WorldWideScience

Sample records for adjacent rrna nucleotide

  1. The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.

    OpenAIRE

    Takaiwa, F; Kusuda, M; Saga, N; Sugiura, M

    1982-01-01

    The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).

  2. The conformation of 23S rRNA nucleotide A2058 determines its recognition by the ErmE methyltransferase

    DEFF Research Database (Denmark)

    Vester, B; Hansen, L H; Douthwaite, S

    1995-01-01

    The ErmE methyltransferase confers resistance to MLS antibiotics by specifically dimethylating adenine 2058 (A2058, Escherichia coli numbering) in bacterial 23S rRNA. To define nucleotides in the rRNA that are part of the motif recognized by ErmE, we investigated both in vivo and in vitro...... the effects of mutations around position A2058 on methylation. Mutagenizing A2058 (to G or U) completely abolishes methylation of 23S rRNA by ErmE. No methylation occurred at other sites in the rRNA, demonstrating the fidelity of ErmE for A2058. Breaking the neighboring G2057-C2611 Watson-Crick base pair...... and it was shown that the A2057 and U2611 mutations alone and in combination alter the reactivity of A2058 and adjacent bases. However, mutagenizing position G-->A2032 in an adjacent loop, which has been implicated to interact with A2058, alters neither the ErmE methylation at A2058 nor the accessibility...

  3. Nucleotide sequence of the 18S-26S rRNA intergene region of the sea urchin.

    OpenAIRE

    Hindenach, B R; Stafford, D W

    1984-01-01

    The DNA sequence which spans the internal transcribed spacers of a cloned ribosomal transcription unit from the sea urchin, Lytechinus variegatus, has been determined. The region extends from the conserved Eco RI site near the 3' end of the 18S rDNA to a Bam HI site in the 26S rDNA and includes 232 nucleotides coding for 18S rRNA, 367 nucleotides of internal transcribed spacer, 159 nucleotides coding for 5.8S rRNA, 338 nucleotides of internal transcribed spacer, and 505 nucleotides coding for...

  4. Nucleotide sequence of the 18S-26S rRNA intergene region of the sea urchin.

    Science.gov (United States)

    Hindenach, B R; Stafford, D W

    1984-02-10

    The DNA sequence which spans the internal transcribed spacers of a cloned ribosomal transcription unit from the sea urchin, Lytechinus variegatus, has been determined. The region extends from the conserved Eco RI site near the 3' end of the 18S rDNA to a Bam HI site in the 26S rDNA and includes 232 nucleotides coding for 18S rRNA, 367 nucleotides of internal transcribed spacer, 159 nucleotides coding for 5.8S rRNA, 338 nucleotides of internal transcribed spacer, and 505 nucleotides coding for 26S rRNA. The rRNA coding regions were identified by direct analysis of 3'-labeled 18S and 5.8S rRNA and 5'-labeled 5.8S rRNA, and by sequence homology of the 26S rDNA with yeast and vertebrate 26/28S rRNAs. The internal transcribed spacers are GC-rich, similar to those of vertebrates. The 5.8S and 5' 26S rDNA sequences support a proposed model for a structural domain of the yeast large subunit ribosomal RNA (Veldman et al. [1981] Nucleic Acids Res. 9, 6935-6952).

  5. [Nucleotide sequences of 5S rRNA genes of polyploid species of wheat and Aegilops species].

    Science.gov (United States)

    Vakhitov, V A; Gimalov, F R; Shumiatskiĭ, G P

    1989-01-01

    Primary structures of 5S rRNA genes and of non-transcribed spacers between them were determined in families of 5S DNA repeats 420 and 500 b.p. long in 8 wheat and Aegilops species. The high conservatism of sequences coding for 5S rRNA, 3'- and 5'-ends of non-transcribed spacers was shown not to depend on the evolutional position, ploidy level and genomic composition of species. The activity of transcription of 5S rRNA cloned genes was determined in vitro. The functional heterogeneity was revealed in each family of repeats due to the existence of exchanges of separate nucleotides within the internal transcription control region. A greater deficiency of CpG dinucleotide was revealed in 5S rRNA genes than in non-transcribed spacers.

  6. YebU is a m5C methyltransferase specific for 16 S rRNA nucleotide 1407

    DEFF Research Database (Denmark)

    Andersen, Niels Møller; Douthwaite, Stephen

    2006-01-01

    generally require specific enzymes, and only one m5C rRNA methyltransferase, RsmB (formerly Fmu) that methylates nucleotide C967, has previously been identified. BLAST searches of the E.coli genome revealed a single gene, yebU, with sufficient similarity to rsmB to encode a putative m5C RNA...... methyltransferase. This suggested that the yebU gene product modifies C1407 and/or C1962. Here, we analysed the E.coli rRNAs by matrix assisted laser desorption/ionization mass spectrometry and show that inactivation of the yebU gene leads to loss of methylation at C1407 in 16 S rRNA, but does not interfere...

  7. The antibiotics micrococcin and thiostrepton interact directly with 23S rRNA nucleotides 1067A and 1095A

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S

    1994-01-01

    The antibiotics thiostrepton and micrococcin bind to the GTPase region in domain II of 23S rRNA, and inhibit ribosomal A-site associated reactions. When bound to the ribosome, these antibiotics alter the accessibility of nucleotides 1067A and 1095A towards chemical reagents. Plasmid......-coded Escherichia coli 23S rRNAs with single mutations at positions 1067 or 1095 were expressed in vivo. Mutant ribosomes are functional in protein synthesis, although those with transversion mutations function less effectively. Antibiotics were bound under conditions where wild-type and mutant ribosomes compete...

  8. YccW is the m5C methyltransferase specific for 23S rRNA nucleotide 1962

    DEFF Research Database (Denmark)

    Purta, Elzbieta; O'Connor, Michelle; Bujnicki, Janusz M

    2008-01-01

    Methylation at the 5-position of cytosine [m(5)C (5-methylcytidine)] occurs at three RNA nucleotides in Escherichia coli. All these modifications are at highly conserved nucleotides in the rRNAs, and each is catalyzed by its own m(5)C methyltransferase enzyme. Two of the enzymes, RsmB and Rsm......F, are already known and methylate 16S rRNA at nucleotides C967 and C1407, respectively. Here, we report the identity of the third E. coli m(5)C methyltransferase. Analysis of rRNAs by matrix-assisted laser desorption/ionization mass spectrometry showed that inactivation of the yccW gene leads to loss of m(5)C....... coli marginally reduces its growth rate. YccW had previously eluded identification because it displays only limited sequence similarity to the m(5)C methyltransferases RsmB and RsmF and is in fact more similar to known m(5)U (5-methyluridine) RNA methyltransferases. In keeping with the previously...

  9. Identification of the RsmG methyltransferase target as 16S rRNA nucleotide G527 and characterization of Bacillus subtilis rsmG mutants

    DEFF Research Database (Denmark)

    Nishimura, Kenji; Johansen, Shanna K; Inaoka, Takashi

    2007-01-01

    The methyltransferase RsmG methylates the N7 position of nucleotide G535 in 16S rRNA of Bacillus subtilis (corresponding to G527 in Escherichia coli). Disruption of rsmG resulted in low-level resistance to streptomycin. A growth competition assay revealed that there are no differences in fitness...

  10. Identification of single nucleotide polymorphisms (SNPs) in the 16S rRNA gene of foodborne Bacillus spp.

    Science.gov (United States)

    Fernández-No, I C; Böhme, K; Caamaño-Antelo, S; Barros-Velázquez, J; Calo-Mata, P

    2015-04-01

    The main goal of this work was the identification of single nucleotide polymorphisms (SNPs) in the 16S rRNA gene of foodborne Bacillus spp. that may be useful for typing purposes. These species include, among others, Bacillus cereus, an important pathogenic species involved in food poisoning, and Bacillus licheniformis, Bacillus subtilis and Bacillus pumilus, which are causative agents of food spoilage described as responsible for foodborne disease outbreaks. With this purpose in mind, 52 Bacillus strains isolated from culture collections and fresh and processed food were considered. SNP type "Y" at sites 212 and 476 appeared in the majority of B. licheniformis studied strains. SNP type "R" at site 278 was detected in many strains of the B. subtilis/Bacillus amyloliquefaciens group, while polymorphism "Y" at site 173 was characteristic of the majority of strains of B. cereus/Bacillus thuringiensis group. The analysis of SNPs provided more intra-specific information than phylogenetic analysis in the cases of B. cereus and B. subtilis. Moreover, this study describes novel SNPs that should be considered when designing 16S rRNA-based primers and probes for multiplex-PCR, Real-Time PCR and microarray systems for foodborne Bacillus spp. Copyright © 2014 Elsevier Ltd. All rights reserved.

  11. YgdE is the 2'-O-ribose methyltransferase RlmM specific for nucleotide C2498 in bacterial 23S rRNA

    DEFF Research Database (Denmark)

    Purta, Elzbieta; O'Connor, Michelle; Bujnicki, Janusz M

    2009-01-01

    The rRNAs of Escherichia coli contain four 2'-O-methylated nucleotides. Similar to other bacterial species and in contrast with Archaea and Eukaryota, the E. coli rRNA modifications are catalysed by specific methyltransferases that find their nucleotide targets without being guided by small...... complementary RNAs. We show here that the ygdE gene encodes the methyltransferase that catalyses 2'-O-methylation at nucleotide C2498 in the peptidyl transferase loop of E. coli 23S rRNA. Analyses of rRNAs using MALDI mass spectrometry showed that inactivation of the ygdE gene leads to loss of methylation...... at nucleotide C2498. The loss of ygdE function causes a slight reduction in bacterial fitness. Methylation at C2498 was restored by complementing the knock-out strain with a recombinant copy of ygdE. The recombinant YgdE methyltransferase modifies C2498 in naked 23S rRNA, but not in assembled 50S subunits...

  12. Identification and Analysis of Informative Single Nucleotide Polymorphisms in 16S rRNA Gene Sequences of the Bacillus cereus Group.

    Science.gov (United States)

    Hakovirta, Janetta R; Prezioso, Samantha; Hodge, David; Pillai, Segaran P; Weigel, Linda M

    2016-11-01

    Analysis of 16S rRNA genes is important for phylogenetic classification of known and novel bacterial genera and species and for detection of uncultivable bacteria. PCR amplification of 16S rRNA genes with universal primers produces a mixture of amplicons from all rRNA operons in the genome, and the sequence data generally yield a consensus sequence. Here we describe valuable data that are missing from consensus sequences, variable effects on sequence data generated from nonidentical 16S rRNA amplicons, and the appearance of data displayed by different software programs. These effects are illustrated by analysis of 16S rRNA genes from 50 strains of the Bacillus cereus group, i.e., Bacillus anthracis, Bacillus cereus, Bacillus mycoides, and Bacillus thuringiensis These species have 11 to 14 rRNA operons, and sequence variability occurs among the multiple 16S rRNA genes. A single nucleotide polymorphism (SNP) previously reported to be specific to B. anthracis was detected in some B. cereus strains. However, a different SNP, at position 1139, was identified as being specific to B. anthracis, which is a biothreat agent with high mortality rates. Compared with visual analysis of the electropherograms, basecaller software frequently missed gene sequence variations or could not identify variant bases due to overlapping basecalls. Accurate detection of 16S rRNA gene sequences that include intragenomic variations can improve discrimination among closely related species, improve the utility of 16S rRNA databases, and facilitate rapid bacterial identification by targeted DNA sequence analysis or by whole-genome sequencing performed by clinical or reference laboratories. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  13. Update on Pneumocystis carinii f. sp. hominis typing based on nucleotide sequence variations in internal transcribed spacer regions of rRNA genes

    DEFF Research Database (Denmark)

    Lee, C H; Helweg-Larsen, J; Tang, X

    1998-01-01

    Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from...... the previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types...... are named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study....

  14. Mapping important nucleotides in the peptidyl transferase centre of 23 S rRNA using a random mutagenesis approach

    DEFF Research Database (Denmark)

    Porse, B T; Garrett, R A

    1995-01-01

    Random mutations were generated in the lower half of the peptidyl transferase loop in domain V of 23 S rRNA from Escherichia coli using a polymerase chain reaction (PCR) approach, a rapid procedure for identifying mutants and a plasmid-based expression system. The effects of 21 single-site mutati......Random mutations were generated in the lower half of the peptidyl transferase loop in domain V of 23 S rRNA from Escherichia coli using a polymerase chain reaction (PCR) approach, a rapid procedure for identifying mutants and a plasmid-based expression system. The effects of 21 single......-site mutations, at 18 different positions, on cell growth, mutant rRNA incorporation into ribosomes and peptidyl transferase activity of the mutant ribosomes were analysed. The general importance of the whole region for the peptidyl transferase centre was emphasized by the finding that 14 of the mutants were...... sick, or very sick, when ribosomes containing chromosomal-encoded 23 S rRNA were inhibited by erythromycin, and all except one of these exhibited low levels of peptidyl transferase activity in their mutated ribosomes. Two mutations, psi 2580-->C and U2584-->G that both yielded inactive ribosomes were...

  15. Identification of 5-hydroxycytidine at position 2501 concludes characterization of modified nucleotides in E. coli 23S rRNA

    DEFF Research Database (Denmark)

    Havelund, Jesper Foged; Giessing, Anders Michael Bernth; Hansen, Trine Møller

    2011-01-01

    modification as 5-hydroxycytidine-a novel modification in RNA. Identification of 5-hydroxycytidine was completed by liquid chromatography under nonoxidizing conditions using a graphitized carbon stationary phase in combination with ion trap tandem mass spectrometry and by comparing the fragmentation behavior...... rRNA-has previously been characterized in the bacterium Escherichia coli. Despite a first report nearly 20 years ago, the chemical nature of the modification at position 2501 has remained elusive, and attempts to isolate it have so far been unsuccessful. We unambiguously identify this last unknown...... of the natural nucleoside with that of a chemically synthesized ditto. Furthermore, we show that 5-hydroxycytidine is also present in the equivalent position of 23S rRNA from the bacterium Deinococcus radiodurans. Given the unstable nature of 5-hydroxycytidine, this modification might be found in other RNAs when...

  16. Events during eucaryotic rRNA transcription initiation and elongation: Conversion from the closed to the open promoter complex requires nucleotide substrates

    Energy Technology Data Exchange (ETDEWEB)

    Bateman, E.; Paule, M.R.

    1988-05-01

    Chemical footprinting and topological analysis were carried out on the Acanthamoeba castellanii rRNA transcription initiation factor (TIF) and RNA polymerase I complexes with DNA during transcription initiation and elongation. The results show that the binding of TIF and polymerase to the promoter does not alter the supercoiling of the DNA template and the template does not become sensitive to modification by diethylpyro-carbonate, which can identify melted DNA regions. Thus, in contrast to bacterial RNA polymerase, the eucaryotic RNA polymerase I-promoter complex is in a closed configuration preceding addition of nucleotides in vitro. Initiation and 3'-O-methyl CTP-limited translocation by RNA polymerase I results in separation of the polymerase-TIF footprints, leaving the TIF footprint unaltered. In contrast, initiation and translocation result in a significant change in the conformation of the polymerase-DNA complex, culminating in an unwound DNA region of at least 10 base pairs.

  17. Resistance to the macrolide antibiotic tylosin is conferred by single methylations at 23S rRNA nucleotides G748 and A2058 acting in synergy

    Science.gov (United States)

    Liu, Mingfu; Douthwaite, Stephen

    2002-01-01

    The macrolide antibiotic tylosin has been used extensively in veterinary medicine and exerts potent antimicrobial activity against Gram-positive bacteria. Tylosin-synthesizing strains of the Gram-positive bacterium Streptomyces fradiae protect themselves from their own product by differential expression of four resistance determinants, tlrA, tlrB, tlrC, and tlrD. The tlrB and tlrD genes encode methyltransferases that add single methyl groups at 23S rRNA nucleotides G748 and A2058, respectively. Here we show that methylation by neither TlrB nor TlrD is sufficient on its own to give tylosin resistance, and resistance is conferred by the G748 and A2058 methylations acting together in synergy. This synergistic mechanism of resistance is specific for the macrolides tylosin and mycinamycin that possess sugars extending from the 5- and 14-positions of the macrolactone ring and is not observed for macrolides, such as carbomycin, spiramycin, and erythromycin, that have different constellations of sugars. The manner in which the G748 and A2058 methylations coincide with the glycosylation patterns of tylosin and mycinamycin reflects unambiguously how these macrolides fit into their binding site within the bacterial 50S ribosomal subunit. PMID:12417742

  18. Modified nucleotides m2G966/m5C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon

    Science.gov (United States)

    Prokhorova, Irina V.; Osterman, Ilya A.; Burakovsky, Dmitry E.; Serebryakova, Marina V.; Galyamina, Maria A.; Pobeguts, Olga V.; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G.; Govorun, Vadim M.; Bogdanov, Alexey A.; Sergiev, Petr V.; Dontsova, Olga A.

    2013-11-01

    Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show - using proteomic analysis and dual fluorescence reporter in vivo assays - that m2G966 and m5C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m2G966 and m5C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon.

  19. Nucleotide sequence of the leading region adjacent to the origin of transfer on plasmid F and its conservation among conjugative plasmids.

    Science.gov (United States)

    Loh, S; Cram, D; Skurray, R

    1989-10-01

    The leading region of the Escherichia coli K12 F plasmid is the first segment of DNA to be transferred into the recipient cell during conjugal transfer. We report the nucleotide sequence of the 64.20-66.77F portion of the leading region immediately adjacent to the origin of transfer, oriT. The 2582 bp region encodes three open reading frames, ORF95, ORF169 and ORF273; the product of ORF273, is equivalent in size and map location to the 35 kDa protein, 6d, previously described (Cram et al. 1984). S1 nuclease analyses of mRNA transcripts have identified a potential promoter for ORF95 and ORF273 and indicated that these ORFs are transcribed as a single transcript; in contrast, ORF169 appears to be transcribed from two overlapping promoters on the complementary DNA strand. The products of ORF95 and ORF273 are mainly hydrophilic and are probably located in the cytoplasm. ORF273 shares some homology with DNA-binding proteins. There is a signal peptide sequence at the NH2-terminus of ORF169 and the mature form of ORF169 probably resides in the periplasm due to its hydrophilic nature. Both ORF273 and ORF169 are well conserved among conjugative F-like and a few non-F-like plasmids. On the other hand, ORF95 sequences are only present on some of these plasmids. Several primosome and integration host factor recognition sites are present implicating this region in DNA metabolism and/or replication functions.

  20. Development of a simple and practical method of discrimination between Vibrio furnissii and V. fluvialis based on single-nucleotide polymorphisms of 16S rRNA genes observed in V. furnissii but not in V. fluvialis.

    Science.gov (United States)

    Takajo, Ichiro; Yamada, Akiteru; Umeki, Kazumi; Saeki, Yuji; Hashikura, Yuuki; Yamamoto, Ikuo; Umekita, Kunihiko; Urayama-Kawano, Midori; Yamasaki, Shogo; Taniguchi, Takako; Misawa, Naoaki; Okayama, Akihiko

    2018-01-01

    Vibrio furnissii and V. fluvialis are closely related, the discrimination of which by conventional biochemical assay remains a challenge. Investigation of the sequence of the 16S rRNA genes in a clinical isolate of V. furnissii by visual inspection of a sequencing electropherogram revealed two sites of single-nucleotide polymorphisms (SNPs; positions 460 A/G and 1261 A/G) in these genes. A test of 12 strains each of V. fluvialis and V. furnissii revealed these SNPs to be common in V. furnissii but not in V. fluvialis. Divergence of SNP frequency was observed among the strains of V. furnissii tested. Because the SNPs described in V. furnissii produce a difference in the target sequence of restriction enzymes, a combination of polymerase chain reaction (PCR) of the 16S rRNA genes using conventional primers and restriction fragment length polymorphism analysis using Eco RV and Eae I was shown to discriminate between V. fluvialis and V. furnissii. This method is simple and alleviates the need for expensive equipment or primer sets specific to these bacteria. Therefore, we believe that this method can be useful, alongside specific PCR and mass spectrometry, when there is a need to discriminate between V. fluvialis and V. furnissii. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Mycoplasma bovis isolates from dairy calves in Japan have less susceptibility than a reference strain to all approved macrolides associated with a point mutation (G748A) combined with multiple species-specific nucleotide alterations in 23S rRNA.

    Science.gov (United States)

    Sato, Toyotaka; Higuchi, Hidetoshi; Yokota, Shin-Ichi; Tamura, Yutaka

    2017-06-01

    Erythromycin, tylosin and tilmicosin are approved for use in cattle in Japan, the latter two being used to treat Mycoplasma bovis infection. In this study, 58 M. bovis isolates obtained from Japanese dairy calves all exhibited reduced susceptibility to these macrolides, this widespread reduced susceptibility being attributable to a few dominant lineages. All 58 isolates contained the G748A variant in both the rrl3 and rrl4 alleles of 23S rRNA, whereas a reference strain (PG45) did not. G748 localizes in the central loop of domain II (from C744 to A753) of 23S rRNA, which participates in binding to mycinose, a sugar residue present in both tylosin and tilmicosin. A number of in vitro-selected mutants derived from M. bovis PG45 showed reduced susceptibility to tylosin and tilmicosin and contained a nucleotide insertion within the central loop of domain II of rrl3 (U747-G748Ins_CU/GU or A743-U744Ins_UA), suggesting that mutations around G748 confer this reduced susceptibility phenotype. However, other Mycoplasma species containing G748A were susceptible to tylosin and tilmicosin. Sequence comparison with Escherichia coli revealed that M. bovis PG45 and isolates harbored five nucleotide alterations (U744C, G745A, U746C, A752C and A753G) in the central loop of domain II of 23S rRNA, whereas other Mycoplasma species lacked at least two of these five nucleotide alterations. It was therefore concluded that G748 mutations in combination with species-specific nucleotide alterations in the central loop of domain II of 23S rRNA are likely sufficient to reduce susceptibility of M. bovis to tylosin and tilmicosin. © 2017 The Societies and John Wiley & Sons Australia, Ltd.

  2. Nucleotide sequence of an external transcribed spacer in Xenopus laevis rDNA: sequences flanking the 5' and 3' ends of 18S rRNA are non-complementary.

    OpenAIRE

    Maden, B E; Moss, M; Salim, M

    1982-01-01

    We have sequenced the external transcribed spacer (ETS) of a ribosomal transcription unit from Xenopus laevis, together with sections of the preceding non-transcribed spacer. Our analysis was carried out on the same cloned transcription unit as that from which the internal transcribed spacers (ITS) were previously sequenced. The ETS is approximately 712 nucleotides long and, like the ITS regions, is generally very rich in C plus G. Features of the sequence include an excess of oligo-C tracts ...

  3. Structure of mouse rRNA precursors. Complete sequence and potential folding of the spacer regions between 18S and 28S rRNA.

    OpenAIRE

    Michot, B; Bachellerie, J P; Raynal, F

    1983-01-01

    We have determined the complete nucleotide sequence of the regions of mouse ribosomal RNA transcription unit which separate mature rRNA genes. These internal transcribed spacers (ITS) are excised from rRNA precursor during ribosome biosynthesis. ITS 1, between 18S and 5.8S rRNA genes, is 999 nucleotides long. ITS 2, between 5.8S and 28S rRNA genes, is 1089 nucleotides long. Both spacers are very rich in G + C, 70 and 74% respectively. Mouse sequences have been compared with the other availabl...

  4. Nucleotide sequence of an external transcribed spacer in Xenopus laevis rDNA: sequences flanking the 5' and 3' ends of 18S rRNA are non-complementary.

    Science.gov (United States)

    Maden, B E; Moss, M; Salim, M

    1982-04-10

    We have sequenced the external transcribed spacer (ETS) of a ribosomal transcription unit from Xenopus laevis, together with sections of the preceding non-transcribed spacer. Our analysis was carried out on the same cloned transcription unit as that from which the internal transcribed spacers (ITS) were previously sequenced. The ETS is approximately 712 nucleotides long and, like the ITS regions, is generally very rich in C plus G. Features of the sequence include an excess of oligo-C tracts over oligo-G tracts and a tract of 37 nucleotides consisting almost entirely of G and A residues. Parts of the sequence can give rise to stable internal secondary structures. However, in contrast to Escherichia coli, there is no potential for major base-pairing between the 18S flanking regions of the ETS and ITS. Further findings are that there are no initiation (ATG) codons in the ETS and that, as in other X.laevis rDNA cloned units, the sequence preceding the ETS is duplicated, with a few changes, in the "Bam island" sequence of the non-transcribed spacer.

  5. Nucleotide Metabolism

    DEFF Research Database (Denmark)

    Martinussen, Jan; Willemoës, M.; Kilstrup, Mogens

    2011-01-01

    Metabolic pathways are connected through their utilization of nucleotides as supplier of energy, allosteric effectors, and their role in activation of intermediates. Therefore, any attempt to exploit a given living organism in a biotechnological process will have an impact on nucleotide metabolism...

  6. Structure of mouse rRNA precursors. Complete sequence and potential folding of the spacer regions between 18S and 28S rRNA.

    Science.gov (United States)

    Michot, B; Bachellerie, J P; Raynal, F

    1983-05-25

    We have determined the complete nucleotide sequence of the regions of mouse ribosomal RNA transcription unit which separate mature rRNA genes. These internal transcribed spacers (ITS) are excised from rRNA precursor during ribosome biosynthesis. ITS 1, between 18S and 5.8S rRNA genes, is 999 nucleotides long. ITS 2, between 5.8S and 28S rRNA genes, is 1089 nucleotides long. Both spacers are very rich in G + C, 70 and 74% respectively. Mouse sequences have been compared with the other available eukaryotes: while no homology is apparent with yeast or xenopus, mouse and rat ITS sequences have been largely conserved, with homologous segments interspersed with highly divergent tracts. Homology with rat is much more extensive for ITS 1 than for ITS 2. Tentative secondary structure models are proposed for the folding of these regions within rRNA precursor; they are closely related in mouse and rat.

  7. Cervical Adjacent Segment Disease

    OpenAIRE

    Özbek, Zühtü; Özkara, Emre; Yağmur, İpek; Arslantaş, Ali

    2017-01-01

    Cervical adjacent segment disease; is the general name ofdisc pathologies that develop in adjacent levels after cervical surgery. If thecervical adjacent segment disease that do not require reoperation and it doesnot cause clinical signs is called radiological cervical adjacent segmentpathology, but those causing radiculopathy, myelopathy or instability is calledclinic cervical adjacent segment pathology. The incidence of cervical adjacentsegment disease in 10-year follow-up is 2.4% -2.9%. Wh...

  8. Pseudoknot in domain II of 23 S rRNA is essential for ribosome function

    DEFF Research Database (Denmark)

    Rosendahl, G; Hansen, L H; Douthwaite, S

    1995-01-01

    The structure of domain II in all 23 S (and 23 S-like) rRNAs is constrained by a pseudoknot formed between nucleotides 1005 and 1138, and between 1006 and 1137 (Escherichia coli numbering). These nucleotides are exclusively conserved as 1005C.1138G and 1006C.1137G pairs in all Bacteria, Archaea...... increased accessibility in the rRNA structure close to the sites of the mutations. The degree to which the mutations increase rRNA accessibility correlates with the severity of their phenotypic effects. Nucleotide 1131G is extremely reactive to dimethyl sulphate modification in wild-type subunits...

  9. [Characterization of 5S rRNA gene sequence and secondary structure in gymnosperms].

    Science.gov (United States)

    Liu, Zhan-Lin; Zhang, Da-Ming; Wang, Xiao-Ru

    2003-01-01

    diploid hybrid between P. tabulaeformis and P. yunnanensis. Its 5S rDNA composition is consistent with its hybrid origin. 5S rRNA of all gymnosperms published so far could be folded into a general secondary structure. Variation in this secondary structure was detected among species. About 55% of the 120 bp nucleotide positions was variable, in which 68% was on stem regions. Nevertheless, the positions at the end of the stems and those adjacent to loops are conserved. Their stability directly determines the size of the loops. Some mutations such as compensatory base-pair substitutions, and G-U pairing could be regarded as mechanisms for maintaining a stable secondary structure. The loops of the secondary structure are also relatively conserved. It seems that stable helices are necessary for the function of the gene. The conserved nucleotides in the loops are probably involved in the interaction with proteins and/or RNAs or with other nucleotide in the formation of the tertiary structure. However, unlike other reports, Loop E was found quite mutable among pines. These variations together with those on stems might be caused by the presence of pseudogenes among our clones. A preliminary evaluation indicates that only seven of 50 unique sequences are potentially functional genes.

  10. NUCLEOTIDES IN INFANT FEEDING

    Directory of Open Access Journals (Sweden)

    L.G. Mamonova

    2007-01-01

    Full Text Available The article reviews the application of nucleotides-metabolites, playing a key role in many biological processes, for the infant feeding. The researcher provides the date on the nucleotides in the women's milk according to the lactation stages. She also analyzes the foreign experience in feeding newborns with nucleotides-containing milk formulas. The article gives a comparison of nucleotides in the adapted formulas represented in the domestic market of the given products.Key words: children, feeding, nucleotides.

  11. Adjacent segment disease.

    Science.gov (United States)

    Virk, Sohrab S; Niedermeier, Steven; Yu, Elizabeth; Khan, Safdar N

    2014-08-01

    EDUCATIONAL OBJECTIVES As a result of reading this article, physicians should be able to: 1. Understand the forces that predispose adjacent cervical segments to degeneration. 2. Understand the challenges of radiographic evaluation in the diagnosis of cervical and lumbar adjacent segment disease. 3. Describe the changes in biomechanical forces applied to adjacent segments of lumbar vertebrae with fusion. 4. Know the risk factors for adjacent segment disease in spinal fusion. Adjacent segment disease (ASD) is a broad term encompassing many complications of spinal fusion, including listhesis, instability, herniated nucleus pulposus, stenosis, hypertrophic facet arthritis, scoliosis, and vertebral compression fracture. The area of the cervical spine where most fusions occur (C3-C7) is adjacent to a highly mobile upper cervical region, and this contributes to the biomechanical stress put on the adjacent cervical segments postfusion. Studies have shown that after fusion surgery, there is increased load on adjacent segments. Definitive treatment of ASD is a topic of continuing research, but in general, treatment choices are dictated by patient age and degree of debilitation. Investigators have also studied the risk factors associated with spinal fusion that may predispose certain patients to ASD postfusion, and these data are invaluable for properly counseling patients considering spinal fusion surgery. Biomechanical studies have confirmed the added stress on adjacent segments in the cervical and lumbar spine. The diagnosis of cervical ASD is complicated given the imprecise correlation of radiographic and clinical findings. Although radiological and clinical diagnoses do not always correlate, radiographs and clinical examination dictate how a patient with prolonged pain is treated. Options for both cervical and lumbar spine ASD include fusion and/or decompression. Current studies are encouraging regarding the adoption of arthroplasty in spinal surgery, but more long

  12. Pseudoknot in domain II of 23 S rRNA is essential for ribosome function

    DEFF Research Database (Denmark)

    Rosendahl, G; Hansen, L H; Douthwaite, S

    1995-01-01

    The structure of domain II in all 23 S (and 23 S-like) rRNAs is constrained by a pseudoknot formed between nucleotides 1005 and 1138, and between 1006 and 1137 (Escherichia coli numbering). These nucleotides are exclusively conserved as 1005C.1138G and 1006C.1137G pairs in all Bacteria, Archaea...... and chloroplasts, whereas 1005G.1138C and 1006U.1137A pairs occur in Eukarya. We have mutagenized nucleotides 1005C-->G, 1006C-->U, 1137G-->A and 1138G-->C, both individually and in combinations, in a 23 S rRNA gene from the bacterium E. coli. The ability of 23 S rRNA to support cell growth is reduced when either...... increased accessibility in the rRNA structure close to the sites of the mutations. The degree to which the mutations increase rRNA accessibility correlates with the severity of their phenotypic effects. Nucleotide 1131G is extremely reactive to dimethyl sulphate modification in wild-type subunits...

  13. Adjacent segment degeneration

    OpenAIRE

    Birjandi, Alireza

    2012-01-01

    Abstract: Adjacent segment disease (ASD) is defined as degeneration that develops at mobile segments above or below a fused spinal segment and usually develops after spinal fusion or other back surgeries. Nearly 5 decades ago, the medical findings related to ASD were usually released in case reports as a relatively unusual complication of lumbar or lumbosacral fusions. Since the initial reports, ASD has been found to occur more often than the earlier predictions for its prospect incidence. It...

  14. Recognition elements in rRNA for the tylosin resistance methyltransferase RlmA(II)

    DEFF Research Database (Denmark)

    Lebars, Isabelle; Husson, Clotilde; Yoshizawa, Satoko

    2007-01-01

    The methyltransferase RlmA(II) (formerly TlrB) is found in many Gram-positive bacteria, and methylates the N-1 position of nucleotide G748 within the loop of hairpin 35 in 23S rRNA. Methylation of the rRNA by RlmA(II) confers resistance to tylosin and other mycinosylated 16-membered ring macrolide...... are insufficient on their own to support the methylation reaction. Here we use biochemical techniques in conjunction with heteronuclear/homonuclear nuclear magnetic resonance spectroscopy to define the RNA structures that are required for efficient methylation by RlmA(II). Progressive truncation of the r...

  15. Recognition determinants for proteins and antibiotics within 23S rRNA

    DEFF Research Database (Denmark)

    Douthwaite, Stephen Roger; Voldborg, Bjørn Gunnar Rude; Hansen, Lykke Haastrup

    1995-01-01

    -proteins L10.(L12)4 and L11 and is inhibited by interaction with the antibiotic thiostrepton. The peptidyltransferase center within domain V is inhibited by macrolide, lincosamide, and streptogramin B antibiotics, which interact with the rRNA around nucleotide A2058. Drug resistance is conferred by mutations......Ribosomal RNAs fold into phylogenetically conserved secondary and tertiary structures that determine their function in protein synthesis. We have investigated Escherichia coli 23S rRNA to identify structural elements that interact with antibiotic and protein ligands. Using a combination...

  16. DNA sequencing reveals limited heterogeneity in the 16S rRNA gene from the rrnB operon among five Mycoplasma hominis isolates

    DEFF Research Database (Denmark)

    Mygind, T; Birkelund, Svend; Christiansen, Gunna

    1998-01-01

    To investigate the intraspecies heterogeneity within the 16S rRNA gene of Mycoplasma hominis, five isolates with diverse antigenic profiles, variable/identical P120 hypervariable domains, and different 16S rRNA gene RFLP patterns were analysed. The 16S rRNA gene from the rrnB operon was amplified...... by PCR and the PCR products were sequenced. Three isolates had identical 16S rRNA sequences and two isolates had sequences that differed from the others by only one nucleotide....

  17. Two distinct 18S rRNA secondary structures in Dipodascus (Hemiascomycetes).

    Science.gov (United States)

    Ueda-Nishimura, K; Mikata, K

    2000-05-01

    The nucleotide sequences of the 18S rRNA gene from ascomycetous yeast-like fungi in the genera Dipodascus, Galactomyces and Geotrichum were determined and the tested strains were separated into two groups by sequence length. In group 1, the length and secondary structure of 18S rRNA corresponded to those of typical eukaryotes. In group 2, the 18S rRNA gene sequences were about 150 nt shorter than those of most other eukaryotes and the predicted secondary structure lacked helices 10 and E21-5. Many substitutions and some deletions in group 2 18S rRNA gene were not only found in variable regions, but also in regions that are highly conserved among ascomycetes. Despite the considerable differences in 18S rRNA gene sequence and secondary structure between group 2 and other fungi, including group 1, phylogenetic analysis revealed that groups 1 and 2 are closely related. These findings suggest that a number of deletions occurred in the 18S rRNA of the common ancestor of group 2 strains.

  18. Main: Nucleotide Analysis [KOME

    Lifescience Database Archive (English)

    Full Text Available Nucleotide Analysis Japonica genome blast search result Result of blastn search against jap...onica genome sequence kome_japonica_genome_blast_search_result.zip kome_japonica_genome_blast_search_result ...

  19. Recognition determinants for proteins and antibiotics within 23S rRNA

    DEFF Research Database (Denmark)

    Douthwaite, Stephen Roger; Voldborg, Bjørn Gunnar Rude; Hansen, Lykke Haastrup

    1995-01-01

    Ribosomal RNAs fold into phylogenetically conserved secondary and tertiary structures that determine their function in protein synthesis. We have investigated Escherichia coli 23S rRNA to identify structural elements that interact with antibiotic and protein ligands. Using a combination of molecu......Ribosomal RNAs fold into phylogenetically conserved secondary and tertiary structures that determine their function in protein synthesis. We have investigated Escherichia coli 23S rRNA to identify structural elements that interact with antibiotic and protein ligands. Using a combination......-proteins L10.(L12)4 and L11 and is inhibited by interaction with the antibiotic thiostrepton. The peptidyltransferase center within domain V is inhibited by macrolide, lincosamide, and streptogramin B antibiotics, which interact with the rRNA around nucleotide A2058. Drug resistance is conferred by mutations...

  20. Effect of mutations in the A site of 16 S rRNA on aminoglycoside antibiotic-ribosome interaction

    DEFF Research Database (Denmark)

    Recht, M I; Douthwaite, S; Dahlquist, K D

    1999-01-01

    of universally conserved nucleotides at 1406 to 1408 and 1494 to 1495 in the decoding region of plasmid-encoded bacterial 16 S rRNA. Phenotypic changes range from the benign effect of U1406-->A or A1408-->G substitutions, to the highly deleterious 1406G and 1495 mutations that assemble into 30 S subunits...

  1. Sequence of the chloroplast 16S rRNA gene and its surrounding regions of Chlamydomonas reinhardii.

    Science.gov (United States)

    Dron, M; Rahire, M; Rochaix, J D

    1982-01-01

    The sequence of a 2 kb DNA fragment containing the chloroplast 16S ribosomal RNA gene from Chlamydomonas reinhardii and its flanking regions has been determined. The algal 16S rRNA sequence (1475 nucleotides) and secondary structure are highly related to those found in bacteria and in the chloroplasts of higher plants. In contrast, the flanking regions are very different. In C. reinhardii the 16S rRNA gene is surrounded by AT rich segments of about 180 bases, which are followed by a long stretch of complementary bases separated from each other by 1833 nucleotides. It is likely that these structures play an important role in the folding and processing of the precursor of 16S rRNA. The primary and secondary structures of the binding sites of two ribosomal proteins in the 16SrRNAs of E. coli and C. reinhardii are considerably related. Images PMID:6296784

  2. A pseudogene cluster in the leader region of the Euglena chloroplast 16S-23S rRNA genes.

    Science.gov (United States)

    Miyata, T; Kikuno, R; Ohshima, Y

    1982-01-01

    The nucleotide sequence of a region (leader region) preceding the 5'-end of 16S-23S rRNA gene region of Euglena gracilis chloroplast DNA was compared with the homologous sequences that code for the 16S-23S rRNA operons of Euglena and E. coli. The leader region shows close homology in sequence to the 16S-23S rRNA gene region of Euglena (Orozco et al. (1980) J. Biol.Chem. 255, 10997-11003) as well as to the rrnD operon of E. coli, suggesting that it was derived from the 16S-23S rRNA gene region by gene duplication. It was shown that the leader region had accumulated nucleotide substitutions at an extremely rapid rate in its entirety, similar to the rate of tRNAIle pseudogene identified in the leader region. In addition, the leader region shows an unique base content which is quite distinct from those of 16S-23S rRNA gene regions of Euglena and E. coli, but again is similar to that of the tRNAIle pseudogene. The above two results strongly suggest that the leader region contains a pseudogene cluster which was derived from a gene cluster coding for the functional 16S-23S rRNA operon possibly by imperfect duplication during evolution of Euglena chloroplast DNA. PMID:7041094

  3. Modified Method of rRNA Structure Analysis Reveals Novel Characteristics of Box C/D RNA Analogues.

    Science.gov (United States)

    Filippova, J A; Stepanov, G A; Semenov, D V; Koval, O A; Kuligina, E V; Rabinov, I V; Richter, V A

    2015-01-01

    Ribosomal RNA (rRNA) maturation is a complex process that involves chemical modifications of the bases or sugar residues of specific nucleotides. One of the most abundant types of rRNA modifications, ribose 2'-O-methylation, is guided by ribonucleoprotein complexes containing small nucleolar box C/D RNAs. Since the majority of 2'-O-methylated nucleotides are located in the most conserved regions of rRNA that comprise functionally important centers of the ribosome, an alteration in a 2'-O-methylation profile can affect ribosome assembly and function. One of the key approaches for localization of 2'-O-methylated nucleotides in long RNAs is a method based on the termination of reverse transcription. The current study presents an adaptation of this method for the use of fluorescently labeled primers and analysis of termination products by capillary gel electrophoresis on an automated genetic analyzer. The developed approach allowed us to analyze the influence of the synthetic analogues of box C/D RNAs on post-transcriptional modifications of human 28S rRNA in MCF-7 cells. It has been established that the transfection of MCF-7 cells with a box C/D RNA analogue leads to an enhanced modification level of certain native sites of 2'-O-methylation in the target rRNA. The observed effect of synthetic RNAs on the 2'-O-methylation of rRNA in human cells demonstrates a path towards targeted regulation of rRNA post-transcriptional maturation. The described approach can be applied in the development of novel diagnostic methods for detecting diseases in humans.

  4. Cyclic nucleotides and radioresistnace

    International Nuclear Information System (INIS)

    Kulinskij, V.I.; Mikheeva, G.A.; Zel'manovich, B.M.

    1982-01-01

    The addition of glucose to meat-peptone broth does not change the radiosensitizing effect (RSE) of cAMP at the logarithmic phase (LP) and the radioprotective effect (RPE) at the stationary phase (SP), but sensitization, characteristic of cGMP, disappears in SP and turns into RPE in LP. Introduction of glucose into the broth for 20 min eliminates all the effects of both cyclic nucleotides in the cya + strain while cya - mutant exhibits RSE. RSE of both cyclic nucleotides is only manifested on minimal media. These data brought confirmation of the dependence of the influence of cyclic media. These data brought confirmation of the dependence of the influence of cyclic nucleotides on radioresistance upon the metabolic status of the cell [ru

  5. How Much Do rRNA Gene Surveys Underestimate Extant Bacterial Diversity?

    Science.gov (United States)

    Rodriguez-R, Luis M; Castro, Juan C; Kyrpides, Nikos C; Cole, James R; Tiedje, James M; Konstantinidis, Konstantinos T

    2018-03-15

    The most common practice in studying and cataloguing prokaryotic diversity involves the grouping of sequences into operational taxonomic units (OTUs) at the 97% 16S rRNA gene sequence identity level, often using partial gene sequences, such as PCR-generated amplicons. Due to the high sequence conservation of rRNA genes, organisms belonging to closely related yet distinct species may be grouped under the same OTU. However, it remains unclear how much diversity has been underestimated by this practice. To address this question, we compared the OTUs of genomes defined at the 97% or 98.5% 16S rRNA gene identity level against OTUs of the same genomes defined at the 95% whole-genome average nucleotide identity (ANI), which is a much more accurate proxy for species. Our results show that OTUs resulting from a 98.5% 16S rRNA gene identity cutoff are more accurate than 97% compared to 95% ANI (90.5% versus 89.9% accuracy) but indistinguishable from any other threshold in the 98.29 to 98.78% range. Even with the more stringent thresholds, however, the 16S rRNA gene-based approach commonly underestimates the number of OTUs by ∼12%, on average, compared to the ANI-based approach (∼14% underestimation when using the 97% identity threshold). More importantly, the degree of underestimation can become 50% or more for certain taxa, such as the genera Pseudomonas , Burkholderia , Escherichia , Campylobacter , and Citrobacter These results provide a quantitative view of the degree of underestimation of extant prokaryotic diversity by 16S rRNA gene-defined OTUs and suggest that genomic resolution is often necessary. IMPORTANCE Species diversity is one of the most fundamental pieces of information for community ecology and conservational biology. Therefore, employing accurate proxies for what a species or the unit of diversity is are cornerstones for a large set of microbial ecology and diversity studies. The most common proxies currently used rely on the clustering of 16S rRNA

  6. Single Nucleotide Polymorphism

    DEFF Research Database (Denmark)

    Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg

    2014-01-01

    Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification...

  7. Intraspecific sequence variation in 16S rRNA gene of Ureaplasma diversum isolates.

    Science.gov (United States)

    Marques, L M; Buzinhani, M; Guimaraes, A M S; Marques, R C P; Farias, S T; Neto, R L; Yamaguti, M; Oliveira, R C; Timenetsky, J

    2011-08-26

    Ureaplasma diversum infection in bulls may result in seminal vesiculitis, balanoposthitis and alterations in spermatozoids. In cows, it can cause placentitis, fetal alveolitis, abortion and the birth of weak calves. U. diversum ATCC 49782 (serogroups A), ATCC 49783 (serogroup C) and 34 field isolates were used for this study. These microorganisms were submitted to Polymerase Chain Reaction for 16S gene sequence determination using Taq High Fidelity and the products were purified and bi-directionally sequenced. Using the sequence obtained, a fragment containing four hypervariable regions was selected and nucleotide polymorphisms were identified based on their position within the 16S rRNA gene. Forty-four single nucleotide polymorphisms (SNP) were detected. The genotypic variability of the 16S rRNA gene of U. diversum isolates shows that the taxonomy classification of these organisms is likely much more complex than previously described and that 16S rRNA gene sequencing may be used to suggest an epidemiologic pattern of different origin strains. Copyright © 2011 Elsevier B.V. All rights reserved.

  8. Effect of mutations in the A site of 16 S rRNA on aminoglycoside antibiotic-ribosome interaction

    DEFF Research Database (Denmark)

    Recht, M I; Douthwaite, S; Dahlquist, K D

    1999-01-01

    antibiotics, which also interact with this region of rRNA. Mutations of certain nucleotides in rRNA reduce aminoglycoside binding affinity, as previously demonstrated using a model RNA oligonucleotide system. Here, predictions from the oligonucleotide system were tested in the ribosome by mutation...... for the aminoglycoside paromomycin, whereas no discernible reduction in affinity was observed with 1406 mutant ribosomes. These data are consistent with prior NMR structural determination of aminoglycoside interaction with the decoding region, and further our understanding of how aminoglycoside resistance can...

  9. Sequence organization and putative regulatory elements in the 5S rRNA genes of two higher plants (Vigna radiata and Matthiola incana).

    Science.gov (United States)

    Hemleben, V; Werts, D

    1988-01-01

    The tandemly arranged and clustered highly repeated 5S rRNA genes are investigated for two plants belonging to different higher plant families: Matthiola incana (Brassicaceae, Dilleniidae, Rosidae; 3600 5S rRNA genes/n) shows a homogeneous repeat size of 510 bp, whereas Vigna radiata (mung bean, former Phaseolus aureus, Fabaceae, Rosidae; approx. 4300 5S rRNA genes) has a repeat size of 215 bp. The mung-bean 5S rRNA coding region starts 5' with AGG and ends with CCT; Matthiola starts with GGG and ends with CCC. Striking is the strict occurrence of a 'TATA' box starting at nucleotide-28 similar to Neurospora crassa 5S rRNA genes. The 3' end is followed by CTTTT or GTTT stretches present in different numbers in the non-transcribed spacer suggesting a function in termination.

  10. Technologically important extremophile 16S rRNA sequence Shannon entropy and fractal property comparison with long term dormant microbes

    Science.gov (United States)

    Holden, Todd; Gadura, N.; Dehipawala, S.; Cheung, E.; Tuffour, M.; Schneider, P.; Tremberger, G., Jr.; Lieberman, D.; Cheung, T.

    2011-10-01

    Technologically important extremophiles including oil eating microbes, uranium and rocket fuel perchlorate reduction microbes, electron producing microbes and electrode electrons feeding microbes were compared in terms of their 16S rRNA sequences, a standard targeted sequence in comparative phylogeny studies. Microbes that were reported to have survived a prolonged dormant duration were also studied. Examples included the recently discovered microbe that survives after 34,000 years in a salty environment while feeding off organic compounds from other trapped dead microbes. Shannon entropy of the 16S rRNA nucleotide composition and fractal dimension of the nucleotide sequence in terms of its atomic number fluctuation analyses suggest a selected range for these extremophiles as compared to other microbes; consistent with the experience of relatively mild evolutionary pressure. However, most of the microbes that have been reported to survive in prolonged dormant duration carry sequences with fractal dimension between 1.995 and 2.005 (N = 10 out of 13). Similar results are observed for halophiles, red-shifted chlorophyll and radiation resistant microbes. The results suggest that prolonged dormant duration, in analogous to high salty or radiation environment, would select high fractal 16S rRNA sequences. Path analysis in structural equation modeling supports a causal relation between entropy and fractal dimension for the studied 16S rRNA sequences (N = 7). Candidate choices for high fractal 16S rRNA microbes could offer protection for prolonged spaceflights. BioBrick gene network manipulation could include extremophile 16S rRNA sequences in synthetic biology and shed more light on exobiology and future colonization in shielded spaceflights. Whether the high fractal 16S rRNA sequences contain an asteroidlike extra-terrestrial source could be speculative but interesting.

  11. Isolation, crystallization, and investigation of ribosomal protein S8 complexed with specific fragments of rRNA of bacterial or archaeal origin.

    Science.gov (United States)

    Tishchenko, S V; Vassilieva, J M; Platonova, O B; Serganov, A A; Fomenkova, N P; Mudrik, E S; Piendl, W; Ehresmann, C; Ehresmann, B; Garber, M B

    2001-09-01

    The core ribosomal protein S8 binds to the central domain of 16S rRNA independently of other ribosomal proteins and is required for assembling the 30S subunit. It has been shown with E. coli ribosomes that a short rRNA fragment restricted by nucleotides 588-602 and 636-651 is sufficient for strong and specific protein S8 binding. In this work, we studied the complexes formed by ribosomal protein S8 from Thermus thermophilus and Methanococcus jannaschii with short rRNA fragments isolated from the same organisms. The dissociation constants of the complexes of protein S8 with rRNA fragments were determined. Based on the results of binding experiments, rRNA fragments of different length were designed and synthesized in preparative amounts in vitro using T7 RNA-polymerase. Stable S8-RNA complexes were crystallized. Crystals were obtained both for homologous bacterial and archaeal complexes and for hybrid complexes of archaeal protein with bacterial rRNA. Crystals of the complex of protein S8 from M. jannaschii with the 37-nucleotide rRNA fragment from the same organism suitable for X-ray analysis were obtained.

  12. The importance of highly conserved nucleotides in the binding region of chloramphenicol at the peptidyl transfer centre of Escherichia coli 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Vester, Birte; Garrett, Roger Antony

    1988-01-01

    conserved nucleotides. With a view to investigate the function of this RNA region further, four of these conserved nucleotides, including one indirectly implicated in chloramphenicol binding, were selected for mutation in Escherichia coli 23S rRNA using oligonucleotide primers. Mutant RNAs were expressed...

  13. Mechanisms of Streptomycin Resistance: Selection of Mutations in the 16S rRNA Gene Conferring Resistance

    Science.gov (United States)

    Springer, Burkhard; Kidan, Yishak G.; Prammananan, Therdsak; Ellrott, Kerstin; Böttger, Erik C.; Sander, Peter

    2001-01-01

    Chromosomally acquired streptomycin resistance is frequently due to mutations in the gene encoding the ribosomal protein S12, rpsL. The presence of several rRNA operons (rrn) and a single rpsL gene in most bacterial genomes prohibits the isolation of streptomycin-resistant mutants in which resistance is mediated by mutations in the 16S rRNA gene (rrs). Three strains were constructed in this investigation: Mycobacterium smegmatis rrnB, M. smegmatis rpsL3+, and M. smegmatis rrnB rpsL3+. M. smegmatis rrnB carries a single functional rrn operon, i.e., rrnA (comprised of 16S, 23S, and 5S rRNA genes) and a single rpsL+ gene; M. smegmatis rpsL3+ is characterized by the presence of two rrn operons (rrnA and rrnB) and three rpsL+ genes; and M. smegmatis rrnB rpsL3+ carries a single functional rrn operon (rrnA) and three rpsL+ genes. By genetically altering the number of rpsL and rrs alleles in the bacterial genome, mutations in rrs conferring streptomycin resistance could be selected, as revealed by analysis of streptomycin-resistant derivatives of M. smegmatis rrnB rpsL3+. Besides mutations well known to confer streptomycin resistance, novel streptomycin resistance conferring mutations were isolated. Most of the mutations were found to map to a functional pseudoknot structure within the 530 loop region of the 16S rRNA. One of the mutations observed, i.e., 524G→C, severely distorts the interaction between nucleotides 524G and 507C, a Watson-Crick interaction which has been thought to be essential for ribosome function. The use of the single rRNA allelic M. smegmatis strain should help to elucidate the principles of ribosome-drug interactions. PMID:11557484

  14. Macrolide resistance conferred by rRNA mutations in field isolates of Mannheimia haemolytica and Pasteurella multocida

    DEFF Research Database (Denmark)

    Olsen, Anders S; Warrass, Ralf; Douthwaite, Stephen Roger

    2014-01-01

    OBJECTIVES: To determine how resistance to macrolides is conferred in field isolates of Pasteurella multocida and Mannheimia haemolytica that lack previously identified resistance determinants for rRNA methylation, efflux and macrolide-modifying enzymes. METHODS: Isolates of P. multocida and M...... by genome sequencing and primer extension on the rRNAs. RESULTS: Macrolide resistance in one M. haemolytica isolate was conferred by the 23S rRNA mutation A2058G; resistance in three P. multocida isolates were caused by mutations at the neighbouring nucleotide A2059G. In each strain, all six copies...... of the rrn operons encoded the respective mutations. There were no mutations in the ribosomal protein genes rplD or rplV, and no other macrolide resistance mechanism was evident. CONCLUSIONS: High-level macrolide resistance can arise from 23S rRNA mutations in P. multocida and M. haemolytica despite...

  15. ethiopian rift and adjacent highlands

    African Journals Online (AJOL)

    ABSTRACT: Remotely sensed thermal-infrared spectral data can be used to derive surface temperature of any object if the optical and thermal properties are known. In this study 1M band six has been used to assess the spatial variability of the kinetic temperature of the central Ethiopian rift lakes and adjacent highlands.

  16. Phylogenetic relationships of Salmonella based on rRNA sequences

    DEFF Research Database (Denmark)

    Christensen, H.; Nordentoft, Steen; Olsen, J.E.

    1998-01-01

    separated by 16S rRNA analysis and found to be closely related to the Escherichia coli and Shigella complex by both 16S and 23S rRNA analyses. The diphasic serotypes S. enterica subspp. I and VI were separated from the monophasic serotypes subspp. IIIa and IV, including S. bongori, by 23S rRNA sequence...

  17. Single Nucleotide Polymorphism

    DEFF Research Database (Denmark)

    Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg

    2014-01-01

    and briefly describe the methods that are preferred for SNP typing in forensic genetics. In addition, we will illustrate how SNPs can be used as investigative leads in the police investigation by discussing the use of ancestry informative markers and forensic DNA phenotyping. Modern DNA sequencing......Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification...... technologies (also called next generation sequencing or NGS) have the potential to completely transform forensic genetic investigations as we know them today. Here, we will make a short introduction to NGS and explain how NGS may combine analysis of the traditional forensic genetic markers with analysis...

  18. The importance of highly conserved nucleotides in the binding region of chloramphenicol at the peptidyl transfer centre of Escherichia coli 23S ribosomal RNA

    DEFF Research Database (Denmark)

    Vester, Birte; Garrett, Roger Antony

    1988-01-01

    conserved nucleotides. With a view to investigate the function of this RNA region further, four of these conserved nucleotides, including one indirectly implicated in chloramphenicol binding, were selected for mutation in Escherichia coli 23S rRNA using oligonucleotide primers. Mutant RNAs were expressed...... of highly conserved nucleotides in the chloramphenicol binding region. A mechanistic model is also presented to explain the disruptive effect of chloramphenicol (and other antibiotics) on peptide bond formation at the ribosomal subunit interface....

  19. Variable Copy Number, Intra-Genomic Heterogeneities and Lateral Transfers of the 16S rRNA Gene in Pseudomonas

    Science.gov (United States)

    Bodilis, Josselin; Nsigue-Meilo, Sandrine; Besaury, Ludovic; Quillet, Laurent

    2012-01-01

    Even though the 16S rRNA gene is the most commonly used taxonomic marker in microbial ecology, its poor resolution is still not fully understood at the intra-genus level. In this work, the number of rRNA gene operons, intra-genomic heterogeneities and lateral transfers were investigated at a fine-scale resolution, throughout the Pseudomonas genus. In addition to nineteen sequenced Pseudomonas strains, we determined the 16S rRNA copy number in four other Pseudomonas strains by Southern hybridization and Pulsed-Field Gel Electrophoresis, and studied the intra-genomic heterogeneities by Denaturing Gradient Gel Electrophoresis and sequencing. Although the variable copy number (from four to seven) seems to be correlated with the evolutionary distance, some close strains in the P. fluorescens lineage showed a different number of 16S rRNA genes, whereas all the strains in the P. aeruginosa lineage displayed the same number of genes (four copies). Further study of the intra-genomic heterogeneities revealed that most of the Pseudomonas strains (15 out of 19 strains) had at least two different 16S rRNA alleles. A great difference (5 or 19 nucleotides, essentially grouped near the V1 hypervariable region) was observed only in two sequenced strains. In one of our strains studied (MFY30 strain), we found a difference of 12 nucleotides (grouped in the V3 hypervariable region) between copies of the 16S rRNA gene. Finally, occurrence of partial lateral transfers of the 16S rRNA gene was further investigated in 1803 full-length sequences of Pseudomonas available in the databases. Remarkably, we found that the two most variable regions (the V1 and V3 hypervariable regions) had probably been laterally transferred from another evolutionary distant Pseudomonas strain for at least 48.3 and 41.6% of the 16S rRNA sequences, respectively. In conclusion, we strongly recommend removing these regions of the 16S rRNA gene during the intra-genus diversity studies. PMID:22545126

  20. The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara Elizabeth

    2016-05-11

    Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

  1. Ketolide antimicrobial activity persists after disruption of interactions with domain II of 23S rRNA.

    Science.gov (United States)

    Novotny, Guy W; Jakobsen, Lene; Andersen, Niels M; Poehlsgaard, Jacob; Douthwaite, Stephen

    2004-10-01

    Ketolides are the latest derivatives developed from the macrolide erythromycin to improve antimicrobial activity. All macrolides and ketolides bind to the 50S ribosomal subunit, where they come into contact with adenosine 2058 (A2058) within domain V of the 23S rRNA and block protein synthesis. An additional interaction at nucleotide A752 in the rRNA domain II is made via the synthetic carbamate-alkyl-aryl substituent in the ketolides HMR3647 (telithromycin) and HMR3004, and this interaction contributes to their improved activities. Only a few macrolides, including tylosin, come into contact with domain II of the rRNA and do so via interactions with nucleotides G748 and A752. We have disrupted these macrolide-ketolide interaction sites in the rRNA to assess their relative importance for binding. Base substitutions at A752 were shown to confer low levels of resistance to telithromycin but not to HMR3004, while deletion of A752 confers low levels of resistance to both ketolides. Mutations at position 748 confer no resistance. Substitution of guanine at A2058 gives rise to the MLS(B) (macrolide, lincosamide, and streptogramin B) phenotype, which confers resistance to all the drugs. However, resistance to ketolides was abolished when the mutation at position 2058 was combined with a mutation in domain II of the same rRNA. In contrast, the same dual mutations in rRNAs conferred enhanced resistance to tylosin. Our results show that the domain II interactions of telithromycin and HMR3004 differ from each other and from those of tylosin. The data provide no indication that mutations within domain II, either alone or in combination with an A2058 mutation, can confer significant levels of telithromycin resistance.

  2. Interaction of the tylosin-resistance methyltransferase RlmA II at its rRNA target differs from the orthologue RlmA I

    DEFF Research Database (Denmark)

    Douthwaite, Stephen; Jakobsen, Lene; Yoshizawa, Satoko

    2008-01-01

    RlmA(II) methylates the N1-position of nucleotide G748 in hairpin 35 of 23 S rRNA. The resultant methyl group extends into the peptide channel of the 50 S ribosomal subunit and confers resistance to tylosin and other mycinosylated macrolide antibiotics. Methylation at G748 occurs in several groups...... of Gram-positive bacteria, including the tylosin-producer Streptomyces fradiae and the pathogen Streptococcus pneumoniae. Recombinant S. pneumoniae RlmA(II) was purified and shown to retain its activity and specificity in vitro when tested on unmethylated 23 S rRNA substrates. RlmA(II) makes multiple...

  3. Intra-Genomic Heterogeneity in 16S rRNA Genes in Strictly Anaerobic Clinical Isolates from Periodontal Abscesses

    Science.gov (United States)

    Chen, Jiazhen; Miao, Xinyu; Xu, Meng; He, Junlin; Xie, Yi; Wu, Xingwen; Chen, Gang; Yu, Liying; Zhang, Wenhong

    2015-01-01

    Background Members of the genera Prevotella, Veillonella and Fusobacterium are the predominant culturable obligate anaerobic bacteria isolated from periodontal abscesses. When determining the cumulative number of clinical anaerobic isolates from periodontal abscesses, ambiguous or overlapping signals were frequently encountered in 16S rRNA gene sequencing chromatograms, resulting in ambiguous identifications. With the exception of the genus Veillonella, the high intra-chromosomal heterogeneity of rrs genes has not been reported. Methods The 16S rRNA genes of 138 clinical, strictly anaerobic isolates and one reference strain were directly sequenced, and the chromatograms were carefully examined. Gene cloning was performed for 22 typical isolates with doublet sequencing signals for the 16S rRNA genes, and four copies of the rrs-ITS genes of 9 Prevotella intermedia isolates were separately amplified by PCR, sequenced and compared. Five conserved housekeeping genes, hsp60, recA, dnaJ, gyrB1 and rpoB from 89 clinical isolates of Prevotella were also amplified by PCR and sequenced for identification and phylogenetic analysis along with 18 Prevotella reference strains. Results Heterogeneity of 16S rRNA genes was apparent in clinical, strictly anaerobic oral bacteria, particularly in the genera Prevotella and Veillonella. One hundred out of 138 anaerobic strains (72%) had intragenomic nucleotide polymorphisms (SNPs) in multiple locations, and 13 strains (9.4%) had intragenomic insertions or deletions in the 16S rRNA gene. In the genera Prevotella and Veillonella, 75% (67/89) and 100% (19/19) of the strains had SNPs in the 16S rRNA gene, respectively. Gene cloning and separate amplifications of four copies of the rrs-ITS genes confirmed that 2 to 4 heterogeneous 16S rRNA copies existed. Conclusion Sequence alignment of five housekeeping genes revealed that intra-species nucleotide similarities were very high in the genera Prevotella, ranging from 94.3–100%. However, the

  4. Development of an oligonucleotide probe for Aureobasidium pullulans based on the small-subunit rRNA gene.

    Science.gov (United States)

    Li, S; Cullen, D; Hjort, M; Spear, R; Andrews, J H

    1996-01-01

    Aureobasidium pullulans, a cosmopolitan yeast-like fungus, colonizes leaf surfaces and has potential as a biocontrol agent of pathogens. To assess the feasibility of rRNA as a target for A. pullulans-specific oligonucleotide probes, we compared the nucleotide sequences of the small-subunit rRNA (18S) genes of 12 geographically diverse A. pullulans strains. Extreme sequence conservation was observed. The consensus A. pullulans sequence was compared with other fungal sequences to identify potential probes. A 21-mer probe which hybridized to the 12 A. pullulans strains but not to 98 other fungi, including 82 isolates from the phylloplane, was identified. A 17-mer highly specific for Cladosporium herbarum was also identified. These probes have potential in monitoring and quantifying fungi in leaf surface and other microbial communities. PMID:8633850

  5. The Identification of Discriminating Patterns from 16S rRNA Gene to Generate Signature for Bacillus Genus.

    Science.gov (United States)

    More, Ravi P; Purohit, Hemant J

    2016-08-01

    The 16S ribosomal RNA (16S rRNA) gene has been widely used for the taxonomic classification of bacteria. A molecular signature is a set of nucleotide patterns, which constitute a regular expression that is specific to each particular taxon. Our main goal was to identify discriminating nucleotide patterns in 16S rRNA gene and then to generate signatures for taxonomic classification. To demonstrate our approach, we used the phylum Firmicutes as a model using representative taxa Bacilli (class), Bacillales (order), Bacillaceae (family), and Bacillus (genus), according to their dominance at each hierarchical taxonomic level. We applied combined composite vector and multiple sequence alignment approaches to generate gene-specific signatures. Further, we mapped all the patterns into the different hypervariable regions of 16S rRNA gene and confirmed the most appropriate distinguishing region as V3-V4 for targeted taxa. We also examined the evolution in discriminating patterns of signatures across taxonomic levels. We assessed the comparative classification accuracy of signatures with other methods (i.e., RDP Classifier, KNN, and SINA). Results revealed that the signatures for taxa Bacilli, Bacillales, Bacillaceae, and Bacillus could correctly classify isolate sequences with sensitivity of 0.99, 0.97, 0.94, and 0.89, respectively, and specificity close to 0.99. We developed signature-based software DNA Barcode Identification (DNA BarID) for taxonomic classification that is available at website http://www.neeri.res.in/DNA_BarID.htm . This pattern-based study provides a deeper understanding of taxon-specific discriminating patterns in 16S rRNA gene with respect to taxonomic classification.

  6. Insights into the structure, function and evolution of the radical-SAM 23S rRNA methyltransferase Cfr that confers antibiotic resistance in bacteria

    DEFF Research Database (Denmark)

    Karminska, K. H.; Purta, E.; Hansen, L .H.

    2010-01-01

    The Cfr methyltransferase confers combined resistance to five classes of antibiotics that bind to the peptidyl tranferase center of bacterial ribosomes by catalyzing methylation of the C-8 position of 23S rRNA nucleotide A2503. The same nucleotide is targeted by the housekeeping methyltransferase...... of a 4Fe-4S cluster, a SAM molecule coordinated to the iron-sulfur cluster (SAM1) and a SAM molecule that is the putative methyl group donor (SAM2). All mutations at predicted functional sites affect Cfr activity significantly as assayed by antibiotic susceptibility testing and primer extension analysis...

  7. [TYPING OF LEPTOSPIRA SPP. STRAINS BASED ON 16S rRNA].

    Science.gov (United States)

    Ostankova, Yu V; Semenov, A V; Stoyanova, N A; Tokarevich, N K; Lyubimova, N E; Petrova, O A; Ananina, Yu V; Petrov, E M

    2016-01-01

    Comparative typing of Leptospira spp. strain collection based on analysis of 16S RNA fragment. 2 pairs of primers were used for PCR, that jointly flank 1423b.p. sized fragment. Sequences of Leptospira spp. strain 16S rRNA, presented in the international database, were used for phylogenetic analysis. A high similarity, including interspecies, of the 16S fragment in Leptospira spp. strains was shown independently of the source, serovar and serogroup. Heterogeneity of the primary matrix, spontaneous mutations of hotspots and erroneous nucleotide couplings, characteristic for 16S sequence of pathogenic Leptospira spp. strains, are discussed. Molecular-genetic characteristic of certain reference Leptospira spp. strains by 16S sequence is obtained. Results of the studies give evidence on expedience of introduction into clinical practice of identification of Leptospira spp. by 16S sequence directly from the clinical material, that would allow to significantly reduce identification time, dismiss complex type-specific sera and other labor-intensive methods.

  8. Multi-site-specific 16S rRNA methyltransferase RsmF from Thermus thermophilus

    DEFF Research Database (Denmark)

    Demirci, Hasan; Larsen, Line H G; Hansen, Trine

    2010-01-01

    Cells devote a significant effort toward the production of multiple modified nucleotides in rRNAs, which fine tune the ribosome function. Here, we report that two methyltransferases, RsmB and RsmF, are responsible for all four 5-methylcytidine (m(5)C) modifications in 16S rRNA of Thermus...... thermophilus. Like Escherichia coli RsmB, T. thermophilus RsmB produces m(5)C967. In contrast to E. coli RsmF, which introduces a single m(5)C1407 modification, T. thermophilus RsmF modifies three positions, generating m(5)C1400 and m(5)C1404 in addition to m(5)C1407. These three residues are clustered near...

  9. Patents and Antitrust: Application to Adjacent Markets

    OpenAIRE

    Nicholas Economides; William N. Hebert

    2007-01-01

    We examine the intersection of patents and antitrust where a patent holder uses the monopoly power it possesses in the market for a patented product to exclude competitors in an adjacent market and attempt to monopolize or monopolize the adjacent market. The present scheme for awarding patents cannot judge when the issuance of a patent will lead to the appropriate balance between innovation and efficiency. Where a patent holder’s invention uses an interface with adjacent products, the patent ...

  10. Mutations in 23S rRNA at the Peptidyl Transferase Center and Their Relationship to Linezolid Binding and Cross-Resistance

    DEFF Research Database (Denmark)

    Long, Katherine; Munck, Christian

    2010-01-01

    The oxazolidinone antibiotic linezolid targets the peptidyl transferase center (PTC) on the bacterial ribosome. Thirteen single and four double 23S rRNA mutations were introduced into a Mycobacterium smegmatis strain with a single rRNA operon. Converting bacterial base identity by single mutations...... at positions 2032, 2453, and 2499 to human cytosolic base identity did not confer significantly reduced susceptibility to linezolid. The largest decrease in linezolid susceptibility for any of the introduced single mutations was observed with the G2576U mutation at a position that is 7.9 Å from linezolid....... Smaller decreases were observed with the A2503G, U2504G, and G2505A mutations at nucleotides proximal to linezolid, showing that the degree of resistance conferred is not simply inversely proportional to the nucleotide-drug distance. The double mutations G2032A-C2499A, G2032A-U2504G, C2055A-U2504G, and C...

  11. Nucleotide excision repair in yeast

    NARCIS (Netherlands)

    Eijk, Patrick van

    2012-01-01

    Nucleotide Excision Repair (NER) is a conserved DNA repair pathway capable of removing a broad spectrum of DNA damage. In human cells a defect in NER leads to the disorder Xeroderma pigmentosum (XP). The yeast Saccharomyces cerevisiae is an excellent model organism to study the mechanism of NER. The

  12. Comparison of primary and secondary 26S rRNA structures in two Tetrahymena species: evidence for a strong evolutionary and structural constraint in expansion segments

    DEFF Research Database (Denmark)

    Engberg, J; Nielsen, Henrik; Lenaers, G

    1990-01-01

    . These are regions within the common core of secondary structure where expansions have taken place during the evolution of the rRNA of higher eukaryotes. The dispensable nature of some of the expansion segments has been taken as evidence of their non-functionality. However, our data show that a considerable......We have determined the nucleotide sequence of the 26S large subunit (LSU) rRNA genes for two Tetrahymena species, T. thermophila and T. pyriformis. The inferred rRNA sequences are presented in their most probable secondary structures based on compensatory mutations, energy, and conservation...... selective constraint has operated to preserve the secondary structure of these segments. Especially in the case of the D2 and D8 segments, the presence of a considerable number of compensatory base changes suggests that the secondary structure of these regions is of functional importance. Alternatively...

  13. ANALISA URUTAN GEN 16S rRNA DARI BAKTERI ORAL YANG TIDAK DIKENAL

    Directory of Open Access Journals (Sweden)

    Ariana Djais

    2015-07-01

    Full Text Available The purpose of this study was to identify five unknown bacterial strains by using 16S rRNA gene sequencing. These strains isolated from endodontic lesions and periodontal pocket are culture-difficult and inert in most biochemical tests, and could not be classified to any established bacterial species by conventional bacteriological method. In the present study, genomic DNA was extracted from the cultured bacterial cells with InstaGene (BIO-RAD, and the 16S rRNA gene was amplified by PCR with universal primers (27F and 1492R and Premix Taq (Ex Taq version, Takara, then was sequenced by using a Thermo Sequence Fluorescent Labelled Primer Cycle Sequencing Kit (Amersham and an ALFexpress DNA sequencer (Pharmacin LKB. The segmented nucleotide sequences of 16S rDNA were integrated by using SEQMAN in LASERGENE computer program (DNASTAR. The 16S rDNA sequences of the unknown bacterial strain were applied to GenBank by using BLAST program to search the suspected bacterial species . The MEGALIGN search program showed that the sequence similarities were 89.5% - 91.3% to a type strain of Dialister pneumosintes among the established bacterial species. Based on the phylogenetic data, it is considered that the five unknown strains have to be presented a new bacterial species as Dialister-like bacterium.

  14. Phylogenetic inference of Coxiella burnetii by 16S rRNA gene sequencing.

    Directory of Open Access Journals (Sweden)

    Heather P McLaughlin

    Full Text Available Coxiella burnetii is a human pathogen that causes the serious zoonotic disease Q fever. It is ubiquitous in the environment and due to its wide host range, long-range dispersal potential and classification as a bioterrorism agent, this microorganism is considered an HHS Select Agent. In the event of an outbreak or intentional release, laboratory strain typing methods can contribute to epidemiological investigations, law enforcement investigation and the public health response by providing critical information about the relatedness between C. burnetii isolates collected from different sources. Laboratory cultivation of C. burnetii is both time-consuming and challenging. Availability of strain collections is often limited and while several strain typing methods have been described over the years, a true gold-standard method is still elusive. Building upon epidemiological knowledge from limited, historical strain collections and typing data is essential to more accurately infer C. burnetii phylogeny. Harmonization of auspicious high-resolution laboratory typing techniques is critical to support epidemiological and law enforcement investigation. The single nucleotide polymorphism (SNP -based genotyping approach offers simplicity, rapidity and robustness. Herein, we demonstrate SNPs identified within 16S rRNA gene sequences can differentiate C. burnetii strains. Using this method, 55 isolates were assigned to six groups based on six polymorphisms. These 16S rRNA SNP-based genotyping results were largely congruent with those obtained by analyzing restriction-endonuclease (RE-digested DNA separated by SDS-PAGE and by the high-resolution approach based on SNPs within multispacer sequence typing (MST loci. The SNPs identified within the 16S rRNA gene can be used as targets for the development of additional SNP-based genotyping assays for C. burnetii.

  15. Negative in vitro selection identifies the rRNA recognition motif for ErmE methyltransferase

    DEFF Research Database (Denmark)

    Nielsen, A K; Douthwaite, S; Vester, B

    1999-01-01

    Erm methyltransferases modify bacterial 23S ribosomal RNA at adenosine 2058 (A2058, Escherichia coli numbering) conferring resistance to macrolide, lincosamide, and streptogramin B (MLS) antibiotics. The motif that is recognized by Erm methyltransferases is contained within helix 73 of 23S r......RNA and the adjacent single-stranded region around A2058. An RNA transcript of 72 nt that displays this motif functions as an efficient substrate for the ErmE methyltransferase. Pools of degenerate RNAs were formed by doping 34-nt positions that extend over and beyond the putative Erm recognition motif within the 72......-mer RNA. The RNAs were passed through a series of rounds of methylation with ErmE. After each round, RNAs were selected that had partially or completely lost their ability to be methylated. After several rounds of methylation/selection, 187 subclones were analyzed. Forty-three of the subclones...

  16. Biosynthesis of a hypermodified nucleotide in Saccharomyces carlsbergensis 17S and HeLa-cell 18S ribosomal ribonucleic acid.

    Science.gov (United States)

    Brand, R C; Klootwijk, J; Planta, R J; Maden, B E

    1978-01-01

    The biosynthesis of a hypermodified nucleotide, similar to or identical with 3-(3-amino-3-carboxypropyl)-1-methylpseudouridine monophosphate, present in Saccharomyces carlsbergensis 17S and HeLa-cell 18S rRNA, was investigated with respect to the sequence of reactions required for synthesis and their timing in ribosome maturation. In both yeast and HeLa cells methylation precedes attachment of the 3-amino-3-carboxypropyl group. In yeast the methylated precursor nucleotide was tentatively characterized as 1-methylpseudouridine. This precursor nucleotide was demonstrated in both 37S and most of the cytoplasmic 18S pre-rRNA (rRNA precursor) molecules. The synthesis of the hypermodified nucleotide is completed just before the final cleavage of 18S pre-rRNA to give 17S rRNA, so that the final addition of the 3-amino-3-carboxypropyl group is a cytoplasmic event. Comparable experiments with HeLa cells indicated that formation of 1-methylpseudouridine occurs at the level of 45S RNA and addition of the 3-amino-3-carboxypropyl group occurs in the cytoplasm on newly synthesized 18S RNA.

  17. Macrolide resistance conferred by rRNA mutations in field isolates of Mannheimia haemolytica and Pasteurella multocida.

    Science.gov (United States)

    Olsen, Anders S; Warrass, Ralf; Douthwaite, Stephen

    2015-02-01

    To determine how resistance to macrolides is conferred in field isolates of Pasteurella multocida and Mannheimia haemolytica that lack previously identified resistance determinants for rRNA methylation, efflux and macrolide-modifying enzymes. Isolates of P. multocida and M. haemolytica identified as being highly resistant (MICs >64 mg/L) to the macrolides erythromycin, gamithromycin, tilmicosin, tildipirosin and tulathromycin were screened by multiplex PCR for the previously identified resistance genes erm(42), msr(E) and mph(E). Strains lacking these determinants were analysed by genome sequencing and primer extension on the rRNAs. Macrolide resistance in one M. haemolytica isolate was conferred by the 23S rRNA mutation A2058G; resistance in three P. multocida isolates were caused by mutations at the neighbouring nucleotide A2059G. In each strain, all six copies of the rrn operons encoded the respective mutations. There were no mutations in the ribosomal protein genes rplD or rplV, and no other macrolide resistance mechanism was evident. High-level macrolide resistance can arise from 23S rRNA mutations in P. multocida and M. haemolytica despite their multiple copies of rrn. Selective pressures from exposure to different macrolide or lincosamide drugs presumably resulted in consolidation of either the A2058G or the A2059G mutation. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  18. Structure of ERA in complex with the 3′ end of 16S rRNA: Implications for ribosome biogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Tu, Chao; Zhou, Xiaomei; Tropea, Joseph E.; Austin, Brian P.; Waugh, David S.; Court, Donald L.; Ji, Xinhua; (NCI)

    2009-10-09

    ERA, composed of an N-terminal GTPase domain followed by an RNA-binding KH domain, is essential for bacterial cell viability. It binds to 16S rRNA and the 30S ribosomal subunit. However, its RNA-binding site, the functional relationship between the two domains, and its role in ribosome biogenesis remain unclear. We have determined two crystal structures of ERA, a binary complex with GDP and a ternary complex with a GTP-analog and the {sub 1531}AUCACCUCCUUA{sub 1542} sequence at the 3' end of 16S rRNA. In the ternary complex, the first nine of the 12 nucleotides are recognized by the protein. We show that GTP binding is a prerequisite for RNA recognition by ERA and that RNA recognition stimulates its GTP-hydrolyzing activity. Based on these and other data, we propose a functional cycle of ERA, suggesting that the protein serves as a chaperone for processing and maturation of 16S rRNA and a checkpoint for assembly of the 30S ribosomal subunit. The AUCA sequence is highly conserved among bacteria, archaea, and eukaryotes, whereas the CCUCC, known as the anti-Shine-Dalgarno sequence, is conserved in noneukaryotes only. Therefore, these data suggest a common mechanism for a highly conserved ERA function in all three kingdoms of life by recognizing the AUCA, with a 'twist' for noneukaryotic ERA proteins by also recognizing the CCUCC.

  19. Synthetic spike-in standards for high-throughput 16S rRNA gene amplicon sequencing.

    Science.gov (United States)

    Tourlousse, Dieter M; Yoshiike, Satowa; Ohashi, Akiko; Matsukura, Satoko; Noda, Naohiro; Sekiguchi, Yuji

    2017-02-28

    High-throughput sequencing of 16S rRNA gene amplicons (16S-seq) has become a widely deployed method for profiling complex microbial communities but technical pitfalls related to data reliability and quantification remain to be fully addressed. In this work, we have developed and implemented a set of synthetic 16S rRNA genes to serve as universal spike-in standards for 16S-seq experiments. The spike-ins represent full-length 16S rRNA genes containing artificial variable regions with negligible identity to known nucleotide sequences, permitting unambiguous identification of spike-in sequences in 16S-seq read data from any microbiome sample. Using defined mock communities and environmental microbiota, we characterized the performance of the spike-in standards and demonstrated their utility for evaluating data quality on a per-sample basis. Further, we showed that staggered spike-in mixtures added at the point of DNA extraction enable concurrent estimation of absolute microbial abundances suitable for comparative analysis. Results also underscored that template-specific Illumina sequencing artifacts may lead to biases in the perceived abundance of certain taxa. Taken together, the spike-in standards represent a novel bioanalytical tool that can substantially improve 16S-seq-based microbiome studies by enabling comprehensive quality control along with absolute quantification. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Adjacent segment disease following cervical spine surgery.

    Science.gov (United States)

    Cho, Samuel K; Riew, K Daniel

    2013-01-01

    Cervical spine surgery is broadly divided into fusion and nonfusion procedures. Anterior cervical diskectomy and fusion (ACDF) is a common procedure, although adjacent segment disease following the surgery is an ongoing clinical concern. Adjacent segment cervical disease occurs in approximately 3% of patients per year, with an expected incidence of 25% within the first 10 years following fusion. Nonfusion procedures such as anterior diskectomy and posterior foraminotomy do not decrease the rate of adjacent segment disease compared with ACDF. Recently, enthusiasm has developed for artificial disk replacement as a motion-sparing alternative to fusion. To date, however, multiple clinical trials and subsequent follow-up studies have failed to demonstrate significant reduction of adjacent segment disease when artificial disk replacement is performed instead of fusion.

  1. Adjacent Segment Pathology after Lumbar Spinal Fusion

    OpenAIRE

    Lee, Jae Chul; Choi, Sung-Woo

    2015-01-01

    One of the major clinical issues encountered after lumbar spinal fusion is the development of adjacent segment pathology (ASP) caused by increased mechanical stress at adjacent segments, and resulting in various radiographic changes and clinical symptoms. This condition may require surgical intervention. The incidence of ASP varies with both the definition and methodology adopted in individual studies; various risk factors for this condition have been identified, although a significant contro...

  2. Adjacent Segment Pathology after Anterior Cervical Fusion

    OpenAIRE

    Chung, Jae Yoon; Park, Jong-Beom; Seo, Hyoung-Yeon; Kim, Sung Kyu

    2016-01-01

    Anterior cervical fusion has become a standard of care for numerous pathologic conditions of the cervical spine. However, subsequent development of clinically significant disc disease at levels adjacent to fused discs is a serious long-term complication of this procedure. As more patients live longer after surgery, it is foreseeable that adjacent segment pathology (ASP) will develop in increasing numbers of patients. Also, ASP has been studied more intensively with the recent popularity of mo...

  3. High throughput 16S rRNA gene amplicon sequencing

    DEFF Research Database (Denmark)

    Nierychlo, Marta; Larsen, Poul; Jørgensen, Mads Koustrup

    S rRNA gene amplicon sequencing has been developed over the past few years and is now ready to use for more comprehensive studies related to plant operation and optimization thanks to short analysis time, low cost, high throughput, and high taxonomic resolution. In this study we show how 16S r......RNA gene amplicon sequencing can be used to reveal factors of importance for the operation of full-scale nutrient removal plants related to settling problems and floc properties. Using optimized DNA extraction protocols, indexed primers and our in-house Illumina platform, we prepared multiple samples...... be correlated to the presence of the species that are regarded as “strong” and “weak” floc formers. In conclusion, 16S rRNA gene amplicon sequencing provides a high throughput approach for a rapid and cheap community profiling of activated sludge that in combination with multivariate statistics can be used...

  4. Nucleotide composition of CO1 sequences in Chelicerata (Arthropoda): detecting new mitogenomic rearrangements.

    Science.gov (United States)

    Arabi, Juliette; Judson, Mark L I; Deharveng, Louis; Lourenço, Wilson R; Cruaud, Corinne; Hassanin, Alexandre

    2012-02-01

    Here we study the evolution of nucleotide composition in third codon-positions of CO1 sequences of Chelicerata, using a phylogenetic framework, based on 180 taxa and three markers (CO1, 18S, and 28S rRNA; 5,218 nt). The analyses of nucleotide composition were also extended to all CO1 sequences of Chelicerata found in GenBank (1,701 taxa). The results show that most species of Chelicerata have a positive strand bias in CO1, i.e., in favor of C nucleotides, including all Amblypygi, Palpigradi, Ricinulei, Solifugae, Uropygi, and Xiphosura. However, several taxa show a negative strand bias, i.e., in favor of G nucleotides: all Scorpiones, Opisthothelae spiders and several taxa within Acari, Opiliones, Pseudoscorpiones, and Pycnogonida. Several reversals of strand-specific bias can be attributed to either a rearrangement of the control region or an inversion of a fragment containing the CO1 gene. Key taxa for which sequencing of complete mitochondrial genomes will be necessary to determine the origin and nature of mtDNA rearrangements involved in the reversals are identified. Acari, Opiliones, Pseudoscorpiones, and Pycnogonida were found to show a strong variability in nucleotide composition. In addition, both mitochondrial and nuclear genomes have been affected by higher substitution rates in Acari and Pseudoscorpiones. The results therefore indicate that these two orders are more liable to fix mutations of all types, including base substitutions, indels, and genomic rearrangements.

  5. What an rRNA secondary structure tells about phylogeny of fungi in Ascomycota with emphasis on evolution of major types of ascus.

    Directory of Open Access Journals (Sweden)

    Wen-Ying Zhuang

    Full Text Available BACKGROUND: RNA secondary structure is highly conserved throughout evolution. The higher order structure is fundamental in establishing important structure-function relationships. Nucleotide sequences from ribosomal RNA (rRNA genes have made a great contribution to our understanding of Ascomycota phylogeny. However, filling the gaps between molecular phylogeny and morphological assumptions based on ascus dehiscence modes and type of fruitbodies at the higher level classification of the phylum remains an unfulfilled task faced by mycologists. METHODOLOGY/PRINCIPAL FINDINGS: We selected some major groups of Ascomycota to view their phylogenetic relationships based on analyses of rRNA secondary structure. Using rRNA secondary structural information, here, we converted nucleotide sequences into the structure ones over a 20-symbol code. Our structural analyses together with ancestral character state reconstruction produced reasonable phylogenetic position for the class Geoglossomycetes as opposed to the classic nucleotide analyses. Judging from the secondary structure analyses with consideration of mode of ascus dehiscence and the ability of forming fruitbodies, we draw a clear picture of a possible evolutionary route for fungal asci and some major groups of fungi in Ascomycota. The secondary structure trees show a more reasonable phylogenetic position for the class Geoglossomycetes. CONCLUSIONS: Our results illustrate that asci lacking of any dehiscence mechanism represent the most primitive type. Passing through the operculate and Orbilia-type asci, bitunicate asci occurred. The evolution came to the most advanced inoperculate type. The ascus-producing fungi might be derived from groups lacking of the capacity to form fruitbodies, and then evolved multiple times. The apothecial type of fruitbodies represents the ancestral state, and the ostiolar type is advanced. The class Geoglossomycetes is closely related to Leotiomycetes and Sordariomycetes

  6. Archaea box C/D enzymes methylate two distinct substrate rRNA sequences with different efficiency

    Science.gov (United States)

    Graziadei, Andrea; Masiewicz, Pawel; Lapinaite, Audrone; Carlomagno, Teresa

    2016-01-01

    RNA modifications confer complexity to the 4-nucleotide polymer; nevertheless, their exact function is mostly unknown. rRNA 2′-O-ribose methylation concentrates to ribosome functional sites and is important for ribosome biogenesis. The methyl group is transferred to rRNA by the box C/D RNPs: The rRNA sequence to be methylated is recognized by a complementary sequence on the guide RNA, which is part of the enzyme. In contrast to their eukaryotic homologs, archaeal box C/D enzymes can be assembled in vitro and are used to study the mechanism of 2′-O-ribose methylation. In Archaea, each guide RNA directs methylation to two distinct rRNA sequences, posing the question whether this dual architecture of the enzyme has a regulatory role. Here we use methylation assays and low-resolution structural analysis with small-angle X-ray scattering to study the methylation reaction guided by the sR26 guide RNA from Pyrococcus furiosus. We find that the methylation efficacy at sites D and D′ differ substantially, with substrate D′ turning over more efficiently than substrate D. This observation correlates well with structural data: The scattering profile of the box C/D RNP half-loaded with substrate D′ is similar to that of the holo complex, which has the highest activity. Unexpectedly, the guide RNA secondary structure is not responsible for the functional difference at the D and D′ sites. Instead, this difference is recapitulated by the nature of the first base pair of the guide-substrate duplex. We suggest that substrate turnover may occur through a zip mechanism that initiates at the 5′-end of the product. PMID:26925607

  7. Forensically informative nucleotide sequencing (FINS) for the first time authentication of Indian Varanus species: implication in wildlife forensics and conservation.

    Science.gov (United States)

    Rajpoot, Ankita; Kumar, Ved Prakash; Bahuguna, Archana; Kumar, Dhyanendra

    2017-11-01

    Monitor lizards are Varanus species widely distributed, endangered reptile in the IUCN red data list. In India, based on the morphological and ecological characteristic, it is divided into four species viz. Bengal monitor lizard, Yellow monitor lizard, Desert monitor lizard and Water monitor lizard. These four species listed as Schedule I species in Indian Wildlife (Protection) Act 1972. This paper first attempt to present Forensically Informative Nucleotide Sequencing (FINS) for the Indian Varanus based on three mitochondrial genes. The molecular framework will be useful for the identification of Indian Varanus species and trade products derived from monitors and as such, have important applications for wildlife management and conservation. Here, we used known 14 individual skin pieces of four species of monitor lizards; the partial fragment of three mitochondrial genes (Cyt b, 12S rRNA, and 16S rRNA) were amplified for genetic study. In Cyt b, 12S rRNA and 16s rRNA, we observed, 5, 5 and 4 Haplotypes; 71, 69, and 43 Variables sites; 90, 89, and 50 Parsimony Informative sites within four species of Indian monitor lizards, respectively. Despite it, the nucleotide composition was T 26.4, C 32.8, A 29.2 and G11.6; T 18.8, C 29.7, A 34.0 and G 17.5; T 21.7, C 27.3, A 32.5 and G 18.5 in Cyt b, 12S rRNA and 16S rRNA, respectively. The neighbor joining phylogenetic tree and maximum parsimony tree of three mitochondrial genes, showed similar results and reveal that, there are two major clades are present in Indian monitor lizards.

  8. Deletion of the nucleotide excision repair gene Ercc1 reduces immunoglobulin class switching and alters mutations near switch recombination junctions

    NARCIS (Netherlands)

    C.E. Schrader; J. Vardo; E. Linehan; M.Z. Twarog; L.J. Niedernhofer (Laura); J. Stavnezer; J.H.J. Hoeijmakers (Jan)

    2004-01-01

    textabstractThe structure-specific endonuclease ERCC1-XPF is an essential component of the nucleotide excision DNA repair pathway. ERCC1-XPF nicks double-stranded DNA immediately adjacent to 3' single-strand regions. Substrates include DNA bubbles and flaps. Furthermore, ERCC1 interacts with Msh2, a

  9. The nucleotide sequence of two restriction fragments located in the gene AB region of bacteriophage S13.

    NARCIS (Netherlands)

    F.G. Grosveld (Frank); J.H. Spencer

    1977-01-01

    textabstractThe nucleotide sequence of a double stranded DNA fragment from the gene AB region of bacteriophage S13 DNA has been determined. The fragment was isolated as two adjacent shorter fragments by cleavage of S13 replicative form (RF) DNA with restriction endonuclease III from Hemophilus

  10. Assessing hog lagoon waste contamination in the Cape Fear Watershed using Bacteroidetes 16S rRNA gene pyrosequencing.

    Science.gov (United States)

    Arfken, Ann M; Song, Bongkeun; Mallin, Michael A

    2015-09-01

    Hog lagoons can be major sources of waste and nutrient contamination to watersheds adjacent to pig farms. Fecal source tracking methods targeting Bacteroidetes 16S rRNA genes in pig fecal matter may underestimate or fail to detect hog lagoon contamination in riverine environments. In order to detect hog lagoon wastewater contamination in the Cape Fear Watershed, where a large number of hog farms are present, we conducted pyrosequencing analyses of Bacteroidetes 16S rRNA genes in hog lagoon waste and identified new hog lagoon-specific marker sequences. Additional pyrosequencing analyses of Bacteroidetes 16S rRNA genes were conducted with surface water samples collected at 4 sites during 5 months in the Cape Fear Watershed. Using an operational taxonomic unit (OTU) identity cutoff value of 97 %, these newly identified hog lagoon markers were found in 3 of the river samples, while only 1 sample contained the pig fecal marker. In the sample containing the pig fecal marker, there was a relatively high percentage (14.1 %) of the hog lagoon markers and a low pig fecal marker relative abundance of 0.4 % in the Bacteroidetes 16S rRNA gene sequences. This suggests that hog lagoon contamination must be somewhat significant in order for pig fecal markers to be detected, and low levels of hog lagoon contamination cannot be detected targeting only pig-specific fecal markers. Thus, new hog lagoon markers have a better detection capacity for lagoon waste contamination, and in conjunction with a pig fecal marker, provide a more comprehensive and accurate detection of hog lagoon waste contamination in susceptible watersheds.

  11. Structure of 23S rRNA hairpin 35 and its interaction with the tylosin-resistance methyltransferase RlmAII

    Science.gov (United States)

    Lebars, Isabelle; Yoshizawa, Satoko; Stenholm, Anne R.; Guittet, Eric; Douthwaite, Stephen; Fourmy, Dominique

    2003-01-01

    The bacterial rRNA methyltransferase RlmAII (formerly TlrB) contributes to resistance against tylosin-like 16-membered ring macrolide antibiotics. RlmAII was originally discovered in the tylosin-producer Streptomyces fradiae, and members of this subclass of methyltransferases have subsequently been found in other Gram-positive bacteria, including Streptococcus pneumoniae. In all cases, RlmAII methylates 23S rRNA at nucleotide G748, which is situated in a stem–loop (hairpin 35) at the macrolide binding site of the ribosome. The conformation of hairpin 35 recognized by RlmAII is shown here by NMR spectroscopy to resemble the anticodon loop of tRNA. The loop folds independently of the rest of the 23S rRNA, and is stabilized by a non-canonical G–A pair and a U-turn motif, rendering G748 accessible. Binding of S.pneumoniae RlmAII induces changes in NMR signals at specific nucleotides that are involved in the methyltransferase–RNA interaction. The conformation of hairpin 35 that interacts with RlmAII is radically different from the structure this hairpin adopts within the 50S subunit. This indicates that the hairpin undergoes major structural rearrangement upon interaction with ribosomal proteins during 50S assembly. PMID:12514124

  12. The tylosin resistance gene tlrB of Streptomyces fradiae encodes a methyltransferase that targets G748 in 23S rRNA

    DEFF Research Database (Denmark)

    Liu, M; Kirpekar, F; Van Wezel, G P

    2000-01-01

    tlrB is one of four resistance genes encoded in the operon for biosynthesis of the macrolide tylosin in antibiotic-producing strains of Streptomyces fradiae. Introduction of tlrB into Streptomyces lividans similarly confers tylosin resistance. Biochemical analysis of the rRNA from the two...... Streptomyces species indicates that in vivo TlrB modifies nucleotide G748 within helix 35 of 23S rRNA. Purified recombinant TlrB retains its activity and specificity in vitro and modifies G748 in 23S rRNA as well as in a 74 nucleotide RNA containing helix 35 and surrounding structures. Modification...... is dependent on the presence of the methyl group donor, S-adenosyl methionine. Analysis of the 74-mer RNA substrate by biochemical and mass spectrometric methods shows that TlrB adds a single methyl group to the base of G748. Homologues of TlrB in other bacteria have been revealed through database searches...

  13. Adjacent stimulation and measurement patterns considered harmful

    International Nuclear Information System (INIS)

    Adler, Andy; Maimaitijiang, Yasheng; Gaggero, Pascal Olivier

    2011-01-01

    We characterize the ability of electrical impedance tomography (EIT) to distinguish changes in internal conductivity distributions, and analyze it as a function of stimulation and measurement patterns. A distinguishability measure, z, is proposed which is related to the signal-to-noise ratio of a medium and to the probability of detection of conductivity changes in a region of interest. z is a function of the number of electrodes, the EIT stimulation and measurement protocol, the stimulation amplitude, the measurement noise, and the size and location of the contrasts. Using this measure we analyze various choices of stimulation and measurement patterns under the constraint of medical electrical safety limits (maximum current into the body). Analysis is performed for a planar placement of 16 electrodes for simulated 3D tank and chest shapes, and measurements in a saline tank. Results show that the traditional (and still most common) adjacent stimulation and measurement patterns have by far the poorest performance (by 6.9 ×). Good results are obtained for trigonometric patterns and for pair drive and measurement patterns separated by over 90°. Since the possible improvement over adjacent patterns is so large, we present this result as a call to action: adjacent patterns are harmful, and should be abandoned. We recommend using pair drive and measurement patterns separated by one electrode less than 180°. We describe an approach to modify an adjacent pattern EIT system by adjusting electrode placement

  14. Variation of 16S-23S rRNA intergenic spacer regions (ISRs) in Acinetobacter baylyi (strain B2) isolated from activated sludge.

    Science.gov (United States)

    Carr, Emma L; Gürtler, Volker; Seviour, Robert J

    2004-08-01

    To determine the variability of the 16S-23S rRNA intergenic spacer region (ISR) of the newly described Acinetobacter baylyi, 88 clones containing ISR amplicons were screened and 14 chosen for further analysis. Two different sized 16S-23S rRNA ISRs were distinguished comprising five variable and four conserved nucleotide blocks. The major regions of heterogeneity between the different sized ISRs were due to blocks of substitutions with unique secondary structures interspersed with nucleotide substitutions, rather than differences caused by presence or absence of tRNA genes, which is often the case. Recombination events causing shuffling of nucleotide blocks are considered the most likely explanation for the mosaic structure observed between the different copies of the ISR. Single base differences present in the long ISR (LISR) were then exploited in attempts to detect possible heterogeneity between rrn copies in Acinetobacter baylyi but variability was not detected by RFLP analysis of LISR-specific PCR products. These primers were shown to be highly specific for 3 Acinetobacter baylyi strains based on LISR sequence homogeneity.

  15. Mutations in domain II of 23 S rRNA facilitate translation of a 23 S rRNA-encoded pentapeptide conferring erythromycin resistance

    DEFF Research Database (Denmark)

    Dam, M; Douthwaite, S; Tenson, T

    1996-01-01

    , the erythromycin resistance determinant in the mutants was shown to be confined to a small 23 S rRNA segment containing the coding region and the ribosome binding site of the E-peptide open reading frame. It thus appears that the domain II mutations mediate erythromycin resistance by increasing expression......Mutations in domain II of Escherichia coli 23 S rRNA that cause resistance to erythromycin do so in a manner fundamentally different from mutations at the drug binding site in domain V of the 23 S rRNA. The domain II mutations are located in a hairpin structure between nucleotides 1198 and 1247....... This is close to a short open reading frame in the 23 S rRNA that encodes a pentapeptide (E-peptide) whose expression in vivo renders cells resistant to erythromycin. Therefore, a possible mechanism of resistance caused by domain II mutations may be related to an increased expression of the E-peptide. To test...

  16. Mutations in domain II of 23 S rRNA facilitate translation of a 23 S rRNA-encoded pentapeptide conferring erythromycin resistance

    DEFF Research Database (Denmark)

    Dam, M; Douthwaite, S; Tenson, T

    1996-01-01

    Mutations in domain II of Escherichia coli 23 S rRNA that cause resistance to erythromycin do so in a manner fundamentally different from mutations at the drug binding site in domain V of the 23 S rRNA. The domain II mutations are located in a hairpin structure between nucleotides 1198 and 1247....... This is close to a short open reading frame in the 23 S rRNA that encodes a pentapeptide (E-peptide) whose expression in vivo renders cells resistant to erythromycin. Therefore, a possible mechanism of resistance caused by domain II mutations may be related to an increased expression of the E-peptide. To test...... this hypothesis, a range of point mutations was generated in domain II of 23 S rRNA in the vicinity of the E-peptide open reading frame. We find a correlation between erythromycin resistance of the mutant clones and increased accessibility of the ribosome binding site of the E-peptide gene. Furthermore...

  17. A Simple Method to Decode the Complete 18-5.8-28S rRNA Repeated Units of Green Algae by Genome Skimming.

    Science.gov (United States)

    Lin, Geng-Ming; Lai, Yu-Heng; Audira, Gilbert; Hsiao, Chung-Der

    2017-11-06

    Green algae, Chlorella ellipsoidea , Haematococcus pluvialis and Aegagropila linnaei (Phylum Chlorophyta) were simultaneously decoded by a genomic skimming approach within 18-5.8-28S rRNA region. Whole genomic DNAs were isolated from green algae and directly subjected to low coverage genome skimming sequencing. After de novo assembly and mapping, the size of complete 18-5.8-28S rRNA repeated units for three green algae were ranged from 5785 to 6028 bp, which showed high nucleotide diversity (π is around 0.5-0.6) within ITS1 and ITS2 (Internal Transcribed Spacer) regions. Previously, the evolutional diversity of algae has been difficult to decode due to the inability design universal primers that amplify specific marker genes across diverse algal species. In this study, our method provided a rapid and universal approach to decode the 18-5.8-28S rRNA repeat unit in three green algal species. In addition, the completely sequenced 18-5.8-28S rRNA repeated units provided a solid nuclear marker for phylogenetic and evolutionary analysis for green algae for the first time.

  18. A single mutation in the 15S rRNA gene confers nonsense suppressor activity and interacts with mRF1 the release factor in yeast mitochondria

    Directory of Open Access Journals (Sweden)

    Ali Gargouri

    2015-08-01

    Full Text Available We have determined the nucleotide sequence of the mim3-1 mitochondrial ribosomal suppressor, acting on ochre mitochondrial mutations and one frameshift mutation in Saccharomyces cerevisiae. The 15s rRNA suppressor gene contains a G633 to C transversion. Yeast mitochondrial G633 corresponds to G517 of the E.coli 15S rRNA, which is occupied by an invariant G in all known small rRNA sequences. Interestingly, this mutation has occurred at the same position as the known MSU1 mitochondrial suppressor which changes G633 to A. The suppressor mutation lies in a highly conserved region of the rRNA, known in E.coli as the 530-loop, interacting with the S4, S5 and S12 ribosomal proteins. We also show an interesting interaction between the mitochondrial mim3-1 and the nuclear nam3-1 suppressors, both of which have the same action spectrum on mitochondrial mutations: nam3-1 abolishes the suppressor effect when present with mim3-1 in the same haploid cell. We discuss these results in the light of the nature of Nam3, identified by [1] as the yeast mitochondrial translation release factor. A hypothetical mechanism of suppression by "ribosome shifting" is also discussed in view of the nature of mutations suppressed and not suppressed.

  19. Additional decompression at adjacent segments leads to adjacent segment degeneration after PLIF.

    Science.gov (United States)

    Miyagi, Masayuki; Ikeda, Osamu; Ohtori, Seiji; Tsuneizumi, Yoshikazu; Someya, Yukio; Shibayama, Masataka; Ogawa, Yasufumi; Inoue, Gen; Orita, Sumihisa; Eguchi, Yawara; Kamoda, Hiroto; Arai, Gen; Ishikawa, Tetsuhiro; Aoki, Yasuchika; Toyone, Tomoaki; Ooi, Toshio; Takahashi, Kazuhisa

    2013-08-01

    Adjacent segment degeneration (ASD) is one of the major complications of lumbar fusion. Several previous retrospective studies reported ASD after PLIF. However, few reports evaluated whether decompression surgery combined with fusion surgery increases the rate of complications in adjacent segments. The purpose of the current study was to investigate the degeneration in decompressed adjacent segments after PLIF. A total of 23 patients (12 men, 11 women; average age, 58.6) who underwent PLIF surgery [1 level (n = 9), 2 levels (n = 8), 3 levels (n = 4), 4 levels (n = 2)] were included. Additional adjacent decompression above or below the level of interbody fusion was performed at 25 levels and no adjacent decompression was performed at 15 levels. We retrospectively investigated ASD by X-ray films of all 40 adjacent segments (above and below fusion level) and clinical outcomes of all 23 cases. Of the 40 adjacent segments, 19 (47.5%) showed ASD and 9 (22.5%) showed symptomatic ASD. In the 19 segments with ASD, ASD occurred in 16 of 25 (64.0%) segments at decompressed sites compared with 3 of 15 (20.0%) non-decompressed sites. The ratio of ASD in adjacent segments was significantly higher at decompressed sites than at non-decompressed sites (p < 0.01). ASD occurs frequently in association with additional decompression above or below the level of PLIF. In cases in which the adjacent segments require decompression, a surgical strategy that preserves as much of the posterior complex as possible should be selected.

  20. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    The plastid genome regions of two intergenic spacers, psbA–trnH and trnL–trnF, were sequenced to study the nucleotide diversity and phylogenetic relationships among Gladiolus cultivars. Nucleotide diversity of psbA–trnH region was higher than trnL–trnF region of chloroplast. We employed Bayesian, maximum ...

  1. Robust computational analysis of rRNA hypervariable tag datasets.

    Directory of Open Access Journals (Sweden)

    Maksim Sipos

    Full Text Available Next-generation DNA sequencing is increasingly being utilized to probe microbial communities, such as gastrointestinal microbiomes, where it is important to be able to quantify measures of abundance and diversity. The fragmented nature of the 16S rRNA datasets obtained, coupled with their unprecedented size, has led to the recognition that the results of such analyses are potentially contaminated by a variety of artifacts, both experimental and computational. Here we quantify how multiple alignment and clustering errors contribute to overestimates of abundance and diversity, reflected by incorrect OTU assignment, corrupted phylogenies, inaccurate species diversity estimators, and rank abundance distribution functions. We show that straightforward procedural optimizations, combining preexisting tools, are effective in handling large (10(5-10(6 16S rRNA datasets, and we describe metrics to measure the effectiveness and quality of the estimators obtained. We introduce two metrics to ascertain the quality of clustering of pyrosequenced rRNA data, and show that complete linkage clustering greatly outperforms other widely used methods.

  2. Time-constrained project scheduling with adjacent resources

    NARCIS (Netherlands)

    Hurink, Johann L.; Kok, A.L.; Paulus, J.J.; Schutten, Johannes M.J.

    2008-01-01

    We develop a decomposition method for the Time-Constrained Project Scheduling Problem (TCPSP) with Adjacent Resources. For adjacent resources the resource units are ordered and the units assigned to a job have to be adjacent. On top of that, adjacent resources are not required by single jobs, but by

  3. Time-constrained project scheduling with adjacent resources

    NARCIS (Netherlands)

    Hurink, Johann L.; Kok, A.L.; Paulus, J.J.; Schutten, Johannes M.J.

    We develop a decomposition method for the Time-Constrained Project Scheduling Problem (TCPSP) with adjacent resources. For adjacent resources the resource units are ordered and the units assigned to a job have to be adjacent. On top of that, adjacent resources are not required by single jobs, but by

  4. Structural Rearrangements in the Active Site of the Thermus thermophilus 16S rRNA Methyltransferase KsgA in a Binary Complex with 5'-Methylthioadenosine

    Energy Technology Data Exchange (ETDEWEB)

    Demirci, H.; Belardinelli, R; Seri, E; Gregory, S; Gualerzi, C; Dahlberg, A; Jogl, G

    2009-01-01

    Posttranscriptional modification of ribosomal RNA (rRNA) occurs in all kingdoms of life. The S-adenosyl-l-methionine-dependent methyltransferase KsgA introduces the most highly conserved rRNA modification, the dimethylation of A1518 and A1519 of 16S rRNA. Loss of this dimethylation confers resistance to the antibiotic kasugamycin. Here, we report biochemical studies and high-resolution crystal structures of KsgA from Thermus thermophilus. Methylation of 30S ribosomal subunits by T. thermophilus KsgA is more efficient at low concentrations of magnesium ions, suggesting that partially unfolded RNA is the preferred substrate. The overall structure is similar to that of other methyltransferases but contains an additional ?-helix in a novel N-terminal extension. Comparison of the apoenzyme with complex structures with 5?-methylthioadenosine or adenosine bound in the cofactor-binding site reveals novel features when compared with related enzymes. Several mobile loop regions that restrict access to the cofactor-binding site are observed. In addition, the orientation of residues in the substrate-binding site indicates that conformational changes are required for binding two adjacent residues of the substrate rRNA.

  5. Adjacent Segment Pathology after Lumbar Spinal Fusion

    Science.gov (United States)

    Lee, Jae Chul

    2015-01-01

    One of the major clinical issues encountered after lumbar spinal fusion is the development of adjacent segment pathology (ASP) caused by increased mechanical stress at adjacent segments, and resulting in various radiographic changes and clinical symptoms. This condition may require surgical intervention. The incidence of ASP varies with both the definition and methodology adopted in individual studies; various risk factors for this condition have been identified, although a significant controversy still exists regarding their significance. Motion-preserving devices have been developed, and some studies have shown their efficacy of preventing ASP. Surgeons should be aware of the risk factors of ASP when planning a surgery, and accordingly counsel their patients preoperatively. PMID:26435804

  6. Frequency and spectrum of mitochondrial 12S rRNA variants in 440 Han Chinese hearing impaired pediatric subjects from two otology clinics

    Directory of Open Access Journals (Sweden)

    Zhou Jianjin

    2011-01-01

    Full Text Available Abstract Background Aminoglycoside ototoxicity is one of the common health problems. Mitochondrial 12S rRNA mutations are one of the important causes of aminoglycoside ototoxicity. However, the incidences of 12S rRNA mutations associated with aminoglycoside ototoxicity are less known. Methods A total of 440 Chinese pediatric hearing-impaired subjects were recruited from two otology clinics in the Ningbo and Wenzhou cities of Zhejiang Province, China. These subjects underwent clinical, genetic evaluation and molecular analysis of mitochondrial 12S rRNA. Resultant mtDNA variants were evaluated by structural and phylogenetic analysis. Results The study samples consisted of 227 males and 213 females. The age of all participants ranged from 1 years old to 18 years, with the median age of 9 years. Ninety-eight subjects (58 males and 40 females had a history of exposure to aminoglycosides, accounting for 22.3% cases of hearing loss in this cohort. Molecular analysis of 12S rRNA gene identified 41 (39 known and 2 novel variants. The incidences of the known deafness-associated 1555A > G, 1494C > T and 1095T > C mutations were 7.5%, 0.45% and 0.91% in this entire hearing-impaired subjects, respectively, and 21.4%, 2% and 2% among 98 subjects with aminoglycoside ototoxicity, respectively. The structural and phylogenetic evaluations showed that a novel 747A > G variant and known 839A > G, 1027A > G, 1310C > T and 1413T > C variants conferred increased sensitivity to aminoglycosides or nonsyndromic deafness as they were absent in 449 Chinese controls and localized at highly conserved nucleotides of this rRNA. However, other variants were polymorphisms. Of 44 subjects carrying one of definite or putative deafness-related 12S rRNA variants, only one subject carrying the 1413T > C variant harbored the 235DelC/299DelAT mutations in the GJB2 gene, while none of mutations in GJB2 gene was detected in other 43 subjects. Conclusions Mutations in mitochondrial 12S rRNA

  7. Adjacent Segment Pathology after Anterior Cervical Fusion.

    Science.gov (United States)

    Chung, Jae Yoon; Park, Jong-Beom; Seo, Hyoung-Yeon; Kim, Sung Kyu

    2016-06-01

    Anterior cervical fusion has become a standard of care for numerous pathologic conditions of the cervical spine. However, subsequent development of clinically significant disc disease at levels adjacent to fused discs is a serious long-term complication of this procedure. As more patients live longer after surgery, it is foreseeable that adjacent segment pathology (ASP) will develop in increasing numbers of patients. Also, ASP has been studied more intensively with the recent popularity of motion preservation technologies like total disc arthroplasty. The true nature and scope of ASP remains poorly understood. The etiology of ASP is most likely multifactorial. Various factors including altered biomechanical stresses, surgical disruption of soft tissue and the natural history of cervical disc disease contribute to the development of ASP. General factors associated with disc degeneration including gender, age, smoking and sports may play a role in the development of ASP. Postoperative sagittal alignment and type of surgery are also considered potential causes of ASP. Therefore, a spine surgeon must be particularly careful to avoid unnecessary disruption of the musculoligamentous structures, reduced risk of direct injury to the disc during dissection and maintain a safe margin between the plate edge and adjacent vertebrae during anterior cervical fusion.

  8. Adjacent Segment Pathology after Anterior Cervical Fusion

    Science.gov (United States)

    Chung, Jae Yoon; Park, Jong-Beom; Seo, Hyoung-Yeon

    2016-01-01

    Anterior cervical fusion has become a standard of care for numerous pathologic conditions of the cervical spine. However, subsequent development of clinically significant disc disease at levels adjacent to fused discs is a serious long-term complication of this procedure. As more patients live longer after surgery, it is foreseeable that adjacent segment pathology (ASP) will develop in increasing numbers of patients. Also, ASP has been studied more intensively with the recent popularity of motion preservation technologies like total disc arthroplasty. The true nature and scope of ASP remains poorly understood. The etiology of ASP is most likely multifactorial. Various factors including altered biomechanical stresses, surgical disruption of soft tissue and the natural history of cervical disc disease contribute to the development of ASP. General factors associated with disc degeneration including gender, age, smoking and sports may play a role in the development of ASP. Postoperative sagittal alignment and type of surgery are also considered potential causes of ASP. Therefore, a spine surgeon must be particularly careful to avoid unnecessary disruption of the musculoligamentous structures, reduced risk of direct injury to the disc during dissection and maintain a safe margin between the plate edge and adjacent vertebrae during anterior cervical fusion. PMID:27340541

  9. Characterization of Vibrio fischeri rRNA operons and subcloning of a ribosomal DNA promoter.

    Science.gov (United States)

    Amikam, D; Kuhn, J

    1987-01-01

    Analysis of rRNA genes in Vibrio fischeri indicates the presence of eight rRNA gene sets in this organism. It was found that the genes for 5S rRNA, 16S rRNA, and 23S rRNA are organized in operons in the following order: 5' end 16S rRNA 23S RNA 5S rRNA 3' end. Although the operons are homologous, they are not identical with regard to cleavage sites for various restriction endonucleases. A DNA library was constructed, and three ribosomal DNA clones were obtained. One of these clones contained an entire rRNA operon and was used as a source for subcloning. The promoter region which leads to plasmid instability was successfully subcloned into pHG165. The terminator region was subcloned into pBR322. PMID:3571170

  10. Intrinsic resistance to aminoglycosides in Enterococcus faecium is conferred by the 16S rRNA m5C1404-specific methyltransferase EfmM

    DEFF Research Database (Denmark)

    Galimand, Marc; Schmitt, Emmanuelle; Panvert, Michel

    2011-01-01

    methyltransferase, as well as by the previously characterized aac(6')-Ii that encodes a 6'-N-aminoglycoside acetyltransferase. Inactivation of efmM in E. faecium increases susceptibility to the aminoglycosides kanamycin and tobramycin, and, conversely, expression of a recombinant version of efmM in Escherichia coli...... confers resistance to these drugs. The EfmM protein shows significant sequence similarity to E. coli RsmF (previously called YebU), which is a 5-methylcytidine (m(5)C) methyltransferase modifying 16S rRNA nucleotide C1407. The target for EfmM is shown by mass spectrometry to be a neighboring 16S r...

  11. Resistance to ketolide antibiotics by coordinated expression of rRNA methyltransferases in a bacterial producer of natural ketolides.

    Science.gov (United States)

    Almutairi, Mashal M; Park, Sung Ryeol; Rose, Simon; Hansen, Douglas A; Vázquez-Laslop, Nora; Douthwaite, Stephen; Sherman, David H; Mankin, Alexander S

    2015-10-20

    Ketolides are promising new antimicrobials effective against a broad range of Gram-positive pathogens, in part because of the low propensity of these drugs to trigger the expression of resistance genes. A natural ketolide pikromycin and a related compound methymycin are produced by Streptomyces venezuelae strain ATCC 15439. The producer avoids the inhibitory effects of its own antibiotics by expressing two paralogous rRNA methylase genes pikR1 and pikR2 with seemingly redundant functions. We show here that the PikR1 and PikR2 enzymes mono- and dimethylate, respectively, the N6 amino group in 23S rRNA nucleotide A2058. PikR1 monomethylase is constitutively expressed; it confers low resistance at low fitness cost and is required for ketolide-induced activation of pikR2 to attain high-level resistance. The regulatory mechanism controlling pikR2 expression has been evolutionary optimized for preferential activation by ketolide antibiotics. The resistance genes and the induction mechanism remain fully functional when transferred to heterologous bacterial hosts. The anticipated wide use of ketolide antibiotics could promote horizontal transfer of these highly efficient resistance genes to pathogens. Taken together, these findings emphasized the need for surveillance of pikR1/pikR2-based bacterial resistance and the preemptive development of drugs that can remain effective against the ketolide-specific resistance mechanism.

  12. Recombination drives evolution of the Clostridium difficile 16S-23S rRNA intergenic spacer region.

    Science.gov (United States)

    Janezic, Sandra; Indra, Alexander; Rattei, Thomas; Weinmaier, Thomas; Rupnik, Maja

    2014-01-01

    PCR-ribotyping, a typing method based on size variation in 16S-23S rRNA intergenic spacer region (ISR), has been used widely for molecular epidemiological investigations of C. difficile infections. In the present study, we describe the sequence diversity of ISRs from 43 C. difficile strains, representing different PCR-ribotypes and suggest homologous recombination as a possible mechanism driving the evolution of 16S-23S rRNA ISRs. ISRs of 45 different lengths (ranging from 185 bp to 564 bp) were found among 458 ISRs. All ISRs could be described with one of the 22 different structural groups defined by the presence or absence of different sequence modules; tRNAAla genes and different combinations of spacers of different lengths (33 bp, 53 bp or 20 bp) and 9 bp direct repeats separating the spacers. The ISR structural group, in most cases, coincided with the sequence length. ISRs that were of the same lengths had also very similar nucleotide sequence, suggesting that ISRs were not suitable for discriminating between different strains based only on the ISR sequence. Despite large variations in the length, the alignment of ISR sequences, based on the primary sequence and secondary structure information, revealed many conserved regions which were mainly involved in maturation of pre-rRNA. Phylogenetic analysis of the ISR alignment yielded strong evidence for intra- and inter-homologous recombination which could be one of the mechanisms driving the evolution of C. difficile 16S-23S ISRs. The modular structure of the ISR, the high sequence similarities of ISRs of the same sizes and the presence of homologous recombination also suggest that different copies of C. difficile 16S-23S rRNA ISR are evolving in concert.

  13. Recombination drives evolution of the Clostridium difficile 16S-23S rRNA intergenic spacer region.

    Directory of Open Access Journals (Sweden)

    Sandra Janezic

    Full Text Available PCR-ribotyping, a typing method based on size variation in 16S-23S rRNA intergenic spacer region (ISR, has been used widely for molecular epidemiological investigations of C. difficile infections. In the present study, we describe the sequence diversity of ISRs from 43 C. difficile strains, representing different PCR-ribotypes and suggest homologous recombination as a possible mechanism driving the evolution of 16S-23S rRNA ISRs. ISRs of 45 different lengths (ranging from 185 bp to 564 bp were found among 458 ISRs. All ISRs could be described with one of the 22 different structural groups defined by the presence or absence of different sequence modules; tRNAAla genes and different combinations of spacers of different lengths (33 bp, 53 bp or 20 bp and 9 bp direct repeats separating the spacers. The ISR structural group, in most cases, coincided with the sequence length. ISRs that were of the same lengths had also very similar nucleotide sequence, suggesting that ISRs were not suitable for discriminating between different strains based only on the ISR sequence. Despite large variations in the length, the alignment of ISR sequences, based on the primary sequence and secondary structure information, revealed many conserved regions which were mainly involved in maturation of pre-rRNA. Phylogenetic analysis of the ISR alignment yielded strong evidence for intra- and inter-homologous recombination which could be one of the mechanisms driving the evolution of C. difficile 16S-23S ISRs. The modular structure of the ISR, the high sequence similarities of ISRs of the same sizes and the presence of homologous recombination also suggest that different copies of C. difficile 16S-23S rRNA ISR are evolving in concert.

  14. Insights into the structure, function and evolution of the radical-SAM 23S rRNA methyltransferase Cfr that confers antibiotic resistance in bacteria

    DEFF Research Database (Denmark)

    Karminska, K. H.; Purta, E.; Hansen, L .H.

    2010-01-01

    The Cfr methyltransferase confers combined resistance to five classes of antibiotics that bind to the peptidyl tranferase center of bacterial ribosomes by catalyzing methylation of the C-8 position of 23S rRNA nucleotide A2503. The same nucleotide is targeted by the housekeeping methyltransferase....... The investigation has identified essential amino acids and Cfr variants with altered reaction mechanisms and represents a first step towards understanding the structural basis of Cfr activity....... of a 4Fe-4S cluster, a SAM molecule coordinated to the iron-sulfur cluster (SAM1) and a SAM molecule that is the putative methyl group donor (SAM2). All mutations at predicted functional sites affect Cfr activity significantly as assayed by antibiotic susceptibility testing and primer extension analysis...

  15. Macrolide-ketolide inhibition of MLS-resistant ribosomes is improved by alternative drug interaction with domain II of 23S rRNA

    DEFF Research Database (Denmark)

    Douthwaite, S; Hansen, L H; Mauvais, P

    2000-01-01

    The macrolide antibiotic erythromycin and its 6-O-methyl derivative (clarithromycin) bind to bacterial ribosomes primarily through interactions with nucleotides in domains II and V of 23S rRNA. The domain II interaction occurs between nucleotide A752 and the macrolide 3-cladinose moiety. Removal...... cause of drug resistance in some clinical pathogens. The 2058G mutation disrupts the drug-domain V contact and leads to a further > 25 000-fold decrease in the binding of RU 56006. Drug binding to resistant ribosomes can be improved over 3000-fold by forming an alternative and more effective contact...... to A752 via alkyl-aryl groups linked to a carbamate at the drug 11/12 position (in the ketolide antibiotics HMR 3647 and HMR 3004). The data indicate that simultaneous drug interactions with domains II and V strengthen binding and that the domain II contact is of particular importance to achieve...

  16. Isolation of temperature-sensitive mutants of 16 S rRNA in Escherichia coli

    DEFF Research Database (Denmark)

    Triman, K; Becker, E; Dammel, C

    1989-01-01

    Temperature-sensitive mutants have been isolated following hydroxylamine mutagenesis of a plasmid containing Escherichia coli rRNA genes carrying selectable markers for spectinomycin resistance (U1192 in 16 S rRNA) and erythromycin resistance (G2058 in 23 S rRNA). These antibiotic resistance...

  17. The Era GTPase recognizes the GAUCACCUCC sequence and binds helix 45 near the 3; end of 16S rRNA

    Energy Technology Data Exchange (ETDEWEB)

    Tu, Chao; Zhou, Xiaomei; Tarasov, Sergey G.; Tropea, Joseph E.; Austin, Brian P.; Waugh, David S.; Court, Donald L.; Ji, Xinhua (NCI)

    2012-03-26

    Era, composed of a GTPase domain and a K homology domain, is essential for bacterial cell viability. It is required for the maturation of 16S rRNA and assembly of the 30S ribosomal subunit. We showed previously that the protein recognizes nine nucleotides (1531{sup AUCACCUCC}1539) near the 3{prime} end of 16S rRNA, and that this recognition stimulates GTP-hydrolyzing activity of Era. In all three kingdoms of life, the 1530{sup GAUCA}1534 sequence and helix 45 (h45) (nucleotides 1506-1529) are highly conserved. It has been shown that the 1530{sup GA}1531 to 1530{sup AG}1531 double mutation severely affects the viability of bacteria. However, whether Era interacts with G1530 and/or h45 and whether such interactions (if any) contribute to the stimulation of Era's GTPase activity were not known. Here, we report two RNA structures that contain nucleotides 1506-1542 (RNA301), one in complex with Era and GDPNP (GNP), a nonhydrolysable GTP-analogue, and the other in complex with Era, GNP, and the KsgA methyltransferase. The structures show that Era recognizes 10 nucleotides, including G1530, and that Era also binds h45. Moreover, GTPase assay experiments show that G1530 does not stimulate Era's GTPase activity. Rather, A1531 and A1534 are most important for stimulation and h45 further contributes to the stimulation. Although G1530 does not contribute to the intrinsic GTPase activity of Era, its interaction with Era is important for binding and is essential for the protein to function, leading to the discovery of a new cold-sensitive phenotype of Era.

  18. The international nucleotide sequence database collaboration.

    Science.gov (United States)

    Karsch-Mizrachi, Ilene; Takagi, Toshihisa; Cochrane, Guy

    2018-01-04

    For more than 30 years, the International Nucleotide Sequence Database Collaboration (INSDC; http://www.insdc.org/) has been committed to capturing, preserving and providing access to comprehensive public domain nucleotide sequence and associated metadata which enables discovery in biomedicine, biodiversity and biological sciences. Since 1987, the DNA Data Bank of Japan (DDBJ) at the National Institute for Genetics in Mishima, Japan; the European Nucleotide Archive (ENA) at the European Molecular Biology Laboratory's European Bioinformatics Institute (EMBL-EBI) in Hinxton, UK; and GenBank at National Center for Biotechnology Information (NCBI), National Library of Medicine, National Institutes of Health in Bethesda, Maryland, USA have worked collaboratively to enable access to nucleotide sequence data in standardized formats for the worldwide scientific community. In this article, we reiterate the principles of the INSDC collaboration and briefly summarize the trends of the archival content. Published by Oxford University Press on behalf of Nucleic Acids Research 2017.

  19. Nucleotide excision repair in the test tube.

    NARCIS (Netherlands)

    N.G.J. Jaspers (Nicolaas); J.H.J. Hoeijmakers (Jan)

    1995-01-01

    textabstractThe eukaryotic nucleotide excision-repair pathway has been reconstituted in vitro, an achievement that should hasten the full enzymological characterization of this highly complex DNA-repair pathway.

  20. Counting and Size Classification of Active Soil Bacteria by Fluorescence In Situ Hybridization with an rRNA Oligonucleotide Probe

    Science.gov (United States)

    Christensen, Henrik; Hansen, Michael; Sørensen, Jan

    1999-01-01

    A fluorescence in situ hybridization (FISH) technique based on binding of a rhodamine-labelled oligonucleotide probe to 16S rRNA was used to estimate the numbers of ribosome-rich bacteria in soil samples. Such bacteria, which have high cellular rRNA contents, were assumed to be active (and growing) in the soil. Hybridization to an rRNA probe, EUB338, for the domain Bacteria was performed with a soil slurry, and this was followed by collection of the bacteria by membrane filtration (pore size, 0.2 μm). A nonsense probe, NONEUB338 (which has a nucleotide sequence complementary to the nucleotide sequence of probe EUB338), was used as a control for nonspecific staining. Counting and size classification into groups of small, medium, and large bacteria were performed by fluorescence microscopy. To compensate for a difference in the relative staining intensities of the probes and for binding by the rhodamine part of the probe, control experiments in which excess unlabelled probe was added were performed. This resulted in lower counts with EUB338 but not with NONEUB338, indicating that nonspecific staining was due to binding of rhodamine to the bacteria. A value of 4.8 × 108 active bacteria per g of dry soil was obtained for bulk soil incubated for 2 days with 0.3% glucose. In comparison, a value of 3.8 × 108 active bacteria per g of dry soil was obtained for soil which had been air dried and subsequently rewetted. In both soils, the majority (68 to 77%) of actively growing bacteria were members of the smallest size class (cell width, 0.25 to 0.5 μm), but the active (and growing) bacteria still represented only approximately 5% of the total bacterial population determined by DAPI (4′,6-diamidino-2-phenylindole) staining. The FISH technique in which slurry hybridization is used holds great promise for use with phylogenetic probes and for automatic counting of soil bacteria. PMID:10103277

  1. Spondylolisthesis adjacent to a cervical disc arthroplasty does not increase the risk of adjacent level degeneration.

    Science.gov (United States)

    Kieser, David Christopher; Cawley, Derek Thomas; Roscop, Cecile; Mazas, Simon; Coudert, Pierre; Boissiere, Louis; Obeid, Ibrahim; Vital, Jean-Marc; Pointillart, Vincent; Gille, Olivier

    2018-03-31

    To understand whether a spondylolisthesis in the sub-axial spine cranial to a cervical disc arthroplasty (CDA) construes a risk of adjacent level disease (ALD). A retrospective review of 164 patients with a minimum 5-year follow-up of a cervical disc arthroplasty was performed. Multi-level surgeries, including hybrid procedures, were included. Multiple implant types were included. The two inter-vertebral discs (IVD) cranial of the CDA were monitored for evidence of radiologic degeneration using the Kettler criteria. The rate of ALD in CDA found in this series was 17.8%, with most affecting the immediately adjacent IVD (27.4 and 7.6%, respectively p = 0.000). Pre-operative mild spondylolisthesis adjacent to a planned CDA was not found to be a risk factor for ALD within 5 years. Those with a degenerative spondylolisthesis are at higher risk of ALD (33%) than those with a non-degenerative cause for their spondylolisthesis (11%). Post-operative CDA alignment, ROM or induced spondylolisthesis do not affect the rate of ALD in those with an adjacent spondylolisthesis. Patients with ALD experience significantly worse 5-year pain and functional outcomes than those unaffected by ALD. A pre-operatively identified mild spondylolisthesis in the sub-axial spine cranially adjacent to a planned CDA is not a risk factor for ALD within 5 years. These slides can be retrieved under Electronic Supplementary Material.

  2. Effects of nucleotides and nucleosides on coagulation

    DEFF Research Database (Denmark)

    Bune, Laurids; Thaning, Pia; Johansson, Pär I

    2010-01-01

    Nucleotides, including ADP, ATP and uridine triphosphate (UTP), are discharged profusely in the circulation during many pathological conditions including sepsis. Sepsis can cause hypotension and systemic activation of the coagulation and fibrinolytic systems in humans, which may cause disseminated...... intravascular coagulation. We investigated whether nucleotide-induced cardiovascular collapse as provoked by systemic infusion of adenosine, ADP, ATP, UTP and nitric oxide affected the haemostatic system as assessed by whole blood thromboelastography (TEG) analysis. Ten pigs received a randomized infusion...

  3. The rRNA evolution and procaryotic phylogeny

    Science.gov (United States)

    Fox, G. E.

    1986-01-01

    Studies of ribosomal RNA primary structure allow reconstruction of phylogenetic trees for prokaryotic organisms. Such studies reveal major dichotomy among the bacteria that separates them into eubacteria and archaebacteria. Both groupings are further segmented into several major divisions. The results obtained from 5S rRNA sequences are essentially the same as those obtained with the 16S rRNA data. In the case of Gram negative bacteria the ribosomal RNA sequencing results can also be directly compared with hybridization studies and cytochrome c sequencing studies. There is again excellent agreement among the several methods. It seems likely then that the overall picture of microbial phylogeny that is emerging from the RNA sequence studies is a good approximation of the true history of these organisms. The RNA data allow examination of the evolutionary process in a semi-quantitative way. The secondary structures of these RNAs are largely established. As a result it is possible to recognize examples of local structural evolution. Evolutionary pathways accounting for these events can be proposed and their probability can be assessed.

  4. A Bayesian taxonomic classification method for 16S rRNA gene sequences with improved species-level accuracy.

    Science.gov (United States)

    Gao, Xiang; Lin, Huaiying; Revanna, Kashi; Dong, Qunfeng

    2017-05-10

    Species-level classification for 16S rRNA gene sequences remains a serious challenge for microbiome researchers, because existing taxonomic classification tools for 16S rRNA gene sequences either do not provide species-level classification, or their classification results are unreliable. The unreliable results are due to the limitations in the existing methods which either lack solid probabilistic-based criteria to evaluate the confidence of their taxonomic assignments, or use nucleotide k-mer frequency as the proxy for sequence similarity measurement. We have developed a method that shows significantly improved species-level classification results over existing methods. Our method calculates true sequence similarity between query sequences and database hits using pairwise sequence alignment. Taxonomic classifications are assigned from the species to the phylum levels based on the lowest common ancestors of multiple database hits for each query sequence, and further classification reliabilities are evaluated by bootstrap confidence scores. The novelty of our method is that the contribution of each database hit to the taxonomic assignment of the query sequence is weighted by a Bayesian posterior probability based upon the degree of sequence similarity of the database hit to the query sequence. Our method does not need any training datasets specific for different taxonomic groups. Instead only a reference database is required for aligning to the query sequences, making our method easily applicable for different regions of the 16S rRNA gene or other phylogenetic marker genes. Reliable species-level classification for 16S rRNA or other phylogenetic marker genes is critical for microbiome research. Our software shows significantly higher classification accuracy than the existing tools and we provide probabilistic-based confidence scores to evaluate the reliability of our taxonomic classification assignments based on multiple database matches to query sequences. Despite

  5. NMR structure determination of the binding site for ribosomal protein S8 from Escherichia coli 16 S rRNA.

    Science.gov (United States)

    Kalurachchi, K; Nikonowicz, E P

    1998-07-24

    Many cellular processes involve the preferential interaction of an RNA molecule with a specific protein. A detailed analysis of the individual protein and RNA components of these interactions can provide unique insights into the structural features important for protein-RNA recognition. Ribosomal protein S8 of Escherichia coli plays a key role in 30 S ribosomal subunit assembly through its interaction with 16 S rRNA. The binding site for protein S8 comprises a portion of helix 21, nucleotides G588 to G604 and C634 to C651. This region forms a base-paired helix that is interrupted by a non-Watson-Crick segment composed of nine phylogenetically conserved nucleotides. We have investigated the detailed structure of the conserved segment and the interaction of this region with metal ions using NMR spectroscopy. Twenty-four of the 40 calculated structures converged to similar conformations and were grouped into two families. The main difference between the families is the orientation of the base of U641. The rms deviation between the heavy-atoms of the ten lowest-energy structures is 1.24 A. The orientations of the G597.C643 base-pair and A595.(A596.U644) base-triple within the conserved core have been defined and appear to extend the proximal segment of helix 21 into the phylogenetically conserved core. The base of A642 terminates this helix by stacking against C643 and the base of U641 forms hydrogen bonds with core nucleotides. The conserved core also contains a Mg2+-binding site that promotes stabilization of the secondary and tertiary structure elements of the core. A model for the interaction of S8 with its RNA-binding site is proposed. Copyright 1998 Academic Press.

  6. Loading effects of anterior cervical spine fusion on adjacent segments

    OpenAIRE

    Chien-Shiung Wang; Jia-Hao Chang; Ti-Sheng Chang; Hung-Yi Chen; Ching-Wei Cheng

    2012-01-01

    Adjacent segment degeneration typically follows anterior cervical spine fusion. However, the primary cause of adjacent segment degeneration remains unknown. Therefore, in order to identify the loading effects that cause adjacent segment degeneration, this study examined the loading effects to superior segments adjacent to fused bone following anterior cervical spine fusion. The C3–C6 cervical spine segments of 12 sheep were examined. Specimens were divided into the following groups: intact sp...

  7. [Analysis of the ITS1/ITS2 nuclear spacers and the secondary structure of 5.8S rRNA gene in endemic species Bellevalia sarmatica (Pall. ex Georgi) Woronow and related species of the subfamily scilloideae].

    Science.gov (United States)

    Trifonova, A A; Filyushin, M A; Kochieva, E Z; Kudryavtsev, A M

    2016-05-01

    Sequence variability of the ITS spacers and 5.8S rRNA gene was examined in 11 accessions of the subfamily Scilloideae, including seven accessions of rare and endangered species Bellevalia sarmatica from Volgograd region. The intraspecific polymorphism level of the examined ITS1–5.8S–ITS2 sequence of B. sarmatica accessions constituted 1.3%. The phylogenetic position of B. sarmatica within the genus Bellevalia was determined. It was demonstrated that B. sarmatica belonged to the section Nutantes, and the most closely related species were B. webbiana and B. dubia. Nucleotide substitutions in the 5.8S rRNA gene sequence of the analyzed Scilloideae accessions were identified and studied. The predicted secondary structure of 5.8S rRNA gene was constructed. It was demonstrated that in the examined accessions, mutations in the 5.8S rRNA gene were mainly localized in the third hairpin region and had no effect on the secondary structure of the 5.8S rRNA molecule.

  8. Conservation of tRNA and rRNA 5-methylcytosine in the kingdom Plantae.

    Science.gov (United States)

    Burgess, Alice Louise; David, Rakesh; Searle, Iain Robert

    2015-08-14

    Post-transcriptional methylation of RNA cytosine residues to 5-methylcytosine (m(5)C) is an important modification that regulates RNA metabolism and occurs in both eukaryotes and prokaryotes. Yet, to date, no transcriptome-wide identification of m(5)C sites has been undertaken in plants. Plants provide a unique comparative system for investigating the origin and evolution of m(5)C as they contain three different genomes, the nucleus, mitochondria and chloroplast. Here we use bisulfite conversion of RNA combined with high-throughput IIlumina sequencing (RBS-seq) to identify single-nucleotide resolution of m(5)C sites in non-coding ribosomal RNAs and transfer RNAs of all three sub-cellular transcriptomes across six diverse species that included, the single-celled algae Nannochloropsis oculata, the macro algae Caulerpa taxifolia and multi-cellular higher plants Arabidopsis thaliana, Brassica rapa, Triticum durum and Ginkgo biloba. Using the plant model Arabidopsis thaliana, we identified a total of 39 highly methylated m(5)C sites in predicted structural positions of nuclear tRNAs and 7 m(5)C sites in rRNAs from nuclear, chloroplast and mitochondrial transcriptomes. Both the nucleotide position and percent methylation of tRNAs and rRNAs m(5)C sites were conserved across all species analysed, from single celled algae N. oculata to multicellular plants. Interestingly the mitochondrial and chloroplast encoded tRNAs were devoid of m(5)C in A. thaliana and this is generally conserved across Plantae. This suggests independent evolution of organelle methylation in animals and plants, as animal mitochondrial tRNAs have m(5)C sites. Here we characterize 5 members of the RNA 5-methylcytosine family in Arabidopsis and extend the functional characterization of TRDMT1 and NOP2A/OLI2. We demonstrate that nuclear tRNA methylation requires two evolutionarily conserved methyltransferases, TRDMT1 and TRM4B. trdmt1 trm4b double mutants are hypersensitive to the antibiotic hygromycin B

  9. 'Candidatus mycoplasma haemodidelphidis' sp. nov., 'Candidatus mycoplasma haemolamae' sp. nov. and Mycoplasma haemocanis comb. nov., haemotrophic parasites from a naturally infected opossum (Didelphis virginiana), alpaca (Lama pacos) and dog (Canis familiaris): phylogenetic and secondary structural relatedness of their 16S rRNA genes to other mycoplasmas.

    Science.gov (United States)

    Messick, Joanne B; Walker, Pamela G; Raphael, William; Berent, Linda; Shi, Xun

    2002-05-01

    The 16S rRNA sequence of newly characterized haemotrophic bacteria in an opossum (Didelphis virginiana) and alpaca (Lama pacos) was determined. In addition, the 16S rRNA sequence of a haemotrophic parasite in the dog (Canis familiaris) was determined. Sequence alignment and evolutionary analysis as well as secondary structural similarity and signature nucleotide sequence motifs of their 16S rRNA genes, positioned these organisms in the genus Mycoplasma. The highest scoring sequence similarities were 16S rRNA genes from haemotrophic mycoplasma species (Haemobartonella and Eperythrozoon spp.). However, the lack of several higher-order structural idiosyncrasies used to define the pneumoniae group, suggests that these organisms and related haemotrophic mycoplasmas represent a new group of mycoplasmas. It is recommended that the organisms be named 'Candidatus Mycoplasma haemodidelphidis', 'Candidatus Mycoplasma haemolamae' and Mycoplasma haemocanis comb. nov., to provide some indication of the target cell and host species of these parasites, and to reflect their phylogenetic affiliation.

  10. Molecular characterization of the non-coding promoter and leader regions and full-length 16S ribosomal RNA (rRNA) gene of Taylorella asinigenitalis.

    Science.gov (United States)

    Tazumi, A; Saito, S; Sekizuka, T; Murayama, O; Moore, J E; Millar, B C; Matsuda, M

    2007-06-01

    The 3,339 base pair (bp) sequences encoding a putative open reading frame (ORF), non-coding promoter and leader regions (approximately 320 bp), full-length 16S ribosomal RNA (rRNA) gene (approximate 1,540 bp) and part of the 16S-23S rDNA internal spacer region (ISR) were determined from genome DNA libraries of the Taylorella asinigenitalis (UK-1) isolate. The non-coding promoter and leader regions included antiterminators (boxB, boxA and boxC) immediately upstream of the 16S rRNA gene sequence. An approximately 680 bp region upstream of the non-coding promoter region appears to contain a putative ORF with high sequence similarity to GTP cyclohydrolase I. In addition, a typical order of intercistronic tRNA genes with the 48 nucleotide spacer of 5'-16S rDNA-tRNA(Ile)-tRNA(Ala)-23S rDNA-3' was demonstrated in a part of the 16S-23S rDNA ISR. The antiterminators of boxB and boxA were also identified in the ISR.A phylogenetic analysis based on the 16S rRNA gene sequence information clearly demonstrated that the five T. asinigenitalis isolates formed a cluster together with the three T. equigenitalis strains, more similar to Pelistega europaea than the other beta-Proteobacteria from the 13 species of 11 genera.

  11. Structural features of the binding site for ribosomal protein S8 in Escherichia coli 16S rRNA defined using NMR spectroscopy.

    Science.gov (United States)

    Kalurachchi, K; Uma, K; Zimmermann, R A; Nikonowicz, E P

    1997-03-18

    Ribosomal protein S8 of Escherichia coli plays a key role in 30S ribosomal subunit assembly through its interaction with 16S rRNA. S8 also participates in the translational regulation of ribosomal protein expression through its interaction with spc operon mRNA. The binding site for protein S8 within the 16S rRNA encompasses nucleotides G588 to G604 and C634 to C651 and is composed of two base paired helical regions that flank a phylogenetically conserved core element containing nine residues. We have investigated the structure of the rRNA binding site for S8 both in the free state and in the presence of protein using NMR spectroscopy. The integrity of the two helical segments has been verified, and the presence of G597 x C643 and A596 x U644 base pairs within the conserved core, predicted from comparative analysis, have been confirmed. In addition, we have identified a base triple within the core that is composed of residues A595 x (A596 x U644). The NMR data suggest that S8-RNA interaction is accomplished without significant changes in the RNA. Nonetheless, S8 binding promotes formation of the U598 x A640 base pair and appears to stabilize the G597 x C643 and A596 x U644 base pairs.

  12. Structural features of the binding site for ribosomal protein S8 in Escherichia coli 16S rRNA defined using NMR spectroscopy

    Science.gov (United States)

    Kalurachchi, K.; Uma, K.; Zimmermann, R. A.; Nikonowicz, E. P.

    1997-01-01

    Ribosomal protein S8 of Escherichia coli plays a key role in 30S ribosomal subunit assembly through its interaction with 16S rRNA. S8 also participates in the translational regulation of ribosomal protein expression through its interaction with spc operon mRNA. The binding site for protein S8 within the 16S rRNA encompasses nucleotides G588 to G604 and C634 to C651 and is composed of two base paired helical regions that flank a phylogenetically conserved core element containing nine residues. We have investigated the structure of the rRNA binding site for S8 both in the free state and in the presence of protein using NMR spectroscopy. The integrity of the two helical segments has been verified, and the presence of G597·C643 and A596·U644 base pairs within the conserved core, predicted from comparative analysis, have been confirmed. In addition, we have identified a base triple within the core that is composed of residues A595·(A596· U644). The NMR data suggest that S8–RNA interaction is accomplished without significant changes in the RNA. Nonetheless, S8 binding promotes formation of the U598·A640 base pair and appears to stabilize the G597·C643 and A596·U644 base pairs. PMID:9122161

  13. Identification of Entamoeba polecki with Unique 18S rRNA Gene Sequences from Celebes Crested Macaques and Pigs in Tangkoko Nature Reserve, North Sulawesi, Indonesia.

    Science.gov (United States)

    Tuda, Josef; Feng, Meng; Imada, Mihoko; Kobayashi, Seiki; Cheng, Xunjia; Tachibana, Hiroshi

    2016-09-01

    Unique species of macaques are distributed across Sulawesi Island, Indonesia, and the details of Entamoeba infections in these macaques are unknown. A total of 77 stool samples from Celebes crested macaques (Macaca nigra) and 14 stool samples from pigs were collected in Tangkoko Nature Reserve, North Sulawesi, and the prevalence of Entamoeba infection was examined by PCR. Entamoeba polecki was detected in 97% of the macaques and all of the pigs, but no other Entamoeba species were found. The nucleotide sequence of the 18S rRNA gene in E. polecki from M. nigra was unique and showed highest similarity with E. polecki subtype (ST) 4. This is the first case of identification of E. polecki ST4 from wild nonhuman primates. The sequence of the 18S rRNA gene in E. polecki from pigs was also unique and showed highest similarity with E. polecki ST1. These results suggest that the diversity of the 18S rRNA gene in E. polecki is associated with differences in host species and geographic localization, and that there has been no transmission of E. polecki between macaques and pigs in the study area. © 2016 The Author(s) Journal of Eukaryotic Microbiology © 2016 International Society of Protistologists.

  14. Mapping of Complete Set of Ribose and Base Modifications of Yeast rRNA by RP-HPLC and Mung Bean Nuclease Assay.

    Directory of Open Access Journals (Sweden)

    Jun Yang

    Full Text Available Ribosomes are large ribonucleoprotein complexes that are fundamental for protein synthesis. Ribosomes are ribozymes because their catalytic functions such as peptidyl transferase and peptidyl-tRNA hydrolysis depend on the rRNA. rRNA is a heterogeneous biopolymer comprising of at least 112 chemically modified residues that are believed to expand its topological potential. In the present study, we established a comprehensive modification profile of Saccharomyces cerevisiae's 18S and 25S rRNA using a high resolution Reversed-Phase High Performance Liquid Chromatography (RP-HPLC. A combination of mung bean nuclease assay, rDNA point mutants and snoRNA deletions allowed us to systematically map all ribose and base modifications on both rRNAs to a single nucleotide resolution. We also calculated approximate molar levels for each modification using their UV (254nm molar response factors, showing sub-stoichiometric amount of modifications at certain residues. The chemical nature, their precise location and identification of partial modification will facilitate understanding the precise role of these chemical modifications, and provide further evidence for ribosome heterogeneity in eukaryotes.

  15. Seismicity in Azerbaijan and Adjacent Caspian Sea

    International Nuclear Information System (INIS)

    Panahi, Behrouz M.

    2006-01-01

    So far no general view on the geodynamic evolution of the Black Sea to the Caspian Sea region is elaborated. This is associated with the geological and structural complexities of the region revealed by geophysical, geochemical, petrologic, structural, and other studies. A clash of opinions on geodynamic conditions of the Caucasus region, sometimes mutually exclusive, can be explained by a simplified interpretation of the seismic data. In this paper I analyze available data on earthquake occurrences in Azerbaijan and the adjacent Caspian Sea region. The results of the analysis of macroseismic and instrumental data, seismic regime, and earthquake reoccurrence indicate that a level of seismicity in the region is moderate, and seismic event are concentrated in the shallow part of the lithosphere. Seismicity is mostly intra-plate, and spatial distribution of earthquake epicenters does not correlate with the plate boundaries

  16. Proofreading of misincorporated nucleotides in DNA transcription

    International Nuclear Information System (INIS)

    Voliotis, Margaritis; Liverpool, Tanniemola B; Cohen, Netta; Molina-París, Carmen

    2012-01-01

    The accuracy of DNA transcription is crucial for the proper functioning of the cell. Although RNA polymerases demonstrate selectivity for correct nucleotides, additional active mechanisms of transcriptional error correction are required to achieve observed levels of fidelity. Recent experimental findings have shed light on a particular mechanism of transcriptional error correction involving: (i) diffusive translocation of the RNA polymerase along the DNA (backtracking) and (ii) irreversible RNA cleavage. This mechanism achieves preferential cleavage of misincorporated nucleotides by biasing the local rates of translocation. Here, we study how misincorporated nucleotides affect backtracking dynamics and how this effect determines the level of transcriptional fidelity. We consider backtracking as a diffusive process in a periodic, one-dimensional energy landscape, which at a coarse-grained level gives rise to a hopping process between neighbouring local minima. We propose a model for how misincorporated nucleotides deform this energy landscape and hence affect the hopping rates. In particular, we show that this model can be used to derive both the theoretical limit on the fidelity (i.e. the minimum fraction of misincorporated nucleotides) and the actual fidelity relative to this optimum, achieved for specific combinations of the cleavage and polymerization rates. Finally, we study how external factors influencing backtracking dynamics affect transcriptional fidelity. We show that biologically relevant loads, similar to those exerted by nucleosomes or other transcriptional barriers, increase error correction. (paper)

  17. A Nucleotide Phosphatase Activity in the Nucleotide Binding Domain of an Orphan Resistance Protein from Rice*

    Science.gov (United States)

    Fenyk, Stepan; de San Eustaquio Campillo, Alba; Pohl, Ehmke; Hussey, Patrick J.; Cann, Martin J.

    2012-01-01

    Plant resistance proteins (R-proteins) are key components of the plant immune system activated in response to a plethora of different pathogens. R-proteins are P-loop NTPase superfamily members, and current models describe their main function as ATPases in defense signaling pathways. Here we show that a subset of R-proteins have evolved a new function to combat pathogen infection. This subset of R-proteins possesses a nucleotide phosphatase activity in the nucleotide-binding domain. Related R-proteins that fall in the same phylogenetic clade all show the same nucleotide phosphatase activity indicating a conserved function within at least a subset of R-proteins. R-protein nucleotide phosphatases catalyze the production of nucleoside from nucleotide with the nucleotide monophosphate as the preferred substrate. Mutation of conserved catalytic residues substantially reduced activity consistent with the biochemistry of P-loop NTPases. Kinetic analysis, analytical gel filtration, and chemical cross-linking demonstrated that the nucleotide-binding domain was active as a multimer. Nuclear magnetic resonance and nucleotide analogues identified the terminal phosphate bond as the target of a reaction that utilized a metal-mediated nucleophilic attack by water on the phosphoester. In conclusion, we have identified a group of R-proteins with a unique function. This biochemical activity appears to have co-evolved with plants in signaling pathways designed to resist pathogen attack. PMID:22157756

  18. A nucleotide phosphatase activity in the nucleotide binding domain of an orphan resistance protein from rice.

    Science.gov (United States)

    Fenyk, Stepan; Campillo, Alba de San Eustaquio; Pohl, Ehmke; Hussey, Patrick J; Cann, Martin J

    2012-02-03

    Plant resistance proteins (R-proteins) are key components of the plant immune system activated in response to a plethora of different pathogens. R-proteins are P-loop NTPase superfamily members, and current models describe their main function as ATPases in defense signaling pathways. Here we show that a subset of R-proteins have evolved a new function to combat pathogen infection. This subset of R-proteins possesses a nucleotide phosphatase activity in the nucleotide-binding domain. Related R-proteins that fall in the same phylogenetic clade all show the same nucleotide phosphatase activity indicating a conserved function within at least a subset of R-proteins. R-protein nucleotide phosphatases catalyze the production of nucleoside from nucleotide with the nucleotide monophosphate as the preferred substrate. Mutation of conserved catalytic residues substantially reduced activity consistent with the biochemistry of P-loop NTPases. Kinetic analysis, analytical gel filtration, and chemical cross-linking demonstrated that the nucleotide-binding domain was active as a multimer. Nuclear magnetic resonance and nucleotide analogues identified the terminal phosphate bond as the target of a reaction that utilized a metal-mediated nucleophilic attack by water on the phosphoester. In conclusion, we have identified a group of R-proteins with a unique function. This biochemical activity appears to have co-evolved with plants in signaling pathways designed to resist pathogen attack.

  19. Design and synthesis of ATP-based nucleotide analogues and profiling of nucleotide-binding proteins

    NARCIS (Netherlands)

    Wolters, Justina. C.; Roelfes, Gerard; Poolman, Bert

    Two nucleotide-based probes were designed and synthesized in order to enrich samples for specific classes of proteins by affinity-based protein profiling. We focused on the profiling of adenine nucleotide-binding proteins. Two properties were considered in the design of the probes: the bait needs to

  20. Pyrrolidine analogues of nucleosides and nucleotides

    Czech Academy of Sciences Publication Activity Database

    Rejman, Dominik; Pohl, Radek; Kovačková, Soňa; Kočalka, Petr; Švenková, Alžběta; Šanderová, Hana; Krásný, Libor; Rosenberg, Ivan

    -, č. 52 (2008), s. 577-578 ISSN 0261-3166. [Joint Symposium of the International Roundtable on Nucleosides, Nucleotides and Nucleic Acids /18./ and the International Symposium on Nucleic Acid Chemistry /35./. Kyoto, 08.09.2008-12.09.2008] R&D Projects: GA MŠk(CZ) LC06077; GA MŠk 2B06065; GA MZd NR9138 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50200510; CEZ:AV0Z50520514 Keywords : pyrrolidine * nucleoside * nucleotide Subject RIV: CC - Organic Chemistry

  1. Exploiting the CRISPR/Cas9 PAM Constraint for Single-Nucleotide Resolution Interventions.

    Directory of Open Access Journals (Sweden)

    Yi Li

    Full Text Available CRISPR/Cas9 is an enabling RNA-guided technology for genome targeting and engineering. An acute DNA binding constraint of the Cas9 protein is the Protospacer Adjacent Motif (PAM. Here we demonstrate that the PAM requirement can be exploited to specifically target single-nucleotide heterozygous mutations while exerting no aberrant effects on the wild-type alleles. Specifically, we target the heterozygous G13A activating mutation of KRAS in colorectal cancer cells and we show reversal of drug resistance to a MEK small-molecule inhibitor. Our study introduces a new paradigm in genome editing and therapeutic targeting via the use of gRNA to guide Cas9 to a desired protospacer adjacent motif.

  2. Isolation of temperature-sensitive mutants of 16 S rRNA in Escherichia coli

    DEFF Research Database (Denmark)

    Triman, K; Becker, E; Dammel, C

    1989-01-01

    Temperature-sensitive mutants have been isolated following hydroxylamine mutagenesis of a plasmid containing Escherichia coli rRNA genes carrying selectable markers for spectinomycin resistance (U1192 in 16 S rRNA) and erythromycin resistance (G2058 in 23 S rRNA). These antibiotic resistance...... alleles, originally identified by Morgan and co-workers, enable us to follow expression of cloned rRNA genes in vivo. Recessive mutations causing the loss of expression of the cloned 16 S rRNA gene were identified by the loss of the ability of cells to survive on media containing spectinomycin....... The mutations were localized by in vitro restriction fragment replacement followed by in vivo marker rescue and were identified by DNA sequence analysis. We report here seven single-base alterations in 16 S rRNA (A146, U153, A350, A359, A538, A1292 and U1293), five of which produce temperature...

  3. Rates of rRNA synthesis and degradation in senescing wheat leaves

    International Nuclear Information System (INIS)

    Lamattina, L.; Pinedo, M.; Pont Lezica, R.; Conde, R.

    1987-01-01

    Changes in cytoplasmic and chloroplastic rRNA content and rates of rRNA synthesis and degradation of detached wheat leaves were determined. It was found that rRNA loss occurs mainly in chloroplast. Rates of synthesis were measured by incorporation of large amounts of ( 3 H)orotic acid into rRNA. This approach overcome size differences between pyrimidine pools of cells under different physiological status. Rate of degradation were estimated either as the difference between synthesis and net variation of rRNA or by disappearance of radioactivity from ( 32 P)-labeled rRNA. Results indicate a decrease in the net rRNA synthesis capacity of leaves after 48 h of detachment. However the fractional rates of rRNA synthesis were maintained in both cytoplasma and chloroplast. Ribosomal RNA degradation rates were 2.5-fold higher in chloroplast than in cytoplasm. It is concluded that the observed chloroplastic rRNA loss is due to an increased degradation rate which is 15-fold higher than synthesis rate at 48 h after detachment

  4. Estimation of rRNA synthesis and degradation rates in senescing wheat leaves

    International Nuclear Information System (INIS)

    Lamattina, L.; Pinedo, M.; Yudi, V.P.; Pont Lezica, R.F.; Conde, R.D.

    1988-01-01

    Changes in cytoplasmic and chloroplast rRNA content and rates of rRNA synthesis and degradation of detached wheat leaves were determined. It was found that rRNA loss is proportionally higher in chloroplasts than in cytoplasm. Rates of synthesis were measured by incorporation of large amounts of [ 3 H]orotic acid into rRNA. This approach overcame size differences between pyrimidine pools of cells under different physiological status. Furthermore, these pools reached nearly the same specific radioactivity as that of the administered solution. Rates of degradation were estimated either as the difference between synthesis and net variation of rRNA or by disappearance of radioactivity from 32 P-labeled rRNA. Results indicated a decrease in the net rRNA synthesis capacity of leaves after 48 h of detachment. However, the fractional rates of rRNA synthesis were maintained in both cytoplasm and chloroplasts. Ribosomal RNA degradation rates were 2.5-fold higher in chloroplast than in cytoplasm. The observed chloroplast rRNA loss is due to an increased degradation rate which is 15-fold higher than the synthesis rate 48 h after detachment

  5. Visual Adjacency Lists for Dynamic Graphs.

    Science.gov (United States)

    Hlawatsch, Marcel; Burch, Michael; Weiskopf, Daniel

    2014-11-01

    We present a visual representation for dynamic, weighted graphs based on the concept of adjacency lists. Two orthogonal axes are used: one for all nodes of the displayed graph, the other for the corresponding links. Colors and labels are employed to identify the nodes. The usage of color allows us to scale the visualization to single pixel level for large graphs. In contrast to other techniques, we employ an asymmetric mapping that results in an aligned and compact representation of links. Our approach is independent of the specific properties of the graph to be visualized, but certain graphs and tasks benefit from the asymmetry. As we show in our results, the strength of our technique is the visualization of dynamic graphs. In particular, sparse graphs benefit from the compact representation. Furthermore, our approach uses visual encoding by size to represent weights and therefore allows easy quantification and comparison. We evaluate our approach in a quantitative user study that confirms the suitability for dynamic and weighted graphs. Finally, we demonstrate our approach for two examples of dynamic graphs.

  6. Expressed sequence tags (ESTs) and single nucleotide ...

    African Journals Online (AJOL)

    Expressed Sequence Tags (ESTs) and Single Nucleotide Polymorphisms (SNPs) are providing in depth knowledge in plant biology, breeding and biotechnology. The emergence of many novel molecular marker techniques are changing and accelerating the process of producing mutations in plant molecular biology ...

  7. Retrieval and Representation of Nucleotide Sequence of ...

    African Journals Online (AJOL)

    Nigerian Journal of Basic and Applied Science (March, 2013), 21(1): 27-32. DOI: http://dx.doi.org/10.4314/njbas.v21i1.4. ISSN 0794-5698. Retrieval and Representation of Nucleotide Sequence of Saccharomyces cerevisiae Cystathionine. Gamma-Lyase (CYS3) Gene in Five Formats. *R. A. Umar, H. Abdullahi and N. Lawal.

  8. Incision Coordination in Nucleotide Excision Repair

    NARCIS (Netherlands)

    W.L. de Laat (Wouter)

    1998-01-01

    textabstractThis thesis aims to contribute to the understanding of the molecular mechanism that underlies one of the main DNA repair pathways in mammals, nucleotide excision rcpair. In chapter 1 the relevance of DNA repair in general is outlined. An overview of mammalian strategies to counteract DNA

  9. Single-nucleotide polymorphisms in peroxisome proliferator ...

    Indian Academy of Sciences (India)

    Prakash

    the metabolic syndrome (MS) and type 2 diabetes. We also investigated the correlation of these two single-nucleotide polymorphisms (SNPs) with plasma resistin levels. The C1431T SNP was associated with higher levels of plasma resistin (P = 0.017). Furthermore, C1431T was associated with resistin in different tertiles.

  10. Evolution of small putative group I introns in the SSU rRNA gene locus of Phialophora species

    Directory of Open Access Journals (Sweden)

    Harris Lorena B

    2011-07-01

    Full Text Available Abstract Background Group I introns (specifically subgroup IC1 are common in the nuclear ribosomal RNA genes of fungi. While most range in length from more than 200 to nearly 1800 nucleotides (nt in length, several small putative (or degenerate group I introns have been described that are between 56 and 81 nt. Although small, previously we demonstrated that the PaSSU intron in the rRNA small subunit gene of Phialophora americana isolate Wang 1046 is capable of in vitro splicing using a standard group I intron pathway, thus qualifying it as a functional ribozyme. Findings Here, we describe eight short putative group I introns, ranging in length from 63 to 75 nt, in the rRNA small subunit genes of Phialophora isolates, a fungal genus that ranges from saprobic to pathogenic on plants and animals. All contain putative pairing regions P1, P7, and P10, as well as a pairing region formed between the middle of the intron and part of the 3' exon. The other pairing regions common in the core of standard group I introns are absent. However, parts of the 3' exon may aid in the stabilization of these small introns. Although the eight putative group I introns were from at least three species of Phialophora, phylogenetic analysis indicated that the eight are monophyletic. They are also monophyletic with the small introns of two lichen-forming fungi, Porpidia crustulata and Arthonia lapidicola. Conclusions The small putative group I introns in Phialophora have common features that may represent group I introns at their minima. They appear to have a single origin as indicated by their monophyly in phylogenetic analyses.

  11. rRNA chemical groups required for aminoglycoside binding.

    Science.gov (United States)

    Blanchard, S C; Fourmy, D; Eason, R G; Puglisi, J D

    1998-05-26

    Through an affinity chromatography based modification-interference assay, we have identified chemical groups within Escherichia coli 16S ribosomal RNA sequence that are required for binding the aminoglycoside antibiotic paromomycin. Paromomycin was covalently linked to solid support via a nine atom spacer from the 6"'-amine of ring IV, and chemical modifications to an A-site oligonucleotide that disrupted binding were identified. Positions in the RNA oligonucleotide that correspond to G1405(N7), G1491(N7), G1494(N7), A1408(N7), A1493(N7), A1408(N1), A1492(N1), and A1493(N1), as well as the pro-R phosphate oxygens of A1492 and A1493 in 16S rRNA are chemical groups that are essential for a high-affinity RNA-paromomycin interaction. These data are consistent with genetic, biochemical, and structural studies related to neomycin-class antibiotics and provide additional information for establishing an exact model for their interaction with the ribosome.

  12. Analysis of adjacent segment reoperation after lumbar total disc replacement

    OpenAIRE

    Rainey, Scott; Blumenthal, Scott L.; Zigler, Jack E.; Guyer, Richard D.; Ohnmeiss, Donna D.

    2012-01-01

    Background Fusion has long been used for treating chronic back pain unresponsive to nonoperative care. However, potential development of adjacent segment degeneration resulting in reoperation is a concern. Total disc replacement (TDR) has been proposed as a method for addressing back pain and preventing or reducing adjacent segment degeneration. The purpose of the study was to determine the reoperation rate at the segment adjacent to a level implanted with a lumbar TDR and to analyze the pre-...

  13. Alteration of rRNA gene copy number and expression in patients ...

    African Journals Online (AJOL)

    Background: Intellectual disability (ID) is an important medical and social problem that can be caused by different genetic and environmental factors. One such factor could be rDNA amplification and changes in rRNA expression and maturation. Aim of the study: The aim of the present study was to investigate rRNA levels in ...

  14. Inhibition of Escherichia coli precursor-16S rRNA processing by mouse intestinal contents

    DEFF Research Database (Denmark)

    Licht, Tine Rask; Tolker-Nielsen, Tim; Holmstrøm, Kim

    1999-01-01

    growth. The amounts of 23S rRNA and pre-16S rRNA measured for E. coli growing in intestinal mucus corresponded to that expected for bacteria with the observed growth rate. In contrast, the slow-growing E. coli cells present in intestinal contents turned out to have an approximately ninefold higher...

  15. Hepatic rRNA Transcription Regulates High-Fat-Diet-Induced Obesity

    Directory of Open Access Journals (Sweden)

    Shohei Oie

    2014-05-01

    Full Text Available Ribosome biosynthesis is a major intracellular energy-consuming process. We previously identified a nucleolar factor, nucleomethylin (NML, which regulates intracellular energy consumption by limiting rRNA transcription. Here, we show that, in livers of obese mice, the recruitment of NML to rRNA gene loci is increased to repress rRNA transcription. To clarify the relationship between obesity and rRNA transcription, we generated NML-null (NML-KO mice. NML-KO mice show elevated rRNA level, reduced ATP concentration, and reduced lipid accumulation in the liver. Furthermore, in high-fat-diet (HFD-fed NML-KO mice, hepatic rRNA levels are not decreased. Both weight gain and fat accumulation in HFD-fed NML-KO mice are significantly lower than those in HFD-fed wild-type mice. These findings indicate that rRNA transcriptional activation promotes hepatic energy consumption, which alters hepatic lipid metabolism. Namely, hepatic rRNA transcriptional repression by HFD feeding is essential for energy storage.

  16. Utility of 16S rRNA PCR performed on clinical specimens in patient management

    Directory of Open Access Journals (Sweden)

    A. Akram

    2017-04-01

    Conclusions: Despite the low diagnostic yield, results of 16S rRNA PCR can still have a significant impact on patient management due to rationalization or cessation of the antimicrobial therapy. The yield of 16S rRNA PCR was highest for heart valves.

  17. Novel mutation in 16S rRNA associated with streptomycin dependence in Mycobacterium tuberculosis.

    OpenAIRE

    Honoré, N; Marchal, G; Cole, S T

    1995-01-01

    Molecular characterization of a streptomycin-dependent mutant of Mycobacterium tuberculosis revealed the presence of a novel mutation in the rrs gene encoding 16S rRNA. Insertion of an additional cytosine in the 530 loop of 16S rRNA, a region known to be involved in streptomycin susceptibility and resistance, was associated with streptomycin dependence.

  18. The International Nucleotide Sequence Database Collaboration.

    Science.gov (United States)

    Cochrane, Guy; Karsch-Mizrachi, Ilene; Nakamura, Yasukazu

    2011-01-01

    Under the International Nucleotide Sequence Database Collaboration (INSDC; http://www.insdc.org), globally comprehensive public domain nucleotide sequence is captured, preserved and presented. The partners of this long-standing collaboration work closely together to provide data formats and conventions that enable consistent data submission to their databases and support regular data exchange around the globe. Clearly defined policy and governance in relation to free access to data and relationships with journal publishers have positioned INSDC databases as a key provider of the scientific record and a core foundation for the global bioinformatics data infrastructure. While growth in sequence data volumes comes no longer as a surprise to INSDC partners, the uptake of next-generation sequencing technology by mainstream science that we have witnessed in recent years brings a step-change to growth, necessarily making a clear mark on INSDC strategy. In this article, we introduce the INSDC, outline data growth patterns and comment on the challenges of increased growth.

  19. Nucleotide Manipulatives to Illustrate the Central Dogma

    OpenAIRE

    Sonja B. Yung; Todd P. Primm

    2015-01-01

    The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.

  20. Nucleotide Manipulatives to Illustrate the Central Dogma

    Directory of Open Access Journals (Sweden)

    Sonja B. Yung

    2015-08-01

    Full Text Available The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.

  1. Pyrrolidine nucleotide analogs with a tunable conformation

    Czech Academy of Sciences Publication Activity Database

    Poštová Slavětínská, Lenka; Rejman, Dominik; Pohl, Radek

    2014-01-01

    Roč. 10, Aug 22 (2014), s. 1967-1980 ISSN 1860-5397 R&D Projects: GA ČR GA13-24880S Institutional support: RVO:61388963 Keywords : conformation * NMR * nucleic acids * nucleotide analog * phosphonic acid * pseudorotation * pyrrolidine Subject RIV: CC - Organic Chemistry Impact factor: 2.762, year: 2014 http://www.beilstein-journals.org/bjoc/single/articleFullText.htm?publicId=1860-5397-10-205

  2. Aggregation of rat neutrophils by nucleotide triphosphates.

    OpenAIRE

    Ford-Hutchinson, A. W.

    1982-01-01

    1 Adenosine 5'-triphosphate (ATP) and uridine 5'-triphosphate (UTP) at concentrations of 3 x 10(-7)M and greater cause a rapid partially reversible aggregation of rat polymorphonuclear leucocytes. 2 Other nucleotide phosphates are much less active at producing aggregation responses; the agonist potencies being UTP greater than ATP greater than guanosine 5'-triphosphate, cytidine 5'-triphosphate, thymidine 5'-triphosphate; ATP greater than adenosine 5'-diphosphate (ADP) greater than adenosine ...

  3. Vacuum ultraviolet photoionization of carbohydrates and nucleotides

    International Nuclear Information System (INIS)

    Shin, Joong-Won; Bernstein, Elliot R.

    2014-01-01

    Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5 ′ -monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C–C and C–O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results

  4. Vacuum ultraviolet photoionization of carbohydrates and nucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Shin, Joong-Won, E-mail: jshin@govst.edu [Division of Science, Governors State University, University Park, Illinois 60484-0975 (United States); Department of Chemistry, Colorado State University, Fort Collins, Colorado 80523-1872 (United States); Bernstein, Elliot R., E-mail: erb@lamar.colostate.edu [Department of Chemistry, Colorado State University, Fort Collins, Colorado 80523-1872 (United States)

    2014-01-28

    Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5{sup ′}-monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C–C and C–O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results.

  5. Vacuum ultraviolet photoionization of carbohydrates and nucleotides

    Science.gov (United States)

    Shin, Joong-Won; Bernstein, Elliot R.

    2014-01-01

    Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5'-monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C-C and C-O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results.

  6. Visualization of cyclic nucleotide dynamics in neurons

    Directory of Open Access Journals (Sweden)

    Kirill eGorshkov

    2014-12-01

    Full Text Available The second messengers cAMP and cGMP transduce many neuromodulatory signals from hormones and neurotransmitters into specific functional outputs. Their production, degradation and signaling are spatiotemporally regulated to achieve high specificity in signal transduction. The development of genetically encodable fluorescent biosensors has provided researchers with useful tools to study these versatile second messengers and their downstream effectors with unparalleled spatial and temporal resolution in cultured cells and living animals. In this review, we introduce the general design of these fluorescent biosensors and describe several of them in more detail. Then we discuss a few examples of using cyclic nucleotide fluorescent biosensors to study regulation of neuronal function and finish with a discussion of advances in the field. Although there has been significant progress made in understanding how the specific signaling of cyclic nucleotide second messengers is achieved, the mechanistic details in complex cell types like neurons are only just beginning to surface. Current and future fluorescent protein reporters will be essential to elucidate the role of cyclic nucleotide signaling dynamics in the functions of individual neurons and their networks.

  7. The Microbial Ecosystem Distinguishes Chronically Diseased Tissue from Adjacent Tissue in the Sigmoid Colon of Chronic, Recurrent Diverticulitis Patients.

    Science.gov (United States)

    Schieffer, Kathleen M; Sabey, Kate; Wright, Justin R; Toole, David R; Drucker, Rebecca; Tokarev, Vasily; Harris, Leonard R; Deiling, Sue; Eshelman, Melanie A; Hegarty, John P; Yochum, Gregory S; Koltun, Walter A; Lamendella, Regina; Stewart, David B

    2017-08-16

    Diverticular disease is commonly associated with the older population in the United States. As individual's age, diverticulae, or herniation of the mucosa through the colonic wall, develop. In 10-25% of individuals, the diverticulae become inflamed, resulting in diverticulitis. The gut ecosystem relies on the interaction of bacteria and fungi to maintain homeostasis. Although bacterial dysbiosis has been implicated in the pathogenesis of diverticulitis, associations between the microbial ecosystem and diverticulitis remain largely unstudied. This study investigated how the cooperative network of bacteria and fungi differ between a diseased area of the sigmoid colon chronically affected by diverticulitis and adjacent non-affected tissue. To identify mucosa-associated microbes, bacterial 16S rRNA and fungal ITS sequencing were performed on chronically diseased sigmoid colon tissue (DT) and adjacent tissue (AT) from the same colonic segment. We found that Pseudomonas and Basidiomycota OTUs were associated with AT while Microbacteriaceae and Ascomycota were enriched in DT. Bipartite co-occurrence networks were constructed for each tissue type. The DT and AT networks were distinct for each tissue type, with no microbial relationships maintained after intersection merge of the groups. Our findings indicate that the microbial ecosystem distinguishes chronically diseased tissue from adjacent tissue.

  8. 33 CFR 80.1395 - Puget Sound and adjacent waters.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Puget Sound and adjacent waters. 80.1395 Section 80.1395 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY... waters. The 72 COLREGS shall apply on all waters of Puget Sound and adjacent waters, including Lake Union...

  9. Objectifying the Adjacent and Opposite Angles: A Cultural Historical Analysis

    Science.gov (United States)

    Daher, Wajeeh; Musallam, Nadera

    2018-01-01

    The angle topic is central to the development of geometric knowledge. Two of the basic concepts associated with this topic are the adjacent and opposite angles. It is the goal of the present study to analyze, based on the cultural historical semiotics framework, how high-achieving seventh grade students objectify the adjacent and opposite angles'…

  10. Effects of hypokinesia on cyclic nucleotides and hormonal regulation ...

    African Journals Online (AJOL)

    PTH), calcitonin (CT), cyclic nucleotides (cAMP, cGMP) and calcium in the blood of rats, while in urine - phosphate, calcium and cyclic nucleotides. Design: Laboratory based experiment. Setting: Laboratory in the Department of Biochemistry, ...

  11. Identification of pathogenic Nocardia species by reverse line blot hybridization targeting the 16S rRNA and 16S-23S rRNA gene spacer regions.

    Science.gov (United States)

    Xiao, Meng; Kong, Fanrong; Sorrell, Tania C; Cao, Yongyan; Lee, Ok Cha; Liu, Ying; Sintchenko, Vitali; Chen, Sharon C A

    2010-02-01

    Although 16S rRNA gene sequence analysis is employed most often for the definitive identification of Nocardia species, alternate molecular methods and polymorphisms in other gene targets have also enabled species determinations. We evaluated a combined Nocardia PCR-based reverse line blot (RLB) hybridization assay based on 16S and 16S-23S rRNA gene spacer region polymorphisms to identify 12 American Type Culture Collection and 123 clinical Nocardia isolates representing 14 species; results were compared with results from 16S rRNA gene sequencing. Thirteen 16S rRNA gene-based (two group-specific and 11 species-specific) and five 16S-23S spacer-targeted (two taxon-specific and three species-specific) probes were utilized. 16S rRNA gene-based probes correctly identified 124 of 135 isolates (sensitivity, 92%) but were unable to identify Nocardia paucivorans strains (n = 10 strains) and a Nocardia asteroides isolate with a novel 16S rRNA gene sequence. Nocardia farcinica and Nocardia cyriacigeorgica strains were identified by the sequential use of an N. farcinica-"negative" probe and a combined N. farcinica/N. cyriacigeorgica probe. The assay specificity was high (99%) except for weak cross-reactivity between the Nocardia brasiliensis probe with the Nocardia thailandica DNA product; however, cross-hybridization with closely related nontarget species may occur. The incorporation of 16S-23S rRNA gene spacer-based probes enabled the identification of all N. paucivorans strains. The overall sensitivity using both probe sets was >99%. Both N. farcinica-specific 16S-23S rRNA gene spacer-directed probes were required to identify all N. farcinica stains by using this probe set. The study demonstrates the utility of a combined PCR/RLB assay for the identification of clinically relevant Nocardia species and its potential for studying subtypes of N. farcinica. Where species assignment is ambiguous or not possible, 16S rRNA gene sequencing is recommended.

  12. Ribosomal proteins L11 and L10.(L12)4 and the antibiotic thiostrepton interact with overlapping regions of the 23 S rRNA backbone in the ribosomal GTPase centre

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S

    1993-01-01

    RNA, and to investigate how this interaction is influenced by other ribosomal components. Complexes were characterized in both naked 23 S rRNA and ribosomes from an E. coli L11-minus strain, before and after reconstitution with L11. The protein protects 17 riboses between positions 1058 and 1085 in the naked 23 S r......The Escherichia coli ribosomal protein (r-protein) L11 and its binding site on 23 S ribosomal RNA (rRNA) are associated with ribosomal hydrolysis of guanosine 5'-triphosphate (GTP). We have used hydroxyl radical footprinting to map the contacts between L11 and the backbone riboses in 23 S r......)4 and other proteins within the ribosome. The antibiotics thiostrepton and micrococcin inhibit the catalytic functions of this region by slotting in between the accessible loops and interacting with nucleotides there....

  13. Ius Chasma Tributary Valleys and Adjacent Plains

    Science.gov (United States)

    2006-01-01

    This image covers valley tributaries of Ius Chasma, as well as the plains adjacent to the valleys. Ius Chasma is one of several canyons that make up the Valles Marineris canyon system. Valles Marineris likely formed by extension associated with the growth of the large volcanoes and topographic high of Tharsis to the northwest. As the ground was pulled apart, large and deep gaps resulted in the valleys seen in the top and bottom of this HiRISE image. Ice that was once in the ground could have also melted to create additional removal of material in the formation of the valleys. HiRISE is able to see the rocks along the walls of both these valleys and also impact craters in the image. Rock layers that appear lower down in elevation appear rougher and are shedding boulders. Near the top of the walls and also seen in patches along the smooth plains are brighter layers. These brighter layers are not shedding boulders so they must represent a different kind of rock formed in a different kind of environment than those further down the walls. Because they are highest in elevation, the bright layers are youngest in age. HiRISE is able to see dozens of the bright layers, which are perhaps only a meter in thickness. Darker sand dunes and ripples cover most of the plains and fill the floors of impact craters. Image PSP_001351_1715 was taken by the High Resolution Imaging Science Experiment (HiRISE) camera onboard the Mars Reconnaissance Orbiter spacecraft on November 9, 2006. The complete image is centered at -8.3 degrees latitude, 275.4 degrees East longitude. The range to the target site was 254.3 km (158.9 miles). At this distance the image scale ranges from 25.4 cm/pixel (with 1 x 1 binning) to 101.8 cm/pixel (with 4 x 4 binning). The image shown here has been map-projected to 25 cm/pixel and north is up. The image was taken at a local Mars time of 3:32 PM and the scene is illuminated from the west with a solar incidence angle of 59 degrees, thus the sun was about 31

  14. Molecular characterization of intervening sequences in 23S rRNA genes and 23S rRNA fragmentation in Taylorella equigenitalis.

    Science.gov (United States)

    Tazumi, A; Sekizuka, T; Moore, J E; Millar, B C; Taneike, I; Matsuda, M

    2008-01-01

    Using two primer pairs constructed in silico for the amplification of the intervening sequences (IVSs) of the 23S rRNA gene sequences of the genus Taylorella, none of the three representative T. equigenitalis strains NCTC11184(T), Kentucky 188 and EQ59 was shown to contain any IVSs in the first quarter region. In the central region, all three strains possessed one approximately 70 bp IVS (TeIVS2) different from any IVSs found in T. asinigenitalis. The predicted secondary structure model of the IVSs contained stem and loop structures. The central region of the IVS-stem structure contains an identical double-stranded consensus 15-bp sequence. The purified RNA fraction from the three strains contained 16S and 4-5S RNA species but no 23S rRNA species. Thus, the primary 23S rRNA transcripts from the three strains would be cleaved into approximately 1.2- and 1.6-kb rRNA fragments and approximately 70-bp IVS. In addition, 16 other T. equigenitalis isolates were found to carry a similar 70-bp IVS in the central region and to produce fragmented 23S rRNA.

  15. Intervening sequences in 23S rRNA genes and 23S rRNA fragmentation in Taylorella asinigenitalis UCD-1(T) strain.

    Science.gov (United States)

    Tazumi, Akihiro; Sekizuka, Tsuyoshi; Moore, John E; Millar, Cherie B; Taneike, Ikue; Matsuda, Motoo

    2008-08-01

    PCR was performed with Taylorella asinigenitalis UCD-1(T) using two primer pairs constructed in silico for the amplification of the intervening sequences (IVSs) in the first quarter and central regions of the 23S rRNA gene. Following TA cloning and sequencing, the strain was identified to carry heterogeneous and multiple IVSs. Two similar tandem repeat units of 25 and 24 base pairs (bp) with unknown function(s) were identified within the two IVSs in the central region. Secondary structure models of IVSs, containing stem and loop structures, were demonstrated. Although 16S rRNA and 4-5S RNA species were identified in the purified RNA fraction, no 23S rRNAs were evident, resulting in the occurrence of some smaller RNA fragments from approximately 500 to 1,600 bp, in length. Thus, the 23S rRNA primary transcripts may be cleaved into some smaller fragments and IVSs. No IVS transcript was detected by northern blot hybridization analysis. The present and previous results strongly demonstrate the occurrence of heterogeneous and multiple IVSs in 23S rRNA gene sequences and 23S rRNA fragmentation, in T. asinigenitalis. (c) 2008 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. 18S rRNA degradation is not accompanied by altered rRNA transport at early times following irradiation of HeLa cells

    Energy Technology Data Exchange (ETDEWEB)

    Fuchs, P.; Krolak, J.M.; McClain, D.; Minton, K.W.

    1990-01-01

    In recent investigations on the effects of radiation on rRNA processing in HeLa S3 cells, the authors pulse-labeled the cells with uridine immediately prior to irradiation. The 45 S rRNA precursor, which undergoes nuclear processing to form one each of its major daughter species, 28S and 18S rRNA, was separated from the daughter species by gel electrophoresis and the radiolabel in each species determined at various times after irradiation. By pulse-labeling the cells prior to irradiation, superimposed effects caused by radiation-induced alterations of rRNA transcription and Refs. therein were minimized, permitting selective analysis of the processing of that fraction of 45S precursor that had been synthesized (radiolabeled) predominantly prior to irradiation. They now report more detailed studies on 45S rRNA processing within the first 2 h following irradiation in which they have found a maximum 28 S:18 S ratio of 2:1 that is observed about 1 h following irradiation of 5 or 10 Gy.

  17. A molecular phylogeny of the marine red algae (Rhodophyta) based on the nuclear small-subunit rRNA gene.

    Science.gov (United States)

    Ragan, M A; Bird, C J; Rice, E L; Gutell, R R; Murphy, C A; Singh, R K

    1994-01-01

    A phylogeny of marine Rhodophyta has been inferred by a number of methods from nucleotide sequences of nuclear genes encoding small subunit rRNA from 39 species in 15 orders. Sequence divergences are relatively large, especially among bangiophytes and even among congeners in this group. Subclass Bangiophycidae appears polyphyletic, encompassing at least three lineages, with Porphyridiales distributed between two of these. Subclass Florideophycidae is monophyletic, with Hildenbrandiales, Corallinales, Ahnfeltiales, and a close association of Nemaliales, Acrochaetiales, and Palmariales forming the four deepest branches. Cermiales may represent a convergence of vegetative and reproductive morphologies, as family Ceramiaceae is at best weakly related to the rest of the order, and one of its members appears to be allied to Gelidiales. Except for Gigartinales, for which more data are required, the other florideophyte orders appear distinct and taxonomically justified. A good correlation was observed with taxonomy based on pit-plug ultrastructure. Tests under maximum-likelihood and parsimony of alternative phylogenies based on structure and chemistry refuted suggestions that Acrochaetiales is the most primitive florideophyte order and that Gelidiales and Hildenbrandiales are sister groups. PMID:8041780

  18. Evidence of birth-and-death evolution of 5S rRNA gene in Channa species (Teleostei, Perciformes).

    Science.gov (United States)

    Barman, Anindya Sundar; Singh, Mamta; Singh, Rajeev Kumar; Lal, Kuldeep Kumar

    2016-12-01

    In higher eukaryotes, minor rDNA family codes for 5S rRNA that is arranged in tandem arrays and comprises of a highly conserved 120 bp long coding sequence with a variable non-transcribed spacer (NTS). Initially the 5S rDNA repeats are considered to be evolved by the process of concerted evolution. But some recent reports, including teleost fishes suggested that evolution of 5S rDNA repeat does not fit into the concerted evolution model and evolution of 5S rDNA family may be explained by a birth-and-death evolution model. In order to study the mode of evolution of 5S rDNA repeats in Perciformes fish species, nucleotide sequence and molecular organization of five species of genus Channa were analyzed in the present study. Molecular analyses revealed several variants of 5S rDNA repeats (four types of NTS) and networks created by a neighbor net algorithm for each type of sequences (I, II, III and IV) did not show a clear clustering in species specific manner. The stable secondary structure is predicted and upstream and downstream conserved regulatory elements were characterized. Sequence analyses also shown the presence of two putative pseudogenes in Channa marulius. Present study supported that 5S rDNA repeats in genus Channa were evolved under the process of birth-and-death.

  19. Phylogenetic relationships of true butterflies (Lepidoptera: Papilionoidea) inferred from COI, 16S rRNA and EF-1α sequences.

    Science.gov (United States)

    Kim, Man Il; Wan, Xinlong; Kim, Min Jee; Jeong, Heon Cheon; Ahn, Neung-Ho; Kim, Ki-Gyoung; Han, Yeon Soo; Kim, Iksoo

    2010-11-01

    The molecular phylogenetic relationships among true butterfly families (superfamily Papilionoidea) have been a matter of substantial controversy; this debate has led to several competing hypotheses. Two of the most compelling of those hypotheses involve the relationships of (Nymphalidae + Lycaenidae) + (Pieridae + Papilionidae) and (((Nymphalidae + Lycaenidae) + Pieridae) + Papilionidae). In this study, approximately 3,500 nucleotide sequences from cytochrome oxidase subunit I (COI), 16S ribosomal RNA (16S rRNA), and elongation factor-1 alpha (EF-1α) were sequenced from 83 species belonging to four true butterfly families, along with those of three outgroup species belonging to three lepidopteran superfamilies. These sequences were subjected to phylogenetic reconstruction via Bayesian Inference (BI), Maximum Likelihood (ML), and Maximum Parsimony (MP) algorithms. The monophyletic Pieridae and monophyletic Papilionidae evidenced good recovery in all analyses, but in some analyses, the monophylies of the Lycaenidae and Nymphalidae were hampered by the inclusion of single species of the lycaenid subfamily Miletinae and the nymphalid subfamily Danainae. Excluding those singletons, all phylogenetic analyses among the four true butterfly families clearly identified the Nymphalidae as the sister to the Lycaenidae and identified this group as a sister to the Pieridae, with the Papilionidae identified as the most basal linage to the true butterfly, thus supporting the hypothesis: (Papilionidae + (Pieridae + (Nymphalidae + Lycaenidae))).

  20. Two distinct types of rRNA operons in the Bacillus cereus group.

    Science.gov (United States)

    Candelon, Benjamin; Guilloux, Kévin; Ehrlich, S Dusko; Sorokin, Alexei

    2004-03-01

    The Bacillus cereus group includes insecticidal bacteria (B. thuringiensis), food-borne pathogens (B. cereus and B. weihenstephanensis) and B. anthracis, the causative agent of anthrax. The precise number of rRNA operons in 12 strains of the B. cereus group was determined. Most of the tested strains possess 13 operons and the tested psychrotolerant strains contain 14 operons, the highest number ever found in bacteria. The separate clustering of the tested psychrotolerant strains was confirmed by partial sequencing of several genes distributed over the chromosomes. Analysis of regions downstream of the 23S rRNA genes in the type strain B. cereus ATCC 14579 indicates that the rRNA operons can be divided into two classes, I and II, consisting respectively of eight and five operons. Class II operons exhibit multiple tRNA genes downstream of the 5S rRNA gene and a putative promoter sequence in the 23S-5S intergenic region, suggesting that 5S rRNA and the downstream tRNA genes can be transcribed independently of the 16S and 23S genes. Similar observations were made in the recently sequenced genome of B. anthracis strain Ames. The existence of these distinct types of rRNA operons suggests an unknown mechanism for regulation of rRNA and tRNA synthesis potentially related to the pool of amino acids available for protein synthesis.

  1. Loading effects of anterior cervical spine fusion on adjacent segments

    Directory of Open Access Journals (Sweden)

    Chien-Shiung Wang

    2012-11-01

    Full Text Available Adjacent segment degeneration typically follows anterior cervical spine fusion. However, the primary cause of adjacent segment degeneration remains unknown. Therefore, in order to identify the loading effects that cause adjacent segment degeneration, this study examined the loading effects to superior segments adjacent to fused bone following anterior cervical spine fusion. The C3–C6 cervical spine segments of 12 sheep were examined. Specimens were divided into the following groups: intact spine (group 1; and C5–C6 segments that were fused via cage-instrumented plate fixation (group 2. Specimens were cycled between 20° flexion and 15° extension with a displacement control of 1°/second. The tested parameters included the range of motion (ROM of each segment, torque and strain on both the body and inferior articular process at the superior segments (C3–C4 adjacent to the fused bone, and the position of the neutral axis of stress at under 20° flexion and 15° extension. Under flexion and Group 2, torque, ROM, and strain on both the bodies and facets of superior segments adjacent to the fused bone were higher than those of Group 1. Under extension and Group 2, ROM for the fused segment was less than that of Group 1; torque, ROM, and stress on both the bodies and facets of superior segments adjacent to the fused bone were higher than those of Group 1. These analytical results indicate that the muscles and ligaments require greater force to achieve cervical motion than the intact spine following anterior cervical spine fusion. In addition, ROM and stress on the bodies and facets of the joint segments adjacent to the fused bone were significantly increased. Under flexion, the neutral axis of the stress on the adjacent segment moved backward, and the stress on the bodies of the segments adjacent to the fused bone increased. These comparative results indicate that increased stress on the adjacent segments is caused by stress-shielding effects

  2. The Conserved RNA Exonuclease Rexo5 Is Required for 3′ End Maturation of 28S rRNA, 5S rRNA, and snoRNAs

    Directory of Open Access Journals (Sweden)

    Stefanie Gerstberger

    2017-10-01

    Full Text Available Non-coding RNA biogenesis in higher eukaryotes has not been fully characterized. Here, we studied the Drosophila melanogaster Rexo5 (CG8368 protein, a metazoan-specific member of the DEDDh 3′-5′ single-stranded RNA exonucleases, by genetic, biochemical, and RNA-sequencing approaches. Rexo5 is required for small nucleolar RNA (snoRNA and rRNA biogenesis and is essential in D. melanogaster. Loss-of-function mutants accumulate improperly 3′ end-trimmed 28S rRNA, 5S rRNA, and snoRNA precursors in vivo. Rexo5 is ubiquitously expressed at low levels in somatic metazoan cells but extremely elevated in male and female germ cells. Loss of Rexo5 leads to increased nucleolar size, genomic instability, defective ribosome subunit export, and larval death. Loss of germline expression compromises gonadal growth and meiotic entry during germline development.

  3. Comparative structural analysis of cytoplasmic and chloroplastic 5S rRNA from spinach.

    Science.gov (United States)

    Pieler, T; Digweed, M; Bartsch, M; Erdmann, V A

    1983-01-01

    5S rRNAs from Spinacea oleracea cytoplasmic and chloroplastic ribosomes have been subjected to digestion with the single strand specific nuclease S1 and to chemical modification of cytidines by sodium bisulphite in order to probe the RNA structure. According to these data, cytoplasmic 5S rRNA can be folded as proposed in the general eukaryotic 5S rRNA structure (1) and 5S rRNA from chloroplastides is shown to be more related to the general eubacterial structure (2). Images PMID:6340063

  4. Comparative structural analysis of cytoplasmic and chloroplastic 5S rRNA from spinach.

    OpenAIRE

    Pieler, T; Digweed, M; Bartsch, M; Erdmann, V A

    1983-01-01

    5S rRNAs from Spinacea oleracea cytoplasmic and chloroplastic ribosomes have been subjected to digestion with the single strand specific nuclease S1 and to chemical modification of cytidines by sodium bisulphite in order to probe the RNA structure. According to these data, cytoplasmic 5S rRNA can be folded as proposed in the general eukaryotic 5S rRNA structure (1) and 5S rRNA from chloroplastides is shown to be more related to the general eubacterial structure (2).

  5. Intragenomic Variation Among 16S rRNA Copies in Vibrio - Significance of Lifestyle

    OpenAIRE

    Karlsholm, Line Strand

    2017-01-01

    Intragenomic heterogeneity among 16S rRNA gene copies has been found in several species of bacteria. In this thesis, the presence of different 16S rRNA gene copies and the differences in the relative abundance of these 16S rRNA gene variants for different lifestyles was examined for three species of Vibrio. The Vibrio strains used were Vibrio anguillarum strain HI610, Vibrio campbellii strain BB120 and the Vibrio sp. strain RD5-30. The methods used to examine this were denaturing gradient g...

  6. Reverse transcription and polymerase chain reaction amplification of rRNA for detection of Helicobacter species.

    OpenAIRE

    Engstrand, L; Nguyen, A M; Graham, D Y; el-Zaatari, F A

    1992-01-01

    Sequence data on Helicobacter pylori 16S rRNA were used to select two 22-base oligonucleotide primers for use in a polymerase chain reaction (PCR) for detection of H. pylori. H. pylori cells were treated with lysis buffer, boiled, and chloroform extracted. Reverse transcription of rRNA was followed by PCR amplification (RT-PCR) of the synthesized cDNA and 16S rRNA gene. The amplified PCR products were analyzed by agarose gel electrophoresis and Southern blotting. Using ethidium bromide-staine...

  7. Specificity shifts in the rRNA and tRNA nucleotide targets of archaeal and bacterial m5U methyltransferases

    DEFF Research Database (Denmark)

    Auxilien, Sylvie; Rasmussen, Anette; Rose, Simon

    2011-01-01

    Methyltransferase enzymes that use S-adenosylmethionine as a cofactor to catalyze 5-methyl uridine (m(5)U) formation in tRNAs and rRNAs are widespread in Bacteria and Eukaryota, but are restricted to the Thermococcales and Nanoarchaeota groups amongst the Archaea. The RNA m(5)U methyltransferases...

  8. DNA authentication of Plantago Herb based on nucleotide sequences of 18S-28S rRNA internal transcribed spacer region.

    Science.gov (United States)

    Sahin, Fatma Pinar; Yamashita, Hiromi; Guo, Yahong; Terasaka, Kazuyoshi; Kondo, Toshiya; Yamamoto, Yutaka; Shimada, Hiroshi; Fujita, Masao; Kawasaki, Takeshi; Sakai, Eiji; Tanaka, Toshihiro; Goda, Yukihiro; Mizukami, Hajime

    2007-07-01

    Internal transcribed spacer (ITS) regions of nuclear ribosomal RNA gene were amplified from 23 plant- and herbarium specimens belonging to eight Plantago species (P. asiatica, P. depressa, P. major, P. erosa, P. hostifolia, P. camtschatica, P. virginica and P. lanceolata). Sequence comparison indicated that these Plantago species could be identified based on the sequence type of the ITS locus. Sequence analysis of the ITS regions amplified from the crude drug Plantago Herb obtained in the markets indicated that all the drugs from Japan were derived from P. asiatica whereas the samples obtained in China were originated from various Plantago species including P. asiatica, P. depressa, P. major and P. erosa.

  9. Nucleotide sequence database comparison for Internal Transcribed Spacer 2 genetic region DNA barcode dermatophyte routine identification.

    Science.gov (United States)

    Normand, A C; Packeu, A; Cassagne, C; Hendrickx, M; Ranque, S; Piarroux, R

    2018-02-28

    Conventional dermatophyte identification is based on morphological features. However, recent studies have proposed to use the nucleotide sequences of the rRNA ITS region as an identification barcode of all fungi, including dermatophytes. Several nucleotide databases are available to compare sequences and thus identify isolates; however, these databases often contain mislabeled sequences that impair sequence-based identification.We evaluated five of these databases on a clinical isolate panel. We selected 292 clinical dermatophyte strains that were prospectively subjected to ITS2 nucleotide sequence analysis. Sequences were analyzed against the databases, and the results were compared to clusters obtained via DNA alignment of sequence segments. The DNA tree served as the identification standard throughout the study.According to the ITS2 sequence identification, the majority of strains (255/292) belonged to the genus Trichophyton , mainly T. rubrum complex (n=184), T. interdigitale (n=40), T. tonsurans (n=26) and T. benhamiae (n=5). Other genera included Microsporum (e.g., M canis (n=21), M. audouinii (n=10) and Nannizzia gypseum (n=3), and Epidermophyton (n=3)). Species-level identification of T. rubrum complex isolates was an issue.Overall, ITS DNA sequencing is a reliable tool to identify dermatophyte species given that a comprehensive and correctly-labeled database is consulted. As many inaccurate identification results exist in the DNA databases used for this study, reference databases must be verified frequently and amended in line with the current revisions of fungal taxonomy. Before describing a new species or adding a new DNA reference to the available databases, its position in the phylogenetic tree must be verified. Copyright © 2018 American Society for Microbiology.

  10. Bacterial community variations in an alfalfa-rice rotation system revealed by 16S rRNA gene 454-pyrosequencing.

    Science.gov (United States)

    Lopes, Ana R; Manaia, Célia M; Nunes, Olga C

    2014-03-01

    Crop rotation is a practice harmonized with the sustainable rice production. Nevertheless, the implications of this empirical practice are not well characterized, mainly in relation to the bacterial community composition and structure. In this study, the bacterial communities of two adjacent paddy fields in the 3rd and 4th year of the crop rotation cycle and of a nonseeded subplot were characterized before rice seeding and after harvesting, using 454-pyrosequencing of the 16S rRNA gene. Although the phyla Acidobacteria, Proteobacteria, Chloroflexi, Actinobacteria and Bacteroidetes predominated in all the samples, there were variations in relative abundance of these groups. Samples from the 3rd and 4th years of the crop rotation differed on the higher abundance of groups of presumable aerobic bacteria and of presumable anaerobic and acidobacterial groups, respectively. Members of the phylum Nitrospira were more abundant after rice harvest than in the previously sampled period. Rice cropping was positively correlated with the abundance of members of the orders Acidobacteriales and 'Solibacterales' and negatively with lineages such as Chloroflexi 'Ellin6529'. Studies like this contribute to understand variations occurring in the microbial communities in soils under sustainable rice production, based on real-world data. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  11. Effects of nucleotides and nucleosides on coagulation

    DEFF Research Database (Denmark)

    Bune, Laurids; Thaning, Pia; Johansson, Pär I

    2010-01-01

    Nucleotides, including ADP, ATP and uridine triphosphate (UTP), are discharged profusely in the circulation during many pathological conditions including sepsis. Sepsis can cause hypotension and systemic activation of the coagulation and fibrinolytic systems in humans, which may cause disseminated...... of adenosine, ADP, ATP, UTP or nitric oxide until mean arterial pressure was reduced to approximately 40% of baseline simulating sepsis-induced hypotension. The effect of the infusions on the haemostatic system was evaluated by TEG, and endothelial release of tissue plasminogen activator and plasminogen...... activator inhibitor-1 was measured. In contrast to the other infused substrates, ADP caused a reduction in maximum amplitude (71.4 to 64.2; P

  12. Characterisation of peacock (Pavo cristatus) mitochondrial 12S rRNA sequence and its use in differentiation from closely related poultry species.

    Science.gov (United States)

    Saini, M; Das, D K; Dhara, A; Swarup, D; Yadav, M P; Gupta, P K

    2007-04-01

    1. Poaching of peacocks, the national bird of India, is illegal. People kill this beautiful pheasant bird for tail feathers and mix the meat with chicken or turkey. Differentiation of the meat of these species is essential in order to address the ambiguity about the origin of the sample. 2. The present study was carried out to investigate the use of polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) of mitochondrial 12S rRNA gene for identification of these species. 3. Peacock mitochondrial 12S rRNA partial gene was amplified using universal primers, cloned and characterised. It was found to be 446 nucleotides long. 4. Sequence analysis revealed 86.8 and 84.1% similarity with reported turkey and chicken sequences, respectively. Sequence and phylogenetic analysis showed that the peacock is much closer to the turkey than the chicken. 5. PCR-RFLP of 446 bp amplicon using commonly available restriction enzymes AluI and Sau3AI produced a differential pattern for identifying these poultry species unambiguously.

  13. Phylogenetic relatedness determined between antibiotic resistance and 16S rRNA genes in actinobacteria

    Czech Academy of Sciences Publication Activity Database

    Ságová-Marečková, M.; Ulanová, Dana; Šanderová, P.; Omelka, M.; Kameník, Zdeněk; Olšovská, J.; Kopecký, J.

    2015-01-01

    Roč. 15, APR 2015 (2015) ISSN 1471-2180 Institutional support: RVO:61388971 Keywords : Actinobacteria * 16S rRNA diversity * Resistance genes Subject RIV: EH - Ecology, Behaviour Impact factor: 2.581, year: 2015

  14. [Molecular relationship of Eurytrema coelmaticum inferred from 18S rRNA sequence].

    Science.gov (United States)

    Zheng, Ya-dong; Luo, Xue-nong; Shi, Cheng-hong; Zong, Rui-qian; Jing, Zhi-zhong; Cai, Xue-peng

    2006-10-01

    To elucidate the taxonomic position of Eurytrema coelmaticum by using molecular technology. 18S rRNA fragment was amplified from E. coelmaticum genomic DNA by specific conservative primers and sequenced. Homology and phylogenic tree of 18S rRNA sequences between E. coelmaticum and other Dicrocoeliidae trematodes were analyzed and constructed by DNAStar and MEGA3 respectively, and their evolutionary relationship was determined. E. coelmaticum 18S rRNA sequence was with high homology to those from Dicrocoelium dendriticum, Lyperosomum collurionis and Brachylecithum lobatum. Among them, the diversity of E. coelmaticum from D. dendriticum was 2.42%, and that from L. collurionis was 1.75%; D. dendriticum and B. lobatum were closer in evolution only with 1.09% diversity. For Dicrocoeliidae trematodes, classification based on 18S rRNA target is valid and the sequences are highly conservative. E. coelmaticum is evolutionarily closer to L. collurionis than to D. dendriticum and B. lobatum.

  15. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    Science.gov (United States)

    Yang, Y.; Fox, G. E.

    1996-01-01

    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  16. NADH peroxidase: kinetic mechanism and nucleotide specificity

    Energy Technology Data Exchange (ETDEWEB)

    Stoll, V.S.; Blanchard, J.S.

    1987-05-01

    NADH peroxidase is a flavoprotein reductase isolated from Streptococcus faecalis which catalyzes the pyridine nucleotide dependent reduction of hydrogen peroxide to water. Initial velocity, product and dead-end inhibition studies have been performed and all support a ping-pong kinetic mechanism. Further support for the ping-pong nature of the kinetic mechanism are the hydrogen peroxide independent transhydrogenase activity of the enzyme, measured either with thio-NAD or with radiolabeled NAD (isotope exchange studies). Kinetic parameters will be presented for a number of reduced pyridine nucleotide analogs. Analogs which have been modified in the adenine ring exhibit much higher K/sub m/'s relative to their adenine analogs. NADH peroxidase catalyzes the stereo-specific removal of the 4S hydrogen of NADH and primary deuterium kinetic isotope effects have been determined for a number of these substrates with 4S-deuterated molecules. There is a strong correlation between their steady-state K/sub m/ and /sup D/V/K. Small values for /sup D/V are interpreted as supporting rate-limitation in the oxidative half-reaction. These data will be discussed in terms of a kinetic and chemical mechanism proposed for NADH peroxidase.

  17. Classifying Coding DNA with Nucleotide Statistics

    Directory of Open Access Journals (Sweden)

    Nicolas Carels

    2009-10-01

    Full Text Available In this report, we compared the success rate of classification of coding sequences (CDS vs. introns by Codon Structure Factor (CSF and by a method that we called Universal Feature Method (UFM. UFM is based on the scoring of purine bias (Rrr and stop codon frequency. We show that the success rate of CDS/intron classification by UFM is higher than by CSF. UFM classifies ORFs as coding or non-coding through a score based on (i the stop codon distribution, (ii the product of purine probabilities in the three positions of nucleotide triplets, (iii the product of Cytosine (C, Guanine (G, and Adenine (A probabilities in the 1st, 2nd, and 3rd positions of triplets, respectively, (iv the probabilities of G in 1st and 2nd position of triplets and (v the distance of their GC3 vs. GC2 levels to the regression line of the universal correlation. More than 80% of CDSs (true positives of Homo sapiens (>250 bp, Drosophila melanogaster (>250 bp and Arabidopsis thaliana (>200 bp are successfully classified with a false positive rate lower or equal to 5%. The method releases coding sequences in their coding strand and coding frame, which allows their automatic translation into protein sequences with 95% confidence. The method is a natural consequence of the compositional bias of nucleotides in coding sequences.

  18. NADH peroxidase: kinetic mechanism and nucleotide specificity

    International Nuclear Information System (INIS)

    Stoll, V.S.; Blanchard, J.S.

    1987-01-01

    NADH peroxidase is a flavoprotein reductase isolated from Streptococcus faecalis which catalyzes the pyridine nucleotide dependent reduction of hydrogen peroxide to water. Initial velocity, product and dead-end inhibition studies have been performed and all support a ping-pong kinetic mechanism. Further support for the ping-pong nature of the kinetic mechanism are the hydrogen peroxide independent transhydrogenase activity of the enzyme, measured either with thio-NAD or with radiolabeled NAD (isotope exchange studies). Kinetic parameters will be presented for a number of reduced pyridine nucleotide analogs. Analogs which have been modified in the adenine ring exhibit much higher K/sub m/'s relative to their adenine analogs. NADH peroxidase catalyzes the stereo-specific removal of the 4S hydrogen of NADH and primary deuterium kinetic isotope effects have been determined for a number of these substrates with 4S-deuterated molecules. There is a strong correlation between their steady-state K/sub m/ and /sup D/V/K. Small values for /sup D/V are interpreted as supporting rate-limitation in the oxidative half-reaction. These data will be discussed in terms of a kinetic and chemical mechanism proposed for NADH peroxidase

  19. Influence of cantilevered sheet pile deflection on adjacent roadways.

    Science.gov (United States)

    2009-06-01

    Cantilevered sheet pile walls are often used adjacent roadways as temporary support during construction. Excess movement of these walls has led to excessive roadway distress causing additional repairs to be necessary. This study assessed the effects ...

  20. Systems of pillarless working of adjacent, sloped and inclined seams

    Energy Technology Data Exchange (ETDEWEB)

    Batmanov, Yu.K.; Bakhtin, A.F.; Bulavka, E.I.

    1979-01-01

    An analysis is made (advantages and disadvantages) of existing and recommended (pillarless) systems of working adjacent, sloped, and inclined seams. The economic benefits, area and extent of those systems are indicated. 8 references, 4 figures.

  1. Prevalence of 16S rRNA methylase genes among β-lactamase ...

    African Journals Online (AJOL)

    Background: Co production of 16S rRNA methylases gene and β-Lactamase gene among Enterobacteriaceae isolates conferring resistance to both therapeutic options has serious implications for clinicians worldwide. Methods: To study co existence of 16S rRNA methylases (armA, rmtA, rmtB, rmtC, rmtD, and npmA) and ...

  2. Differentiation of Shigella flexneri strains by rRNA gene restriction patterns.

    OpenAIRE

    Faruque, S M; Haider, K; Rahman, M M; Abdul Alim, A R; Ahmad, Q S; Albert, M J; Sack, R B

    1992-01-01

    We studied the restriction endonuclease cleavage patterns of rRNA genes (ribotypes) of 72 clinical isolates of Shigella flexneri representing eight serotypes to determine whether ribotyping could be used to distinguish S. flexneri strains and to compare the discriminating ability of the method with that of serotyping. By using a cloned Escherichia coli rRNA operon as the probe, Southern blot hybridization of restriction endonuclease-digested total DNA was carried out. Ribotyping of the isolat...

  3. Dynamics and rRNA transcriptional activity of lactococci and lactobacilli during Cheddar cheese ripening.

    Science.gov (United States)

    Desfossés-Foucault, Émilie; LaPointe, Gisèle; Roy, Denis

    2013-08-16

    Cheddar cheese is a complex ecosystem where both the bacterial population and the cheese making process contribute to flavor and texture development. The aim of this study was to use molecular methods to evaluate the impact of milk heat treatment and ripening temperature on starter lactococci and non-starter lactic acid bacteria (NSLAB) throughout ripening of Cheddar cheese. Eight Cheddar cheese batches were manufactured (four with thermized and four with pasteurized milk) and ripened at 4, 7 and 12°C to analyze the bacterial composition and rRNA transcriptional activity reflecting the ability of lactococci and lactobacilli to synthesize proteins. Abundance and rRNA transcription of lactococci and lactobacilli were quantified after DNA and RNA extraction by using quantitative PCR (qPCR) and reverse transcription-quantitative PCR (RT-qPCR) targeting the 16S rRNA gene, respectively. Results showed that lactococci remained dominant throughout ripening, although 16S rRNA genome and cDNA copies/g of cheese decreased by four and two log copy numbers, respectively. Abundance and rRNA transcription of Lactobacillus paracasei, Lactobacillus buchneri/parabuchneri, Lactobacillus rhamnosus, Lactobacillus brevis, and Lactobacillus coryniformis as well as total lactobacilli were also estimated using specific 16S rRNA primers. L. paracasei and L. buchneri/parabuchneri concomitantly grew in cheese made from thermized milk at 7 and 12°C, although L. paracasei displayed the most rRNA transcription among Lactobacillus species. This work showed that rRNA transcriptional activity of lactococci decreased throughout ripening and supports the usefulness of RNA analysis to assess which bacterial species have the ability to synthesize proteins during ripening, and could thereby contribute to cheese quality. © 2013.

  4. Adjacent segment disease perspective and review of the literature.

    Science.gov (United States)

    Saavedra-Pozo, Fanor M; Deusdara, Renato A M; Benzel, Edward C

    2014-01-01

    Adjacent segment disease has become a common topic in spine surgery circles because of the significant increase in fusion surgery in recent years and the development of motion preservation technologies that theoretically should lead to a decrease in this pathology. The purpose of this review is to organize the evidence available in the current literature on this subject. FOR THIS LITERATURE REVIEW, A SEARCH WAS CONDUCTED IN PUBMED WITH THE FOLLOWING KEYWORDS: adjacent segment degeneration and disease. Selection, review, and analysis of the literature were completed according to level of evidence. The PubMed search identified 850 articles, from which 41 articles were selected and reviewed. The incidence of adjacent segment disease in the cervical spine is close to 3% without a significant statistical difference between surgical techniques (fusion vs arthroplasty). Authors report the incidence of adjacent segment disease in the lumbar spine to range from 2% to 14%. Damage to the posterior ligamentous complex and sagittal imbalances are important risk factors for both degeneration and disease. Insufficient evidence exists at this point to support the idea that total disc arthroplasty is superior to fusion procedures in minimizing the incidence of adjacent segment disease. The etiology is most likely multifactorial but it is becoming abundantly clear that adjacent segment disease is not caused by motion segment fusion alone. Fusion plus the presence of abnormal end-fusion alignment appears to be a major factor in creating end-fusion stresses that result in adjacent segment degeneration and subsequent disease. The data presented cast further doubt on previously established rationales for total disc arthroplasty, at least with regard to the effect of total disc arthroplasty on adjacent segment degeneration pathology.

  5. Adjacent Segment Disease Perspective and Review of the Literature

    Science.gov (United States)

    Saavedra-Pozo, Fanor M.; Deusdara, Renato A. M.; Benzel, Edward C.

    2014-01-01

    Background Adjacent segment disease has become a common topic in spine surgery circles because of the significant increase in fusion surgery in recent years and the development of motion preservation technologies that theoretically should lead to a decrease in this pathology. The purpose of this review is to organize the evidence available in the current literature on this subject. Methods For this literature review, a search was conducted in PubMed with the following keywords: adjacent segment degeneration and disease. Selection, review, and analysis of the literature were completed according to level of evidence. Results The PubMed search identified 850 articles, from which 41 articles were selected and reviewed. The incidence of adjacent segment disease in the cervical spine is close to 3% without a significant statistical difference between surgical techniques (fusion vs arthroplasty). Authors report the incidence of adjacent segment disease in the lumbar spine to range from 2% to 14%. Damage to the posterior ligamentous complex and sagittal imbalances are important risk factors for both degeneration and disease. Conclusion Insufficient evidence exists at this point to support the idea that total disc arthroplasty is superior to fusion procedures in minimizing the incidence of adjacent segment disease. The etiology is most likely multifactorial but it is becoming abundantly clear that adjacent segment disease is not caused by motion segment fusion alone. Fusion plus the presence of abnormal end-fusion alignment appears to be a major factor in creating end-fusion stresses that result in adjacent segment degeneration and subsequent disease. The data presented cast further doubt on previously established rationales for total disc arthroplasty, at least with regard to the effect of total disc arthroplasty on adjacent segment degeneration pathology. PMID:24688337

  6. Variability of adjacency effects in sky reflectance measurements.

    Science.gov (United States)

    Groetsch, Philipp M M; Gege, Peter; Simis, Stefan G H; Eleveld, Marieke A; Peters, Steef W M

    2017-09-01

    Sky reflectance R sky (λ) is used to correct in situ reflectance measurements in the remote detection of water color. We analyzed the directional and spectral variability in R sky (λ) due to adjacency effects against an atmospheric radiance model. The analysis is based on one year of semi-continuous R sky (λ) observations that were recorded in two azimuth directions. Adjacency effects contributed to R sky (λ) dependence on season and viewing angle and predominantly in the near-infrared (NIR). For our test area, adjacency effects spectrally resembled a generic vegetation spectrum. The adjacency effect was weakly dependent on the magnitude of Rayleigh- and aerosol-scattered radiance. The reflectance differed between viewing directions 5.4±6.3% for adjacency effects and 21.0±19.8% for Rayleigh- and aerosol-scattered R sky (λ) in the NIR. Under which conditions in situ water reflectance observations require dedicated correction for adjacency effects is discussed. We provide an open source implementation of our method to aid identification of such conditions.

  7. Biomechanical effects of pedicle screw fixation on adjacent segments.

    Science.gov (United States)

    Kyaw, Thein Aung; Wang, Zhuo; Sakakibara, Toshihiko; Yoshikawa, Takamasa; Inaba, Tadashi; Kasai, Yuichi

    2014-07-01

    Various biomechanical investigations have attempted to clarify the aetiology of adjacent segment disease (ASD). However, no biomechanical study has examined in detail the deformation behaviour of the adjacent segments when both pure torque and an angular displacement load are applied to the vertebrae along multiple segments. The purpose of this study is to investigate the biomechanical effects of pedicle screw fixation on adjacent segments. Ten cadaveric lumbar spines (L2-L5) of boars were used. Control and fusion models were prepared by disc damage and pedicle screw fixation of each specimen, and then, bending and rotation tests were performed using a six-axis material tester. In the biomechanical tests regulated by an angular displacement load, the range of motion (ROM) of the cranial and caudal adjacent segments in antero-posterior flexion and lateral bending was increased by about 20 % (p fusion surgery as a mechanism to compensate for the ROM lost due to excessive fusion by pedicle screw fixation, so that a large torque may be applied to adjacent segments within a physiologically possible range, and it might gradually lead to a degenerative intervertebral disc or progression of spondylolisthesis in the adjacent segments.

  8. The Volpe Center GPS Adjacent Band Compatibility Program Plan : GPS Adjacent Band Compatibility Workshop, Volpe Center, Cambridge MA

    Science.gov (United States)

    2014-09-18

    Approach to DOT GPS Adjacent Band Compatibility Assessment. Identify forums and provide public outreach to make sure the progress and work are as open and transparent as possible. Develop an implementation plan that incorporates aspects from the DOT ...

  9. Molecular Disorganization of Axons Adjacent to Human Cortical Microinfarcts

    Directory of Open Access Journals (Sweden)

    Hamza Coban

    2017-08-01

    Full Text Available Cortical microinfarcts (CMIs are microscopically identified wedge-shaped ischemic lesions that occur at or near the cortical surface and result from occlusion of penetrating arterioles. These microscopic lesions can be observed with high-resolution magnetic resonance imaging in aging brains and in patients with cerebrovascular disease. Recent studies have suggested that strategically located microinfarcts strongly correlate with cognitive deficits, which can contribute to Alzheimer’s disease as well as other forms of dementia. We have recently shown that the molecular organization of axons into functional microdomains is altered in areas adjacent to white matter lacunar and microinfarcts, creating a peri-infarct penumbral injury in surviving axons. Whether similar changes in nodal, adjacent paranodal, and proximal axon initial segment molecular organization occur in the cortex adjacent to human CMIs is not known. Paraffin-embedded sections of autopsy brain tissue from five patients with CMIs were immunofluorescently labeled for nodal and paranodal markers including beta-IV spectrin, ankyrin-G, and contactin-associated protein. High magnification images from the peri-infarct cortical tissue were generated using confocal microscopy. In surviving cortical tissue adjacent to microinfarcts, we observed a dramatic loss of axon initial segments, suggesting that neuronal firing capacity in adjacent cortical tissue is likely compromised. The number of identifiable nodal/paranodal complexes in surviving cortical tissue is reduced adjacent to microinfarcts, while the average paranodal length is increased indicating a breakdown of axoglial contact. This axonal microdomain disorganization occurs in the relative absence of changes in the structural integrity of myelinated axons as measured by myelin basic protein and neurofilament staining. These findings indicate that the molecular organization of surviving axons adjacent to human CMIs is abnormal

  10. Optimization of ribosome structure and function by rRNA base modification.

    Directory of Open Access Journals (Sweden)

    Jennifer L Baxter-Roshek

    2007-01-01

    Full Text Available Translating mRNA sequences into functional proteins is a fundamental process necessary for the viability of organisms throughout all kingdoms of life. The ribosome carries out this process with a delicate balance between speed and accuracy. This work investigates how ribosome structure and function are affected by rRNA base modification. The prevailing view is that rRNA base modifications serve to fine tune ribosome structure and function.To test this hypothesis, yeast strains deficient in rRNA modifications in the ribosomal peptidyltransferase center were monitored for changes in and translational fidelity. These studies revealed allele-specific sensitivity to translational inhibitors, changes in reading frame maintenance, nonsense suppression and aa-tRNA selection. Ribosomes isolated from two mutants with the most pronounced phenotypic changes had increased affinities for aa-tRNA, and surprisingly, increased rates of peptidyltransfer as monitored by the puromycin assay. rRNA chemical analyses of one of these mutants identified structural changes in five specific bases associated with the ribosomal A-site.Together, the data suggest that modification of these bases fine tune the structure of the A-site region of the large subunit so as to assure correct positioning of critical rRNA bases involved in aa-tRNA accommodation into the PTC, of the eEF-1A.aa-tRNA.GTP ternary complex with the GTPase associated center, and of the aa-tRNA in the A-site. These findings represent a direct demonstration in support of the prevailing hypothesis that rRNA modifications serve to optimize rRNA structure for production of accurate and efficient ribosomes.

  11. Palindromic nucleotide analysis in human T cell receptor rearrangements.

    Directory of Open Access Journals (Sweden)

    Santosh K Srivastava

    Full Text Available Diversity of T cell receptor (TCR genes is primarily generated by nucleotide insertions upon rearrangement from their germ line-encoded V, D and J segments. Nucleotide insertions at V-D and D-J junctions are random, but some small subsets of these insertions are exceptional, in that one to three base pairs inversely repeat the sequence of the germline DNA. These short complementary palindromic sequences are called P nucleotides. We apply the ImmunoSeq deep-sequencing assay to the third complementarity determining region (CDR3 of the β chain of T cell receptors, and use the resulting data to study P nucleotides in the repertoire of naïve and memory CD8(+ and CD4(+ T cells. We estimate P nucleotide distributions in a cross section of healthy adults and different T cell subtypes. We show that P nucleotide frequency in all T cell subtypes ranges from 1% to 2%, and that the distribution is highly biased with respect to the coding end of the gene segment. Classification of observed palindromic sequences into P nucleotides using a maximum conditional probability model shows that single base P nucleotides are very rare in VDJ recombination; P nucleotides are primarily two bases long. To explore the role of P nucleotides in thymic selection, we compare P nucleotides in productive and non-productive sequences of CD8(+ naïve T cells. The naïve CD8(+ T cell clones with P nucleotides are more highly expanded.

  12. Insights into the Origin of Clostridium botulinum Strains: Evolution of Distinct Restriction Endonuclease Sites in rrs (16S rRNA gene).

    Science.gov (United States)

    Bhushan, Ashish; Mukherjee, Tanmoy; Joshi, Jayadev; Shankar, Pratap; Kalia, Vipin Chandra

    2015-06-01

    Diversity analysis of Clostridium botulinum strains is complicated by high microheterogeneity caused by the presence of 9-22 copies of rrs (16S rRNA gene). The need is to mine genetic markers to identify very closely related strains. Multiple alignments of the nucleotide sequences of the 212 rrs of 13 C. botulinum strains revealed intra- and inter-genomic heterogeneity. Low intragenomic heterogeneity in rrs was evident in strains 230613, Alaska E43, Okra, Eklund 17B, Langeland, 657, Kyoto, BKT015925, and Loch Maree. The most heterogenous rrs sequences were those of C. botulinum strains ATCC 19397, Hall, H04402065, and ATCC 3502. In silico restriction mapping of these rrs sequences was observable with 137 type II Restriction endonucleases (REs). Nucleotide changes (NC) at these RE sites resulted in appearance of distinct and additional sites, and loss in certain others. De novo appearances of RE sites due to NC were recorded at different positions in rrs gene. A nucleotide transition A>G in rrs of C. botulinum Loch Maree and 657 resulted in the generation of 4 and 10 distinct RE sites, respectively. Transitions A>G, G>A, and T>C led to the loss of RE sites. A perusal of the entire NC and in silico RE mapping of rrs of C. botulinum strains provided insights into their evolution. Segregation of strains on the basis of RE digestion patterns of rrs was validated by the cladistic analysis involving six house keeping genes: dnaN, gyrB, metG, prfA, pyrG, and Rho.

  13. Maturation of teeth adjacent to dental agenesis site.

    Science.gov (United States)

    Ben-Bassat, Yocheved; Babadzhanov, Daniel; Brin, Ilana; Hazan-Molina, Hagai; Aizenbud, Dror

    2014-10-01

    The purpose of this study was to evaluate the developmental stage of teeth adjacent to the agenesis site in comparison to their antimeres. Panoramic views of 39 patients with unilateral dental agenesis and 42 normal controls were evaluated. The dental developmental stage (normal or delayed) of the teeth adjacent to the agenesis site was determined for each patient using the Haavikko's method, while the overall dental age was determined by Becker's method. No statistically significant difference was found in the developmental stage of teeth adjacent to the agenesis, compared to their antimere and to the same teeth in the normal control group. However, the prevalence of cases with no difference in development was almost double for the tooth distal to the agenesis site compared to the tooth mesial to the agenesis site in the hypodontia group (84.6% distal and 43.6% mesial; p agenesis site was the 1st permanent molar. (1) No difference was found between the developmental stage of teeth adjacent to the agenesis site and their antimeres. (2) Teeth mesial to the agenesis site showed some delay in development compared to teeth distal to the agenesis site, in this study. (3) The 1st molars, which were in most of the cases the distal adjacent tooth to the site of agenesis, showed developmental stability. (4) Additional longitudinal studies are needed to examine the dental developmental pattern in patients with agenesis.

  14. Vertebroplasty for adjacent vertebral fracture following lumbar interbody fusion.

    Science.gov (United States)

    Ahn, Yong; Lee, Sang-Ho

    2011-02-01

    Adjacent segment vertebral compression fracture after lumbosacral instrumented fusion has been reported to be a significant complication. Recently, percutaneous vertebroplasty (PVP) has been widely used for the treatment of non-traumatic osteoporotic vertebral fracture. However, the clinical effect of this minimally invasive treatment option to the post-fusion vertebral fracture has rarely been reported. We analysed characteristics of adjacent vertebral fractures following lumbar fusion and evaluated the clinical outcome of PVP. A total of 202 consecutive patients underwent PVP for compression fracture in our institute between January 2007 and December 2008. Among them, nine symptomatic adjacent vertebral fractures following lumbar fusion were identified. We randomly selected 50 control patients undergoing vertebroplasty for osteoporotic compression fracture in single level. We analysed the clinical data according to age, height, body weight, body mass index (BMI), and bone mineral density (BMD). Clinical outcome was assessed by a visual analogue scale (VAS) score and the rate of overall satisfaction. Fractures occurred at the cranial adjacent vertebra after fusion surgery in all cases. The mean BMD score for the spine and femur were significantly higher than the control group (p adjacent segment disease. The increased stress around the fusion segment can cause vertebral fracture even with a relatively higher BMD score. Vertebroplasty for the post-fusion vertebral fracture can be as effective as it is for the usual osteoporotic vertebral fracture.

  15. Temporal distribution of bacterial community structure in the Changjiang Estuary hypoxia area and the adjacent East China Sea

    International Nuclear Information System (INIS)

    Liu Min; Huang Huiqin; Bao Shixiang; Xiao Tian; Zhang Wuchang; Wu Ying; Zhou Feng

    2012-01-01

    Bacterial community structure and the effects of environmental factors on the microbial community distribution were investigated in the Changjiang Estuary hypoxia area and its adjacent area in the East China Sea (ECS) in June, August and October, 2006. Profiles of bacterial communities were generated by denaturing gradient gel electrophoresis (DGGE) of 16S rRNA genes followed by DNA sequence analysis. The dominant bacterial groups were affiliated to Gammaproteobacteria, Cytophaga–Flavobacteria–Bacteroides (CFB), Deltaproteobacteria, Cyanobacteria and Firmicutes, which were mostly from the marine seawater ecosystem. Effects of environmental factors on the bacterial community distribution were analyzed by the ordination technique of canonical correspondence analysis (CCA). The environmental factors significantly influencing bacterial community structure were different in the three months; dissolved organic carbon (DOC) and temperature in June and nitrite in August. No environmental variables displayed significant influence on the bacterial community at the 5% level in October. The seasonal environmental heterogeneity in the Changjiang Estuary and the adjacent ECS, such as seasonal hydrodynamic conditions and riverine input of nutrients, might be the reason for the difference in the key environmental factors determining the bacterial community in the three months. (letter)

  16. Rasp21 sequences opposite the nucleotide binding pocket are required for GRF-mediated nucleotide release

    DEFF Research Database (Denmark)

    Leonardsen, L; DeClue, J E; Lybaek, H

    1996-01-01

    The substrate requirements for the catalytic activity of the mouse Cdc25 homolog Guanine nucleotide Release Factor, GRF, were determined using the catalytic domain of GRF expressed in insect cells and E. coli expressed H-Ras mutants. We found a requirement for the loop 7 residues in Ras (amino ac...... and the human Ras like proteins RhoA, Rap1A, Rac1 and G25K revealed a strict Ras specificity; of these only S. pombe Ras was GRF sensitive....

  17. Modulation of 16S rRNA function by ribosomal protein S12.

    Science.gov (United States)

    Vila-Sanjurjo, Anton; Lu, Ying; Aragonez, Jamie L; Starkweather, Rebekah E; Sasikumar, Manoj; O'Connor, Michael

    2007-01-01

    Ribosomal protein S12 is a critical component of the decoding center of the 30S ribosomal subunit and is involved in both tRNA selection and the response to streptomycin. We have investigated the interplay between S12 and some of the surrounding 16S rRNA residues by examining the phenotypes of double-mutant ribosomes in strains of Escherichia coli carrying deletions in all chromosomal rrn operons and expressing total rRNA from a single plasmid-borne rrn operon. We show that the combination of S12 and otherwise benign mutations at positions C1409-G1491 in 16S rRNA severely compromises cell growth while the level and range of aminoglycoside resistances conferred by the G1491U/C substitutions is markedly increased by a mutant S12 protein. The G1491U/C mutations in addition confer resistance to the unrelated antibiotic, capreomycin. S12 also interacts with the 912 region of 16S rRNA. Genetic selection of suppressors of streptomycin dependence caused by mutations at proline 90 in S12 yielded a C912U substitution in 16S rRNA. The C912U mutation on its own confers resistance to streptomycin and restricts miscoding, properties that distinguish it from a majority of the previously described error-promoting ram mutants that also reverse streptomycin dependence.

  18. Decreases in average bacterial community rRNA operon copy number during succession.

    Science.gov (United States)

    Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R

    2016-05-01

    Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution.

  19. Deep sequencing of subseafloor eukaryotic rRNA reveals active Fungi across marine subsurface provinces.

    Directory of Open Access Journals (Sweden)

    William Orsi

    Full Text Available The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Because DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA by amplicon pyrosequencing, unique profiles of Fungi were found across a range of marine subsurface provinces including ridge flanks, continental margins, and abyssal plains. Subseafloor fungal populations exhibit statistically significant correlations with total organic carbon (TOC, nitrate, sulfide, and dissolved inorganic carbon (DIC. These correlations are supported by terminal restriction length polymorphism (TRFLP analyses of fungal rRNA. Geochemical correlations with fungal pyrosequencing and TRFLP data from this geographically broad sample set suggests environmental selection of active Fungi in the marine subsurface. Within the same dataset, ancient rRNA signatures were recovered from plants and diatoms in marine sediments ranging from 0.03 to 2.7 million years old, suggesting that rRNA from some eukaryotic taxa may be much more stable than previously considered in the marine subsurface.

  20. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria.

    Directory of Open Access Journals (Sweden)

    Jeffrey R Johansen

    Full Text Available A highly divergent 16S rRNA gene was found in one of the five ribosomal operons present in a species complex currently circumscribed as Scytonema hyalinum (Nostocales, Cyanobacteria using clone libraries. If 16S rRNA sequence macroheterogeneity among ribosomal operons due to insertions, deletions or truncation is excluded, the sequence heterogeneity observed in S. hyalinum was the highest observed in any prokaryotic species thus far (7.3-9.0%. The secondary structure of the 16S rRNA molecules encoded by the two divergent operons was nearly identical, indicating possible functionality. The 23S rRNA gene was examined for a few strains in this complex, and it was also found to be highly divergent from the gene in Type 2 operons (8.7%, and likewise had nearly identical secondary structure between the Type 1 and Type 2 operons. Furthermore, the 16S-23S ITS showed marked differences consistent between operons among numerous strains. Both operons have promoter sequences that satisfy consensus requirements for functional prokaryotic transcription initiation. Horizontal gene transfer from another unknown heterocytous cyanobacterium is considered the most likely explanation for the origin of this molecule, but does not explain the ultimate origin of this sequence, which is very divergent from all 16S rRNA sequences found thus far in cyanobacteria. The divergent sequence is highly conserved among numerous strains of S. hyalinum, suggesting adaptive advantage and selective constraint of the divergent sequence.

  1. Assembly of proteins and 5 S rRNA to transcripts of the major structural domains of 23 S rRNA

    DEFF Research Database (Denmark)

    Ostergaard, P; Phan, H; Johansen, L B

    1998-01-01

    The six major structural domains of 23 S rRNA from Escherichia coli, and all combinations thereof, were synthesized as separate T7 transcripts and reconstituted with total 50 S subunit proteins. Analysis by one and two-dimensional gel electrophoresis demonstrated the presence of at least one......+VI. This indicates that there are two major protein assembly centres located at the ends of the 23 S rRNA, which is consistent with an earlier view that in vitro protein assembly nucleates around proteins L24 and L3. Although similar protein assembly patterns were observed over a range of temperature and magnesium...... approach was used to map the putative binding regions on domain V of protein L9 and the 5 S RNA-L5-L18 complex....

  2. Community analysis of picocyanobacteria in an oligotrophic lake by cloning 16S rRNA gene and 16S rRNA gene amplicon sequencing.

    Science.gov (United States)

    Fujimoto, Naoshi; Mizuno, Keigo; Yokoyama, Tomoki; Ohnishi, Akihiro; Suzuki, Masaharu; Watanabe, Satoru; Komatsu, Kenji; Sakata, Yoichi; Kishida, Naohiro; Akiba, Michihiro; Matsukura, Satoko

    2015-01-01

    In this study, the picocyanobacterial species composition of Lake Miyagase was examined by analyzing the 16S rRNA gene in a clone library and by amplicon sequencing using a benchtop next-generation sequencer. Five separate samples were analyzed from different days over a ten-month period. In the picocyanobacterial lineage, 9 and 12 OTUs were identified from a clone library and by amplicon sequencing, respectively. Both analyses suggested that a picocyanobacterium related to Synechococcus sp. MW6B4 was dominant in Lake Miyagase. Our findings suggest that 16S rRNA gene amplicon sequencing enables detailed evaluation of picocyanobacteria composition. One OTU identified was found to be a novel cluster that does not group with any of the known freshwater picocyanobacteria.

  3. Development of an endpoint genotyping assay to detect the Mycoplasma pneumoniae 23S rRNA gene and distinguish the existence of macrolide resistance-associated mutations at position 2063.

    Science.gov (United States)

    Suzuki, Yu; Seto, Junji; Shimotai, Yoshitaka; Ikeda, Tatsuya; Yahagi, Kazue; Mizuta, Katsumi; Matsuzaki, Yoko; Hongo, Seiji

    2016-12-01

    The prevalence of macrolide-resistant Mycoplasma pneumoniae harboring a mutation in the 23S rRNA gene is increasing, and rapid detection assays are needed for clinical management. We developed an endpoint genotyping assay to detect the M. pneumoniae 23S rRNA gene and determine the existence of macrolide resistance-associated mutations at position 2063 (A2063G, A2063T and A2063C mutations). This A2063B genotyping assay detected more than 50 copies/reaction of the M. pneumoniae gene in every nucleotide mutation at position 2063. Of 42 clinical specimens, 3 were positive without mutation, 6 were positive with the A2063G mutation, and 33 were negative. The results were confirmed using nested PCR with the sequencing of the M. pneumoniae 23S rRNA gene, and a high sensitivity (90%), specificity (100%), and coincidence ratio (kappa coefficient=0.93) were obtained. Therefore, the A2063B genotyping assay is useful for the rapid discrimination of macrolide resistance mutations at position 2063. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Adjacent Infrared Multitarget Detection Using Robust Background Estimation

    Directory of Open Access Journals (Sweden)

    Sungho Kim

    2016-01-01

    Full Text Available Small target detection is very important for infrared search and track (IRST problems. Grouped targets are difficult to detect using the conventional constant false alarm rate (CFAR detection method. In this study, a novel multitarget detection method was developed to identify adjacent or closely spaced small infrared targets. The neighboring targets decrease the signal-to-clutter ratio in hysteresis threshold-based constant false alarm rate (H-CFAR detection, which leads to poor detection performance in cluttered environments. The proposed adjacent target rejection-based robust background estimation can reduce the effects of the neighboring targets and enhance the small multitarget detection performance in infrared images by increasing the signal-to-clutter ratio. The experimental results of the synthetic and real adjacent target sequences showed that the proposed method produces an upgraded detection rate with the same false alarm rate compared to the recent target detection methods (H-CFAR, Top-hat, and TDLMS.

  5. Cyclic nucleotide specific phosphodiesterases of Leishmania major

    Directory of Open Access Journals (Sweden)

    Linder Markus

    2006-03-01

    Full Text Available Abstract Background Leishmania represent a complex of important human pathogens that belong to the systematic order of the kinetoplastida. They are transmitted between their human and mammalian hosts by different bloodsucking sandfly vectors. In their hosts, the Leishmania undergo several differentiation steps, and their coordination and optimization crucially depend on numerous interactions between the parasites and the physiological environment presented by the fly and human hosts. Little is still known about the signalling networks involved in these functions. In an attempt to better understand the role of cyclic nucleotide signalling in Leishmania differentiation and host-parasite interaction, we here present an initial study on the cyclic nucleotide-specific phosphodiesterases of Leishmania major. Results This paper presents the identification of three class I cyclic-nucleotide-specific phosphodiesterases (PDEs from L. major, PDEs whose catalytic domains exhibit considerable sequence conservation with, among other, all eleven human PDE families. In contrast to other protozoa such as Dictyostelium, or fungi such as Saccharomyces cerevisiae, Candida ssp or Neurospora, no genes for class II PDEs were found in the Leishmania genomes. LmjPDEA contains a class I catalytic domain at the C-terminus of the polypeptide, with no other discernible functional domains elsewhere. LmjPDEB1 and LmjPDEB2 are coded for by closely related, tandemly linked genes on chromosome 15. Both PDEs contain two GAF domains in their N-terminal region, and their almost identical catalytic domains are located at the C-terminus of the polypeptide. LmjPDEA, LmjPDEB1 and LmjPDEB2 were further characterized by functional complementation in a PDE-deficient S. cerevisiae strain. All three enzymes conferred complementation, demonstrating that all three can hydrolyze cAMP. Recombinant LmjPDEB1 and LmjPDEB2 were shown to be cAMP-specific, with Km values in the low micromolar range

  6. Assembly of proteins and 5 S rRNA to transcripts of the major structural domains of 23 S rRNA

    DEFF Research Database (Denmark)

    Ostergaard, P; Phan, H; Johansen, L B

    1998-01-01

    The six major structural domains of 23 S rRNA from Escherichia coli, and all combinations thereof, were synthesized as separate T7 transcripts and reconstituted with total 50 S subunit proteins. Analysis by one and two-dimensional gel electrophoresis demonstrated the presence of at least one prim...... approach was used to map the putative binding regions on domain V of protein L9 and the 5 S RNA-L5-L18 complex....

  7. Emission of pesticides during drilling and deposition in adjacent areas

    Directory of Open Access Journals (Sweden)

    Heimbach, Udo

    2014-02-01

    Full Text Available In seven experiments seeds of maize, oil seed rape and barley, treated with neonicotinoids, were sown using pneumatic drilling equipment with deflectors attached in case of pneumatic suction systems. Directly adjacent to the drilled area of usually about 50 m width were replicated areas with bare soil as well as with crops. During maize (Zea mays drilling flowering oil seed rape (Brassica napus and during drilling of barley (Hordeum vulgare and oil seed rape flowering white mustard (Sinapis alba was adjacent. The amount of residues in the adjacent non crop areas in Petri dishes being distributed on the bare soil declined only slowly from 1 to 20 m distance from the area drilled. Seed batches with more abrasion and higher content of active substances in the dust resulted in higher residues off crop. After drilling of maize in four experiments in Petri dishes in adjacent non crop areas in 1-5 m distance between 0.02 and 0.40 g a.s./ha of neonicotinoids and in the adjacent oil seed rape a total of 0.05–0.80 g a.s./ha were detected. After drilling oil seed rape or barley these values were only 0.02–0.06 g a.s./ha in Petri dishes in non crop areas and 0.03-0.08 g a.s./ha in total in adjacent white mustard. In gauze net samplers installed vertically in 3 m distance in non crop areas up to seven times higher values were detected compared to Petri dishes.

  8. Transforaminal Endoscopic Surgery for Adjacent Segment Disease After Lumbar Fusion.

    Science.gov (United States)

    Telfeian, Albert Edward

    2017-01-01

    The natural history of degenerative disease after instrumented lumbar fusion can result in symptomatic radiculopathy at the adjacent segment. Here we describe our experience with transforaminal endoscopic decompression for the treatment of adjacent segment radiculopathy. A technique for the transforaminal endoscopic treatment of lumbar radiculopathy adjacent to instrumented lumbar fusions is presented. Prospectively, we followed a series of 9 consecutive patients operated on with lumbar radiculopathy above (5) or below (4) their instrumented fusion. Preoperative and postoperative clinical data with 2-year follow-up are presented. A consecutive series of 9 patients who underwent transforaminal endoscopic treatment for lumbar radiculopathy adjacent to an instrumented spinal fusion between 2012 and 2014 is presented. Three patients required revision to fusion at 2, 13, and 19 months postoperatively. The mean visual analogue scale score for radicular pain improved from an average pain score before surgery of 8.4 to 1.3 1 year after surgery and the mean visual analogue scale for back pain improved from an average pain score before surgery of 8.0 to 4.7 1 year after surgery (excluding the 1 patient with 2month postoperative failure). Transforaminal endoscopic surgical access to adjacent level disease pathology may be a unique approach to the treatment of adjacent segment disease because it allows for neural decompression of disc and foraminal pathology without requiring significant destabilizing bone removal. However, the 2-year failure rate presented here is 33%, which indicates that the benefit of this technique may ultimately be temporary. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Modeling fires in adjacent ship compartments with computational fluid dynamics

    International Nuclear Information System (INIS)

    Wix, S.D.; Cole, J.K.; Koski, J.A.

    1998-01-01

    This paper presents an analysis of the thermal effects on radioactive (RAM) transportation packages with a fire in an adjacent compartment. An assumption for this analysis is that the adjacent hold fire is some sort of engine room fire. Computational fluid dynamics (CFD) analysis tools were used to perform the analysis in order to include convective heat transfer effects. The analysis results were compared to experimental data gathered in a series of tests on tile US Coast Guard ship Mayo Lykes located at Mobile, Alabama

  10. Sequence organization of the Acanthamoeba rRNA intergenic spacer: identification of transcriptional enhancers.

    Science.gov (United States)

    Yang, Q; Zwick, M G; Paule, M R

    1994-01-01

    The primary sequence of the entire 2330 bp intergenic spacer of the A.castellanii ribosomal RNA gene was determined. Repeated sequence elements averaging 140 bp were identified and found to bind a protein required for optimum initiation at the core promoter. These repeated elements were shown to stimulate rRNA transcription by RNA polymerase I in vitro. The repeats inhibited transcription when placed in trans, and stimulated transcription when in cis, in either orientation, but only when upstream of the core promoter. Thus, these repeated elements have characteristics similar to polymerase I enhancers found in higher eukaryotes. The number of rRNA repeats in Acanthamoeba cells was determined to be 24 per haploid genome, the lowest number so far identified in any eukaryote. However, because Acanthamoeba is polyploid, each cell contains approximately 600 rRNA genes. Images PMID:7984432

  11. In-silico single nucleotide polymorphisms (SNP) mining of Sorghum ...

    African Journals Online (AJOL)

    Single nucleotide polymorphisms (SNPs) may be considered the ultimate genetic markers as they represent the finest resolution of a DNA sequence (a single nucleotide), and are generally abundant in populations with a low mutation rate. SNPs are important tools in studying complex genetic traits and genome evolution.

  12. Supplementary Material for: The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara

    2016-01-01

    Abstract Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

  13. Condensing the information in DNA with double-headed nucleotides

    DEFF Research Database (Denmark)

    Hornum, Mick; Sharma, Pawan K; Reslow-Jacobsen, Charlotte

    2017-01-01

    A normal duplex holds as many Watson-Crick base pairs as the number of nucleotides in its constituent strands. Here we establish that single nucleotides can be designed to functionally imitate dinucleotides without compromising binding affinity. This effectively allows sequence information...

  14. Exploring microbial diversity and taxonomy using SSU rRNA hypervariable tag sequencing.

    Directory of Open Access Journals (Sweden)

    Susan M Huse

    2008-11-01

    Full Text Available Massively parallel pyrosequencing of hypervariable regions from small subunit ribosomal RNA (SSU rRNA genes can sample a microbial community two or three orders of magnitude more deeply per dollar and per hour than capillary sequencing of full-length SSU rRNA. As with full-length rRNA surveys, each sequence read is a tag surrogate for a single microbe. However, rather than assigning taxonomy by creating gene trees de novo that include all experimental sequences and certain reference taxa, we compare the hypervariable region tags to an extensive database of rRNA sequences and assign taxonomy based on the best match in a Global Alignment for Sequence Taxonomy (GAST process. The resulting taxonomic census provides information on both composition and diversity of the microbial community. To determine the effectiveness of using only hypervariable region tags for assessing microbial community membership, we compared the taxonomy assigned to the V3 and V6 hypervariable regions with the taxonomy assigned to full-length SSU rRNA sequences isolated from both the human gut and a deep-sea hydrothermal vent. The hypervariable region tags and full-length rRNA sequences provided equivalent taxonomy and measures of relative abundance of microbial communities, even for tags up to 15% divergent from their nearest reference match. The greater sampling depth per dollar afforded by massively parallel pyrosequencing reveals many more members of the "rare biosphere" than does capillary sequencing of the full-length gene. In addition, tag sequencing eliminates cloning bias and the sequences are short enough to be completely sequenced in a single read, maximizing the number of organisms sampled in a run while minimizing chimera formation. This technique allows the cost-effective exploration of changes in microbial community structure, including the rare biosphere, over space and time and can be applied immediately to initiatives, such as the Human Microbiome Project.

  15. Behaviour of REEs in a tropical estuary and adjacent continental ...

    Indian Academy of Sciences (India)

    The distribution and accumulation of the rare earth elements (REE) in the sediments of the Cochin. Estuary and adjacent continental shelf ... in petroleum cracking catalysis, for the produc- tion of light weight hydrocarbons such as ...... Physics and Chemistry of the Earth (eds) Ahrens L H,. Press F, Runcorn S K and Urey H C ...

  16. Bird use of banana plantations adjacent to Kibale National Park ...

    African Journals Online (AJOL)

    To evaluate bird use of a widespread matrix habitat in forested landscapes of western Uganda, I used mist nets to compare bird communities in the understory of continuous forest and adjacent banana plantations. Frugivorous and insectivorous birds accounted for a higher proportion of captures in the forest habitat than in ...

  17. PROBABILISTIC ZONING OF ADJACENT CATCHMENTS BY PHYSICAL MODELING

    Directory of Open Access Journals (Sweden)

    Yu. B. Andreev

    2012-01-01

    Full Text Available Now the probabilistic zoning of avalanche sites is being made either on the basis of the available field data, or using the mathematical and physical modeling of avalanche dynamics processes. The work purpose consisted in research of interaction and compiling probabilistic zoning maps of two adjacent avalanche sites by a physical modeling method. For the two adjacent sites № 9 and 10 on the slope of northern exposition ofTchegetMountain(Elbrus region,Caucasus the model of this slope with the scale of 1: 2 500 was created. The model dimension is 0,82 × 1,1 ×0,57 m. This model was produced using the 4-mm plywood sheets imposed against each other. The model horizontals correspond to the10 mnatural ones. The model slope was also surfaced by thin gypsum lay and then varnished. The fine-grained sawdust (0.1 mm with a natural friction angle of 43º has been chosen as the loose material modeling snow. A series of experiments on modeling avalanche releases from the two sites were carried out resulted in the measurements of avalanche deposit parameters such as run-out distance and length, width and thickness of deposits. The similarity criteria were used during the experiments. The morphometric features of adjacent sites interaction are revealed. The basic result of the carried out work will consist in the probabilistic zoning map of two adjacent sites № 9 and 10.

  18. Concurrent statistical learning of adjacent and nonadjacent dependencies

    NARCIS (Netherlands)

    Vuong, L.C.; Meyer, A.S.; Christiansen, M.H.

    2016-01-01

    When children learn their native language, they have to deal with a confusing array of dependencies between various elements in an utterance. The dependent elements may be adjacent to one another or separated by intervening material. Prior studies suggest that nonadjacent dependencies are hard to

  19. Measurement Methods to Determine Air Leakage Between Adjacent Zones

    Energy Technology Data Exchange (ETDEWEB)

    Hult, Erin L. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Dickerhoff, Darryl J. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Price, Phillip N. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)

    2012-09-01

    Air leakage between adjacent zones of a building can lead to indoor air quality and energy efficiency concerns, however there is no existing standard for measuring inter-zonal leakage. In this study, synthesized data and field measurements are analyzed in order to explore the uncertainty associated with different methods for collecting and analyzing fan pressurization measurements to calculate interzone leakage.

  20. Optimal induced universal graphs and adjacency labeling for trees

    DEFF Research Database (Denmark)

    Alstrup, Stephen; Dahlgaard, Søren; Knudsen, Mathias Bæk Tejs

    2015-01-01

    bound. The lower bound and previously best upper bounds were presented in Alstrup and Rauhe (FOCS'02). Our upper bounds are obtained through a log2 n + O(1) labeling scheme for adjacency queries in forests. We hereby solve an open problem being raised repeatedly over decades, e.g. in Kannan, Naor...

  1. Herpetology of the American Madrean Archipelago and adjacent valleys

    Science.gov (United States)

    Lawrence L. C. Jones

    2005-01-01

    Approximately 110 species of amphibians (18 frogs and toads, and 1 salamander) and reptiles (47 snakes, 39 lizards, and 5 turtles) are known from the American Madrean Archipelago and adjacent valleys. The high diversity of the herpetofauna comes from a variety of factors, including a convergence of biotic communities representing deserts, grasslands, and mountains....

  2. Dose distribution in the irradiation with adjacent fields. Medical application

    International Nuclear Information System (INIS)

    Cudalbu, Cristina; Cozar, Onuc; Stan, Andrada

    2002-01-01

    In this paper we analyzed the absorbed dose distribution for the irradiation with two adjacent fields in the case of medulloblastoma treatment and we optimized the irradiation technique by using three adjacent fields. As a purpose of this study we considered the secondary effects of the irradiation with two adjacent fields at the sensitive organs such as heart and lung. The objectives of this paper are: to achieve dose uniformity in the field junction region; to avoid the underdosage or overdosage in the junction area; the hot spot created due to the overlap of the beams in the depth has to be clinically acceptable; the dosage received by a sensitive structure such as the spinal cord must not exceed its tolerance dose. We should specify that this treatment technique was developed considering the following risk factors: the possibility of introducing very large dosage errors across the junction; the tumor recurrence if it is underdosed; severe complications if it is overdosed. The analysis of the irradiation technique was made from two points of view, geometric and dosimetric. The analysis from geometric and dosimetric points of view entails the conclusion that at the cord and lung level exists the risk of an important overdosage. This inconvenience was solved by moving one of the fields at the other side of the risk organs (if this procedure is possible) and by optimizing the irradiation technique by using three adjacent fields. (authors)

  3. Realisation of two adjacent high tones: Acoustic evidence from ...

    African Journals Online (AJOL)

    We present findings of a multi-speaker production study that was undertaken to investigate the realisation of two adjacent high tones within the verb word in Northern Sotho, a Southern Bantu language. Experimental tokens are selected to ensure that the high tones originate from different combinations of morphosyntactic ...

  4. Adjacent segment degeneration: observations in a goat spinal fusion study

    NARCIS (Netherlands)

    Hoogendoorn, R.J.W.; Helder, M.N.; Wuisman, P.I.J.M.; Bank, R.A.; Everts, V.; Smit, T.H.

    2008-01-01

    Study Design. The adjacent discs of 13 goats, originally used in a lumbar spinal fusion model study, were analyzed for symptoms of intervertebral disc degeneration by means of magnetic resonance imaging (MRI), macroscopy, and histology. These goats were followed for 6 months and the results were

  5. Adjacent segment degeneration: observations in a goat spinal fusion study

    NARCIS (Netherlands)

    Hoogendoorn, Roel J. W.; Helder, Macro N.; Wuisman, Paul I. J. M.; Bank, Ruud A.; Everts, Vincent E.; Smit, Theo H.

    2008-01-01

    The adjacent discs of 13 goats, originally used in a lumbar spinal fusion model study, were analyzed for symptoms of intervertebral disc degeneration by means of magnetic resonance imaging (MRI), macroscopy, and histology. These goats were followed for 6 months and the results were compared with 6

  6. Predisposing Characteristics of Adjacent Segment Disease After Lumbar Fusion.

    Science.gov (United States)

    Alentado, Vincent J; Lubelski, Daniel; Healy, Andrew T; Orr, Robert D; Steinmetz, Michael P; Benzel, Edward C; Mroz, Thomas E

    2016-07-15

    Retrospective Review. The aim of this study was to determine medical, radiographic, and surgical risk factors for the development of adjacent segment disease (ASD) after lumbar fusion. ASD is a recognized outcome of spinal fusion that leads to increased costs and debilitating symptoms for patients. However, a comprehensive understanding of risk factors for the development of this surgical outcome does not exist. The medical records of patients who received their first lumbar fusion for any indication were retrospectively examined for preoperative medical comorbidities and medications, as well as surgical approach and perioperative complications. A blinded reviewer assessed radiographs for each patient to examine sagittal alignment after fusion. Multivariable logistic regression was used to model the risk of developing ASD on the basis of one or more predictors. A total of 137 patients fit the inclusion criteria; 9% required a follow-up operation for degeneration at segments adjacent to the fusion. The ASD group had a mean follow-up of 21.1 months prior to revision surgery and an overall follow-up of 41.0 months. The average follow-up in the control group was 14.0 months. Statistically significant independent predictors of developing ASD included antidepressant use [odds ratio (OR) = 5.4], diagnosis of degenerative scoliosis (OR = 34.2), fusion of L4-S1 (OR = 56.5), having no decompressions adjacent to the fusion, and low sacral slope (OR = 0.9). No patient who developed ASD received a decompression adjacent to the fusion such that an OR could not be generated for this independent predictor. This study is the first to use a combination of medical, surgical, and postoperative sagittal balance as risk factors for the development of adjacent segment disease after lumbar fusion. The awareness of these risk factors may allow for better patient selection and surgical technique to decrease the probability of acquiring this adverse outcome. 4.

  7. The Unusual 23S rRNA Gene of Coxiella burnetii: Two Self-Splicing Group I Introns Flank a 34-Base-Pair Exon, and One Element Lacks the Canonical ΩG▿

    Science.gov (United States)

    Raghavan, Rahul; Miller, Scott R.; Hicks, Linda D.; Minnick, Michael F.

    2007-01-01

    We describe the presence and characteristics of two self-splicing group I introns in the sole 23S rRNA gene of Coxiella burnetii. The two group I introns, Cbu.L1917 and Cbu.L1951, are inserted at sites 1917 and 1951 (Escherichia coli numbering), respectively, in the 23S rRNA gene of C. burnetii. Both introns were found to be self-splicing in vivo and in vitro even though the terminal nucleotide of Cbu.L1917 is adenine and not the canonical conserved guanine, termed ΩG, found in Cbu.L1951 and all other group I introns described to date. Predicted secondary structures for both introns were constructed and revealed that Cbu.L1917 and Cbu.L1951 were group IB2 and group IA3 introns, respectively. We analyzed strains belonging to eight genomic groups of C. burnetii to determine sequence variation and the presence or absence of the elements and found both introns to be highly conserved (≥99%) among them. Although phylogenetic analysis did not identify the specific identities of donors, it indicates that the introns were likely acquired independently; Cbu.L1917 was acquired from other bacteria like Thermotoga subterranea and Cbu.L1951 from lower eukaryotes like Acanthamoeba castellanii. We also confirmed the fragmented nature of mature 23S rRNA in C. burnetii due to the presence of an intervening sequence. The presence of three selfish elements in C. burnetii's 23S rRNA gene is very unusual for an obligate intracellular bacterium and suggests a recent shift to its current lifestyle from a previous niche with greater opportunities for lateral gene transfer. PMID:17644584

  8. The distribution, diversity, and importance of 16S rRNA gene introns in the order Thermoproteales.

    Science.gov (United States)

    Jay, Zackary J; Inskeep, William P

    2015-07-09

    Intron sequences are common in 16S rRNA genes of specific thermophilic lineages of Archaea, specifically the Thermoproteales (phylum Crenarchaeota). Environmental sequencing (16S rRNA gene and metagenome) from geothermal habitats in Yellowstone National Park (YNP) has expanded the available datasets for investigating 16S rRNA gene introns. The objectives of this study were to characterize and curate archaeal 16S rRNA gene introns from high-temperature habitats, evaluate the conservation and distribution of archaeal 16S rRNA introns in geothermal systems, and determine which "universal" archaeal 16S rRNA gene primers are impacted by the presence of intron sequences. Several new introns were identified and their insertion loci were constrained to thirteen locations across the 16S rRNA gene. Many of these introns encode homing endonucleases, although some introns were short or partial sequences. Pyrobaculum, Thermoproteus, and Caldivirga 16S rRNA genes contained the most abundant and diverse intron sequences. Phylogenetic analysis of introns revealed that sequences within the same locus are distributed biogeographically. The most diverse set of introns were observed in a high-temperature, circumneutral (pH 6) sulfur sediment environment, which also contained the greatest diversity of different Thermoproteales phylotypes. The widespread presence of introns in the Thermoproteales indicates a high probability of misalignments using different "universal" 16S rRNA primers employed in environmental microbial community analysis.

  9. Robertsonian translocation 13/14 associated with rRNA genes ...

    African Journals Online (AJOL)

    Alexander A. Dolskiy

    2017-12-01

    Dec 1, 2017 ... Robertsonian translocation 13/14 associated with rRNA genes ... Chromosome 13. Chromosome 14. Intellectual disability. a b s t r a c t. Background: The Robertsonian translocations inherited from parents with a normal ..... expression in lymphocyte of trisomy 21 babies/children: in vivo evaluation.

  10. Alteration of rRNA gene copy number and expression in patients ...

    African Journals Online (AJOL)

    Irina S. Kolesnikova

    2017-09-01

    Sep 1, 2017 ... Background: Intellectual disability (ID) is an important medical and social problem that can be caused by different genetic and environmental factors. One such factor could be rDNA amplification and changes in. rRNA expression and maturation. Aim of the study: The aim of the present study was to ...

  11. Transcription analysis of the Streptomyces coelicolor A3(2) rrnA operon

    DEFF Research Database (Denmark)

    van Wezel, G P; Krab, I M; Douthwaite, S

    1994-01-01

    common to P2, P3 and P4 is not similar to any other known consensus promoter sequence. In fast-growing mycelium, P2 appears to be the most frequently used promoter. Transcription from all of the rrnA promoters decreased during the transition from exponential to stationary phase, although transcription...

  12. Methyltransferase Erm(37) Slips on rRNA to Confer Atypical Resistance in Mycobacterium tuberculosis

    Czech Academy of Sciences Publication Activity Database

    Madsen, Ch. T.; Jakobsen, L.; Buriánková, Karolína; Doucet-Populaire, F.; Perdonet, J. L.; Douthwaite, S.

    2005-01-01

    Roč. 280, č. 47 (2005), s. 38942-38947 ISSN 0021-9258 R&D Projects: GA ČR GA310/03/0292 Institutional research plan: CEZ:AV0Z50200510 Keywords : methyltransferase erm * mycobacterium tuberculosis * rRNA Subject RIV: EE - Microbiology, Virology Impact factor: 5.854, year: 2005

  13. Global Perspectives on Activated Sludge Community Composition analyzed using 16S rRNA amplicon sequencing

    DEFF Research Database (Denmark)

    Nierychlo, Marta; Saunders, Aaron Marc; Albertsen, Mads

    Activated sludge is the most commonly applied bioprocess throughout the world for wastewater treatment. Microorganisms are key to the process, yet our knowledge of their identity and function is still limited. High-througput16S rRNA amplicon sequencing can reliably characterize microbial...

  14. Transcription analysis of the Streptomyces coelicolor A3(2) rrnA operon

    DEFF Research Database (Denmark)

    van Wezel, G P; Krab, I M; Douthwaite, S

    1994-01-01

    Transcription start sites and processing sites of the Streptomyces coelicolor A3(2) rrnA operon have been investigated by a combination of in vivo and in vitro transcription analyses. The data from these approaches are consistent with the existence of four in vivo transcription sites, correspondi...

  15. Archaeal rRNA operons, intron splicing and homing endonucleases, RNA polymerase operons and phylogeny

    DEFF Research Database (Denmark)

    Garrett, Roger Antony; Aagaard, Claus Sindbjerg; Andersen, Morten

    1994-01-01

    Over the past decade our laboratory has had a strong interest in defining the phylogenetic status of the archaea. This has involved determining and analysing the sequences of operons of both rRNAs and RNA polymerases and it led to the discovery of the first archaeal rRNA intron. What follows...

  16. Phylogenetic analysis of 23S rRNA gene sequences of some ...

    African Journals Online (AJOL)

    The phylogenetic relationships among thirteen Rhizobium leguminosarum bv. viciae isolates collected from various geographical regions were studied by analysis of the 23S rRNA sequences. The average of genetic distance among the studied isolates was very narrow (ranged from 0.00 to 0.04) and the studied isolates ...

  17. NOF1 encodes an Arabidopsis protein involved in the control of rRNA expression.

    Directory of Open Access Journals (Sweden)

    Erwana Harscoët

    Full Text Available The control of ribosomal RNA biogenesis is essential for the regulation of protein synthesis in eukaryotic cells. Here, we report the characterization of NOF1 that encodes a putative nucleolar protein involved in the control of rRNA expression in Arabidopsis. The gene has been isolated by T-DNA tagging and its function verified by the characterization of a second allele and genetic complementation of the mutants. The nof1 mutants are affected in female gametogenesis and embryo development. This result is consistent with the detection of NOF1 mRNA in all tissues throughout plant life's cycle, and preferentially in differentiating cells. Interestingly, the closely related proteins from zebra fish and yeast are also necessary for cell division and differentiation. We showed that the nof1-1 mutant displays higher rRNA expression and hypomethylation of rRNA promoter. Taken together, the results presented here demonstrated that NOF1 is an Arabidopsis gene involved in the control of rRNA expression, and suggested that it encodes a putative nucleolar protein, the function of which may be conserved in eukaryotes.

  18. Prosthetic joint infection due to Lysobacter thermophilus diagnosed by 16S rRNA gene sequencing

    OpenAIRE

    B Dhawan; S Sebastian; R Malhotra; A Kapil; D Gautam

    2016-01-01

    We report the first case of prosthetic joint infection caused by Lysobacter thermophilus which was identified by 16S rRNA gene sequencing. Removal of prosthesis followed by antibiotic treatment resulted in good clinical outcome. This case illustrates the use of molecular diagnostics to detect uncommon organisms in suspected prosthetic infections.

  19. Prosthetic joint infection due to Lysobacter thermophilus diagnosed by 16S rRNA gene sequencing

    Directory of Open Access Journals (Sweden)

    B Dhawan

    2016-01-01

    Full Text Available We report the first case of prosthetic joint infection caused by Lysobacter thermophilus which was identified by 16S rRNA gene sequencing. Removal of prosthesis followed by antibiotic treatment resulted in good clinical outcome. This case illustrates the use of molecular diagnostics to detect uncommon organisms in suspected prosthetic infections.

  20. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)

    Czech Academy of Sciences Publication Activity Database

    Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, M.; Zima Jr., J.; Štenclová, Lenka; Hauer, T.

    2017-01-01

    Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 Institutional support: RVO:60077344 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Microbiology Impact factor: 2.806, year: 2016

  1. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)

    Czech Academy of Sciences Publication Activity Database

    Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, Markéta; Zima, Jan; Štenclová, L.; Hauer, Tomáš

    2017-01-01

    Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 R&D Projects: GA ČR(CZ) GA15-11912S Institutional support: RVO:67985939 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Plant sciences, botany Impact factor: 2.806, year: 2016

  2. Phylogenetic analysis of 23S rRNA gene sequences of some ...

    African Journals Online (AJOL)

    Tuoyo Aghomotsegin

    2016-08-31

    Aug 31, 2016 ... The phylogenetic relationships among thirteen Rhizobium leguminosarum bv. viciae isolates collected from various geographical regions were studied by analysis of the 23S rRNA sequences. The average of genetic distance among the studied isolates was very narrow (ranged from 0.00 to 0.04) and the ...

  3. Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification

    NARCIS (Netherlands)

    Ziesemer, K.A.; Mann, A.E.; Sankaranarayanan, K.; Schroeder, H.; Ozga, A.T.; Brandt, B.W.; Zaura, E.; Waters-Rist, A.; Hoogland, M.; Salazar-García, D.C.; Aldenderfer, M.; Speller, C.; Hendy, J.; Weston, D.A.; MacDonald, S.J.; Thomas, G.H.; Collins, M.J.; Lewis, C.M.; Hofman, C.; Warinner, C.

    2015-01-01

    To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341-534) of this

  4. Synthetic Nucleotides as Probes of DNA Polymerase Specificity

    Directory of Open Access Journals (Sweden)

    Jason M. Walsh

    2012-01-01

    Full Text Available The genetic code is continuously expanding with new nucleobases designed to suit specific research needs. These synthetic nucleotides are used to study DNA polymerase dynamics and specificity and may even inhibit DNA polymerase activity. The availability of an increasing chemical diversity of nucleotides allows questions of utilization by different DNA polymerases to be addressed. Much of the work in this area deals with the A family DNA polymerases, for example, Escherichia coli DNA polymerase I, which are DNA polymerases involved in replication and whose fidelity is relatively high, but more recent work includes other families of polymerases, including the Y family, whose members are known to be error prone. This paper focuses on the ability of DNA polymerases to utilize nonnatural nucleotides in DNA templates or as the incoming nucleoside triphosphates. Beyond the utility of nonnatural nucleotides as probes of DNA polymerase specificity, such entities can also provide insight into the functions of DNA polymerases when encountering DNA that is damaged by natural agents. Thus, synthetic nucleotides provide insight into how polymerases deal with nonnatural nucleotides as well as into the mutagenic potential of nonnatural nucleotides.

  5. Crystal Structure of the Thermus thermophilus 16 S rRNA Methyltransferase RsmC in Complex with Cofactor and Substrate Guanosine

    Energy Technology Data Exchange (ETDEWEB)

    Demirci, H.; Gregory, S; Dahlberg, A; Jogl, G

    2008-01-01

    Post-transcriptional modification is a ubiquitous feature of ribosomal RNA in all kingdoms of life. Modified nucleotides are generally clustered in functionally important regions of the ribosome, but the functional contribution to protein synthesis is not well understood. Here we describe high resolution crystal structures for the N{sup 2}-guanine methyltransferase RsmC that modifies residue G1207 in 16 S rRNA near the decoding site of the 30 S ribosomal subunit. RsmC is a class I S-adenosyl-l-methionine-dependent methyltransferase composed of two methyltransferase domains. However, only one S-adenosyl-l-methionine molecule and one substrate molecule, guanosine, bind in the ternary complex. The N-terminal domain does not bind any cofactor. Two structures with bound S-adenosyl-l-methionine and S-adenosyl-l-homocysteine confirm that the cofactor binding mode is highly similar to other class I methyltransferases. Secondary structure elements of the N-terminal domain contribute to cofactor-binding interactions and restrict access to the cofactor-binding site. The orientation of guanosine in the active site reveals that G1207 has to disengage from its Watson-Crick base pairing interaction with C1051 in the 16 S rRNA and flip out into the active site prior to its modification. Inspection of the 30 S crystal structure indicates that access to G1207 by RsmC is incompatible with the native subunit structure, consistent with previous suggestions that this enzyme recognizes a subunit assembly intermediate.

  6. Caracterização de rizóbios indicados para produção de inoculantes por meio de sequenciamento parcial do 16S rRNA Characterization of rhizobia indicated for inoculant production using 16S rRNA partial sequencing

    Directory of Open Access Journals (Sweden)

    Bethânia Figueiredo Barbosa de Toledo

    2009-04-01

    Full Text Available O objetivo deste trabalho foi confrontar as sequências parciais do gene 16S rRNA de estirpes padrão de rizóbios com as de estirpes recomendadas para a produção de inoculantes no Brasil, com vistas à verificação da confiabilidade do sequenciamento parcial desse gene para a identificação rápida de estirpes. Foram realizados sequenciamentos através de reação em cadeia da polimerase (PCR com iniciadores relativos à região codificadora do gene 16S rRNA entre as bactérias estudadas. Os resultados foram analisados pela consulta de similaridade de nucleotídeos aos do "Basic Local Alignment Search Tool" (Blastn e por meio da interpretação de árvores filogenéticas geradas usando ferramentas de bioinformática. A classificação taxonômica das estirpes Semia recomendadas para inoculação de leguminosas com base em propriedades morfológicas e especificidade hospedeira não foi confirmada em todas as estirpes. A maioria das estirpes estudadas, consultadas no Blastn, é consistente com a classificação proposta pela construção de árvores filogenéticas das sequências destas estirpes, com base na similaridade pelo sequenciamento parcial do gene considerado.The aim of this work was to compare the partial sequences of 16S rRNA gene of rhizobia strain patterns already classified with strains recommended for the production of inoculants in Brazil, in order to verify the reliability of partial sequencing of the gene for the purpose of rapid identification of strains. Polymerase Chain Reaction (PCR sequencing using primers on the coding region of the 16S rRNA gene among the bacteria studied was conducted. The results were analyzed by consulting the nucleotides' similarity based on Basic Local Alignment Search Tool (Blastn and by interpreting the phylogenetic trees generated by bioinformatic tools. The taxonomic classification of Semia strains recommended for legume inoculation based on morphological properties and host specificity was

  7. Molecular evolution of the mitochondrial 12S rRNA in Ungulata (mammalia).

    Science.gov (United States)

    Douzery, E; Catzeflis, F M

    1995-11-01

    The complete 12S rRNA gene has been sequenced in 4 Ungulata (hoofed eutherians) and 1 marsupial and compared to 38 available mammalian sequences in order to investigate the molecular evolution of the mitochondrial small-subunit ribosomal RNA molecule. Ungulata were represented by one artiodactyl (the collared peccary, Tayassu tajacu, suborder Suiformes), two perissodactyls (the Grevy's zebra, Equus grevyi, suborder Hippomorpha; the white rhinoceros, Ceratotherium simum, suborder Ceratomorpha), and one hyracoid (the tree hyrax, Dendrohyrax dorsalis). The fifth species was a marsupial, the eastern gray kangaroo (Macropus giganteus). Several transition/transversion biases characterized the pattern of changes between mammalian 12S rRNA molecules. A bias toward transitions was found among 12S rRNA sequences of Ungulata, illustrating the general bias exhibited by ribosomal and protein-encoding genes of the mitochondrial genome. The derivation of a mammalian 12S rRNA secondary structure model from the comparison of 43 eutherian and marsupial sequences evidenced a pronounced bias against transversions in stems. Moreover, transversional compensatory changes were rare events within double-stranded regions of the ribosomal RNA. Evolutionary characteristics of the 12S rRNA were compared with those of the nuclear 18S and 28S rRNAs. From a phylogenetic point of view, transitions, transversions and indels in stems as well as transversional and indels events in loops gave congruent results for comparisons within orders. Some compensatory changes in double-stranded regions and some indels in single-stranded regions also constituted diagnostic events. The 12S rRNA molecule confirmed the monophyly of infraorder Pecora and order Cetacea and demonstrated the monophyly of the suborder Ruminantia was not supported and the branching pattern between Cetacea and the artiodacytyl suborders Ruminantia and Suiformes was not established. The monophyly of the order Perissodactyla was evidenced

  8. Nucleotide Excision Repair in Cellular Chromatin: Studies with Yeast from Nucleotide to Gene to Genome

    Directory of Open Access Journals (Sweden)

    Simon Reed

    2012-09-01

    Full Text Available Here we review our development of, and results with, high resolution studies on global genome nucleotide excision repair (GGNER in Saccharomyces cerevisiae. We have focused on how GGNER relates to histone acetylation for its functioning and we have identified the histone acetyl tranferase Gcn5 and acetylation at lysines 9/14 of histone H3 as a major factor in enabling efficient repair. We consider results employing primarily MFA2 as a model gene, but also those with URA3 located at subtelomeric sequences. In the latter case we also see a role for acetylation at histone H4. We then go on to outline the development of a high resolution genome-wide approach that enables one to examine correlations between histone modifications and the nucleotide excision repair (NER of UV-induced cyclobutane pyrimidine dimers throughout entire genomes. This is an approach that will enable rapid advances in understanding the complexities of how compacted chromatin in chromosomes is processed to access DNA damage and then returned to its pre-damaged status to maintain epigenetic codes.

  9. Specific recognition of rpsO mRNA and 16S rRNA by Escherichia coli ribosomal protein S15 relies on both mimicry and site differentiation.

    Science.gov (United States)

    Mathy, Nathalie; Pellegrini, Olivier; Serganov, Alexander; Patel, Dinshaw J; Ehresmann, Chantal; Portier, Claude

    2004-05-01

    The ribosomal protein S15 binds to 16S rRNA, during ribosome assembly, and to its own mRNA (rpsO mRNA), affecting autocontrol of its expression. In both cases, the RNA binding site is bipartite with a common subsite consisting of a G*U/G-C motif. The second subsite is located in a three-way junction in 16S rRNA and in the distal part of a stem forming a pseudoknot in Escherichia coli rpsO mRNA. To determine the extent of mimicry between these two RNA targets, we determined which amino acids interact with rpsO mRNA. A plasmid carrying rpsO (the S15 gene) was mutagenized and introduced into a strain lacking S15 and harbouring an rpsO-lacZ translational fusion. Analysis of deregulated mutants shows that each subsite of rpsO mRNA is recognized by a set of amino acids known to interact with 16S rRNA. In addition to the G*U/G-C motif, which is recognized by the same amino acids in both targets, the other subsite interacts with amino acids also involved in contacts with helix H22 of 16S rRNA, in the region adjacent to the three-way junction. However, specific S15-rpsO mRNA interactions can also be found, probably with A(-46) in loop L1 of the pseudoknot, demonstrating that mimicry between the two targets is limited.

  10. Cyclic nucleotide content of tobacco BY-2 cells.

    Science.gov (United States)

    Richards, Helen; Das, Swadipa; Smith, Christopher J; Pereira, Louisa; Geisbrecht, Alan; Devitt, Nicola J; Games, David E; van Geyschem, Jan; Gareth Brenton, A; Newton, Russell P

    2002-11-01

    The cyclic nucleotide content of cultured tobacco bright yellow-2 (BY-2) cells was determined, after freeze-killing, perchlorate extraction and sequential chromatography, by radioimmunoassay. The identities of the putative cyclic nucleotides, adenosine 3',5'-cyclic monophosphate (cyclic AMP), guanosine 3',5'-cyclic monophosphate (cyclic GMP) and cytidine 3',5'-cyclic monophosphate (cyclic CMP) were unambiguously confirmed by tandem mass spectrometry. The potential of BY-2 cell cultures as a model system for future investigations of cyclic nucleotide function in higher plants is discussed.

  11. Growth increase of Arabidopsis by forced expression of rice 45S rRNA gene.

    Science.gov (United States)

    Makabe, So; Motohashi, Reiko; Nakamura, Ikuo

    2017-02-01

    Forced expression of rice 45S rRNA gene conferred ca. 2-fold increase of above-ground growth in transgenic Arabidopsis . This growth increase was probably brought by cell proliferation, not by cell enlargement. Recent increase in carbon dioxide emissions is causing global climate change. The use of plant biomass as alternative energy source is one way to reduce these emissions. Therefore, reinforcement of plant biomass production is an urgent key issue to overcome both depletion of fossil energies and emission of carbon dioxide. Here, we created transgenic Arabidopsis with a 2-fold increase in above-ground growth by forced expression of the rice 45S rRNA gene using the maize ubiquitin promoter. Although the size of guard cells and ploidy of leaf-cells were similar between transgenic and control plants, numbers of stomata and pavement cells were much increased in the transgenic leaf. This data suggested that cell number, not cell expansion, was responsible for the growth increase, which might be brought by the forced expression of exogenous and full-length 45S rRNA gene. The expression level of rice 45S rRNA transcripts was very low, possibly triggering unknown machinery to enhance cell proliferation. Although microarray analysis showed enhanced expression of ethylene-responsive transcription factors, these factors might respond to ethylene induced by abiotic/biotic stresses or genomic incompatibility, which might be involved in the expression of species-specific internal transcribed spacer (ITS) sequences within rice 45S rRNA transcripts. Further analysis of the mechanism underlying the growth increase will contribute to understanding the regulation of the cell proliferation and the mechanism of hybrid vigor.

  12. Organism-specific rRNA capture system for application in next-generation sequencing.

    Directory of Open Access Journals (Sweden)

    Sai-Kam Li

    Full Text Available RNA-sequencing is a powerful tool in studying RNomics. However, the highly abundance of ribosomal RNAs (rRNA and transfer RNA (tRNA have predominated in the sequencing reads, thereby hindering the study of lowly expressed genes. Therefore, rRNA depletion prior to sequencing is often performed in order to preserve the subtle alteration in gene expression especially those at relatively low expression levels. One of the commercially available methods is to use DNA or RNA probes to hybridize to the target RNAs. However, there is always a concern with the non-specific binding and unintended removal of messenger RNA (mRNA when the same set of probes is applied to different organisms. The degree of such unintended mRNA removal varies among organisms due to organism-specific genomic variation. We developed a computer-based method to design probes to deplete rRNA in an organism-specific manner. Based on the computation results, biotinylated-RNA-probes were produced by in vitro transcription and were used to perform rRNA depletion with subtractive hybridization. We demonstrated that the designed probes of 16S rRNAs and 23S rRNAs can efficiently remove rRNAs from Mycobacterium smegmatis. In comparison with a commercial subtractive hybridization-based rRNA removal kit, using organism-specific probes is better in preserving the RNA integrity and abundance. We believe the computer-based design approach can be used as a generic method in preparing RNA of any organisms for next-generation sequencing, particularly for the transcriptome analysis of microbes.

  13. Riboprinting and 16S rRNA Gene Sequencing for Identification of Brewery Pediococcus Isolates

    Science.gov (United States)

    Barney, Michael; Volgyi, Antonia; Navarro, Alfonso; Ryder, David

    2001-01-01

    A total of 46 brewery and 15 ATCC Pediococcus isolates were ribotyped using a Qualicon RiboPrinter. Of these, 41 isolates were identified as Pediococcus damnosus using EcoRI digestion. Three ATCC reference strains had patterns similar to each other and matched 17 of the brewery isolates. Six other brewing isolates were similar to ATCC 25249. The other 18 P. damnosus brewery isolates had unique patterns. Of the remaining brewing isolates, one was identified as P. parvulus, two were identified as P. acidilactici, and two were identified as unique Pediococcus species. The use of alternate restriction endonucleases indicated that PstI and PvuII could further differentiate some strains having identical EcoRI profiles. An acid-resistant P. damnosus isolate could be distinguished from non-acid-resistant varieties of the same species using PstI instead of EcoRI. 16S rRNA gene sequence analysis was compared to riboprinting for identifying pediococci. The complete 16S rRNA gene was PCR amplified and sequenced from seven brewery isolates and three ATCC references with distinctive riboprint patterns. The 16S rRNA gene sequences from six different brewery P. damnosus isolates were homologous with a high degree of similarity to the GenBank reference strain but were identical to each other and one ATCC strain with the exception of 1 bp in one strain. A slime-producing, beer spoilage isolate had 16S rRNA gene sequence homology to the P. acidilactici reference strain, in agreement with the riboprint data. Although 16S rRNA gene sequencing correctly identified the genus and species of the test Pediococcus isolates, riboprinting proved to be a better method for subspecies differentiation. PMID:11157216

  14. The role of human ribosomal proteins in the maturation of rRNA and ribosome production.

    Science.gov (United States)

    Robledo, Sara; Idol, Rachel A; Crimmins, Dan L; Ladenson, Jack H; Mason, Philip J; Bessler, Monica

    2008-09-01

    Production of ribosomes is a fundamental process that occurs in all dividing cells. It is a complex process consisting of the coordinated synthesis and assembly of four ribosomal RNAs (rRNA) with about 80 ribosomal proteins (r-proteins) involving more than 150 nonribosomal proteins and other factors. Diamond Blackfan anemia (DBA) is an inherited red cell aplasia caused by mutations in one of several r-proteins. How defects in r-proteins, essential for proliferation in all cells, lead to a human disease with a specific defect in red cell development is unknown. Here, we investigated the role of r-proteins in ribosome biogenesis in order to find out whether those mutated in DBA have any similarities. We depleted HeLa cells using siRNA for several individual r-proteins of the small (RPS6, RPS7, RPS15, RPS16, RPS17, RPS19, RPS24, RPS25, RPS28) or large subunit (RPL5, RPL7, RPL11, RPL14, RPL26, RPL35a) and studied the effect on rRNA processing and ribosome production. Depleting r-proteins in one of the subunits caused, with a few exceptions, a decrease in all r-proteins of the same subunit and a decrease in the corresponding subunit, fully assembled ribosomes, and polysomes. R-protein depletion, with a few exceptions, led to the accumulation of specific rRNA precursors, highlighting their individual roles in rRNA processing. Depletion of r-proteins mutated in DBA always compromised ribosome biogenesis while affecting either subunit and disturbing rRNA processing at different levels, indicating that the rate of ribosome production rather than a specific step in ribosome biogenesis is critical in patients with DBA.

  15. Oral microbiome profiles: 16S rRNA pyrosequencing and microarray assay comparison.

    Directory of Open Access Journals (Sweden)

    Jiyoung Ahn

    Full Text Available The human oral microbiome is potentially related to diverse health conditions and high-throughput technology provides the possibility of surveying microbial community structure at high resolution. We compared two oral microbiome survey methods: broad-based microbiome identification by 16S rRNA gene sequencing and targeted characterization of microbes by custom DNA microarray.Oral wash samples were collected from 20 individuals at Memorial Sloan-Kettering Cancer Center. 16S rRNA gene survey was performed by 454 pyrosequencing of the V3-V5 region (450 bp. Targeted identification by DNA microarray was carried out with the Human Oral Microbe Identification Microarray (HOMIM. Correlations and relative abundance were compared at phylum and genus level, between 16S rRNA sequence read ratio and HOMIM hybridization intensity.The major phyla, Firmicutes, Proteobacteria, Bacteroidetes, Actinobacteria, and Fusobacteria were identified with high correlation by the two methods (r = 0.70∼0.86. 16S rRNA gene pyrosequencing identified 77 genera and HOMIM identified 49, with 37 genera detected by both methods; more than 98% of classified bacteria were assigned in these 37 genera. Concordance by the two assays (presence/absence and correlations were high for common genera (Streptococcus, Veillonella, Leptotrichia, Prevotella, and Haemophilus; Correlation = 0.70-0.84.Microbiome community profiles assessed by 16S rRNA pyrosequencing and HOMIM were highly correlated at the phylum level and, when comparing the more commonly detected taxa, also at the genus level. Both methods are currently suitable for high-throughput epidemiologic investigations relating identified and more common oral microbial taxa to disease risk; yet, pyrosequencing may provide a broader spectrum of taxa identification, a distinct sequence-read record, and greater detection sensitivity.

  16. Migration of PCBs from Sealants to Adjacent Material

    DEFF Research Database (Denmark)

    Andersen, Helle Vibeke; Gunnarsen, Lars Bo; Kampmann, Kristoffer

    2015-01-01

    PCB in sealants can migrate into porous surfaces like concrete and brick and contaminate these materials. The study focuses on an analysis of concentration profiles in relation to alleviation of PCB contamination. The PCB content was determined in 20 samples of concrete and 6 samples of brick...... adjacent to outdoor PCB-containing sealants. The samples were submitted to the laboratory for normal commercial assessment of PCB content in relation to the handling of waste from renovation works in Denmark. The results showed that the PBC concentration in the sealant not necessarily relate...... to the concentration of the adjacent material. The profiles of PCB concentration into the materials showed some variation, though in general there is a tendency of relative higher concentration near the primary source in concrete and longer migration at low concentrations in brick. The concentration profiles seemed...

  17. New adjacent Bis-tetrahydrofuran Annonaceous acetogenins from Annona muricata.

    Science.gov (United States)

    Chang, Fang-Rong; Liaw, Chih-Chuang; Lin, Chih-Yuan; Chou, Chi-Jung; Chiu, Hui-Fen; Wu, Yang-Chang

    2003-03-01

    Bioactivity-guided fractionation led to the isolation of two new Annonaceous acetogenins, annocatacin A ( 1). and annocatacin B ( 2). from the seeds and the leaves, respectively, of Annona muricata. Compounds 1 and 2 are the first examples where the adjacent bis-tetrahydrofuran ring system is located at C-15. The new structures were elucidated and characterized by spectral and chemical methods. Both Annonaceous acetogenins 1 and 2 showed significant in vitro cytotoxicity toward the human hepatoma cell lines, Hep G2 and 2,2,15, and were compared with the known adjacent bis-tetrahydrofuran acetogenins, neoannonin ( 3). desacetyluvaricin ( 4). bullatacin ( 5). asimicin ( 6). annoglaucin ( 7). squamocin ( 8). and rollimusin ( 9).

  18. Osteopathic Manipulative Treatment for the Management of Adjacent Segment Pathology.

    Science.gov (United States)

    Lewis, Drew D; Summers, Garth K

    2017-12-01

    Adjacent segment pathology is an adverse effect of spinal fusion that precipitates accelerated spinal degenerative changes at vertebral segments contiguous with the fused vertebrae. The accelerated degeneration related to ASP can be challenging to manage, as it can lead to conditions such as radiculopathy and can create the need for reoperation. In the present case, a 50-year-old woman with a previous spinal fusion presented with a 1-year history of progressive low back pain, lumbar radiculopathy, and sciatica. Osteopathic manipulative treatment was used to manage her pain, and the patient reported that the treatment provided long-term resolution of her sciatica symptoms. This case demonstrates an effective use of osteopathic manipulative treatment in the conservative management of lumbar radiculopathy related to adjacent segment pathology.

  19. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

    Science.gov (United States)

    Kondo, Jiro; Westhof, Eric

    2011-10-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

  20. Plutonium in soil adjacent to Rocky Flats plant

    International Nuclear Information System (INIS)

    Hume, M.W.; Illsley, C.T.

    1979-01-01

    In 1975, lawsuits were filed claiming contaminated lands adjacent to the plant. Five remote as well as 89 sites on lands under litigation were sampled using four sampling techniques at each site. An additional 71 sites were sampled using the Rockwell International technique. No results approached the EPA proposed guideline screening level of 200 mCi/km 2 , although numerous sites to the last of the plant exceed 2 d/m/g (10 mCi/km 2 )

  1. The Benguela upwelling ecosystem lies adjacent to the south ...

    African Journals Online (AJOL)

    denise

    The Benguela upwelling ecosystem lies adjacent to the south-western coast of Africa, from southern Angola. (15°S) to Cape Agulhas (35°S; Fig. 1). Ecologically, it is split into separate northern and southern sub- systems by a zone of intense perennial upwelling near. Lüderitz (26–27.5°S; Shannon 1985). As is charac-.

  2. Fish species diversity and conservation in Beijing and adjacent areas

    OpenAIRE

    Chunguang Zhang; Yahui Zhao; Yingchun Xing; Ruilu Guo; Qing Zhang; Yun Feng; Enyuan Fan

    2011-01-01

    Based on field surveys between 2002 and 2010, and fish collections in the National Zoological Museum, Institute of Zoology, Chinese Academy of Sciences, a total of 93 wild fish species including 12 in-troduced species had been recorded in Beijing and adjacent areas. Eighty five of these species, including some migratory and estuarine fishes, are native to the region. Only 43 native wild species were collected in our field work from 2002 to 2010. Compared with the historical records, nearly 50...

  3. Jaw position uncertainty and adjacent fields in breast cancer radiotherapy.

    Science.gov (United States)

    Hedin, Emma; Bäck, Anna; Chakarova, Roumiana

    2015-11-08

    Locoregional treatment of breast cancer involves adjacent, half blocked fields matched at isocenter. The objective of this work is to study the dosimetric effects of the uncertainties in jaw positioning for such a case, and how a treatment planning protocol including adjacent field overlap of 1 mm affects the dose distribution. A representative treatment plan, involving 6 and 15 photon beams, for a patient treated at our hospital is chosen. Monte Carlo method (EGSnrc/BEAMnrc) is used to simulate the treatment. Uncertainties in jaw positioning of ± 1 mm are addressed, which implies extremes in reality of 2 mm field gap/overlap when planning adjacent fields without overlap and 1 mm gap or 3 mm overlap for a planning protocol with 1 mm overlap. Dosimetric parameters for PTV, lung and body are analyzed. Treatment planning protocol with 1 mm overlap of the adjacent fields does not considerably counteract possible underdosage of the target in the case studied. PTV-V95% is for example reduced from 95% for perfectly aligned fields to 90% and 91% for 2 mm and 1 mm gap, respectively. However, the risk of overdosage in PTV and in healthy soft tissue is increased when following the protocol with 1 mm overlap. A 3 mm overlap compared to 2 mm overlap results in an increase in maximum dose to PTV, PTV-D2%, from 113% to 121%. V120% for 'Body-PTV' is also increased from 5 cm(3) to 14 cm(3). A treatment planning protocol with 1 mm overlap does not considerably improve the coverage of PTV in the case of erroneous jaw positions causing gap between fields, but increases the overdosage in PTV and doses to healthy tissue, in the case of overlapping fields, for the case investigated.

  4. Processing multiple non-adjacent dependencies: evidence from sequence learning

    Science.gov (United States)

    de Vries, Meinou H.; Petersson, Karl Magnus; Geukes, Sebastian; Zwitserlood, Pienie; Christiansen, Morten H.

    2012-01-01

    Processing non-adjacent dependencies is considered to be one of the hallmarks of human language. Assuming that sequence-learning tasks provide a useful way to tap natural-language-processing mechanisms, we cross-modally combined serial reaction time and artificial-grammar learning paradigms to investigate the processing of multiple nested (A1A2A3B3B2B1) and crossed dependencies (A1A2A3B1B2B3), containing either three or two dependencies. Both reaction times and prediction errors highlighted problems with processing the middle dependency in nested structures (A1A2A3B3_B1), reminiscent of the ‘missing-verb effect’ observed in English and French, but not with crossed structures (A1A2A3B1_B3). Prior linguistic experience did not play a major role: native speakers of German and Dutch—which permit nested and crossed dependencies, respectively—showed a similar pattern of results for sequences with three dependencies. As for sequences with two dependencies, reaction times and prediction errors were similar for both nested and crossed dependencies. The results suggest that constraints on the processing of multiple non-adjacent dependencies are determined by the specific ordering of the non-adjacent dependencies (i.e. nested or crossed), as well as the number of non-adjacent dependencies to be resolved (i.e. two or three). Furthermore, these constraints may not be specific to language but instead derive from limitations on structured sequence learning. PMID:22688641

  5. Adjacent segment disease in degenerative pathologies with posterior instrumentation

    OpenAIRE

    Ana Guadalupe Ramírez Olvera; Manuel Villarreal Arroyo; Luis Mario Hinojosa Martínez; Enrique Méndez Pérez; Luis Romeo Ramos Hinojosa

    2015-01-01

    OBJECTIVE: To establish the real incidence of adjacent segment disease after fusion, and to identify the levels and predisposing factors for the pathology, as well as the functional results. METHODS: a retrospective case series study with level of evidence IIB, in a sample of 179 patients diagnosed with stenosis of the lumbar spine, spondylolisthesis and degenerative scoliosis, submitted to surgery in the period 2005 to December 2013, with posterior instrumentation and posterolateral fusion, ...

  6. Nucleotide sequences of ribosomal internal transcribed spacers and their utility in distinguishing closely related Perinereis polychaets (Annelida; Polychaeta; Nereididae).

    Science.gov (United States)

    Chen, Chaolun Allen; Chen, Chang-Po; Fan, Tung-Yung; Yu, Jr-Kai; Hsieh, Hwey-Lian

    2002-01-01

    Nucleotide sequences of a segment of the rRNA transcription unit spanning from the 3' end of the 18S rDNA to the 5' end of 28S rDNA were determined for four species of Perinereis polychaetes: P. aibuhitensis, P. floridana, and two undescribed species, Perinereis sp1 and sp2. The 5.8S rDNA sequences are identical among the four species. Intraspecific variability was low with the Kimura 2-parameter (K2P) distance, ranging from 0 to 0.0138 for ITS1 and 0 to 0.0247 for ITS2. The interspecific nucleotide difference was significantly higher than those within species, with a mean K2P of 0.172 for ITS1 and 0.204 for ITS2, suggesting that comparisons of ITS regions can be used to evaluate the phylogenetic relationships among Perinereis species. Both neighbor-joining and parsimony analyses of ITS variability indicate a close relationship between the two undescribed species of Perinereis. These findings highlight the utility of the ITS sequence in conjunction with other morphological and ecological characters to delineate species boundaries among closely related polychaetes.

  7. Predicting Agenesis of the Mandibular Second Premolar from Adjacent Teeth.

    Directory of Open Access Journals (Sweden)

    Geetanjali Sharma

    Full Text Available Early diagnosis of agenesis of the mandibular second premolar (P2 enhances management of the dental arch in the growing child. The aim of this study was to explore the relationship in the development of the mandibular first molar (M1 and first premolar (P1 at early stages of P2 (second premolar. Specifically, we ask if the likelihood of P2 agenesis can be predicted from adjacent developing teeth. We selected archived dental panoramic radiographs with P2 at crown formation stages (N = 212 and calculated the likelihood of P2 at initial mineralisation stage 'Ci' given the tooth stage of adjacent teeth. Our results show that the probability of observing mandibular P2 at initial mineralisation stage 'Ci' decreased as both the adjacent P1 and M1 matured. The modal stage at P2 'Ci' was P1 'Coc' (cusp outline complete and M1 'Crc' (crown complete. Initial mineralisation of P2 was observed up to P1 'Crc' and M1 stage 'R½' (root half. The chance of observing P2 at least 'Coc' (coalescence of cusps was considerably greater prior to these threshold stages compared to later stages of P1 and M1. These findings suggest that P2 is highly unlikely to develop if P1 is beyond 'Crc' and M1 is beyond 'R½'.

  8. Predicting Agenesis of the Mandibular Second Premolar from Adjacent Teeth.

    Science.gov (United States)

    Sharma, Geetanjali; Johal, Ama S; Liversidge, Helen M

    2015-01-01

    Early diagnosis of agenesis of the mandibular second premolar (P2) enhances management of the dental arch in the growing child. The aim of this study was to explore the relationship in the development of the mandibular first molar (M1) and first premolar (P1) at early stages of P2 (second premolar). Specifically, we ask if the likelihood of P2 agenesis can be predicted from adjacent developing teeth. We selected archived dental panoramic radiographs with P2 at crown formation stages (N = 212) and calculated the likelihood of P2 at initial mineralisation stage 'Ci' given the tooth stage of adjacent teeth. Our results show that the probability of observing mandibular P2 at initial mineralisation stage 'Ci' decreased as both the adjacent P1 and M1 matured. The modal stage at P2 'Ci' was P1 'Coc' (cusp outline complete) and M1 'Crc' (crown complete). Initial mineralisation of P2 was observed up to P1 'Crc' and M1 stage 'R½' (root half). The chance of observing P2 at least 'Coc' (coalescence of cusps) was considerably greater prior to these threshold stages compared to later stages of P1 and M1. These findings suggest that P2 is highly unlikely to develop if P1 is beyond 'Crc' and M1 is beyond 'R½'.

  9. Adjacent Segment Disease in the Cervical and Lumbar Spine.

    Science.gov (United States)

    Tobert, Daniel G; Antoci, Valentin; Patel, Shaun P; Saadat, Ehsan; Bono, Christopher M

    2017-04-01

    Adjacent segment disease (ASD) is disappointing long-term outcome for both the patient and clinician. In contrast to adjacent segment degeneration, which is a common radiographic finding, ASD is less common. The incidence of ASD in both the cervical and lumbar spine is between 2% and 4% per year, and ASD is a significant contributor to reoperation rates after spinal arthrodesis. The etiology of ASD is multifactorial, stemming from existing spondylosis at adjacent levels, predisposed risk to degenerative changes, and altered biomechanical forces near a previous fusion site. Numerous studies have sought to identify both patient and surgical risk factors for ASD, but a consistent, sole predictor has yet to be found. Spinal arthroplasty techniques seek to preserve physiological biomechanics, thereby minimizing the risk of ASD, and long-term clinical outcome studies will help quantify its efficacy. Treatment strategies for ASD are initially nonoperative, provided a progressive neurological deficit is not present. The spine surgeon is afforded many surgical strategies once operative treatment is elected. The goal of this manuscript is to consider the etiologies of ASD, review its manifestations, and offer an approach to treatment.

  10. Overview of the application of nucleotide in aquaculture

    Directory of Open Access Journals (Sweden)

    Hoang Do Huu

    2016-10-01

    Full Text Available Although long history application in infant formula, dietary nucleotide supplementation has been used only recently in the evaluation of growth performance, stress and pathogen resistance in aquaculture species. This paper addresses the present knowledge of the use of nucleotide supplemented in the diet for culture species. Research reveals that dietary nucleotide may have significant impact and is recommended to add to the feed of aquatic species to get better performance. However, more studies should also be conducted to have better understandings on dose requirement, duration of application, impact on different life stage and under different environmental stress and pathogens. Further study should also examine the effects of dietary nucleotide supplementation of intestinal microbiota and gut morphology, and immune response of aquaculture species.

  11. Enzymatic Incorporation of Modified Purine Nucleotides in DNA.

    Science.gov (United States)

    Abu El Asrar, Rania; Margamuljana, Lia; Abramov, Mikhail; Bande, Omprakash; Agnello, Stefano; Jang, Miyeon; Herdewijn, Piet

    2017-12-14

    A series of nucleotide analogues, with a hypoxanthine base moiety (8-aminohypoxanthine, 1-methyl-8-aminohypoxanthine, and 8-oxohypoxanthine), together with 5-methylisocytosine were tested as potential pairing partners of N 8 -glycosylated nucleotides with an 8-azaguanine or 8-aza-9-deazaguanine base moiety by using DNA polymerases (incorporation studies). The best results were obtained with the 5-methylisocytosine nucleotide followed by the 1-methyl-8-aminohypoxanthine nucleotide. The experiments demonstrated that small differences in the structure (8-azaguanine versus 8-aza-9-deazaguanine) might lead to significant differences in recognition efficiency and selectivity, base pairing by Hoogsteen recognition at the polymerase level is possible, 8-aza-9-deazaguanine represents a self-complementary base pair, and a correlation exists between in vitro incorporation studies and in vivo recognition by natural bases in Escherichia coli, but this recognition is not absolute (exceptions were observed). © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Complete nucleotide sequence and organization of the mitogenome ...

    African Journals Online (AJOL)

    Phylogenetic reconstruction using the concatenated 13 amino acid and nucleotide sequences of the protein-coding genes (PCGs) consistently supported a close relationship between Bombycoidea and Geometroidea among six available lepidopteran superfamilies (Tortricoidea, Pyraloidea, Papilionoidea, Bombycoidea, ...

  13. Extracellular nucleotide derivatives protect cardiomyctes against hypoxic stress

    DEFF Research Database (Denmark)

    Golan, O; Issan, Y; Isak, A

    2011-01-01

    assures cardioprotection. Treatment with extracellular nucleotides, or with tri/di-phosphate, administered under normoxic conditions or during hypoxic conditions, led to a decrease in reactive oxygen species production. CONCLUSIONS: Extracellular tri/di-phosphates are apparently the molecule responsible...

  14. Nucleotide Metabolism and its Control in Lactic Acid Bacteria

    DEFF Research Database (Denmark)

    Kilstrup, Mogens; Hammer, Karin; Jensen, Peter Ruhdal

    2005-01-01

    Most metabolic reactions are connected through either their utilization of nucleotides or their utilization of nucleotides or their regulation by these metabolites. In this review the biosynthetic pathways for pyrimidine and purine metabolism in lactic acid bacteria are described including...... the interconversion pathways, the formation of deoxyribonucleotides and the salvage pathways for use of exogenous precursors. The data for the enzymatic and the genetic regulation of these pathways are reviewed, as well as the gene organizations in different lactic acid bacteria. Mutant phenotypes and methods...... for manipulation of nucleotide pools are also discussed. Our aim is to provide an overview of the physiology and genetics of nucleotide metabolism and its regulation that will facilitate the interpretation of data arising from genetics, metabolomics, proteomics, and transcriptomics in lactic acid bacteria....

  15. Single nucleotide polymorphism (SNP) detection on a magnetoresistive sensor

    DEFF Research Database (Denmark)

    Rizzi, Giovanni; Østerberg, Frederik Westergaard; Dufva, Martin

    2013-01-01

    We present a magnetoresistive sensor platform for hybridization assays and demonstrate its applicability on single nucleotide polymorphism (SNP) genotyping. The sensor relies on anisotropic magnetoresistance in a new geometry with a local negative reference and uses the magnetic field from...

  16. Nucleolin is required for DNA methylation state and the expression of rRNA gene variants in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Frédéric Pontvianne

    2010-11-01

    Full Text Available In eukaryotes, 45S rRNA genes are arranged in tandem arrays in copy numbers ranging from several hundred to several thousand in plants. Although it is clear that not all copies are transcribed under normal growth conditions, the molecular basis controlling the expression of specific sets of rRNA genes remains unclear. Here, we report four major rRNA gene variants in Arabidopsis thaliana. Interestingly, while transcription of one of these rRNA variants is induced, the others are either repressed or remain unaltered in A. thaliana plants with a disrupted nucleolin-like protein gene (Atnuc-L1. Remarkably, the most highly represented rRNA gene variant, which is inactive in WT plants, is reactivated in Atnuc-L1 mutants. We show that accumulated pre-rRNAs originate from RNA Pol I transcription and are processed accurately. Moreover, we show that disruption of the AtNUC-L1 gene induces loss of symmetrical DNA methylation without affecting histone epigenetic marks at rRNA genes. Collectively, these data reveal a novel mechanism for rRNA gene transcriptional regulation in which the nucleolin protein plays a major role in controlling active and repressed rRNA gene variants in Arabidopsis.

  17. Linking Maternal and Somatic 5S rRNA types with Different Sequence-Specific Non-LTR Retrotransposons

    NARCIS (Netherlands)

    Locati, M.D.; Pagano, J.F.B.; Ensink, W.A.; van Olst, M.; van Leeuwen, S.; Nehrdich, U.; Zhu, K.; Spaink, H.P.; Girard, G.; Rauwerda, H.; Jonker, M.J.; Dekker, R.J.; Breit, T.M.

    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo and adult tissue,

  18. Phylogenetic relationships between Sarcocystis species from reindeer and other Sarcocystidae deduced from ssu rRNA gene sequences

    DEFF Research Database (Denmark)

    Dahlgren, S.S.; Oliveira, Rodrigo Gouveia; Gjerde, B.

    2008-01-01

    any effect on previously inferred phylogenetic relationships within the Sarcocystidae. The complete small subunit (ssu) rRNA gene sequences of all six Sarcocystis species from reindeer were used in the phylogenetic analyses along with ssu rRNA gene sequences of 85 other members of the Coccidea. Trees...

  19. Microsporidia: Why Make Nucleotides if You Can Steal Them?

    Directory of Open Access Journals (Sweden)

    Paul Dean

    2016-11-01

    Full Text Available Microsporidia are strict obligate intracellular parasites that infect a wide range of eukaryotes including humans and economically important fish and insects. Surviving and flourishing inside another eukaryotic cell is a very specialised lifestyle that requires evolutionary innovation. Genome sequence analyses show that microsporidia have lost most of the genes needed for making primary metabolites, such as amino acids and nucleotides, and also that they have only a limited capacity for making adenosine triphosphate (ATP. Since microsporidia cannot grow and replicate without the enormous amounts of energy and nucleotide building blocks needed for protein, DNA, and RNA biosynthesis, they must have evolved ways of stealing these substrates from the infected host cell. Providing they can do this, genome analyses suggest that microsporidia have the enzyme repertoire needed to use and regenerate the imported nucleotides efficiently. Recent functional studies suggest that a critical innovation for adapting to intracellular life was the acquisition by lateral gene transfer of nucleotide transport (NTT proteins that are now present in multiple copies in all microsporidian genomes. These proteins are expressed on the parasite surface and allow microsporidia to steal ATP and other purine nucleotides for energy and biosynthesis from their host. However, it remains unclear how other essential metabolites, such as pyrimidine nucleotides, are acquired. Transcriptomic and experimental studies suggest that microsporidia might manipulate host cell metabolism and cell biological processes to promote nucleotide synthesis and to maximise the potential for ATP and nucleotide import. In this review, we summarise recent genomic and functional data relating to how microsporidia exploit their hosts for energy and building blocks needed for growth and nucleic acid metabolism and we identify some remaining outstanding questions.

  20. Nucleotide fluctuation of radiation-resistant Halobacterium sp. NRC-1 single-stranded DNA-binding protein (RPA) genes

    Science.gov (United States)

    Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Gadura, N.; Schneider, P.; Sullivan, R.; Flamholz, A.; Lieberman, D.; Cheung, T. D.

    2009-08-01

    The Single-Stranded DNA-Binding Protein (RPA) Genes in gamma ray radiation-resistant halophilic archaeon Halobacterium sp. NRC-1 were analyzed in terms of their nucleotide fluctuations. In an ATCG sequence, each base was assigned a number equal to its atomic number. The resulting numerical sequence was the basis of the statistical analysis in this study. Fractal analysis using the Higuchi method gave fractal dimensions of 2.04 and 2.06 for the gene sequences VNG2160 and VNG2162, respectively. The 16S rRNA sequence has a fractal dimension of 1.99. The di-nucleotide Shannon entropy values were found to be negatively correlated with the observed fractal dimensions (R2~ 0.992, N=3). Inclusion of Deinococcus radiodurans Rad-A in the regression analysis decreases the R2 slightly to 0.98 (N=4). A third VNG2163 RPA gene of unknown function but with upregulation activity under irradiation was found to have a fractal dimension of 2.05 and a Shannon entropy of 3.77 bits. The above results are similar to those found in bacterial Deinococcus radiodurans and suggest that their high radiation resistance property would have favored selection of CG di-nucleotide pairs. The two transcription factors TbpD (VNG7114) and TfbA (VNG 2184) were also studied. Using VNG7114, VNG2184, and VNG2163; the regression analysis of fractal dimension versus Shannon entropy shows that R2 ~ 0.997 for N =3. The VNG2163 unknown function may be related to the pathways with transcriptions closely regulated to sequences VNG7114 and VNG2184.

  1. A renaissance for the pioneering 16S rRNA gene.

    Science.gov (United States)

    Tringe, Susannah G; Hugenholtz, Philip

    2008-10-01

    Culture-independent molecular surveys using the 16S rRNA gene have become a mainstay for characterizing microbial community structure over the past quarter century. More recently this approach has been overshadowed by metagenomics, which provides a global overview of a community's functional potential rather than just an inventory of its inhabitants. However, the pioneering 16S rRNA gene is making a comeback in its own right thanks to a number of methodological advancements including higher resolution (more sequences), analysis of multiple related samples (e.g. spatial and temporal series) and improved metadata, and use of metadata. The standard conclusion that microbial ecosystems are remarkably complex and diverse is now being replaced by detailed insights into microbial ecology and evolution based only on this one historically important marker gene.

  2. A renaissance for the pioneering 16S rRNA gene

    Energy Technology Data Exchange (ETDEWEB)

    Tringe, Susannah; Hugenholtz, Philip

    2008-09-07

    Culture-independent molecular surveys using the 16S rRNA gene have become a mainstay for characterizing microbial community structure over the last quarter century. More recently this approach has been overshadowed by metagenomics, which provides a global overview of a community's functional potential rather than just an inventory of its inhabitants. However, the pioneering 16S rRNA gene is making a comeback in its own right thanks to a number of methodological advancements including higher resolution (more sequences), analysis of multiple related samples (e.g. spatial and temporal series) and improved metadata and use of metadata. The standard conclusion that microbial ecosystems are remarkably complex and diverse is now being replaced by detailed insights into microbial ecology and evolution based only on this one historically important marker gene.

  3. Structural analysis of base substitutions in Thermus thermophilus 16S rRNA conferring streptomycin resistance.

    Science.gov (United States)

    Demirci, Hasan; Murphy, Frank V; Murphy, Eileen L; Connetti, Jacqueline L; Dahlberg, Albert E; Jogl, Gerwald; Gregory, Steven T

    2014-08-01

    Streptomycin is a bactericidal antibiotic that induces translational errors. It binds to the 30S ribosomal subunit, interacting with ribosomal protein S12 and with 16S rRNA through contacts with the phosphodiester backbone. To explore the structural basis for streptomycin resistance, we determined the X-ray crystal structures of 30S ribosomal subunits from six streptomycin-resistant mutants of Thermus thermophilus both in the apo form and in complex with streptomycin. Base substitutions at highly conserved residues in the central pseudoknot of 16S rRNA produce novel hydrogen-bonding and base-stacking interactions. These rearrangements in secondary structure produce only minor adjustments in the three-dimensional fold of the pseudoknot. These results illustrate how antibiotic resistance can occur as a result of small changes in binding site conformation. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  4. The Tomato Nucleotide-binding Leucine-rich Repeat (NLR) Immune Receptor I-2 Couples DNA-Binding to Nucleotide-Binding Domain Nucleotide Exchange

    NARCIS (Netherlands)

    Fenyk, S.; Dixon, C.H.; Gittens, W.H.; Townsend, P.D.; Sharples, G.J.; Pålsson, L.O.; Takken, F.L.W.; Cann, M.J.

    2016-01-01

    Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognise and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception.

  5. Effects of nucleotides and nucleotide analogue inhibitors of HIV-1 reverse transcriptase in a ratchet model of polymerase translocation.

    Science.gov (United States)

    Götte, Matthias

    2006-01-01

    A single cycle of nucleotide incorporation by the reverse transcriptase of the human immunodeficiency virus type 1 (HIV-1 RT) involves the initial binding of an incoming nucleotide, a conformational change that traps the substrate, the formation of a new phosphodiester bond, the release of pyrophosphate (PPi), and ultimately polymerase translocation, which clears the nucleotide binding site. This article reviews different mechanistic models for polymerase translocation with emphasis placed on HIV-1 RT. Structure-function analyses of stalled complexes of HIV-1 RT provide strong evidence to suggest that the enzyme can oscillate between pre- and post-translocational states. Nucleotide hydrolysis is not required for the movement of the polymerase in a stalled configuration; thermal energy is sufficient to allow random bidirectional sliding. The next complementary nucleotide, following the incorporated chain-terminator, acts like a pawl of a ratchet that traps the enzyme in the post-translocation state and prevents the reverse movement. Quantitative footprinting experiments have shown that the concentration of the templated nucleotide required to shift the translocational equilibrium forward depends crucially on the structure of the 3'end of the primer. Changes in the relative population of pre- and post-translocation complexes can influence rates of excision of incorporated NRTIs, which, in turn, affects drug susceptibility. The concept of a ratchet model of HIV-1 RT translocation and its implications for drug action and resistance, and the discovery and development of novel antiviral compounds is discussed.

  6. Development of a 9600-clone procedure for oligonucleotide fingerprinting of rRNA genes: utilization to identify soil bacterial rRNA genes that correlate in abundance with the development of avocado root rot.

    Science.gov (United States)

    Bent, Elizabeth; Yin, Bei; Figueroa, Andres; Ye, Jingxiao; Fu, Qi; Liu, Zheng; McDonald, Virginia; Jeske, Daniel; Jiang, Tao; Borneman, James

    2006-10-01

    Oligonucleotide fingerprinting of rRNA genes (OFRG) is an array-based method that generates microbial community profiles through analysis of rRNA gene clone libraries. The original OFRG method allowed 1536 clones to be analyzed per experiment. This report describes a procedure for analyzing 9600 clones per experiment, including a new probe set for bacterial analysis, and improved data processing and statistical analysis tools. The software tools are available at the OFRG website (). Use of the 9600-clone procedure was demonstrated by examining the bacterial rRNA gene compositions of soils subjected to various temperature treatments. These treatments produced a series of soils with a range of abilities to suppress avocado root rot, enabling the identification of bacterial rRNA genes that correlate in abundance with root rot suppressiveness. OFRG analysis of these soils produced 8876 bacterial rRNA gene fingerprints grouped into 5123 clusters, or operational taxonomic units (OTUs). Eleven OTUs exhibited a positive correlation between the number of clones and the percentage of healthy roots. An in silico analysis was performed to examine the relationship between the number of rRNA genes analyzed and the number of correlates (rRNA gene-avocado root rot symptoms) identified. As the number of clones decreased, fewer correlates were identified. To further increase the throughput of the OFRG method, use of a glass slide-fluorescent probe microarray format was also explored.

  7. Impaired rRNA synthesis triggers homeostatic responses in hippocampal neurons

    Directory of Open Access Journals (Sweden)

    Anna eKiryk

    2013-11-01

    Full Text Available Decreased rRNA synthesis and nucleolar disruption, known as nucleolar stress, are primary signs of cellular stress associated with aging and neurodegenerative disorders. Silencing of rDNA occurs during early stages of Alzheimer´s disease (AD and may play a role in dementia. Moreover aberrant regulation of the protein synthesis machinery is present in the brain of suicide victims and implicates the epigenetic modulation of rRNA. Recently, we developed unique mouse models characterized by nucleolar stress in neurons. We inhibited RNA polymerase I by genetic ablation of the basal transcription factor TIF-IA in adult hippocampal neurons. Nucleolar stress resulted in progressive neurodegeneration, although with a differential vulnerability within the CA1, CA3 and dentate gyrus. Here, we investigate the consequences of nucleolar stress on learning and memory. The mutant mice show normal performance in the Morris water maze and in other behavioral tests, suggesting the activation of adaptive mechanisms. In fact, we observe a significantly enhanced learning and re-learning corresponding to the initial inhibition of rRNA transcription. This phenomenon is accompanied by aberrant synaptic plasticity. By the analysis of nucleolar function and integrity, we find that the synthesis of rRNA is later restored. Gene expression profiling shows that thirty-six transcripts are differentially expressed in comparison to the control group in absence of neurodegeneration. Additionally, we observe a significant enrichment of the putative serum response factor (SRF binding sites in the promoters of the genes with changed expression, indicating potential adaptive mechanisms mediated by the mitogen-activated protein kinase pathway. In the dentate gyrus a neurogenetic response might compensate the initial molecular deficits. These results underscore the role of nucleolar stress in neuronal homeostasis and open a new ground for therapeutic strategies aiming at preserving

  8. Greengenes: Chimera-checked 16S rRNA gene database and workbenchcompatible in ARB

    Energy Technology Data Exchange (ETDEWEB)

    DeSantis, T.Z.; Hugenholtz, P.; Larsen, N.; Rojas, M.; Brodie,E.L; Keller, K.; Huber, T.; Dalevi, D.; Hu, P.; Andersen, G.L.

    2006-02-01

    A 16S rRNA gene database (http://greengenes.lbl.gov) addresses limitations of public repositories by providing chimera-screening, standard alignments and taxonomic classification using multiple published taxonomies. It was revealed that incongruent taxonomic nomenclature exists among curators even at the phylum-level. Putative chimeras were identified in 3% of environmental sequences and 0.2% of records derived from isolates. Environmental sequences were classified into 100 phylum-level lineages within the Archaea and Bacteria.

  9. Phylogenetic Analysis of Cryptosporidium Parasites Based on the Small-Subunit rRNA Gene Locus

    OpenAIRE

    Xiao, Lihua; Escalante, Lillian; Yang, Chunfu; Sulaiman, Irshad; Escalante, Anannias A.; Montali, Richard J.; Fayer, Ronald; Lal, Altaf A.

    1999-01-01

    Biological data support the hypothesis that there are multiple species in the genus Cryptosporidium, but a recent analysis of the available genetic data suggested that there is insufficient evidence for species differentiation. In order to resolve the controversy in the taxonomy of this parasite genus, we characterized the small-subunit rRNA genes of Cryptosporidium parvum, Cryptosporidium baileyi, Cryptosporidium muris, and Cryptosporidium serpentis and performed a phylogenetic analysis of t...

  10. Prevalence of 16S rRNA methylase genes among b-lactamase ...

    African Journals Online (AJOL)

    2014-07-07

    Jul 7, 2014 ... 16S rRNA methylase genes bla genes were detected in b-lactamase-producing isolates by PCR using the previously reported oligonucleotide primers for blaTEM-1, blaSHV-12, blaCTX-M-14 (18), and the. armA, rmtA, rmtB, rmtC, rmtD, and npmA genes by using the following previously described primers ...

  11. Quantification of Lincomycin Resistance Genes Associated with Lincomycin Residues in Waters and Soils Adjacent to Representative Swine Farms in China

    Directory of Open Access Journals (Sweden)

    Liang eLi

    2013-12-01

    Full Text Available Lincomycin is commonly used on swine farms for growth promotion as well as disease treatment and control. Consequently, lincomycin may accumulate in the environment adjacent to the swine farms in many ways, thereby influencing antibiotic resistance in the environment. Levels of lincomycin-resistance genes and lincomycin residues in water and soil samples collected from multiple sites near wastewater discharge areas were investigated in this study. Sixteen lincomycin-resistance and 16S rRNA genes were detected using real-time PCR. Three genes, lnu(F, erm(A and erm(B, were detected in all water and soil samples except control samples. Lincomycin residues were determined by rapid resolution liquid chromatography-tandem mass spectrometry, with concentrations detected as high as 9.29 ng/mL in water and 0.97 ng/g in soil. A gradual reduction in the levels of lincomycin-resistance genes and lincomycin residues in the waters and soils were detected from multiple sites along the path of wastewater discharging to the surrounding environment from the swine farms. Significant correlations were found between levels of lincomycin-resistance genes in paired water and soil samples (r = 0.885, p = 0.019, and between lincomycin-resistance genes and lincomycin residues (r = 0.975, p < 0.01. This study emphasized the potential risk of dissemination of lincomycin-resistance genes such as lnu(F, erm(A and erm(B, associated with lincomycin residues in surrounding environments adjacent to swine farms.

  12. Microwave treatment of renal cell carcinoma adjacent to renal sinus.

    Science.gov (United States)

    Gao, Yongyan; Liang, Ping; Yu, Xiaoling; Yu, Jie; Cheng, Zhigang; Han, Zhiyu; Duan, Shaobo; Huang, Hui

    2016-11-01

    To evaluate the efficacy and safety of ultrasound (US)-guided percutaneous microwave ablation (MWA) for renal cell carcinoma (RCC) adjacent to renal sinus. This retrospective study included 41 patients who underwent US-guided percutaneous MWA of 41 RCCs adjacent to the renal sinus from April 2006 to December 2015. Contrast-enhanced images of US and computed tomography (CT) or magnetic resonance (MR) imaging were performed at pre-ablation and 1day, 1 month, 3 months, and every 6 months after ablation. Initial ablation success (IAS), disease-free survival (DFS), RCC-related survival (RRS), and overall survival (OS) were recorded at the follow-up visits. IAS was achieved in 92.7% (38/41) of the study subjects. The IAS significantly differed between patients with RCCs ≤4cm (100%, 29/29) and RCCs >4cm (75%, 9/12, p=0.021). During the median follow-up of 37.6 (range, 3.0-97.3) months, the estimated 1-, 3-, and 5-year DFS of patients with an initial tumor of ≤4cm were 100%, 89.7%, and 81.5%, respectively. The 1-, 3-, and 5-year RRS were 100%, 93.3%, and 93.3%, respectively. The 1-, 3-, and 5-year OS were 97.1%, 87.8%, and 83.6%, respectively. The multivariate analysis using the Cox proportional hazard model revealed no independent predictor of recurrence among all the variables. There were no MWA-related deaths among the study subjects. One patient developed a retroperitoneal abscess after ablation. US-guided percutaneous MWA appears to be a promising method for RCCs adjacent to renal sinus, especially for tumors ≤4cm. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  13. Biomechanical Evaluation of Lumbar Decompression Adjacent to Instrumented Segments.

    Science.gov (United States)

    Grunert, Peter; Reyes, Phillip M; Newcomb, Anna G U S; Towne, Sara B; Kelly, Brian P; Theodore, Nicholas; Härtl, Roger

    2016-12-01

    Multilevel lumbar stenosis, in which 1 level requires stabilization due to spondylolisthesis, is routinely treated with multilevel open laminectomy and fusion. We hypothesized that a minimally invasive (MI) decompression is biomechanically superior to open laminectomy and may allow decompression of the level adjacent the spondylolisthesis without additional fusion. To study the mechanical effect of various decompression procedures adjacent to instrumented segments in cadaver lumbar spines. Conditions tested were (1) L4-L5 instrumentation, (2) L3-L4 MI decompression, (3) addition of partial facetectomy at L3-L4, and (4) addition of laminectomy at L3-L4. Flexibility tests were performed for range of motion (ROM) analysis by applying nonconstraining, pure moment loading during flexion-extension, lateral bending, and axial rotation. Compression flexion tests were performed for motion distribution analysis. After instrumentation, MI decompression increased flexion-extension ROM at L3-L4 by 13% (P = .03) and axial rotation by 23% (P = .003). Partial facetectomy further increased axial rotation by 15% (P = .03). After laminectomy, flexion-extension ROM further increased by 12% (P = .05), a 38% increase from baseline, and axial rotation by 17% (P = .02), a 58% increase from baseline. MI decompression yielded no significant increase in segmental contribution of motion at L3-L4, in contrast to partial facetectomy and laminectomy (<.05). MI tubular decompression is biomechanically superior to open laminectomy adjacent to instrumented segments. These results lend support to the concept that in patients in whom a multilevel MI decompression is performed, the fusion might be limited to the segments with actual instability. MI, minimally invasive.

  14. The Human Microbiome and Understanding the 16S rRNA Gene in Translational Nursing Science.

    Science.gov (United States)

    Ames, Nancy J; Ranucci, Alexandra; Moriyama, Brad; Wallen, Gwenyth R

    As more is understood regarding the human microbiome, it is increasingly important for nurse scientists and healthcare practitioners to analyze these microbial communities and their role in health and disease. 16S rRNA sequencing is a key methodology in identifying these bacterial populations that has recently transitioned from use primarily in research to having increased utility in clinical settings. The objectives of this review are to (a) describe 16S rRNA sequencing and its role in answering research questions important to nursing science; (b) provide an overview of the oral, lung, and gut microbiomes and relevant research; and (c) identify future implications for microbiome research and 16S sequencing in translational nursing science. Sequencing using the 16S rRNA gene has revolutionized research and allowed scientists to easily and reliably characterize complex bacterial communities. This type of research has recently entered the clinical setting, one of the best examples involving the use of 16S sequencing to identify resistant pathogens, thereby improving the accuracy of bacterial identification in infection control. Clinical microbiota research and related requisite methods are of particular relevance to nurse scientists-individuals uniquely positioned to utilize these techniques in future studies in clinical settings.

  15. Development of Faecalibacterium 16S rRNA gene marker for identification of human faeces.

    Science.gov (United States)

    Zheng, G; Yampara-Iquise, H; Jones, J E; Andrew Carson, C

    2009-02-01

    The focus of this study was to identify a bacterial 16S rRNA gene sequence, unique to microbiota in the human gut, for use in development of a dependable PCR assay to detect human faecal pollution in water. Suppression subtractive hybridization (SSH) and bioinformatics were used to identify a genetic marker, within the 16S rRNA gene of Faecalibacterium, for the detection of human faeces. DNA sequencing analysis demonstrated that a majority (16) of 74 clones of the SSH library contained insertion sequences identified as Faecalibacterium 16S rRNA genes. Human faeces-specific sequences were derived and six PCR primer sets designed and tested against faecal DNA samples from human and nonhuman sources. One PCR primer set, HFB-F3 and HFB-R5, was exclusively associated with human faeces. These primers generated a human faeces-specific amplicon of 399 bp from 60.2% of human faecal samples and 100% of sewage samples. The subject Faecalibacterium marker is specific for sewage. This study represents the initial report of a Faecalibacterium marker for human faeces, which may prove useful for microbial source tracking.

  16. Characterization of Hydrocortisone Biometabolites and 18S rRNA Gene in Chlamydomonas reinhardtii Cultures

    Directory of Open Access Journals (Sweden)

    Seyed Bagher Mosavi-Azam

    2008-10-01

    Full Text Available A unicellular microalga, Chlamydomonas reinhardtii, was isolated from rice paddy-field soil and water samples and used in the biotransformation of hydrocortisone (1. This strain has not been previously tested for steroid bioconversion. Fermentation was carried out in BG-11 medium supplemented with 0.05% substrate at 25ºC for 14 days of incubation. The products obtained were chromatographically purified and characterized using spectroscopic methods. 11b,17b-Dihydroxyandrost-4-en-3-one (2, 11b-hydroxyandrost-4-en-3,17-dione (3, 11b,17a,20b,21-tetrahydroxypregn-4-en-3-one (4 and prednisolone (5 were the main products of the bioconversion. The observed bioreaction features were the side chain degradation of the substrate to give compounds 2 and 3 and the 20-ketone reduction and 1,2-dehydrogenation affording compounds 4 and 5, respectively. A time course study showed the accumulation of product 2 from the second day of the fermentation and of compounds 3, 4 and 5 from the third day. All the metabolites reached their maximum concentration in seven days. Microalgal 18S rRNA gene was also amplified by PCR. PCR products were sequenced to confirm their authenticity as 18S rRNA gene of microalgae. The result of PCR blasted with other sequenced microalgae in NCBI showed 100% homology to the 18S small subunit rRNA of two Chlamydomonas reinhardtii spp.

  17. Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification.

    Science.gov (United States)

    Ziesemer, Kirsten A; Mann, Allison E; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T; Brandt, Bernd W; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A; MacDonald, Sandy J; Thomas, Gavin H; Collins, Matthew J; Lewis, Cecil M; Hofman, Corinne; Warinner, Christina

    2015-11-13

    To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341-534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions.

  18. Phosphate-Modified Nucleotides for Monitoring Enzyme Activity.

    Science.gov (United States)

    Ermert, Susanne; Marx, Andreas; Hacker, Stephan M

    2017-04-01

    Nucleotides modified at the terminal phosphate position have been proven to be interesting entities to study the activity of a variety of different protein classes. In this chapter, we present various types of modifications that were attached as reporter molecules to the phosphate chain of nucleotides and briefly describe the chemical reactions that are frequently used to synthesize them. Furthermore, we discuss a variety of applications of these molecules. Kinase activity, for instance, was studied by transfer of a phosphate modified with a reporter group to the target proteins. This allows not only studying the activity of kinases, but also identifying their target proteins. Moreover, kinases can also be directly labeled with a reporter at a conserved lysine using acyl-phosphate probes. Another important application for phosphate-modified nucleotides is the study of RNA and DNA polymerases. In this context, single-molecule sequencing is made possible using detection in zero-mode waveguides, nanopores or by a Förster resonance energy transfer (FRET)-based mechanism between the polymerase and a fluorophore-labeled nucleotide. Additionally, fluorogenic nucleotides that utilize an intramolecular interaction between a fluorophore and the nucleobase or an intramolecular FRET effect have been successfully developed to study a variety of different enzymes. Finally, also some novel techniques applying electron paramagnetic resonance (EPR)-based detection of nucleotide cleavage or the detection of the cleavage of fluorophosphates are discussed. Taken together, nucleotides modified at the terminal phosphate position have been applied to study the activity of a large diversity of proteins and are valuable tools to enhance the knowledge of biological systems.

  19. Uncovering the polymerase-induced cytotoxicity of an oxidized nucleotide

    Science.gov (United States)

    Freudenthal, Bret D.; Beard, William A.; Perera, Lalith; Shock, David D.; Kim, Taejin; Schlick, Tamar; Wilson, Samuel H.

    2015-01-01

    Oxidative stress promotes genomic instability and human diseases. A common oxidized nucleoside is 8-oxo-7,8-dihydro-2'-deoxyguanosine, which is found both in DNA (8-oxo-G) and as a free nucleotide (8-oxo-dGTP). Nucleotide pools are especially vulnerable to oxidative damage. Therefore cells encode an enzyme (MutT/MTH1) that removes free oxidized nucleotides. This cleansing function is required for cancer cell survival and to modulate Escherichia coli antibiotic sensitivity in a DNA polymerase (pol)-dependent manner. How polymerases discriminate between damaged and non-damaged nucleotides is not well understood. This analysis is essential given the role of oxidized nucleotides in mutagenesis, cancer therapeutics, and bacterial antibiotics. Even with cellular sanitizing activities, nucleotide pools contain enough 8-oxo-dGTP to promote mutagenesis. This arises from the dual coding potential where 8-oxo-dGTP(anti) base pairs with cytosine and 8-oxo-dGTP(syn) uses its Hoogsteen edge to base pair with adenine. Here we use time-lapse crystallography to follow 8-oxo-dGTP insertion opposite adenine or cytosine with human pol β, to reveal that insertion is accommodated in either the syn- or anti-conformation, respectively. For 8-oxo-dGTP(anti) insertion, a novel divalent metal relieves repulsive interactions between the adducted guanine base and the triphosphate of the oxidized nucleotide. With either templating base, hydrogen-bonding interactions between the bases are lost as the enzyme reopens after catalysis, leading to a cytotoxic nicked DNA repair intermediate. Combining structural snapshots with kinetic and computational analysis reveals how 8-oxo-dGTP uses charge modulation during insertion that can lead to a blocked DNA repair intermediate.

  20. Microwave treatment of renal cell carcinoma adjacent to renal sinus

    International Nuclear Information System (INIS)

    Gao, Yongyan; Liang, Ping; Yu, Xiaoling; Yu, Jie; Cheng, Zhigang; Han, Zhiyu; Duan, Shaobo; Huang, Hui

    2016-01-01

    Highlights: • This study shows US-guided microwave ablation appears to be a promising method to treat renal cell carcinoma adjacent to renal sinus. • The estimated 1-, 3- and 5-year RCC-related survival were 100%, 93.3% and 93.3%, respectively. • The estimated 1-, 3- and 5-year overall survival were 97.1%, 87.8%, 83.6%, respectively. • For patients with RCC ≤4 cm, initial ablation success was 100% (29/29) and the estimated 5-year disease-free survival were 81.5%. - Abstract: Purpose: To evaluate the efficacy and safety of ultrasound (US)-guided percutaneous microwave ablation (MWA) for renal cell carcinoma (RCC) adjacent to renal sinus. Materials and methods: This retrospective study included 41 patients who underwent US-guided percutaneous MWA of 41 RCCs adjacent to the renal sinus from April 2006 to December 2015. Contrast-enhanced images of US and computed tomography (CT) or magnetic resonance (MR) imaging were performed at pre-ablation and 1 day, 1 month, 3 months, and every 6 months after ablation. Initial ablation success (IAS), disease-free survival (DFS), RCC-related survival (RRS), and overall survival (OS) were recorded at the follow-up visits. Results: IAS was achieved in 92.7% (38/41) of the study subjects. The IAS significantly differed between patients with RCCs ≤4 cm (100%, 29/29) and RCCs >4 cm (75%, 9/12, p = 0.021). During the median follow-up of 37.6 (range, 3.0–97.3) months, the estimated 1-, 3-, and 5-year DFS of patients with an initial tumor of ≤4 cm were 100%, 89.7%, and 81.5%, respectively. The 1-, 3-, and 5-year RRS were 100%, 93.3%, and 93.3%, respectively. The 1-, 3-, and 5-year OS were 97.1%, 87.8%, and 83.6%, respectively. The multivariate analysis using the Cox proportional hazard model revealed no independent predictor of recurrence among all the variables. There were no MWA-related deaths among the study subjects. One patient developed a retroperitoneal abscess after ablation. Conclusion: US-guided percutaneous MWA

  1. Adjacent Lumbar Disc Herniation after Lumbar Short Spinal Fusion

    OpenAIRE

    Ninomiya, Koshi; Iwatsuki, Koichi; Ohnishi, Yu-ichiro; Ohkawa, Toshika; Yoshimine, Toshiki

    2014-01-01

    A 70-year-old outpatient presented with a chief complaint of sudden left leg motor weakness and sensory disturbance. He had undergone L4/5 posterior interbody fusion with L3–5 posterior fusions for spondylolisthesis 3 years prior, and the screws were removed 1 year later. He has been followed up for 3 years, and there had been no adjacent segment problems before this presentation. Lumbar magnetic resonance imaging (MRI) showed a large L2/3 disc hernia descending to the L3/4 level. Compared to...

  2. Osteoid Osteoma of Cervical Spine in two adjacent Vertebrae

    Directory of Open Access Journals (Sweden)

    MR Etemadifar

    2005-09-01

    Full Text Available Osteoid osteoma is a benign bone tumor, mainly seen in 10-30 years male. Spine is a relatively common site and almost always, posterior elements are involved. Plain X-Ray-, CT scan and Isotope scan help to identify and localize spine lesions. We described one 18 years old boy with 3 years low neck pain. Isotope scan, MRI and CT scan showed two lesions in C7 and T1. Gross inspection and histopathology examination confirmed osteoid osteoma in two adjacent vertebrae which has not been reported elsewhere in the literature. Key words: Osteoid Osteoma, Spine, Multifocal

  3. Microwave treatment of renal cell carcinoma adjacent to renal sinus

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Yongyan, E-mail: gaoyongyan7@163.com [Department of Interventional Ultrasound, Chinese PLA General Hospital, 28 Fuxing Road, Beijing, 100853 (China); Department of Ultrasound, The General Hospital of Chinese People’s Armed Police Forces, 69 Yongding Road, Beijing, 100039 (China); Liang, Ping, E-mail: liangping301@hotmail.com [Department of Interventional Ultrasound, Chinese PLA General Hospital, 28 Fuxing Road, Beijing, 100853 (China); Yu, Xiaoling, E-mail: 784107477@qq.com [Department of Interventional Ultrasound, Chinese PLA General Hospital, 28 Fuxing Road, Beijing, 100853 (China); Yu, Jie, E-mail: 1411495161@qq.com [Department of Interventional Ultrasound, Chinese PLA General Hospital, 28 Fuxing Road, Beijing, 100853 (China); Cheng, Zhigang, E-mail: 13691367317@163.com [Department of Interventional Ultrasound, Chinese PLA General Hospital, 28 Fuxing Road, Beijing, 100853 (China); Han, Zhiyu, E-mail: hanzhiyu122@163.com [Department of Interventional Ultrasound, Chinese PLA General Hospital, 28 Fuxing Road, Beijing, 100853 (China); Duan, Shaobo, E-mail: Dustin2662@163.com [Department of Interventional Ultrasound, Chinese PLA General Hospital, 28 Fuxing Road, Beijing, 100853 (China); Huang, Hui, E-mail: 309hh@sina.com [Department of Interventional Ultrasound, Chinese PLA General Hospital, 28 Fuxing Road, Beijing, 100853 (China)

    2016-11-15

    Highlights: • This study shows US-guided microwave ablation appears to be a promising method to treat renal cell carcinoma adjacent to renal sinus. • The estimated 1-, 3- and 5-year RCC-related survival were 100%, 93.3% and 93.3%, respectively. • The estimated 1-, 3- and 5-year overall survival were 97.1%, 87.8%, 83.6%, respectively. • For patients with RCC ≤4 cm, initial ablation success was 100% (29/29) and the estimated 5-year disease-free survival were 81.5%. - Abstract: Purpose: To evaluate the efficacy and safety of ultrasound (US)-guided percutaneous microwave ablation (MWA) for renal cell carcinoma (RCC) adjacent to renal sinus. Materials and methods: This retrospective study included 41 patients who underwent US-guided percutaneous MWA of 41 RCCs adjacent to the renal sinus from April 2006 to December 2015. Contrast-enhanced images of US and computed tomography (CT) or magnetic resonance (MR) imaging were performed at pre-ablation and 1 day, 1 month, 3 months, and every 6 months after ablation. Initial ablation success (IAS), disease-free survival (DFS), RCC-related survival (RRS), and overall survival (OS) were recorded at the follow-up visits. Results: IAS was achieved in 92.7% (38/41) of the study subjects. The IAS significantly differed between patients with RCCs ≤4 cm (100%, 29/29) and RCCs >4 cm (75%, 9/12, p = 0.021). During the median follow-up of 37.6 (range, 3.0–97.3) months, the estimated 1-, 3-, and 5-year DFS of patients with an initial tumor of ≤4 cm were 100%, 89.7%, and 81.5%, respectively. The 1-, 3-, and 5-year RRS were 100%, 93.3%, and 93.3%, respectively. The 1-, 3-, and 5-year OS were 97.1%, 87.8%, and 83.6%, respectively. The multivariate analysis using the Cox proportional hazard model revealed no independent predictor of recurrence among all the variables. There were no MWA-related deaths among the study subjects. One patient developed a retroperitoneal abscess after ablation. Conclusion: US-guided percutaneous MWA

  4. Modular cervical plate system for adjacent segment disease.

    Science.gov (United States)

    Hawasli, Ammar H; Cashin, John L; Wright, Neill M

    2018-02-23

    Adjacent-level disease after anterior cervical discectomy and fusion (ACDF) occurs in a significant proportion of patients and frequently requires revision operation. Methods using traditional plates typically require removal of the plate with anecdotally increased operative-time and morbidity. We review our experience in treating symptomatic adjacent-segment disease using both traditional plate removal and modular- plate system which allows for add-on plate components rather than removal of the entire plate. Authors compared 64 patients with revision surgery using modular-plate system for adjacent- segment disease compared to 2-cohorts: (1) patients with traditional plate-removal and (2) patients with no prior plate. Clinical data included demographics, original surgery, presentation, current surgery, use of modular system, need for preoperative computed-topography, operative-time, blood loss, hospital stay, complications, length of dysphagia, neck disability index and time-until-fusion. Modular cervical plate system was utilized to prevent exposure and removal of the entire plate. The terminal portion of the plate was exposed and the distal module was removed. Following the discectomy/arthrodesis, a module-plate extension was added onto the previous plate for extension of the prior instrumentation. Preoperative planning computed-topography was required in 26% of plate-removal and 17% of modular-plate cases. Revision surgery with no prior plate had reduced operative-time (77.0±18.1 min) when compared with plate removal (103.8±46.2 min; p<0.01). Blood-loss was lower for modular-plate system (38.3±20.4 mL) and no prior plate (38.4±12.6 mL) versus plate removal (78.2±65.9 mL, p<0.01). Hospital stay was similar for all groups. No complications were experienced with modular-plate revision but plate removal and revision after no prior plate carried 7.7% and 10.5% complication rates, respectively. There was a trend towards lower dysphagia and neck disability index

  5. Adjacent segment infection after surgical treatment of spondylodiscitis

    OpenAIRE

    Siam, Ahmed Ezzat; El Saghir, Hesham; Boehm, Heinrich

    2015-01-01

    Background This is the first case series to describe adjacent segment infection (ASI) after surgical treatment of spondylodiscitis (SD). Materials and methods Patients with SD, spondylitis who were surgically treated between 1994 and 2012 were included. Out of 1187 cases, 23 (1.94?%) returned to our institution (Zentralklinik Bad Berka) with ASI: 10?males, 13 females, with a mean age of 65.1?years and a mean follow-up of 69?months. Results ASI most commonly involved L3?4 (seven patients), T12...

  6. Microsatellite Polymorphisms Adjacent to the Oxytocin Receptor Gene in Domestic Cats: Association with Personality?

    Directory of Open Access Journals (Sweden)

    Minori Arahori

    2017-12-01

    Full Text Available A growing number of studies have explored the oxytocin system in humans and non-human animals, and some have found important genetic polymorphisms in the oxytocin receptor gene (OXTR associated with the bonding system, social behaviors, and personality in several species. Although single nucleotide polymorphisms in OXTR have been well-examined in various species, microsatellites (or short tandem repeats adjacent to OXTR have rarely been studied, despite some suggestions that microsatellite polymorphisms near genes might play a role in genetic transcription and translation. In this study, we surveyed microsatellites in the upstream, intron, and downstream regions of OXTR in domestic cats (Felis catus. We succeeded in amplifying 5 out of 10 regions, and recognized these five regions as polymorphic. We compared allele frequencies in these five regions between mongrel cats in Japan (n = 100 and cats of 10 pure breeds (n = 40. There were significant differences in allele frequencies between the two populations in all microsatellite regions. Additionally, the owners of mongrel cats answered a comprehensive personality questionnaire, and factor analysis extracted four factors (Openness, Friendliness, Roughness, and Neuroticism. We examined the association between the microsatellite genotypes, age, sex, neutering status, and personality scores. Compared to their counterparts, younger cats tended to score higher on Openness, male cats scored higher on Friendliness, and female and neutered cats scored higher on Roughness. When we divided the sample into three groups depending on the length of alleles, we found a marginally significant association between Friendliness and MS3. Additionally, we found a sex-mediated effect of genotypes in MS4 on Friendliness, resulting in different effects on females and males. Our findings that mongrel cats had longer alleles in MS3 and MS4 than purebred cats, and that those cats tended to score higher on Friendliness

  7. Improved identification of Gordonia, Rhodococcus and Tsukamurella species by 5'-end 16S rRNA gene sequencing.

    Science.gov (United States)

    Wang, Tao; Kong, Fanrong; Chen, Sharon; Xiao, Meng; Sorrell, Tania; Wang, Xiaoyan; Wang, Shuo; Sintchenko, Vitali

    2011-01-01

    The identification of fastidious aerobic Actinomycetes such as Gordonia, Rhodococcus, and Tsukamurella has remained a challenge leading to clinically significant misclassifications. This study is intended to examine the feasibility of partial 5'-end 16S rRNA gene sequencing for the identification of Gordonia, Rhodococcus, and Tsukamurella, and defined potential reference sequences for species from each of these genera. The 16S rRNA gene sequence based identification algorithm for species identification was used and enhanced by aligning test sequences with reference sequences from the List of Prokaryotic Names with Standing in Nomenclature. Conventional PCR based 16S rRNA gene sequencing and the alignment of the isolate 16S rRNA gene sequence with reference sequences accurately identified 100% of clinical strains of aerobic Actinomycetes. While partial 16S rRNA gene sequences of reference type strains matched with the 16S rRNA gene sequences of 19 isolates in our data set, another 13 strains demonstrated a degree of polymorphism with a 1-4 bp difference in the regions of difference. 5'-end 606 bp 16S rRNA gene sequencing, coupled with the assignment of well defined reference sequences to clinically relevant species of bacteria, can be a useful strategy for improving the identification of clinically relevant aerobic Actinomycetes.

  8. [Phylogenetic comparison between Spirulina and Arthrospira based on 16S rRNA and rpoC1 gene].

    Science.gov (United States)

    Wu, Yuemei; Wang, Suying; Dong, Shirui

    2016-02-04

    Based on 16S rRNA and rpoC1 gene sequences, the phylogenetic relationship between Spirulina and Arthrospira were studied and compared. We amplified, sequenced and analyzed 16S rRNA and rpoC1 of 84 strains. Then the phylogenetic trees were constructed and compared. The conserved sites percentage, average G+C content and sequence identity of rpoC1 were 49.7%, 47.7%, 76%-100% respectively, significantly lower than 79.4%, 55.6% and 91%-100% of 16S rRNA, and the heterogeneity degree was higher. The trees generated with two different genes showed similar topologies and thus inferred consistent phylogenetic relationships. Eighty-four experimental strains were divided into 3 groups belonging to 2 genera: F-35 1, F-904-2, F-1070 and TJBC14 were Spirulina and the rest were Arthrospira. Although morphospecies and geographical species could not be distinguished based on 16S rRNA and rpoC1 gene sequences, the bootstrap value of rpoC1 (100%) was higher than that of 16S rRNA (99%). Moreover, clustering effect of rpoC1 for Spirulina and Arthrospirai was better than 16S rRNA. Spirulina and Arthrospira were different genera, rpoC1 gene has more advantage to distinguish the strains in the same genus than that of 16S rRNA gene.

  9. rRNA Operon Copy Number Can Explain the Distinct Epidemiology of Hospital-Associated Methicillin-Resistant Staphylococcus aureus

    Science.gov (United States)

    Jansen, M. D.; Bosch, T.; Jansen, W. T. M.; Schouls, L.; Jonker, M. J.; Boel, C. H. E.

    2016-01-01

    The distinct epidemiology of original hospital-associated methicillin-resistant Staphylococcus aureus (HA-MRSA) and early community-associated MRSA (CA-MRSA) is largely unexplained. S. aureus carries either five or six rRNA operon copies. Evidence is provided for a scenario in which MRSA has adapted to the hospital environment by rRNA operon loss (six to five copies) due to antibiotic pressure. Early CA-MRSA, in contrast, results from wild-type methicillin-susceptible S. aureus (MSSA) that acquired mecA without loss of an rRNA operon. Of the HA-MRSA isolates (n = 77), 67.5% had five rRNA operon copies, compared to 23.2% of the CA-MRSA isolates (n = 69) and 7.7% of MSSA isolates (n = 195) (P operon copies. For all subsets, a correlation between resistance profile and rRNA copy number was found. Furthermore, we showed that in vitro antibiotic pressure may result in rRNA operon copy loss. We also showed that without antibiotic pressure, S. aureus isolates containing six rRNA copies are more fit than isolates with five copies. We conclude that HA-MRSA and cystic fibrosis isolates most likely have adapted to an environment with high antibiotic pressure by the loss of an rRNA operon copy. This loss has facilitated resistance development, which promoted survival in these niches. However, strain fitness decreased, which explains their lack of success in the community. In contrast, CA-MRSA isolates retained six rRNA operon copies, rendering them fitter and thereby able to survive and spread in the community. PMID:27671073

  10. Structure of a eukaryotic cyclic nucleotide-gated channel

    Science.gov (United States)

    Li, Minghui; Zhou, Xiaoyuan; Wang, Shu; Michailidis, Ioannis; Gong, Ye; Su, Deyuan; Li, Huan; Li, Xueming; Yang, Jian

    2018-01-01

    Summary Cyclic nucleotide-gated (CNG) channels are essential for vision and olfaction. They belong to the voltage-gated ion channel superfamily but their activities are controlled by intracellular cyclic nucleotides instead of transmembrane voltage. Here we report a 3.5 Å-resolution single-particle electron cryomicroscopy structure of a CNG channel from C. elegans in the cGMP-bound open state. The channel has an unusual voltage-sensor-like domain (VSLD), accounting for its deficient voltage dependence. A C-terminal linker connecting S6 and the cyclic nucleotide-binding domain interacts directly with both the VSLD and pore domain, forming a gating ring that couples conformational changes triggered by cyclic nucleotide binding to the gate. The selectivity filter is lined by the carboxylate side chains of a functionally important glutamate and three rings of backbone carbonyls. This structure provides a new framework for understanding mechanisms of ion permeation, gating and channelopathy of CNG channels and cyclic nucleotide modulation of related channels. PMID:28099415

  11. Adjacent segment disease in degenerative pathologies with posterior instrumentation

    Directory of Open Access Journals (Sweden)

    Ana Guadalupe Ramírez Olvera

    2015-03-01

    Full Text Available OBJECTIVE: To establish the real incidence of adjacent segment disease after fusion, and to identify the levels and predisposing factors for the pathology, as well as the functional results. METHODS: a retrospective case series study with level of evidence IIB, in a sample of 179 patients diagnosed with stenosis of the lumbar spine, spondylolisthesis and degenerative scoliosis, submitted to surgery in the period 2005 to December 2013, with posterior instrumentation and posterolateral fusion, with follow-up from 2007 until May 2014, in which the symptomology and radiographic findings were evaluated, to establish the diagnosis and treatment. RESULTS: the study included 179 patients diagnosed with stenosis of the lumbar spine (n=116, isthmic and degenerative spondylolisthesis (n=50 and degenerative scoliosis (n=13; during the study, 20 cases of adjacent level segment were identified, 80% of which were treated surgically with extension of the instrumentation, while 20% were treated conservatively with NSAIDs and therapeutic blocks. CONCLUSION: An incidence of 11% was found, with an average of 3.25 years in diagnosis and treatment, a prevalence of females and diagnosis of stenosis of the lumbar canal on posterior instrumentation, a predominance of levels L4-L5; 80% were treated with extension of the instrumentation. The complications were persistent radiculopathy, infection of the surgical wound, and one death due to causes not related to the lumbar pathology.

  12. Absorbed dose distribution analyses in irradiation with adjacent fields

    International Nuclear Information System (INIS)

    Cudalbu, C.; Onuc, C.; Andrada, S.

    2002-01-01

    Because the special irradiation technique with adjacent fields is the most used in the case of medulloblastoma treatment, we consider very important to specify some general information about medulloblastoma. This malignant disease has a large incidence in children with age between 5-7 years. This tumor usually originates in the cerebellum and is referred to as primitive undifferentiated tumor. It may spread contiguously to the cerebellar peduncle, floor of the fourth ventricle, into the cervical spine. In addition, it may spread via the cerebrospinal fluid intracranially and/or to the spinal cord. For this purpose it is necessary to perform a treatment technique with cranial tangential fields combined with adjacent fields for the entire spinal cord to achieve a perfect coverage of the zones with malignant cells. The treatment in this case is an association between surgery-radio-chemotherapy, where the radiotherapy has a very important roll and a curative purpose. This is due to the fact that the migration of malignant cells in the body can't be controlled by surgery. Because of this special irradiation technique used in medulloblastoma treatment, we chase to describe in this paper this complex type of irradiation where the implications of the beams divergence in doses distribution are essentials

  13. Spatial Distribution of Escherichia coli in the Mouse Large Intestine Inferred from rRNA In Situ Hybridization

    DEFF Research Database (Denmark)

    Poulsen, Lars Kærgaard; Lan, Fusheng; Sternberg, Claus

    1994-01-01

    Fluorescent oligonucleotide probes targeting rRNA were used to develop an in situ hybridization technique by which the spatial distribution of Escherichia coli in the large intestines of streptomycin-treated mice was determined. Single E. coli cells were identified in thin frozen sections from...... the large intestines by the use of a probe specific for E. coli 23S rRNA. Furthermore, the total bacterial population was visualized with an rRNA probe targeting the domain Bacteria. By this technique, all E. coli cells were seen embedded in the mucosal material overlying the epithelial cells of the large...

  14. Molecular identification of airborne bacteria associated with aerial spraying of bovine slurry waste employing 16S rRNA gene PCR and gene sequencing techniques.

    Science.gov (United States)

    Murayama, Mayumi; Kakinuma, Yuki; Maeda, Yasunori; Rao, Juluri R; Matsuda, Motoo; Xu, Jiru; Moore, Peter J A; Millar, B Cherie; Rooney, Paul J; Goldsmith, Colin E; Loughrey, Anne; McMahon, M Ann S; McDowell, David A; Moore, John E

    2010-03-01

    Polymerase chain reaction amplification of the universal 16S ribosomal RNA (rRNA) gene was performed on a collection of 38 bacterial isolates, originating from air sampled immediately adjacent to the agricultural spreading of bovine slurry. A total of 16 bacterial genera were identified including both Gram-positive and Gram-negative genera. Gram-positive organisms accounted for 34/38 (89.5%) of total bacterial numbers consisting of 12 genera and included Staphylococcus (most common genus isolated), Arthrobacter (2nd most common genus isolated), Brachybacterium, Exiguobacterium, Lactococcus, Microbacterium and Sporosarcina (next most common genera isolated) and finally, Bacillus, Brevibacterium, Frigoribacterium, Mycoplana and Pseudoclavibacter. Gram-negative organisms accounted for only 4/38 (10.5%) bacterial isolates and included the following genera, Brevundimonas, Lysobacter, Psychrobacter and Rhizobium. No gastrointestinal pathogens were detected. Although this study demonstrated a high diversity of the microorganisms present, only a few have been shown to be opportunistically pathogenic to humans and none of these organisms described have been described previously as having an inhalational route of infection and therefore we do not believe that the species of organisms identified pose a significant health and safety threat for immunocompetant individuals. (c) 2009 Elsevier Inc. All rights reserved.

  15. Compositions and methods for detecting single nucleotide polymorphisms

    Energy Technology Data Exchange (ETDEWEB)

    Yeh, Hsin-Chih; Werner, James; Martinez, Jennifer S.

    2016-11-22

    Described herein are nucleic acid based probes and methods for discriminating and detecting single nucleotide variants in nucleic acid molecules (e.g., DNA). The methods include use of a pair of probes can be used to detect and identify polymorphisms, for example single nucleotide polymorphism in DNA. The pair of probes emit a different fluorescent wavelength of light depending on the association and alignment of the probes when hybridized to a target nucleic acid molecule. Each pair of probes is capable of discriminating at least two different nucleic acid molecules that differ by at least a single nucleotide difference. The methods can probes can be used, for example, for detection of DNA polymorphisms that are indicative of a particular disease or condition.

  16. Effect of nucleotides on broiler performance and carcass yield

    Directory of Open Access Journals (Sweden)

    VC Pelícia

    2010-03-01

    Full Text Available This study aimed at evaluating the effect of nucleotides on the performance and carcass yield of broilers fed diets with no antibiotic growth promoters (AGP, anticoccidials, or animal feedstuffs. In the trial, 600 Ross 308 male broilers were distributed in a completely randomized experimental design into six treatments with four replicates of 25 birds each. Treatments consisted of a control diet (CD, CD + AGP, CD + 0.04%, CD + 0.05%, CD + 0.06%, and CD + 0.07% nucleotides. The experimental diets did not contain anticoccidials, and birds were vaccinated against coccidiosis at three days of age. No significant differences were detected among broilers submitted to the different treatments in none of the studied parameters. Under the conditions of this experiment, diets supplemented with nucleotides did not influence broiler performance or carcass yield at 42 days of age, and were not different from the feeds not containing any additive or with AGP.

  17. Updating our view of organelle genome nucleotide landscape

    Directory of Open Access Journals (Sweden)

    David Roy Smith

    2012-09-01

    Full Text Available Organelle genomes show remarkable variation in architecture and coding content, yet their nucleotide composition is relatively unvarying across the eukaryotic domain, with most having a high adenine and thymine (AT content. Recent studies, however, have uncovered guanine and cytosine (GC-rich mitochondrial and plastid genomes. These sequences come from a small but eclectic list of species, including certain green plants and animals. Here, I review GC-rich organelle DNAs and the insights they have provided into the evolution of nucleotide landscape. I emphasize that GC-biased mitochondrial and plastid DNAs are more widespread than once thought, sometimes occurring together in the same species, and suggest that the forces biasing their nucleotide content can differ both among and within lineages, and may be associated with specific genome architectural features and life history traits.

  18. Detection and characterization of ‘Candidatus Phytoplasma asteris’ associated with littleleaf disease of bitter gourd from India by 16S rRNA phylogenetic and RFLP (in vitro and virtual analysis

    Directory of Open Access Journals (Sweden)

    Venkataravanappa Venkataravanappa

    2017-01-01

    Full Text Available Bitter gourd plants showing symptoms of little leaf disease are prevalent in farmers’ fields in the Bangalore rural district, Karnataka state, India. Twenty leaf samples from different locations were collected to determine the etiology of the disease. Using PCR and phytoplasma 16S rRNA gene-specific universal primers, we observed positive amplification for the phytoplasma specific primers in five out of twenty samples. The amplified products were cloned, sequenced and nucleotide (NT sequence comparisons were made with the available phytoplasmas’ 16S rRNA gene NT sequences in the NCBI database. The 16S rRNA gene NT sequence of bitter gourd phytoplasma shared highest identity of 81.7-96.0% with ‘Candidatus Phytoplasma asteris’ (Ca. P. asteris 16Sr I group isolates from different parts of the world. This was supported by close clustering of phytoplasma of the current study with the Ca. P. asteris 16Sr I subgroup by phylogenetic analysis. The virtual restriction fragment length polymorphism (RFLP pattern generated for the Phytoplasma from bitter gourd was in congruence with the in vitro RFLP pattern for the six enzymes. This was typical to Ca. P. asteris from the 16Sr I group. Further, virtual RFLP analysis with 11 more enzymes used for RFLP pattern prediction revealed differences only in the Mse I RFLP pattern, with a similarity coefficient of 0.91, which is less than the threshold similarity coefficient for a new subgroup. We propose that the phytoplasma detected in the present study that infects bitter gourd and causes littleleaf disease should be considered as a new subgroup of group 16Sr I (Ca. P. asteris. This is the first report of phytoplasma associated with littleleaf disease of bitter gourd from India.

  19. Risk factors for adjacent segment disease after lumbar fusion

    Science.gov (United States)

    Lee, Choon Sung; Lee, Sung-Woo; Ahn, Young-Joon; Kim, Yung-Tae; Lee, Dong-Ho; Lee, Mi Young

    2009-01-01

    The incidence of adjacent segment problems after lumbar fusion has been found to vary, and risk factors for these problems have not been precisely verified, especially based on structural changes determined by magnetic resonance imaging. The purpose of this retrospective clinical study was to describe the incidence and clinical features of adjacent segment disease (ASD) after lumbar fusion and to determine its risk factors. We assessed the incidence of ASD in patients who underwent lumbar or lumbosacral fusions for degenerative conditions between August 1995 and March 2006 with at least a 1-year follow-up. Patients less than 35 years of age at the index spinal fusion, patients with uninstrumented fusion, and patients who had not achieved successful union were excluded. Of the 1069 patients who underwent fusions, 28 (2.62%) needed secondary operations because of ASD and were included in this study. In order to identify the risk factors, we matched a disease group and a control group. The disease group consisted of 26 of the 28 patients with ASD, excluding the 2 patients for whom we did not have initial MRI data. Each patient in the disease group was matched by age, sex, fusion level and follow-up period with a control patient. The assumed risk factors included disc and facet degeneration, instability, listhesis, rotational deformity, and disc wedging. The mean age of the 28 patients with ASD requiring surgical treatment was 58.4 years, which did not differ significantly from that of the population in which ASD did not develop (58.2 years, p = 0.894). Of the 21 patients who underwent floating fusion, only 1 developed distal ASD. Facet degeneration was a significant risk factor (p < 0.01) on logistic regression analysis. The incidence of distal ASD was much lower than that of proximal ASD. Pre-existing facet degeneration may be associated with a high risk of adjacent segment problems following lumbar fusion procedures. PMID:19533182

  20. Cervical adjacent segment pathology following fusion: Is it due to fusion?

    OpenAIRE

    Rosenthal, Philip; Kim, Kee D

    2013-01-01

    Adjacent segment pathology affects 25% of patients within ten years of anterior cervical diskectomy and fusion (ACDF). Laboratory studies demonstrate fused segments increase adjacent level stress including elevated intradiscal pressure and increased range of motion. Radiographic adjacent segment pathology (RASP) has been associated to ACDF in multiple statistically significant studies. Randomized controlled trials (RCTs) comparing anterior cervical discectomy and arthroplasty (ACDA) and ACDF ...

  1. Pseudoscorpion mitochondria show rearranged genes and genome-wide reductions of RNA gene sizes and inferred structures, yet typical nucleotide composition bias

    Directory of Open Access Journals (Sweden)

    Ovchinnikov Sergey

    2012-03-01

    Full Text Available Abstract Background Pseudoscorpions are chelicerates and have historically been viewed as being most closely related to solifuges, harvestmen, and scorpions. No mitochondrial genomes of pseudoscorpions have been published, but the mitochondrial genomes of some lineages of Chelicerata possess unusual features, including short rRNA genes and tRNA genes that lack sequence to encode arms of the canonical cloverleaf-shaped tRNA. Additionally, some chelicerates possess an atypical guanine-thymine nucleotide bias on the major coding strand of their mitochondrial genomes. Results We sequenced the mitochondrial genomes of two divergent taxa from the chelicerate order Pseudoscorpiones. We find that these genomes possess unusually short tRNA genes that do not encode cloverleaf-shaped tRNA structures. Indeed, in one genome, all 22 tRNA genes lack sequence to encode canonical cloverleaf structures. We also find that the large ribosomal RNA genes are substantially shorter than those of most arthropods. We inferred secondary structures of the LSU rRNAs from both pseudoscorpions, and find that they have lost multiple helices. Based on comparisons with the crystal structure of the bacterial ribosome, two of these helices were likely contact points with tRNA T-arms or D-arms as they pass through the ribosome during protein synthesis. The mitochondrial gene arrangements of both pseudoscorpions differ from the ancestral chelicerate gene arrangement. One genome is rearranged with respect to the location of protein-coding genes, the small rRNA gene, and at least 8 tRNA genes. The other genome contains 6 tRNA genes in novel locations. Most chelicerates with rearranged mitochondrial genes show a genome-wide reversal of the CA nucleotide bias typical for arthropods on their major coding strand, and instead possess a GT bias. Yet despite their extensive rearrangement, these pseudoscorpion mitochondrial genomes possess a CA bias on the major coding strand. Phylogenetic

  2. DNA sequencing reveals limited heterogeneity in the 16S rRNA gene from the rrnB operon among five Mycoplasma hominis isolates

    DEFF Research Database (Denmark)

    Mygind, T; Birkelund, Svend; Christiansen, Gunna

    1998-01-01

    To investigate the intraspecies heterogeneity within the 16S rRNA gene of Mycoplasma hominis, five isolates with diverse antigenic profiles, variable/identical P120 hypervariable domains, and different 16S rRNA gene RFLP patterns were analysed. The 16S rRNA gene from the rrnB operon was amplified...

  3. Determination of the Nucleotide Sequences of Heat Shock Operon groESL and the Citrate Synthase Gene (gltA) of Anaplasma (Ehrlichia) platys for Phylogenetic and Diagnostic Studies

    Science.gov (United States)

    Inokuma, Hisashi; Fujii, Kaori; Okuda, Masaru; Onishi, Takafumi; Beaufils, Jean-Pierre; Raoult, Didier; Brouqui, Philippe

    2002-01-01

    The 1,670-bp nucleotide sequence of the heat shock operon groESL and the 1,236-bp sequence of the citrate synthase gene (gltA) of Anaplasma (Ehrlichia) platys were determined. The topology of the groEL- and gltA-based phylogenetic tree was similar to that derived from 16S rRNA gene analyses with distances. Both groESL- and gltA-based PCRs specific to A. platys were also developed based upon the alignment data. PMID:12204973

  4. Evaluation of PacBio sequencing for full-length bacterial 16S rRNA gene classification.

    Science.gov (United States)

    Wagner, Josef; Coupland, Paul; Browne, Hilary P; Lawley, Trevor D; Francis, Suzanna C; Parkhill, Julian

    2016-11-14

    Currently, bacterial 16S rRNA gene analyses are based on sequencing of individual variable regions of the 16S rRNA gene (Kozich, et al Appl Environ Microbiol 79:5112-5120, 2013).This short read approach can introduce biases. Thus, full-length bacterial 16S rRNA gene sequencing is needed to reduced biases. A new alternative for full-length bacterial 16S rRNA gene sequencing is offered by PacBio single molecule, real-time (SMRT) technology. The aim of our study was to validate PacBio P6 sequencing chemistry using three approaches: 1) sequencing the full-length bacterial 16S rRNA gene from a single bacterial species Staphylococcus aureus to analyze error modes and to optimize the bioinformatics pipeline; 2) sequencing the full-length bacterial 16S rRNA gene from a pool of 50 different bacterial colonies from human stool samples to compare with full-length bacterial 16S rRNA capillary sequence; and 3) sequencing the full-length bacterial 16S rRNA genes from 11 vaginal microbiome samples and compare with in silico selected bacterial 16S rRNA V1V2 gene region and with bacterial 16S rRNA V1V2 gene regions sequenced using the Illumina MiSeq. Our optimized bioinformatics pipeline for PacBio sequence analysis was able to achieve an error rate of 0.007% on the Staphylococcus aureus full-length 16S rRNA gene. Capillary sequencing of the full-length bacterial 16S rRNA gene from the pool of 50 colonies from stool identified 40 bacterial species of which up to 80% could be identified by PacBio full-length bacterial 16S rRNA gene sequencing. Analysis of the human vaginal microbiome using the bacterial 16S rRNA V1V2 gene region on MiSeq generated 129 operational taxonomic units (OTUs) from which 70 species could be identified. For the PacBio, 36,000 sequences from over 58,000 raw reads could be assigned to a barcode, and the in silico selected bacterial 16S rRNA V1V2 gene region generated 154 OTUs grouped into 63 species, of which 62% were shared with the MiSeq dataset. The Pac

  5. Adjacent Lumbar Disc Herniation after Lumbar Short Spinal Fusion

    Directory of Open Access Journals (Sweden)

    Koshi Ninomiya

    2014-01-01

    Full Text Available A 70-year-old outpatient presented with a chief complaint of sudden left leg motor weakness and sensory disturbance. He had undergone L4/5 posterior interbody fusion with L3–5 posterior fusions for spondylolisthesis 3 years prior, and the screws were removed 1 year later. He has been followed up for 3 years, and there had been no adjacent segment problems before this presentation. Lumbar magnetic resonance imaging (MRI showed a large L2/3 disc hernia descending to the L3/4 level. Compared to the initial MRI, this hernia occurred in an “intact” disc among multilevel severely degenerated discs. Right leg paresis and bladder dysfunction appeared a few days after admission. Microscopic lumbar disc herniotomy was performed. The right leg motor weakness improved just after the operation, but the moderate left leg motor weakness and difficulty in urination persisted.

  6. Tritium in the Savannah River estuary and adjacent marine waters

    International Nuclear Information System (INIS)

    Hayes, D.W.

    1979-01-01

    The tritium distribution in the Savannah River estuary and adjacent marine waters was measured to provide information on the dilution, mixing and movement of Savannah River water in this region. The Savannah River marine region was chosen because the average tritium concentration in this river is approximately 5 pCi/ml, whereas other rivers in the southeastern United States of America average less than 0.5 pCi/ml. The increased tritium concentration in the Savannah River is due to releases from the Savannah River Plant of the Department of Energy. Tritium measurements have proved particularly effective in estimating the flushing time of the Savannah River estuary (2.4 days) and in delineating the relative contribution to the water masses in Ossabaw and Port Royal Sounds from the river and from sea-water. Ossabaw and Port Royal Sounds are located approximately 20 km south and north of the Savannah River estuary respectively. (author)

  7. Improved lookup table to correct CRT adjacent pixel nonlinearity

    Science.gov (United States)

    Klein, Stanley A.; Carney, Thom; Hu, Q. James

    1995-04-01

    Standard 1D gamma-correcting lookup tables do not compensate for adjacent pixel spatial nonlinearities along the direction of the display raster. These nonlinearities can alter the local mean luminance and contrast of the displayed image. Five steps are described for generating a 2D lookup table (LUT) that compensates for the nonlinearity. By adjusting the 2D LUT so it takes into account the inherent blur at light to dark transitions of the display system, the usable luminance range of the LUT can be extended while reducing the ringing artifact associated with luminance compensation. Use of the blur-compensated 2D LUT incurs no additional computational effort over an uncompensated 2D LUT. Matlab programs are included that can be used to generate a 2D LUT for a user's particular display system.

  8. Adjacent Lumbar Disc Herniation after Lumbar Short Spinal Fusion

    Science.gov (United States)

    Iwatsuki, Koichi; Ohnishi, Yu-ichiro; Yoshimine, Toshiki

    2014-01-01

    A 70-year-old outpatient presented with a chief complaint of sudden left leg motor weakness and sensory disturbance. He had undergone L4/5 posterior interbody fusion with L3–5 posterior fusions for spondylolisthesis 3 years prior, and the screws were removed 1 year later. He has been followed up for 3 years, and there had been no adjacent segment problems before this presentation. Lumbar magnetic resonance imaging (MRI) showed a large L2/3 disc hernia descending to the L3/4 level. Compared to the initial MRI, this hernia occurred in an “intact” disc among multilevel severely degenerated discs. Right leg paresis and bladder dysfunction appeared a few days after admission. Microscopic lumbar disc herniotomy was performed. The right leg motor weakness improved just after the operation, but the moderate left leg motor weakness and difficulty in urination persisted. PMID:25276453

  9. Transcriptional down-regulation and rRNA cleavage in Dictyostelium discoideum mitochondria during Legionella pneumophila infection.

    Directory of Open Access Journals (Sweden)

    Chenyu Zhang

    2009-05-01

    Full Text Available Bacterial pathogens employ a variety of survival strategies when they invade eukaryotic cells. The amoeba Dictyostelium discoideum is used as a model host to study the pathogenic mechanisms that Legionella pneumophila, the causative agent of Legionnaire's disease, uses to kill eukaryotic cells. Here we show that the infection of D. discoideum by L. pneumophila results in a decrease in mitochondrial messenger RNAs, beginning more than 8 hours prior to detectable host cell death. These changes can be mimicked by hydrogen peroxide treatment, but not by other cytotoxic agents. The mitochondrial large subunit ribosomal RNA (LSU rRNA is also cleaved at three specific sites during the course of infection. Two LSU rRNA fragments appear first, followed by smaller fragments produced by additional cleavage events. The initial LSU rRNA cleavage site is predicted to be on the surface of the large subunit of the mitochondrial ribosome, while two secondary sites map to the predicted interface with the small subunit. No LSU rRNA cleavage was observed after exposure of D. discoideum to hydrogen peroxide, or other cytotoxic chemicals that kill cells in a variety of ways. Functional L. pneumophila type II and type IV secretion systems are required for the cleavage, establishing a correlation between the pathogenesis of L. pneumophila and D. discoideum LSU rRNA destruction. LSU rRNA cleavage was not observed in L. pneumophila infections of Acanthamoeba castellanii or human U937 cells, suggesting that L. pneumophila uses distinct mechanisms to interrupt metabolism in different hosts. Thus, L. pneumophila infection of D. discoideum results in dramatic decrease of mitochondrial RNAs, and in the specific cleavage of mitochondrial rRNA. The predicted location of the cleavage sites on the mitochondrial ribosome suggests that rRNA destruction is initiated by a specific sequence of events. These findings suggest that L. pneumophila specifically disrupts mitochondrial

  10. RNase MRP is required for entry of 35S precursor rRNA into the canonical processing pathway.

    Science.gov (United States)

    Lindahl, Lasse; Bommankanti, Ananth; Li, Xing; Hayden, Lauren; Jones, Adrienne; Khan, Miriam; Oni, Tolulope; Zengel, Janice M

    2009-07-01

    RNase MRP is a nucleolar RNA-protein enzyme that participates in the processing of rRNA during ribosome biogenesis. Previous experiments suggested that RNase MRP makes a nonessential cleavage in the first internal transcribed spacer. Here we report experiments with new temperature-sensitive RNase MRP mutants in Saccharomyces cerevisiae that show that the abundance of all early intermediates in the processing pathway is severely reduced upon inactivation of RNase MRP. Transcription of rRNA continues unabated as determined by RNA polymerase run-on transcription, but the precursor rRNA transcript does not accumulate, and appears to be unstable. Taken together, these observations suggest that inactivation of RNase MRP blocks cleavage at sites A0, A1, A2, and A3, which in turn, prevents precursor rRNA from entering the canonical processing pathway (35S > 20S + 27S > 18S + 25S + 5.8S rRNA). Nevertheless, at least some cleavage at the processing site in the second internal transcribed spacer takes place to form an unusual 24S intermediate, suggesting that cleavage at C2 is not blocked. Furthermore, the long form of 5.8S rRNA is made in the absence of RNase MRP activity, but only in the presence of Xrn1p (exonuclease 1), an enzyme not required for the canonical pathway. We conclude that RNase MRP is a key enzyme for initiating the canonical processing of precursor rRNA transcripts, but alternative pathway(s) might provide a backup for production of small amounts of rRNA.

  11. Evidence for indigenous Streptomyces populations in a marine environment determined with a 16S rRNA probe.

    OpenAIRE

    Moran, M A; Rutherford, L T; Hodson, R E

    1995-01-01

    A 16S rRNA genus-specific probe was used to determine whether Streptomyces populations are an indigenous component of marine sediment bacterial communities. Previous debates have suggested that marine Streptomyces isolates are derived not from resident populations but from spores of terrestrial species which have been physically transported to marine ecosystems but remain dormant until isolation. Rigorously controlled hybridization of rRNA extracted from coastal marsh sediments with the genus...

  12. Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

    Science.gov (United States)

    Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

    2018-01-01

    Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

  13. A phylogenetic framework for the kingdom Fungi based on 18S rRNA gene sequences.

    Science.gov (United States)

    Yarza, Pablo; Yilmaz, Pelin; Panzer, Katrin; Glöckner, Frank Oliver; Reich, Marlis

    2017-12-01

    The usage of molecular phylogenetic approaches is critical to advance the understanding of systematics and community processes in the kingdom Fungi. Among the possible phylogenetic markers (or combinations of them), the 18S rRNA gene appears currently as the most prominent candidate due to its large availability in public databases and informative content. The purpose of this work was the creation of a reference phylogenetic framework that can serve as ready-to-use package for its application on fungal classification and community analysis. The current database contains 9329 representative 18S rRNA gene sequences covering the whole fungal kingdom, a manually curated alignment, an annotated and revised phylogenetic tree with all the sequence entries, updated information on current taxonomy, and recommendations of use. Out of 201 total fungal taxa with more than two sequences in the dataset, 179 were monophyletic. From another perspective, 66% of the entries had a tree-derived classification identical to that obtained from the NCBI taxonomy, whereas 34% differed in one or the other rank. Most of the differences were associated to missing taxonomic assignments in NCBI taxonomy, or the unexpected position of sequences that positioned out of their theoretically corresponding clades. The strong correlation observed with current fungal taxonomy evidences that 18S rRNA gene sequence-based phylogenies are adequate to reflect genealogy of Fungi at the levels of order and above, and justify their further usage and exploration. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  14. Mutations in 23S rRNA confer resistance against azithromycin in Pseudomonas aeruginosa.

    Science.gov (United States)

    Marvig, Rasmus Lykke; Søndergaard, Mette S R; Damkiær, Søren; Høiby, Niels; Johansen, Helle Krogh; Molin, Søren; Jelsbak, Lars

    2012-08-01

    The emergence of antibiotic-resistant Pseudomonas aeruginosa is an important concern in the treatment of long-term airway infections in cystic fibrosis patients. In this study, we report the occurrence of azithromycin resistance among clinical P. aeruginosa DK2 isolates. We demonstrate that resistance is associated with specific mutations (A2058G, A2059G, and C2611T in Escherichia coli numbering) in domain V of 23S rRNA and that introduction of A2058G and C2611T into strain PAO1 results in azithromycin resistance.

  15. Duration of the first steps of the human rRNA processing

    Czech Academy of Sciences Publication Activity Database

    Popov, A.; Smirnov, E.; Kováčik, L.; Raška, O.; Hagen, G.; Stixová, Lenka; Raška, I.

    2013-01-01

    Roč. 4, č. 2 (2013), s. 134-141 ISSN 1949-1034 R&D Projects: GA ČR(CZ) GBP302/12/G157; GA MŠk(CZ) EE2.3.30.0030 Grant - others:GA ČR(CZ) GAP302/12/1885 Institutional research plan: CEZ:AV0Z50040702 Institutional support: RVO:68081707 Keywords : rRNA processing * cleavage * half-life time Subject RIV: BO - Biophysics Impact factor: 3.148, year: 2013

  16. Mutations in 23S rRNA Confer Resistance against Azithromycin in Pseudomonas aeruginosa

    DEFF Research Database (Denmark)

    Marvig, Rasmus Lykke; Søndergaard, Mette S. R.; Pedersen, Søren Damkiær

    2012-01-01

    The emergence of antibiotic-resistant Pseudomonas aeruginosa is an important concern in the treatment of long-term airway infections in cystic fibrosis patients. In this study, we report the occurrence of azithromycin resistance among clinical P. aeruginosa DK2 isolates. We demonstrate...... that resistance is associated with specific mutations (A2058G, A2059G, and C2611T in Escherichia coli numbering) in domain V of 23S rRNA and that introduction of A2058G and C2611T into strain PAO1 results in azithromycin resistance....

  17. Globicatella sanguinis bacteraemia identified by partial 16S rRNA gene sequencing

    DEFF Research Database (Denmark)

    Abdul-Redha, Rawaa Jalil; Balslew, Ulla; Christensen, Jens Jørgen

    2007-01-01

    Globicatella sanguinis is a gram-positive coccus, resembling non-haemolytic streptococci. The organism has been isolated infrequently from normally sterile sites of humans. Three isolates obtained by blood culture could not be identified by Rapid 32 ID Strep, but partial sequencing of the 16S r......RNA gene revealed the identity of the isolated bacteria, and supplementary biochemical tests confirmed the species identification. The cases histories illustrate the dilemma of finding relevant, newly recognized, opportunistic pathogens and the identification achievement (s) that can be obtained by using...

  18. IDENTIFIKASI BAKTERI PENGOKSIDASI BESI DAN SULFUR BERDASARKAN GEN 16S rRNA DARI LAHAN TAMBANG TIMAH DI BELITUNG

    Directory of Open Access Journals (Sweden)

    Dhewanti Puspitasari

    2014-03-01

    Full Text Available Heavy metals contamination disturb balance and diversity of microorganism in soil. Microorganisms which can able to survive in those conditions are bacteria capable of oxidizing heavy metals. Identification based on 16S rRNA was used to determine characteristics and phylogenetic relationship of bacteria which can oxidize iron and sulphur in tin mining areas. The aim of this research was able to determine the bacterias characteristics isolated from tin mining areas and determine the phylogenetic relation of iron-sulphur oxidizing bacteria on tin mining soil in Belitung based on 16S rRNA sequences. This research was done using descriptive method, including isolation, morphological characterization, and identification based on 16S rRNA sequences. Morphology characterization includes colony and cell morphology through Gram staining. Molecular characterization includes amplification of 16S rRNA gene (Polymerase Chain Reaction/ PCR, electrophoresis amplicon and sequencing. Bacteria identification was done by comparing the 16S rRNA gene sequence in GenBank. The result showed three bacterias were identified by 16S rRNA have a similarity with Bacillus anthracis strain Ames, Bacillus cereus ATCC 14579, Staphylococcus sciuri subsp. Sciuri strains DSM 20345 and Micrococcus luteus NCTC 2665.

  19. Degradation of 16S rRNA and attributes of viability of viable but nonculturable probiotic bacteria.

    Science.gov (United States)

    Lahtinen, S J; Ahokoski, H; Reinikainen, J P; Gueimonde, M; Nurmi, J; Ouwehand, A C; Salminen, S J

    2008-06-01

    To assess the stability of 16S rRNA of viable but nonculturable (VBNC) probiotics during storage when compared with different attributes of viability. Levels of RNA of the probiotic strains Bifidobacterium longum 46, B. longum 2C and B. animalis subsp. lactis Bb-12 were monitored during storage in fermented and nonfermented foods. Cells which gradually lost their culturability in fermented products retained high level of rRNA, whereas rRNA of acid-killed control cells decreased at faster rate. Furthermore, the viability of B. longum 2C was monitored during storage by measuring changes in reductase activity, cytoplasmic membrane integrity and esterase activity using a flow cytometer. All of the culture-independent viability assays suggested that the cells remained viable during storage. In nonfermented media, the observed losses in culturability were smaller, and the changes in cell counts were comparable with the changes in rRNA levels. Viable but nonculturable probiotics maintain high levels of rRNA and retain properties of viable bacteria including reductase activity. Quantification of 16S rRNA complements culture-independent viability assays. Culture-independent viability assays allow the detection of VBNC probiotics, and can be used parallel to conventional culture-dependent methods to obtain accurate information on probiotic viability.

  20. On Mathematical Optimization for the Visualization of Frequencies and Adjacencies as Rectangular Maps

    DEFF Research Database (Denmark)

    Carrizosa, Emilio; Guerrero, Vanesa; Morales, Dolores Romero

    2018-01-01

    In this paper we address the problem of visualizing a frequency distribution and an adjacency relation attached to a set of individuals. We represent this information using a rectangular map, i.e., a subdivision of a rectangle into rectangular portions so that each portion is associated with one...... individuals as adjacent rectangular portions as possible and adding as few false adjacencies, i.e., adjacencies between rectangular portions corresponding to non-adjacent individuals, as possible. We formulate this visualization problem as a Mixed Integer Linear Programming (MILP) model. We propose...

  1. Nucleotide composition bias and codon usage trends of gene ...

    Indian Academy of Sciences (India)

    2015-06-10

    Jun 10, 2015 ... Figure 1. Variations of the nucleotide composition of genes of the two mycoplasma species. (a) M. capricolum subsp. capricolum;. (b) M. agalactiae. Journal of Genetics, Vol. 94, No. 2, June 2015 ..... 2010 Codon usage bias and the evolution of influenza A viruses. Codon usage biases of influenza virus.

  2. Single nucleotide polymorphism genotyping and its application on ...

    African Journals Online (AJOL)

    The nucleotide diversity across a genome is the source of most phenotypic variation. Such DNA polymorphism is the basis for the development of molecular markers, an indispensable tool in genetic mapping studies. In general, the high resolution fine mapping of genes is often limited by lack of sufficient number of ...

  3. Spatiotemporal regulation of Rap guanine nucleotide exchange factors

    NARCIS (Netherlands)

    Consonni, S.V.

    2014-01-01

    Guanine nucleotide exchange factors (GEFs) and GTPase activating proteins (GAPs) orchestrate the activity of small G-proteins. In response to extracellular stimuli, GEFs and GAPs activate signaling cascades regulated by G-proteins by controlling their regulation in time and in space. Generally, GEFs

  4. Review Single nucleotide polymorphism in genome-wide ...

    African Journals Online (AJOL)

    Genome-wide patterns of variation across individuals provide most powerful source of data for uncovering the history of migration, expansion, and adaptation of the human population. The arrival of new technologies that type more than millions of the single nucleotide polymorphisms (SNPs) in a single experiment has ...

  5. Nucleotide variation at the dopa decarboxylase (Ddc) gene in ...

    Indian Academy of Sciences (India)

    We studied nucleotide sequence variation at the gene coding for dopa decarboxylase (Ddc) in seven populations of Drosophila melanogaster. Strength and pattern of linkage disequilibrium are somewhat distinct in the extensively sampled Spanish and Raleigh populations. In the Spanish population, a few sites are in ...

  6. Exogenous Nucleotides Antagonize the Developmental Toxicity of Ethanol In Vitro

    Directory of Open Access Journals (Sweden)

    Jie Zhao

    2013-01-01

    Full Text Available The objective of this study was to assess whether nucleotides supplementation in vitro could suppress ethanol-induced developmental toxicity in mouse. The models of whole embryo culture (WEC and midbrain (MB cell micromass culture were used in this study. In WEC system, exposure to 4.0 mg/mL ethanol for 48 h yielded various developmental malformations of the mice embryos. Nucleotides supplementation (0.16, 0.80, 4.00, 20.00, and 100.00 mg/L improved the growth parameters to some extent, and the protective effects peaked at 4.00 mg/L. In MB cell micromass culture system, exposure to 4.0 mg/mL ethanol for 5 days resulted in suppression of proliferation and differentiation. Supplementation of nucleotides (0.16, 0.80, 4.00, 20.00, and 100.00 mg/L showed some protective effects, which peaked at 4.00 mg/L, too. The present research indicated that nucleotides supplementation might be of some benefit in the prevention of ethanol-induced birth defects; however, appropriate dosage requires attention.

  7. Energy Conversion by Molecular Motors Coupled to Nucleotide Hydrolysis

    Science.gov (United States)

    Lipowsky, Reinhard; Liepelt, Steffen; Valleriani, Angelo

    2009-06-01

    Recent theoretical work on the energy conversion by molecular motors coupled to nucleotide hydrolysis is reviewed. The most abundant nucleotide is provided by adenosine triphosphate (ATP) which is cleaved into adenosine diphosphate (ADP) and inorganic phosphate. The motors have several catalytic domains (or active sites), each of which can be empty or occupied by ATP or ADP. The chemical composition of all catalytic domains defines distinct nucleotide states of the motor which form a discrete state space. Each of these motor states is connected to several other states via chemical transitions. For stepping motors such as kinesin, which walk along cytoskeletal filaments, some motor states are also connected by mechanical transitions, during which the motor is displaced along the filament and able to perform mechanical work. The different motor states together with the possible chemical and mechanical transitions provide a network representation for the chemomechanical coupling of the motor molecule. The stochastic motor dynamics on these networks exhibits several distinct motor cycles, which represent the dominant pathways for different regimes of nucleotide concentrations and load force. For the kinesin motor, the competition of two such cycles determines the stall force, at which the motor velocity vanishes and the motor reverses its direction of motion. In general, kinesin is found to be governed by the competition of three distinct chemomechanical cycles. The corresponding network representation provides a unified description for all motor properties that have been determined by single molecule experiments.

  8. Effects of Dietary Nucleotides on Growth Rate and Disease ...

    African Journals Online (AJOL)

    Effects of dietary nucleotides on growth and disease resistance of crustaceans were evaluated using axenic Artemia culture tests. Higher Artemia growth in xenic culture (15.6 ± 2.9 mm) than in axenic culture (9.2 ± 1.9 mm) reaffirmed the need to eliminate microbial populations known to influence growth and disease ...

  9. Adiponectin Single Nucleotide Polymorphism (+276G/T) and Its ...

    African Journals Online (AJOL)

    The present study was investigating the association between the single nucleotide polymorphism +276 G/T of the adiponectin gene with serum adiponectin level in patients with coronary artery disease (CAD). In this study 100 healthy controls and 100 Egyptian patients with coronary artery disease of both genders ...

  10. Prospects for inferring pairwise relationships with single nucleotide polymorphisms

    Science.gov (United States)

    Jeffery C. Glaubitz; O. Eugene, Jr. Rhodes; J. Andrew DeWoody

    2003-01-01

    An extraordinarily large number of single nucleotide polymorphisms (SNPs) are now available in humans as well as in other model organisms. Technological advancements may soon make it feasible to assay hundreds of SNPs in virtually any organism of interest. One potential application of SNPs is the determination of pairwise genetic relationships in populations without...

  11. Single nucleotide polymorphism in genome-wide association of ...

    African Journals Online (AJOL)

    Mohd Fareed

    2012-09-25

    Sep 25, 2012 ... The arrival of new technologies that type more than millions of the single nucleotide polymor- phisms (SNPs) in .... Rapid advances in technology ...... carriers. Neuron. 2007;54:713–20. [97] Baum AE, Akula N, Cabanero M, et al. A genome-wide association study implicates diacylglycerol kinase eta (DGKH).

  12. Effects of Dietary Nucleotides on Growth Rate and Disease ...

    African Journals Online (AJOL)

    cultured in 800 ml conical cylinders with sufficient aeration as described by Sorgeloos et al., (1986). The cylinders were put in a water bath so as to maintain the temperature at 25oC. The Artemia nauplii were fed with a non-sterile .... demand for nucleotides. At the same time, juveniles have a high rate of growth, which again ...

  13. Nucleotide excision repair I: from E.coli to yeast.

    NARCIS (Netherlands)

    J.H.J. Hoeijmakers (Jan)

    1993-01-01

    textabstractGenetic information is constantly deteriorating, mainly as a consequence of the action of numerous genotoxic agents. In order to cope with this fundamental problem, all living organisms have acquired a complex network of DNA repair systems to safeguard their genetic integrity. Nucleotide

  14. Detection of new single nucleotide polymorphisms by means of real ...

    Indian Academy of Sciences (India)

    Unknown

    Real time polymerase chain reaction (RT-PCR) is a new technique in molecular genetics which allows quantifica- tion of polymorphic DNA regions and genotyping of sin- gle nucleotide polymorphisms (SNPs) in one run. A by- product of real time PCR is the opportunity to identify new SNPs in the proximity of gene loci of ...

  15. Exact correspondence between walk in nucleotide and protein sequence spaces.

    Directory of Open Access Journals (Sweden)

    Dmitry N Ivankov

    Full Text Available In the course of evolution, genes traverse the nucleotide sequence space, which translates to a trajectory of changes in the protein sequence in protein sequence space. The correspondence between regions of the nucleotide and protein sequence spaces is understood in general but not in detail. One of the unexplored questions is how many sequences a protein can reach with a certain number of nucleotide substitutions in its gene sequence. Here I propose an algorithm to calculate the volume of protein sequence space accessible to a given protein sequence as a function of the number of nucleotide substitutions made in the protein-coding sequence. The algorithm utilizes the power of the dynamic programming approach, and makes all calculations within a couple of seconds on a desktop computer. I apply the algorithm to green fluorescence protein, and get the number of sequences four times higher than estimated before. However, taking into account the astronomically huge size of the protein sequence space, the previous estimate can be considered as acceptable as an order of magnitude estimation. The proposed algorithm has practical applications in the study of evolutionary trajectories in sequence space.

  16. Regulatory single nucleotide polymorphisms at the beginning of ...

    Indian Academy of Sciences (India)

    2015-11-28

    Nov 28, 2015 ... SNPs (rs12228277: T>A, rs12226937: G>A, and rs61761074: T>G) located in the same region of human KRAS. We ... and Merkulova TI 2015 Regulatory single nucleotide polymorphisms at the beginning of intron 2 of the human KRAS gene. J. Biosci. .... Membranes were blocked with 5% nonfat dried milk,.

  17. The nucleotide sequences of two leghemoglobin genes from soybean

    DEFF Research Database (Denmark)

    Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O

    1982-01-01

    We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...

  18. Nucleotide composition bias and codon usage trends of gene ...

    Indian Academy of Sciences (India)

    Table 2. Comparative synonymous codon usage patterns of the two mycoplasmas and ovine genomes. Codon (amino acid). Ovine*. M. capricolum .... Supplementary data, J. Genet. 94, 251–260. Table 4. Nucleotide composition statistics for a gene population in the two mycoplasma species. f ′. 1 = 6.75%# f ′. 2 = 5.82% ...

  19. Identification of sixteen single-nucleotide polymorphism markers in ...

    Indian Academy of Sciences (India)

    [Huang X., Wu S., Guan Y., Li Y. and He M. 2014 Development of sixteen single nucleotide polymorphism markers in the pearl oyster,. Pinctada fucata for .... P value. (. ◦. C) product allele and size (bp) frequency. PM5. As1: GCGGGCAGGGCGGCTGTGACTGCAGTGCATTAGGGT. 60. T 207. T. 0.3846 0.4212 0.5843.

  20. Unique nucleotide polymorphism of ankyrin gene cluster in ...

    Indian Academy of Sciences (India)

    Genomics 19, 478–493. Krumlauf R. 1992 Evolution of the vertebrate Hox homeobox genes. BioEssays 14, 245–252. Kuittinen H. and Aguadé M. 2000 Nucleotide variation at the. CHALCONE ISOMERASE locus in Arabidopsis thaliana. Ge- netics 155, 863–872. Lercher M. J., Urrutia A. O. and Hurst L. D. 2002 Clustering of.

  1. Combined LC/radiometric method of free nucleotide determination

    International Nuclear Information System (INIS)

    Mego, V.

    1980-01-01

    The combined chromatographic/radiometric method of determining free nucleotides allows their separation on ion exchanger DOWEX within one shift (i.e., 8 hours). A subsequent or parallel determination of activity of individual fractions increases the accuracy of results and gives a dynamic insight into the utilization of inorganic phosphorus by plants. (author)

  2. Detection of MspI polymorphism and the single nucleotide ...

    African Journals Online (AJOL)

    The aim of this study was to detect the genetic polymorphism of GH gene in five camel breeds reared in Egypt which are Sudany, Somali, Mowaled, Maghrabi and Falahy, using polymerase chain reaction- restriction fragment length polymorphism (PCR-RFLP) technique. Also, this work aimed to identify the single nucleotide ...

  3. Diversity and evolutionary relationship of nucleotide binding site ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR

    Most plant disease-resistance genes (R-genes) isolated so far encode proteins with a nucleotide binding site (NBS) domain and belong to a superfamily. NBS domains related to R-genes show a highly conserved backbone of an amino acid motif, which makes it possible to isolate resistance gene analogues (RGAs) by ...

  4. Single nucleotide polymorphisms in ghrelin gene and the resulting ...

    African Journals Online (AJOL)

    Ghrelin is a growth hormone releasing peptide which also affects feed intake in chickens. Ghrelin is encoded by chicken ghrelin gene (cGHRL) found in chromosome 7. Single nucleotide polymorphisms (SNPs) have been reported in cGHRL in Chinese native chickens, but such studies have not been carried out in chickens ...

  5. Development of a single nucleotide polymorphism (SNP) marker for ...

    African Journals Online (AJOL)

    The nature of the single nucleotide polymorphism (SNP) marker was validated by DNA sequencing of the parental PCR products. Using high resolution melt (HRM) profiles and normalised difference plots, we successfully differentiated the homozygous dominant (wild type), homozygous recessive (LPA) and heterozygous ...

  6. Four new single nucleotide polymorphisms (SNPs) of toll-like ...

    African Journals Online (AJOL)

    In order to reveal the single nucleotide polymorphisms (SNPs), genotypes and allelic frequencies of each mutation site of TLR7 gene in Chinese native duck breeds, SNPs of duck TLR7 gene were detected by DNA sequencing. The genotypes of 465 native ducks from eight key protected duck breeds were determined by ...

  7. Regulatory single nucleotide polymorphisms at the beginning of ...

    Indian Academy of Sciences (India)

    There are two regulatory single nucleotide polymorphisms (rSNPs) at the beginning of the second intron of the mouse - gene that are strongly associated with lung cancer susceptibility. We performed functional analysis of three SNPs (rs12228277: T>A, rs12226937: G>A, and rs61761074: T>G) located in the same ...

  8. The association of single nucleotide polymorphism of interleukin-21 ...

    African Journals Online (AJOL)

    Yasmin Mohamed Ahmed

    2016-05-08

    May 8, 2016 ... duced by activated CD4+ T cells, natural killer T cells and T helper (Th) cells. There is increasing evidence that IL-21 contributes to the pathogenesis of SLE due to its biological activity. Aim of the study: To investigate the association between single nucleotide polymorphism (SNP) of IL-21 rs2221903 gene ...

  9. Single nucleotide polymorphism (SNP) detection on a magnetoresistive sensor

    DEFF Research Database (Denmark)

    Rizzi, Giovanni; Østerberg, Frederik Westergaard; Dufva, Martin

    2013-01-01

    We present a magnetoresistive sensor platform for hybridization assays and demonstrate its applicability on single nucleotide polymorphism (SNP) genotyping. The sensor relies on anisotropic magnetoresistance in a new geometry with a local negative reference and uses the magnetic field from the se...

  10. Complete nucleotide sequence and gene rearrangement of the ...

    Indian Academy of Sciences (India)

    ... Journals; Journal of Genetics; Volume 93; Issue 3. Complete nucleotide sequence and gene rearrangement of the mitochondrial genome of Occidozyga martensii. En Li Xiaoqiang Li Xiaobing Wu Ge Feng Man Zhang Haitao Shi Lijun Wang Jianping Jiang. Research Article Volume 93 Issue 3 December 2014 pp 631-641 ...

  11. Single nucleotide polymorphisms in the 5'-flanking region of the ...

    African Journals Online (AJOL)

    Prolactin (PRL), a polypeptide hormone synthesized and secreted by the animal's anterior pituitary gland, plays an important role in the regulation of mammalian lactation and avian reproduction. Considering the significant association between single nucleotide polymorphisms (SNPs) in the 5'-flanking region of PRL and ...

  12. Nucleotide variation at the methionine synthase locus in an ...

    African Journals Online (AJOL)

    Nucleotide variation at the methionine synthase (MetE) locus within and among populations of an endangered forest tree Fokienia hodginsii in Vietnam was investigated in the present study. A total of 12 populations were sampled across Vietnam. The length of the sequenced locus varied from 1567 to 1559 bp. A total of 42 ...

  13. Synthesis, bioanalysis and pharmacology of nucleoside and nucleotide analogs

    NARCIS (Netherlands)

    Jansen, R.S.

    2009-01-01

    Nucleoside analogs are an important class of drugs in anticancer and antiviral therapy. The compounds are, however, only active after intracellular conversion to their mono-, di- and triphosphate nucleotide form. In this thesis the development of sensitive liquid chromatography coupled to tandem

  14. [Tabular excel editor for analysis of aligned nucleotide sequences].

    Science.gov (United States)

    Demkin, V V

    2010-01-01

    Excel platform was used for transition of results of multiple aligned nucleotide sequences obtained using the BLAST network service to the form appropriate for visual analysis and editing. Two macros operators for MS Excel 2007 were constructed. The array of aligned sequences transformed into Excel table and processed using macros operators is more appropriate for analysis than initial html data.

  15. Peptidyl transferase antibiotics perturb the relative positioning of the 3'-terminal adenosine of P/P'-site-bound tRNA and 23S rRNA in the ribosome

    DEFF Research Database (Denmark)

    Kirillov, S V; Porse, B T; Garrett, R A

    1999-01-01

    A range of antibiotic inhibitors that act within the peptidyl transferase center of the ribosome were examined for their capacity to perturb the relative positioning of the 3' end of P/P'-site-bound tRNA and the Escherichia coli ribosome. The 3'-terminal adenosines of deacylated tRNA and N......' at nucleotides C2601/A2602, U2584/U2585 (F1'), U2506 (F2'), and A2062/C2063 (F4'). Each of these nucleotides lies within the peptidyl transferase loop region of the 23S rRNA. Cross-links were also formed with ribosomal proteins L27 (strong) and L33 (weak), as shown earlier. The antibiotics sparsomycin......, chloramphenicol, the streptogramins pristinamycin IA and IIA, gougerotin, lincomycin, and spiramycin were tested for their capacity to alter the identities or yields of each of the cross-links. Although no new cross-links were detected, each of the drugs produced major changes in cross-linking yields, mainly...

  16. Global regulation of nucleotide biosynthetic genes by c-Myc.

    Directory of Open Access Journals (Sweden)

    Yen-Chun Liu

    2008-07-01

    Full Text Available The c-Myc transcription factor is a master regulator and integrates cell proliferation, cell growth and metabolism through activating thousands of target genes. Our identification of direct c-Myc target genes by chromatin immunoprecipitation (ChIP coupled with pair-end ditag sequencing analysis (ChIP-PET revealed that nucleotide metabolic genes are enriched among c-Myc targets, but the role of Myc in regulating nucleotide metabolic genes has not been comprehensively delineated.Here, we report that the majority of genes in human purine and pyrimidine biosynthesis pathway were induced and directly bound by c-Myc in the P493-6 human Burkitt's lymphoma model cell line. The majority of these genes were also responsive to the ligand-activated Myc-estrogen receptor fusion protein, Myc-ER, in a Myc null rat fibroblast cell line, HO.15 MYC-ER. Furthermore, these targets are also responsive to Myc activation in transgenic mouse livers in vivo. To determine the functional significance of c-Myc regulation of nucleotide metabolism, we sought to determine the effect of loss of function of direct Myc targets inosine monophosphate dehydrogenases (IMPDH1 and IMPDH2 on c-Myc-induced cell growth and proliferation. In this regard, we used a specific IMPDH inhibitor mycophenolic acid (MPA and found that MPA dramatically inhibits c-Myc-induced P493-6 cell proliferation through S-phase arrest and apoptosis.Taken together, these results demonstrate the direct induction of nucleotide metabolic genes by c-Myc in multiple systems. Our finding of an S-phase arrest in cells with diminished IMPDH activity suggests that nucleotide pool balance is essential for c-Myc's orchestration of DNA replication, such that uncoupling of these two processes create DNA replication stress and apoptosis.

  17. Interactions of fluoride and guanine nucleotides with thyroid adenylate cyclase.

    Science.gov (United States)

    Goldhammer, A; Wolff, J

    1982-02-18

    The activation of bovine thyroid adenylate cyclase (ATP pyrophosphate-lyase (cyclizing), EC 4.6.1.1) by Gpp(NH)p has been studied using steady-state kinetic methods. This activation is complex and may be characterized by two Gpp(NH)p binding sites of different affinities with measured constants: Ka1 = 0.1 micro M and Ka2 = 2.9 micro M. GDP beta S does not completely inhibit the Gpp(NH)p activation: analysis of the data is consistent with a single GDP beta S inhibitory site which is competitive with the weaker Gpp(NH)p site. Guanine nucleotide effects upon F- activation of adenylate cyclase have been studied. When App(NH)p is the substrate, 10 micro M GTP along with 10 mM NaF gives higher activity than NaF alone, while GDP together with NaF inhibits the activity by 50% relative to NaF. These features are not observed when the complex is assayed with ATP in the presence of a nucleotide regenerating system or when analogs Gpp)NH)p or GDP beta S are used along with NaF. These effects were studied in three other membrane systems using App(NH)p as substrate: rat liver, rat ovary and turkey erythrocyte. No consistent pattern of guanine nucleotide effects upon fluoride activation could be observed in the different membrane preparations. Previous experiments showed that the size of soluble thyroid adenylate cyclase changed whether membranes were preincubated with Gpp(NH)p or NaF. This size change roughly corresponded to the molecular weight of the nucleotide regulatory protein. This finding, coupled with the present data, suggests that two guanine nucleotide binding sites may be involved in regulating thyroid cyclase and that these sites may be on different protein chains.

  18. Deletion of the nucleotide excision repair gene Ercc1 reduces immunoglobulin class switching and alters mutations near switch recombination junctions.

    Science.gov (United States)

    Schrader, Carol E; Vardo, Joycelyn; Linehan, Erin; Twarog, Michael Z; Niedernhofer, Laura J; Hoeijmakers, Jan H J; Stavnezer, Janet

    2004-08-02

    The structure-specific endonuclease ERCC1-XPF is an essential component of the nucleotide excision DNA repair pathway. ERCC1-XPF nicks double-stranded DNA immediately adjacent to 3' single-strand regions. Substrates include DNA bubbles and flaps. Furthermore, ERCC1 interacts with Msh2, a mismatch repair (MMR) protein involved in class switch recombination (CSR). Therefore, ERCC1-XPF has abilities that might be useful for antibody CSR. We tested whether ERCC1 is involved in CSR and found that Ercc1(-)(/)(-) splenic B cells show moderately reduced CSR in vitro, demonstrating that ERCC1-XPF participates in, but is not required for, CSR. To investigate the role of ERCC1 in CSR, the nucleotide sequences of switch (S) regions were determined. The mutation frequency in germline Smicro segments and recombined Smicro-Sgamma3 segments cloned from Ercc1(-)(/)(-) splenic B cells induced to switch in culture was identical to that of wild-type (WT) littermates. However, Ercc1(-)(/)(-) cells show increased targeting of the mutations to G:C bp in RGYW/WRCY hotspots and mutations occur at sites more distant from the S-S junctions compared with WT mice. The results indicate that ERCC1 is not epistatic with MMR and suggest that ERCC1 might be involved in processing or repair of DNA lesions in S regions during CSR.

  19. Accuracy of taxonomy prediction for 16S rRNA and fungal ITS sequences

    Directory of Open Access Journals (Sweden)

    Robert C. Edgar

    2018-04-01

    Full Text Available Prediction of taxonomy for marker gene sequences such as 16S ribosomal RNA (rRNA is a fundamental task in microbiology. Most experimentally observed sequences are diverged from reference sequences of authoritatively named organisms, creating a challenge for prediction methods. I assessed the accuracy of several algorithms using cross-validation by identity, a new benchmark strategy which explicitly models the variation in distances between query sequences and the closest entry in a reference database. When the accuracy of genus predictions was averaged over a representative range of identities with the reference database (100%, 99%, 97%, 95% and 90%, all tested methods had ≤50% accuracy on the currently-popular V4 region of 16S rRNA. Accuracy was found to fall rapidly with identity; for example, better methods were found to have V4 genus prediction accuracy of ∼100% at 100% identity but ∼50% at 97% identity. The relationship between identity and taxonomy was quantified as the probability that a rank is the lowest shared by a pair of sequences with a given pair-wise identity. With the V4 region, 95% identity was found to be a twilight zone where taxonomy is highly ambiguous because the probabilities that the lowest shared rank between pairs of sequences is genus, family, order or class are approximately equal.

  20. Comparison of two approaches for the classification of 16S rRNA gene sequences.

    Science.gov (United States)

    Chatellier, Sonia; Mugnier, Nathalie; Allard, Françoise; Bonnaud, Bertrand; Collin, Valérie; van Belkum, Alex; Veyrieras, Jean-Baptiste; Emler, Stefan

    2014-10-01

    The use of 16S rRNA gene sequences for microbial identification in clinical microbiology is accepted widely, and requires databases and algorithms. We compared a new research database containing curated 16S rRNA gene sequences in combination with the lca (lowest common ancestor) algorithm (RDB-LCA) to a commercially available 16S rDNA Centroid approach. We used 1025 bacterial isolates characterized by biochemistry, matrix-assisted laser desorption/ionization time-of-flight MS and 16S rDNA sequencing. Nearly 80 % of isolates were identified unambiguously at the species level by both classification platforms used. The remaining isolates were mostly identified correctly at the genus level due to the limited resolution of 16S rDNA sequencing. Discrepancies between both 16S rDNA platforms were due to differences in database content and the algorithm used, and could amount to up to 10.5 %. Up to 1.4 % of the analyses were found to be inconclusive. It is important to realize that despite the overall good performance of the pipelines for analysis, some inconclusive results remain that require additional in-depth analysis performed using supplementary methods. © 2014 The Authors.

  1. Combining 16S rRNA gene variable regions enables high-resolution microbial community profiling.

    Science.gov (United States)

    Fuks, Garold; Elgart, Michael; Amir, Amnon; Zeisel, Amit; Turnbaugh, Peter J; Soen, Yoav; Shental, Noam

    2018-01-26

    Most of our knowledge about the remarkable microbial diversity on Earth comes from sequencing the 16S rRNA gene. The use of next-generation sequencing methods has increased sample number and sequencing depth, but the read length of the most widely used sequencing platforms today is quite short, requiring the researcher to choose a subset of the gene to sequence (typically 16-33% of the total length). Thus, many bacteria may share the same amplified region, and the resolution of profiling is inherently limited. Platforms that offer ultra-long read lengths, whole genome shotgun sequencing approaches, and computational frameworks formerly suggested by us and by others all allow different ways to circumvent this problem yet suffer various shortcomings. There is a need for a simple and low-cost 16S rRNA gene-based profiling approach that harnesses the short read length to provide a much larger coverage of the gene to allow for high resolution, even in harsh conditions of low bacterial biomass and fragmented DNA. This manuscript suggests Short MUltiple Regions Framework (SMURF), a method to combine sequencing results from different PCR-amplified regions to provide one coherent profiling. The de facto amplicon length is the total length of all amplified regions, thus providing much higher resolution compared to current techniques. Computationally, the method solves a convex optimization problem that allows extremely fast reconstruction and requires only moderate memory. We demonstrate the increase in resolution by in silico simulations and by profiling two mock mixtures and real-world biological samples. Reanalyzing a mock mixture from the Human Microbiome Project achieved about twofold improvement in resolution when combing two independent regions. Using a custom set of six primer pairs spanning about 1200 bp (80%) of the 16S rRNA gene, we were able to achieve ~ 100-fold improvement in resolution compared to a single region, over a mock mixture of common human gut

  2. Age and pro-inflammatory gene polymorphisms influence adjacent segment disc degeneration more than fusion does in patients treated for chronic low back pain.

    Science.gov (United States)

    Omair, Ahmad; Mannion, Anne F; Holden, Marit; Leivseth, Gunnar; Fairbank, Jeremy; Hägg, Olle; Fritzell, Peter; Brox, Jens I

    2016-01-01

    Does lumbar fusion lead to accelerated adjacent segment disc degeneration (ASDD) or is it explained by genetics and aging? The influence of genetics on ASDD remains to be explored. This study assesses whether the disc space height adjacent to a fused segment is associated with candidate gene single nucleotide polymorphisms (SNPs). Patients with low back pain from four RCTs (N = 208 fusion; 77 non-operative treatment) underwent standing plain radiography and genetic analyses at 13 ± 4 years follow-up. Disc space height was measured using a validated computer-assisted distortion-compensated roentgen analysis technique and reported in standard deviations from normal values. Genetic association analyses included 34 SNPs in 25 structural, inflammatory, matrix degrading, apoptotic, vitamin D receptor and OA-related genes relevant to disc degeneration. These were analysed for their association with disc space height (after adjusting for age, gender, smoking, duration of follow-up and treatment group) first, separately, and then together in a stepwise multivariable model. Two SNPs from the IL18RAP gene (rs1420106 and rs917997) were each associated with a lower disc space height at the adjacent level (B = -0.34, p = 0.04 and B = -0.35, p = 0.04, respectively) and the MMP-9 gene SNP rs20544 was associated with a greater disc space height (B = 0.35, p = 0.04). Age (p fusion (p fusion. In the multivariable regression analysis (with nine SNPs selected for entry, along with the covariates) the total explained variance in disc space height was 23 %, with the nine SNPs, age and fusion accounting for 45, 45 and 7 % of this, respectively. Age was the most significant determinant of adjacent segment disc space height followed by genetic factors, specifically inflammatory genes. Fusion explained a statistically significant but small proportion of the total variance. Much of the variance remained to be explained.

  3. Evidence for indigenous Streptomyces populations in a marine environment determined with a 16S rRNA probe.

    Science.gov (United States)

    Moran, M A; Rutherford, L T; Hodson, R E

    1995-10-01

    A 16S rRNA genus-specific probe was used to determine whether Streptomyces populations are an indigenous component of marine sediment bacterial communities. Previous debates have suggested that marine Streptomyces isolates are derived not from resident populations but from spores of terrestrial species which have been physically transported to marine ecosystems but remain dormant until isolation. Rigorously controlled hybridization of rRNA extracted from coastal marsh sediments with the genus-specific probe indicated that Streptomyces rRNA accounted for 2 to 5% of the sediment community rRNA and that spores are not the source of the hybridization signal. Streptomyces populations must therefore be at least the 26th most abundant genus-level source of bacterial rRNA. the relative amounts of rRNAs from Streptomyces spp. and members of the Bacteria (69 to 79%) and Archaea (4 to 7%) domains were highly consistent in these marine sediments throughout an annual cycle, indicating that the species composition of sediment bacterial communities may be more stable than recent studies suggest for marine planktonic bacterial communities. Laboratory studies designed to investigate the possible functional roles of Streptomyces populations in coastal sediments demonstrated that population levels of this genus changed relatively rapidly (within a time frame of 6 weeks) in response to manipulation of substrate availability. Amendments of intact sediment cores with two compounds (vanillic acid and succinic acid) consistently resulted in Streptomyces populations contributing an increased percentage of rRNA (6 to 15%) to the total bacterial rRNA pool.

  4. Modern sedimentary processes along the Doce river adjacent continental shelf

    Directory of Open Access Journals (Sweden)

    Valéria da Silva Quaresma

    Full Text Available In areas of the continental shelf where sediment supply is greater than the sediment dispersion capacity, an extensive terrigenous deposits and consequently submerged deltas can be formed. The Eastern Brazilian shelf is characterized by the occurrence of river feed deltas in between starving coasts. Herein, modern sedimentary processes acting along the Doce river adjacent continental shelf are investigated. The main objective was to understand the shelf sediment distribution, recognizing distinct sedimentary patterns and the major influence of river sediment discharge in the formation of shelf deposits. The study used 98 surficial samples that were analyzed for grain size, composition and bulk density. Results revealed 3 distinct sectors: south - dominated by mud fraction with a recent deposition from riverine input until 30 m deep and from this depth bioclastic sands dominate; central north - sand mud dominated, been recognized as a bypass zone of resuspended sediment during high energy events; and north - relict sands with high carbonate content. The modern sedimentation processes along the Doce river continental shelf is dominated by distinct sedimentary regimes, showing a strong fluvial influence associated with wave/wind induced sediment dispersion and a carbonate regime along the outer shelf. These regimes seem to be controlled by the distance from the river mouth and bathymetric gradients.

  5. Mechanical interactions between adjacent airways in the lung.

    Science.gov (United States)

    Ma, Baoshun; Bates, Jason H T

    2014-03-15

    The forces of mechanical interdependence between the airways and the parenchyma in the lung are powerful modulators of airways responsiveness. Little is known, however, about the extent to which adjacent airways affect each other's ability to narrow due to distortional forces generated within the intervening parenchyma. We developed a two-dimensional computational model of two airways embedded in parenchyma. The parenchyma itself was modeled in three ways: 1) as a network of hexagonally arranged springs, 2) as a network of triangularly arranged springs, and 3) as an elastic continuum. In all cases, we determined how the narrowing of one airway was affected when the other airway was relaxed vs. when it narrowed to the same extent as the first airway. For the continuum and triangular network models, interactions between airways were negligible unless the airways lay within about two relaxed diameters of each other, but even at this distance the interactions were small. By contrast, the hexagonal spring network model predicted that airway-airway interactions mediated by the parenchyma can be substantial for any degree of airway separation at intermediate values of airway contraction forces. Evidence to date suggests that the parenchyma may be better represented by the continuum model, which suggests that the parenchyma does not mediate significant interactions between narrowing airways.

  6. Cryogun cryotherapy for oral leukoplakia and adjacent melanosis lesions.

    Science.gov (United States)

    Chen, Hsin-Ming; Cheng, Shih-Jung; Lin, Hung-Pin; Yu, Chuan-Hang; Wu, Yang-Che; Chiang, Chun-Pin

    2015-09-01

    Our previous study has shown that cryogun cryotherapy is a good and effective treatment modality for oral leukoplakia. In this study, we used cryogun cryotherapy to treat 72 oral leukoplakia and adjacent smoking-induced melanosis (OLM) lesions on the buccal mucosae. Of 72 OLM lesions, 14 had epithelial hyperplasia with parakeratosis, 24 had epithelial hyperplasia with hyperkeratosis, 26 had mild dysplasia, seven had moderate dysplasia, and one had severe dysplasia. Complete regression was achieved in all 72 OLM lesions after a mean of 3.3 ± 1.3 cryogun cryotherapy treatments. We found that OLM lesions in patients without smoking habit, with the greatest diameter cryotherapy treatment to achieve complete regression than those OLM lesions in patients with smoking habit, with the greatest diameter ≥ 2.8 cm, without epithelial dysplasia, or with a surface keratin thickness > 50 μm (all P-values cryotherapy treatment number (all P-values cryotherapy treatment required to achieve complete regression of the OLM lesion by multivariate logistic regression analyses. Cryogun cryotherapy is an effective treatment modality for OLM lesions. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  7. Repeated adjacent-segment degeneration after posterior lumbar interbody fusion.

    Science.gov (United States)

    Okuda, Shinya; Oda, Takenori; Yamasaki, Ryoji; Maeno, Takafumi; Iwasaki, Motoki

    2014-05-01

    One of the most important sequelae affecting long-term results is adjacent-segment degeneration (ASD) after posterior lumbar interbody fusion (PLIF). Although several reports have described the incidence rate, there have been no reports of repeated ASD. The purpose of this report was to describe 1 case of repeated ASD after PLIF. A 62-year-old woman with L-4 degenerative spondylolisthesis underwent PLIF at L4-5. At the second operation, L3-4 PLIF was performed for L-3 degenerative spondylolisthesis 6 years after the primary operation. At the third operation, L2-3 PLIF was performed for L-2 degenerative spondylolisthesis 1.5 years after the primary operation. Vertebral collapse of L-1 was detected 1 year after the third operation, and the collapse had progressed. At the fourth operation, 3 years after the third operation, vertebral column resection of L-1 and replacement of titanium mesh cages with pedicle screw fixation between T-4 and L-5 was performed. Although the patient's symptoms resolved after each operation, the time between surgeries shortened. The sacral slope decreased gradually although each PLIF achieved local lordosis at the fused segment.

  8. Flow and edge scour in current adjacent to stone covers

    DEFF Research Database (Denmark)

    Petersen, Thor U.; Sumer, B. Mutlu; Bøgelund, Jon

    2015-01-01

    This paper presents the results of an experimental investigation on edge scour adjacent to a stone cover laid on a sandy bed. The three-dimensional flow over the edge of the stone layer has been investigated by the use of particle image velocimetry. The flow measurements show a significant amount...... of turbulence in the primary flow near the junction between the stone layer and the sand bed and the formation of complex secondary-flow structures. The results show that the flow and the edge scour process in a steady current are governed by the size of the roughness elements and to some extent the side slope...... of the berm. The edge scour is caused by the combined action of the primary flow and the secondary flow. The primary flow stirs up the sediment and puts it into suspension, and the secondary flow carries it away from the junction between the stone layer and the sand bed, resulting in a scour hole forming...

  9. A deterministic seismic hazard map of India and adjacent areas

    International Nuclear Information System (INIS)

    Parvez, Imtiyaz A.; Vaccari, Franco; Panza, Giuliano

    2001-09-01

    A seismic hazard map of the territory of India and adjacent areas has been prepared using a deterministic approach based on the computation of synthetic seismograms complete of all main phases. The input data set consists of structural models, seismogenic zones, focal mechanisms and earthquake catalogue. The synthetic seismograms have been generated by the modal summation technique. The seismic hazard, expressed in terms of maximum displacement (DMAX), maximum velocity (VMAX), and design ground acceleration (DGA), has been extracted from the synthetic signals and mapped on a regular grid of 0.2 deg. x 0.2 deg. over the studied territory. The estimated values of the peak ground acceleration are compared with the observed data available for the Himalayan region and found in good agreement. Many parts of the Himalayan region have the DGA values exceeding 0.6 g. The epicentral areas of the great Assam earthquakes of 1897 and 1950 represent the maximum hazard with DGA values reaching 1.2-1.3 g. (author)

  10. Review of vibration effect during piling installation to adjacent structure

    Science.gov (United States)

    Rahman, Nurul Aishah Abd; Musir, Adhilla Ainun; Dahalan, Nurol Huda; Ghani, Abdul Naser Abdul; Khalil, Muhamad Kasimi Abd

    2017-12-01

    Basically, many major structures across the world such as towers, high rise building, houses and bridges utilize pile as a support material. The use of pile is important to strengthen the structures. However, this has led to another problem to the nearest surrounding structures resulted from pile driving. As part of a construction work, unavoidable pile driving activity generates a vibration towards the surrounding structures if uncontrolled may cause damage to the adjacent structure. As the current construction works are frequently located in urban areas where the distance between the nearest building structures is not far, vibration may cause damage to nearby structures. Knowing which part of the building that is mostly affected by various vibration patterns from the impact of pile driving is crucial. Thus, it is very important to predict the impact of vibration during piling installation work. This paper reviews the vibrations generated by piling activity toward surrounding structures in terms sources of vibration, impact of piling installation, pile-soil interaction, and factors affecting the vibration impact of building as well as to study the parameters involved in vibration generation during piling works.

  11. Characterization of adjacent breast tumors using oligonucleotide microarrays

    International Nuclear Information System (INIS)

    Unger, Meredith A; Rishi, Mazhar; Clemmer, Virginia B; Hartman, Jennifer L; Keiper, Elizabeth A; Greshock, Joel D; Chodosh, Lewis A; Liebman, Michael N; Weber, Barbara L

    2001-01-01

    Current methodology often cannot distinguish second primary breast cancers from multifocal disease, a potentially important distinction for clinical management. In the present study we evaluated the use of oligonucleotide-based microarray analysis in determining the clonality of tumors by comparing gene expression profiles. Total RNA was extracted from two tumors with no apparent physical connection that were located in the right breast of an 87-year-old woman diagnosed with invasive ductal carcinoma (IDC). The RNA was hybridized to the Affymetrix Human Genome U95A Gene Chip ® (12,500 known human genes) and analyzed using the Gene Chip Analysis Suite ® 3.3 (Affymetrix, Inc, Santa Clara, CA, USA) and JMPIN ® 3.2.6 (SAS Institute, Inc, Cary, NC, USA). Gene expression profiles of tumors from five additional patients were compared in order to evaluate the heterogeneity in gene expression between tumors with similar clinical characteristics. The adjacent breast tumors had a pairwise correlation coefficient of 0.987, and were essentially indistinguishable by microarray analysis. Analysis of gene expression profiles from different individuals, however, generated a pairwise correlation coefficient of 0.710. Transcriptional profiling may be a useful diagnostic tool for determining tumor clonality and heterogeneity, and may ultimately impact on therapeutic decision making

  12. A systematic review of definitions and classification systems of adjacent segment pathology.

    Science.gov (United States)

    Kraemer, Paul; Fehlings, Michael G; Hashimoto, Robin; Lee, Michael J; Anderson, Paul A; Chapman, Jens R; Raich, Annie; Norvell, Daniel C

    2012-10-15

    Systematic review. To undertake a systematic review to determine how "adjacent segment degeneration," "adjacent segment disease," or clinical pathological processes that serve as surrogates for adjacent segment pathology are classified and defined in the peer-reviewed literature. Adjacent segment degeneration and adjacent segment disease are terms referring to degenerative changes known to occur after reconstructive spine surgery, most commonly at an immediately adjacent functional spinal unit. These can include disc degeneration, instability, spinal stenosis, facet degeneration, and deformity. The true incidence and clinical impact of degenerative changes at the adjacent segment is unclear because there is lack of a universally accepted classification system that rigorously addresses clinical and radiological issues. A systematic review of the English language literature was undertaken and articles were classified using the Grades of Recommendation Assessment, Development, and Evaluation criteria. RESULTS.: Seven classification systems of spinal degeneration, including degeneration at the adjacent segment, were identified. None have been evaluated for reliability or validity specific to patients with degeneration at the adjacent segment. The ways in which terms related to adjacent segment "degeneration" or "disease" are defined in the peer-reviewed literature are highly variable. On the basis of the systematic review presented in this article, no formal classification system for either cervical or thoracolumbar adjacent segment disorders currently exists. No recommendations regarding the use of current classification of degeneration at any segments can be made based on the available literature. A new comprehensive definition for adjacent segment pathology (ASP, the now preferred terminology) has been proposed in this Focus Issue, which reflects the diverse pathology observed at functional spinal units adjacent to previous spinal reconstruction and balances

  13. Analysis of the phylogenetic relationships of strains of Burkholderia solanacearum, Pseudomonas syzygii, and the blood disease bacterium of banana based on 16S rRNA gene sequences.

    Science.gov (United States)

    Taghavi, M; Hayward, C; Sly, L I; Fegan, M

    1996-01-01

    We determined nearly complete 16S rRNA gene sequences for 19 isolates of Burkholderia solanacearum, three isolates of the blood disease bacterium of bananas, and two isolates of Pseudomonas syzygii, the cause of Sumatra disease of cloves. The dendrogram produced by comparing all of these sequences revealed that there were two divisions, which corresponded to the results obtained previously in a restriction fragment length polymorphism analysis (D. Cook, E. Barlow, and L. Sequeira, Mol. Plant Microbe Interact. 2:113-121, 1989) and a total 16S ribosomal DNA (rDNA) sequence analysis of four isolates representing four biovars of B. solanacearum (X. Li, M. Dorsch, T. Del Dot, L. I. Sly, E. Stackebrandt, and A. C. Hayward, J. Appl. Bacteriol. 74:324-329, 1993). Division 1 comprised biovars 3, 4, and 5 and an aberrant biovar 2 isolate (strain ACH0732), and division 2 included biovars 1, 2, and N2, the blood disease bacterium, and P. syzygii. Specific nucleotides at positions 458 to 460 (UUC) and 474 (A) characterized division 2, whereas in division 1 the nucleotides at these positions were ACU and U, respectively. However, strain ACH0732 had a U at position 458, as did division 2 isolates, and G instead of U at position 474. Division 2 consisted of two subdivisions; one subdivision contained two B. solanacearum isolates that originated from Indonesia, P. syzygii strains, and blood disease bacterium strains, and the other subdivision contained all of the other division 2 isolates. Within division 1, the level of 16S rDNA sequence similarity ranged from 99.8 to 100%, and within division 2, the levels of 16S rDNA sequence similarity ranged from 99.1 to 100%. The division 1 isolates exhibited an average level of 16S rDNA sequence similarity to division 2 isolates of 99.3% (range, 99.1 to 99.5%). The occurrence of consistent polymorphisms in the 16S rDNA sequences of B. solanacearum strains, in particular unique 16S rDNA sequence differences in aberrant biovar 2 isolate ACH

  14. Content discovery and retrieval services at the European Nucleotide Archive.

    Science.gov (United States)

    Silvester, Nicole; Alako, Blaise; Amid, Clara; Cerdeño-Tárraga, Ana; Cleland, Iain; Gibson, Richard; Goodgame, Neil; Ten Hoopen, Petra; Kay, Simon; Leinonen, Rasko; Li, Weizhong; Liu, Xin; Lopez, Rodrigo; Pakseresht, Nima; Pallreddy, Swapna; Plaister, Sheila; Radhakrishnan, Rajesh; Rossello, Marc; Senf, Alexander; Smirnov, Dmitriy; Toribio, Ana Luisa; Vaughan, Daniel; Zalunin, Vadim; Cochrane, Guy

    2015-01-01

    The European Nucleotide Archive (ENA; http://www.ebi.ac.uk/ena) is Europe's primary resource for nucleotide sequence information. With the growing volume and diversity of public sequencing data comes the need for increased sophistication in data organisation, presentation and search services so as to maximise its discoverability and usability. In response to this, ENA has been introducing and improving checklists for use during submission and expanding its search facilities to provide targeted search results. Here, we give a brief update on ENA content and some major developments undertaken in data submission services during 2014. We then describe in more detail the services we offer for data discovery and retrieval. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. Genome-wide patterns of nucleotide polymorphism in domesticated rice

    DEFF Research Database (Denmark)

    Caicedo, Ana L; Williamson, Scott H; Hernandez, Ryan D

    2007-01-01

    Domesticated Asian rice (Oryza sativa) is one of the oldest domesticated crop species in the world, having fed more people than any other plant in human history. We report the patterns of DNA sequence variation in rice and its wild ancestor, O. rufipogon, across 111 randomly chosen gene fragments......, and use these to infer the evolutionary dynamics that led to the origins of rice. There is a genome-wide excess of high-frequency derived single nucleotide polymorphisms (SNPs) in O. sativa varieties, a pattern that has not been reported for other crop species. We developed several alternative models...... the dominant demographic model for domesticated species, cannot explain the derived nucleotide polymorphism site frequency spectrum in rice. Instead, a bottleneck model that incorporates selective sweeps, or a more complex demographic model that includes subdivision and gene flow, are more plausible...

  16. Identification of cyclic nucleotide gated channels using regular expressions

    KAUST Repository

    Zelman, Alice K.

    2013-09-03

    Cyclic nucleotide-gated channels (CNGCs) are nonselective cation channels found in plants, animals, and some bacteria. They have a six-transmembrane/one- pore structure, a cytosolic cyclic nucleotide-binding domain, and a cytosolic calmodulin-binding domain. Despite their functional similarities, the plant CNGC family members appear to have different conserved amino acid motifs within corresponding functional domains than animal and bacterial CNGCs do. Here we describe the development and application of methods employing plant CNGC-specific sequence motifs as diagnostic tools to identify novel candidate channels in different plants. These methods are used to evaluate the validity of annotations of putative orthologs of CNGCs from plant genomes. The methods detail how to employ regular expressions of conserved amino acids in functional domains of annotated CNGCs and together with Web tools such as PHI-BLAST and ScanProsite to identify novel candidate CNGCs in species including Physcomitrella patens. © Springer Science+Business Media New York 2013.

  17. Genetic variations in the internal transcribed spacer and mitochondrial small subunit rRNA gene of Naegleria spp.

    Science.gov (United States)

    Zhou, Ling; Sriram, Rama; Visvesvara, Govinda S; Xiao, Lihua

    2003-01-01

    Naegleria spp. are widely distributed free-living amebas, but one species in the genus, N. fowleri, causes acute fulminant primary amebic meningoencephalitis in humans and other animals. Thus, it is important to differentiate N. fowleri from the rest in the genus of Naegleria, and to develop tools for the detection of intra-specific genetic variations. In this study, one isolate each of N. australiensis, N. gruberi, N. jadini, and N. lovaniensis and 22 isolates of N. fowleri were characterized at the internal transcribed spacers (ITS) and mitochondrial small subunit rRNA (mtSSU rRNA) gene. The mtSSU rRNA primers designed amplified DNA of all isolates, with distinct sequences obtained from all species examined. In contrast, the ITS primers only amplified DNA from N. lovaniensis and N. fowleri, with minor sequence differences between the two. Three genotypes of N. fowleri were found among the isolates analyzed in both the mtSSU rRNA gene and ITS. The extent of sequence variation was greater in the mtSSU rRNA gene, but the ITS had the advantage of length polymorphism. These data should be useful in the development of molecular tools for rapid species differentiation and genotyping of Naegleria spp.

  18. Statistical properties of nucleotides in human chromosomes 21 and 22

    International Nuclear Information System (INIS)

    Zhang Linxi; Sun Tingting

    2005-01-01

    In this paper the statistical properties of nucleotides in human chromosomes 21 and 22 are investigated. The n-tuple Zipf analysis with n = 3, 4, 5, 6, and 7 is used in our investigation. It is found that the most common n-tuples are those which consist only of adenine (A) and thymine (T), and the rarest n-tuples are those in which GC or CG pattern appears twice. With the n-tuples become more and more frequent, the double GC or CG pattern becomes a single GC or CG pattern. The percentage of four nucleotides in the rarest ten and the most common ten n-tuples are also considered in human chromosomes 21 and 22, and different behaviors are found in the percentage of four nucleotides. Frequency of appearance of n-tuple f(r) as a function of rank r is also examined. We find the n-tuple Zipf plot shows a power-law behavior for r n-1 and a rapid decrease for r > 4 n-1 . In order to explore the interior statistical properties of human chromosomes 21 and 22 in detail, we divide the chromosome sequence into some moving windows and we discuss the percentage of ξη (ξ, η = A, C, G, T) pair in those moving windows. In some particular regions, there are some obvious changes in the percentage of ξη pair, and there maybe exist functional differences. The normalized number of repeats N 0 (l) can be described by a power law: N 0 (l) ∼ l -μ . The distance distributions P 0 (S) between two nucleotides in human chromosomes 21 and 22 are also discussed. A two-order polynomial fit exists in those distance distributions: log P 0 (S) = a + bS + cS 2 , and it is quite different from the random sequence

  19. Mitochondria as determinant of nucleotide pools and chromosomal stability

    DEFF Research Database (Denmark)

    Madsen, Claus Desler; Munch-Petersen, Birgitte; Stevnsner, Tinna

    2007-01-01

    Mitochondrial function plays an important role in multiple human diseases and mutations in the mitochondrial genome have been detected in nearly every type of cancer investigated to date. However, the mechanism underlying the interrelation is unknown. We used human cell lines depleted of mitochon...... mitochondrial activity. Our results suggest that mitochondria are central players in maintaining genomic stability and in controlling essential nuclear processes such as upholding a balanced supply of nucleotides....

  20. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    Energy Technology Data Exchange (ETDEWEB)

    Lo, A.; Yang, H.L.

    1990-02-13

    This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.

  1. Detailed analysis of RNA-protein interactions within the ribosomal protein S8-rRNA complex from the archaeon Methanococcus jannaschii.

    Science.gov (United States)

    Tishchenko, S; Nikulin, A; Fomenkova, N; Nevskaya, N; Nikonov, O; Dumas, P; Moine, H; Ehresmann, B; Ehresmann, C; Piendl, W; Lamzin, V; Garber, M; Nikonov, S

    2001-08-10

    The crystal structure of ribosomal protein S8 bound to its target 16 S rRNA from a hyperthermophilic archaeon Methanococcus jannaschii has been determined at 2.6 A resolution. The protein interacts with the minor groove of helix H21 at two sites located one helical turn apart, with S8 forming a bridge over the RNA major groove. The specificity of binding is essentially provided by the C-terminal domain of S8 and the highly conserved nucleotide core, characterized by two dinucleotide platforms, facing each other. The first platform (A595-A596), which is the less phylogenetically and structurally constrained, does not directly contact the protein but has an important shaping role in inducing cross-strand stacking interactions. The second platform (U641-A642) is specifically recognized by the protein. The universally conserved A642 plays a pivotal role by ensuring the cohesion of the complex organization of the core through an array of hydrogen bonds, including the G597-C643-U641 base triple. In addition, A642 provides the unique base-specific interaction with the conserved Ser105, while the Thr106 - Thr107 peptide link is stacked on its purine ring. Noteworthy, the specific recognition of this tripeptide (Thr-Ser-Thr/Ser) is parallel to the recognition of an RNA tetraloop by a dinucleotide platform in the P4-P6 ribozyme domain of group I intron. This suggests a general dual role of dinucleotide platforms in recognition of RNA or peptide motifs. One prominent feature is that conserved side-chain amino acids, as well as conserved bases, are essentially involved in maintaining tertiary folds. The specificity of binding is mainly driven by shape complementarity, which is increased by the hydrophobic part of side-chains. The remarkable similarity of this complex with its homologue in the T. thermophilus 30 S subunit indicates a conserved interaction mode between Archaea and Bacteria. Copyright 2001 Academic Press.

  2. Nucleotide effects on the structure and dynamics of actin.

    Science.gov (United States)

    Zheng, Xiange; Diraviyam, Karthikeyan; Sept, David

    2007-08-15

    Adenosine 5'-triphosphate or ATP is the primary energy source within the cell, releasing its energy via hydrolysis into adenosine 5'-diphosphate or ADP. Actin is an important ATPase involved in many aspects of cellular function, and the binding and hydrolysis of ATP regulates its polymerization into actin filaments as well as its interaction with a host of actin-associated proteins. Here we study the dynamics of monomeric actin in ATP, ADP-Pi, and ADP states via molecular dynamics simulations. As observed in some crystal structures we see that the DNase-I loop is an alpha-helix in the ADP state but forms an unstructured coil domain in the ADP-Pi and ATP states. We also find that this secondary structure change is reversible, and by mimicking nucleotide exchange we can observe the transition between the helical and coil states. Apart from the DNase-I loop, we also see several key structural differences in the nucleotide binding cleft as well as in the hydrophobic cleft between subdomains 1 and 3 where WH2-containing proteins have been shown to interact. These differences provide a structural basis for understanding the observed differences between the various nucleotide states of actin and provide some insight into how ATP regulates the interaction of actin with itself and other proteins.

  3. Nucleotide Sequencing and Identification of Some Wild Mushrooms

    Directory of Open Access Journals (Sweden)

    Sudip Kumar Das

    2013-01-01

    Full Text Available The rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers fragment of the genomic DNA of 8 wild edible mushrooms (collected from Eastern Chota Nagpur Plateau of West Bengal, India was amplified using ITS1 (Internal Transcribed Spacers 1 and ITS2 primers and subjected to nucleotide sequence determination for identification of mushrooms as mentioned. The sequences were aligned using ClustalW software program. The aligned sequences revealed identity (homology percentage from GenBank data base of Amanita hemibapha [CN (Chota Nagpur 1, % identity 99 (JX844716.1], Amanita sp. [CN 2, % identity 98 (JX844763.1], Astraeus hygrometricus [CN 3, % identity 87 (FJ536664.1], Termitomyces sp. [CN 4, % identity 90 (JF746992.1], Termitomyces sp. [CN 5, % identity 99 (GU001667.1], T. microcarpus [CN 6, % identity 82 (EF421077.1], Termitomyces sp. [CN 7, % identity 76 (JF746993.1], and Volvariella volvacea [CN 8, % identity 100 (JN086680.1]. Although out of 8 mushrooms 4 could be identified up to species level, the nucleotide sequences of the rest may be relevant to further characterization. A phylogenetic tree is constructed using Neighbor-Joining method showing interrelationship between/among the mushrooms. The determined nucleotide sequences of the mushrooms may provide additional information enriching GenBank database aiding to molecular taxonomy and facilitating its domestication and characterization for human benefits.

  4. Nucleotide sequencing and identification of some wild mushrooms.

    Science.gov (United States)

    Das, Sudip Kumar; Mandal, Aninda; Datta, Animesh K; Gupta, Sudha; Paul, Rita; Saha, Aditi; Sengupta, Sonali; Dubey, Priyanka Kumari

    2013-01-01

    The rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) fragment of the genomic DNA of 8 wild edible mushrooms (collected from Eastern Chota Nagpur Plateau of West Bengal, India) was amplified using ITS1 (Internal Transcribed Spacers 1) and ITS2 primers and subjected to nucleotide sequence determination for identification of mushrooms as mentioned. The sequences were aligned using ClustalW software program. The aligned sequences revealed identity (homology percentage from GenBank data base) of Amanita hemibapha [CN (Chota Nagpur) 1, % identity 99 (JX844716.1)], Amanita sp. [CN 2, % identity 98 (JX844763.1)], Astraeus hygrometricus [CN 3, % identity 87 (FJ536664.1)], Termitomyces sp. [CN 4, % identity 90 (JF746992.1)], Termitomyces sp. [CN 5, % identity 99 (GU001667.1)], T. microcarpus [CN 6, % identity 82 (EF421077.1)], Termitomyces sp. [CN 7, % identity 76 (JF746993.1)], and Volvariella volvacea [CN 8, % identity 100 (JN086680.1)]. Although out of 8 mushrooms 4 could be identified up to species level, the nucleotide sequences of the rest may be relevant to further characterization. A phylogenetic tree is constructed using Neighbor-Joining method showing interrelationship between/among the mushrooms. The determined nucleotide sequences of the mushrooms may provide additional information enriching GenBank database aiding to molecular taxonomy and facilitating its domestication and characterization for human benefits.

  5. Prediction of Nucleotide Binding Peptides Using Star Graph Topological Indices.

    Science.gov (United States)

    Liu, Yong; Munteanu, Cristian R; Fernández Blanco, Enrique; Tan, Zhiliang; Santos Del Riego, Antonino; Pazos, Alejandro

    2015-11-01

    The nucleotide binding proteins are involved in many important cellular processes, such as transmission of genetic information or energy transfer and storage. Therefore, the screening of new peptides for this biological function is an important research topic. The current study proposes a mixed methodology to obtain the first classification model that is able to predict new nucleotide binding peptides, using only the amino acid sequence. Thus, the methodology uses a Star graph molecular descriptor of the peptide sequences and the Machine Learning technique for the best classifier. The best model represents a Random Forest classifier based on two features of the embedded and non-embedded graphs. The performance of the model is excellent, considering similar models in the field, with an Area Under the Receiver Operating Characteristic Curve (AUROC) value of 0.938 and true positive rate (TPR) of 0.886 (test subset). The prediction of new nucleotide binding peptides with this model could be useful for drug target studies in drug development. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Electronic properties of carbon nanotubes complexed with a DNA nucleotide.

    Science.gov (United States)

    Chehelamirani, Morteza; da Silva, Maurício C; Salahub, Dennis R

    2017-03-08

    Electronic properties of carbon nanotubes (CNTs) play an important role in their interactions with nano-structured materials. In this work, interactions of adenosine monophosphate (AMP), a DNA nucleotide, with metallic and semi-conducting CNTs are studied using the density functional tight binding (DFTB) method. The electronic structure of semi-conducting CNTs was found to be changed as they turned to metallic CNTs in a vacuum upon interaction with the nucleotide while metallic CNTs remain metallic. Specifically, the band gap of semi-conducting CNTs was decreased by 0.79 eV on average while nearly no change was found in the metallic tubes. However, our investigations showed that the presence of explicit water molecules prevents the metallicity change and only small changes in the CNT band gap occur. According to our charge analysis, the average negative charge accumulated on CNTs upon interaction with the AMP was determined to be 0.77 e in a vacuum while it was 0.03 e in solution. Therefore, it is essential to include explicit water molecules in simulating complexes formed by DNA nucleotides and CNTs which were ignored in several past studies performed using quantum mechanical approaches.

  7. Tidally influenced alongshore circulation at an inlet-adjacent shoreline

    Science.gov (United States)

    Hansen, Jeff E.; Elias, Edwin P.L.; List, Jeffrey H.; Erikson, Li H.; Barnard, Patrick L.

    2013-01-01

    The contribution of tidal forcing to alongshore circulation inside the surfzone is investigated at a 7 km long sandy beach adjacent to a large tidal inlet. Ocean Beach in San Francisco, CA (USA) is onshore of a ∼150 km2 ebb-tidal delta and directly south of the Golden Gate, the sole entrance to San Francisco Bay. Using a coupled flow-wave numerical model, we find that the tides modulate, and in some cases can reverse the direction of, surfzone alongshore flows through two separate mechanisms. First, tidal flow through the inlet results in a barotropic tidal pressure gradient that, when integrated across the surfzone, represents an important contribution to the surfzone alongshore force balance. Even during energetic wave conditions, the tidal pressure gradient can account for more than 30% of the total alongshore pressure gradient (wave and tidal components) and up to 55% during small waves. The wave driven component of the alongshore pressure gradient results from alongshore wave height and corresponding setup gradients induced by refraction over the ebb-tidal delta. Second, wave refraction patterns over the inner shelf are tidally modulated as a result of both tidal water depth changes and strong tidal flows (∼1 m/s), with the effect from currents being larger. These tidally induced changes in wave refraction result in corresponding variability of the alongshore radiation stress and pressure gradients within the surfzone. Our results indicate that tidal contributions to the surfzone force balance can be significant and important in determining the direction and magnitude of alongshore flow.

  8. Adjacent level disease following lumbar spine surgery: A review

    Science.gov (United States)

    Epstein, Nancy E.

    2015-01-01

    Background: Instrumented lumbar spine surgery is associated with an increased risk of adjacent segment disease (ASD). Multiple studies have explored the various risk factors contributing to ASD that include; fusion length (especially, three or more levels), sagittal malalignment, facet injury, advanced age, and prior cephalad degenerative disease. Methods: In this selective review of ASD, following predominantly instrumented fusions for lumbar degenerative disease, patients typically underwent open versus minimally invasive surgery (MIS), transforaminal lumbar interbody fusions (TLIFs), posterior lumbar interbody fusions (PLIFs), or rarely posterolateral lumbar instrumented or noninstrumented fusions (posterolateral lumbar fusion). Results: The incidence of ASD, following open or MI lumbar instrumented fusions, ranged up to 30%; notably, the addition of instrumentation in different series did not correlate with improved outcomes. Alternatively, in one series, at 164 postoperative months, noninstrumented lumbar fusions reduced the incidence of ASD to 5.6% versus 18.5% for ASD performed with instrumentation. Of interest, dynamic instrumented/stabilization techniques did not protect patients from ASD. Furthermore, in a series of 513 MIS TLIF, there was a 15.6% incidence of perioperative complications that included; a 5.1% frequency of durotomy and a 2.3% instrumentation failure rate. Conclusions: The incidence of postoperative ASD (up to 30%) is greater following either open or MIS instrumented lumbar fusions (e.g., TLIF/PLIF), while decompressions with noninstrumented fusions led to a much smaller 5.6% risk of ASD. Other findings included: MIS instrumented fusions contributed to higher perioperative complication rates, and dynamic stabilization did not protect against ASD. PMID:26693387

  9. Preliminary study on mitochondrial 16S rRNA gene sequences and phylogeny of flatfishes (Pleuronectiformes)

    Science.gov (United States)

    You, Feng; Liu, Jing; Zhang, Peijun; Xiang, Jianhai

    2005-09-01

    A 605 bp section of mitochondrial 16S rRNA gene from Paralichthys olivaceus, Pseudorhombus cinnamomeus, Psetta maxima and Kareius bicoloratus, which represent 3 families of Order Pleuronectiformes was amplified by PCR and sequenced to show the molecular systematics of Pleuronectiformes for comparison with related gene sequences of other 6 flatfish downloaded from GenBank. Phylogenetic analysis based on genetic distance from related gene sequences of 10 flatfish showed that this method was ideal to explore the relationship between species, genera and families. Phylogenetic trees set-up is based on neighbor-joining, maximum parsimony and maximum likelihood methods that accords to the general rule of Pleuronectiformes evolution. But they also resulted in some confusion. Unlike data from morphological characters, P. olivaceus clustered with K. bicoloratus, but P. cinnamomeus did not cluster with P. olivaceus, which is worth further studying.

  10. Fluoroscence in situ hybridization of chicken intestinal samples with bacterial rRNA targeted oligonucleotide probes

    DEFF Research Database (Denmark)

    Olsen, Katja Nyholm; Francesch, M.; Christensen, Henrik

    2006-01-01

    The objective was to develop a fast and accurate molecular method for the quantification of the intestinal flora in chickens by rRNA fluorescence in situ hybridization (FISH). Seven weeks old conventionally reared Lohmann hens were used to set up the method. To sample ileal intestinal content......, the distal part from Meckels diverticulum to the ileo-caecal junction was removed. Fixation was performed in ethanol and phosphate buffered saline. After washing by centrifugation, the sample was resuspended in pre-heated hybridization buffer with oligonucleotide probe labelled with Cy3 (10ng/µl). The cells...... were hybridized for 24-72h, centrifuged, washed with pre-heated hybridization buffer, centrifuged and resuspended in Millipore quality water before filtration onto a 0.22 µm black polycarbonate filter. The probes used in this study were, LGC354A, LGC354B, LGC354C, Strc493, Bacto1080, Sal3, Chis150, EUB...

  11. Soil DNA extraction procedure influences protist 18S rRNA gene community profiling outcome

    DEFF Research Database (Denmark)

    Santos, Susana S.; Nunes, Ines Marques; Nielsen, Tue K.

    2017-01-01

    Advances in sequencing technologies allow deeper studies of the soil protist diversity and function. However, little attention has been given to the impact of the chosen soil DNA extraction procedure to the overall results. We examined the effect of three acknowledged DNA recovery methods, two...... manual methods (ISOm-11063, GnS-GII) and one commercial kit (MoBio), on soil protist community structures obtained from different sites with different land uses. Results from 18S rRNA gene amplicon sequencing suggest that DNA extraction method significantly affect the replicate homogeneity, the total...... number of operational taxonomic units (OTUs) recovered and the overall taxonomic structure and diversity of soil protist communities. However, DNA extraction effects did not overwhelm the natural variation among samples, as the community data still strongly grouped by geographical location...

  12. Histological and histomorphometrical evaluation of tissue reactions adjacent to endosteal implants in monkeys

    DEFF Research Database (Denmark)

    Gotfredsen, K; Rostrup, E; Hjörting-Hansen, E

    1992-01-01

    A qualitative and quantitative histological study of the initial healing response adjacent to 24 submerged and non-submerged implants placed in the lower jaws of 6 monkeys is presented. The histomorphometric analysis showed no significant differences in mineralized bone-implant contact length bet...... adjacent to non-submerged implants without oral hygiene than were seen adjacent to non-submerged implants with oral hygiene in the initial healing period....

  13. Load Rate of Facet Joints at the Adjacent Segment Increased After Fusion

    OpenAIRE

    Li, Hui; Pei, Bao-Qing; Yang, Jin-Cai; Hai, Yong; Li, De-Yu; Wu, Shu-Qin

    2015-01-01

    Background: The cause of the adjacent segment degeneration (ASD) after fusion remains unknown. It is reported that adjacent facet joint stresses increase after anterior cervical discectomy and fusion. This increase of stress rate may lead to tissue injury. Thus far, the load rate of the adjacent segment facet joint after fusion remains unclear. Methods: Six C2-C7 cadaveric spine specimens were loaded under four motion modes: Flexion, extension, rotation, and lateral bending, with a pure m...

  14. The Role of Cyclic Nucleotide Signaling Pathways in Cancer: Targets for Prevention and Treatment

    Energy Technology Data Exchange (ETDEWEB)

    Fajardo, Alexandra M.; Piazza, Gary A. [Drug Discovery Research Center, Mitchell Cancer Institute, University of South Alabama, 1660 Springhill Ave, Suite 3029, Mobile, AL 36604 (United States); Tinsley, Heather N., E-mail: htinsley@montevallo.edu [Department of Biology, Chemistry, and Mathematics, University of Montevallo, Station 6480, Montevallo, AL 35115 (United States)

    2014-02-26

    For more than four decades, the cyclic nucleotides cyclic AMP (cAMP) and cyclic GMP (cGMP) have been recognized as important signaling molecules within cells. Under normal physiological conditions, cyclic nucleotides regulate a myriad of biological processes such as cell growth and adhesion, energy homeostasis, neuronal signaling, and muscle relaxation. In addition, altered cyclic nucleotide signaling has been observed in a number of pathophysiological conditions, including cancer. While the distinct molecular alterations responsible for these effects vary depending on the specific cancer type, several studies have demonstrated that activation of cyclic nucleotide signaling through one of three mechanisms—induction of cyclic nucleotide synthesis, inhibition of cyclic nucleotide degradation, or activation of cyclic nucleotide receptors—is sufficient to inhibit proliferation and activate apoptosis in many types of cancer cells. These findings suggest that targeting cyclic nucleotide signaling can provide a strategy for the discovery of novel agents for the prevention and/or treatment of selected cancers.

  15. Antibiotic interactions at the GTPase-associated centre within Escherichia coli 23S rRNA

    DEFF Research Database (Denmark)

    Egebjerg, J; Douthwaite, S; Garrett, R A

    1989-01-01

    A comprehensive range of chemical reagents and ribonucleases was employed to investigate the interaction of the antibiotics thiostrepton and micrococcin with the ribosomal protein L11-23S RNA complex and with the 50S subunit. Both antibiotics block processes associated with the ribosomal A-site b...... important exception, however, occurred at nucleotide A1067 within a terminal loop where thiostrepton protected the N-1 position while micrococcin rendered it more reactive. This difference correlates with the opposite effects of the two antibiotics on GTPase activity....

  16. KAMG: A Tool for Converting Blood Ties and Affinity Ties into Adjacency Matrices

    Directory of Open Access Journals (Sweden)

    Hang Xiong

    2016-07-01

    Full Text Available Kinship Adjacency Matrix Generator (KAMG is a browser-based software for creating adjacency matrices using the information of kinship ties. Specifically, it is capable of converting the family trees in the format of GEDCOM files into adjacency matrices of blood relationship. With the data of intermarriages between different families, it can further create the adjacency matrix of affinity relationship for the families. The outcomes can be directly used to create networks. KAMG is written in JavaScript and implemented on web browsers. It is completely open source and the source code is publicly available on GitHub.

  17. Mangroves as a major source of soil carbon storage in adjacent seagrass meadows

    Science.gov (United States)

    Chen, Guangcheng; Azkab, Muhammad Husni; Chmura, Gail L.; Chen, Shunyang; Sastrosuwondo, Pramudji; Ma, Zhiyuan; Dharmawan, I. Wayan Eka; Yin, Xijie; Chen, Bin

    2017-02-01

    Mangrove forests have the potential to export carbon to adjacent ecosystems but whether mangrove-derived organic carbon (OC) would enhance the soil OC storage in seagrass meadows adjacent to mangroves is unclear. In this study we examine the potential for the contribution of mangrove OC to seagrass soils on the coast of North Sulawesi, Indonesia. We found that seagrass meadows adjacent to mangroves had significantly higher soil OC concentrations, soil OC with lower δ 13C, and lower bulk density than those at the non-mangrove adjacent meadows. Soil OC storage to 30 cm depth ranged from 3.21 to 6.82 kg C m-2, and was also significantly higher at the mangrove adjacent meadows than those non-adjacent meadows. δ13C analyses revealed that mangrove OC contributed 34 to 83% to soil OC at the mangrove adjacent meadows. The δ13C value of seagrass plants was also different between the seagrasses adjacent to mangroves and those which were not, with lower values measured at the seagrasses adjacent to mangroves. Moreover, we found significant spatial variation in both soil OC concentration and storage, with values decreasing toward sea, and the contribution of mangrove-derived carbon also reduced with distance from the forest.

  18. 16S rRNA gene sequencing as a tool to study microbial populations in foods and process environments

    DEFF Research Database (Denmark)

    Buschhardt, Tasja; Hansen, Tina Beck; Bahl, Martin Iain

    2015-01-01

    Introduction: Methodological constraints during culturing and biochemical testing have left the true microbiological diversity of foods and process environments unexplored. Culture-independent molecular methods, such as 16S rRNA gene sequencing, may provide deeper insight into microbial communities...... reference. Results: Taxonomic assignments and abundances of sequences in the total community and in the Enterobacteriaceae subpopulation were affected by the 16S rRNA gene variable region, DNA extraction methods, and polymerases chosen. However, community compositions were very reproducible when the same...... methods were used. Conclusions: Altogether, we have shown that conclusions from population studies based on 16S rRNA gene sequencing need to be made with caution. Overcoming the constraints, we believe that population studies can give new research possibilities for e.g. interaction studies, identification...

  19. n-Nucleotide circular codes in graph theory.

    Science.gov (United States)

    Fimmel, Elena; Michel, Christian J; Strüngmann, Lutz

    2016-03-13

    The circular code theory proposes that genes are constituted of two trinucleotide codes: the classical genetic code with 61 trinucleotides for coding the 20 amino acids (except the three stop codons {TAA,TAG,TGA}) and a circular code based on 20 trinucleotides for retrieving, maintaining and synchronizing the reading frame. It relies on two main results: the identification of a maximal C(3) self-complementary trinucleotide circular code X in genes of bacteria, eukaryotes, plasmids and viruses (Michel 2015 J. Theor. Biol. 380, 156-177. (doi:10.1016/j.jtbi.2015.04.009); Arquès & Michel 1996 J. Theor. Biol. 182, 45-58. (doi:10.1006/jtbi.1996.0142)) and the finding of X circular code motifs in tRNAs and rRNAs, in particular in the ribosome decoding centre (Michel 2012 Comput. Biol. Chem. 37, 24-37. (doi:10.1016/j.compbiolchem.2011.10.002); El Soufi & Michel 2014 Comput. Biol. Chem. 52, 9-17. (doi:10.1016/j.compbiolchem.2014.08.001)). The univerally conserved nucleotides A1492 and A1493 and the conserved nucleotide G530 are included in X circular code motifs. Recently, dinucleotide circular codes were also investigated (Michel & Pirillo 2013 ISRN Biomath. 2013, 538631. (doi:10.1155/2013/538631); Fimmel et al. 2015 J. Theor. Biol. 386, 159-165. (doi:10.1016/j.jtbi.2015.08.034)). As the genetic motifs of different lengths are ubiquitous in genes and genomes, we introduce a new approach based on graph theory to study in full generality n-nucleotide circular codes X, i.e. of length 2 (dinucleotide), 3 (trinucleotide), 4 (tetranucleotide), etc. Indeed, we prove that an n-nucleotide code X is circular if and only if the corresponding graph [Formula: see text] is acyclic. Moreover, the maximal length of a path in [Formula: see text] corresponds to the window of nucleotides in a sequence for detecting the correct reading frame. Finally, the graph theory of tournaments is applied to the study of dinucleotide circular codes. It has full equivalence between the combinatorics

  20. Phylogenetic relationships within the family Halomonadaceae based on comparative 23S and 16S rRNA gene sequence analysis.

    Science.gov (United States)

    de la Haba, Rafael R; Arahal, David R; Márquez, M Carmen; Ventosa, Antonio

    2010-04-01

    A phylogenetic study of the family Halomonadaceae was carried out based on complete 16S rRNA and 23S rRNA gene sequences. Several 16S rRNA genes of type strains were resequenced, and 28 new sequences of the 23S rRNA gene were obtained. Currently, the family includes nine genera (Carnimonas, Chromohalobacter, Cobetia, Halomonas, Halotalea, Kushneria, Modicisalibacter, Salinicola and Zymobacter). These genera are phylogenetically coherent except Halomonas, which is polyphyletic. This genus comprises two clearly distinguished clusters: group 1 includes Halomonas elongata (the type species) and the species Halomonas eurihalina, H. caseinilytica, H. halmophila, H. sabkhae, H. almeriensis, H. halophila, H. salina, H. organivorans, H. koreensis, H. maura and H. nitroreducens. Group 2 comprises the species Halomonas aquamarina, H. meridiana, H. axialensis, H. magadiensis, H. hydrothermalis, H. alkaliphila, H. venusta, H. boliviensis, H. neptunia, H. variabilis, H. sulfidaeris, H. subterranea, H. janggokensis, H. gomseomensis, H. arcis and H. subglaciescola. Halomonas salaria forms a cluster with Chromohalobacter salarius and the recently described genus Salinicola, and their taxonomic affiliation requires further study. More than 20 Halomonas species are phylogenetically not within the core constituted by the Halomonas sensu stricto cluster (group 1) or group 2 and, since their positions on the different phylogenetic trees are not stable, they cannot be recognized as additional groups either. In general, there is excellent agreement between the phylogenies based on the two rRNA gene sequences, but the 23S rRNA gene showed higher resolution in the differentiation of species of the family Halomonadaceae.

  1. Seasonal Dynamics of Bacterioplankton Community Structure in a Eutrophic Lake as Determined by 5S rRNA Analysis

    Science.gov (United States)

    Höfle, Manfred G.; Haas, Heike; Dominik, Katja

    1999-01-01

    Community structure of bacterioplankton was studied during the major growth season for phytoplankton (April to October) in the epilimnion of a temperate eutrophic lake (Lake Plußsee, northern Germany) by using comparative 5S rRNA analysis. Estimates of the relative abundances of single taxonomic groups were made on the basis of the amounts of single 5S rRNA bands obtained after high-resolution electrophoresis of RNA directly from the bacterioplankton. Full-sequence analysis of single environmental 5S rRNAs enabled the identification of single taxonomic groups of bacteria. Comparison of partial 5S rRNA sequences allowed the detection of changes of single taxa over time. Overall, the whole bacterioplankton community showed two to eight abundant (>4% of the total 5S rRNA) taxa. A distinctive seasonal succession was observed in the taxonomic structure of this pelagic community. A rather-stable community structure, with seven to eight different taxonomic units, was observed beginning in April during the spring phytoplankton bloom. A strong reduction in this diversity occurred at the beginning of the clear-water phase (early May), when only two to four abundant taxa were observed, with one taxon dominating (up to 72% of the total 5S rRNA). The community structure during summer stagnation (June and July) was characterized by frequent changes of different dominating taxa. During late summer, a dinoflagellate bloom (Ceratium hirudinella) occurred, with Comamonas acidovorans (β-subclass of the class Proteobacteria) becoming the dominant bacterial species (average abundance of 43% of the total 5S rRNA). Finally, the seasonal dynamics of the community structure of bacterioplankton were compared with the abundances of other major groups of the aquatic food web, such as phyto- and zooplankton, revealing that strong grazing pressure by zooplankton can reduce microbial diversity substantially in pelagic environments. PMID:10388718

  2. Nucleotide sequences specific to Brucella and methods for the detection of Brucella

    Energy Technology Data Exchange (ETDEWEB)

    McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA

    2009-02-24

    Nucleotide sequences specific to Brucella that serves as a marker or signature for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

  3. Effect of adenine nucleotides and gamma radiation on the transport of TEMPOL across the erythrocyte membrane

    Energy Technology Data Exchange (ETDEWEB)

    Jozwiak, Z.; Gwozdzinski, K.; Helszer, Z. (Lodz Univ. (Poland). Dept. of Biophysics)

    1983-09-01

    External adenine compounds bring about changes in the transport of hydrophilic molecules across control and irradiated bovine erythrocyte membranes. Changes in the transport induced by incubation of erythrocytes with nucleotides depend on the type of nucleotide and its concentration. The range of nucleotide concentrations over which the stimulatory effect on the transport occurs is established.

  4. Changes in growth, rRNA content, and cell morphology of Listeria monocytogenes induced by CO2 up- and downshift

    DEFF Research Database (Denmark)

    Jydegaard-Axelsen, A.M.; Aaes-Jorgensen, A.; Koch, A.G.

    2005-01-01

    Cell morphology, rRNA content, and growth were examined for Listeria monocytogenes LO28 and EGD, respectively, grown in brain-heart infusion (BHI) and on slices of sausage at 10degreesC in 100% CO2, 100% N-2, and air. In CO2, filamentous cells were formed by both strains on sausage slices and by L...... unchanged. On sausage slices, the number of colony forming units also increased rapidly for both strains in response to CO2 downshift. Large variations in rRNA content of individual cells were observed in the tested scenarios. The results demonstrate the risk of underestimating the number of infectious...

  5. Community structure, cellular rRNA content, and activity of sulfate-reducing bacteria in marine Arctic sediments

    DEFF Research Database (Denmark)

    Ravenschlag, K.; Sahm, K.; Knoblauch, C.

    2000-01-01

    The community structure of sulfate-reducing bacteria (SRB) of a marine Arctic sediment (Smeerenburg-fjorden, Svalbard) a-as characterized by both fluorescence in situ hybridization (FISH) and rRNA slot blot hybridization by using group- and genus-specific 16S rRNA-targeted oligonucleotide probes......-to-bottom approach we aimed to further resolve the composition of this large group of SRB by using probes for cultivated genera. While this approach failed, directed cloning of probe-targeted genes encoding 16S rRNA was successful and resulted in sequences which were all affiliated with the Desulfosarcina...

  6. SSU rRNA reveals a sequential increase in shell complexity among the euglyphid testate amoebae (Rhizaria: Euglyphida)

    DEFF Research Database (Denmark)

    Lara, Enrique; Heger, Thierry J; Mitchell, Edward A D

    2007-01-01

    The existing data on the molecular phylogeny of filose testate amoebae from order Euglyphida has revealed contradictions between traditional morphological classification and SSU rRNA phylogeny and, moreover, the position of several important genera remained unknown. We therefore carried out a study...... aiming to fill several important gaps and better understand the relationships among the main euglyphid testate amoebae and the evolutionary steps that led to the present diversity at a higher level. We obtained new SSU rRNA sequences from five genera and seven species. This new phylogeny obtained shows...

  7. Extensive 16S rRNA gene sequence diversity in Campylobacter hyointestinalis strains: taxonomic and applied implications

    DEFF Research Database (Denmark)

    Harrington, C.S.; On, Stephen L.W.

    1999-01-01

    Phylogenetic relationships of Campylobacter hyointestinalis subspecies were examined by means of 16S rRNA gene sequencing. Sequence similarities among C. hyointestinalis subsp. lawsonii strains exceeded 99.0 %, but values among C. hyointestinalis subsp. hyointestinalis strains ranged from 96...... of the genus Campylobacter, emphasizing the need for multiple strain analysis when using 16S rRNA gene sequence comparisons for taxonomic investigations........4 to 100 %. Sequence similarites between strains representing the two different subspecies ranged from 95.7 to 99.0 %. An intervening sequence was identified in certain of the C. hyointestinalis subsp. lawsonii strains. C. hyointestinalis strains occupied two distinct branches in a phylogenetic analysis...

  8. Defining reference sequences for Nocardia species by similarity and clustering analyses of 16S rRNA gene sequence data.

    Directory of Open Access Journals (Sweden)

    Manal Helal

    Full Text Available BACKGROUND: The intra- and inter-species genetic diversity of bacteria and the absence of 'reference', or the most representative, sequences of individual species present a significant challenge for sequence-based identification. The aims of this study were to determine the utility, and compare the performance of several clustering and classification algorithms to identify the species of 364 sequences of 16S rRNA gene with a defined species in GenBank, and 110 sequences of 16S rRNA gene with no defined species, all within the genus Nocardia. METHODS: A total of 364 16S rRNA gene sequences of Nocardia species were studied. In addition, 110 16S rRNA gene sequences assigned only to the Nocardia genus level at the time of submission to GenBank were used for machine learning classification experiments. Different clustering algorithms were compared with a novel algorithm or the linear mapping (LM of the distance matrix. Principal Components Analysis was used for the dimensionality reduction and visualization. RESULTS: The LM algorithm achieved the highest performance and classified the set of 364 16S rRNA sequences into 80 clusters, the majority of which (83.52% corresponded with the original species. The most representative 16S rRNA sequences for individual Nocardia species have been identified as 'centroids' in respective clusters from which the distances to all other sequences were minimized; 110 16S rRNA gene sequences with identifications recorded only at the genus level were classified using machine learning methods. Simple kNN machine learning demonstrated the highest performance and classified Nocardia species sequences with an accuracy of 92.7% and a mean frequency of 0.578. CONCLUSION: The identification of centroids of 16S rRNA gene sequence clusters using novel distance matrix clustering enables the identification of the most representative sequences for each individual species of Nocardia and allows the quantitation of inter- and intra

  9. Crustal stress pattern in China and its adjacent areas

    Science.gov (United States)

    Hu, Xingping; Zang, Arno; Heidbach, Oliver; Cui, Xiaofeng; Xie, Furen; Chen, Jiawei

    2017-11-01

    During the update of the World Stress Map (WSM) database, we integrated the China stress database by strictly using the internationally developed quality ranking scheme for each individual stress data record. This effort resulted in a comprehensive and reliable dataset for the crustal stress of China and its adjacent areas with almost double the amount of data records from the WSM database release 2008, i.e., a total of 8228 data records with reliable A-C qualities in the region of 45-155° East and 0-60° North. We use this dataset for an analysis of the stress pattern for the orientation of maximum compressive horizontal stress (SHmax). In contrast to earlier findings that suggested that the mean SHmax orientation would be aligned with the direction of plate motion, we clearly see from our results that the plate boundary forces, as well as topography and faulting, are important control factors for the overall stress pattern. Furthermore, the smoothing results indicate that the SHmax orientation in China rotates clockwise from the west to the east, which results in a fan-shaped crustal stress pattern for the continental scale. The plate boundary forces around China, which are the Indian-Eurasian plate collision in the west and the Pacific plate subduction and the push from the Philippine plate in the east, can still be seen as the key driving processes and the first-order controls for the crustal stress pattern. The South-North seismic zone can be seen as the separation zone for the western and eastern plate boundary forces. Topographic variation and faulting activity, however, provide second-order changes, and lead to local variations and different inhomogeneity scales for the stress pattern. Due to differences in these factors, Northeast China and the central part of the Tibetan plateau have notably homogeneous stress patterns, while the South-North seismic zone, the Hindu Kush-Pamir region, and the Taiwan region have extremely inhomogeneous stress patterns

  10. The Tomato Nucleotide-binding Leucine-rich Repeat Immune Receptor I-2 Couples DNA-binding to Nucleotide-binding Domain Nucleotide Exchange*

    Science.gov (United States)

    Fenyk, Stepan; Dixon, Christopher H.; Gittens, William H.; Townsend, Philip D.; Sharples, Gary J.; Pålsson, Lars-Olof; Takken, Frank L. W.; Cann, Martin J.

    2016-01-01

    Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. PMID:26601946

  11. The Tomato Nucleotide-binding Leucine-rich Repeat Immune Receptor I-2 Couples DNA-binding to Nucleotide-binding Domain Nucleotide Exchange.

    Science.gov (United States)

    Fenyk, Stepan; Dixon, Christopher H; Gittens, William H; Townsend, Philip D; Sharples, Gary J; Pålsson, Lars-Olof; Takken, Frank L W; Cann, Martin J

    2016-01-15

    Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. Impact of body mass index on adjacent segment disease after lumbar fusion for degenerative spine disease.

    Science.gov (United States)

    Ou, Chien-Yu; Lee, Tao-Chen; Lee, Tsung-Han; Huang, Yu-Hua

    2015-04-01

    Adjacent segment disease is an important complication after fusion of degenerative lumbar spines. However, the role of body mass index (BMI) in adjacent segment disease has been addressed less. To examine the relationship between BMI and adjacent segment disease after lumbar fusion for degenerative spine diseases. For this retrospective study, we enrolled 190 patients undergoing lumbar fusion surgery for degeneration. BMI at admission was documented. Adjacent segment disease was defined by integration of the clinical presentations and radiographic criteria based on the morphology of the dural sac on magnetic resonance images. Adjacent segment disease was identified in 13 of the 190 patients, accounting for 6.8%. The interval between surgery and diagnosis as adjacent segment disease ranged from 21 to 66 months. Five of the 13 patients required subsequent surgical intervention for clinically relevant adjacent segment disease. In the logistic regression model, BMI was a risk factor for adjacent segment disease after lumbar fusion for degenerative spine diseases (odds ratio, 1.68; 95% confidence interval, 1.27-2.21; P disease rate by 67.6%. The patients were subdivided into 2 groups based on BMI, and up to 11.9% of patients with BMI ≥ 25 kg/m were diagnosed as having adjacent segment disease at the last follow-up. BMI is a risk factor for adjacent segment disease in patients undergoing lumbar fusion for degenerative spine diseases. Because BMI is clinically objective and modifiable, controlling body weight before or after surgery may provide opportunities to reduce the rate of adjacent segment disease and to improve the outcome of fusion surgery.

  13. Changes in rRNA levels during stress invalidates results from mRNA blotting: Fluorescence in situ rRNA hybridization permits renormalization for estimation of cellular mRNA levels

    DEFF Research Database (Denmark)

    Hansen, M.C.; Nielsen, A.K.; Molin, Søren

    2001-01-01

    in the hrcA-grpE-dnaK operon was analyzed. The hybridization data suggested a complex heat shock regulation indicating that the mRNA levels continued to rise after 30 min, but after renormalization the calculated average cellular levels exhibited a much simpler induction pattern, eventually attaining...... the relative level of rRNA per cell, and slot blotting to rRNA probes, which estimates the level of rRNA per extracted total RNA, the amount of RNA per cell was calculated in a series of heat shock experiments with the gram-positive bacterium Lactococcus lactis. It was found that the level of rRNA per cell...... decreased to 30% in the course of the heat shock. This lowered ribosome level led to a decrease in the total RNA content, resulting in a gradually increasing overestimation of the mRNA levels throughout the experiment. Using renormalized cellular mRNA levels, the HrcA-mediated regulation of the genes...

  14. 33 CFR 162.215 - Lake Tahoe, Nev.; restricted area adjacent to Nevada Beach.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Lake Tahoe, Nev.; restricted area adjacent to Nevada Beach. 162.215 Section 162.215 Navigation and Navigable Waters COAST GUARD, DEPARTMENT... § 162.215 Lake Tahoe, Nev.; restricted area adjacent to Nevada Beach. (a) The restricted area. The...

  15. Variable length adjacent partitioning for PTS based PAPR reduction of OFDM signal

    International Nuclear Information System (INIS)

    Ibraheem, Zeyid T.; Rahman, Md. Mijanur; Yaakob, S. N.; Razalli, Mohammad Shahrazel; Kadhim, Rasim A.

    2015-01-01

    Peak-to-Average power ratio (PAPR) is a major drawback in OFDM communication. It leads the power amplifier into nonlinear region operation resulting into loss of data integrity. As such, there is a strong motivation to find techniques to reduce PAPR. Partial Transmit Sequence (PTS) is an attractive scheme for this purpose. Judicious partitioning the OFDM data frame into disjoint subsets is a pivotal component of any PTS scheme. Out of the existing partitioning techniques, adjacent partitioning is characterized by an attractive trade-off between cost and performance. With an aim of determining effects of length variability of adjacent partitions, we performed an investigation into the performances of a variable length adjacent partitioning (VL-AP) and fixed length adjacent partitioning in comparison with other partitioning schemes such as pseudorandom partitioning. Simulation results with different modulation and partitioning scenarios showed that fixed length adjacent partition had better performance compared to variable length adjacent partitioning. As expected, simulation results showed a slightly better performance of pseudorandom partitioning technique compared to fixed and variable adjacent partitioning schemes. However, as the pseudorandom technique incurs high computational complexities, adjacent partitioning schemes were still seen as favorable candidates for PAPR reduction

  16. Variable length adjacent partitioning for PTS based PAPR reduction of OFDM signal

    Energy Technology Data Exchange (ETDEWEB)

    Ibraheem, Zeyid T.; Rahman, Md. Mijanur; Yaakob, S. N.; Razalli, Mohammad Shahrazel; Kadhim, Rasim A. [School of Computer and Communication Engineering, Universiti Malaysia Perlis, 02600 Arau, Perlis (Malaysia)

    2015-05-15

    Peak-to-Average power ratio (PAPR) is a major drawback in OFDM communication. It leads the power amplifier into nonlinear region operation resulting into loss of data integrity. As such, there is a strong motivation to find techniques to reduce PAPR. Partial Transmit Sequence (PTS) is an attractive scheme for this purpose. Judicious partitioning the OFDM data frame into disjoint subsets is a pivotal component of any PTS scheme. Out of the existing partitioning techniques, adjacent partitioning is characterized by an attractive trade-off between cost and performance. With an aim of determining effects of length variability of adjacent partitions, we performed an investigation into the performances of a variable length adjacent partitioning (VL-AP) and fixed length adjacent partitioning in comparison with other partitioning schemes such as pseudorandom partitioning. Simulation results with different modulation and partitioning scenarios showed that fixed length adjacent partition had better performance compared to variable length adjacent partitioning. As expected, simulation results showed a slightly better performance of pseudorandom partitioning technique compared to fixed and variable adjacent partitioning schemes. However, as the pseudorandom technique incurs high computational complexities, adjacent partitioning schemes were still seen as favorable candidates for PAPR reduction.

  17. Fluorides leaching from restorative materials and the effect on adjacent teeth

    DEFF Research Database (Denmark)

    Qvist, Vibeke; Poulsen, Agneta; Teglers, Poul Thorpen

    2010-01-01

    Placing a Class II restoration in a tooth changes the local environment, including that for the adjacent tooth. Apart from the change to a less- or non-cariogenic environment for the restored tooth, the effect of leachable components from a restoration in the adjacent tooth should be taken into c...

  18. 33 CFR 110.140 - Buzzards Bay, Nantucket Sound, and adjacent waters, Mass.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Buzzards Bay, Nantucket Sound, and adjacent waters, Mass. 110.140 Section 110.140 Navigation and Navigable Waters COAST GUARD..., Nantucket Sound, and adjacent waters, Mass. (a) New Bedford Outer Harbor—(1) Anchorage A. West of Sconticut...

  19. 33 CFR 110.168 - Hampton Roads, Virginia and adjacent waters (Datum: NAD 83).

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Hampton Roads, Virginia and adjacent waters (Datum: NAD 83). 110.168 Section 110.168 Navigation and Navigable Waters COAST GUARD..., Virginia and adjacent waters (Datum: NAD 83). (a) Anchorage Grounds—(1) Anchorage A [Naval Anchorage]. The...

  20. Fluorides leaching from restorative materials and the effect on adjacent teeth

    DEFF Research Database (Denmark)

    Qvist, Vibeke; Poulsen, Agneta; Teglers, Poul Thorpen

    2010-01-01

    Placing a Class II restoration in a tooth changes the local environment, including that for the adjacent tooth. Apart from the change to a less- or non-cariogenic environment for the restored tooth, the effect of leachable components from a restoration in the adjacent tooth should be taken...

  1. Large subarticular cysts (geodes) adjacent to the knee-joint in rheumatoid arthritis.

    Science.gov (United States)

    Carter, A R; Liyanage, S P

    1975-10-01

    Two patients with rheumatoid arthritis are described, who developed very large bone cysts or geodes adjacent to the knee-joint. The existence of cysts adjacent to joints involved by rheumatoid arthritis is well recognised, but the occurrence of very large cysts is unusual and may present diagnostic difficulties. Possible aetiological factors are discussed.

  2. Treatment Outcome and Patient Satisfaction with Two Adjacent Implant-Supported Restorations in the Esthetic Zone

    NARCIS (Netherlands)

    Tymstra, Nynke; Meijer, Henny J. A.; Stellingsma, Kees; Raghoebar, Gerry M.; Vissink, Arjan

    2010-01-01

    The purpose of this study was to evaluate the clinical and radiographic parameters as well as the esthetic outcome of two adjacent implant-supported restorations and the surrounding peri-implant mucosa in the maxillary esthetic zone. Ten patients were treated with two adjacent implants in the

  3. 16S rRNA Amplicon Sequencing for Epidemiological Surveys of Bacteria in Wildlife.

    Science.gov (United States)

    Galan, Maxime; Razzauti, Maria; Bard, Emilie; Bernard, Maria; Brouat, Carine; Charbonnel, Nathalie; Dehne-Garcia, Alexandre; Loiseau, Anne; Tatard, Caroline; Tamisier, Lucie; Vayssier-Taussat, Muriel; Vignes, Helene; Cosson, Jean-François

    2016-01-01

    The human impact on natural habitats is increasing the complexity of human-wildlife interactions and leading to the emergence of infectious diseases worldwide. Highly successful synanthropic wildlife species, such as rodents, will undoubtedly play an increasingly important role in transmitting zoonotic diseases. We investigated the potential for recent developments in 16S rRNA amplicon sequencing to facilitate the multiplexing of the large numbers of samples needed to improve our understanding of the risk of zoonotic disease transmission posed by urban rodents in West Africa. In addition to listing pathogenic bacteria in wild populations, as in other high-throughput sequencing (HTS) studies, our approach can estimate essential parameters for studies of zoonotic risk, such as prevalence and patterns of coinfection within individual hosts. However, the estimation of these parameters requires cleaning of the raw data to mitigate the biases generated by HTS methods. We present here an extensive review of these biases and of their consequences, and we propose a comprehensive trimming strategy for managing these biases. We demonstrated the application of this strategy using 711 commensal rodents, including 208 Mus musculus domesticus , 189 Rattus rattus , 93 Mastomys natalensis , and 221 Mastomys erythroleucus , collected from 24 villages in Senegal. Seven major genera of pathogenic bacteria were detected in their spleens: Borrelia , Bartonella , Mycoplasma , Ehrlichia , Rickettsia , Streptobacillus , and Orientia . Mycoplasma , Ehrlichia , Rickettsia , Streptobacillus , and Orientia have never before been detected in West African rodents. Bacterial prevalence ranged from 0% to 90% of individuals per site, depending on the bacterial taxon, rodent species, and site considered, and 26% of rodents displayed coinfection. The 16S rRNA amplicon sequencing strategy presented here has the advantage over other molecular surveillance tools of dealing with a large spectrum of

  4. Labeling of mitochondrial adenine nucleotides of bovine sperm

    International Nuclear Information System (INIS)

    Cheetham, J.; Lardy, H.A.

    1986-01-01

    Incorporation of 32 P/sub i/ into the adenine nucleotide pool of intact bovine spermatozoa utilizing endogenous substrates results in a specific activity (S.A.) ratio ATP/ADP of 0.3 to 0.5, suggesting compartmentation of nucleotide pools or a pathway for phosphorylation of AMP in addition to the myokinase reaction. Incubation of filipin-permeabilized cells with pyruvate, acetylcarnitine, or α-ketoglutarate (αKG) resulted in ATP-ADP S.A. ratios of 0.5, 0.8, and 1.6, respectively, for mitochondrial nucleotides. However, when malate was included with pyruvate or acetylcarnitine, the ATP/ADP S.A. ratio increased by 400% to 2.0 for pyruvate/malate and by 290% to 2.8 for acetylcarnitine/malate, while the ATP/ADP ratio increased by less than 100% in both cases. These results may indicate that under conditions of limited flux through the citric acid cycle a pathway for phosphorylation of AMP from a precursor other than ATP exists or that ATP is compartmented within the mitochondrion. In the presence of uncoupler and oligomycin with αKG, pyruvate/malate, or acetylcarnitine/malate, 32 P/sub i/ is incorporated primarily into ATP, resulting in an ATP/ADP S.A. ratio of 4.0 for αKG, 2.7 for pyruvate/malate, and 2.8 for acetylcarnitine/malate. These data are consistent with phosphorylation of ADP during substrate level phosphorylation in the citric acid cycle

  5. Nucleotide sequence of the triosephosphate isomerase gene from Macaca mulatta

    Energy Technology Data Exchange (ETDEWEB)

    Old, S.E.; Mohrenweiser, H.W. (Univ. of Michigan, Ann Arbor (USA))

    1988-09-26

    The triosephosphate isomerase gene from a rhesus monkey, Macaca mulatta, charon 34 library was sequenced. The human and chimpanzee enzymes differ from the rhesus enzyme at ASN 20 and GLU 198. The nucleotide sequence identity between rhesus and human is 97% in the coding region and >94% in the flanking regions. Comparison of the rhesus and chimp genes, including the intron and flanking sequences, does not suggest a mechanism for generating the two TPI peptides of proliferating cells from hominoids and a single peptide from the rhesus gene.

  6. Microarray Beads for Identifying Blood Group Single Nucleotide Polymorphisms

    OpenAIRE

    Drago, Francesca; Karpasitou, Katerina; Poli, Francesca

    2009-01-01

    We have developed a high-throughput system for single nucleotide polymorphism (SNP) genotyping of alleles of diverse blood group systems exploiting Luminex technology. The method uses specific oligonucleotide probes coupled to a specific array of fluorescent microspheres and is designed for typing Jka/Jkb, Fya/Fyb, S/s, K/k, Kpa/Kpb, Jsa/Jsb, Coa/Cob and Lua/Lub alleles. Briefly, two multiplex PCR reactions (PCR I and PCR II) according to the laboratory specific needs are set up. PCR I amplif...

  7. Assay of covalent intermediate of 5'-nucleotide phosphodiesterase

    International Nuclear Information System (INIS)

    Blytt, H.J.; Brotherton, J.E.; Butler, L.

    1985-01-01

    A new procedure is reported for isolating a covalent phosphoryl enzyme (diester) intermediate of bovine intestinal 5'-nucleotide phosphodiesterase. The convenience of the procedure makes it possible to determine effects of reaction conditions on the yield of covalent intermediate. Under optimum conditions, using [methyl- 3 H]deoxythymidine 5'-triphosphate as substrate, more than 50% of the enzyme is recovered as thymidylyl enzyme, a 10-fold increase in yield over the previous procedure. Yields of thymidylyl enzyme were maximal at pH 4, whereas optimum catalytic activity is observed at pH greater than 9

  8. Purine nucleotide synthesis in cultured rat embryos undergoing organogenesis

    International Nuclear Information System (INIS)

    Rowe, P.B.; Kalaizis, A.; McEwen, S.E.

    1986-01-01

    The authors show that de n ovo synthesis is the sole source of the purine nucleotides required for in vitro rat embryonic growth during organogenesis. The presence of high levels of activity of purine catabolic enzymes in the homologous serum essential for culture prohibits the salvage of purine. While the 3-carbon atom of serine is the major source of one carbon units for purine ring synthesis there is a significant contribution from the 2-ring carbon atom of tryptophan. The paper describes in detail the incorporation of (1-14C)glycine into the acid soluble phase and other processes connected with de novo purine synthesis

  9. Nucleotide Selectivity at a Preinsertion Checkpoint of T7 RNA Polymerase Transcription Elongation.

    Science.gov (United States)

    E, Chao; Duan, Baogen; Yu, Jin

    2017-04-20

    Nucleotide selection is crucial for transcription fidelity control, in particular, for viral T7 RNA polymerase (RNAP) lack of proofreading activity. It has been recognized that multiple kinetic checkpoints exist prior to full nucleotide incorporation. In this work, we implemented intensive atomistic molecular dynamics (MD) simulations to quantify how strong the nucleotide selection is at the initial checkpoint of an elongation cycle of T7 RNAP. The incoming nucleotides bind into a preinsertion site where a critical tyrosine residue locates nearby to assist the nucleotide selection. We calculated the relative binding free energy between a noncognate nucleotide and a cognate one at a preinsertion configuration via alchemical simulations, showing that a small selection free energy or the binding free energy difference (∼3 k B T) exists between the two nucleotides. Indeed, another preinsertion configuration favored by the noncognate nucleotides was identified, which appears to be off path for further nucleotide insertion and additionally assists the nucleotide selection. By chemical master equation (CME) approach, we show that the small selection free energy at the preinsertion site along with the off-path noncognate nucleotide filtering can help substantially to reduce the error rate and to maintain the elongation rate high in the T7 RNAP transcription.

  10. The secondary structure of large-subunit rRNA divergent domains, a marker for protist evolution

    DEFF Research Database (Denmark)

    Lenaers, G; Nielsen, Henrik; Engberg, J

    1988-01-01

    ), Tetrahymena thermophila (ciliate), Physarum polycephalum and Dictyostelium discoideum (slime moulds), Crithidia fasciculata and Giardia lamblia (parasitic flagellates). The folding for the D3, D7a and D10 divergent domains has been refined and a consensus model for the protist 24-26S rRNA structure...

  11. Taxonomy of the genus Rhexinema (Ulvophyceae) based on phylogeny of the 18S rRNA and morphology

    Czech Academy of Sciences Publication Activity Database

    Caisová, Lenka

    2009-01-01

    Roč. 48, č. 4 (2009), s. 15-15 ISSN 0031-8884. [International Phycological Congress /9./. 02.08.2009-08.08.2009, Tokyo ] Institutional research plan: CEZ:AV0Z60050516 Keywords : Rhexinema * 18S rRNA * morphology Subject RIV: EF - Botanics

  12. Genera Chroococcus and Limnococcus (Cyanobacteria) on the basis of 16S rRNA sequences and strains morphology

    Czech Academy of Sciences Publication Activity Database

    Komárková, Jaroslava; Jezberová, Jitka; Komárek, Ondřej; Zapomělová, Eliška

    2009-01-01

    Roč. 48, č. 4 (2009), s. 64-65 ISSN 0031-8884. [International Phycological Congress /9./. 02.08.2009-08.08.2009, Tokyo ] Institutional research plan: CEZ:AV0Z60050516; CEZ:AV0Z60170517; CEZ:AV0Z60870520 Keywords : Chroococcus * Limnococcus * 16S rRNA Subject RIV: EF - Botanics

  13. Variation in secondary structure of the 16S rRNA molecule in cyanobacteria with implications for phylogenetic analysis

    Czech Academy of Sciences Publication Activity Database

    Řeháková, Klára; Johansen, J. R.; Bowen, M.B.; Martin, M.P.; Sheil, C.A.

    2014-01-01

    Roč. 14, č. 2 (2014), s. 161-178 ISSN 1802-5439 Institutional support: RVO:60077344 Keywords : 16S rRNA secondary structure * cyanobacteria * phylogeny Subject RIV: EE - Microbiology, Virology Impact factor: 1.930, year: 2014

  14. Several RNase T2 enzymes function in induced tRNA and rRNA turnover in the ciliate Tetrahymena

    DEFF Research Database (Denmark)

    Andersen, Kasper Langebjerg; Collins, Kathleen

    2012-01-01

    RNA fragments continued to accumulate, with only a minor change in fragment profile in one strain. We therefore generated strains lacking pairwise combinations of the top three candidates for Rnt2 tRNases. Each of these strains showed a distinct starvation-specific profile of tRNA and rRNA fragment accumulation...

  15. Flow cytometry-assisted cloning of specific sequence motifs from complex 16S rRNA gene libraries

    DEFF Research Database (Denmark)

    Nielsen, J. L.; Schramm, A.; Engh, G. van den

    2004-01-01

    A How cytometry method was developed for rapid screening and recovery of cloned DNA containing common sequence motifs. This approach, termed fluorescence-activated cell sorting-assisted cloning, was used to recover sequences affiliated with a unique lineage within the Bacteroidetes not abundant i...... in a clone library of environmental 16S rRNA genes....

  16. Improving the microbial community reconstruction at the genus level by multiple 16S rRNA regions.

    Science.gov (United States)

    Wang, Shengqin; Sun, Beili; Tu, Jing; Lu, Zuhong

    2016-06-07

    16S rRNA genes have been widely used for phylogenetic reconstruction and the quantification of microbial diversity through the application of next-generation sequencing technology. However, long-read sequencing is still costly, while short-read sequencing carries less information for complex microbial community profiling; therefore, the applications of high throughput sequencing platforms still remain challenging in microbial community reconstruction analysis. Here, we developed a method to investigate the profile of aligned 16S rRNA gene sequences and to measure the proper region for microbial community reconstruction, as a step in creating a more efficient way to detect microorganism at the genus level. Finally, we found that each genus has its own preferential genus-specific amplicons for a genus assignment, which are not always located in hyper variable regions (HVRs). It was also noted that the rare genera should contribute less than dominant ones to the common profile of the aligned 16S rRNA sequences and have lower affinity to the common universal primer. Therefore, using multiple 16S rRNA regions rather than one "universal" region can significantly improve the ability of microbial community reconstruction. In addition, we found that a short fragment is suitable for most genera identifications, and the proper conserved regions used for primer design are larger than before. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. Exploring internal features of 16S rRNA gene for identification of clinically relevant species of the genus Streptococcus.

    Science.gov (United States)

    Lal, Devi; Verma, Mansi; Lal, Rup

    2011-06-25

    Streptococcus is an economically important genus as a number of species belonging to this genus are human and animal pathogens. The genus has been divided into different groups based on 16S rRNA gene sequence similarity. The variability observed among the members of these groups is low and it is difficult to distinguish them. The present study was taken up to explore 16S rRNA gene sequence to develop methods that can be used for preliminary identification and can supplement the existing methods for identification of clinically-relevant isolates of the genus Streptococcus. 16S rRNA gene sequences belonging to the isolates of S. dysgalactiae, S. equi, S. pyogenes, S. agalactiae, S. bovis, S. gallolyticus, S. mutans, S. sobrinus, S. mitis, S. pneumoniae, S. thermophilus and S. anginosus were analyzed with the purpose to define genetic variability within each species to generate a phylogenetic framework, to identify species-specific signatures and in-silico restriction enzyme analysis. The framework based analysis was used to segregate Streptococcus spp. previously identified upto genus level. This segregation was validated using species-specific signatures and in-silico restriction enzyme analysis. 43 uncharacterized Streptococcus spp. could be identified using this approach. The markers generated exploring 16S rRNA gene sequences provided useful tool that can be further used for identification of different species of the genus Streptococcus.

  18. The secondary structure of large-subunit rRNA divergent domains, a marker for protist evolution

    DEFF Research Database (Denmark)

    Lenaers, G; Nielsen, Henrik; Engberg, J

    1988-01-01

    The secondary structure of the large-subunit ribosomal RNA (24-26S rRNA) has been studied with emphasis on comparative analysis of the folding patterns of the divergent domains in the available protist sequences, that is Prorocentrum micans (dinoflagellate), Saccharomyces carlsbergensis (yeast), ...

  19. 16S rRNA partial gene sequencing for the differentiation and molecular subtyping of Listeria species.

    Science.gov (United States)

    Hellberg, Rosalee S; Martin, Keely G; Keys, Ashley L; Haney, Christopher J; Shen, Yuelian; Smiley, R Derike

    2013-12-01

    Use of 16S rRNA partial gene sequencing within the regulatory workflow could greatly reduce the time and labor needed for confirmation and subtyping of Listeria monocytogenes. The goal of this study was to build a 16S rRNA partial gene reference library for Listeria spp. and investigate the potential for 16S rRNA molecular subtyping. A total of 86 isolates of Listeria representing L. innocua, L. seeligeri, L. welshimeri, and L. monocytogenes were obtained for use in building the custom library. Seven non-Listeria species and three additional strains of Listeria were obtained for use in exclusivity and food spiking tests. Isolates were sequenced for the partial 16S rRNA gene using the MicroSeq ID 500 Bacterial Identification Kit (Applied Biosystems). High-quality sequences were obtained for 84 of the custom library isolates and 23 unique 16S sequence types were discovered for use in molecular subtyping. All of the exclusivity strains were negative for Listeria and the three Listeria strains used in food spiking were consistently recovered and correctly identified at the species level. The spiking results also allowed for differentiation beyond the species level, as 87% of replicates for one strain and 100% of replicates for the other two strains consistently matched the same 16S type. Copyright © 2013 Elsevier Ltd. All rights reserved.

  20. A new sequence data set of SSU rRNA gene for Scleractinia and its phylogenetic and ecological applications

    KAUST Repository

    Arrigoni, Roberto

    2016-11-27

    Scleractinian corals (i.e. hard corals) play a fundamental role in building and maintaining coral reefs, one of the most diverse ecosystems on Earth. Nevertheless, their phylogenies remain largely unresolved and little is known about dispersal and survival of their planktonic larval phase. The small subunit ribosomal RNA (SSU rRNA) is a commonly used gene for DNA barcoding in several metazoans, and small variable regions of SSU rRNA are widely adopted as barcode marker to investigate marine plankton community structure worldwide. Here, we provide a large sequence data set of the complete SSU rRNA gene from 298 specimens, representing all known extant reef coral families and a total of 106 genera. The secondary structure was extremely conserved within the order with few exceptions due to insertions or deletions occurring in the variable regions. Remarkable differences in SSU rRNA length and base composition were detected between and within acroporids (Acropora, Montipora, Isopora and Alveopora) compared to other corals. The V4 and V9 regions seem to be promising barcode loci because variation at commonly used barcode primer binding sites was extremely low, while their levels of divergence allowed families and genera to be distinguished. A time-calibrated phylogeny of Scleractinia is provided, and mutation rate heterogeneity is demonstrated across main lineages. The use of this data set as a valuable reference for investigating aspects of ecology, biology, molecular taxonomy and evolution of scleractinian corals is discussed.

  1. Exploring internal features of 16S rRNA gene for identification of clinically relevant species of the genus Streptococcus

    Directory of Open Access Journals (Sweden)

    Verma Mansi

    2011-06-01

    Full Text Available Abstract Background Streptococcus is an economically important genus as a number of species belonging to this genus are human and animal pathogens. The genus has been divided into different groups based on 16S rRNA gene sequence similarity. The variability observed among the members of these groups is low and it is difficult to distinguish them. The present study was taken up to explore 16S rRNA gene sequence to develop methods that can be used for preliminary identification and can supplement the existing methods for identification of clinically-relevant isolates of the genus Streptococcus. Methods 16S rRNA gene sequences belonging to the isolates of S. dysgalactiae, S. equi, S. pyogenes, S. agalactiae, S. bovis, S. gallolyticus, S. mutans, S. sobrinus, S. mitis, S. pneumoniae, S. thermophilus and S. anginosus were analyzed with the purpose to define genetic variability within each species to generate a phylogenetic framework, to identify species-specific signatures and in-silico restriction enzyme analysis. Results The framework based analysis was used to segregate Streptococcus spp. previously identified upto genus level. This segregation was validated using species-specific signatures and in-silico restriction enzyme analysis. 43 uncharacterized Streptococcus spp. could be identified using this approach. Conclusions The markers generated exploring 16S rRNA gene sequences provided useful tool that can be further used for identification of different species of the genus Streptococcus.

  2. High or low correlation between co-occuring gene clusters and 16S rRNA gene phylogeny.

    Science.gov (United States)

    Rudi, Knut; Sekelja, Monika

    2013-02-01

    Ribosomal RNA (rRNA) genes are universal for all living organisms. Yet, the correspondence between genome composition and rRNA phylogeny remains poorly known. The aim of this study was to use the information from genome sequence databases to address the correlation between rRNA gene phylogeny and total gene composition in bacteria. This was done by analysing 327 genomes with TIGRFAM functional gene annotations. Our approach consisted of two steps. First, we searched for discriminatory clusters of co-occurring genes. Using a multivariate statistical approach, we identified 11 such clusters which contain genes that were co-occurring only in a subset of genomes and contributed to explain the gene content differences between genome subsets. Second, we mapped the discovered clusters to 16S rRNA-based phylogeny and calculated the correlation between co-occuring genes and phylogeny. Six of the 11 clusters exhibited significant correlation with 16S rRNA gene phylogeny. The most distinct phylogenetic finding was a high correlation between iron-sulfur oxidoreductases in combination with carbon nitrogen ligases and Chlorobium. The other correlations identified covered relatively large phylogroups: Actinobacteria were positively associated with kinases, while Gammaproteobacteria were positively associated with methylases and acyltransferases. The suggested functional differences between higher phylogroups, however, need experimental verification. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  3. 16S rRNA gene sequencing in routine identification of anaerobic bacteria isolated from blood cultures

    DEFF Research Database (Denmark)

    Justesen, Ulrik Stenz; Skov, Marianne Nielsine; Knudsen, Elisa

    2010-01-01

    A comparison between conventional identification and 16S rRNA gene sequencing of anaerobic bacteria isolated from blood cultures in a routine setting was performed (n = 127). With sequencing, 89% were identified to the species level, versus 52% with conventional identification. The times...

  4. Direct 16S rRNA gene sequencing of polymicrobial culture-negative samples with analysis of mixed chromatograms

    DEFF Research Database (Denmark)

    Hartmeyer, Gitte N; Justesen, Ulrik S

    2010-01-01

    Two cases involving polymicrobial culture-negative samples were investigated by 16S rRNA gene sequencing, with analysis of mixed chromatograms. Fusobacterium necrophorum, Prevotella intermedia and Streptococcus constellatus were identified from pleural fluid in a patient with Lemierre's syndrome...

  5. 16S rRNA amplicon sequencing identifies microbiota associated with oral cancer, Human Papilloma Virus infection and surgical treatment

    NARCIS (Netherlands)

    Guerrero-Preston, Rafael; Godoy-Vitorino, Filipa; Jedlicka, Anne; Rodriguez-Hilario, Arnold; Gonzalez, Herminio; Bondy, Jessica; Lawson, Fahcina; Folawiyo, Oluwasina; Michailidi, Christina; Dziedzic, Amanda; Thangavel, Rajagowthamee; Hadar, Tal; Noordhuis, Maartje G.; Westra, William; Koch, Wayne; Sidransky, David

    2016-01-01

    Systemic inflammatory events and localized disease, mediated by the microbiome, may be measured in saliva as head and neck squamous cell carcinoma (HNSCC) diagnostic and prognostic biomonitors. We used a 16S rRNA V3-V5 marker gene approach to compare the saliva microbiome in DNA isolated from

  6. rRNA Operon Copy Number Can Explain the Distinct Epidemiology of Hospital-Associated Methicillin-Resistant Staphylococcus aureus

    NARCIS (Netherlands)

    Fluit, A.C.; Jansen, M.D.; Bosch, T.; Jansen, W.T.M.; Schouls, L.; Jonker, M.J.; Boel, C.H.E.

    2016-01-01

    The distinct epidemiology of original hospital-associated methicillin-resistant Staphylococcus aureus (HA-MRSA) and early community-associated MRSA (CA-MRSA) is largely unexplained. S. aureus carries either five or six rRNA operon copies. Evidence is provided for a scenario in which MRSA has adapted

  7. Highly divergent 18S rRNA gene paralogs in a Cryptosporidium genotype from eastern chipmunks (Tamias striatus)

    Czech Academy of Sciences Publication Activity Database

    Stenger, B.L.S.; Clark, M.E.; Kváč, Martin; Khan, E.; Giddings, C.W.; Dyer, N.W.; Schultz, J.L.; McEvoy, J.M.

    2015-01-01

    Roč. 32, JUN 2015 (2015), s. 113-123 ISSN 1567-1348 R&D Projects: GA MŠk(CZ) LH11061 Institutional support: RVO:60077344 Keywords : Cryptosporidium * Paralogy * 18S rRNA * 18S rDNA Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 2.591, year: 2015

  8. Exploring internal features of 16S rRNA gene for identification of clinically relevant species of the genus Streptococcus

    Science.gov (United States)

    2011-01-01

    Background Streptococcus is an economically important genus as a number of species belonging to this genus are human and animal pathogens. The genus has been divided into different groups based on 16S rRNA gene sequence similarity. The variability observed among the members of these groups is low and it is difficult to distinguish them. The present study was taken up to explore 16S rRNA gene sequence to develop methods that can be used for preliminary identification and can supplement the existing methods for identification of clinically-relevant isolates of the genus Streptococcus. Methods 16S rRNA gene sequences belonging to the isolates of S. dysgalactiae, S. equi, S. pyogenes, S. agalactiae, S. bovis, S. gallolyticus, S. mutans, S. sobrinus, S. mitis, S. pneumoniae, S. thermophilus and S. anginosus were analyzed with the purpose to define genetic variability within each species to generate a phylogenetic framework, to identify species-specific signatures and in-silico restriction enzyme analysis. Results The framework based analysis was used to segregate Streptococcus spp. previously identified upto genus level. This segregation was validated using species-specific signatures and in-silico restriction enzyme analysis. 43 uncharacterized Streptococcus spp. could be identified using this approach. Conclusions The markers generated exploring 16S rRNA gene sequences provided useful tool that can be further used for identification of different species of the genus Streptococcus. PMID:21702978

  9. Comparison of gull-specific assays targeting 16S rRNA gene of Catellicoccus marimammalium and Streptococcus spp.

    Science.gov (United States)

    Gulls have been implicated as a source of fecal contamination in inland and coastal waters. Only one gull-specific assay is currently available (i.e., gull2 qPCR assay). This assay is based on the 16S rRNA gene of Catellicocclls marimammalium and has showed a high level of host-s...

  10. Modeling the integration of bacterial rRNA fragments into the human cancer genome.

    Science.gov (United States)

    Sieber, Karsten B; Gajer, Pawel; Dunning Hotopp, Julie C

    2016-03-21

    Cancer is a disease driven by the accumulation of genomic alterations, including the integration of exogenous DNA into the human somatic genome. We previously identified in silico evidence of DNA fragments from a Pseudomonas-like bacteria integrating into the 5'-UTR of four proto-oncogenes in stomach cancer sequencing data. The functional and biological consequences of these bacterial DNA integrations remain unknown. Modeling of these integrations suggests that the previously identified sequences cover most of the sequence flanking the junction between the bacterial and human DNA. Further examination of these reads reveals that these integrations are rich in guanine nucleotides and the integrated bacterial DNA may have complex transcript secondary structures. The models presented here lay the foundation for future experiments to test if bacterial DNA integrations alter the transcription of the human genes.

  11. Efficient subtraction of insect rRNA prior to transcriptome analysis of Wolbachia-Drosophila lateral gene transfer

    Directory of Open Access Journals (Sweden)

    Kumar Nikhil

    2012-05-01

    Full Text Available Abstract Background Numerous methods exist for enriching bacterial or mammalian mRNA prior to transcriptome experiments. Yet there persists a need for methods to enrich for mRNA in non-mammalian animal systems. For example, insects contain many important and interesting obligate intracellular bacteria, including endosymbionts and vector-borne pathogens. Such obligate intracellular bacteria are difficult to study by traditional methods. Therefore, genomics has greatly increased our understanding of these bacteria. Efficient subtraction methods are needed for removing both bacteria and insect rRNA in these systems to enable transcriptome-based studies. Findings A method is described that efficiently removes >95% of insect rRNA from total RNA samples, as determined by microfluidics and transcriptome sequencing. This subtraction yielded a 6.2-fold increase in mRNA abundance. Such a host rRNA-depletion strategy, in combination with bacterial rRNA depletion, is necessary to analyze transcription of obligate intracellular bacteria. Here, transcripts were identified that arise from a lateral gene transfer of an entire Wolbachia bacterial genome into a Drosophila ananassae chromosome. In this case, an rRNA depletion strategy is preferred over polyA-based enrichment since transcripts arising from bacteria-to-animal lateral gene transfer may not be poly-adenylated. Conclusions This enrichment method yields a significant increase in mRNA abundance when poly-A selection is not suitable. It can be used in combination with bacterial rRNA subtraction to enable experiments to simultaneously measure bacteria and insect mRNA in vector and endosymbiont biology experiments.

  12. A framework for establishing predictive relationships between specific bacterial 16S rRNA sequence abundances and biotransformation rates.

    Science.gov (United States)

    Helbling, Damian E; Johnson, David R; Lee, Tae Kwon; Scheidegger, Andreas; Fenner, Kathrin

    2015-03-01

    The rates at which wastewater treatment plant (WWTP) microbial communities biotransform specific substrates can differ by orders of magnitude among WWTP communities. Differences in taxonomic compositions among WWTP communities may predict differences in the rates of some types of biotransformations. In this work, we present a novel framework for establishing predictive relationships between specific bacterial 16S rRNA sequence abundances and biotransformation rates. We selected ten WWTPs with substantial variation in their environmental and operational metrics and measured the in situ ammonia biotransformation rate constants in nine of them. We isolated total RNA from samples from each WWTP and analyzed 16S rRNA sequence reads. We then developed multivariate models between the measured abundances of specific bacterial 16S rRNA sequence reads and the ammonia biotransformation rate constants. We constructed model scenarios that systematically explored the effects of model regularization, model linearity and non-linearity, and aggregation of 16S rRNA sequences into operational taxonomic units (OTUs) as a function of sequence dissimilarity threshold (SDT). A large percentage (greater than 80%) of model scenarios resulted in well-performing and significant models at intermediate SDTs of 0.13-0.14 and 0.26. The 16S rRNA sequences consistently selected into the well-performing and significant models at those SDTs were classified as Nitrosomonas and Nitrospira groups. We then extend the framework by applying it to the biotransformation rate constants of ten micropollutants measured in batch reactors seeded with the ten WWTP communities. We identified phylogenetic groups that were robustly selected into all well-performing and significant models constructed with biotransformation rates of isoproturon, propachlor, ranitidine, and venlafaxine. These phylogenetic groups can be used as predictive biomarkers of WWTP microbial community activity towards these specific

  13. Phylogenetic Relationship of Phosphate Solubilizing Bacteria according to 16S rRNA Genes

    Directory of Open Access Journals (Sweden)

    Mohammad Bagher Javadi Nobandegani

    2015-01-01

    Full Text Available Phosphate solubilizing bacteria (PSB can convert insoluble form of phosphorous to an available form. Applications of PSB as inoculants increase the phosphorus uptake by plant in the field. In this study, isolation and precise identification of PSB were carried out in Malaysian (Serdang oil palm field (University Putra Malaysia. Identification and phylogenetic analysis of 8 better isolates were carried out by 16S rRNA gene sequencing in which as a result five isolates belong to the Beta subdivision of Proteobacteria, one isolate was related to the Gama subdivision of Proteobacteria, and two isolates were related to the Firmicutes. Bacterial isolates of 6upmr, 2upmr, 19upmnr, 10upmr, and 24upmr were identified as Alcaligenes faecalis. Also, bacterial isolates of 20upmnr and 17upmnr were identified as Bacillus cereus and Vagococcus carniphilus, respectively, and bacterial isolates of 31upmr were identified as Serratia plymuthica. Molecular identification and characterization of oil palm strains as the specific phosphate solubilizer can reduce the time and cost of producing effective inoculate (biofertilizer in an oil palm field.

  14. dinoref: A curated dinoflagellate (Dinophyceae) reference database for the 18S rRNA gene.

    Science.gov (United States)

    Mordret, Solenn; Piredda, Roberta; Vaulot, Daniel; Montresor, Marina; Kooistra, Wiebe H C F; Sarno, Diana

    2018-03-30

    Dinoflagellates are a heterogeneous group of protists present in all aquatic ecosystems where they occupy various ecological niches. They play a major role as primary producers, but many species are mixotrophic or heterotrophic. Environmental metabarcoding based on high-throughput sequencing is increasingly applied to assess diversity and abundance of planktonic organisms, and reference databases are definitely needed to taxonomically assign the huge number of sequences. We provide an updated 18S rRNA reference database of dinoflagellates: dinoref. Sequences were downloaded from genbank and filtered based on stringent quality criteria. All sequences were taxonomically curated, classified taking into account classical morphotaxonomic studies and molecular phylogenies, and linked to a series of metadata. dinoref includes 1,671 sequences representing 149 genera and 422 species. The taxonomic assignation of 468 sequences was revised. The largest number of sequences belongs to Gonyaulacales and Suessiales that include toxic and symbiotic species. dinoref provides an opportunity to test the level of taxonomic resolution of different 18S barcode markers based on a large number of sequences and species. As an example, when only the V4 region is considered, 374 of the 422 species included in dinoref can still be unambiguously identified. Clustering the V4 sequences at 98% similarity, a threshold that is commonly applied in metabarcoding studies, resulted in a considerable underestimation of species diversity. © 2018 John Wiley & Sons Ltd.

  15. Fluoroscence in situ hybridization of chicken intestinal samples with bacterial rRNA targeted oligonucleotide probes

    DEFF Research Database (Denmark)

    Olsen, Katja Nyholm; Francesch, M.; Christensen, Henrik

    2006-01-01

    The objective was to develop a fast and accurate molecular method for the quantification of the intestinal flora in chickens by rRNA fluorescence in situ hybridization (FISH). Seven weeks old conventionally reared Lohmann hens were used to set up the method. To sample ileal intestinal content...... were hybridized for 24-72h, centrifuged, washed with pre-heated hybridization buffer, centrifuged and resuspended in Millipore quality water before filtration onto a 0.22 µm black polycarbonate filter. The probes used in this study were, LGC354A, LGC354B, LGC354C, Strc493, Bacto1080, Sal3, Chis150, EUB...... were counted by the EUB338 probe. Three weeks old male broiler Ross 308 chickens were used to investigate the bacterial composition of the intestine. The birds received a wheat-barley diet. Counts with the EUB338 probe were 1.97x108(std 1.45x108) The means of counts obtained with probes targeting the r...

  16. PCR primers that amplify fungal rRNA genes from environmental samples.

    Science.gov (United States)

    Borneman, J; Hartin, R J

    2000-10-01

    Two PCR primer pairs were designed to amplify rRNA genes (rDNA) from all four major phyla of fungi: Ascomycota, Basidiomycota, Chytridomycota, and Zygomycota. PCRs performed with these primers showed that both pairs amplify DNA from organisms representing the major taxonomic groups of fungi but not from nonfungal sources. To test the ability of the primers to amplify fungal rDNA from environment samples, clone libraries from two avocado grove soils were constructed and analyzed. These soils possess different abilities to inhibit avocado root rot caused by Phythophthora cinnamomi. Analysis of the two rDNA clone libraries revealed differences in the two fungal communities. It also revealed a markedly different depiction of the soil fungal community than that generated by a culture-based analysis, confirming the value of rDNA-based approaches for identifying organisms that may not readily grow on agar media. Additional evidence of the usefulness of the primers was obtained by identifying fungi associated with avocado leaves. In both the soil and leaf analyses, no nonfungal rDNA sequences were identified, illustrating the selectivity of these PCR primers. This work demonstrates the ability of two newly developed PCR primer sets to amplify fungal rDNA from soil and plant tissue, thereby providing unique tools to examine this vast and mostly undescribed community of organisms.

  17. Small RNA sequences are readily stabilized by inclusion in a carrier rRNA.

    Science.gov (United States)

    D'Souza, Lisa M; Larios-Sanz, Maia; Setterquist, Robert A; Willson, Richard C; Fox, George E

    2003-01-01

    This laboratory previously showed that an RNA derived from 5S ribosomal RNA could be used as a carrier to harbor a nucleic acid "tag" for monitoring genetically engineered or naturally occurring bacteria. The prototype system expressed a specific tagged RNA that was stable and accumulated to high levels. For such a system to be useful there should, however, be little limitation on the sequence composition and length of the insert. To test these limitations, a collection of insertion sequences were created and introduced into the artificial 5S rRNA cassette. This library consisted of random 13- and 50-base oligonucleotides that were inserted into the carrier RNA. We report here that essentially all of the insert-containing RNAs are stable and accumulate to detectable levels. Tagged RNAs were produced by both plasmid-borne and chromosomally integrated expression systems in E. coli and several Pseudomonas strains without obvious effect on the host cell. It is anticipated that in addition to its intended use in environmental monitoring, this system can be used for in vivo selection of useful artificial RNAs. Because the carrier lends stability to the RNAs, the system may also be useful in RNA production.

  18. Prokaryotic community profiling of local algae wastewaters using advanced 16S rRNA gene sequencing.

    Science.gov (United States)

    Limayem, Alya; Micciche, Andrew; Nayak, Bina; Mohapatra, Shyam

    2018-01-01

    Algae biomass-fed wastewaters are a promising source of lipid and bioenergy manufacture, revealing substantial end-product investment returns. However, wastewaters would contain lytic pathogens carrying drug resistance detrimental to algae yield and environmental safety. This study was conducted to simultaneously decipher through high-throughput advanced Illumina 16S ribosomal RNA (rRNA) gene sequencing, the cultivable and uncultivable bacterial community profile found in a single sample that was directly recovered from the local wastewater systems. Samples were collected from two previously documented sources including anaerobically digested (AD) municipal wastewater and swine wastewater with algae namely Chlorella spp. in addition to control samples, swine wastewater, and municipal wastewater without algae. Results indicated the presence of a significant level of Bacteria in all samples with an average of approximately 95.49% followed by Archaea 2.34%, in local wastewaters designed for algae cultivation. Taxonomic genus identification indicated the presence of Calothrix, Pseudomonas, and Clostridium as the most prevalent strains in both local municipal and swine wastewater samples containing algae with an average of 17.37, 12.19, and 7.84%, respectively. Interestingly, swine wastewater without algae displayed the lowest level of Pseudomonas strains algae indicates potential coexistence between these strains and algae microenvironment, suggesting further investigations. This finding was particularly relevant for the earlier documented adverse effects of some nosocomial Pseudomonas strains on algae growth and their multidrug resistance potential, requiring the development of targeted bioremediation with regard to the beneficial flora.

  19. 16S rRNA analysis of diversity of manure microbial community in dairy farm environment.

    Science.gov (United States)

    Pandey, Pramod; Chiu, Colleen; Miao, Max; Wang, Yi; Settles, Matthew; Del Rio, Noelia Silva; Castillo, Alejandro; Souza, Alex; Pereira, Richard; Jeannotte, Richard

    2018-01-01

    Dairy farms generate a considerable amount of manure, which is applied in cropland as fertilizer. While the use of manure as fertilizer reduces the application of chemical fertilizers, the main concern with regards to manure application is microbial pollution. Manure is a reservoir of a broad range of microbial populations, including pathogens, which have potential to cause contamination and pose risks to public and animal health. Despite the widespread use of manure fertilizer, the change in microbial diversity of manure under various treatment processes is still not well-understood. We hypothesize that the microbial population of animal waste changes with manure handling used in a farm environment. Consequential microbial risk caused by animal manure may depend on manure handling. In this study, a reconnaissance effort for sampling dairy manure in California Central Valley followed by 16S rRNA analysis of content and diversity was undertaken to understand the microbiome of manure after various handling processes. The microbial community analysis of manure revealed that the population in liquid manure differs from that in solid manure. For instance, the bacteria of genus Sulfuriomonas were unique in liquid samples, while the bacteria of genus Thermos were observed only in solid samples. Bacteria of genus Clostridium were present in both solid and liquid samples. The population among liquid samples was comparable, as was the population among solid samples. These findings suggest that the mode of manure application (i.e., liquid versus solid) could have a potential impact on the microbiome of cropland receiving manure as fertilizers.

  20. Evolution of green plants as deduced from 5S rRNA sequences.

    Science.gov (United States)

    Hori, H; Lim, B L; Osawa, S

    1985-02-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other.