of kisspeptin in regulating vertebrate reproduction has been well established, but the exact mechanism continues to unfold. Unlike mammals, many lower vertebrates possess a dual kisspeptin system, Kiss1 and Kiss2. To decipher the roles of the kisspeptins in fish, we identified two potential kisspeptin antagonists, pep 234 and pep 359, by screening analogs for their ability to inactivate striped bass Kiss1 and Kiss2 receptors expressed in COS7 cells. Pep 234 (a mammalian KISS1 antagonist) antagonizes Kiss1r signaling activated by Kiss1 and Kiss2, and pep 359 (a novel analog) antagonizes Kiss2 activation of both receptors. In vitro studies using brain slices demonstrated that only Kiss2 can upregulate the expression of the hypophysiotropic gnrh1, which was subsequently diminished by pep 234 and pep 359. In primary pituitary cell cultures, the two antagonists revealed a complex network of putative endogenous and exogenous regulation by kisspeptin. While both kisspeptins stimulate Fsh expression and secretion, Kiss2 predominately induces Lh secretion. Pep 234 and 359 treatment of spawning males hindered sperm production. This effect was accompanied with decreased brain gnrh1 and gnrh2 mRNA levels and peptide content in the pituitary, and increased levels of pituitary Lh, probably due to attenuation of Lh release. Strikingly, the mRNA levels of arginine-vasotocin, the neurons of which in the preoptic area coexpress kiss2r, were dramatically reduced by the antagonists. Our results demonstrate differential actions of Kiss1 and Kiss2 systems along the hypothalamic-pituitary axis and interactions with other neuropeptides, and further reinforce the importance of kisspeptin in the execution of spawning. © 2015 by the Society for the Study of Reproduction, Inc.
Duydu, Yalçın; Başaran, Nurşen; Ustündağ, Aylin; Aydın, Sevtap; Undeğer, Ulkü; Ataman, Osman Yavuz; Aydos, Kaan; Düker, Yalçın; Ickstadt, Katja; Waltrup, Brita Schulze; Golka, Klaus; Bolt, Hermann Maximilian
2016-01-01
Boric acid and sodium borates are classified as toxic to reproduction in the CLP Regulation under "Category 1B" with the hazard statement of "H360FD". This classification is based on the reprotoxic effects of boric acid and sodium borates in animal experiments at high doses. However, boron mediated reprotoxic effects have not been proven in epidemiological studies so far. The epidemiological study performed in Bandırma boric acid production plant is the most comprehensive published study in this field with 204 voluntarily participated male workers. Sperm quality parameters (sperm morphology, concentration and motility parameters), FSH, LH and testosterone levels were determined in all participated employees as the reproductive toxicity biomarkers of males. However, boron mediated unfavorable effects on reproduction in male workers have not been determined even in the workers under very high daily boron exposure (0.21 mg B/kg-bw/day) conditions. The NOAEL for rat reproductive toxicity is equivalent to a blood boron level of 2020 ng/g. This level is higher than the mean blood boron concentration (223.89 ± 69.49 ng/g) of the high exposure group workers in Bandırma boric acid production plant (Turkey) by a factor of 9. Accordingly, classifying boric acid and sodium borates under "Category 1B" as "presumed reproductive human toxicant in the CLP regulation seems scientifically not reasonable. The results of the epidemiological studies (including the study performed in China) support for a down-classification of boric acid from the category 1B, H360FD to category 2, H361d, (suspected of damaging the unborn child).
Ameloblastic fibro-odontoma in children. Clinical aspects and review of the literature
Directory of Open Access Journals (Sweden)
Marcello Augello
2017-06-01
Full Text Available The ameloblastic fibro-odontoma (AFO is a rare mixed odontogenic tumor. Clinically AFO presents as a hamartoma or immature odontoma. The AFO is a well-encapsulated, painless, slow-growing and expanding tumor in young patients. Histologically, it has been classified as an ameloblastic fibroma or odontoma. Despite numerous efforts, there is still considerable confusion concerning the nature, the histology and the surgical therapy of this lesion. However, it can present with progressive growth causing bone destruction and significant deformity. The transformation of AFO in sarcoma is also known and extremely rare. Therefore a long term follow up is recommended. Enucleation still remains the gold standard. We are discussing our experience with AFO focused on children in clinical and surgical features and reviewing the relevant literature.
Rethinking reproductive "tourism" as reproductive "exile".
Inhorn, Marcia C; Patrizio, Pasquale
2009-09-01
Whereas reproductive "tourism" implies leisure travel, reproductive "exile" bespeaks the numerous difficulties and constraints faced by infertile patients who are "forced" to travel globally for assisted reproduction. Given this reality, it is time to rethink the language of "reproductive tourism," replacing it with more accurate and patient-centered terms.
Lysophosphatidic Acid (LPA Signaling in Human and Ruminant Reproductive Tract
Directory of Open Access Journals (Sweden)
Izabela Wocławek-Potocka
2014-01-01
Full Text Available Lysophosphatidic acid (LPA through activating its G protein-coupled receptors (LPAR 1–6 exerts diverse cellular effects that in turn influence several physiological processes including reproductive function of the female. Studies in various species of animals and also in humans have identified important roles for the receptor-mediated LPA signaling in multiple aspects of human and animal reproductive tract function. These aspects range from ovarian and uterine function, estrous cycle regulation, early embryo development, embryo implantation, decidualization to pregnancy maintenance and parturition. LPA signaling can also have pathological consequences, influencing aspects of endometriosis and reproductive tissue associated tumors. The review describes recent progress in LPA signaling research relevant to human and ruminant reproduction, pointing at the cow as a relevant model to study LPA influence on the human reproductive performance.
Role of leptin in female reproduction.
Pérez-Pérez, Antonio; Sánchez-Jiménez, Flora; Maymó, Julieta; Dueñas, José L; Varone, Cecilia; Sánchez-Margalet, Víctor
2015-01-01
Reproductive function is dependent on energy resources. The role of weight, body composition, fat distribution and the effect of diet have been largely investigated in experimental female animals as well as in women. Any alteration in diet and/or weight may induce abnormalities in timing of sexual maturation and fertility. However, the cellular mechanisms involved in the fine coordination of energy balance and reproduction are largely unknown. The brain and hypothalamic structures receive endocrine and/or metabolic signals providing information on the nutritional status and the degree of fat stores. Adipose tissue acts both as a store of energy and as an active endocrine organ, secreting a large number of biologically important molecules termed adipokines. Adipokines have been shown to be involved in regulation of the reproductive functions. The first adipokine described was leptin. Extensive research over the last 10 years has shown that leptin is not only an adipose tissue-derived messenger of the amount of energy stores to the brain, but also a crucial hormone/cytokine for a number of diverse physiological processes, such as inflammation, angiogenesis, hematopoiesis, immune function, and most importantly, reproduction. Leptin plays an integral role in the normal physiology of the reproductive system with complex interactions at all levels of the hypothalamic-pituitary gonadal (HPG) axis. In addition, leptin is also produced by placenta, where it plays an important autocrine function. Observational studies have demonstrated that states of leptin excess, deficiency, or resistance can be associated with abnormal reproductive function. This review focuses on the leptin action in female reproduction.
Crozier, G K D; Martin, Dominique
2012-04-01
One of the areas of concern raised by cross-border reproductive travel regards the treatment of women who are solicited to provide their ova or surrogacy services to foreign consumers. This is particularly troublesome in the context of developing countries where endemic poverty and low standards for both medical care and informed consent may place these women at risk of exploitation and harm. We explore two contrasting proposals for policy development regarding the industry, both of which seek to promote ethical outcomes and social justice: While one proposal advocates efforts to minimize cross-border demand for female reproductive resources through the pursuit of national self-sufficiency, the other defends cross-border trade as a means for meeting the needs of vulnerable groups. Despite the conflicting objectives of the proposed strategies, the paper identifies common values and points of agreement between the two, including the importance of regulations to safeguard those providing ova or surrogacy services. © 2012 Blackwell Publishing Ltd.
Talpur, H S; Chandio, I B; Brohi, R D; Worku, T; Rehman, Z; Bhattarai, D; Ullah, F; JiaJia, L; Yang, L
2018-04-16
Melatonin and its receptors play a crucial role in the regulation of the animal reproductive process, primarily in follicular development. However, the role that melatonin performs in regulating hormones related with reproduction remains unclear. Melatonin and its receptors are present both in female and male animals' organs, such as ovaries, heart, brain and liver. Melatonin regulates ovarian actions and is a key mediator of reproductive actions. Melatonin has numerous effects on animal reproduction, such as protection of gametes and embryos, response to clock genes, immune-neuroendocrine, reconciliation of seasonal variations in immune function, and silence or blockage of genes. The growth ratio of reproductive illnesses in animals has raised a remarkable concern for the government, animal caretakers and farm managers. In order to resolve this challenging issue, it is very necessary to conduct state-of-the-art research on melatonin and its receptors because melatonin has considerable physiognomies. This review article presents a current contemporary research conducted by numerous researchers from the entire world on the role of melatonin and its receptors in animal reproduction, from the year 1985 to the year 2017. Furthermore, this review shows scientific research challenges related to melatonin receptors and their explanations based on the findings of 172 numerous research articles, and also represents significant proficiencies of melatonin in order to show enthusiastic study direction for animal reproduction researchers. © 2018 The Authors. Reproduction in Domestic Animals Published by Blackwell Verlag GmbH.
Lindstrom, Laura J.
2002-01-01
In the last several years, there have been a number of advances in the area of assisted (or advanced) reproductive technology (ART) that are so fantastic that they strain the credulity of even those well-versed in medicine and science. Moreover, the potential medical, legal, psychological, and social repercussions of the applications of these technologies cause most people who hear about their use to worry somewhat about the ramifications. In fact, part of the general fear of these technologi...
Effects of environment on buffalo reproduction
Directory of Open Access Journals (Sweden)
W. G. Vale
2010-02-01
Full Text Available It has been long recognized that the environment has an important role to play in the regulation of the mammalian reproductive function. Environmental cues, such as changing day-light or increase temperature, are know to trigger off growth or regression of the reproductive organs in a whole variety of species and nutrition and stress can influence the onset of breeding and affect the fertility. Although the domestic buffalo (Bubalus bubalis has been since long time considered as a short-day-breeder polyestral seasonal animal, indeed in the tropical areas near of equator line they are polyestral continuous. It would seem that photoperiod has a marked influence in buffalo reproduction in determinate areas of the world, however in some tropical areas like in Brazil, mainly in the Amazon valley and areas nearest of the equator the light seems to have a minimal effect or no effect on the reproductive cues however the nutrition and heat stress measured throughout temperature/ humidity indexes (THI play an important role in the reproductive functions of buffaloes and it is suggested that THI >75 has a negative effect on reproductive performances of buffaloes. The calving season is regulated by the availability of native pasture in the floodplain or in areas of artificial pasture On the other hand when buffaloes are raised in the southwest and southern regions (parallels 14 to 33 South they show a typical seasonal pattern when the calving season are concentrated between de February to July. The body condition score (BCS seems to affect directly the fertility of female buffaloes since females that calve with a BCS < 2.5 show delayed postpartum ovulation, weak estrus symptoms and more service per conception rate. Seasonal anestrus is a normal phenomenon in the out breeding season that occur in areas near, upon or down of the Cancer and Capricorn lines, respectively, however the anoestrus can be overcame by the use of hormone to synchronize heat and
Kisspeptins and RFRP-3 act in concert to synchronize rodent reproduction with seasons
Directory of Open Access Journals (Sweden)
Valerie eSimonneaux
2013-02-01
Full Text Available Seasonal mammals use the photoperiodic variation in the nocturnal production of the pineal hormone melatonin to synchronize their reproductive activity with seasons. In rodents, the short day profile of melatonin secretion has long been proven to inhibit reproductive activity. Lately, we demonstrated that melatonin regulates the expression of the hypothalamic peptides kisspeptins (Kp and RFamide-related peptide-3 (RFRP-3, recently discovered as potent regulators of GnRH neuron activity. In the male Syrian hamster, Kp expression in the arcuate nucleus is down-regulated by melatonin independently of the inhibitory feedback of testosterone. A central or peripheral administration of Kp induces an increase in pituitary gonadotropins and gonadal hormone secretion, but most importantly a chronic infusion of the peptide reactivates the photoinhibited reproductive axis of Syrian hamsters kept in short day conditions. RFRP-3 expression in the dorsomedial hypothalamus is also strongly inhibited by melatonin in a short day photoperiod. Although RFRP-3 is usually considered as an inhibitory component of the gonadotropic axis, a central acute administration of RFRP-3 in the male Syrian hamster induces a marked increase in gonadotropin secretion and testosterone production. Furthermore, a chronic central infusion of RFRP-3 in short day-adapted hamsters reactivates the reproductive axis, in the same manner as Kp. Both Kp and RFRP-3 neurons project onto GnRH neurons and both neuropeptides regulate GnRH neuron activity. In addition, central RFRP-3 infusion was associated with a significant increase in arcuate Kp expression. However, the actual sites of action of both peptides in the Syrian hamster brain are still unknown. Altogether our findings indicate that Kp and RFRP neurons are pivotal relays for the seasonal regulation of reproduction, and also suggest that RFRP neurons might be the primary target of the melatoninergic message.
Kim, Ha Jeong; Chun, Min Ho; Kim, Hong Min; Kim, Bo Ryun
2013-08-01
To evaluate the effects of heel-opened ankle foot orthosis (HOAFO) on hemiparetic gait after stroke, especially on external foot rotation, and to compare the effects of HOAFO with conventional plastic-AFO (pAFO) and barefoot during gait. This cross-over observational study involved 15 hemiparetic patients with external rotation of the affected foot. All subjects were able to walk independently, regardless of their usual use of a single cane, and had a less than fair-grade in ankle dorsiflexion power. Each patient was asked to walk in three conditions with randomized sequences: 1) barefoot, 2) with a pAFO, and 3) with an HOAFO. Their gait patterns were analyzed using a motion analysis system. Fifteen patients consisted of nine males and six females. On gait analysis, hip and foot external rotation were significantly greater in pAFO (-3.35° and -23.68°) than in barefoot and HOAFO conditions (pexternal rotation compared with pAFO; although there was no significant difference between HOAFO and barefoot walking. Walking speed and percentage of single limb support were significantly greater for HOAFO than in barefoot walking. HOAFO was superior to pAFO in reducing hip and foot external rotation during the stance phase in patients with post-stroke hemiparesis. HOAFO may, therefore, be useful in patients with excessive external rotation of the foot during conventional pAFO.
Marketing of Assisted Human Reproduction and the Indian State
Shree Mulay; Emily Gibson
2006-01-01
Shree Mulay and Emily Gibson examine the factors responsible for the phenomenal growth of the private fee-for-service health sector in India and the industry related to Assisted Human Reproduction, its negative effect on the public health sector as well as the feeble attempts by the Indian state to regulate this industry, and its implications for women's reproductive rights and health. Development (2006) 49, 84–93. doi:10.1057/palgrave.development.1100311
Thyroid hormone actions on male reproductive system of teleost fish.
Tovo-Neto, Aldo; da Silva Rodrigues, Maira; Habibi, Hamid R; Nóbrega, Rafael Henrique
2018-04-17
Thyroid hormones (THs) play important roles in the regulation of many biological processes of vertebrates, such as growth, metabolism, morphogenesis and reproduction. An increasing number of studies have been focused on the involvement of THs in the male reproductive system of vertebrates, in particular of fish. Therefore, this mini-review aims to summarize the main findings on THs role in male reproductive system of fish, focusing on sex differentiation, testicular development and spermatogenesis. The existing data in the literature have demonstrated that THs exert their roles at the different levels of the hypothalamic-pituitary-gonadal (HPG) axis. In general a positive correlation has been shown between THs and fish reproductive status; where THs are associated with testicular development, growth and maturation. Recently, the molecular mechanisms underlying the role of THs in spermatogenesis have been unraveled in zebrafish testis. THs promote germ cell proliferation and differentiation by increasing a stimulatory growth factor of spermatogenesis produced by Sertoli cells. In addition, THs enhanced the gonadotropin-induced androgen release in zebrafish testis. Next to their functions in the adult testis, THs are involved in the gonadal sex differentiation through modulating sex-related gene expression, and testicular development via regulation of Sertoli cell proliferation. In conclusion, this mini-review showed that THs modulate the male reproductive system during the different life stages of fish. The physiological and molecular mechanisms showed a link between the thyroid and reproduction, suggesting a possibly co-evolution and interdependence of these two systems. Copyright © 2018 Elsevier Inc. All rights reserved.
Kerkum, Yvette L; Buizer, Annemieke I; van den Noort, Josien C; Becher, Jules G; Harlaar, Jaap; Brehm, Merel-Anne
2015-01-01
Rigid Ankle-Foot Orthoses (AFOs) are commonly prescribed to counteract excessive knee flexion during the stance phase of gait in children with cerebral palsy (CP). While rigid AFOs may normalize knee kinematics and kinetics effectively, it has the disadvantage of impeding push-off power. A spring-like AFO may enhance push-off power, which may come at the cost of reducing the knee flexion less effectively. Optimizing this trade-off between enhancing push-off power and normalizing knee flexion in stance is expected to maximize gait efficiency. This study investigated the effects of varying AFO stiffness on gait biomechanics and efficiency in children with CP who walk with excessive knee flexion in stance. Fifteen children with spastic CP (11 boys, 10±2 years) were prescribed with a ventral shell spring-hinged AFO (vAFO). The hinge was set into a rigid, or spring-like setting, using both a stiff and flexible performance. At baseline (i.e. shoes-only) and for each vAFO, a 3D-gait analysis and 6-minute walk test with breath-gas analysis were performed at comfortable speed. Lower limb joint kinematics and kinetics were calculated. From the 6-minute walk test, walking speed and the net energy cost were determined. A generalized estimation equation (ppush-off power did not lead to greater reductions in walking energy cost. These findings suggest that, in this specific group of children with spastic CP, the vAFO stiffness that maximizes gait efficiency is primarily determined by its effect on knee kinematics and kinetics rather than by its effect on push-off power. Dutch Trial Register NTR3418.
Directory of Open Access Journals (Sweden)
Tracie L. Wilson
2016-12-01
Full Text Available This article examines assisted reproduction policy and practices in Germany and Poland. Germany is among the most restrictive countries in the European Union (EU with respect to assisted reproductive technologies. In contrast, Poland only recently passed legislation regulating assisted reproductive technologies. Before this, most practices were unregulated, despite vocal opposition to all forms of IVF from conservative Roman Catholic activists. Germany and Poland differ significantly regarding the cultural narratives and historical experience that impact attitudes toward reproduction. In Germany, discussions on assisted reproduction often invoke concerns about medical intervention in ethically complex matters, due – in part – to the country’s National Socialist past. My objectives in this article centre on examining assisted reproduction contexts in each of these two countries, with attention to the framing of debates on reproduction, the anxieties that inform them, and the resulting paradoxes. I consider the unintended consequences of domestic policy and their importance regarding cross-border reproductive care (CBRC. Within the borderless EU, the widespread practice of CBRC demonstrates the ineffectiveness of national policies. Moreover, this shift in location can impact practices and trends found in other accessible, but less restrictive countries. Of particular concern are the relocation of risk to ‘bioavailable’ populations in less affluent countries and the reification of cultural and socio-economic hierarchies.
Changing reproductive effort within a semelparous reproductive episode.
Hughes, P William; Simons, Andrew M
2014-08-01
• Life-history theory predicts a trade-off between current and future reproduction for iteroparous organisms-as individuals age, the expected value of future reproduction declines, and thus reproductive effort is expected to be higher in later clutches than in earlier. In contrast, models explaining the evolution of semelparity treat semelparous reproduction as instantaneous, with no scope for intraindividual variation. However, semelparous reproduction is also extended, but over shorter time scales; whether there are similar age- or stage-specific changes in reproductive effort within a semelparous episode is unclear. In this study, we assessed whether semelparous individuals increase reproductive effort as residual reproductive value declines by comparing the reproductive phenotype of flowers at five different floral positions along a main inflorescence.• Using the herbaceous monocarp Lobelia inflata, we conducted a longitudinal study of 409 individuals including both laboratory and field populations over three seasons. We recorded six reproductive traits-including the length of three phenological intervals as well as fruit size, seed size, and seed number-for all plants across floral positions produced throughout the reproductive episode.• We found that while the rate of flower initiation did not change, flowers at distal (late) floral positions developed more quickly and contained larger seed than flowers at basal (early) floral positions did.• Our results were consistent with the hypothesis that, like iteroparous organisms, L. inflata increases reproductive effort in response to low residual reproductive value. © 2014 Botanical Society of America, Inc.
The role of leptin in nutritional status and reproductive function.
Keisler, D H; Daniel, J A; Morrison, C D
1999-01-01
Infertility associated with suboptimal nutrition is a major concern among livestock producers. Undernourished prepubertal animals will not enter puberty until they are well fed; similarly, adult, normally cyclic females will stop cycling when faced with extreme undernutrition. Work in our laboratory has focused on how body fat (or adiposity) of an animal can communicate to the brain and regulate reproductive competence. In 1994, the discovery in rodents of the obese (ob) gene product leptin, secreted as a hormone from adipocytes, provided a unique opportunity to understand and hence regulate whole body compositional changes. There is now evidence that similar mechanisms are functioning in livestock species in which food intake, body composition, and reproductive performance are of considerable economic importance. Leptin has been reported to be a potent regulator of food intake and reproduction in rodents. There is evidence indicating that at least some of the effects of leptin occur through receptor-mediated regulation of the hypothalamic protein neuropeptide Y (NPY). NPY is a potent stimulator of food intake, is present at high concentrations in feed-restricted cattle and ewes, and is an inhibitor of LH secretion in these livestock species. In our investigations in sheep, we have cloned a partial cDNA corresponding to the ovine long-form leptin receptor, presumably the only fully active form, and have localized the long-form leptin receptor in the ventromedial and arcuate nuclei of the hypothalamus. Leptin receptor mRNA expression was colocalized with NPY mRNA-containing cell bodies in those regions. We have also determined that hypothalamic leptin receptor expression is greater in feed-restricted ewes than in well-fed ewes. These observations provide a foundation for future investigations into the nutritional modulators of reproduction in livestock.
Malvasi, A; Signore, F; Napoletano, S; Bruti, V; Sestili, C; Di Luca, N M
2017-01-01
More than ten years after law n. 40 of February 19, 2004 became effective, regulation on medically assisted reproduction has dramatically changed outlook. The authors report on the steps that led to these changes through Courts' rulings, the Supreme Court's verdicts and the European Court of Human Rights' decisions, as well as ministerial regulations and guidelines concerning medically assisted reproduction. The aforementioned jurisprudential evolution was set to reach a new balance between the embryo's right to its own dignity and the woman's right to health and freedom of self-determination in reproduction. No court ruling denies that embryos have also to be safeguarded. In fact, there are still numerous prohibitions, including using embryos for experimental purposes. Judges aim primarily at avoiding that embryos' rights overcome the right to parenthood. The authors review the legislation of the various European countries: some have adopted a legislation to regulate medically assisted reproduction, while others have developed in this field some recommendations or guidelines. This is why they call for enactment of a European law governing the implementation/operational methods of medically assisted reproduction in order to avoid the scourge of procreative tourism to countries that have a more permissive law.
A link between hypothyroidism, obesity and male reproduction.
Aiceles, Veronica; da Fonte Ramos, Cristiane
2016-01-01
Hypothyroidism is a condition in which the serum levels of thyroid hormones are below that necessary to carry out physiological functions in the body. Hypothyroidism is related to obesity as an increase in body weight gain is seen in hypothyroid patients. Moreover, an inverse correlation between free thyroxine values and body mass index has been reported. Leptin, a polypeptide hormone produced by adipocytes, was originally thought to be an antiobesity hormone due its anorexic effects on hypothalamic appetite regulation. However, nowadays it is known that leptin conveys information about the nutritional status to the brain being considered a crucial endocrine factor for regulating several physiological processes including reproduction. Since the identification of thyroid hormone and leptin receptors on the testes, these hormones are being recognized as having important roles in male reproductive functions. A clear link exists among thyroid hormones, leptin and reproduction. Both hormones can negatively affect spermatogenesis and consequently may cause male infertility. The World Health Organization (WHO) estimates the overall prevalence of primary infertility ranging from 8 to 15%. The fact that 30% of couples' inability to conceive is related to a male factor and that the longer hypothyroidism persisted, the greater the damage to the testes, strongly suggest that more studies attempting to clarify both hormones actions directly in the testes need to be conducted specially in cases of congenital hypothyroidism. Therefore, the goal of this review is to highlight the relationship of such hormones in the reproductive system.
Zulu, Victor Chisha; Nakao, Toshihiko; Sawamukai, Yutaka
2002-08-01
The current review aims to establish insulin-like growth factor-1 (IGF-I) as the factor that signals nutritional status to the reproductive axis, and show that assessment of IGF-I in blood early postpartum during the negative energy balance (NEB) period could be used to predict both nutritional and reproductive status in dairy cattle. The review also explores the effect of nutritional status on circulating IGF-I concentrations and the endocrine role of IGF-I on the reproductive axis. IGF-I plays an important role in gonadotropin-induced folliculogenesis, ovarian steroidogenesis and corpus luteum (CL) function. It also modulates pituitary and hypothalamus function. IGF-I clearly has an endocrine role on the reproductive axis. Severe under nutrition significantly reduces plasma IGF-I concentrations. During the critical period of NEB in high yielding dairy cattle early postpartum, IGF-I concentrations are low in blood and its levels are positively correlated to energy status and reproductive function during this period. Changes in circulating IGF-I immediately postpartum may help predict both nutritional and reproductive status in dairy cattle. IGF-I is therefore one of the long sought factors that signal nutritional status to the reproductive axis.
Reproduction in eusocial bees (Apidae: Apini, Meliponini)
Chinh, T.X.
2004-01-01
This thesis presents some key aspects of the regulation and the mechanisms of colony reproduction in honeybees and stingless bees. Special attention is paid to key questions about how the production of males, gynes and swarms takes place, and what intranidal and extranidal factors are related to
Bovine reproduction in tropical environment
International Nuclear Information System (INIS)
Jimenez Lopez, J.
2001-01-01
In this document it has met relating data to the reproduction of bovine and their handling for the man that it can serve as norms to judge reproductive efficiency but always view in the aspect of the nutritious, climatic circumstances and of handling under which met. Under the previous description one can say that the fertility is the resultant of the interaction among the inheritance, the means and the handling, they vary in particular for each region and property. The fertility can be good, regulate or bad in the measure in that the factors that intervene. The environmental effect on the reproductive processes of the cow represents 80 percent of the variation factors and they include climate, effect of the light, effect of the temperature, effect of the nutritious contribution, effect of psychological factors: the loss of the tendency to the seasonal reproduction is in fact an answer from the animals to its association with the man. The influence of the environment and the feeding of the animals are more intense in the females than in the males, being evidenced that the reproduction control is under the influence hormonal joint with the nutrition. An appropriate nutrition is prerequisite for the beginning of the sexual maturation with an appropriate weight and corporal condition. It is also described the effect and the relationship of the energy contribution about the fertility, the restart of the ovarian activity, its cause of the continuation of the interval childbirth-conception, silent ovulation, organic ancestry and interval among childbirths
Reimegård, Johan; Kundu, Snehangshu; Pendle, Ali; Irish, Vivian F; Shaw, Peter; Nakayama, Naomi; Sundström, Jens F; Emanuelsson, Olof
2017-04-07
Co-expression of physically linked genes occurs surprisingly frequently in eukaryotes. Such chromosomal clustering may confer a selective advantage as it enables coordinated gene regulation at the chromatin level. We studied the chromosomal organization of genes involved in male reproductive development in Arabidopsis thaliana. We developed an in-silico tool to identify physical clusters of co-regulated genes from gene expression data. We identified 17 clusters (96 genes) involved in stamen development and acting downstream of the transcriptional activator MS1 (MALE STERILITY 1), which contains a PHD domain associated with chromatin re-organization. The clusters exhibited little gene homology or promoter element similarity, and largely overlapped with reported repressive histone marks. Experiments on a subset of the clusters suggested a link between expression activation and chromatin conformation: qRT-PCR and mRNA in situ hybridization showed that the clustered genes were up-regulated within 48 h after MS1 induction; out of 14 chromatin-remodeling mutants studied, expression of clustered genes was consistently down-regulated only in hta9/hta11, previously associated with metabolic cluster activation; DNA fluorescence in situ hybridization confirmed that transcriptional activation of the clustered genes was correlated with open chromatin conformation. Stamen development thus appears to involve transcriptional activation of physically clustered genes through chromatin de-condensation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
REPRODUCTIVE SEASONALITY AND ITS CONTROL IN SPANISH SHEEP AND GOATS
Directory of Open Access Journals (Sweden)
Amelia Gómez Brunet
2011-12-01
Full Text Available Sheep and goat breeds from subtropical, middle and high latitudes show seasonal changes in reproductive activity. In general, the breeding season starts in autumn and ends in winter, with anoestrus in spring/summer. An endogenous circannual rhythm driven and synchronised by the annual photoperiod cycle regulates the onset and offset of the breeding season. However, the timing and duration of the breeding season can be affected by interactions between the photoperiod and factors such as breed, geographical origin, nutritional and lactational status, social interactions, and the season of parturition. Seasonality in reproduction is naturally accompanied by variation in the availability and price of meat, milk and cheese over the year, affecting the economy of farmers, consumers and the food industry alike. The control of reproduction outside the normal breeding season by inducing and synchronizing oestrus and ovulation plus the use of artificial insemination and/or natural mating would help ensure the year-round availability of products. This review describes the seasonal variation in the sexual activity of ovine and caprine species with special regard to local Spanish sheep and goats breeds, examines how the photoperiod regulates their annual reproductive cycle, and discusses a number of strategies that can be used to induce and synchronise ovulation outside the natural breeding season.
Roles of autophagy in male reproductive development in plants
Directory of Open Access Journals (Sweden)
Shigeru eHanamata
2014-09-01
Full Text Available Autophagy, a major catabolic pathway in eukaryotic cells, is essential in development, maintenance of cellular homeostasis, immunity and programmed cell death (PCD in multicellular organisms. In plant cells, autophagy plays roles in recycling of proteins and metabolites including lipids, and is involved in many physiological processes such as abiotic and biotic stress responses. However, its roles during reproductive development had remained poorly understood. Quantitative live cell imaging techniques for the autophagic flux and genetic studies in several plant species have recently revealed significant roles of autophagy in developmental processes, regulation of PCD and lipid metabolism. We here review the novel roles of autophagic fluxes in plant cells, and discuss their possible significance in PCD and metabolic regulation, with particular focus on male reproductive development during the pollen maturation.
Provision of assisted reproductive technology for single women in China: a new challenge.
Zhou, Ling Jing
2004-01-01
Following the enactment of the Jilin Regulation, single women, for the first time, are allowed to access assisted reproductive services in China. This paper is intended to analyze the arguments over whether single women are entitled to access assisted reproductive services, in relation to Chinese legal, ethical and social characteristics.
Reproductive rights approach to reproductive health in developing countries
Directory of Open Access Journals (Sweden)
Vijayan K. Pillai
2011-12-01
Full Text Available Research on reproductive health in developing countries focuses mostly on the role of economic development on various components of reproductive health. Cross-sectional and empirical research studies in particular on the effects of non-economic factors such as reproductive rights remain few and far between.This study investigates the influence of two components of an empowerment strategy, gender equality, and reproductive rights on women's reproductive health in developing countries. The empowerment strategy for improving reproductive health is theoretically situated on a number of background factors such as economic and social development.Cross-national socioeconomic and demographic data from a number of international organizations on 142 developing countries are used to test a model of reproductive rights and reproductive health.The findings suggest that both economic and democratic development have significant positive effects on levels of gender equality. The level of social development plays a prominent role in promoting reproductive rights. It is found that reproductive rights channel the influences of social structural factors and gender equality on reproductive health.
Reproductive rights approach to reproductive health in developing countries.
Pillai, Vijayan K; Gupta, Rashmi
2011-01-01
Research on reproductive health in developing countries focuses mostly on the role of economic development on various components of reproductive health. Cross-sectional and empirical research studies in particular on the effects of non-economic factors such as reproductive rights remain few and far between. This study investigates the influence of two components of an empowerment strategy, gender equality, and reproductive rights on women's reproductive health in developing countries. The empowerment strategy for improving reproductive health is theoretically situated on a number of background factors such as economic and social development. Cross-national socioeconomic and demographic data from a number of international organizations on 142 developing countries are used to test a model of reproductive rights and reproductive health. The findings suggest that both economic and democratic development have significant positive effects on levels of gender equality. The level of social development plays a prominent role in promoting reproductive rights. It is found that reproductive rights channel the influences of social structural factors and gender equality on reproductive health.
Reproductive neuroendocrine pathways of social behavior
Directory of Open Access Journals (Sweden)
Ishwar eParhar
2016-03-01
Full Text Available Social behaviors are key components of reproduction because they are essential for successful fertilization. Social behaviors such as courtship, mating, and aggression are strongly associated with sex steroids, such as testosterone, estradiol and progesterone. Secretion of sex steroids from the gonads is regulated by the hypothalamus-pituitary-gonadal (HPG axis in vertebrates. Gonadotropin-releasing hormone (GnRH is a pivotal hypothalamic neuropeptide that stimulates gonadotropin release from the pituitary. In recent years, the role of neuropeptides containing the C-terminal Arg-Phe-NH2 (RFamide peptides has been emphasized in vertebrate reproduction. In particular, two key RFamide peptides, kisspeptin and gonadotropin-inhibitory hormone (GnIH, emerged as critical accelerator and suppressor of gonadotropin secretion. Kisspeptin stimulates GnRH release by directly acting on GnRH neurons, whereas GnIH inhibits gonadotropin release by inhibiting kisspeptin or GnRH neurons or pituitary gonadotropes. These neuropeptides can regulate social behavior by regulating the HPG axis. However, distribution of neuronal fibers of GnRH, kisspeptin and GnIH neurons are not limited within the hypothalamus, and the existence of extra-hypothalamic neuronal fibers suggests direct control of social behavior within the brain. It has traditionally been shown that central administration of GnRH can stimulate female sexual behavior in rats. Recently, it was shown that Kiss1, one of the paralogs of kisspeptin peptide family, regulates fear responses in zebrafish and GnIH inhibits socio-sexual behavior in birds. Here we highlight recent findings regarding the role of GnRH, kisspeptin and GnIH in the regulation of social behaviors in fish, birds and mammals and discuss their importance in future biological and biomedical research.
Toward a gender-sensitive assisted reproduction policy.
Donchin, Anne
2009-01-01
The recent case of the UK woman who lost her legal struggle to be impregnated with her own frozen embryos, raises critical issues about the meaning of reproductive autonomy and the scope of regulatory practices. I revisit this case within the context of contemporary debate about the moral and legal dimensions of assisted reproduction. I argue that the gender neutral context that frames discussion of regulatory practices is unjust unless it gives appropriate consideration to the different positions women and men occupy in relation to reproductive processes and their options for autonomous choice. First, I consider relevant legal rulings, media debate, and scholarly commentary. Then I discuss the concept of reproductive autonomy imbedded in this debate. I argue that this concept conflates informed consent and reproductive autonomy, thereby providing an excessively narrow reading of autonomy that fails to give due regard to relations among individuals or the social, political and economic environment that shapes their options. I contrast this notion of autonomy with feminist formulations that seek to preserve respect for the agency of individuals without severing them from the conditions of their embodiment, their surrounding social relationships, or the political contexts that shape their options. Taking these considerations into account I weigh the advantages of regulation over the commercial market arrangement that prevails in some countries and suggest general guidelines for a regulatory policy that would more equitably resolve conflicting claims to reproductive autonomy.
Environmental Hexachlorobenzene exposure and human male reproductive function
DEFF Research Database (Denmark)
Specht, Ina Olmer; Bonde, Jens Peter Ellekilde; Toft, Gunnar
2015-01-01
Hexachlorobenzene (HCB) is a persistent environmental fungicide that may disrupt androgen regulation. The aim of this study was to investigate associations between HCB levels and biomarkers of male reproductive function. 589 Spouses of pregnant women from Greenland, Poland and Ukraine were enroll...
Benagiano, Giuseppe; d'Arcangues, Catherine; Harris Requejo, Jennifer; Schafer, Alessandra; Say, Lale; Merialdi, Mario
2012-01-01
The Special Programme of Research in Human Reproduction (HRP), co-sponsored by the UNDP, UNFPA, WHO, and the World Bank, is celebrating 40 years of activities with an expansion of its mandate and new co-sponsors. When it began, in 1972, the main focus was on evaluating the acceptability, effectiveness, and safety of existing fertility-regulating methods, as well as developing new, improved modalities for family planning. In 1994, HRP not only made major contributions to the Plan of Action of the International Conference on Population and Development (ICPD); it also broadened its scope of work to include other aspects of health dealing with sexuality and reproduction, adding a specific perspective on gender issues and human rights. In 2002, HRP's mandate was once again broadened to include sexually transmitted infections and HIV/AIDS and in 2003 it was further expanded to research activities on preventing violence against women and its many dire health consequences. Today, the work of the Programme includes research on: the sexual and reproductive health of adolescents, women, and men; maternal and perinatal health; reproductive tract and sexually transmitted infections (including HIV/AIDS); family planning; infertility; unsafe abortion; sexual health; screening for cancer of the cervix in developing countries, and gender and reproductive rights. Additional activities by the Programme have included: fostering international cooperation in the field of human reproduction; the elaboration of WHO's first Global Reproductive Health Strategy; work leading to the inclusion of ICPD's goal 'reproductive health for all by 2015' into the Millennium Development Goal framework; the promotion of critical interagency statements on the public health, legal, and human rights implications of female genital mutilation and gender-biased sex selection. Finally, HRP has been involved in the creation of guidelines and tools, such as the 'Medical eligibility criteria for contraceptive use
Pinto, P; Velez, Z; Sousa, C; Santos, S; Andrade, A; Alvarado, M V; Felip, A; Zanuy, S; Canário, A V M
2017-09-01
The neuropeptide galanin (Gal) is a putative factor regulating puberty onset and reproduction through its actions on the pituitary. The present study investigated the pituitary responsiveness to galanin and the patterns of galanin receptors (Galrs) expression throughout the reproductive cycle of two years old male European sea bass (Dicentrarchus labrax), an important aquaculture species. Quantitative analysis of pituitary and hypothalamus transcript expression of four galr subtypes revealed differential regulation according to the testicular developmental stage, with an overall decrease in expression from the immature stage to the mid-recrudescence stage. Incubation of pituitary cells with mammalian 1-29Gal peptide induced significant changes in cAMP concentration, with sensitivities that varied according to the testicular development stages. Furthermore 1-29Gal was able to stimulate both follicle stimulating hormone (Fsh) and luteinizing hormone (Lh) release from pituitary cell suspensions. The magnitude of the effects and effective concentrations varied according to reproductive stage, with generalized induction of Fsh and Lh release in animals sampled in January (full spermiation). The differential expression of galrs in pituitary and hypothalamus across the reproductive season, together with the differential effects of Gal on gonadotropins release in vitro strongly suggests the involvement of the galaninergic system in the regulation the hypothalamus-pituitary-gonad axis of male sea bass. This is to our knowledge the first clear evidence for the involvement of galanin in the regulation of reproduction in non-mammalian vertebrates. Copyright © 2017 Elsevier Inc. All rights reserved.
Ethics and regulation of inter-country medically assisted reproduction: a call for action.
Shalev, Carmel; Moreno, Adi; Eyal, Hedva; Leibel, Michal; Schuz, Rhona; Eldar-Geva, Talia
2016-01-01
The proliferation of medically assisted reproduction (MAR) for the treatment of infertility has brought benefit to many individuals around the world. But infertility and its treatment continue to be a cause of suffering, and over the past decade, there has been a steady growth in a new global market of inter-country medically assisted reproduction (IMAR) involving 'third-party' individuals acting as surrogate mothers and gamete donors in reproductive collaborations for the benefit of other individuals and couples who wish to have children. At the same time there is evidence of a double standard of care for third-party women involved in IMAR, violations of human rights of children and women, and extreme abuses that are tantamount to reproductive trafficking. This paper is the report of an inter-disciplinary working group of experts who convened in Israel to discuss the complex issues of IMAR. In Israel too IMAR practices have grown rapidly in recent years, mainly because of restrictions on access to domestic surrogacy for same sex couples and a chronically insufficient supply of egg cells for the treatment of couples and singles in need. Drawing upon local expertise, the paper describes documented practices that are harmful, suggests principles of good practice based on an ethic of care, and calls for action at the international, national and professional levels to establish a human rights based system of international governance for IMAR based on three regulatory models: public health monitoring, inter-country adoption, and trafficking in human beings, organs and tissues.
Energy Technology Data Exchange (ETDEWEB)
Yin, Li [Institute of Toxicology, College of Preventive Medicine, Third Military Medical University, Chongqing 400038 (China); Dai, Yanlin [Institute of Toxicology, College of Preventive Medicine, Third Military Medical University, Chongqing 400038 (China); Medical Laboratory Technology Department, Chuxiong Medical College, Yunnan 675005 (China); Cui, Zhihong; Jiang, Xiao; Liu, Wenbin; Han, Fei; Lin, Ao; Cao, Jia [Institute of Toxicology, College of Preventive Medicine, Third Military Medical University, Chongqing 400038 (China); Liu, Jinyi, E-mail: jinyiliutmmu@163.com [Institute of Toxicology, College of Preventive Medicine, Third Military Medical University, Chongqing 400038 (China)
2017-01-01
Bisphenol A (2,2-bis(4-hydroxyphenyl)propane, BPA) is ubiquitous in the environment, wildlife, and humans. Evidence from past studies suggests that BPA is associated with decreased semen quality. However, the molecular basis for the adverse effect of BPA on male reproductive toxicity remains unclear. We evaluated the effect of BPA on mouse spermatocytes GC-2 cells and adult mice, and we explored the potential mechanism of its action. The results showed that BPA inhibited cell proliferation and increased the apoptosis rate. The testes from BPA-treated mice showed fewer spermatogenic cells and sperm in the seminiferous tubules. In addition, BPA caused reactive oxygen species (ROS) accumulation. Previous study has verified that mitochondrion was the organelle affected by the BPA-triggered ROS accumulation. We found that BPA induced damage to the endoplasmic reticulum (ER) in addition to mitochondria, and most ER stress-related proteins were activated in cellular and animal models. Knocking down of the PERK/EIF2α/chop pathway, one of the ER stress pathways, partially recovered the BPA-induced cell apoptosis. In addition, an ROS scavenger attenuated the expression of the PERK/EIF2α/chop pathway-related proteins. Taken together, these data suggested that the ROS regulated PERK/EIF2α/chop pathway played a vital role in BPA-induced male reproductive toxicity. - Highlights: • BPA exposure caused the damage of the endoplasmic reticulum. • BPA exposure activated ER stress related proteins in male reproductive system. • ROS regulated PERK/EIF2α/chop pathway played a vital role in BPA-induced toxicity.
Effects of melatonin and prolactin in reproduction: review of literature
Tenorio, Fernanda das Chagas Angelo Mendes; Simões, Manuel de Jesus; Teixeira, Valéria Wanderley; Teixeira, Álvaro Aguiar Coelho
2015-01-01
Summary The pineal gland is responsible for producing a hormone called melatonin (MEL), and is accepted as the gland that regulates reproduction in mammals. Prolactin (PRL) also exhibits reproductive activity in animals in response to photoperiod. It is known that the concentrations of PRL are high in the summer and reduced during winter, the opposite of what is seen with melatonin in these seasons. In placental mammals, both prolactin and melatonin affect implantation, which is considered a ...
Effects of fluctuating temperature and food availability on reproduction and lifespan
Schwartz, Tonia S.; Pearson, Phillip; Dawson, John; Allison, David B.; Gohlke, Julia M.
2016-01-01
Experimental studies on energetics and aging often remove two major factors that in part regulate the energy budget in a normal healthy individual: reproduction and fluctuating environmental conditions that challenge homeostasis. Here we use the cyclical parthenogenetic Daphnia pulex to evaluate the role of a fluctuating thermal environment on both reproduction and lifespan across six food concentrations. We test the hypotheses that (1) caloric restriction extends lifespan; (2) maximal reprod...
Effects of dietary omega-3/omega-6 fatty acid ratios on reproduction in the young breeder rooster.
Feng, Yun; Ding, Yu; Liu, Juan; Tian, Ye; Yang, Yanzhou; Guan, Shuluan; Zhang, Cheng
2015-03-21
Polyunsaturated fatty acids (PUFAs) are necessary for the body's metabolism, growth and development. Although PUFAs play an important role in the regulation of reproduction, their role in testis development in the rooster is unknown. The present study was conducted to investigate the effects of omega-3/omega-6 (n-3/n-6, PUFAs) ratios on reproductive performance in young breeder roosters. Plasma levels of reproductive hormones, testis development, and reproductive hormone receptor and StAR mRNA expression were also assessed. Although PUFAs (n-3/n-6: 1/4.15) had no significant effect on the testis index (P > 0.05), the spermatogonial development and germ cell layers were increased. Moreover, serum levels of hormones (GnRH, FSH, LH and T) on day 35 were also significantly increased by PUFAs (n-3/n-6: 1/4.15). To investigate whether PUFAs regulate the expression of hormone receptors and StAR, real time-PCR was used to measure GnRHR, FSHR, LHR and StAR mRNA levels. PUFAs significantly increased the mRNA levels of all of these genes. These results indicate that PUFAs enhance the reproductive performance of young roosters by increasing hormone secretion and function, the latter by up-regulating receptor expression. These findings provide a sound basis for a balanced n-3/n-6 PUFA ratio being beneficial to young rooster reproduction.
Reproductive rights approach to reproductive health in developing countries
Pillai, Vijayan Kumara; Gupta, Rashmi
2011-01-01
Background: Research on reproductive health in developing countries focuses mostly on the role of economic development on various components of reproductive health. Cross-sectional and empirical research studies in particular on the effects of non-economic factors such as reproductive rights remain few and far between. Objective: This study investigates the influence of two components of an empowerment strategy, gender equality, and reproductive rights on women’s reproductive health in develo...
Reproductive Rights and Women’s Freedom. Remarks on the Feminist Debate
Directory of Open Access Journals (Sweden)
Isabel Fanlo Cortés
2017-07-01
Full Text Available This article seeks to contribute to the issue of reproductive rights, assuming for the analysis the perspective of the contemporary Western feminist debate. Notwithstanding the variety of approaches and positions that find expression in the scope of such a debate, emphasis is given to the convergent interest of the most recent feminist bioethical discussion in the subject of legal regulation that the States predict, both in relation to the use of certain Reproductive technologies, and the exercise of other reproductive rights, as well as the value premises that underpin these policies and their effects on the lives of women. Finally, in the light of the recent transformations of the modalities of public control over reproductive choices, some challenges will be identified that fall on contemporary feminisms.
DEFF Research Database (Denmark)
Henningsen, Jo B.; Ancel, Caroline; Mikkelsen, Jens D.
2017-01-01
In females, reproductive activity relies on proper integration of daily and environmental changes as well as cyclic sex-steroid feedback. This study sought to investigate the role of the hypothalamic Arg-Phe amide-related peptide (RFRP)-3 in the daily and seasonal control of reproductive activity...... alongside kisspeptin neurons, are essential for proper synchronization of reproductive activity with the time of the day, the stage of the estrous cycle, and the seasonal changes in photoperiod....
Similarities between Reproductive and Immune Pistil Transcriptomes of Arabidopsis Species.
Mondragón-Palomino, Mariana; John-Arputharaj, Ajay; Pallmann, Maria; Dresselhaus, Thomas
2017-07-01
Independent lines of evidence suggest that members from ancient and polymorphic gene families such as defensins and receptor-like kinases mediate intercellular communication during both the immune response and reproduction. Here, we report a large-scale analysis to investigate the extent of overlap between these processes by comparing differentially expressed genes (DEGs) in the pistil transcriptomes of Arabidopsis thaliana and Arabidopsis halleri during self-pollination and interspecific pollination and during infection with Fusarium graminearum In both Arabidopsis species, the largest number of DEGs was identified in infected pistils, where genes encoding regulators of cell division and development were most frequently down-regulated. Comparison of DEGs between infection and various pollination conditions showed that up to 79% of down-regulated genes are shared between conditions and include especially defensin-like genes. Interspecific pollination of A. thaliana significantly up-regulated thionins and defensins. The significant overrepresentation of similar groups of DEGs in the transcriptomes of reproductive and immune responses of the pistil makes it a prime system in which to study the consequences of plant-pathogen interactions on fertility and the evolution of intercellular communication in pollination. © 2017 American Society of Plant Biologists. All Rights Reserved.
Directory of Open Access Journals (Sweden)
Kian-Hong Ng
2009-11-01
Full Text Available The Arabidopsis homeotic protein AGAMOUS (AG, a MADS domain transcription factor, specifies reproductive organ identity during flower development. Using a binding assay and expression analysis, we identified a direct target of AG, GIANT KILLER (GIK, which fine-tunes the expression of multiple genes downstream of AG. The GIK protein contains an AT-hook DNA binding motif that is widely found in chromosomal proteins and that binds to nuclear matrix attachment regions of DNA elements. Overexpression and loss of function of GIK cause wide-ranging defects in patterning and differentiation of reproductive organs. GIK directly regulates the expression of several key transcriptional regulators, including ETTIN/AUXIN RESPONSE FACTOR 3 (ETT/ARF3 that patterns the gynoecium, by binding to the matrix attachment regions of target promoters. Overexpression of GIK causes a swift and dynamic change in repressive histone modification in the ETT promoter. We propose that GIK acts as a molecular node downstream of the homeotic protein AG, regulating patterning and differentiation of reproductive organs through chromatin organization.
Desloovere, Kaat; Molenaers, Guy; Van Gestel, Leen; Huenaerts, Catherine; Van Campenhout, Anja; Callewaert, Barbara; Van De Walle, Patricia; Seyler, J
2006-01-01
Several studies indicated that walking with an ankle foot orthosis (AFO) impaired third rocker. The purpose of this study was to evaluate the effects of two types of orthoses, with similar goal settings, on gait, in a homogeneous group of children, using both barefoot and shoe walking as control conditions. Fifteen children with hemiplegia, aged between 4 and 10 years, received two types of individually tuned AFOs: common posterior leaf-spring (PLS) and Dual Carbon Fiber Spring AFO (CFO) (wit...
Neuroendocrine regulation of gonadotropin secretion in seasonally breeding birds
Directory of Open Access Journals (Sweden)
Takayoshi eUbuka
2013-03-01
Full Text Available Seasonally breeding birds detect environmental signals, such as light, temperature, food availability and presence of mates to time reproduction. Hypothalamic neurons integrate external and internal signals, and regulate reproduction by releasing neurohormones to the pituitary gland. The pituitary gland synthesizes and releases gonadotropins which in turn act on the gonads to stimulate gametogenesis and sex steroid secretion. Accordingly, how gonadotropin secretion is controlled by the hypothalamus is key to our understanding of the mechanisms of seasonal reproduction. A hypothalamic neuropeptide, gonadotropin-releasing hormone (GnRH, activates reproduction by stimulating gonadotropin synthesis and release. Another hypothalamic neuropeptide, gonadotropin-inhibitory hormone (GnIH, inhibits gonadotropin synthesis and release directly by acting on the pituitary gland or indirectly by decreasing the activity of GnRH neurons. Therefore, the next step to understand seasonal reproduction is to investigate how the activities of GnRH and GnIH neurons in the hypothalamus and their receptors in the pituitary gland are regulated by external and internal signals. It is possible that locally-produced triiodothyronine resulting from the action of type 2 iodothyronine deiodinase on thyroxine stimulates the release of gonadotropins, perhaps by action on GnRH neurons. The function of GnRH neurons is also regulated by transcription of the GnRH gene. Melatonin, a nocturnal hormone, stimulates the synthesis and release of GnIH and GnIH may therefore regulate a daily rhythm of gonadotropin secretion. GnIH may also temporally suppress gonadotropin secretion when environmental conditions are unfavorable. Environmental and social milieus fluctuate seasonally in the wild. Accordingly, complex interactions of various neuronal and hormonal systems need to be considered if we are to understand the mechanisms underlying seasonal reproduction.
Male Reproductive Toxicology: Environmental Exposures vs Reproductive Competence
Like the lecture this chapter begins with an overview of male reproductive biology and transitions into male reproductive toxicology. It ends with a brief discussion of the strengths and weaknesses in male reproductive toxicology and epidemiology today. This chapter is highly il...
Condition-dependent chemosignals in reproductive behavior of lizards.
Martín, José; López, Pilar
2015-02-01
This article is part of a Special Issue "Chemosignals and Reproduction". Many lizards have diverse glands that produce chemosignals used in intraspecific communication and that can have reproductive consequences. For example, information in chemosignals of male lizards can be used in intrasexual competition to identify and assess the fighting potential or dominance status of rival males either indirectly through territorial scent-marks or during agonistic encounters. Moreover, females of several lizard species "prefer" to establish or spend more time on areas scent-marked by males with compounds signaling a better health or body condition or a higher genetic compatibility, which can have consequences for their mating success and inter-sexual selection processes. We review here recent studies that suggest that the information content of chemosignals of lizards may be reliable because several physiological and endocrine processes would regulate the proportions of chemical compounds available for gland secretions. Because chemosignals are produced by the organism or come from the diet, they should reflect physiological changes, such as different hormonal levels (e.g. testosterone or corticosterone) or different health states (e.g. parasitic infections, immune response), and reflect the quality of the diet of an individual. More importantly, some compounds that may function as chemosignals also have other important functions in the organism (e.g. as antioxidants or regulating the immune system), so there could be trade-offs between allocating these compounds to attending physiological needs or to produce costly sexual "chemical ornaments". All these factors may contribute to maintain chemosignals as condition-dependent sexual signals, which can inform conspecifics on the characteristics and state of the sender and allow making behavioral decisions with reproductive consequences. To understand the evolution of chemical secretions of lizards as sexual signals and their
DEFF Research Database (Denmark)
Crain, D Andrew; Janssen, Sarah J; Edwards, Thea M
2008-01-01
To evaluate the possible role of endocrine-disrupting compounds (EDCs) on female reproductive disorders emphasizing developmental plasticity and the complexity of endocrine-dependent ontogeny of reproductive organs. Declining conception rates and the high incidence of female reproductive disrupti......To evaluate the possible role of endocrine-disrupting compounds (EDCs) on female reproductive disorders emphasizing developmental plasticity and the complexity of endocrine-dependent ontogeny of reproductive organs. Declining conception rates and the high incidence of female reproductive...... disruptions warrant evaluation of the impact of EDCs on female reproductive health....
RFRP neurons are critical gatekeepers for the photoperiodic control of reproduction
Directory of Open Access Journals (Sweden)
Valerie eSimonneaux
2012-12-01
Full Text Available Seasonally-breeding mammals rely on the photoperiodic signal to restrict their fertility to a certain time of the year. The photoperiodic information is translated in the brain via the pineal hormone melatonin, and it is now well established that it is the variation in the duration of the nocturnal peak of melatonin which synchronises reproduction with the seasons. The Syrian hamster is a long day breeder, and sexual activity is therefore promoted by exposure to a long day photoperiod and inhibited by exposure to a short day photoperiod. Interestingly, in this species electrolytic lesion of the mediobasal hypothalamus abolishes the short day-induced gonadal regression. We have shown that the expression of a recently discovered neuronal population, namely RFamide-related peptide (rfrp neurons, present in the mediobasal hypothalamus, is strongly down-regulated by melatonin in short day conditions, but not altered by circulating levels of sex steroids. The role of rfrp and its product RFRP-3 in the regulation of reproductive activity has been extensively studied in mammals, and our recent findings indicate that this peptide is a potent stimulator of the reproductive axis in the Syrian hamster. It induces a marked increase in GnRH neuron activity and gonadotrophin secretion, and it is able to rescue reproductive activity in short day sexually inactive hamsters. Little is known about the localisation of the RFRP-3 receptor, GPR147, in the rodent brain. Accumulating evidence suggests that RFRP-3 could be acting via two intermediates, the GnRH neurons in the preoptic area and the Kiss1 neurons in the arcuate nucleus, but future studies should aim at describing the localisation of Gpr147 in the Syrian hamster brain. Altogether our data indicate that the rfrp neuronal population within the mediobasal hypothalamus might be a serious candidate in mediating the photoperiodic effects of melatonin on the regulation of the reproductive axis.
Wang, Bin; Liu, Quan; Liu, Xuezhou; Xu, Yongjiang; Song, Xuesong; Shi, Bao
2017-11-01
Kisspeptin (Kiss) plays a critical role in mediating gonadal steroid feedback to the gonadotropin-releasing hormone (GnRH) neurons in mammals. However, little information regarding the regulation of kisspeptin gene by sex steroids is available in teleosts. In this study, we examined the direct actions of estradiol (E2) and testosterone (T) on hypothalamic expression of kisspeptin and other key factors involved in reproductive function of half-smooth tongue sole. As a first step, a partial-length cDNA of kiss2 was identified from the brain of tongue sole and kiss2 transcript levels were shown to be widely expressed in various tissues, notably in the ovary. Then, the actions of sex steroids on kiss2 and other reproduction-related genes were evaluated using a primary hypothalamus culture system. Our results showed that neither kiss2 nor its receptor kiss2r mRNA levels were significantly altered by sex steroids. Moreover, sex steroids did not modify hypothalamic expression of gonadotropin-inhibitory hormone (gnih) and its receptor gnihr mRNAs, either. However, E2 markedly stimulated both gnrh2 and gnrh3 mRNAs levels. Overall, this study provides insights into the role of sex steroids in the reproductive function of Pleuronectiform teleosts. Copyright © 2017 Elsevier Inc. All rights reserved.
Brain serotonin, psychoactive drugs, and effects on reproduction.
Ayala, María Elena
2009-12-01
Serotonin, a biogenic amine, is present in significant amounts in many structures of the CNS. It is involved in regulation of a wide variety of physiological functions, such as sensory and motor functions, memory, mood, and secretion of hormones including reproductive hormones. It has also been implicated in the etiology of a range of psychiatric disorders such as anxiety, depression, and eating disorders, along with other conditions such as obesity and migraine. While some drugs that affect serotonin, such as fenfluramine and fluoxetine, have been successfully used in treatment of a range of psychiatric diseases, others, such as the amphetamine analogues MDMA and METH, are potent psychostimulant drugs of abuse. Alterations in serotonergic neurons caused by many of these drugs are well characterized; however, little is known about the reproductive consequences of such alterations. This review evaluates the effects of drugs such as MDMA, pCA, fenfluramine, and fluoxetine on serotonergic transmission in the brain, examines the relationships of these drug effects with the neuroendocrine mechanisms modulating reproductive events such as gonadotropin secretion, ovulation, spermatogenesis, and sexual behavior in animal models, and discusses possible reproductive implications of these drugs in humans.
Effects of fluctuating temperature and food availability on reproduction and lifespan.
Schwartz, Tonia S; Pearson, Phillip; Dawson, John; Allison, David B; Gohlke, Julia M
2016-12-15
Experimental studies on energetics and aging often remove two major factors that in part regulate the energy budget in a normal healthy individual: reproduction and fluctuating environmental conditions that challenge homeostasis. Here we use the cyclical parthenogenetic Daphnia pulex to evaluate the role of a fluctuating thermal environment on both reproduction and lifespan across six food concentrations. We test the hypotheses that (1) caloric restriction extends lifespan; (2) maximal reproduction will come with a cost of shortened lifespan; and (3) at a given food concentration, relative to a metabolically equivalent constant temperature environment a diel fluctuating thermal environment will alter the allocation of energy to reproduction and lifespan to maintain homeostasis. We did not identify a level of food concentration that extended lifespan in response to caloric restriction, and we found no cost of reproduction in terms of lifespan. Rather, the individuals at the highest food levels generally had the highest reproductive output and the longest lifespans, the individuals at the intermediate food level decreased reproduction and maintained lifespan, and the individuals at the three lower food concentrations had a decrease in reproduction and lifespan as would be predicted with increasing levels of starvation. Fluctuating temperature had no effect on lifespan at any food concentration, but delayed time to reproductive maturity and decreased early reproductive output at all food concentrations. This suggests that a fluctuating temperature regimen activates molecular pathways that alter energy allocation. The costs of fluctuating temperature on reproduction were not consistent across the lifespan. Statistical interactions for age of peak reproduction and lifetime fecundity suggest that senescence of the reproductive system may vary between temperature regimens at the different food concentrations. Copyright © 2016 Elsevier Inc. All rights reserved.
Epigenetics of reproductive infertility.
Das, Laxmidhar; Parbin, Sabnam; Pradhan, Nibedita; Kausar, Chahat; Patra, Samir K
2017-06-01
Infertility is a complex pathophysiological condition. It may caused by specific or multiple physical and physiological factors, including abnormalities in homeostasis, hormonal imbalances and genetic alterations. In recent times various studies implicated that, aberrant epigenetic mechanisms are associated with reproductive infertility. There might be transgenerational effects associated with epigenetic modifications of gametes and studies suggest the importance of alterations in epigenetic modification at early and late stages of gametogenesis. To determine the causes of infertility it is necessary to understand the altered epigenetic modifications of associated gene and mechanisms involved therein. This review is devoted to elucidate the recent mechanistic advances in regulation of genes by epigenetic modification and emphasizes their possible role related to reproductive infertility. It includes environmental, nutritional, hormonal and physiological factors and influence of internal structural architecture of chromatin nucleosomes affecting DNA and histone modifications in both male and female gametes, early embryogenesis and offspring. Finally, we would like to emphasize that research on human infertility by gene knock out of epigenetic modifiers genes must be relied upon animal models.
Reproductive Rights or Reproductive Justice? Lessons from Argentina.
Morgan, Lynn
2015-06-11
Argentine sexual and reproductive rights activists insist on using the language and framework of "human rights," even when many reproductive rights activists in the US and elsewhere now prefer the framework of "reproductive justice." Reflecting on conversations with Argentine feminist anthropologists, social scientists, and reproductive rights activists, this paper analyzes why the Argentine movement to legalize abortion relies on the contested concept of human rights. Its conclusion that "women's rights are human rights" is a powerful claim in post-dictatorship politics where abortion is not yet legal and the full scope of women's rights has yet to be included in the government's human rights agenda. Argentine feminist human rights activists have long been attentive to the ways that social class, gender, migration, and racism intersect with reproduction. Because their government respects and responds to a human rights framework, however, they have not felt it necessary--as U.S. feminists have--to invent a new notion of reproductive justice in order to be heard. Given the increasing popularity of reproductive justice in health and human rights, the Argentine case shows that rights-based claims can still be politically useful when a State values the concept of human rights. Copyright 2015 Morgan. This is an open access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original author and source are credited.
Association between AA-NAT gene polymorphism and reproductive performance in sheep
Ding-ping,Bai; Cheng-jiang,Yu; Yu-lin,Chen
2012-01-01
Arylalkylamine N-acetyltransferase (AA-NAT) is critical enzyme in Melatonin (MLT) biosynthesis for MLT regulating the animal seasonal breeding. In this study, DNA sequencing methods were applied to detect the polymorphisms of the AA-NAT gene in 179 Chinese sheep belonging to two non-seasonal reproduction breeds and two seasonal reproduction breeds. One mutation at exon 3 (NM_001009461:c.486A > G) was firstly described at the sheep AA-NAT locus. Hence, we described the SmaI PCR-RFLP m...
Gao, Fan; Carlton, William; Kapp, Susan
2011-06-01
Articulated or hinged ankle-foot orthosis (AFO) allow more range of motion. However, quantitative investigation on articulated AFO is still sparse. The objective of the study was to quantitatively investigate effects of alignment and joint types on mechanical properties of the thermoplastic articulated AFO. Tamarack dorsiflexion assist flexure joints with three durometers (75, 85 and 95) and free motion joint were tested. The AFO joint was aligned with the center of the motor shaft (surrogate ankle joint), 10 mm superior, inferior, anterior and posterior with respect to the motor shaft center. The AFO was passively moved from 20° plantar flexion to 15° dorsiflexion at a speed of 10°/s using a motorized device. Mechanical properties including index of hysteresis, passive resistance torque and quasi-static stiffness (at neutral, 5°, 10° and 15° in plantar flexion) were quantified. Significant effects of joint types and joint alignment on the mechanical properties of an articulated thermoplastic AFO were revealed. Specifically, center alignment showed minimum resistance and stiffness while anterior and posterior alignment showed significantly higher resistance and stiffness. The dorsiflexion assist torques at neutral position ranged from 0.69 ± 0.09 to 1.88 ± 0.10 Nm. Anterior and posterior alignment should be avoided as much as possible. The current study suggested that anterior and posterior alignment be avoided as much as possible in clinical practice due to potential skin irritation and increase in stress around the ankle joint.
Ameloblastic fibro-odontoma masquerading as odontoma
Directory of Open Access Journals (Sweden)
Kanwar Deep Singh Nanda
2011-01-01
Full Text Available Ameloblastic fibro-odontoma (AFO is a rare, benign epithelial mixed odontogenic tumor. It occurs as an intraosseous lesion, generally asymptomatic and more prevalent in children and adolescent. AFO is found on radiographic evaluation of patients with unerupted or impacted teeth in many cases. Histological examination reveals a fibrous soft tissue, islands of odontogenic epithelium and a disordered mixture of dental tissues. The treatment modality in most cases involves conservative surgery with enucleation. We present a case of 13-year-old boy with a missing right central incisor, mimicking-like odontoma on radiograph but proved to be AFO and treated with enucleation with preservation of impacted tooth. There was no recurrence after one year of follow-up. This report discusses the clinical, radiographical, histological features and surgical assessment to preserve the impacted tooth associated with AFO.
Obesity and the reproductive system disorders: epigenetics as a potential bridge.
Crujeiras, Ana B; Casanueva, Felipe F
2015-01-01
Obesity and overweight are significantly involved in several reproductive pathologies contributing to infertility in men and women. In addition, several cancers of the reproductive system, such as endometrial, ovarian, breast, testicular and prostate cancers, are strongly influenced by obesity. However, the molecular mechanisms involved in the association between obesity and reproductive disorders remain unclear. Our proposal is to review the current scientific evidence regarding the effect of obesity-related factors as the core of the collective mechanisms directly and indirectly involved in the relationship between obesity and reproductive disorders, with a special and original focus on the effect of the obesity state microenvironment on the epigenetic profile as a reversible mechanistic link between obesity and the reproductive disorders. A PubMed search was performed using keywords related to obesity and adipose-related factors and epigenetics and associated with keywords related to reproduction. Full-text articles and abstracts in the English language published prior to 31 December 2013 were reviewed. The obesity state notably contributes to a reproductive dysfunction in both men and women, ranging from infertility to oncological outcomes. Several epidemiological and experimental studies demonstrate that factors secreted by the adipose tissue and gut in an obesity state can directly induce reproductive disturbances. Relevantly, these same factors are able to alter the epigenetic regulation of genes, a dynamic and reversible mechanism by which the organism responds to environmental pressures critical to the reproductive function. This review outlines the evidence showing that the association between the reproductive pathologies and obesity is not inevitable but is potentially preventable and reversible. The epigenetic marks related to obesity could constitute a therapeutic target for the reproductive disorders associated with obesity. © The Author 2014
A Role for Glucocorticoids in Stress-Impaired Reproduction: Beyond the Hypothalamus and Pituitary
Whirledge, Shannon; Cidlowski, John A.
2013-01-01
In addition to the well-characterized role of the sex steroid receptors in regulating fertility and reproduction, reproductive events are also mediated by the hypothalamic-pituitary-adrenal axis in response to an individual's environment. Glucocorticoid secretion in response to stress contributes to the well-characterized suppression of the hypothalamic-pituitary-gonadal axis through central actions in the hypothalamus and pituitary. However, both animal and in vitro studies indicate that oth...
Developmental programming of reproductive and metabolic health1,2
Padmanabhan, V.; Veiga-Lopez, A.
2014-01-01
The inappropriate programming of the reproductive system by developmental exposure to excess steroid hormones is of concern. Sheep are well suited for investigating developmental origin of reproductive and metabolic disorders. The developmental time line of female sheep (~5 mo gestation and ~7 mo to puberty) is ideal for conducting sequential studies of the progression of metabolic and (or) reproductive disruption from the developmental insult to manifestation of adult consequences. Major benefits of using sheep include knowledge of established critical periods to target adult defects, a rich understanding of reproductive neuroendocrine regulation, availability of non-invasive approaches to monitor follicular dynamics, established surgical approaches to obtain hypophyseal portal blood for measurement of hypothalamic hormones, and the ability to perform studies in natural setting keeping behavioral interactions intact. Of importance is the ability to chronically instrument fetus and mother for determining early endocrine perturbations. Prenatal exposure of the female to excess testosterone (T) leads to an array of adult reproductive disorders that include LH excess, functional hyperandrogenism, neuroendocrine defects, multifollicular ovarian morphology, and corpus luteum dysfunction culminating in early reproductive failure. At the neuroendocrine level all three feedback systems are compromised. At the pituitary level, gonadotrope (LH secretion) sensitivity to GnRH is increased. Multifollicular ovarian morphology stems from persistence of follicles, as well as enhanced follicular recruitment. These defects culminate in progressive loss of cyclicity and reduced fecundity. Prenatal T excess also leads to fetal growth retardation, an early marker of adult reproductive/metabolic diseases, insulin resistance, hypertension and behavioral deficits. Collectively, the reproductive and metabolic deficits of prenatal T-treated sheep provide proof of concept for the
Chance, choice, and the future of reproduction.
Miller, W B
1983-11-01
The evolution of reproduction has been characterized by the development of complex biological and behavioral mechanisms that serve to regulate chance events. Human reproduction has been characterized by the increasing importance of individual choice. Some contemporary manifestations of this broad trend are the high incidence of contraceptive and "proceptive" behavior among couples in Western, industrialized nations. The former behavior willingly attempts to prevent conception while the latter actively attempts to induce conception (such as concentrating intercourse around the time of ovulation). Both patterns of behavior indicate that a choice is being made. A 3-year study of 1000 women revealed proceptive behavior as the most important factor predicting occurance of conception among married couples in the United States. The general strategeis people follow while making childbearing decisions: termination, sequencing, and pre-planning form a continuum following the historical trend toward greater reproductive control. In the terminating strategy, a couple makes no decision about child bearing until the number of children they have become enough or too much. In the sequencing strategy, decisions to have children are made 1 child at a time until a satisfactory limit is reached. In the pre-planning strategy, a plan is worked out ahead of time and is subsequently carried out. As new reproductive technology is introduced and as progressive change is made in society's reproductive related values and beliefs, choice will continue to dominate chance as the highly likely trend for the future of reproduction. Surrogate maternity is just 1 example of this trend. However, these new options, which culminate in the theory and practice of "progensis," (still in its infancy), as well as offering a rich opportunity, can also incur psychological burdens on a couple. Thus, as with any kind of freedom, these developments will require care, caution and responsibility.
Functional study of Cordyceps sinensis and cordycepin in male reproduction: A review
Directory of Open Access Journals (Sweden)
Yung-Chia Chen
2017-01-01
Full Text Available Cordyceps sinensis has various biological and pharmacological functions, and it has been claimed as a tonic supplement for sexual and reproductive dysfunctions for a long time in oriental society. In this article, the in vitro and in vivo effects of C. sinensis and cordycepin on mouse Leydig cell steroidogenesis are briefly described, the stimulatory mechanisms are summarized, and the recent findings related to the alternative substances regulating male reproductive functions are also discussed.
Harding, John C S; Ladinig, Andrea; Novakovic, Predrag; Detmer, Susan E; Wilkinson, Jamie M; Yang, Tianfu; Lunney, Joan K; Plastow, Graham S
2017-09-01
A large challenge experiment using North American porcine reproductive and respiratory virus (PRRSV-2) provided new insights into the pathophysiology of reproductive PRRS. Deep phenotyping of dams and fetuses identified maternal and fetal predictors of PRRS severity and resilience. PRRSV infection resulted in dramatic decreases in all leukocyte subsets by 2days post inoculation. Apoptosis in the interface region was positively related to endometrial vasculitis, viral load in endometrium and fetal thymus, and odds of meconium staining. Viral load at the maternal-fetal interface was a strong predictor of viral load in fetal thymus and odds of fetal death. However, interferon-alpha suppression, a consequence of PRRSV infection, was protective against fetal death. Although the prevalence of fetal lesions was low, their presence in fetal organs and umbilical cord was strongly associated with fetal compromise. Fetal death and viral load clustered in litters suggesting inter-fetal transmission starting from a limited number of index fetuses. Factors associated with index fetal infection are unclear, but large fetuses appear at greater risk. Disease progression in fetuses was associated with an up-regulation of genes associated with inflammation, innate immunity, and cell death signaling, and down-regulation of genes associated with cell cycle and lymphocyte quality. A number of maternal transcriptomic responses were associated with PRRS resilience including higher basal gene expression correlated with platelet function, interferon and pro-inflammatory responses. Twenty-one genomic regions across 10 chromosomes were associated with important traits including fetal viral load, fetal death and viability suggesting that selection for reproductive PRRS resilience may be possible. Copyright © 2017 Elsevier B.V. All rights reserved.
Arabidopsis thaliana MLO genes are expressed in discrete domains during reproductive development.
Davis, Thomas C; Jones, Daniel S; Dino, Arianna J; Cejda, Nicholas I; Yuan, Jing; Willoughby, Andrew C; Kessler, Sharon A
2017-12-01
MLOs in Plant Reproduction. The MILDEW RESISTANCE LOCUS-O (MLO) protein family, comprised of 15 members, plays roles in diverse cell-cell communication processes such as powdery mildew susceptibility, root thigmomorphogenesis, and pollen tube reception. The NORTIA (NTA, AtMLO7) gene is expressed in the synergid cells of the female gametophyte where it functions in intercellular communication with the pollen tube. Discrepancies between previously published promoter::GUS and promoter::gene-GUS constructs expression patterns led us to explore the regulation of NTA expression. Here we found via NTA pro ::gNTA-GUS truncations that sequences within the NTA gene negatively regulate its expression in the stomata and carpel walls. This led to the hypothesis that other MLO family members may also have additional regulatory sequences within the gene. MLO pro ::gMLO-GUS constructs were examined for each family member focusing specifically on flowers in order to determine whether other MLOs could play a role in reproductive cell-cell communication. Notably, several MLOs were expressed in the pollen, in the stigma, in the pollinated style, and in the synergids and central cell. These findings indicate that other MLOs in addition to NTA could play a role in reproduction. Previous studies on the MLO family showed that phylogenetically related MLOs had redundant functions in powdery mildew infection and root thigmomorphogenesis; however, MLO expression in reproductive tissues did not strictly follow phylogenetic relationships, indicating that MLOs from different evolutionary origins may have been recruited for function in sexual reproduction.
Melatonin and male reproductive health: relevance of darkness and antioxidant properties.
Rocha, C S; Rato, L; Martins, A D; Alves, M G; Oliveira, P F
2015-01-01
The pineal hormone melatonin controls several physiological functions that reach far beyond the regulation of the circadian rhythm. Moreover, it can be produced in extra-pineal organs such as reproductive organs. The role of melatonin in the mammalian seasonal and circadian rhythm is well known. Nevertheless, its overall effect in male reproductive physiology remains largely unknown. Melatonin is a very powerful endogenous antioxidant that can also be exogenously taken safely. Interestingly, its antioxidant properties have been consistently reported to improve the male reproductive dysfunctions associated with pathological conditions and also with the exposure to toxicants. Nevertheless, the exact molecular mechanisms by which melatonin exerts its action in the male reproductive system remain a matter of debate. Herein, we propose to present an up-to-date overview of the melatonin effects in the male reproductive health and debate future directions to disclose possible sites of melatonin action in male reproductive system. We will discuss not only the role of melatonin during darkness and sleep but also the importance of the antioxidant properties of this hormone to male fertility. Since melatonin readily crosses the physiological barriers, such as the blood-testis barrier, and has a very low toxicity, it appears as an excellent candidate in the prevention and/or treatment of the multiple male reproductive dysfunctions associated with various pathologies.
DePina, Ana S; Iser, Wendy B; Park, Sung-Soo; Maudsley, Stuart; Wilson, Mark A; Wolkow, Catherine A
2011-07-12
Evolutionary theories of aging propose that longevity evolves as a competition between reproduction and somatic maintenance for a finite pool of resources. Reproduction is thought to shorten lifespan by depleting resources from processes promoting somatic maintenance. Maternal yolk production, vitellogenesis, represents a significant maternal cost for reproduction and is suppressed under genetic and environmental conditions that extend lifespan. However, little is known about the pathways regulating vitellogenesis in response to prolongevity cues. In order to identify mechanisms that suppress vitellogenesis under prolongevity conditions, we studied factors regulating vitellogenesis in C. elegans nematodes. In C. elegans, vitellogenesis is depressed in the absence of insulin-like signaling (IIS). We found that the C. elegans daf-2/IIS pathway regulates vitellogenesis through two mechanisms. vit-2 transcript levels in daf-2 mutants were indirectly regulated through a germline-dependent signal, and could be rescued by introduction of daf-2(+) sperm. However, yolk protein (YP) levels in daf-2 mutants were also regulated by germline-independent posttranscriptional mechanisms. C. elegans vitellogenesis is regulated transcriptionally and posttranscriptionally in response to environmental and reproductive cues. The daf-2 pathway suppressed vitellogenesis through transcriptional mechanisms reflecting reproductive phenotypes, as well as distinct posttranscriptional mechanisms. This study reveals that pleiotropic effects of IIS pathway mutations can converge on a common downstream target, vitellogenesis, as a mechanism to modulate longevity.
Directory of Open Access Journals (Sweden)
Wilson Mark A
2011-07-01
Full Text Available Abstract Background Evolutionary theories of aging propose that longevity evolves as a competition between reproduction and somatic maintenance for a finite pool of resources. Reproduction is thought to shorten lifespan by depleting resources from processes promoting somatic maintenance. Maternal yolk production, vitellogenesis, represents a significant maternal cost for reproduction and is suppressed under genetic and environmental conditions that extend lifespan. However, little is known about the pathways regulating vitellogenesis in response to prolongevity cues. Results In order to identify mechanisms that suppress vitellogenesis under prolongevity conditions, we studied factors regulating vitellogenesis in C. elegans nematodes. In C. elegans, vitellogenesis is depressed in the absence of insulin-like signaling (IIS. We found that the C. elegans daf-2/IIS pathway regulates vitellogenesis through two mechanisms. vit-2 transcript levels in daf-2 mutants were indirectly regulated through a germline-dependent signal, and could be rescued by introduction of daf-2(+ sperm. However, yolk protein (YP levels in daf-2 mutants were also regulated by germline-independent posttranscriptional mechanisms. Conclusions C. elegans vitellogenesis is regulated transcriptionally and posttranscriptionally in response to environmental and reproductive cues. The daf-2 pathway suppressed vitellogenesis through transcriptional mechanisms reflecting reproductive phenotypes, as well as distinct posttranscriptional mechanisms. This study reveals that pleiotropic effects of IIS pathway mutations can converge on a common downstream target, vitellogenesis, as a mechanism to modulate longevity.
Metabolic fuel and clinical implications for female reproduction.
Mircea, Carmen N; Lujan, Marla E; Pierson, Roger A
2007-11-01
Reproduction is a physiologically costly process that consumes significant amounts of energy. The physiological mechanisms controlling energy balance are closely linked to fertility. This close relationship ensures that pregnancy and lactation occur only in favourable conditions with respect to energy. The primary metabolic cue that modulates reproduction is the availability of oxidizable fuel. An organism's metabolic status is transmitted to the brain through metabolic fuel detectors. There are many of these detectors at both the peripheral (e.g., leptin, insulin, ghrelin) and central (e.g., neuropeptide Y, melanocortin, orexins) levels. When oxidizable fuel is scarce, the detectors function to inhibit the release of gonadotropin-releasing hormone and luteinizing hormone, thereby altering steroidogenesis, reproductive cyclicity, and sexual behaviour. Infertility can also result when resources are abundant but food intake fails to compensate for increased energy demands. Examples of these conditions in women include anorexia nervosa and exercise-induced amenorrhea. Infertility associated with obesity appears to be less related to an effect of oxidizable fuel on the hypothalamic-pituitary-ovarian axis. Impaired insulin sensitivity may play a role in the etiology of these conditions, but their specific etiology remains unresolved. Research into the metabolic regulation of reproductive function has implications for elucidating mechanisms of impaired pubertal development, nutritional amenorrhea, and obesity-related infertility. A better understanding of these etiologies has far-reaching implications for the prevention and management of reproductive dysfunction and its associated comorbidities.
DEFF Research Database (Denmark)
Crain, D Andrew; Janssen, Sarah J; Edwards, Thea M
2008-01-01
To evaluate the possible role of endocrine-disrupting compounds (EDCs) on female reproductive disorders emphasizing developmental plasticity and the complexity of endocrine-dependent ontogeny of reproductive organs. Declining conception rates and the high incidence of female reproductive...... disruptions warrant evaluation of the impact of EDCs on female reproductive health....
Feasibility study for the computerized automation of the Annapolis Field Office of EPA region III
International Nuclear Information System (INIS)
Ames, H.S.; Barton, G.W. Jr.; Bystroff, R.I.; Crawford, R.W.; Kray, A.M.; Maples, M.D.
1976-08-01
This report describes a feasibility study for computerized automation of the Annapolis Field Office (AFO) of EPA's Region III. The AFO laboratory provides analytical support for a number of EPA divisions; its primary function at present is analysis of water samples from rivers, estuaries, and the ocean in the Chesapeake Bay area. Automation of the AFO laboratory is found to be not only feasible but also highly desirable. An automation system is proposed which will give major improvements in analytical capacity, quality control, sample management, and reporting capabilities. This system is similar to the LLL-developed automation systems already installed at other EPA laboratories, with modifications specific to the needs of the AFO laboratory and the addition of sample file control. It is estimated that the initial cost of the system, nearly $300,000, would be recouped in about three years by virtue of the increased capacity and efficiency of operation
de Ziegler, Dominique; de Ziegler, Nathalie; Sean, Sokteang; Bajouh, Osama; Meldrum, David R
2015-07-01
Standardized, high-quality training in reproductive endocrinology, infertility, and assisted reproductive technologies (REI-ART) faces challenges owing to the high-tech nature of ART and the important country-to-country differences in clinical practice and regulations overseeing training. Moreover, while the training capacity of the classical by-fellowship training platforms is shrinking, an increasing demand for REI-ART specialists is coming from emerging countries. To meet this expanding need for REI-ART specialists, we propose a novel by-network model linking a reference training center to satellite practical training sites. Simulation should be used more extensively to achieve competency before initiating live clinical experience, analogous to the highly effective training systems that have been used in aviation for decades. Large ART databases that exist because of obligations to report ART activity and results constitute unique yet so far untapped sources for developing by-scenario simulation training models. Online training materials incorporating these state-of-the-art information technology tools could be developed as a means of fulfilling training needs worldwide. Copyright © 2015. Published by Elsevier Inc.
Reproductive technology: in Britain, the debate after the Warnock Report.
Gillon, Raanan
1987-06-01
Gillon contributes an article on Great Britain to the Hastings Center Report series on reproductive technologies outside the United States. In 1984 the Warnock Committee's report represented the first attempt by a national government to formulate a policy on reproductive issues such as artificial insemination, in vitro fertilization, surrogate mothers, and research on human embryos. Reaction to the Warnock report has focused on its recommendations to ban commercial surrogacy and to allow experimentation on embryos up to 14 days after fertilization. Legislation on surrogacy was passed in 1985, while bills banning embryo research failed in 1986. A 1986 government consultation paper called for discussion of other aspects of the Warnock report, including its recommendation that a statutory licensing authority to regulate reproductive technologies be established. Gillon predicts that no new legislation will be enacted under the present government.
Hasebe, Masaharu; Kanda, Shinji; Oka, Yoshitaka
2016-11-01
Close interaction exists between energy-consuming reproduction and nutritional status. However, there are differences in costs and priority for reproduction among species and even between sexes, which leads to diversification of interactions between reproduction and nutritional status. Despite such diversified interactions among species and sexes, most of the analysis of the nutritional status-dependent regulation of reproduction has been limited to an endothermic vertebrate, mammalian species of either sex. Therefore, the mechanisms underlying the diversified interactions remain elusive. In the present study, we demonstrated the effects of malnutritional status on reproduction at both organismal and cellular levels in an ectothermic vertebrate, a teleost medaka of both sexes. First, we analyzed the effects of malnutrition by fasting on gonadosomatic index, number of spawned/fertilized eggs, and courtship behavior. Fasting strongly suppressed reproduction in females but, surprisingly, not in males. Next, we analyzed the effects of fasting on firing activity of hypothalamic GnRH1 neurons, which form the final common pathway for the control of reproduction. An electrophysiological analysis showed that low glucose, which is induced by fasting, directly suppresses the firing activity of GnRH1 neurons specifically in females through intracellular ATP-sensitive potassium channels and AMP-activated protein kinase pathways. Based on the fact that such suppressions occurred only in females, we conclude that nutritional status-dependent, glucose-sensing in GnRH1 neurons may contribute to the most fitted reproductive regulation for each sex.
Zhao, Chunyan; Xu, Shihong; Feng, Chengcheng; Liu, Yifan; Yang, Yang; Wang, Yanfeng; Xiao, Yongshuang; Song, Zongcheng; Liu, Qinghua; Li, Jun
2017-10-01
Turbots (Schophthalmus maximus), one of the most important economic marine flatfish species, fail to undergo final spawning and spermiation naturally under artificial farming conditions. In vertebrates, reproduction is regulated by the brain-pituitary-gonadal axis (BPG-axis), and gonadotropin releasing hormone (GnRH) is one of its key components. Therefore, to better understand the physiology of reproduction in the turbot, three of the genes encoding GnRH subtypes—sbGnRH, cGnRH-II and sGnRH—were cloned and sequenced by isolating the cDNA sequences. The localizations and patterns of expression of their mRNAs were also evaluated during seasonal gonadal development. All three mRNAs were expressed abundantly in the brain; sbGnRH and sGnRH mRNAs were also detected in the gonads and pituitary gland, and sbGnRH expression was much higher than that of sGnRH, indicating the critical role of sbGnRH in regulating the BPG-axis. Moreover, the brain expression patterns of sbGnRH and sGnRH mRNAs showed an increased trend during gonadal development, peaking in mature stages. This indicated the direct regulation of gonadal development by the GnRH system. In addition, cGnRH-II mRNA expression showed no significant variations, suggesting that cGnRH-II is not critically involved in the control of reproduction. Further, the mRNA abundances of the three GnRH forms in the breeding season were significantly higher than those in immature and post-breeding stages in all analyzed brain areas. Therefore, we propose that sbGnRH is the most important hormone for the regulation of reproduction in turbot via the BPG-axis. These results will help in better understanding the reproductive endocrine mechanisms of turbots and lay the groundwork for additional studies aimed at comparing the reproductive physiology of wild individuals with those raised under artificial conditions.
A conserved non-reproductive GnRH system in chordates.
Directory of Open Access Journals (Sweden)
Takehiro G Kusakabe
Full Text Available Gonadotropin-releasing hormone (GnRH is a neuroendocrine peptide that plays a central role in the vertebrate hypothalamo-pituitary axis. The roles of GnRH in the control of vertebrate reproductive functions have been established, while its non-reproductive function has been suggested but less well understood. Here we show that the tunicate Ciona intestinalis has in its non-reproductive larval stage a prominent GnRH system spanning the entire length of the nervous system. Tunicate GnRH receptors are phylogenetically closest to vertebrate GnRH receptors, yet functional analysis of the receptors revealed that these simple chordates have evolved a unique GnRH system with multiple ligands and receptor heterodimerization enabling complex regulation. One of the gnrh genes is conspicuously expressed in the motor ganglion and nerve cord, which are homologous structures to the hindbrain and spinal cord of vertebrates. Correspondingly, GnRH receptor genes were found to be expressed in the tail muscle and notochord of embryos, both of which are phylotypic axial structures along the nerve cord. Our findings suggest a novel non-reproductive role of GnRH in tunicates. Furthermore, we present evidence that GnRH-producing cells are present in the hindbrain and spinal cord of the medaka, Oryzias latipes, thereby suggesting the deep evolutionary origin of a non-reproductive GnRH system in chordates.
Possible influence of vitamin D on male reproduction
DEFF Research Database (Denmark)
Boisen, Ida Marie; Hansen, Lasse Bøllehuus; Mortensen, Li Juel
2017-01-01
Vitamin D is a versatile signaling molecule with an established role in the regulation of calcium homeostasis and bone health. In recent years the spectrum of vitamin D target organs has expanded and a reproductive role is supported by the presence of the vitamin D receptor (VDR) and the vitamin D...... studies have supported the notion of a positive association between serum 25-hydroxyvitamin D (25-OHD) level and semen quality in both fertile and infertile men. However, it remains to be determined whether this association reflects a causal effect. The VDR is ubiquitously expressed and activated vitamin...... steroid production in infertile men. In this review known and possible future implications of vitamin D in human male reproduction function will be discussed....
Hooiveld, Mariette; van Dijk, Christel; van der Sman-de Beer, Femke; Smit, Lidwien A M; Vogelaar, Maartje; Wouters, Inge M; Heederik, Dick J; Yzermans, C Joris
2015-01-01
INTRODUCTION AND OBJECTIVES: Odour annoyance forms the main source of environmental stress in residents living in the proximity of animal feeding operations (AFOs) and it has been associated with reduced health. This study aims to gain more insight into the association between AFOs in the
Hooiveld, M.; Dijk, C.E. van; Sman-de Beer, F. van der; Smit, L.A.M.; Vogelaar, M.; Wouters, I.M.; Heederik, D.J.; Yzermans, C.J.
2015-01-01
Introduction and objectives. Odour annoyance forms the main source of environmental stress in residents living in the proximity of animal feeding operations (AFOs) and it has been associated with reduced health. This study aims to gain more insight into the association between AFOs in the
Use of and Satisfaction with Ankle Foot Orthoses
Joost van Hoof; Eveline Wouters; Yvonne van Zaalen; F.C. Holtkamp; M.J. Verkerk
2015-01-01
Objective: The aim of this study was to obtain insight in specific elements influencing the use, non-use, satisfaction, and dissatisfaction of ankle foot orthoses (AFOs) and the presence of underexposed problems with respect to AFOs. Methods: A questionnaire was composed to obtain information from
Use of and satisfaction with ankle foot orthoses
Holtkamp, F.C.; Wouters, E.J.M.; van Hoof, J.; van Zaalen, Y.; Verkerk, M.
2015-01-01
Objective: The aim of this study was to obtain insight in specific elements influencing the use, non-use, satisfaction, and dissatisfaction of ankle foot orthoses (AFOs) and the presence of underexposed problems with respect to AFOs. Methods: A questionnaire was composed to obtain information from
Kerkum, Yvette L.; Buizer, Annemieke I.; van den Noort, Josien C.; Becher, Jules G.; Harlaar, Jaap; Brehm, Merel-Anne
2015-01-01
Rigid Ankle-Foot Orthoses (AFOs) are commonly prescribed to counteract excessive knee flexion during the stance phase of gait in children with cerebral palsy (CP). While rigid AFOs may normalize knee kinematics and kinetics effectively, it has the disadvantage of impeding push-off power. A
Kerkum, Y.L.; Buizer, A.I.; van den Noort, J.C.; Becher, J.G.; Harlaar, J.; Brehm, M.A.
2015-01-01
Introduction: Rigid Ankle-Foot Orthoses (AFOs) are commonly prescribed to counteract excessive knee flexion during the stance phase of gait in children with cerebral palsy (CP). While rigid AFOs may normalize knee kinematics and kinetics effectively, it has the disadvantage of impeding push-off
Directory of Open Access Journals (Sweden)
Chakrabarti B
2011-10-01
Full Text Available Biswajit Chakrabarti1, Sabita Purkait2, Punyabrata Gun2, Vicky C Moore3, Samadrita Choudhuri4, MJ Zaman5,6, Christopher J Warburton1, Peter MA Calverley7, Rahul Mukherjee3 1Aintree Chest Centre, University Hospital Aintree, Liverpool, UK; 2Moitri Swasthya Kendra, Shramajibi Swasthya Udyog, Chengail, West Bengal, India; 3Department of Respiratory Medicine and Physiology, Birmingham Heartlands Hospital, Birmingham, UK; 4National Medical College, Birgunj, Nepal; 5Department of Epidemiology and Public Health, University College, London, UK; 6The George Institute for Global Health, Sydney, Australia; 7Clinical Sciences Centre, University Hospital Aintree, Liverpool, UK Purpose: Respiratory conditions remain a source of morbidity globally. As such, this study aimed to explore factors associated with the development of airflow obstruction (AFO in a rural Indian setting and, using spirometry, study whether underweight is linked to AFO. Methods: Patients > 35 years old attending a rural clinic in West Bengal, India, took a structured questionnaire, had their body mass index (BMI measured, and had spirometry performed by an ancillary health care worker. Results: In total, 416 patients completed the study; spirometry was acceptable for analysis of forced expiratory volume in 1 second in 286 cases (69%; 16% were noted to exhibit AFO. Factors associated with AFO were: increasing age (95% confidence interval (CI 0.004–0.011; P = 0.005, smoking history (95% CI 0.07–0.174; P = 0.006, male gender (95% CI 0.19–0.47; P = 0.012, reduced BMI (95% CI 0.19–0.65; P = 0.02, and occupation (95% CI 0.12–0.84; P = 0.08. The mean BMI in males who currently smoked (n = 60; 19.29 kg/m2; standard deviation [SD] 3.46 was significantly lower than in male never smokers (n = 33; 21.15 kg/m2 SD 3.38; P < 0.001. AFO was observed in 27% of subjects with a BMI <18.5 kg/m2, falling to 13% with a BMI ≥18.5 kg/m2 (P = 0.013. AFO was observed in 11% of housewives, 22% of farm
Jiao Zhang, Jiao; Luong Huynh, Do; Chandimali, Nisansala; Kang, Tae Yoon; Kim, Nameun; Mok, Young Sun; Kwon, Taeho; Jeong, Dong Kee
2018-05-01
This study investigated whether plasma treatment of fertilized eggs before hatching could affect the growth and reproduction of chickens. Three point five-day-incubated fertilized eggs exposed to non-thermal dielectric barrier discharge plasma at 2.81 W of power for 2 min resulted in the highest growth in chickens. Plasma growth-promoting effect was regulated by the reactive oxygen species homeostasis and the improvement of energy metabolism via increasing serum hormones and adenosine triphosphate levels which were resulted from the regulation of genes involved in antioxidant defense, hormone biosynthesis and energetic metabolism. Interestingly, plasma-treated male chickens conspicuously grew faster than females. Further, aspects of male reproductive system (testosterone level and sperm quality) were improved by the plasma treatment but female reproduction (estradiol and progesterone levels, egg-laying rate and egg weight) had no significant changes. Unfortunately, offspring whose parents were the optimal plasma-treated chickens did not show any difference on growth characteristics and failed to inherit excellent growth features from their parents. Our results suggest a new method to improve the growth rate and male reproductive capacity in poultry but it is only effective in the plasma direct-treated generation.
Rapkin, James; Archer, C Ruth; Grant, Charles E; Jensen, Kim; House, Clarissa M; Wilson, Alastair J; Hunt, John
2017-09-01
There is often large divergence in the effects of key nutrients on life span (LS) and reproduction in the sexes, yet nutrient intake is regulated in the same way in males and females given dietary choice. This suggests that the sexes are constrained from feeding to their sex-specific nutritional optima for these traits. Here, we examine the potential for intralocus sexual conflict (IASC) over optimal protein and carbohydrate intake for LS and reproduction to constrain the evolution of sex-specific nutrient regulation in the field cricket, Teleogryllus commodus. We show clear sex differences in the effects of protein and carbohydrate intake on LS and reproduction and strong positive genetic correlations between the sexes for the regulated intake of these nutrients. However, the between-sex additive genetic covariance matrix had very little effect on the predicted evolutionary response of nutrient regulation in the sexes. Thus, IASC appears unlikely to act as an evolutionary constraint on sex-specific nutrient regulation in T. commodus. This finding is supported by clear sexual dimorphism in the regulated intake of these nutrients under dietary choice. However, nutrient regulation did not coincide with the nutritional optima for LS or reproduction in either sex, suggesting that IASC is not completely resolved in T. commodus. © 2017 The Author(s). Evolution published by Wiley Periodicals, Inc. on behalf of The Society for the Study of Evolution.
Regulation of gonadotropin-releasing hormone neurons by glucose
Roland, Alison V.; Moenter, Suzanne M.
2011-01-01
Reproduction is influenced by energy balance, but the physiological pathways mediating their relationship have not been fully elucidated. As the central regulators of fertility, gonadotropin-releasing hormone (GnRH) neurons integrate numerous physiological signals, including metabolic cues. Circulating glucose levels regulate GnRH release and may in part mediate the effects of negative energy balance on fertility. Existing evidence suggests that neural pathways originating in the hindbrain, as well as in the hypothalamic feeding nuclei, transmit information concerning glucose availability to GnRH neurons. Here we review recent evidence suggesting that GnRH neurons may directly sense changes in glucose availability by a mechanism involving adenosine monophosphate-activated protein kinase (AMPK). These findings expand our understanding of how metabolic signaling in the brain regulates reproduction. PMID:21855365
Marvel, Miranda; Spicer, Olivia Smith; Wong, Ten-Tsao; Zmora, Nilli; Zohar, Yonathan
2018-04-04
Gonadotropin-releasing hormone (GnRH) is known as a pivotal upstream regulator of reproduction in vertebrates. However, reproduction is not compromised in the hypophysiotropic Gnrh3 knockout line in zebrafish (gnrh3-/-). In order to determine if Gnrh2, the only other Gnrh isoform in zebrafish brains, is compensating for the loss of Gnrh3, we generated a double Gnrh knockout zebrafish line. Surprisingly, the loss of both Gnrh isoforms resulted in no major impact on reproduction, indicating that a compensatory response, outside of the Gnrh system, was evoked. A plethora of factors acting along the reproductive hypothalamus-pituitary axis were evaluated as possible compensators based on neuroanatomical and differential gene expression studies. In addition, we also examined the involvement of feeding factors in the brain as potential compensators for Gnrh2, which has known anorexigenic effects. We found that the double knockout fish exhibited upregulation of several genes in the brain, specifically gonadotropin-inhibitory hormone (gnih), secretogranin 2 (scg2), tachykinin 3a (tac3a), and pituitary adenylate cyclase-activating peptide 1 (pacap1), and downregulation of agouti-related peptide 1 (agrp1), indicating the compensation occurs outside of Gnrh cells and therefore is a non-cell autonomous response to the loss of Gnrh. While the differential expression of gnih and agrp1 in the double knockout line was confined to the periventricular nucleus and hypothalamus, respectively, the upregulation of scg2 corresponded with a broader neuronal redistribution in the lateral hypothalamus and hindbrain. In conclusion, our results demonstrate the existence of a redundant reproductive regulatory system that comes into play when Gnrh2 and Gnrh3 are lost.
The community-level effects of women's education on reproductive behaviour in rural Ghana
Directory of Open Access Journals (Sweden)
Kofi D. Benefo
2006-06-01
Full Text Available Using survey and census data for rural Ghana collected in the 1980s, this study examines the ability of women's education to increase interest in fertility regulation and contraception among all women, regardless of their individual and household features. The study finds that, net of her own characteristics, a woman's interest in limiting fertility and using modern contraception increase with the percent of educated women in her community. These results suggest that female education has a greater capacity to introduce novel reproductive ideas and behaviors into rural areas of Africa and thereby transform the demographic landscape in the region than is currently believed. There is also evidence that female education may undermine existing methods of regulating fertility. Other community characteristics that increase women's interest in regulating fertility and contraceptive use in this setting include access to transportation and proximity to urban areas. However, these are not as powerful as women's education in transforming reproductive behavior.
Vitamin D metabolism, sex hormones, and male reproductive function.
Blomberg Jensen, Martin
2012-08-01
The spectrum of vitamin D (VD)-mediated effects has expanded in recent years, and VD is now recognized as a versatile signaling molecule rather than being solely a regulator of bone health and calcium homeostasis. One of the recently identified target areas of VD is male reproductive function. The VD receptor (VDR) and the VD metabolizing enzyme expression studies documented the presence of this system in the testes, mature spermatozoa, and ejaculatory tract, suggesting that both systemic and local VD metabolism may influence male reproductive function. However, it is still debated which cell is the main VD target in the testis and to what extent VD is important for sex hormone production and function of spermatozoa. This review summarizes descriptive studies on testicular VD metabolism and spatial distribution of VDR and the VD metabolizing enzymes in the mammalian testes and discusses mechanistic and association studies conducted in animals and humans. The reviewed evidence suggests some effects of VD on estrogen and testosterone biosynthesis and implicates involvement of both systemic and local VD metabolism in the regulation of male fertility potential.
Effects of dietary soybean isoflavones (SI) on reproduction in the young breeder rooster.
Heng, Dai; Zhang, Tao; Tian, Ye; Yu, Shangyu; Liu, Wenbo; Xu, Kaili; Liu, Juan; Ding, Yu; Zhu, Baochang; Yang, Yanzhou; Zhang, Cheng
2017-02-01
Soybean isoflavones (SIs) are phytoestrogens that competitive with estrogens in body. Although SIs play an important role in reproduction, their role in testicular development in roosters is unknown. This study was conducted to investigate the effect of SIs on testicular development and serum reproductive hormone profiles in young breeder roosters (70-133days old). Gene expression of steroidogenic acute regulatory protein (StAR), cholesterol side-chain cleavage enzyme (P450scc), and 3β-hydroxysteroid dehydrogenase (3β-HSD), which are related to testosterone synthesis, in rooster testis were also evaluated after treatment with different SI doses. Although SIs had no significant effect on body weight, 5mg/kg SIs significantly increased the testis index and serum levels of reproductive hormones (gonadotropin releasing hormone, follicle- stimulating hormone, luteinizing hormone, and testosterone).To further investigate whether SIs regulate hormone synthesis via StAR, p450scc, 3β-HSD, real time-PCR was performed to measure the mRNA levels of the corresponding genes. The results showed that 5mg/kg of SIs significantly increased StAR mRNA levels. However, there were no significant effects on p450scc or 3β-HSD mRNA levels. Moreover, the spermatogonial development and the number of germ cell layers were increased by treatment with 5mg/kg of SIs. These results suggest that SIs promote testicular growth by increasing reproductive hormone secretion, which is closely related to StAR expression, to positively regulate reproduction in young roosters. Copyright © 2016 Elsevier B.V. All rights reserved.
Ploeger, Hilde E.; Bus, Sicco A.; Brehm, Merel-Anne; Nollet, Frans
2014-01-01
In polio survivors with calf muscle weakness, dorsiflexion-restricting ankle-foot orthoses (DR-AFOs) aim to improve gait in order to reduce walking-related problems such as instability or increased energy cost. However, evidence on the efficacy of DR-AFOs in polio survivors is lacking. We
Sex steroid hormone determination of the maternal brain: effects beyond reproduction.
Kinsley, C H; Meyer, E; Rafferty, K A
2012-10-01
Herein we discuss the effects of hormones on reproduction, but with a focus on the ripples that emanate from the main effects. That is, the role of hormones in reproductive events is both well-known and well accepted; less studied and understood are effects that appear to be ancillary to the primary objectives of the hormonal effects, which support, complement and extend their primary effects. We present evidence for how the hormonal stimulation of pregnancy constructs the maternal brain; makes it more efficient; enhances cognition; regulates stress responsiveness; modifies sensory systems (we discuss mainly olfaction); neurogenesis; and learning. Thus, steroid and other hormones and neuropeptides restructure the nervous system, particularly of females, to produce and regulate maternal behavior as well as behaviors and physiological systems that contribute to and support what is arguably the primary function of the hormones: survival and effective nurturance of the female's metabolic and genetic investment.
Vitamin D (soltriol), light, and reproduction
International Nuclear Information System (INIS)
Stumpf, W.E.; Denny, M.E.
1989-01-01
Evidence from autoradiographic studies with 1,25(OH)2-vitamin D3 (vitamin D, soltriol) labeled with tritium and from the literature indicates that the steroid hormone soltriol regulates and modulates reproductive processes in the female, as it does in the male. Nuclear receptors for soltriol have been discovered in the uterus, oviduct, ovary, mammary gland, placenta, and fetal membranes, as well as in the pituitary and hypothalamus. Soltriol is recognized as a transducer and hormonal messenger of sunlight, acting as a somatotropic activator and modulator of vital processes for the seasonal and estival adaptation of growth, development, and procreation. Its influence on calcium equilibrium is just one of its many functions to serve this goal. This article reviews experimental, clinical, and epidemiologic evidence that suggests the involvement of soltriol in the control of reproductive processes, noting its importance for the onset of puberty, fertility, pregnancy, lactation, and probably sexual behavior. Cooperative actions between soltriol and other steroid hormones, especially estradiol, are pointed out.107 references
Corticosterone mediated costs of reproduction link current to future breeding.
Crossin, Glenn T; Phillips, Richard A; Lattin, Christine R; Romero, L Michael; Williams, Tony D
2013-11-01
Life-history theory predicts that costs are associated with reproduction. One possible mediator of costs involves the secretion of glucocorticoid hormones, which in birds can be measured in feathers grown during the breeding period. Glucocorticoids mediate physiological responses to unpredictable environmental or other stressors, but they can also function as metabolic regulators during more predictable events such as reproduction. Here we show that corticosterone ("Cort") in feathers grown during the breeding season reflects reproductive effort in two Antarctic seabird species (giant petrels, Macronectes spp.). In females of both species, but not males, feather Cort ("fCort") was nearly 1.5-fold higher in successful than failed breeders (those that lost their eggs/chicks), suggesting a cost of successful reproduction, i.e., high fCort levels in females reflect the elevated plasma Cort levels required to support high metabolic demands of chick-rearing. Successful breeding also led to delayed moult prior to winter migration. The fCort levels and pre-migration moult score that we measured at the end of current breeding were predictive of subsequent reproductive effort in the following year. Birds with high fCort and a delayed initiation of moult were much more likely to defer breeding in the following year. Cort levels and the timing of moult thus provide a potential mechanism for the tradeoff between current and future reproduction. Crown Copyright © 2013. Published by Elsevier Inc. All rights reserved.
Leptin and its potential interest in assisted reproduction cycles.
Catteau, A; Caillon, H; Barrière, P; Denis, M G; Masson, D; Fréour, T
2016-04-01
Leptin, an adipose hormone, has been shown to control energy homeostasis and food intake, and exert many actions on female reproductive function. Consequently, this adipokine is a pivotal factor in studies conducted on animal models and humans to decipher the mechanisms behind the infertility often observed in obese women. A systematic PubMed search was conducted on all articles, published up to January 2015 and related to leptin and its actions on energy balance and reproduction, using the following key words: leptin, reproduction, infertility, IVF and controlled ovarian stimulation. The available literature was reviewed in order to provide an overview of the current knowledge on the physiological roles of leptin, its involvement in female reproductive function and its potential interest as a prognostic marker in IVF cycles. Animal and human studies show that leptin communicates nutritional status to the central nervous system and emerging evidence has demonstrated that leptin is involved in the control of reproductive functions by acting both directly on the ovaries and indirectly on the central nervous system. With respect to the clinical use of leptin as a biomarker in IVF cycles, a systematic review of the literature suggested its potential interest as a predictor of IVF outcome, as high serum and/or follicular fluid leptin concentrations have correlated negatively with cycle outcome. However, these preliminary results remain to be confirmed. Leptin regulates energy balance and female reproductive function, mainly through its action on hypothalamic-pituitary-ovarian function, whose molecular and cellular aspects are progressively being deciphered. Preliminary studies evaluating leptin as a biomarker in human IVF seem promising but need further confirmation. © The Author 2015. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Schrank, Elisa S; Hitch, Lester; Wallace, Kevin; Moore, Richard; Stanhope, Steven J
2013-10-01
Passive-dynamic ankle-foot orthosis (PD-AFO) bending stiffness is a key functional characteristic for achieving enhanced gait function. However, current orthosis customization methods inhibit objective premanufacture tuning of the PD-AFO bending stiffness, making optimization of orthosis function challenging. We have developed a novel virtual functional prototyping (VFP) process, which harnesses the strengths of computer aided design (CAD) model parameterization and finite element analysis, to quantitatively tune and predict the functional characteristics of a PD-AFO, which is rapidly manufactured via fused deposition modeling (FDM). The purpose of this study was to assess the VFP process for PD-AFO bending stiffness. A PD-AFO CAD model was customized for a healthy subject and tuned to four bending stiffness values via VFP. Two sets of each tuned model were fabricated via FDM using medical-grade polycarbonate (PC-ISO). Dimensional accuracy of the fabricated orthoses was excellent (average 0.51 ± 0.39 mm). Manufacturing precision ranged from 0.0 to 0.74 Nm/deg (average 0.30 ± 0.36 Nm/deg). Bending stiffness prediction accuracy was within 1 Nm/deg using the manufacturer provided PC-ISO elastic modulus (average 0.48 ± 0.35 Nm/deg). Using an experimentally derived PC-ISO elastic modulus improved the optimized bending stiffness prediction accuracy (average 0.29 ± 0.57 Nm/deg). Robustness of the derived modulus was tested by carrying out the VFP process for a disparate subject, tuning the PD-AFO model to five bending stiffness values. For this disparate subject, bending stiffness prediction accuracy was strong (average 0.20 ± 0.14 Nm/deg). Overall, the VFP process had excellent dimensional accuracy, good manufacturing precision, and strong prediction accuracy with the derived modulus. Implementing VFP as part of our PD-AFO customization and manufacturing framework, which also includes fit customization, provides a novel and powerful method to
Levitt, M
2001-01-01
In the UK human embryo research and infertility treatments are regulated by the Human Fertilisation and Embryology Authority (HFEA), a national statutory body set up in 1991. Clinics are required by law to be licensed by the HFEA and open to inspection. In 1999 there were 107 clinics licensed to carry out IVF and/or donor insemination. There are regional variations in National Health Service funding and seventy-five percent of those treated pay for most of their treatment, usually to avoid long waiting lists or because they do not meet the eligibility criteria set by their local health authority. Having described the code of practice laid down by the HFEA the paper discusses the implications of new reproductive technologies from a social science perspective, focusing on three topics which continue to be debated by the media, the regulatory authorities, health professionals and 'lay' people. First, age limits and other criteria for assisted reproduction which raise the question 'who should be allowed to reproduce?' Second, donor anonymity and the question of payment for donors. Finally, the screening and selection of embryos for implantation and the recurring theme in the media of 'designer babies'. The HFEA can be seen to fulfill its intended role, mediating between the infertility professionals, patients and the wider general public. It seeks to allay public fears while supporting professionals by avoiding restrictions on research and treatment and by consulting with the public as to when extensions to research will be acceptable.
Ando, Hironori; Shahjahan, Md; Kitahashi, Takashi
2018-04-03
The seasonal, daily and lunar control of reproduction involves photoperiodic, circadian and lunar changes in the activity of kisspeptin, gonadotropin-inhibitory hormone (GnIH) and gonadotropin-releasing hormone (GnRH) neurons. These changes are brought through complex networks of light-, time- and non-photic signal-dependent control mechanisms, which are mostly unknown at present. The grass puffer, Takifugu alboplumbeus, a semilunar spawner, provides a unique and excellent animal model to assess this question because its spawning is synchronized with seasonal, daily and lunar cycles. In the diencephalon, the genes for kisspeptin, GnIH and their receptors showed similar expression patterns with clear seasonal and daily oscillations, suggesting that they are regulated by common mechanisms involving melatonin, circadian clock and water temperature. For implications in semilunar-synchronized spawning rhythm, melatonin receptor genes showed ultradian oscillations in expression with the period of 14.0-15.4 h in the pineal gland. This unique ultradian rhythm might be driven by circatidal clock. The possible circatidal clock and circadian clock in the pineal gland may cooperate to drive circasemilunar rhythm to regulate the expression of the kisspeptin, GnIH and their receptor genes. On the other hand, high temperature (over 28 °C) conditions, under which the expression of the kisspeptin and its receptor genes is markedly suppressed, may provide an environmental signal that terminates reproduction at the end of breeding period. Taken together, the periodic regulation of the kisspeptin, GnIH and their receptor genes by melatonin, circadian clock and water temperature may be important in the precisely-timed spawning of the grass puffer. Copyright © 2018 Elsevier Inc. All rights reserved.
Reproductive toxicity: Male and female reproductive systems as targets for chemical injury
Energy Technology Data Exchange (ETDEWEB)
Mattison, D.R.; Plowchalk, D.R.; Meadows, M.J.; Al-Juburi, A.Z.; Gandy, J.; Malek, A. (Univ. of Arkansas for Medical Sciences, Little Rock (USA))
1990-03-01
On the basis of current knowledge of reproductive biology and toxicology, it is apparent that chemicals affecting reproduction may elicit their effects at a number of sites in both the male and the female reproductive system. This multiplicity of targets is attributable to the dynamic nature of the reproductive system, in which the hypothalamic-pituitary-gonadal axis is controlled by precise positive and negative feedback mechanisms among its components. Interference by a xenobiotic at any level in either the male or the female reproductive system may ultimately impair hypothalamic or pituitary function. Normal gonadal processes such as spermatogenesis or oogenesis, ejaculation or ovulation, hormone production by Leydig or granulosa cells, and the structure or function of the accessory reproductive structures (e.g., epididymis, fallopian tube) also appear vulnerable to xenobiotics. The reproductive system is a complex one that requires local and circulating hormones for control. This brief review illustrates a system for characterizing the mechanism of action of reproductive toxicants, as well as for defining the sites available for disruption of reproduction. Unfortunately, at present, data addressing the actual vulnerability of reproduction are sorely lacking. However, when experiments have been conducted and combined with epidemiologic data or clinical observation, it has been possible to demonstrate impairment of reproductive processes by xenobiotics. The role of environmental exposure to xenobiotics in the increase in infertility that has been observed remains to be defined. 87 references.
Patient monitoring in Polish assisted reproductive technology centres
Directory of Open Access Journals (Sweden)
Anna Krawczak
2016-12-01
Full Text Available In 2014, the Polish non-governmental patient association ‘Our Stork’ (Nasz Bocian introduced the ‘Patient monitoring in ART centres’ research project to gather previously unrecorded information on the situation of infertile people and the provision of assisted reproductive treatment in Poland. When the research project began, assisted reproductive treatment centres were unregulated by the state, a situation that had existed for more than 28 years following the birth of the first Polish test-tube baby in 1987. Patients signed civil contracts, remaining unprotected in terms of safety of treatment and recognition of their rights, and their presumed social position was described by doctors as ‘disciplined patients’ – a reflection of what Michele Foucault described as biopolitics. The research project comprised patient questionnaires (responses from 722 patients provided the basis for the document ‘Patient Recommendations in Infertility Treatment’, analysis of civil contracts and their accuracy in the context of patients’ legal rights in Poland, and in-depth interviews with assisted reproductive treatment centres’ owners, doctors, midwives, and patients to explore patient care. The data reveal that there is a lack of patient-centred care among doctors and medical staff in Poland and that following the passing into law of the 2015 Infertility Act, which introduced state regulation of assisted reproductive treatment centres, the situation for patients worsened.
Shi, Lihong
2017-12-01
This article explores the creation and ramifications of a stratified reproductive system under China's state control of reproduction. Within this system, an emerging group of "new rich" are able to circumvent birth regulations and have unplanned births because of their financial capabilities and social networks. While China's birth-planning policy is meant to be enforced equally for all couples, the unequal access to wealth and bureaucratic power as a result of China's widening social polarization has created disparate reproductive rights and experiences. This article identifies three ways in which reproductive privileges are created. It further explores how a stratified reproductive system under state population control reinforces social polarization. While many socially marginalized couples are unable to register their unplanned children for citizenship status and social benefits, the new rich are able to legitimate their births and transfer their privilege and status to their children, thus reproducing a new generation of elites. © 2016 by the American Anthropological Association.
... With the Male Reproductive System Print en español Sistema reproductor masculino Reproduction All living things reproduce. Reproduction — ... of Use Notice of Nondiscrimination Visit the Nemours Web site. Note: All information on KidsHealth® is for ...
Different aspects of reproduction strategies in crayfish: A review
Directory of Open Access Journals (Sweden)
Yazicioglu B.
2016-01-01
Full Text Available Study of the reproductive strategy of crayfish species is of great importance in the current astacological world. Crayfish are among the largest freshwater invertebrates, and as keystone species, they are able to regulate the structure of the benthic fauna in the freshwaters, demonstrating different ecological strategies and life spans ranging up to 20+ years. In order to bring together the various pieces of information related to this issue, this overview of published scientific reports was conducted. The majority of crayfish species studied show sexual dimorphism, with approximately equal numbers of males and females. However, over some decades numerous observations have been made for a few species that may have different modes of reproduction, such as hermaphroditism or intersex (e.g. Cherax quadricarinatus, Samastacus spinifrons, Parastacus virilastacus and Pacifastacus leniusculus and parthenogenesis (only Procambarus fallax f. virginalis. A recent study showed a new case of parthenogenesis as apomictic parthenogenesis (only Orconectes limosus. In addition, there are many investigations into the reproduction biology of crayfish, including using eyestalk ablation or androgenic gland ablation under various lab conditions and hybridization under natural conditions (e.g. Astacus astacus X Astacus leptodactylus, Orconectes rusticus X Orconectes propinquus. There are also some chemical factors which could possibly affect the reproduction system of crayfish in the wild.
Seasonal variation in human reproduction: environmental factors.
Bronson, F H
1995-06-01
Almost all human populations exhibit seasonal variation in births, owing mostly to seasonal variation in the frequency of conception. This review focuses on the degree to which environmental factors like nutrition, temperature and photoperiod contribute to these seasonal patterns by acting directly on the reproductive axis. The reproductive strategy of humans is basically that of the apes: Humans have the capacity to reproduce continuously, albeit slowly, unless inhibited by environmental influences. Two, and perhaps three, environmental factors probably act routinely as seasonal inhibitors in some human populations. First, it seems likely that ovulation is regulated seasonally in populations experiencing seasonal variation in food availability. More specifically, it seems likely that inadequate food intake or the increased energy expenditure required to obtain food, or both, can delay menarche, suppress the frequency of ovulation in the nonlactating adult, and prolong lactational amenorrhea in these populations on a seasonal basis. This action is most easily seen in tropical subsistence societies where food availability often varies greatly owing to seasonal variation in rainfall; hence births in these populations often correlate with rainfall. Second, it seems likely that seasonally high temperatures suppress spermatogenesis enough to influence the incidence of fertilization in hotter latitudes, but possibly only in males wearing clothing that diminishes scrotal cooling. Since most of our knowledge about this phenomenon comes from temperate latitudes, the sensitivity of spermatogenesis in both human and nonhuman primates to heat in the tropics needs further study. It is quite possible that high temperatures suppress ovulation and early embryo survival seasonally in some of these same populations. Since we know less than desired about the effect of heat stress on ovulation and early pregnancy in nonhuman mammals, and nothing at all about it in humans or any of the
Bunning, Harriet; Bassett, Lee; Clowser, Christina; Rapkin, James; Jensen, Kim; House, Clarissa M; Archer, Catharine R; Hunt, John
2016-07-01
Sexual selection may cause dietary requirements for reproduction to diverge across the sexes and promote the evolution of different foraging strategies in males and females. However, our understanding of how the sexes regulate their nutrition and the effects that this has on sex-specific fitness is limited. We quantified how protein (P) and carbohydrate (C) intakes affect reproductive traits in male (pheromone expression) and female (clutch size and gestation time) cockroaches (Nauphoeta cinerea). We then determined how the sexes regulate their intake of nutrients when restricted to a single diet and when given dietary choice and how this affected expression of these important reproductive traits. Pheromone levels that improve male attractiveness, female clutch size and gestation time all peaked at a high daily intake of P:C in a 1:8 ratio. This is surprising because female insects typically require more P than males to maximize reproduction. The relatively low P requirement of females may reflect the action of cockroach endosymbionts that help recycle stored nitrogen for protein synthesis. When constrained to a single diet, both sexes prioritized regulating their daily intake of P over C, although this prioritization was stronger in females than males. When given the choice between diets, both sexes actively regulated their intake of nutrients at a 1:4.8 P:C ratio. The P:C ratio did not overlap exactly with the intake of nutrients that optimized reproductive trait expression. Despite this, cockroaches of both sexes that were given dietary choice generally improved the mean and reduced the variance in all reproductive traits we measured relative to animals fed a single diet from the diet choice pair. This pattern was not as strong when compared to the single best diet in our geometric array, suggesting that the relationship between nutrient balancing and reproduction is complex in this species.
Parasite dispersal risk tolerance is mediated by its reproductive value.
Nolan, Maxcy P; Delaplane, Keith S
2017-10-01
Parasite dispersal theory draws heavily upon epidemiological SIR models in which host status (susceptible (S), infected (I), or recovered (R)) is used to study parasite dispersal evolution. In contrast to these extrinsically host-centric drivers, in this study we focus on an intrinsic driver, the parasite's reproductive value (predicted future offspring) as a regulator of the extent to which the individual will engage in risky dispersal behaviour. As a model system we use the honeybee Apis mellifera and its ectoparasite, the mite Varroa destructor . Mite reproduction happens exclusively inside cells of bee brood, and newly emerged fecund mites may parasitize either a homocolonial brood cell (low risk dispersal) or emigrate to a new bee colony via phoretic attachment to mature forager bees (high risk dispersal). In an empirical bioassay, prepartum mites (high reproductive value) and postpartum mites (low reproductive value) were offered a choice of newly emerged homocolonial worker bees (low risk), homocolonial pollen forager bees (high risk), or heterocolonial pollen foragers (high risk). A preference for newly emerged bees was earlier and more strongly sustained among prepartum mites. This suggests comparatively greater dispersal risk tolerance among postpartum mites with lower reproductive value. A dangerous bid for dispersal may be adaptive if the individual has already successfully reproduced and the rewards for successful dispersal are sufficiently large.
PHEROMONAL MODULATION OF REPRODUCTIVE FUNCTION IN MAMMALS
Directory of Open Access Journals (Sweden)
Matthieu Keller
2011-11-01
Full Text Available Social olfactory signals, often known as pheromones, are powerful regulators of reproductive function. These chemosignals can be detected by two olfactory systems, namely the main or the accessory olfactory systems. While initially anatomically segregated, both systems converge functionally as they can detect and process overlapping sets of chemosignals. This convergence also takes place at the level of their central projections in the hypothalamus. It is probably at this level that future investigations will be needed. Indeed, if the physiology of both olfactory system and reproductive function are now quite well characterized, the interrelation between both systems is unclear. Among the many cell populations that can serve as targets or relays for the pheromonal information in the hypothalamus are GnRH cells or the recently discovered Kispeptin population which have been showed to be activated after pheromonal activation. However, many works will be needed before having a definitive picture.
Du, MeiRong; Piao, HaiLan; Li, DaJin
2014-03-01
After the first and second international conferences on reproductive immunology held by Dr. DaJin Li in Shanghai, the related investigators all over the world hope to get together to share their latest findings with each other. Drs. DaJin Li and MeiRong Du sponsored and organized the third international conference on reproductive immunology at the Obstetrics and Gynecology Hospital affiliated with Fudan University, Shanghai, China, in the autumn of 2013. This congress brought together more than 100 International and National investigators representing a wide range of scientific disciplines. All the investigators actively work on reproductive immunology using human or large and small animal models. A range of reproductive immunological topics including the maternal-fetal immune regulation, reproductive tract mucosal immunology, immunocontraception, and pregnancy complications were highlighted and discussed in this conference. This conference supplied a good platform for the international reproductive immunologists to exchange their latest study progression and discuss the development direction of reproductive immunology in the near future. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Reproductive Disorders in Snakes.
Di Girolamo, Nicola; Selleri, Paolo
2017-05-01
Reproduction of snakes is one of the challenging aspects of herpetology medicine. Due to the complexity of reproduction, several disorders may present before, during, or after this process. This article describes the physical examination, and radiographic, ultrasonographic, and endoscopic findings associated with reproductive disorders in snakes. Surgical techniques used to resolve reproductive disorders in snakes are described. Finally, common reproductive disorders in snakes are individually discussed. Copyright © 2017 Elsevier Inc. All rights reserved.
A MATHEMATICAL MODEL FOR THE KINETICS OF THE MALE REPRODUCTIVE ENDOCRINE SYSTEM
In this presentation a model for the hormonal regulation of the reproductive endocrine system in the adult male rat will be discussed. The model includes a description of the kinetics of the androgenic hormones testosterone and dihydrotestosterone, as well as the receptor-mediate...
Toll-like receptors and their role in animal reproduction.
Kannaki, T R; Shanmugam, M; Verma, P C
2011-05-01
Toll-like receptors (TLRs) are evolutionarily conserved innate immune receptors that recognize pathogen specific molecular pattern (PAMPs) in an efficient, non-self-reactive manner and initiate specific immune signaling that culminates in triggering antigen-specific adaptive responses. Different TLR genes in domestic animal species have been characterized and accumulating evidence from recent studies indicates an extended role for TLR signaling in reproductive physiology. In females, TLRs have been implicated in the regulation of ovulation, fertilization, gestation and parturition, as well as in pathological conditions such as endometritis and mastitis. In males, TLRs play a role in steroidogenesis and spermatogenesis. Use of TLR agonists has also been shown to be effective in the treatment of certain reproductive tract infections. Moreover, gene polymorphisms in TLRs have been associated with mastitis providing evidence that TLRs can potentially be exploited as markers in future breeding programs. The aim of this review is to provide a comprehensive treatise on role of TLRs in male and female reproductive physiology and associated pathology in domestic livestock. Copyright © 2011. Published by Elsevier B.V.
Hormone levels predict individual differences in reproductive success in a passerine bird.
Ouyang, Jenny Q; Sharp, Peter J; Dawson, Alistair; Quetting, Michael; Hau, Michaela
2011-08-22
Hormones mediate major physiological and behavioural components of the reproductive phenotype of individuals. To understand basic evolutionary processes in the hormonal regulation of reproductive traits, we need to know whether, and during which reproductive phases, individual variation in hormone concentrations relates to fitness in natural populations. We related circulating concentrations of prolactin and corticosterone to parental behaviour and reproductive success during both the pre-breeding and the chick-rearing stages in both individuals of pairs of free-living house sparrows, Passer domesticus. Prolactin and baseline corticosterone concentrations in pre-breeding females, and prolactin concentrations in pre-breeding males, predicted total number of fledglings. When the strong effect of lay date on total fledgling number was corrected for, only pre-breeding baseline corticosterone, but not prolactin, was negatively correlated with the reproductive success of females. During the breeding season, nestling provisioning rates of both sexes were negatively correlated with stress-induced corticosterone levels. Lastly, individuals of both sexes with low baseline corticosterone before and high baseline corticosterone during breeding raised the most offspring, suggesting that either the plasticity of this trait contributes to reproductive success or that high parental effort leads to increased hormone concentrations. Thus hormone concentrations both before and during breeding, as well as their seasonal dynamics, predict reproductive success, suggesting that individual variation in absolute concentrations and in plasticity is functionally significant, and, if heritable, may be a target of selection.
A transcriptomics investigation into pine reproductive organ development.
Niu, Shihui; Yuan, Huwei; Sun, Xinrui; Porth, Ilga; Li, Yue; El-Kassaby, Yousry A; Li, Wei
2016-02-01
The development of reproductive structures in gymnosperms is still poorly studied because of a lack of genomic information and useful genetic tools. The hermaphroditic reproductive structure derived from unisexual gymnosperms is an even less studied aspect of seed plant evolution. To extend our understanding of the molecular mechanism of hermaphroditism and the determination of sexual identity of conifer reproductive structures in general, unisexual and bisexual cones from Pinus tabuliformis were profiled for gene expression using 60K microarrays. Expression patterns of genes during progression of sexual cone development were analysed using RNA-seq. The results showed that, overall, the transcriptomes of male structures in bisexual cones were more similar to those of female cones. However, the expression of several MADS-box genes in the bisexual cones was similar to that of male cones at the more juvenile developmental stage, while despite these expression shifts, male structures of bisexual cones and normal male cones were histologically indistinguishable and cone development was continuous. This study represents a starting point for in-depth analysis of the molecular regulation of cone development and also the origin of hermaphroditism in pine. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.
Directory of Open Access Journals (Sweden)
Wooyoung Jeong
Full Text Available The reproductive system of chickens undergoes dynamic morphological and functional tissue remodeling during the molting period. The present study identified global gene expression profiles following oviductal tissue regression and regeneration in laying hens in which molting was induced by feeding high levels of zinc in the diet. During the molting and recrudescence processes, progressive morphological and physiological changes included regression and re-growth of reproductive organs and fluctuations in concentrations of testosterone, progesterone, estradiol and corticosterone in blood. The cDNA microarray analysis of oviductal tissues revealed the biological significance of gene expression-based modulation in oviductal tissue during its remodeling. Based on the gene expression profiles, expression patterns of selected genes such as, TF, ANGPTL3, p20K, PTN, AvBD11 and SERPINB3 exhibited similar patterns in expression with gradual decreases during regression of the oviduct and sequential increases during resurrection of the functional oviduct. Also, miR-1689* inhibited expression of Sp1, while miR-17-3p, miR-22* and miR-1764 inhibited expression of STAT1. Similarly, chicken miR-1562 and miR-138 reduced the expression of ANGPTL3 and p20K, respectively. These results suggest that these differentially regulated genes are closely correlated with the molecular mechanism(s for development and tissue remodeling of the avian female reproductive tract, and that miRNA-mediated regulation of key genes likely contributes to remodeling of the avian reproductive tract by controlling expression of those genes post-transcriptionally. The discovered global gene profiles provide new molecular candidates responsible for regulating morphological and functional recrudescence of the avian reproductive tract, and provide novel insights into understanding the remodeling process at the genomic and epigenomic levels.
An Ethical Analysis of Assisted Reproduction Providers' Websites in Pakistan.
Irshad, Ayesha; Werner-Felmayer, Gabriele
2016-07-01
Assisted reproductive technologies (ARTs) and reproductive genetic technologies (RGTs) are intertwined and coevolving. These technologies are increasingly used to fulfill socially and culturally framed requests, for example, "family balancing," or to enable postmenopausal women or homosexual couples to have genetically linked children. The areas of ART and RGT are replete with ethical issues, because different social practices and legal regulations, as well as economic inequalities within and among countries, create vulnerable groups and, therefore, the potential for exploitation. This article provides an overview of the ART and RGT landscape in Pakistan and analyzes the available online content addressing Pakistani citizens and international clients. We explored the topic in view of socioeconomic challenges in Pakistan, particularly deeply rooted poverty, lack of education, gender discrimination, and absence of regulation. As online information given by ART and RGT providers is readily available and could easily raise false hopes, make use of discriminatory statements with regard to women, and promote gender selection to meet sociocultural expectations, it should be subjected to quality control.
Reproductive medicine and the law: egg donation in Germany, Spain and other European countries.
Romeo Casabona, Carlos María; Paslack, Rainer; Simon, Jörgen W
2013-01-01
This paper analyzes the key legal issues raised by Reproductive Medicine practiced in Europe, with special attention to the rules prevailing in countries such as Germany and Spain. Thus, the paper involves a detailed study of the regulation in force in those countries, comparing their solutions with the rules adopted in other EU countries. It also highlights the high risk of com-modification in oocyte donation. In light of this, the differences between the laws of EU countries -some of them, very restrictive with prohibitions or requirements for recipient women and others more permissive with the use of reproductive technologies- can lead to a "reproductive tourism" between countries, as indeed is happening nowadays.
Neuropeptides linking the control of appetite with reproductive function in domestic animals
The occurrence of puberty and maintenance of normal reproductive cycles are regulated by secretion of gonadotropin hormones from the pituitary gland, which is dependent upon the pulsatile release of gonadotropin-releasing hormone (GnRH) from the hypothalamus. It is well established that secretion of...
Directory of Open Access Journals (Sweden)
Renata Zadrag-Tecza
2018-01-01
Full Text Available The total lifespan of the yeast Saccharomyces cerevisiae may be divided into two phases: the reproductive phase, during which the cell undergoes mitosis cycles to produce successive buds, and the postreproductive phase, which extends from the last division to cell death. These phases may be regulated by a common mechanism or by distinct ones. In this paper, we proposed a more comprehensive approach to reveal the mechanisms that regulate both reproductive potential and total lifespan in cell size context. Our study was based on yeast cells, whose size was determined by increased genome copy number, ranging from haploid to tetraploid. Such experiments enabled us to test the hypertrophy hypothesis, which postulates that excessive size achieved by the cell—the hypertrophy state—is the reason preventing the cell from further proliferation. This hypothesis defines the reproductive potential value as the difference between the maximal size that a cell can reach and the threshold value, which allows a cell to undergo its first cell cycle and the rate of the cell size to increase per generation. Here, we showed that cell size has an important impact on not only the reproductive potential but also the total lifespan of this cell. Moreover, the maximal cell size value, which limits its reproduction capacity, can be regulated by different factors and differs depending on the strain ploidy. The achievement of excessive size by the cell (hypertrophic state may lead to two distinct phenomena: the cessation of reproduction without “mother” cell death and the cessation of reproduction with cell death by bursting, which has not been shown before.
Ciparis, Serena; Iwanowicz, Luke R.; Voshell, J. Reese
2012-01-01
Application of manures from animal feeding operations (AFOs) as fertilizer on agricultural land can introduce nutrients and hormones (e.g. estrogens) to streams. A landscape-scale study was conducted in the Shenandoah River watershed (Virginia, USA) in order to assess the relationship between densities of AFOs in watersheds of agricultural streams and in-stream nutrient concentrations and estrogenic activity. The effect of wastewater treatment plants (WWTPs) on nutrients and estrogenic activity was also evaluated. During periods of high and low flow, dissolved inorganic nitrogen (DIN) and orthophosphate (PO4-P) concentrations were analyzed and estrogens/estrogenic compounds were extracted and quantified as17β-estradiol equivalents (E2Eq) using a bioluminescent yeast estrogen screen. Estrogenic activity was measurable in the majority of collected samples, and 20% had E2Eq concentrations > 1 ng/L. Relatively high concentrations of DIN (> 1000 μg/L) were also frequently detected. During all sampling periods, there were strong relationships between watershed densities of AFOs and in-stream concentrations of DIN (R2 = 0.56–0.81) and E2Eq (R2 = 0.39–0.75). Relationships between watershed densities of AFOs and PO4-P were weaker, but were also significant (R2 = 0.27–0.57). When combined with the effect of watershed AFO density, streams receiving WWTP effluent had higher concentrations of PO4-P than streams without WWTP discharges, and PO4-P was the only analyte with a consistent relationship to WWTPs. The results of this study suggest that as the watershed density of AFOs increases, there is a proportional increase in the potential for nonpoint source pollution of agricultural streams and their receiving waters by nutrients, particularly DIN, and compounds that can cause endocrine disruption in aquatic organisms.
Ciparis, Serena; Iwanowicz, Luke R; Voshell, J Reese
2012-01-01
Application of manures from animal feeding operations (AFOs) as fertilizer on agricultural land can introduce nutrients and hormones (e.g. estrogens) to streams. A landscape-scale study was conducted in the Shenandoah River watershed (Virginia, USA) in order to assess the relationship between densities of AFOs in watersheds of agricultural streams and in-stream nutrient concentrations and estrogenic activity. The effect of wastewater treatment plants (WWTPs) on nutrients and estrogenic activity was also evaluated. During periods of high and low flow, dissolved inorganic nitrogen (DIN) and orthophosphate (PO(4)-P) concentrations were analyzed and estrogens/estrogenic compounds were extracted and quantified as17β-estradiol equivalents (E2Eq) using a bioluminescent yeast estrogen screen. Estrogenic activity was measurable in the majority of collected samples, and 20% had E2Eq concentrations >1 ng/L. Relatively high concentrations of DIN (>1000 μg/L) were also frequently detected. During all sampling periods, there were strong relationships between watershed densities of AFOs and in-stream concentrations of DIN (R(2) = 0.56-0.81) and E2Eq (R(2) = 0.39-0.75). Relationships between watershed densities of AFOs and PO(4)-P were weaker, but were also significant (R(2) = 0.27-0.57). When combined with the effect of watershed AFO density, streams receiving WWTP effluent had higher concentrations of PO(4)-P than streams without WWTP discharges, and PO(4)-P was the only analyte with a consistent relationship to WWTPs. The results of this study suggest that as the watershed density of AFOs increases, there is a proportional increase in the potential for nonpoint source pollution of agricultural streams and their receiving waters by nutrients, particularly DIN, and compounds that can cause endocrine disruption in aquatic organisms. Copyright © 2011 Elsevier B.V. All rights reserved.
The infra-value of human rights in the context of assisted regulation in México.
Esparza-Pérez, Rosa Verónica
Infertility represents a problem in the context of reproductive health; to treat it were developed the techniques of assisted human reproduction, despite medical advances, the practice of techniques is subject to medical, legal and ethical dysfunctions. In Mexico, since the late 1980s assisted reproduction clinics were set up in public and private sector hospitals; however, they do not yet have a legal framework to regulate them in a specific way, which causes human rights violations that could be avoided with adequate regulation. This article advances the need to provide Mexico with such regulation as a means of guaranteeing both human rights and the rights of physicians and other health workers involved in these techniques. Copyright: © 2017 SecretarÍa de Salud.
Wierman, Margaret E; Xu, Mei; Pierce, A; Bliesner, B; Bliss, S P; Roberson, M S
2012-01-01
Selective deletion of extracellular signal-regulated kinase (ERK) 1 and ERK2 in the pituitary gonadotrope and ovarian granulosa cells disrupts female reproductive axis function. Thus, we asked if ERK1 and ERK2 are critical for GnRH neuron ontogeny or the central control of female reproductive function. GnRH-Cre-recombinase (Cre+) expressing mice were crossed with mice with a global deletion of ERK1 and a floxed ERK2 allele (Erk1-/Erk2fl/fl) to selectively delete ERK2 in GnRH neurons. Cre-recombinase mRNA was selectively expressed in the brain of Cre+ mice. GnRH neuron number and location were determined during embryogenesis and in the adult. GnRH neuron counts at E15 did not differ between experimental and control groups (1,198 ± 65 and 1,160 ± 80 respectively, p = NS). In adults, numbers of GnRH neurons in the GnRHCre+Erk1-/Erk2- mice (741 ± 157) were similar to those in controls (756 ± 7), without alteration in their distribution across the forebrain. ERK1 and 2 deficiency did not alter the timing of vaginal opening, age at first estrus, or estrous cyclicity. Although ERK1 and 2 are components of a dominant signaling pathway in GnRH neuronal cells that modulates survival and control of GnRH gene expression, other signaling pathways compensate for their deletion in vivo to allow GnRH neuron survival and targeting and normal onset of female sexual maturation and reproductive function. In contrast to effects at the pituitary and the ovary, ERK1 and ERK2 are dispensable at the level of the GnRH neuron. Copyright © 2011 S. Karger AG, Basel.
Marijuana, the Endocannabinoid System and the Female Reproductive System
Brents, Lisa K.
2016-01-01
Marijuana use among women is highly prevalent, but the societal conversation on marijuana rarely focuses on how marijuana affects female reproduction and endocrinology. This article reviews the current scientific literature regarding marijuana use and hypothalamic-pituitary-ovarian (HPO) axis regulation, ovarian hormone production, the menstrual cycle, and fertility. Evidence suggests that marijuana can reduce female fertility by disrupting hypothalamic release of gonadotropin releasing hormo...
Voice and Handgrip Strength Predict Reproductive Success in a Group of Indigenous African Females
Sorokowska, Agnieszka; Sorokowski, Piotr; Mberira, Mara; Bartels, Astrid; Gallup, Gordon G.
2012-01-01
Evolutionary accounts of human traits are often based on proxies for genetic fitness (e.g., number of sex partners, facial attractiveness). Instead of using proxies, actual differences in reproductive success is a more direct measure of Darwinian fitness. Certain voice acoustics such as fundamental frequency and measures of health such as handgrip strength correlate with proxies of fitness, yet there are few studies showing the relation of these traits to reproduction. Here, we explore whether the fundamental frequency of the voice and handgrip strength account for differences in actual reproduction among a population of natural fertility humans. Our results show that both fundamental frequency and handgrip strength predict several measures of reproductive success among a group of indigenous Namibian females, particularly amongst the elderly, with weight also predicting reproductive outcomes among males. These findings demonstrate that both hormonally regulated and phenotypic quality markers can be used as measures of Darwinian fitness among humans living under conditions that resemble the evolutionary environment of Homo sapiens. We also argue that these findings provide support for the Grandmother Hypothesis. PMID:22870251
Ameloblastic fibro-odontoma differentiating into odontoma: An old concept revised
Directory of Open Access Journals (Sweden)
Ajas A Gogri
2014-01-01
Full Text Available Ameloblastic fibro-odontoma (AFO is a benign mixed tumor of odontogenic origin. It generally occurs in children and teenagers; however, cases occurring in the elderly have also been reported. Generally, the tumor is asymptomatic and is discovered accidently on a radiograph taken for an unerupted tooth, but examples of large tumors causing jaw swelling have been reported in literature. This article presents a case of AFO causing jaw expansion with pain and lymphadenopathy in a 17-year-old male. As the final diagnosis is always confirmed by histopathology, this case is a unique one diagnosed by clinical and radiographic findings as an odontoma and suggesting the differentiation of an AFO to odontoma.
Fake it till you make it: Policymaking and assisted human reproduction in Canada.
Baylis, Françoise; Downie, Jocelyn; Snow, Dave
2014-06-01
The Assisted Human Reproduction Act (AHR Act) came into effect in 2004. The AHR Act stipulates in s.12 that no reimbursement of expenditures incurred in the course of donating gametes, maintaining or transporting in vitro embryos, or providing surrogacy services is permitted, except in accordance with the regulations and with receipts. Ten years later, Health Canada still has not drafted the regulations governing reimbursement. Section 12 is therefore still not in force. Health Canada and others have asserted that there is a Health Canada policy on reimbursement and that reimbursement with receipts is legally permissible. We dispute the existence of such a policy and its legitimacy (if it exists). We also challenge the decision by Health Canada not to produce regulations and thereby make it possible for Parliament to bring s.12 into force. This intentional lack of action is worrisome on at least two fronts. First, it sidesteps the processes required for regulations and thereby ducks the Parliamentary oversight very deliberately built into the AHR Act. Second, it leaves Canadians who provide and who access assisted human reproduction uncertain about what is and is not permitted, and therefore fearful of, or at risk of, prosecution. We conclude that Health Canada should take the steps necessary to put regulations in front of Parliament so that Parliament will then be able to pass regulations and bring s.12 into force. Canadians should demand no less.
Vitamin D and male reproductive system.
Costanzo, Pablo R; Knoblovits, Pablo
2016-12-01
Vitamin D deficiency is a highly prevalent worldwide condition and affects people of all ages. The most important role of vitamin D is the regulation of intestinal calcium absorption and metabolism of calcium and phosphorus to maintain muscle and bone homeostasis. Furthermore, in recent years it has been discovered that the vitamin D receptor (VDR) is widely distributed in many organs and tissues where vitamin D can perform other actions that include the modulation of the immune response, insulin secretion, anti-proliferative effect on cells of vascular smooth muscle, modulation of the renin-angiotensin-aldosterone system and regulates cell growth in several organs. The VDR is widely distributed in the male reproductive system. Vitamin D induces changes in the spermatozoa's calcium and cholesterol content and in protein phosphorylation to tyrosine/threonine residues. These changes could be involved in sperm capacitation. Vitamin D seems to regulate aromatase expression in different tissues. Studies analyzing seasonal variations of sex steroids in male populations yield conflicting results. This is probably due to the wide heterogeneity of the populations included according to age, systemic diseases and obesity.
Cabal, Luisa; Olaya, Monica Arango; Robledo, Valentina Montoya
2014-12-11
Conscientious Objection or conscientious refusal (CO) in access to reproductive health care is at the center of current legal debates worldwide. In countries such as the US and the UK, constitutional dilemmas surrounding CO in the context of reproductive health services reveal inadequate policy frameworks for balancing CO rights with women's rights to access contraception and abortion. The Colombian Constitutional Court's holistic jurisprudence regarding CO standards has applied international human rights norms so as to not only protect women's reproductive rights as fundamental rights, but to also introduce clear limits for the exercise of CO in health care settings. This paper reviews Latin American lines of regulation in Argentina, Uruguay, and Mexico City to argue that the Colombian Court's jurisprudence offers a strong guidance for future comprehensive policy approaches that aim to effectively balance tensions between CO and women's reproductive rights. Copyright © 2014 Cabal, Olaya, Robledo. This is an open access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original author and source are credited.
Ruiz, Mayté; French, Susannah S; Demas, Gregory E; Martins, Emília P
2010-02-01
The energetic resources in an organism's environment are essential for executing a wide range of life-history functions, including immunity and reproduction. Most energetic budgets, however, are limited, which can lead to trade-offs among competing functions. Increasing reproductive effort tends to decrease immunity in many cases, and increasing total energy via supplemental feedings can eliminate this effect. Testosterone (T), an important regulator of reproduction, and food availability are thus both potential factors regulating life-history processes, yet they are often tested in isolation of each other. In this study, we considered the effect of both food availability and elevated T on immune function and reproductive behavior in sagebrush lizards, Sceloporus graciosus, to assess how T and energy availability affect these trade-offs. We experimentally manipulated diet (via supplemental feedings) and T (via dermal patches) in males from a natural population. We determined innate immune response by calculating the bacterial killing capability of collected plasma exposed to Escherichia coli ex vivo. We measured reproductive behavior by counting the number of courtship displays produced in a 20-min sampling period. We observed an interactive effect of food availability and T-patch on immune function, with food supplementation increasing immunity in T-patch lizards. Additionally, T increased courtship displays in control food lizards. Lizards with supplemental food had higher circulating T than controls. Collectively, this study shows that the energetic state of the animal plays a critical role in modulating the interactions among T, behavior and immunity in sagebrush lizards and likely other species. Copyright 2009 Elsevier Inc. All rights reserved.
Penasa, Simone
2012-01-01
This article will describe the current legal framework on Assisted Reproduction Technology (ART) regulation in Italy, taking into account recent case-law derived from the implementation of the Law 40 of 2004 on ART. Special attention will be devoted to the case of Costa and Pavan v. Italy, recently decided by the Tenth Session of the European Court of Human Rights (ECtHR). In that decision, the European Court declared the incompatibility of the ban to pre-implantation genetic diagnosis introduced by the abovementioned Italian law on ART. The case will be analysed from a dual perspective. On the one hand, it will be considered in the light of the ECtHR case-law, in order to derive systematic aspects of continuity or discontinuity between the former and the latter2. On the other hand, the case will be considered in the light of its concrete and prospective impact on the Italian legal approach to ART regulation, considering especially the direct and indirect influence of the case: e.g., its possible utilisation by Italian judges when they are called upon to implement Law 40.
Jones, Susan M
2017-04-01
Australian lizards exhibit a broad array of different reproductive strategies and provide an extraordinary diversity and range of models with which to address fundamental problems in reproductive biology. Studies on lizards have frequently led to new insights into hormonal regulatory pathways or mechanisms of control, but we have detailed knowledge of the reproductive cycle in only a small percentage of known species. This review provides an overview and synthesis of current knowledge of the hormonal control of reproductive cycles in Australian lizards. Agamid lizards have provided useful models with which to test hypotheses about the hormonal regulation of the expression of reproductive behaviors, while research on viviparous skinks is providing insights into the evolution of the endocrine control of gestation. However, in order to better understand the potential risks that environmental factors such as climate change and endocrine disrupting chemicals pose to our fauna, better knowledge is required of the fundamental characteristics of the reproductive cycle in a broader range of lizard species. Copyright © 2015 Elsevier Inc. All rights reserved.
Radovic, Milan; Ristic, Lidija; Ciric, Zorica; Dinic-Radovic, Violeta; Stankovic, Ivana; Pejcic, Tatjana; Rancic, Milan; Bogdanovic, Dragan
2016-01-01
During the treatment phase of active pulmonary tuberculosis (PTB), respiratory function impairment is usually restrictive. This may become obstructive, as a PTB-associated airflow obstruction (AFO) or as a later manifestation of underlying COPD. The aim of the study was to examine the potential causes and risks for AFO development in PTB by exploring the aspects of spirometry limitations and clinical implications for the underlying COPD detection, taking into account various confounding factors. Prospective, nest case-control study on 40 new cases of PTB with initial restrictive respiratory function impairment, diagnosed and treated according to the directly observed treatment short course (DOTS) strategy. From all observed patients, 37.5% of them developed AFO upon the completion of PTB treatment, with significantly increased average of forced vital capacity (%) (Ppulmonary tuberculosis lesions (OR 1.01-1.05 for 95% CI; P=0.02) and sputum conversion rate on culture (OR 1.02-1.68 for 95% CI; P=0.04) as the most significant predictors for the risk of AFO development. AFO upon PTB treatment is a common manifestation of underlying COPD, which mostly occurs later, during the reparative processes in active PTB, even in the absence of major risk factors, such as cigarette smoking and biomass fuel dust exposure. Initial spirometry testing in patients with active PTB is not a sufficient and accurate approach in the detection of underlying COPD, which may lead to their further potential health deterioration.
Reproductive Toxicity of Triptolide in Male House Rat, Rattus rattus
Directory of Open Access Journals (Sweden)
Neena Singla
2014-01-01
Full Text Available The aim of study was to investigate the toxic effect of triptolide fed in bait on reproduction of male house rat, Rattus rattus. Feeding of cereal based bait containing 0.2% triptolide to male R. rattus for 5 days in no-choice feeding test, leading to mean daily ingestion of 20.45 mg/kg bw of triptolide, was found effective in significantly (P≤0.05 reducing sperm motility and viability in cauda epididymal fluid by 80.65 and 75.14%, respectively, from that of untreated rats. Pregnancy rates were decreased by 100% in untreated cyclic female rats paired with male rats treated with 0.2% triptolide. Present studies suggest the potential of 0.2% triptolide bait in regulating reproductive output of R. rattus.
External and internal controls of lunar-related reproductive rhythms in fishes.
Takemura, A; Rahman, M S; Park, Y J
2010-01-01
Reproductive activities of many fish species are, to some extent, entrained to cues from the moon. During the spawning season, synchronous spawning is repeated at intervals of c. 1 month (lunar spawning cycle) and 2 weeks (semi-lunar spawning cycle) or daily according to tidal changes (tidal spawning cycle). In species showing lunar-related spawning cycles, oocytes in the ovary develop towards and mature around a specific moon phase for lunar spawners, around spring tides for semi-lunar spawners and at daytime high tides for tidal spawners. The production of sex steroid hormones also changes in accordance with synchronous oocyte development. Since the production of the steroid hormones with lunar-related reproductive periodicity is regulated by gonadotropins, it is considered that the higher parts of the hypothalamus-pituitary-gonad axis play important roles in the perception and regulation of lunar-related periodicity. It is likely that fishes perceive cues from the moon by sensory organs; however, it is still unknown how lunar cues are transduced as an endogenous rhythm exerting lunar-related spawning rhythmicity. Recent research has revealed that melatonin fluctuated according to the brightness at night, magnetic fields and the tidal cycle. In addition, cyclic changes in hydrostatic pressure had an effect on monoamine contents in the brain. These factors may be indirectly related to the exertion of lunar-related periodicity. Molecular approaches have revealed that mRNA expressions of light-sensitive clock genes change with moonlight, suggesting that brightness at night plays a role in phase-shifting or resetting of biological clocks. Some species may have evolved biological clocks in relation to lunar cycles, although it is still not known how lunar periodicities are endogenously regulated in fishes. This review demonstrates that lunar-related periodicity is utilized and incorporated by ecological and physiological mechanisms governing the reproductive success
Normal Female Reproductive Anatomy
... historical Searches are case-insensitive Reproductive System, Female, Anatomy Add to My Pictures View /Download : Small: 720x756 ... Large: 3000x3150 View Download Title: Reproductive System, Female, Anatomy Description: Anatomy of the female reproductive system; drawing ...
Reproductive strategies in snakes.
Shine, Richard
2003-05-22
Snakes of both sexes display remarkable flexibility and diversity in their reproductive tactics. Many features of reproduction in female snakes (such as reproductive mode and frequency, seasonality and multiple mating) allow flexible maternal control. For example, females can manipulate not only the genotypes of their offspring (through mate choice or enhanced sperm competition) but also the phenotypes of their offspring (through allocation 'decisions', behavioural and physiological thermoregulation, and nest-site selection). Reliance on stored energy ('capital') to fuel breeding results in low frequencies of female reproduction and, in extreme cases, semelparity. A sophisticated vomeronasal system not only allows male snakes to locate reproductive females by following scent trails, but also facilitates pheromonally mediated mate choice by males. Male-male rivalry takes diverse forms, including female mimicry and mate guarding; combat bouts impose strong selection for large body size in males of some species. Intraspecific (geographical) variation and phenotypic plasticity in a wide array of reproductive traits (offspring size and number; reproductive frequency; incidence of multiple mating; male tactics such as mate guarding and combat; mate choice criteria) provide exceptional opportunities for future studies.
Gee, G.F.; Gibbons, Edward F.; Durrant, Barbara S.; Demarest, Jack
1995-01-01
Knowledge of the many physiological factors associated with egg production , fertility, incubation, and brooding in nondomestic birds is limited. Science knows even less about reproduction in most of the 238 endangered or threatened birds. This discussion uses studies of nondomestic and, when necessary, domestic birds to describe physiological control of reproduction. Studies of the few nondomestic avian species show large variation in physiological control of reproduction. Aviculturists, in order to successfully propagate an endangered bird, must understand the bird's reproductive peculiarities. First, investigators can do studies with carefully chosen surrogate species, but eventually they need to confirm the results in the target endangered bird. Studies of reproduction in nondomestic birds increased in the last decade. Still, scientists need to do more comparative studies to understand the mechanisms that control reproduction in birds. New technologies are making it possible to study reproductive physiology of nondomestic species in less limiting ways. These technologies include telemetry to collect information without inducing stress on captives (Howey et al., 1987; Klugman, 1987), new tests for most of the humoral factors associated with reproduction, and the skill to collect small samples and manipulate birds without disrupting the physiological mechanisms (Bercovitz et al., 1985). Managers are using knowledge from these studies to improve propagation in zoological parks, private and public propagation facilities, and research institutions. Researchers need to study the control of ovulation, egg formation, and oviposition in the species of nondomestic birds that lay very few eggs in a season, hold eggs in the oviduct for longer intervals, or differ in other ways from the more thoroughly studied domestic birds. Other techniques that would enhance propagation for nondomestlc birds include tissue culture of cloned embryonic cells, cryopreservation of embryos
Reproduction, physiology and biochemistry
This chapter summarizes fundamental knowledge and recent discoveries about the reproduction, physiology and biochemistry of plant-parasitic nematodes. Various types of reproduction are reviewed, including sexual reproduction and mitotic and meiotic parthenogenesis. Although much is known about the p...
Effect of raceme-localized supplemental light on soybean reproductive abscission
International Nuclear Information System (INIS)
Myers, R.L.; Brun, W.A.; Brenner, M.L.
1987-01-01
The percentage of soybean [Glycine max (L.) Merr.] reproductive structures that abscise is a potentially important yield factor. To better understand the involvement of light in the abscission of reproductive structures, a series of in vitro raceme-culture and growth-chamber experiments were conducted. In the in vitro raceme-culture experiments, racemes with four to six flowers at or past anthesis were excised from the soybean plant (genotype IX93-100), embedded in a complete nutrient, solid agar medium, and subjected to various light treatments. A series of three experiments indicated that the racemes contain a photoreceptor, possibly phytochrome, capable of regulating sucrose accumulation. In each of the growth chamber studies, supplemental light was supplied directly to individual soybean flowers via fiber optic light guides. The light source increased the photon flux to the flowers by 10-fold. The first growth chamber experiment showed that flowers receiving supplemental light were more intense sinks for 14 C-sucrose than were controls (intensity value of 1.0 vs 0.4 x 10 -7 , intensity = [dps of flower/dps of raceme]/[kg dry wt of flower]). In a second study, 42% of flowers treated with supplemental light set pods, while only 26% of control flowers set pods. A third experiment showed that red supplemental light produced 55% fruit set, compared to 41% set for far-red light, and 35% for controls. These experiments indicate that both photoassimilate accumulation and abscission in young soybean reproductive structures may be regulated by light quality
National Research Council Canada - National Science Library
Rocha, Maria João; Arukwe, Augustine; Kapoor, B. G
2008-01-01
... of reproductive systems is essential for such studies. Fishes comprise over 28,000 species, with a remarkable variability in morphology, physiology and environmental adaptation. Knowledge on fish reproduction is scattered across numerous sources that shows a dynamic research field. The Editors believe it to be an opportune moment for a...
Symbiotic regulation of plant growth, development and reproduction
Russell J. Rodriguez; D. Carl Freeman; E. Durant McArthur; Yong Ok Kim; Regina S. Redman
2009-01-01
The growth and development of rice (Oryzae sativa) seedlings was shown to be regulated epigenetically by a fungal endophyte. In contrast to un-inoculated (nonsymbiotic) plants, endophyte colonized (symbiotic) plants preferentially allocated resources into root growth until root hairs were well established. During that time symbiotic roots expanded at...
Kirby, David A
2017-09-01
In the mid-twentieth century film studios sent their screenplays to Hollywood's official censorship body, the Production Code Administration (PCA), and to the Catholic Church's Legion of Decency for approval and recommendations for revision. This article examines the negotiations between filmmakers and censorship groups in order to show the stories that censors did, and did not, want told about pregnancy, childbirth and abortion, as well as how studios fought to tell their own stories about human reproduction. I find that censors considered pregnancy to be a state of grace and a holy obligation that was restricted to married women. For censors, human reproduction was not only a private matter, it was also an unpleasant biological process whose entertainment value was questionable. They worried that realistic portrayals of pregnancy and childbirth would scare young women away from pursuing motherhood. In addition, I demonstrate how filmmakers overcame censors' strict prohibitions against abortion by utilizing ambiguity in their storytelling. Ultimately, I argue that censors believed that pregnancy and childbirth should be celebrated but not seen. But if pregnancy and childbirth were required then censors preferred mythic versions of motherhood instead of what they believed to be the sacred but horrific biological reality of human reproduction.
Role of oxidative stress in female reproduction
Directory of Open Access Journals (Sweden)
Sharma Rakesh K
2005-07-01
embryopathies, preterm labour and preeclampsia and gestational diabetes. The review also addresses the growing literature on the role of nitric oxide species in female reproduction. The involvement of nitric oxide species in regulation of endometrial and ovarian function, etiopathogenesis of endometriosis, and maintenance of uterine quiescence, initiation of labour and ripening of cervix at parturition is discussed. Complex interplay between cytokines and oxidative stress in the etiology of female reproductive disorders is discussed. Oxidant status of the cell modulates angiogenesis, which is critical for follicular growth, corpus luteum formation endometrial differentiation and embryonic growth is also highlighted in the review. Strategies to overcome oxidative stress and enhance fertility, both natural and assisted are delineated. Early interventions being investigated for prevention of preeclampsia are enumerated. Trials investigating combination intervention strategy of vitamin E and vitamin C supplementation in preventing preeclampsia are highlighted. Antioxidants are powerful and there are few trials investigating antioxidant supplementation in female reproduction. However, before clinicians recommend antioxidants, randomized controlled trials with sufficient power are necessary to prove the efficacy of antioxidant supplementation in disorders of female reproduction. Serial measurement of oxidative stress biomarkers in longitudinal studies may help delineate the etiology of some of the diosorders in female reproduction such as preeclampsia.
Van Hoof, Wannes; Pennings, Guido
2011-11-01
Since the development of assisted reproduction technologies, there has been discussion on which people should have access to these technologies and which treatments and techniques are morally acceptable. However, national legislation can no longer determine what citizens do. Some countries react to their citizens going abroad to evade restrictions by implementing even more restrictive laws. Turkey has recently become the first state to ban reproductive travel in pursuit of donor gametes. Several states in Australia have enacted or are considering laws that prohibit international commercial surrogacy. This article investigates the consistency and morality of several state reactions to cross-border reproductive care (CBRC), including extraterritorial regulation. The only widespread existing extraterritorial regulation of private life concerns female genital cutting (FGC), sex with children and (largely in the past) abortion. This discussion develops an analogy with these cross-border crimes to evaluate the morality of similar legislation in cases of CBRC. The dissimilarity in these analogies shows that extraterritoriality is a radical position that is generally inappropriate in the case of CBRC. Subsequently, several potential state reactions to CBRC for law evasion are considered. It is concluded that legislation of CBRC should be modest, tolerant and nuanced. Copyright © 2011 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.
A mixed odontogenic sarcoma: A challenging histopathologic case and brief review of the literature.
Atarbashi-Moghadam, Saede; Lotfi, Ali; Mokhtari, Sepideh
2018-01-01
Ameloblastic fibro-odontosarcoma (AFOS) is an extremely rare malignant mixed odontogenic tumor. The ectomesenchymal part of the neoplasm shows malignancy, whereas the epithelial component is rather benign. In addition, small areas with deposition of enamel matrix and dentine material are seen. The rarity of this neoplasm and microscopic similarities with other malignant and benign tumors can lead to diagnostic problems. Here, we describe the histopathologic features of a new case of AFOS of the mandible in a 34-year-old female patient. It is essential for oral pathologists to be familiar with the microscopic features of this rare neoplasm to have a proper diagnosis. This is also the first reported case of AFOS that closely resembles osteosarcoma in some areas.
Andrade, Luiza Freire de; Mourão, Marina de Moraes; Geraldo, Juliana Assis; Coelho, Fernanda Sales; Silva, Larissa Lopes; Neves, Renata Heisler; Volpini, Angela; Machado-Silva, José Roberto; Araujo, Neusa; Nacif-Pimenta, Rafael; Caffrey, Conor R; Oliveira, Guilherme
2014-06-01
Protein kinases are proven targets for drug development with an increasing number of eukaryotic Protein Kinase (ePK) inhibitors now approved as drugs. Mitogen-activated protein kinase (MAPK) family members connect cell-surface receptors to regulatory targets within cells and influence a number of tissue-specific biological activities such as cell proliferation, differentiation and survival. However, the contributions of members of the MAPK pathway to schistosome development and survival are unclear. We employed RNA interference (RNAi) to elucidate the functional roles of five S. mansoni genes (SmCaMK2, SmJNK, SmERK1, SmERK2 and SmRas) involved in MAPK signaling pathway. Mice were injected with post-infective larvae (schistosomula) subsequent to RNAi and the development of adult worms observed. The data demonstrate that SmJNK participates in parasite maturation and survival of the parasites, whereas SmERK are involved in egg production as infected mice had significantly lower egg burdens with female worms presenting underdeveloped ovaries. Furthermore, it was shown that the c-fos transcription factor was overexpressed in parasites submitted to RNAi of SmERK1, SmJNK and SmCaMK2 indicating its putative involvement in gene regulation in this parasite's MAPK signaling cascade. We conclude that MAPKs proteins play important roles in the parasite in vivo survival, being essential for normal development and successful survival and reproduction of the schistosome parasite. Moreover SmERK and SmJNK are potential targets for drug development.
Kisspeptin and the seasonal control of reproduction in hamsters
DEFF Research Database (Denmark)
Simonneaux, Valérie; Ansel, Laura; Revel, Florent G
2008-01-01
-expressing neurons, which were recently shown to be implicated in the regulation of GnRH release. Hamsters are seasonal rodents which are sexually active in long photoperiod and quiescent in short photoperiod. The photoperiodic information is transmitted to the reproductive system by melatonin, a pineal...... hormone whose secretion is adjusted to night length. The photoperiodic variation in circulating melatonin has been shown to synchronize reproductive activity with seasons, but the mechanisms involved in this effect of melatonin were so far unknown. Recently we have observed that Kiss1 mRNA level...... in the arcuate nucleus of the Syrian hamster is lower in short photoperiod, when animals are sexually quiescent. Notably, intracerebroventricular infusion of Kiss1 gene product, kisspeptin, in hamsters kept in short photoperiod is able to override the inhibitory photoperiod and to reactivate sexual activity...
The role of adiponectin in reproduction: from polycystic ovary syndrome to assisted reproduction.
Michalakis, Konstantinos G; Segars, James H
2010-11-01
To summarize the effects of the adipokine adiponectin on the reproductive endocrine system, from the hypothalamic-pituitary axis to the gonads and target tissues of the reproductive system. A Medline computer search was performed to identify relevant articles. Research institution. None. Adiponectin is a hormone secreted by adipose tissue that acts to reduce insulin resistance and atherogenic damage, but it also exerts actions in other tissues. Adiponectin mediates its actions in the periphery mainly via two receptors, AdipoR1 and AdipoR2. Adiponectin receptors are present in many reproductive tissues, including the central nervous system, ovaries, oviduct, endometrium, and testes. Adiponectin influences gonadotropin release, normal pregnancy, and assisted reproduction outcomes. Adiponectin, a beneficial adipokine, represents a major link between obesity and reproduction. Higher levels of adiponectin are associated with improved menstrual function and better outcomes in assisted reproductive cycles. Published by Elsevier Inc.
On reproduction in red algae: further research needed at the molecular level
García-Jiménez, Pilar; Robaina, Rafael R.
2015-01-01
Multicellular red algae (Rhodophyta) have some of the most complex life cycles known in living organisms. Economically valuable seaweeds, such as phycocolloid producers, have a triphasic (gametophyte, carposporophyte, and tetrasporophyte) life cycle, not to mention the intricate alternation of generations in the edible “sushi-alga” nori. It is a well-known fact that reproductive processes are controlled by one or more abiotic factor(s), including day length, light quality, temperature, and nutrients. Likewise, endogenous chemical factors such as plant growth regulators have been reported to affect reproductive events in some red seaweeds. Still, in the genomic era and given the high throughput techniques at our disposal, our knowledge about the endogenous molecular machinery lags far behind that of higher plants. Any potential effective control of the reproductive process will entail revisiting most of these results and facts to answer basic biological questions as yet unresolved. Recent results have shed light on the involvement of several genes in red alga reproductive events. In addition, a working species characterized by a simple filamentous architecture, easy cultivation, and accessible genomes may also facilitate our task. PMID:25755663
On reproduction in red algae: further research needed at the molecular level
Directory of Open Access Journals (Sweden)
Pilar eGarcía-Jiménez
2015-02-01
Full Text Available Multicellular red algae (Rhodophyta have some of the most complex life cycles known in living organisms. Economically valuable seaweeds, such as phycocolloid producers, have a triphasic (gametophyte, carposporophyte and tetrasporophyte life cycle, not to mention the intricate alternation of generations in the edible sushi-alga nori. It is a well-known fact that reproductive processes are controlled by one or more abiotic factor(s, including day length, light quality, temperature and nutrients. Likewise, endogenous chemical factors such as plant growth regulators have been reported to affect reproductive events in some red seaweeds. Still, in the genomic era and given the high throughput techniques at our disposal, our knowledge about the endogenous molecular machinery lags far behind that of higher plants. Any potential effective control of the reproductive process will entail revisiting most of these results and facts to answer basic biological questions as yet unresolved. Recent results have shed light on the involvement of several genes in red alga reproductive events. In addition, a working species characterized by a simple filamentous architecture, easy cultivation and accessible genomes may also facilitate our task.
MicroRNA regulation of immune events at conception.
Robertson, Sarah A; Zhang, Bihong; Chan, Honyueng; Sharkey, David J; Barry, Simon C; Fullston, Tod; Schjenken, John E
2017-09-01
The reproductive tract environment at conception programs the developmental trajectory of the embryo, sets the course of pregnancy, and impacts offspring phenotype and health. Despite the fundamental importance of this stage of reproduction, the rate-limiting regulatory mechanisms operating locally to control fertility and fecundity are incompletely understood. Emerging studies highlight roles for microRNAs (miRNAs) in regulating reproductive and developmental processes and in modulating the quality and strength of the female immune response. Since endometrial receptivity and robust placentation require specific adaptation of the immune response, we hypothesize that miRNAs participate in establishing pregnancy through effects on key gene networks in immune cells. Our recent studies investigated miRNAs that are induced in the peri-conception environment, focusing on miRNAs that have immune-regulatory roles-particularly miR-223, miR-155, and miR-146a. Genetic mouse models deficient in individual miRNAs are proving informative in defining roles for these miRNAs in the generation and stabilization of regulatory T cells (Treg cells) that confer adaptive immune tolerance. Overlapping and redundant functions between miRNAs that target multiple genes, combined with multiple miRNAs targeting individual genes, indicate complex and sensitive regulatory networks. Although to date most data on miRNA regulation of reproductive events are from mice, conserved functions of miRNAs across species imply similar biological pathways operate in all mammals. Understanding the regulation and roles of miRNAs in the peri-conception immune response will advance our knowledge of how environmental determinants act at conception, and could have practical applications for animal breeding as well as human fertility. © 2017 Wiley Periodicals, Inc.
Ankle-foot orthosis bending axis influences running mechanics.
Russell Esposito, Elizabeth; Ranz, Ellyn C; Schmidtbauer, Kelly A; Neptune, Richard R; Wilken, Jason M
2017-07-01
Passive-dynamic ankle-foot orthoses (AFOs) are commonly prescribed to improve locomotion for people with lower limb musculoskeletal weakness. The clinical prescription and design process are typically qualitative and based on observational assessment and experience. Prior work examining the effect of AFO design characteristics generally excludes higher impact activities such as running, providing clinicians and researchers limited information to guide the development of objective prescription guidelines. The proximal location of the bending axis may directly influence energy storage and return and resulting running mechanics. The purpose of this study was to determine if the location of an AFO's bending axis influences running mechanics. Marker and force data were recorded as 12 participants with lower extremity weakness ran overground while wearing a passive-dynamic AFO with posterior struts manufactured with central (middle) and off-centered (high and low) bending axes. Lower extremity joint angles, moments, powers, and ground reaction forces were calculated and compared between limbs and across bending axis conditions. Bending axis produced relatively small but significant changes. Ankle range of motion increased as the bending axis shifted distally (pbenefits during running, although individual preference and physical ability should also be considered. Published by Elsevier B.V.
Molecular basis for the reproductive division of labour in a lower termite
Directory of Open Access Journals (Sweden)
Rehli Michael
2007-06-01
Full Text Available Abstract Background Polyphenism, the expression of different phenotypes with the same genetic background, is well known for social insects. The substantial physiological and morphological differences among the castes generally are the result of differential gene expression. In lower termites, workers are developmentally flexible to become neotenic replacement reproductives via a single moult after the death of the founding reproductives. Thus, both castes (neotenics and workers are expected to differ mainly in the expression of genes linked to reproductive division of labour, which constitutes the fundamental basis of insect societies. Results Representational difference analysis of cDNAs was used to study differential gene expression between neotenics and workers in the drywood termite Cryptotermes secundus (Kalotermitidae. We identified and, at least partially cloned five novel genes that were highly expressed in female neotenics. Quantitative real-time PCR analysis of all five genes in different castes (neotenics, founding reproductives, winged sexuals and workers of both sexes confirmed the differential expression patterns. In addition, the relative expression of these genes was determined in three body parts of female neotenics (head, thorax, and abdomen using quantitative real-time PCR. Conclusion The identified genes could be involved in the control and regulation of reproductive division of labour. Interestingly, this study revealed an expression pattern partly similar to social Hymenoptera indicating both common and species-specific regulatory mechanisms in hemimetabolous and holometabolous social insects.
Directory of Open Access Journals (Sweden)
Jill Allison
2016-12-01
Full Text Available Assisted reproductive technology has become a normalized part of reproductive medicine in many countries around the world. Access, however, is uneven and inconsistent, facilitated and restricted by such factors as affordability, social and moral acceptance or refusal and local cultures of medical practice. In Ireland, assisted reproductive technology has been available since 1987 but remains unregulated by legislation. This creates an uncertain and untenable legal circumstance given the contested issues related to constitutional protection of the right to life of the unborn and the indeterminate legal status of embryos in vitro. This paper examines the impact of an enduring political impasse. It explores how clinical assisted reproductive technology services in Ireland operate both inside and outside dominant institutional frameworks, meeting a pronatalist and pro-family social and political agenda, while sometimes contradicting the pro-life politics that has continued to shape women’s reproductive lives. The medical approaches to infertility thus intersect with the ongoing debates around abortion, the failure of the government to regulate, and notions of embodied motherhood and responsibility within changing meanings of family and kinship. At the same time women and their partners seek assisted reproductive technology treatment in other countries throughout the European Union where laws differ and availability of services varies. A decade has passed since the Commission on Assisted Human Reproduction in Ireland released its recommendations; the enduring legislative vacuum leaves women, families and practitioners in potential legal limbo.
Estradiol Membrane-Initiated Signaling in the Brain Mediates Reproduction.
Micevych, Paul E; Mermelstein, Paul G; Sinchak, Kevin
2017-11-01
Over the past few years our understanding of estrogen signaling in the brain has expanded rapidly. Estrogens are synthesized in the periphery and in the brain, acting on multiple receptors to regulate gene transcription, neural function, and behavior. Various estrogen-sensitive signaling pathways often operate in concert within the same cell, increasing the complexity of the system. In females, estrogen concentrations fluctuate over the estrous/menstrual cycle, dynamically modulating estrogen receptor (ER) expression, activity, and trafficking. These dynamic changes influence multiple behaviors but are particularly important for reproduction. Using the female rodent model, we review our current understanding of estradiol signaling in the regulation of sexual receptivity. Copyright © 2017 Elsevier Ltd. All rights reserved.
Phillips, Margaret; Radford, Kathryn; Wills, Adrian
2011-01-01
To explore important aspects of the benefits, important characteristics, barriers to use and disadvantages of using ankle foot orthoses (AFOs) as seen by people with Charcot Marie Tooth disease (CMT) and the orthotists who will fit and supply them. This qualitative study used the nominal group technique and individual semi-structured interviews, according to participant preference and ability to travel. Propositions were put to 15 participants (eight females) with CMT regarding benefits, disadvantages, barriers to use and important characteristics of ankle foot orthoses AFOs and regarding benefits and disadvantages to seven orthotists. Priorities in these areas were ranked and a thematic analysis of the free text was made separately by two observers and a joint decision made of final themes. Fifteen people (eight females) with CMT and seven orthotists participated. Users' themes concerned functional mobility walking, pain/discomfort, choice of AFOs and associated footwear, custom made design, use in practical situations and support for foot and ankle. They noted that AFOs improved walking, but practical aspects of use and provision, as well as consideration of cosmetic aspects, were frequently problematic. Orthotists had similar themes, but with a difference in emphasis, that included prevention of future complications, education regarding device limitations and craftsmanship as a further theme. Users understood the potential benefits of AFOs and could identify disadvantages which might be remedied, but were frustrated by the difficulties in translating this into practice. Further refinement of current orthoses and delivery of orthotic services may assist in addressing these issues. © 2011 Informa UK, Ltd.
Desloovere, Kaat; Molenaers, Guy; Van Gestel, Leen; Huenaerts, Catherine; Van Campenhout, Anja; Callewaert, Barbara; Van de Walle, Patricia; Seyler, J
2006-10-01
Several studies indicated that walking with an ankle foot orthosis (AFO) impaired third rocker. The purpose of this study was to evaluate the effects of two types of orthoses, with similar goal settings, on gait, in a homogeneous group of children, using both barefoot and shoe walking as control conditions. Fifteen children with hemiplegia, aged between 4 and 10 years, received two types of individually tuned AFOs: common posterior leaf-spring (PLS) and Dual Carbon Fiber Spring AFO (CFO) (with carbon fibre at the dorsal part of the orthosis). Both orthoses were expected to prevent plantar flexion, thus improving first rocker, allowing dorsiflexion to improve second rocker, absorbing energy during second rocker, and returning it during the third rocker. The effect of the AFOs was studied using objective gait analysis, including 3D kinematics, and kinetics in four conditions: barefoot, shoes without AFO, and PLS and CFO combined with shoes. Several gait parameters significantly changed in shoe walking compared to barefoot walking (cadence, ankle ROM and velocity, knee shock absorption, and knee angle in swing). The CFO produced a significantly larger ankle ROM and ankle velocity during push-off, and an increased plantar flexion moment and power generation at pre-swing compared to the PLS (<0.01). The results of this study further support the findings of previous studies indicating that orthoses improve specific gait parameters compared to barefoot walking (velocity, step length, first and second ankle rocker, sagittal knee and hip ROM). However, compared to shoes, not all improvements were statistically significant.
Directory of Open Access Journals (Sweden)
Dapeng Zhang
Full Text Available BACKGROUND: Many vertebrates, including the goldfish, exhibit seasonal reproductive rhythms, which are a result of interactions between external environmental stimuli and internal endocrine systems in the hypothalamo-pituitary-gonadal axis. While it is long believed that differential expression of neuroendocrine genes contributes to establishing seasonal reproductive rhythms, no systems-level investigation has yet been conducted. METHODOLOGY/PRINCIPAL FINDINGS: In the present study, by analyzing multiple female goldfish brain microarray datasets, we have characterized global gene expression patterns for a seasonal cycle. A core set of genes (873 genes in the hypothalamus were identified to be differentially expressed between May, August and December, which correspond to physiologically distinct stages that are sexually mature (prespawning, sexual regression, and early gonadal redevelopment, respectively. Expression changes of these genes are also shared by another brain region, the telencephalon, as revealed by multivariate analysis. More importantly, by examining one dataset obtained from fish in October who were kept under long-daylength photoperiod (16 h typical of the springtime breeding season (May, we observed that the expression of identified genes appears regulated by photoperiod, a major factor controlling vertebrate reproductive cyclicity. Gene ontology analysis revealed that hormone genes and genes functionally involved in G-protein coupled receptor signaling pathway and transmission of nerve impulses are significantly enriched in an expression pattern, whose transition is located between prespawning and sexually regressed stages. The existence of seasonal expression patterns was verified for several genes including isotocin, ependymin II, GABA(A gamma2 receptor, calmodulin, and aromatase b by independent samplings of goldfish brains from six seasonal time points and real-time PCR assays. CONCLUSIONS/SIGNIFICANCE: Using both
... of the Female Reproductive System Print en español Sistema reproductor femenino About Human Reproduction All living things ... of Use Notice of Nondiscrimination Visit the Nemours Web site. Note: All information on KidsHealth® is for ...
Adult Neurogenesis in Sheep: Characterization and Contribution to Reproduction and Behavior
Lévy, Frederic; Batailler, Martine; Meurisse, Maryse; Migaud, Martine
2017-01-01
Sheep have many advantages to study neurogenesis in comparison to the well-known rodent models. Their development and life expectancy are relatively long and they possess a gyrencephalic brain. Sheep are also seasonal breeders, a characteristic that allows studying the involvement of hypothalamic neurogenesis in the control of seasonal reproduction. Sheep are also able to individually recognize their conspecifics and develop selective and lasting bonds. Adult olfactory neurogenesis could be adapted to social behavior by supporting recognition of conspecifics. The present review reveals the distinctive features of the hippocampal, olfactory, and hypothalamic neurogenesis in sheep. In particular, the organization of the subventricular zone and the dynamic of neuronal maturation differs from that of rodents. In addition, we show that various physiological conditions, such as seasonal reproduction, gestation, and lactation differently modulate these three neurogenic niches. Last, we discuss recent evidence indicating that hypothalamic neurogenesis acts as an important regulator of the seasonal control of reproduction and that olfactory neurogenesis could be involved in odor processing in the context of maternal behavior. PMID:29109674
Czech Academy of Sciences Publication Activity Database
Mazurová, E.; Hilscherová, Klára; Triebskorn, R.; Kohler, H.R.; Maršálek, Blahoslav; Bláha, Luděk
2008-01-01
Roč. 63, č. 2 (2008), s. 139-150 ISSN 0006-3088 Institutional research plan: CEZ:AV0Z60050516 Keywords : crustaceans * reproduction * endocrine disruption Subject RIV: EF - Botanics Impact factor: 0.406, year: 2008
Korenevsky, A V; Milyutina, Yu P; Bukalyov, A V; Baranova, Yu P; Vinogradova, I A; Arutjunyan, A V
2013-01-01
Potential neuroprotective effects of the pineal gland hormone melatonin and peptide preparation epitalon on estrous cycles and the central regulation of reproduction in female rats exposed to unfavourable environmental factors have been studied. Estrous cycles of young, mature and aging rats exposed to light pollution were described. The diurnal dynamics and daily mean content of biogenic amines in the hypothalamic areas responsible for gonadotropin-releasing hormone synthesis and secretion in animals of different age groups were investigated. An effect of a chemical factor on the noradrenergic system of the medial preoptic area and on the dopaminergic system of the median eminence with arcuate nuclei of the hypothalamus was studied in premature aging of reproduction model. Administration of the pineal gland peptide melatonin and peptide preparation epitalon was shown to be able to correct a number of impairments of the hypothalamic-pituitary-gonadal axis that can be observed, when the experimental animals were exposed to permanent artificial lighting and a neurotoxic xenobiotic 1,2-dimethylhydrazine. The data obtained testify to an important role of the pineal gland in the circadian signal formation needed for gonadotropin-releasing hormone in order to exert its preovulatory peak secretion and to the protective effect of melatonin and epitalon, which are able to reduce unfavourable environmental influences on reproduction of young and aging female rats.
Ameloblastic fibro-odontoma of maxilla with its analysis on cone beam computed tomography
Directory of Open Access Journals (Sweden)
Karan R Shah
2017-01-01
Full Text Available The ameloblastic fibro-odontoma (AFO is a rare mixed odontogenic tumor which shows properties of both ameloblastic fibroma and odontoma. It commonly affects children and young adults. In most cases, it is asymptomatic but may cause painless, slow growing swelling and discomfort. Radiologically, it is a well-circumscribed, mixed radiopaque and radiolucent entity consisting of radiolucency within which radiopaque foci of various sizes and shapes are seen. Histological examination shows both hard and soft tissue. The treatment of AFO usually conservative due to their benign biological behavior and consists of enucleation or surgical curettage. The purpose of this article is to present a case of an AFO in the posterior maxilla, along with discussion on clinical, radiological (including cone beam computed tomography scan, histological findings, and treatment of this tumor.
VARIATIONS IN REPRODUCTIVE TOXICANT IDENTIFICATION
Energy Technology Data Exchange (ETDEWEB)
Simmons, F
2008-05-13
Reproductive toxicants are a very important class of compounds. They present unique hazards to those of child bearing ages, perform their 'dirty work' using a wide variety of mechanisms on a number of different organs, and are regulatorily important. Because of all of this, properly identifying reproductive toxicants is important, but fraught with difficulty. In this paper we will describe types or reproductive toxicants, their importance, and both mistakes and good practices that people who are not experts in reproductive toxicology may use in their attempts to identify them. Additionally, this paper will focus on chemical reproductive toxicants and will not address biological agents that could affect reproductive toxicity although many principles outlined here could be applied to that endeavor.
Directory of Open Access Journals (Sweden)
Brown Yvonne A
2005-10-01
Full Text Available Abstract Background The gut hormone, ghrelin, is involved in the neuroendocrine and metabolic responses to hunger. In monogastric species, circulating ghrelin levels show clear meal-related and body weight-related changes. The pattern of secretion and its role in ruminant species is less clear. Ghrelin acts via growth hormone secretagogue receptors (GHSR-1a to alter food intake, fat utilization, and cellular proliferation. There is also evidence that ghrelin is involved in reproductive function. In the present study we used immunohistochemistry to investigate the presence of ghrelin and GHSR-1a in sheep reproductive tissues. In addition, we examined whether ghrelin and GHSR-1a protein expression is developmentally regulated in the adult and fetal ovine testis, and whether there is an association with markers of cellular proliferation, i.e. stem cell factor (SCF and proliferating cell nuclear antigen (PCNA. Methods Antibodies raised against ghrelin and its functional receptor, GHSR-type 1a, were used in standard immunohistochemical protocols on various reproductive tissues collected from adult and fetal sheep. GHSR-1a mRNA presence was also confirmed by in situ hybridisation. SCF and PCNA immunoexpression was investigated in fetal testicular samples. Adult and fetal testicular immunostaining for ghrelin, GHSR-1a, SCF and PCNA was analysed using computer-aided image analysis. Image analysis data were subjected to one-way ANOVA, with differences in immunostaining between time-points determined by Fisher's least significant difference. Results In adult sheep tissue, ghrelin and GHSR-1a immunostaining was detected in the stomach (abomasum, anterior pituitary gland, testis, ovary, and hypothalamic and hindbrain regions of the brain. In the adult testis, there was a significant effect of season (photoperiod on the level of immunostaining for ghrelin (p Conclusion Evidence is presented for the presence of ghrelin and its receptor in various reproductive
A novel 3-hydroxysteroid dehydrogenase that regulates reproductive development and longevity.
Directory of Open Access Journals (Sweden)
Joshua Wollam
Full Text Available Endogenous small molecule metabolites that regulate animal longevity are emerging as a novel means to influence health and life span. In C. elegans, bile acid-like steroids called the dafachronic acids (DAs regulate developmental timing and longevity through the conserved nuclear hormone receptor DAF-12, a homolog of mammalian sterol-regulated receptors LXR and FXR. Using metabolic genetics, mass spectrometry, and biochemical approaches, we identify new activities in DA biosynthesis and characterize an evolutionarily conserved short chain dehydrogenase, DHS-16, as a novel 3-hydroxysteroid dehydrogenase. Through regulation of DA production, DHS-16 controls DAF-12 activity governing longevity in response to signals from the gonad. Our elucidation of C. elegans bile acid biosynthetic pathways reveals the possibility of novel ligands as well as striking biochemical conservation to other animals, which could illuminate new targets for manipulating longevity in metazoans.
Leptin and Reproduction: Past Milestones, Present Undertakings and Future Endeavors
Chehab, Farid F.
2014-01-01
The association between leptin and reproduction originated with the leptin-mediated correction of sterility in ob/ob mice and initiation of reproductive function in normal female mice. The uncovering of a central leptin pathway regulating food intake prompted the dissection of neuroendocrine mechanisms involving leptin in the metabolic control of reproduction. The absence of leptin receptors on GnRH neurons incited a search for intermediary neurons situated between leptin responsive and GnRH neurons. This review addresses the most significant findings that have furthered our understanding of recent progress in this new field. The role of leptin in puberty was impacted by the discovery of neurons that co-express kisspeptin, neurokinin B and dynorphin and that could act as leptin intermediates. Furthermore, the identification of first-order leptin-responsive neurons in the premammilary ventral nucleus and other brain regions opens new avenues to explore their relationship to GnRH neurons. Central to these advances is the unveiling that AgRP/NPY neurons project onto GnRH and kisspeptin neurons, allowing a crosstalk between food intake and reproduction. Finally, whereas puberty is a state of leptin sensitivity, mid-gestation represents a state of leptin resistance aimed at building energy stores to sustain pregnancy and lactation. Mechanisms underlying leptin resistance in pregnancy have lagged, however the establishment of this natural state is significant. Reproduction and energy balance are tightly controlled and backed up by redundant mechanisms that are critical for the survival of our species. It will be the goal of the next decade to shed new light on these complex and essential pathways. PMID:25118207
Discovery of a secular trend in Cayo Santiago macaque reproduction.
Hernández-Pacheco, Raisa; Rawlins, Richard G; Kessler, Matthew J; Delgado, Diana L; Ruiz-Lambides, Angelina V; Sabat, Alberto M
2016-02-01
Reproductive synchrony and the consequent clustering of births are hypothesized to be regulated by seasonal changes in rainfall and food availability. Such climate-related seasonality is, however, questionable in tropical populations occupying temporally invariant habitats year round. Using the long-term data of the Cayo Santiago rhesus macaques from 1973 to 2013, this study distinguishes synchrony (a greater than chance clustering of births) from seasonality (a cluster of births during a period of the year when abiotic conditions are favorable) and shows that females are highly synchronized (>72% of births in a 3-month period) but the effects of environmental zeitgebers on reproduction are overridden by biological factors. Specifically, biotic and abiotic factors including (i) loss of immature offspring; (ii) population density; (iii) age at delivery; (iv) rainfall; and (v) changes in colony management were modeled in relation to the annual onset of births and the median birth date. Females experiencing loss of immature offspring had an interbirth interval of trend in both the onset of births and the median date of birth is documented and the model predicts that the median birth date will advance across all calendar-based seasons by 2050. The secular trend in reproduction appears to be triggered by changes in the age at delivery of females, the absence of physiological constraints from maternal investment due to offspring loss, shorter interbirth interval, and a higher degree of coordination due to increasing population density. This study challenges the reproductive phenology previously described for rhesus macaques highlighting the importance of long-term studies in addressing the ultimate causes of reproductive synchrony. © 2015 Wiley Periodicals, Inc.
A policy analysis of the problem of the reproductive health of women in the workplace.
Kotch, J B; Ossler, C C; Howze, D C
1984-06-01
Many occupations in which women comprise the majority of the workforce involve exposure to biological, physical, and chemical hazards. Potential reproductive effects of work-related substances include impaired reproductive capacity, mutagenesis, teratogenesis, and transplacental carcinogenesis. However, female-dominated occupations tend to be only minimally regulated by the US Occupational Safety and Health Administration, and the corporate response to the issue of reproductive and fetal health has been to institute "protective discrimination policies" such as the demotion or exclusion of women of childbearing age from certain jobs. This article rates the effectiveness of alternate policy responses to increase women's occupational health and safety through use of a series of analysis criteria: equity, efficiency, preference satisfaction, right to privacy, avoidance of stigma, and unintended consequences. Policy options include the following: 1) do nothing, 2) leave current policies intact while supporting a research program to document the health consequences of specific occupational risks to women's reproductive health, 3) restrict women for who pregnancy is not ruled out from occupations or work areas known or suspected to be hazardous, 4) improve working conditions for all women, and 5) improve working conditions for all workers. Policy analysis suggests the working conditions of all workers should be improved. This alternative reduces inequity, eliminates stigma, maintains privacy, and honors preferences. Implementation of this policy would be expensive, requiring an increase in knowledge of the effects of industrial substances on female and male reproductive health, expansion of the technical capacity to control occupational hazards, and an increase in the resources of programs that monitor and regulate occupational health. However, this approach is in accord with growing concern that workers should not have to compromise their health to keep their jobs.
Kitagawa, Satoshi; Shimada, Sanae; Murai, Koji
2012-01-01
The photoperiod sensitivity gene Ppd-1 influences the timing of flowering in temperate cereals such as wheat and barley. The effect of Ppd-1 on the expression of flowering-time genes was assessed by examining the expression levels of the vernalization genes VRN1 and VRN3/WFT and of two CONSTANS-like genes, WCO1 and TaHd1, during vegetative and reproductive growth stages. Two near-isogenic lines (NILs) were used: the first carried a photoperiod-insensitive allele of Ppd-1 (Ppd-1a-NIL), the other, a photoperiod-sensitive allele (Ppd-1b-NIL). We found that the expression pattern of VRN1 was similar in Ppd-1a-NIL and Ppd-1b-NIL plants, suggesting that VRN1 is not regulated by Ppd-1. Under long day conditions, VRN3/WFT showed similar expression patterns in Ppd-1a-NIL and Ppd-1b-NIL plants. However, expression differed greatly under short day conditions: VRN3/WFT expression was detected in Ppd-1a-NIL plants at the 5-leaf stage when they transited from vegetative to reproductive growth; very low expression was present in Ppd-1b-NIL throughout all growth stages. Thus, the Ppd-1b allele acts to down-regulate VRN3/WFT under short day conditions. WCO1 showed high levels of expression at the vegetative stage, which decreased during the phase transition and reproductive growth stages in both Ppd-1a-NIL and Ppd-1b-NIL plants under short day conditions. By contrast to WCO1, TaHd1 was up-regulated during the reproductive stage. The level of TaHd1 expression was much higher in Ppd-1a-NIL than the Ppd-1b-NIL plants, suggesting that the Ppd-1b allele down-regulates TaHd1 under short day conditions. The present study indicates that down-regulation of VRN3/WFT together with TaHd1 is the cause of late flowering in the Ppd-1b-NIL plants under short day conditions.
Mang, Hyunggon; Feng, Baomin; Hu, Zhangjian; Boisson-Dernier, Aurélien; Franck, Christina M; Meng, Xiangzong; Huang, Yanyan; Zhou, Jinggeng; Xu, Guangyuan; Wang, Taotao; Shan, Libo; He, Ping
2017-12-01
Plants have evolved two tiers of immune receptors to detect infections: cell surface-resident pattern recognition receptors (PRRs) that sense microbial signatures and intracellular nucleotide binding domain leucine-rich repeat (NLR) proteins that recognize pathogen effectors. How PRRs and NLRs interconnect and activate the specific and overlapping plant immune responses remains elusive. A genetic screen for components controlling plant immunity identified ANXUR1 (ANX1), a malectin-like domain-containing receptor-like kinase, together with its homolog ANX2, as important negative regulators of both PRR- and NLR-mediated immunity in Arabidopsis thaliana ANX1 constitutively associates with the bacterial flagellin receptor FLAGELLIN-SENSING2 (FLS2) and its coreceptor BRI1-ASSOCIATED RECEPTOR KINASE1 (BAK1). Perception of flagellin by FLS2 promotes ANX1 association with BAK1, thereby interfering with FLS2-BAK1 complex formation to attenuate PRR signaling. In addition, ANX1 complexes with the NLR proteins RESISTANT TO PSEUDOMONAS SYRINGAE2 (RPS2) and RESISTANCE TO P. SYRINGAE PV MACULICOLA1. ANX1 promotes RPS2 degradation and attenuates RPS2-mediated cell death. Surprisingly, a mutation that affects ANX1 function in plant immunity does not disrupt its function in controlling pollen tube growth during fertilization. Our study thus reveals a molecular link between PRR and NLR protein complexes that both associate with cell surface-resident ANX1 and uncovers uncoupled functions of ANX1 and ANX2 during plant immunity and sexual reproduction. © 2017 American Society of Plant Biologists. All rights reserved.
Force Reproduction Error Depends on Force Level, whereas the Position Reproduction Error Does Not
Onneweer, B.; Mugge, W.; Schouten, Alfred Christiaan
2016-01-01
When reproducing a previously perceived force or position humans make systematic errors. This study determined the effect of force level on force and position reproduction, when both target and reproduction force are self-generated with the same hand. Subjects performed force reproduction tasks at
International Nuclear Information System (INIS)
Hou, Jie; Li, Li; Wu, Ning; Su, Yujing; Lin, Wang; Li, Guangyu; Gu, Zemao
2016-01-01
Microcystin-LR (MC-LR) has been found to cause reproductive and developmental impairments as well as to disrupt sex hormone homeostasis of fish during acute and sub-chronic toxic experiments. However, fish in natural environments are continuously exposed to MC-LR throughout their entire life cycle as opposed to short-term exposure. Here, we tested the hypothesis that the mechanism by which MC-LR harms female fish reproduction and development within natural water bodies is through interference of the reproductive endocrine system. In the present study, zebrafish hatchlings (5 d post-fertilization) were exposed to 0, 0.3, 3 and 30 μg/L MC-LR for 90 d until reaching sexual maturity. Female zebrafish were selected, and the changes in growth and developmental indicators, ovarian ultrastructure as well as the levels of gonadal steroid hormones and vitellogenin (VTG) were examined along with the transcription of related genes in the hypothalamic–pituitary–gonadal–liver axis (HPGL-axis). The results showed for the first time, a life cycle exposure to MC-LR caused growth inhibition, decreased ovary weight and ovarian ultra-pathological lesions. Decreased ovarian testosterone levels indicated that MC-LR disrupted sex steroid hormone balance. Significantly up-regulated transcription of brain FSHβ and LHβ along with ovarian ERα, FSHR and LHR suggested positive feedback regulation in the HPGL-axis was induced as a compensatory mechanism for MC-LR damage. It was also noted that ovarian VTG content and hepatic ERα and VTG1 expression were all down-regulated, which might be responsible for reduced vitellus storage noted in our histological observations. Our findings indicate that a life cycle exposure to MC-LR impairs the development and reproduction of female zebrafish by disrupting the transcription of related HPGL-axis genes, suggesting that MC-LR has potential adverse effects on fish reproduction and thus population dynamics in MCs-contaminated aquatic
Kornthong, Napamanee; Cummins, Scott F; Chotwiwatthanakun, Charoonroj; Khornchatri, Kanjana; Engsusophon, Attakorn; Hanna, Peter J; Sobhon, Prasert
2014-01-01
The central nervous system (CNS) is often intimately involved in reproduction control and is therefore a target organ for transcriptomic investigations to identify reproduction-associated genes. In this study, 454 transcriptome sequencing was performed on pooled brain and ventral nerve cord of the female mud crab (Scylla olivacea) following serotonin injection (5 µg/g BW). A total of 197,468 sequence reads was obtained with an average length of 828 bp. Approximately 38.7% of 2,183 isotigs matched with significant similarity (E value reproductive-related genes, namely farnesoic acid o-methyltransferase (FAMeT), estrogen sulfotransferase (ESULT) and prostaglandin F synthase (PGFS). Following serotonin injection, which would normally initiate reproductive processes, we found up-regulation of FAMeT, ESULT and PGFS expression in the female CNS and ovary. Our data here provides an invaluable new resource for understanding the molecular role of the CNS on reproduction in S. olivacea.
Androgens and the male reproductive tract: an overview of classical roles and current perspectives.
Patrão, Marilia T C C; Silva, Erick J R; Avellar, Maria Christina W
2009-11-01
Androgens are steroid hormones that play key roles in the development and maintenance of male phenotype and reproductive function. These hormones also affect the function of several non-reproductive organs, such as bone and skeletal muscle. Endogenous androgens exert most of their effects by genomic mechanisms, which involve hormone binding to the androgen receptor (AR), a ligand-activated transcription factor, resulting in the modulation of gene expression. AR-induced non-genomic mechanisms have also been reported. A large number of steroidal and non-steroidal AR-ligands have been developed for therapeutic use, including the treatment of male hypogonadism (AR agonists) and prostate diseases (AR antagonists), among other pathological conditions. Here, the AR gene and protein structure, mechanism of action and AR gene homologous regulation were reviewed. The AR expression pattern, its in vivo regulation and physiological relevance in the developing and adult testis and epididymis, which are sites of sperm production and maturation, respectively, were also presented.
Reproduction in females bufalinas: artificial insemination and assisted reproduction
International Nuclear Information System (INIS)
Vale, William G.
2011-01-01
Reproductive behavior in females bufalinas has been studied for the detection of estrus. A system that works through radio telemetry has been developed and proposed to replace the daily visual observation to determine the estrous phase with efficiency and precision. The method used is the fixation on the back of the female with a sensor that emits radio waves every time suffer a pressure exerted by the mountain. Waves have been captured by an antenna and sent to a computer system. The knowledge that has been developed on the management and use of reproductive biotechnologies of reproduction in buffalo, have enabled the technicians and breeders evaluate and indicate which procedures can be used successfully, and increase the application of the fixed-time artificial insemination during the year [es
Reproductive strategies in snakes.
Shine, Richard
2003-01-01
Snakes of both sexes display remarkable flexibility and diversity in their reproductive tactics. Many features of reproduction in female snakes (such as reproductive mode and frequency, seasonality and multiple mating) allow flexible maternal control. For example, females can manipulate not only the genotypes of their offspring (through mate choice or enhanced sperm competition) but also the phenotypes of their offspring (through allocation 'decisions', behavioural and physiological thermoreg...
Reproductive arrest and stress resistance in winter-acclimated Drosophila suzukii.
Toxopeus, Jantina; Jakobs, Ruth; Ferguson, Laura V; Gariepy, Tara D; Sinclair, Brent J
2016-06-01
Overwintering insects must survive the multiple-stress environment of winter, which includes low temperatures, reduced food and water availability, and cold-active pathogens. Many insects overwinter in diapause, a developmental arrest associated with high stress tolerance. Drosophila suzukii (Diptera: Drosophilidae), spotted wing drosophila, is an invasive agricultural pest worldwide. Its ability to overwinter and therefore establish in temperate regions could have severe implications for fruit crop industries. We demonstrate here that laboratory populations of Canadian D. suzukii larvae reared under short-day, low temperature, conditions develop into dark 'winter morph' adults similar to those reported globally from field captures, and observed by us in southern Ontario, Canada. These winter-acclimated adults have delayed reproductive maturity, enhanced cold tolerance, and can remain active at low temperatures, although they do not have the increased desiccation tolerance or survival of fungal pathogen challenges that might be expected from a more heavily melanised cuticle. Winter-acclimated female D. suzukii have underdeveloped ovaries and altered transcript levels of several genes associated with reproduction and stress. While superficially indicative of reproductive diapause, the delayed reproductive maturity of winter-acclimated D. suzukii appears to be temperature-dependent, not regulated by photoperiod, and is thus unlikely to be 'true' diapause. The traits of this 'winter morph', however, likely facilitate overwintering in southern Canada, and have probably contributed to the global success of this fly as an invasive species. Copyright © 2016 Elsevier Ltd. All rights reserved.
Zhang, Genxi; Zhang, Li; Wei, Yue; Wang, Jinyu; Ding, Fuxiang; Dai, Guojun; Xie, Kaizhou
2012-01-01
Myostatin, or growth and differentiation factor 8, is a member of the transforming growth factor-β superfamily; it functions as a negative regulator of skeletal muscle development and growth in mammals. In this study, single nucleotide polymorphisms in the 5' regulatory region and exon 1 of the myostatin gene were detected by PCR-SSCP in the Bian, Jinghai, Youxi, and Arbor Acre chickens, and the associations of the polymorphisms with reproduction traits were analyzed. Seven SNPs (A326G, C334G, C1346T, G1375A, A1473G, G1491A, and G2283A) were found in the myostatin gene. Association analysis showed that the G2283A were significantly associated with reproduction traits. Bian chickens of the GG genotype had a greater age at first egg than those of the GA and AA genotypes (Pchickens of the GA and AA genotypes had larger egg number at 300 days than those of the GG genotype (Pchickens of the AA genotype had significantly higher body weight at 300 days than those of the GG genotype (P<0.05). These results suggested that the myostatin gene may have certain effects on reproduction traits other than merely as a negative regulator of skeletal muscle development and growth in mammals previously reported.
International Nuclear Information System (INIS)
Mashneva, N.I.
1984-01-01
Studies on clarification of importance of different harmful factors of radiation and chemical nature on the function of progeny reproduction, growth and development are presented. Intake of radionuclides to organism, of white mices and rats in concentrations corresponding to 10 6 PCsub(s) ( 90 Sr, 210 Po, 210 Pb and other) is shown to result in 100% sterility of females, 10 5 -10 4 PCsub(s) concentrations cause damaging effect of different degrees of expression at later stages of effect. Smaller contents of radionuclides (10 3 -10 2 PCsub(s)) did not result in noticeable changes in reproductivity of animals. Similar regularities were observed under effect of different concentrations of chemical agent. Some peculiarities of animal physiology should be taken into account to obtain data of estimation of damaging effect of harmful factors on reproduction function
Effects of season and regulated photoperiod on the reproductive ...
African Journals Online (AJOL)
user
constant photoperiod (10 h light and 14 h darkness) and control sows (n = 187) ... Keywords: Season, regulated photoperiod, return to oestrus, farrowing rate, litter size .... were exposed to a minimum daylight cycle of 10.4 h during winter and a ...
Female Reproductive System (For Teens)
... of the Female Reproductive System Print en español Sistema reproductor femenino Reproduction All living things reproduce. Reproduction — ... of Use Notice of Nondiscrimination Visit the Nemours Web site. Note: All information on TeensHealth® is for ...
Fungal Meiosis and Parasexual Reproduction – Lessons from Pathogenic Yeast
Sherwood, Racquel K.; Bennett, Richard J.
2009-01-01
Meiosis is an integral part of sexual reproduction in eukaryotic species. It performs the dual functions of halving the genetic content in the cell, as well as increasing genetic diversity by promoting recombination between chromosome homologs. Despite extensive studies of meiosis in model yeast, it is now apparent that both the regulation of meiosis and the machinery mediating recombination has significantly diverged, even between closely related species. To highlight this, we discuss new st...
Sparkman, Amanda M; Arnold, Stevan J; Bronikowski, Anne M
2007-04-07
Evolutionary theory predicts that differential reproductive effort and rate of reproductive senescence will evolve under different rates of external mortality. We examine the evolutionary divergence of age-specific reproduction in two life-history ecotypes of the western terrestrial garter snake, Thamnophis elegans. We test for the signature of reproductive senescence (decreasing fecundity with age) and increasing reproductive effort with age (increasing reproductive productivity per gram female) in replicate populations of two life-history ecotypes: snakes that grow fast, mature young and have shorter lifespans, and snakes that grow slow, mature late and have long lives. The difference between life-history ecotypes is due to genetic divergence in growth rate. We find (i) reproductive success (live litter mass) increases with age in both ecotypes, but does so more rapidly in the fast-growth ecotype, (ii) reproductive failure increases with age in both ecotypes, but the proportion of reproductive failure to total reproductive output remains invariant, and (iii) reproductive effort remains constant in fast-growth individuals with age, but declines in slow-growth individuals. This illustration of increasing fecundity with age, even at the latest ages, deviates from standard expectations for reproductive senescence, as does the lack of increases in reproductive effort. We discuss our findings in light of recent theories regarding the phenomenon of increased reproduction throughout life in organisms with indeterminate growth and its potential to offset theoretical expectations for the ubiquity of senescence.
Directory of Open Access Journals (Sweden)
Sushil Kumar
Full Text Available Nutritional infertility is very common in societies where women fail to eat enough to match their energy expenditure and such females often present as clinical cases of anorexia nervosa. The cellular and molecular mechanisms that link energy balance and central regulation of reproduction are still not well understood. Peripheral hormones such as estradiol, testosterone and leptin, as well as neuropeptides like kisspeptin and neuropeptides Y (NPY play a potential role in regulation of reproduction and energy balance with their primary target converging on the hypothalamic median eminence-arcuate region. The present study was aimed to explore the effects of negative energy state resulting from intermittent fasting dietary restriction (IF-DR regimen on complete hypothalamo-hypophysial-gonadal axis in Wistar strain young female and male rats. Significant changes in body weight, blood glucose, estrous cyclicity and serum estradiol, testosterone and LH level indicated the negative role of IF-DR regimen on reproduction in these young animals. Further, it was elucidated whether serum level of metabolic hormone, leptin plays a mechanistic role in suppressing hypothalamo-hypophysial-gonadal (HPG axis via energy regulators, kisspeptin and NPY in rats on IF-DR regimen. We also studied the effect of IF-DR regimen on structural remodeling of GnRH axon terminals in median eminence region of hypothalamus along with the glial cell marker, GFAP and neuronal plasticity marker, PSA-NCAM using immunostaining, Western blotting and RT-PCR. Together these data suggest that IF-DR regimen negatively influences reproduction in young animals due to its adverse effects on complete hypothalamus-hypophysial-gonadal axis and may explain underlying mechanism(s to understand the clinical basis of nutritional infertility.
Kumar, Sushil; Kaur, Gurcharan
2013-01-01
Nutritional infertility is very common in societies where women fail to eat enough to match their energy expenditure and such females often present as clinical cases of anorexia nervosa. The cellular and molecular mechanisms that link energy balance and central regulation of reproduction are still not well understood. Peripheral hormones such as estradiol, testosterone and leptin, as well as neuropeptides like kisspeptin and neuropeptides Y (NPY) play a potential role in regulation of reproduction and energy balance with their primary target converging on the hypothalamic median eminence-arcuate region. The present study was aimed to explore the effects of negative energy state resulting from intermittent fasting dietary restriction (IF-DR) regimen on complete hypothalamo-hypophysial-gonadal axis in Wistar strain young female and male rats. Significant changes in body weight, blood glucose, estrous cyclicity and serum estradiol, testosterone and LH level indicated the negative role of IF-DR regimen on reproduction in these young animals. Further, it was elucidated whether serum level of metabolic hormone, leptin plays a mechanistic role in suppressing hypothalamo-hypophysial-gonadal (HPG) axis via energy regulators, kisspeptin and NPY in rats on IF-DR regimen. We also studied the effect of IF-DR regimen on structural remodeling of GnRH axon terminals in median eminence region of hypothalamus along with the glial cell marker, GFAP and neuronal plasticity marker, PSA-NCAM using immunostaining, Western blotting and RT-PCR. Together these data suggest that IF-DR regimen negatively influences reproduction in young animals due to its adverse effects on complete hypothalamus-hypophysial-gonadal axis and may explain underlying mechanism(s) to understand the clinical basis of nutritional infertility.
Altruism and Reproductive Limitations
Directory of Open Access Journals (Sweden)
Carey J. Fitzgerald
2009-04-01
Full Text Available We examined how different types of reproductive limitations — functional (schizoid personality disorder and schizophrenia, physical (malnutrition, and sexual (bisexuality and homosexuality — influenced altruistic intentions toward hypothetical target individuals of differing degrees of relatedness (r = 0, .25, and .50. Participants were 312 undergraduate students who completed a questionnaire on altruism toward hypothetical friends, half-siblings, and siblings with these different types of reproductive limitations. Genetic relatedness and reproductive limitations did not influence altruistic decision-making when the cost of altruism was low but did as the cost of altruism increased, with participants being more likely to help a sibling over a half-sibling and a half-sibling over a friend. Participants also indicated they were more likely to help a healthy (control person over people with a reproductive limitation. Of the three types of reproductive limitations, functional limitations had the strongest effect on altruistic decision-making, indicating that people were less likely to help those who exhibit abnormal social behavior.
Franchising reproductive health services.
Stephenson, Rob; Tsui, Amy Ong; Sulzbach, Sara; Bardsley, Phil; Bekele, Getachew; Giday, Tilahun; Ahmed, Rehana; Gopalkrishnan, Gopi; Feyesitan, Bamikale
2004-12-01
Networks of franchised health establishments, providing a standardized set of services, are being implemented in developing countries. This article examines associations between franchise membership and family planning and reproductive health outcomes for both the member provider and the client. Regression models are fitted examining associations between franchise membership and family planning and reproductive health outcomes at the service provider and client levels in three settings. Franchising has a positive association with both general and family planning client volumes, and the number of family planning brands available. Similar associations with franchise membership are not found for reproductive health service outcomes. In some settings, client satisfaction is higher at franchised than other types of health establishments, although the association between franchise membership and client outcomes varies across the settings. Franchise membership has apparent benefits for both the provider and the client, providing an opportunity to expand access to reproductive health services, although greater attention is needed to shift the focus from family planning to a broader reproductive health context.
Smiley, Kristina O; Adkins-Regan, Elizabeth
2016-08-01
Variation in parental care can lead to important fitness consequences. The endocrine system is known to regulate physiological and behavioral reproductive traits that are important contributors to lifetime reproductive success. However, the hormonal basis of variation in avian parental care is still not well understood. Plasma prolactin (PRL) concentrations are generally high during post-hatch parental care in birds, and may be a candidate mechanism that regulates variation in parental care and other reproductive success outcomes. Here we analyze the relationship between PRL, parental behavior (chick brooding and feeding) and reproductive success outcomes (clutch size, number of chicks hatched, and chick survival) for the first time in the zebra finch (Taeniopygia guttata). Birds were given cabergoline, a dopamine agonist traditionally used to lower prolactin in mammals, or vehicle in their food. Cabergoline had no effect on prolactin concentrations, but across both groups we found that PRL is positively correlated with parental behavior, number of chicks hatched, and chick survival, but not clutch size. Results from this study will inform hypotheses and predictions for future manipulation studies which test for a causal role for PRL in parental traits. Copyright © 2016 Elsevier Inc. All rights reserved.
2011-09-23
... of study results to assess concerns about human reproductive and developmental toxicities. It does... assist that office in processing your requests. See the SUPPLEMENTARY INFORMATION section for electronic access to the guidance document. Submit electronic comments on the guidance to http://www.regulations.gov...
Cabot, Perry E; Nowak, Pete
2005-01-01
The paper explores how decisions made on animal feeding operations (AFOs) influence the management of manure and phosphorus. Variability among these decisions from operation to operation and from field to field can influence the validity of nutrient loss risk assessments. These assessments are based on assumptions that the decision outcomes regarding manure distribution will occur as they are planned. The discrepancy between planned versus actual outcomes in phosphorus management was explored on nine AFOs managing a contiguous set of 210 fields in south-central Wisconsin. A total of 2611 soil samples were collected and multiple interviews conducted to assign phosphorus index (PI) ratings to the fields. Spearman's rank correlation coefficients (r(S)) indicated that PI ratings were less sensitive to soil test phosphorus (STP) levels (r(S) = 0.378), universal soil loss equation (USLE) (r(S) = 0.261), ratings for chemical fertilizer application (r(S) = 0.185), and runoff class (r(S) = -0.089), and more sensitive to ratings for manure application (r(S) = 0.854). One-way ANOVA indicated that mean field STP levels were more homogenous than field PI ratings between AFOs. Kolmogorov-Smirnov (K-S) tests displayed several nonsignificant comparisons for cumulative distribution functions, S(x), of mean STP levels on AFO fields. On the other hand, the K-S tests of S(x) for PI ratings indicated that the majority of these S(x) functions were significantly different between AFOs at or greater than the 0.05 significance level. Interviews suggested multiple reasons for divergence between planned and actual outcomes in managing phosphorus, and that this divergence arises at the strategic, tactical, and operational levels of decision-making.
Lebigre, Christophe; Arcese, Peter; Reid, Jane M
2013-07-01
Age-specific variances and covariances in reproductive success shape the total variance in lifetime reproductive success (LRS), age-specific opportunities for selection, and population demographic variance and effective size. Age-specific (co)variances in reproductive success achieved through different reproductive routes must therefore be quantified to predict population, phenotypic and evolutionary dynamics in age-structured populations. While numerous studies have quantified age-specific variation in mean reproductive success, age-specific variances and covariances in reproductive success, and the contributions of different reproductive routes to these (co)variances, have not been comprehensively quantified in natural populations. We applied 'additive' and 'independent' methods of variance decomposition to complete data describing apparent (social) and realised (genetic) age-specific reproductive success across 11 cohorts of socially monogamous but genetically polygynandrous song sparrows (Melospiza melodia). We thereby quantified age-specific (co)variances in male within-pair and extra-pair reproductive success (WPRS and EPRS) and the contributions of these (co)variances to the total variances in age-specific reproductive success and LRS. 'Additive' decomposition showed that within-age and among-age (co)variances in WPRS across males aged 2-4 years contributed most to the total variance in LRS. Age-specific (co)variances in EPRS contributed relatively little. However, extra-pair reproduction altered age-specific variances in reproductive success relative to the social mating system, and hence altered the relative contributions of age-specific reproductive success to the total variance in LRS. 'Independent' decomposition showed that the (co)variances in age-specific WPRS, EPRS and total reproductive success, and the resulting opportunities for selection, varied substantially across males that survived to each age. Furthermore, extra-pair reproduction increased
Milner, Jos M; van Beest, Floris M; Solberg, Erling J; Storaas, Torstein
2013-08-01
A life history strategy that favours somatic growth over reproduction is well known for long-lived iteroparous species, especially in unpredictable environments. Risk-sensitive female reproductive allocation can be achieved by a reduced reproductive effort at conception, or the subsequent adjustment of investment during gestation or lactation in response to unexpected environmental conditions or resource availability. We investigated the relative importance of reduced investment at conception compared with later in the reproductive cycle (i.e. prenatal, perinatal or neonatal mortality) in explaining reproductive failure in two high-density moose (Alces alces) populations in southern Norway. We followed 65 multiparous, global positioning system (GPS)-collared females throughout the reproductive cycle and focused on the role of maternal nutrition during gestation in determining reproductive success using a quasi-experimental approach to manipulate winter forage availability. Pregnancy rates in early winter were normal (≥0.8) in all years while spring calving rates ranged from 0.4 to 0.83, with prenatal mortality accounting for most of the difference. Further losses over summer reduced autumn recruitment rates to 0.23-0.69, despite negligible predation. Over-winter mass loss explained variation in both spring calving and autumn recruitment success better than absolute body mass in early or late winter. Although pregnancy was related to body mass in early winter, overall reproductive success was unrelated to pre-winter body condition. We therefore concluded that reproductive success was limited by winter nutritional conditions. However, we could not determine whether the observed reproductive allocation adjustment was a bet-hedging strategy to maximise reproduction without compromising survival or whether females were simply unable to invest more resources in their offspring.
Lessons from reproductive immunology for other fields of immunology and clinical approaches.
Markert, Udo R; Fitzgerald, Justine S; Seyfarth, Lydia; Heinzelmann, Joana; Varosi, Frauke; Voigt, Sandra; Schleussner, Ekkehard; Seewald, Hans-Joachim
2005-01-01
Reproduction is indispensable to evolution and, thus, life. Nonetheless, it overcomes common rules known to established life. Immunology of reproduction, and especially the tolerance of two genetically distinct organisms and their fruitful symbiosis, is one of the most imposing paradox of life. Mechanisms, which are physiologically used for induction of said tolerance, are frequently abused by pathogens or tumors intending to escape the host's immune response. Understanding the regulation of immune responses in pregnancy and the invasion of allogeneic fetus-derived trophoblast cells into the decidua may lead to new therapeutic concepts. In transplantation, knowledge concerning local physiological immunotolerance may be useful for the development of new therapies, which do not require a general immune suppression of the patient. In immunological disorders, such as autoimmune diseases or allergies, immune deviations occur which are either prevented during pregnancy or have parallels to pregnancy. Vice versa, lessons from other fields of immunology may also offer new notions for the comprehension of reproductive immunology and may lead to new therapies for the treatment of pregnancy-related problems.
For Whom the Clock Ticks: Reproductive Ageing and Egg Freezing in Dutch and British News Media
Directory of Open Access Journals (Sweden)
Lucy van de Wiel
2014-01-01
Full Text Available The last century saw struggles for women's reproductive choices both to avoid childbearing (i.e. abortion, contraception and to achieve it (i.e. IVF, artificial insemination. Now, after the turn of the millennium, these two approaches to regulate reproduction are combined in oocyte cryopreservation (OC, or egg freezing. With it, a new reproductive question has emerged as egg freezing simultaneously represents an active choice not to have children at present and a commitment to a future, possibly assisted, reproduction. Women's usage of OC to preserve fertility is itself an act of refusing current childbearing, thus calling into question an easy distinction between reproductive and non-reproductive behaviour. In this article, I discuss the representation of this new choice by using a selection of Dutch and UK news media pieces, focusing specifically on the implications of egg freezing for conceptualisations of the female reproductive body as site of a gendered politics of ageing. Firstly, I address the rhetorical divisions between 'medical' and 'social' motivations for egg freezing and then I argue that the media narratives around these divisions create new subject positions related to reproductive identity through which medical authority becomes extended into new parts of social life. Secondly, I address the discursive construction of the decision to use egg freezing technology in relation to the notion of the 'biological clock' and the reconceptualisations of age-specific (non-reproductive bodies, which focus on the ovum as the locus of fertility. The news coverage of OC thus reveals a gendered politics of ageing, predicated on reproductive ability as the organising principle for the temporal structuring of life, which not only interpellates (potentially infertile women who desire to reproduce, but also has an impact on the wider public.
Identification of sheep ovary genes potentially associated with off-season reproduction.
Chen, Lei; Liu, Ka; Zhao, Zongsheng; Blair, Hugh T; Zhang, Peng; Li, Daquan; Ma, Runlin Z
2012-04-20
Off-season reproduction is a favorable economic trait for sheep industry. Hu sheep, an indigenous Chinese sheep breed, demonstrates a higher productivity of lambs and displays year-around oestrous behavior under proper nutrition and environment. The genetic basis behind these traits, however, is not well understood. In order to identify genes associated with the off-season reproduction, we constructed a suppression subtractive hybridization (SSH) cDNA library using pooled ovary mRNAs of 6 oestrous Hu females as a tester and the pooled ovary mRNAs of 6 non-oestrous Chinese Merino females as a driver. A total of 382 resulting positive clones were obtained after the SSH. We identified 114 differentially up-regulated genes in oestrous Hu sheep by using subsequent screening and DNA sequencing, of which 8 were previously known, 93 were reported for the first time in sheep, and 13 were novel with no significant homology to any sequence in the DNA databases. Functions of the genes identified are related to cell division, signal transduction, structure, metabolism, or cell defense. To validate the results of SSH, 6 genes (Ntrk2, Ppap2b, Htra1, Nid1, Serpine2 and Foxola) were selected for conformational analysis using quantitative real-time PCR (qRT-PCR), and two of them (Htral and Foxo1a) were verified by Northern blot. All of the 6 genes were differentially up-regulated in the ovary of oestrous Hu. It is obvious that off-season reproduction is a complex trait involving multiple genes in multiple organs. This study helps to provide a foundation for the final identification of functional genes involved in the sheep ovary. Copyright © 2012. Published by Elsevier Ltd.
2010-07-01
... 36 Parks, Forests, and Public Property 3 2010-07-01 2010-07-01 false Reproduction. 705.4 Section 705.4 Parks, Forests, and Public Property LIBRARY OF CONGRESS REPRODUCTION, COMPILATION, AND....4 Reproduction. (a) Library of Congress staff acting under the general authority of the Librarian of...
Squalus cubensis Reproduction Data
National Oceanic and Atmospheric Administration, Department of Commerce — Reproductive data from Squalus cubensis (Cuban dogfish) were opportunistically collected from 2005-2012. Data include those necessary to examine reproductive cycle,...
32 CFR 310.20 - Reproduction fees.
2010-07-01
... 32 National Defense 2 2010-07-01 2010-07-01 false Reproduction fees. 310.20 Section 310.20... PROGRAM DOD PRIVACY PROGRAM Access by Individuals § 310.20 Reproduction fees. (a) Assessing fees. (1) Charge the individual only the direct cost of reproduction. (2) Do not charge reproduction fees if...
Love, Oliver P.
2007-01-01
Managing reproductive investment within the scope of an individual’s energetic condition is required to maximize fitness. To be successful, individuals must make the correct decisions about when to reproduce, when to abandon an attempt, how many resources to invest in current and future attempts and where those resources should be allocated. These reproductive decisions therefore involve complex life-history trade-offs between an individual’s condition and current reproduction, future reprodu...
2010-10-01
... 42 Public Health 1 2010-10-01 2010-10-01 false Reproduction. 9.7 Section 9.7 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL PROVISIONS STANDARDS OF CARE FOR CHIMPANZEES HELD IN THE FEDERALLY SUPPORTED SANCTUARY SYSTEM § 9.7 Reproduction. Chimpanzee reproduction is...
Identification of ligands for DAF-12 that govern dauer formation and reproduction in C. elegans.
Motola, Daniel L; Cummins, Carolyn L; Rottiers, Veerle; Sharma, Kamalesh K; Li, Tingting; Li, Yong; Suino-Powell, Kelly; Xu, H Eric; Auchus, Richard J; Antebi, Adam; Mangelsdorf, David J
2006-03-24
In response to environmental and dietary cues, the C. elegans orphan nuclear receptor, DAF-12, regulates dauer diapause, reproductive development, fat metabolism, and life span. Despite strong evidence for hormonal control, the identification of the DAF-12 ligand has remained elusive. In this work, we identified two distinct 3-keto-cholestenoic acid metabolites of DAF-9, a cytochrome P450 involved in hormone production, that function as ligands for DAF-12. At nanomolar concentrations, these steroidal ligands (called dafachronic acids) bind and transactivate DAF-12 and rescue the hormone deficiency of daf-9 mutants. Interestingly, DAF-9 has a biochemical activity similar to mammalian CYP27A1 catalyzing addition of a terminal acid to the side chain of sterol metabolites. Together, these results define the first steroid hormones in nematodes as ligands for an invertebrate orphan nuclear receptor and demonstrate that steroidal regulation of reproduction, from biology to molecular mechanism, is conserved from worms to humans.
From esterilología to reproductive biology: The story of the Mexican assisted reproduction business.
González-Santos, Sandra P
2016-06-01
This paper provides the first overview of how assisted reproduction emerged and developed in Mexico. In doing so it addresses two broad points: when and how treatments using assisted reproductive technology became common practice within reproductive medicine; and how the Mexican assisted reproduction industry emerged. The paper begins in 1949, when the first medical association dedicated to esterilología - the biomedical area focused on the study of infertility - was established, thus providing the epistemic and professional ground upon which assisted reproductive technology would later thrive. The paper then traces the way in which this biomedical industry developed, from individual doctors in their practices to networks of clinics and from a clinical practice to a reproductive industry. It also describes the different ways in which the professional community and the government have worked towards developing a regulatory frame for the practice of assisted reproduction. The paper is informed by ethnographic work conducted at clinics, conferences, online forums and websites, as well as by analysis of the contemporary national media, government documents and national medical journals from the early mid-twentieth century to the those published today.
Zhao, Yunli; Wu, Qiuli; Wang, Dayong
2016-02-01
Although many studies have suggested the adverse effects of engineered nanomaterials (ENMs), the self-protection mechanisms for organisms against ENMs toxicity are still largely unclear. Using Caenorhabditis elegans as an in vivo assay system, our results suggest the toxicity of graphene oxide in reducing reproductive capacity by inducing damage on gonad development. The observed reproductive toxicity of GO on gonad development was due to the combinational effect of germline apoptosis and cell cycle arrest, and DNA damage activation might act as an inducer for this combinational effect. For the underlying molecular mechanism of reproductive toxicity of GO, we raised a signaling cascade of HUS-1/CLK-2-CEP-1-EGL-1-CED-4-CED-3 to explain the roles of core apoptosis signaling pathway and DNA damage checkpoints. Moreover, we identified a miRNA regulation mechanism activated by GO to suppress its induced reproductive toxicity. A mir-360 regulation mechanism was activated by GO to suppress its induced DNA damage-apoptosis signaling cascade through affecting component of CEP-1. Our identified epigenetic signal encoded protection mechanism activated by GO suggests a novel self-protection mechanism for organisms against the ENMs toxicity. Copyright © 2015 Elsevier Ltd. All rights reserved.
Matsuyama, Shuhei; Sakimoto, Michinori
2008-06-01
The cost of reproduction in dioecious plants is often female-biased. However, several studies have reported no difference in costs of reproduction between the sexes. In this study, the relative reproductive allocation and costs at the shoot and whole-plant levels were examined in woody dioecious Rhus javanica and R. trichocarpa, in order to examine differences between types of phenophase (i.e. physiological stage of development). Male and female Rhus javanica and R. trichocarpa were sampled and the reproductive and vegetative allocation of the shoot were estimated by harvesting reproductive current-year shoots during flowering and fruiting. Measurements were made of the number of reproductive and total current-year shoots per whole plant, and of the basal area increment (BAI). The numbers of reproductive and total current-year shoots per 1-year-old shoot were counted in order to examine the costs in the following year at the shoot level. A female-biased annual reproductive allocation was found; however, the ratio of reproductive current-year shoots per tree and the BAI did not differ between sexes in Rhus javanica and R. trichocarpa. The percentage of 1-year-old shoots with at least one reproductive current-year shoot was significantly male-biased in R. trichocarpa, but not in R. javanica, indicating that there was a relative cost at the shoot level only in R. trichocarpa. The female-biased leaf mass per shoot, an indicator of compensation for costs, was only found in R. javanica. Relative reproductive costs at the shoot level were detected in Rhus trichocarpa, which has simultaneous leafing and flowering, but not in R. javanica, which has leafing followed by flowering. However, the costs for the whole-plant level were diminished in both species. The results suggest that the phenophase type may produce the different costs for R. javanica and R. trichocarpa through the development of a compensation mechanism.
Franchising Reproductive Health Services
Stephenson, Rob; Tsui, Amy Ong; Sulzbach, Sara; Bardsley, Phil; Bekele, Getachew; Giday, Tilahun; Ahmed, Rehana; Gopalkrishnan, Gopi; Feyesitan, Bamikale
2004-01-01
Objectives Networks of franchised health establishments, providing a standardized set of services, are being implemented in developing countries. This article examines associations between franchise membership and family planning and reproductive health outcomes for both the member provider and the client. Methods Regression models are fitted examining associations between franchise membership and family planning and reproductive health outcomes at the service provider and client levels in three settings. Results Franchising has a positive association with both general and family planning client volumes, and the number of family planning brands available. Similar associations with franchise membership are not found for reproductive health service outcomes. In some settings, client satisfaction is higher at franchised than other types of health establishments, although the association between franchise membership and client outcomes varies across the settings. Conclusions Franchise membership has apparent benefits for both the provider and the client, providing an opportunity to expand access to reproductive health services, although greater attention is needed to shift the focus from family planning to a broader reproductive health context. PMID:15544644
Reproductive tradeoffs and yolk steroids in female leopard geckos, Eublepharis macularius.
Rhen, T; Crews, D; Fivizzani, A; Elf, P
2006-11-01
Life history theory predicts tradeoffs among reproductive traits, but the physiological mechanisms underlying such tradeoffs remain unclear. Here we examine reproductive tradeoffs and their association with yolk steroids in an oviparous lizard. Female leopard geckos lay two eggs in a clutch, produce multiple clutches in a breeding season, and reproduce for several years. We detected a significant tradeoff between egg size and the number of clutches laid by females during their first two breeding seasons. Total reproductive effort was strongly condition-dependent in the first season, but much less so in the second season. Although these and other tradeoffs were unmistakable, they were not associated with levels of androstenedione, oestradiol, or testosterone in egg yolk. Female condition and egg size, however, were inversely related to dihydrotestosterone (DHT) levels in egg yolk. Finally, steroid levels in egg yolk were not directly related to steroid levels in the maternal circulation when follicles were developing, indicating that steroid transfer to eggs is regulated. These findings suggest that maternal allocation of DHT could mitigate tradeoffs that lead to poor offspring quality (i.e. poor female condition) and small offspring size (i.e. small egg size).
Diabetes-induced hyperglycemia impairs male reproductive function: a systematic review.
Maresch, Constanze C; Stute, Dina C; Alves, Marco G; Oliveira, Pedro F; de Kretser, David M; Linn, Thomas
2018-01-01
Hyperglycemia can result from a loss of pancreatic beta-cells or a decline in their function leading to decreased insulin secretion or may arise from insulin resistance and variable degrees of inadequate insulin secretion resulting in diabetes and related comorbidities. To date several reviews have addressed the issue of diabetes-related male infertility but most have focused on how metabolic syndrome causes the decline in male fertility. However, a comprehensive overview as to how diabetes-induced hyperglycemia impairs male fertility is missing. Impaired regulation of glucose and the resultant hyperglycemia are major threats to the health of individuals in modern societies especially given the rapidly rising prevalence affecting an increasing number of men in their reproductive years. Consequently, diabetes-induced hyperglycemia is likely to contribute to a decline in global birth rates especially in those societies with a high diabetic prevalence. This systematic review addresses and summarizes the impact of hyperglycemia on male reproductive health with a particular emphasis on the molecular mechanisms that influence the testis and other parts of the male reproductive tract. A systematic search of the literature published in the MEDLINE-Pubmed database (http://www.ncbi.nlm.nih.gov/pubmed) and Cochrane Library (http://www.cochranelibrary.com) was performed, as well as hand searching reference lists, from the earliest available online indexing year until May 2017, using diabetes- and male fertility-related keywords in combination with other search phrases relevant to the topic of hyperglycemia. Inclusion criteria were: clinical studies on type 1 diabetic (T1D) men and studies on T1D animal models with a focus on reproductive parameters. Case reports/series, observational studies and clinical trials were included. Studies on patients with type 2 diabetes (T2D) or animal models of T2D were excluded to distinguish hyperglycemia from other metabolic effects. A total
Children's Concepts of Reproduction
Moore, James E.; Kendall, Diane G.
1971-01-01
Results of this study provide little support for either Freudian or Piagetian theorizing about what the young child thinks of reproduction. Implications for sex education and reproduction information are presented. (Author/CJ)
Lovejoy, David A; Pavlović, Téa
2015-11-01
In humans, the teneurin gene family consists of four highly conserved paralogous genes that are the result of early vertebrate gene duplications arising from a gene introduced into multicellular organisms from a bacterial ancestor. In vertebrates and humans, the teneurins have become integrated into a number of critical physiological systems including several aspects of reproductive physiology. Structurally complex, these genes possess a sequence in their terminal exon that encodes for a bioactive peptide sequence termed the 'teneurin C-terminal associated peptide' (TCAP). The teneurin/TCAP protein forms an intercellular adhesive unit with its receptor, latrophilin, an Adhesion family G-protein coupled receptor. It is present in numerous cell types and has been implicated in gamete migration and gonadal morphology. Moreover, TCAP is highly effective at reducing the corticotropin-releasing factor (CRF) stress response. As a result, TCAP may also play a role in regulating the stress-associated inhibition of reproduction. In addition, the teneurins and TCAP have been implicated in tumorigenesis associated with reproductive tissues. Therefore, the teneurin/TCAP system may offer clinicians a novel biomarker system upon which to diagnose some reproductive pathologies.
Assisted reproductive travel: UK patient trajectories.
Hudson, Nicky; Culley, Lorraine
2011-11-01
Media reporting of 'fertility tourism' tends to portray those who travel as a cohesive group, marked by their desperation and/or selfishness and propensity towards morally questionable behaviour. However, to date little has been known about the profile of those leaving the UK for treatment. This paper discusses the first UK-based study of patient assisted reproduction travel that was designed to explore individual travel trajectories. It is argued that existing ways of conceptualizing cross-border reproductive care as 'fertility or reproductive tourism' are in danger of essentializing what the data suggest are diverse, complex and often ambiguous motivations for reproductive travel. The concept of seriality is used to suggest that, whilst 'reproductive tourists' share some characteristics, they also differ in significant ways. This paper argues that, through an examination of the personal landscapes of fertility travel, the diverse processes involved in reproductive travel can be better understood and policymakers can be assisted to avoid what might be regarded as simplistic responses to cross-border reproductive care. Copyright © 2011 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.
Selective Reproductive Technologies
DEFF Research Database (Denmark)
Gammeltoft, Tine; Wahlberg, Ayo
2014-01-01
From a historical perspective, selective reproduction is nothing new. Infanticide, abandonment, and selective neglect of children have a long history, and the widespread deployment of sterilization and forced abortion in the twentieth century has been well documented. Yet in recent decades select......, discussing how selective reproduction engages with issues of long-standing theoretical concern in anthropology, such as politics, kinship, gender, religion, globalization, and inequality....... (ARTs), what we term selective reproductive technologies (SRTs) are of a more specific nature: Rather than aiming to overcome infertility, they are used to prevent or allow the birth of certain kinds of children. This review highlights anthropological research into SRTs in different parts of the world...
The market for reproductive tourism: an analysis with special reference to Greece.
Paraskou, Anastasia; George, Babu P
2017-01-01
For many people, the need for parenthood remains unfulfilled due to biological reasons and a remedy for these individuals is assisted reproduction (AR). Because of widely differing and sometimes incompatible legislations around the world related to AR, there is considerable confusion across national borders. Within Europe, Greece seems to be in a comparatively favorable position because of lower restrictions and the availability of decent quality specialized medical facilities. This research is a market study with a business perspective and explores the emerging landscape of reproductive tourism (RT) in Greece. The research adopted mixed methods. First, open-ended questions were used to interview foreign medical tourists and staff in various AR clinics. Based on the insights from these interviews and guided by the extent literature, a survey instrument was prepared and administered among 130 patients. Findings indicate that Greece still lack policies that nurture transparency and dynamic response to technological changes in AR. Also, the travel industry lack specialists who can effectively liaison with clinics, who understand the availability of AR technologies, regulations, and the unique needs of AR tourists. Globally, the need for assisted reproduction has tremendously increased; yet, the supply of facilities is lagging far behind. There is a unique advantage for clinics located in touristic locations in countries that offer cheaper treatment options. Given the shape of its debt-ridden economy, Greece needs foreign exchange inflows and gaining first mover advantage in reproductive tourism is probably an important way to achieve this. This research draws up a reproductive tourism strategy for Greece.
The role of brain peptides in the reproduction of blue gourami males (Trichogaster trichopterus).
Levy, Gal; Degani, Gad
2013-10-01
In all vertebrates, reproduction and growth are closely linked and both are controlled by complex hormonal interactions at the brain-pituitary level. In this study, we focused on the reciprocal interactions between brain peptides that regulate growth and reproductive functions in a teleostei fish (blue gourami Trichogaster trichopterus). An increase in gonadotropin-releasing hormone 1 (GnRH1) gene expression was detected during ontogeny, and this peptide increased growth hormone (GH) and β follicle-stimulating hormone (βFSH) gene expression in pituitary cell culture. However, although no change in gonadotropin-releasing hormone 2 (GnRH2) gene expression during the reproductive cycle or sexual behavior was detected, a stimulatory effect of this peptide on β gonadotropins (βGtH) gene expression was observed. In addition, pituitary adenylate cyclase-activating polypeptide 38 (PACAP-38) inhibited GnRH-analog-induced βFSH gene expression, and co-treatment of cells with GnRH-analog and PACAP-38 inhibited GnRH-analog-stimulatory and PACAP-38-inhibitory effects on GH gene expression. These findings together with previous studies were used to create a model summarizing the mechanism of brain peptides (GnRH, PACAP and its related peptide) and the relationship to reproduction and growth through pituitary hormone gene expression during ontogenesis and reproductive stages in blue gourami. © 2013 Wiley Periodicals, Inc.
DEFF Research Database (Denmark)
Ansel, L; Bolborea, M; Bentsen, A H
2010-01-01
In seasonal breeders, reproduction is synchronized to seasons by day length via the pineal hormone melatonin. Recently, we have demonstrated that Kiss1, a key activator of the reproductive function, is down-regulated in sexually inactive hamsters maintained in inhibitory short days (SDs). In rode......In seasonal breeders, reproduction is synchronized to seasons by day length via the pineal hormone melatonin. Recently, we have demonstrated that Kiss1, a key activator of the reproductive function, is down-regulated in sexually inactive hamsters maintained in inhibitory short days (SDs......). In rodents, Kiss1 is expressed in the anteroventral periventricular nucleus (AVPV) and in the arcuate nucleus (ARC). Because both the duration of the nocturnal peak of melatonin and circulating sex steroid levels vary with photoperiod, the aim of this study was to determine whether melatonin and sex steroids...... differentially regulate Kiss1 expression in the ARC and the AVPV. Kiss1 expression was examined by in situ hybridization in both male and female hamsters kept in various experimental conditions, and we observed that 1) SD exposure markedly reduced Kiss1 expression in the ARC and AVPV of male and female hamsters...
2010-10-01
... 46 Shipping 8 2010-10-01 2010-10-01 false Reproduction. 380.21 Section 380.21 Shipping MARITIME... Reproduction. (a) The records described in § 380.24 may be microfilmed or otherwise reproduced in lieu of their retention in original form: Provided, That such reproductions shall not be made prior to completion of the...
Hou, Jie; Li, Li; Wu, Ning; Su, Yujing; Lin, Wang; Li, Guangyu; Gu, Zemao
2016-01-01
Microcystin-LR (MC-LR) has been found to cause reproductive and developmental impairments as well as to disrupt sex hormone homeostasis of fish during acute and sub-chronic toxic experiments. However, fish in natural environments are continuously exposed to MC-LR throughout their entire life cycle as opposed to short-term exposure. Here, we tested the hypothesis that the mechanism by which MC-LR harms female fish reproduction and development within natural water bodies is through interference of the reproductive endocrine system. In the present study, zebrafish hatchlings (5 d post-fertilization) were exposed to 0, 0.3, 3 and 30 μg/L MC-LR for 90 d until reaching sexual maturity. Female zebrafish were selected, and the changes in growth and developmental indicators, ovarian ultrastructure as well as the levels of gonadal steroid hormones and vitellogenin (VTG) were examined along with the transcription of related genes in the hypothalamic-pituitary-gonadal-liver axis (HPGL-axis). The results showed for the first time, a life cycle exposure to MC-LR caused growth inhibition, decreased ovary weight and ovarian ultra-pathological lesions. Decreased ovarian testosterone levels indicated that MC-LR disrupted sex steroid hormone balance. Significantly up-regulated transcription of brain FSHβ and LHβ along with ovarian ERα, FSHR and LHR suggested positive feedback regulation in the HPGL-axis was induced as a compensatory mechanism for MC-LR damage. It was also noted that ovarian VTG content and hepatic ERα and VTG1 expression were all down-regulated, which might be responsible for reduced vitellus storage noted in our histological observations. Our findings indicate that a life cycle exposure to MC-LR impairs the development and reproduction of female zebrafish by disrupting the transcription of related HPGL-axis genes, suggesting that MC-LR has potential adverse effects on fish reproduction and thus population dynamics in MCs-contaminated aquatic environment
Zika virus and assisted reproduction.
Cordeiro, Christina N; Bano, Rashda; Washington Cross, Chantel I; Segars, James H
2017-06-01
Due to the fact that the Zika virus can be sexually transmitted, there is a potential risk for disease transmission at several stages of assisted reproduction. Such a possibility poses a serious challenge to couples pursing fertility with reproductive technologies. Here, we discuss what is known regarding Zika virus infection with respect to sexual transmission and correlate this knowledge with recent recommendations in the realm of infertility treatment. Zika virus can be transmitted from infected men and women through vaginal, oral or anal intercourse. Zika virus RNA has been detected in blood, semen, cervical mucus and vaginal fluid. Currently, the Centers for Disease Control recommends that infected men wait 6 months, and infected women 8 weeks, prior to attempting pregnancy. Reproductive tissue donors should wait 6 months before giving a specimen. Further study of Zika virus transmission in different reproductive tissues and establishment of validated testing methods for viral disease transmissibility are urgently needed. Reproductive technologists need to establish screening, testing and laboratory protocols aimed to reduce the risk of Zika virus transmission during assisted reproduction.
Reproductive history of cane rat: a review of the reproduction and ...
African Journals Online (AJOL)
This study evaluates in a review the reproduction and reproductive performance of cane rat. Breeding time in cane rat depends on which part of Africa the Animal is found and the weather. In the wild, cane rat lives in groups of males and females during the breeding season. The wet season of the year is the usual breeding ...
Introduction: Communicating Reproduction.
Hopwood, Nick; Jones, Peter Murray; Kassell, Lauren; Secord, Jim
2015-01-01
Communication should be central to histories of reproduction, because it has structured how people do and do not reproduce. Yet communication has been so pervasive, and so various, that it is often taken for granted and the historical specificities overlooked. Making communication a frame for histories of reproduction can draw a fragmented field together, including by putting the promotion of esoteric ideas on a par with other practical activities. Paying communication close attention can revitalize the history of reproduction over the long term by highlighting continuities as well as the complex connections between new technologies and new approaches. Themes such as the power of storytelling, the claiming and challenging of expertise, and relations between knowledge and ignorance, secrecy and propriety also invite further study.
Marshall, Eleanor; Costa, Liliana M; Gutierrez-Marcos, Jose
2011-03-01
Cell-cell communication in plants is essential for the correct co-ordination of reproduction, growth, and development. Studies to dissect this mode of communication have previously focussed primarily on the action of plant hormones as mediators of intercellular signalling. In animals, peptide signalling is a well-documented intercellular communication system, however, relatively little is known about this system in plants. In recent years, numerous reports have emerged about small, secreted peptides controlling different aspects of plant reproduction. Interestingly, most of these peptides are cysteine-rich, and there is convincing evidence suggesting multiple roles for related cysteine-rich peptides (CRPs) as signalling factors in developmental patterning as well as during plant pathogen responses and symbiosis. In this review, we discuss how CRPs are emerging as key signalling factors in regulating multiple aspects of vegetative growth and reproductive development in plants.
Variation in male reproductive longevity across traditional societies.
Directory of Open Access Journals (Sweden)
Lucio Vinicius
Full Text Available Most accounts of human life history propose that women have short reproductive spans relative to their adult lifespans, while men not only remain fertile but carry on reproducing until late life. Here we argue that studies have overlooked evidence for variation in male reproductive ageing across human populations. We apply a Bayesian approach to census data from Agta hunter-gatherers and Gambian farmers to show that long post-reproductive lifespans characterise not only women but also males in some traditional human populations. We calculate three indices of reproductive ageing in men (oldest age at reproduction, male late-life reproduction, and post-reproductive representation and identify a continuum of male reproductive longevity across eight traditional societies ranging from !Kung, Hadza and Agta hunter-gatherers exhibiting low levels of polygyny, early age at last reproduction and long post-reproductive lifespans, to male Gambian agriculturalists and Turkana pastoralists showing higher levels of polygyny, late-life reproduction and shorter post-reproductive lifespans. We conclude that the uniquely human detachment between rates of somatic senescence and reproductive decline, and the existence of post-reproductive lifespans, are features of both male and female life histories, and therefore not exclusive consequences of menopause.
A pneumatic power harvesting ankle-foot orthosis to prevent foot-drop
Directory of Open Access Journals (Sweden)
Chin Robin
2009-06-01
Full Text Available Abstract Background A self-contained, self-controlled, pneumatic power harvesting ankle-foot orthosis (PhAFO to manage foot-drop was developed and tested. Foot-drop is due to a disruption of the motor control pathway and may occur in numerous pathologies such as stroke, spinal cord injury, multiple sclerosis, and cerebral palsy. The objectives for the prototype PhAFO are to provide toe clearance during swing, permit free ankle motion during stance, and harvest the needed power with an underfoot bellow pump pressurized during the stance phase of walking. Methods The PhAFO was constructed from a two-part (tibia and foot carbon composite structure with an articulating ankle joint. Ankle motion control was accomplished through a cam-follower locking mechanism actuated via a pneumatic circuit connected to the bellow pump and embedded in the foam sole. Biomechanical performance of the prototype orthosis was assessed during multiple trials of treadmill walking of an able-bodied control subject (n = 1. Motion capture and pressure measurements were used to investigate the effect of the PhAFO on lower limb joint behavior and the capacity of the bellow pump to repeatedly generate the required pneumatic pressure for toe clearance. Results Toe clearance during swing was successfully achieved during all trials; average clearance 44 ± 5 mm. Free ankle motion was observed during stance and plantarflexion was blocked during swing. In addition, the bellow component repeatedly generated an average of 169 kPa per step of pressure during ten minutes of walking. Conclusion This study demonstrated that fluid power could be harvested with a pneumatic circuit built into an AFO, and used to operate an actuated cam-lock mechanism that controls ankle-foot motion at specific periods of the gait cycle.
Reproduction in the space environment: Part I. Animal reproductive studies
Santy, P. A.; Jennings, R. T.; Craigie, D.
1990-01-01
Mankind's exploration and colonization of the frontier of space will ultimately depend on men's and women's ability to live, work, and reproduce in the space environment. This paper reviews animal studies, from microorganisms to mammals, done in space or under space-simulated conditions, which identify some of the key areas which might interfere with human reproductive physiology and/or embryonic development. Those space environmental factors which impacted almost all species included: microgravity, artificial gravity, radiation, and closed life support systems. These factors may act independently and in combination to produce their effects. To date, there have been no studies which have looked at the entire process of reproduction in any animal species. This type of investigation will be critical in understanding and preventing the problems which will affect human reproduction. Part II will discuss these problems directly as they relate to human physiology.
Regulation of fertilization and early seed development.
Dresselhaus, Thomas; Doughty, James
2014-04-01
Plant reproduction meetings often deal either with pre-fertilization processes such as flowering and pollen biology or post-fertilization processes such as embryogenesis and seed development. The Biochemical Society Focused Meeting entitled 'Regulation of Fertilization and Early Seed Development' was organized to close this gap and to discuss mechanistic similarities and future research directions in the reproductive processes shortly before, during and after fertilization. As an outcome of the workshop, invited speakers and a few selected oral communication presenters contributed focused reviews and technical articles for this issue of Biochemical Society Transactions. We provide here a short overview of the contents and highlights of the various articles.
Human rights versus legal control over women's reproductive self-determination.
Uberoi, Diya; de Bruyn, Maria
2013-06-14
States have a duty under international human rights law to protect people's health. Nonetheless, while some health-related policies and laws protect basic human rights, others violate fundamental rights when they criminalize, prohibit, and restrict access to necessary health services. For example, laws and regulations related to protection of life from conception, contraception, actions of pregnant women, and abortion can harm women and place women and health care providers in jeopardy of legal penalization. Given the adverse consequences of punitive and restrictive laws related to pregnancy, advocates, civil society groups, human rights groups, and government institutions must work together to promote, protect, and fulfill women's fundamental reproductive rights. Copyright © 2013 Uberoi and de Bruyn. This is an open access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original author and source are credited.
Transmembrane carbonic anhydrase isozymes IX and XII in the female mouse reproductive organs
Directory of Open Access Journals (Sweden)
Tomas Eija
2004-10-01
Full Text Available Abstract Background Carbonic anhydrase (CA classically catalyses the reversible hydration of dissolved CO2 to form bicarbonate ions and protons. The twelve active CA isozymes are thought to regulate a variety of cellular functions including several processes in the reproductive systems. Methods The present study was designed to investigate the expression of transmembrane CAs, CA IX and XII, in the mouse uterus, ovary and placenta. The expression of CA IX and XII was examined by immunoperoxidase staining method and western blotting. CA II and XIII served as positive controls since they are known to be present in the mouse reproductive tract. Results The data of our study indicated that CA XII is expressed in the mouse endometrium. Only very faint signal was observed in the corpus luteum of the ovary and the placenta remained mainly negative. CA IX showed weak reaction in the endometrial epithelium, while it was completely absent in the ovary and placenta. Conclusion The conservation of CA XII expression in both mouse and human endometrium suggests a role for this isozyme in reproductive physiology.
Veilleux, Heather D; Donelson, Jennifer M; Munday, Philip L
2017-01-01
Reproduction in marine fish is generally tightly linked with water temperature. Consequently, when adults are exposed to projected future ocean temperatures, reproductive output of many species declines precipitously. Recent research has shown that in the common reef fish, Acanthochromis polyacanthus, step-wise exposure to higher temperatures over two generations (parents: +1.5°C, offspring: +3.0°C) can improve reproductive output in the F2 generation compared to F2 fish that have experienced the same high temperatures over two generations (F1 parents: +3.0°C, F2 offspring: +3.0°C). To investigate how a step-wise increase in temperature between generations improved reproductive capacity, we tested the expression of well-known teleost reproductive genes in the brain and gonads of F2 fish using quantitative reverse transcription PCR and compared it among control (+0.0°C for two generations), developmental (+3.0°C in second generation only), step (+1.5°C in first generation and +3.0°C in second generation), and transgenerational (+3.0°C for two generations) treatments. We found that levels of gonadotropin receptor gene expression (Fshr and Lhcgr) in the testes were reduced in developmental and transgenerational temperature treatments, but were similar to control levels in the step treatment. This suggests Fshr and Lhcgr may be involved in regulating male reproductive capacity in A. polyacanthus. In addition, lower Fshb expression in the brain of females in all temperature treatments compared to control, suggests that Fshb expression, which is involved in vitellogenesis, is sensitive to high temperatures. Our results help elucidate key genes that facilitate successful reproduction in reef fishes when they experience a gradual increase in temperature across generations consistent with the trajectory of climate change.
Tilahun, Mesfin; Mengistie, Bezatu; Egata, Gudina; Reda, Ayalu A
2012-09-03
Adolescents in developing countries face a range of sexual and reproductive health problems. Lack of health care service for reproductive health or difficulty in accessing them are among them. In this study we aimed to examine health care workers' attitudes toward sexual and reproductive health services to unmarried adolescents in Ethiopia. We conducted a descriptive cross-sectional survey among 423 health care service providers working in eastern Ethiopia in 2010. A pre-tested structured questionnaire was used to collect data. Descriptive statistics, chi-square tests and logistic regression were performed to drive proportions and associations. The majority of health workers had positive attitudes. However, nearly one third (30%) of health care workers had negative attitudes toward providing RH services to unmarried adolescents. Close to half (46.5%) of the respondents had unfavorable responses toward providing family planning to unmarried adolescents. About 13% of health workers agreed to setting up penal rules and regulations against adolescents that practice pre-marital sexual intercourse. The multivariate analysis indicated that being married (OR 2.15; 95% CI 1.44 - 3.06), lower education level (OR 1.45; 95% CI 1.04 - 1.99), being a health extension worker (OR 2.49; 95% CI 1.43 - 4.35), lack of training on reproductive health services (OR 5.27; 95% CI 1.51 - 5.89) to be significantly associated with negative attitudes toward provision of sexual and reproductive services to adolescents. The majority of the health workers had generally positive attitudes toward sexual and reproductive health to adolescents. However, a minority has displayed negatives attitudes. Such negative attitudes will be barriers to service utilization by adolescents and hampers the efforts to reduce sexually transmitted infections and unwanted pregnancies among unmarried adolescents. We therefore call for a targeted effort toward alleviating negative attitudes toward adolescent
Veilleux, Heather D; Donelson, Jennifer M; Munday, Philip L
2018-01-01
Reproduction in marine fish is generally tightly linked with water temperature. Consequently, when adults are exposed to projected future ocean temperatures, reproductive output of many species declines precipitously. Recent research has shown that in the common reef fish, Acanthochromis polyacanthus , step-wise exposure to higher temperatures over two generations (parents: +1.5°C, offspring: +3.0°C) can improve reproductive output in the F2 generation compared to F2 fish that have experienced the same high temperatures over two generations (F1 parents: +3.0°C, F2 offspring: +3.0°C). To investigate how a step-wise increase in temperature between generations improved reproductive capacity, we tested the expression of well-known teleost reproductive genes in the brain and gonads of F2 fish using quantitative reverse transcription PCR and compared it among control (+0.0°C for two generations), developmental (+3.0°C in second generation only), step (+1.5°C in first generation and +3.0°C in second generation), and transgenerational (+3.0°C for two generations) treatments. We found that levels of gonadotropin receptor gene expression ( Fshr and Lhcgr ) in the testes were reduced in developmental and transgenerational temperature treatments, but were similar to control levels in the step treatment. This suggests Fshr and Lhcgr may be involved in regulating male reproductive capacity in A. polyacanthus . In addition, lower Fshb expression in the brain of females in all temperature treatments compared to control, suggests that Fshb expression, which is involved in vitellogenesis, is sensitive to high temperatures. Our results help elucidate key genes that facilitate successful reproduction in reef fishes when they experience a gradual increase in temperature across generations consistent with the trajectory of climate change.
Veilleux, Heather D
2017-12-07
Reproduction in marine fish is generally tightly linked with water temperature. Consequently, when adults are exposed to projected future ocean temperatures, reproductive output of many species declines precipitously. Recent research has shown that in the common reef fish, Acanthochromis polyacanthus, step-wise exposure to higher temperatures over two generations (parents: +1.5°C, offspring: +3.0°C) can improve reproductive output in the F2 generation compared to F2 fish that have experienced the same high temperatures over two generations (F1 parents: +3.0°C, F2 offspring: +3.0°C). To investigate how a step-wise increase in temperature between generations improved reproductive capacity, we tested the expression of well-known teleost reproductive genes in the brain and gonads of F2 fish using quantitative reverse transcription PCR and compared it among control (+0.0°C for two generations), developmental (+3.0°C in second generation only), step (+1.5°C in first generation and +3.0°C in second generation), and transgenerational (+3.0°C for two generations) treatments. We found that levels of gonadotropin receptor gene expression (Fshr and Lhcgr) in the testes were reduced in developmental and transgenerational temperature treatments, but were similar to control levels in the step treatment. This suggests Fshr and Lhcgr may be involved in regulating male reproductive capacity in A. polyacanthus. In addition, lower Fshb expression in the brain of females in all temperature treatments compared to control, suggests that Fshb expression, which is involved in vitellogenesis, is sensitive to high temperatures. Our results help elucidate key genes that facilitate successful reproduction in reef fishes when they experience a gradual increase in temperature across generations consistent with the trajectory of climate change.
International Nuclear Information System (INIS)
Blanche, Dominique
2002-01-01
Full text: The interaction between nutrition and reproductive activity has been described in both wild and farm animals. The lactating cow is one of the very best examples of this interaction. During lactation, the length of time spent in negative energy balance around parturition seems to be an important factor controlling the delay to return to breeding after parturition. The mechanism by which nutrition regulates the reproductive system is not fully understood in lactating dairy cows or indeed in any other situation in ruminants or mammals in general. However, to be effective, a nutritional signal should ultimately act on at least one of the 3 regulatory sites in the reproductive axis - the brain, the pituitary gland and the gonads. Nutrition is likely to involve metabolic signals that could act directly on one of these targets or it could interfere with other regulatory mechanisms such as the feedback by gonadal steroids on gonadotrophin secretion. In this presentation, we will use examples from laboratory rodents and ruminants, and from dairy cattle where they are available, to examine how IGF-1 and leptin, amongst several other blood metabolites and metabolic hormones, could be part of the link between nutrition and reproduction in the postpartum dairy cow. A number of studies have proposed a role for IGF-1 in the control of postpartum anoestrus and the framework of the current hypothesis will be presented. The role of leptin is still not clear for ruminants in general, but especially in cattle, because leptin was only recently discovered (about 6 years ago) and because a reliable radioimmunoassay for bovine leptin only became available since 1999. The possibilities and restrictions of a role for leptin in the control of reproduction by nutrition will be discussed. To conclude, we will examine the use of these two hormones as potential indicators of the adequacy of nutritional status for reproductive function and we will introduce insulin as another
Directory of Open Access Journals (Sweden)
Netta Shemesh
2017-08-01
Full Text Available Cell-non-autonomous signals dictate the functional state of cellular quality control systems, remodeling the ability of cells to cope with stress and maintain protein homeostasis (proteostasis. One highly regulated cell-non-autonomous switch controls proteostatic capacity in Caenorhabditis elegans adulthood. Signals from the reproductive system down-regulate cyto-protective pathways, unless countered by signals reporting on germline proliferation disruption. Here, we utilized dihomo-γ-linolenic acid (DGLA that depletes the C. elegans germline to ask when cell-non-autonomous signals from the reproductive system determine somatic proteostasis and whether such regulation is reversible. We found that diet supplementation of DGLA resulted in the maintenance of somatic proteostasis after the onset of reproduction. DGLA-dependent proteostasis remodeling was only effective if animals were exposed to DGLA during larval development. A short exposure of 16 h during the second to fourth larval stages was sufficient and required to maintain somatic proteostasis in adulthood but not to extend lifespan. The reproductive system was required for DGLA-dependent remodeling of proteostasis in adulthood, likely via DGLA-dependent disruption of germline stem cells. However, arachidonic acid (AA, a somatic regulator of this pathway that does not require the reproductive system, presented similar regulatory timing. Finally, we showed that DGLA- and AA-supplementation led to activation of the gonadal longevity pathway but presented differential regulatory timing. Proteostasis and stress response regulators, including hsf-1 and daf-16, were only activated if exposed to DGLA and AA during development, while other gonadal longevity factors did not show this regulatory timing. We propose that C. elegans determines its proteostatic fate during development and is committed to either reproduction, and thus present restricted proteostasis, or survival, and thus present robust
Directory of Open Access Journals (Sweden)
Angélique Slijper
2012-01-01
Full Text Available Objective. The aim was to compare walking with an individually designed dynamic hinged ankle foot orthosis (DAFO and a standard carbon composite ankle foot orthosis (C-AFO. Methods. Twelve participants, mean age 56 years (range 26–72, with hemiparesis due to stroke were included in the study. During the six-minute walk test (6MW, walking velocity, the Physiological Cost Index (PCI, and the degree of experienced exertion were measured with a DAFO and C-AFO, respectively, followed by a Stairs Test velocity and perceived confidence was rated. Results. The mean differences in favor for the DAFO were in 6MW 24.3 m (95% confidence interval [CI] 4.90, 43.76, PCI −0.09 beats/m (95% CI −0.27, 0.95, velocity 0.04 m/s (95% CI −0.01, 0.097, and in the Stairs Test −11.8 s (95% CI −19.05, −4.48. All participants except one perceived the degree of experienced exertion lower and felt more confident when walking with the DAFO. Conclusions. Wearing a DAFO resulted in longer walking distance and faster stair climbing compared to walking with a C-AFO. Eleven of twelve participants felt more confident with the DAFO, which may be more important than speed and distance and the most important reason for prescribing an AFO.
Reproductive Life Planning: Raising the Questions.
Morse, Jessica E; Moos, Merry-K
2018-04-01
Introduction Unintended pregnancy has been a concerning public health problem for decades. As we begin to understand the complexities of pregnancy intention and how women experience these pregnancies, reproductive life planning offers a paradigm shift. Methods Reproductive life planning is a patient-centered approach that places a patient's reproductive preferences-whether concrete or ambivalent-at the forefront of her clinical care. Results This process grants women and men the opportunity to consider how reproduction fits within the context of their broader lives. Within a clinical encounter, reproductive life planning allows counseling and care to be tailored to patient preferences. Discussion Although there is great potential for positive public health impacts in unintended pregnancy, contraceptive use and improved preconception health, the true benefit lies within reinforcing reproductive empowerment. Despite recommendations for universal adoption, many questions remain regarding implementation, equity and outcomes.
21 CFR 884.6130 - Assisted reproduction microtools.
2010-04-01
... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Assisted reproduction microtools. 884.6130 Section... (CONTINUED) MEDICAL DEVICES OBSTETRICAL AND GYNECOLOGICAL DEVICES Assisted Reproduction Devices § 884.6130 Assisted reproduction microtools. (a) Identification. Assisted reproduction microtools are pipettes or...
The Mahabharata and reproductive endocrinology
Kalra, Bharti; Baruah, Manash P.; Kalra, Sanjay
2016-01-01
This communication approaches the Mahabharata through the prism of reproductive endocrinology. Descriptions of episodes related to reproduction are listed here, to provide fodder for the endocrinologically minded brain. The cases described here are perhaps, the first documented observations of fetal orgasm, pseudocyesis and assisted reproductive technology, including assisted insemination by donor, induction of ovulation, and in vitro fertilization as well as precocious growth and intersex. W...
32 CFR 2103.41 - Reproduction controls.
2010-07-01
... 32 National Defense 6 2010-07-01 2010-07-01 false Reproduction controls. 2103.41 Section 2103.41... Safeguarding § 2103.41 Reproduction controls. The Staff Secretary shall maintain records to show the number and... dissemination or reproduction limitations. ...
Zampas, Christina; Andión-Ibañez, Ximena
2012-06-01
The practice of conscientious objection often arises in the area of individuals refusing to fulfil compulsory military service requirements and is based on the right to freedom of thought, conscience and religion as protected by national, international and regional human rights law. The practice of conscientious objection also arises in the field of health care, when individual health care providers or institutions refuse to provide certain health services based on religious, moral or philosophical objections. The use of conscientious objection by health care providers to reproductive health care services, including abortion, contraceptive prescriptions, and prenatal tests, among other services is a growing phenomena throughout Europe. However, despite recent progress from the European Court of Human Rights on this issue (RR v. Poland, 2011), countries and international and regional bodies generally have failed to comprehensively and effectively regulate this practice, denying many women reproductive health care services they are legally entitled to receive. The Italian Ministry of Health reported that in 2008 nearly 70% of gynaecologists in Italy refuse to perform abortions on moral grounds. It found that between 2003 and 2007 the number of gynaecologists invoking conscientious objection in their refusal to perform an abortion rose from 58.7 percent to 69.2 percent. Italy is not alone in Europe, for example, the practice is prevalent in Poland, Slovakia, and is growing in the United Kingdom. This article outlines the international and regional human rights obligations and medical standards on this issue, and highlights some of the main gaps in these standards. It illustrates how European countries regulate or fail to regulate conscientious objection and how these regulations are working in practice, including examples of jurisprudence from national level courts and cases before the European Court of Human Rights. Finally, the article will provide recommendations
Understanding Female Receiver Psychology in Reproductive Contexts.
Lynch, Kathleen S
2017-10-01
Mate choice decision-making requires four components: sensory, cognitive, motivation, and salience. During the breeding season, the neural mechanisms underlying these components act in concert to radically transform the way a female perceives the social cues around her as well as the way in which cognitive and motivational processes influence her decision to respond to courting males. The role of each of these four components in mate choice responses will be discussed here as well as the brain regions involved in regulating each component. These components are not independent, modular systems. Instead, they are dependent on one another. This review will discuss the many ways in which these components interact and affect one another. The interaction of these components, however, ultimately leads back to a few key neuromodulators that thread motivation, sensory, salience, and cognitive components into a set of inter-dependent processes. These neuromodulators are estrogens and catecholamines. This review will highlight the need to understand estrogens in reproductive contexts not just as simply a 'sexual motivation modulator' or catecholamines as 'cognitive regulators' but as neuromodulators that work together to fully transform a non-breeding female into a completely reproductive female displaying: heightened sexual interest in courting males, greater arousal and selective attention toward courtship signals, improved signal detection and discrimination abilities, enhanced contextual signal memory, and increased motivation to respond to signals assigned incentive salience. The aim of this review is to build a foundation in which to understand the brain regions associated with cognitive, sensory, motivational, and signal salience not as independently acting systems but as a set of interacting processes that function together in a context-appropriate manner. © The Author 2017. Published by Oxford University Press on behalf of the Society for Integrative and Comparative
Neuromedin s as novel putative regulator of luteinizing hormone secretion.
Vigo, E; Roa, J; López, M; Castellano, J M; Fernandez-Fernandez, R; Navarro, V M; Pineda, R; Aguilar, E; Diéguez, C; Pinilla, L; Tena-Sempere, M
2007-02-01
Neuromedin S (NMS), a 36 amino acid peptide structurally related to neuromedin U, was recently identified in rat brain as ligand for the G protein-coupled receptor FM4/TGR-1, also termed neuromedin U receptor type-2 (NMU2R). Central expression of NMS appears restricted to the suprachiasmatic nucleus, and NMS has been involved in the regulation of dark-light rhythms and suppression of food intake. Reproduction is known to be tightly regulated by metabolic and photoperiodic cues. Yet the potential contribution of NMS to the control of reproductive axis remains unexplored. We report herein analyses of hypothalamic expression of NMS and NMU2R genes, as well as LH responses to NMS, in different developmental and functional states of the female rat. Expression of NMS and NMU2R genes was detected at the hypothalamus along postnatal development, with significant fluctuations of their relative levels (maximum at prepubertal stage and adulthood). In adult females, hypothalamic expression of NMS (which was confined to suprachiasmatic nucleus) and NMU2R significantly varied during the estrous cycle (maximum at proestrus) and was lowered after ovariectomy and enhanced after progesterone supplementation. Central administration of NMS evoked modest LH secretory responses in pubertal and cyclic females at diestrus, whereas exaggerated LH secretory bursts were elicited by NMS at estrus and after short-term fasting. Conversely, NMS significantly decreased elevated LH concentrations of ovariectomized rats. In summary, we provide herein novel evidence for the ability of NMS to modulate LH secretion in the female rat. Moreover, hypothalamic expression of NMS and NMU2R genes appeared dependent on the functional state of the female reproductive axis. Our data are the first to disclose the potential implication of NMS in the regulation of gonadotropic axis, a function that may contribute to the integration of circadian rhythms, energy balance, and reproduction.
The Future of human reproduction
National Research Council Canada - National Science Library
Overall, Christine
1989-01-01
... Contradictions III SOCIAL POLICY QUESTIONS Pregnancy as Justification for Loss of Juridical Autonomy Sanda Rodgers 174 Prenatal Diagnosis: Reproductive Choice? Reproductive Control? Abby Lippman ...
The future of human reproduction
National Research Council Canada - National Science Library
Overall, Christine
1989-01-01
... Contradictions III SOCIAL POLICY QUESTIONS Pregnancy as Justification for Loss of Juridical Autonomy Sanda Rodgers 174 Prenatal Diagnosis: Reproductive Choice? Reproductive Control? Abby Lippman ...
Directory of Open Access Journals (Sweden)
Baker Dean A
2009-05-01
Full Text Available Abstract Background Despite the importance of egg development to the female life cycle in Drosophila, global patterns of gene expression have not been examined in detail, primarily due to the difficulty in isolating synchronised developmental stages in sufficient quantities for gene expression profiling. Entry into vitellogenesis is a key stage of oogenesis and by forcing females into reproductive diapause we are able to arrest oogenesis at the pre-vitellogenic stages. Releasing females from diapause allows collection of relatively synchronous developing egg populations and an investigation of some of the transcriptional dynamics apparent before and after reproductive diapause. Results Focusing on gender-biased transcription, we identified mechanisms of egg development suppressed during reproductive dormancy as well as other molecular changes unique to the diapausing female. A microarray based analysis generated a set of 3565 transcripts with at least 2-fold greater expression in females as compared to control males, 1392 such changes were biased during reproductive dormancy. In addition, we also detect 1922 up-regulated transcriptional changes after entry into vitellogenesis, which were classified into discrete blocks of co-expression. We discuss some of the regulatory aspects apparent after re-initiation of egg development, exploring the underlying functions, maternal contribution and evolutionary conservation of co-expression patterns involved in egg production. Conclusion Although much of the work we present is descriptive, fundamental aspects of egg development and gender-biased transcription can be derived from our time-series experiment. We believe that our dataset will facilitate further exploration of the developmental and evolutionary characteristics of oogenesis as well as the nature of reproductive arrest in Drosophila.
Reproduction (II): Human Control of Reproductive Processes
Jost, Alfred
1970-01-01
Describes methods of intervening in reproduction of animals and humans (artificial insemination, contraception, ovular and blastodisc transplants, pre selection of sex, cloning) and discusses the social implications of their use with humans. (AL)
Directory of Open Access Journals (Sweden)
Jacques Auger
2014-02-01
Full Text Available In the present review, we first summarize the main benefits, limitations and pitfalls of conventional in vivo approaches to assessing male reproductive structures and functions in rodents in cases of endocrine active substance (EAS exposure from the postulate that they may provide data that can be extrapolated to humans. Then, we briefly present some integrated approaches in rodents we have recently developed at the organism level. We particularly focus on the possible effects and modes of action (MOA of these substances at low doses and in mixtures, real-life conditions and at the organ level, deciphering the precise effects and MOA on the fetal testis. It can be considered that the in vivo experimental EAS exposure of rodents remains the first choice for studies and is a necessary tool (together with the epidemiological approach for understanding the reproductive effects and MOA of EASs, provided the pitfalls and limitations of the rodent models are known and considered. We also provide some evidence that classical rodent models may be refined for studying the multiple consequences of EAS exposure, not only on the reproductive axis but also on various hormonally regulated organs and tissues, among which several are implicated in the complex process of mammalian reproduction. Such models constitute an interesting way of approaching human exposure conditions. Finally, we show that organotypic culture models are powerful complementary tools, especially when focusing on the MOA. All these approaches have contributed in a combinatorial manner to a better understanding of the impact of EAS exposure on human reproduction.
Gender and social reproduction: historical perspectives.
Laslett, B; Brenner, J
1989-01-01
It is argued that gender relations and social reproduction were both shaped by macrohistorical processes and shaped the processes. Social reproduction is defined within feminist theory as more than production in the Marxist sense. Societal reproduction is a combination of the organization of production, the organization of social reproduction, the perpetuation of gender, and the continuation of class relations. Social reproduction includes the care and socialization of children and care of the elderly or infirm. Social reproduction includes the organization of sexuality, biological reproduction, and how food, clothing, and shelter are made available. Most social reproduction occurs within the family unit. It is pointed out that variations in the distribution of the work of social reproduction are affected by the family, market, community, and state. The ways in which women construct their own worlds of activity is a central concern. The feminist concept of social reproduction differs from modernization theory, which is concerned with the institutional location of the tasks of social reproduction and the structural effects on the family and gender relations. This literature review focuses only on the history of family strategies and separate gender-related activities. The authors describe the changes in family organization that define men as income producers and women as caretakers, who base child rearing on love and feminine virtue rather than patriarchal authority and religious doctrine. The discussion focuses on the differences in marital relationships, motherhood, and sexuality between upper and middle class and working class women in the 19th century. Among working class women, a good wife was an efficient manager, a skilled domestic worker, and an income earner. The turn of the century was a period of social change marked by smaller average family size, the decline of household production, the rise in real wages, and increased consumption. It is argued that
Reproductive endocrinology of vitamin D
DEFF Research Database (Denmark)
Lorenzen, Mette; Boisen, Ida Marie; Mortensen, Li Juel
2017-01-01
Vitamin D is a versatile hormone with several functions beyond its well-established role in maintenance of skeletal health and calcium homeostasis. The effects of vitamin D are mediated by the vitamin D receptor, which is expressed together with the vitamin D metabolizing enzymes in the reproduct...... suffering from reproductive problems and abnormal endocrinology research addressing the role of vitamin D in reproductive endocrinology may be of clinical importance....
International Nuclear Information System (INIS)
Ponzo, Osvaldo J.; Silvia, Carbone
2013-01-01
Endocrine disruptors (EDs) are exogenous substances or xenoestrogens natural or synthetic, capable of interacting with different systems and altering their normal hormonal regulation, being the reproductive system one of the most affected. EDs produce their effects not only by acting on nuclear steroid receptors, but also on membrane receptors, steroidal and non-steroidal synthetic enzymatic pathways and/or metabolism. The incorporation to the body depend on each EDs, which are liposoluble and easily deposited in the tissue; thus ensuring a prolonged accumulation and release, even when the exposure is not continuous. In addition to cross the placenta, EDs may act in the offspring during the reproductive system formation and maturation key stages and its regulatory mechanisms. The effects of EDs can be multiple, but most acts mediating estrogenic and/or antiandrogenic effect. Three groups of EDs are widely used: in plastics (phtalates), sunscreens (cinnamate and methylbenzylcamphor), and detergents (nonylphenol). In this paper we review the effects of the exposure to these environmental chemicals on the reproductive system and the possible mechanisms by which they occur, focusing in the hypothalamic–pituitary neuroendocrine mechanisms that regulate the reproductive system
Involvement of galectin-1 in reproduction: past, present and future.
Barrientos, Gabriela; Freitag, Nancy; Tirado-González, Irene; Unverdorben, Laura; Jeschke, Udo; Thijssen, Victor L J L; Blois, Sandra M
2014-01-01
After recognition of its pivotal contribution to fetomaternal tolerance, the study of galectin-1 (gal-1) functions in the context of pregnancy became an attractive topic in reproductive medicine. Despite considerable advances in the understanding of the immuno- and growth-regulatory properties of gal-1 at the fetal-maternal interface, many functional aspects of this lectin in reproduction are only emerging. The published literature was searched using Pubmed focusing on gal-1 signalling and functional properties at the maternal-fetal interface, including data on its implication in pregnancy disorders and malignancies of the female reproductive system. Papers discussing animal and human studies were included. This review provides an overview of gal-1 functions during pregnancy, such as modulation of maternal immune responses and roles in embryo implantation and placentation. We also emphasize the role of gal-1 in key regulatory processes, including trophoblast migration, invasion, syncytium formation and expression of non-classical MHC class I molecules (HLA-G). In addition, we argue in favour of gal-1 pro-angiogenic properties, as observed in tumourigenesis and other pathological settings, and its implication in the angiogenesis process associated with early gestation. The involvement of gal-1 in the regulation of different processes during the establishment, development and maintenance of pregnancy could be described as unique. Gal-1 has emerged as an important lectin with major functions in pregnancy.
Ding, Jun; Wu, You; You, Lin-Lin; Xu, Bin; Ge, Lin-Quan; Yang, Guo-Qing; Wu, Jin-Cai
2017-06-01
The small brown planthopper (SBPH), Laodelphax striatellus (Fallen), is a serious pest insect of rice, wheat, and maize in China. SBPH not only sucks plant sap but also transmits plant disease viruses, causing serious damage. These viruses include rice striped virus disease (RSV disease), black streaked dwarf, and maize rough disease virus. SBPH outbreaks are related to the overuse of pesticides in China. Some pesticides, such as triazophos, stimulate the reproduction of SBPH, but an antibiotic fungicide jinggangmycin (JGM) suppresses its reproduction. However, mechanisms of decreased reproduction of SBPH induced by JGM remain unclear. The present findings show that JGM suppressed reproduction of SBPH (↓approximately 35.7%) and resulted in the down-regulated expression of glucose dehydrogenase (GDH). GDH-silenced control females (control+dsGDH) show that the number of eggs laid was reduced by 48.6% compared to control females. Biochemical tests show that the total lipid and fatty acid contents in JGM-treated and control+dsGDH females decreased significantly. Thus, we propose that the suppression of reproduction in SBPH induced by JGM is mediated by GDH via metabolic pathways. Copyright © 2017 Elsevier Inc. All rights reserved.
Brown, Megan E; Converse, Sarah J.; Chandler, Jane N.; Shafer, Charles; Brown, Janine L; Keefer, Carol L; Songsasen, Nucharin
2016-01-01
Reproductive success of endangered whooping cranes (Grus americana) maintained ex situ is poor. As part of an effort to identify potential causes of poor reproductive success in a captive colony, we used non-invasive endocrine monitoring to assess gonadal and adrenal steroids of bird pairs with various reproductive outcomes and evaluated the relationships of hormones and behaviors to reproductive performance. Overall, reproductively successful (i.e., egg laying) females had significantly higher mean estrogen levels but lower mean progestogen concentrations than did unsuccessful females. Other hormones, including glucocorticoids and androgens, were not significantly different between successful and unsuccessful individuals. Observations of specific behaviors such as unison calling, marching, and the number of copulation attempts, along with overall time spent performing reproductive behaviors, were significantly higher in successful pairs. Our findings indicate that overall reproductive performance of whooping crane pairs is linked to female gonadal hormone excretion and reproductive behaviors, but not to altered adrenal hormone production.
Brown, Megan E; Converse, Sarah J; Chandler, Jane N; Shafer, Charles; Brown, Janine L; Keefer, Carol L; Songsasen, Nucharin
2016-05-01
Reproductive success of endangered whooping cranes (Grus americana) maintained ex situ is poor. As part of an effort to identify potential causes of poor reproductive success in a captive colony, we used non-invasive endocrine monitoring to assess gonadal and adrenal steroids of bird pairs with various reproductive outcomes and evaluated the relationships of hormones and behaviors to reproductive performance. Overall, reproductively successful (i.e., egg laying) females had significantly higher mean estrogen levels but lower mean progestogen concentrations than did unsuccessful females. Other hormones, including glucocorticoids and androgens, were not significantly different between successful and unsuccessful individuals. Observations of specific behaviors such as unison calling, marching, and the number of copulation attempts, along with overall time spent performing reproductive behaviors, were significantly higher in successful pairs. Our findings indicate that overall reproductive performance of whooping crane pairs is linked to female gonadal hormone excretion and reproductive behaviors, but not to altered adrenal hormone production. Published by Elsevier Inc.
Neuroendocrine control by kisspeptins: role in metabolic regulation of fertility.
Navarro, Victor M; Tena-Sempere, Manuel
2011-09-13
The neurohormonal control of reproduction involves a hierarchical network of central and peripheral signals in the hypothalamic-pituitary-gonadal (HPG) axis. Development and function of this neuroendocrine system is the result of a lifelong delicate balance between endogenous regulators and environmental cues, including nutritional and metabolic factors. Kisspeptins are the peptide products of KISS1, which operate via the G-protein-coupled receptor GPR54 (also known as Kiss1R). These peptides have emerged as essential upstream regulators of neurons secreting gonadotropin-releasing hormone (GnRH), the major hypothalamic node for the stimulatory control of the HPG axis. They are potent elicitors of gonadotropin secretion in various species and physiological settings. Moreover, Kiss1 neurons in the hypothalamus participate in crucial features of reproductive maturation and function, such as brain-level sex differentiation, puberty onset and the neuroendocrine regulation of gonadotropin secretion and ovulation. Cotransmitters of Kiss1 neurons, such as neurokinin B, with roles in controlling the HPG axis have been identified by genetic, neuroanatomical and physiological studies. In addition, a putative role has been proposed for Kiss1 neurons in transmitting metabolic information to GnRH neurons, although the precise mechanisms are as yet unclear. In this Review, we present the major reproductive features of kisspeptins, especially their interplay with neurokinin B and potential roles in the metabolic control of puberty and fertility, and suggest new avenues for research.
Influence of season of birth on growth and reproductive development of Brahman bulls.
Tatman, Shawn R; Neuendorff, Don A; Wilson, Timothy W; Randel, Ronald D
2004-07-01
Seasonal effects on reproduction are more dramatic in Bos indicus than Bos taurus cattle. This experiment evaluated reproductive development of fall- (n=7) versus spring- (n = 10) born Brahman bulls to determine if season of birth affects reproductive development. Measurements of growth and reproductive development began after weaning and continued at bi-weekly intervals until each bull reached sexual maturity. Different stages of sexual development were classified according to characteristics of the ejaculate and included first sperm in the ejaculate, puberty (> 50 x 10(6) sperm/ejaculate), and sexual maturity (two ejaculates with > 500 = 10(6) sperm/ejaculate). Average daily increases in all measured traits were similar in fall- and spring-born bulls and there were no differences in age, body weight, scrotal circumference, or paired testis volume between groups at first sperm or puberty. However, fall-born bulls were older (P days versus 481 days, respectively) as the interval between puberty and sexual maturity was longer (P days versus 54 days, respectively). The prolonged interval between puberty and sexual maturity in fall-born calves coincided with a short photoperiod (winter) whereas the short interval between puberty and sexual maturity in spring-born calves coincided with a long photoperiod (summer). In conclusion, season of birth affected sexual development; photoperiod might be involved in regulating testicular function immediately after puberty in Brahman bulls.
The Reproduction of Intelligence
Meisenberg, Gerhard
2010-01-01
Although a negative relationship between fertility and education has been described consistently in most countries of the world, less is known about the relationship between intelligence and reproductive outcomes. Also the paths through which intelligence influences reproductive outcomes are uncertain. The present study uses the NLSY79 to analyze…
Assisted Reproductive Technologies : Implications for Women's ...
International Development Research Centre (IDRC) Digital Library (Canada)
Assisted Reproductive Technologies : Implications for Women's Reproductive Rights and Social Citizenship. There is a general perception that assisted reproductive technologies (ARTs) affect only a small number of affluent women in India. However, the ART industry - tied as it is to the vigorously pushed medical tourism ...
A Program to Detect and Characterize Extra-Solar Giant Planets
Lindstrom, David (Technical Monitor); Noyes, Robert W.
2003-01-01
We initiated a significant hardware upgrade to the AFOE, to increase its efficiency for precise radial velocity studies to the level where we can continue to contribute usefully to extrasolar planet research on relatively bright stars. The AFOE, at a 1.5-m telescope, will of course not have the sensitivity of radial velocity instruments at larger telescopes, such as the HIRES on Keck or the Hectochelle on the MMT telescope (about to come on line). However, it has been possible to increase its efficiency for precise radial velocity studies by a factor of 4 to 5, which-combined with the large amount of telescope time available at the 1.5-m telescope-will permit us to do intensive follow-up observations of stars brighter than about 8 magnitude. The AFOE was originally designed primarily for asteroseismology using a ThAr reference. This provided useful wavelength stability over tens of minutes as required for asteroseismology, but we were unable to get a long-term (month-to-month) velocity precision better than about 15 m/s with that setup. Hence, we implemented an iodine cell as a wavelength reference for extrasolar planet studies. However, the optical design of the original AFOE did not completely span the wavelength range covered by the iodine absorption spectrum, and furthermore the optics suffered significant light loss through optical obscuration in the camera secondary. To remedy this, we replaced the AFOE grating with a new one that covered the entire iodine spectral range at somewhat lower spectral resolution, and replaced the camera with a transmitting lens. (The use of a lens was made possible by restricting the spectral range covered by the upgraded AFOE to only the iodine region.) These upgrades were successfully completed, and the instrument was tested for three nights in fall of 2002. The expected improvement in sensitivity by a factor of 4 to 5 was observed: that is, the same velocity precision as previously attained (of order 5 to 7 m/s) was now
Zampas, Christina
2013-12-01
The practice of conscientious objection by healthcare workers is growing across the globe. It is most common in reproductive healthcare settings because of the religious or moral values placed on beliefs as to when life begins. It is often invoked in the context of abortion and contraceptive services, including the provision of information related to such services. Few states adequately regulate the practice, leading to denial of access to lawful reproductive healthcare services and violations of fundamental human rights. International ethical, health, and human rights standards have recently attempted to address these challenges by harmonizing the practice of conscientious objection with women's right to sexual and reproductive health services. FIGO ethical standards have had an important role in influencing human rights development in this area. They consider regulation of the unfettered use of conscientious objection essential to the realization of sexual and reproductive rights. Under international human rights law, states have a positive obligation to act in this regard. While ethical and human rights standards regarding this issue are growing, they do not yet exhaustively cover all the situations in which women's health and human rights are in jeopardy because of the practice. The present article sets forth existing ethical and human rights standards on the issue and illustrates the need for further development and clarity on balancing these rights and interests. Copyright © 2013 International Federation of Gynecology and Obstetrics. Published by Elsevier Ireland Ltd. All rights reserved.
Reproductive sharing among queens in the ant Formica fusca
Minttumaaria Hannonen; Liselotte Sundstro¨m
2003-01-01
Reproductive sharing among cobreeders, in which reproductive shares may vary from equal contribution (low reproductive skew) to reproductive dominance by one individual (high reproductive skew), is a fundamental feature of animal societies. Recent theoretical work, the reproductive skew models, has focused on factors affecting the degree to which reproduction is skewed within a society. We used the parameters provided by skew models as a guideline to study determinants of reproductive sharing...
Cottingham, Jane; Berer, Marge
2011-11-01
The range of medicines and technologies that are essential for sexual and reproductive health care is well established, but access to them is far from universally assured, particularly in less developed countries. This paper shows how the pharmaceutical industry plays a major role in the lack of access to essential medicines for sexual and reproductive health care, by a) investing in products for profit-making reasons despite their negative health impact (e.g. hormone replacement therapy), b) marketing new essential medicines at prices beyond the reach of countries that most need them (e.g. HPV vaccines), and c) failing to invest in the development of new products (e.g. microbicides and medical abortion pills). Small companies, some of them non-profit-making, struggle to fill some of that demand (e.g. for female condoms). International patent protection contributes to high prices of medicines, and while international agreements such as compulsory licensing under TRIPS and the Medicines Patent Pool allow for mechanisms to enable poorer countries to get access to essential medicines, the obstacles created by "big pharma" are daunting. All these barriers have fostered a market in sub-standard medicines (e.g. fake medical abortion pills sold over the internet). An agenda driven by sexual and reproductive health needs, based on the right to health, must focus on universal access to essential medicines at prices developing countries can afford. We call for greater public investment in essential medicines, expanded production of affordable generic drugs, and the development of broad strategic plans, that include affordable medicines and technologies, for addressing identified public health problems, such as cervical cancer. Copyright © 2011 Reproductive Health Matters. Published by Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Ruairidh D Campbell
Full Text Available Using 15 years of data from a stable population of wild Eurasian beavers (Castor fiber, we examine how annual and lifetime access to food resources affect individual age-related changes in reproduction and somatic condition. We found an age-related decline in annual maternal reproductive output, after a peak at age 5-6. Rainfall, an established negative proxy of annual resource availability for beavers, was consistently associated with lower reproductive output for females of all ages. In contrast, breeding territory quality, as a measure of local resource history over reproductive lifetimes, caused differences in individual patterns of reproductive senescence; animals from lower quality territories senesced when younger. Litter size was unrelated to maternal age, although adult body weight increased with age. In terms of resource effects, in poorer years but not in better years, older mothers produced larger offspring than did younger mothers, giving support to the constraint theory. Overall, our findings exemplify state-dependent life-history strategies, supporting an effect of resources on reproductive senescence, where cumulative differences in resource access, and not just reproductive strategy, mediate long-term reproductive trade-offs, consistent with the disposable soma and reproductive restraint theories. We propose that flexible life-history schedules could play a role in the dynamics of populations exhibiting reproductive skew, with earlier breeding opportunities leading to an earlier senescence schedule through resource dependent mechanisms.
Artificial reproductive technologies (ART) applications in Turkey as viewed by feminists.
Sahinoglu-Pelin, S
2002-01-01
Since 1979, a lot of couples have benefited, in terms of having babies, from Artificial Reproductive Technologies (ART). In Turkey, there are presently about 20 centres in existence for this purpose where two approved sets of regulations are in operation; the second being an improved form of the former. In this paper, ART applications in Turkey, as viewed by feminists, will be discussed. During ART, the body of the woman concerned is directly involved. And after every application, the possibility of not having a living baby can adversely affect the physical and psychological state of the woman in question with the trauma being sometimes beyond endurance. In the two sets of approved regulations mentioned above, this application has been questioned in terms of ethics.
Rules and economic features connected with adoption and medical assisted reproduction
Directory of Open Access Journals (Sweden)
Hemion Braho
2015-07-01
Full Text Available The aim of this brief study is to analyze the phenomenon of adoption and the assisted reproductive technologies, not from a social point of view as experts often do, but on an economic point of view. This could be possible analyzing first of all the laws regulating these “markets” and the influence of this regulation on the economic aspects. Although it could seem immoral to study this social aspects connected with filiation, we know that the social desire of some parents or some individuals to have children and their possibility is oriented by laws, economic possibilities and economy in general. This study is based on an empirical methodology, taking as study-case Italy and trying not to give any ethic orientation.
Circadian rhythms and reproduction.
Boden, Michael J; Kennaway, David J
2006-09-01
There is a growing recognition that the circadian timing system, in particular recently discovered clock genes, plays a major role in a wide range of physiological systems. Microarray studies, for example, have shown that the expression of hundreds of genes changes many fold in the suprachiasmatic nucleus, liver heart and kidney. In this review, we discuss the role of circadian rhythmicity in the control of reproductive function in animals and humans. Circadian rhythms and clock genes appear to be involved in optimal reproductive performance, but there are sufficient redundancies in their function that many of the knockout mice produced do not show overt reproductive failure. Furthermore, important strain differences have emerged from the studies especially between the various Clock (Circadian Locomotor Output Cycle Kaput) mutant strains. Nevertheless, there is emerging evidence that the primary clock genes, Clock and Bmal1 (Brain and Muscle ARNT-like protein 1, also known as Mop3), strongly influence reproductive competency. The extent to which the circadian timing system affects human reproductive performance is not known, in part, because many of the appropriate studies have not been done. With the role of Clock and Bmal1 in fertility becoming clearer, it may be time to pursue the effect of polymorphisms in these genes in relation to the various types of infertility in humans.
Survival and reproductive rate of mites in relation to resistance of their barn swallow hosts.
Møller, A P
2000-08-01
Parasite resistance may act via a number of different mechanisms that regulate or control the survival and the reproductive rate of parasites. Observations and experiments were used to test for effects of host resistance on parasite survival and rate of reproduction. Natural levels of infestation of barn swallow Hirundo rustica nests by the tropical fowl mite Ornithonyssus bursa were positively related to brood size, inversely related to the length of the outermost tail feathers of male nest owners (a secondary sexual character) and affected by time of reproduction by the host. A mite inoculation experiment, in which 50 adult mites were introduced into nests during the laying period of the host, was used to test for differential survival and reproduction of mites as a function of host resistance. The relationship between survival and reproduction of parasites, male tail length and host resistance was investigated. There was a negative relationship between mite numbers per nest after fledging of nestlings and male tail length. This relationship was mainly caused by a reduction in the number of mites in the first and second nymph stage with increasing tail length of male hosts, implying a reduction in rate of reproduction of mites. The proportion of mites that had recently fed was inversely related to tail length of male hosts. The proportion of nymph stages was positively related to the proportion of mites that had recently had a blood meal. Parasite resistance of barn swallows to the tropical fowl mite thus appeared to act through increased mortality rate of adult and nymph stages of mites, and through reduced reproductive rates of mites on resistant hosts. This is the first study demonstating a direct relationship between fitness components of a parasite and the expression of a secondary sexual character of a host.
Wu, Yi-Fei; Wei, Lu-Sha; Anthony Torres, Mark; Zhang, Xu; Wu, Shao-Ping; Chen, Hui
2017-01-01
Studying the reproductive attributes of pests is central to understanding their life cycle history and in crafting management strategies to regulate, if not bring down, their population below threshold levels. In this article, the morphology of the male reproductive tract, topology of the spermatozoa, and salient features of spermiogenesis in the Chinese white pine beetle, Dendroctonus armandi Tsai and Li was studied to provide baseline information for further pest management studies. Results showed that male reproductive tract of this species differs from those documented in other Coleopterans by having 20 testicular tubules in each testis and the presence of two types of accessory glands. The spermatozoon is seen having peculiar characteristics such as an "h"-shaped acrosomal vesicle with a "puff"-like expansion, one centriole, one large spongy body, and two accessory bodies. Despite with some morphological differences of the male reproductive organ, spermatogenesis in this organism is similar to other Coleopterans. Overall, detailed studies regarding the components of the primary male reproductive organ of this beetle species would expand the knowledge on the less-understood biology of Coleopteran pests and would help in designing regulatory measures to conserve endemic and indigenous pine trees in China. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America.
44 CFR 6.85 - Reproduction fees.
2010-10-01
... 44 Emergency Management and Assistance 1 2010-10-01 2010-10-01 false Reproduction fees. 6.85... HOMELAND SECURITY GENERAL IMPLEMENTATION OF THE PRIVACY ACT OF 1974 Fees § 6.85 Reproduction fees. (a... over 81/2 x 14 inches or whose physical characteristics do not permit reproduction by routine...
REPRODUCTION & REPRODUCTION PHYSIOLOGY
1996-01-01
Abstract not available. REPRODUCTION & REPRODUCTION PHYSIOLOGY (1996). Abstracts of the communications presented during the 6th World Rabbit Congress: REPRODUCTION & REPRODUCTION PHYSIOLOGY. Toulouse, July 9-12, 1996. World Rabbit Science. 58-67. doi:10.4995/wrs.1996.302 58 67 04
A novel quantitative approach to women's reproductive strategies.
Directory of Open Access Journals (Sweden)
Fritha H Milne
Full Text Available The patterned way in which individuals allocate finite resources to various components of reproduction (e.g. mating effort, reproductive timing and parental investment is described as a reproductive strategy. As energy is limited, trade-offs between and within aspects of reproductive strategies are expected. The first aim of this study was to derive aspects of reproductive strategies using complete reproductive histories from 718 parous Western Australian women. Factor analysis using a subset of these participants resulted in six factors that represented 'short-term mating strategy', 'early onset of sexual activity', 'reproductive output', 'timing of childbearing', 'breastfeeding', and 'child spacing'. This factor structure was internally validated by replication using a second independent subset of the data. The second aim of this study examined trade-offs between aspects of reproductive strategies derived from aim one. Factor scores calculated for each woman were incorporated in generalised linear models and interaction terms were employed to examine the effect of mating behaviour on the relationships between reproductive timing, parental investment and overall reproductive success. Early sexual activity correlates with early reproductive onset for women displaying more long-term mating strategies. Women with more short-term mating strategies exhibit a trade-off between child quantity and child quality not observed in women with a long-term mating strategy. However, women with a short-term mating strategy who delay reproductive timing exhibit levels of parental investment (measured as breastfeeding duration per child similar to that of women with long-term mating strategies. Reproductive delay has fitness costs (fewer births for women displaying more short-term mating strategies. We provide empirical evidence that reproductive histories of contemporary women reflect aspects of reproductive strategies, and associations between these strategic
Reproductive endocrinology of vitamin D.
Lorenzen, Mette; Boisen, Ida Marie; Mortensen, Li Juel; Lanske, Beate; Juul, Anders; Blomberg Jensen, Martin
2017-09-15
Vitamin D is a versatile hormone with several functions beyond its well-established role in maintenance of skeletal health and calcium homeostasis. The effects of vitamin D are mediated by the vitamin D receptor, which is expressed together with the vitamin D metabolizing enzymes in the reproductive tissues. The reproductive organs are therefore responsive to and able to metabolize vitamin D locally. The exact role remains to be clarified but several studies have suggested a link between vitamin D and production/release of reproductive hormones into circulation, which will be the main focus of this review. Current evidence is primarily based on small human association studies and rodent models. This highlights the need for randomized clinical trials, but also functional animal and human in vitro studies, and larger, prospective cohort studies are warranted. Given the high number of men and women suffering from reproductive problems and abnormal endocrinology research addressing the role of vitamin D in reproductive endocrinology may be of clinical importance. Copyright © 2017 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Rute S T Martins
Full Text Available The acquisition of reproductive competence requires the activation of the brain-pituitary-gonad (BPG axis, which in most vertebrates, including fishes, is initiated by changes in photoperiod. In the European sea bass long-term exposure to continuous light (LL alters the rhythm of reproductive hormones, delays spermatogenesis and reduces the incidence of precocious males. In contrast, an early shift from long to short photoperiod (AP accelerates spermatogenesis. However, how photoperiod affects key genes in the brain to trigger the onset of puberty is still largely unknown. Here, we investigated if the integration of the light stimulus by clock proteins is sufficient to activate key genes that trigger the BPG axis in the European sea bass. We found that the clock genes clock, npas2, bmal1 and the BPG genes gnrh, kiss and kissr share conserved transcription factor frameworks in their promoters, suggesting co-regulation. Other gene promoters of the BGP axis were also predicted to be co-regulated by the same frameworks. Co-regulation was confirmed through gene expression analysis of brains from males exposed to LL or AP photoperiod compared to natural conditions: LL fish had suppressed gnrh1, kiss2, galr1b and esr1, while AP fish had stimulated npas2, gnrh1, gnrh2, kiss2, kiss1rb and galr1b compared to NP. It is concluded that fish exposed to different photoperiods present significant expression differences in some clock and reproductive axis related genes well before the first detectable endocrine and morphological responses of the BPG axis.
Vitamin D metabolism, sex hormones, and male reproductive function
DEFF Research Database (Denmark)
Blomberg Jensen, Martin
2012-01-01
The spectrum of vitamin D (VD)-mediated effects has expanded in recent years, and VD is now recognized as a versatile signaling molecule rather than being solely a regulator of bone health and calcium homeostasis. One of the recently identified target areas of VD is male reproductive function...... is the main VD target in the testis and to what extent VD is important for sex hormone production and function of spermatozoa. This review summarizes descriptive studies on testicular VD metabolism and spatial distribution of VDR and the VD metabolizing enzymes in the mammalian testes and discusses...
Reproductive Ethics in Commercial Surrogacy: Decision-Making in IVF Clinics in New Delhi, India.
Tanderup, Malene; Reddy, Sunita; Patel, Tulsi; Nielsen, Birgitte Bruun
2015-09-01
As a neo-liberal economy, India has become one of the new health tourism destinations, with commercial gestational surrogacy as an expanding market. Yet the Indian Assisted Reproductive Technology (ART) Bill has been pending for five years, and the guidelines issued by the Indian Council of Medical Research are somewhat vague and contradictory, resulting in self-regulated practices of fertility clinics. This paper broadly looks at clinical ethics in reproduction in the practice of surrogacy and decision-making in various procedures. Through empirical research in New Delhi, the capital of India, from December 2011 to November 2012, issues of decision-making on embryo transfer, fetal reduction, and mode of delivery were identified. Interviews were carried out with doctors in eighteen ART clinics, agents from four agencies, and fourteen surrogates. In aiming to fulfil the commissioning parents' demands, doctors were willing to go to the greatest extent possible in their medical practice. Autonomy and decision-making regarding choice of the number of embryos to transfer and the mode of delivery lay neither with commissioning parents nor surrogate mothers but mostly with doctors. In order to ensure higher success rates, surrogates faced the risk of multiple pregnancy and fetal reduction with little information regarding the risks involved. In the globalized market of commercial surrogacy in India, and with clinics compromising on ethics, there is an urgent need for formulation of regulative law for the clinical practice and maintenance of principles of reproductive ethics in order to ensure that the interests of surrogate mothers are safeguarded.
INNOVATIVE SYSTEM OF FIXED CAPITAL REPRODUCTION
Directory of Open Access Journals (Sweden)
G. S. Merzlikina
2015-01-01
Full Text Available The article presents the basic problems of fixed capital reproduction. There are considered a significant depreciation of fixed assets of Russian enterprises. There are presented arguments in favor of urgency of the problem of reproduction of fixed assets of the Russian Federation. The paper presents theoretical evidence base basic types of fixed capital reproduction. There are identified all possible sources of simple and expanded reproduction of capital. There are considered the role of value and feasibility of depreciation in the formation of Reserve reproduction. Suggested the formation of accounting and analytical management provision fixed capital, as well as an innovative system of fixed capital reproduction, which implies the creation of depreciation , capital, revaluation, liquidation reserves. The algorithm of business valuation based on an innovative system of capital reproduction. The algorithm and the possibility of formation of reserves are considered on a concrete example of one of the industrial enterprises of the city Volgograd. On the basis of the algorithm presented calculations of business valuation of the enterprise. Calculations have shown an increase in value of the business condition of the formation of special reserves, which underlines the necessary and urgency of their formation in accounting policy and economy organizations and enterprises of Russia as a whole.
Ameloblastic fibro-odontoma of the anterior mandible in a 22-month-old boy
Directory of Open Access Journals (Sweden)
Wewel John
2010-01-01
Full Text Available We report an ameloblastic fibro-odontoma (AFO presenting in the anterior mandible as a "bump on his gums" in a 22-month-old boy. An occlusal radiograph revealed a well-circumscribed radiolucency with scattered radiopaque foci. The tumor was enucleated under general anesthesia. The histologic findings were characteristic of an AFO, a mixed odontogenic tumor most common in the posterior jaws, primarily affecting individuals with an average age of 10 years. The clinical presentation, microscopic findings, differential diagnoses, and treatment are discussed.
Social Reproduction in the Live Stream
Directory of Open Access Journals (Sweden)
Elise Thorburn
2017-05-01
Full Text Available In the most recent wave of struggles a changed logic of activism is evident (Dyer-Witheford, 2015. Research on this wave has often emphasised the interactions of the digital (through online forms of activism, communication, and coordination with the embodied (in assemblies, spatial occupations, and face-to-face encounters (Gerbaudo, 2012. Although gender has been considered in regard to these struggles (Herrera, 2014 feminist concerns over social reproduction – concerns which have also been central to the contemporary epoch of struggle (Brown, et al, 2013 – have been largely neglected. Social reproduction refers to the capacities of populations to reproduce themselves and through this to reproduce the material basis of the economy (Bezanson and Luxton, 2006; Federici, 2012. It is a site wherein human beings and capital compete for the reproduction of living bodies, and contemporary social movements have become ground zero for such socially reproductive contestations (Thorburn, 2015. Within contemporary movements, struggles over social reproduction are increasingly channelled through digital networks as well as embodied practices. This digital-embodied convergence opens up strengths and weaknesses in the contemporary epoch of social/political contestation. In this paper I seek to explicate how alternative feminist modes of social reproduction emerge through digital networks in contemporary social movements and compare this digital social reproduction to more embodied forms also witnessed. Using a case study of Concordia University Television’s live streaming of Quebec’s 2012 student strike, as well as the live streaming initiatives in the anti-police brutality protests in Ferguson and Baltimore 2015, this paper will suggest future horizons of digital and embodied activism around social reproduction focused on media forms within social movements. Based on ethnographic research, including participant observation and interviews, I
Directory of Open Access Journals (Sweden)
Farideh Zafari Zangeneh
2009-09-01
Full Text Available Nowadays stress is an integral part of everyday living and the physiological and behavioral consequences of exposure to stressful situations have been extensively studied for decades. The stress response is a necessary mechanism but disrupts homeostatic process and it is sub served by a complex system located in both the central nervous system (CNS and the periphery. Stressor-induced activation of the hypothalamus–pituitary–adrenal (HPA axis and the sympathetic nervous system (SNS results in a series of neural and endocrine adaptations known as the "stress response" or "stress cascade." The stress cascade is responsible for allowing the body to make the necessary physiological and metabolic changes required to cope with the demands of a homeostatic challenge. Normal activation of the HPA axis is essential for reproduction, growth, metabolic homeostasis, and responses to stress and they are critical for adapting to changes in the external environment. The regulation of gonadal function in men and women is under the control of the HPA. This regulation is complex and sex steroids are important regulators of GnRH and gonadotropin release through classical feedback mechanisms in the hypothalamus and the pituitary. The present overview focuses on the neuroendocrine infrastructure of the adaptive response to stress and its effects on the female reproductive system.
Posthumous Assisted Reproduction from Islamic Perspective
Directory of Open Access Journals (Sweden)
Reza Omani Samani
2008-01-01
Full Text Available Rapid development in assisted reproductive techniques along with relieving the pain of childlessnesshas brought new ethical and policy dilemmas. Posthumous assisted reproduction is the mostchallenging, difficult and sensitive issue to be discussed ethically and religiously. In this paper theacceptability of the posthumous reproduction in Islamic contexts is evaluated and major concernslike Consent and ownership of the gametes after death, Family and Marriage vision and Welfareof the child are discussed together with some international legislation. We can conclude that uponIslamic vision to assisted reproductive techniques as treatment of families and relieving the seriousproblem of childlessness, posthumous assisted reproduction is unacceptable even with previouslyfrozen gametes or embryos. Also, Islamic vision to marriage, consent and welfare of the childconfirms the unacceptability. There must be some law or legislation to ban this procedure in Islamiccontexts.
Girling, Jane E; Hedger, Mark P
2007-01-01
Interactions between the immune system and reproductive system have important consequences for fertility and reproductive health in general. There is increasing evidence that many of the interactions between the immune and reproductive systems involve the Toll-like receptors (TLRs). While there is no doubt that TLRs are important in providing protection against infection in the reproductive tract, there is increasing evidence for the involvement of TLRs in more basic pathology and physiology of reproduction. In the female, TLRs have been implicated in critical aspects of ovarian, endometrial and placental function, as well as in ovarian cancer, pelvic inflammatory disease, intrauterine growth restriction, pre-eclampsia and preterm birth. In the male, TLRs appear to play a role in the control of testicular steroidogenesis and spermatogenesis in disease and, potentially, during normal function, as well. Recent studies also have begun to highlight the role of various TLRs in the aetiology of prostatitis and prostatic cancer. Given the nascent state of knowledge concerning this important area, it is clear that more studies are needed, which should provide valuable new insights into the biology of the TLRs and reproductive function in general.
Van den Berghe, F; Paris, D B B P; Van Soom, A; Rijsselaere, T; Van der Weyde, L; Bertschinger, H J; Paris, M C J
2012-07-01
The African wild dog (Lycaon pictus) is an endangered exotic canid with less than 5500 animals remaining in the wild. Despite numerous strategies to conserve this species, numbers of free-living animals are in decline. It is a highly social species with a complex pack structure: separate male and female dominant hierarchies with, typically, participation of subdominant adults in the rearing of the dominant breeding pairs' pups. Basic reproductive knowledge is largely missing in this species, with only limited information available on the profile of reproductive hormones, based on non-invasive endocrine monitoring. The dominant or alpha male and female are reproductively active and the subdominants are generally reproductively suppressed. However, the occasional production of litters by subdominant females and evidence of multiple paternity within litters suggests that fertility of subordinates is not completely inhibited. In this respect, there are still considerable gaps in our knowledge about the mechanisms governing reproduction and reproductive suppression in African wild dogs, particularly the influence of dominance and pack structure on both male and female fertility. Given concerns over the long-term survival of this species, further research in this area is essential to provide valuable information for their captive breeding and conservation. Reproductive information can also be applied to the development of Assisted Reproductive Techniques for this species; the utility of which in African wild dog conservation is also discussed. Copyright © 2012 Elsevier B.V. All rights reserved.
Asher, G W
2011-04-01
The cervids are a complex assemblage of taxa showing extreme diversity in morphology, physiology, ecology and geographical distribution. Reproductive strategies adopted by various species are also diverse, and include a range from highly seasonal to completely aseasonal birth patterns. The recent growth in knowledge on cervid reproduction is strongly biased towards the larger-bodied, gregarious mixed grazer-browser species that have adapted well to human management and commercialisation. These species tend to represent 'K-selected' climax species characterised by very productive annual breeding success, singleton births and long breeding life (10+ years). Conversely, we know relatively little about the reproductive patterns of the 'r-selected' smaller-bodied, solitary (and often highly territorial), forest-dwelling browser species, often characterised by great fecundity (twinning) and shorter breeding life (<10 years). This group includes many of the endangered cervid taxa. This review extends earlier reviews to include more recent work on cervid reproductive cycles, particularly in relation to environmental factors influencing gestation length. Copyright © 2010 Elsevier B.V. All rights reserved.
African Journal of Reproductive Health
African Journals Online (AJOL)
African Journal of Reproductive Health (AJRH) is published by the Women's Health and ... review articles, short reports and commentaries on reproductive health in Africa. ... Social norms and adolescents' sexual health: an introduction for ...
Preparing for Assisted Reproductive Technology
... CDC Cancel Submit Search The CDC Assisted Reproductive Technology (ART) Note: Javascript is disabled or is not ... visit this page: About CDC.gov . Assisted Reproductive Technology (ART) What Is ART Patient Resources Preparing for ...
[The haematogenous reproduction theory of Aristotle].
Kremer, J
2003-12-20
From the very beginning, man has been fascinated by the continuous coming into being of new life on Earth. Archeological and anthropological data indicate that in prehistoric times, reproduction was attributed to a fertility goddess that required no sperm for this purpose. In the early historical Middle East it was believed that a godly being brought about pregnancy by using male and female semen. It was the merit of the Greek philosophers of the 6th-3rd century B.C. to realize that reproduction was governed by natural laws. Several theories were developed to understand how reproduction could occur. The haematogenous theory of reproduction, developed by Aristotle, has received the most attention. The essence of this theory is that the male sperm, with a haematogenous origin, causes the development of an embryo from menstrual blood present in the female uterus. The theory survived about 2000 years, with modifications, and was also introduced into Christianity. It was only about 150 years ago that the reproduction theory based on hypotheses was changed into a reproduction science based on facts.
Factors affecting reproductive performance of dairy cows.
Coleman, D A; Thayne, W V; Dailey, R A
1985-07-01
We conducted two studies to determine how herd management practices and traits of individual cows affect performance of the herd and of the cow within a herd. Management practices, reproductive performance of the herd, and relationships between management and reproductive performance were characterized on 83 dairy farms with 7596 cows. Data included 21 management variables (e.g., facilities, herd health program, estrous detection program) and 8 performance variables obtained from Dairy Herd Improvement or unofficial records (e.g., size of herd, production, days open). Although varying among herds, annual average herd incidences of reproductive disorders and reproductive performance were similar to those reported. Managerial practices influenced incidences of retained placenta and uterine infection, days open of cows not bred and of all cows, services per conception, and percentages of herd open more than 100 days and culled for low production. Veterinarian was the most consistent variable influencing herd reproductive performance. Data also were collected from production and lifetime records of 2532 cows in 19 herds. Reproductive performance was affected by season of calving, production, maturity, and reproductive disorders. Several cows with extremely poor reproductive records were maintained.
Neuroendocrine regulation of appetitive ingestive behavior
Keen-Rhinehart, Erin; Ondek, Katelynn; Schneider, Jill E.
2013-01-01
Food availability in nature is often irregular, and famine is commonplace. Increased motivation to engage in ingestive behaviors increases the chance of survival, providing additional potential opportunities for reproduction. Because of the advantages conferred by entraining ingestive behavior to environmental conditions, neuroendocrine mechanisms regulating the motivation to acquire and ingest food have evolved to be responsive to exogenous (i.e., food stored for future consumption) and endo...
Neuro-endocrine regulation of LH secretion in cyclic pigs
Dierx, J.
1999-01-01
The present thesis describes the study in the hormonal (endocrine) regulation of the fertility in the female pig. Fertility is optimal when during the reproductive cycle the concentrations of hormones change in a particular sequence. In the present thesis it has been shown that, amongst
Directory of Open Access Journals (Sweden)
Napamanee Kornthong
Full Text Available The central nervous system (CNS is often intimately involved in reproduction control and is therefore a target organ for transcriptomic investigations to identify reproduction-associated genes. In this study, 454 transcriptome sequencing was performed on pooled brain and ventral nerve cord of the female mud crab (Scylla olivacea following serotonin injection (5 µg/g BW. A total of 197,468 sequence reads was obtained with an average length of 828 bp. Approximately 38.7% of 2,183 isotigs matched with significant similarity (E value < 1e-4 to sequences within the Genbank non-redundant (nr database, with most significant matches being to crustacean and insect sequences. Approximately 32 putative neuropeptide genes were identified from nonmatching blast sequences. In addition, we identified full-length transcripts for crustacean reproductive-related genes, namely farnesoic acid o-methyltransferase (FAMeT, estrogen sulfotransferase (ESULT and prostaglandin F synthase (PGFS. Following serotonin injection, which would normally initiate reproductive processes, we found up-regulation of FAMeT, ESULT and PGFS expression in the female CNS and ovary. Our data here provides an invaluable new resource for understanding the molecular role of the CNS on reproduction in S. olivacea.
Vitousek, Maren N; Rubenstein, Dustin R; Nelson, Karin N; Wikelski, Martin
2008-07-01
Polygynous lek-mating systems are characterized by high reproductive skew, with a small number of males gaining a disproportionate share of copulations. In lekking species, where female choice drives male mating success and patterns of reproductive skew, female preferences for 'good genes' should lead to preferred males having high reproductive success in all years. Here we investigate whether these 'hotshot' males have steroid hormone patterns that are consistent over time (between two mating seasons), and whether hormone levels consistently predict display behavior. We test these questions in the Galápagos marine iguana (Amblyrhynchus cristatus), a lekking vertebrate with high male reproductive skew. We found that male mating success and testosterone levels were not consistent across years. The most successful males showed an inverse relationship in copulation success between years. Similarly, territorial males that had high testosterone in one year had low levels in the next. Across years, testosterone was strongly associated with head-bob display, suggesting that this steroid plays a key role in mate attraction. These results suggest that female marine iguanas are not choosing the same 'hotshot' males in every year, but instead base their reproductive decisions on male behavioral traits that are hormonally mediated and variable across years. By using testosterone to regulate their costly display behaviors male marine iguanas appear to have a mechanism that allows them to adjust their reproductive effort depending on extrinsic and/or intrinsic factors.
Bisphenol A in Reproduction: Epigenetic Effects.
Chianese, Rosanna; Troisi, Jacopo; Richards, Sean; Scafuro, Marika; Fasano, Silvia; Guida, Maurizio; Pierantoni, Riccardo; Meccariello, Rosaria
2018-02-21
Bisphenol A (BPA) is an endocrine disrupting chemical widely used in the manufacture of polycarbonate plastic and epoxy resin to produce a multitude of consumer products, food and drink containers, and medical devices. BPA is similar to estradiol in structure and thus interferes in steroid signalling with different outcomes on reproductive health depending on doses, life stage, mode, and timing of exposure. In this respect, it has an emerging and controversial role as a "reproductive toxicant" capable of inducing short and long-term effects including the modulation of gene expression through epigenetic modification (i.e. methylation of CpG islands, histone modifications and production of non-coding RNA) with direct and trans-generational effects on exposed organisms and their offspring, respectively. This review provides an overview about BPA effects on reproductive health and aims to summarize the epigenetic effects of BPA in male and female reproduction. BPA exerts epigenetic effects in both male and female reproduction. In males, BPA affects spermatogenesis and sperm quality and possible trans-generational effects on the reproductive ability of the offspring. In females, BPA affects ovary, embryo development, and gamete quality for successful in vivo and in vitro fertilization (IVF). The exact mechanisms of BPA-mediated effects in reproduction are not fully understood; however, the environmental exposure to BPA - especially in fetal and neonatal period - deserves attention to preserve the reproductive ability in both sexes and to reduce the epigenetic risk for the offspring. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Mammalian target of rapamycin (mTOR): a central regulator of male fertility?
Jesus, Tito T; Oliveira, Pedro F; Sousa, Mário; Cheng, C Yan; Alves, Marco G
2017-06-01
Mammalian target of rapamycin (mTOR) is a central regulator of cellular metabolic phenotype and is involved in virtually all aspects of cellular function. It integrates not only nutrient and energy-sensing pathways but also actin cytoskeleton organization, in response to environmental cues including growth factors and cellular energy levels. These events are pivotal for spermatogenesis and determine the reproductive potential of males. Yet, the molecular mechanisms by which mTOR signaling acts in male reproductive system remain a matter of debate. Here, we review the current knowledge on physiological and molecular events mediated by mTOR in testis and testicular cells. In recent years, mTOR inhibition has been explored as a prime strategy to develop novel therapeutic approaches to treat cancer, cardiovascular disease, autoimmunity, and metabolic disorders. However, the physiological consequences of mTOR dysregulation and inhibition to male reproductive potential are still not fully understood. Compelling evidence suggests that mTOR is an arising regulator of male fertility and better understanding of this atypical protein kinase coordinated action in testis will provide insightful information concerning its biological significance in other tissues/organs. We also discuss why a new generation of mTOR inhibitors aiming to be used in clinical practice may also need to include an integrative view on the effects in male reproductive system.
Bligh, Mark W; Maheshwari, Pradeep; David Waite, T
2017-11-01
Iron salts are routinely dosed in wastewater treatment as a means of achieving effluent phosphorous concentration goals. The iron oxides that result from addition of iron salts partake in various reactions, including reductive dissolution and phosphate adsorption. The reactivity of these oxides is controlled by the conditions of formation and the processes, such as aggregation, that lead to a reduction in accessible surface sites following formation. The presence of organic compounds is expected to significantly impact these processes in a number of ways. In this study, amorphous ferric oxide (AFO) reactivity and aging was investigated following the addition of ferric iron (Fe(III)) to three solution systems: two synthetic buffered systems, either containing no organic or containing alginate, and a supernatant system containing soluble microbial products (SMPs) sourced from a membrane bioreactor (MBR). Reactivity of the Fe(III) phases in these systems at various times (1-60 min) following Fe(III) addition was quantified by determining the rate constants for ascorbate-mediated reductive dissolution over short (5 min) and long (60 min) dissolution periods and for a range (0.5-10 mM) of ascorbate concentrations. AFO particle size was monitored using dynamic light scattering during the aging and dissolution periods. In the presence of alginate, AFO particles appeared to be stabilized against aggregation. However, aging in the alginate system was remarkably similar to the inorganic system where aging is associated with aggregation. An aging mechanism involving restructuring within the alginate-AFO assemblage was proposed. In the presence of SMPs, a greater diversity of Fe(III) phases was evident with both a small labile pool of organically complexed Fe(III) and a polydisperse population of stabilized AFO particles present. The prevalence of low molecular weight organic molecules facilitated stabilization of the Fe(III) oxyhydroxides formed but subsequent aging
Women Reproductive Rights in India: Prospective Future
Directory of Open Access Journals (Sweden)
Srinivas Kosgi
2011-04-01
Full Text Available Reproductive rights were established as a subset of the human rights. Parents have a basic human right to determine freely and responsibly the number and the spacing of their children. Issues regarding the reproductive rights are vigorously contested, regardless of the population’s socioeconomic level, religion or culture. Following review article discusses reproductive rights with respect to Indian context focusing on socio economic and cultural aspects. Also discusses sensitization of government and judicial agencies in protecting the reproductive rights with special focus on the protecting the reproductive rights of people with disability (mental illness and mental retardation.
Bayefsky, Michelle J
2016-12-01
Unlike many European nations, the USA has no regulations concerning the use of preimplantation genetic diagnosis (PGD), a technique employed during some fertility treatments to select embryos based on their genes. As such, PGD can and is used for a variety of controversial purposes, including sex selection, selection for children with disabilities such as deafness, and selection for 'saviour siblings' who can serve as tissue donors for sick relatives. The lack of regulation, which is due to particular features of the US political and economic landscape, has ethical and practical implications for patients seeking PGD around the world. This paper contrasts the absence of PGD oversight in the USA with existing PGD policies in Switzerland, Italy, France and the UK. The primary reasons why PGD is not regulated in the USA are addressed, with consideration of factors such as funding for assisted reproductive technology treatmemt and the proximity of PGD to the contentious abortion debate. The obstacles that would need to be overcome in the USA for PGD to be regulated in the future are outlined. Then, the significance of the current divergence in PGD policy for patients around the world are discussed. Regulatory differences create opportunities for reproductive tourism, which result in legal, health and moral challenges. The paper concludes with comments on the need for policymakers around the world to balance respect for the characters and constitutions of their individual countries with appreciation of the needs of infertile patients across the globe.
Stern, Judy E; McLain, Alexander C; Buck Louis, Germaine M; Luke, Barbara; Yeung, Edwina H
2016-08-01
It is unknown whether data obtained from maternal self-report for assisted reproductive technology treatment parameters and reproductive history are accurate for use in research studies. We evaluated the accuracy of self-reported in assisted reproductive technology treatment and reproductive history from the Upstate KIDS study in comparison with clinical data reported to the Society for Assisted Reproductive Technology Clinic Outcome Reporting System. Upstate KIDS maternal questionnaire data from deliveries between 2008 and 2010 were linked to data reported to Society for Assisted Reproductive Technology Clinic Outcome Reporting System. The 617 index deliveries were compared as to treatment type (frozen embryo transfer and donor egg or sperm) and use of intracytoplasmic sperm injection and assisted hatching. Use of injectable medications, self-report for assisted reproductive technology, or frozen embryo transfer prior to the index deliveries were also compared. We report agreement in which both sources had yes or both no and sensitivity of maternal report using Society for Assisted Reproductive Technology Clinic Outcome Reporting System as the gold standard. Significance was determined using χ(2) at P < 0.05. Universal agreement was not reached on any parameter but was best for treatment type of frozen embryo transfer (agreement, 96%; sensitivity, 93%) and use of donor eggs (agreement, 97%; sensitivity, 82%) or sperm (agreement, 98%; sensitivity, 82%). Use of intracytoplasmic sperm injection (agreement, 78%: sensitivity, 78%) and assisted hatching (agreement, 57%; sensitivity, 38%) agreed less well with self-reported use (P < .0001). In vitro fertilization (agreement, 82%) and frozen embryo transfer (agreement, 90%) prior to the index delivery were more consistently reported than was use of injectable medication (agreement, 76%) (P < .0001). Women accurately report in vitro fertilization treatment but are less accurate about procedures handled in the
Pregnancy outcomes after assisted human reproduction.
Okun, Nanette; Sierra, Sony
2014-01-01
independent risk factor for obstetrical complications and adverse perinatal outcomes, even without the addition of assisted human reproduction. (II-2) 2. The relative risk for an imprinting phenotype such as Silver-Russell syndrome, Beckwith-Wiedemann syndrome, or Angelman syndrome is increased in the assisted reproduction population, but the actual risk for one of these phenotypes to occur in an assisted pregnancy is estimated to be low, at less than 1 in 5000. The exact biological etiology for this increased imprinting risk is likely heterogeneous and requires more research. (II-2) Recommendations 1. All men with severe oligozoospermia or azoospermia (sperm count assisted human reproductive treatments. (II-2A) 4. The benefits and cumulative pregnancy rates of elective single embryo transfer support a policy of using this protocol in couples with good prognosis for success, and elective single embryo transfer should be strongly encouraged in this population. (II-2A) 5. To reduce the incidence of multiple pregnancy, health care policies that support public funding for assisted human reproduction, with regulations promoting best practice regarding elective single embryo transfer, should be strongly encouraged. (II-2A) 6. Among singleton pregnancies, assisted reproductive technology is associated with increased risks of preterm birth and low birth weight infants, and ovulation induction is associated with an increased risk of low birth weight infants. Until sufficient research has clarified the independent roles of infertility and treatment for infertility, couples should be counselled about the risks associated with treatment. (II-2B) There is a role for closer obstetric surveillance of women who conceive with assisted human reproduction. (III-L) 7. There is growing evidence that pregnancy outcomes are better for cryopreserved embryos fertilized in vitro than for fresh embryo transfers. This finding supports a policy of elective single embryo transfer for women with a good
Diaz, Mireia; Lenoir, Alain; Ivon Paris, Carolina; Boulay, Raphaël; Gómez, Crisanto
2018-01-01
In insect societies, chemical communication plays an important role in colony reproduction and individual social status. Many studies have indicated that cuticular hydrocarbons (CHCs) are the main chemical compounds encoding reproductive status. However, these studies have largely focused on queenless or monogynous species whose workers are capable of egg laying and have mainly explored the mechanisms underlying queen-worker or worker-worker reproductive conflicts. Less is known about what occurs in highly polygynous ant species with permanently sterile workers. Here, we used the Argentine ant as a model to examine the role of CHCs in communicating reproductive information in such insect societies. The Argentine ant is unicolonial, highly polygynous, and polydomous. We identified several CHCs whose presence and levels were correlated with queen age, reproductive status, and fertility. Our results also provide new insights into queen executions in the Argentine ant, a distinctive feature displayed by this species in its introduced range. Each spring, just before new sexuals appear, workers eliminate up to 90% of the mated queens in their colonies. We discovered that queens that survived execution had different CHC profiles from queens present before and during execution. More specifically, levels of some CHCs were higher in the survivors, suggesting that workers could eliminate queens based on their chemical profiles. In addition, queen CHC profiles differed based on season and species range (native vs. introduced). Overall, the results of this study provide new evidence that CHCs serve as queen signals and do more than just regulate worker reproduction. PMID:29470506
Matsuyama, Syuhei; Nagao, Takashi; Sasaki, Ken
2015-01-15
Dopamine (DA) and tyramine (TA) have neurohormonal roles in the production of reproductive workers in queenless colonies of honey bees, but the regulation of these biogenic amines in the brain are still largely unclear. Nutrition is an important factor in promoting reproduction and might be involved in the regulation of these biogenic amines in the brain. To test this hypothesis, we examined the effect of oral treatments of tyrosine (Tyr; a common precursor of DA, TA and octopamine, and a component of royal jelly) in queenless workers and quantified the resulting production of biogenic amines. Tyrosine treatments enhanced the levels of DA, TA and their metabolites in the brain. Workers fed royal jelly had significantly larger brain levels of Tyr, DA, TA and the metabolites in the brains compared with those bees fed honey or sucrose (control). Treatment with Tyr also inhibited the behavior of workers outside of the hive and promoted ovarian development. These results suggest that there is a link between nutrition and the regulation of DA and TA in the brain to promote the production of reproductive workers in queenless honey bee colonies. Copyright © 2014 Elsevier Inc. All rights reserved.
Neethling, Lourelle Alicia Martins; Avenant-Oldewage, Annemariè
2015-02-01
The morphology of the male reproductive system as well as sperm transfer in Branchiura has been described for Dolops ranarum and Argulus japonicus. In this study, the reproductive system and accessory structures are described for male Chonopeltis australis using histology, light microscopy, and scanning electron microscopy. For the first time, we describe sperm transfer by means of a spermatophore in this genus. The internal and external morphology and mechanism of sperm transfer is compared with other Branchiura, where it has been described. The morphology of the reproductive system of C. australis is similar to that of D. ranarum while the accessory structures and the spermatophore produced are similar to that of A. japonicus. A revision of the definition of Branchiura with respect to reproduction is provided. © 2014 Wiley Periodicals, Inc.
Werner, Jan; Griebeler, Eva Maria
2011-01-01
Janis and Carrano (1992) suggested that large dinosaurs might have faced a lower risk of extinction under ecological changes than similar-sized mammals because large dinosaurs had a higher potential reproductive output than similar-sized mammals (JC hypothesis). First, we tested the assumption underlying the JC hypothesis. We therefore analysed the potential reproductive output (reflected in clutch/litter size and annual offspring number) of extant terrestrial mammals and birds (as "dinosaur analogs") and of extinct dinosaurs. With the exception of rodents, the differences in the reproductive output of similar-sized birds and mammals proposed by Janis and Carrano (1992) existed even at the level of single orders. Fossil dinosaur clutches were larger than litters of similar-sized mammals, and dinosaur clutch sizes were comparable to those of similar-sized birds. Because the extinction risk of extant species often correlates with a low reproductive output, the latter difference suggests a lower risk of population extinction in dinosaurs than in mammals. Second, we present a very simple, mathematical model that demonstrates the advantage of a high reproductive output underlying the JC hypothesis. It predicts that a species with a high reproductive output that usually faces very high juvenile mortalities will benefit more strongly in terms of population size from reduced juvenile mortalities (e.g., resulting from a stochastic reduction in population size) than a species with a low reproductive output that usually comprises low juvenile mortalities. Based on our results, we suggest that reproductive strategy could have contributed to the evolution of the exceptional gigantism seen in dinosaurs that does not exist in extant terrestrial mammals. Large dinosaurs, e.g., the sauropods, may have easily sustained populations of very large-bodied species over evolutionary time.
Werner, Jan; Griebeler, Eva Maria
2011-01-01
Janis and Carrano (1992) suggested that large dinosaurs might have faced a lower risk of extinction under ecological changes than similar-sized mammals because large dinosaurs had a higher potential reproductive output than similar-sized mammals (JC hypothesis). First, we tested the assumption underlying the JC hypothesis. We therefore analysed the potential reproductive output (reflected in clutch/litter size and annual offspring number) of extant terrestrial mammals and birds (as “dinosaur analogs”) and of extinct dinosaurs. With the exception of rodents, the differences in the reproductive output of similar-sized birds and mammals proposed by Janis and Carrano (1992) existed even at the level of single orders. Fossil dinosaur clutches were larger than litters of similar-sized mammals, and dinosaur clutch sizes were comparable to those of similar-sized birds. Because the extinction risk of extant species often correlates with a low reproductive output, the latter difference suggests a lower risk of population extinction in dinosaurs than in mammals. Second, we present a very simple, mathematical model that demonstrates the advantage of a high reproductive output underlying the JC hypothesis. It predicts that a species with a high reproductive output that usually faces very high juvenile mortalities will benefit more strongly in terms of population size from reduced juvenile mortalities (e.g., resulting from a stochastic reduction in population size) than a species with a low reproductive output that usually comprises low juvenile mortalities. Based on our results, we suggest that reproductive strategy could have contributed to the evolution of the exceptional gigantism seen in dinosaurs that does not exist in extant terrestrial mammals. Large dinosaurs, e.g., the sauropods, may have easily sustained populations of very large-bodied species over evolutionary time. PMID:22194835
Directory of Open Access Journals (Sweden)
Jan Werner
Full Text Available Janis and Carrano (1992 suggested that large dinosaurs might have faced a lower risk of extinction under ecological changes than similar-sized mammals because large dinosaurs had a higher potential reproductive output than similar-sized mammals (JC hypothesis. First, we tested the assumption underlying the JC hypothesis. We therefore analysed the potential reproductive output (reflected in clutch/litter size and annual offspring number of extant terrestrial mammals and birds (as "dinosaur analogs" and of extinct dinosaurs. With the exception of rodents, the differences in the reproductive output of similar-sized birds and mammals proposed by Janis and Carrano (1992 existed even at the level of single orders. Fossil dinosaur clutches were larger than litters of similar-sized mammals, and dinosaur clutch sizes were comparable to those of similar-sized birds. Because the extinction risk of extant species often correlates with a low reproductive output, the latter difference suggests a lower risk of population extinction in dinosaurs than in mammals. Second, we present a very simple, mathematical model that demonstrates the advantage of a high reproductive output underlying the JC hypothesis. It predicts that a species with a high reproductive output that usually faces very high juvenile mortalities will benefit more strongly in terms of population size from reduced juvenile mortalities (e.g., resulting from a stochastic reduction in population size than a species with a low reproductive output that usually comprises low juvenile mortalities. Based on our results, we suggest that reproductive strategy could have contributed to the evolution of the exceptional gigantism seen in dinosaurs that does not exist in extant terrestrial mammals. Large dinosaurs, e.g., the sauropods, may have easily sustained populations of very large-bodied species over evolutionary time.
Mourocq, Emeline; Bize, Pierre; Bouwhuis, Sandra; Bradley, Russell; Charmantier, Anne; de la Cruz, Carlos; Drobniak, Szymon M; Espie, Richard H M; Herényi, Márton; Hötker, Hermann; Krüger, Oliver; Marzluff, John; Møller, Anders P; Nakagawa, Shinichi; Phillips, Richard A; Radford, Andrew N; Roulin, Alexandre; Török, János; Valencia, Juliana; van de Pol, Martijn; Warkentin, Ian G; Winney, Isabel S; Wood, Andrew G; Griesser, Michael
2016-02-01
Fitness can be profoundly influenced by the age at first reproduction (AFR), but to date the AFR-fitness relationship only has been investigated intraspecifically. Here, we investigated the relationship between AFR and average lifetime reproductive success (LRS) across 34 bird species. We assessed differences in the deviation of the Optimal AFR (i.e., the species-specific AFR associated with the highest LRS) from the age at sexual maturity, considering potential effects of life history as well as social and ecological factors. Most individuals adopted the species-specific Optimal AFR and both the mean and Optimal AFR of species correlated positively with life span. Interspecific deviations of the Optimal AFR were associated with indices reflecting a change in LRS or survival as a function of AFR: a delayed AFR was beneficial in species where early AFR was associated with a decrease in subsequent survival or reproductive output. Overall, our results suggest that a delayed onset of reproduction beyond maturity is an optimal strategy explained by a long life span and costs of early reproduction. By providing the first empirical confirmations of key predictions of life-history theory across species, this study contributes to a better understanding of life-history evolution. © 2016 The Author(s). Evolution © 2016 The Society for the Study of Evolution.
Physiological Roles for mafr-1 in Reproduction and Lipid Homeostasis
Directory of Open Access Journals (Sweden)
Akshat Khanna
2014-12-01
Full Text Available Maf1 is a conserved repressor of RNA polymerase (Pol III transcription; however, its physiological role in the context of a multicellular organism is not well understood. Here, we show that C. elegans MAFR-1 is functionally orthologous to human Maf1, represses the expression of both RNA Pol III and Pol II transcripts, and mediates organismal fecundity and lipid homeostasis. MAFR-1 impacts lipid transport by modulating intestinal expression of the vitellogenin family of proteins, resulting in cell-nonautonomous defects in the developing reproductive system. MAFR-1 levels inversely correlate with stored intestinal lipids, in part by influencing the expression of the lipogenesis enzymes fasn-1/FASN and pod-2/ACC1. Animals fed a high carbohydrate diet exhibit reduced mafr-1 expression and mutations in the insulin signaling pathway genes daf-18/PTEN and daf-16/FoxO abrogate the lipid storage defects associated with deregulated mafr-1 expression. Our results reveal physiological roles for mafr-1 in regulating organismal lipid homeostasis, which ensure reproductive success.
CLP Regulation and the transport of dangerous goods
Directory of Open Access Journals (Sweden)
Sergio Benassai
2011-01-01
Full Text Available Regulations concerning different modes of transport of dangerous goods are well harmonized at global level: they were then looked at as a model for developing Globally Harmonized System of Classification and Labelling of Chemicals (GHS, (on which CLP Regulations is based. Transport regulations do not cover some hazard classes, such as germ cell mutagenicity, carcinogenicity, reproductive toxicity, having been evaluated that such hazards are not relevant in transport because in general, in case of accident, no repeated and prolonged exposure takes place. Other differences with CLP Regulation are related to the use of "building block approach". Transport labels, which were used as a basis for GHS, can be used, instead of CLP pictograms, on packages during transport.
Grandparental effects on reproductive strategizing
Directory of Open Access Journals (Sweden)
2004-09-01
Full Text Available This paper analyzes data from the household registers for two villages in the Nôbi region of central Japan in the late Edo period (1717-1869 to assess how grandparents may have affected reproductive strategizing in stem families. The particulars of the family system fostered a culturally favored set of reproductive goals, in particular, a daughter as eldest child, followed by a son (and heir, coupled with gender alternation in subsequent reproduction and overall gender balance. This reproductive strategy was generally followed during the stem phase of the domestic cycle, when one or both grandparents were present, especially when the family head was in the senior generation. By contrast, a son-first strategy was favored when childbearing began in the conjugal phase of the cycle. This suggests grandparental influence on the junior couple's reproductive decisions in favor of the cultural ideal. I find that the senior couple's decision to marry the heir early or late strongly affects the reproductive strategies followed by him after marriage. I show that when a grandmother is present at the onset of childbearing, especially if she is relatively young, the junior couple ends up with more offspring on average. A controlled analysis of infanticiding behavior is interpreted in terms of conjugal power and coalition formation. It appears that a grandmother gets her way only when she and her son gang up on the daughter-in-law, but such a coalition is likely only when her son dominates the conjugal relationship (which in turn reflects the grandmother's success in binding the son tightly to her emotionally and in delaying his marriage. Otherwise, the grandmother may be shut out from reproductive decision-making by the solidary conjugal coalition.
Slabbert, A.M.
2018-01-01
Many sexual and reproductive health inequities are rooted in gender inequality that place women in South Africa, especially adolescent girls and sex workers, at increased risk of adverse outcomes. Gender inequality causes multiple layers of stigma, discrimination, and marginalisation, including misuse of criminal law, gender-based and sexual violence, and denial of sexual and reproductive health rights, which continue to create barriers to realising these rights. This thesis adopts a social a...
Directory of Open Access Journals (Sweden)
Mascha Stroobant
2014-10-01
Full Text Available Objective: To record the reproductive pattern of a natural population of Pterocladiella capillacea from G áldar (Canary Islands, Spain from February to August in relation to temperature, irradiance and photoperiod environmental conditions. Methods: Field observation of reproductive thalli was used at different seasons in the year. Results: Tetrasporophytes and vegetative thalli were observed during all the period of study, while female gametophytes bearing cystocarps have been found from May to August in correspondence with the highest water temperature and irradiance values. Conclusions: Our data suggest that the temperature may be the determining factor which regulates the presence of tetrasporophytes in the field. The constant presence of tetrasporophytes could depend on the low excursion range of water temperature (4-5 °C throughout the period of study, with the highest abundance in February at 20 °C.
Religious aspects of assisted reproduction
Sallam, H N; Sallam, N H
2016-03-28
Human response to new developments regarding birth, death, marriage and divorce is largely shaped by religious beliefs. When assisted reproduction was introduced into medical practice in the last quarter of the twentieth century, it was fiercely attacked by some religious groups and highly welcomed by others. Today, assisted reproduction is accepted in nearly all its forms by Judaism, Hinduism and Buddhism, although most Orthodox Jews refuse third party involvement. On the contrary assisted reproduction is totally unacceptable to Roman Catholicism, while Protestants, Anglicans, Coptic Christians and Sunni Muslims accept most of its forms, which do not involve gamete or embryo donation. Orthodox Christians are less strict than Catholic Christians but still refuse third party involvement. Interestingly, in contrast to Sunni Islam, Shi'a Islam accepts gamete donation and has made provisions to institutionalize it. Chinese culture is strongly influenced by Confucianism, which accepts all forms of assisted reproduction that do not involve third parties. Other communities follow the law of the land, which is usually dictated by the religious group(s) that make(s) the majority of that specific community. The debate will certainly continue as long as new developments arise in the ever-evolving field of assisted reproduction.
[Effect of External Irradiation and Immobilization Stress on the Reproductive System of Male Rats].
Vereschako, G G; Tshueshova, N V; Gorokh, G A; Kozlov, I G; Naumov, A D
2016-01-01
We studied the state of the reproductive system of male rats after irradiation at a dose of 2.0 Gy, immobilization stress (6 hours/day for 7 days) and their combined effects. On the 30th day after the combined treatment (37 days after irradiation) a decrease in the testicular weight by almost 50% compared with the control and lesions connected with the process of spermatogenesis are observed. In the remote period--on the 60th day (67th after irradiation) the effect of irradiation and irradiation in combination with immobilization stress leads to a sharp drop in the number of epididymal sperm (up to 18% of the control), and a reduction of their viability. The reaction ofthe reproductive system to the immobilization stress is expressed in a certain increase in the mass of the testes and epididymis, moderate imbalances in the composition of spermatogenic cells in the testis tissue, and in the long term--in the increased number of epididymal sperm and the decrease in their viability. Changes of testosterone in the blood serum, especially significant for the combined effect, reflect impairments of the regulation of the reproductive system of males under these conditions. With regard to individual indicators of the reproductive system of male rats in some cases, the- combined effects of radiation and stress had a synergistic, or, on the contrary, antagonistic character.
Seminal Fluid-Mediated Inflammation in Physiology and Pathology of the Female Reproductive Tract
Directory of Open Access Journals (Sweden)
Anthonio O. Adefuye
2016-01-01
Full Text Available Inflammation is a multifaceted process involving a host of resident and recruited immune cells that eliminate the insult or injury and initiate tissue repair. In the female reproductive tract (FMRT, inflammation-mediated alterations in epithelial, vascular, and immune functions are important components of complex physiological processes and many local and systemic pathologies. It is well established that intracoital and postcoital function of seminal fluid (SF goes beyond nutritive support for the spermatozoa cells. SF, in particular, the inflammatory bioactive lipids, and prostaglandins present in vast quantities in SF, have a role in localized immune modulation and regulation of pathways that can exacerbate inflammation in the FMRT. In sexually active women SF-mediated inflammation has been implicated in physiologic processes such as ovulation, implantation, and parturition while also enhancing tumorigenesis and susceptibility to infection. This review highlights the molecular mechanism by which SF regulates inflammatory pathways in the FMRT and how alterations in these pathways contribute to physiology and pathology of the female reproductive function. In addition, based on findings from TaqMan® 96-Well Plate Arrays, on neoplastic cervical cells treated with SF, we discuss new findings on the role of SF as a potent driver of inflammatory and tumorigenic pathways in the cervix.
Liu, Zong-Yu; Jiang, Yi-Ping; Li, Lei; You, Lin-Lin; Wu, You; Xu, Bin; Ge, Lin-Quan; Wu, Jin-Cai
2016-03-01
The brown plant hopper (BPH), Nilaparvata lugens Stål (Hemiptera: Delphacidae), is a major pest affecting rice in Asia, and outbreaks of this pest are closely linked to pesticide-induced stimulation of reproduction. Therefore, the BPH is a classic example of a resurgent pest. However, the effects of different genes on the regulation of pesticide-induced reproductive stimulation in the BPH are unclear. In this study, the regulatory effects of acyl-coenzyme A oxidase (ACO) on the reproduction and biochemistry of the BPH were investigated with gene silencing. The number of eggs laid per female by triazophos (TZP)+dsACO BPH females was significantly lower than those of TZP-treated (without ACO silencing) or TZP+GFP females (negative control), with the number of eggs decreasing by 30.8% (from 529.5 to 366.3) and 32.0% (from 540.5 to 366.3), respectively. The preoviposition period, oviposition period, and longevity of the TZP-treated females were also influenced by dsACO treatment. Additionally, the amounts of crude fat, protein, and some fatty acids (oleic acid, palmitic acid, linoleic acid, stearic acid, and myristoleic acid) in TZP+dsACO females were significantly lower than in TZP-treated females. Thus, ACO is one of the key genes regulating the TZP-induced stimulation of reproduction in BPH females. Copyright © 2015 Elsevier Inc. All rights reserved.
Male Reproductive System (For Teens)
... Affecting the Male Reproductive System Print en español Sistema reproductor masculino All living things reproduce. Reproduction — the ... of Use Notice of Nondiscrimination Visit the Nemours Web site. Note: All information on TeensHealth® is for ...
Reproduction in the space environment: Part II. Concerns for human reproduction
Jennings, R. T.; Santy, P. A.
1990-01-01
Long-duration space flight and eventual colonization of our solar system will require successful control of reproductive function and a thorough understanding of factors unique to space flight and their impact on gynecologic and obstetric parameters. Part II of this paper examines the specific environmental factors associated with space flight and the implications for human reproduction. Space environmental hazards discussed include radiation, alteration in atmospheric pressure and breathing gas partial pressures, prolonged toxicological exposure, and microgravity. The effects of countermeasures necessary to reduce cardiovascular deconditioning, calcium loss, muscle wasting, and neurovestibular problems are also considered. In addition, the impact of microgravity on male fertility and gamete quality is explored. Due to current constraints, human pregnancy is now contraindicated for space flight. However, a program to explore effective countermeasures to current constraints and develop the required health care delivery capability for extended-duration space flight is suggested. A program of Earth- and space-based research to provide further answers to reproductive questions is suggested.
21 CFR 884.6200 - Assisted reproduction laser system.
2010-04-01
... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Assisted reproduction laser system. 884.6200... (CONTINUED) MEDICAL DEVICES OBSTETRICAL AND GYNECOLOGICAL DEVICES Assisted Reproduction Devices § 884.6200 Assisted reproduction laser system. (a) Identification. The assisted reproduction laser system is a device...
Qin, Geng; Johnson, Cara; Zhang, Yuan; Zhang, Huixian; Yin, Jianping; Miller, Glen; Turingan, Ralph G; Guisbert, Eric; Lin, Qiang
2018-05-15
Inshore-offshore migration occurs frequently in seahorse species either because of prey opportunities or because it is driven by reproduction, and variations in water temperature may dramatically change migratory seahorse behavior and physiology. The present study investigated the behavioral and physiological responses of the lined seahorse Hippocampus erectus under thermal stress and evaluated the potential effects of different temperatures on its reproduction. The results showed that the thermal tolerance of the seahorses was time dependent. Acute thermal stress (30°C, 2-10 hours) increased the basal metabolic rate (breathing rate) and the expression of stress response genes ( Hsp genes) significantly and further stimulated seahorse appetite. Chronic thermal treatment (30°C, 4 weeks) led to a persistently higher basal metabolic rate, higher stress response gene expression, and higher mortality, indicating that the seahorses could not acclimate to chronic thermal stress and might experience massive mortality due to excessive basal metabolic rates and stress damage. Additionally, no significant negative effects on gonad development or reproductive endocrine regulation genes were observed in response to chronic thermal stress, suggesting that seahorse reproductive behavior could adapt to higher-temperature conditions during migration and within seahorse breeding grounds. In conclusion, this simulation experiment indicated that temperature variations during inshore-offshore migration have no effect on reproduction but promote basal metabolic rates and stress responses significantly. Therefore, we suggest that the high observed tolerance of seahorse reproduction was in line with the inshore-offshore reproductive migration pattern of lined seahorse. © 2018. Published by The Company of Biologists Ltd.
Nanotechnology in reproductive medicine: emerging applications of nanomaterials.
Barkalina, Natalia; Charalambous, Charis; Jones, Celine; Coward, Kevin
2014-07-01
In the last decade, nanotechnology has been extensively introduced for biomedical applications, including bio-detection, drug delivery and diagnostic imaging, particularly in the field of cancer diagnostics and treatment. However, there is a growing trend towards the expansion of nanobiotechnological tools in a number of non-cancer applications. In this review, we discuss the emerging uses of nanotechnology in reproductive medicine and reproductive biology. For the first time, we summarise the available evidence regarding the use of nanomaterials as experimental tools for the detection and treatment of malignant and benign reproductive conditions. We also present an overview of potential applications for nanomaterials in reproductive biology, discuss the benefits and concerns associated with their use in a highly delicate system of reproductive tissues and gametes, and address the feasibility of this innovative and potentially controversial approach in the clinical setting and for investigative research into the mechanisms underlying reproductive diseases. This unique review paper focuses on the emerging use of nanotechnology in reproductive medicine and reproductive biology, highlighting the role of nanomaterials in the detection and treatment of various reproductive conditions, keeping in mind the benefits and potential concerns associated with nanomaterial use in the delicate system of reproductive tissue and gametes. Copyright © 2014 Elsevier Inc. All rights reserved.
Ovarian Stem Cell Nests in Reproduction and Ovarian Aging.
Ye, Haifeng; Zheng, Tuochen; Li, Wei; Li, Xiaoyan; Fu, Xinxin; Huang, Yaoqi; Hu, Chuan; Li, Jia; Huang, Jian; Liu, Zhengyv; Zheng, Liping; Zheng, Yuehui
2017-01-01
The fixed primordial follicles pool theory, which monopolized reproductive medicine for more than one hundred years, has been broken by the discovery, successful isolation and establishment of ovarian stem cells. It has brought more hope than ever of increasing the size of primordial follicle pool, improving ovarian function and delaying ovarian consenescence. Traditional view holds that stem cell aging contributes to the senility of body and organs. However, in the process of ovarian aging, the main factor leading to the decline of the reproductive function is the aging and degradation of ovarian stem cell nests, rather than the senescence of ovarian germ cells themselves. Recent studies have found that the immune system and circulatory system are involved in the formation of ovarian germline stem cell niches, as well as regulating the proliferation and differentiation of ovarian germline stem cells through cellular and hormonal signals. Therefore, we can improve ovarian function and delay ovarian aging by improving the immune system and circulatory system, which will provide an updated program for the treatment of premature ovarian failure (POF) and infertility. © 2017 The Author(s). Published by S. Karger AG, Basel.
Social influences and reproductive health of adolescents
Stanković Biljana
2007-01-01
Reproductive health represents a state of complete physical, mental and social prosperity, and not just the absence of illness or weakness, and it refers to reproductive processes, functions and systems. Adolescents, young people from the age of ten to nineteen, are yet to achieve their reproductive function, thus their reproductive health and behavior are very significant both from the individual and social standpoint. Risky behavior, which represents the main cause of diseases that young pe...
de Moura, Stéfanie Menezes; Artico, Sinara; Lima, Cássio; Nardeli, Sarah Muniz; Berbel, Ana; Oliveira-Neto, Osmundo Brilhante; Grossi-de-Sá, Maria Fátima; Ferrándiz, Cristina; Madueño, Francisco; Alves-Ferreira, Márcio
2017-03-01
Expression analysis of the AG -subfamily members from G. hirsutum during flower and fruit development. Reproductive development in cotton, including the fruit and fiber formation, is a complex process; it involves the coordinated action of gene expression regulators, and it is highly influenced by plant hormones. Several studies have reported the identification and expression of the transcription factor family MADS-box members in cotton ovules and fibers; however, their roles are still elusive during the reproductive development in cotton. In this study, we evaluated the expression profiles of five MADS-box genes (GhMADS3, GhMADS4, GhMADS5, GhMADS6 and GhMADS7) belonging to the AGAMOUS-subfamily in Gossypium hirsutum. Phylogenetic and protein sequence analyses were performed using diploid (G. arboreum, G. raimondii) and tetraploid (G. barbadense, G. hirsutum) cotton genomes, as well as the AG-subfamily members from Arabidopsis thaliana, Petunia hybrida and Antirrhinum majus. qPCR analysis showed that the AG-subfamily genes had high expression during flower and fruit development in G. hirsutum. In situ hybridization analysis also substantiates the involvement of AG-subfamily members on reproductive tissues of G. hirsutum, including ovule and ovary. The effect of plant hormones on AG-subfamily genes expression was verified in cotton fruits treated with gibberellin, auxin and brassinosteroid. All the genes were significantly regulated in response to auxin, whereas only GhMADS3, GhMADS4 and GhMADS7 genes were also regulated by brassinosteroid treatment. In addition, we have investigated the GhMADS3 and GhMADS4 overexpression effects in Arabidopsis plants. Interestingly, the transgenic plants from both cotton AG-like genes in Arabidopsis significantly altered the fruit size compared to the control plants. This alteration suggests that cotton AG-like genes might act regulating fruit formation. Our results demonstrate that members of the AG-subfamily in G. hirsutum
Tillitt, Donald E.; Buxton, Herbert T.
2011-01-01
Agricultural contaminants of emerging concern (CECs) are generally thought of as certain classes of chemicals associated with animal feeding and production facilities. Veterinary pharmaceuticals used in animal food production systems represent one of the largest groups of CECs. In our review, we discuss the extensive increase in use of antibiotics in animal feeding operations (AFOs) around the world. AFOs are a major consumer of antibiotics and other veterinary pharmaceuticals and over the past decade there has been growing information on the occurrence, release, and fate of CECs from animal food production operations, including the application of pharmaceutical-containing manure to agricultural fields and releases from waste lagoons. Concentrations of CECs in surface and ground water in proximity to AFOs correspond to their presence in the AFO wastes. In many cases, the environmental concentrations of agriculturally-derived CECs are below toxicity thresholds. Hormones and hormone replacement compounds are a notable exception, where chemical concentrations near AFOs can exceed concentrations known to cause adverse effects on endocrine-related functions in fish. In addition, some agricultural pesticides, once thought to be safe to non-target organisms, have demonstrated endocrine-related effects that may pose threats to fish populations in agricultural regions. That is, we have pesticides with emerging concerns, thus, the concern is emerging and not necessarily the chemical. In this light, one must consider certain agricultural pesticides to be included in the list of CECs. Even though agricultural pesticides are routinely evaluated in regulatory testing schemes which have been used for decades, the potential hazards of some pesticides have only recently been emerging. Emerging concerns of pesticides in fish include interference with hormone signaling pathways; additive (or more than additive) effects from pesticide mixtures; and adverse population-level effects at
Sexual behaviour, contraceptive practice and reproductive health ...
African Journals Online (AJOL)
Conclusion: The gaps in reproductive health knowledge, negative attitudes, high prevalence of risky sexual activity and poor reproductive health care seeking behaviour call for mounting of educational intervention programmes and development of youth-friendly reproductive health services on campus. KEY WORDS: ...
Porter, Danielle T; Roberts, David A; Maruska, Karen P
2017-10-01
Integration of reproduction and metabolism is necessary for species survival. While the neural circuits controlling energy homeostasis are well-characterized, the signals controlling the relay of nutritional information to the reproductive axis are less understood. The cichlid fish Astatotilapia burtoni is ideal for studying the neural regulation of feeding and reproduction because females cycle between a feeding gravid state and a period of forced starvation while they brood developing young inside their mouths. To test the hypothesis that candidate neuropeptide-containing neurons known to be involved in feeding and energy homeostasis in mammals show conserved distribution patterns, we performed immunohistochemistry and in situ hybridization to localize appetite-stimulating (neuropeptide Y, NPY; agouti-related protein, AGRP) and appetite-inhibiting (cocaine and amphetamine-regulated transcript, CART; pro-opiomelanocortin, pomc1a) neurons in the brain. NPY, AGRP, CART, and pomc1a somata showed distribution patterns similar to other teleosts, which included localization to the lateral tuberal nucleus (NLT), the putative homolog of the mammalian arcuate nucleus. Gravid females also had larger NPY and AGRP neurons in the NLT compared to brooding females, but brooding females had larger pomc1a neurons compared to gravid females. Hypothalamic agrp mRNA levels were also higher in gravid compared to brooding females. Thus, larger appetite-stimulating neurons (NPY, AGRP) likely promote feeding while females are gravid, while larger pomc1a neurons may act as a signal to inhibit food intake during mouth brooding. Collectively, our data suggest a potential role for NPY, AGRP, POMC, and CART in regulating energetic status in A. burtoni females during varying metabolic and reproductive demands. © 2017 Wiley Periodicals, Inc.
Reproductive Liberty and Overpopulation
Carol A. Kates
2004-01-01
Despite substantial evidence pointing to a looming Malthusian catastrophe, governmental measures to reduce population have been opposed both by religious conservatives and by many liberals, especially liberal feminists. Liberal critics have claimed that 'utilitarian' population policies violate a 'fundamental right of reproductive liberty'. This essay argues that reproductive liberty should not be considered a fundamental human right, or certainly not an indefeasible right. It should, instead...
Hanssen, S A; Hasselquist, Dennis; Folstad, I; Erikstad, K E
2005-01-01
Life-history theory predicts that increased current reproductive effort should lead to a fitness cost. This cost of reproduction may be observed as reduced survival or future reproduction, and may be caused by temporal suppression of immune function in stressed or hard-working individuals. In birds, consideration of the costs of incubating eggs has largely been neglected in favour of the costs of brood rearing. We manipulated incubation demand in two breeding seasons (2000 and 2001) in female...
Directory of Open Access Journals (Sweden)
Stefano Lorenzetti
2011-12-01
Full Text Available Reproductive toxicity, with its many targets and mechanisms, is a complex area of toxicology; thus, the screening and identification of reproductive toxicants is a main scientific challenge for the safety assessment of chemicals, including the European Regulation on Chemicals (REACH. Regulatory agencies recommend the implementation of the 3Rs principle (refinement, reduction, replacement as well as of intelligent testing strategies, through the development of in vitro methods and the use of mechanistic information in the hazard identification and characterization steps of the risk assessment process. The EU Integrated Project ReProTect (6th Framework Programme implemented an array of in vitro tests to study different building blocks of the mammalian reproductive cycle: methodological developments and results on male and female germ cells, prostate and placenta are presented.
Michailidis, Georgios
2010-06-01
In recent years host antimicrobial peptides and proteins have been recognised as key mediators of the innate immune response in many vertebrate species, providing the first line of defense against potential pathogens. In chickens a number of cationic antimicrobial peptides have been recently identified. However, although these peptides have been studied extensively in the avian gastrointestinal tract, little is known about their function in the chicken reproductive organs and embryos. Chicken Liver Expressed Antimicrobial Peptide-2 (cLEAP-2) has been previously reported to function in protecting birds against microbial attack. The aim of this study was to investigate the expression of cLEAP-2 gene in the chicken reproductive organs, as well as in chicken embryos during embryonic development, and to determine whether cLEAP-2 expression in the chicken reproductive organs was constitutive or induced as a response to Salmonella enteritidis infection. RNA was extracted from ovary, oviduct, testis and epididymis of sexually mature healthy and Salmonella infected birds, as well as from chicken embryos until day ten of embryonic development. Expression analysis data revealed that cLEAP-2 was expressed in the chicken ovary, testis and epididymis as well as in embryos during early embryonic development. Quantitative real-time PCR analysis revealed that cLEAP-2 expression was constitutive in the chicken epididymis, but was significantly up regulated in the chicken gonads, following Salmonella infection. In addition, expression of cLEAP-2 during chicken embryogenesis appeared to be developmentally regulated. These data provide evidence to suggest a key role of cLEAP-2 in the protection of the chicken reproductive organs and the developing embryos from Salmonella colonization.
Prolactin and Male Fertility: The Long and Short Feedback Regulation
Directory of Open Access Journals (Sweden)
M. K. Gill-Sharma
2009-01-01
Full Text Available In the last 20 years, a pituitary-hypothalamus tissue culture system with intact neural and portal connections has been developed in our lab and used to understand the feedback mechanisms that regulate the secretions of adenohypophyseal hormones and fertility of male rats. In the last decade, several in vivo rat models have also been developed in our lab with a view to substantiate the in vitro findings, in order to delineate the role of pituitary hormones in the regulation of fertility of male rats. These studies have relied on both surgical and pharmacological interventions to modulate the secretions of gonadotropins and testosterone. The interrelationship between the circadian release of reproductive hormones has also been ascertained in normal men. Our studies suggest that testosterone regulates the secretion of prolactin through a long feedback mechanism, which appears to have been conserved from rats to humans. These studies have filled in a major lacuna pertaining to the role of prolactin in male reproductive physiology by demonstrating the interdependence between testosterone and prolactin. Systemic levels of prolactin play a deterministic role in the mechanism of chromatin condensation during spermiogenesis.
10 CFR 1017.25 - Reproduction.
2010-01-01
... 10 Energy 4 2010-01-01 2010-01-01 false Reproduction. 1017.25 Section 1017.25 Energy DEPARTMENT OF ENERGY (GENERAL PROVISIONS) IDENTIFICATION AND PROTECTION OF UNCLASSIFIED CONTROLLED NUCLEAR INFORMATION Physical Protection Requirements § 1017.25 Reproduction. A document marked as containing UCNI may be...
International Nuclear Information System (INIS)
Dimitrov, M.; Georgiev, P.; Vasilev, K.
1988-01-01
The following applications of radioimmunoassay were studied: 1) for early diagnosis of pregnance in caws and sheep by determination of progesterone (PG) in milk and blood plasma via veterinary radioimmunological test STERON - RM 125 ; 2) for diagnosis and treatment of ovarian disturbances in cows by RIA of luteinizing hormone (LH), follicle stimulating hormone (FSH) and PG in blood plasma; 3) for control of the biological efficiency of sheep estrus synchronisation with MAP (vaginal tampons) and Estrophan (PgF 2 α); 4) for control of the reproductive condition of rams and effect of Tribestan in treatment of different forms of impotention by RIA of testosterone in blood. It was established that the use of RIA objectified the process of decision-making in regulation of the reproduction deviations in ruminating farm animals by veterinary means. Conclusions are drawn and suppositions are made for introduction of the radioisotope methods in the reproduction control of cattle and sheep breeding in practice. 4 tabs.; 15 refs
Reproductive prognosis in endometriosis
DEFF Research Database (Denmark)
Hjordt Hansen, Maj V; Dalsgaard, Torur; Hartwell, Dorthe
2014-01-01
OBJECTIVE: To assess the reproductive long-term prognosis of women with and without endometriosis, to explore changes over time, and to quantify the contribution of artificial reproductive techniques. DESIGN: Cohort study. SETTING: Denmark 1977-2009. SAMPLE: Data retrieved from four national...... registries. Among 15-49-year-old women during the period 1977-82, 24 667 were diagnosed with endometriosis and 98 668 (1:4) women without endometriosis were age-matched. METHODS: To assess long-term reproductive prognosis, all pregnancy outcomes were identified among the women with and without endometriosis...... until the end of 2009. To explore changes over time, the endometriosis cohorts were followed for 15 years from the years 1980, 1986, 1992 and 1998, with the corresponding control cohorts. All pregnancy outcomes were categorized into naturally or artificially conceived pregnancies. MAIN OUTCOME MEASURES...
Religious aspects of assisted reproduction
Sallam, HN; Sallam, NH
2016-01-01
Abstract Human response to new developments regarding birth, death, marriage and divorce is largely shaped by religious beliefs. When assisted reproduction was introduced into medical practice in the last quarter of the twentieth century, it was fiercely attacked by some religious groups and highly welcomed by others. Today, assisted reproduction is accepted in nearly all its forms by Judaism, Hinduism and Buddhism, although most Orthodox Jews refuse third party involvement. On the contrary assisted reproduction is totally unacceptable to Roman Catholicism, while Protestants, Anglicans, Coptic Christians and Sunni Muslims accept most of its forms, which do not involve gamete or embryo donation. Orthodox Christians are less strict than Catholic Christians but still refuse third party involvement. Interestingly, in contrast to Sunni Islam, Shi’a Islam accepts gamete donation and has made provisions to institutionalize it. Chinese culture is strongly influenced by Confucianism, which accepts all forms of assisted reproduction that do not involve third parties. Other communities follow the law of the land, which is usually dictated by the religious group(s) that make(s) the majority of that specific community. The debate will certainly continue as long as new developments arise in the ever-evolving field of assisted reproduction. PMID:27822349
Jaffré, Yannick; Suh, Siri
2016-05-01
Despite impressive global investment in reproductive health programs in West Africa, maternal mortality remains unacceptably high and obstetric care is often inadequate. Fertility is among the highest in the world, while contraceptive prevalence remains among the lowest. This paper explores the social and technical dimensions of this situation. We argue that effective reproductive health programs require analyzing the interfaces between technical programs and the social logics and behaviors of health professionals and client populations. Significant gaps between health programs' goals and the behaviors of patients and health care professionals have been observed. While public health projects aim to manage reproduction, sexuality, fertility, and professional practices are regulated socially. Such projects may target technical practices, but access to care is greatly influenced by social norms and ethics. This paper shows how an empirical anthropology that investigates the social and technical interfaces of reproduction can contribute to improved global health. Copyright © 2016 Elsevier Ltd. All rights reserved.
Reproductive health and empowerment -- a Rajasthan perspective.
Pal, P; Joshi, V
1996-01-01
Reproductive health is one of the major issues of current feminist debates. The issue was brought to light because of population control policies which are being enforced through women's bodies and the spread of HIV/AIDS. In this context, women's organizations and activists are trying to focus upon the issue of reproductive health as part of the larger issue of the position of women in families, societies, and states. Policy makers and donor agencies are trying to address the problem as lack of awareness and knowledge of how to use contraceptives. The authors argue in this situation that it is important to study reproductive health relative to the status of women in society. This paper looks at the existing social construct of patriarchy and population control policies in relation to reproductive health. Women and self, the reproductive role of women, preference for male children, family planning decision making, family planning programs and reproductive health, and the Vikalp program in two districts of Rajasthan are discussed.
Directory of Open Access Journals (Sweden)
Olivia Smith Spicer
Full Text Available Gnrh is the major neuropeptide regulator of vertebrate reproduction, triggering a cascade of events in the pituitary-gonadal axis that result in reproductive competence. Previous research in mice and humans has demonstrated that Gnrh/GNRH null mutations result in hypogonadotropic hypogonadism and infertility. The goal of this study was to eliminate gnrh3 (the hypophysiotropic Gnrh form function in zebrafish (Danio rerio to determine how ontogeny and reproductive performance are affected, as well as factors downstream of Gnrh3 along the reproductive axis. Using the TALEN technology, we developed a gnrh3-/- zebrafish line that harbors a 62 bp deletion in the gnrh3 gene. Our gnrh3-/- zebrafish line represents the first targeted and heritable mutation of a Gnrh isoform in any organism. Using immunohistochemistry, we verified that gnrh3-/- fish do not possess Gnrh3 peptide in any regions of the brain. However, other than changes in mRNA levels of pituitary gonadotropin genes (fshb, lhb, and cga during early development, which are corrected by adulthood, there were no changes in ontogeny and reproduction in gnrh3-/- fish. The gnrh3-/- zebrafish are fertile, displaying normal gametogenesis and reproductive performance in males and females. Together with our previous results that Gnrh3 cell ablation causes infertility, these results indicate that a compensatory mechanism is being activated, which is probably primed early on upon Gnrh3 neuron differentiation and possibly confined to Gnrh3 neurons. Potential compensation factors and sensitive windows of time for compensation during development and puberty should be explored.
Reproductive Investment and Health Costs in Roma Women
Directory of Open Access Journals (Sweden)
Jelena Čvorović
2017-11-01
Full Text Available In this paper, we examine whether variation in reproductive investment affects the health of Roma women using a dataset collected through original anthropological fieldwork among Roma women in Serbia. Data were collected in 2014–2016 in several Roma semi-urban settlements in central Serbia. The sample consisted of 468 Roma women, averaging 44 years of age. We collected demographic data (age, school levels, socioeconomic status, risk behaviors (smoking and alcohol consumption, marital status, and reproductive history variables (the timing of reproduction, the intensity of reproduction, reproductive effort and investment after birth, in addition to self-reported health, height, and weight. Data analyses showed that somatic, short-term costs of reproduction were revealed in this population, while evolutionary, long-term costs were unobservable—contrariwise, Roma women in poor health contributed more to the gene pool of the next generation than their healthy counterparts. Our findings appear to be consistent with simple trade-off models that suggest inverse relationships between reproductive effort and health. Thus, personal sacrifice—poor health as an outcome—seems crucial for greater reproductive success.
(Revised The role of melatonin as a hormone and an antioxidant in the control of fish reproduction
Directory of Open Access Journals (Sweden)
Dr. Saumen Kumar Maitra
2016-05-01
Full Text Available Reproduction in most fish is seasonal or periodic and the spawning occurs in an appropriate season to ensure maximum survival of the offspring. The sequence of reproductive events in an annual cycle is largely under the control of a species-specific endogenous timing system, which essentially relies on a well-equipped physiological response mechanism to changing environmental cues. The duration of solar light or photoperiod is one of the most predictable environmental signals used by a large number of animals including fish to coordinate their seasonal breeding. In vertebrates, the pineal gland is the major photo-neuroendocrine part of the brain that rhythmically synthesizes and releases melatonin (N-acetyl-5-methoxytryptamine into the circulation in synchronization with the environmental light-dark cycle. Past few decades witnessed an enormous progress in understanding the mechanisms by which melatonin regulates seasonal reproduction in fish and in other vertebrates. Most studies emphasized hormonal actions of melatonin through its high-affinity, pertussis toxin-sensitive G-protein (guanine nucleotide binding protein coupled receptors on the hypothalamus-pituitary-gonad (HPG axis of fish. However, the discovery that melatonin due to its lipophilic nature can easily cross the plasma membrane of all cells and may act as a potent scavenger of free radicals and stimulant of different antioxidants added a new dimension to the idea explaining mechanisms of melatonin actions in the regulation of ovarian functions. The basic concept on the actions of melatonin as an antioxidant emerged from mammalian studies. Recently, however, some new studies clearly suggested that melatonin, apart from playing the role of a hormone, may also be associated with the reduction in oxidative stress to augment ovarian functions during spawning. This review thus aims to bring together the current knowledge on the role of melatonin as a hormone as well as an antioxidant in
Chehab, Farid F
2014-10-01
The association between leptin and reproduction originated with the leptin-mediated correction of sterility in ob/ob mice and initiation of reproductive function in normal female mice. The uncovering of a central leptin pathway regulating food intake prompted the dissection of neuroendocrine mechanisms involving leptin in the metabolic control of reproduction. The absence of leptin receptors on GnRH neurons incited a search for intermediary neurons situated between leptin-responsive and GnRH neurons. This review addresses the most significant findings that have furthered our understanding of recent progress in this new field. The role of leptin in puberty was impacted by the discovery of neurons that co-express kisspeptin, neurokinin B, and dynorphin and these could act as leptin intermediates. Furthermore, the identification of first-order leptin-responsive neurons in the premammilary ventral nucleus and other brain regions opens new avenues to explore their relationship to GnRH neurons. Central to these advances is the unveiling that agouti-related protein/neuropeptide Y neurons project onto GnRH and kisspeptin neurons, allowing for a crosstalk between food intake and reproduction. Finally, while puberty is a state of leptin sensitivity, mid-gestation represents a state of leptin resistance aimed at building energy stores to sustain pregnancy and lactation. The mechanisms underlying leptin resistance in pregnancy have lagged; however, the establishment of this natural state is significant. Reproduction and energy balance are tightly controlled and backed up by redundant mechanisms that are critical for the survival of our species. It will be the goal of the following decade to shed new light on these complex and essential pathways. © 2014 Society for Endocrinology.
Directory of Open Access Journals (Sweden)
Anand Kumar
2014-01-01
Full Text Available Male reproduction is governed by the classical hypothalamo-hypophyseal testicular axis: Hypothalamic gonadotropin releasing hormone (GnRH, pituitary luteinizing hormone (LH and follicle stimulating hormone (FSH and the gonadal steroid, principally, testosterone. Thyroid hormones have been shown to exert a modulatory influence on this axis and consequently the sexual and spermatogenic function of man. This review will examine the modulatory influence of thyroid hormones on male reproduction.
A Novel Quantitative Approach to Women’s Reproductive Strategies
Milne, Fritha H.; Judge, Debra S.
2012-01-01
The patterned way in which individuals allocate finite resources to various components of reproduction (e.g. mating effort, reproductive timing and parental investment) is described as a reproductive strategy. As energy is limited, trade-offs between and within aspects of reproductive strategies are expected. The first aim of this study was to derive aspects of reproductive strategies using complete reproductive histories from 718 parous Western Australian women. Factor analysis using a subset of these participants resulted in six factors that represented ‘short-term mating strategy’, ‘early onset of sexual activity’, ‘reproductive output’, ‘timing of childbearing’, ‘breastfeeding’, and ‘child spacing’. This factor structure was internally validated by replication using a second independent subset of the data. The second aim of this study examined trade-offs between aspects of reproductive strategies derived from aim one. Factor scores calculated for each woman were incorporated in generalised linear models and interaction terms were employed to examine the effect of mating behaviour on the relationships between reproductive timing, parental investment and overall reproductive success. Early sexual activity correlates with early reproductive onset for women displaying more long-term mating strategies. Women with more short-term mating strategies exhibit a trade-off between child quantity and child quality not observed in women with a long-term mating strategy. However, women with a short-term mating strategy who delay reproductive timing exhibit levels of parental investment (measured as breastfeeding duration per child) similar to that of women with long-term mating strategies. Reproductive delay has fitness costs (fewer births) for women displaying more short-term mating strategies. We provide empirical evidence that reproductive histories of contemporary women reflect aspects of reproductive strategies, and associations between these
THE DISCOUNTED REPRODUCTIVE NUMBER FOR EPIDEMIOLOGY
Reluga, Timothy C.; Medlock, Jan; Galvani, Alison
2009-01-01
The basic reproductive number, , and the effective reproductive number, , are commonly used in mathematical epidemiology as summary statistics for the size and controllability of epidemics. However, these commonly used reproductive numbers can be misleading when applied to predict pathogen evolution because they do not incorporate the impact of the timing of events in the life-history cycle of the pathogen. To study evolution problems where the host population size is changing, measur...
Gender and Women's Reproductive Health
Directory of Open Access Journals (Sweden)
Aygul Akyuz
2010-08-01
Full Text Available AIM: According to the rights to equality in reproductive and sexual rights, no persons should be discriminated against their sexual and reproductive lives, in their access to health care and/or services on the grounds of race, sex, sexual orientation, marital status, family position, age, language, religion, political, or other opinion; national or social origin, property, birth, or other status In this context, health professionals devoted to reproductive health are responsible for the provision of services to individuals equally and should maintain equality rights. The aim of this study is to determine the effects of gender on the reproductive health of women and utilization of reproductive health services. METHODS: The study population consisted of 250 married women at their reproductive ages of 15 to 49, who applied to the obstetrics and gynecology service of a university hospital and a gynecology clinic of a training hospital dedicated to obstetrics and gynecology between 1 February 2007 and 30 April 2007. The data collection form was developed by researchers after evaluation of the relevant literature which relevance of gender discrimination could show where the questions. RESULTS: 52% of Women have graduated from primary school. Education levels of women with men (her husband between level of education is statistically significant difference, and women were receive less education than men (her husband (²=34.231, p<0.001. The study was determined that women who received training secondary school and above, worked and decision maker to domestic that they get prenatal care of a high percentage and deliver their babies in the hospital with the aid of a health care professional, and they go to medical center from gynecological problems and they need to obtain permission from their husbands in order to seek aid at a medical center of a low percentage (p<0.05. CONCLUSION: Women's reproductive health, gender discrimination status
Visual monitoring of reproduction in dairy herds
DEFF Research Database (Denmark)
Thysen, Iver; Enevoldsen, Carsten
1994-01-01
Two complementary approaches to produce visual information from reproduction records are described and exemplified. The Event Display shows all reproductive events, over a year, for all cows in a herd, by symbols placed in an array with columns representing calendar weeks and rows representing...... individual cows. The Reproduction Monitor consists of graphs of insemination and pregnancy rates evaluated weekly with a Bayesian technique. These visual monitoring tools are well suited to explore temporal variation in reproductive performance, they provide a quick overview of herd performance...
A progesterone-brown fat axis is involved in regulating fetal growth.
McIlvride, Saraid; Mushtaq, Aleena; Papacleovoulou, Georgia; Hurling, Chloe; Steel, Jennifer; Jansen, Eugène; Abu-Hayyeh, Shadi; Williamson, Catherine
2017-01-01
Pregnancy is associated with profound maternal metabolic changes, necessary for the growth and development of the fetus, mediated by reproductive signals acting on metabolic organs. However, the role of brown adipose tissue (BAT) in regulating gestational metabolism is unknown. We show that BAT
Automatic color preference correction for color reproduction
Tsukada, Masato; Funayama, Chisato; Tajima, Johji
2000-12-01
The reproduction of natural objects in color images has attracted a great deal of attention. Reproduction more pleasing colors of natural objects is one of the methods available to improve image quality. We developed an automatic color correction method to maintain preferred color reproduction for three significant categories: facial skin color, green grass and blue sky. In this method, a representative color in an object area to be corrected is automatically extracted from an input image, and a set of color correction parameters is selected depending on the representative color. The improvement in image quality for reproductions of natural image was more than 93 percent in subjective experiments. These results show the usefulness of our automatic color correction method for the reproduction of preferred colors.
Mendoza-Porras, Omar; Botwright, Natasha A; Reverter, Antonio; Cook, Mathew T; Harris, James O; Wijffels, Gene; Colgrave, Michelle L
2017-12-01
Inefficient control of temperate abalone spawning prevents pair-wise breeding and production of abalone with highly marketable traits. Traditionally, abalone farmers have used a combination of UV irradiation and application of temperature gradients to the tank water to artificially induce spawning. Proteins are known to regulate crucial processes such as respiration, muscle contraction, feeding, growth and reproduction. Spawning as a pre-requisite of abalone reproduction is likely to be regulated, in part, by endogenous proteins. A first step in elucidating the mechanisms that regulate spawning is to identify which proteins are directly involved during spawning. The present study examined protein expression following traditional spawning induction in the Haliotis laevigata female. Gonads were collected from abalone in the following physiological states: (1) spawning; (2) post-spawning; and (3) failed-to-spawn. Differential protein abundance was initially assessed using two-dimensional difference in-gel electrophoresis coupled with mass spectrometry for protein identification. A number of reproductive proteins such as vitellogenin, vitelline envelope zona pellucida domain 29 and prohibitin, and metabolic proteins such as thioredoxin peroxidase, superoxide dismutase and heat shock proteins were identified. Differences in protein abundance levels between physiological states were further assessed using scheduled multiple reaction monitoring mass spectrometry. Positive associations were observed between the abundance of specific proteins, such as heat shock cognate 70 and peroxiredoxin 6, and the propensity or failure to spawn in abalone. These findings have contributed to better understand both the effects of oxidative and heat stress over abalone physiology and their influence on abalone spawning. Crown Copyright © 2016. Published by Elsevier Inc. All rights reserved.
32 CFR 507.11 - Reproduction of designs.
2010-07-01
... 32 National Defense 3 2010-07-01 2010-07-01 true Reproduction of designs. 507.11 Section 507.11... Reproduction of designs. (a) The photographing, printing, or, in any manner making or executing any engraving... Force is authorized provided that such reproduction does not bring discredit upon the military service...
Oxidative shielding and the cost of reproduction.
Blount, Jonathan D; Vitikainen, Emma I K; Stott, Iain; Cant, Michael A
2016-05-01
Life-history theory assumes that reproduction and lifespan are constrained by trade-offs which prevent their simultaneous increase. Recently, there has been considerable interest in the possibility that this cost of reproduction is mediated by oxidative stress. However, empirical tests of this theory have yielded equivocal support. We carried out a meta-analysis to examine associations between reproduction and oxidative damage across markers and tissues. We show that oxidative damage is positively associated with reproductive effort across females of various species. Yet paradoxically, categorical comparisons of breeders versus non-breeders reveal that transition to the reproductive state is associated with a step-change reduction in oxidative damage in certain tissues and markers. Developing offspring may be particularly sensitive to harm caused by oxidative damage in mothers. Therefore, such reductions could potentially function to shield reproducing mothers, gametes and developing offspring from oxidative insults that inevitably increase as a consequence of reproductive effort. According to this perspective, we hypothesise that the cost of reproduction is mediated by dual impacts of maternally-derived oxidative damage on mothers and offspring, and that mothers may be selected to diminish such damage. Such oxidative shielding may explain why many existing studies have concluded that reproduction has little or no oxidative cost. Future advance in life-history theory therefore needs to take account of potential transgenerational impacts of the mechanisms underlying life-history trade-offs. © 2015 Cambridge Philosophical Society.
Directory of Open Access Journals (Sweden)
Michelle J Bayefsky
2016-12-01
Full Text Available Unlike many European nations, the USA has no regulations concerning the use of preimplantation genetic diagnosis (PGD, a technique employed during some fertility treatments to select embryos based on their genes. As such, PGD can and is used for a variety of controversial purposes, including sex selection, selection for children with disabilities such as deafness, and selection for ‘saviour siblings’ who can serve as tissue donors for sick relatives. The lack of regulation, which is due to particular features of the US political and economic landscape, has ethical and practical implications for patients seeking PGD around the world. This paper contrasts the absence of PGD oversight in the USA with existing PGD policies in Switzerland, Italy, France and the UK. The primary reasons why PGD is not regulated in the USA are addressed, with consideration of factors such as funding for assisted reproductive technology treatmemt and the proximity of PGD to the contentious abortion debate. The obstacles that would need to be overcome in the USA for PGD to be regulated in the future are outlined. Then, the significance of the current divergence in PGD policy for patients around the world are discussed. Regulatory differences create opportunities for reproductive tourism, which result in legal, health and moral challenges. The paper concludes with comments on the need for policymakers around the world to balance respect for the characters and constitutions of their individual countries with appreciation of the needs of infertile patients across the globe.
The ART of mating: alternative reproductive tactics and mating success in a nest-guarding fish.
Mascolino, S; Benvenuto, C; Gubili, C; Sacchi, C; Boufana, B; Mariani, S
2016-12-01
Behavioural observations in the field of male Mediterranean damselfish Chromis chromis were combined with molecular analyses, using bi-parentally and maternally inherited markers, to investigate reproductive success patterns of alternative reproductive tactics (ARTs) in terms of number of eggs sired and number of females contributing to each nest. Cuckoldry was observed in every nest sampled, with at least two and up to seven sneaker males per nest. The nesting male, however, always significantly fertilized the greater number of eggs (on average 49%) in each clutch, whereas each sneaker fertilized around 7% of the clutch. The average number of females whose eggs were fertilized by nesting males was 6·76 (range 2-13), while each sneaker on average fertilized the eggs of 1·74 (range 1-8) females. Using this sibship reconstruction, some of the factors involved in the regulation of the dynamic equilibrium of reproductive success were investigated between the two ARTs shown by C. chromis males. Results show that the sneakers' reproductive success was positively linked to egg clutch size; the density of individuals in the nesting area negatively affected the size of egg clutches; the rate of defence behaviours performed by nesting males negatively influenced the number of females contributing to each nest. © 2016 The Fisheries Society of the British Isles.
Interaction of environment and reproductive processes in cattle
International Nuclear Information System (INIS)
Thatcher, W.W.; Collier, R.J.; Beede, D.K.; Wilcox, C.J.
1986-01-01
Effects of environment on reproductive processes of female cattle are described. Variation in fertility responses is divided into environmental and genetic effects. Environmental effects are defined as all effects non-genetic, and emphasis is placed on the quantitation of various climatic measurements (e.g. maximum environmental temperature) associated with reproductive performance. Sensitivities of various reproductive events to thermal stress are defined and include such responses as: reproductive behaviour; hormonal balance related to both reproductive events and metabolic adaptations; alterations in uterine blood flow; embryonic death; conceptus development; placental function; and restoration of postpartum reproductive function. Also discussed are several management strategies to improve animal productivity, including environmental modification and the potential for genetic development of less heat-sensitive animals. (author)
Chronic pelvic pain in women of reproductive and post-reproductive age: a population-based study.
Ayorinde, A A; Bhattacharya, S; Druce, K L; Jones, G T; Macfarlane, G J
2017-03-01
Epidemiological studies on chronic pelvic pain (CPP) have focused on women of reproductive age. We aimed to determine the prevalence of chronic pelvic pain (CPP) in adult women and the differences in associated factors among women of reproductive age and older women. In addition, to determine whether distinct subgroups existed among CPP cases. A cross-sectional postal survey was conducted among 5300 randomly selected women aged ≥25 years resident in the Grampian region, UK. Multivariable logistic regression was used to determine pregnancy-related and psychosocial factors associated with CPP. To identify subgroups of CPP cases, we performed cluster analysis using variables of pain severity, psychosocial factors and pain coping strategies. Of 2088 participants, 309 (14.8%) reported CPP. CPP was significantly associated with being of reproductive age (odds ratios (OR) 2.43, 95% CI 1.69-3.48), multiple non-pain somatic symptoms (OR 3.58 95% CI 2.23-5.75), having fatigue (OR mild 1.74 95% CI 1.24-2.44, moderate/severe 1.82, 95% CI 1.25-2.63) and having depression (OR 1.61, 95% CI 1.09-2.38). CPP was less associated with multiple non-pain somatic symptoms in women of reproductive age compared to older women (interaction OR 0.51, 95% CI 0.28-0.92). We identified two clusters of CPP cases; those having little/no psychosocial distress and those having high psychosocial distress. CPP is common in both age groups, though women of reproductive age are more likely to report it. Heightened somatic awareness may be more strongly associated with CPP in older women. There are distinct groups of CPP cases characterized by the absence/presence of psychosocial distress. Heightened somatic awareness may be more strongly associated with CPP in women of post-reproductive years compared to women of reproductive years. Two subgroups of CPP cases can be differentiated by the absence/presence of psychosocial distress suggesting that stratified management approach may be more efficient.
The Mahabharata and reproductive endocrinology
Directory of Open Access Journals (Sweden)
Bharti Kalra
2016-01-01
Full Text Available This communication approaches the Mahabharata through the prism of reproductive endocrinology. Descriptions of episodes related to reproduction are listed here, to provide fodder for the endocrinologically minded brain. The cases described here are perhaps, the first documented observations of fetal orgasm, pseudocyesis and assisted reproductive technology, including assisted insemination by donor, induction of ovulation, and in vitro fertilization as well as precocious growth and intersex. We do not presume to offer a definite explanation for these interesting episodes from the Mahabharata. We do, however, hope to stimulate interest in ancient Indian literature, and encourage a literary “forensic endocrine” analysis of events relevant to our specialty.
Directory of Open Access Journals (Sweden)
Kerkum Yvette L
2013-02-01
Full Text Available Abstract Background Ankle-Foot-Orthoses with a ventral shell, also known as Floor Reaction Orthoses (FROs, are often used to reduce gait-related problems in children with spastic cerebral palsy (SCP, walking with excessive knee flexion. However, current evidence for the effectiveness (e.g. in terms of walking energy cost of FROs is both limited and inconclusive. Much of this ambiguity may be due to a mismatch between the FRO ankle stiffness and the patient’s gait deviations. The primary aim of this study is to evaluate the effect of FROs optimised for ankle stiffness on the walking energy cost in children with SCP, compared to walking with shoes alone. In addition, effects on various secondary outcome measures will be evaluated in order to identify possible working mechanisms and potential predictors of FRO treatment success. Method/Design A pre-post experimental study design will include 32 children with SCP, walking with excessive knee flexion in midstance, recruited from our university hospital and affiliated rehabilitation centres. All participants will receive a newly designed FRO, allowing ankle stiffness to be varied into three configurations by means of a hinge. Gait biomechanics will be assessed for each FRO configuration. The FRO that results in the greatest reduction in knee flexion during the single stance phase will be selected as the subject’s optimal FRO. Subsequently, the effects of wearing this optimal FRO will be evaluated after 12–20 weeks. The primary study parameter will be walking energy cost, with the most important secondary outcomes being intensity of participation, daily activity, walking speed and gait biomechanics. Discussion The AFO-CP trial will be the first experimental study to evaluate the effect of individually optimised FROs on mobility and participation. The evaluation will include outcome measures at all levels of the International Classification of Functioning, Disability and Health, providing a unique
Gene-environment interaction and male reproductive function
DEFF Research Database (Denmark)
Axelsson, Jonatan; Bonde, Jens Peter; Giwercman, Yvonne L
2010-01-01
As genetic factors can hardly explain the changes taking place during short time spans, environmental and lifestyle-related factors have been suggested as the causes of time-related deterioration of male reproductive function. However, considering the strong heterogeneity of male fecundity between...... that specific genotypes may confer a larger risk of male reproductive disorders following certain exposures. This paper presents a critical review of animal and human evidence on how genes may modify environmental effects on male reproductive function. Some examples have been found that support this mechanism...... of reproduction, namely environmental and lifestyle factors as the cause of sperm DNA damage. It remains to be investigated to what extent such genetic changes, by natural conception or through the use of assisted reproductive techniques, are transmitted to the next generation, thereby causing increased morbidity...
Persistent organic pollutants and male reproductive health
DEFF Research Database (Denmark)
Vested, Anne; Giwercman, Aleksander; Bonde, Jens Peter
2014-01-01
development. An extensive number of epidemiological studies have addressed the possible effects of exposure to POPs on male reproductive health, but the results are conflicting. Thus far, most studies have focused on investigating exposure and the different reproductive health outcomes during adulthood. Some...... suggested adverse effects of exposure to these compounds on human reproductive health, which, according to the endocrine disrupter hypothesis, are ascribed to the compounds' potential to interfere with endocrine signaling, especially when exposure occurs during certain phases of fetal and childhood...... studies have addressed the potential harmful effects of fetal exposure with respect to malformations at birth and/or reproductive development, whereas only a few studies have been able to evaluate whether intrauterine exposure to POPs has long-term consequences for male reproductive health with measurable...
Sense and nonsense in metabolic control of reproduction.
Schneider, Jill E; Klingerman, Candice M; Abdulhay, Amir
2012-01-01
An exciting synergistic interaction occurs among researchers working at the interface of reproductive biology and energy homeostasis. Reproductive biologists benefit from the theories, experimental designs, and methodologies used by experts on energy homeostasis while they bring context and meaning to the study of energy homeostasis. There is a growing recognition that identification of candidate genes for obesity is little more than meaningless reductionism unless those genes and their expression are placed in a developmental, environmental, and evolutionary context. Reproductive biology provides this context because metabolic energy is the most important factor that controls reproductive success and gonadal hormones affect energy intake, storage, and expenditure. Reproductive hormone secretion changes during development, and reproductive success is key to evolutionary adaptation, the process that most likely molded the mechanisms that control energy balance. It is likely that by viewing energy intake, storage, and expenditure in the context of reproductive success, we will gain insight into human obesity, eating disorders, diabetes, and other pathologies related to fuel homeostasis. This review emphasizes the metabolic hypothesis: a sensory system monitors the availability of oxidizable metabolic fuels and orchestrates behavioral motivation to optimize reproductive success in environments where energy availability fluctuates or is unpredictable.
DEFF Research Database (Denmark)
Linde, Tore; Zoglowek, Marta; Lübeck, Mette
2016-01-01
The global regulatory protein LaeA is known for regulating the production of many kinds of secondary metabolites in Aspergillus species, as well as sexual and asexual reproduction, and morphology. In Aspergillus carbonarius, it has been shown that LaeA regulates production of ochratoxin. We have ...
Unisexual reproduction in Huntiella moniliformis.
Wilson, A M; Godlonton, T; van der Nest, M A; Wilken, P M; Wingfield, M J; Wingfield, B D
2015-07-01
Sexual reproduction in fungi is controlled by genes present at the mating type (MAT) locus, which typically harbors transcription factors that influence the expression of many sex-related genes. The MAT locus exists as two alternative idiomorphs in ascomycetous fungi and sexual reproduction is initiated when genes from both idiomorphs are expressed. Thus, the gene content of this locus determines whether a fungus is heterothallic (self-sterile) or homothallic (self-fertile). Recently, a unique sub-class of homothallism has been described in fungi, where individuals possessing a single MAT idiomorph can reproduce sexually in the absence of a partner. Using various mycological, molecular and bioinformatic techniques, we investigated the sexual strategies and characterized the MAT loci in two tree wound-infecting fungi, Huntiella moniliformis and Huntiella omanensis. H. omanensis was shown to exhibit a typically heterothallic sexual reproductive cycle, with isolates possessing either the MAT1-1 or MAT1-2 idiomorph. This was in contrast to the homothallism via unisexual reproduction that was shown in H. moniliformis, where only the MAT1-2-1 gene was present in sexually reproducing cultures. While the evolutionary benefit and mechanisms underpinning a unisexual mating strategy remain unknown, it could have evolved to minimize the costs, while retaining the benefits, of normal sexual reproduction. Copyright © 2015 Elsevier Inc. All rights reserved.
Chemosignals, hormones, and amphibian reproduction.
Woodley, Sarah
2015-02-01
This article is part of a Special Issue "Chemosignals and Reproduction". Amphibians are often thought of as relatively simple animals especially when compared to mammals. Yet the chemosignaling systems used by amphibians are varied and complex. Amphibian chemosignals are particularly important in reproduction, in both aquatic and terrestrial environments. Chemosignaling is most evident in salamanders and newts, but increasing evidence indicates that chemical communication facilitates reproduction in frogs and toads as well. Reproductive hormones shape the production, dissemination, detection, and responsiveness to chemosignals. A large variety of chemosignals have been identified, ranging from simple, invariant chemosignals to complex, variable blends of chemosignals. Although some chemosignals elicit straightforward responses, others have relatively subtle effects. Review of amphibian chemosignaling reveals a number of issues to be resolved, including: 1) the significance of the complex, individually variable blends of courtship chemosignals found in some salamanders, 2) the behavioral and/or physiological functions of chemosignals found in anuran "breeding glands", 3) the ligands for amphibian V2Rs, especially V2Rs expressed in the main olfactory epithelium, and 4) the mechanism whereby transdermal delivery of chemosignals influences behavior. To date, only a handful of the more than 7000 species of amphibians has been examined. Further study of amphibians should provide additional insight to the role of chemosignals in reproduction. Copyright © 2014 Elsevier Inc. All rights reserved.
Singer, Elyse Ona
2017-12-01
Building on medical anthropology literature that analyzes doctor-patient interactions as a charged site for the production of political subjectivities, I demonstrate how a central feature of Mexico City's new public sector abortion program involves "responsibilization." In accordance with entrenched Ministry of Health objectives, providers transmit a suite of values about personal responsibility and self-regulation through the use of birth control, hinging abortion rights to responsible reproductive subjectivity. Based on 18 months of ethnographic research across program clinics, including 75 interviews with patients and providers, I show how interrupción legal del embarazo protocols fashion "responsibilized" liberal subjects. I argue that the recent granting of abortion rights in Mexico City-ostensibly a new moment for the construction of women's citizenship-instead reflects and extends long-standing state agendas of "reproductive governance." My analysis of reproductive rights as the newest framing of ongoing population policies in Mexico adds to a critical anthropology of human rights and of liberal projects of governance. © 2016 by the American Anthropological Association.
Impaired reproduction after exposure to ADHD drugs
DEFF Research Database (Denmark)
Danborg, Pia Brandt; Simonsen, Anders Lykkemark; Gøtzsche, Peter C
2017-01-01
BACKGROUND: Few studies have reported on long-term harms caused by ADHD drugs but they are known to impair growth. OBJECTIVE: To assess whether ADHD drugs impair reproduction in mammals. METHODS: Systematic review of reproduction in studies of animals treated with ADHD drugs. DATA SOURCES: Pub....... CONCLUSION: ADHD drugs impair the reproduction in animals....
Bacterial reproductive pathogens of cats and dogs.
Graham, Elizabeth M; Taylor, David J
2012-05-01
With the notable exception of Brucella canis, exogenous bacterial pathogens are uncommon causes of reproductive disease in cats and dogs. Most bacterial reproductive infections are endogenous, and predisposing factors for infection are important. This article reviews the etiology, pathogenesis, clinical presentation, diagnosis, treatment, and public health significance of bacterial reproductive pathogens in cats and dogs.
Social influences and reproductive health of adolescents
Directory of Open Access Journals (Sweden)
Stanković Biljana
2007-01-01
Full Text Available Reproductive health represents a state of complete physical, mental and social prosperity, and not just the absence of illness or weakness, and it refers to reproductive processes, functions and systems. Adolescents, young people from the age of ten to nineteen, are yet to achieve their reproductive function, thus their reproductive health and behavior are very significant both from the individual and social standpoint. Risky behavior, which represents the main cause of diseases that young people contract most often, in the field of sexuality often lead to unplanned pregnancies and abortions, as well as diseases from sexually transmitted infections. The extensiveness can be decreased by prevention. Reproductive health promotion, as well as general health promotion, understands a social surrounding that supports healthy behavior styles. Above all, the family, schoolmates, health and school systems, mass media, without neglecting the importance of economic, social and political security in society, political and legal solutions, as well as activities of nongovernmental, religious and other organizations. Their impact, in complex interaction, directly and indirectly influence youth behavior and determine the decisions they make regarding reproductive health.
The Effect of Latitudinal Variation on Shrimp Reproductive Strategies.
van de Kerk, Madelon; Jones Littles, Chanda; Saucedo, Omar; Lorenzen, Kai
2016-01-01
Reproductive strategies comprise the timing and frequency of reproductive events and the number of offspring per reproductive event, depending on factors such as climate conditions. Therefore, species that exhibit plasticity in the allocation of reproductive effort can alter their behavior in response to climate change. Studying how the reproductive strategy of species varies along the latitudinal gradient can help us understand and predict how they will respond to climate change. We investigated the effects of the temporal allocation of reproductive effort on the population size of brown shrimp (Farfantepenaeus aztecus) along a latitudinal gradient. Multiple shrimp species exhibit variation in their reproductive strategies, and given the economic importance of brown shrimp to the commercial fishing sector of the Unites States, changes in the timing of their reproduction could have significant economic and social consequences. We used a stage-based, density-dependent matrix population model tailored to the life history of brown shrimp. Shrimp growth rates and environmental carrying capacity were varied based on the seasonal climate conditions at different latitudes, and we estimated the population size at equilibrium. The length of the growing season increased with decreasing latitude and the reproductive strategy leading to the highest population size changed from one annual birth pulse with high reproductive output to continuous low-output reproduction. Hence, our model confirms the classical paradigm of continuous reproduction at low latitudes, with increased seasonality of the breeding period towards the poles. Our results also demonstrate the potential for variation in climate to affect the optimal reproductive strategy for achieving maximum population sizes. Certainly, understanding these dynamics may inform more comprehensive management strategies for commercially important species like brown shrimp.
The Effect of Latitudinal Variation on Shrimp Reproductive Strategies.
Directory of Open Access Journals (Sweden)
Madelon van de Kerk
Full Text Available Reproductive strategies comprise the timing and frequency of reproductive events and the number of offspring per reproductive event, depending on factors such as climate conditions. Therefore, species that exhibit plasticity in the allocation of reproductive effort can alter their behavior in response to climate change. Studying how the reproductive strategy of species varies along the latitudinal gradient can help us understand and predict how they will respond to climate change. We investigated the effects of the temporal allocation of reproductive effort on the population size of brown shrimp (Farfantepenaeus aztecus along a latitudinal gradient. Multiple shrimp species exhibit variation in their reproductive strategies, and given the economic importance of brown shrimp to the commercial fishing sector of the Unites States, changes in the timing of their reproduction could have significant economic and social consequences. We used a stage-based, density-dependent matrix population model tailored to the life history of brown shrimp. Shrimp growth rates and environmental carrying capacity were varied based on the seasonal climate conditions at different latitudes, and we estimated the population size at equilibrium. The length of the growing season increased with decreasing latitude and the reproductive strategy leading to the highest population size changed from one annual birth pulse with high reproductive output to continuous low-output reproduction. Hence, our model confirms the classical paradigm of continuous reproduction at low latitudes, with increased seasonality of the breeding period towards the poles. Our results also demonstrate the potential for variation in climate to affect the optimal reproductive strategy for achieving maximum population sizes. Certainly, understanding these dynamics may inform more comprehensive management strategies for commercially important species like brown shrimp.
Directory of Open Access Journals (Sweden)
François VÉzina, Katrina G. SALVANTE
2010-12-01
Full Text Available Interest in phenotypic flexibility has increased dramatically over the last decade, but flexibility during reproduction has received relatively little attention from avian scientists, despite its possible impact on fitness. Because most avian species maintain atrophied reproductive organs when not active, reproduction in birds requires major tissue remodeling in preparation for breeding. Females undergo rapid (days recrudescence and regression of their reproductive organs at each breeding attempt, while males grow their organs ahead of time at a much slower rate (weeks and may maintain them at maximal size throughout the breeding season. Reproduction is associated with significant metabolic costs. Egg production leads to a 22–27% increase in resting metabolic rate (RMR over non-reproductive values. This is partly due to the activity of the oviduct, an organ that may allow females to adjust reproductive investment by modulating egg size and quality. In males, gonadal recrudescence may lead to a 30% increase in RMR, but the data are inconsistent and general conclusions regarding energetic costs of reproduction in males will require more research. Recent studies on captive female zebra finches describe the impacts of these costs on daily energy budgets and highlight the strategies used by birds to maintain their investment in reproduction when energy is limited. Whenever possible, birds use behavioral flexibility as a first means of saving energy. Decreasing locomotor activity saves energy during challenges such as egg production or exposure to cold temperatures and is an efficient way to buffer variation in individual daily energy budgets. However, when behavioral flexibility is not possible, birds must rely on flexibility at the physiological level to meet energy demands. In zebra finches breeding in the cold, this results in a reduced pace of laying, likely due to down-regulation of both reproductive and non-reproductive function, allowing
Identification of photoperiod-regulated gene in soybean and ...
Indian Academy of Sciences (India)
2014-04-15
Apr 15, 2014 ... Flowering is a critical stage in plant reproductive growth. Regulation of ... accumulation and high CO protein stability coincide at the end of the .... by 20 min of inactivation of T4 DNA polymerase at 70. ◦. C. ... tion medium and the next day, the culture was inoculated ... 2.0 and left at room temperature for 3 h.
Wang, Y; Yang, H M; Cao, W; Li, Y B
2017-09-01
The effects of dietary supplementation of sodium selenite (SS) on the reproductive performance and the concentration of selenium, glutathione peroxidase (GSH-Px), superoxide dismutase (SOD), and malondialdehyde (MDA) were determined, and expression of glutathione peroxidase 4 (GPx4) and bone morphogenic protein 15 (BMP15) was evaluated. Paired pigeons (n = 864) were fed: T1 received no SS, while T2, T3, and T4 received 0.5, 1.0, and 1.5 mg of SS/kg of dry matter (DM), respectively. Treatments were performed in triplicate with 72 pairs in each replicate. The results showed that selenium supplementation significantly affected pigeon reproductive performance. Birds fed 1.0 mg of SS/kg displayed higher egg production (P > 0.05), higher birth rate, and lower dead sperm rate than the control group (P Selenium and biochemical analyses revealed a higher selenium concentration in the 1.5 mg of SS/kg group than in the control group (P 0.05); however, in plasma, MDA was lower in the control group (P 0.05), while in ovary, BMP15 was down-regulated in the 1.5 mg of SS/kg group (P selenium concentration, and 0.5 mg of SS/kg up-regulated GSH-Px activity. © 2017 Poultry Science Association Inc.
Male reproductive health and environmental xenoestrogens
DEFF Research Database (Denmark)
Toppari, J; Larsen, J C; Christiansen, Peter
1996-01-01
that the adverse changes may be inter-related and have a common origin in fetal life or childhood. Exposure of the male fetus to supranormal levels of estrogens, such as diethlylstilbestrol, can result in the above-mentioned reproductive defects. The growing number of reports demonstrating that common......Male reproductive health has deteriorated in many countries during the last few decades. In the 1990s, declining semen quality has been reported from Belgium, Denmark, France, and Great Britain. The incidence of testicular cancer has increased during the same time incidences of hypospadias...... and cryptorchidism also appear to be increasing. Similar reproductive problems occur in many wildlife species. There are marked geographic differences in the prevalence of male reproductive disorders. While the reasons for these differences are currently unknown, both clinical and laboratory research suggest...
Male reproductive health and environmental xenoestrogens
DEFF Research Database (Denmark)
Toppari, J; Larsen, J C; Christiansen, Peter
1996-01-01
Male reproductive health has deteriorated in many countries during the last few decades. In the 1990s, declining semen quality has been reported from Belgium, Denmark, France, and Great Britain. The incidence of testicular cancer has increased during the same time incidences of hypospadias...... and cryptorchidism also appear to be increasing. Similar reproductive problems occur in many wildlife species. There are marked geographic differences in the prevalence of male reproductive disorders. While the reasons for these differences are currently unknown, both clinical and laboratory research suggest...... that the adverse changes may be inter-related and have a common origin in fetal life or childhood. Exposure of the male fetus to supranormal levels of estrogens, such as diethlylstilbestrol, can result in the above-mentioned reproductive defects. The growing number of reports demonstrating that common...
Directory of Open Access Journals (Sweden)
Daniel J Spade
Full Text Available BACKGROUND: Queen conch (Strombus gigas reproduction is inhibited in nearshore areas of the Florida Keys, relative to the offshore environment where conchs reproduce successfully. Nearshore reproductive failure is possibly a result of exposure to environmental factors, including heavy metals, which are likely to accumulate close to shore. Metals such as Cu and Zn are detrimental to reproduction in many mollusks. METHODOLOGY/PRINCIPAL FINDINGS: Histology shows gonadal atrophy in nearshore conchs as compared to reproductively healthy offshore conchs. In order to determine molecular mechanisms leading to tissue changes and reproductive failure, a microarray was developed. A normalized cDNA library for queen conch was constructed and sequenced using the 454 Life Sciences GS-FLX pyrosequencer, producing 27,723 assembled contigs and 7,740 annotated transcript sequences. The resulting sequences were used to design the microarray. Microarray analysis of conch testis indicated differential regulation of 255 genes (p<0.01 in nearshore conch, relative to offshore. Changes in expression for three of four transcripts of interest were confirmed using real-time reverse transcription polymerase chain reaction. Gene Ontology enrichment analysis indicated changes in biological processes: respiratory chain (GO:0015992, spermatogenesis (GO:0007283, small GTPase-mediated signal transduction (GO:0007264, and others. Inductively coupled plasma-mass spectrometry analysis indicated that Zn and possibly Cu were elevated in some nearshore conch tissues. CONCLUSIONS/SIGNIFICANCE: Congruence between testis histology and microarray data suggests that nearshore conch testes regress during the reproductive season, while offshore conch testes develop normally. Possible mechanisms underlying the testis regression observed in queen conch in the nearshore Florida Keys include a disruption of small GTPase (Ras-mediated signaling in testis development. Additionally, elevated tissue
Dinosaur Reproduction and Parenting
Horner, John R.
Non-avian dinosaur reproductive and parenting behaviors were mostly similar to those of extant archosaurs. Non-avian dinosaurs were probably sexually dimorphic and some may have engaged in hierarchical rituals. Non-avian coelurosaurs (e.g. Troodontidae, Oviraptorosauria) had two active oviducts, each of which produced single eggs on a daily or greater time scale. The eggs of non-coelurosaurian dinosaurs (e.g. Ornithischia, Sauropoda) were incubated in soils, whereas the eggs of non-avian coelurosaurs (e.g. Troodon, Oviraptor) were incubated with a combination of soil and direct parental contact. Parental attention to the young was variable, ranging from protection from predators to possible parental feeding of nest-bound hatchlings. Semi-altricial hadrosaur hatchlings exited their respective nests near the time of their first linear doubling. Some reproductive behaviors, once thought exclusive to Aves, arose first in non-avian dinosaurs. The success of the Dinosauria may be related to reproductive strategies.
Differential fitness costs of reproduction between the sexes
Penn, Dustin J.; Smith, Ken R.
2006-01-01
Natural selection does not necessarily favor maximal reproduction because reproduction imposes fitness costs, reducing parental survival, and offspring quality. Here, we show that parents in a preindustrial population in North America incurred fitness costs from reproduction, and women incurred greater costs than men. We examined the survivorship and reproductive success (Darwinian fitness) of 21,684 couples married between 1860 and 1895 identified in the Utah Population Database. We found th...
Effects of melatonin and prolactin in reproduction: review of literature.
Tenorio, Fernanda das Chagas Angelo Mendes; Simões, Manuel de Jesus; Teixeira, Valéria Wanderley; Teixeira, Álvaro Aguiar Coelho
2015-01-01
The pineal gland is responsible for producing a hormone called melatonin (MEL), and is accepted as the gland that regulates reproduction in mammals. Prolactin (PRL) also exhibits reproductive activity in animals in response to photoperiod. It is known that the concentrations of PRL are high in the summer and reduced during winter, the opposite of what is seen with melatonin in these seasons. In placental mammals, both prolactin and melatonin affect implantation, which is considered a critical point of pregnancy, since a successful pregnancy requires the development of a synchronous interaction between the endometrium and blastocyst for placental development. It is also known that PRL levels during pregnancy are essential for the maintenance of pregnancy, because this hormone induces the corpus luteum to produce progesterone, in addition to stimulating blastocyst implantation to maintain pregnancy and form the placenta. However, melatonin levels in plasma have also been shown to increase during pregnancy, peaking at the end of this period, which suggests that this hormone plays an important role in the maintenance of pregnancy. Thus, it is clear that treatment with prolactin or melatonin interferes with the processes responsible for the development and maintenance of pregnancy.
Effects of melatonin and prolactin in reproduction: review of literature
Directory of Open Access Journals (Sweden)
Fernanda das Chagas Angelo Mendes Tenorio
2015-06-01
Full Text Available Summary The pineal gland is responsible for producing a hormone called melatonin (MEL, and is accepted as the gland that regulates reproduction in mammals. Prolactin (PRL also exhibits reproductive activity in animals in response to photoperiod. It is known that the concentrations of PRL are high in the summer and reduced during winter, the opposite of what is seen with melatonin in these seasons. In placental mammals, both prolactin and melatonin affect implantation, which is considered a critical point of pregnancy, since a successful pregnancy requires the development of a synchronous interaction between the endometrium and blastocyst for placental development. It is also known that PRL levels during pregnancy are essential for the maintenance of pregnancy, because this hormone induces the corpus luteum to produce progesterone, in addition to stimulating blastocyst implantation to maintain pregnancy and form the placenta. However, melatonin levels in plasma have also been shown to increase during pregnancy, peaking at the end of this period, which suggests that this hormone plays an important role in the maintenance of pregnancy. Thus, it is clear that treatment with prolactin or melatonin interferes with the processes responsible for the development and maintenance of pregnancy.
[Contract focused short-term group therapy--results of an evaluation].
Hirschberg, Rainer; Meyer, Birgit
2010-01-01
A short description outlines the development of commission focused short-term therapy (AFoG) for children and adolescents. Subsequently the generic principles of psychotherapy are applied to AFoG in order to underline the basic assumptions of this variation of systemic group therapy. Behavioural changes arising in different contexts (school, family, group therapy) show the need for an appropriate flexibility of group therapy techniques. The evaluation was accomplished using the Child Behaviour Checklist (CBCL 4-18) at the beginning and 3 month after the end of the group therapy. The results show positive effects which finally are discussed critically.
Steroids as central regulators of organismal development and lifespan.
Directory of Open Access Journals (Sweden)
Siu Sylvia Lee
Full Text Available Larvae of the nematode Caenorhabditis elegans must choose between reproductive development and dauer diapause. This decision is based on sensing of environmental inputs and dauer pheromone, a small molecule signal that serves to monitor population density. These signals are integrated via conserved neuroendocrine pathways that converge on steroidal ligands of the nuclear receptor DAF-12, a homolog of the mammalian vitamin D receptor and liver X receptor. DAF-12 acts as the main switch between gene expression programs that drive either reproductive development or dauer entry. Extensive studies in the past two decades demonstrated that biosynthesis of two bile acid-like DAF-12 ligands, named dafachronic acids (DA, controls developmental fate. In this issue of PLoS Biology, Wollam et al. showed that a conserved steroid-modifying enzyme, DHS-16, introduces a key feature in the structures of the DAF-12 ligands, closing a major gap in the DA biosynthesis pathway. The emerging picture of DA biosynthesis in C. elegans enables us to address a key question in the field: how are complex environmental signals integrated to enforce binary, organism-wide decisions on developmental fate? Schaedel et al. demonstrated that pheromone and DA serve as competing signals, and that a positive feedback loop based on regulation of DA biosynthesis ensures organism-wide commitment to reproductive development. Considering that many components of DA signaling are highly conserved, ongoing studies in C. elegans may reveal new aspects of bile acid function and lifespan regulation in mammals.
Directory of Open Access Journals (Sweden)
Jin-A Lee
2015-05-01
Full Text Available Porcine reproductive and respiratory syndrome (PRRS is a chronic and immunosuppressive viral disease that is responsible for substantial economic losses for the swine industry. Honeybee venom (HBV is known to possess several beneficial biological properties, particularly, immunomodulatory effects. Therefore, this study aimed at evaluating the effects of HBV on the immune response and viral clearance during the early stage of infection with porcine reproductive and respiratory syndrome virus (PRRSV in pigs. HBV was administered via three routes of nasal, neck, and rectal and then the pigs were inoculated with PRRSV intranasally. The CD4+/CD8+ cell ratio and levels of interferon (IFN-γ and interleukin (IL-12 were significantly increased in the HBV-administered healthy pigs via nasal and rectal administration. In experimentally PRRSV-challenged pigs with virus, the viral genome load in the serum, lung, bronchial lymph nodes and tonsil was significantly decreased, as was the severity of interstitial pneumonia, in the nasal and rectal administration group. Furthermore, the levels of Th1 cytokines (IFN-γ and IL-12 were significantly increased, along with up-regulation of pro-inflammatory cytokines (TNF-α and IL-1β with HBV administration. Thus, HBV administration—especially via the nasal or rectal route—could be a suitable strategy for immune enhancement and prevention of PRRSV infection in pigs.
Gene-environment interaction and male reproductive function
Axelsson, Jonatan; Bonde, Jens Peter; Giwercman, Yvonne L.; Rylander, Lars; Giwercman, Aleksander
2010-01-01
As genetic factors can hardly explain the changes taking place during short time spans, environmental and lifestyle-related factors have been suggested as the causes of time-related deterioration of male reproductive function. However, considering the strong heterogeneity of male fecundity between and within populations, genetic variants might be important determinants of the individual susceptibility to the adverse effects of environment or lifestyle. Although the possible mechanisms of such interplay in relation to the reproductive system are largely unknown, some recent studies have indicated that specific genotypes may confer a larger risk of male reproductive disorders following certain exposures. This paper presents a critical review of animal and human evidence on how genes may modify environmental effects on male reproductive function. Some examples have been found that support this mechanism, but the number of studies is still limited. This type of interaction studies may improve our understanding of normal physiology and help us to identify the risk factors to male reproductive malfunction. We also shortly discuss other aspects of gene-environment interaction specifically associated with the issue of reproduction, namely environmental and lifestyle factors as the cause of sperm DNA damage. It remains to be investigated to what extent such genetic changes, by natural conception or through the use of assisted reproductive techniques, are transmitted to the next generation, thereby causing increased morbidity in the offspring. PMID:20348940