WorldWideScience

Sample records for adenocarcinoma cell line

  1. Antiproliferative activity of Thai medicinal plant extracts on human breast adenocarcinoma cell line.

    Science.gov (United States)

    Moongkarndi, Primchanien; Kosem, Nuttavut; Luanratana, Omboon; Jongsomboonkusol, Suna; Pongpan, Narongchai

    2004-06-01

    Ethanolic extracts of selected nine Thai medicinal plants were tested for antiproliferative activity against SKBR3 human breast adenocarcinoma cell line using MTT assay. Garcinia mangostana showed the most potent activity. However, all plant extracts showed activity in potential range for further investigation on cancer cells. Copyright 2004 Elsevier B.V.

  2. Nuclear expression of claudin-3 in human colorectal adenocarcinoma cell lines and tissues.

    Science.gov (United States)

    Tokuhara, Yasunori; Morinishi, Tatsuya; Matsunaga, Toru; Sakai, Manabu; Sakai, Takayoshi; Ohsaki, Hiroyuki; Kadota, Kyuichi; Kushida, Yoshio; Haba, Reiji; Hirakawa, Eiichiro

    2018-01-01

    Claudins are members of a large family of transmembrane proteins, which are essential for the formation of tight junctions and have a significant effect on the biological behavior of tumor progression. Previous studies have demonstrated that several claudins show aberrant expression patterns in numerous types of cancer. The present study investigated the expression and localization of claudin-3 and claudin-7 in human colorectal adenocarcinoma cell lines and tissues. The protein expression levels of claudin-3 and claudin-7 were determined using immunocytochemical and immunohistochemical staining. Claudin-3, but not claudin-7, exhibited nuclear localization in the human colorectal adenocarcinoma Caco-2 and SW620 cell lines. Surgically resected colorectal adenocarcinoma tissue specimens were obtained, and the associations between the expression of claudin-3 or claudin-7 and various clinicopathological parameters were analyzed. The membranous expression rates of claudin-3 and claudin-7 were 58.0 and 50.0%, while their nuclear expression rates were 22.0 and 2.0%, respectively. The membranous expression of claudin-3 and claudin-7 was not associated with any clinicopathological factors, whereas the nuclear expression of claudin-3 was associated with histological type and was significantly increased in colorectal mucinous adenocarcinomas compared with that in well- to moderately-differentiated colorectal adenocarcinomas (P<0.01). However, no associations were observed between the nuclear expression of claudin-7 and any clinicopathological parameter. In conclusion, the nuclear expression of claudin-3 in colorectal mucinous adenocarcinoma may be involved in the biological transformation of tumors. The results from the present study indicated that claudin-3 is an important protein associated with histological type and has potential as a prognostic marker. Although the mechanisms underlying the nuclear localization of claudin-3 in tumorigenesis have not yet been elucidated in

  3. Assessment of cytotoxicity of Portulaca oleracea Linn. against human colon adenocarcinoma and vero cell line

    Science.gov (United States)

    Mali, Prashant Y.

    2015-01-01

    Background: Portulaca oleracea Linn. (Portulacaceae) is commonly known as purslane in English. In traditional system it is used to cure diarrhea, dysentery, leprosy, ulcers, asthma, and piles, reduce small tumors and inflammations. Aim: To assess cytotoxic potential of chloroform extract of P. oleracea whole plant against human colon adenocarcinoma (HCT-15) and normal (Vero) cell line. Materials and Methods: Characterization of chloroform extract of P. oleracea by Fourier transform infrared (FTIR) spectroscopy was performed. Cytotoxicity (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazolium bromide) assay was used for assessment of cytotoxic potential of chloroform extract of P. oleracea. The concentrations of 1000–0.05 μg/ml were used in the experiment. Doxorubicin was considered as standard reference drug. Results: FTIR spectrum showed the peak at 1019.52 and 1396.21 center. The 50% cell growth inhibition (IC50) of chloroform extract of P. oleracea and doxorubicin was 1132.02 μg/ml and 460.13 μg/ml against human colon adenocarcinoma and 767.60 μg/ml and 2392.71 μg/ml against Vero cell line, respectively. Conclusion: Chloroform extract of P. oleracea whole plant was less efficient or does not have cytotoxic activity against human colon adenocarcinoma cell line. It was not safe to normal Vero cell line. But, there is a need to isolate, identify, and confirm the phytoconstituents present in extract by sophisticated analytical techniques. PMID:27833374

  4. Sulforaphane?induced apoptosis in Xuanwei lung adenocarcinoma cell line XWLC?05

    OpenAIRE

    Zhou, Lan; Yao, Qian; Li, Yan; Huang, Yun?chao; Jiang, Hua; Wang, Chuan?qiong; Fan, Lei

    2016-01-01

    Background Xuanwei district in Yunnan Province has the highest incidence of lung cancer in China, especially among non?smoking women. Cruciferous vegetables can reduce lung cancer risk by prompting a protective mechanism against respiratory tract inflammation caused by air pollution, and are rich in sulforaphane, which can induce changes in gene expression. We investigated the effect of sulforaphane?induced apoptosis in Xuanwei lung adenocarcinoma cell line (XWCL?05) to explore the value of s...

  5. Roles of histamine on the expression of aldehyde dehydrogenase 1 in endometrioid adenocarcinoma cell line

    Science.gov (United States)

    Wang, Yi; Jiang, Yang; Ikeda, Jun-ichiro; Tian, Tian; Sato, Atsushi; Ohtsu, Hiroshi; Morii, Eiichi

    2014-01-01

    Cancer-initiating cells (CICs) are a limited number of cells that are essential for maintenance, recurrence, and metastasis of tumors. Aldehyde dehydrogenase 1 (ALDH1) has been recognized as a marker of CICs. We previously reported that ALDH1-high cases of uterine endometrioid adenocarcinoma showed poor prognosis, and that ALDH1 high population was more tumorigenic, invasive, and resistant to apoptosis than ALDH1 low population. Histamine plays a critical role in cancer cell proliferation, migration, and invasion. Here, we examined the effect of histamine on ALDH1 expression in endometrioid adenocarcinoma cell line. The addition of histamine increased ALDH1 high population, which was consistent with the result that histamine enhanced the invasive ability and the resistance to anticancer drug. Among 4 types of histamine receptors, histamine H1 and H2 receptor (H1R and H2R) were expressed in endometrioid adenocarcinoma cell line. The addition of H1R agonist but not H2R agonist increased ALDH1. The antagonist H1R but not H2R inhibited the effect of histamine on ALDH1 expression. These results indicated that histamine increased the expression of ALDH1 via H1R but not H2R. These findings may provide the evidence for exploring a new strategy to suppress CICs by inhibiting ALDH1 expression with histamine. PMID:25045085

  6. Roles of histamine on the expression of aldehyde dehydrogenase 1 in endometrioid adenocarcinoma cell line.

    Science.gov (United States)

    Wang, Yi; Jiang, Yang; Ikeda, Jun-Ichiro; Tian, Tian; Sato, Atsushi; Ohtsu, Hiroshi; Morii, Eiichi

    2014-10-01

    Cancer-initiating cells (CICs) are a limited number of cells that are essential for maintenance, recurrence, and metastasis of tumors. Aldehyde dehydrogenase 1 (ALDH1) has been recognized as a marker of CICs. We previously reported that ALDH1-high cases of uterine endometrioid adenocarcinoma showed poor prognosis, and that ALDH1 high population was more tumorigenic, invasive, and resistant to apoptosis than ALDH1 low population. Histamine plays a critical role in cancer cell proliferation, migration, and invasion. Here, we examined the effect of histamine on ALDH1 expression in endometrioid adenocarcinoma cell line. The addition of histamine increased ALDH1 high population, which was consistent with the result that histamine enhanced the invasive ability and the resistance to anticancer drug. Among 4 types of histamine receptors, histamine H1 and H2 receptor (H1R and H2R) were expressed in endometrioid adenocarcinoma cell line. The addition of H1R agonist but not H2R agonist increased ALDH1. The antagonist H1R but not H2R inhibited the effect of histamine on ALDH1 expression. These results indicated that histamine increased the expression of ALDH1 via H1R but not H2R. These findings may provide the evidence for exploring a new strategy to suppress CICs by inhibiting ALDH1 expression with histamine. © 2014 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  7. Exogenous wild type p53 gene affects radiosensitivity of human lung adenocarcinoma cell line under hypoxia

    International Nuclear Information System (INIS)

    Wang Jianhua; Wang Feng; Liu Yongping; Zhang Yaping; Ni Yan; Li Shirong

    2008-01-01

    Objective: To evaluate the effect of exogenous wild type p53 (wtp53) gene on radiosensitivity of human lung adenocarcinoma cell line under hypoxia. Methods: Human lung adenocarcinoma cell line A549 was transfected with adenovirus carrying recombinant exogenous wtp53. Four irradiation groups were studied: normal cell (Group A), wtp53 transfected cell (Group B), normal cell under hypoxia (Group C) and wtp53 transfected cell under hypoxia(Group D). Cells were irradiated with 9 MeV electron beams. Cellular survival fraction was analyzed. Multi-target single-hit model was used to plot the survival curve. D 0 , D q , oxygen enhancement ratio (OER), sensitizing enhancement ratio (SER) and other parameters were used to evaluate the effects of wtp53 gene on radiosensitivity of A549. The cell apoptotic rate of each group was examined by flow cytometry. Results: OER was 1.75 and 0.81 before and after wtp53 transfection. SER was 1.77 in oxic circumstance and 3.84 under hypoxia. The cell apoptotic rate of Group A and B was lower than Group C and D (F=7.92, P=0.048), with Group A lower than B and Group C lower than D (F=82.50, P=0.001). But Group B and D were similar(t=2.04, P=0.111). Conclusions: Hypoxia can increase the radiation resistance of lung adenocarcinoma cell line A549. The wtp53 can promote apoptosis and improve tumor radiosensitivity, especially under hypoxia. (authors)

  8. Effect of repeated irradiation on biological characteristics of lung adenocarcinoma cell line Anip973 in vitro

    International Nuclear Information System (INIS)

    Xu Qingyong; Xu Xiangying; Yang Zhiwei

    2008-01-01

    Objective: To study the effect of repeated irradiation on biological characteristics of human lung adenocarcinoma cell line Anip973 in vitro. Methods: Anip973 cells were treated with high energy X-ray to a total dose of 60 Gy at 4 Gy fractions. The radiosensitivity of Anip973R and its parental cell were measured by clonogenic assay. The biological parameters were fitted to the single hit multitarget formula. Furthermore, the population double time(PDT) and cell cycle distribution were measured by cell growth curve and flow cytometry, respectively. Results: Comparing with its parental cell, Anip973 R acquired radioresistance showing increased D 0 , D q and SF 2 and a broader shoulder. PDT of Anip973R extended 3 h more than that of Anip973. The Anip973R also showed higher and lower percentage of cells in G 1 and S phase (P 2 /M distribution (P>0.05). Conclusions: A radioresistant lung adenocarcinoma cell line Anip973R is established by repeatedly irradiation. Its radioresistance displays obviously in lower dose area. However, its characteristic of cell cycle is not completely coincident with the classical radiobiological theory. (authors)

  9. The expression of oncogenes on the radiation-induced apoptosis in SCK mammary adenocarcinoma cell line

    International Nuclear Information System (INIS)

    Lee, Hyung Sik; Park, Hong Kyu; Moon, Chang Woo; Yoon, Seon Min; Hur, Won Joo; Jeong, Su Jin; Lee, Sang Hwa; Jeong, Min Ho; Park, Heon Joo

    1999-01-01

    The expression of p53, p21/WAF/CIP, Bcl-2, and Bax underlying the radiation-induced apoptosis in different pH environments using SCK mammary adenocarcinoma cell line was investigated. Mammary adenocarcinoma cells of A/J mice (SCK cells) in exponential growth phase were irradiated with a linear accelerator at room temperature. The cells were irradiated with 12 Gy and one hour later, the media was replaced with fresh media at a different pHs. After incubation at 37 .deg. for 0-48 h, the extent of apoptosis was determined using agarose gel electrophoresis and flow cytometry. The progression of cells through the cell cycle after irradiation in different pHs was also determined with flow cytometry. Western blot analysis was used to monitor p53, P21/WAF/CIP, BcI-2, and Bax protein levels. The induction of apoptosis by irradiation in pH 6.6 medium was markedly less than that in pH 7.5 medium. The radiation-induced G2/M arrest in pH 6.6 medium lasted markedly longer than that in pH 7.5 medium. Considerable amounts of p53 and p21 proteins already existed at pH 7.5 and increased the level of p53 and p21 significantly after 12 Gy X-irradiation. An incubation at pH6.6 after 12 Gy X-irradiation did not change the level of p53 and p21 protein levels significantly. BcI-2 proteins were not significantly affected by radiation and showed no correlation with cell susceptibility to radiation-induced apoptosis in different pHs. An exposure to 12 Gy of X-rays increased the level of Bax protein at pH 7.5 but at pH 6.6, it was slight. The molecular mechanism underlying radiation-induced apoptosis in different pH environments using SCK mammary adenocarcinoma cell line was dependent of the expression p53 and p21/WAF/CIP proteins. We may propose following hypothesis that an acidic stress augments the radiation-induced G2/M arrest, which inhibiting the irradiated cells undergo post-mitotic apoptosis. The effects of environmental acidity on anti-apoptotic and pro-apoptotic function of BcI-2

  10. Sulforaphane‐induced apoptosis in Xuanwei lung adenocarcinoma cell line XWLC‐05

    Science.gov (United States)

    Zhou, Lan; Yao, Qian; Huang, Yun‐chao; Jiang, Hua; Wang, Chuan‐qiong; Fan, Lei

    2016-01-01

    Background Xuanwei district in Yunnan Province has the highest incidence of lung cancer in China, especially among non‐smoking women. Cruciferous vegetables can reduce lung cancer risk by prompting a protective mechanism against respiratory tract inflammation caused by air pollution, and are rich in sulforaphane, which can induce changes in gene expression. We investigated the effect of sulforaphane‐induced apoptosis in Xuanwei lung adenocarcinoma cell line (XWCL‐05) to explore the value of sulforaphane in lung cancer prevention and treatment. Methods Cell growth inhibition was determined by methyl thiazolyl tetrazolium assay; cell morphology and apoptosis were observed under transmission electron microscope; cell cycle and apoptosis rates were detected using flow cytometry; B‐cell lymphoma 2 (Bcl‐2) and Bcl‐2‐like protein 4 (Bax) messenger RNA expression were determined by quantitative PCR; and p53, p73, p53 upregulated modulator of apoptosis (PUMA), Bax, Bcl‐2, and caspase‐9 protein expression were detected by Western blotting. Results Sulforaphane inhibited XWLC‐05 cell growth with inhibitory concentration (IC)50 of 4.04, 3.38, and 3.02 μg/mL at 24, 48, and 72 hours, respectively. Sulforaphane affected the XWLC‐05 cell cycle as cells accumulated in the G2/M phase. The proportion of apoptotic cells observed was 27.6%. Compared with the control, the sulforaphane group showed decreased Bcl‐2 and p53 expression, and significantly increased p73, PUMA, Bax, and caspase‐9 protein expression (P Sulforaphane induces Xuanwei lung adenocarcinoma cell apoptosis. Its possible mechanism may involve the upregulation of p73 expression and its effector target genes PUMA and Bax in lung cancer cells, downregulation of the anti‐apoptotic gene B cl ‐2, and activation of caspase‐9. It may also involve downregulation of the mutant p53 protein. PMID:27878984

  11. Cytokinetic effects of razoxane and relevance to radiopotentiation in a human adenocarcinoma cell line

    International Nuclear Information System (INIS)

    Norimah Yusof.

    1982-01-01

    Razoxane (+-1,2-bis (3,5-dioxopiperazin-1-yl)propane) or ICRF 159 has been shown to enhance the X-radiation sensitivity of a human colorectal adenocarcinoma cell line (HT29R) in culture if the cells were incubated with the drug for more than ten hours prior irradiation. Razoxane was shown not to interfere with repair of sublethal of potentially lethal damage of radiation. The radiosensitizing effect is therefore attributed to a reduced ability to accumulate such damage. As the effect was shown greater in exponential phase, which consists of greater proportion of dividing cells than plateau phase cells, it is believed that the drug (0.1 - 100 μg/ml) potentiates the effect of X-radiation in HT29R cells by pertubation in the cell cycle kinetics. Razoxane at low and high concentrations (5 and 100 μg/ml) was shown to delay the cell progression on cells entering mitosis. Chromosomes of drug-treated cells seemed to be unable to condense at the premitosis stage and cells with chromosomes resembling those in prophase were allowed to proceed through mitosis but progressed very slowly so that accumulation of mitotic cells were seen. Cells were than allowed to complete mitosis but frequently failed to undergo cytokinesis and subsequently produced many giant multinucleate cells. It is likely that the cells in mitosis and multinucleate cells are more radiosensitive. However, the mitotic delay was found to be reversible following progressive drug inactivation in the cells. Cells appeared to return to normal cell progression rate and division while the radiopotentiating effect was disappearing. The mechanism of drug action in inhibiting chromosome condensation was shown to involve the drug interference with histone H 1 phosphorylation. The inhibition of H 1 phosphorylation might reduce the cross-linking of the histone on DNA strands and thus preventing them from participating in supercoiling of the chromosome. (author)

  12. Mechanism of arctigenin-mediated specific cytotoxicity against human lung adenocarcinoma cell lines.

    Science.gov (United States)

    Susanti, Siti; Iwasaki, Hironori; Inafuku, Masashi; Taira, Naoyuki; Oku, Hirosuke

    2013-12-15

    The lignan arctigenin (ARG) from the herb Arctium lappa L. possesses anti-cancer activity, however the mechanism of action of ARG has been found to vary among tissues and types of cancer cells. The current study aims to gain insight into the ARG mediated mechanism of action involved in inhibiting proliferation and inducing apoptosis in lung adenocarcinoma cells. This study also delineates the cancer cell specificity of ARG by comparison with its effects on various normal cell lines. ARG selectively arrested the proliferation of cancer cells at the G0/G1 phase through the down-regulation of NPAT protein expression. This down-regulation occurred via the suppression of either cyclin E/CDK2 or cyclin H/CDK7, while apoptosis was induced through the modulation of the Akt-1-related signaling pathway. Furthermore, a GSH synthase inhibitor specifically enhanced the cytotoxicity of ARG against cancer cells, suggesting that the intracellular GSH content was another factor influencing the susceptibility of cancer cells to ARG. These findings suggest that specific cytotoxicity of ARG against lung cancer cells was explained by its selective modulation of the expression of NPAT, which is involved in histone biosynthesis. The cytotoxicity of ARG appeared to be dependent on the intracellular GSH level. Copyright © 2013 Elsevier GmbH. All rights reserved.

  13. Characterization of four clones derived from human adenocarcinoma cell line, HT29, and analysis of their response to sodium butyrate

    Czech Academy of Sciences Publication Activity Database

    Štokrová, Jitka; Šloncová, Eva; Sovová, Vlasta; Kučerová, Dana; Žíla, Vojtěch; Turečková, Jolana; Vojtěchová, Martina; Korb, Jan; Tuháčková, Zdena

    2006-01-01

    Roč. 28, č. 2 (2006), s. 559-565 ISSN 1019-6439 R&D Projects: GA AV ČR(CZ) KJB5052302 Institutional research plan: CEZ:AV0Z50520514 Keywords : adenocarcinoma * HT29 cell line * ultrastructure analysis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.556, year: 2006

  14. Nintedanib plus docetaxel as second-line therapy in patients with non-small-cell lung cancer of adenocarcinoma histology

    DEFF Research Database (Denmark)

    Popat, Sanjay; Mellemgaard, Anders; Reck, Martin

    2017-01-01

    PATIENTS & METHODS: We provide an update to a network meta-analysis evaluating the relative efficacy of nintedanib + docetaxel versus other second-line agents in adenocarcinoma histology non-small-cell lung cancer. RESULTS: Overall similarity of nintedanib + docetaxel versus ramucirumab + docetaxel...

  15. The identification of new genes related to cisplatin resistance in ovarian adenocarcinoma cell line A2780

    International Nuclear Information System (INIS)

    Solar, P.; Fedorocko, P.; Sytkowski, A.; Hodorova, I.

    2006-01-01

    Ovarian cancer cells are usually sensitive to platinum-based chemotherapy, such as cisplatin (CDDP), initially but typically become resistant to the drug over time. The phenomenon of clinical drug resistance represents a serious problem for successful disease treatment, and the molecular mechanism(s) are not fully understood. In search of novel mechanisms that may lead to the development of CDDP chemoresistance we have applied subtractive hybridization based on the PCR-select cDNA subtraction. In current study we have used subtractive hybridization to identify differentially-expressed genes in CDDP resistant CP70 and C200 cells versus CDDP-sensitive A2780 human ovarian adenocarcinoma cells. We have analyzed 256 randomly selected clones. Subtraction efficiency was determined by dot blot and DNA sequencing. Confirmation of differentially expressed cDNAs was done by virtual northern blot analysis, and 17 genes that were differentially expressed in both CDDP resistant cell lines versus CDDP sensitive A2780 cells were identified. The expression of 10 of these genes was undetectable or detected with low expression in sensitive A2780 cells in comparison to resistant ones. These genes included ARHGDIB, RANBP2, ASPH, PRTFDC1, SSX2IP, MBNL1, DNAJC15, MMP10, TCTE1L and one unidentified sequence. Additional 7 genes that were more highly expressed in resistant CP70 and C200 vs. A2780 cells included ANXA2, USP8, HSPCA, TRA1, CNAP1, ATP2B1 and COX2. Interestingly, multi-drug resistance associated p-glycoprotein (p170) was not detected by the western blot in CDDP resistant CP70 and C200 cells. Our identified genes are involved in diverse processes, such as stress response, chromatin condensation, protection from protein degradation, invasiveness of cells, alterations of Ca 2+ homeostasis and others which may contribute to CDDP resistance of ovarian adenocarcinoma cells. Further characterization of these genes and gene products should yield important insights into the biology of

  16. Antitumor activity of acriflavine in lung adenocarcinoma cell line A549.

    Science.gov (United States)

    Lee, Chia-Jen; Yue, Chia-Herng; Lin, Yu-Jie; Lin, Yu-Yu; Kao, Shao-Hsuan; Liu, Jer-Yuh; Chen, Yieng-How

    2014-11-01

    Aim/Materials and Methods: In order to develop better drugs against non-small cell lung cancer (NSCLC), we screened a variety of compounds and treated the human lung adenocarcinoma cell line A549 with different drug concentrations. We then examined the cell viability using the MTT assay. Data show that a new candidate drug, acriflavine (ACF), suppresses the viability of A549 cells in a concentration- and time-dependent manner. Flow cytometry analysis revealed that ACF significantly caused cell growth arrest in the G2/M phase on A549 cells. Moreover, ACF decreased Bcl-2 expression and increased Bax expression. The content of cleaved poly(ADP-ribose)polymerase-1 (PARP-1) and caspase-3 are significantly increased. These findings suggest that ACF is cytotoxic against A549 cells and suppresses A549 cells growth through the caspase-3 activation pathway. In the in vivo test, nude mice bearing A549 cells xenografts by intravenous injection were randomly assigned into two groups: control and experimental group. Treatment was initiated 10 days after implantation and intraperitoneal injection of 0.9% normal saline or 2 mg/kg of ACF was continued daily for five weeks. ACF treatment significantly decreased tumor size and tumor spots on lung surface of tumor-bearing mice. ACF can inhibit cell growth in A549 cells. Our results may assist on the delineation of the mechanism(s) leading to NSCLC cell growth inhibition and provide a new antitumor strategy against NSCLC. Copyright© 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  17. Sulforaphane-induced apoptosis in Xuanwei lung adenocarcinoma cell line XWLC-05.

    Science.gov (United States)

    Zhou, Lan; Yao, Qian; Li, Yan; Huang, Yun-Chao; Jiang, Hua; Wang, Chuan-Qiong; Fan, Lei

    2017-01-01

    Xuanwei district in Yunnan Province has the highest incidence of lung cancer in China, especially among non-smoking women. Cruciferous vegetables can reduce lung cancer risk by prompting a protective mechanism against respiratory tract inflammation caused by air pollution, and are rich in sulforaphane, which can induce changes in gene expression. We investigated the effect of sulforaphane-induced apoptosis in Xuanwei lung adenocarcinoma cell line (XWCL-05) to explore the value of sulforaphane in lung cancer prevention and treatment. Cell growth inhibition was determined by methyl thiazolyl tetrazolium assay; cell morphology and apoptosis were observed under transmission electron microscope; cell cycle and apoptosis rates were detected using flow cytometry; B-cell lymphoma 2 (Bcl-2) and Bcl-2-like protein 4 (Bax) messenger RNA expression were determined by quantitative PCR; and p53, p73, p53 upregulated modulator of apoptosis (PUMA), Bax, Bcl-2, and caspase-9 protein expression were detected by Western blotting. Sulforaphane inhibited XWLC-05 cell growth with inhibitory concentration (IC) 50 of 4.04, 3.38, and 3.02 μg/mL at 24, 48, and 72 hours, respectively. Sulforaphane affected the XWLC-05 cell cycle as cells accumulated in the G2/M phase. The proportion of apoptotic cells observed was 27.6%. Compared with the control, the sulforaphane group showed decreased Bcl-2 and p53 expression, and significantly increased p73, PUMA, Bax, and caspase-9 protein expression (P cell apoptosis. Its possible mechanism may involve the upregulation of p73 expression and its effector target genes PUMA and Bax in lung cancer cells, downregulation of the anti-apoptotic gene B cl -2, and activation of caspase-9. It may also involve downregulation of the mutant p53 protein. © 2016 The Authors. Thoracic Cancer published by China Lung Oncology Group and John Wiley & Sons Australia, Ltd.

  18. Transforming growth factor-β impairs glucocorticoid activity in the A549 lung adenocarcinoma cell line.

    Science.gov (United States)

    Salem, S; Harris, T; Mok, J S L; Li, M Y S; Keenan, C R; Schuliga, M J; Stewart, A G

    2012-08-01

    The lung adenocarcinoma cell line, A549, undergoes epithelial-mesenchymal cell transition (EMT) in response to TGF-β. Glucocorticoids do not prevent the EMT response, but TGF-β induced resistance to the cytokine-regulatory action of glucocorticoids. We sought to characterize the impairment of glucocorticoid response in A549 cells. A549 cells were exposed to TGF-β for up to 96 h before glucocorticoid treatment and challenge with IL-1α to assess glucocorticoid regulation of IL-6 and CXCL8 production. Nuclear localization of the glucocorticoid receptor α (GRα) was ascertained by immunofluorescence and Western blotting. Transactivation of the glucocorticoid response element (GRE) was measured with a transfected GRE-secreted human placental alkaline phosphatase reporter. TGF-β (40-400 pM) reduced the maximum inhibitory effect of dexamethasone on IL-1α-induced IL-6 and CXCL8 production. The impaired glucocorticoid response was detected with 4 h of TGF-β (40 pM) exposure (and 4 h IL-1α to induce CXCL8 expression) and therefore was not secondary to EMT, a process that requires longer incubation periods and higher concentrations of TGF-β. TGF-β also impaired dexamethasone regulation of granulocyte-macrophage colony-stimulating factor in thrombin-stimulated BEAS-2B epithelial cells. Impaired regulation of CXCL8 was associated with markedly reduced GRE transactivation and reduced induction of mRNA for IκBα, the glucocorticoid-inducible leucine zipper and the epithelial sodium channel (SCNN1A). The expression, cellular levels and nuclear localization of GRα were reduced by TGF-β. We have identified mechanisms underlying the impairment of responses to glucocorticoids by TGF-β in the A549 and BEAS-2B cell lines. © 2012 The Authors. British Journal of Pharmacology © 2012 The British Pharmacological Society.

  19. Curcumin induced autophagy anticancer effects on human lung adenocarcinoma cell line A549.

    Science.gov (United States)

    Liu, Furong; Gao, Song; Yang, Yuxuan; Zhao, Xiaodan; Fan, Yameng; Ma, Wenxia; Yang, Danrong; Yang, Aimin; Yu, Yan

    2017-09-01

    To investigate the anticancer effects of curcumin-induced autophagy and its effects on the human lung adenocarcinoma A549 cell line, inverted phase contrast microscopy was used to observe alterations to the cytomorphology of cells. An MTT assay was used to measure cell viability. Autophagy was detected using acridine orange (AO) staining and 3-methyladenine (3-MA) was used as an autophagy-specific inhibitor. Dose- and time-dependent A549 cell viability inhibition was observed following curcumin treatment. A dose-dependent increase in the red fluorescent structures in A549 cells was identified following curcumin treatment for 48 h through AO staining. In addition, the activation of autophagy was determined through changes in the number of autophagic vesicles (AVs; fluorescent particles) infected with monodansylcadaverine (MDC). The fluorescence intensity and density of AVs in the curcumin-treated groups were higher at 48 h compared with the control group. Finally, the MTT assay demonstrated that the survival rates of the curcumin-treated cells were increased when pretreated with 3-MA for 3 h, indicating that the inhibitory effect of curcumin on A549 cells is reduced following the inhibition of autophagy. Furthermore, AO and MDC staining confirmed that 3-MA does inhibit the induction of autophagy. Thus, it was hypothesized that the induction of autophagy is partially involved in the reduction of cell viability observed following curcumin treatment. The anticancer effects of curcumin on A549 cells can be reduced using autophagy inhibitors. This suggests a possible cancer therapeutic application of curcumin through the activation of autophagy. These findings have improved the understanding of the mechanism underlying the anticancer property of curcumin.

  20. Gene expression changes associated with Barrett's esophagus and Barrett's-associated adenocarcinoma cell lines after acid or bile salt exposure

    Directory of Open Access Journals (Sweden)

    Sahbaie Peyman

    2007-06-01

    Full Text Available Abstract Background Esophageal reflux and Barrett's esophagus represent two major risk factors for the development of esophageal adenocarcinoma. Previous studies have shown that brief exposure of the Barrett's-associated adenocarcinoma cell line, SEG-1, or primary cultures of Barrett's esophageal tissues to acid or bile results in changes consistent with cell proliferation. In this study, we determined whether similar exposure to acid or bile salts results in gene expression changes that provide insights into malignant transformation. Methods Using previously published methods, Barrett's-associated esophageal adenocarcinoma cell lines and primary cultures of Barrett's esophageal tissue were exposed to short pulses of acid or bile salts followed by incubation in culture media at pH 7.4. A genome-wide assessment of gene expression was then determined for the samples using cDNA microarrays. Subsequent analysis evaluated for statistical differences in gene expression with and without treatment. Results The SEG-1 cell line showed changes in gene expression that was dependent on the length of exposure to pH 3.5. Further analysis using the Gene Ontology, however, showed that representation by genes associated with cell proliferation is not enhanced by acid exposure. The changes in gene expression also did not involve genes known to be differentially expressed in esophageal adenocarcinoma. Similar experiments using short-term primary cultures of Barrett's esophagus also did not result in detectable changes in gene expression with either acid or bile salt exposure. Conclusion Short-term exposure of esophageal adenocarcinoma SEG-1 cells or primary cultures of Barrett's esophagus does not result in gene expression changes that are consistent with enhanced cell proliferation. Thus other model systems are needed that may reflect the impact of acid and bile salt exposure on the esophagus in vivo.

  1. Fourier transform infrared (FTIR) spectromicroscopic characterization of stem-like cell populations in human esophageal normal and adenocarcinoma cell lines.

    Science.gov (United States)

    Zhao, R; Quaroni, L; Casson, A G

    2010-01-01

    We have tested an approach to identify putative cancer stem cells that involves measurement of the infrared absorption spectrum of individual cells in an aqueous environment, and their subsequent classification using multivariate data analysis techniques. Two primary esophageal cell lines were characterized: the immortalized normal esophageal epithelial cell line, Het-1A, and the esophageal adenocarcinoma cell line, OE33. In addition, we also evaluated spheroids, reflecting stem-like cell populations, which were derived from each parent cell line when grown in serum-free media. As differences in cell size appeared to be a strong discriminating factor, a correction needs to be performed to allow a reliable classification based on infrared absorption spectra. We demonstrated that stem-like cells derived from Het-1A could easily be discriminated on the basis of absorbance differences in the 1000-1200 cm(-1) spectral interval, whereas this was not possible for OE33. Furthermore, we found that changes due to aging of OE33 cells in culture dominated the infrared absorption spectra and somewhat limited the potential of this approach to identify stem-like cell populations using this in vitro model system.

  2. Enhancement of Radiation Effects by Ursolic Acid in BGC-823 Human Adenocarcinoma Gastric Cancer Cell Line.

    Directory of Open Access Journals (Sweden)

    Yang Yang

    Full Text Available Recent research has suggested that certain plant-derived polyphenols, i.e., ursolic acid (UA, which are reported to have antitumor activities, might be used to sensitize tumor cells to radiation therapy by inhibiting pathways leading to radiation therapy resistance. This experiment was designed to investigate the effects and possible mechanism of radiosensitization by UA in BGC-823 cell line from human adenocarcinoma gastric cancer in vitro. UA caused cytotoxicity in a dose-dependent manner, and we used a sub-cytotoxicity concentration of UA to test radioenhancement efficacy with UA in gastric cancer. Radiosensitivity was determined by clonogenic survival assay. Surviving fraction of the combined group with irradiation and sub-cytotoxicity UA significantly decreased compared with the irradiation group. The improved radiosensitization efficacy was associated with enhanced G2/M arrest, increased reactive oxygen species (ROS, down-regulated Ki-67 level and improved apoptosis. In conclusion, as UA demonstrated potent antiproliferation effect and synergistic effect, it could be used as a potential drug sensitizer for the application of radiotherapy.

  3. Novel pancreatic cancer cell lines derived from genetically engineered mouse models of spontaneous pancreatic adenocarcinoma: applications in diagnosis and therapy.

    Directory of Open Access Journals (Sweden)

    María P Torres

    Full Text Available Pancreatic cancer (PC remains one of the most lethal human malignancies with poor prognosis. Despite all advances in preclinical research, there have not been significant translation of novel therapies into the clinics. The development of genetically engineered mouse (GEM models that produce spontaneous pancreatic adenocarcinoma (PDAC have increased our understanding of the pathogenesis of the disease. Although these PDAC mouse models are ideal for studying potential therapies and specific genetic mutations, there is a need for developing syngeneic cell lines from these models. In this study, we describe the successful establishment and characterization of three cell lines derived from two (PDAC mouse models. The cell line UN-KC-6141 was derived from a pancreatic tumor of a Kras(G12D;Pdx1-Cre (KC mouse at 50 weeks of age, whereas UN-KPC-960 and UN-KPC-961 cell lines were derived from pancreatic tumors of Kras(G12D;Trp53(R172H;Pdx1-Cre (KPC mice at 17 weeks of age. The cancer mutations of these parent mice carried over to the daughter cell lines (i.e. Kras(G12D mutation was observed in all three cell lines while Trp53 mutation was observed only in KPC cell lines. The cell lines showed typical cobblestone epithelial morphology in culture, and unlike the previously established mouse PDAC cell line Panc02, expressed the ductal marker CK19. Furthermore, these cell lines expressed the epithelial-mesenchymal markers E-cadherin and N-cadherin, and also, Muc1 and Muc4 mucins. In addition, these cell lines were resistant to the chemotherapeutic drug Gemcitabine. Their implantation in vivo produced subcutaneous as well as tumors in the pancreas (orthotopic. The genetic mutations in these cell lines mimic the genetic compendium of human PDAC, which make them valuable models with a high potential of translational relevance for examining diagnostic markers and therapeutic drugs.

  4. Escin reduces cell proliferation and induces apoptosis on glioma and lung adenocarcinoma cell lines.

    Science.gov (United States)

    Çiftçi, Gülşen Akalin; Işcan, Arzu; Kutlu, Mehtap

    2015-10-01

    Aesculus hippocastanum (the horse chestnut) seed extract has a wide variety of biochemical and pharmacological effects including anti-inflammatory, antianalgesic, and antipyretic activities. The main active compound of this plant is escin. It is known that several medicinal herbs with anti-inflammatory properties have been found to have a role in the prevention and treatment of cancer. In the present study, the cytotoxic effects of escin in the C6 glioma and A549 cell lines were analyzed by MTT. Apoptotic effects of escin on both cell lines were evaluated by Annexin V binding capacity with flow cytometric analysis. Structural and ultrastructural changes were also evaluated using transmission electron microscopy. The results indicated that escin has potent antiproliferative effects against C6 glioma and A549 cells. These effects are both dose and time dependent. Taken together, escin possesses cell cycle arrest on G0/G1 phase and selective apoptotic activity on A549 cells as indicated by increased Annexin V-binding capacity, bax protein expression, caspase-3 activity and morphological changes obtained from micrographs by transmission electron microscopy.

  5. Lung Adenocarcinomas and Lung Cancer Cell Lines Show Association of MMP-1 Expression With STAT3 Activation

    Directory of Open Access Journals (Sweden)

    Alexander Schütz

    2015-04-01

    Full Text Available Signal transducer and activator of transcription 3 (STAT3 is constitutively activated in the majority of lung cancer. This study aims at defining connections between STAT3 function and the malignant properties of non–small cell lung carcinoma (NSCLC cells. To address possible mechanisms by which STAT3 influences invasiveness, the expression of matrix metalloproteinase-1 (MMP-1 was analyzed and correlated with the STAT3 activity status. Studies on both surgical biopsies and on lung cancer cell lines revealed a coincidence of STAT3 activation and strong expression of MMP-1. MMP-1 and tyrosine-phosphorylated activated STAT3 were found co-localized in cancer tissues, most pronounced in tumor fronts, and in particular in adenocarcinomas. STAT3 activity was constitutive, although to different degrees, in the lung cancer cell lines investigated. Three cell lines (BEN, KNS62, and A549 were identified in which STAT3 activitation was inducible by Interleukin-6 (IL-6. In A549 cells, STAT3 activity enhanced the level of MMP-1 mRNA and stimulated transcription from the MMP-1 promoter in IL-6–stimulated A549 cells. STAT3 specificity of this effect was confirmed by STAT3 knockdown through RNA interference. Our results link aberrant activity of STAT3 in lung cancer cells to malignant tumor progression through up-regulation of expression of invasiveness-associated MMPs.

  6. The effects of combined treatment with sevoflurane and cisplatin on growth and invasion of human adenocarcinoma cell line A549.

    Science.gov (United States)

    Liang, Hua; Wang, Han Bing; Liu, Hong Zhen; Wen, Xian Jie; Zhou, Qiao Ling; Yang, Cheng Xiang

    2013-07-01

    Sevoflurane, an inhalational anesthetic, and cisplatin (DDP)-based chemotherapy have been widely used during lung cancer surgery. However, the effect of sevoflurane on the sensitivity of lung cancer cells to DDP chemotherapy remains unclear. In this study, the effects of combined treatment with sevoflurane and cisplatin on the growth and invasion of human lung adenocarcinoma A549 cell line have been investigated. The underlying mechanism has also been explored. In our experiment, A549 cells were treated with 2.5% sevoflurane, 10μmol/L DDP, or the co-treatment of sevoflurane and DDP for 4h, respectively. Cell proliferation was evaluated by the MTT assay and colony formation assay. Apoptosis was assessed by flow cytometry. Cell invasion was detected by Transwell assay. The expressions of X-linked inhibitor of apoptosis protein (XIAP), Survivin, matrix metalloproteinase (MMP)-2 and MMP-9 were determined by western blotting. Our results showed that sevoflurane combined with DDP resulted in a more pronounced inhibition of tumor cells growth and invasion as compared with either drug alone. Besides, XIAP, Survivin, MMP-2, and MMP-9 were downregulated more significantly by the co-treatment of the two drugs as compared to sevoflurane treatment or DDP treatment alone. Taken together, the growth-inhibitory and invasion-inhibitory synergy between sevoflurane and DDP in human adenocarcinoma A549 cell line was found in this study. Furthermore, we showed that the growth-inhibitory synergy between sevoflurane and DDP might be associated with the downregulation of XIAP and Survivin, and the invasion-inhibitory synergy between sevoflurane and DDP might be involved in the downregulation of MMP-2 and MMP-9. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  7. Inositol Hexakisphosphate Mediates Apoptosis in Human Breast Adenocarcinoma MCF-7 Cell Line via Intrinsic Pathway

    Science.gov (United States)

    Agarwal, Rakhee; Ali, Nawab

    2010-04-01

    Inositol polyphosphates (InsPs) are naturally occurring compounds ubiquitously present in plants and animals. Inositol hexakisphosphate (InsP6) is the most abundant among all InsPs and constitutes the major portion of dietary fiber in most cereals, legumes and nuts. Certain derivatives of InsPs also regulate cellular signaling mechanisms. InsPs have also been shown to reduce tumor formation and induce apoptosis in cancerous cells. Therefore, in this study, the effects of InsPs on apoptosis were studied in an attempt to investigate their potential anti-cancer therapeutic application and understand their mechanism of action. Acridine orange and ethidium bromide staining suggested that InsP6 dose dependently induced apoptosis in human breast adenocarcinoma MCF-7 cells. Among InsPs tested (InsP3, InsP4, InsP5, and InsP6), InsP6 was found to be the most effective in inducing apoptosis. Furthermore, effects of InsP6 were found most potent inducing apoptosis. Etoposide, the drug known to induce apoptosis in both in vivo and in vitro, was used as a positive control. Western blotting experiments using specific antibodies against known apoptotic markers suggested that InsP6 induced apoptotic changes were mediated via an intrinsic apoptotic pathway.

  8. INOSITOL HEXAKISPHOSPHATE MEDIATES APOPTOSIS IN HUMAN BREAST ADENOCARCINOMA MCF-7 CELL LINE VIA INTRINSIC PATHWAY

    International Nuclear Information System (INIS)

    Agarwal, Rakhee; Ali, Nawab

    2010-01-01

    Inositol polyphosphates (InsP s ) are naturally occurring compounds ubiquitously present in plants and animals. Inositol hexakisphosphate (InsP 6 ) is the most abundant among all InsP s and constitutes the major portion of dietary fiber in most cereals, legumes and nuts. Certain derivatives of InsP s also regulate cellular signaling mechanisms. InsP s have also been shown to reduce tumor formation and induce apoptosis in cancerous cells. Therefore, in this study, the effects of InsPs on apoptosis were studied in an attempt to investigate their potential anti-cancer therapeutic application and understand their mechanism of action. Acridine orange and ethidium bromide staining suggested that InsP 6 dose dependently induced apoptosis in human breast adenocarcinoma MCF-7 cells. Among InsP s tested (InsP 3 , InsP 4 , InsP 5 , and InsP 6 ), InsP 6 was found to be the most effective in inducing apoptosis. Furthermore, effects of InsP 6 were found most potent inducing apoptosis. Etoposide, the drug known to induce apoptosis in both in vivo and in vitro, was used as a positive control. Western blotting experiments using specific antibodies against known apoptotic markers suggested that InsP 6 induced apoptotic changes were mediated via an intrinsic apoptotic pathway.

  9. Human Genetic Relevance and Potent Antitumor Activity of Heat Shock Protein 90 Inhibition in Canine Lung Adenocarcinoma Cell Lines.

    Directory of Open Access Journals (Sweden)

    Francisco Clemente-Vicario

    Full Text Available It has been an open question how similar human and canine lung cancers are. This has major implications in availability of human treatments for dogs and in establishing translational models to test new therapies in pet dogs. The prognosis for canine advanced lung cancer is poor and new treatments are needed. Heat shock protein 90 (HSP90 is an ATPase-dependent molecular chaperone ubiquitously expressed in eukaryotic cells. HSP90 is essential for posttranslational conformational maturation and stability of client proteins including protein kinases and transcription factors, many of which are important for the proliferation and survival of cancer cells. We investigated the activity of STA-1474, a HSP90 inhibitor, in two canine lung cancer cell lines, BACA and CLAC.Comparative genomic hybridization analysis of both cell lines revealed genetic relevance to human non-small cell lung cancer. STA-1474 inhibited growth and induced apoptosis of both cell lines in a dose- and time-dependent manner. The ICs50 after 72 h treatment with STA-1474 were 0.08 and 0.11 μM for BACA and CLAC, respectively. When grown as spheroids, the IC50 of STA-1474 for BACA cells was approximately two-fold higher than when grown as a monolayer (0.348 μM vs. 0.168 μM, whereas CLAC spheroids were relatively drug resistant. Treatment of tumor-stromal fibroblasts with STA-1474 resulted in a dose-dependent decrease in their relative cell viability with a low IC50 of 0.28 μM.Here we first established that lung adenocarcinoma in people and dogs are genetically and biochemically similar. STA1474 demonstrated biological activity in both canine lung cancer cell lines and tumor-stromal fibroblasts. As significant decreases in relative cell viability can be achieved with nanomolar concentrations of STA-1474, investigation into the clinical efficacy of this drug in canine lung cancer patients is warranted.

  10. [Growing characteristic of breast adenocarcinoma suicide gene cell line T47D-tk and construction of subcutaneous xenografts].

    Science.gov (United States)

    Xu, Wen-Gui; Yang, Kun; Fang, Na; Dai, Dong; Yu, Jin-Pu; Wei, Feng; Song, Xiu-Yu; Zhu, Yan-Jia; Wang, Jian; Men, Xiao-Yuan; Zhang, Ying

    2009-02-17

    To further identify the breast adenocarcinoma cell line T47D-tk stably expressing the suicide gene HSV1-tk, observe its growing characteristics, and establish an animal model of implanted breast adenocarcinoma. Retroviral vector of HSV1-tk gene and breast carcinoma cell line T47D-tk stably expressing the HSV1-tk gene were established. Breast carcinoma cells of the lines T47D and T47D-tk were cultured, and observed by inverted microscope. Growth curve was drawn. Genomic DNA of T47D-tk cells was extracted, and amplified by PCR with HSV1-tk and HSV1-tk P2 as primers. Agarose gel electrophoresis was used to identify the HSV1tk gene. Suspensions of T47D and T47D-tk cells were inoculated subcutaneously at bilateral roots of foreleg of female BALB/c nude mice respectively. The growth of tumor was observed every day. PCR showed 1131 bp fragment in the T47D-tk genome, but not in the T47D genome. The numbers of growing T47D cells on days 3, and 7 were (10.00 +/- 1.30) x 10(3) and (19.25 +/- 0.66) x 10(3) respectively, not significantly different from those of the T47D-tk cells [(10.25 +/- 0.90) x 10(3) and (19.00 +/- 1.80) x 10(3) respectively, both P > 0.05]. The time needed for tumor formation after the inoculation of T47D cells was (9.67 +/- 0.33) d, not significantly different from that of the T47D-tk cells [(9.83 +/- 0.48) d, P > 0.05]. The tumor size 19 days after inoculation of the T47D cells was (72.17 +/- 25.88) mm(3), not significantly different from that of the T47D-tk cells [(70.66 +/- 22.16) mm(3), P > 0.05]. The T47D-tk cells have integrated the HSV1-tk gene without changing its growing characteristics. An animal model of implanted breast cancer has been successfully established. The T47D and T47D-tk subcutaneous xenografts offer the foundation for further study of gene imaging and gene therapy.

  11. Curcumin Effect on the Expressional Profile of OCT4, Nanog and Nucleostemin Genes in AGS (Adenocarcinoma Cancer Cell Line

    Directory of Open Access Journals (Sweden)

    Fahmideh Bagrezaei

    2016-07-01

    Full Text Available Background Curcumin is the natural yellow pigment in turmeric isolated from the rhizome of the plant Curcuma longa. Curcumin inhibits formation and invasive cancer cells and destroys cancer cells resistant to chemotherapeutic drugs. Objectives The purpose of this study was the survey of effects of different concentrations of alcoholic curcumin on the octamer-binding transcription factor 4 (OCT4 Nanog and Nucleostemin genes in the AGS (human gastric adenocarcinoma cell line. Materials and Methods In this experimental study the AGS cell line was cultured in RPMI-1640, supplemented with penicillin/streptomycin (100 U/mL and 100 mg/mL, respectively and 10% fetal bovine serum, at 37°C in a humidified atmosphere of 5% CO2. In 60 - 70% cell confluence, the cells were treated with curcumin concentration (20, 40, 100 μL and incubated for 24, 48 and 72 hours. Finally, total RNA were extracted and cDNA were synthesized and the expression of mentioned genes was detected. The data were analyzed by excel software. Results Expression rate of OCT4A, OCT4B, Nanog and Nucleostemin (GLN3 at concentrations less than 20 μg/mL were reduced but OCT4B1 expression showed increased by hours respectively. Conclusions The results showed that curcumin inhibited cell division; also, this study could be the basis for more extensive studies on the anti-cancer effect of the combined plants.

  12. In vitro selective growth inhibition of breast adenocarcinoma cell lines by Pseudomonas sp. UW4 metabolites

    Directory of Open Access Journals (Sweden)

    Maedeh Pasiar

    2016-12-01

    Full Text Available Background: Breast cancer is a malignant proliferation of epithelial cells that lining the ducts or lobules of the breast. It is the second common cancer, after lung cancer in women. Since growth inhibition is an important strategy in cancer treatment, many attempts are in program to find new apoptotic inducer agents. Today there is some reports about effect of metabolites of Pseudomonas on cancer cells, hence, metabolites of Pseudomonas sp. UW4, were isolated and anti-cancer and anti-microbial activity of these metabolites was studied. Methods: This experimental study was performed in cellular and developmental biology of Shahrekord Islamic Azad University from April 2015 to August 2015. Anti-microbial activity of metabolites of Pseudomonas sp. UW4 was tested against a pathogenic bacteria, including Escherichia coli, Bacillus cereus and Staphylococcus aureus. For anti-cancer activity, in this study SKBR3 cells and normal fibroblast cells (HU-02 were cultured in DMEM medium with 10% fetal bovine serum (FBS. The cells were treated by various concentrations of these metabolites 5, 10, 15 and 20 mg/ml for 24, 48 and 72 h. Cell viability was assessed by MTS assay. Cells were seeded at 5×103 cells/ml in 96 well plates and incubated for 24 hr. Then metabolites of bacteria were added, after indicated times MTS (20 µl was added and the absorbance was measured at 492 nm using ELISA plate reader. Results: Pseudomonas sp. UW4 was able to produce antimicrobial metabolites against Staphylococcus aureus. Metabolites decreases the viability of SKBR3 cell line in a time and dose dependent manner, so that the most effective concentration of this substance was 20 mg/ml and 72 h after treatment (P< 0.01. While Pseudomonas sp. UW4 in various concentrations had no significant effect on normal fibroblast cells (P= 0.24. Conclusion: Bioactive compounds produced by of Pseudomonas sp. UW4 could be used for elimination of infections and treatment of breast cancer SK

  13. Establishment and characterization of a new human pancreatic adenocarcinoma cell line with high metastatic potential to the lung

    International Nuclear Information System (INIS)

    Kalinina, Tatyana; Simon, Ronald; Otto, Benjamin; Dierlamm, Judith; Schwarzenbach, Heidi; Effenberger, Katharina E; Bockhorn, Maximilian; Izbicki, Jakob R; Yekebas, Emre F; Güngör, Cenap; Thieltges, Sabrina; Möller-Krull, Maren; Murga Penas, Eva Maria; Wicklein, Daniel; Streichert, Thomas; Schumacher, Udo; Kalinin, Viacheslav

    2010-01-01

    Pancreatic cancer is still associated with devastating prognosis. Real progress in treatment options has still not been achieved. Therefore new models are urgently needed to investigate this deadly disease. As a part of this process we have established and characterized a new human pancreatic cancer cell line. The newly established pancreatic cancer cell line PaCa 5061 was characterized for its morphology, growth rate, chromosomal analysis and mutational analysis of the K-ras, EGFR and p53 genes. Gene-amplification and RNA expression profiles were obtained using an Affymetrix microarray, and overexpression was validated by IHC analysis. Tumorigenicity and spontaneous metastasis formation of PaCa 5061 cells were analyzed in pfp -/- /rag2 -/- mice. Sensitivity towards chemotherapy was analysed by MTT assay. PaCa 5061 cells grew as an adhering monolayer with a doubling time ranging from 30 to 48 hours. M-FISH analyses showed a hypertriploid complex karyotype with multiple numerical and unbalanced structural aberrations. Numerous genes were overexpressed, some of which have previously been implicated in pancreatic adenocarcinoma (GATA6, IGFBP3, IGFBP6), while others were detected for the first time (MEMO1, RIOK3). Specifically highly overexpressed genes (fold change > 10) were identified as EGFR, MUC4, CEACAM1, CEACAM5 and CEACAM6. Subcutaneous transplantation of PaCa 5061 into pfp -/- /rag2 -/- mice resulted in formation of primary tumors and spontaneous lung metastasis. The established PaCa 5061 cell line and its injection into pfp -/- /rag2 -/- mice can be used as a new model for studying various aspects of the biology of human pancreatic cancer and potential treatment approaches for the disease

  14. Effects of X-ray irradiation on the expression of Pokemon gene in human lung adenocarcinoma cell line

    International Nuclear Information System (INIS)

    Liang Xiaofang; Zou Yue; Wang Lu; Jiang Qisheng; Li Fengsheng

    2012-01-01

    Objective: To study the dose and time effects of X-ray radiation on the expression of Pokemon gene and protein in human lung adenocarcinoma cell line A 549 . Methods: A 549 cells was exposed to different doses of X-ray (2, 4, 6 and 8 Gy), and the expression of Pokemon mRNA and protein of the cells was detected by using Quantitative real-time PCR and western-blotting at 2, 4, 8, 12, 24, and 48 h after irradiation. 3-( 4, 5-Dimethylthiazole-2-yl )-2, 5-diphenyltetrazolium bromide was used to detect the proliferation of A 549 cells at 1, 2, 3, 4, and 5 d after 2 Gy X-ray irradiation. The mock treated A 549 cells were used as the control. Results: The expression of Pokemon mRNA trended to decrease after irradiated with 4, 6 and 8 Gy in the earlier period and increased in the later period with statistical difference at the most time points (t =3.40 -154.76, P =0.000 -0.041). The expression of Pokemon protein trended to increase and reached the peak at 8 h after irradiated of 2, 4, 6 and 8 Gy with statistical difference at the most time points (t =4.18 - 89.64, P =0.000 - 0.039). Compared with the control, the proliferation of A 549 cells was significantly inhibited during 3 to 5 d after irradiation of 2 Gy (t =2.34 - 18.19, P =0.000 -0.040). Conclusions: X-ray irradiation may increase the expression of Pokemon mRNA and protein in A 549 cells, which might be correlated with radiation-resistance of A 549 cells. (authors)

  15. [Effect of Nm23-H1 Nuclear Localization on Proliferation of 
Human Lung Adenocarcinoma Cell Line A549].

    Science.gov (United States)

    Sheng, Ya; Xiong, Yanli; Xu, Mingfang; Kuang, Xunjie; Wang, Dong; Yang, Xueqin

    2017-04-20

    Recent studies have indicated that Nm23-H1 is found in the nucleus, but previous studies have been based on the overexpression or suppression of Nm23-H1 in the cytoplasm. Due to the lacking nuclear localization signal of Nm23-H1, these results cannot reflect or repeat cells in which Nm23-H1 mainly positioned in nuclei and whether they cause clinical biological effects. Therefore, to explore the effects of transposing Nm23-H1 from the cytoplasm to the nucleus during lung cancer cell proliferation, a vector with a nuclear localization signal of Nm23-H1 was constructed and A549 cells were transfected. Gene recombination technology was used to construct pLentis-CMV-NME1-IRES2-PURO lentiviral vectors using a nuclear localization signal sequence, and the recombinant plasmid was verified using restriction enzyme analysis and sequencing. Nm23-H1 positioning and expression were performed after the stably transfected A549 cells were assessed by Western blot and confocal laser scanning microscope. The A549 cell proliferation was assessed using a cell counting kit-8. Flow cytometry was performed to assess the cell cycle distribution of A549 cells. The directional Nm23-H1 lentiviral vector was successfully constructed within the nucleus. Compared with that of the empty vector group, the proliferation rates of the transfection groups at 72 h, 96 h, and 120 h were remarkably increased (PA549 cells in the G0/G1 phase proportion was 35.69%, which was higher than the 28.28% of the transfection group (t=1.461, P=0.217); furthermore, the transfection group of A549 cells in the G2/M phase proportion was 58.7% and that of the empty vector group was 31.30% (t=4.560, P=0.010). Human lung adenocarcinoma cell line A549 cells of Nm23-H1 nuclear localized mainly in the G2/M phase and the nuclear Nm23-H1 promoted A549 cell proliferation in vitro.

  16. Trans- and cis-2-phenylindole platinum(II) complexes as cytotoxic agents against human breast adenocarcinoma cell lines

    Science.gov (United States)

    Tomé, Maria; López, Concepción; González, Asensio; Ozay, Bahadir; Quirante, Josefina; Font-Bardía, Mercè; Calvet, Teresa; Calvis, Carme; Messeguer, Ramon; Baldomá, Laura; Badía, Josefa

    2013-09-01

    The synthesis and characterization of the new 2-phenylindole derivative: C8H3N-2-C6H5-3NOMe-5OMe (3c) and the trans- and cis-isomers of [Pt(3c)Cl2(DMSO)] complexes (4c and 5c, respectively) are described. The crystal structures of 4c·CH2Cl2 and 5c confirm: (a) the existence of a Pt-Nindole bond, (b) the relative arrangement of the Cl- ligands [trans- (in 4c) or cis- (in 5c)] and (c) the anti-(E) configuration of the oxime. The cytotoxic assessment of C8H3N-2-(C6H4-4‧R1)-3NOMe-5R2 [with R1 = R2 = H (3a); R1 = Cl, R2 = H (3b) and R1 = H, R2 = OMe (3c)] and the geometrical isomers of [Pt(L)Cl2(DMSO)] with L = 3a-3c [trans- (4a-4c) and cis- (5a-5c), respectively] against human breast adenocarcinoma cell lines (MDA-MB231 and MCF-7) is also reported and reveals that all the platinum(II) complexes (except 4a) are more cytotoxic than cisplatin in front of the MCF7 cell line. Electrophoretic DNA migration studies of the synthesized compounds in the absence and in the presence of topoisomerase-I have been performed, in order to get further insights into their mechanism of action.

  17. In vitro and in vivo studies on antitumor effects of gossypol on human stomach adenocarcinoma (AGS) cell line and MNNG induced experimental gastric cancer

    International Nuclear Information System (INIS)

    Gunassekaran, G.R.; Kalpana Deepa Priya, D.; Gayathri, R.; Sakthisekaran, D.

    2011-01-01

    Highlights: → Gossypol is a well known polyphenolic compound used for anticancer studies but we are the first to report that gossypol has antitumor effect on MNNG induced gastric cancer in experimental animal models. → Our study shows that gossypol inhibits the proliferation of AGS (human gastric adenocarcinoma) cell line. → In animal models, gossypol extends the survival of cancer bearing animals and also protects the cells from carcinogenic effect. → So we suggest that gossypol would be a potential chemotherapeutic and chemopreventive agent for gastric cancer. -- Abstract: The present study has evaluated the chemopreventive effects of gossypol on N-methyl-N'-nitro-N-nitrosoguanidine (MNNG)-induced gastric carcinogenesis and on human gastric adenocarcinoma (AGS) cell line. Gossypol, C 30 H 30 O 8 , is a polyphenolic compound that has anti proliferative effect and induces apoptosis in various cancer cells. The aim of this work was to delineate in vivo and in vitro anti-initiating mechanisms of orally administered gossypol in target (stomach) tissues and in human gastric adenocarcinoma (AGS) cell line. In vitro results prove that gossypol has potent cytotoxic effect and inhibit the proliferation of adenocarcinoma (AGS) cell line. In vivo results prove gossypol to be successful in prolonging the survival of MNNG induced cancer bearing animals and in delaying the onset of tumor in animals administrated with gossypol and MNNG simultaneously. Examination of the target (stomach) tissues in sacrificed experimental animals shows that administration of gossypol significantly reduces the level of tumor marker enzyme (carcino embryonic antigen) and pepsin. The level of Nucleic acid contents (DNA and RNA) significantly reduces, and the membrane damage of glycoprotein subsides, in the target tissues of cancer bearing animals, with the administration of gossypol. These data suggest that gossypol may create a beneficial effect in patients with gastric cancer.

  18. miR-197-3p-induced downregulation of lysine 63 deubiquitinase promotes cell proliferation and inhibits cell apoptosis in lung adenocarcinoma cell lines

    Science.gov (United States)

    Chen, Yang; Yang, Chunlu

    2018-01-01

    Lung adenocarcinoma (LUAD) is a common cause of cancer-associated mortality. The dysregulation of microRNA (miR) expression has been reported to induce lung carcinogenesis. In the present study, miR-197-3p upregulation was detected within LUAD tissues compared with in adjacent noncancerous tissues. The suppression of miR-197-3p expression was confirmed to inhibit proliferative ability and induce apoptosis of LUAD cell lines; miR-197-3p overexpression within the HBE cell line exhibited opposing effects. Via in silico modeling, western blot analyses and dual-luciferase assays, it was confirmed that miR-197-3p directly targets the lysine 63 deubiquitinase (CYLD) gene. In the present study, the expression of miR-197-3p was negatively associated with CYLD mRNA expression within LUAD cell lines. In conclusion, the findings of the present study have provided novel insight into the association of miR-197-3p with LUAD proliferation and apoptotic regulation; the miR-197-3p/CYLD axis may serve as a novel potential therapeutic target for the treatment of LUAD. PMID:29286108

  19. Effects of RNAi-mediated TUSC3 silencing on radiation-induced autophagy and radiation sensitivity of human lung adenocarcinoma cell line A549 under hypoxic condition.

    Science.gov (United States)

    Li, Ya-Guang; Liang, Nai-Xin; Qin, Ying-Zhi; Ma, Dong-Jie; Huang, Chang-Jin; Liu, Lei; Li, Shan-Qing

    2016-11-30

    This study examined the effects of RNAi-mediated TUSC3 silencing on radiation-induced autophagy and radiation sensitivity of human lung adenocarcinoma cell line A549 under hypoxic condition. Different CoCl 2 concentrations were used to treat A549 cells and establish a CoCl 2 -induced hypoxic model of A549 cells. MTT and clone formation assays were used to determine the effects of different concentrations of CoCl 2 on the growth and proliferation of A549 cells treated by different doses of X-ray irradiation. The siRNA-expressing vector was transfected by liposomes and for silencing of TUSC3. Flow cytometry was used to measure cell cycle changes and apoptosis rate. Real-time quantitative polymerase chain reaction (qRT-PCR) assay was performed to detect the expression of TUSC3 mRNA. Western blotting was applied to detect the changes of TUSC3, LC3, and p62 proteins under different CoCl 2 concentrations and after siRNA silencing of TUSC3. The TUSC3 levels in A549 cells increased under hypoxic conditions in a dose-dependent manner (P A549 cells and promoted apoptosis (P A549 cells showed significantly increased growth and proliferation and decreased apoptosis (P A549 cell growth and proliferation after radiotherapy under hypoxic condition, promoted apoptosis, increased G0/G1 phase cells, and reduced S phase cells (all P A549 lung adenocarcinoma cells.

  20. Okadaic acid inhibits cell multiplication and induces apoptosis in a549 cells, a human lung adenocarcinoma cell line.

    Science.gov (United States)

    Wang, Renjun; Lv, Lili; Zhao, Yunfeng; Yang, Nana

    2014-01-01

    This essay aims to research the effect of okadaic acid (OA) on A549 cell multiplication, and cell apoptosis induced by OA was observed by cell morphology. MTT assay, trypan blue exclusion test (TBET), Giemsa staining method and acridine orange (AO) fluorescence staining assay were applied. The results of cell survival evaluated by TBET and colorimetric assay with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) showed: The number of A549 cells was decreased in a dose-dependent manner. Cytomorphology observation of okadaic acid-treated cells showed that cells became shrinkage and turned round, some cells floated in the nutrient medium with nucleus agglutination broken, resulting in apoptotic bodies. Above-mentioned results indicated that OA exerted significantly inhibitory effect on A549 cell multiplication due to the apoptosis induced by OA.

  1. MicroRNA alterations in Barrett′s esophagus, esophageal adenocarcinoma, and esophageal adenocarcinoma cell lines following cranberry extract treatment: Insights for chemoprevention

    Directory of Open Access Journals (Sweden)

    Laura A Kresty

    2011-01-01

    Full Text Available Background: Aberrant expression of small noncoding endogenous RNA molecules known as microRNAs (miRNAs is documented to occur in multiple cancer types including esophageal adencarcinoma (EAC and its only known precursor, Barrett′s esophagus (BE. Recent studies have linked dysregulation of specific miRNAs to histological grade, neoplastic progression and metastatic potential. Materials and Methods: Herein, we present a summary of previously reported dysregulated miRNAs in BE and EAC tissues as well as EAC cell lines and evaluate a cranberry proanthocyanidin rich extract′s (C-PAC ability to modulate miRNA expression patterns of three human EAC cell lines (JHEso-Ad-1, OE33 and OE19. Results: A review of 13 published studies revealed dysregulation of 87 miRNAs in BE and EAC tissues, whereas 52 miRNAs have been reported to be altered in BE or EAC cell lines, with 48% overlap with miRNA changes reported in tissues. We report for the first time C-PAC-induced modulation of five miRNAs in three EAC cell lines resulting in 26 validated gene targets and identification of key signaling pathways including p53, angiogenesis, T-cell activation and apoptosis. Additionally, mutiple cancer related networks were ideintified as modulated by C-PAC utilizing Kyoto Encyclopedia of Genes and Genomes (KEGG, Protein Analysis Through Evolutionary Relationships (PANTHER, and MetaCore analysis tools. Conclusions: Study results support the cancer inhibitory potential of C-PAC is in part attributable to C-PAC′s ability to modify miRNA profiles within EAC cells. A number of C-PAC-modulated miRNAs have been been identified as dysregulated in BE and EAC. Further insights into miRNA dysregulation and modulation by select cancer preventive agents will support improved targeted interventions in high-risk cohorts.

  2. Melatonin inhibits the migration of human lung adenocarcinoma A549 cell lines involving JNK/MAPK pathway.

    Directory of Open Access Journals (Sweden)

    Qiaoyun Zhou

    Full Text Available OBJECTIVE: Melatonin, an indolamine produced and secreted predominately by the pineal gland, exhibits a variety of physiological functions, possesses antioxidant and antitumor properties. But, the mechanisms for the anti-cancer effects are unknown. The present study explored the effects of melatonin on the migration of human lung adenocarcinoma A549 cells and its mechanism. METHODS: MTT assay was employed to measure the viability of A549 cells treated with different concentrations of melatonin. The effect of melatonin on the migration of A549 cells was analyzed by wound healing assay. Occludin location was observed by immunofluorescence. The expression of occludin, osteopontin (OPN, myosin light chain kinase (MLCK and phosphorylation of myosin light chain (MLC, JNK were detected by western blots. RESULTS: After A549 cells were treated with melatonin, the viability and migration of the cells were inhibited significantly. The relative migration rate of A549 cells treated with melatonin was only about 20% at 24 h. The expression level of OPN, MLCK and phosphorylation of MLC of A549 cells were reduced, while the expression of occludin was conversely elevated, and occludin located on the cell surface was obviously increased. The phosphorylation status of JNK in A549 cells was also reduced when cells were treated by melatonin. CONCLUSIONS: Melatonin significantly inhibits the migration of A549 cells, and this may be associated with the down-regulation of the expression of OPN, MLCK, phosphorylation of MLC, and up-regulation of the expression of occludin involving JNK/MAPK pathway.

  3. Overexpression of miR-30a in lung adenocarcinoma A549 cell line inhibits migration and invasion via targeting EYA2

    Science.gov (United States)

    Yuan, Yuncang; Zheng, Shangyong; Li, Qian; Xiang, Xudong; Gao, Tangxin; Ran, Pengzhan; Sun, Lijuan; Huang, Qionglin; Xie, Fei; Du, Jing; Xiao, Chunjie

    2016-01-01

    MicroRNAs (miRNAs) are a class of small non-coding RNAs and closely related to the pathogenesis of cancers. Increasing evidence indicates that miR-30a plays a profound role during the development of cancers. However, the functions of miR-30a in non-small-cell lung cancer (NSCLC) are still ambiguous. Here we found that miR-30a was decreased in lung adenocarcinoma A549 cells and in tissue samples from 14 patients by qRT-PCR, and also found that overexpression of miR-30a in A549 cells inhibited migration and invasion but not cell proliferation and cell cycle progression by wound-healing assay, matrigel invasion assay, MTS-based cell proliferation assay, and flow cytometry-based cell cycle analysis, respectively. We further explored the potential mechanism of miR-30a-mediated gene regulation in lung adenocarcinoma cell lines. EYA2 is a predicted target of miR-30a, and it has been found that EYA2 expression is inhibited by miR-30a in breast cancer cells. We demonstrated that EYA2 is a direct target of miR-30a by using the dual-luciferase reporter assay in A549 cells and showed that EYA2 protein levels are inversely correlated with miR-30a expression in A549 and BEAS-2B cells. In addition, we also confirmed the rescue effects of EYA2 overexpression in A549 cells by cotransfection with EYA2 expression vector and miR-30a mimics. Taken together, our results demonstrate that overexpression of miR-30a in lung adenocarcinoma A549 cells can inhibit cell migration and invasion, which is partially attributed to the decrease of EYA2 expression. Our findings suggest that miR-30a may be used as a new potential target for the treatment of lung adenocarcinoma in the future. PMID:26837415

  4. Establishment of an experimental human lung adenocarcinoma cell line SPC-A-1BM with high bone metastases potency by 99mTc-MDP bone scintigraphy

    International Nuclear Information System (INIS)

    Yang Shunfang; Dong Qianggang; Yao Ming; Shi Meiping; Ye Jianding; Zhao Langxiang; Su Jianzhong; Gu Weiyong; Xie Wenhui; Wang Kankan; Du Yanzhi; Li Yao; Huang Yan

    2009-01-01

    Background: Bone metastasis is one of the most common clinical phenomena of late stage lung cancer. A major impediment to understanding the pathogenesis of bone metastasis has been the lack of an appropriate animal and cell model. This study aims to establish human lung adenocarcinoma cell line with highly bone metastases potency with 99m Tc-MDP bone scintigraphy. Methods: The human lung adenocarcinoma cancer cells SPC-A-1 were injected into the left cardiac ventricle of NIH-Beige-Nude-XID (NIH-BNX) immunodeficient mice. The metastatic lesions of tumor-bearing mice were imaged with 99m Tc-MDP bone scintigraphy on a Siemens multi-single photon emission computed tomography. Pinhole images were acquired on a GZ-B conventional gamma camera with a self-designed pinhole collimator. The mice with bone metastasis were sacrificed under deep anesthesia, and the lesions were resected. Bone metastatic cancer cells in the resected lesions were subjected for culture and then reinoculated into the NIH-BNX mice through left cardiac ventricle. The process was repeated for eight cycles to obtain a novel cell subline SPC-A-1BM. Real-time polymerase chain reaction (PCR) was used to compare the gene expression differences in the parental and SPC-A-1BM cells. Results: The bone metastasis sites were successfully revealed by bone scintigraphy. The established bone metastasis cell line SPC-A-1BM had a high potential to metastasize in bone, including mandible, humerus, thoracic vertebra, lumbar, femur, patella, ilium and cartilage rib. The expression level of vascular endothelial growth factor gene family, Bcl-2 and cell adhesion-related genes ECM1, ESM1, AF1Q, SERPINE2 and FN1 were examined. Gene expression difference was found between parental and bone-seeking metastasis cell SPC-A-1BM, which indicates SPC-A-1BM has metastatic capacity vs. its parental cells. Conclusion: SPC-A-1BM is a bone-seeking metastasis human lung adenocarcinoma cell line. Bone scintigraphy may be used as an

  5. Glucose-regulated protein 58 modulates β-catenin protein stability in a cervical adenocarcinoma cell line.

    Science.gov (United States)

    Liao, Chia-Jung; Wu, Tzu-I; Huang, Ya-Hui; Chang, Ting-Chang; Lai, Chyong-Huey; Jung, Shih-Ming; Hsueh, Chuen; Lin, Kwang-Huei

    2014-08-01

    Cervical cancer continues to threaten women's health worldwide, and the incidence of cervical adenocarcinoma (AD) is rising in the developed countries. Previously, we showed that glucose-regulated protein 58 (Grp58) served as an independent factor predictive of poor prognosis of patients with cervical AD. However, the molecular mechanism underlying the involvement of Grp58 in cervical carcinogenesis is currently unknown. DNA microarray and enrichment analysis were used to identify the pathways disrupted by knockdown of Grp58 expression. Among the pathway identified, the WNT signaling pathway was one of those that were significantly associated with knockdown of Grp58 expression in HeLa cells. Our experiments showed that β-catenin, a critical effector of WNT signaling, was stabilized thereby accumulated in stable Grp58 knockdown cells. Membrane localization of β-catenin was observed in Grp58 knockdown, but not control cells. Using a transwell assay, we found that accumulated β-catenin induced by Grp58 knockdown or lithium chloride treatment inhibited the migration ability of HeLa cells. Furthermore, an inverse expression pattern of Grp58 and β-catenin was observed in cervical tissues. Our results demonstrate that β-catenin stability is negatively regulated by Grp58 in HeLa cells. Overexpression of Grp58 may be responsible for the loss of or decrease in membranous β-catenin expression in cervical AD.

  6. Comparative proteome analysis of three mouse lung adenocarcinoma CMT cell lines with different metastatic potential by two-dimensional gel electrophoresis and mass spectrometry.

    Science.gov (United States)

    Zhang, Kelan; Wrzesinski, Krzysztof; Stephen, J Fey; Larsen, Peter Mose; Zhang, Xumin; Roepstorff, Peter

    2008-12-01

    Metastasis is a lethal attribute of a cancer and presents a continuing therapeutic challenge. Metastasis is a highly complex process and more knowledge about the mechanisms behind metastasis is highly desirable. Isogenic CMT cell lines were selected from a spontaneous mouse lung adenocarcinoma and characterized in vivo to have different metastatic potential. In this study, the comprehensive protein expression profiles of three of these CMT cell lines at passage 5, 15 and 35 were analyzed by 2-DE separation followed by MS identification. As a result, 82 and 40 unique proteins were found to be significantly up- or down-regulated between cell lines with different metastatic potential at passages 5 and 15, respectively. These proteins were identified by MS and most of them have previously been reported to be related to cancer development and/or metastasis. Bioinformatics analysis indicated that several of the proteins were involved in proteasome, cell-cycle and cell-communication pathways. Among them, some keratins, 14-3-3 proteins and 26S proteasome proteins were identified and their aberrant expression may be directly or indirectly involved in cancer development and metastasis. In conclusion, our comprehensive 2-DE-based proteomics studies revealed some candidate proteins, protein families and signaling pathways, which might be important in cancer development and metastasis.

  7. Extracellular Signals of a Human Epithelial Colorectal Adenocarcinoma (Caco-2) Cell Line Facilitate the Penetration of Pseudomonas aeruginosa PAO1 Strain through the Mucin Layer

    Science.gov (United States)

    Hayashi, Naoki; Yokotani, Atsushi; Yamamoto, Masami; Kososhi, Mariko; Morita, Mayu; Fukunishi, Chiaki; Nishizawa, Nagisa; Gotoh, Naomasa

    2017-01-01

    Pseudomonas aeruginosa can penetrate the layer of mucus formed by host intestinal epithelial cells, often resulting in sepsis in immunocompromised patients. We have previously demonstrated that P. aeruginosa can penetrate the mucin layer by flagellar motility and the degradation of the mucin layer. However, it remains unclear how P. aeruginosa initially recognizes epithelial cells. Using the human epithelial colorectal adenocarcinoma (Caco-2) cell line, we investigated extracellular signaling that could facilitate the penetration of P. aeruginosa through the mucin layer. The supernatant from Caco-2 cell cultures increased penetration of P. aeruginosa through an artificial mucin layer. The Caco-2 cell supernatant increased bacterial flagella-dependent swarming motility, but it did not influence P. aeruginosa growth or protease activity. Filtering of the Caco-2 cell supernatant indicated that proteins weighing Caco-2 cell supernatant attracted P. aeruginosa cells. Finally, we identified that growth-regulated oncogene-α (GRO-α) secreted by Caco-2 cells was a factor facilitating flagellar filament rotation and swarming motility, although it did not attract the bacteria. We conclude that penetration of the mucin layer by P. aeruginosa is facilitated by small proteins (Caco-2 cells, both by inducing acceleration of flagellar motility and increasing chemotaxis. PMID:28983473

  8. Knockdown of eukaryotic translation initiation factor 4E suppresses cell growth and invasion, and induces apoptosis and cell cycle arrest in a human lung adenocarcinoma cell line.

    Science.gov (United States)

    Chen, Baofu; Zhang, Bo; Xia, Lilong; Zhang, Jian; Chen, Yu; Hu, Quanteng; Zhu, Chengchu

    2015-12-01

    Eukaryotic translation initiation factor 4E (eIF4E) was shown to be upregulated in malignant human tumors. To assess the effect of downregulation of eIF4E on the proliferation and invasiveness of a human lung adenocarcinoma cell line, a short hairpin (sh)RNA targeting eIF4E was constructed and transfected into A549 human lung adenocarcinoma cells. The expression of eIF4E was determined by reverse transcription‑quantitative polymerase chain reaction and western blotting. Cell viability was assessed using a Cell Counting kit‑8, and apoptosis levels and cell cycle distribution were assessed by flow cytometry. Invasiveness was assessed using Transwell chambers. Transfection of the A549 cells with eIF4E targeting shRNA reduced the mRNA and protein expression levels of eIF4E by >70% 48 and 72 h following transfection, and eIF4E targeting shRNA‑transfected cells were significantly less viable compared with the cells transfected with scrambled shRNA. The rate of apoptosis was also significantly increased, significantly more cells were in the G0/G1 phase and fewer were in the S phase, indicating cell cycle arrest. The fraction of transfected cells migrating across Transwell inserts were also reduced. In conclusion, inhibition of eIF4E suppressed cell growth and invasion, induced apoptosis and cell cycle arrest, suggesting that eIF4E may be a potential therapeutic target in lung adenocarcinoma.

  9. γ-Synuclein confers both pro-invasive and doxorubicin-mediated pro-apoptotic properties to the colon adenocarcinoma LS 174T cell line.

    Science.gov (United States)

    Goh, Kai-Wey; Say, Yee-How

    2015-09-01

    γ-synuclein, a neuronal protein of the synuclein family, is involved in carcinogenesis. To investigate its role in colorectal cancer carcinogenesis, we overexpressed γ-synuclein in LS 174T colon adenocarcinoma cell line (termed LS 174T-γsyn). When compared with untransfected/mock transfectants, LS 174T-γsyn had higher mobility in scratch wound assay, tend to scatter more in cell-scattering assay, and had enhanced lamellipodia and filopodia formation in cell-spreading assay. Enhanced adhesion of LS 174T-γsyn to fibronectin and collagen and significantly higher proliferation rate showed that γ-synuclein was able to increase extracellular matrix interaction and promoted proliferation of LS 174T. Higher invasiveness of LS 174T-γsyn was evidenced by enhanced invasion to the bottom of the basement membrane in Boyden chamber assay. However, LS 174T-γsyn were significantly more vulnerable to doxorubicin, vincristine and hydrogen peroxide insults, via apoptotic cell death. LS 174T-γsyn also had reduced anchorage-independent growth as shown by reduced colony formation and reduced anoikis resistance. We found that overexpression of γ-synuclein confers both pro-invasive and doxorubicin-mediated pro-apoptotic properties to LS 174T, where the former was mediated through enhanced cyclic adenosine monophosphate response element binding protein (CREB) phosphorylation, while the latter involved hepatocyte growth factor (HGF) downregulation and subsequent downstream signalling pathways possibly involving extracellular signal-regulated kinases (ERK)1/2, p38α, c-Jun N-terminal kinase (JNK) pan and Signal Transducers and Activators of Transcription (STATs). This unexpected contrasting finding as compared to other similar studies on colon cancer cell lines might be correlated with the degree of tumour advancement from which the cell lines were derived from.

  10. Clinical Significance of T Lymphocyte Subset Changes After First Line Chemotherapy in Peripheral Blood from Patients with Advanced Stage Adenocarcinoma Cell Lung Cancer

    Directory of Open Access Journals (Sweden)

    Xiang YAN

    2012-03-01

    Full Text Available Background and objective The immune function disorder relates closely to the occurrence, metastasis, and prognosis of cancer. T lymphocyte subsets take an important role in immune function. We identified the dynamic changes of the immune system by investigating the levels of T lymphocyte subsets in peripheral blood of lung cancer patients with advanced stage adenocarcinoma undergoing first line chemotherapy. The results aided the search for rational chemo-immunotherapy strategies in lung cancer treatment. Methods Samples from 49 patients with pathologically demonstrated advanced stage adenocarcinoma cell lung cancer were compared with those from 33 healthy donors. Subsequently, the patients were separately treated with Docetaxol-based or Pemetrexed-based therapy. Peripheral blood samples at different time points after therapy were analyzed by flowcytometry. The lymphocyte subsets of the total lymphocytes were compared. Independent sample t test was used for the quantitative data analysis. Results The percentage of CD3+, CD3+CD4+, CD4+CD25+ cells of the lung cancer patients significantly varied from those of the healthy donors, the P values are 0.012, 0.034 and 0.006 separately. The CD3+ and CD3+CD4+ levels increased significantly on the 4th and 7th-10th day post-chemotherapy, which return to normal levels on the 21th day. The CD3+ level increased significantly both in the treatment group on all time points, while the CD3+, CD3+CD4+, CD4+/CD8+ levels significantly increased and the CD3+CD8+, CD8+CD28- levels significantly decreased on the 4th day in Pemetrexed group. The CD3+CD4+ levels increased significantly on the 4th and 7th-10th day and the CD3+CD8+, CD8+CD28- levels decreased on the 4th day in partial response group. Conclusion The immune function of advanced stage adenocarcinoma cell lung cancer patients was evidently suppressed, and was restored at the 4th day, followed by a reduction at the 21st day after chemotherapy. On the 4th day

  11. Vitamin E analogue, D-alpha tocopherol succinate, enhances x-ray induced growth delay of human adenocarcinoma cancer cell line

    International Nuclear Information System (INIS)

    Jaworska, A.; Ottesen, T.E.

    2003-01-01

    The purpose of this study was to assess the effects of d-alpha Tocopherol succinate (alpha-TS) in modifying radiation-induced viability reduction and apoptosis occurrence in the model for normal and cancer cells. Our hypothesis was that alpha-TS enhances the growth-inhibitory effect of x-irradiation in cancer cells and that the effect is more pronounced in these cells than in normal cells. Murine NIH 3T3 Swiss albino embryonic cells and HT29 human Caucasian colon adenocarcinoma cells were used in the experiments. Alpha-TS was added to the cultures 1 h prior to irradiation with doses of 2 or 5Gy of x-ray. After irradiation cells were incubated for 73 h. Trypan blue exclusion viability test and estimation of apoptosis and necrosis were made. Apoptotic and necrotic cells were counted in fluorescence microscope using fluorescence dyes: propidium iodide and Hoechst 33342. For experiments with the dose of 5 Gy at least five series of experiments were performed. At lower doses (up to approximately 25μM/ml) treatment with alpha-TS alone enhanced growth of both cell lines. At higher doses treatment with alpha-TS alone delayed the growth of the cell cultures, accompanied by 20-25% necrosis. At the concentrations higher than 25μM/mL alpha-TS alone caused growth delay of both cell cultures, being much more pronounced for the cancer cell line HT29. At the concentrations of 50 μM/mL, responsible for about 30-60% of growth delay, there was observed a synergy effect for x-rays and alpha-TS for both cell lines. The effect was more pronounced for HT29 cells (DMF=0.48 for HT29 versus DMF=0.73 for NIH 3T3). These results may confirm the views of the literature reports suggesting that use of vitamin E together with radiation could be favorable for colon cancer treatment; however, more experiments using more advanced techniques are needed

  12. Role of Estrogen and Progesterone in the Survival of Ovarian Tumors — A Study of the Human Ovarian Adenocarcinoma Cell Line OC-117-VGH

    Directory of Open Access Journals (Sweden)

    Kung-Chong Chao

    2005-08-01

    Conclusion: Based on the findings of decreased survival and/or growth in OC-117-VGH ovarian adenocarcinoma cells treated with either estrogen or progesterone, we suspect that both hormones act effectively against ER-negative and PR-negative ovarian cancer cells. These findings should lead to a reassessment of hormone therapy for ovarian cancers.

  13. Epithelial-to-Mesenchymal Transition in Pancreatic Ductal Adenocarcinoma and Pancreatic Tumor Cell Lines: The Role of Neutrophils and Neutrophil-Derived Elastase

    Directory of Open Access Journals (Sweden)

    Thomas Große-Steffen

    2012-01-01

    Full Text Available Pancreatic ductal adenocarcinoma (PDAC is frequently associated with fibrosis and a prominent inflammatory infiltrate in the desmoplastic stroma. Moreover, in PDAC, an epithelial-to-mesenchymal transition (EMT is observed. To explore a possible connection between the infiltrating cells, particularly the polymorphonuclear neutrophils (PMN and the tumor cell transition, biopsies of patients with PDAC (n=115 were analysed with regard to PMN infiltration and nuclear expression of β-catenin and of ZEB1, well-established indicators of EMT. In biopsies with a dense PMN infiltrate, a nuclear accumulation of β-catenin and of ZEB1 was observed. To address the question whether PMN could induce EMT, they were isolated from healthy donors and were cocultivated with pancreatic tumor cells grown as monolayers. Rapid dyshesion of the tumor cells was seen, most likely due to an elastase-mediated degradation of E-cadherin. In parallel, the transcription factor TWIST was upregulated, β-catenin translocated into the nucleus, ZEB1 appeared in the nucleus, and keratins were downregulated. EMT was also induced when the tumor cells were grown under conditions preventing attachment to the culture plates. Here, also in the absence of elastase, E-cadherin was downmodulated. PMN as well as prevention of adhesion induced EMT also in liver cancer cell line. In conclusion, PMN via elastase induce EMT in vitro, most likely due to the loss of cell-to-cell contact. Because in pancreatic cancers the transition to a mesenchymal phenotype coincides with the PMN infiltrate, a contribution of the inflammatory response to the induction of EMT and—by implication—to tumor progression is possible.

  14. Response of HT115, a highly invasive human colorectal adenocarcinoma cell line, to sodium butyrate treatment and glucose deprivation

    Czech Academy of Sciences Publication Activity Database

    Štokrová, Jitka; Sovová, Vlasta; Šloncová, Eva; Kučerová, Dana; Tuháčková, Zdena; Korb, Jan

    2005-01-01

    Roč. 26, č. 3 (2005), s. 793-799 ISSN 1019-6439 R&D Projects: GA AV ČR(CZ) KSK5020115 Keywords : HT115 cells * sodium butyrate * glucose deprivation Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.681, year: 2005

  15. The expression of NADPH oxidases and production of reactive oxygen species by human lung adenocarcinoma epithelial cell line A549

    Czech Academy of Sciences Publication Activity Database

    Kolářová, Hana; Binó, Lucia; Pejchalová, Kateřina; Kubala, Lukáš

    2010-01-01

    Roč. 56, č. 5 (2010), s. 211-217 ISSN 0015-5500 R&D Projects: GA ČR(CZ) GA524/06/1197; GA ČR(CZ) GA524/08/1753 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : lung epithelial cells * reactive oxygen species * NADPH oxidase Subject RIV: BO - Biophysics Impact factor: 0.729, year: 2010

  16. Molecular mechanisms of bortezomib resistant adenocarcinoma cells.

    Directory of Open Access Journals (Sweden)

    Erika Suzuki

    Full Text Available Bortezomib (Velcade™ is a reversible proteasome inhibitor that is approved for the treatment of multiple myeloma (MM. Despite its demonstrated clinical success, some patients are deprived of treatment due to primary refractoriness or development of resistance during therapy. To investigate the role of the duration of proteasome inhibition in the anti-tumor response of bortezomib, we established clonal isolates of HT-29 adenocarcinoma cells adapted to continuous exposure of bortezomib. These cells were ~30-fold resistant to bortezomib. Two novel and distinct mutations in the β5 subunit, Cys63Phe, located distal to the binding site in a helix critical for drug binding, and Arg24Cys, found in the propeptide region were found in all resistant clones. The latter mutation is a natural variant found to be elevated in frequency in patients with MM. Proteasome activity and levels of both the constitutive and immunoproteasome were increased in resistant cells, which correlated to an increase in subunit gene expression. These changes correlated with a more rapid recovery of proteasome activity following brief exposure to bortezomib. Increased recovery rate was not due to increased proteasome turnover as similar findings were seen in cells co-treated with cycloheximide. When we exposed resistant cells to the irreversible proteasome inhibitor carfilzomib we noted a slower rate of recovery of proteasome activity as compared to bortezomib in both parental and resistant cells. Importantly, carfilzomib maintained its cytotoxic potential in the bortezomib resistant cell lines. Therefore, resistance to bortezomib, can be overcome with irreversible inhibitors, suggesting prolonged proteasome inhibition induces a more potent anti-tumor response.

  17. MiRNA-145 increases therapeutic sensibility to gemcitabine treatment of pancreatic adenocarcinoma cells.

    Science.gov (United States)

    Lin, Yong; Ge, Xin; Wen, Yiyang; Shi, Zhu-Mei; Chen, Qiu-Dan; Wang, Min; Liu, Ling-Zhi; Jiang, Bing-Hua; Lu, Yuan

    2016-10-25

    Pancreatic adenocarcinoma is one of the most leading causes of cancer-related deaths worldwide. Although recent advances provide various treatment options, pancreatic adenocarcinoma has poor prognosis due to its late diagnosis and ineffective therapeutic multimodality. Gemcitabine is the effective first-line drug in pancreatic adenocarcinoma treatment. However, gemcitabine chemoresistance of pancreatic adenocarcinoma cells has been a major obstacle for limiting its treatment effect. Our study found that p70S6K1 plays an important role in gemcitabine chemoresistence. MiR-145 is a tumor suppressor which directly targets p70S6K1 for inhibiting its expression in pancreatic adenocarcinoma, providing new therapeutic scheme. Our findings revealed a new mechanism underlying gemcitabine chemoresistance in pancreatic adenocarcinoma cells.

  18. Modulation of cell cycle and gene expression in pancreatic tumor cell lines by methionine deprivation (methionine stress): implications to the therapy of pancreatic adenocarcinoma.

    Science.gov (United States)

    Kokkinakis, Demetrius M; Liu, Xiaoyan; Neuner, Russell D

    2005-09-01

    The effect of methionine deprivation (methionine stress) on the proliferation, survival, resistance to chemotherapy, and regulation of gene and protein expression in pancreatic tumor lines is examined. Methionine stress prevents successful mitosis and promotes cell cycle arrest and accumulation of cells with multiple micronuclei with decondensed chromatin. Inhibition of mitosis correlates with CDK1 down-regulation and/or inhibition of its function by Tyr(15) phosphorylation or Thr(161) dephosphorylation. Inhibition of cell cycle progression correlates with loss of hyperphosphorylated Rb and up-regulation of p21 via p53 and/or transforming growth factor-beta (TGF-beta) activation depending on p53 status. Although methionine stress-induced toxicity is not solely dependent on p53, the gain in p21 and loss in CDK1 transcription are more enhanced in wild-type p53 tumors. Up-regulation of SMAD7, a TGF-beta signaling inhibitor, suggests that SMAD7 does not restrict the TGF-beta-mediated induction of p21, although it may prevent up-regulation of p27. cDNA oligoarray analysis indicated a pleiotropic response to methionine stress. Cell cycle and mitotic arrest is in agreement with up-regulation of NF2, ETS2, CLU, GADD45alpha, GADD45beta, and GADD45gamma and down-regulation of AURKB, TOP2A, CCNA, CCNB, PRC1, BUB1, NuSAP, IFI16, and BRCA1. Down-regulation of AREG, AGTR1, M-CSF, and EGF, IGF, and VEGF receptors and up-regulation of GNA11 and IGFBP4 signify loss of growth factor support. PIN1, FEN1, and cABL up-regulation and LMNB1, AREG, RhoB, CCNG, TYMS, F3, and MGMT down-regulation suggest that methionine stress sensitizes the tumor cells to DNA-alkylating drugs, 5-fluorouracil, and radiation. Increased sensitivity of pancreatic tumor cell lines to temozolomide is shown under methionine stress conditions and is attributed in part to diminished O(6)-methylguanine-DNA methyltransferase and possibly to inhibition of the cell cycle progression.

  19. Tissue detection of natural killer cells in colorectal adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Patsouris Efstratios S

    2004-09-01

    Full Text Available Abstract Background Natural killer (NK cells represent a first line of defence against a developing cancer; however, their exact role in colorectal cancer remains undetermined. The aim of the present study was to evaluate the expression of CD16 and CD57 [immunohistochemical markers of natural NK cells] in colorectal adenocarcinoma. Methods Presence of NK cells was investigated in 82 colorectal adenocarcinomas. Immunohistochemical analysis was performed, using 2 monoclonal antibodies (anti-Fc Gamma Receptor II, CD16 and an equivalent to Leu-7, specific for CD-57. The number of immunopositive cells (% was evaluated by image analysis. The cases were characterized according to: patient gender and age, tumor location, size, grade, bowel wall invasion, lymph node metastases and Dukes' stage. Results NK cells were detected in 79/82 cases at the primary tumor site, 27/33 metastatic lymph nodes and 3/4 hepatic metastases; they were detected in levels similar to those reported in the literature, but their presence was not correlated to the clinical or pathological characteristics of the series, except for a negative association with the patients' age (p = 0.031. Conclusions Our data do not support an association of NK cell tissue presence with clinical or pathological variables of colorectal adenocarcinoma, except for a negative association with the patients' age; this might possibly be attributed to decreased adhesion molecule expression in older ages.

  20. Lycopene-rich extract from red guava (Psidium guajava L.) displays cytotoxic effect against human breast adenocarcinoma cell line MCF-7 via an apoptotic-like pathway.

    Science.gov (United States)

    Dos Santos, Raimunda C; Ombredane, Alicia S; Souza, Jéssica Maria T; Vasconcelos, Andreanne G; Plácido, Alexandra; Amorim, Adriany das G N; Barbosa, Eder Alves; Lima, Filipe C D A; Ropke, Cristina D; Alves, Michel M M; Arcanjo, Daniel D R; Carvalho, Fernando A A; Delerue-Matos, Cristina; Joanitti, Graziella A; Leite, José Roberto de S A

    2018-03-01

    This study investigated a lycopene-rich extract from red guava (LEG) for its chemical composition using spectrophotometry, mass spectrometry, attenuated total reflectance-fourier transform infrared spectroscopy (ATR-FTIR), and computational studies. The cytotoxic activity of LEG and the underlying mechanism was studied in human breast adenocarcinoma cells (MCF-7), murine fibroblast cells (NIH-3T3), BALB/c murine peritoneal macrophages, and sheep blood erythrocytes by evaluating the cell viability with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) method and flow cytometry. Spectrophotometry analysis showed that LEG contained 20% of lycopene per extract dry weight. Experimental and theoretical ATR-FTIR suggests the presence of lycopene, whereas MS/MS spectra obtained after fragmentation of the molecular ion [M] +• of 536.4364 show fragment ions at m/z 269.2259, 375.3034, 444.3788, and 467.3658, corroborating the presence of lycopene mostly related to all-trans configuration. Treatment with LEG (1600 to 6.25μg/mL) for 24 and 72h significantly affected the viability of MCF-7 cells (mean half maximal inhibitory concentration [IC 50 ]=29.85 and 5.964μg/mL, respectively) but not NIH-3T3 cells (IC 50 =1579 and 911.5μg/mL, respectively). Furthermore LEG at concentrations from 800 to 6.25μg/mL presented low cytotoxicity against BALB/c peritoneal macrophages (IC 50 ≥800μg/mL) and no hemolytic activity. LEG (400 and 800μg/mL) caused reduction in the cell proliferation and induced cell cycle arrest, DNA fragmentation, modifications in the mitochondrial membrane potential, and morphologic changes related to granularity and size in MCF-7 cells; however, it failed to cause any significant damage to the cell membrane or display necrosis or traditional apoptosis. In conclusion, LEG was able to induce cytostatic and cytotoxic effects on breast cancer cells probably via induction of an apoptotic-like pathway. Copyright © 2017. Published by Elsevier Ltd.

  1. Comparative proteome analysis of three mouse lung adenocarcinoma CMT cell lines with different metastatic potential by two-dimensional gel electrophoresis and mass spectrometry

    DEFF Research Database (Denmark)

    Zhang, Kelan; Wrzesinski, Krzysztof; Stephen, J Fey

    2008-01-01

    and characterized in vivo to have different metastatic potential. In this study, the comprehensive protein expression profiles of three of these CMT cell lines at passage 5, 15 and 35 were analyzed by 2-DE separation followed by MS identification. As a result, 82 and 40 unique proteins were found...

  2. Up regulation of K A I 1 gene expression and apoptosis effect of imatinib mesylate in gastric adenocarcinoma (AGS cell line

    Directory of Open Access Journals (Sweden)

    eyed Ataollah Sadat Shandiz

    2016-02-01

    Full Text Available Objective: To evaluate the effect of imatinib mesylate on KAI1 gene expression and apoptosis properties in human gastric carcinoma AGS cell line. Methods: Cell viability was assessed by MTT assay and quantitative real time PCR method was applied for investigation of Bax, Bcl-2, and KAI1 gene expression in AGS cells. The quantity of KAI1, Bax, and Bcl-2 compared to GAPDH gene expressions were examined using the formula 2-∆∆Ct. Furthermore, cell apoptosis/necrosis was carried out by annexin V/PI staining and quantified with flow cytometry after treatment with imatinib. Results: Imatinib mesylate was showed to have a dose-dependent toxicity effect against AGS cells. KAI1/GAPDH gene expression ratios were 1.07 ± 0.02 (P > 0.05, 1.68 ± 0.19 (P > 0.05, 3.60 ± 0.55 (P < 0.05, 6.54 ± 0.27 (P < 0.001 for 20, 50, 80 and 100 μmol/L of imatinib concentrations. The mRNA levels of Bax detected by real-time PCR after treatment with imatinib mesylate were significantly increased. Also, the number of apoptotic cells was increased from 3.72% (statistically significant; P < 0.05 in untreated AGS cells to 21.72%, 83.04% and 85.80%, respectively, following treatment with 20, 40, and 60 μmol/L imatinib mesylate. Conclusions: The results suggest that imatinib mesylate can induce apoptosis pathway in a dose-dependent mode and might modulate metastasis by up regulating KAI1 gene expression in human gastric carcinoma AGS cell line.

  3. Inhibition of Lipopolysaccharide-Induced Interleukin 8 in Human Adenocarcinoma Cell Line HT-29 by Spore Probiotics: B. coagulans and B. subtilis (natto).

    Science.gov (United States)

    Azimirad, Masoumeh; Alebouyeh, Masoud; Naji, Tahereh

    2017-03-01

    Probiotics are used as a treatment for different intestinal disorders. They confer health benefits by different ways. This study was aimed to investigate immunomodulatory effect of Bacillus probiotic spores on the production of lipopolysaccharide (LPS)-induced interleukin 8 (IL-8) in HT-29 intestinal epithelial cells. Differentiated intestinal epithelial cell line was used as a model for the study of colonization of purified spores (Bacillus subtilis (natto) and B. coagulans) and their anti-inflammatory effects. MTT assay and trypan blue staining were used for the detection of optimal concentration of the purified spores and LPS. Pre-treatment assay was done by treatment of the cells with the purified spores for 2 h, followed by challenges with LPS for 3 and 18 h. Post-treatment assay was done by initial treatment of the cells with LPS for 18 h, followed by the spores for 3 and 6 h. Levels of IL-8 secretion and its mRNA expression were measured by ELISA and relative Q real-time PCR. Our results showed similar rates of adherence to intestinal epithelial cells by the spore probiotics, while displaying no cytotoxic effect. In the pre-treatment assay, a significant decrease in IL-8, at both protein and mRNA levels, was measured for B. coagulans spores after the addition of LPS, which was higher than those observed for Bacillus subtilis (natto) spores. In the post-treatment assay, while Bacillus subtilis (but not B. coagulans) diminished the LPS-stimulated IL-8 levels after 3 h of incubation, the inhibitory effect was not constant. In conclusion, ability of Bacillus spore probiotics for adherence to intestinal epithelial cell and their anti-inflammatory effects, through interference with LPS/IL-8 signaling, was shown in this study. Further studies are needed to characterize responsible bacterial compounds associated with these effects.

  4. Characterization of a beta 1----3-N-acetylglucosaminyltransferase associated with synthesis of type 1 and type 2 lacto-series tumor-associated antigens from the human colonic adenocarcinoma cell line SW403.

    Science.gov (United States)

    Holmes, E H

    1988-01-01

    Previous studies have indicated that activation of a normally unexpressed beta 1----3-N-acetylglucosaminyltransferase is responsible for the accumulation of a wide diversity of both type 1 and 2 lacto-series antigens in human colonic adenocarcinomas. A beta 1----3-N-acetylglucosaminyltransferase has been solubilized from the human colonic adenocarcinoma cell line SW403 by 0.2% Triton X-100 and some of its properties have been studied. The enzyme was active over a broad pH range from 5.8 to 7.5 and had a strict requirement for Mn2+ as a divalent metal ion. Transfer of N-acetylglucosamine (GlcNAc) to lactosylceramide was optimal when assayed in the presence of a final concentration of Triton CF-54 of 0.3%. Inclusion of CDPcholine in the reaction mixture stimulated the activity by protecting the UDP[14C]GlcNAc from hydrolysis by endogenous enzymes. The kinetic parameters of the enzyme were studied. Km values for acceptors nLc4 and nLc6 were determined to be 0.19 mM for each. However, the Vmax values calculated for these acceptors were 150 and 110 pmol/h/mg protein for nLc4 and nLc6, respectively, suggesting reduced potential for further elongation as the chain length increases. The Km for UDPGlcNAc was determined to be 0.17 mM. Studies of the acceptor specificity have indicated transfer of GlcNAc occurs mainly to type 2 chain nonfucosylated structures. However, elongation of the type 1 chain structure Lc4 was also detected.

  5. Vaginal laparoscopically assisted radical trachelectomy in cervical clear cell adenocarcinoma.

    Science.gov (United States)

    Iacoponi, Sara; Diestro, Maria Dolores; Zapardiel, Ignacio; Serrano, María; Santiago, Javier De

    2013-01-01

    Adenocarcinoma of the cervix is a rare condition that has shown an increase in incidence, especially in the 20- to 34-year-old group. Adenocarcinoma represents about 5-10% of all tumours in this area, and, among these, the clear cell type accounts for 4-9%. This type of tumour affects mainly postmenopausal women but also occurs in young women with a history of prenatal exposure to diethylstilbestrol (DES). The prognosis for adenocarcinoma of the cervix is poor overall and worse for the clear cell variety. This article discusses a case of clear cell adenocarcinoma of the cervix, unrelated to intrauterine exposure to DES, in a woman of childbearing age who wished to preserve her fertility and was therefore treated by radical vaginal trachelectomy and pelvic lymphadenectomy.

  6. Curcumin Modulates Pancreatic Adenocarcinoma Cell-Derived Exosomal Function

    Science.gov (United States)

    Osterman, Carlos J. Diaz; Lynch, James C.; Leaf, Patrick; Gonda, Amber; Ferguson Bennit, Heather R.; Griffiths, Duncan; Wall, Nathan R.

    2015-01-01

    Pancreatic cancer has the highest mortality rates of all cancer types. One potential explanation for the aggressiveness of this disease is that cancer cells have been found to communicate with one another using membrane-bound vesicles known as exosomes. These exosomes carry pro-survival molecules and increase the proliferation, survival, and metastatic potential of recipient cells, suggesting that tumor-derived exosomes are powerful drivers of tumor progression. Thus, to successfully address and eradicate pancreatic cancer, it is imperative to develop therapeutic strategies that neutralize cancer cells and exosomes simultaneously. Curcumin, a turmeric root derivative, has been shown to have potent anti-cancer and anti-inflammatory effects in vitro and in vivo. Recent studies have suggested that exosomal curcumin exerts anti-inflammatory properties on recipient cells. However, curcumin’s effects on exosomal pro-tumor function have yet to be determined. We hypothesize that curcumin will alter the pro-survival role of exosomes from pancreatic cancer cells toward a pro-death role, resulting in reduced cell viability of recipient pancreatic cancer cells. The main objective of this study was to determine the functional alterations of exosomes released by pancreatic cancer cells exposed to curcumin compared to exosomes from untreated pancreatic cancer cells. We demonstrate, using an in vitro cell culture model involving pancreatic adenocarcinoma cell lines PANC-1 and MIA PaCa-2, that curcumin is incorporated into exosomes isolated from curcumin-treated pancreatic cancer cells as observed by spectral studies and fluorescence microscopy. Furthermore, curcumin is delivered to recipient pancreatic cancer cells via exosomes, promoting cytotoxicity as demonstrated by Hoffman modulation contrast microscopy as well as AlamarBlue and Trypan blue exclusion assays. Collectively, these data suggest that the efficacy of curcumin may be enhanced in pancreatic cancer cells through

  7. NR4A2 is regulated by gastrin and influences cellular responses of gastric adenocarcinoma cells.

    Directory of Open Access Journals (Sweden)

    Kristine Misund

    Full Text Available The peptide hormone gastrin is known to play a role in differentiation, growth and apoptosis of cells in the gastric mucosa. In this study we demonstrate that gastrin induces Nuclear Receptor 4A2 (NR4A2 expression in the adenocarcinoma cell lines AR42J and AGS-GR, which both possess the gastrin/CCK2 receptor. In vivo, NR4A2 is strongly expressed in the gastrin responsive neuroendocrine ECL cells in normal mucosa, whereas gastric adenocarcinoma tissue reveals a more diffuse and variable expression in tumor cells. We show that NR4A2 is a primary early transient gastrin induced gene in adenocarcinoma cell lines, and that NR4A2 expression is negatively regulated by inducible cAMP early repressor (ICER and zinc finger protein 36, C3H1 type-like 1 (Zfp36l1, suggesting that these gastrin regulated proteins exert a negative feedback control of NR4A2 activated responses. FRAP analyses indicate that gastrin also modifies the nucleus-cytosol shuttling of NR4A2, with more NR4A2 localized to cytoplasm upon gastrin treatment. Knock-down experiments with siRNA targeting NR4A2 increase migration of gastrin treated adenocarcinoma AGS-GR cells, while ectopically expressed NR4A2 increases apoptosis and hampers gastrin induced invasion, indicating a tumor suppressor function of NR4A2. Collectively, our results uncover a role of NR4A2 in gastric adenocarcinoma cells, and suggest that both the level and the localization of NR4A2 protein are of importance regarding the cellular responses of these cells.

  8. Growth inhibitory effect of the Src inhibitor dasatinib in combination with anticancer agents on uterine cervical adenocarcinoma cells.

    Science.gov (United States)

    Takiguchi, Eri; Nishimura, Masato; Mineda, Ayuka; Kawakita, Takako; Abe, Akiko; Irahara, Minoru

    2017-11-01

    Uterine cervical adenocarcinoma has a poor clinical prognosis when compared with squamous cell carcinoma. Therefore, the development of new treatment strategies for uterine cervical adenocarcinoma is necessary. Src is a proto-oncogene that is important in cancer progression. Dasatinib is a Src inhibitor that has been reported to be effective when used in combination with anticancer drugs. The present study aimed to confirm Src expression in human cervical adenocarcinoma cell lines and to determine the mechanism underlying the inhibitory effect of dasatinib on Src signaling in vitro . Western blot analysis was performed to investigate Src expression in cervical adenocarcinoma cell lines (HeLa and TCO-2 cells). The cells were cultured for 48 h with the addition of different concentrations of anticancer drugs (paclitaxel or oxaliplatin). Viable cell count was measured using a colorimetric (WST-1) assay. The concentrations of anticancer agents were fixed according to the results obtained, and the same experiments were performed using the drugs in combination with dasatinib at various concentrations to determine the concentrations that significantly affected the number of viable cells. The presence or absence of apoptosis was investigated using a caspase-3/7 assay. Signal transduction in each cell line was examined using western blotting. Src was activated in the two cell lines, and cell proliferation was significantly suppressed by each anticancer drug in combination with 10 µM dasatinib. Caspase-3/7 activity was also increased and Src signaling was suppressed by each anticancer drug in combination with dasatinib. In conclusion, Src is overexpressed in cervical adenocarcinoma cell lines, and dasatinib inhibits intracellular Src signaling and causes apoptosis. The results of the present study suggest that Src may be targeted in novel therapeutic strategies for cervical adenocarcinoma.

  9. Enhancement of radiosensitivity of recombinant Ad-p53 gene on human lung adenocarcinoma cell with different p53 status

    International Nuclear Information System (INIS)

    Pang Dequan; Wang Peiguo; Wang Ping; Zhang Weiming

    2008-01-01

    Objective: To investigate the enhancement of radiosensitivity of recombinant Ad-p53 gene on human lung adenocarcinoma cell lines(A549 and GLC-82) with different p53 status in vitro. Methods: Two human lung adenocarcinoma cell lines of A549 and GLC-82 were examined on their difference in p53 status with immunohistochemistry stain and PCR-SSCP technique. Expand Ad-wtp53 was transfected into tumor cells. Clonogenic assays were performed to evaluate the inhibition effect on cell growth and the degree of sensitization to irradiation. Apoptosis and cell cycle changes were determined using the flow cytometry assay. Results: The A549 cell line presented positive P53 expression while GLC-82 negative. GLC-82 bore mutant p53 on the exon 7. The wtp53 gene could be efficiently expressed in the two cell lines and greatly inhibit the cell growth. Its efficiency didn't depend on the intrinsic p53 genetic status. After irradiation, its function of inducing G 1 arrest and apoptosis on GLC-82 cell line was much stronger than the A549 cell line. In both the A549 and GLC-82 cell lines, the combination of Ad-p53 plus radiation resulted in more apoptosis than the others. There was no significant difference between two groups. Conclusions: Ad-p53 can depress the tumor growth and enhance the radiosensitivity of human lung adenocarcinoma cells. And this effect is independent of endogenous p53 status. (authors)

  10. Chylous ascites due to signet ring cell gastric adenocarcinoma

    African Journals Online (AJOL)

    2011-09-04

    Sep 4, 2011 ... He was underwent to medium chain triglycerides based diet, total parenteric diet and treatment with somatostatin ... esophageal, lung, colorectal, prostate or gastric cancer.[4,5]. Signet ring cell gastric adenocarcinoma is a .... pattern and performs subsequent analysis that disclosed high triglycerides levels.

  11. Mammalian mediator 19 mediates H1299 lung adenocarcinoma cell clone conformation, growth, and metastasis.

    Science.gov (United States)

    Xu, Lu-Lu; Guo, Shu-Liang; Ma, Su-Ren; Luo, Yong-Ai

    2012-01-01

    Mammalian mediator (MED) is a multi-protein coactivator that has been identified by several research groups. The involvement of the MED complex subunit 19 (MED 19) in the metastasis of lung adenocarcinoma cell line (H1299), which expresses the MED 19 subunit, was here investigated. When MED 19 expression was decreased by RNA interference H1299 cells demonstrated reduced clone formation, arrest in the S phase of the cell cycle, and lowered metastatic capacity. Thus, MED 19 appears to play important roles in the biological behavior of non-small cell lung carcinoma cells. These findings may be important for the development of novel lung carcinoma treatments.

  12. Plant extracts as natural photosensitizers in photodynamic therapy: in vitro activity against human mammary adenocarcinoma MCF-7 cells

    Directory of Open Access Journals (Sweden)

    Rigo Baluyot Villacorta

    2017-04-01

    Conclusions: Two of the plant extracts used, L. racemosa and A. procera were toxic and induced apoptosis to mammary cell adenocarcinoma, MCF-7 when photoactivated. These extracts were also more toxic to human cancer than non-cancer cell lines.

  13. Cell kinetic parameters of a solid mammary adenocarcinoma

    International Nuclear Information System (INIS)

    Porschen, R.; Feinendegen, L.E.

    1978-01-01

    Several cell kinetic parameters of the mammary adenocarcinoma EO 771 were evaluated by means of tumor volume measurements and of 125 I-UdR. The in-situ measured activity loss rate is disturbed by a slow elimination of labelled necrotic cells and by reutilization of 125 I-UdR. The restrictions of the I-UdR method are mentioned and the measured activity loss rates are compared with calculated volume loss rates. (orig./MG) [de

  14. Synchronous adenocarcinoma and mantle cell lymphoma of the colon.

    Science.gov (United States)

    Padmanabhan, Vijayalakshmi; Trainer, Thomas D

    2003-02-01

    Synchronous occurrence of malignant lymphoma and carcinoma, both located in the intestinal tract, is unusual. We report a unique case of an adenocarcinoma of the cecum and a simultaneous mantle cell lymphoma of the colon, terminal ileum, and regional lymph nodes in an 85-year-old man. Grossly, the adenocarcinoma was identified as a cecal mass. Lymphomatous involvement of the gastrointestinal tract was evident only on microscopic examination. The terminal ileum and colon showed microscopic disseminated multiple mucosal nodules, with involvement of the regional lymph nodes. There was no involvement of distant organs, suggesting that the mantle cell lymphoma was early in its evolution without formation of polyps or a mass lesion. To our knowledge, this is the fourth reported case with this association and the second case that showed early involvement of the gastrointestinal tract with mantle cell lymphoma without polyp formation.

  15. Different molecular organization of two carotenoids, lutein and zeaxanthin, in human colon epithelial cells and colon adenocarcinoma cells

    Science.gov (United States)

    Grudzinski, Wojciech; Piet, Mateusz; Luchowski, Rafal; Reszczynska, Emilia; Welc, Renata; Paduch, Roman; Gruszecki, Wieslaw I.

    2018-01-01

    Two cell lines, human normal colon epithelial cells (CCD 841 CoTr) and human colon adenocarcinoma cells (HT-29) were cultured in the presence of exogenous carotenoids, either zeaxanthin or lutein. Both carotenoids demonstrated cytotoxicity with respect to cancer cells but not to normal cells. Cells from both the cell lines were analyzed with application of fluorescence lifetime imaging microscopy and Raman scattering microscopy. Both imaging techniques show effective incorporation of carotenoid molecules into growing cells. Comparison of the Raman scattering and fluorescence lifetime characteristics reveals different molecular organization of carotenoids in the carcinoma and normal cells. The main difference consists in a carotenoid aggregation level which is substantially lower in the carcinoma cells as compared to the normal cells. Different molecular organization of carotenoids was interpreted in terms of a different metabolism of normal and carcinoma cells and has been concluded to provide a possibility of cancer diagnosis based on spectroscopic analyses.

  16. Treatment of squamous cell and adenocarcinoma of the esophagus

    Directory of Open Access Journals (Sweden)

    Rathbone B

    2012-11-01

    Full Text Available Barrie Rathbone,1 Janusz Jankowski,2 Michael Rathbone31University Hospitals of Leicester, Leicester, 2Sir James Black Professor Queen Mary University of London, 3St George's University of London, London, United KingdomAbstract: Esophageal cancer is the sixth commonest cause of cancer death worldwide. It predominantly occurs in two histological types, ie, squamous cell carcinoma and adenocarcinoma, each with its own distinct geographical distribution and natural history. The incidence of esophageal adenocarcinoma is rising, as is that of its precursor lesion, Barrett's esophagus, which consists of metaplastic change in the squamous mucosa of the esophagus in response to damage by gastroesophageal reflux disease. The principal risk factors for esophageal cancer are cigarette smoking and alcohol consumption, reflux disease, and obesity. In tumors without local invasion or distant metastases, surgery remains the treatment option of choice, although there are considerable differences of opinion regarding the roles of chemotherapy and radiotherapy. A wide variety of endoscopic treatments are available for dysplastic lesions and palliation. Despite the availability of increasingly complex imaging modalities and expensive and possibly ineffective attempts at screening, the evidence base is conflicted and the prognosis remains poor. However, from a recent large systematic review, three clear recommendations can be made, ie, use of endoscopic resection for high grade dysplasia, use of radiofrequency ablation for residual premalignant lesions, and, finally, prevention of risk factors for cancer, such as smoking, alcohol consumption, and obesity.Keywords: cancer, Barrett's, esophagus, squamous cell carcinoma, adenocarcinoma

  17. Comparison of erlotinib and pemetrexed as second-/third-line treatment for lung adenocarcinoma patients with asymptomatic brain metastases

    Directory of Open Access Journals (Sweden)

    He YY

    2016-04-01

    Full Text Available Yayi He,1,* Wenwen Sun,2,* Yan Wang,3,* Shengxiang Ren,1 Xuefei Li,3 Jiayu Li,3 Christopher J Rivard,4 Caicun Zhou,1 Fred R Hirsch4 1Department of Oncology, Shanghai Pulmonary Hospital, 2Clinic and Research Center of Tuberculosis, Shanghai Key Laboratory of Tuberculosis, Shanghai Pulmonary Hospital, 3Department of Lung Cancer and Immunology, Shanghai Pulmonary Hospital, Tongji University Medical School Cancer Institute, Tongji University School of Medicine, Shanghai, People’s Republic of China; 4Division of Medical Oncology, Department of Medicine, University of Colorado, Aurora, CO, USA *These authors contributed equally to this work Objective: Brain metastases occur in one-third of all non-small-cell lung cancer patients. Due to restrictive transport at the blood–brain barrier, many drugs provide poor control of metastases in the brain. The aim of this study was to compare erlotinib with pemetrexed as second-/third-line treatment in patients with lung adenocarcinoma with asymptomatic brain metastases.Methods: From January 2012 to June 2014, all lung adenocarcinoma patients with asymptomatic brain metastases who received treatment with erlotinib or pemetrexed as second-/third-line treatment were retrospectively reviewed. Chi-square and log-rank tests were used to perform statistical analysis.Results: The study enrolled 99 patients, of which 44 were positive for EGFR mutation. Median progression-free survival (PFS in months was not significantly different between the erlotinib- and pemetrexed-treated groups (4.2 vs 3.4 months; 95% confidence interval [CI]: 2.01–6.40 vs 2.80–5.00, respectively; P=0.635. Median PFS was found to be significantly longer in EGFR mutation–positive patients in the erlotinib-treated group (8.0 months; 95% CI 5.85–10.15 compared to the pemetrexed group (3.9 months; 95% CI: 1.25–6.55; P=0.032. The most common treatment-related side effect was mild-to-moderate rash and the most common drug-related side

  18. Primary signet cell adenocarcinoma of bladder

    Directory of Open Access Journals (Sweden)

    Prateek Kinra

    2017-01-01

    Full Text Available Primary signet cell cancer of the urinary bladder is a relatively rare entity. Since there is no mucinous epithelium in the bladder, It is proposed that the tumor arises from metaplastic urothelium. Two thirds of the tumours are mucin secreting, in most of which the site of the deposition is either extracellular or intracellular displacing the nucleus to a peripheral crescent, giving the cells a signet ring appearance. The tumours are most often infiltrative and diffusely involving the majority of the bladder akin to its name sake in stomach. It is essential to distinguish this carcinoma from gastrointestinal metastases as different therapeutic strategies are often necessary.

  19. Increased risk of gastric adenocarcinoma after treatment of primary gastric diffuse large B-cell lymphoma

    International Nuclear Information System (INIS)

    Inaba, Koji; Morota, Madoka; Mayahara, Hiroshi; Ito, Yoshinori; Sumi, Minako; Uno, Takashi; Itami, Jun; Kushima, Ryoji; Murakami, Naoya; Kuroda, Yuuki; Harada, Ken; Kitaguchi, Mayuka; Yoshio, Kotaro; Sekii, Shuhei; Takahashi, Kana

    2013-01-01

    There have been sporadic reports about synchronous as well as metachronous gastric adenocarcinoma and primary gastric lymphoma. Many reports have dealt with metachronous gastric adenocarcinoma in mucosa-associated lymphoid tissue lymphoma of stomach. But to our knowledge, there have been no reports that document the increased incidence of metachronous gastric adenocarcinoma in patients with gastric diffuse large B-cell lymphoma. This retrospective study was conducted to estimate the incidence of metachronous gastric adenocarcinoma after primary gastric lymphoma treatment, especially in diffuse large B-cell lymphoma. The retrospective cohort study of 139 primary gastric lymphoma patients treated with radiotherapy at our hospital. Mean observation period was 61.5 months (range: 3.7-124.6 months). Patients profile, characteristics of primary gastric lymphoma and metachronous gastric adenocarcinoma were retrieved from medical records. The risk of metachronous gastric adenocarcinoma was compared with the risk of gastric adenocarcinoma in Japanese population. There were 10 (7.2%) metachronous gastric adenocarcinoma patients after treatment of primary gastric lymphomas. It was quite high risk compared with the risk of gastric carcinoma in Japanese population of 54.7/100,000. Seven patients of 10 were diffuse large B-cell lymphoma and other 3 patients were mixed type of diffuse large B-cell lymphoma and mucosa associated lymphoid tissue lymphoma. Four patients of 10 metachronous gastric adenocarcinomas were signet-ring cell carcinoma and two patients died of gastric adenocarcinoma. Metachronous gastric adenocarcinoma may have a more malignant potential than sporadic gastric adenocarcinoma. Old age, Helicobacter pylori infection and gastric mucosal change of chronic gastritis and intestinal metaplasia were possible risk factors for metachronous gastric adenocarcinoma. There was an increased risk of gastric adenocarcinoma after treatment of primary gastric lymphoma

  20. Nonsense and missense mutation of mitochondrial ND6 gene promotes cell migration and invasion in human lung adenocarcinoma

    International Nuclear Information System (INIS)

    Yuan, Yang; Wang, Weixing; Li, Huizhong; Yu, Yongwei; Tao, Jin; Huang, Shengdong; Zeng, Zhiyong

    2015-01-01

    Previous study showed that mitochondrial ND6 (mitND6) gene missense mutation resulted in NADH dehydrogenase deficiency and was associated with tumor metastasis in several mouse tumor cell lines. In the present study, we investigated the possible role of mitND6 gene nonsense and missense mutations in the metastasis of human lung adenocarcinoma. The presence of mitND6 gene mutations was screened by DNA sequencing of tumor tissues from 87 primary lung adenocarcinoma patients and the correlation of the mutations with the clinical features was analyzed. In addition, we constructed cytoplasmic hybrid cells with denucleared primary lung adenocarcinoma cell as the mitochondria donor and mitochondria depleted lung adenocarcinoma A549 cell as the nuclear donor. Using these cells, we studied the effects of mitND6 gene nonsense and missense mutations on cell migration and invasion through wounding healing and matrigel-coated transwell assay. The effects of mitND6 gene mutations on NADH dehydrogenase activity and ROS production were analyzed by spectrophotometry and flow cytometry. mitND6 gene nonsense and missense mutations were detected in 11 of 87 lung adenocarcinoma specimens and was correlated with the clinical features including age, pathological grade, tumor stage, lymph node metastasis and survival rate. Moreover, A549 cell containing mitND6 gene nonsense and missense mutation exhibited significantly lower activity of NADH dehydrogenase, higher level of ROS, higher capacity of cell migration and invasion, and higher pAKT and pERK1/ERK2 expression level than cells with the wild type mitND6 gene. In addition, NADH dehydrogenase inhibitor rotenone was found to significantly promote the migration and invasion of A549 cells. Our data suggest that mitND6 gene nonsense and missense mutation might promote cell migration and invasion in lung adenocarcinoma, probably by NADH dehydrogenase deficiency induced over-production of ROS

  1. 5-Fluorouracil-radiation interactions in human colon adenocarcinoma cells

    International Nuclear Information System (INIS)

    Buchholz, Daniel J.; Lepek, Katherine J.; Rich, Tyvin A.; Murray, David

    1995-01-01

    Purpose: To determine the effect of cellular proliferation and cell cycle stage on the ability of postirradiation 5-fluorouracil (5-FU) to radiosensitize cultured human colon adenocarcinoma Clone A cells. Methods and Materials: Cell survival curves were generated for irradiated: (a) log- and plateau-phase Clone A cells; and (b) Clone A cells separated by centrifugal elutriation into the various phases of the cell cycle; with and without postirradiation treatment with 100 μg/ml 5-FU. Results: Postirradiation treatment with 5-FU sensitized proliferating cells to a greater degree than it sensitized cells growing in plateau phase. The β component of cell kill in log-phase cells was increased by a factor of 1.5 with a sensitizer enhancement ratio of 1.21 at the 0.01 survival level. Plateau-phase cells showed less radiosensitization (sensitizer enhancement ratio of 1.13 at the 0.01 survival level); however, there was a mild increase in both α and β kill in plateau-phase cells. Elutriated G 1 cells were the most radiosensitive, independent of treatment with 5-FU. The phase of the cell cycle had little effect on the ability of fluorouracil to radiosensitize Clone A cells. Conclusion: Proliferating cells are more susceptible to radiosensitization with 5-FU than plateau-phase cells are, but this effect appears to be independent of the phase of the cell cycle

  2. Emerging immunotherapeutics in adenocarcinomas: A focus on CAR-T cells.

    Science.gov (United States)

    Yazdanifar, Mahboubeh; Zhou, Ru; Mukherjee, Pinku

    2016-01-01

    More than 80% of all cancers arise from epithelial cells referred to as carcinomas. Adenocarcinomas are the most common type of carcinomas arising from the specialized epithelial cells that line the ducts of our major organs. Despite many advances in cancer therapies, metastatic and treatment-refractory cancers remain the 2 nd leading cause of death. Immunotherapy has offered potential opportunities with specific targeting of tumor cells and inducing remission in many cancer patients. Numerous therapies using antibodies as antagonists or checkpoint inhibitors/immune modulators, peptide or cell vaccines, cytokines, and adoptive T cell therapies have been developed. The most innovative immunotherapy approach so far has been the use of engineered T cell, also referred to as chimeric antigen receptor T cells (CAR-T cells). CAR-T cells are genetically modified naïve T cells that express a chimeric molecule which comprises of the antigen-recognition domains (scFv) of an anti-tumor antibody and one, two, or three intracellular signaling domains of the T cell receptor (TCR). When these engineered T cells recognize and bind to the tumor antigen target via the scFv fragment, a signal is sent to the intracellular TCR domains of the CAR, leading to activation of the T cells to become cytolytic against the tumor cells. CAR-T cell therapy has shown tremendous success for certain hematopoietic malignancies, but this success has not been extrapolated to adenocarcinomas. This is due to multiple factors associated with adenocarcinoma that are different from hematopoietic tumors. Although many advances have been made in targeting multiple cancers by CAR-T cells, clinical trials have shown adverse effects and toxicity related to this treatment. New strategies are yet to be devised to manage side effects associated with CAR-T cell therapies. In this review, we report some of the promising immunotherapeutic strategies being developed for treatment of most common adenocarcinomas with

  3. A case with primary signet ring cell adenocarcinoma of the prostate and review of the literature

    Directory of Open Access Journals (Sweden)

    Orcun Celik

    2014-06-01

    Full Text Available Primary signet cell carcinoma of the prostate is a rare histological variant of prostate malignancies. It is commonly originated from the stomach, colon, pancreas, and less commonly in the bladder. Prognosis of the classical type is worse than the adenocarcinoma of the prostate. Primary signet cell adenocarcinoma is diagnosed by eliminating the adenocarcinomas of other organs such as gastrointestinal tract organs. In this case report, we present a case with primary signet cell adenocarcinoma of the prostate who received docetaxel chemotherapy because of short prostate specific antigen doubling time.

  4. Effect of gyromagnetic fields on human prostatic adenocarcinoma cells

    Directory of Open Access Journals (Sweden)

    Lei H

    2015-11-01

    Full Text Available Hongen Lei,1 Yongde Xu,1 Ruili Guan,1 Meng Li,2 Yu Hui,3 Zhezhu Gao,1 Bicheng Yang,1 Zhongcheng Xin1 1Andrology Center, Peking University First Hospital, Peking University, Beijing, 2Department of Urology, General Hospital of Ningxia Medical University, Yinchuan, 3Department of Urology, The First Affiliated Hospital of Soochow University, Soochow, People’s Republic of China Purpose: To investigate the biological effect of gyromagnetic fields (GMFs on cell proliferation and apoptosis of human prostatic adenocarcinoma cells and explore the underlying mechanisms.Methods: PC-3 cells were grouped into normal control (NC and GMF treatment groups. Cell proliferation was analyzed with kit-8 and Ki67 immunofluorescence staining, while cell apoptosis was analyzed with flow cytometry double staining of Annexin V-PE/7-AAD. The Akt and p38 MAPK/Caspase signaling pathways were analyzed by western blotting and immunofluorescence staining, and cell polarization was analyzed with PARD3.Results: Cell proliferation and activity of the Akt pathway were significantly decreased by the GMF, while cell apoptosis, activity of p38 MAPK, and PARD3-positive cell number were significantly increased in the GMF group compared to the NC group.Conclusion: GMFs inhibit cell proliferation, induce apoptosis, and regulate tumor cell polarity conditions, potentially through down-regulating Akt, activating the p38 MAPK/Caspase pathway, and promoting PARD3 expression in PC-3 cells. Keywords: apoptosis, gyromagnetic fields, PC-3 cells, prostate cancer

  5. Clear Cell Adenocarcinoma of the Urethra: Review of the Literature

    Directory of Open Access Journals (Sweden)

    Anthony Kodzo-Grey Venyo

    2015-01-01

    Full Text Available Background. Clear cell adenocarcinoma of the urethra (CCAU is extremely rare and a number of clinicians may be unfamiliar with its diagnosis and biological behaviour. Aims. To review the literature on CCAU. Methods. Various internet databases were used. Results/Literature Review. (i CCAU occurs in adults and in women in the great majority of cases. (ii It has a particular association with urethral diverticulum, which has been present in 56% of the patients; is indistinguishable from clear cell adenocarcinoma of the female genital tract but is not associated with endometriosis; and probably does not arise by malignant transformation of nephrogenic adenoma. (iii It is usually, readily distinguished from nephrogenic adenoma because of greater cytological a-typicality and mitotic activity and does not stain for prostate-specific antigen or prostatic acid phosphatase. (iv It has been treated by anterior exenteration in women and cystoprostatectomy in men and at times by radiotherapy; chemotherapy has rarely been given. (v CCAU is aggressive with low 5-year survival rates. (vi There is no consensus opinion of treatment options that would improve the prognosis. Conclusions. Few cases of CCAU have been reported. Urologists, gynaecologists, pathologists, and oncologists should report cases of CCAU they encounter and enter them into a multicentric trial to determine the best treatment options that would improve the prognosis.

  6. An iPSC Line from Human Pancreatic Ductal Adenocarcinoma Undergoes Early to Invasive Stages of Pancreatic Cancer Progression

    Directory of Open Access Journals (Sweden)

    Jungsun Kim

    2013-06-01

    Full Text Available Pancreatic ductal adenocarcinoma (PDAC carries a dismal prognosis and lacks a human cell model of early disease progression. When human PDAC cells are injected into immunodeficient mice, they generate advanced-stage cancer. We hypothesized that if human PDAC cells were converted to pluripotency and then allowed to differentiate back into pancreatic tissue, they might undergo early stages of cancer. Although most induced pluripotent stem cell (iPSC lines were not of the expected cancer genotype, one PDAC line, 10–22 cells, when injected into immunodeficient mice, generated pancreatic intraepithelial neoplasia (PanIN precursors to PDAC that progressed to the invasive stage. The PanIN-like cells secrete or release proteins from many genes that are known to be expressed in human pancreatic cancer progression and that predicted an HNF4α network in intermediate-stage lesions. Thus, rare events allow iPSC technology to provide a live human cell model of early pancreatic cancer and insights into disease progression.

  7. Telomere maintenance in laser capture microdissection-purified Barrett's adenocarcinoma cells and effect of telomerase inhibition in vivo

    Science.gov (United States)

    Shammas, Masood A; Qazi, Aamer; Batchu, Ramesh B; Bertheau, Robert C; Wong, Jason YY; Rao, Manjula Y; Prasad, Madhu; Chanda, Diptiman; Ponnazhagan, Selvarangan; Anderson, Kenneth C; Steffes, Christopher P; Munshi, Nikhil C; De Vivo, Immaculata; Beer, David G.; Gryaznov, Sergei; Weaver, Donald W; Goyal, Raj K

    2009-01-01

    Purpose: The aims of this study were to investigate telomere function in normal and Barrett's esophageal adenocarcinoma (BEAC) cells purified by laser capture microdissection (LCM) and to evaluate the impact of telomerase inhibition in cancer cells in vitro and in vivo. Experimental Design: Epithelial cells were purified from surgically resected esophagi. Telomerase activity was measured by modified “Telomeric Repeat Amplification Protocol” and telomere length determined by Real-Time PCR assay. To evaluate the impact of telomerase inhibition, adenocarcinoma cell lines were continuously treated with a specific telomerase inhibitor (GRN163L) and live cell number determined weekly. Apoptosis was evaluated by annexin labeling and senescence by beta-galactosidase staining. For in vivo studies, SCID-mice were subcutaneously inoculated with adenocarcinoma cells and following appearance of palpable tumors, injected intraperitoneally with saline or GRN163L. Results: Telomerase activity was significantly elevated whereas telomeres were shorter in BEAC cells relative to normal esophageal epithelial cells. The treatment of adenocarcinoma cells with telomerase inhibitor, GRN163L, led to loss of telomerase activity, reduction in telomere length, and growth arrest through induction of both the senescence and apoptosis. GRN163L induced cell death could also be expedited by addition of chemotherapeutic agents, doxorubicin and ritonavir. Finally, the treatment with GRN163L led to a significant reduction in tumor volume in a subcutaneous tumor model. Conclusions: We show that telomerase activity is significantly elevated whereas telomeres are shorter in BEAC and suppression of telomerase inhibits proliferation of adenocarcinoma cells both in vitro and in vivo. PMID:18676772

  8. ALDH1-high ovarian cancer stem-like cells can be isolated from serous and clear cell adenocarcinoma cells, and ALDH1 high expression is associated with poor prognosis.

    Directory of Open Access Journals (Sweden)

    Takafumi Kuroda

    Full Text Available Cancer stem-like cells (CSCs/cancer-initiating cells (CICs are defined as a small population of cancer cells that have high tumorigenicity. Furthermore, CSCs/CICs are resistant to several cancer therapies, and CSCs/CICs are therefore thought to be responsible for cancer recurrence after treatment and distant metastasis. In epithelial ovarian cancer (EOC cases, disease recurrence after chemotherapy is frequently observed, suggesting ovarian CSCs/CICs are involved. There are four major histological subtypes in EOC, and serous adenocarcinoma and clear cell adenocarcinoma are high-grade malignancies. We therefore analyzed ovarian CSCs/CICs from ovarian carcinoma cell lines (serous adenocarcinoma and clear cell adenocarcinoma and primary ovarian cancer cells in this study. We isolated ovarian CSCs/CICs as an aldehyde dehydrogenase 1 high (ALDH1(high population from 6 EOC cell lines (3 serous adenocarcinomas and 3 clear cell adenocarcinomas by the ALDEFLUOR assay. ALDH1(high cells showed greater sphere-forming ability, higher tumorigenicity and greater invasive capability, indicating that ovarian CSCs/CICs are enriched in ALDH1(high cells. ALDH1(high cells could also be isolated from 8 of 11 primary ovarian carcinoma samples. Immunohistochemical staining revealed that higher ALDH1 expression levels in ovary cancer cases are related to poorer prognosis in both serous adenocarcinoma cases and clear cell adenocarcinoma cases. Taken together, the results indicate that ALDH1 is a marker for ovarian CSCs/CICs and that the expression level of ALDH1 might be a novel biomarker for prediction of poor prognosis.

  9. Cell line provenance.

    Science.gov (United States)

    Freshney, R Ian

    2002-07-01

    Cultured cell lines have become an extremely valuable resource, both in academic research and in industrial biotechnology. However, their value is frequently compromised by misidentification and undetected microbial contamination. As detailed elsewhere in this volume, the technology, both simple and sophisticated, is available to remedy the problems of misidentification and contamination, given the will to apply it. Combined with proper records of the origin and history of the cell line, assays for authentication and contamination contribute to the provenance of the cell line. Detailed records should start from the initiation or receipt of the cell line, and should incorporate data on the donor as well as the tissue from which the cell line was derived, should continue with details of maintenance, and include any accidental as well as deliberate deviations from normal maintenance. Records should also contain details of authentication and regular checks for contamination. With this information, preferably stored in a database, and suitable backed up, the provenance of the cell line so created makes the cell line a much more valuable resource, fit for validation in industrial applications and more likely to provide reproducible experimental results when disseminated for research in other laboratories.

  10. Infrared light-absorbing gold/gold sulfide nanoparticles induce cell death in esophageal adenocarcinoma

    Science.gov (United States)

    Li, Yan; Gobin, Andre M; Dryden, Gerald W; Kang, Xinqin; Xiao, Deyi; Li, Su Ping; Zhang, Guandong; Martin, Robert CG

    2013-01-01

    Gold nanoparticles and near infrared-absorbing light are each innocuous to tissue but when combined can destroy malignant tissue while leaving healthy tissue unharmed. This study investigated the feasibility of photothermal ablation therapy for esophageal adenocarcinoma using chitosan-coated gold/gold sulfide (CS-GGS) nanoparticles. A rat esophagoduodenal anastomosis model was used for the in vivo ablation study, and three human esophageal cell lines were used to study the response of cancer cells and benign cells to near infrared light after treatment with CS-GGS. The results indicate that both cancerous tissue and cancer cells took up more gold nanoparticles and were completely ablated after exposure to near infrared light. The benign tissue and noncancerous cells showed less uptake of these nanoparticles, and remained viable after exposure to near infrared light. CS-GGS nanoparticles could provide an optimal endoluminal therapeutic option for near infrared light ablation of esophageal cancer. PMID:23818775

  11. Cytoplasmic Overexpression of CD95L in Esophageal Adenocarcinoma Cells Overcomes Resistance to CD95-Mediated Apoptosis

    Directory of Open Access Journals (Sweden)

    Gregory A. Watson

    2011-03-01

    Full Text Available Introduction: The CD95/CD95L pathway plays a critical role in tissue homeostasis and immune system regulation; however, the function of this pathway in malignancy remains poorly understood. We hypothesized that CD95L expression in esophageal adenocarcinoma confers advantages to the neoplasm other than immune privilege. Methods: CD95L expression was characterized in immortalized squamous esophagus (HET-1A and Barrett esophagus (BAR-T cells; adenocarcinoma cell lines FLO-1, SEG-1, and BIC-1, and MDA468 (- control; and KFL cells (+ control. Analyses included reverse transcription-polymerase chain reaction, immunoblots of whole cell and secretory vesicle lysates, FACScan analysis, laser scanning confocal microscopy of native proteins and fluorescent constructs, and assessment of apoptosis and ERK1/2 pathways. Results: Cleaved, soluble CD95L is expressed at both the RNA and protein levels in these cell lines derived from esophageal adenocarcinoma and other human tissues. CD95L was neither trafficked to the cell membrane nor secreted into the media or within vesicles, rather the protein seems to be sequestered in the cytoplasm. CD95 and CD95L colocalize by immunofluorescence, but an interaction was not proven by immunoprecipitation. Overexpression of CD95L in the adenocarcinoma cell lines induced robust apoptosis and, under conditions of pan-caspase inhibition, resulted in activation of ERK signaling. Conclusions: CD95L localization in EA cells is inconsistent with the conference of immune privilege and is more consistent with a function that promotes tumor growth through alternative CD95 signaling. Reduced cell surface expression of CD95 affects cell sensitivity to extracellular apoptotic signals more significantly than alterations in downstream modulators of apoptosis.

  12. Stem cells as the root of pancreatic ductal adenocarcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Balic, Anamaria; Dorado, Jorge; Alonso-Gomez, Mercedes; Heeschen, Christopher, E-mail: christopher.heeschen@cnio.es

    2012-04-01

    Emerging evidence suggests that stem cells play a crucial role not only in the generation and maintenance of different tissues, but also in the development and progression of malignancies. For the many solid cancers, it has now been shown that they harbor a distinct subpopulation of cancer cells that bear stem cell features and therefore, these cells are termed cancer stem cells (CSC) or tumor-propagating cells. CSC are exclusively tumorigenic and essential drivers for tumor progression and metastasis. Moreover, it has been shown that pancreatic ductal adenocarcinoma does not only contain one homogeneous population of CSC rather than diverse subpopulations that may have evolved during tumor progression. One of these populations is called migrating CSC and can be characterized by CXCR4 co-expression. Only these cells are capable of evading the primary tumor and traveling to distant sites such as the liver as the preferred site of metastatic spread. Clinically even more important, however, is the observation that CSC are highly resistant to chemo- and radiotherapy resulting in their relative enrichment during treatment and rapid relapse of disease. Many laboratories are now working on the further in-depth characterization of these cells, which may eventually allow for the identification of their Achilles heal and lead to novel treatment modalities for fighting this deadly disease.

  13. Nox1-dependent superoxide production controls colon adenocarcinoma cell migration.

    Science.gov (United States)

    Sadok, Amine; Bourgarel-Rey, Véronique; Gattacceca, Florence; Penel, Claude; Lehmann, Maxime; Kovacic, Hervé

    2008-01-01

    Reactive oxygen species are well-known mediators of various biological responses. Recently, new homologues of the catalytic subunit of NADPH oxidase have been discovered in non-phagocytic cells. These new homologues (Nox1-Nox5) produce low levels of superoxides compared to the phagocytic homologue Nox2/gp91phox. Using Nox1 siRNA, we show that Nox1-dependent superoxide production affects the migration of HT29-D4 colonic adenocarcinoma cells on collagen-I. Nox1 inhibition or down-regulation led to a decrease of superoxide production and alpha 2 beta 1 integrin membrane availability. An addition of arachidonic acid stimulated Nox1-dependent superoxide production and HT29-D4 cell migration. Pharmacological evidences using phospholipase A2, lipoxygenases and protein kinase C inhibitors show that upstream regulation of Nox1 relies on arachidonic acid metabolism. Inhibition of 12-lipoxygenase decreased basal and arachidonic acid induced Nox1-dependent superoxide production and cell migration. Migration and ROS production inhibited by a 12-lipoxygenase inhibitor were restored by the addition of 12(S)-HETE, a downstream product of 12-lipoxygenase. Protein kinase C delta inhibition by rottlerin (and also GO6983) prevented Nox1-dependent superoxide production and inhibited cell migration, while other protein kinase C inhibitors were ineffective. We conclude that Nox1 activation by arachidonic acid metabolism occurs through 12-lipoxygenase and protein kinase C delta, and controls cell migration by affecting integrin alpha 2 subunit turn-over.

  14. Clear Cell Adenocarcinoma Arising from Abdominal Wall Endometriosis

    Directory of Open Access Journals (Sweden)

    Thouraya Achach

    2008-01-01

    Full Text Available Endometriosis is a frequent benign disorder. Malignancy arising in extraovarian endometriosis is a rare event. A 49-year-old woman is presented with a large painful abdominal wall mass. She underwent a myomectomy, 20 years before, for uterus leiomyoma. Computed tomography suggested that this was a desmoid tumor and she underwent surgery. Histological examination showed a clear cell adenocarcinoma associated with endometriosis foci. Pelvic ultrasound, computed tomography, and endometrial curettage did not show any malignancy or endometriosis in the uterus and ovaries. Adjuvant chemotherapy was recommended, but the patient was lost to follow up. Six months later, she returned with a recurrence of the abdominal wall mass. She was given chemotherapy and then she was reoperated.

  15. NFAT5 promotes proliferation and migration of lung adenocarcinoma cells in part through regulating AQP5 expression

    Energy Technology Data Exchange (ETDEWEB)

    Guo, Kai, E-mail: gk161@163.com [Department of Respiration, Tangdu Hospital, Fourth Military Medical University, Xi' an 710038 (China); Department of Respiration, 161th Hospital, PLA, Wuhan 430015 (China); Jin, Faguang, E-mail: jinfag@fmmu.edu.cn [Department of Respiration, Tangdu Hospital, Fourth Military Medical University, Xi' an 710038 (China)

    2015-09-25

    The osmoregulated transcription factor nuclear factor of activated T-cells 5(NFAT5), has been found to play important roles in the development of many kinds of human cancers, including breast cancer, colon carcinoma, renal cell carcinoma and melanoma. The aim of the present study was to determine whether NFAT5 is involved in the proliferation and migration of lung adenocarcinoma cells. We found that NFAT5 was upregulated in lung adenocarcinoma cells and knockdown of NFAT5 decreased proliferation and migration of the cells, accompanied by a significant reduction in the expression of AQP5. AQP5 was upregulated in lung adenocarcinoma cells and knockdown of AQP5 also inhibited proliferation and migration of the cells as knockdown of NFAT5 did. Moreover, overexpression of NFAT5 promoted proliferation and migration of lung adenocarcinoma cells, accompanied by a significant increase in the expression of AQP5. These results indicate that NFAT5 plays important roles in proliferation and migration of human lung adenocarcinoma cells through regulating AQP5 expression, providing a new therapeutic option for lung adenocarcinoma therapy. - Highlights: • NFAT5 expression is higher in lung adenocarcinoma cells compared with normal cells. • NFAT5 knockdown decreases proliferation and migration of lung adenocarcinoma cells. • Knockdown of NFAT5 reduces AQP5 expression in human lung adenocarcinoma cells. • Overexpression of NFAT5 promotes proliferation and migration of lung adenocarcinoma cells. • Overexpression of NFAT5 increases AQP5 expression in human lung adenocarcinoma cells.

  16. NFAT5 promotes proliferation and migration of lung adenocarcinoma cells in part through regulating AQP5 expression

    International Nuclear Information System (INIS)

    Guo, Kai; Jin, Faguang

    2015-01-01

    The osmoregulated transcription factor nuclear factor of activated T-cells 5(NFAT5), has been found to play important roles in the development of many kinds of human cancers, including breast cancer, colon carcinoma, renal cell carcinoma and melanoma. The aim of the present study was to determine whether NFAT5 is involved in the proliferation and migration of lung adenocarcinoma cells. We found that NFAT5 was upregulated in lung adenocarcinoma cells and knockdown of NFAT5 decreased proliferation and migration of the cells, accompanied by a significant reduction in the expression of AQP5. AQP5 was upregulated in lung adenocarcinoma cells and knockdown of AQP5 also inhibited proliferation and migration of the cells as knockdown of NFAT5 did. Moreover, overexpression of NFAT5 promoted proliferation and migration of lung adenocarcinoma cells, accompanied by a significant increase in the expression of AQP5. These results indicate that NFAT5 plays important roles in proliferation and migration of human lung adenocarcinoma cells through regulating AQP5 expression, providing a new therapeutic option for lung adenocarcinoma therapy. - Highlights: • NFAT5 expression is higher in lung adenocarcinoma cells compared with normal cells. • NFAT5 knockdown decreases proliferation and migration of lung adenocarcinoma cells. • Knockdown of NFAT5 reduces AQP5 expression in human lung adenocarcinoma cells. • Overexpression of NFAT5 promotes proliferation and migration of lung adenocarcinoma cells. • Overexpression of NFAT5 increases AQP5 expression in human lung adenocarcinoma cells

  17. Effect of inhibition proliferation in human lung adenocarcinoma A549 cells by cytokine-induced killer cells.

    Science.gov (United States)

    Li, Dengrui; Guo, Sumin; Li, Hui; Zhu, Guiyun; Gao, Li; Xin, Xin; Yan, Dandan; Li, Xiuwu; Geng, Shujun; Hou, Hongwei; Yang, Yonghui

    2015-07-01

    Adenocarcinoma, the most common form of lung cancer, is one of main human malignant tumors. In this paper, we focus on the effect of antitumor activity of cytokine-induced killer (CIK) cells on human lung adenocarcinoma cell line A549. CIK cells were obtained by inducing peripheral blood mononuclear cells with recombinant human (rh) interferon-gamma, monoclonal anti-CD3 antibody, rh interleukin (IL)-1alpha, and rhIL-2, which were added into the culture. A549 cell viability of CIK cells was determined using MTS assay. Flow cytometry (FCM) experiments were performed to detect cell cycle changes. The expression of P27 in A549 cells treated by CIK cells was evaluated by Western blot. The percentage of CD3+CD16+CD56+ T cells in a representative peripheral blood mononucleated cell sample was 33.7 ± 1.3%. CIK cells, in dose and time dependent manners, inhibited the proliferation of A549. FCM demonstrated that A549 cells were accumulated in G2/M and G0/G1 phases when treated with CIK cells. FCM was used to analyze whether A549 cells treated with CIK cells induced apotosis or necrosis at 10:1 or 20:1. Compared to the control group, P27 was prominently upregulated in the CIK treated group. We propose that the pharmacological mechanisms of A549 cells inhibited by CIK cells can be estimated to possibly elicit different biological significance, which, in part, can be ascribed to a different mass transport rate in vitro.

  18. MicroRNA-449a enhances radiosensitivity in CL1-0 lung adenocarcinoma cells.

    Directory of Open Access Journals (Sweden)

    Yi-Jyun Liu

    Full Text Available Lung cancer is the leading cause of cancer-related mortality worldwide. Radiotherapy is often applied for treating lung cancer, but it often fails because of the relative non-susceptibility of lung cancer cells to radiation. MicroRNAs (miRNAs have been reported to modulate the radiosensitivity of lung cancer cells and have the potential to improve the efficacy of radiotherapy. The purpose of this study was to identify a miRNA that can adjust radiosensitivity in lung adenocarcinoma cells. Two lung adenocarcinoma cell lines (CL1-0 and CL1-5 with different metastatic ability and radiosensitivity were used. In order to understand the regulatory mechanisms of differential radiosensitivity in these isogenic tumor cells, both CL1-0 and CL1-5 were treated with 10 Gy radiation, and were harvested respectively at 0, 1, 4, and 24 h after radiation exposure. The changes in expression of miRNA upon irradiation were examined using Illumina Human microRNA BeadChips. Twenty-six miRNAs were identified as having differential expression post-irradiation in CL1-0 or CL1-5 cells. Among these miRNAs, miR-449a, which was down-regulated in CL1-0 cells at 24 h after irradiation, was chosen for further investigation. Overexpression of miR-449a in CL1-0 cells effectively increased irradiation-induced DNA damage and apoptosis, altered the cell cycle distribution and eventually led to sensitization of CL1-0 to irradiation.

  19. [Impact of Cystic Fibrosis Transmembrane Conductance Regulator on Malignant
 Properties of KRAS Mutant Lung Adenocarcinoma A549 Cells].

    Science.gov (United States)

    Li, Hui; Wang, Ying; Yang, Jiali; Liu, Xiaoming; Shi, Juan

    2018-02-20

    The incidence of lung cancer is gradually increased, and the cystic fibrosis transmembrane conductance regulator (CFTR) has recently demonstrated to have an implication in the deoncogenesis and malignant transformation of many types of cancers. The aim of this study is to investigate impacts of CFTR on the malignant features of lung adenocarcinoma A549 cells. The capacity of cell proliferation, migration, invasion and clonogenicity of non-small cell lung cancer A549 cells were detected by CCK8 cell proliferation assay, cell scratch assay, Transwell cell invasion assay and clone formation assay, respectively. Meanwhile, the effect of CFTR gene on the expression of cancer stem cell related transcriptional factors was also detected by immunoblotting (Western blot) assay. An overexpression of CFTR gene in A549 cells significantly inhibited the malignant capacity of A549 cells, including potencies of cell proliferation, migration, invasion and colony formation; while knockdown of CFTR gene expression by RNA interference in A549 cells resulted in an opposite effect seen in above cells overexpressing CFTR gene. Mechanistically, immunoblotting assay further revealed that the ectopic expression of CFTR gene led an inhibitory expression of stem cell-related transcriptional factors SOX2 and OCT3/4, and cancer stem cell surface marker CD133 in A549 cells, while a knockdown of CFTR expression yielded a moderately increased expression of these gene. However, an alteration of CFTR gene expression had neither effect on the expression of putative lung cancer stem cell marker aldehyde dehydrogenase1 (ALDH1), nor the frequency of ALDH1A-positive cells in A549 cells, as ascertained by the immunoblotting assay and cytometry analysis, respectively. The CFTR exhibited an inhibitory role in the malignancy of lung adenocarcinoma A549 cells, suggesting that it may be a novel potential target for lung cancer treatment. However, its functions in other lung adenocarcinoma cell lines and its

  20. The HSP90 Inhibitor Ganetespib Radiosensitizes Human Lung Adenocarcinoma Cells

    Energy Technology Data Exchange (ETDEWEB)

    Gomez-Casal, Roberto; Bhattacharya, Chitralekha [The University of Pittsburgh Cancer Institute, Pittsburgh, PA 15213 (United States); Department of Medicine, The University of Pittsburgh, Pittsburgh, PA 15213 (United States); Epperly, Michael W. [The University of Pittsburgh Cancer Institute, Pittsburgh, PA 15213 (United States); Department of Radiation Oncology, The University of Pittsburgh, Pittsburgh, PA 15213 (United States); Basse, Per H. [The University of Pittsburgh Cancer Institute, Pittsburgh, PA 15213 (United States); Department of Immunology, The University of Pittsburgh, Pittsburgh, PA 15213 (United States); Wang, Hong [The University of Pittsburgh Cancer Institute, Pittsburgh, PA 15213 (United States); Department of Biostatistics, The University of Pittsburgh, Pittsburgh, PA 15213 (United States); Wang, Xinhui [Harvard Medical School, Harvard University, 25 Shattuck Street, Boston, MA 02115 (United States); Proia, David A. [Synta Pharmaceuticals Corp., 45 Hartwell Avenue, Lexington, MA 02421 (United States); Greenberger, Joel S. [The University of Pittsburgh Cancer Institute, Pittsburgh, PA 15213 (United States); Department of Radiation Oncology, The University of Pittsburgh, Pittsburgh, PA 15213 (United States); Socinski, Mark A.; Levina, Vera, E-mail: levinav@upmc.edu [The University of Pittsburgh Cancer Institute, Pittsburgh, PA 15213 (United States); Department of Medicine, The University of Pittsburgh, Pittsburgh, PA 15213 (United States)

    2015-05-22

    The molecular chaperone HSP90 is involved in stabilization and function of multiple client proteins, many of which represent important oncogenic drivers in NSCLC. Utilization of HSP90 inhibitors as radiosensitizing agents is a promising approach. The antitumor activity of ganetespib, HSP90 inhibitor, was evaluated in human lung adenocarcinoma (AC) cells for its ability to potentiate the effects of IR treatment in both in vitro and in vivo. The cytotoxic effects of ganetespib included; G2/M cell cycle arrest, inhibition of DNA repair, apoptosis induction, and promotion of senescence. All of these antitumor effects were both concentration- and time-dependent. Both pretreatment and post-radiation treatment with ganetespib at low nanomolar concentrations induced radiosensitization in lung AC cells in vitro. Ganetespib may impart radiosensitization through multiple mechanisms: such as down regulation of the PI3K/Akt pathway; diminished DNA repair capacity and promotion of cellular senescence. In vivo, ganetespib reduced growth of T2821 tumor xenografts in mice and sensitized tumors to IR. Tumor irradiation led to dramatic upregulation of β-catenin expression in tumor tissues, an effect that was mitigated in T2821 xenografts when ganetespib was combined with IR treatments. These data highlight the promise of combining ganetespib with IR therapies in the treatment of AC lung tumors.

  1. Poly-lactic-glycolic-acid surface nanotopographies selectively decrease breast adenocarcinoma cell functions

    Science.gov (United States)

    Zhang, Lijuan; Webster, Thomas J.

    2012-04-01

    The ability of poly(lactic-co-glycolic acid) (PLGA, 50:50 PLG/PGA, wt%) nanotopographies to decrease lung epithelial carcinoma cell functions (including adhesion, proliferation, apoptosis and vascular endothelial growth factor (VEGF) secretion) has been previously reported. Specifically, results demonstrated decreased lung epithelial carcinoma cell VEGF synthesis on 23 nm surface-featured PLGA compared to traditional nanosmooth PLGA. However, clearly, different cell lines could have different behaviors on similar biomaterials. Thus, to investigate the universality of nanopatterned PLGA substrates to inhibit numerous cancer cell functions, here, breast epithelial adenocarcinoma cell (MCF-7) adhesion, proliferation, apoptosis and VEGF secretion were determined on different PLGA nanometer surface topographies. To isolate surface nanotopographical effects from all other surface properties, PLGA surfaces with various nanotopographies but similar chemistry and hydrophobicity were fabricated here. Atomic force microscopy (AFM) verified the varied nanotopographies on the PLGA surfaces prepared in this study. Importantly, results demonstrated for the first time significantly decreased breast adenocarcinoma cell functions (including decreased proliferation rate, increased apoptosis and decreased VEGF synthesis) on 23 nm featured PLGA surfaces compared to all other PLGA surface topographies fabricated (specifically, nanosmooth, 300 and 400 nm surface-featured PLGA surfaces). In contrast, healthy breast epithelial cells proliferated more (24%) on the 23 nm featured PLGA surfaces compared to all other PLGA samples. In summary, these results provided further insights into understanding the role PLGA surface nanotopographies can have on cancer cell functions and, more importantly, open the possibility of using polymer nanotopographies for a wide range of anticancer regenerative medicine applications (without resorting to the use of chemotherapeutics).

  2. Bioactivation of the citrus flavonoid nobiletin by CYP1 enzymes in MCF7 breast adenocarcinoma cells.

    Science.gov (United States)

    Surichan, Somchaiya; Androutsopoulos, Vasilis P; Sifakis, Stavros; Koutala, Eleni; Tsatsakis, Aristidis; Arroo, Randolph R J; Boarder, Michael R

    2012-09-01

    Recent studies have demonstrated cytochrome P450 CYP1-mediated metabolism and CYP1-enzyme induction by naturally occurring flavonoids in cancer cell line models. The arising metabolites often exhibit higher activity than the parent compound. In the present study we investigated the CYP1-mediated metabolism of the citrus polymethoxyflavone nobiletin by recombinant CYP1 enzymes and MCF7 breast adenocarcinoma cells. Incubation of nobiletin in MCF7 cells produced one main metabolite (NM1) resulting from O-demethylation in either A or B rings of the flavone moiety. Among the three CYP1 isoforms, CYP1A1 exhibited the highest rate of metabolism of nobiletin in recombinant CYP microsomal enzymes. The intracellular CYP1-mediated bioconversion of the flavone was reduced in the presence of the CYP1A1 and CYP1B1-selective inhibitors α-napthoflavone and acacetin. In addition nobiletin induced CYP1 enzyme activity, CYP1A1 protein and CYP1B1 mRNA levels in MCF7 cells at a concentration dependent manner. MTT assays in MCF7 cells further revealed that nobiletin exhibited significantly lower IC50 (44 μM) compared to cells treated with nobiletin and CYP1A1 inhibitor (69 μM). FACS analysis demonstrated cell a cycle block at G1 phase that was attenuated in the presence of CYP1A1 inhibitor. Taken together the data suggests that the dietary flavonoid nobiletin induces its own metabolism and in turn enhances its cytostatic effect in MCF7 breast adenocarcinoma cells, via CYP1A1 and CYP1B1 upregulation. Copyright © 2012 Elsevier Ltd. All rights reserved.

  3. In vitro cytotoxicity screening of wild plant extracts from Saudi Arabia on human breast adenocarcinoma cells.

    Science.gov (United States)

    Ali, M A; Abul Farah, M; Al-Hemaid, F M; Abou-Tarboush, F M

    2014-05-23

    This study investigated the in vitro anticancer activities of a total of 14 wild angiosperms collected in Saudi Arabia. The cytotoxic activity of each extract was assessed against human breast adenocarcinoma (MCF-7) cell lines by using the MTT assay. Among the plants screened, the potential cytotoxic activity exhibited by the extract of Lavandula dentata (Lamiaceae) was identified, and we analyzed its anticancer potential by testing antiproliferative and apoptotic activity. Our results clearly show that ethanolic extract of L. dentata exhibits promising cytotoxic activity with an IC50 value of 39 μg/mL. Analysis of cell morphological changes, DNA fragmentation and apoptosis (using an Annexin V assay) also confirmed the apoptotic effect of L. dentata extract, and thus, our data call for further investigations to determine the active chemical constituent(s) and their mechanisms of inducing apoptosis.

  4. Cytomorphological features of ALK-positive lung adenocarcinomas: psammoma bodies and signet ring cells.

    Science.gov (United States)

    Pareja, Fresia; Crapanzano, John P; Mansukhani, Mahesh M; Bulman, William A; Saqi, Anjali

    2015-03-01

    Correlation between histology and genotype has been described in lung adenocarcinomas. For example, studies have demonstrated that adenocarcinomas with an anaplastic lymphoma kinase (ALK) gene rearrangement may have mucinous features. The objective of the current study was to determine whether a similar association can be identified in cytological specimens. A retrospective search for ALK-rearranged cytopathology (CP) and surgical pathology (SP) lung carcinomas was conducted. Additional ALK-negative (-) lung adenocarcinomas served as controls. For CP and SP cases, the clinical data (i.e., age, sex, and smoking history), architecture, nuclear features, presence of mucin-containing cells (including signet ring cells), and any additional salient characteristics were evaluated. The search yielded 20 ALK-positive (+) adenocarcinomas. Compared with patients with ALK(-) lung adenocarcinomas (33 patients; 12 with epidermal growth factor receptor [EGFR]-mutation, 11 with Kristen rat sarcoma [KRAS]-mutation, and 10 wild-type adenocarcinomas), patients with ALK(+) adenocarcinoma presented at a younger age; and there was no correlation noted with sex or smoking status. The most common histological pattern in SP was papillary/micropapillary. Mucinous features were associated with ALK rearrangement in SP specimens. Signet ring cells and psammoma bodies were evident in and significantly associated with ALK(+) SP and CP specimens. However, psammoma bodies were observed in rare adenocarcinomas with an EGFR mutation. Both the ALK(+) and ALK(-) groups had mostly high nuclear grade. Salient features, including signet ring cells and psammoma bodies, were found to be significantly associated with ALK(+) lung adenocarcinomas and are identifiable on CP specimens. Recognizing these may be especially helpful in the molecular triage of scant CP samples. © 2014 American Cancer Society.

  5. Net expression inhibits the growth of pancreatic ductal adenocarcinoma cell PL45 in vitro and in vivo.

    Directory of Open Access Journals (Sweden)

    Baiwen Li

    Full Text Available Pancreatic ductal adenocarcinoma has a poor prognosis due to late diagnosis and a lack of effective therapeutic options. Thus, it is important to better understand its molecular mechanisms and to develop more effective treatments for the disease. The ternary complex factor Net, which exerts its strong inhibitory function on transcription of proto-oncogene gene c-fos by forming ternary complexes with a second transcription factor, has been suspected of being involved in pancreatic cancer and other tumors biology. In this study, we found that the majority of pancreatic ductal adenocarcinoma tissues and cell lines had weak or no expression of Net, whereas significantly high level of Net expression occurred in paired adjacent normal tissues we studied. Furthermore, using in vitro and in vivo model systems, we found that overexpression of Net inhibited cell growth and survival and induced cell apoptosis in human pancreatic ductal adenocarcinoma cell PL45; the mechanisms by which Net inhibited the cell cycle progression were mainly through P21-Cyclin D1/CDK4 Pathway. Our data thus suggested that Net might play an important role in pancreatic carcinogenesis, possibly by acting as a tumor suppressor gene.

  6. Subcloning of ovarian cancer cell lines.

    Science.gov (United States)

    Grunt, T W

    2001-01-01

    Cellular heterogeneity of malignant tissues is a well-known phenomenon (1). Intralineal/intraclonal diversity may be explained in part by proposing the concept of a hierarchically ordered, differentiating and self-renewing stem cell system for transformed cell populations (2). However, in many solid tumors, the stem cells are not easily accessible to phenotypic identification. In the past, density gradient centrifugation was successfully used to separate cells from tumors and from cell lines into distinct subpopulations (3-5). Using Percoll density gradients, we isolated undifferentiated clonogenic tumor stem-cell fractions from HOC-7 human ovarian adenocarcinoma cells. In addition, we also identified a low-density cell subpopulation formed by large, vacuolated, slowly growing, adenoid differentiated cells with very low clonogenic activity (6-11). Further characterization of these cell fractions in terms of stability of the isolated phenotypes is essential for the assessment of their biological significance. Subcloning of the isolated cell fractions by limiting dilution culture (12) followed by long-term culture yielded three permanent monoclonal sublines, which reveal a stable adenoid differentiated phenotype, and three subclones representing undifferentiated, clonogenic tumor stem cells (13). These data demonstrate that the isolated phenotypes represent distinct cell entities reflecting specific stages of ovarian surface epithelial cell differentiation.

  7. Cytotoxic and apoptotic effects of chalcone derivatives of 2-acetyl thiophene on human colon adenocarcinoma cells.

    Science.gov (United States)

    de Vasconcelos, Alana; Campos, Vinicius Farias; Nedel, Fernanda; Seixas, Fabiana Kömmling; Dellagostin, Odir A; Smith, Kevin R; de Pereira, Cláudio Martin Pereira; Stefanello, Francieli Moro; Collares, Tiago; Barschak, Alethéa Gatto

    2013-06-01

    Recent studies report that chalcones exhibit cytotoxicity to human cancer cell lines. Typically, the form of cell death induced by these compounds is apoptosis. In the context of the discovery of new anticancer agents and in light of the antitumour potential of several chalcone derivatives, in the present study, we synthesized and tested the cytotoxicity of six chalcone derivatives on human colon adenocarcinoma cells. Six derivatives of 3-phenyl-1-(thiophen-2-yl) prop-2-en-1-one were prepared and characterized on the basis of their (1) H and (13) C NMR spectra. HT-29 cells were treated with synthesized chalcones on two concentrations by three different incubation times. Cells were evaluated by cell morphology, Tetrazolium dye (MTT) colorimetric assay, live/dead, flow cytometry (annexin V) and gene expression analyses to determine the cytotoxic way. Chalcones 3-(4-bromophenyl)-1-(thiophen-2-yl)prop-2-en-1-one (C06) and 3-(2-nitrophenyl)-1-(thiophen-2-yl)prop-2-en-1-one (C09) demonstrated higher cytotoxicity than other chalcones as shown by cell morphology, live/dead and MTT assays. In addition, C06 induced apoptosis on flow cytometry annexin V assay. These data were confirmed by a decreased expression of anti-apoptotic genes and increased pro-apoptotic genes. Our findings indicate in summary that the cytotoxic activity of chalcone C06 on colorectal carcinoma cells occurs by apoptosis. Copyright © 2012 John Wiley & Sons, Ltd.

  8. Clear cell adenocarcinoma of the ulterine cervix in a 15 year old girl: A case report

    International Nuclear Information System (INIS)

    Choi, Seung Joon; Kim, Jee Eun; KIm, Hyung Sik; Choi, Hye Young

    2013-01-01

    Cervical cancer is rare in the pediatric population. In cases of cervical cancer, adenocarcinoma is predominantly reported. Clear cell adenocarcinoma (CCAC) of the uterine cervix is a very rare tumor and accounts for only 4% of all adenocarcinomas of the uterine cervix. Risk factors and pathogenesis of this disease are not exactly revealed. The intrauterine exposure to diethylstilbestrol (DES) and associated non-steroidal estrogen during pregnancy before 18 weeks is the only known risk factor. This study reports the imaging finding of primary uterine cervical tumor in a 15-year-old girl, who was finally diagnosed with CCAC, with no maternal history of DES exposure in utero.

  9. Clear cell adenocarcinoma of the ulterine cervix in a 15 year old girl: A case report

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Seung Joon; Kim, Jee Eun; KIm, Hyung Sik; Choi, Hye Young [Dept. of Radiology, Gachon University Gil Hospital, Incheon (Korea, Republic of)

    2013-10-15

    Cervical cancer is rare in the pediatric population. In cases of cervical cancer, adenocarcinoma is predominantly reported. Clear cell adenocarcinoma (CCAC) of the uterine cervix is a very rare tumor and accounts for only 4% of all adenocarcinomas of the uterine cervix. Risk factors and pathogenesis of this disease are not exactly revealed. The intrauterine exposure to diethylstilbestrol (DES) and associated non-steroidal estrogen during pregnancy before 18 weeks is the only known risk factor. This study reports the imaging finding of primary uterine cervical tumor in a 15-year-old girl, who was finally diagnosed with CCAC, with no maternal history of DES exposure in utero.

  10. Radiation induced esophageal adenocarcinoma in a woman previously treated for breast cancer and renal cell carcinoma.

    Science.gov (United States)

    Raissouni, Soundouss; Raissouni, Ferdaous; Rais, Ghizlane; Aitelhaj, Meryem; Lkhoyaali, Siham; Latib, Rachida; Mohtaram, Amina; Rais, Fadoua; Mrabti, Hind; Kabbaj, Nawal; Amrani, Naima; Errihani, Hassan

    2012-08-09

    Secondary radiation-induced cancers are rare but well-documented as long-term side effects of radiation in large populations of breast cancer survivors. Multiple neoplasms are rare. We report a case of esophageal adenocarcinoma in a patient treated previously for breast cancer and clear cell carcinoma of the kidney. A 56 year-old non smoking woman, with no alcohol intake and no familial history of cancer; followed in the National Institute of Oncology of Rabat Morocco since 1999 for breast carcinoma, presented on consultation on January 2011 with dysphagia. Breast cancer was treated with modified radical mastectomy, 6 courses of chemotherapy based on CMF regimen and radiotherapy to breast, inner mammary chain and to pelvis as castration. Less than a year later, a renal right mass was discovered incidentally. Enlarged nephrectomy realized and showed renal cell carcinoma. A local and metastatic breast cancer recurrence occurred in 2007. Patient had 2 lines of chemotherapy and 2 lines of hormonotherapy with Letrozole and Tamoxifen assuring a stable disease. On January 2011, the patient presented dysphagia. Oesogastric endoscopy showed middle esophagus stenosing mass. Biopsy revealed adenocarcinoma. No evidence of metastasis was noticed on computed tomography and breast disease was controlled. Palliative brachytherapy to esophagus was delivered. Patient presented dysphagia due to progressive disease 4 months later. Jejunostomy was proposed but the patient refused any treatment. She died on July 2011. We present here a multiple neoplasm in a patient with no known family history of cancers. Esophageal carcinoma is most likely induced by radiation. However the presence of a third malignancy suggests the presence of genetic disorders.

  11. Radiation induced esophageal adenocarcinoma in a woman previously treated for breast cancer and renal cell carcinoma

    Directory of Open Access Journals (Sweden)

    Raissouni Soundouss

    2012-08-01

    Full Text Available Abstract Background Secondary radiation-induced cancers are rare but well-documented as long-term side effects of radiation in large populations of breast cancer survivors. Multiple neoplasms are rare. We report a case of esophageal adenocarcinoma in a patient treated previously for breast cancer and clear cell carcinoma of the kidney. Case presentation A 56 year-old non smoking woman, with no alcohol intake and no familial history of cancer; followed in the National Institute of Oncology of Rabat Morocco since 1999 for breast carcinoma, presented on consultation on January 2011 with dysphagia. Breast cancer was treated with modified radical mastectomy, 6 courses of chemotherapy based on CMF regimen and radiotherapy to breast, inner mammary chain and to pelvis as castration. Less than a year later, a renal right mass was discovered incidentally. Enlarged nephrectomy realized and showed renal cell carcinoma. A local and metastatic breast cancer recurrence occurred in 2007. Patient had 2 lines of chemotherapy and 2 lines of hormonotherapy with Letrozole and Tamoxifen assuring a stable disease. On January 2011, the patient presented dysphagia. Oesogastric endoscopy showed middle esophagus stenosing mass. Biopsy revealed adenocarcinoma. No evidence of metastasis was noticed on computed tomography and breast disease was controlled. Palliative brachytherapy to esophagus was delivered. Patient presented dysphagia due to progressive disease 4 months later. Jejunostomy was proposed but the patient refused any treatment. She died on July 2011. Conclusion We present here a multiple neoplasm in a patient with no known family history of cancers. Esophageal carcinoma is most likely induced by radiation. However the presence of a third malignancy suggests the presence of genetic disorders.

  12. Appendiceal goblet cell carcinoids and adenocarcinomas ex-goblet cell carcinoid are genetically distinct from primary colorectal-type adenocarcinoma of the appendix

    DEFF Research Database (Denmark)

    Jesinghaus, Moritz; Konukiewitz, Björn; Foersch, Sebastian

    2018-01-01

    The appendix gives rise to goblet cell carcinoids, which represent special carcinomas with distinct biological and histological features. Their genetic background and molecular relationship to colorectal adenocarcinoma is largely unknown. We therefore performed a next-generation sequencing analysis...... a morphomolecular entity, histologically and genetically distinct from appendiceal colorectal-type adenocarcinomas and its colorectal counterparts. Altered Wnt-signaling associated genes, apart from APC, may act as potential drivers of these neoplasms. The absence of KRAS/NRAS mutations might render some...... of these tumors eligible for anti-EGFR directed therapy regimens.Modern Pathology advance online publication, 12 January 2018; doi:10.1038/modpathol.2017.184....

  13. DNA damage response signaling in lung adenocarcinoma A549 cells following gamma and carbon beam irradiation.

    Science.gov (United States)

    Ghosh, Somnath; Narang, Himanshi; Sarma, Asitikantha; Krishna, Malini

    2011-11-01

    Carbon beams (5.16MeV/u, LET=290keV/μm) are high linear energy transfer (LET) radiation characterized by higher relative biological effectiveness than low LET radiation. The aim of the current study was to determine the signaling differences between γ-rays and carbon ion-irradiation. A549 cells were irradiated with 1Gy carbon or γ-rays. Carbon beam was found to be three times more cytotoxic than γ-rays despite the fact that the numbers of γ-H2AX foci were same. Percentage of cells showing ATM/ATR foci were more with γ-rays however number of foci per cell were more in case of carbon irradiation. Large BRCA1 foci were found in all carbon irradiated cells unlike γ-rays irradiated cells and prosurvival ERK pathway was activated after γ-rays irradiation but not carbon. The noteworthy finding of this study is the early phase apoptosis induction by carbon ions. In the present study in A549 lung adenocarcinoma, authors conclude that despite activation of same repair molecules such as ATM and BRCA1, differences in low and high LET damage responses might be due to their distinct macromolecular complexes rather than their individual activation and the activation of cytoplasmic pathways such as ERK, whether it applies to all the cell lines need to be further explored. Copyright © 2011 Elsevier B.V. All rights reserved.

  14. Co-Expression of Cancer Stem Cell Markers Corresponds to a Pro-Tumorigenic Expression Profile in Pancreatic Adenocarcinoma

    Science.gov (United States)

    Skoda, Jan; Hermanova, Marketa; Loja, Tomas; Nemec, Pavel; Neradil, Jakub; Karasek, Petr; Veselska, Renata

    2016-01-01

    Pancreatic ductal adenocarcinoma (PDAC) remains one of the most lethal malignancies. Its dismal prognosis is often attributed to the presence of cancer stem cells (CSCs) that have been identified in PDAC using various markers. However, the co-expression of all of these markers has not yet been evaluated. Furthermore, studies that compare the expression levels of CSC markers in PDAC tumor samples and in cell lines derived directly from those tumors are lacking. Here, we analyzed the expression of putative CSC markers—CD24, CD44, epithelial cell adhesion molecule (EpCAM), CD133, and nestin—by immunofluorescence, flow cytometry and quantitative PCR in 3 PDAC-derived cell lines and by immunohistochemistry in 3 corresponding tumor samples. We showed high expression of the examined CSC markers among all of the cell lines and tumor samples, with the exception of CD24 and CD44, which were enriched under in vitro conditions compared with tumor tissues. The proportions of cells positive for the remaining markers were comparable to those detected in the corresponding tumors. Co-expression analysis using flow cytometry revealed that CD24+/CD44+/EpCAM+/CD133+ cells represented a significant population of the cells (range, 43 to 72%) among the cell lines. The highest proportion of CD24+/CD44+/EpCAM+/CD133+ cells was detected in the cell line derived from the tumor of a patient with the shortest survival. Using gene expression profiling, we further identified the specific pro-tumorigenic expression profile of this cell line compared with the profiles of the other two cell lines. Together, CD24+/CD44+/EpCAM+/CD133+ cells are present in PDAC cell lines derived from primary tumors, and their increased proportion corresponds with a pro-tumorigenic gene expression profile. PMID:27414409

  15. Radiosensitivity of mesothelioma cell lines

    International Nuclear Information System (INIS)

    Haekkinen, A.M.; Laasonen, A.; Linnainmaa, K.; Mattson, K.; Pyrhoenen, S.

    1996-01-01

    The present study was carried out in order to examine the radiosensitivity of malignant pleural mesothelioma cell lines. Cell kinetics, radiation-induced delay of the cell cycle and DNA ploidy of the cell lines were also determined. For comparison an HeLa and a human foetal fibroblast cell line were simultaneously explored. Six previously cytogenetically and histologically characterized mesothelioma tumor cell lines were applied. A rapid tiazolyl blue microtiter (MTT) assay was used to analyze radiosensitivity and cell kinetics and DNA ploidy of the cultured cells were determined by flow cytometry. The survival fraction after a dose of 2 Gy (SF2), parameters α and β of the linear quadratic model (LQ-model) and mean inactivation dose (D MID ) were also estimated. The DNA index of four cell lines equaled 1.0 and two cell lines equaled 1.5 and 1.6. Different mesothelioma cell lines showed a great variation in radiosensitivity. Mean survival fraction after a radiation dose of 2 Gy (SF2) was 0.60 and ranged from 0.36 to 0.81 and mean α value was 0.26 (range 0.48-0.083). The SF2 of the most sensitive diploid mesothelioma cell line was 0.36: Less than that of the foetal fibroblast cell line (0.49). The survival fractions (0.81 and 0.74) of the two most resistant cell lines, which also were aneuploid, were equal to that of the HeLa cell line (0.78). The α/β ratios of the most sensitive cell lines were almost an order of magnitude greater than those of the two most resistant cell lines. Radiation-induced delay of the most resistant aneuploid cell line was similar to that of HeLa cells but in the most sensitive (diploid cells) there was practically no entry into the G1 phase following the 2 Gy radiation dose during 36 h. (orig.)

  16. The P2X7 receptor regulates cell survival, migration and invasion of pancreatic ductal adenocarcinoma cells.

    Science.gov (United States)

    Giannuzzo, Andrea; Pedersen, Stine Falsig; Novak, Ivana

    2015-11-25

    Pancreatic ductal adenocarcinoma (PDAC) is presently one of the cancers with the worst survival rates and least effective treatments. Moreover, total deaths due to PDAC are predicted to increase in the next 15 years. Therefore, novel insights into basic mechanism of PDAC development and therapies are needed. PDAC is characterized by a complex microenvironment, in which cancer and stromal cells release different molecules, such as ATP. ATP can be transported and/or exocytosed from active cancer cells and released from dying cells in the necrotic core of the cancer. We hypothesized that one of the ATP receptors, the P2X7 receptor (P2X7R) could be an important player in PDAC behaviour. We determined the expression (real time PCR and Western blot) and localization (immunofluorescence) of P2X7R in human PDAC cell lines (AsPC-1, BxPC-3, Capan-1, MiaPaCa-2, Panc-1) and a "normal" human pancreatic duct epithelial cell line (HPDE). The function of P2X7R in proliferation (BrdU assay), migration (wound assay) and invasion (Boyden chamber with matrigel) was characterized. Furthermore, we studied P2X7R-dependent pore formation (YoPro-1 assay) and cell death (caspase and annexin V / propidium iodide assays). We found higher expression of P2X7R protein in PDAC compared to HPDE cells. P2X7R had notable disparate effects on PDAC survival. Firstly, high concentrations of ATP or the specific P2X7R agonist, BzATP, had cytotoxic effects in all cell lines, and cell death was mediated by necrosis. Moreover, the P2X7R-pore antagonist, A438079, prevented ATP-induced pore formation and cell death. Second, in basal conditions and with low concentrations of ATP/BzATP, the P2X7R allosteric inhibitor AZ10606120 reduced proliferation in all PDAC cell lines. P2X7R also affected other key characteristics of cancer cell behavior. AZ10606120 reduced cell migration and invasion in PDAC cell lines compared to that of untreated/vehicle-treated control cells, and stimulation with sub

  17. CLO : The cell line ontology

    NARCIS (Netherlands)

    Sarntivijai, Sirarat; Lin, Yu; Xiang, Zuoshuang; Meehan, Terrence F.; Diehl, Alexander D.; Vempati, Uma D.; Schuerer, Stephan C.; Pang, Chao; Malone, James; Parkinson, Helen; Liu, Yue; Takatsuki, Terue; Saijo, Kaoru; Masuya, Hiroshi; Nakamura, Yukio; Brush, Matthew H.; Haendel, Melissa A.; Zheng, Jie; Stoeckert, Christian J.; Peters, Bjoern; Mungall, Christopher J.; Carey, Thomas E.; States, David J.; Athey, Brian D.; He, Yongqun

    2014-01-01

    Background: Cell lines have been widely used in biomedical research. The community-based Cell Line Ontology (CLO) is a member of the OBO Foundry library that covers the domain of cell lines. Since its publication two years ago, significant updates have been made, including new groups joining the CLO

  18. Effect of New Water-Soluble Dendritic Phthalocyanines on Human Colorectal and Liver Cancer Cell Lines

    Directory of Open Access Journals (Sweden)

    Ebru YABAŞ

    2017-08-01

    Full Text Available Human hepatocellular carcinoma (HepG2 cells and colorectal adenocarcinoma (DLD-1 cells were treated with the synthesized water soluble phthalocyanine derivatives to understand the effect of the compounds both on colorectal and liver cancer cells. The compounds inhibited cell proliferation and displayed cytotoxic effect on these cancer cell lines however; the effect of the compounds on healthy control fibroblast cell line was comparatively lower. The compounds can be employed for cancer treatment as anticancer agents.

  19. TROP2 overexpression promotes proliferation and invasion of lung adenocarcinoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Li, Zanhua [Medical School of Nanchang University (China); The Chest Hospital of Jiangxi Province Department of Respiration (China); Jiang, Xunsheng [Department of Respiration, Medical School of Nanchang University (China); Zhang, Wei, E-mail: weizhangncu@gmail.com [Department of Respiration, The First Affiliated Hospital of Nanchang University (China)

    2016-01-29

    Recent studies suggest that the human trophoblast cell-surface antigen TROP2 is highly expressed in a number of tumours and is correlated with poor prognosis. However, its role in non-small cell lung carcinoma (NSCLC) remains largely unknown. Here we examined TROP2 expression by immunohistochemistry in a series of 68 patients with adenocarcinoma (ADC). We found significantly elevated TROP2 expression in ADC tissues compared with normal lung tissues (P < 0.05), and TROP2 overexpression was significantly associated with TNM (tumour, node, metastasis) stage (P = 0.012), lymph node metastasis (P = 0.038), and histologic grade (P = 0.013). Kaplan–Meier survival analysis revealed that high TROP2 expression correlated with poor prognosis (P = 0.046). Multivariate analysis revealed that TROP2 expression was an independent prognostic marker for overall survival of ADC patients. Moreover, TROP2 overexpression enhanced cell proliferation, migration, and invasion in the NSCLC cell line A549, whereas knockdown of TROP2 induced apoptosis and impaired proliferation, migration, and invasion in the PC-9 cells. Altogether, our data suggest that TROP2 plays an important role in promoting ADC and may represent a novel prognostic biomarker and therapeutic target for the disease.

  20. Curcumin modulates eukaryotic initiation factors in human lung adenocarcinoma epithelial cells.

    Science.gov (United States)

    Chen, Lixia; Tian, Guoqing; Shao, Changxia; Cobos, Everardo; Gao, Weimin

    2010-10-01

    Curcumin, a polyphenolic compound, is the active component of Curcuma longa and has been extensively investigated as an anticancer drug that modulates multiple pathways. Eukaryotic initiation factors (eIFs) have been known to play important roles in translation initiation, which controls cell growth and proliferation. Little is known about the effects of curcumin on eIFs in lung cancer. The objective of this study was to exam the curcumin cytotoxic effect and modulation of two major rate-limiting translation initiation factors, including eIF2α and eIF4E protein expression levels in lung adenocarcinoma epithelial cell line A549. Cytotoxicity was measured by MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay and protein changes were determined by Western blot. A549 cells were treated with 0-240 μM curcumin for 4-96 h. The inhibitory effects of curcumin on cytotoxicity were dose- and time-dependent (P cells were treated with 20 and 40 μM curcumin for 24 h. In addition, the effects of curcumin on these protein expression changes followed a significant dose-response (P cell viability through prohibiting the initiation of protein synthesis by modulating eIF2α and eIF4E.

  1. Clear cell adenocarcinoma of urinary bladder: A case report and review

    Directory of Open Access Journals (Sweden)

    Somika Sethi

    2011-01-01

    Full Text Available Clear cell carcinoma is an uncommon but distinct variant of urinary bladder carcinoma histologically resembling the neoplasm in the female genital tract. The histogenesis of this neoplasm is uncertain. The clinicopathologic and histologic features are suggestive of a mullerian origin in some tumors, while some believe it to be glandular differentiation of urothelium or a unique vesicular adenocarcinoma of non-mullerian origin. [1] We present a case of clear cell adenocarcinoma in a 74-year-old woman with review of literature along with its differential diagnosis.

  2. Necrosis - the dominant form of cell death after phototoxicity impact of hypericin in colon adenocarcinoma cells HT29

    International Nuclear Information System (INIS)

    Mikes, J.; Kleban, J.; Sackova, V.; Solar, P.; Fedorocko, P.

    2006-01-01

    Photodynamic therapy (PDT) is a therapeutical approach for the treatment of malignant as well as non-malignant disorders based on administration of nontoxic/weakly toxic photosensitive compound and its activation with light. Hypericin, one of the promising photosensitizers, is known to induce apoptosis with high efficiency in various cell line models. However, here we report the prevalence of necrosis in colon adenocarcinoma HT-29 cells exposed to an extensive range of PDT doses evoked by variations in two variables - hypericin concentration and light dose. Necrosis was the principal mode of cell death despite different PDT doses and the absence of anti-apoptotic Bcl-2 expression. It is likely that the mutation in p53 plays a crucial role in cell death signaling in HT-29. Data indicating proliferation shifting in HT29 cells, incidence of cell death (apoptosis, necrosis and secondary necrosis) and comparison of cytotoxicity and caspase-3 activity of HT29 with HeLa cells are presented. (authors)

  3. Radiosensitivity of mesothelioma cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Haekkinen, A.M. [Dept. of Oncology, Univ. Central Hospital, Helsinki (Finland); Laasonen, A. [Dept. of Pathology, Central Hospital of Etelae-Pohjanmaa, Seinaejoki (Finland); Linnainmaa, K. [Dept. of Industrial Hygiene and Toxicology, Inst. of Occupational Health, Helsinki (Finland); Mattson, K. [Dept. Pulmonary Medicine, Univ. Central Hospital, Helsinki (Finland); Pyrhoenen, S. [Dept. of Oncology, Univ. Central Hospital, Helsinki (Finland)

    1996-10-01

    The present study was carried out in order to examine the radiosensitivity of malignant pleural mesothelioma cell lines. Cell kinetics, radiation-induced delay of the cell cycle and DNA ploidy of the cell lines were also determined. For comparison an HeLa and a human foetal fibroblast cell line were simultaneously explored. Six previously cytogenetically and histologically characterized mesothelioma tumor cell lines were applied. A rapid tiazolyl blue microtiter (MTT) assay was used to analyze radiosensitivity and cell kinetics and DNA ploidy of the cultured cells were determined by flow cytometry. The survival fraction after a dose of 2 Gy (SF2), parameters {alpha} and {beta} of the linear quadratic model (LQ-model) and mean inactivation dose (D{sub MID}) were also estimated. The DNA index of four cell lines equaled 1.0 and two cell lines equaled 1.5 and 1.6. Different mesothelioma cell lines showed a great variation in radiosensitivity. Mean survival fraction after a radiation dose of 2 Gy (SF2) was 0.60 and ranged from 0.36 to 0.81 and mean {alpha} value was 0.26 (range 0.48-0.083). The SF2 of the most sensitive diploid mesothelioma cell line was 0.36: Less than that of the foetal fibroblast cell line (0.49). The survival fractions (0.81 and 0.74) of the two most resistant cell lines, which also were aneuploid, were equal to that of the HeLa cell line (0.78). The {alpha}/{beta} ratios of the most sensitive cell lines were almost an order of magnitude greater than those of the two most resistant cell lines. Radiation-induced delay of the most resistant aneuploid cell line was similar to that of HeLa cells but in the most sensitive (diploid cells) there was practically no entry into the G1 phase following the 2 Gy radiation dose during 36 h. (orig.).

  4. Slug regulates E-cadherin expression in metastatic adenocarcinoma cells isolated from pleural fluid.

    Science.gov (United States)

    Li, Xiang-Nan; Fang, Chang-Qing; Wang, Ye-Lin; Wang, Xiu-Ru; Wang, En-Hua; Li, Jian-Hua

    2013-01-01

    Slug protein is a key regulator of epithelial-mesenchymal transition, but its expression in cancer is less well studied. To evaluate the expression of slug, E-cadherin and vimentin in adenocarcinoma cells from malignant pleural effusions, we analyzed 121 malignant pleural fluid specimens. Twenty-eight nonmalignant pleural fluid specimens were analyzed as control. Besides clinical cytological diagnosis tests, immunofluorescence, immunocytochemistry and Western blotting methods were used. Results showed strong membrane staining of E-cadherin in adenocarcinoma cells from pleural fluid. Slug mainly showed nucleus staining. Cytoplasma positive of vimentin was found in adenocarcinoma cells isolated from pleural fluid. Slug, E-cadherin and vimentin expression was found in 43/121 (36%), 87/121 (72%) and 102/121 (84%) cases, respectively. Our data showed elevated levels of slug were accompanied by down regulation of E-cadherin and the expression of vimentin in adenocarcinoma cells. In addition, there was no relationship between slug expression and patient's age or gender or tumor site. Hyperplasia epithelium cells from nonmalignant pleural fluid were uniformly negative for E-cadherin and slug. In conclusion, the results demonstrated the inverse expression of slug and E-cadherin in the majority of malignant pleural fluid cases compared with nonmalignant pleural fluid. The slug protein may be helpful to access the prognosis of patients with pleural fluid. Copyright © 2011 Wiley Periodicals, Inc.

  5. MCF-7 human mammary adenocarcinoma cells exhibit augmented responses to human insulin on a collagen IV surface

    DEFF Research Database (Denmark)

    Listov-Saabye, Nicolai; Jensen, Marianne Blirup; Kiehr, Benedicte

    2009-01-01

    Human mammary cell lines are extensively used for preclinical safety assessment of insulin analogs. However, it is essentially unknown how mitogenic responses can be optimized in mammary cell-based systems. We developed an insulin mitogenicity assay in MCF-7 human mammary adenocarcinoma cells...... was significantly more mitogenic than native insulin, validating the ability of the assay to identify hypermitogenic human insulin analogs. With MCF-7 cells on a collagen IV surface, the ranking of mitogens was maintained, but fold mitogenic responses and dynamic range and steepness of dose-response curves were...... increased. Also, PI3K pathway activation by insulin was enhanced on a collagen IV surface. This study provided the first determination and ranking of the mitogenic potencies of standard reference compounds in an optimized MCF-7 assay. The optimized MCF-7 assay described here is of relevance for in vitro...

  6. Mixed Adenocarcinoma and Squamous Cell Carcinoma of Duodenum: A Case Report and Review of the Literature

    OpenAIRE

    Hammami, Muhammad Bader; Chhaparia, Anuj; Piao, Jinhua; Zhou, Yihua; Hachem, Christine; Lai, Jinping

    2017-01-01

    Despite being the largest part of the human gastrointestinal (GI) tract, the small intestine accounts for only 1–1.4% of all GI malignancies. Adenocarcinoma is the most common primary small bowel malignancy, with the most common site being the duodenum. On the other hand, squamous cell carcinoma (SCC) of the duodenum is extremely uncommon. We report the first case of mixed adenocarcinoma and SCC occurring in the third part of duodenum (D3). Our patient, a 64-year-old female with history of GE...

  7. Iron overload of human colon adenocarcinoma cells studied by synchrotron-based X-ray techniques

    NARCIS (Netherlands)

    Mihucz, Victor G.; Meirer, Florian; Polgári, Zsófia; Réti, Andrea; Pepponi, Giancarlo; Ingerle, Dieter; Szoboszlai, Norbert; Streli, Christina

    2016-01-01

    Fast- and slow-proliferating human adenocarcinoma colorectal cells, HT-29 and HCA-7, respectively, overloaded with transferrin (Tf), Fe(III) citrate, Fe(III) chloride and Fe(II) sulfate were studied by synchrotron radiation total-reflection X-ray spectrometry (TXRF), TXRF-X-ray absorption near edge

  8. Interfacing polymeric scaffolds with primary pancreatic ductal adenocarcinoma cells to develop 3D cancer models

    NARCIS (Netherlands)

    Ricci, C.; Mota, C.M.; Moscato, S.; D' Alessandro, D.; Ugel, S.; Sartoris, S.; Bronte, V.; Boggi, U.; Campani, D.; Funel, N.; Moroni, Lorenzo; Danti, S.

    2014-01-01

    We analyzed the interactions between human primary cells from pancreatic ductal adenocarcinoma (PDAC) and polymeric scaffolds to develop 3D cancer models useful for mimicking the biology of this tumor. Three scaffold types based on two biocompatible polymeric formulations, such as poly(vinyl

  9. Cell-free plasma microRNA in pancreatic ductal adenocarcinoma and disease controls

    DEFF Research Database (Denmark)

    Carlsen, Anting Liu; Joergensen, Maiken Thyregod; Knudsen, Steen

    2013-01-01

    There are no tumor-specific biochemical markers for pancreatic ductal adenocarcinoma (PDAC). Tissue-specific gene expression including microRNA (miRNA) profiling, however, identifies specific PDAC signatures. This study evaluates associations between circulating, cell-free plasma-miRNA profiles...

  10. Second cancers after squamous cell carcinoma and adenocarcinoma of the cervix

    DEFF Research Database (Denmark)

    Chaturvedi, Anil K; Kleinerman, Ruth A; Hildesheim, Allan

    2008-01-01

    PURPOSE: Although cervical squamous cell carcinoma (SCC) and adenocarcinoma (AC) are both caused by human papillomavirus (HPV) infection, they differ in cofactors such as cigarette smoking. We assessed whether these cofactor differences translate into differences in second cancer risk. PATIENTS A...

  11. MiR-221 Promotes Capan-2 Pancreatic Ductal Adenocarcinoma Cells Proliferation by Targeting PTEN-Akt

    Directory of Open Access Journals (Sweden)

    Wenzhuo Yang

    2016-05-01

    Full Text Available Background/Aims: MicroRNAs (miRNAs, miRs have emerged as critical regulators of cancer cell proliferation. The effect of miR-221 on cancer cell growth could be significantly changeable in different cell lines. Although miR-221 was reported to promote the cell growth of pancreatic ductal adenocarcinoma (PDAC cells, its role in Capan-2 cell line is largely unknown. Methods: Capan-2 cells were transfected with miR-221 mimics, inhibitors, or negative controls. Cell Counting Kit-8 was used to determine cell viability. EdU staining and cell cycle analysis were used to measure cell proliferation. Western blotting was used to detect the expression levels of PTEN and phospho-Akt. The PI3K-Akt pathway activator SC-79 and inhibitor LY294002 were used to perform the rescue experiment in determining cell proliferation. Results: Overexpressing miR-221 significantly increased cell vitality and promoted cell proliferation and G1-to-S phase transition of the cell cycle in Capan-2 cells, while inhibition of miR-221 decreased that. The protein level of PTEN in Capan-2 cells was downregulated by overexpressing miR-221, while upregulated by inhibiting miR-221. Consistently, enhanced phosphorylation of AktSer473 was observed in miR-221 overexpressed Capan-2 cells, and the opposite result was found in miR-221 inhibited cells. LY294002 restored the pro-proliferation effect of miR-221 on Capan-2 cells, while SC-79 had no additional effect on cell proliferation in Capan-2 cells transfected with miR-221 mimics. Conclusion: Our study indicates that miR-221 is an oncogenic miRNA which promotes Capan-2 cells proliferation by targeting PTEN-Akt pathway.

  12. Eriocalyxin B induces apoptosis and cell cycle arrest in pancreatic adenocarcinoma cells through caspase- and p53-dependent pathways

    Energy Technology Data Exchange (ETDEWEB)

    Li, Lin [School of Biomedical Sciences, The Chinese University of Hong Kong, Hong Kong (China); Institute of Chinese Medicine, The Chinese University of Hong Kong, Hong Kong (China); State Key Laboratory of Phytochemistry and Plant Resources in West China, The Chinese University of Hong Kong, Hong Kong (China); Yue, Grace G.L. [Institute of Chinese Medicine, The Chinese University of Hong Kong, Hong Kong (China); State Key Laboratory of Phytochemistry and Plant Resources in West China, The Chinese University of Hong Kong, Hong Kong (China); Lau, Clara B.S. [Institute of Chinese Medicine, The Chinese University of Hong Kong, Hong Kong (China); Institute of Chinese Medicine, The Chinese University of Hong Kong, Hong Kong (China); Sun, Handong [State Key Laboratory of Phytochemistry and Plant Resources in West China, Kunming Institute of Botany, CAS, Yunnan (China); Fung, Kwok Pui [School of Biomedical Sciences, The Chinese University of Hong Kong, Hong Kong (China); Institute of Chinese Medicine, The Chinese University of Hong Kong, Hong Kong (China); State Key Laboratory of Phytochemistry and Plant Resources in West China, The Chinese University of Hong Kong, Hong Kong (China); Leung, Ping Chung [Institute of Chinese Medicine, The Chinese University of Hong Kong, Hong Kong (China); State Key Laboratory of Phytochemistry and Plant Resources in West China, The Chinese University of Hong Kong, Hong Kong (China); Han, Quanbin, E-mail: simonhan@hkbu.edu.hk [Institute of Chinese Medicine, The Chinese University of Hong Kong, Hong Kong (China); State Key Laboratory of Phytochemistry and Plant Resources in West China, The Chinese University of Hong Kong, Hong Kong (China); School of Chinese Medicine, The Hong Kong Baptist University, Hong Kong (China); Leung, Po Sing, E-mail: psleung@cuhk.edu.hk [School of Biomedical Sciences, The Chinese University of Hong Kong, Hong Kong (China)

    2012-07-01

    Pancreatic cancer is difficult to detect early and responds poorly to chemotherapy. A breakthrough in the development of new therapeutic agents is urgently needed. Eriocalyxin B (EriB), isolated from the Isodon eriocalyx plant, is an ent-kaurane diterpenoid with promise as a broad-spectrum anti-cancer agent. The anti-leukemic activity of EriB, including the underlying mechanisms involved, has been particularly well documented. In this study, we demonstrated for the first time EriB's potent cytotoxicity against four pancreatic adenocarcinoma cell lines, namely PANC-1, SW1990, CAPAN-1, and CAPAN-2. The effects were comparable to that of the chemotherapeutic camptothecin (CAM), but with much lower toxicity against normal human liver WRL68 cells. EriB's cytoxicity against CAPAN-2 cells was found to involve caspase-dependent apoptosis and cell cycle arrest at the G2/M phase. Moreover, the p53 pathway was found to be activated by EriB in these cells. Furthermore, in vivo studies showed that EriB inhibited the growth of human pancreatic tumor xenografts in BALB/c nude mice without significant secondary adverse effects. These results suggest that EriB should be considered a candidate for pancreatic cancer treatment. -- Highlights: ► We study Eriocalyxin B (EriB)'s cytotoxic effects on pancreatic cancer cell lines. ► EriB inhibits cell proliferation via mediation of apoptosis and cell cycle arrest. ► The effects are involved in caspase-dependent apoptosis and p53 pathway. ► In vivo study also shows EriB inhibits the growth of human pancreatic tumor. ► EriB can be a good candidate for chemotherapy in pancreatic cancer.

  13. A rare tumoral combination, synchronous lung adenocarcinoma and mantle cell lymphoma of the pleura

    Directory of Open Access Journals (Sweden)

    Foroulis Christophoros N

    2008-12-01

    Full Text Available Abstract Background Coexistence of adenocarcinoma and mantle cell lymphoma in the same or different anatomical sites is extremely rare. We present a case of incidental discovery of primary lung adenocarcinoma and mantle cell lymphoma involving the pleura, during an axillary thoracotomy performed for a benign condition. Case presentation A 73-year old male underwent bullectomy and apical pleurectomy for persistent pneumothorax. A bulla of the lung apex was resected en bloc with a scar-like lesion of the lung, which was located in proximity with the bulla origin, by a wide wedge resection. Histologic examination of the stripped-off parietal pleura and of the bullectomy specimen revealed the synchronous occurrence of two distinct neoplasms, a lymphoma infiltrating the pleura and a primary, early lung adenocarcinoma. Immunohistochemical and fluorescence in situ hybridization assays were performed. The morphologic, immunophenotypic and genetic findings supported the diagnosis of primary lung adenocarcinoma (papillary subtype coexisting with a non-Hodgkin, B-cell lineage, mantle cell lymphoma involving both, visceral and parietal pleura and without mediastinal lymph node involvement. The neoplastic lymphoid cells showed the characteristic immunophenotype of mantle cell lymphoma and the translocation t(11;14. The patient received 6 cycles of chemotherapy, while pulmonary function tests precluded further pulmonary parenchyma resection (lobectomy for his adenocarcinoma. The patient is alive and without clinical and radiological findings of local recurrence or distant relapse from both tumors 14 months later. Conclusion This is the first reported case of a rare tumoral combination involving simultaneously lung and pleura, emphasizing at the incidental discovery of the two coexisting neoplasms during a procedure performed for a benign condition. Any tissue specimen resected during operations performed for non-tumoral conditions should be routinely sent for

  14. The different functions and clinical significances of caveolin-1 in human adenocarcinoma and squamous cell carcinoma

    Directory of Open Access Journals (Sweden)

    Fu P

    2017-02-01

    Full Text Available Pin Fu,1 Fuchun Chen,2 Qi Pan,2 Xianda Zhao,1 Chen Zhao,1 William Chi-Shing Cho,3 Honglei Chen1,4 1Department of Pathology, School of Basic Medical Science, Wuhan University, Wuhan, 2Department of Thoracosurgery, Traditional Chinese Medical Hospital of Wenling, Wenling, Zhejiang, 3Department of Clinical Oncology, Queen Elizabeth Hospital, Kowloon, Hong Kong, 4Department of Pathology, Maternal and Child Health Hospital of Hubei, Wuhan, People’s Republic of China Abstract: Caveolin-1 (Cav-1, a major structural protein of caveolae, is an integral membrane protein which plays an important role in the progression of carcinoma. However, whether Cav-1 acts as a tumor promoter or a tumor suppressor still remains controversial. For example, the tumor-promoting function of Cav-1 has been found in renal cancer, prostate cancer, tongue squamous cell carcinoma (SCC, lung SCC and bladder SCC. In contrast, Cav-1 also plays an inhibitory role in esophagus adenocarcinoma, lung adenocarcinoma and cutaneous SCC. The role of Cav-1 is still controversial in thyroid cancer, hepatocellular carcinoma, gastric adenocarcinoma, colon adenocarcinoma, breast cancer, pancreas cancer, oral SCC, laryngeal SCC, head and neck SCC, esophageal SCC and cervical SCC. Besides, it has been reported that the loss of stromal Cav-1 might predict poor prognosis in breast cancer, gastric cancer, pancreas cancer, prostate cancer, oral SCC and esophageal SCC. However, the accumulation of stromal Cav-1 has been found to be promoted by the progression of tongue SCC. Taken together, Cav-1 seems playing a different role in different cancer subtypes even of the same organ, as well as acting differently in the same cancer subtype of different organs. Thus, we hereby explore the functions of Cav-1 in human adenocarcinoma and SCC from the perspective of clinical significances and pathogenesis. We envision that novel targets may come with the further investigation of Cav-1 in carcinogenesis

  15. Black cohosh inhibits 17β-estradiol-induced cell proliferation of endometrial adenocarcinoma cells.

    Science.gov (United States)

    Park, So Yun; Kim, Hee Ja; Lee, Sa Ra; Choi, Youn-Hee; Jeong, Kyungah; Chung, Hyewon

    2016-10-01

    This study was conducted to investigate the effect of black cohosh (BC) extract on the proliferation and apoptosis of Ishikawa cells. Ishikawa human endometrial adenocarcinoma cells were treated with or without BC (1, 5, 10 and 25 μM) and cell proliferation and cytotoxicity were measured by CCK-8 assays and flow cytometry analysis. Additionally, Ishikawa cells were treated with 17β-estradiol (E2), E2 + progesterone and E2 + BC (5 and 10 μM) and the effect of BC and progesterone on E2-induced cell proliferation was analyzed. BC decreased the proliferation of Ishikawa cells at a dose-dependent rate compared with the control group (p < 0.05). The proliferation of Ishikawa cells increased in the presence of E2, whereas the subsequent addition of progesterone or BC decreased proliferation to the level of the control group (p < 0.05). The inhibitory effect of BC on E2-induced cell proliferation was greater than the inhibitory effect of progesterone. In conclusion, BC induces apoptosis in Ishikawa cells and suppresses E2-induced cell proliferation in Ishikawa cells. BC could be considered a candidate co-treatment agent of estrogen-dependent tumors, especially those involving endometrial cells.

  16. Prognostic significance of tumor budding and single cell invasion in gastric adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Che K

    2017-02-01

    Full Text Available Keying Che,1,* Yang Zhao,2,3,* Xiao Qu,1 Zhaofei Pang,1 Yang Ni,4 Tiehong Zhang,4 Jiajun Du,1,5 Hongchang Shen4 1Institute of Oncology, Shandong Provincial Hospital Affiliated to Shandong University, Jinan, 2Department of Breast Surgery, Key Laboratory of Breast Cancer in Shanghai, Collaborative Innovation Center of Cancer Medicine, Fudan University Shanghai Cancer Center, 3Department of Oncology, Shanghai Medical College, Fudan University, Shanghai, 4Department of Oncology, Shandong Provincial Hospital Affiliated to Shandong University, 5Department of Thoracic Surgery, Shandong Provincial Hospital Affiliated to Shandong University, Jinan, People’s Republic of China *These authors contributed equally to this work Purpose: Gastric carcinoma (GC is a highly aggressive cancer and one of the leading causes of cancer-related deaths worldwide. Histopathological evaluation pertaining to invasiveness is likely to provide additional information in relation to patient outcome. In this study, we aimed to evaluate the prognostic significance of tumor budding and single cell invasion in gastric adenocarcinoma.Materials and methods: Hematoxylin and eosin-stained slides generated from 296 gastric adenocarcinoma patients with full clinical and pathological and follow-up information were systematically reviewed. The patients were grouped on the basis of tumor budding, single cell invasion, large cell invasion, mitotic count, and fibrosis. The association between histopathological parameters, different classification systems, and overall survival (OS was statistically analyzed.Results: Among the 296 cases that were analyzed, high-grade tumor budding was observed in 49.0% (145 of them. Single cell invasion and large cell invasion were observed in 62.8% (186 and 16.9% (50 of the cases, respectively. Following univariate analysis, patients with high-grade tumor budding had shorter OS than those with low-grade tumor budding (hazard ratio [HR]: 2.260, P<0

  17. Basal cell adenocarcinoma of minor salivary and seromucous glands of the head and neck region.

    Science.gov (United States)

    Fonseca, I; Soares, J

    1996-05-01

    Basal cell adenocarcinoma of salivary glands is an uncommon and recently described entity occurring almost exclusively at the major salivary glands. This report provides an overview of the clinicopathologic profile of this neoplasm by including the personal experience on the clinical features, microscopic and ultrastructural characteristics, proliferation activity, and DNA tumor patterns of 12 lesions occurring at the minor salivary glands of the head and neck region, where basal cell adenocarcinoma is probably an underecognized entity, previously reported under different designations. Basal cell adenocarcinoma predominates at the seventh decade without sex preference. The tumors affecting the minor salivary glands occur most frequently at the oral cavity (jugal mucosa, palate) and the upper respiratory tract. The prevalent histologic tumor pattern is represented by solid neoplastic aggregates with a peripheral cell palisading arrangement frequently delineated by basement membrane-like material. The neoplastic clusters are formed by two cell populations: the small dark cell type (that predominates) and a large cell type. Necrosis, either of the comedo or the apoptotic type, is a frequent finding. Perineural growth occurs in 50% of the cases and vascular permeation in 25%. Immunohistochemistry identifies a dual differentiation with a reactivity pattern indicative of ductal epithelial and myoepithelial differentiation, which can be confirmed by electron microscopy. The differential diagnosis of the neoplasm includes its benign counterpart, the basal cell adenoma, solid variant of adenoid cystic carcinoma, undifferentiated carcinoma, and basaloid squamous carcinoma. The tumors recur more frequently than lesions originating in major salivary glands. Mortality is associated with the anatomic site of the lesion, advanced stage, residual neoplasia at surgery, and tumor recurrence. The importance of recognizing basal cell adenocarcinoma outside major salivary glands is

  18. Reversal of galectin-1 gene silencing on resistance to cisplatin in human lung adenocarcinoma A549 cells.

    Science.gov (United States)

    Zhang, Lei; Liu, Xuegang; Tang, Zhen; Li, Xiaojun; Wang, Gengming

    2016-10-01

    This study aims to investigate reversal of Galectin-1 gene silencing on resistance to cisplatin in human lung adenocarcinoma A549 (or A549/DDP) in vivo and in vitro. The stably transfected lentivirus vector was used to silence Galectin-1 in human lung adenocarcinoma cell line A549 and A549/DDP cells and the cell lines were cultured and passaged. RT-PCR and western blot assay were used to test A549, A549/DDP cells, silenced Galectin-1A549 (A549/I) cells, Galectin-1 mRNA and protein expression levels, respectively, in A549/DDP (A549/DDP/I) cells. CCK8 assay was used to measure median inhibitory concentration (IC50) in each group and resistant index of A549/DDP cells and A549/DDP/I cells. Tumor model in nude mice was established by armpit injection of A549, A549/DDP, A549/I, A549/DDP/I cells. Cisplatin was injected intraperitoneally in tumor models and growth of tumor was observed in vivo model. Four weeks later, nude mice were killed and tumor weight and diameter was measured. mRNA and protein expression of Galectin-1 in A549/DDP cells was higher than that in A549 cells. mRNA and protein expression of Galectin-1 in A549/DDP/I cells was lower than that in A549/DDP cells. Moreover, IC50 values ​​and resistance index in A549/DDP cells was higher than that in A549 cells group and IC50 values ​​and resistance index A549/DDP/I cell group were lower than that in A549/DDP cells. Additionally, tumor weight and volume in A549/DDP/I cell group were lower than that in A549/DDP. In conclusion, Galectin-1 gene silencing would improve the sensitivity of A549/DDP cells to cisplatin in vivo and in vitro. Copyright © 2016. Published by Elsevier Masson SAS.

  19. SMAD4 Loss triggers the phenotypic changes of pancreatic ductal adenocarcinoma cells

    International Nuclear Information System (INIS)

    Chen, Yu-Wen; Hsiao, Pi-Jung; Weng, Ching-Chieh; Kuo, Kung-Kai; Kuo, Tzu-Lei; Wu, Deng-Chyang; Hung, Wen-Chun; Cheng, Kuang-Hung

    2014-01-01

    SMAD4 is a gastrointestinal malignancy-specific tumor suppressor gene found mutated in one third of colorectal cancer specimens and half of pancreatic tumors. SMAD4 inactivation by allelic deletion or intragenic mutation mainly occurs in the late stage of human pancreatic ductal adenocarcinoma (PDAC). Various studies have proposed potential SMAD4-mediated anti-tumor effects in human malignancy; however, the relevance of SMAD4 in the PDAC molecular phenotype has not yet been fully characterized. The AsPC-1, CFPAC-1 and PANC-1 human PDAC cell lines were used. The restoration or knockdown of SMAD4 expression in PDAC cells were confirmed by western blotting, luciferase reporter and immunofluorescence assays. In vitro cell proliferation, xenograft, wound healing, quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR), Western blotting, and immunohistochemistry analysis were conducted using PDAC cells in which SMAD4 was either overexpressed or knocked down. Here, we report that re-expression of SMAD4 in SMAD4-null PDAC cells does not affect tumor cell growth in vitro or in vivo, but significantly enhances cells migration in vitro. SMAD4 restoration transcriptionally activates the TGF-β1/Nestin pathway and induces expression of several transcriptional factors. In contrast, SMAD4 loss in PDAC leads to increased expression of E-cadherin, vascular endothelial growth factor (VEGF), epidermal growth factor receptor (EGFR) and CD133. Furthermore, SMAD4 loss causes alterations to multiple kinase pathways (particularly the phosphorylated ERK/p38/Akt pathways), and increases chemoresistance in vitro. Finally, PDAC cells with intact SMAD4 are more sensitive to TGF-β1 inhibitor treatment to reduced cell migration; PDAC cells lacking SMAD4 showed decreased cell motility in response to EGFR inhibitor treatment. This study revealed the molecular basis for SMAD4-dependent differences in PDAC with the aim of identifying the subset of patients likely to respond to

  20. Kinetics of colon adenocarcinoma cells in response to selected doses of gamma irradiation

    International Nuclear Information System (INIS)

    Jendzelovsky, R.; Kleban, J.; Mikes, J.; Sackova, V.; Solar, P.; Kulikova, L.; Koval, J.; Fedorocko, P.

    2006-01-01

    In our experiment we monitored changes of individual cytokinetical parameters in colon adenocarcinoma cells which were expressed to single total doses 1, 4, 8, 16, 32 and 64 Gy of gamma irradiation. We analysed cytokinetical parameters, like cellularity of adherent and floating cells, viability and cell cycle. Parameters were evaluated on 24 and 48 hour after irradiation. Dose dependent decrease of cellularity adherent cells and accumulation in G 2 phase of cell cycle was demonstrated, however almost no changes of viability and cellularity of float cells were achieved. (authors)

  1. Indomethacin-Induced Apoptosis in Esophageal Adenocarcinoma Cells Involves Upregulation of Bax and Translocation of Mitochondrial Cytochrome C Independent of COX-2 Expression

    Directory of Open Access Journals (Sweden)

    Sanjeev Aggarwal

    2000-07-01

    Full Text Available The prolonged use of nonsteroidal anti-inflammatory drugs (NSAIDs has been shown to exert a chemopreventive effect in esophageal and other gastrointestinal tumors. The precise mechanism by which this occurs, however, is unknown. While the inhibition of COX-2 as a potential explanation for this chemopreventive effect has gained a great deal of support, there also exists evidence supporting the presence of cyclooxygenase-independent pathways through which NSAIDs may exert their effects. In this study, immunohistochemical analysis of 29 Barrett's epithelial samples and 60 esophageal adenocarcinomas demonstrated abundant expression of the COX-2 protein in Barrett's epithelium, but marked heterogeneity of expression in esophageal adenocarcinomas. The three esophageal adenocarcinoma cell lines, Flo-1, Bic-1, Seg-1, also demonstrated varying expression patterns for COX-1 and COX-2. Indomethacin induced apoptosis in all three cell lines, however, in both a time- and dose-dependent manner. In Flo-1 cells, which expressed almost undetectable levels of COX-1 and COX-2, in Seg-1, which expressed significant levels of COX-1 and COX-2, indomethacin caused upregulation of the pro-apoptosic protein Bax. The upregulation of Bax was accompanied by the translocation of mitochondrial cytochrome c to the cytoplasm, activation of caspase 9. Pre-treatment of both cell lines with the specific caspase 9 inhibitor, z-LEHD-FMK, as well as the broad-spectrum caspase inhibitor, z-VAD-FMK, blocked the effect of indomethacin-induced apoptosis. These data demonstrate that induction of apoptosis by indomethacin in esophageal adenocarcinoma cells is associated with the upregulation of Bax expression and mitochondrial cytochrome c translocation, does not correlate with the expression of COX-2. This may have important implications for identifying new therapeutic targets in this deadly disease.

  2. Cell death in cancer therapy of lung adenocarcinoma.

    Science.gov (United States)

    Zagryazhskaya, Anna; Gyuraszova, Katarina; Zhivotovsky, Boris

    2015-01-01

    Lung cancer is the main cause of all cancer-related deaths in the world, with lung adenocarcinoma (ADC) being the most common subtype of this fatal disease. Lung ADC is often diagnosed at advanced stages involving disseminated metastatic tumors. This is particularly important for the successful development of new cancer therapy approaches. The high resistance of lung ADC to conventional radio- and chemotherapies represents a major challenge to treatment effectiveness. Here we discuss recent progress in understanding the mechanisms of ADC's broad resistance to treatment and its possible therapeutic implications. A number of driving oncogenic alterations were identified in a subset of lung ADCs, making them suitable for targeted therapies directed towards specific cancer-associated molecular changes. In addition, we discuss the molecular aberrations common in lung ADC that are currently being exploited or are potentially important for targeted cancer therapy, as well as limitations of this type of therapy. Furthermore, we highlight possible treatment modalities that hold promise for overcoming resistance to targeted therapies as well as alternative treatment options such as immunotherapies that are potentially promising for improving the clinical outcome of lung ADC patients.

  3. miR-511 and miR-1297 inhibit human lung adenocarcinoma cell proliferation by targeting oncogene TRIB2.

    Directory of Open Access Journals (Sweden)

    Chao Zhang

    Full Text Available microRNAs (miRNAs are small noncoding RNAs that regulate genes and contribute to many kinds of human diseases, including cancer. Two miRNAs, miR-511 and miR-1297, were investigated for a possible role in adenocarcinoma based on predicted binding sites for the TRIB2 oncogene by microRNA analysis software, and the pcDNA-GFP-TRIB2-3'UTR vector was constructed to investigate the interaction between TRIB2 and miR-511/1297 in the adenocarcinoma cell line A549. Green fluorescent protein (GFP expression was estimated by fluorescence microscopy and flow cytometry after A549 cells were co-transfected with miR-511 (or miR-1297 and pcDNA-GFP-TRIB2-3'UTR vector. The expression of GFP in the miR-511- and miR-1297-treated cells was significantly downregulated in contrast with the negative-control (NC miRNA-treated cells. The decreased expression of TRIB2 was further detected after miR-511 (or miR-1297 treatment by western blotting. The MTT test showed inhibition of A549 cell proliferation and Annexin V-FITC/PI dual staining showed increased apoptosis in the miR-511- and miR-1297-treated cells compared to the NC cultures. A transcription factor downstream of TRIB2, the CCAAT/enhancer-binding protein alpha (C/EBPα, was expression at higher levels after miR-511 (or miR-1297 decreasing TRIB2 expression. Our results illustrate that miR-511 and miR-1297 act as tumor suppressor genes, which could suppress A549 cell proliferation in vitro and in vivo by suppressing TRIB2 and further increasing C/EBPα expression.

  4. Multisystem Langerhans cell histiocytosis coexisting with metastasizing adenocarcinoma of the lung: A case report

    Directory of Open Access Journals (Sweden)

    Lovrenski Aleksandra

    2013-01-01

    Full Text Available Introduction. Langerhans cell histiocytosis (LCH is an uncommon disease of unknown etiology characterized by uncontrolled proliferation and infiltration of various organs by Langerhans cells. Case report. We presented a 54-year-old man, heavy smoker, with dyspnea, cough, hemoptysis, headache and ataxia, who died shortly after admission to our hospital. On the autopsy, tumor was found in the posterior segment of the right upper pulmonary lobe as well as a right-sided occipitoparietal lesion which penetrated into the right ventricle resulting in internal and external hematocephalus. Histologically and immunohistohemically, the diagnosis of primary lung adenocarcinoma with brain metastasis was made (tumor cells showed positivity for CK7 and TTF-1 which confirmed the diagnosis. In the lung parenchyma around the tumor, as well as in brain tissue around the metastatic adenocarcinoma histiocytic lesions were found. Light microscopic examination of the other organs also showed histiocytic lesions involving the pituitary gland, hypothalamus, spleen and mediastinal lymph nodes. Immunohistochemical studies revealed CD68, S-100 and CD1a immunoreactivity within the histiocytes upon which the diagnosis of Langerhans' cells histiocytosis was made. Conclusion. The multisystem form of LCH with extensive organ involvement was an incidental finding, while metastatic lung adenocarcinoma to the brain that led to hematocephalus was the cause of death.

  5. Effect of radiation on the expression of tumor-associated antigens of human lung adenocarcinoma cells

    International Nuclear Information System (INIS)

    Hareyama, Masato

    1988-01-01

    We studied the effects of irradiation on the expression of a tumor-associated antigen (YH206 antigen) of cultured human lung adenocarcinoma A549 cells by using enzyme-linked immunosorbent assay (ELISA) and flow cytometry. YH206 antigen is preferentially expressed on adenocarcinoma cells. Irradiation of A549 cells remarkably increased the expression of YH206 antigen on the cell surface and the level of the antigen in the culture supernatant as well as in the cell lysate, whereas it significantly affected the expression of HLA (MHC-class I) antigen on the same cells. The expression of HLA antigen on the cell was also increased after treatment of the cells with interferon-γ. In an additional experiment, cells were stained simultaneously for surface antigens (fluorescein coupled antibodies) and for DNA content (propidium iodide), and then dual parameter measurements were performed by flow cytometry to analyse the relationship between antigen levels and the cell cycle. YH206 antigen and HLA antigen increased more in the S and G 2 /M phases of the cell cycle than in G 0 /G 1 . The expression of YH206 antigen was enhanced in the S and G 2 /M phases by irradiation, whereas the expression of HLA antigen was enhanced in each phase of the cell cycle with irradiation or IFN. These results suggest that irradiation plays a key role in the change of the expression of certain tumor-associated antigens. (author)

  6. Genome wide single cell analysis of chemotherapy resistant metastatic cells in a case of gastroesophageal adenocarcinoma

    International Nuclear Information System (INIS)

    Hjortland, Geir Olav; Fodstad, Oystein; Smeland, Sigbjorn; Hovig, Eivind; Meza-Zepeda, Leonardo A; Beiske, Klaus; Ree, Anne H; Tveito, Siri; Hoifodt, Hanne; Bohler, Per J; Hole, Knut H; Myklebost, Ola

    2011-01-01

    Metastatic progression due to development or enrichment of therapy-resistant tumor cells is eventually lethal. Molecular characterization of such chemotherapy resistant tumor cell clones may identify markers responsible for malignant progression and potential targets for new treatment. Here, in a case of stage IV adenocarcinoma of the gastroesophageal junction, we report the successful genome wide analysis using array comparative genomic hybridization (CGH) of DNA from only fourteen tumor cells using a bead-based single cell selection method from a bone metastasis progressing during chemotherapy. In a case of metastatic adenocarcinoma of the gastroesophageal junction, the progression of bone metastasis was observed during a chemotherapy regimen of epirubicin, oxaliplatin and capecitabine, whereas lung-, liver and lymph node metastases as well as the primary tumor were regressing. A bone marrow aspirate sampled at the site of progressing metastasis in the right iliac bone was performed, and single cell molecular analysis using array-CGH of Epithelial Specific Antigen (ESA)-positive metastatic cells, and revealed two distinct regions of amplification, 12p12.1 and 17q12-q21.2 amplicons, containing the KRAS (12p) and ERBB2 (HER2/NEU) (17q) oncogenes. Further intrapatient tumor heterogeneity of these highlighted gene copy number changes was analyzed by fluorescence in situ hybridization (FISH) in all available primary and metastatic tumor biopsies, and ErbB2 protein expression was investigated by immunohistochemistry. ERBB2 was heterogeneously amplified by FISH analysis in the primary tumor, as well as liver and bone metastasis, but homogenously amplified in biopsy specimens from a progressing bone metastasis after three initial cycles of chemotherapy, indicating a possible enrichment of erbB2 positive tumor cells in the progressing bone marrow metastasis during chemotherapy. A similar amplification profile was detected for wild-type KRAS, although more heterogeneously

  7. Demographic, Clinical, and Prognostic Factors of Ovarian Clear Cell Adenocarcinomas According to Endometriosis Status

    DEFF Research Database (Denmark)

    Schnack, Tine H; Høgdall, Estrid; Thomsen, Lotte Nedergaard

    2017-01-01

    OBJECTIVES: Women with endometriosis carry an increased risk for ovarian clear cell adenocarcinomas (CCCs). Clear cell adenocarcinoma may develop from endometriosis lesions. Few studies have compared clinical and prognostic factors and overall survival in patients diagnosed as having CCC according...... to endometriosis status. METHODS: Population-based prospectively collected data on CCC with coexisting pelvic (including ovarian; n = 80) and ovarian (n = 46) endometriosis or without endometriosis (n = 95) were obtained through the Danish Gynecological Cancer Database. χ Test, independent-samples t test, logistic...... regression, Kaplan-Meier test, and Cox regression were used. Statistical tests were 2 sided. P values less than 0.05 were considered statistically significant. RESULTS: Patients with CCC and pelvic or ovarian endometriosis were significantly younger than CCC patients without endometriosis, and a higher...

  8. Anal metastasis of rectal cancer-adenocarcinoma of squamous cells: a case report and literature review.

    Science.gov (United States)

    Sasaki, Shun; Sugiyama, Masahiko; Nakaji, Yu; Nakanishi, Ryota; Nakashima, Yuichiro; Saeki, Hiroshi; Oki, Eiji; Oda, Yoshinao; Maehara, Yoshihiko

    2017-12-01

    Anal metastasis of colorectal cancer is very rare and is usually associated with a history of anal disease, including anal fistula, fissure, hemorrhoidectomy, and anastomotic injury. We report a case of rectal cancer with a synchronous anal metastasis consisting of adenocarcinoma of squamous cells without a history of anal disease. A 60-year-old woman had a chief complaint of melena. She had a 1.5-cm anal tumor on the perianal skin, and a Bollman type 2 rectal tumor on the Ra portion was found on colonoscopy. Biopsy of both tumors revealed a similar histology of well- to moderately differentiated adenocarcinoma. There was no sign of metastases in lymph nodes or other organs. For the purpose of diagnosis and treatment, transperineal local resection of the anal tumor was performed, and it was histologically identified as adenocarcinoma of squamous cells with no invasion to muscles, lymph ducts, or microvessels. The pathological margin was free. Then, to achieve radical cure, laparoscopic low anterior resection (LAR) with D3 lymphadenectomy was performed. The histological diagnosis of the anal tumor was adenocarcinoma of squamous cells without invasion to muscles, lymph ducts, or vessels. The surgical margin was completely free. Immunohistochemical analysis of both tumors revealed similar staining patterns, and the final diagnosis was rectal cancer with metastasis to the anal skin. The patient received no postoperative therapy, and no recurrences have been observed 12 months after surgery. We expect that our sphincter-preserving surgical strategy provided a good prognosis for the synchronous rectal cancer and anal metastasis. This is a rare report of a case with an anal metastasis of colorectal cancer on perianal squamous cells without a history of anal disease that was resected while preserving anal function.

  9. Genetic and Epigenetic Determinants of Lung Cancer Subtype: Adenocarcinoma to Small Cell Conversion

    Science.gov (United States)

    2016-10-01

    calendar NCI $ 166,700 Elucidating the regulation of mitosis by BRAF V600E in lung cancer The goals of this proposal are to analyze how mutant BRAF...AWARD NUMBER: W81XWH-14-1-0223 TITLE: Genetic and Epigenetic Determinants of Lung Cancer Subtype: Adenocarcinoma to Small Cell Conversion...PRINCIPAL INVESTIGATOR: Charles M. Rudin, MD PhD CONTRACTING ORGANIZATION: Sloan Kettering Institute for Cancer Research New York, NY 10065 REPORT DATE

  10. A clear cell adenocarcinoma of the gallbladder with hepatoid differentiation: case report and review of literature

    Directory of Open Access Journals (Sweden)

    Zhang C

    2016-09-01

    Full Text Available Chengsheng Zhang,1,2 Wei Zhang,1,2 Dianbin Mu,1 Xuetao Shi,1 Lei Zhao1,2 1Department of Hepatobiliary Surgery, Shandong Cancer Hospital affiliated to Shandong University, Shandong Academy of Medical Science, 2School of Medicine and Life Sciences, University of Jinan-Shandong Academy of Medical Sciences, Jinan, Shandong Province, People’s Republic of China Abstract: An 80-year-old male was referred to our department for a gallbladder mass. He denied any history of alcohol consumption or cholecystitis and smoking. Hepatitis B surface antigen test and antihepatitis C antibody test were found to be negative. Serum carbohydrate antigen 19-9 (CA19-9 and carcinoembryonic antigen were elevated (CA19-9 was 59.92 U/mL and carcinoembryonic antigen was 12.64 ng/mL, whereas alpha-fetoprotein was below the normal limit (2.46 ng/mL. Computed tomography scan revealed a solid mass with measurements of 4.6×5.6×7.1 cm, which nearly filled the whole gallbladder space. Radical cholecystectomy, including segments IV B and V of the liver and lymphadenectomy, was performed. The neoplasm in gallbladder was completely resected, and the patient obtained a negative margin. Histological and immunohistochemical profile suggested a clear cell adenocarcinoma of the gallbladder with hepatoid differentiation. After reviewing the literature, we reported that this case is the first identified case of cell adenocarcinoma of the gallbladder with extensive hepatoid differentiation. However, clinical features of clear cell adenocarcinoma with hepatoid differentiation remain unclear due to the extremely rare incidence. There was no indication of adjuvant chemotherapy and no literature has been reported on the application of chemotherapy. This case showed a promising clinical outcome after curative resection, which indicated that surgical treatment could be potentially considered for suitable patients. Keywords: gallbladder, clear cell adenocarcinoma, hepatoid differentiation 

  11. Undifferentiated pulmonary adenocarcinoma of clear cells associated to hypertrophic osteopathy in a dog

    OpenAIRE

    Rossetto, Victor José Vieira [UNESP; Rahal, Sheila Canevese [UNESP; Pardini, Luciana Moura Campos [UNESP; Fabris, Viciany Erique [UNESP; Mamprim, Maria Jaqueline [UNESP; Ribeiro, Sergio Marrone [UNESP

    2015-01-01

    Background: Most of the primary pulmonary tumors in dogs are malignant and from epithelial origin, being bronchioalveolar tumors more prevalent. Adenocarcinoma of clear cells, however, is a very rare pulmonary tumor and its origin is still unknown. It is related to several clinical abnormalities, including hypertrophic osteopathy, an unusual paraneoplastic syndrome characterized by a periosteal reaction along the shaft of long bones. Because of the unusual presentation of the pulmonary adenoc...

  12. Metastatic Basal Cell Adenocarcinoma of Submandibular Gland to the Spine: An Extremely Rare Condition.

    Science.gov (United States)

    Pluemvitayaporn, Tinnakorn; Kunakornsawat, Sombat; Piyaskulkaew, Chaiwat; Pruttikul, Pritsanai; Pongpinyopap, Warongporn

    2017-12-01

    Basal cell adenocarcinomas are rare malignant neoplasms of salivary glands, accounting for gland tumors. Few cases of distant metastases have been reported. A 50-year-old Thai man was diagnosed with basal cell adenocarcinoma of the submandibular gland with pulmonary and cervical spine metastases with progressive myelopathy. He was treated with wide surgical resection of the soft tissue tumor and modified radical neck dissection, anterior cervical total corpectomy with fusion combined with posterior decompression and fusion of the cervical spine, and surgical wound coverage by anterolateral thigh free tissue transfer, followed by adjuvant radiotherapy. At 18-month follow-up, the patient remained in good condition, and no signs of local recurrence or contiguous spreading were detected. Postoperative radiographs showed solid osseous fusion without loss of correction or implant failure. This case highlighted an extremely rare condition of metastatic basal cell adenocarcinoma of the submandibular gland to the lung and spine, which, to our knowledge, has not been previously reported in the literature. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Cell division cycle 20 overexpression predicts poor prognosis for patients with lung adenocarcinoma.

    Science.gov (United States)

    Shi, Run; Sun, Qi; Sun, Jing; Wang, Xin; Xia, Wenjie; Dong, Gaochao; Wang, Anpeng; Jiang, Feng; Xu, Lin

    2017-03-01

    The cell division cycle 20, a key component of spindle assembly checkpoint, is an essential activator of the anaphase-promoting complex. Aberrant expression of cell division cycle 20 has been detected in various human cancers. However, its clinical significance has never been deeply investigated in non-small-cell lung cancer. By analyzing The Cancer Genome Atlas database and using some certain online databases, we validated overexpression of cell division cycle 20 in both messenger RNA and protein levels, explored its clinical significance, and evaluated the prognostic role of cell division cycle 20 in non-small-cell lung cancer. Cell division cycle 20 expression was significantly correlated with sex (p = 0.003), histological classification (p overexpression of cell division cycle 20 was significantly associated with bigger primary tumor size (p = 0.0023), higher MKI67 level (r = 0.7618, p Overexpression of cell division cycle 20 is associated with poor prognosis in lung adenocarcinoma patients, and its overexpression can also be used to identify high-risk groups. In conclusion, cell division cycle 20 might serve as a potential biomarker for lung adenocarcinoma patients.

  14. Thyroid cell lines in research on goitrogenesis.

    Science.gov (United States)

    Gerber, H; Peter, H J; Asmis, L; Studer, H

    1991-12-01

    Thyroid cell lines have contributed a lot to the understanding of goitrogenesis. The cell lines mostly used in thyroid research are briefly discussed, namely the rat thyroid cell lines FRTL and FRTL-5, the porcine thyroid cell lines PORTHOS and ARTHOS, The sheep thyroid cell lines OVNIS 5H and 6H, the cat thyroid cell lines PETCAT 1 to 4 and ROMCAT, and the human thyroid cell lines FTC-133 and HTh 74. Chinese hamster ovary (CHO) cells and COS-7 cells, stably transfected with TSH receptor cDNA and expressing a functional TSH receptor, are discussed as examples for non-thyroidal cells, transfected with thyroid genes.

  15. Goblet cells carcinoid with mucinous adenocarcinoma of the vermiform appendix: a step towards the unitary intestinal stem cell theory?

    Science.gov (United States)

    Gravante, G; Yahia, S; Gopalakrishnan, K; Mathew, G

    2014-06-01

    Associations of various histotypes in appendiceal neoplasms may help elucidate the histogenesis of such uncommon tumors. We present the fourth published case of Goblet Cell Carcinoid (GCC) associated with mucinous adenocarcinoma of the appendix. This association has been described only for GCC and not for classic appendix carcinoids which are thought to originate from neuroendocrine-committed cells. The GCC-mucinous association adds more towards the theory of a pluripotent intestinal stem cell with amphicrine possibilities of differentiation.

  16. [An experimental study on the Chinese lung adenocarcinoma cell clone CPA-Yang1-BR with brain metastasis potency in nude mice and in vivo imaging research].

    Science.gov (United States)

    Lei, Bei; Cao, Jie; Shen, Jie; Zhao, Lanxiang; Liang, Sheng; Meng, Qinggang; Xie, Wenhui; Yang, Shunfang

    2013-08-20

    Lung cancer is the leading cause of cancer-related death in men and women. It is also the most common cause of brain metastases. A brain metastasis model is difficult to be established because of the presence of the blood-brain barrier (BBB) and the lack of optimal methods for detecting brain metastasis in nude mice. Thus, the establishment of a Chinese lung adenocarcinoma cell line and its animal model with brain metastasis potency and in vivo research is of great significance. CPA-Yang1 cells were obtained from a patient with human lung adenocarcinoma by lentiviral vector-mediated transfection of green fluorescence protein. Intracardiac inoculation of the cells was performed in nude mice, and brain metastatic lesions were detected using micro ¹⁸F FDG-PET/CT scanners, small animal in vivo imaging system for fluorescence, radionuclide and X ray fused imaging, magnetic resonance imaging (MRI) with sense body detection, and resection. The samples were divided into two parts for cell culture and histological diagnosis. The process was repeated in vivo and in vitro for four cycles to obtain a novel cell clone, CPA-Yang1-BR. A novel cell clone, CPA-Yang1-BR, was obtained with a brain metastatic rate of 50%. The use of MRI for the detection of brain metastases has obvious advantages. An experimental Chinese lung adenocarcinoma cell clone (CPA-Yang1-BR) and its animal model with brain metastasis potency in nude mice were established. MRI with sense body or micro MRI may be used as a sensitive, accurate, and noninvasive method to detect experimental brain metastases in intact live immunodeficient mice. The results of this study may serve as a technical platform for brain metastases from lung adenocarcinoma.

  17. Per2 participates in AKT-mediated drug resistance in A549/DDP lung adenocarcinoma cells.

    Science.gov (United States)

    Chen, Bo; Tan, Yaoxi; Liang, Yan; Li, Yan; Chen, Lei; Wu, Shuangshuang; Xu, Wei; Wang, Yan; Zhao, Weihong; Wu, Jianqing

    2017-01-01

    Period2 (Per2) is a key mammalian circadian clock protein, and additionally has a tumor suppressive function. The present study aimed to investigate its role in drug resistance in A549/cisplatin (DDP) lung adenocarcinoma cells. Per2 knockdown and overexpression in A549/DDP cells were used to compare cell proliferation (by MTT assay), apoptosis (active-caspase 3 western blot) and clone forming assay. The activation of AKT/mechanistic target of rapamycin (mTOR) was investigated by a western blot assay. The Per2 expression level was decreased in A549/DDP cells compared with A549 cells. Per2 knockdown by short hairpin RNA protects A549/DDP cells from apoptosis, and promotes proliferation and migration. Per2 knockdown results in increased activation of the phosphoinositide 3-kinase (PI3K)/AKT/mTOR signaling pathway. Overexpression of Per2 in A549/DDP cells may reduce the activity of the PI3K/AKT/mTOR signaling pathway, and promote apoptosis of A549 cells. The results of the present study suggest that Per2 participates in AKT-mediated drug resistance in A549/DDP lung adenocarcinoma cells.

  18. [Expression and significance of IKBKB in pulmonary adenocarcinoma A549 cells and its cisplatin-resistant variant A549/DDP].

    Science.gov (United States)

    Qi, Kang; Li, Yang; Li, Xuebing; Zhang, Fang; Shao, Yi; Zhou, Qinghua

    2014-05-01

    Cisplatin-resistance in Lung cancer cells is widespread in the clinical treatment, seriously affecting the effects of the treatment of lung cancer. Therefore, the research of mechanisms of cisplain-resistance has significant meaning for developing new chemotherapeutic drug and solving the cisplain-resistance in clinic treatment. IKBKB is one of the most important catalytic subunits of IKK complexes. It plays an important regulatory role in activation of NF-κB. The aim of this study is to investigate the differential expression of IKBKB gene in human lung adenocarcinoma cells line A549 and the cisplatin-resistant variant A549/DDP and the mechanisms of cisplain-resistance induced by IKBKB gene. MTT assay was employed to determine the sensitivity of A549 and A549/DDP cells line to cisplatin and the effect of IKBKB gene on A549 cell lines' sensitivity to cisplatin. The mRNA level of IKBKB was determined by real-time PCR. Dual luciferase reporter gene experiment was employed to determine the activity of the NF-κB. Apoptosis rate of lung adenocarcinoma cells was determined by flow cytometry. Apoptosis rate and IC50 were significantly different in A549 and A549/DDP cells, the expression of mRNA level of IKBKB gene in A549/DDP was significantly higher than that in A549. Compared with control group, IKBKB gene was able to reduce the cisplain sensitivity of A549 cells. After A549 was transfected with pcDNA3.1/IKBKB plasmid, mRNA level of IKBKB was significantly increased, the sensitivity of cisplain was decreased, the IC50 was increased 2.85 fold, the apoptosis rate was decreased 59%, the activity of NF-κB has been greatly increased. IKBKB inhibits cisplatin-induced apoptosis via the activation of NF-κB pathway. It will be helpful in the development of new anticancer drug and solving the challenge of cisplatin-resistance.

  19. [Comparison of clinical pathological characteristics in ovarian preserving patients with stage IB1 cervical adenocarcinoma and squamous cell carcinoma].

    Science.gov (United States)

    Hu, J; Zheng, P Z; Zhu, L R

    2016-10-18

    To analyze the risk and prognostic of patients with stage IB1 cervical adenocarcinoma. The clinical data of 139 patients with stage IB1 cervical adenocarcinoma treated at Department of Gynecology and Obstetrics in Peking University First Hospital from August 1994 to April 2015 were retrospectively reviewed, which included 38 cases of cervical adenocarcinoma and 101 cases of cervical squamous cell carcinoma. A comparison was made between ovarian preserving group and bilateral oophorectomy group, in order to justify the risk and prognosis of ovarian preserving patients. The 5-year cumulative survival rate of stage IB1 cervical adenocarcinoma and squamous cell carcinoma were 89.1% and 92.9% respectively with significant difference (P=0.034). One ovarian metastasis case was observed among the 32 cervical adenocarcinoma patients of bilateral oophorectomy, while another ovarian metastasis case was observed among 54 cervical squamous cell carcinoma patients of bilateral oophorectomy. The ovarian metastasis rate was 3.1% (1/32) and 1.8 % (1/54) respectively with no statistical difference (P=0.574). The cumulative 5-year survival of 6 ovarian preserving patients with cervical adenocarcinoma was 80.1%, while that of 47 ovarian preserving patients with cervical squamous cell carcinoma was 94.6% (P=0.127). There was no statistical difference between the survival curve of the two groups. The prognosis of stage IB1 cervical adenocarcinomas was somewhat poorer than that of cervical squamous cell carcinoma. However it was still reasonable to perform ovarian preservation among young patients of stage IB1 cervical adenocarcinoma with no high risk factors.

  20. Boletus edulis biologically active biopolymers induce cell cycle arrest in human colon adenocarcinoma cells.

    Science.gov (United States)

    Lemieszek, Marta Kinga; Cardoso, Claudia; Ferreira Milheiro Nunes, Fernando Hermínio; Ramos Novo Amorim de Barros, Ana Isabel; Marques, Guilhermina; Pożarowski, Piotr; Rzeski, Wojciech

    2013-04-25

    The use of biologically active compounds isolated from edible mushrooms against cancer raises global interest. Anticancer properties are mainly attributed to biopolymers including mainly polysaccharides, polysaccharopeptides, polysaccharide proteins, glycoproteins and proteins. In spite of the fact that Boletus edulis is one of the widely occurring and most consumed edible mushrooms, antitumor biopolymers isolated from it have not been exactly defined and studied so far. The present study is an attempt to extend this knowledge on molecular mechanisms of their anticancer action. The mushroom biopolymers (polysaccharides and glycoproteins) were extracted with hot water and purified by anion-exchange chromatography. The antiproliferative activity in human colon adenocarcinoma cells (LS180) was screened by means of MTT and BrdU assays. At the same time fractions' cytotoxicity was examined on the human colon epithelial cells (CCD 841 CoTr) by means of the LDH assay. Flow cytometry and Western blotting were applied to cell cycle analysis and protein expression involved in anticancer activity of the selected biopolymer fraction. In vitro studies have shown that fractions isolated from Boletus edulis were not toxic against normal colon epithelial cells and in the same concentration range elicited a very prominent antiproliferative effect in colon cancer cells. The best results were obtained in the case of the fraction designated as BE3. The tested compound inhibited cancer cell proliferation which was accompanied by cell cycle arrest in the G0/G1-phase. Growth inhibition was associated with modulation of the p16/cyclin D1/CDK4-6/pRb pathway, an aberration of which is a critical step in the development of many human cancers including colon cancer. Our results indicate that a biopolymer BE3 from Boletus edulis possesses anticancer potential and may provide a new therapeutic/preventive option in colon cancer chemoprevention.

  1. Quantitative proteomic profiling identifies DPYSL3 as pancreatic ductal adenocarcinoma-associated molecule that regulates cell adhesion and migration by stabilization of focal adhesion complex.

    Directory of Open Access Journals (Sweden)

    Takeo Kawahara

    Full Text Available Elucidation of how pancreatic cancer cells give rise to distant metastasis is urgently needed in order to provide not only a better understanding of the underlying molecular mechanisms, but also to identify novel targets for greatly improved molecular diagnosis and therapeutic intervention. We employed combined proteomic technologies including mass spectrometry and isobaric tags for relative and absolute quantification peptide tagging to analyze protein profiles of surgically resected human pancreatic ductal adenocarcinoma tissues. We identified a protein, dihydropyrimidinase-like 3, as highly expressed in human pancreatic ductal adenocarcinoma tissues as well as pancreatic cancer cell lines. Characterization of the roles of dihydropyrimidinase-like 3 in relation to cancer cell adhesion and migration in vitro, and metastasis in vivo was performed using a series of functional analyses, including those employing multiple reaction monitoring proteomic analysis. Furthermore, dihydropyrimidinase-like 3 was found to interact with Ezrin, which has important roles in cell adhesion, motility, and invasion, while that interaction promoted stabilization of an adhesion complex consisting of Ezrin, c-Src, focal adhesion kinase, and Talin1. We also found that exogenous expression of dihydropyrimidinase-like 3 induced activating phosphorylation of Ezrin and c-Src, leading to up-regulation of the signaling pathway. Taken together, the present results indicate successful application of combined proteomic approaches to identify a novel key player, dihydropyrimidinase-like 3, in pancreatic ductal adenocarcinoma tumorigenesis, which may serve as an important biomarker and/or drug target to improve therapeutic strategies.

  2. Quantitative proteomic profiling identifies DPYSL3 as pancreatic ductal adenocarcinoma-associated molecule that regulates cell adhesion and migration by stabilization of focal adhesion complex.

    Science.gov (United States)

    Kawahara, Takeo; Hotta, Naoe; Ozawa, Yukiko; Kato, Seiichi; Kano, Keiko; Yokoyama, Yukihiro; Nagino, Masato; Takahashi, Takashi; Yanagisawa, Kiyoshi

    2013-01-01

    Elucidation of how pancreatic cancer cells give rise to distant metastasis is urgently needed in order to provide not only a better understanding of the underlying molecular mechanisms, but also to identify novel targets for greatly improved molecular diagnosis and therapeutic intervention. We employed combined proteomic technologies including mass spectrometry and isobaric tags for relative and absolute quantification peptide tagging to analyze protein profiles of surgically resected human pancreatic ductal adenocarcinoma tissues. We identified a protein, dihydropyrimidinase-like 3, as highly expressed in human pancreatic ductal adenocarcinoma tissues as well as pancreatic cancer cell lines. Characterization of the roles of dihydropyrimidinase-like 3 in relation to cancer cell adhesion and migration in vitro, and metastasis in vivo was performed using a series of functional analyses, including those employing multiple reaction monitoring proteomic analysis. Furthermore, dihydropyrimidinase-like 3 was found to interact with Ezrin, which has important roles in cell adhesion, motility, and invasion, while that interaction promoted stabilization of an adhesion complex consisting of Ezrin, c-Src, focal adhesion kinase, and Talin1. We also found that exogenous expression of dihydropyrimidinase-like 3 induced activating phosphorylation of Ezrin and c-Src, leading to up-regulation of the signaling pathway. Taken together, the present results indicate successful application of combined proteomic approaches to identify a novel key player, dihydropyrimidinase-like 3, in pancreatic ductal adenocarcinoma tumorigenesis, which may serve as an important biomarker and/or drug target to improve therapeutic strategies.

  3. Novel metastatic models of esophageal adenocarcinoma derived from FLO-1 cells highlight the importance of E-cadherin in cancer metastasis.

    Science.gov (United States)

    Liu, David S; Hoefnagel, Sanne J M; Fisher, Oliver M; Krishnadath, Kausilia K; Montgomery, Karen G; Busuttil, Rita A; Colebatch, Andrew J; Read, Matthew; Duong, Cuong P; Phillips, Wayne A; Clemons, Nicholas J

    2016-12-13

    There is currently a paucity of preclinical models available to study the metastatic process in esophageal cancer. Here we report FLO-1, and its isogenic derivative FLO-1LM, as two spontaneously metastatic cell line models of human esophageal adenocarcinoma. We show that FLO-1 has undergone epithelial-mesenchymal transition and metastasizes following subcutaneous injection in mice. FLO-1LM, derived from a FLO-1 liver metastasis, has markedly enhanced proliferative, clonogenic, anti-apoptotic, invasive, immune-tolerant and metastatic potential. Genome-wide RNAseq profiling revealed a significant enrichment of metastasis-related pathways in FLO-1LM cells. Moreover, CDH1, which encodes the adhesion molecule E-cadherin, was the most significantly downregulated gene in FLO-1LM compared to FLO-1. Consistent with this, repression of E-cadherin expression in FLO-1 cells resulted in increased metastatic activity. Importantly, reduced E-cadherin expression is commonly reported in esophageal adenocarcinoma and independently predicts poor patient survival. Collectively, these findings highlight the biological importance of E-cadherin activity in the pathogenesis of metastatic esophageal adenocarcinoma and validate the utility of FLO-1 parental and FLO-1LM cells as preclinical models of metastasis in this disease.

  4. Antioxidant potential of buffalo and cow milk Cheddar cheeses to tackle human colon adenocarcinoma (Caco-2) cells.

    Science.gov (United States)

    Huma, Nuzhat; Rafiq, Saima; Sameen, Aysha; Pasha, Imran; Khan, Muhammad Issa

    2018-02-01

    The aim of present study was to assess the anti-oxidant potential of water-soluble peptides (WSPs) extract derived from buffalo and cow milk Cheddar cheeses at different stages of ripening. The antioxidant potential of WSPs extract was assessed through 2,2'-azinobis-3-ethylbenzothiazoline-6sulfonic acid (ABTS)-radical scavenging activity. In addition, impact of WSPs extract on cell viability and production of reactive oxygen species (ROS) in human colon adenocarcinoma Caco-2 (tert-butylhydroperoxide-induced) cell lines was also evaluated. The ABTS-radical scavenging activity increased progressively with ripening period and dose-dependently in both cheeses. However, peptide extract from buffalo milk Cheddar cheese demonstrated relatively higher activity due to higher contents of water-soluble nitrogen. Intracellular ROS production in Caco-2 cells decreased significantly (pCaco-2 cell line. On the basis of current in vitro study, the Cheddar cheese WSPs extract can protect intestinal epithelium against oxidative stress due to their antioxidant activity.

  5. Antioxidant potential of buffalo and cow milk Cheddar cheeses to tackle human colon adenocarcinoma (Caco-2 cells

    Directory of Open Access Journals (Sweden)

    Nuzhat Huma

    2018-02-01

    Full Text Available Objective The aim of present study was to assess the anti-oxidant potential of water-soluble peptides (WSPs extract derived from buffalo and cow milk Cheddar cheeses at different stages of ripening. Methods The antioxidant potential of WSPs extract was assessed through 2,2’-azinobis-3-ethylbenzothiazoline-6sulfonic acid (ABTS-radical scavenging activity. In addition, impact of WSPs extract on cell viability and production of reactive oxygen species (ROS in human colon adenocarcinoma Caco-2 (tert-butylhydroperoxide-induced cell lines was also evaluated. Results The ABTS-radical scavenging activity increased progressively with ripening period and dose-dependently in both cheeses. However, peptide extract from buffalo milk Cheddar cheese demonstrated relatively higher activity due to higher contents of water-soluble nitrogen. Intracellular ROS production in Caco-2 cells decreased significantly (p<0.05 till 150th day of cheese ripening and remained constant thereafter. Additionally, dose-dependent response of WSPs extract on antioxidant activity was noticed in the Caco-2 cell line. Conclusion On the basis of current in vitro study, the Cheddar cheese WSPs extract can protect intestinal epithelium against oxidative stress due to their antioxidant activity.

  6. Molecular Analysis of Motility in Metastatic Mammary Adenocarcinoma Cells

    Science.gov (United States)

    1996-09-01

    Biology of the Cell, p.508. Garland Publishing, New York. Barkalow K., Witke W., Kwiatkowski DJ., Hartwig JH. 1996. Coordinated regulation of Platelet...distribution unlimited." This report should be released to the National Technical Information Service. 2. Point of contact for this request is Ms. Judy

  7. Characterization of a human ovarian carcinoma cell line: UCI 101.

    Science.gov (United States)

    Fuchtner, C; Emma, D A; Manetta, A; Gamboa, G; Bernstein, R; Liao, S Y

    1993-02-01

    A new epithelial ovarian carcinoma cell line (UCI 101) has been established from the ascitic fluids and solid tumor of a patient with progressive papillary adenocarcinoma of the ovary shown previously to be refractory to combination chemotherapy consisting of cyclophosphamide, Adriamycin, and cisplatin as well as single-agent chemotherapy of taxol and high-dose cisplatin. The UCI 101 cell line grows well with an in vitro doubling time of 24 hr. The cell line expresses the B 72.3 (Tag 72), CA125, MH99 (ESA), and E29 (EMA) cell surface antigens and AE1/AE3 cytokeratins. This cell line overexpresses (as determined by immunocytochemistry) both p-glycoprotein and the epidermal growth factor receptor. The in vitro drug response to single agents including Adriamycin, cisplatin, dequalinium chloride, etoposide, 5-fluorouracil, taxol, and tumor necrosis factor was examined. Intraperitoneal transplantation of the cells into athymic mice resulted in foci of tumor on all peritoneal surfaces including the viscera and diaphragm ultimately leading to solid bulky disease with massive production of ascites. High levels of CA125 (> 500 units/ml) were detected in the serum of tumor-bearing mice. Cytogenetic analysis of cultured cells shows several marker chromosomes containing deletions, duplications, and translocations. Cytologic and histologic evaluation of the xenograft revealed morphological characteristics identical to those of the original tumor.

  8. Usefulness of carcinoembryonic antigen in the diagnosis of small cell lung cancer combined with adenocarcinoma.

    Science.gov (United States)

    Lei, Lei; Chen, Qixun; Wang, Zeng; Han, Na; Chen, Bo; Qin, Jing; Lu, Hong-Yang

    2017-10-01

    Small cell lung cancer (SCLC) includes pure SCLC and SCLC combined with other pathologies (C-SCLC). C-SCLC accounts for about 28% of all SCLCs subjected to surgical resection, but only about 1%-3% of C-SCLCs are detected by biopsy. Since less than 5% of SCLC patients are eligible for surgery, it is necessary to develop alternative methods for the detection of C-SCLC. We determined whether serum carcinoembryonic antigen (CEA) levels, which are usually elevated in lung adenocarcinomas, could be used to differentiate between pure SCLC and SCLC combined with adenocarcinoma. We reviewed the records of 41 SCLC patients (35 with pure SCLC, 6 with C-SCLC) who underwent surgical resection between 2000 and 2014 in Zhejiang Cancer Hospital. Their preoperative serum CEA levels were noted, and the relationship between CEA level and the type of SCLC was analyzed. Serum CEA levels >6ng/mL were found more frequently in C-SCLC patients than in pure SCLC patients (p = 0.031). No such difference was observed when a CEA cut-off of 5ng/mL was used (p = 0.316). A preoperative serum CEA of >6ng/mL may be used as a reference in the diagnosis of SCLC combined with adenocarcinoma.

  9. [Correlation between Serum Tumor Markers and Efficacy of First-line EGFR-TKIs in Patients with Advanced Lung Adenocarcinoma].

    Science.gov (United States)

    Chen, Hanxiao; Yang, Xue; Liu, Huijun; Ma, Kun; Zhong, Jia; Dong, Zhi; Zhuo, Minglei; Wang, Yuyan; Li, Jianjie; An, Tongtong; Wu, Meina; Wang, Ziping; Zhao, Jun

    2017-09-20

    Epidermal growth factor receptor tyrosine kinase inhibitors (EGFR-TKIs) significantly improve the survival of advanced lung adenocarcinoma patients harboring EGFR mutation. Limited to the standards of tumor tissue samples and detection methods, still some people can't receive target therapy following genetic guidance. This study was to explore the relevance between serum tumor markers and treatment of EGFR-TKIs. We retrospectively collected the clinical information of advanced lung adenocarcinoma patients harboring EGFR mutation, who received EGFR-TKIs as first-line therapy from June 2009 to June 2014 in Peking University Cancer Hospital, analyzed the relationship between serum tumor markers and efficacy of EGFR-TKIs. The objective response rate (ORR) was 52.8% and the disease control rate (DCR) was 89.3%. The results showed that, patients with high CEA level before treatment responded better to TKIs (ORR 61.3% vs 35.9%, DCR 95.2% vs 74.4%, PCEA decreased 1 month later (61.5% vs 25%, P=0.002). Progression-free survival (PFS) significantly prolonged in patients with elevated baseline CEA (mPFS 9.8 mo vs 5.9 mo, P=0.027). To the opposite, PFS was significantly shorter in patients with elevated baseline CYFRA21-1 and CA125 (mPFS 9.0 mo vs 11.4 mo, P=0.029; 9.0 mo vs 11.5 mo, P=0.023, respectively). Multivariate analysis showed that Eastern Cooperative Oncology Group (ECOG) score of 0-1, normal baseline CYFRA21-1 and CEA decline predicted longer PFS. The overall survival (OS) was highly associated with elevated CYFRA21-1 and CA125 (median OS 25.1 mo vs 52.5 mo, P=0.003; 22.7 mo vs 55.0 mo, PCEA. High level of baseline CEA and decline 1 month after treatment could predict the efficacy of EGFR-TKIs in patients with advanced lung adenocarcinoma. While high levels of baseline CYFRA21-1 and CA125 indicated shortened survival.

  10. Antimigratory Effects of the Methanol Extract from Momordica charantia on Human Lung Adenocarcinoma CL1 Cells

    Directory of Open Access Journals (Sweden)

    Hsue-Yin Hsu

    2012-01-01

    Full Text Available Momordica charantia has been found to exhibit anticancer activity, in addition to its well-known therapeutic functions. We have demonstrated that the leaf extract of Momordica charantia (MCME induces apoptosis in several human cancer cells through caspase- and mitochondria-dependent pathways. In this study, a different susceptibility to MCME was found in human lung adenocarcinoma CL1 cells with different metastatic ability, leading to the significant difference of cell viability and invasiveness between MCME-treated CL1-0 and CL1-5 cells. MCME was found to upregulate the expression of Wnt-2 and affect the migratory and invasive ability of CL1 cells through suppressed MMP-2 and MMP-9 enzymatic activities. We proposed that MCME mediates inhibition against migration of CL1 cells by reducing the expression and activation of Src and FAK to decrease the expression of downstream Akt, β-catenin, and MMPs.

  11. [Retrospective Study of Efficacy in BIM Gene Polymorphism on First-line EGFR-TKIs Treatment for Advanced Lung Adenocarcinoma].

    Science.gov (United States)

    Qian, Kun; Zhang, Yi; Zhi, Xiuyi

    2017-08-20

    The aim of this study is to detect the BIM polymorphism in 85 formalin-fixed and parrffin-embedded (FFPE) and some blood samples of advanced lung adenocarcinoma patients and study the relativity betweenthe BIM polymorphism and tyrosine kinase inhibitor (TKI). The correlation between BIM detection of different types of specimens was discussed. There were 85 patients who were diagnosed as advanced lung adenocarcinoma with epidermal growth factor receptor (EGFR) 19 or 21 exon mutation in thoracic surgery of Xuanwu Hospital from February 2013 to November 2014, all of who were received EGFR-TKI as first-line treatment in the study. FFPE and some blood were used to detect the BIM polymorphism. The objective response rate (ORR) and progression-free survival (PFS) of two groups were compared. According to smoking, sex, EGFR mutation and other factors, the single factor analysis was performed, and the correlation between paraffin samples and blood test BIM was compared. The ORR in BIM polymorphism and non-polymorphism groups was no significant differences (P>0.05). The median PFS in BIM polymorphism and non-polymorphism group was 7.1 months and 12.8 months, respectively (P=0.013). Univariate analysis the median PFS, women were longer than men (12.1 months vs 10.7 months, P=0.835); Non-smokers were longer than smokers (12.1 months vs 9.7 months, P=0.974). Group in EGFR exon 21 is longer than group in EGFR exon 19 (12.2 months vs 8.7 months, P=0.303). Detection of BIM gene polymorphism in lung cancer patients with EGFR-TKIs treatment might be helpful for predicting prognosis. But a large sample study is needed.

  12. Expression and Significance of IKBKB in Pulmonary Adenocarcinoma A549 Cells and Its Cisplatin-resistant Variant A549/DDP

    Directory of Open Access Journals (Sweden)

    Kang QI

    2014-05-01

    Full Text Available Background and objective Cisplatin-resistance in Lung cancer cells is widespread in the clinical treatment, seriously affecting the effects of the treatment of lung cancer. Therefore, the research of mechanisms of cisplain-resistance has significant meaning for developing new chemotherapeutic drug and solving the cisplain-resistance in clinic treatment. IKBKB is one of the most important catalytic subunits of IKK complexes. It plays an important regulatory role in activation of NF-κB. The aim of this study is to investigate the differential expression of IKBKB gene in human lung adenocarcinoma cells line A549 and the cisplatin-resistant variant A549/DDP and the mechanisms of cisplain-resistance induced by IKBKB gene. Methods MTT assay was employed to determine the sensitivity of A549 and A549/DDP cells line to cisplatin and the effect of IKBKB gene on A549 cell lines’ sensitivity to cisplatin. The mRNA level of IKBKB was determined by real-time PCR. Dual luciferase reporter gene experiment was employed to determine the activity of the NF-κB. Apoptosis rate of lung adenocarcinoma cells was determined by flow cytometry. Results Apoptosis rate and IC50 were significantly different in A549 and A549/DDP cells, the expression of mRNA level of IKBKB gene in A549/DDP was significantly higher than that in A549. Compared with control group, IKBKB gene was able to reduce the cisplain sensitivity of A549 cells. After A549 was transfected with pcDNA3.1/IKBKB plasmid, mRNA level of IKBKB was significantly increased, the sensitivity of cisplain was decreased, the IC50 was increased 2.85 fold, the apoptosis rate was decreased 59%, the activity of NF-κB has been greatly increased. Conclusion IKBKB inhibits cisplatin-induced apoptosis via the activation of NF-κB pathway. It will be helpful in the development of new anticancer drug and solving the challenge of cisplatin-resistance.

  13. Histological transformation of adenocarcinoma to small cell carcinoma lung as a rare mechanism of resistance to epidermal growth factor receptor-tyrosine kinase inhibitors: Report of a case with review of literature.

    Science.gov (United States)

    Hui, Monalisa; Uppin, Shantveer G; Stalin, Bala Joseph; Sadashivudu, G

    2018-01-01

    A subset of non-small cell lung carcinoma (NSCC) harbor active mutations of epidermal growth factor receptor (EGFR). In these, EGFR tyrosine kinase inhibitors (EGFR-TKIs) are recommended as the first-line treatment. Though drug resistance is inevitable, histological transformation to small cell lung carcinoma (SCLC) is a rare mechanism for acquired resistance. Here we report one such rare case of histological transformation of pulmonary adenocarcinoma to small cell lung carcinoma in 46 year old male treated with Gefitinib.

  14. Discovery of HeLa Cell Contamination in HES Cells: Call for Cell Line Authentication in Reproductive Biology Research.

    Science.gov (United States)

    Kniss, Douglas A; Summerfield, Taryn L

    2014-08-01

    Continuous cell lines are used frequently in reproductive biology research to study problems in early pregnancy events and parturition. It has been recognized for 50 years that many mammalian cell lines contain inter- or intraspecies contaminations with other cells. However, most investigators do not routinely test their culture systems for cross-contamination. The most frequent contributor to cross-contamination of cell lines is the HeLa cell isolated from an aggressive cervical adenocarcinoma. We report on the discovery of HeLa cell contamination of the human endometrial epithelial cell line HES isolated in our laboratory. Short tandem repeat analysis of 9 unique genetic loci demonstrated molecular identity between HES and HeLa cells. In addition, we verified that WISH cells, isolated originally from human amnion epithelium, were also contaminated with HeLa cells. Inasmuch as our laboratory did not culture HeLa cells at the time of HES cell derivations, the source of contamination was the WISH cell line. These data highlight the need for continued diligence in authenticating cell lines used in reproductive biology research. © The Author(s) 2014.

  15. Expression of chemokine receptor CXCR4 in esophageal squamous cell and adenocarcinoma

    International Nuclear Information System (INIS)

    Gockel, Ines; Galle, Peter R; Junginger, Theodor; Moehler, Markus; Schimanski, Carl C; Heinrich, Christian; Wehler, T; Frerichs, K; Drescher, Daniel; Langsdorff, Christian von; Domeyer, Mario; Biesterfeld, Stefan

    2006-01-01

    Prognosis of esophageal cancer is poor despite curative surgery. The chemokine receptor CXCR4 has been proposed to distinctly contribute to tumor growth, dissemination and local immune escape in a limited number of malignancies. The aim of our study was to evaluate the role of CXCR4 in tumor spread of esophageal cancer with a differentiated view of the two predominant histologic types – squamous cell and adenocarcinoma. Esophageal cancer tissue samples were obtained from 102 consecutive patients undergoing esophageal resection for cancer with curative intent. The LSAB+ System was used to detect the protein CXCR4. Tumor samples were classified into two groups based on the homogeneous staining intensity. A cut-off between CXCR4w (= weak expression) and CXCR4s (= strong expression) was set at 1.5 (grouped 0 – 1.5 versus 2.0 – 3). Long-term survival rates were calculated using life tables and the Kaplan-Meier method. Using the Cox's proportional hazards analysis, a model of survival prediction was established. The overall expression rate for CXCR4 in esophageal squamous cell carcinoma was 94.1%. Subdividing these samples, CXCR4w was found in 54.9% and CXCR4s in 45.1%. In adenocarcinoma, an overall expression rate of 89.1% was detected with a weak intensitiy in 71.7% compared to strong staining in 29.3% (p = 0.066 squamous cell versus adenocarcinoma). The Cox's proportional hazards analysis identified the pM-category with a hazard ratio (HR) of 1.860 (95% CI: 1.014–3.414) (p = 0.045), the histologic tumor type (HR: 0.334; 95% CI: 0.180–0.618) (p = 0.0001) and the operative approach (transthoracic > transhiatal esophageal resection) (HR: 0.546; 95% CI: 0.324–0.920) (p = 0.023) as independent factors with a possible influence on the long-term prognosis in patients with esophageal carcinoma, whereas CXCR4 expression was statistically not significant (>0.05). Expression of the chemokine receptor CXCR4 in esophageal cancer is of major relevance in both

  16. Monocarboxylate transporters MCT1 and MCT4 regulate migration and invasion of pancreatic ductal adenocarcinoma cells

    DEFF Research Database (Denmark)

    Kong, Su Chii; Nøhr-Nielsen, Asbjørn; Zeeberg, Katrine

    2016-01-01

    OBJECTIVES: Novel treatments for pancreatic ductal adenocarcinoma (PDAC) are severely needed. The aim of this work was to explore the roles of H-lactate monocarboxylate transporters 1 and 4 (MCT1 and MCT4) in PDAC cell migration and invasiveness. METHODS: Monocarboxylate transporter expression......, localization, activity, and function were explored in human PDAC cells (MIAPaCa-2, Panc-1, BxPC-3, AsPC-1) and normal human pancreatic ductal epithelial (HPDE) cells, by quantitative polymerase chain reaction, immunoblotting, immunocytochemistry, lactate flux, migration, and invasion assays. RESULTS: MCT1......, or knockdown of MCT1 or MCT4. PDAC cell migration was largely unaffected by MCT1/MCT2 inhibition or MCT1 knockdown but was reduced by 4-CIN and by MCT4 knockdown (BxPC-3). Invasion measured in Boyden chamber (BxPC-3, Panc-1) and spheroid outgrowth (BxPC-3) assays was attenuated by 4-CIN and AR-C155858...

  17. Hypoxia and prostaglandin E receptor 4 signalling pathways synergise to promote endometrial adenocarcinoma cell proliferation and tumour growth.

    Science.gov (United States)

    Catalano, Rob D; Wilson, Martin R; Boddy, Sheila C; McKinlay, Andrew T M; Sales, Kurt J; Jabbour, Henry N

    2011-05-12

    The prostaglandin endoperoxide synthase (PTGS) pathway is a potent driver of tumour development in humans by enhancing the biosynthesis and signalling of prostaglandin (PG) E(2). PTGS2 expression and PGE(2) biosynthesis is elevated in endometrial adenocarcinoma, however the mechanism whereby PTGS and PGE(2) regulate endometrial tumour growth is unknown. Here we investigated (a) the expression profile of the PGE synthase enzymes (PTGES, PTGES-2, PTGES-3) and PGE receptors (PTGER1-4) in endometrial adenocarcinomas compared with normal endometrium and (b) the role of PTGER4 in endometrial tumorigenesis in vivo. We found elevated expression of PTGES2 and PTGER4 and suppression of PTGER1 and PTGER3 in endometrial adenocarcinomas compared with normal endometrium. Using WT Ishikawa endometrial adenocarcinoma cells and Ishikawa cells stably transfected with the full length PTGER4 cDNA (PTGER4 cells) xenografted in the dorsal flanks of nude mice, we show that PTGER4 rapidly and significantly enhances tumour growth rate. Coincident with enhanced PTGER4-mediated tumour growth we found elevated expression of PTGS2 in PTGER4 xenografts compared with WT xenografts. Furthermore we found that the augmented growth rate of the PTGER4 xenografts was not due to enhanced angiogenesis, but regulated by an increased proliferation index and hypoxia. In vitro, we found that PGE(2) and hypoxia independently induce expression of PTGER4 indicating two independent pathways regulating prostanoid receptor expression. Finally we have shown that PGE(2) and hypoxia synergise to promote cellular proliferation of endometrial adenocarcinoma cells.

  18. Comprehensive sampling of gene expression in human cell lines with massively parallel signature sequencing

    OpenAIRE

    Jongeneel, C. Victor; Iseli, Christian; Stevenson, Brian J.; Riggins, Gregory J.; Lal, Anita; Mackay, Alan; Harris, Robert A.; O'Hare, Michael J.; Neville, A. Munro; Simpson, Andrew J. G.; Strausberg, Robert L.

    2003-01-01

    Whereas information is rapidly accumulating about the structure and position of genes encoded in the human genome, less is known about the complexity and relative abundance of their expression in individual human cells and tissues. Here, we describe the characteristics of the transcriptomes of two cultured cell lines, HB4a (normal breast epithelium) and HCT-116 (colon adenocarcinoma), using massively parallel signature sequencing (MPSS). We generated in excess of 107 short signature sequences...

  19. DNA Damage in CD133-Positive Cells in Barrett’s Esophagus and Esophageal Adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Raynoo Thanan

    2016-01-01

    Full Text Available Barrett’s esophagus (BE caused by gastroesophageal reflux is a major risk factor of Barrett’s esophageal adenocarcinoma (BEA, an inflammation-related cancer. Chronic inflammation and following tissue damage may activate progenitor cells under reactive oxygen/nitrogen species-rich environment. We previously reported the formation of oxidative/nitrative stress-mediated mutagenic DNA lesions, 8-oxo-7,8-dihydro-2′-deoxyguanosine (8-oxodG and 8-nitroguanine, in columnar epithelial cells of BE tissues and cancer cells of BEA tissues. We investigated the mechanisms of BEA development in relation to oxidative/nitrative DNA damage and stem cell hypothesis. We examined 8-nitroguanine and 8-oxodG formation and the expression of stem cell marker (CD133 in biopsy specimens of patients with BE and BEA by immunohistochemical analysis in comparison with those of normal subjects. CD133 was detected at apical surface of columnar epithelial cells of BE and BEA tissues, and the cytoplasm and cell membrane of cancer cells in BEA tissues. DNA lesions and CD133 were colocalized in columnar epithelial cells and cancer cells. Their relative staining intensities in these tissues were significantly higher than those in normal subjects. Our results suggest that BE columnar epithelial cells with CD133 expression in apical surface undergo inflammation-mediated DNA damage, and mutated cells acquire the property of cancer stem cells with cytoplasmic CD133 expression.

  20. Data for comparative proteomics analysis of the antitumor effect of CIGB-552 peptide in HT-29 colon adenocarcinoma cells

    Directory of Open Access Journals (Sweden)

    Teresa Núñez de Villavicencio-Díaz

    2015-09-01

    Full Text Available CIGB-552 is a second generation antitumor peptide that displays potent cytotoxicity in lung and colon cancer cells. The nuclear subproteome of HT-29 colon adenocarcinoma cells treated with CIGB-552 peptide was identified and analyzed [1]. This data article provides supporting evidence for the above analysis.

  1. CEA-producing urothelial cell carcinoma with metastasis presenting as a rectal adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Ming-Hsin Yang

    2012-11-01

    Full Text Available This is a case study of a 61-year-old male who presented with difficult defecation for 1 month. A circumferential submucosal rectal tumor was noted on a digital rectal examination and colonoscopy. Laboratory examination revealed high serum levels of carcinoembryonic antigen (CEA; 43.75 ng/mL and carbohydrate antigen 19-9 (CA19-9; 11,790 U/mL. In addition, tumor biopsies revealed a poorly differentiated adenocarcinoma of the rectum with intact mucosa. The patient had history of advanced stage-T2 urothelial cell carcinoma of bladder, which had been downstaged to T0 by neoadjuvant chemotherapy followed by radical cystectomy 1 year prior. After investigating the initial bladder tumor specimens, a small portion of the tumor with high CEA expression comparable to the submucosal rectal tumor was found. The size of the tumor was reduced and the levels of the tumor markers decreased after administering FOLFIRI chemotherapy targeted at the adenocarcinoma. Although neoadjuvant chemotherapy may have a selective pressure to eliminate most urothelial cell carcinoma, physicians should be aware that it can lead to rectal metastasis via CEA-producing components.

  2. Down-regulation of telomerase activity in DLD-1 human colorectal adenocarcinoma cells by tocotrienol

    International Nuclear Information System (INIS)

    Eitsuka, Takahiro; Nakagawa, Kiyotaka; Miyazawa, Teruo

    2006-01-01

    As high telomerase activity is detected in most cancer cells, inhibition of telomerase by drug or dietary food components is a new strategy for cancer prevention. Here, we investigated the inhibitory effect of vitamin E, with particular emphasis on tocotrienol (unsaturated vitamin E), on human telomerase in cell-culture study. As results, tocotrienol inhibited telomerase activity of DLD-1 human colorectal adenocarcinoma cells in time- and dose-dependent manner, interestingly, with δ-tocotrienol exhibiting the highest inhibitory activity. Tocotrienol inhibited protein kinase C activity, resulting in down-regulation of c-myc and human telomerase reverse transcriptase (hTERT) expression, thereby reducing telomerase activity. In contrast to tocotrienol, tocopherol showed very weak telomerase inhibition. These results provide novel evidence for First time indicating that tocotrienol acts as a potent candidate regulator of telomerase and supporting the anti-proliferative function of tocotrienol

  3. [Synergistic Antitumor Effect of Amorphigenin Combined with Cisplatin in Human Lung Adenocarcinoma A549/DDP Cells].

    Science.gov (United States)

    Zhong, Hongzhen; Zuo, Yufang; Wu, Xin; Peng, Yan; He, Huiping; Yang, Jun; Guan, Chengnong; Xu, Zumin

    2016-12-20

    Amorphigenin, a rotenoid compouns, from seeds of Amorpha fruticosa, has been shown to possess anti-proliferation activities in several cancer cells. To explore the antitumor effects of amorphigenin on cisplatin-resistant human lung adenocarcinoma A549/DDP cells and explore the underlying mechanisms. CCK-8 assay was used to measure the proliferation of A549/DDP cells; Colony formation assay was used to measure the colony formation of A549/DDP cells; Flow cytometry assay was used to detect the apoptosis rates; Western blot analysis was used to explore the expression of apoptosis-related proteins (caspase-3 protein, PARP protein) and lung resistance protein (LRP). Our results demonstrated that amorphigenin could inhibit the proliferation of A549/DDP cells with a inhibition concentration of 50% cell growth (IC50) at 48 h of (2.19±0.92) μmol/L. Amorphigenin could inhibit the colony formation ability and induce apoptosis of A549/DDP cells; Furthermore, amorphigenin combined with cisplatin showed synergistic proliferation-inhibitory effect and apoptosis-promoting effect in A549/DDP cells; reduced the expression of LRP of A549/DDP cells. Amorphigenin remarkably inhibits the proliferation and induces apoptosis in A549/DDP cells. Combination of amorphigenin with cisplatin had the synergistic inhibitory effect on A549/DDP cells by downregulating the expression of LRP.
.

  4. Cinnamomum verum component 2-methoxycinnamaldehyde: a novel antiproliferative drug inducing cell death through targeting both topoisomerase I and II in human colorectal adenocarcinoma COLO 205 cells

    Directory of Open Access Journals (Sweden)

    Kuen-daw Tsai

    2016-06-01

    Full Text Available Background: Cinnamomum verum is used to manufacture the spice cinnamon. In addition, the plant has been used as a Chinese herbal medication. Methods: We investigated the antiproliferative effect of 2-methoxycinnamaldehyde (2-MCA, a constituent of the cortex of the plant, and the molecular biomarkers associated with tumorigenesis in human colorectal adenocarcinoma COLO 205 cells. Specifically, cell viability was evaluated by colorimetric assay; apoptosis was determined by flow cytometry and morphological analysis with bright field, acridine orange, and neutral red stainings, as well as comet assay; topoisomerase I activity was determined by assay based upon DNA relaxation and topoisomerase II by DNA relaxation plus decatentation of kinetoplast DNA; lysosomal vacuolation and volume of acidic compartments (VACs were determined by neutral red staining. Results: The results demonstrate that 2-MCA inhibited proliferation and induced apoptosis as implicated by mitochondrial membrane potential (ΔΨm loss, activation of both caspase-3 and -9, increase of annexin V+PI+ cells, as well as morphological characteristics of apoptosis. Furthermore, 2-MCA also induced lysosomal vacuolation with elevated VAC, cytotoxicity, and inhibitions of topoisomerase I as well as II activities. Additional study demonstrated the antiproliferative effect of 2-MCA found in a nude mice model. Conclusions: Our data implicate that the antiproliferative activity of 2-MCA in vitro involved downregulation of cell growth markers, both topoisomerase I and II, and upregulation of pro-apoptotic molecules, associated with increased lysosomal vacuolation. In vivo 2-MCA reduced the tumor burden that could have significant clinical impact. Indeed, similar effects were found in other tested cell lines, including human hepatocellular carcinoma SK-Hep-1 and Hep 3B, lung adenocarcinoma A549 and squamous cell carcinoma NCI-H520, and T-lymphoblastic MOLT-3 (results not shown. Our data implicate

  5. Detection of Merkel cell polyomavirus in cervical squamous cell carcinomas and adenocarcinomas from Japanese patients

    Directory of Open Access Journals (Sweden)

    Imajoh Masayuki

    2012-08-01

    Full Text Available Abstract Background Merkel cell polyomavirus (MCPyV was identified originally in Merkel cell carcinoma (MCC, a rare form of human skin neuroendocrine carcinoma. Evidence of MCPyV existence in other forms of malignancy such as cutaneous squamous cell carcinomas (SCCs is growing. Cervical cancers became the focus of our interest in searching for potentially MCPyV-related tumors because: (i the major histological type of cervical cancer is the SCC; (ii the uterine cervix is a common site of neuroendocrine carcinomas histologically similar to MCCs; and (iii MCPyV might be transmitted during sexual interaction as demonstrated for human papillomavirus (HPV. In this study, we aimed to clarify the possible presence of MCPyV in cervical SCCs from Japanese patients. Cervical adenocarcinomas (ACs were also studied. Results Formalin-fixed paraffin-embedded tissue samples from 48 cervical SCCs and 16 cervical ACs were examined for the presence of the MCPyV genome by polymerase chain reaction (PCR and sequencing analyses. PCR analysis revealed that 9/48 cervical SCCs (19% and 4/16 cervical ACs (25% were positive for MCPyV DNA. MCPyV-specific PCR products were sequenced to compare them with reference sequences. The nucleotide sequences in the MCPyV large T (LT-sequenced region were the same among MCPyV-positive cervical SCCs and AC. Conversely, in the MCPyV viral protein 1 (VP1-sequenced region, two cervical SCCs and three cervical ACs showed several nucleotide substitutions, of which three caused amino acid substitutions. These sequencing results suggested that three MCPyV variants of the VP1 were identified in our cases. Immunohistochemistry showed that the LT antigen was expressed in tumor cells in MCPyV-positive samples. Genotyping of human HPV in the MCPyV-positive samples revealed that infected HPVs were HPV types 16, 31 and 58 for SCCs and HPV types 16 and 18 for ACs. Conclusions This study provides the first observation that MCPyV coexists in a subset

  6. Met is the most frequently amplified gene in endometriosis-associated ovarian clear cell adenocarcinoma and correlates with worsened prognosis.

    Directory of Open Access Journals (Sweden)

    Yoriko Yamashita

    Full Text Available Clear cell adenocarcinoma of the ovary (OCC is a chemo-resistant tumor with a relatively poor prognosis and is frequently associated with endometriosis. Although it is assumed that oxidative stress plays some role in the malignant transformation of this tumor, the characteristic molecular events leading to carcinogenesis remain unknown. In this study, an array-based comparative genomic hybridization (CGH analysis revealed Met gene amplification in 4/13 OCC primary tumors and 2/8 OCC cell lines. Amplification of the AKT2 gene, which is a downstream component of the Met/PI3K signaling pathway, was also observed in 5/21 samples by array-based CGH analysis. In one patient, both the Met and AKT2 genes were amplified. These findings were confirmed using fluorescence in situ hybridization, real-time quantitative PCR, immunoblotting, and immunohistochemistry. In total, 73 OCC cases were evaluated using real-time quantitative PCR; 37.0% demonstrated Met gene amplification (>4 copies, and 8.2% had AKT2 amplification. Furthermore, stage 1 and 2 patients with Met gene amplification had significantly worse survival than patients without Met gene amplification (p<0.05. Met knockdown by shRNA resulted in reduced viability of OCC cells with Met amplification due to increased apoptosis and cellular senescence, suggesting that the Met signaling pathway plays an important role in OCC carcinogenesis. Thus, we believe that targeted inhibition of the Met pathway may be a promising treatment for OCC.

  7. Neoplastic epithelial duct cell line established from an irradiated human salivary gland. [/sup 60/Co

    Energy Technology Data Exchange (ETDEWEB)

    Shirasuna, K.; Sato, M.; Miyazaki, T.

    1981-08-01

    Transformed epithelial cells were isolated by using tissue culture techniques from an irradiated human submandibular salivary gland which showed no neoplastic lesion. These cells, carrying colony-forming ability in semisolid agar, formed a semiconfluent monolayer with occasional tubular arrangement. All transformed clones were demonstrated by electron microscopic examination to be only one type of cells having fine structure similar to intercalated duct cells. Moreover, inoculation of the cloned cells into nude mice resulted in a production of adenocarcinoma with solid and trabecular pattern. These findings indicate that a human intercalated duct cell line carrying tumorigenicity is established from a human submandibular salivary gland with an exposure to irradiation.

  8. Effects of non-thermal mobile phone radiation on breast adenocarcinoma cells

    Directory of Open Access Journals (Sweden)

    Zen Fourie

    2011-09-01

    Full Text Available Mobile phone usage currently exceeds landline communication in Africa. The extent of this usage has raised concerns about the long-term health effects of the ongoing use of mobile phones. To assess the physiological effects of radiation from mobile phones in vitro, MCF-7 breast adenocarcinoma cells were exposed to 2W/kg non-thermal 900-MHz mobile phone radiation. The effects investigated were those on metabolic activity, cell morphology, cell cycle progression, phosphatidylserine (PS externalisation and the generation of reactive oxygen species and nitrogen species. Statistically insignificant increases in mitochondrial dehydrogenase activity were observed in irradiated cells when compared to controls. Fluorescent detection of F-actin demonstrated an increase in F-actin stress fibre formation in irradiated MCF-7 cells. Cell cycle progression revealed no statistically significant variation. A small increase in early and late apoptotic events in irradiated MCF-7 cells was observed. No statistically significant changes were observed in reactive oxygen and reactive nitrogen species generation. In addition, quantitative and qualitative analyses of cell cycle activity and nuclear and cytosolic changes, respectively, revealed no significant changes. In conclusion, exposure to 1 h of 900-MHz irradiation induced an increase in PS externalisation and an increase in the formation of F-actin stress fibres in MCF-7 cells. Data obtained from this study, and their correlation with other studies, provides intriguing links between radio frequency radiation and cellular events and warrant further investigation.

  9. Sulforaphane down-regulates SKP2 to stabilize p27(KIP1) for inducing antiproliferation in human colon adenocarcinoma cells.

    Science.gov (United States)

    Chung, Yuan-Kai; Chi-Hung Or, Richard; Lu, Chien-Hsing; Ouyang, Wei-Ting; Yang, Shu-Yi; Chang, Chia-Che

    2015-01-01

    Sulforaphane is a cruciferous vegetable-derived isothiocyanate with promising chemopreventive and therapeutic activities. Induction of proliferation arrest and apoptosis principally contribute to sulforaphane's anticancer activity, but the precise molecular mechanisms remain elusive. The oncoprotein SKP2 is a key component of the SKP1-CULLIN1-F-box (SCF) E3 ligase complex and is responsible for directing SCF-mediated degradation of cyclin-dependent kinase inhibitor p27(KIP1) to promote cell proliferation. We herein provide the first evidence supporting the critical involvement of the SKP2-p27(KIP1) axis in sulforaphane-induced antiproliferation in various human colon adenocarcinoma cell lines. Specifically, sulforaphane markedly suppressed the levels of bromodeoxyuridine (BrdU) incorporation and clonogenicity in all tested cell lines, illustrating the antiproliferative effect of sulforaphane. Of note, sulforaphane-induced antiproliferation was accompanied with down-regulation of SKP2, leading to the stabilization and thus up-regulation of p27(KIP1). Additionally, sulforaphane was found to down-regulate SKP2 mainly through transcriptional repression, as sulforaphane lowered SKP2 mRNA expression and the SKP2 promoter activity. Furthermore, sulforaphane treatment led to the activation of both AKT and ERK, thus ruling out the possibility that sulforaphane down-regulates SKP2 by inhibiting AKT or ERK. Notably, sulforaphane-elicited suppression of BrdU incorporation and clonogenicity were significantly rescued in the context of SKP2 overexpression or p27(KIP1) depletion, therefore highlighting the important role of SKP2 down-regulation and the ensuing stabilization of p27(KIP1) in sulforaphane-induced antiproliferation. Collectively, these data expand our molecular understanding about how sulforaphane elicits proliferation arrest, but also implicate the application of sulforaphane in therapeutic modalities targeting SKP2. Copyright © 2014 The Society for Biotechnology

  10. Chemosensitivity of irradiated resistant cells of multicellular spheroids in A549 lung adenocarcinoma

    International Nuclear Information System (INIS)

    Shi Degang; Shi Genming; Huang Gang

    2006-01-01

    Objective: To investigate the chemosensitivity of irradiated resistant cells of multicellular spheroids in A549 lung adenocarcinoma. Methods: The A549 irradiated resistant cells were the 10th regrowth generations after irradiated with 2.5 Gy of 6 MV X-ray, the control groups were A549 parent cells and MCFY/VCR resistant cells. The 6 kinds of chemotherapeutic drugs were DDP, VDS, 5-FU, HCP, MMC and ADM respectively, with verapamil (VPL) as reverse agent. The treatment effect was compared with MTT assay, and the multidrug resistant gene expressions of mdrl and MRP were measured with RT-PCR method. Results: A549 cells and irradiated resistant cells were resistant to DDP, but sensitivity to VDS,5-FU, HCP, MMC and ADM. The inhibitory rates of VPL to the above two cells were 98% and 25% respectively(P 2 -MG and MRP/β 2 -MG of all A549 cells were about 0 and 0.7 respectively, and those of MCFT/VCR cells were 35 and 4.36. Conclusion: The chemosensitivity of A549 irradiated resistant cells had not changed markedly, the decreased sensitivity to VPL could not be explained by the gene expression of mdrl and MRP. It is conferred that some kinds of changes in the cell membrane and decreased regrowth ability to result in resistance. Unlike multidrug resistance induced by chemotherapy, VPL may be not an ideal reverser to irradiated resistant cells. The new kinds of biological preparation should be sought to combine chemotherapy to treat recurring tumor with irradiated resistance. (authors)

  11. Nintedanib plus docetaxel as second-line therapy in patients with non-small-cell lung cancer

    DEFF Research Database (Denmark)

    Popat, Sanjay; Mellemgaard, Anders; Fahrbach, Kyle

    2015-01-01

    BACKGROUND: Nintedanib plus docetaxel has proven an overall survival benefit over docetaxel monotherapy in second-line treatment of non-small-cell lung cancer of adenocarcinoma histology in the LUME-Lung 1 pivotal trial. No published trials have previously compared nintedanib plus docetaxel...... with agents – other than docetaxel – that are approved second-line treatments for non-small-cell lung cancer. METHODS: The relative efficacy of nintedanib plus docetaxel versus second-line agents was evaluated by conducting a network meta-analysis of progression-free survival and overall survival. RESULTS...... with advanced non-small-cell lung cancer of adenocarcinoma histology, results suggest that nintedanib plus docetaxel offers clinical benefit compared with docetaxel alone, when used as second-line treatment, and suggests that this combination may also add clinical benefit compared with erlotinib in this patient...

  12. Apoptosis signal-regulating kinase 1 mediates denbinobin-induced apoptosis in human lung adenocarcinoma cells

    Directory of Open Access Journals (Sweden)

    Pan Shiow-Lin

    2009-05-01

    Full Text Available Abstract In the present study, we explore the role of apoptosis signal-regulating kinase 1 (ASK1 in denbinobin-induced apoptosis in human lung adenocarcinoma (A549 cells. Denbinobin-induced cell apoptosis was attenuated by an ASK1 dominant-negative mutant (ASK1DN, two antioxidants (N-acetyl-L-cysteine (NAC and glutathione (GSH, a c-Jun N-terminal kinase (JNK inhibitor (SP600125, and an activator protein-1 (AP-1 inhibitor (curcumin. Treatment of A549 cells with denbinobin caused increases in ASK1 activity and reactive oxygen species (ROS production, and these effects were inhibited by NAC and GSH. Stimulation of A549 cells with denbinobin caused JNK activation; this effect was markedly inhibited by NAC, GSH, and ASK1DN. Denbinobin induced c-Jun phosphorylation, the formation of an AP-1-specific DNA-protein complex, and Bim expression. Bim knockdown using a bim short interfering RNA strategy also reduced denbinobin-induced A549 cell apoptosis. The denbinobin-mediated increases in c-Jun phosphorylation and Bim expression were inhibited by NAC, GSH, SP600125, ASK1DN, JNK1DN, and JNK2DN. These results suggest that denbinobin might activate ASK1 through ROS production to cause JNK/AP-1 activation, which in turn induces Bim expression, and ultimately results in A549 cell apoptosis.

  13. Parotid Salivary Gland Basal Cell Adenocarcinoma in a Big-eared Opossum (Didelphis aurita).

    Science.gov (United States)

    Díaz-Delgado, J; Coimbra, A A C; Dos Santos-Cirqueira, C; Sanches, T C; Guerra, J M; de Oliveira, A S; Di Loretto, C; Zwarg, T; Ressio, R; Rivas, L; Sansone, M; Nagamori, F O; Kanamura, C; Gonçalves, P S; Fernandes, N C C A; Groch, K R; Catão-Dias, J L

    2018-02-01

    The opossum (family Didelphidae) is a marsupial endemic to the Americas. Apart from the South American short-tailed opossum (Monodelphis domestica) and the Virginia opossum (Didelphis virginiana), there is considerable lack of knowledge about the health and diseases of most opossum species. Among these, the big-eared opossum (Didelphis aurita) is found in Argentina, Brazil and Paraguay. Natural and experimental studies have shown this species to be susceptible to infectious agents with zoonotic potential and the animals may play a role in transmission of such agents. However, neoplasia appears to be uncommon in this species. We describe the gross, microscopical and immunohistochemical features of a parotid salivary gland basal cell adenocarcinoma in a free-living big-eared opossum. This case represents the first report of salivary gland neoplasia in opossums. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. The Prognostic Impact of NK/NKT Cell Density in Periampullary Adenocarcinoma Differs by Morphological Type and Adjuvant Treatment.

    Science.gov (United States)

    Lundgren, Sebastian; Warfvinge, Carl Fredrik; Elebro, Jacob; Heby, Margareta; Nodin, Björn; Krzyzanowska, Agnieszka; Bjartell, Anders; Leandersson, Karin; Eberhard, Jakob; Jirström, Karin

    2016-01-01

    Natural killer (NK) cells and NK T cells (NKT) are vital parts of tumour immunosurveillance. However, their impact on prognosis and chemotherapy response in periampullary adenocarcinoma, including pancreatic cancer, has not yet been described. Immune cell-specific expression of CD56, CD3, CD68 and CD1a was analysed by immunohistochemistry on tissue microarrays with tumours from 175 consecutive cases of periampullary adenocarcinoma, 110 of pancreatobiliary type (PB-type) and 65 of intestinal type (I-type) morphology. Kaplan-Meier and Cox regression analysis were applied to determine the impact of CD56+ NK/NKT cells on 5-year overall survival (OS). High density of CD56+ NK/NKT cells correlated with low N-stage and lack of perineural, lymphatic vessel and peripancreatic fat invasion. High density of CD56+ NK/NKT cells was associated with prolonged OS in Kaplan-Meier analysis (p = 0.003), and in adjusted Cox regression analysis (HR = 0.49; 95% CI 0.29-0.86). The prognostic effect of high CD56+ NK/NKT cell infiltration was only evident in cases not receiving adjuvant chemotherapy in PB-type tumours (p for interaction = 0.014). This study demonstrates that abundant infiltration of CD56+ NK/NKT cells is associated with a prolonged survival in periampullary adenocarcinoma. However, the negative interaction with adjuvant treatment is noteworthy. NK cell enhancing strategies may prove to be successful in the management of these cancers.

  15. BITC Sensitizes Pancreatic Adenocarcinomas to TRAIL-induced Apoptosis

    Directory of Open Access Journals (Sweden)

    Christina A. Wicker

    2009-01-01

    Full Text Available Pancreatic adenocarcinoma is an aggressive cancer with a greater than 95% mortality rate and short survival after diagnosis. Chemotherapeutic resistance hinders successful treatment. This resistance is often associated with mutations in codon 12 of the K-Ras gene (K-Ras 12, which is present in over 90% of all pancreatic adenocarcinomas. Codon 12 mutations maintain Ras in a constitutively active state leading to continuous cellular proliferation. Our study determined if TRAIL resistance in pancreatic adenocarcinomas with K-Ras 12 mutations could be overcome by first sensitizing the cells with Benzyl isothiocyanate (BITC. BITC is a component of cruciferous vegetables and a cell cycle inhibitor. BxPC3, MiaPaCa2 and Panc-1 human pancreatic adenocarcinoma cell lines were examined for TRAIL resistance. Our studies show BITC induced TRAIL sensitization by dual activation of both the extrinsic and intrinsic apoptotic pathways.

  16. Expression of C4.4A in precursor lesions of pulmonary adenocarcinoma and squamous cell carcinoma

    DEFF Research Database (Denmark)

    Jacobsen, Benedikte; Santoni-Rugiu, Eric; Illemann, Martin

    2012-01-01

    in precursor lesions of lung squamous cell carcinoma and adenocarcinoma was investigated by stainings with a specific anti-C4.4A antibody. In the transformation from normal bronchial epithelium to squamous cell carcinoma, C4.4A was weakly expressed in basal cell hyperplasia but dramatically increased...... in squamous metaplasia. This was confined to the cell membrane and sustained in dysplasia, carcinoma in situ, and the invasive carcinoma. The induction of C4.4A already at the stage of hyperplasia could indicate that it is a marker of very early squamous differentiation, which aligns well with our earlier...... finding that C4.4A expression levels do not provide prognostic information on the survival of squamous cell carcinoma patients. In the progression from normal alveolar epithelium to peripheral adenocarcinoma, we observed an unexpected, distinct cytoplasmic staining for C4.4A in a fraction of atypical...

  17. Biosynthesis and transport of lysosomal alpha-glucosidase in the human colon carcinoma cell-line Caco-2: secretion from the apical surface

    NARCIS (Netherlands)

    Klumperman, J.; Fransen, J.A.; Boekestijn, J.C.; Oude Elferink, R.P.; Matter, K.; Hauri, H.P.; Tager, J.M.; Ginsel, L.A.

    1991-01-01

    The human adenocarcinoma cell line Caco-2 was used for studies on the biosynthesis and transport of lysosomal acid alpha-glucosidase in polarized epithelial cells. Metabolic labelling revealed that in Caco-2 cells alpha-glucosidase is synthesized as a precursor form of 110 x 10(3) Mr. This form is

  18. Quercetin Suppresses CYR61-Mediated Multidrug Resistance in Human Gastric Adenocarcinoma AGS Cells

    Directory of Open Access Journals (Sweden)

    Ho Bong Hyun

    2018-01-01

    Full Text Available Cysteine-rich angiogenic inducer 61 (CYR61 is an extracellular matrix-associated protein involved in survival, tumorigenesis, and drug resistance. Therefore, we examined the effects of flavones against CYR61-overexpressing human gastric adenocarcinoma AGS (AGS-cyr61 cells, which show remarkable resistance to 5-fluorouracil (5-FU, adriamycin (ADR, tamoxifen (TAM, paclitaxel (PAC, and docetaxel (DOC. Among the tested flavones, quercetin had the lowest 50% inhibitory concentration (IC50 and significantly reduced the viability of AGS-cyr61 cells compared with AGS cells. Quercetin: (1 reduced multidrug resistance-associated protein 1 and nuclear factor (NF-kappa B p65 subunit levels; (2 reversed multidrug resistance (MDR; (3 inhibited colony formation and induced caspase-dependent apoptosis; and (4 suppressed migration and down-regulated epithelial–mesenchymal transition-related proteins in AGS-cyr61. Moreover, AGS-cyr61 cells treated with quercetin concentrations close to the IC50 and simultaneously treated with 5-FU or ADR in the sub-lethal range showed strong synergism between quercetin and these two drugs. These findings indicate that CYR61 is a potential regulator of drug resistance and that quercetin may be a novel agent for improving the efficacy of anticancer drugs in AGS-cyr61 cells.

  19. Hypoxia and prostaglandin E receptor 4 signalling pathways synergise to promote endometrial adenocarcinoma cell proliferation and tumour growth.

    Directory of Open Access Journals (Sweden)

    Rob D Catalano

    Full Text Available The prostaglandin endoperoxide synthase (PTGS pathway is a potent driver of tumour development in humans by enhancing the biosynthesis and signalling of prostaglandin (PG E(2. PTGS2 expression and PGE(2 biosynthesis is elevated in endometrial adenocarcinoma, however the mechanism whereby PTGS and PGE(2 regulate endometrial tumour growth is unknown. Here we investigated (a the expression profile of the PGE synthase enzymes (PTGES, PTGES-2, PTGES-3 and PGE receptors (PTGER1-4 in endometrial adenocarcinomas compared with normal endometrium and (b the role of PTGER4 in endometrial tumorigenesis in vivo. We found elevated expression of PTGES2 and PTGER4 and suppression of PTGER1 and PTGER3 in endometrial adenocarcinomas compared with normal endometrium. Using WT Ishikawa endometrial adenocarcinoma cells and Ishikawa cells stably transfected with the full length PTGER4 cDNA (PTGER4 cells xenografted in the dorsal flanks of nude mice, we show that PTGER4 rapidly and significantly enhances tumour growth rate. Coincident with enhanced PTGER4-mediated tumour growth we found elevated expression of PTGS2 in PTGER4 xenografts compared with WT xenografts. Furthermore we found that the augmented growth rate of the PTGER4 xenografts was not due to enhanced angiogenesis, but regulated by an increased proliferation index and hypoxia. In vitro, we found that PGE(2 and hypoxia independently induce expression of PTGER4 indicating two independent pathways regulating prostanoid receptor expression. Finally we have shown that PGE(2 and hypoxia synergise to promote cellular proliferation of endometrial adenocarcinoma cells.

  20. Seminal plasma enhances cervical adenocarcinoma cell proliferation and tumour growth in vivo.

    Directory of Open Access Journals (Sweden)

    Jason R Sutherland

    Full Text Available Cervical cancer is one of the leading causes of cancer-related death in women in sub-Saharan Africa. Extensive evidence has shown that cervical cancer and its precursor lesions are caused by Human papillomavirus (HPV infection. Although the vast majority of HPV infections are naturally resolved, failure to eradicate infected cells has been shown to promote viral persistence and tumorigenesis. Furthermore, following neoplastic transformation, exposure of cervical epithelial cells to inflammatory mediators either directly or via the systemic circulation may enhance progression of the disease. It is well recognised that seminal plasma contains an abundance of inflammatory mediators, which are identified as regulators of tumour growth. Here we investigated the role of seminal plasma in regulating neoplastic cervical epithelial cell growth and tumorigenesis. Using HeLa cervical adenocarcinoma cells, we found that seminal plasma (SP induced the expression of the inflammatory enzymes, prostaglandin endoperoxide synthase (PTGS1 and PTGS2, cytokines interleukin (IL -6, and -11 and vascular endothelial growth factor-A (VEGF-A. To investigate the role of SP on tumour cell growth in vivo, we xenografted HeLa cells subcutaneously into the dorsal flank of nude mice. Intra-peritoneal administration of SP rapidly and significantly enhanced the tumour growth rate and size of HeLa cell xenografts in nude mice. As observed in vitro, we found that SP induced expression of inflammatory PTGS enzymes, cytokines and VEGF-A in vivo. Furthermore we found that SP enhances blood vessel size in HeLa cell xenografts. Finally we show that SP-induced cytokine production, VEGF-A expression and cell proliferation are mediated via the induction of the inflammatory PTGS pathway.

  1. Seminal plasma enhances cervical adenocarcinoma cell proliferation and tumour growth in vivo.

    Science.gov (United States)

    Sutherland, Jason R; Sales, Kurt J; Jabbour, Henry N; Katz, Arieh A

    2012-01-01

    Cervical cancer is one of the leading causes of cancer-related death in women in sub-Saharan Africa. Extensive evidence has shown that cervical cancer and its precursor lesions are caused by Human papillomavirus (HPV) infection. Although the vast majority of HPV infections are naturally resolved, failure to eradicate infected cells has been shown to promote viral persistence and tumorigenesis. Furthermore, following neoplastic transformation, exposure of cervical epithelial cells to inflammatory mediators either directly or via the systemic circulation may enhance progression of the disease. It is well recognised that seminal plasma contains an abundance of inflammatory mediators, which are identified as regulators of tumour growth. Here we investigated the role of seminal plasma in regulating neoplastic cervical epithelial cell growth and tumorigenesis. Using HeLa cervical adenocarcinoma cells, we found that seminal plasma (SP) induced the expression of the inflammatory enzymes, prostaglandin endoperoxide synthase (PTGS1 and PTGS2), cytokines interleukin (IL) -6, and -11 and vascular endothelial growth factor-A (VEGF-A). To investigate the role of SP on tumour cell growth in vivo, we xenografted HeLa cells subcutaneously into the dorsal flank of nude mice. Intra-peritoneal administration of SP rapidly and significantly enhanced the tumour growth rate and size of HeLa cell xenografts in nude mice. As observed in vitro, we found that SP induced expression of inflammatory PTGS enzymes, cytokines and VEGF-A in vivo. Furthermore we found that SP enhances blood vessel size in HeLa cell xenografts. Finally we show that SP-induced cytokine production, VEGF-A expression and cell proliferation are mediated via the induction of the inflammatory PTGS pathway.

  2. Antitumor activity of cobrotoxin in human lung adenocarcinoma A549 cells and following transplantation in nude mice.

    Science.gov (United States)

    Shen, Jian; Xie, Yan; Sun, Mei-Lin; Han, Rong; Qin, Zheng-Hong; He, Jing-Kang

    2014-11-01

    The aim of the present study was to investigate cobra neurotoxin (cobrotoxin) activity in A549 cell lines transplanted into nude mice, and to explore its molecular mechanism. The 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) method was used to detect the growth inhibition rate of cobrotoxin in human lung A549 adenocarcinoma cells and HFL1 lung fibroblasts. Cell colony formation assays were performed to determine the effect of cobrotoxin on A549 cell colony formation, and transmission electron microscopy was used to detect cobrotoxin autophagy. In addition, western blot analysis was performed to determine the effect of 3-methyl adenine (3-MA) activity on the inhibition of autophagy, SB203580 inhibition of the p38-mitogen-activated protein kinase (MAPK) pathway, and Beclin 1, LC3, p62, p38 and phosphorylated (p)-p38 protein expression. Nude mice were injected with human lung A549 cells, and intervention and control groups were compared with regard to tumor suppression. The MTT assay revealed that various concentrations of cobrotoxin inhibited growth of A549 cells, but not HFL1 cells. A549 cell colony formation decreased and autophagosome activity was significantly increased compared with the controls. Following 3-MA administration, SB203580 autophagosome activity decreased, and following cobrotoxin administration, Beclin 1, p-p38, and LC3-II protein expression significantly increased, whereas p62 expression significantly decreased. Following 3-MA inhibition of autophagy, Beclin 1, LC3-II and p62 expression increased. Furthermore, following SB203580 inhibition of the p38-MAPK pathway, Beclin 1, p-p38, LC3-II and p62 protein expression increased. Cobrotoxin exhibited inhibitory activity on the human lung cancer A549 cells transplanted into the nude mice, suppressing the tumor growth rate by 43.4% (cobrotoxin 40 μg/kg group). However, following the addition of 3-MA (10 mmol/kg) and SB203580 (5 mg/kg), the suppression of the tumor growth rate

  3. Identification of crucial microRNAs and genes in hypoxia-induced human lung adenocarcinoma cells

    Directory of Open Access Journals (Sweden)

    Geng Y

    2016-07-01

    Full Text Available Ying Geng,1,* Lili Deng,2,* Dongju Su,1 Jinling Xiao,1 Dongjie Ge,3 Yongxia Bao,1 Hui Jing4 1Department of Respiratory, 2Department of Oncology, The Second Affiliated Hospital of Harbin Medical University, 3Department of Respiratory, The First Hospital of Harbin, 4Department of Emergency, The Second Affiliated Hospital of Harbin Medical University Harbin, Heilongjiang, People’s Republic of China *These authors contributed equally to this work Background: Variations of microRNA (miRNA expression profile in hypoxic lung cancer cells have not been studied so far. Therefore, using miRNA microarray technology, this study aimed to study the miRNA expression profile and investigate the potential crucial miRNAs and their target genes in hypoxia-induced human lung adenocarcinoma cells.Materials and methods: Based on miRNA microarray, miRNA expression profiling of hypoxia-induced lung adenocarcinoma A549 cells was obtained. After identification of differentially expressed miRNAs (DE-miRNAs in hypoxic cells, target genes of DE-miRNAs were predicted, and functional enrichment analysis of targets was conducted. Furthermore, the expression levels of DE-miRNAs and their target genes were validated by real-time quantitative polymerase chain reaction. In addition, using miRNA mimics, the effect of overexpressed DE-miRNAs on A549 cell behaviors (cell proliferation, cell cycle, and apoptosis was evaluated.Results: In total, 14 DE-miRNAs (nine upregulated miRNAs and five downregulated miRNAs were identified in hypoxic cells, compared with normoxic cells. Target genes of both upregulated and downregulated miRNAs were enriched in the functions such as chromatin modification, and pathways such as Wnt signaling pathway and transforming growth factor (TGF-β signaling pathway. The expression levels of several miRNAs and their target genes were confirmed, including hsa-miR-301b/FOXF2, hsa-miR-148b-3p/WNT10B, hsa-miR-769-5p/(SMAD2, ARID1A, and hsa-miR-622. Among them

  4. Qualidade de vida de doentes esofagectomizados: adenocarcinoma versus carcinoma epidermoide Quality of life of esophagectomized patients: adenocarcinoma versus squamous cell carcinoma

    Directory of Open Access Journals (Sweden)

    Maricilda Regina Pereira

    2013-02-01

    Full Text Available OBJETIVO: Avaliar e comparar a qualidade de vida de pacientes esofagectomizados para tratamento de adenocarcinoma da junção esofagogástrica e de carcinoma epidermoide. MÉTODOS: estudo transversal no pós-operatório de doentes esofagectomizados por adenocarcinoma da junção esofagogástrica (Adenoca e carcinoma epidermóide (CEC, empregando o questionário SF-36 aplicado em 24 pacientes (10 por Adenoca e 14 por CEC, a partir do 5º mês de pós-operatório, incluindo os sintomas clínicos e a variação de peso. RESULTADOS: A avaliação da QV mostrou melhor resultado de capacidade funcional (p=0,018 para o grupo Adenoca. Houve correlação entre os domínios "saúde mental" e "limitação por aspectos emocionais" (p=0,003 e entre "dor" e "limitação por aspectos físicos" (p=0,003 nos dois tipos histológicos. A perda de peso foi maior nos esofagectomizados por Adenoca (45,9Kg, sem diferença significativa entre o IMC atual (p>0,66. A disfagia foi relatada por 83,3% dos pacientes, a anorexia por 58,3%, a dificuldade de mastigação por 42%, a náuseas e os vômitos por 41,7% e a diarréia por 29,2%, sem correlação com a QV relatada (p>0,05. CONCLUSÃO: O escore mais alto para capacidade funcional indica que o paciente com Adenoca foi capaz de realizar todo tipo de atividade física, incluindo as mais vigorosas em um nível maior que o paciente com CEC. Alguns sintomas persistiram no pós-operatório, porém não interferiram na qualidade de vida dos pacientes.OBJECTIVE: To evaluate and compare the quality of life (QOL of patients undergoing esophagectomy for treatment of adenocarcinoma of the esophagogastric junction and squamous cell carcinoma. METHODS: We conducted a cross-sectional study in postoperative patients submitted to esophagectomy for adenocarcinoma of the esophagogastric junction (ACA and squamous cell carcinoma (SCC, using the SF-36 questionnaire applied in 24 patients (10 ACAs and 14 SCCs, from the 5th months

  5. Iron overload of human colon adenocarcinoma cells studied by synchrotron-based X-ray techniques.

    Science.gov (United States)

    Mihucz, Victor G; Meirer, Florian; Polgári, Zsófia; Réti, Andrea; Pepponi, Giancarlo; Ingerle, Dieter; Szoboszlai, Norbert; Streli, Christina

    2016-04-01

    Fast- and slow-proliferating human adenocarcinoma colorectal cells, HT-29 and HCA-7, respectively, overloaded with transferrin (Tf), Fe(III) citrate, Fe(III) chloride and Fe(II) sulfate were studied by synchrotron radiation total-reflection X-ray spectrometry (TXRF), TXRF-X-ray absorption near edge structure (TXRF-XANES), and micro-X-ray fluorescence imaging to obtain information on the intracellular storage of overloaded iron (Fe). The determined TfR1 mRNA expression for the investigated cells correlated with their proliferation rate. In all cases, the Fe XANES of cells overloaded with inorganic Fe was found to be similar to that of deliquescent Fe(III) sulfate characterized by a distorted octahedral geometry. A fitting model using a linear combination of the XANES of Tf and deliquescent Fe(III) sulfate allowed to explain the near edge structure recorded for HT-29 cells indicating that cellular overload with inorganic Fe results in a non-ferritin-like fast Fe storage. Hierarchical cluster analysis of XANES spectra recorded for Fe overloaded HT-29 and HCA-7 cells was able to distinguish between Fe treatments performed with different Fe species with a 95% hit rate, indicating clear differences in the Fe storage system. Micro-X-ray fluorescence imaging of Fe overloaded HT-29 cells revealed that Fe is primarily located in the cytosol of the cells. By characterizing the cellular Fe uptake, Fe/S content ratios were calculated based on the X-ray fluorescence signals of the analytes. These Fe/S ratios were dramatically lower for HCA-7 treated with organic Fe(III) treatments suggesting dissimilarities from the Tf-like Fe uptake.

  6. Needle tract implantation after fine needle aspiration biopsy (FNAB) of transitional cell carcinoma of the urinary bladder and adenocarcinoma of the lung.

    Science.gov (United States)

    Vignoli, M; Rossi, F; Chierici, C; Terragni, R; De Lorenzi, D; Stanga, M; Olivero, D

    2007-07-01

    This paper reports three clinical cases of needle tract implantation of neoplastic cells on the abdominal and thoracic wall after ultrasound (US) fine needle aspiration biopsy (FNAB). Primary tumors were two transitional cell carcinomas of the urinary bladder (2 dogs) and one pulmonary adenocarcinoma (1 cat). All three masses grew up along the needle tract. To our knowledge, the seeding of pulmonary adenocarcinoma cells after FNAB on the thoracic wall has never been reported in veterinary medicine.

  7. Metformin inhibits 17?-estradiol-induced epithelial-to-mesenchymal transition via ?Klotho-related ERK1/2 signaling and AMPK? signaling in endometrial adenocarcinoma cells

    OpenAIRE

    Liu, Zhao; Qi, Shasha; Zhao, Xingbo; Li, Mingjiang; Ding, Sentai; Lu, Jiaju; Zhang, Hui

    2016-01-01

    The potential role of metformin in treating endometrial cancer remains to be explored. The current study investigated the role of metformin in 17?-estradiol-induced epithelial-mesenchymal transition (EMT) in endometrial adenocarcinoma cells. We found that 17?-estradiol promoted proliferation and migration, attenuated apoptosis in both estrogen receptor (ER) positive and ER negative endometrial adenocarcinoma cells (Ishikawa and KLE cells, respectively). Metformin abolished 17?-estradiol-induc...

  8. STMN-1 is a potential marker of lymph node metastasis in distal esophageal adenocarcinomas and silencing its expression can reverse malignant phenotype of tumor cells

    International Nuclear Information System (INIS)

    Akhtar, Javed; Wang, Zhou; Yu, Che; Li, Chen-Sheng; Shi, Yu-Long; Liu, Hong-Jun

    2014-01-01

    Distal esophageal adenocarcinoma is a highly aggressive neoplasm. Despite advances in diagnosis and therapy, the prognosis is still poor. Stathmin (STMN-1) is a ubiquitously expressed microtubule destabilizing phosphoprotein. It promotes the disassembly of microtubules and prevents assembly. STMN-1 can cause uncontrolled cell proliferation when mutated and not functioning properly. Recently, found to be overexpressed in many types of human cancers. However, its clinical significance remains elusive in distal esophageal adenocarcinoma. Here, we reported for the first time that STMN-1 is highly overexpressed in adenocarcinomas of the distal esophagus and strongly associated with lymph node metastasis. STMN-1 expression in 63 cases of distal esophageal adenocarcinoma was analyzed by immunoblotting, while expression in esophageal adenocarcinoma cells was determined by immunocytochemistry, immunofluorescence, qRT-PCR and western blotting. Lentivirus-mediated RNAi was employed to knock-down STMN-1 expression in Human esophageal adenocarcinoma cells. The relationship between STMN-1 expression and lymph node metastasis in distal esophageal adenocarcinoma was determined by univariate and multivariate analyses. STMN-1 was detected in 31 (49.21%) of the 63 cases. STMN-1 was highly overexpressed in specimens with lymph node metastasis pN (+), but its expression was almost undetected in pN (−) status. Multivarian regression analysis demonstrated that STMN-1 overexpression is an independent factor for lymph node metastasis in distal esophageal adenocarcinoma. STMN-1 shRNA effectively reduced STMN-1 expression in esophageal adenocarcinoma cells (P < 0.05), which significantly suppressed proliferation (P < 0.05), increased migration (P < 0.05) and invasion ability (P < 0.05) and G1 phase arrest (P < 0.05) which lead to induction of apoptosis in esophageal adenocarcinoma cells in vitro. To verify the in vitro data, we conducted in vivo tumor xenograft studies. Esophageal

  9. Nuclear microanalysis of platinum and trace elements in cisplatin-resistant human ovarian adenocarcinoma cells

    Science.gov (United States)

    Moretto, P.; Ortega, R.; Llabador, Y.; Simonoff, M.; Bénard, J.; Moretto, Ph.

    1995-09-01

    Macro-and Micro-PIXE analysis were applied to study the mechanisms of cellular resistance to cisplatin, a chemotherapeutic agent, widely used nowadays for the treatment of ovarian cancer. Two cultured cell lines, a cisplatin-sensitive and a resistant one, were compared for their trace elements content and platinum accumulation following in vitro exposure to the drug. Bulk analysis revealed significant differences in copper and iron content between the two lines. Subsequent individual cell microanalysis permitted us to characterize the response of the different morphological cell types of the resistant line. This study showed that the metabolism of some trace metals in cisplatin-resistant cells could be affected but the exact relationship with the resistant phenotype remains to be determined. From a technical point of view, this experiment demonstrated that an accurate measurement of trace elements could be derived from nuclear microprobe analysis of individual cell.

  10. ITRAQ-Based Proteomics Analysis of Triptolide On Human A549 Lung Adenocarcinoma Cells.

    Science.gov (United States)

    Li, Fangqiong; Zhao, Dongxiao; Yang, Suwen; Wang, Juan; Liu, Qin; Jin, Xin; Wang, Wei

    2018-01-01

    Triptolide (TP) is a diterpenoid triepoxide extracted from the traditional Chinese medical herb Tripterygium wilfordii that exerts prominent broad-spectrum anticancer activity to repress proliferation and induce cancer cell apoptosis through various molecular pathways. We previously observed that TP inhibits the progression of A549 cells and pancreatic cancer cells (PNCA-1) in vitro. However, the complex molecular mechanism underlying the anticancer activity of TP is not well understood. To explore the molecular mechanisms by which TP induces lung cancer cell apoptosis, we investigated changes in the protein profile of A549 cells treated with TP using a proteomics approach (iTRAQ [isobaric tags for relative and absolute quantitation] combined with NanoLC-MS/MS [nano liquid chromatography-mass spectrometry]). Changes in the profiles of the expressed proteins were analyzed using the bioinformatics tools OmicsBean and the Kyoto Encyclopedia of Genes and Genomes (KEGG) and were verified using western blotting. Apoptosis and cell cycle effects were analyzed using flow cytometry. TP induced apoptosis in A549 cells and blocked A549 cells at the G2/M phase. Using iTRAQ technology, we observed 312 differentially expressed proteins associated in networks and implicated in different KEGG pathways. Gene Ontology (GO) analysis showed the overviews of dysregulated proteins in the biological process (BP), cell component (CC), and molecular function (MF) categories. Moreover, some candidate proteins involved in PARP1/AIF and nuclear Akt signaling pathways or metastasis processes were validated by western blotting. TP exerted anti-tumor activity on non-small cell lung cancer (NSCLC) A549 lung adenocarcinoma cells by dysregulating tumor-related protein expression. Herein, we provide a preliminary study of TP-related cytotoxicity on A549 cells using proteomics tools. These findings may improve the current understanding of the anti-tumor effects of TP on lung cancer cells and may

  11. Establishment and conventional cytogenetic characterization of three gastric cancer cell lines.

    Science.gov (United States)

    Leal, Mariana Ferreira; Martins do Nascimento, José Luiz; da Silva, Carla Elvira Araújo; Vita Lamarão, Maria Fernanda; Calcagno, Danielle Queiroz; Khayat, André Salim; Assumpção, Paulo Pimentel; Cabral, Isabel Rosa; de Arruda Cardoso Smith, Marília; Burbano, Rommel Rodríguez

    2009-11-01

    Gastric cancer is the fourth most frequent type of cancer and the second most frequent cause of cancer mortality worldwide. Only a modest number of gastric carcinoma cell lines have been isolated thus far. Here we describe the establishment and cytogenetic characterization of three new gastric cancer cell lines obtained from primary gastric adenocarcinoma (ACP02 and ACP03) and cancerous ascitic fluid (AGP01) of individuals from northern Brazil. ACP02, ACP03, and AGP01 cell lines are presently in the 60th passage. The cell lines grew in a disorganized single layer with some agglomerations and heterogeneous divisions (bipolar and multipolar). All cell lines exhibited a composite karyotype with several clonal chromosome alterations. Trisomy 8 was the most frequent alteration. Chromosome 8 aneusomy was confirmed by fluorescence in situ hybridization. All cell lines also exhibited trisomy 7 and deletion of chromosome arm 17p. These results suggest that, although frequent chromosome alterations are commonly observed due to culture process, the ACP02, ACP03, and AGP01 cell lines and primary gastric cancer from individuals of northern Brazil share genetic alterations, supporting use of these cell lines as a model of gastric carcinogenesis in this population.

  12. Assessing CMT cell line stability by two dimensional polyacrylamide gel electrophoresis and mass spectrometry based proteome analysis

    DEFF Research Database (Denmark)

    Zhang, Kelan; Wrzesinski, Krzysztof; Fey, Stephen J

    2008-01-01

    Two-dimensional polyacrylamide gel electrophoresis (2-D PAGE) followed by mass spectrometric identification of the proteins in the protein spots has become a central tool in proteomics. CMT167(H), CMT64(M) and CMT170(L) cell lines, selected from a spontaneous mouse lung adenocarcinoma, with high...... to be a useful tool for assessing differences in cell line stability. This approach provided a tool to select the best cell line and optimal subculture period for studies of cancer related phenomena and for testing the effect of potential anticancer drugs....

  13. Osthole inhibits the invasive ability of human lung adenocarcinoma cells via suppression of NF-κB-mediated matrix metalloproteinase-9 expression

    Energy Technology Data Exchange (ETDEWEB)

    Kao, Shang-Jyh [Department of Chest Medicine, Shin-Kong Wu Ho-Su Memorial Hospital, Taipei, Taiwan (China); School of Respiratory Therapy, Taipei Medical University, Taipei Taiwan (China); Su, Jen-Liang [Graduate Institute of Cancer Biology, College of Medicine, China Medical University, Taichung, Taiwan (China); Center for Molecular Medicine, China Medical University Hospital, Taichung, Taiwan (China); Department of Biotechnology, Asia University, Taichung, Taiwan (China); Chen, Chi-Kuan [Graduate Institute of Toxicology, College of Medicine, National Taiwan University, Taipei, Taiwan (China); Yu, Ming-Chih; Bai, Kuan-Jen; Chang, Jer-Hua [Division of Pulmonary Medicine, Department of Internal Medicine, Taipei Medical University-Wan Fang Hospital, Taipei, Taiwan (China); Bien, Mauo-Ying [School of Respiratory Therapy, Taipei Medical University, Taipei Taiwan (China); Division of Pulmonary Medicine, Department of Internal Medicine, Taipei Medical University-Wan Fang Hospital, Taipei, Taiwan (China); Yang, Shun-Fa [Institute of Medicine, Chung Shan Medical University, Taichung, Taiwan (China); Department of Medical Research, Chung Shan Medical University Hospital, Taichung, Taiwan (China); Chien, Ming-Hsien, E-mail: mhchien1976@gmail.com [Graduate Institute of Clinical Medicine, Taipei Medical University, Taipei, Taiwan (China)

    2012-05-15

    The induction of matrix metalloproteinase (MMP)-9 is particularly important for the invasiveness of various cancer cells. Osthole, a natural coumarin derivative extracted from traditional Chinese medicines, is known to inhibit the proliferation of a variety of tumor cells, but the effect of osthole on the invasiveness of tumor cells is largely unknown. This study determines whether and by what mechanism osthole inhibits invasion in CL1-5 human lung adenocarcinoma cells. Herein, we found that osthole effectively inhibited the migratory and invasive abilities of CL1-5 cells. A zymographic assay showed that osthole inhibited the proteolytic activity of MMP-9 in CL1-5 cells. Inhibition of migration, invasion, and MMP2 and/or MMP-9 proteolytic activities was also observed in other lung adenocarcinoma cell lines (H1299 and A549). We further found that osthole inhibited MMP-9 expression at the messenger RNA and protein levels. Moreover, a chromatin immunoprecipitation assay showed that osthole inhibited the transcriptional activity of MMP-9 by suppressing the DNA binding activity of nuclear factor (NF)-κB in the MMP-9 promoter. Using reporter assays with point-mutated promoter constructs further confirmed that the inhibitory effect of osthole requires an NF-κB binding site on the MMP-9 promoter. Western blot and immunofluorescence assays demonstrated that osthole inhibited NF-κB activity by inhibiting IκB-α degradation and NF-κB p65 nuclear translocation. In conclusion, we demonstrated that osthole inhibits NF-κB-mediated MMP-9 expression, resulting in suppression of lung cancer cell invasion and migration, and osthole might be a potential agent for preventing the invasion and metastasis of lung cancer. -- Highlights: ► Osthole treatment inhibits lung adenocarcinoma cells migration and invasion. ► Osthole reduces the expression and proteolytic activity of MMP-9. ► Osthole inhibits MMP-9 transcription via suppression of NF-κB binding activity. ► Osthole

  14. High Expression of FAM83B Predicts Poor Prognosis in Patients with Pancreatic Ductal Adenocarcinoma and Correlates with Cell Cycle and Cell Proliferation.

    Science.gov (United States)

    Shen, Chao-Qin; Yan, Ting-Ting; Liu, Wei; Zhu, Xiao-Qiang; Tian, Xiang-Long; Fu, Xue-Liang; Hua, Rong; Zhang, Jun-Feng; Huo, Yan-Miao; Liu, De-Jun; Yang, Jian-Yu; Sun, Yong-Wei; Fang, Jing-Yuan; Chen, Hao-Yan; Hong, Jie

    2017-01-01

    FAM83B (family with sequence similarity 83, member B) seems to emerge as a new class of players involved in the development of a variety of malignant tumors. Yet the molecular mechanisms are not well understood. The present study is intended to investigate the expression and function of FAM83B in pancreatic ductal adenocarcinoma (PDAC). In this study, we found that the expression of FAM83B was significantly increased both in PDAC cell lines and PDAC tumor tissues. FAM83B expression was positively related with advanced clinical stage and poor vital status. Higher FAM83B expression predicted shorter overall survival in PDAC patients, regardless of lymphatic metastasis status and histological differentiation. Actually, FAM83B may act as an independent prognostic indicator as well. What's more, down-regulation of FAM83B in PDAC cells contributed to G0/G1 phase arrest and inhibition of cell proliferation. Finally, a subcutaneous xenograft model indicated that knockdown of FAM83B significantly reduced the tumor volume in vivo . Our findings have provided supporting evidence for the potential molecular biomarker role of FAM83B in PDAC. It's of great interest and broad significance to target FAM83B in PDAC, which may conduce to develop a meaningful and effective strategy in the diagnosis and treatment of PDAC.

  15. Characteristics and prognostic factors of colorectal mucinous adenocarcinoma with signet ring cells

    Directory of Open Access Journals (Sweden)

    Kong XQ

    2017-11-01

    Full Text Available Xiangquan Kong,* Xueqing Zhang,* Yunxia Huang, Lirui Tang, Qingqin Peng, Jinluan Li Department of Radiation Oncology, Fujian Medical University Cancer Hospital, Fujian Cancer Hospital, Fuzhou, People’s Republic of China *These authors contributed equally to this work. Background: Colorectal signet ring cell (SRC carcinoma occurs rarely with a poor prognosis. The present study assessed the prognostic factors and predictive value of SRC ratio in colorectal mucinous adenocarcinoma (MAC with SRCs (MAC-SRC.Patients and methods: A total of 95 consecutive colorectal MAC-SRC patients, confirmed pathologically from February 1987 to December 2015, were analyzed retrospectively in our institute. Clinical characteristics, pathological grade, TNM staging, and SRC ratio were assessed to identify the prognostic factors related to progression-free survival (PFS and overall survival (OS. SPSS 22.0 was used for statistical analyses.Results: The median follow-up time was 29.7 months (range 0.8–165. Meanwhile, 5-year PFS and OS rates were 25.6% (95% confidence interval [CI] 16.192–35.008% and 40.5% (95% CI 29.524–51.476%, respectively. Among the 81 patients who underwent surgery, 78 (96.3% were diagnosed as stage T3 or T4; 74 (91.4% showed lymph node involvement, and 27 (29.3% presented distant metastasis. Metastases of the peritoneal cavity and ovaries were observed commonly in colorectal MAC-SRC. In the multivariate Cox regression model, SRC ratio ≥35%, absence of preoperative radiotherapy, and distant metastasis were independent predictors of PFS. Furthermore, SRC ratio ≥35%, absence of preoperative chemotherapy (pre-CT, and distant metastasis were independent risk factors for poor prognosis.Conclusion: A long-term follow-up of colorectal MAC-SRC reveals that it is a rare subtype of colorectal MAC with a dismal prognosis. Furthermore, SRC ratio, pre-CT, and M stage seem to affect OS independently. Keywords: colorectal mucinous adenocarcinoma

  16. Fraction against Human Cancer Cell Lines

    African Journals Online (AJOL)

    kidney carcinoma cell lines of hamsters (BSR). [11]. While, in another article, A. sieberia unrefined extract exhibited dose dependent antiproliferative activity against several cancer cell lines (human bladder carcinoma RT112, human laryngeal carcinoma and human myelogenous leukaemia K562), with IC50. = 81.59, 59.05 ...

  17. Early-Onset Signet-Ring Cell Adenocarcinoma of the Colon: A Case Report and Review of the Literature

    Directory of Open Access Journals (Sweden)

    Maliha Khan

    2017-01-01

    Full Text Available Colorectal cancer (CRC remains the second leading cause of cancer-related deaths in the United States. While a decline has been observed in the older population, the occurrence of CRC in the adolescent and young adult (AYA population has increased over the past two decades. The histopathologic characteristics and clinical behavior of CRC in AYA patients have been shown to be distinct from those of CRC in older adults. The rarer subtypes of CRC such as mucinous adenocarcinoma and signet-ring cell carcinoma are associated with a poorer prognosis compared to the more common subtypes. Here we report a case of a 20-year-old man who was diagnosed with stage IVB (T4 N2 M1, with peritoneal carcinomatosis signet-ring cell adenocarcinoma of the colon. The scarcity of information on these rarer subtypes merits further study and investigation.

  18. Difference in membrane repair capacity between cancer cell lines and a normal cell line

    DEFF Research Database (Denmark)

    Frandsen, Stine Krog; McNeil, Anna K.; Novak, Ivana

    2016-01-01

    repair was investigated by disrupting the plasma membrane using laser followed by monitoring fluorescent dye entry over time in seven cancer cell lines, an immortalized cell line, and a normal primary cell line. The kinetics of repair in living cells can be directly recorded using this technique......, providing a sensitive index of repair capacity. The normal primary cell line of all tested cell lines exhibited the slowest rate of dye entry after laser disruption and lowest level of dye uptake. Significantly, more rapid dye uptake and a higher total level of dye uptake occurred in six of the seven tested...

  19. OSI-027 inhibits pancreatic ductal adenocarcinoma cell proliferation and enhances the therapeutic effect of gemcitabine both in vitro and in vivo.

    Science.gov (United States)

    Zhi, Xiao; Chen, Wei; Xue, Fei; Liang, Chao; Chen, Bryan Wei; Zhou, Yue; Wen, Liang; Hu, Liqiang; Shen, Jian; Bai, Xueli; Liang, Tingbo

    2015-09-22

    Despite its relative rarity, pancreatic ductal adenocarcinoma (PDAC) accounts for a large percentage of cancer deaths. In this study, we investigated the in vitro efficacy of OSI-027, a selective inhibitor of mammalian target of rapamycin complex 1 (mTORC1) and mTORC2, to treat PDAC cell lines alone, and in combination with gemcitabine (GEM). Similarly, we tested the efficacy of these two compounds in a xenograft mouse model of PDAC. OSI-027 significantly arrested cell cycle in G0/G1 phase, inhibited the proliferation of Panc-1, BxPC-3, and CFPAC-1 cells, and downregulated mTORC1, mTORC2, phospho-Akt, phospho-p70S6K, phospho-4E-BP1, cyclin D1, and cyclin-dependent kinase 4 (CDK4) in these cells. Moreover, OSI-027 also downregulated multidrug resistance (MDR)-1, which has been implicated in chemotherapy resistance in PDAC cells and enhanced apoptosis induced by GEM in the three PDAC cell lines. When combined, OSI-027 with GEM showed synergistic cytotoxic effects both in vitro and in vivo. This is the first evidence of the efficacy of OSI-027 in PDAC and may provide the groundwork for a new clinical PDAC therapy.

  20. Urachal Adenocarcinoma

    African Journals Online (AJOL)

    degree of suspicion for these rare tumors. Introduction. Primary urachal adenocarcinoma is a rare and devastating disease believed to arise from malignant transformation of columnar or glandular metaplastic epithelium (1). Clinically the distinction of urachal carcinoma from other bladder adenocarcinomas may be difficult ...

  1. Conventional cytogenetic characterization of a new cell line, ACP01, established from a primary human gastric tumor

    Directory of Open Access Journals (Sweden)

    E.M. Lima

    2004-12-01

    Full Text Available Gastric cancer is the second most frequent type of neoplasia and also the second most important cause of death in the world. Virtually all the established cell lines of gastric neoplasia were developed in Asian countries, and western countries have contributed very little to this area. In the present study we describe the establishment of the cell line ACP01 and characterize it cytogenetically by means of in vitro immortalization. Cells were transformed from an intestinal-type gastric adenocarcinoma (T4N2M0 originating from a 48-year-old male patient. This is the first gastric adenocarcinoma cell line established in Brazil. The most powerful application of the cell line ACP01 is in the assessment of cytotoxicity. Solid tumor cell lines from different origins have been treated with several conventional and investigational anticancer drugs. The ACP01 cell line is triploid, grows as a single, non-organized layer, similar to fibroblasts, with focus formation, heterogeneous division, and a cell cycle of approximately 40 h. Chromosome 8 trisomy, present in 60% of the cells, was the most frequent cytogenetic alteration. These data lead us to propose a multifactorial triggering of gastric cancer which evolves over multiple stages involving progressive genetic changes and clonal expansion.

  2. Cytokine-Induced Killer Cells Modulates Resistance to Cisplatin in the A549/DDP Cell Line.

    Science.gov (United States)

    Yang, Lili; Du, Chunjuan; Wu, Lei; Yu, Jinpu; An, Xiumei; Yu, Wenwen; Cao, Shui; Li, Hui; Ren, Xiubao

    2017-01-01

    Background Cytokine-induced killer (CIK) cells can potentially enhance the tumor-killing activity of chemotherapy. Objective This study aimed to evaluate the effects of CIK cells on cisplatin (DDP) resistance in the human lung adenocarcinoma cell line A549/DDP. Methods The detect resistance index, drug resistance related-genes and cytokine secretion of A549/DDP co-cultured with CIK cells were assayed in vitro . Results After A549/DDP co-culture with CIK cells, the DDP resistance of A549/DDP significantly decreased in a time-dependent manner. The DDP resistance of A549/DDP co-cultured with CIK cells for 20 h decreased 4.93-fold compared with that of A549/DDP cells cultured alone ( P A549/DDP significantly decreased after co-culture with CIK cells ( P A549/DDP with CIK cells. The expression of GST-π was restored by adding the neutralizing IFN-γ. Conclusion CIK cells can reverse the drug resistance of A549/DDP in a time-dependent manner by reducing GST-π expression to increase the accumulation of DDP. The effect of CIK cells on re-sensitizing lung cancer cells to the chemotherapy drug was partially dependent on the secretion of IFN-γ.

  3. Synthesis of 2,3-diyne-1,4-naphthoquinone derivatives and evaluation of cytotoxic activity against tumor cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Silva, Mauro G.; Camara, Celso A.; Silva, Tania M.S., E-mail: ccelso@dcm.ufrpe.br [Universidade Federal Rural de Pernambuco (LSCB/UFRPE), Recife, PE (Brazil). Dept. de Ciencias Moleculares. Lab. de Sintese de Compostos Bioativos; Feitosa, Anderson C.S.; Meira, Assuero S.; Pessoa, Claudia [Universidade Federal do Ceara (LOE/UFC), Fortaleza, CE (Brazil). Dept. de Fisiologia e Farmacologia. Lab. de Oncologia Experimental

    2013-09-15

    A series of 2,3-diyne-1,4-naphthoquinone derivatives was synthesized from 2,3-dibromo- 1,4-naphthoquinone and various functionalized terminal alkynes using palladium-catalyzed Sonogashira cross-coupling reaction. The diynes were evaluated as potential cytotoxic agents against three tumor cell lines: human ovarian adenocarcinoma (OVCAR-8), human metastatic prostate cancer (PC-3M) and human bronchoalveolar lung carcinoma (NCI-H358M), presenting, in general, satisfactory results for inhibition of cell growth. (author)

  4. Synthesis of 2,3-diyne-1,4-naphthoquinone derivatives and evaluation of cytotoxic activity against tumor cell lines

    International Nuclear Information System (INIS)

    Silva, Mauro G.; Camara, Celso A.; Silva, Tania M.S.; Feitosa, Anderson C.S.; Meira, Assuero S.; Pessoa, Claudia

    2013-01-01

    A series of 2,3-diyne-1,4-naphthoquinone derivatives was synthesized from 2,3-dibromo- 1,4-naphthoquinone and various functionalized terminal alkynes using palladium-catalyzed Sonogashira cross-coupling reaction. The diynes were evaluated as potential cytotoxic agents against three tumor cell lines: human ovarian adenocarcinoma (OVCAR-8), human metastatic prostate cancer (PC-3M) and human bronchoalveolar lung carcinoma (NCI-H358M), presenting, in general, satisfactory results for inhibition of cell growth. (author)

  5. Biophysical Profiling of Tumor Cell Lines

    Directory of Open Access Journals (Sweden)

    Frederick Coffman

    2011-01-01

    Full Text Available Despite significant differences in genetic profiles, cancer cells share common phenotypic properties, including membrane-associated changes that facilitate invasion and metastasis. The Corning Epic® optical biosensor was used to monitor dynamic mass rearrangements within and proximal to the cell membrane in tumor cell lines derived from cancers of the colon, bone, cervix, lung and breast. Data was collected in real time and required no exogenously added signaling moiety (signal-free technology. Cell lines displayed unique profiles over the time-courses: the time-courses all displayed initial signal increases to maximal values, but the rate of increase to those maxima and the value of those maxima were distinct for each cell line. The rate of decline following the maxima also differed among cell lines. There were correlations between the signal maxima and the observed metastatic behavior of the cells in xenograft experiments; for most cell types the cells that were more highly metastatic in mice had lower time-course maxima values, however the reverse was seen in breast cancer cells. The unique profiles of these cell lines and the correlation of at least one profile characteristic with metastatic behavior demonstrate the potential utility of biophysical tumor cell profiling in the study of cancer biology.

  6. Frequency of brain metastasis in adenocarcinoma and large cell carcinoma of the lung: correlation with survival

    International Nuclear Information System (INIS)

    Komaki, R.; Cox, J.D.; Stark, R.

    1983-01-01

    From January 1970 through December 1981, 469 patients with histologically or cytologically proven adenocarcinoma (AC) (349) and large cell carcinoma (LC) (120) of the lung were seen at the Department of Radiation Oncology, Medical College of Wisconsin Affiliated Hospitals. One quarter (126/469) of these patients had brain metastasis: 48 patients presented with brain metastasis and 78 patients subsequently developed brain metastasis. Brain was the dominant site of metastasis in 82 patients who received only cranial + thoracic irradiation; 37 patients (17 simultaneous, 20 metachronous) also required irradiation of other sites of metastasis. All 17 patients with LC, and 47/61 (77%) with AC who developed metachronous brain metastasis did so within one year. The cumulative probability of brain metastasis increased with survival to the levels predicted by autopsy studies. Therapeutic brain irradiation may result in long-term survival in patients with single organ brain metastasis. Since patients with AC and LC so frequently develop brain metastasis and the brain may be the only site of metastasis, prophylactic cranial irradiation may significantly reduce morbidity and mortality from these diseases

  7. Resolution of diabetes after pancreaticoduodenectomy in patients with and without pancreatic ductal cell adenocarcinoma.

    Science.gov (United States)

    Wu, Jin-Ming; Kuo, Ting-Chun; Yang, Ching-Yao; Chiang, Pin-Yi; Jeng, Yung-Ming; Huang, Pei-Hsin; Tien, Yu-Wen

    2013-01-01

    New-onset diabetes mellitus (DM) is associated with pancreatic ductal cell adenocarcinoma (PDCA) and can resolve after pancreaticoduodenectomy (PD). Whether DM also resolves after PD in patients operated for disease other than PDCA remains to be determined. We compared glycemic status before and after PD between patients with and without PDCA by review of a prospectively maintained database including all patients receiving PD from 2005 to 2011. New-onset DM was defined as diagnosis of DM less than 24 months before PD, and cases with DM diagnosis≥24 months preceding PD were described as long-standing DM. Of 458 patients receiving PD, there were 146 (31.9%) PDCA and 312 (68.1%) non-PDCA, including 160 benign diseases, 113 ampulla cancer, 29 distal common bile duct cancer, and 10 duodenal cancer. Overall prevalence of DM was higher in PDCA group than non-PDCA group (37.7 vs. 25.6%; P=0.011). Resolution of new-onset DM after PD was observed in 9 (41%) of 22 patients with PDCA and in 12 (63%) of 19 patients without PDCA. Resolution of long-standing DM after PD was also observed in 3 (9.1%) of 33 patients with PDCA and in 6 (9.8%) of 61 patients without PDCA. DM resolved after PD in some patients both with and without PDCA. These findings suggest that PD-associated anatomic change may play a role in resolution of DM after PD.

  8. Establishment of cell lines with rat spermatogonial stem cell characteristics

    NARCIS (Netherlands)

    van Pelt, Ans M. M.; Roepers-Gajadien, Hermien L.; Gademan, Iris S.; Creemers, Laura B.; de Rooij, Dirk G.; van Dissel-Emiliani, Federica M. F.

    2002-01-01

    Spermatogonial cell lines were established by transfecting a mixed population of purified rat A(s) (stem cells), A(pr) and A(al) spermatogonia with SV40 large T antigen. Two cell lines were characterized and found to express Hsp90alpha and oct-4, specific markers for germ cells and A spermatogonia,

  9. A Petiveria alliacea standardized fraction induces breast adenocarcinoma cell death by modulating glycolytic metabolism.

    Science.gov (United States)

    Hernández, John Fredy; Urueña, Claudia Patricia; Cifuentes, Maria Claudia; Sandoval, Tito Alejandro; Pombo, Luis Miguel; Castañeda, Diana; Asea, Alexzander; Fiorentino, Susana

    2014-05-14

    Folk medicine uses aqueous and alcoholic extracts from Petiveria alliacea (Phytolaccaceae) in leukemia and breast cancer treatment in the Caribbean, Central and South America. Herein, we validated the biological activity of a Petiveria alliacea fraction using a metastatic breast adenocarcinoma model (4T1). Petiveria alliacea fraction biological activity was determined estimating cell proliferation, cell colony growth capacity and apoptosis (caspase-3 activity, DNA fragmentation and mitochondrial membrane potential) in 4T1 cells. Petiveria alliacea was used at IC₅₀ concentration (29 µg/mL) and 2 dilutions below, doxorubicin at 0.27 µg/mL (positive control) and dibenzyl disulfide at 2.93 µg/mL (IC50 fraction marker compound). Proteomic estimations were analyzed by LC-MS-MS. Protein level expression was confirmed by RT-PCR. Glucose and lactate levels were measured by enzymatic assays. LD50 was established in BALB/c mice and antitumoral activity evaluated in mice transplanted with GFP-tagged 4T1 cells. Mice were treated with Petiveria alliacea fraction via I.P (182 mg/kg corresponding to 1/8 of LD₅₀ and 2 dilutions below). Petiveria alliacea fraction in vitro induces 4T1 cells apoptosis, caspase-3 activation, DNA fragmentation without mitochondria membrane depolarization, and decreases cell colony growth capacity. Also, changes in glycolytic enzymes expression cause a decrease in glucose uptake and lactate production. Fraction also promotes breast primary tumor regression in BALB/c mice transplanted with GFP-tagged 4T1 cells. A fraction of Petiveria alliacea leaves and stems induces in vitro cell death and in vivo tumor regression in a murine breast cancer model. Our results validate in partly, the traditional use of Petiveria alliacea in breast cancer treatment, revealing a new way of envisioning Petiveria alliacea biological activity. The fraction effect on the glycolytic pathway enzymes contributes to explain the antiproliferative and antitumor activities

  10. Characterization of Cancer Stem Cells in Colon Adenocarcinoma Metastasis to the Liver

    Directory of Open Access Journals (Sweden)

    Hugo N. Humphries

    2018-01-01

    Full Text Available BackgroundFifty percent of colorectal cancer (CRC patients develop liver metastasis. This study identified and characterized cancer stem cells (CSCs within colon adenocarcinoma metastasis to the liver (CAML.Methods3,3-Diaminobenzidine immunohistochemical (IHC staining was performed on nine CAML samples for embryonic stem cell (ESC markers OCT4, SOX2, NANOG, c-Myc, and KLF4. Immunofluorescence (IF IHC staining was performed to investigate coexpression of two markers. NanoString mRNA expression analysis and colorimetric in situ hybridization (CISH were performed on four snap-frozen CAML tissue samples for transcript expression of these ESC markers. Cells stained positively and negatively for each marker by IHC and CISH staining were counted and analyzed.Results3,3-Diaminobenzidine IHC staining, and NanoString and CISH mRNA analyses demonstrated the expression of OCT4, SOX2, NANOG, c-Myc, and KLF4 within in all nine CAML samples, except for SOX2 which was below detectable levels on NanoString mRNA analysis. IF IHC staining showed the presence of a SOX2+/NANOG+/KLF4+/c-Myc+/OCT− CSC subpopulation within the tumor nests, and a SOX2+/NANOG+/KLF4+/c-Myc+/OCT4− CSC subpopulation and a SOX2+/NANOG+/KLF4+/c-Myc+/OCT4+ CSC subpopulation within the peritumoral stroma.ConclusionThe novel finding of three CSC subpopulations within CAML provides insights into the biology of CRC.

  11. Acetylsalicylic Acid Exhibits Antitumor Effects in Esophageal Adenocarcinoma Cells In Vitro and In Vivo.

    Science.gov (United States)

    Piazuelo, Elena; Esquivias, Paula; De Martino, Alba; Cebrián, Carmelo; Conde, Blanca; Santander, Sonia; Emperador, Sonia; García-González, María Asunción; Carrera-Lasfuentes, Patricia; Lanas, Angel

    2016-10-01

    Recent observational studies have shown therapeutic benefits of acetylsalicylic acid (ASA) in several types of cancer. We examined whether ASA exerts antitumor activity in esophageal adenocarcinoma (EAC). Human EAC cells (OE33) were treated with ASA (0-5 mM) to evaluate proliferation, apoptosis, and migration. In vivo model: OE33-derived tumors were subcutaneously implanted into athymic mice which were allocated to ASA (5 or 50 mg/kg/day)/vehicle (5-6 animals/group). Tumor growth was assessed every 2-3 days, and after 40 days, mice were euthanized. Plasma drug levels were determined by high-performance liquid chromatography. Histological and immunohistochemical (Ki67, activated caspase-3) analysis of tumors were performed. The effect of ASA on tumor prostaglandin E2 (PGE2) levels was also evaluated. In vitro cell proliferation and migration were significantly inhibited while apoptosis increased (p < 0.05) by ASA. Although ASA did not induce tumor remission, tumor progression was significantly lower in ASA-treated mice when compared to non-treated animals (478 % in mice treated with 5 mg/kg/day ASA vs. 2696 % control; 748 % in mice treated with 50 mg/kg/day ASA vs. 2670 % control). Maximum tumor inhibition was 92 and 85 %, respectively. This effect was associated with a significant decrease of proliferation index in tumors. ASA 5 mg/kg/day did not modify tumor PGE2 levels. Whereas tumor PGE2 content in mice treated with ASA 50 mg/kg was lower than in control mice, the difference was not significant. Although these results need to be confirmed in other EAC cells, our data suggest a role for ASA in the treatment of this tumor.

  12. Ovarian transitional cell carcinoma represents a poorly differentiated form of high-grade serous or endometrioid adenocarcinoma.

    Science.gov (United States)

    Takeuchi, Tadahisa; Ohishi, Yoshihiro; Imamura, Hiroko; Aman, Murasaki; Shida, Kaai; Kobayashi, Hiroaki; Kato, Kiyoko; Oda, Yoshinao

    2013-07-01

    Ovarian transitional cell tumors include Brenner tumors (BTs) and transitional cell carcinoma (TCC; non-BTs) according to the most recent World Health Organization classification. However, it remains a matter of debate whether TCC represents a distinct entity or a morphologic variant of high-grade serous adenocarcinoma (HG-SC). The purpose of this study was to resolve the above question by clarifying the morphologic, immunohistochemical, and molecular features of TCC. We reviewed 488 cases of epithelial ovarian carcinomas and reclassified them on the basis of the most recent World Health Organization classification with the modifications proposed by Köbel and colleagues, and 35 cases of TCC were identified; 25 and 6 TCCs were admixed with HG-SC and endometrioid adenocarcinoma (EC), respectively, and the remaining 4 cases were pure TCC. TCC components were not observed in any clear cell carcinomas or mucinous adenocarcinomas. Only 2 cases of malignant BT were identified. In addition to TCCs, malignant BTs, and related adenocarcinomas, benign and borderline BTs were included in the following immunohistochemical and molecular analyses. Immunohistochemically, pure TCCs, TCCs admixed with HG-SC, and pure HG-SCs were characterized by frequent aberrant p53 expression (diffuse or null pattern) and WT1+/ER+/PR+/IMP2+ immunophenotype, whereas BTs, including benign, borderline, and malignant BTs, were characterized by lack of aberrant p53 expression and WT1-/ER-/PR-/IMP2- immunophenotype. In contrast to the BTs, pure ECs and TCCs admixed with EC showed an ER+/PR+ immunophenotype. Nearly all the tumors with a TP53 gene mutation by molecular analysis showed aberrant p53 staining patterns. In conclusion, TCC is not a distinct entity but a poorly differentiated form of serous or EC, as (1) most TCCs coexist with HG-SC (mostly) or EC (occasionally), and (2) the immunophenotype and molecular features are similar to those of HG-SC or EC but different from those of BTs.

  13. HOXC13 promotes proliferation of lung adenocarcinoma via modulation of CCND1 and CCNE1.

    Science.gov (United States)

    Yao, Yu; Luo, Jing; Sun, Qi; Xu, Ting; Sun, Siqing; Chen, Meili; Lin, Xin; Qian, Qiuping; Zhang, Yu; Cao, Lin; Zhang, Po; Lin, Yong

    2017-01-01

    In this study, we confirmed that HOXC13 might be a potential oncogene in lung adenocarcinoma through an analysis of The Cancer Genome Atlas (TCGA) datasets. Further analysis revealed that the expression of HOXC13 was significantly higher in lung adenocarcinoma tissues than in adjacent normal tissues; importantly, its expression correlated with poor clinical characteristics and worse prognosis. In vitro experiments showed that HOXC13 expression generally increased in lung adenocarcinoma cell lines. Moreover, knockdown of HOXC13 inhibited lung adenocarcinoma cell proliferation, and induced G1-phase arrest via downregulation of CCND1 and CCNE1. Conversely, HOXC13 overexpression promoted lung adenocarcinoma cell proliferation, and decreased the percentage of cells in G1-phase via upregulation of CCND1 and CCNE1. We also found that miR-141 downregulated HOXC13, by directly targeting its 3'UTR, and inhibited proliferation of lung adenocarcinoma cells. Taken together, our results suggest that HOXC13, which is directly targeted by miR-141, is highly expressed in lung adenocarcinoma, and promotes proliferation of lung adenocarcinoma by modulating the expression of CCND1 and CCNE1.

  14. Effect of gemcitabine on the uptake of (18)F-fluorodeoxyglucose and (18)F-fluorothymidine in lung adenocarcinoma A549 cells and the animal tumor model.

    Science.gov (United States)

    Zhang, Bin; Deng, Sheng-Ming; Guo, Ling-Chuan; Dong, Jia-Jia; Zhu, Yan-Bo; Gao, Yuan; Wang, Zhen-Xin; Cho, William C

    2016-01-01

    Gemcitabine is the first-line drug for nonsmall cell lung cancer, and 18F-fluorodeoxyglucose. (18F-FDG) and 18F-fluorothymidine. (18F-FLT) are positron emission tomography. (PET) imaging agents. The aim of this study was to explore the effect of gemcitabine on the uptake of 18F-FDG and 18F-FLT in A549 cells and the animal tumor model. The inhibitory effects of gemcitabine on cell growth were determined by tetrazolium blue method, and uptake rates of 18F-FDG and 18F-FLT were determined under the same conditions. The adenocarcinoma-bearing nude mice before and after gemcitabine treatments were performed microPET imaging with 18F-FDG and 18F-FLT. Hematoxylin and eosin staining and immunohistochemical analysis of tumor specimens were conducted. After the administration of gemcitabine, positive correlations were observed between inhibition of 18F-FDG or 18F.FLT uptake and cell growth. (r = 0.957 or 0.981, P cells at the dose of 60 mmol/L, and the expression of glucose transporter protein-1, Ki-67 and proliferating cell nuclear antigen in tumor cells were inhibited. 18F-FLT imaging can assess the proliferation of tumor cells and 18F-FDG imaging can reflect the changes of the tumor microenvironment after administration of gemcitabine.

  15. Cytotoxicity screening of essential oils in cancer cell lines

    Directory of Open Access Journals (Sweden)

    Pollyanna Francielli de Oliveira

    Full Text Available Abstract This study evaluated the cytotoxicity activity of the essential oils of Tagetes erecta L., Asteraceae (TE-OE, Tetradenia riparia (Hochst. Codd, Lamiaceae (TR-OE, Bidens sulphurea (Cav. Sch. Bip., Asteraceae (BS-OE, and Foeniculum vulgare Mill., Apiaceae (FV-OE, traditionally used in folk medicine, against the tumor cell lines murine melanoma (B16F10, human colon carcinoma (HT29, human breast adenocarcinoma (MCF-7, human cervical adenocarcinoma (HeLa, human hepatocellular liver carcinoma (HepG2, and human glioblastoma (MO59J, U343, and U251. Normal hamster lung fibroblasts (V79 cells were included as control. The cells were treated with essential oil concentrations ranging from 3.12 to 400 µg/ml for 24 h. The cytotoxic activity was evaluated using the XTT assay; results were expressed as IC50, and the selectivity index was calculated. The results were compared with those achieved for classic chemotherapeutic agents. TE-OE was the most promising among the evaluated oils: it afforded the lowest IC50 values for B16F10 cells (7.47 ± 1.08 µg/ml and HT29 cells (6.93 ± 0.77 µg/ml, as well as selectivity indices of 2.61 and 2.81, respectively. The major BS-EO, FV-EO and TE-EO chemical constituents were identified by gas chromatography mass spectrometry as being (E-caryophyllene (10.5%, germacrene D (35.0% and 2,6-di-tert-butyl-4-methylphenol (43.0% (BS-EO; limonene (21.3% and (E-anethole (70.2% (FV-EO; limonene (10.4%, dihydrotagetone (11.8%, α-terpinolene (18.1% and (E-ocimenone (13.0% (TE-EO; and fenchone (6.1%, dronabinol (11.0%, aromadendrene oxide (14.7% and (E,E–farnesol (15.0% (TR-EO. 2,6-di-tert-butyl-4-methylphenol (43.0%, (E-anethole (70.2% and α-terpinolene (18.1%, respectively. These results suggest that TE-OE may be used to treat cancer without affecting normal cells.

  16. Galectin-1 is overexpressed in CD133+ human lung adenocarcinoma cells and promotes their growth and invasiveness

    Science.gov (United States)

    Zhou, Xuefeng; Li, Dan; Wang, Xianguo; Zhang, Bo; Zhu, Hua; Zhao, Jinping

    2015-01-01

    Previous studies demonstrated that a subpopulation of cancer cells, which are CD133 positive (CD133+) feature higher invasive and metastatic abilities, are called cancer stem cells (CSCs). By using tumor cells derived from patients with lung adenocarcinoma, we found that galectin-1 is highly overexpressed in the CD133+ cancer cells as compared to the normal cancer cells (CD133−) from the same patients. We overexpressed galectin-1 in CD133− cancer cells and downregulated it in CSCs. We found that overexpression of galectin-1 promoted invasiveness of CD133− cells, while knockdown of galectin-1 suppressed proliferation, colony formation and invasiveness of CSCs. Furthermore, tumor growth was significantly inhibited in CSCs xenografts with knockdown of galectin-1 as compared to CSCs treated with scramble siRNAs. Biochemical studies revealed that galectin-1 knockdown led to the suppression of COX-2/PGE2 and AKT/mTOR pathways, indicating galectin-1 might control the phenotypes of CSCs by regulating these signaling pathways. Finally, a retrospective study revealed that galectin-1 levels in blood circulation negatively correlates with overall survival and positively correlates with lymph node metastasis of the patients. Taken together, these findings suggested that galectin-1 plays a major role on the tumorigenesis and invasiveness of CD133+ cancer cells and might serve as a potential therapeutic target for treatment of human patients with lung adenocarcinoma. PMID:25605013

  17. Biosynthesis of fucose containing lacto-series glycolipids in human colonic adenocarcinoma Colo 205 cells.

    Science.gov (United States)

    Holmes, E H; Levery, S B

    1989-11-01

    Biosynthesis of fucose containing lacto-series glycolipids has been studied in human colonic adenocarcinoma Colo 205 cells. Transfer of fucose in both alpha 1----3 linkage to type 2 chain acceptors and alpha 1----4 linkage to type 1 chain acceptors was demonstrated with a Triton X-100 solubilized membrane fraction. The enzyme was found to be highly active over a broad pH range between 6.0 and 7.5. Kinetics of the transfer reactions were studied and indicated that the enzyme had an apparent Km for GDPfucose of 53 and 49 microM with acceptors nLc4 and Lc4, respectively. The apparent Km values for acceptors Lc4, nLc4, and IV3NeuAcnLc4 were determined to be 42, 18, and 26 microM, respectively. Transfer of fucose to the type 1 chain acceptor Lc4 alone and in the presence of increasing concentrations of the type 2 chain acceptor IV3NeuAcnLc4 or Gb3 suggested that both type 1 and 2 acceptors were alternate acceptors for a single enzyme. This was further established by the finding that IV3NeuAcnLc4 behaved as a competitive inhibitor of fucose transfer with respect to Lc4. Conditions were defined for preparative scale in vitro synthesis of fucosylated products of nLc6 catalyzed by the Colo 205 cell enzyme. Yields of the monofucosyl derivative of 2.5 mg (46%) and 1 mg (17%) of the difucosyl derivative were obtained from 5 mg of original nLc6. The structures of these biosynthetic products were carefully studied by 1H NMR, +FAB-MS, and methylation analysis. These studies revealed extremely high purity products composed of III3FucnLc6 and III3V3Fuc2nLc6. The significance of the nature of these products and enzymatic properties is discussed.

  18. K-Ras-Independent Effects of the Farnesyl Transferase Inhibitor L-744,832 on Cyclin B1/Cdc2 Kinase Activity, G2/M Cell Cycle Progression and Apoptosis in Human Pancreatic Ductal Adenocarcinoma Cell

    Directory of Open Access Journals (Sweden)

    Si Young Song

    2000-05-01

    Full Text Available Pancreatic ductal adenocarcinoma is a highly lethal malignancy that is resistant to traditional cytotoxic therapy. High rates of activating codon 12 K-Ras mutations in this disease have generated considerable interest in the therapeutic application of novel farnesyl transferase inhibitors (FTIs. However, a comprehensive analysis of the effects of FTI treatment on pancreatic cancer cells has not been performed. Treatment of five different human pancreatic cancer cell lines with FTI L744,832 resulted in inhibition of anchorage-dependent growth, with wide variation in sensitivity among different lines. Effective growth inhibition by L-744,832 correlated with accumulation of cells with a tetraploid (4N DNA content and high levels of cyclin B1/cdc2 kinase activity, implying cell cycle arrest downstream from the DNA damage -inducible G2/M cell cycle checkpoint. In addition, sensitive cell lines underwent apoptosis as evidenced by changes in nuclear morphology and internucleosomal DNA fragmentation. L-744,832 at a concentration of 1 µM additively enhanced the cytotoxic effect of ionizing radiation, apparently by overriding G2/M checkpoint activation. The effects of FTI treatment on cell growth and cell cycle regulation were associated with changes in posttranslational processing of H-Ras and N-Ras, but not K-Ras. The results confirm the potential therapeutic efficacy of FTI treatment in pancreatic cancer, and suggest that farnesylated proteins other than K-Ras may act as important regulators of G2/M cell cycle kinetics.

  19. BHD Tumor Cell Line and Renal Cell Carcinoma Line | NCI Technology Transfer Center | TTC

    Science.gov (United States)

    Scientists at the National Cancer Institute  have developed a novel renal cell carcinoma (RCC) cell line designated UOK257, which was derived from the surgical kidney tissue of a patient with hereditary Birt-Hogg-Dube''''(BHD) syndrome and companion cell line UOK257-2 in which FLCN expression has been restored by lentivirus infection. The NCI Urologic Oncology Branch seeks parties interested in licensing or collaborative research to co-develop, evaluate, or commercialize kidney cancer tumor cell lines.

  20. BRM270 inhibits cancer stem cell maintenance via microRNA regulation in chemoresistant A549 lung adenocarcinoma cells.

    Science.gov (United States)

    Kwon, Taeho; Chandimali, Nisansala; Huynh, Do Luong; Zhang, Jiao Jiao; Kim, Nameun; Bak, Yesol; Yoon, Do-Young; Yu, Dae-Yeul; Lee, Jae Cheol; Gera, Meeta; Ghosh, Mrinmoy; Park, Yang Ho; Jeong, Dong Kee

    2018-02-14

    Chemotherapy is a standard treatment for non-small-cell lung cancer (NSCLC). However, the dose-limiting toxicity of drugs and the development of chemoresistance are major clinical challenges to successful management of NSCLC. Asian traditional medicine is gaining global attention as a non-toxic alternative to chemotherapy. BRM270 is an extract formulated from seven Asian medicinal plants that has been shown to inhibit tumor cell proliferation in diverse cancer types. We previously demonstrated that BRM270 suppresses tumorigenesis by negatively regulating nuclear factor-κB signaling in multidrug-resistant cancer stem cells (CSCs). In this study we report that the growth, migration, and invasion of normal human lung adenocarcinoma cells and their chemoresistant derivatives was inhibited by BRM270 treatment. Notably, BRM270 was found to modulate CSC self-renewal and tumor-initiating capacity via positive regulation of the miRNA-128. Thus, combination therapy with miRNA-128 and BRM270 may be an effective treatment strategy for chemoresistant NSCLC.

  1. Nitrophenols isolated from diesel exhaust particles promote the growth of MCF-7 breast adenocarcinoma cells

    International Nuclear Information System (INIS)

    Furuta, Chie; Suzuki, Akira K.; Watanabe, Gen; Li, ChunMei; Taneda, Shinji; Taya, Kazuyoshi

    2008-01-01

    Diesel exhaust particles (DEPs) cause many adverse health problems, and reports indicate increased risk of breast cancer in men and women through exposure to gasoline and vehicle exhaust. However, DEPs include vast numbers of compounds, and the specific compound(s) responsible for these actions are not clear. We recently isolated two nitrophenols from DEPs-3-methyl-4-nitrophenol (4-nitro-m-cresol; PNMC) and 4-nitro-3-phenylphenol (PNMPP)-and showed that they had estrogenic and anti-androgenic activities. Here, we tried to clarify the involvement of these two nitrophenols in promoting the growth of the MCF-7 breast cancer cell line. First, comet assay was used to detect the genotoxicity of PNMC and PNMPP in a CHO cell line. At all doses tested, PNMC and PNMPP showed negative genotoxicity, indicating that they had no tumor initiating activity. Next, the estrogen-responsive breast cancer cell line MCF-7 was used to assess cell proliferation. Proliferation of MCF-7 cells was stimulated by PNMC, PNMPP, and estradiol-17β and the anti-estrogens 4-hydroxytamoxifen and ICI 182,780 inhibited the proliferation. To further investigate transcriptional activity through the estrogen receptor, MCF-7 cells were transfected with a receptor gene that allowed expression of luciferase enzyme under the control of the estrogen regulatory element. PNMC and PNMPP induced luciferase activity in a dose-dependent manner at submicromolar concentrations. ICI 182,780 inhibited the luciferase activity induced by PNMC and PNMPP. These results clearly indicate that PNMC and PNMPP do not show genotoxicity but act as tumor promoters in an estrogen receptor α-predominant breast cancer cell line

  2. SPRY4-mediated ERK1/2 signaling inhibition abolishes 17β-estradiol-induced cell growth in endometrial adenocarcinoma cell.

    Science.gov (United States)

    Li, Mingjiang; Zhang, Hui; Zhao, Xingbo; Yan, Lei; Wang, Chong; Li, Chunyan; Li, Changzhong

    2014-08-01

    Basic fibroblast growth factor (FGF2)-mediated Extracellular signal-regulated kinases1/2 (ERK1/2) signaling is a critical modulator in angiogenesis. SPRY4 has been reported to be a feedback negative regulator of FGFs-induced ERK1/2 signaling. The aim of this study was to explore the role of SPRY4 in endometrial adenocarcinoma cell. The effect of SPRY4 expression on FGF2-mediated ERK1/2 signaling was detected by luciferase assay and Western blot analysis. The growth of Ishikawa cells was detected using colony formation assay and cell number counting experiment. We found that plasmid-driven SPRY4 expression efficiently blocked the activity of FGF2-induced ERK1/2 signaling in Ishikawa cells. SPRY4 expression significantly reduced the proliferation and 17β-estradiol-induced proliferation of Ishikawa cells. SPRY4 may function as a tumor suppressor in endometrial adenocarcinoma.

  3. LAP TGF-Beta Subset of CD4+CD25+CD127− Treg Cells is Increased and Overexpresses LAP TGF-Beta in Lung Adenocarcinoma Patients

    Science.gov (United States)

    Islas-Vazquez, Lorenzo; Aguilar-Cazares, Dolores; Meneses-Flores, Manuel; Galicia-Velasco, Miriam; Romero-Garcia, Susana; Camacho-Mendoza, Catalina; Lopez-Gonzalez, Jose Sullivan

    2015-01-01

    Lung cancer is the leading cause of cancer death worldwide. Adenocarcinoma, the most commonly diagnosed histologic type of lung cancer, is associated with smoking. Cigarette smoke promotes inflammation on the airways, which might be mediated by Th17 cells. This inflammatory environment may contribute to tumor development. In contrast, some reports indicate that tumors may induce immunosuppressive Treg cells to dampen immune reactivity, supporting tumor growth and progression. Thus, we aimed to analyze whether chronic inflammation or immunosuppression predominates at the systemic level in lung adenocarcinoma patients, and several cytokines and Th17 and Treg cells were studied. Higher proportions of IL-17-producing CD4+ T-cells were found in smoking control subjects and in lung adenocarcinoma patients compared to nonsmoking control subjects. In addition, lung adenocarcinoma patients increased both plasma concentrations of IL-2, IL-4, IL-6, and IL-10, and proportions of Latency Associated Peptide (LAP) TGF-β subset of CD4+CD25+CD127− Treg cells, which overexpressed LAP TGF-β. This knowledge may lead to the development of immunotherapies that could inhibit the suppressor activity mediated by the LAP TGF-β subset of CD4+CD25+CD127− Treg cells to promote reactivity of immune cells against lung adenocarcinoma cells. PMID:26582240

  4. LAP TGF-Beta Subset of CD4+CD25+CD127− Treg Cells is Increased and Overexpresses LAP TGF-Beta in Lung Adenocarcinoma Patients

    Directory of Open Access Journals (Sweden)

    Lorenzo Islas-Vazquez

    2015-01-01

    Full Text Available Lung cancer is the leading cause of cancer death worldwide. Adenocarcinoma, the most commonly diagnosed histologic type of lung cancer, is associated with smoking. Cigarette smoke promotes inflammation on the airways, which might be mediated by Th17 cells. This inflammatory environment may contribute to tumor development. In contrast, some reports indicate that tumors may induce immunosuppressive Treg cells to dampen immune reactivity, supporting tumor growth and progression. Thus, we aimed to analyze whether chronic inflammation or immunosuppression predominates at the systemic level in lung adenocarcinoma patients, and several cytokines and Th17 and Treg cells were studied. Higher proportions of IL-17-producing CD4+ T-cells were found in smoking control subjects and in lung adenocarcinoma patients compared to nonsmoking control subjects. In addition, lung adenocarcinoma patients increased both plasma concentrations of IL-2, IL-4, IL-6, and IL-10, and proportions of Latency Associated Peptide (LAP TGF-β subset of CD4+CD25+CD127− Treg cells, which overexpressed LAP TGF-β. This knowledge may lead to the development of immunotherapies that could inhibit the suppressor activity mediated by the LAP TGF-β subset of CD4+CD25+CD127− Treg cells to promote reactivity of immune cells against lung adenocarcinoma cells.

  5. Renal carcinoma cell-derived exosomes induce human immortalized line of Jurkat T lymphocyte apoptosis in vitro.

    Science.gov (United States)

    Yang, Lin; Wu, Xiaohou; Wang, Dan; Luo, Chunli; Chen, Lixue

    2013-01-01

    Tumor-derived exosomes usually contain some molecules that can help immune evasion by tumors. This study is aimed at investigating the potential effect of exosomes from human kidney adenocarcinoma cells on a human immortalized line of Jurkat T lymphocytes in vitro. Exosomes were purified from human kidney adenocarcinoma ACHN cells by sequential centrifugations and ultrafiltrations, and characterized by transmission electron microscopy. The effects of exosomes on the proliferation, cytokine production and apoptosis of Jurkat T cells were determined using flow cytometry and enzyme-linked immunosorbent assay. The relative levels of pro- and anti-apoptotic molecules were determined by Western blotting. Exosomes were purified from ACHN cells and exhibited typical characteristics. Treatment with exosomes inhibited Jurkat T cell proliferation and induced Jurkat T cell apoptosis in a dose- and time-dependent manner. Treatment with exosomes reduced spontaneous interleukin-2 (IL-2), interferon-γ, IL-6 and IL-10 production by Jurkat T cells. Treatment with exosomes increased the relative levels of cleaved caspase-3, -8 and -9 as well as Bax, but reduced the levels of Bcl-2 in Jurkat T cells. The purified exosomes contained Fas ligand, and treatment with soluble Fas abrogated exosome-mediated Jurkat T cell apoptosis. Our data indicate that exosomes from kidney adenocarcinoma cells contain Fas ligand and trigger Jurkat T cell apoptosis, contributing to the immune evasion of tumors. Copyright © 2013 S. Karger AG, Basel.

  6. Retracted: Resveratrol inhibits oesophageal adenocarcinoma cell proliferation via AMP-activated protein kinase signaling

    Science.gov (United States)

    2017-11-24

    Retraction: Retracted:Resveratrol inhibits oesophageal adenocarcinoma cell proliferation via AMP-activated protein kinase signaling Asian Pacific Journal of Cancer Prevention (APJCP) has retracted the article titled “Resveratrol Inhibits Oesophageal Adenocarcinoma Cell Proliferation via AMP-activated Protein Kinase Signaling”(1) for reason of having duplicated contents brought to the attention of APJCP’s editorial office by the following email content: “Dear Editors of Gastroenterology and Hepatology, Acta Pharmacologica Sinica, Asian Pac J Cancer Prev, Clinical and Experimental Hypertension, I write to you from the editorial office of PLOS ONE to inform you of concerns related to duplicated content in articles published by your journals. We have been following up on concerns of overlapping text and duplicate Western blots within the following PLOS ONE article: [1] Berberine Improves Kidney Function in Diabetic Mice via AMPK Activation https://doi.org/10.1371/journal.pone.0113398 Received: June 9, 2014; Accepted: October 23, 2014; Published: November 19, 2014 It was initially brought to our attention that there is duplication of Western blot images between the PLOS ONE article and the following published papers: [2] Brain Injury (Received 28 Oct 2013, Accepted 4 Jan 2015, Published online 20 Mar 2015) doi: 10.3109/02699052.2015.1004746: Figure 6b GAPDH is similar to Figure 2A AMPK in [1] [3] Exp Mol Pathol (Received 24 Feb 2014, Accepted 10 Sep 2014, Available online 16 Sep 2014) doi:10.1016/j.yexmp.2014.09.006: Figure 5B GAPDH is similar to Figure 2A AMPK in [1]; Figure 5C Occludin is similar to Figure 2A LKB1 in [1] [4] Korean J Physiol Pharmacol, (Received 7 Nov 2013, Accepted 3 Jan 2016) doi: 10.4196/kjpp.2016.20.4.325 RETRACTED: Figure 6B GAPDH is similar to Figure 2A AMPK [1] Please note that the KJPP paper has been retracted as a result of the content duplication issues. During the course of our follow up, we have discovered additional instances of

  7. Trastuzumab mediated T-cell response against HER-2/neu overexpressing esophageal adenocarcinoma depends on intact antigen processing machinery.

    Directory of Open Access Journals (Sweden)

    Francesca Milano

    2010-08-01

    Full Text Available Esophageal adenocarcinoma (EAC is a highly aggressive disease with poor prognosis, which frequently exhibits HER-2 gene amplification. Trastuzumab, the humanized antibody against HER-2, has potent growth inhibitory effects on HER-2 overexpressing cancers. One effect of trastuzumab is that it causes HER-2 receptor internalization and degradation, enhancing presentation of HER-2 epitopes on MHC-Class I molecules. This enhances the ability of HER-2 specific cytotoxic T lymphocytes (CTLs to recognize and kill cancer cells. Novel strategies targeting the HER-2 receptor either directly by trastuzumab and/or indirectly by inducing a CTL response against HER-2 epitopes with, for instance, DC immunotherapy and consequently combining these strategies might prove to be very effective.In this study we report that trastuzumab has potent growth inhibitory effects on two HER-2 overexpressing EAC cell lines OE33 and OE19. However, we found that trastuzumab and HER-2 specific CTLs act synergistically in inducing tumor lysis in OE33 but not in OE19. We discovered that in OE19 this deficient response is due to a down-regulation of the Transporter Associated with Antigen Processing-2 (TAP-2. TAP-2 is an important member of the Antigen Processing Machinery (APM, and is one of the essential elements for loading antigens on MHC class I molecules. Importantly, we demonstrated that by inducing re-expression of TAP-2 in OE19 with INF-γ treatment or by incubating the cells with INF-γ producing CTLs, the specific anti HER-2 CTL tumor lysis response and synergistic effect with trastuzumab can be restored.An inefficient response of HER-2 overexpressing EAC to trastuzumab and/or DC immunotherapy can be due to a down-regulated TAP-2 expression and thus a deficient APM. Future studies combining trastuzumab with IFN-γ and/or immune-therapies inducing potent anti HER-2 CTL responses could lead to an effective combinatorial strategy for successful treatment of HER-2

  8. Comprehensive sampling of gene expression in human cell lines with massively parallel signature sequencing.

    Science.gov (United States)

    Jongeneel, C Victor; Iseli, Christian; Stevenson, Brian J; Riggins, Gregory J; Lal, Anita; Mackay, Alan; Harris, Robert A; O'Hare, Michael J; Neville, A Munro; Simpson, Andrew J G; Strausberg, Robert L

    2003-04-15

    Whereas information is rapidly accumulating about the structure and position of genes encoded in the human genome, less is known about the complexity and relative abundance of their expression in individual human cells and tissues. Here, we describe the characteristics of the transcriptomes of two cultured cell lines, HB4a (normal breast epithelium) and HCT-116 (colon adenocarcinoma), using massively parallel signature sequencing (MPSS). We generated in excess of 10(7) short signature sequences per cell line, thus providing a comprehensive snapshot of gene expression, within the technical limitations of the method. The number of genes expressed at one copy per cell or more in either of the lines was estimated to be between 10,000 and 15,000. The vast majority of the transcripts found in these cells can be mapped to known genes and their polyadenylation variants. Among the genes that could be identified from their signature sequences, approximately 8,500 were expressed by both cell lines, whereas 6,000 showed cellular specificity. Taking into account sequence tags that map uniquely to the genome but not to known transcripts, overall the data are consistent with an upper limit of 17,000 for the total number of genes expressed at more than one copy per cell in one or both of the two cell lines examined.

  9. [Value of immunocytochemistry in differential diagnosis of gastric adenocarcinoma, reactive mesothelial cells and malignant epithelial mesothelioma in metastatic effusion fluid].

    Science.gov (United States)

    Lyu, M; Cha, N; Zou, Y F; Leng, J H; Xu, L; Sun, Y; Hao, Y Y

    2018-03-08

    Objective: To investigate the diagnostic value of some antibodies in peritoneal fluid of patients with gastric cancer and malignant epithelioid mesothelioma in serous effusion. Methods: One hundred and eighty-two cases of serous effusion were collected at Jilin Cancer Hospital, from July 2012 to July 2016. The expression of GLUT1, CDX2, Villin, calretinin and WT1 was evaluated using SP immunocytochemical technique in peritoneal fluid samples collected from 98 patients with gastric cancer and 74 patients with reactive mesothelial cells. The expression of GLUT1, calretinin and WT1 was also evaluated in serous effusion from 10 patients with mesothelioma. Results: The sensitivity of GLUT1, CDX2 and Villin in adenocarcinoma cells was 91.8%(90/98), 68.4% (67/98) and 88.8%(87/98), respectively. The specificity was 95.9% (71/74), 100.0%(74/74) and 100.0% (74/74), respectively. The sensitivity of calretinin and WT1 for reactive mesothelium was 93.2% (69/74) and 79.7% (59/74), respectively. The specificity was 96.9% (95/98) and 100.0% (98/98), respectively. The sensitivity of GLUT1, calretinin and WT1 for mesothelioma was 9/10, 9/10 and 7/10. The reactivity of GLUT1, CDX2, Villin, calretinin and WT1 showed a significant difference ( P <0.01) between adenocarcinoma cells and reactive mesothelium. The reactivity of GLUT1 showed a significant difference ( P <0.01) between mesothelioma and reactive mesothelium. Conclusions: The optimal combination is a panel of GLUT1, CDX2, Villin, calretinin and WT1 for differential diagnosis between adenocarcinoma cells and reactive mesothelium in peritoneal fluid of patients with gastric cancer. Whereas GLUT1, calretinin and WT1 is the best for differential diagnosis between reactive mesothelium and mesothelioma in serous effusions.

  10. [Down-expression of FOXA2 in gastric adenocarcinoma].

    Science.gov (United States)

    Zhang, Zhengliang; Sun, Jiangli; Bai, Zhenghai; Li, Haijun; He, Shicai; Chen, Rui; Che, Xiangming

    2015-05-01

    To investigate the expression of FOXA2 in human gastric adenocarcinoma and its correlation with cell migration and invasion. Fifty-six pairs of gastric adenocarcinoma and matched tumor-adjacent tissues were freshly collected. The expressions of FOXA2 and epithelial cadherin (E-cadherin) in the gastric specimens were detected using immunohistochemistry. Western blotting was performed to test FOXA2 and E-cadherin expressions in different gastric cancer cell lines. FOXA2 was over-expressed in MKN-45 cells. TranswellTM assays were performed to observe gastric cancer cell migration and invasion in vitro. Spearman rank correlation coefficient was used for correlation analysis. The expressions of FOXA2 and E-cadherin in gastric adenocarcinoma were significantly lower than those in matched tumor-adjacent noncancerous tissues. FOXA2 was positively correlated with E-cadherin expression in gastric adenocarcinoma tissues. Clinical analysis suggested that FOXA2 expression was prominently associated with tumor differentiation, infiltration depth, lymph node metastasis and TNM stage, respectively. The lowest expressions of FOXA2 and E-cadherin were found in highly invasive gastric cancer MKN-45 cell line; the highest expressions of FOXA2 and E-cadherin were observed in low metastatic gastric cancer N-87 cell line. Over-expression of FOXA2 significantly increased the expression of E-cadherin protein and obviously inhibited cell migration and invasion in MKN-45 cells. Expression of FOXA2 is reduced in gastric adenocarcinoma tissues and its low-expression is correlated with malignant clinical pathological features. Over-expression of FOXA2 in MKN-45 cells up-regulates E-cadherin expression and inhibits gastric cancer cell migration and invasion.

  11. High-resolution cytometry of selected genetic elements in human adenocarcinoma cells induced to differentiate

    Czech Academy of Sciences Publication Activity Database

    Harničarová, Andrea; Bártová, Eva; Kozubek, Stanislav

    2006-01-01

    Roč. 39, č. 5 (2006), s. 362-362 ISSN 0960-7722. [Cytomics Emerging from Cytometry 16th Annual Meeting of the german Society for cytometry. 18.10.2006-21.10.2006, Heidelberg] Institutional research plan: CEZ:AV0Z50040507 Keywords : adenocarcinoma * NaBt * differentiation Subject RIV: BO - Biophysics

  12. Novel therapeutic strategies for treating esophageal adenocarcinoma: the potential of dendritic cell immunotherapy and combinatorial regimens

    NARCIS (Netherlands)

    Milano, Francesca; Krishnadath, Kausilia K.

    2008-01-01

    Esophageal adenocarcinoma (EAC) is an extremely aggressive disease with an overall 5 years survival rate of less than 20%. Current treatments, such as surgery, or chemo- and radiotherapy have only little effect on survival. Attempts to combine these treatment modalities were only limited successful

  13. Antiproliferative and Proapoptotic Activities of Marine Sponge Hyrtios erectus Extract on Breast Carcinoma Cell Line (MCF-7)

    OpenAIRE

    Muthiyan, Ramachandran; Nambikkairaj, Balwin; Mahanta, Nilkamal; Immanuel, Titus; Mandal, Rahul Shubhra; Kumaran, Kubendiran; De, Arun Kumar

    2017-01-01

    Background: Marine sponge is a rich natural resource of many pharmacologically important compounds. Objective: Marine sponge Hyrtios erectus, collected from North Bay, South Andaman Sea, India, was screened for potential antiproliferative and proapoptotic properties on a breast adenocarcinoma cell line (MCF-7). Materials and Methods: 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay was used to test the antiproliferative and cytotoxicity effects of the sponge extract. Analysi...

  14. A neoplastic epithelial duct cell line established from an irradiated human salivary gland

    Energy Technology Data Exchange (ETDEWEB)

    Shirasuna, K.; Sato, M.; Miyazaki, T.

    1981-08-01

    Transformed epithelial cells were isolated by using tissue culture techniques from an irradiated human submandibular salivary gland which showed no neoplastic lesion. These cells, carrying colony-forming ability in semisolid agar, formed a semiconfluent monolayer with occasional tubular arrangement. All transformed clones were demonstrated by electron microscopic examination to be only one type of cells having fine structure similar to intercalated duct cells. Of six clones isolated, one clone with stable growth was cultured within the sponge matrix, resulting in formation of duct-like structure with mucinous eosinophilic substance. Moreover, inoculation of the cloned cells into nude mice resulted in a production of adenocarcinoma with solid and trabecular pattern. These findings indicate that a human intercalated duct cell line carrying tumorigenicity is established from a human submandibular salivary gland with an exposure to irradiation.

  15. Rhesus CE expression on patient red blood cells is an independent prognostic factor for adenocarcinoma of the lung.

    Science.gov (United States)

    Schulze, A B; Schmidt, L H; Baie, L; Heitkötter, B; Kuemmel, A; Mohr, M; Buhl, R; Hillmann, H; Geißler, G; Kelsch, R; Görlich, D; Berdel, W E; Hartmann, W; Wiewrodt, R

    2017-04-11

    The influence of blood group antigens on cancerogenesis is shown for distinct tumor types, yet the impact of Rhesus blood group antigens in lung cancer is not clarified. To investigate the impact of Rhesus blood groups a non-small cell lung cancer (NSCLC) collective (n = 1047) was analyzed retrospectively. Using a second cohort of n = 340 primarily operated stage I-III NSCLC patients, we evaluated immunohistochemistry of CD47-antibody stained tissue samples in correlation to histopathologic subtype and Rhesus blood group. In 516 of 1047 patients blood group data were available. Seven different RhCE phenotypes were grouped as "··ee," "ccE·," and "C·E·." Adenocarcinoma patients with Rh "··ee" revealed improved overall survival (29 (21.2-36.8) m; HR 1.00 [index]) compared with Rh "ccE·" (19 (1.9-36.1) m; HR 1.76 [1.15-2.70]) and Rh "C·E·" (10 (7.4-12.6) m; HR 2.65 [1.70-4.12]) univariately (P Rh "··ee" showed reduced incidence of CNS-metastasis (P = .014) and metastasis count (P = .032) in stage IV adenocarcinoma. Immunohistochemistry associated CD47-positivity with adenocarcinomas (n = 340, P = .048). In n = 51 cases blood group data were available. The prognostic effect of Rh "··ee" compared with Rh "ccE·" and Rh "C·E·" was stated (P = .001), foremost in CD47-positive adenocarcinomas (Rh "··ee" vs. Rh "ccE·" and Rh "C·E·," P = .008). Inversely Rh "ccE·" or Rh "C·E·" was found beneficial in CD47-negative non-adenocarcinomas (P = .046). Phenotypic RhCE expression may be an independent prognostic factor for overall survival in adeno-NSCLC. We hypothesize an erythrocytic-immunologic interaction with tumor tissue, possibly altered by RhCE and CD47, resulting in a metastatic prone condition. © 2017 John Wiley & Sons Ltd.

  16. Telomerase inhibition by siRNA causes senescence and apoptosis in Barrett's adenocarcinoma cells: mechanism and therapeutic potential

    Directory of Open Access Journals (Sweden)

    Batchu Ramesh B

    2005-07-01

    Full Text Available Abstract Background In cancer cells, telomerase induction helps maintain telomere length and thereby bypasses senescence and provides enhanced replicative potential. Chemical inhibitors of telomerase have been shown to reactivate telomere shortening and cause replicative senescence and apoptotic cell death of tumor cells while having little or no effect on normal diploid cells. Results We designed siRNAs against two different regions of telomerase gene and evaluated their effect on telomere length, proliferative potential, and gene expression in Barrett's adenocarcinoma SEG-1 cells. The mixture of siRNAs in nanomolar concentrations caused a loss of telomerase activity that appeared as early as day 1 and was essentially complete at day 3. Inhibition of telomerase activity was associated with marked reduction in median telomere length and complete loss of detectable telomeres in more than 50% of the treated cells. Telomere loss caused senescence in 40% and apoptosis in 86% of the treated cells. These responses appeared to be associated with activation of DNA sensor HR23B and subsequent activation of p53 homolog p73 and p63 and E2F1. Changes in these gene regulators were probably the source of observed up-regulation of cell cycle inhibitors, p16 and GADD45. Elevated transcript levels of FasL, Fas and caspase 8 that activate death receptors and CARD 9 that interacts with Bcl10 and NFKB to enhance mitochondrial translocation and activation of caspase 9 were also observed. Conclusion These studies show that telomerase siRNAs can cause effective suppression of telomerase and telomere shortening leading to both cell cycle arrest and apoptosis via mechanisms that include up-regulation of several genes involved in cell cycle arrest and apoptosis. Telomerase siRNAs may therefore be strong candidates for highly selective therapy for chemoprevention and treatment of Barrett's adenocarcinoma.

  17. Genomic characterisation of acral melanoma cell lines.

    Science.gov (United States)

    Furney, Simon J; Turajlic, Samra; Fenwick, Kerry; Lambros, Maryou B; MacKay, Alan; Ricken, Gerda; Mitsopoulos, Costas; Kozarewa, Iwanka; Hakas, Jarle; Zvelebil, Marketa; Lord, Christopher J; Ashworth, Alan; Reis-Filho, Jorge S; Herlyn, Meenhard; Murata, Hiroshi; Marais, Richard

    2012-07-01

    Acral melanoma is a rare melanoma subtype with distinct epidemiological, clinical and genetic features. To determine if acral melanoma cell lines are representative of this melanoma subtype, six lines were analysed by whole-exome sequencing and array comparative genomic hybridisation. We demonstrate that the cell lines display a mutation rate that is comparable to that of published primary and metastatic acral melanomas and observe a mutational signature suggestive of UV-induced mutagenesis in two of the cell lines. Mutations were identified in oncogenes and tumour suppressors previously linked to melanoma including BRAF, NRAS, KIT, PTEN and TP53, in cancer genes not previously linked to melanoma and in genes linked to DNA repair such as BRCA1 and BRCA2. Our findings provide strong circumstantial evidence to suggest that acral melanoma cell lines and acral tumours share genetic features in common and that these cells are therefore valuable tools to investigate the biology of this aggressive melanoma subtype. Data are available at: http://rock.icr.ac.uk/collaborations/Furney_et_al_2012/. © 2012 John Wiley & Sons A/S.

  18. Activated Pancreatic Stellate Cells Sequester CD8+ T-Cells to Reduce Their Infiltration of the Juxtatumoral Compartment of Pancreatic Ductal Adenocarcinoma

    Science.gov (United States)

    Ene-Obong, Abasi; Clear, Andrew J.; Watt, Jennifer; Wang, Jun; Fatah, Rewas; Riches, John C.; Marshall, John F.; Chin-Aleong, Joanne; Chelala, Claude; Gribben, John G.; Ramsay, Alan G.; Kocher, Hemant M.

    2013-01-01

    Background & Aims Pancreatic ductal adenocarcinoma (PDAC) is characterized by a prominent desmoplastic microenvironment that contains many different immune cells. Activated pancreatic stellate cells (PSCs) contribute to the desmoplasia. We investigated whether distinct stromal compartments are differentially infiltrated by different types of immune cells. Method We used tissue microarray analysis to compare immune cell infiltration of different pancreatico-biliary diseased tissues (PDAC, ampullary carcinoma, cholangiocarcinoma, mucinous cystic neoplasm, chronic inflammation, and chronic pancreatitis), and juxtatumoral stromal (cancer cells. Deregulated signaling by activated PSCs could prevent an effective anti-tumor immune response. PMID:23891972

  19. Demographic Clinical and Prognostic Factors of Primary Ovarian Adenocarcinomas of Serous and Clear Cell Histology—A Comparative Study

    DEFF Research Database (Denmark)

    Schnack, Tine H; Høgdall, Estrid; Nedergaard, Lotte

    2016-01-01

    OBJECTIVE: To compare clinical demographic and prognostic factors as well as overall survival in a nationwide cohort of patients diagnosed with ovarian clear cell carcinoma (oCCC) and high grade ovarian serous adenocarcinoma (oSAC) during 2005 to 2013. MATERIALS AND METHODS: Population......SAC cases. Furthermore, our findings confirm that advanced stages of oCCC have a poorer prognosis compared with oSAC probably because of the resistance toward adjuvant chemotherapy. The observed differences highlight the need for subtype-specific research and individualized treatment within ovarian cancer....

  20. Metronidazole affects breast cancer cell lines.

    Science.gov (United States)

    Sadowska, A; Prokopiuk, S; Miltyk, W; Surażyński, A; Konończuk, J; Sawicka, D; Car, H

    2013-01-01

    The aim of our study was to evaluate the impact of metronidazole (MTZ) on cytotoxicity and DNA synthesis in MCF-7 (estrogen receptor positive) and MDA-MB-231 (estrogen receptor negative) breast cancer cell lines. Toxicity of MTZ was determined by MTT test. MCF-7 and MDA-MB-231 cells were incubated with metronidazole used in different concentrations for 24, 48 and 72 hours. The effect of MTZ on DNA synthesis was measured as [3H]-thymidine incorporation. We showed that MTZ in concentration 250 μg/ml significantly increases the growth of MCF-7 cell lines after 24 hours of incubation, but it reduces cell viability in concentrations 1 and 10 μg/ml 72 hours after the drug application. Significant increase of MDA-MB-231 cell viability was obtained in MTZ concentration of 250 μg/ml after 24 and 72 hours. The increase of [3H]-thymidine incorporation in MCF-7 cell line treated with MTZ in concentration 250 μg/ml was statistically significant after 24 hours. Great suppression of cell proliferation was obtained in MDA-MB-231 breast cell line after application of the following concentrations of MTZ: 0.1 μg/ml (after 24 hours) and 0.1, 10, 50, 250 μg/ml (after 72h). We found that metronidazole exerts different dose- and time- dependent effects on human breast cancer cell lines characterized by presence or absence of estrogen receptors. We suggest that these discrepancies may be influenced by the estrogen signaling.

  1. VAMP2-NRG1 Fusion Gene is a Novel Oncogenic Driver of Non-Small-Cell Lung Adenocarcinoma.

    Science.gov (United States)

    Jung, Yeonjoo; Yong, Seunghui; Kim, Pora; Lee, Hee-Young; Jung, Yeonhwa; Keum, Juhee; Lee, Sanghyuk; Kim, Jhingook; Kim, Jaesang

    2015-07-01

    Neuregulin 1 (NRG1) has been discovered as the tail moiety of fusion genes with several distinct partner head genes in lung cancers. These fusion genes activate ERBB2/ERBB3 receptor-mediated cell signaling and thereby function as oncogenic drivers. We have carried out whole-transcriptome sequencing of 100 non-small-cell lung carcinoma tumors and isolated a novel fusion gene consisting of vesicle-associated membrane protein 2 (VAMP2) and NRG1. Reverse transcription-polymerase chain reaction and genomic DNA analysis were used to demonstrate interchromosomal translocation. Immunoblotting and soft agar assays were used to examine stimulating activity of the fusion gene through ERBB2/ERBB3 signaling pathway. The most highly expressed splice variant of VAMP2-NRG1 fusion gene was shown to be membrane bound and display EGF-like domain of NRG1 extracellularly. VAMP2-NRG1 promotes anchorage-independent colony formation of H1568 lung adenocarcinoma cells. Ectopic expression of the fusion gene stimulates phosphorylation of ERBB2 and ERBB3 as well as downstream targets, AKT and ERK, confirming activation of the signaling pathway. VAMP2-NRG1 is a novel oncogenic fusion gene representing a new addition to the list of NRG1 fusion genes, which together may form an important diagnostic and clinical category of lung adenocarcinoma cases.

  2. Immunohistochemistry for cell polarity protein lethal giant larvae 2 differentiates pancreatic intraepithelial neoplasia-3 and ductal adenocarcinoma of the pancreas from lower-grade pancreatic intraepithelial neoplasias.

    Science.gov (United States)

    Lisovsky, Mikhail; Dresser, Karen; Woda, Bruce; Mino-Kenudson, Mari

    2010-06-01

    Pancreatic intraepithelial neoplasia is a precursor to ductal adenocarcinoma of the pancreas that shows gastric differentiation. Pancreatic intraepithelial neoplasia-3 has the highest potential to progress to adenocarcinoma, and its distinction from lower-grade pancreatic intraepithelial neoplasias is important for clinical management. However, morphologic grading of pancreatic intraepithelial neoplasia suffers from significant interobserver variability. A product of cell polarity gene lethal giant larvae 2 is a marker of gastric foveolar epithelium expressed in a basolateral fashion, which is lost or mislocalized in gastric epithelial dysplasia and adenocarcinoma. In this study, we investigated a role of lethal giant larvae 2 expression in differentiating low-grade pancreatic intraepithelial neoplasias, that is, pancreatic intraepithelial neoplasia-1 and pancreatic intraepithelial neoplasia-2, from pancreatic intraepithelial neoplasia-3 and pancreatic ductal adenocarcinoma. The immunohistochemical patterns of lethal giant larvae 2 expression were examined in normal pancreatic ducts, 48 pancreatic intraepithelial neoplasia lesions of all histologic grades, and 91 adenocarcinomas on a tissue microarray or conventional sections. The expression pattern was recorded as basolateral, cytoplasmic, negative, or combinations of any of them. Whereas normal duct epithelia did not exhibit lethal giant larvae immunoreactivity, all but one lesion of low-grade pancreatic intraepithelial neoplasia showed basolateral lethal giant larvae staining. Conversely, all lesions of pancreatic intraepithelial neoplasia-3 and adenocarcinoma showed loss of lethal giant larvae 2 staining and/or its cytoplasmic localization. Interestingly, a basolateral expression was focally seen in 4 adenocarcinomas with a foamy gland pattern and was always admixed with negatively stained areas. In conclusion, our results show that low-grade pancreatic intraepithelial neoplasias express lethal giant larvae 2

  3. DAG/PKCδ and IP3/Ca²⁺/CaMK IIβ Operate in Parallel to Each Other in PLCγ1-Driven Cell Proliferation and Migration of Human Gastric Adenocarcinoma Cells, through Akt/mTOR/S6 Pathway.

    Science.gov (United States)

    Dai, Lianzhi; Zhuang, Luhua; Zhang, Bingchang; Wang, Fen; Chen, Xiaolei; Xia, Chun; Zhang, Bing

    2015-12-01

    Phosphoinositide specific phospholipase Cγ (PLCγ) activates diacylglycerol (DAG)/protein kinase C (PKC) and inositol 1,4,5-trisphosphate (IP3)/Ca(2+)/calmodulin-dependent protein kinase II (CaMK II) axes to regulate import events in some cancer cells, including gastric adenocarcinoma cells. However, whether DAG/PKCδ and IP3/Ca(2+)/CaMK IIβ axes are simultaneously involved in PLCγ1-driven cell proliferation and migration of human gastric adenocarcinoma cells and the underlying mechanism are not elucidated. Here, we investigated the role of DAG/PKCδ or CaMK IIβ in PLCγ1-driven cell proliferation and migration of human gastric adenocarcinoma cells, using the BGC-823 cell line. The results indicated that the inhibition of PKCδ and CaMK IIβ could block cell proliferation and migration of BGC-823 cells as well as the effect of inhibiting PLCγ1, including the decrease of cell viability, the increase of apoptotic index, the down-regulation of matrix metalloproteinase (MMP) 9 expression level, and the decrease of cell migration rate. Both DAG/PKCδ and CaMK IIβ triggered protein kinase B (Akt)/mammalian target of rapamycin (mTOR)/S6 pathway to regulate protein synthesis. The data indicate that DAG/PKCδ and IP3/Ca(2+)/CaMK IIβ operate in parallel to each other in PLCγ1-driven cell proliferation and migration of human gastric adenocarcinoma cells through Akt/mTOR/S6 pathway, with important implication for validating PLCγ1 as a molecular biomarker in early gastric cancer diagnosis and disease surveillance.

  4. Cytotoxic Activity of Selected Iranian Traditional Medicinal Plants on Colon, Colorectal and Breast Cancer Cell Lines

    Directory of Open Access Journals (Sweden)

    Leila Mohammad Taghizadeh Kashani

    2014-11-01

    Full Text Available Background: Many natural products from plants have been recognized to exert anticancer activity. In this study, ethanolic extracts of selected medicinal herbs from Iranian flora including Alyssum homolocarpum Fisch. (from seeds, Urtica dioica L. (from aerial parts, Cichorium intybus L. (from roots and Solanum nigrum L. (from fruits, were evaluated for their cytotoxic effect on different cell lines.Methods: Cytotoxic effect of these extracts was studied on three different cancer cell lines; colon carcinoma (HT-29, colorectal adenocarcinoma (Caco-2 and breast ductal carcinoma (T47D. In addition, Swiss mouse embryo fibroblasts (NIH 3T3 were used as normal nonmalignant cells. MTT assay (3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide was utilized for calculating the cytotoxicity of extracts on cell lines.Results: Results showed the potent cytotoxic activity of U. dioica ethanolic extract against T47D cell line with IC50 value of 46.14±4.55 µg/ml. Other extracts showed poor activity with IC50>100 µg/ml.Conclusions: Cytotoxic activity recorded in the present study revealed high potential antiproliferative activity of U. dioica ethanolic extract against T47D cell line. The real IC50 values of this extract may be considerably lower than the IC50 measured in our study if its pharmacological active compounds become pure. The results emphasize the importance of studies on U. dioica ethanolic extract to characterize potential components as cytotoxic natural medicines.

  5. Cell Line Data Base: structure and recent improvements towards molecular authentication of human cell lines.

    Science.gov (United States)

    Romano, Paolo; Manniello, Assunta; Aresu, Ottavia; Armento, Massimiliano; Cesaro, Michela; Parodi, Barbara

    2009-01-01

    The Cell Line Data Base (CLDB) is a well-known reference information source on human and animal cell lines including information on more than 6000 cell lines. Main biological features are coded according to controlled vocabularies derived from international lists and taxonomies. HyperCLDB (http://bioinformatics.istge.it/hypercldb/) is a hypertext version of CLDB that improves data accessibility by also allowing information retrieval through web spiders. Access to HyperCLDB is provided through indexes of biological characteristics and navigation in the hypertext is granted by many internal links. HyperCLDB also includes links to external resources. Recently, an interest was raised for a reference nomenclature for cell lines and CLDB was seen as an authoritative system. Furthermore, to overcome the cell line misidentification problem, molecular authentication methods, such as fingerprinting, single-locus short tandem repeat (STR) profile and single nucleotide polymorphisms validation, were proposed. Since this data is distributed, a reference portal on authentication of human cell lines is needed. We present here the architecture and contents of CLDB, its recent enhancements and perspectives. We also present a new related database, the Cell Line Integrated Molecular Authentication (CLIMA) database (http://bioinformatics.istge.it/clima/), that allows to link authentication data to actual cell lines.

  6. Melatonin increases the effect of 5-fluorouracil-based chemotherapy in human colorectal adenocarcinoma cells in vitro.

    Science.gov (United States)

    Pariente, Roberto; Bejarano, Ignacio; Rodríguez, Ana Beatriz; Pariente, José Antonio; Espino, Javier

    2018-03-01

    Melatonin has antitumor activity via several mechanisms including its anti-proliferative and pro-apoptotic effects. Moreover, it has been proven that melatonin in combination with chemotherapeutic agents enhances chemotherapy-triggered apoptosis in several types of cancer. Therefore, this study was intended to evaluate whether melatonin is able to strengthen the anti-cancer potential of different chemotherapeutic drugs in human colorectal adenocarcinoma HT-29 cells. We found that treatment with 20 µM cisplatin (CIS) or 1 mM 5-fluorouracil (5-FU) for 72 h induced a decrease in HT-29 cell viability. Furthermore, 1 mM melatonin significantly (P < 0.05) increased the cytotoxic effects of 5-FU. Likewise, simultaneous stimulation with 1 mM melatonin and 1 mM 5-FU significantly (P < 0.05) enhanced the ratio of cells with an overproduction of intracellular reactive oxygen species and substantially augmented the population of apoptotic cells compared to the treatment with 5-FU alone. Nonetheless, melatonin only displayed moderate chemosensitizing effects in CIS-treated HT-29 cells, as suggested by a slight increment in the fraction of early apoptotic cells that was observed only after 48 h. Consistently, co-stimulation of HT-29 cells with 20 µM CIS or 1 mM 5-FU in the presence of 1 mM melatonin further increased caspase-3 activation. Apart from this, the cytostatic activity displayed by CIS due to S phase arrest was not affected by concomitant stimulation with melatonin. Overall, our results indicate that melatonin increases the sensitivity of HT-29 cells to 5-FU treatment and, consequently, the indolamine could be potentially applied to colorectal adenocarcinoma treatment as a potent chemosensitizing agent.

  7. Anti-proliferative effect of rhein, an anthraquinone isolated from Cassia species, on Caco-2 human adenocarcinoma cells

    Science.gov (United States)

    Aviello, Gabriella; Rowland, Ian; Gill, Christopher I; Acquaviva, Angela Maria; Capasso, Francesco; McCann, Mark; Capasso, Raffaele; Izzo, Angelo A; Borrelli, Francesca

    2010-01-01

    Abstract In recent years, the use of anthraquinone laxatives, in particular senna, has been associated with damage to the intestinal epithelial layer and an increased risk of developing colorectal cancer. In this study, we evaluated the cytotoxicity of rhein, the active metabolite of senna, on human colon adenocarcinoma cells (Caco-2) and its effect on cell proliferation. Cytotoxicity studies were performed using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), neutral red (NR) and trans-epithelial electrical resistance (TEER) assays whereas 3H-thymidine incorporation and Western blot analysis were used to evaluate the effect of rhein on cell proliferation. Moreover, for genoprotection studies Comet assay and oxidative biomarkers measurement (malondialdehyde and reactive oxygen species) were used. Rhein (0.1–10 μg/ml) had no significant cytotoxic effect on proliferating and differentiated Caco-2 cells. Rhein (0.1 and 1 μg/ml) significantly reduced cell proliferation as well as mitogen-activated protein (MAP) kinase activation; by contrast, at high concentration (10 μg/ml) rhein significantly increased cell proliferation and extracellular-signal-related kinase (ERK) phosphorylation. Moreover, rhein (0.1–10 μg/ml): (i) did not adversely affect the integrity of tight junctions and hence epithelial barrier function; (ii) did not induce DNA damage, rather it was able to reduce H2O2-induced DNA damage and (iii) significantly inhibited the increase in malondialdehyde and reactive oxygen species (ROS) levels induced by H2O2/Fe2+. Rhein was devoid of cytotoxic and genotoxic effects in colon adenocarcinoma cells. Moreover, at concentrations present in the colon after a human therapeutic dosage of senna, rhein inhibited cell proliferation via a mechanism that seems to involve directly the MAP kinase pathway. Finally, rhein prevents the DNA damage probably via an anti-oxidant mechanism. PMID:19538468

  8. Role of Rac1 Pathway in Epithelial-to-Mesenchymal Transition and Cancer Stem-like Cell Phenotypes in Gastric Adenocarcinoma.

    Science.gov (United States)

    Yoon, Changhwan; Cho, Soo-Jeong; Chang, Kevin K; Park, Do Joong; Ryeom, Sandra W; Yoon, Sam S

    2017-08-01

    Rac1, a Rho GTPase family member, is dysregulated in a variety of tumor types including gastric adenocarcinoma, but little is known about its role in cancer stem-like cells (CSCs). Therefore, Rac1 activity and inhibition were examined in gastric adenocarcinoma cells and mouse xenograft models for epithelial-to-mesenchymal transition (EMT) and CSC phenotypes. Rac1 activity was significantly higher in spheroid-forming or CD44 + gastric adenocarcinoma CSCs compared with unselected cells. Rac1 inhibition using Rac1 shRNA or a Rac1 inhibitor (NSC23766) decreased expression of the self-renewal transcription factor, Sox-2, decreased spheroid formation by 78%-81%, and prevented tumor initiation in immunodeficient mice. Gastric adenocarcinoma CSCs had increased expression of the EMT transcription factor Slug, 4.4- to 8.3-fold greater migration, and 4.2- to 12.6-fold greater invasion than unselected cells, and these increases could be blocked completely with Rac1 inhibition. Gastric adenocarcinoma spheroid cells were resistant to 5-fluorouracil and cisplatin chemotherapy, and this chemotherapy resistance could be reversed with Rac1 shRNA or NSC23766. The PI3K/Akt pathway may be upstream of Rac1, and JNK may be downstream of Rac1. In the MKN-45 xenograft model, cisplatin inhibited tumor growth by 50%, Rac1 inhibition by 35%, and the combination by 77%. Higher Rac1 activity, in clinical specimens from gastric adenocarcinoma patients who underwent potentially curative surgery, correlated with significantly worse survival ( P = 0.017). In conclusion, Rac1 promotes the EMT program in gastric adenocarcinoma and the acquisition of a CSC state. Rac1 inhibition in gastric adenocarcinoma cells blocks EMT and CSC phenotypes, and thus may prevent metastasis and augment chemotherapy. Implications: In gastric adenocarcinoma, therapeutic targeting of the Rac1 pathway may prevent or reverse EMT and CSC phenotypes that drive tumor progression, metastasis, and chemotherapy resistance. Mol

  9. The anti-cancer effects of poi (Colocasia esculenta) on colonic adenocarcinoma cells In vitro.

    Science.gov (United States)

    Brown, Amy C; Reitzenstein, Jonathan E; Liu, Jessie; Jadus, Martin R

    2005-09-01

    Hawaiians tend to have lower incidence rates of colorectal cancer and it was hypothesized that this may be due to ethnic differences in diet, specifically, their consumption of poi, a starchy paste made from the taro (Colocasia esulenta L.) plant corm. Soluble extracts of poi were incubated at 100 mg/mL in vitro for antiproliferative activity against the rat YYT colon cancer cell line. (3)H-thymidine incorporation studies were conducted to demonstrate that the poi inhibited the proliferation of these cancer cells in a dose-dependent manner. The greatest suppression of YYT colon cancer growth occurred when 25% concentration was used. When poi was incubated with the YYT cells after 2 days, the YYT cells underwent apoptotic changes as evidenced by a positive terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL) stain. Poi enhanced the proliferation of normal mouse splenocyte control cells, suggesting that poi is not simply toxic to all cells but even has a positive immunostimulatory role. By flow cytometry, T cells (CD4+ and CD8+) were predominantly activated by the poi. Although numerous factors can contribute to the risk of colon cancer, perhaps poi consumption may contribute to the lower colon cancer rates among Hawaiians by two distinct mechanisms. First, by inducing apoptosis within colon cancer cells; second, by non-specifically activating lymphocytes, which in turn can lyse cancerous cells. Our results suggest for the first time that poi may have novel tumor specific anti-cancer activities and future research is suggested with animal studies and human clinical trials. Copyright 2005 John Wiley & Sons, Ltd.

  10. Significance of tumour cell HLA-G5/-G6 isoform expression in discrimination for adenocarcinoma from squamous cell carcinoma in lung cancer patients.

    Science.gov (United States)

    Yan, Wei-Hua; Liu, Di; Lu, Hai-Yan; Li, Ying-Ying; Zhang, Xia; Lin, Aifen

    2015-04-01

    Human leucocyte antigen (HLA)-G has seven isoforms, of which HLA-G1-G4 are membrane-bound and HLA-G5-G7 are soluble. Previous studies reinforced HLA-G expression was strongly related to poor prognosis in different types of cancers. Among these studies, the monoclonal antibody (mAb) 4H84 was used which detects all HLA-G isoform heavy chain; unfortunately, leaves the specific types of isoforms expressed in lesions undistinguished and its clinical significance needs to be clarified. To explore clinical significance of lesion soluble HLA-G (sHLA-G) in non-small-cell lung cancer (NSCLC), mAb 5A6G7 recognizing HLA-G5/-G6 molecules was used. Tumour cell sHLA-G expression in 131 primary NSCLC lesions (66 squamous cell carcinoma, 55 adenocarcinoma and 10 adenosquamous carcinoma) were analysed with immunohistochemistry. Data showed that sHLA-G expression was observed in 34.0% (45/131) of the NSCLC lesions, which was unrelated to patient age, sex, lymph nodal status, tumour-node-metastasis stage and patient survival. However, tumour cell sHLA-G expression in lesions was predominately observed in adenocarcinoma lesions (73.0%, 40/55) which was significantly higher than that in squamous cell carcinoma (6.0%, 4/66) and adenosquamous carcinoma lesions (10.0%, 1/10, P < 0.001). The area under the receiver operating characteristic curve for lesion sHLA-G was 0.833 (95% CI: 0.754-0.912, P < 0.001) for adenocarcinoma versus squamous cell carcinoma. Our findings for the first time showed that tumour cell sHLA-G was predominately expressed in lung adenocarcinoma, which could be a useful biomarker to discriminate adenocarcinoma from squamous cell carcinoma in NSCLC patients. © 2015 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

  11. Targeted interfering DEP domain containing 1 protein induces apoptosis in A549 lung adenocarcinoma cells through the NF-κB signaling pathway.

    Science.gov (United States)

    Wang, Qingqing; Li, Aili; Jin, Junfei; Huang, Guojin

    2017-01-01

    Ectopic expression of DEP domain containing 1 (DEPDC1) in lung adenocarcinomas is associated with poor prognosis, but its role and the underlying mechanism remain unknown. In this study, DEPDC1 expression in lung cancer cell lines was examined with Western blot assay, and DEPDC1-positive cell A549 was selected for further experiments. DEPDC1 inhibitor miR-130a was overexpressed in A549 cells, and the proliferation and apoptosis of these cells were analyzed with cell counting and flow cytometry assay. Interfering peptide 11R-DEP:611-628 and JNK inhibitor SP600125 were used alone or in combination to treat A549 cells, and the cell proliferation and apoptosis were assessed by flow cytometry assay; caspase 3 and cleaved caspase 3, phosphor-JNK, and total JNK were detected by Western blotting; and nuclear factor kappa B (NF-κB) localization was determined by immunofluorescence staining. We found that miR-130a and 11R-DEP:611-628 peptides (5 μM) both inhibited A549 proliferation and induced apoptosis. We observed that 11R-DEP:611-628 peptide treatment resulted in elevated A20 expression, dramatically reduced nuclear NF-κB, and increased phosphor-JNK. These findings indicate that DEPDC1 inhibits apoptosis of A549 cell by suppressing A20 expression to regulate NF-κB activity, and that JNK plays a protective role upon 11R-DEP:611-628 peptide treatment. In conclusion, DEPDC1 might be a novel therapeutic target for lung cancer, and the 11R-DEP:611-628 peptide is a potent apoptosis inducer in A549 cells.

  12. (Asteraceae) Fraction against Human Cancer Cell Lines

    African Journals Online (AJOL)

    Purpose: To investigate the anti-proliferative and apoptotic activity of crude and dichloromethane fraction of A. sieberi against seven cancer cell lines (Colo20, HCT116, DLD, MCF7, Jurkat, HepG2 and L929). Methods: A. sieberi was extracted with methanol and further purification was carried out using liquidliquid extraction ...

  13. Breast cancer cell lines: friend or foe?

    International Nuclear Information System (INIS)

    Burdall, Sarah E; Hanby, Andrew M; Lansdown, Mark RJ; Speirs, Valerie

    2003-01-01

    The majority of breast cancer research is conducted using established breast cancer cell lines as in vitro models. An alternative is to use cultures established from primary breast tumours. Here, we discuss the pros and cons of using both of these models in translational breast cancer research

  14. Boletus edulis ribonucleic acid - a potent apoptosis inducer in human colon adenocarcinoma cells.

    Science.gov (United States)

    Lemieszek, Marta Kinga; Ribeiro, Miguel; Guichard Alves, Helena; Marques, Guilhermina; Nunes, Fernando Milheiro; Rzeski, Wojciech

    2016-07-13

    Despite the large popularity of the Boletus edulis mushroom, little is known about its influence on human health and the possibilities of its therapeutic use. Nevertheless, several reports revealed the usefulness of biopolymers isolated from it in cancer treatment. Our previous studies have shown that B. edulis water soluble biopolymers are not toxic against normal colon epithelial cells (CCD841 CoTr) and at the same concentration range elicited a very prominent antiproliferative effect in colon cancer cells (LS180) which was accompanied with cell cycle arrest in the G0/G1 phase. The purpose of the present study was to verify the proapoptotic properties of a selected fraction from B. edulis - BE3, as well as determine its chemical nature. The BE3 fraction was extracted with hot water and purified by anion-exchange chromatography. Further chemical examinations revealed that BE3 consists mainly of ribonucleic acid (59.1%). The ability of BE3 to induce programmed cell death was examined in human colon cancer cell lines LS180 and HT-29 by measuring caspase activation, DNA fragmentation and expression of BAX, BCL2, TP53 and CDKN1A genes. The sensitivity of colon cancer cells with silenced BAX, TP53 and CDKN1A expression to BE3 treatment was also evaluated. We have demonstrated for the first time that the BE3 fraction is a potent apoptosis inducer in human colon cancer cells. The revealed mechanism of apoptosis triggering was dependent on the presence of functional p53 and consequently was a little different in investigated cell lines. Our results indicated that BE3 stimulated proapoptotic genes BAX (LS180, HT-29), TP53 (LS180) and CDKN1A (HT-29) while at the same time silenced the expression of the key prosurvival gene BCL2 (LS180, HT-29). The obtained results indicate the high therapeutic potential of the BE3 fraction against colon cancer, yet it is necessary to further confirm fraction efficacy and safety in animal and clinical studies.

  15. Crosstalk between EGFR and integrin affects invasion and proliferation of gastric cancer cell line, SGC7901

    Directory of Open Access Journals (Sweden)

    Dan L

    2012-10-01

    Full Text Available Li Dan,1,* Ding Jian,2,* Lin Na,1 Wang Xiaozhong,1 1Digestive Department, the Union Hospital of Fujian Medical University, Fujian, People’s Republic of China; 2Digestive Department, the First Affiliated Hospital of Fujian Medical University, Fuzhou, Fujian, People’s Republic of China*These authors contributed equally to this workBackground/objective: To investigate the crosstalk between epidermal growth factor receptor (EGFR and integrin-mediated signal transduction pathways in human gastric adenocarcinoma cells.Methods: EGF was used as a ligand of EGFR to stimulate the gastric adenocarcinoma cell, SGC7901. Signal molecules downstream of the integrin, FAK(Y397 and p130cas(Y410 phosphorylation, were measured by immunoprecipitation and western blot. Fibronectin (Fn was used as a ligand of integrin to stimulate the same cell line. Signal molecules downstream of EGFR and extracellular signal-regulated kinase (ERK general phosphorylation were also measured. Focal adhesion kinase (FAK small-interfering RNA was designed and transfected into SGC7901 cells to decrease the expression of FAK. Modified Boyden chambers and MTT assay were used to examine the effect of FAK inhibition on the invasiveness and proliferation of SGC7901.Results: EGF activated FAK(Y397 and p130cas(Y410 phosphorylation, while Fn activated ERK general phosphorylation. Inhibition of FAK expression decreased p130cas(Y410 phosphorylation activated by EGF and ERK general phosphorylation activated by Fn, also decreased the invasiveness and proliferation of SGC7901 cells activated by EGF or Fn.Conclusion: There is crosstalk between EGFR and integrin signal transduction. FAK may be a key cross point of the two signal pathways and acts as a potential target for human gastric cancer therapy.Keywords: gastric adenocarcinoma, epidermal growth factor receptor, integrin, focal adhesion kinase, crosstalk

  16. Enterococcus faecalis Infection and Reactive Oxygen Species Down-Regulates the miR-17-92 Cluster in Gastric Adenocarcinoma Cell Culture

    DEFF Research Database (Denmark)

    Strickertsson, Jesper A B; Rasmussen, Lene Juel; Friis-Hansen, Lennart

    2014-01-01

    of many human diseases including gastric cancer. Here we studied the impact of infection by the gram-positive bacteria Enterococcus faecalis (E. faecalis) on global miRNA expression as well as the effect of ROS on selected miRNAs. Human gastric adenocarcinoma cell line MKN74 was infected with living E....... faecalis for 24 h or for 5 days or with E. faecalis lysate for 5 days. The miRNA expression was examined by microarray analysis using Affymetrix GeneChip miRNA Arrays. To test the effect of ROS, MKN74 cells were treated with 100 mM tert-Butyl hydroperoxide (TBHP). Following 5 days of E. faecalis infection...... by living E. faecalis bacteria caused a significant global response in miRNA expression in the MKN74 cell culture. E. faecalis infection as well as ROS stimulation down-regulated the expression of the miR-17-92 cluster. We believe that these changes could reflect a general response of gastric epithelial...

  17. Clinicopathological characteristics and survival of ALK, ROS1 and RET rearrangements in non-adenocarcinoma non-small cell lung cancer patients.

    Science.gov (United States)

    Song, Zhengbo; Yu, Xinmin; Zhang, Yiping

    2017-11-02

    ALK, ROS1 and RET rearrangements represent 3 most frequent fusion genes in non-small cell lung cancer (NSCLC). Rearrangements of these 3 genes exist predominantly in lung adenocarcinoma while rarely in non-adenocarcinoma. Our objective was to explore the frequency, clinicopathological characteristics and survival of ALK, ROS1 and RET rearrangements in non-adenocarcinoma NSCLC patients. ALK, ROS1 and RET rearrangements were screened by reverse transcriptase polymerase chain reaction (RT-PCR) in patients with completely resected non-adenocarcinoma NSCLC. All positive samples were confirmed with fluorescence in situ hybridization (FISH). Survival analysis was performed with Kaplan-Meier method and log-rank for comparison. A total of 385 patients underwent complete resection, including squamous cell carcinoma (n = 245), adenosquamous carcinoma (n = 85) and large cell carcinoma (n = 55). Twelve of them were identified as harboring fusion genes, including ALK (n = 7), ROS1 (n = 3) and RET (n = 2) rearrangements. The fusion frequencies of adenosquamous, squamous cell and large cell carcinomas were 8.2%, 1.6% and 1.8% respectively. Their median age was 49.5 y and 3 of them had a smoking history. No survival difference existed between fusion gene positive and negative patients (36.7 vs.50.2 months, P = 0.21). The frequencies of ALK, ROS1 and RET rearrangements are low in non-adenocarcinoma NSCLC patients. And their clinical characteristics are similar to those in lung adenocarcinoma. Fusions of the above 3 genes are not prognostic factor for non-adnocarcinoma NSCLC patients.

  18. Difference in prognostic significance of maximum standardized uptake value on [18F]-fluoro-2-deoxyglucose positron emission tomography between adenocarcinoma and squamous cell carcinoma of the lung

    International Nuclear Information System (INIS)

    Tsutani, Yasuhiro; Miyata, Yoshihiro; Misumi, Keizo; Ikeda, Takuhiro; Mimura, Takeshi; Hihara, Jun; Okada, Morihito

    2011-01-01

    This study evaluates the prognostic significance of [18F]-fluoro-2-deoxyglucose positron emission tomography/computed tomography findings according to histological subtypes in patients with completely resected non-small cell lung cancer. We examined 176 consecutive patients who had undergone preoperative [18F]-fluoro-2-deoxyglucose-positron emission tomography/computed tomography imaging and curative surgical resection for adenocarcinoma (n=132) or squamous cell carcinoma (n=44). Maximum standardized uptake values for the primary lesions in all patients were calculated as the [18F]-fluoro-2-deoxyglucose uptake and the surgical results were analyzed. The median values of maximum standardized uptake value for the primary tumors were 2.60 in patients with adenocarcinoma and 6.95 in patients with squamous cell carcinoma (P 6.95 (P=0.83) among patients with squamous cell carcinoma, 2-year disease-free survival rates were 93.9% for maximum standardized uptake value ≤3.7 and 52.4% for maximum standardized uptake value >3.7 (P<0.0001) among those with adenocarcinoma, and notably, 100 and 57.2%, respectively, in patients with Stage I adenocarcinoma (P<0.0001). On the basis of the multivariate Cox analyses of patients with adenocarcinoma, maximum standardized uptake value (P=0.008) was a significantly independent factor for disease-free survival as well as nodal metastasis (P=0.001). Maximum standardized uptake value of the primary tumor was a powerful prognostic determinant for patients with adenocarcinoma, but not with squamous cell carcinoma of the lung. (author)

  19. Cranberry proanthocyanidins inhibit esophageal adenocarcinoma in vitro and in vivo through pleiotropic cell death induction and PI3K/AKT/mTOR inactivation

    Science.gov (United States)

    Kresty, Laura A.; Weh, Katherine M.; Zeyzus-Johns, Bree; Perez, Laura N.; Howell, Amy B.

    2015-01-01

    Cranberries are rich in bioactive constituents known to improve urinary tract health and more recent evidence supports cranberries possess cancer inhibitory properties. However, mechanisms of cancer inhibition by cranberries remain to be elucidated, particularly in vivo. Properties of a purified cranberry-derived proanthocyanidin extract (C-PAC) were investigated utilizing acid-sensitive and acid-resistant human esophageal adenocarcinoma (EAC) cell lines and esophageal tumor xenografts in athymic NU/NU mice. C-PAC induced caspase-independent cell death mainly via autophagy and low levels of apoptosis in acid-sensitive JHAD1 and OE33 cells, but resulted in cellular necrosis in acid-resistant OE19 cells. Similarly, C-PAC induced necrosis in JHAD1 cells pushed to acid-resistance via repeated exposures to an acidified bile cocktail. C-PAC associated cell death involved PI3K/AKT/mTOR inactivation, pro-apoptotic protein induction (BAX, BAK1, deamidated BCL-xL, Cytochrome C, PARP), modulation of MAPKs (P-P38/P-JNK) and G2-M cell cycle arrest in vitro. Importantly, oral delivery of C-PAC significantly inhibited OE19 tumor xenograft growth via modulation of AKT/mTOR/MAPK signaling and induction of the autophagic form of LC3B supporting in vivo efficacy against EAC for the first time. C-PAC is a potent inducer of EAC cell death and is efficacious in vivo at non-toxic behaviorally achievable concentrations, holding promise for preventive or therapeutic interventions in cohorts at increased risk for EAC, a rapidly rising and extremely deadly malignancy. PMID:26378019

  20. Recombinant Newcastle disease virus rL-RVG enhances the apoptosis and inhibits the migration of A549 lung adenocarcinoma cells via regulating alpha 7 nicotinic acetylcholine receptors in vitro.

    Science.gov (United States)

    Yan, Yulan; Su, Chunxiang; Hang, Min; Huang, Hua; Zhao, Yinghai; Shao, Xiaomei; Bu, Xuefeng

    2017-10-03

    The aim of this study were to investigate the possible pro-apoptotic mechanisms of the recombinant Newcastle disease virus (NDV) strain rL-RVG, which expresses the rabies virus glycoprotein, in A549 lung adenocarcinoma cells via the regulation of alpha 7 nicotinic acetylcholine receptors (α7 nAChRs) and to analyze the relationships between α7 nAChR expression in lung cancer and the clinical pathological features. α7 nAChR expression in A549, LΑ795, and small-cell lung carcinoma (SCLC) cells, among others, was detected using reverse transcription polymerase chain reaction (RT-PCR). The optimal α7 nAChR antagonist and agonist concentrations for affecting A549 lung adenocarcinoma cells were detected using MTT assays. The α7 nAChR expression in A549 cells after various treatments was assessed by Western blot, immunofluorescence and RT-PCR analyses. Apoptosis in the various groups was also monitored by Western blot and TUNEL assays, followed by the detection of cell migration via transwell and scratch tests. Furthermore, α7 nAChR expression was examined by immunohistochemistry in lung cancer tissue samples from 130 patients and 40 pericancerous tissue samples, and the apoptotis in lung adenocarcinoma tissue was detected by Tunel assay, Then, the expression levels and clinicopathological characteristics were analyzed. Of the A549, LΑ795, SCLC and U251 cell lines, the A549 cells exhibited the highest α7 nAChR expression. The cells infected with rL-RVG exhibited high RVG gene and protein expression. The rL-RVG group exhibited weaker α7 nAChR expression compared with the methyllycaconitine citrate hydrate (MLA, an α7 nAChR antagonist) and NDV groups. At the same time, the MLA and rL-RVG treatments significantly inhibited proliferation and migration and promoted apoptosis in the lung cancer cells (P A549 lung adenocarcinoma cells by regulating α7 nAChR signaling pathways.

  1. Enhanced caveolin-1 expression increases migration, anchorage-independent growth and invasion of endometrial adenocarcinoma cells

    International Nuclear Information System (INIS)

    Diaz-Valdivia, Natalia; Bravo, Denisse; Huerta, Hernán; Henriquez, Soledad; Gabler, Fernando; Vega, Margarita; Romero, Carmen; Calderon, Claudia; Owen, Gareth I.; Leyton, Lisette; Quest, Andrew F. G.

    2015-01-01

    Caveolin-1 (CAV1) has been implicated both in tumor suppression and progression, whereby the specific role appears to be context dependent. Endometrial cancer is one of the most common malignancies of the female genital tract; however, little is known about the role of CAV1 in this disease. Here, we first determined by immunohistochemistry CAV1 protein levels in normal proliferative human endometrium and endometrial tumor samples. Then using two endometrial cancer cell lines (ECC: Ishikawa and Hec-1A) we evaluated mRNA and protein levels of CAV1 by real time qPCR and Western blot analysis, respectively. The role of CAV1 expression in ECC malignancy was further studied by either inducing its expression in endometrial cancer cells with the tumor promotor 12-O-tetradecanoyl-phorbol-13-acetate (4β-TPA) or decreasing expression using short-hairpin RNA constructs, and then evaluating the effects of these changes on ECC proliferation, transmigration, matrigel invasion, and colony formation in soft agar. Immunohistochemical analysis of endometrial epithelia revealed that substantially higher levels of CAV1 were present in endometrial tumors than the normal proliferative epithelium. Also, in Ishikawa and Hec-1A endometrial cancer cells CAV1 expression was readily detectable. Upon treatment with 4β-TPA CAV1 levels increased and coincided with augmented cell transmigration, matrigel invasion, as well as colony formation in soft agar. Reduction of CAV1 expression using short-hairpin RNA constructs ablated these effects in both cell types whether treated or not with 4β-TPA. Alternatively, CAV1 expression appeared not to modulate significantly proliferation of these cells. Our study shows that elevated CAV1, observed in patients with endometrial cancer, is linked to enhanced malignancy of endometrial cancer cells, as evidenced by increased migration, invasion and anchorage-independent growth. The online version of this article (doi:10.1186/s12885-015-1477-5) contains

  2. The P2X7 receptor regulates cell survival, migration and invasion of pancreatic ductal adenocarcinoma cells

    DEFF Research Database (Denmark)

    Giannuzzo, Andrea; Pedersen, Stine Helene Falsig; Novak, Ivana

    2015-01-01

    of the ATP receptors, the P2X7 receptor (P2X7R) could be an important player in PDAC behaviour. METHODS: We determined the expression (real time PCR and Western blot) and localization (immunofluorescence) of P2X7R in human PDAC cell lines (AsPC-1, BxPC-3, Capan-1, MiaPaCa-2, Panc-1) and a "normal" human...... pancreatic duct epithelial cell line (HPDE). The function of P2X7R in proliferation (BrdU assay), migration (wound assay) and invasion (Boyden chamber with matrigel) was characterized. Furthermore, we studied P2X7R-dependent pore formation (YoPro-1 assay) and cell death (caspase and annexin V / propidium...... iodide assays). RESULTS: We found higher expression of P2X7R protein in PDAC compared to HPDE cells. P2X7R had notable disparate effects on PDAC survival. Firstly, high concentrations of ATP or the specific P2X7R agonist, BzATP, had cytotoxic effects in all cell lines, and cell death was mediated...

  3. Quantitative Tyrosine Phosphoproteomics of Epidermal Growth Factor Receptor (EGFR) Tyrosine Kinase Inhibitor-treated Lung Adenocarcinoma Cells Reveals Potential Novel Biomarkers of Therapeutic Response.

    Science.gov (United States)

    Zhang, Xu; Maity, Tapan; Kashyap, Manoj K; Bansal, Mukesh; Venugopalan, Abhilash; Singh, Sahib; Awasthi, Shivangi; Marimuthu, Arivusudar; Charles Jacob, Harrys Kishore; Belkina, Natalya; Pitts, Stephanie; Cultraro, Constance M; Gao, Shaojian; Kirkali, Guldal; Biswas, Romi; Chaerkady, Raghothama; Califano, Andrea; Pandey, Akhilesh; Guha, Udayan

    2017-05-01

    Mutations in the Epidermal growth factor receptor (EGFR) kinase domain, such as the L858R missense mutation and deletions spanning the conserved sequence 747 LREA 750 , are sensitive to tyrosine kinase inhibitors (TKIs). The gatekeeper site residue mutation, T790M accounts for around 60% of acquired resistance to EGFR TKIs. The first generation EGFR TKIs, erlotinib and gefitinib, and the second generation inhibitor, afatinib are FDA approved for initial treatment of EGFR mutated lung adenocarcinoma. The predominant biomarker of EGFR TKI responsiveness is the presence of EGFR TKI-sensitizing mutations. However, 30-40% of patients with EGFR mutations exhibit primary resistance to these TKIs, underscoring the unmet need of identifying additional biomarkers of treatment response. Here, we sought to characterize the dynamics of tyrosine phosphorylation upon EGFR TKI treatment of mutant EGFR-driven human lung adenocarcinoma cell lines with varying sensitivity to EGFR TKIs, erlotinib and afatinib. We employed stable isotope labeling with amino acids in cell culture (SILAC)-based quantitative mass spectrometry to identify and quantify tyrosine phosphorylated peptides. The proportion of tyrosine phosphorylated sites that had reduced phosphorylation upon erlotinib or afatinib treatment correlated with the degree of TKI-sensitivity. Afatinib, an irreversible EGFR TKI, more effectively inhibited tyrosine phosphorylation of a majority of the substrates. The phosphosites with phosphorylation SILAC ratios that correlated with the TKI-sensitivity of the cell lines include sites on kinases, such as EGFR-Y1197 and MAPK7-Y221, and adaptor proteins, such as SHC1-Y349/350, ERRFI1-Y394, GAB1-Y689, STAT5A-Y694, DLG3-Y705, and DAPP1-Y139, suggesting these are potential biomarkers of TKI sensitivity. DAPP1, is a novel target of mutant EGFR signaling and Y-139 is the major site of DAPP1 tyrosine phosphorylation. We also uncovered several off-target effects of these TKIs, such as MST1R-Y1238

  4. Autonomous inhibition of apoptosis correlates with responsiveness of colon carcinoma cell lines to ciglitazone.

    Directory of Open Access Journals (Sweden)

    David M Baron

    Full Text Available Colorectal cancer is a leading cause of mortality worldwide. Resistance to therapy is common and often results in patients succumbing to the disease. The mechanisms of resistance are poorly understood. Cells basically have two possibilities to survive a treatment with potentially apoptosis-inducing substances. They can make use of their existing proteins to counteract the induced reactions or quickly upregulate protective factors to evade the apoptotic signal. To identify protein patterns involved in resistance to apoptosis, we studied two colorectal adenocarcinoma cell lines with different growth responses to low-molar concentrations of the thiazolidinedione Ciglitazone: HT29 cells underwent apoptosis, whereas SW480 cells increased cell number. Fluorescence detection and autoradiography scans of 2D-PAGE gels were performed in both cell lines to assess protein synthesis and turnover, respectively. To verify the data we performed shotgun analysis using the same treatment procedure as in 2D-experiments. Biological functions of the identified proteins were mainly associated with apoptosis regulation, chaperoning, intrinsic inflammation, and DNA repair. The present study suggests that different growth response of two colorectal carcinoma cell lines after treatment with Ciglitazone results from cell-specific protein synthesis and differences in protein regulation.

  5. Characterization and significance of ACE2 and Mas receptor in human colon adenocarcinoma.

    Science.gov (United States)

    Bernardi, Stella; Zennaro, Cristina; Palmisano, Silvia; Velkoska, Elena; Sabato, Nicoletta; Toffoli, Barbara; Giacomel, Greta; Buri, Luigi; Zanconati, Fabrizio; Bellini, Giuseppe; Burrell, Louise M; De Manzini, Nicolò; Fabris, Bruno

    2012-03-01

    A new arm of the renin-angiotensin system (RAS) has been recently characterized; this includes angiotensin converting enzyme (ACE)2 and angiotensin (Ang)1-7, a heptapeptide acting through the Mas receptor (MasR). Recent studies show that Ang1-7 has an antiproliferative action on lung adenocarcinoma cells. The aim of this study was to characterize RAS expression in human colon adenocarcinoma and to investigate whether Ang1-7 exerts an antiproliferative effect on human colon adenocarcinoma cells. Gene, protein expression and enzymatic activity of the main components of the RAS were determined on non-neoplastic colon mucosa as well as on the tumor mass and the mucosa taken 5 cm distant from it, both collected from patients with colon adenocarcinoma. Two different human colon cancer cell lines were treated with AngII and Ang1-7. The novel finding of this study was that MasR was significantly upregulated in colon adenocarcinoma compared with non-neoplastic colon mucosa, which showed little or no expression of it. ACE gene expression and enzymatic activity were also increased in the tumors. However, AngII and Ang1-7 did not have any pro-/antiproliferative effects in the cell lines studied. The data suggest that upregulation of the MasR could be used as a diagnostic marker of colon adenocarcinoma.

  6. Mitochondrial-dependent anticancer activity of δ-tocotrienol and its synthetic derivatives in HER-2/neu overexpressing breast adenocarcinoma cells.

    Science.gov (United States)

    Viola, Valentina; Ciffolilli, Silvia; Legnaioli, Silvia; Piroddi, Marta; Betti, Michele; Mazzini, Francesco; Pierpaoli, Elisa; Provinciali, Mauro; Galli, Francesco

    2013-01-01

    Anticancer activity and mitochondrial mechanism of the vitamin E form δ-tocotrienol (δ-T3) was investigated in HER-2/neu-overexpressing human SKBR3 and murine TUBO breast cancer cells. δ-T3 was confirmed to possess high cytotoxic and apoptotic activity in SKBR3 cells as compared with all natural forms of vitamin E and several synthetic forms that included novel derivatives with the same backbone of δ-T3 such as δ-tocotrienyl-succinyl amide (δ-T3AS) and the redox-active analogue δ-tocotrienyl amine (δ-T3NH2). As observed in the case of alpha-TOS, a prototypical anticancer drug derived from α-tocopherol, succinylation of δ-T3 enhanced citotoxicity and apoptotic activity of the vitamer. δ-T3 induced apoptosis of SKBR3 cells was associated with mitochondrial destabilization, energy failure, and unbalanced activity of stress/survival MAPKs, namely p38 and ERK1/2 pathways. An increased generation of ROS followed to such a series of early events. Enhanced activity of δ-T3 in this human carcinoma cell line was characterized by the sustained uptake and oxidative transformation to the quinone derivative δ-T3Q, thereby suggesting redox effects in SKBR3 mitochondria by this vitamer. Viability and uptake data show a different pattern of responses in TUBO cells with higher response to synthetic derivatives of δ-T3 than in SKBR3 cells. In conclusion, synthetic derivatives of δ-T3 with enhanced apoptotic activity in breast carcinoma cells are investigated for the first time in this study also describing mechanistic aspects of mitochondrial effects of δ-T3. Further investigation in preclinical models of HER2/neu-high breast adenocarcinoma is underway to identify other and more effective forms of VE in this type of cancer. Copyright © 2013 International Union of Biochemistry and Molecular Biology, Inc.

  7. Antitumor effects of the flavone chalcone: inhibition of invasion and migration through the FAK/JNK signaling pathway in human gastric adenocarcinoma AGS cells.

    Science.gov (United States)

    Lin, Su-Hsuan; Shih, Yuan-Wei

    2014-06-01

    Chalcones (benzylideneacetophenone) are cancer-preventive food components found in a human diet rich in fruits and vegetables. In this study, we first report the chemopreventive effect of chalcone in human gastric adenocarcinoma cell lines: AGS. The results showed that chalcone could inhibit the abilities of the adhesion, invasion, and migration by cell-matrix adhesion assay, Boyden chamber invasion/migration assay, and wound-healing assay. Molecular data showed that the effect of chalcone in AGS cells might be mediated via sustained inactivation of the phosphorylation of focal adhesion kinase (FAK) and c-Jun N-terminal kinase 1 and 2 (JNK1/2) signal involved in the downregulation of the expressions of matrix metalloproteinase-2 (MMP-2) and matrix metalloproteinase-9 (MMP-9). Next, chalcone-treated AGS cells showed tremendous decrease in the phosphorylation and degradation of inhibitor of kappaBα (IκBα), the nuclear level of NF-κB, and the binding ability of NF-κB to NF-κB response element. Furthermore, treating FAK small interfering RNA (FAK siRNA) and specific inhibitor for JNK (SP600125) to AGS cells could reduce the phosphorylation of JNK1/2 and the activity of MMP-2 and MMP-9. Our results revealed that chalcone significantly inhibited the metastatic ability of AGS cells by reducing MMP-2 and MMP-9 expressions concomitantly with a marked reduction on cell invasion and migration through suppressing and JNK signaling pathways. We suggest that chalcone may offer the application in clinical medicine.

  8. Circulating blocking factors of lymphoid-cell cytotoxicity in x-ray-induced rat small-bowel adenocarcinoma

    International Nuclear Information System (INIS)

    Stevens, R.H.; Brooks, G.P.; Osborne, J.W.

    1979-01-01

    Circulating blocking factors capable of abrogating cell-mediated immune responses measured by in vitro lymphoid-cell cytotoxicity were identified in the sera of Holtzman outbred rats 6 to 9 months after a single exposure of only the temporarily exteriorized, hypoxic ileum and jejunum to 1700 to 2000 R of X radiation. Such factors were found to exist in the serum of every animal exposed to the ionizing radiation regardless of whether a visibly identifiable small-bowel adenocarcinoma existed or subsequently would develop. Protection of cultured x-ray-induced rat small-bowel cancer cells from destruction by tumor-sensitized lymphoid cells as measured by the release of lactoperoxidase-catalyzed radioiodinated membrane proteins from the tumor target cells was conferred by the action of the blocking factors at both effector and target cell levels. The results of this study demonstrate that exposure of only the rat small intestine to ionizing radiation leads to elaboration of circulating factors identifiable several months postirradiation which will block cell-mediated immune responses directed against cancer cells developing in the exposed tissue

  9. Transcription of a novel mouse semaphorin gene, M-semaH, correlates with the metastatic ability of mouse tumor cell lines

    DEFF Research Database (Denmark)

    Christensen, C R; Klingelhöfer, Jörg; Tarabykina, S

    1998-01-01

    In the attempt to identify genes associated with metastasis, we have compared gene expressions of two metastatic cell lines, 4T1 and 66cl4, and one noninvasive, nonmetastatic cell line, 67NR, which originate from the same mouse mammary adenocarcinoma. Using the technique of differential display, we...... identified a novel member of the semaphorin/collapsin family in the two metastatic cell lines. We have named it M-semaH. Northern hybridization to a panel of tumor cell lines revealed transcripts in 12 of 12 metastatic cell lines but in only 2 of 6 nonmetastatic cells and none in immortalized mouse...... fibroblasts. To our knowledge, this is the first time that the expression of a semaphorin gene has been shown to correlate positively with tumor progression. We have characterized two transcripts present in the tumor cells. One transcript, M-semaH-v, is a putative splice variant, which is less abundant...

  10. Bentonite modified with zinc enhances aflatoxin B1 adsorption and increase survival of fibroblasts (3T3) and epithelial colorectal adenocarcinoma cells (Caco-2).

    Science.gov (United States)

    Nones, Janaína; Solhaug, Anita; Eriksen, Gunnar Sundstøl; Macuvele, Domingos Lusitâneo Pier; Poli, Anicleto; Soares, Cíntia; Trentin, Andrea Gonçalves; Riella, Humberto Gracher; Nones, Jader

    2017-09-05

    Bentonites are commonly used as feed additives to reduce the bioavailability and thus the toxicity of aflatoxins by adsorbing the toxins in the gastrointestinal tract. Aflatoxins are particular harmful mycotoxins mainly found in areas with hot and humid climates. They occur in food and feedstuff as a result of fungal contamination before and after harvest. The aim of this study was to modify Brazilian bentonite clay by incorporation of zinc (Zn) ions in order to increase the adsorption capacity and consequently reduce the toxicity of aflatoxins. The significance of Zn intercalating conditions such as concentration, temperature and reaction time were investigated. Our results showed that the Zn treatment of the bentonite increased the aflatoxin B 1 (AFB 1 ) adsorption and that Zn concentration had a negative effect. Indeed, temperature and time had no significant effect in the binding capacity. The modified bentonite (Zn-Bent1) was not cytotoxic to either fibroblasts (3T3) nor epithelial colorectal adenocarcinoma cells (Caco-2) cell lines. Interestingly, Zn-Bent1 has higher protective effect against AFB 1 induced cytotoxicity than the unmodified bentonite. In conclusion, the Zn modified bentonite, Zn-Bent1, represent an improved tool to prevent aflatoxicosis in animals fed on AFB 1 contaminated feed. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Mesenchymal stem cells promote cell invasion and migration and autophagy-induced epithelial-mesenchymal transition in A549 lung adenocarcinoma cells.

    Science.gov (United States)

    Luo, Dan; Hu, Shiyuan; Tang, Chunlan; Liu, Guoxiang

    2018-03-01

    Mesenchymal stem cells (MSCs) are recruited into the tumour microenvironment and promote tumour growth and metastasis. Tumour microenvironment-induced autophagy is considered to suppress primary tumour formation by impairing migration and invasion. Whether these recruited MSCs regulate tumour autophagy and whether autophagy affects tumour growth are controversial. Our data showed that MSCs promote autophagy activation, reactive oxygen species production, and epithelial-mesenchymal transition (EMT) as well as increased migration and invasion in A549 cells. Decreased expression of E-cadherin and increased expression of vimentin and Snail were observed in A549 cells cocultured with MSCs. Conversely, MSC coculture-mediated autophagy positively promoted tumour EMT. Autophagy inhibition suppressed MSC coculture-mediated EMT and reduced A549 cell migration and invasion slightly. Furthermore, the migratory and invasive abilities of A549 cells were additional increased when autophagy was further enhanced by rapamycin treatment. Taken together, this work suggests that microenvironments containing MSCs can promote autophagy activation for enhancing EMT; MSCs also increase the migratory and invasive abilities of A549 lung adenocarcinoma cells. Mesenchymal stem cell-containing microenvironments and MSC-induced autophagy signalling may be potential targets for blocking lung cancer cell migration and invasion. Copyright © 2018 John Wiley & Sons, Ltd.

  12. MicroRNA-323-3p inhibits cell invasion and metastasis in pancreatic ductal adenocarcinoma via direct suppression of SMAD2 and SMAD3

    Science.gov (United States)

    Wu, Heshui; Cui, Pengfei; Li, Yongfeng; Liu, Yao; Liu, Zhiqiang; Gou, Shanmiao

    2016-01-01

    Pancreatic ductal adenocarcinoma (PDAC), which accounts for 96% of all pancreatic cancer cases, is characterized by rapid progression, invasion and metastasis. Transforming growth factor-beta (TGF-β) signaling is an essential pathway in metastatic progression and microRNAs (miRNA) play central roles in the regulation of various biological and pathologic processes including cancer metastasis. However, the molecular mechanisms involved in regulation of miRNAs and activation of TGF-β signaling in PDAC remain to be established. The results of this study suggested that miR-323-3p expression in PDAC tissues and cell lines was significantly decreased compared to levels in normal pancreatic tissues and primary cultured pancreatic duct epithelial cells. Further investigation revealed that miR-323-3p directly targeted and suppressed SMAD2 and SMAD3, both key components in TGF-β signaling. Lower levels of miR-323-3p predicted poorer prognosis in patients with PDAC. Ectopic overexpression of miR-323-3p significantly inhibited, while silencing of miR-323-3p increased the migration and invasion abilities of PDAC cells in vitro. Moreover, using an in vivo mouse model, we demonstrated that overexpressing of miR-323-3p significantly reduced, while knockdown of miR-323-3p enhanced lung metastatic colonization of PANC-1 cells. Furthermore, miR-323-3p-induced TGF-b signaling inhibition and cell motility suppression were partially rescued by overexpressing of Smad2 and Smad3 in PDAC cells. Our findings suggest that re-expression of miR-323-3p might offer a novel therapeutic target against metastasis in patients with PDAC. PMID:26908446

  13. Methanolic Extracts from Brown Seaweeds Dictyota cilliolata and Dictyota menstrualis Induce Apoptosis in Human Cervical Adenocarcinoma HeLa Cells

    Directory of Open Access Journals (Sweden)

    Dayanne Lopes Gomes

    2015-04-01

    Full Text Available Carcinoma of the uterine cervix is the second most common female tumor worldwide, surpassed only by breast cancer. Natural products from seaweeds evidencing apoptotic activity have attracted a great deal of attention as new leads for alternative and complementary preventive or therapeutic anticancer agents. Here, methanol extracts from 13 species of tropical seaweeds (Rhodophytas, Phaeophyta and Chlorophyta collected from the Northeast of Brazil were assessed as apoptosis-inducing agents on human cervical adenocarcinoma (HeLa. All extracts showed different levels of cytotoxicity against HeLa cells; the most potent were obtained from the brown alga Dictyota cilliolata (MEDC and Dictyota menstrualis (MEDM. In addition, MEDC and MEDM also inhibits SiHa (cervix carcinoma cell proliferation. Studies with these two extracts using flow cytometry and fluorescence microscopy showed that HeLa cells exposed to MEDM and MEDC exhibit morphological and biochemical changes that characterize apoptosis as shown by loss of cell viability, chromatin condensation, phosphatidylserine externalization, and sub-G1 cell cycle phase accumulation, also MEDC induces cell cycle arrest in cell cycle phase S. Moreover, the activation of caspases 3 and 9 by these extracts suggests a mitochondria-dependent apoptosis route. However, other routes cannot be ruled out. Together, these results point out the methanol extracts of the brown algae D. mentrualis and D. cilliolata as potential sources of molecules with antitumor activity.

  14. Effects of X-ray irradiation on expression of Pokemon gene in A549 cells of human lung adenocarcinoma

    International Nuclear Information System (INIS)

    Wang Lu; Zou Yue; Jiang Qisheng; Li Wei; Song Xiujun; Zhou Xiangyan; Wang Cuilan

    2011-01-01

    Objective: To study the dose-and time-effects of X-ray irradiation on the expression of Pokemon gene in A549 cells of human lung adenocarcinoma. Methods: A549 cells were cultured in vitro and exposed to X-rays with the doses of 2, 4, 6 and 8 Gy, respectively. Untreated A549 cells were used as control group. The relative levels of Pokemon mRNA expression in the cells were detected by using quantitative real-time PCR at 2, 4, 8, 12, 24, 48 and 72 h after irradiation. Results: The Pokemon mRNA expression levels decreased in the early period after irradiation (except 2 and 4 h after irradiation in 2 Gy group) and then increased in the later stage (48 h after irradiation) with significant statistical differences at the most time points in comparison with the control group (t=3.40-154.76, P<0.05). Conclusions: Higher doses of X-rays may degrade the expression of Pokemon mRNA in the human A549 cells and induce apoptosis in the early period, hut also may upgrade its expression in the later period, which might be correlated with the cell cycle regulation and DNA damage repair in the A549 cells. (authors)

  15. Phytol isolated from watermelon (Citrullus lanatus) sprouts induces cell death in human T-lymphoid cell line Jurkat cells via S-phase cell cycle arrest.

    Science.gov (United States)

    Itoh, Tomohiro; Ono, Akito; Kawaguchi, Kaori; Teraoka, Sayaka; Harada, Mayo; Sumi, Keitaro; Ando, Masashi; Tsukamasa, Yasuyuki; Ninomiya, Masayuki; Koketsu, Mamoru; Hashizume, Toshiharu

    2018-05-01

    The phytol isolated from watermelon (Citrullus lanatus) sprouts inhibited the growth of a human T-cell leukemia line Jurkat cell and suppressed tumor progression in a xenograft model of human lung adenocarcinoma epithelial cell line A549 in nude mice. To elucidate the mechanisms underlying the phytol-induced cell death in the present study, we examined the changes in cell morphology, DNA fragmentation, and intracellular reactive oxygen species (ROS) levels and performed flow cytometric analysis to evaluate cell cycle stage. There were no significant changes in apoptosis, autophagy, and necrosis marker in cells treated with the phytol. But, we found, for the first time, that phytol remarkably induced S-phase cell cycle arrest accompanied with intracellular ROS production. Western blot analyses showed that phytolinduced S-phase cell cycle arrest was mediated through the decreased expression of cyclins A and D and the downregulations of MAPK and PI3K/Akt. The tumor volume levels in mice treated with phytol were lower than those of non-treatment groups, and it showed very similar suppression compared with those of mice treated with cyclophosphamide. Based on the data of in vitro and in vivo studies and previous studies, we suggest phytol as a potential therapeutic compound for cancer. Copyright © 2018 Elsevier Ltd. All rights reserved.

  16. Diatom-derived polyunsaturated aldehydes activate cell death in human cancer cell lines but not normal cells.

    Directory of Open Access Journals (Sweden)

    Clementina Sansone

    Full Text Available Diatoms are an important class of unicellular algae that produce bioactive polyunsaturated aldehydes (PUAs that induce abortions or malformations in the offspring of invertebrates exposed to them during gestation. Here we compare the effects of the PUAs 2-trans,4-trans-decadienal (DD, 2-trans,4-trans-octadienal (OD and 2-trans,4-trans-heptadienal (HD on the adenocarcinoma cell lines lung A549 and colon COLO 205, and the normal lung/brunch epithelial BEAS-2B cell line. Using the viability MTT/Trypan blue assays, we show that PUAs have a toxic effect on both A549 and COLO 205 tumor cells but not BEAS-2B normal cells. DD was the strongest of the three PUAs tested, at all time-intervals considered, but HD was as strong as DD after 48 h. OD was the least active of the three PUAs. The effect of the three PUAs was somewhat stronger for A549 cells. We therefore studied the death signaling pathway activated in A549 showing that cells treated with DD activated Tumor Necrosis Factor Receptor 1 (TNFR1 and Fas Associated Death Domain (FADD leading to necroptosis via caspase-3 without activating the survival pathway Receptor-Interacting Protein (RIP. The TNFR1/FADD/caspase pathway was also observed with OD, but only after 48 h. This was the only PUA that activated RIP, consistent with the finding that OD causes less damage to the cell compared to DD and HD. In contrast, cells treated with HD activated the Fas/FADD/caspase pathway. This is the first report that PUAs activate an extrinsic apoptotic machinery in contrast to other anticancer drugs that promote an intrinsic death pathway, without affecting the viability of normal cells from the same tissue type. These findings have interesting implications also from the ecological viewpoint considering that HD is one of the most common PUAs produced by diatoms.

  17. A Case of Synchronous Lung Adenocarcinoma and Extranodal Marginal Zone B-Cell Lymphoma of Mucosa-Associated Lymphoid Tissue (MALT) Type.

    Science.gov (United States)

    Jung, Chi Young; Kwon, Kun Young

    2012-07-01

    Extranodal marginal zone B-cell lymphoma of mucosa-associated lymphoid tissue type (extranodal MZL) is a distinct subgroup of non-Hodgkin's lymphoma. Pulmonary extranodal MZL is a rare entity and accounts for less than 0.5% of primary pulmonary malignancies. Only a few cases of simultaneous occurrence of lung cancer and pulmonary extranodal MZL have been reported. A 60-year-old woman was referred to our hospital with a pulmonary nodule. She was diagnosed with lung adenocarcinoma by percutaneous needle biopsy. The protrusions into the left main bronchus were found by accident while performing bronchoscopy during lung cancer evaluation. The bronchial lesions were diagnosed as extranodal MZL. Although the patient underwent surgical resection for the lung adenocarcinoma, the pulmonary extranodal MZL was left untreated; it was monitored during follow-up visits. To our knowledge, this is the first report of synchronous lung adenocarcinoma and primary extranodal MZL of the main bronchus.

  18. Short-Chain Fatty Acids Stimulate Angiopoietin-Like 4 Synthesis in Human Colon Adenocarcinoma Cells by Activating Peroxisome Proliferator-Activated Receptor γ

    DEFF Research Database (Denmark)

    Alex, Sheril; Lange, Katja; Amolo, Tom

    2013-01-01

    with the notion that fermentation leads to PPAR activation in vivo, feeding mice a diet rich in inulin induced PPAR target genes and pathways in the colon. We conclude that (i) SCFA potently stimulate ANGPTL4 synthesis in human colon adenocarcinoma cells and (ii) SCFA transactivate and bind to PPARγ. Our data...

  19. Cellular radiosensitivity of small-cell lung cancer cell lines

    DEFF Research Database (Denmark)

    Krarup, M; Poulsen, H S; Spang-Thomsen, M

    1997-01-01

    PURPOSE: The objective of this study was to determine the radiobiological characteristics of a panel of small-cell lung cancer (SCLC) cell lines by use of a clonogenic assay. In addition, we tested whether comparable results could be obtained by employing a growth extrapolation method based...

  20. ESOPHAGEAL CARCINOMA: IS SQUAMOUS CELL CARCINOMA DIFFERENT DISEASE COMPARED TO ADENOCARCINOMA? A transversal study in a quaternary high volume hospital in Brazil

    Directory of Open Access Journals (Sweden)

    Francisco TUSTUMI

    Full Text Available ABSTRACT Background Esophageal cancer is one of the leading causes of mortality among the neoplasms that affect the gastrointestinal tract. There are several factors that contribute for development of an epidemiological esophageal cancer profile in a population. Objective This study aims to describe both clinically and epidemiologically the population of patients with diagnosis of esophageal cancer treated in a quaternary attention institute for cancer from January, 2009 to December, 2011, in Sao Paulo, Brazil. Methods The charts of all patients diagnosed with esophageal cancer from January, 2009, to December, 2011, in a Sao Paulo (Brazil quaternary oncology institute were retrospectively reviewed. Results Squamous cell cancer made up to 80% of the cases of esophageal cancer. Average age at diagnosis was 60.66 years old for esophageal adenocarcinoma and 62 for squamous cell cancer, average time from the beginning of symptoms to the diagnosis was 3.52 months for esophageal adenocarcinoma and 4.2 months for squamous cell cancer. Average time for initiating treatment when esophageal cancer is diagnosed was 4 months for esophageal adenocarcinoma and 4.42 months for squamous cell cancer. There was a clear association between squamous cell cancer and head and neck cancers, as well as certain habits, such as smoking and alcoholism, while adenocarcinoma cancer showed more association with gastric cancer and gastroesophageal reflux disease. Tumoral bleeding and pneumonia were the main causes of death. No difference in survival rate was noted between the two groups. Conclusion Adenocarcinoma and squamous cell carcinoma are different diseases, but both are diagnosed in advanced stages in Brazil, compromising the patients' possibilities of cure.

  1. Cellular radiosensitivity of small-cell lung cancer cell lines

    DEFF Research Database (Denmark)

    Krarup, M; Poulsen, H S; Spang-Thomsen, M

    1997-01-01

    PURPOSE: The objective of this study was to determine the radiobiological characteristics of a panel of small-cell lung cancer (SCLC) cell lines by use of a clonogenic assay. In addition, we tested whether comparable results could be obtained by employing a growth extrapolation method based...... on the construction of continuous exponential growth curves. METHODS AND MATERIALS: Fifteen SCLC cell lines were studied, applying a slightly modified clonogenic assay and a growth extrapolation method. A dose-survival curve was obtained for each experiment and used for calculating several survival parameters...... to calculate the surviving fraction after 2-Gy irradiation (SF2). RESULTS: In our investigation, the extrapolation method proved to be inappropriate for the study of in vitro cellular radiosensitivity due to lack of reproducibility. The results obtained by the clonogenic assay showed that the cell lines...

  2. Pancreatic ductal adenocarcinoma in hereditary diffuse gastric cancer. A case report

    NARCIS (Netherlands)

    Ottenhof, Niki A.; de Wilde, Roeland F.; Morsink, Folkert H. M.; de Leng, Wendy W. J.; Ausems, Margreet G. E. M.; Morreau, Hans; van Hillegersberg, Richard; Offerhaus, G. Johan A.; Milne, Anya N.

    2012-01-01

    Hereditary diffuse gastric cancer is an autosomal dominant cancer syndrome characterized by highly penetrant diffuse gastric cancer. It is caused by germ line mutations in CDHI, encoding the cell-cell adhesion protein E-cadherin. Pancreatic ductal adenocarcinoma is one of the most dismal

  3. The role of the obestatin/GPR39 system in human gastric adenocarcinomas.

    Science.gov (United States)

    Alén, Begoña O; Leal-López, Saúl; Alén, María Otero; Viaño, Patricia; García-Castro, Victoria; Mosteiro, Carlos S; Beiras, Andrés; Casanueva, Felipe F; Gallego, Rosalía; García-Caballero, Tomás; Camiña, Jesús P; Pazos, Yolanda

    2016-02-02

    Obestatin, a 23-amino acid peptide encoded by the ghrelin gene, and the GPR39 receptor were reported to be involved in the control of mitogenesis of gastric cancer cell lines; however, the relationship between the obestatin/GPR39 system and gastric cancer progression remains unknown. In the present study, we determined the expression levels of the obestatin/GPR39 system in human gastric adenocarcinomas and explored their potential functional roles. Twenty-eight patients with gastric adenocarcinomas were retrospectively studied, and clinical data were obtained. The role of obestatin/GPR39 in gastric cancer progression was studied in vitro using the human gastric adenocarcinoma AGS cell line. Obestatin exogenous administration in these GPR39-bearing cells deregulated the expression of several hallmarks of the epithelial-mesenchymal transition (EMT) and angiogenesis. Moreover, obestatin signaling promoted phenotypic changes via GPR39, increasingly impacting on the cell morphology, proliferation, migration and invasion of these cells. In healthy human stomachs, obestatin expression was observed in the neuroendocrine cells and GPR39 expression was localized mainly in the chief cells of the oxyntic glands. In human gastric adenocarcinomas, no obestatin expression was found; however, an aberrant pattern of GPR39 expression was discovered, correlating to the dedifferentiation of the tumor. Altogether, our data strongly suggest the involvement of the obestatin/GPR39 system in the pathogenesis and/or clinical outcome of human gastric adenocarcinomas and highlight the potential usefulness of GPR39 as a prognostic marker in gastric cancer.

  4. β-Escin inhibits NNK-induced lung adenocarcinoma and ALDH1A1 and RhoA/Rock expression in A/J mice and growth of H460 human lung cancer cells.

    Science.gov (United States)

    Patlolla, Jagan M R; Qian, Li; Biddick, Laura; Zhang, Yuting; Desai, Dhimant; Amin, Shantu; Lightfoot, Stan; Rao, Chinthalapally V

    2013-10-01

    Lung cancer is the leading cause of cancer-related deaths. β-Escin, a triterpene saponin isolated from horse chestnut seeds, was tested for inhibition of lung adenoma and adenocarcinoma induced by the tobacco carcinogen 4-(methyl-nitrosamino)-1-(3-pyridyl)-1-butanone (NNK) in female A/J mice; and its possible mode of action was evaluated using the H460 human lung cancer cell line. At 6 weeks of age, 35 mice were fed AIN-76A-modified diet, and one week later, lung tumors were induced with a single intraperitoneal (i.p.) injection of 10 μmol NNK/mouse. Three weeks after the NNK treatment, groups of mice were fed either control or experimental diets containing 500 ppm for 20 weeks (10 control, 5 β-escin) or 36 weeks (15 control, 5 β-escin) and evaluated for lung tumor via histopathologic methods. Administration of 500 ppm β-escin significantly suppressed lung tumor (adenoma + adenocarcinoma) formation by more than 40% (P Escin inhibited NNK-induced lung adenocarcinoma formation by 65% (P escin showed significantly reduced aldehyde dehydrogenase (ALDH)1A1 and phospho-Akt (p-Akt) expression when compared with those in mice fed control diet. Aldefluor assay for ALDH revealed that among H460 lung cancer cells treated with different concentrations of β-escin (0-40 μmol/L), the subpopulation of cells with elevated ALDH activity was inhibited significantly. Our findings suggest that β-escin inhibits tobacco carcinogen-induced lung tumor formation by modulating ALDH1A1-positive cells and RhoA/Rock signaling.

  5. Dual-specificity phosphatase 6 (Dusp6), a negative regulator of FGF2/ERK1/2 signaling, enhances 17β-estradiol-induced cell growth in endometrial adenocarcinoma cell.

    Science.gov (United States)

    Zhang, Hui; Guo, Qiufen; Wang, Chong; Yan, Lei; Fu, Yibing; Fan, Mingjun; Zhao, Xingbo; Li, Mingjiang

    2013-08-25

    Dual-specificity phosphatase 6 (Dusp6) is a negative feedback mechanism of fibroblast growth factors (FGFs)/mitogen-activated protein kinase (MAPK)/ERK1/2 signaling. The aim of this study was to explore the expression of Dusp6 in human endometrial adenocarcinomas and the role of Dusp6 expression in the growth regulation of endometrial adenocarcinoma cell. We found that Dusp6 was over-expressed in human endometrial adenocarcinomas. In Ishikawa cells, plasmid-driven Dusp6 expression efficiently blocked the activity of FGF2-induced MAPK/ERK1/2 signaling. Unexpectedly, Dusp6 expression significantly enhanced the growth of Ishikawa cells. In Dusp6 forced-expression cells, 17β-estradiol stimulation increased the cell growth by all most threefolds. In addition, progesterone treatment reduced the cell growth to about half both in Ishikawa cells with and without forced-Dusp6-expression. Dusp6 over-expression is involved in the pathogenesis and development of human endometrial adenocarcinomas. Dusp6 functions as a negative regulator of FGF2/ERK1/2 signaling but enhances the growth and 17β-estradiol-induced cell growth in endometrial adenocarcinoma cell. Copyright © 2013. Published by Elsevier Ireland Ltd.

  6. Transforming growth factor-beta1 (TGF-beta1) and acetylcholine (ACh) alter nitric oxide (NO) and interleukin-1beta (IL-1beta) secretion in human colon adenocarcinoma cells.

    Science.gov (United States)

    Paduch, Roman; Kandefer-Szerszeń, Martyna

    2009-10-01

    Colon adenocarcinoma is one of the most common fatal malignancies in Western countries. Progression of this cancer is dependent on tumor microenvironmental signaling molecules such as transforming growth factor-beta (TGF-beta) or acetylcholine (ACh). The present study was conducted to assess the influence of recombinant human transforming growth factor (rhTGF)-beta1 or ACh on nitric oxide (NO) and interleukin-1beta (IL-1beta) secretion by three human colon adenocarcinoma cell lines: HT29, LS180, and SW948, derived from different grade tumors (Duke's stage). The cells were cultured in 2D and 3D (spheroids) conditions. Colon carcinoma cells exhibited different sensitivities to rhTGF-beta1 or ACh dependent on the tumor grade and the culture model. ACh exhibited significant inhibitory effects towards NO, endothelial nitric oxide synthase (eNOS), and IL-1beta secretion especially by tumor cells derived form Duke's C stage of colon carcinoma. rhTGF-beta1 also decreased NO, IL-1beta, and eNOS expression, but its effect was lower than that observed after the administration of ACh. The inhibition of NO and IL-1beta production was more striking in 3D tumor spheroids than in 2D culture monolayers. Taken together, the TGF-beta1-ACh axis may regulate colon carcinoma progression and metastasis by altering NO secretion and influence inflammatory responses by modulating IL-1beta production.

  7. Pancreatic adenocarcinoma exerts systemic effects on the peripheral blood myeloid and plasmacytoid dendritic cells: an indicator of disease severity?

    International Nuclear Information System (INIS)

    Tjomsland, Vegard; Larsson, Marie; Sandström, Per; Spångeus, Anna; Messmer, Davorka; Emilsson, Johan; Falkmer, Ursula; Falkmer, Sture; Magnusson, Karl-Eric; Borch, Kurt

    2010-01-01

    Dendritic cells (DCs) isolated from tumor bearing animals or from individuals with solid tumors display functional abnormalities and the DC impairment has emerged as one mechanism for tumor evasion from the control of the immune system. Ductal pancreatic adenocarcinoma (PDAC), the most common pancreatic cancer, is recognized as a very aggressive cancer type with a mortality that almost matches the rate of incidence. We examined the systemic influence ductal pancreatic adenocarcinoma (PDAC) exerted on levels of peripheral blood DCs and inflammatory mediators in comparison to the effects exerted by other pancreatic tumors, chronic pancreatitis, and age-matched controls. All groups examined, including PDAC, had decreased levels of myeloid DCs (MDC) and plasmacytoid DCs (PDC) and enhanced apoptosis in these cells as compared to controls. We found elevated levels of PGE2 and CXCL8 in subjects with PDAC, and chronic pancreatitis. Levels of these inflammatory factors were in part restored in PDAC after tumor resection, whereas the levels of DCs were impaired in the majority of these patients ~12 weeks after tumor removal. Our results prove that solid pancreatic tumors, including PDAC, systemically affect blood DCs. The impairments do not seem to be tumor-specific, since similar results were obtained in subjects with chronic pancreatitis. Furthermore, we found that PDAC patients with a survival over 2 years had significant higher levels of blood DCs compared to patients with less than one year survival. Our findings points to the involvement of inflammation in the destruction of the blood MDCs and PDCs. Furthermore, the preservation of the blood DCs compartment in PDAC patients seems to benefit their ability to control the disease and survival

  8. Dual effects of human adipose tissue-derived mesenchymal stem cells in human lung adenocarcinoma A549 xenografts and colorectal adenocarcinoma HT-29 xenografts in mice.

    Science.gov (United States)

    Rhyu, Jung Joo; Yun, Jun-Won; Kwon, Euna; Che, Jeong-Hwan; Kang, Byeong-Cheol

    2015-10-01

    Human adipose tissue-derived mesenchymal stem cells (hATMSCs) have great potential as a therapy for various diseases. However, emerging evidence shows that there are conflicting results concerning effects of hATMSCs on tumor progression. Our objective was to determine whether and how hATMSCs modulate tumor growth. After cancer cell lines were subcutaneously inoculated into BALB/c-nude and hairless severe combined immunodeficient mice, hATMSCs were intratumorally injected into the mice. The growth of the A549 tumors was inhibited by hATMSCs, yet that of the HT-29 tumors was significantly promoted by hATMSCs in the in vivo xenograft models. In vitro study using a co-culture system of cancer cells and hATMSCs was consistent with the in vivo experiments. To reveal the molecular events induced by hATMSCs in the xenograft models, global gene expression profiles of the A549 and HT-29 tumors in the absence or presence of hATMSCs were determined. Significant numbers of genes involved in biological processes were altered in the hATMSC-treated A549 tumors, whereas no biological process was regulated by treatment with hATMSCs in the HT-29 tumors, reflecting the different effects of hATMSCs in the different types of cancer. Notably, histone cluster 1, H2aj and neuropeptide Y receptor Y4 were found to be expressed in direct or inverse proportion to tumor size in both xenograft models. In addition, nuclear factor κB (NF-κB) p65 was differentially phosphorylated by the hATMSCs dependent on the source of the cancer cells. In conclusion, the identified gene profiling and NF-κB signaling provide molecular evidence to explain the conflicting findings in tumor‑MSC studies, although further study is needed to confirm these findings using various types of cancer.

  9. Effects of AdCMV-p53 gene transfer induced by irradiation on cycle of human colorectal adenocarcinoma cells

    International Nuclear Information System (INIS)

    Liu Bing; Min Fengling; Xie Yi; Duan Xin; Zhou Qingming; Chinese Academy of Sciences, Beijing; Zhang Hong; Li Wenjian; Hao Jifang; Zhou Guangming; Gao Qingxiang

    2006-01-01

    The work is to investigate effect of AdCMV-p53 gene transfer induced by 60 Co γ-rays on cell cycles of human colorectal adenocarcinoma cells. HT-29 cells exposed to 0.5, 1.0 and 2.0 Gy were infected with AdCMV-GFP, a replication deficient recombinant adenoviral vector containing a CMV promoter and green fluorescent protein, or AdCMV-p53, a replication deficient recombinant adenoviral vector containing a CMV promoter and carrying human wild-type p53 gene. Survival rate of the cells was determined by clonogenic assay. Cell cycle and cell apoptosis were determined by flow cytometry. The results showed that, 0.5-1.0 Gy irradiation significantly enhanced the inhibition of AdCMV-p53 infection on HT-29. Compared with the control, 1 day after the infection, the cells in G 0 /G 1 phase decreased by 5%-15%, the cells in S phase increased by 2%-19%. The 0.5 and 1.0 Gy irradiation made the cells in the in G 2 /M phase increase by 12%, infected with 80 MOI AdCMV-p5. There days later, the proportion of cells in G 2 /M phase in groups of 0.5 and 1.0 Gy irradiation +40 MOI AdCMV-p53 infection increased by 10%-13%. There was a relation between cell apoptosis and irradiation dose, or AdCMV-p53 dose. Therefore, the irradiation-induction could quicken the progression from G 0 /G 1 phase to S phase, and promote S and G 2 /M phase arrest. (authors)

  10. Induced pluripotent stem cell lines derived from human somatic cells.

    Science.gov (United States)

    Yu, Junying; Vodyanik, Maxim A; Smuga-Otto, Kim; Antosiewicz-Bourget, Jessica; Frane, Jennifer L; Tian, Shulan; Nie, Jeff; Jonsdottir, Gudrun A; Ruotti, Victor; Stewart, Ron; Slukvin, Igor I; Thomson, James A

    2007-12-21

    Somatic cell nuclear transfer allows trans-acting factors present in the mammalian oocyte to reprogram somatic cell nuclei to an undifferentiated state. We show that four factors (OCT4, SOX2, NANOG, and LIN28) are sufficient to reprogram human somatic cells to pluripotent stem cells that exhibit the essential characteristics of embryonic stem (ES) cells. These induced pluripotent human stem cells have normal karyotypes, express telomerase activity, express cell surface markers and genes that characterize human ES cells, and maintain the developmental potential to differentiate into advanced derivatives of all three primary germ layers. Such induced pluripotent human cell lines should be useful in the production of new disease models and in drug development, as well as for applications in transplantation medicine, once technical limitations (for example, mutation through viral integration) are eliminated.

  11. 17-AAG suppresses growth and invasion of lung adenocarcinoma cells via regulation of the LATS1/YAP pathway.

    Science.gov (United States)

    Ye, Xiang-Yun; Luo, Qing-Quan; Xu, Yun-Hua; Tang, Nai-Wang; Niu, Xiao-Min; Li, Zi-Ming; Shen, Sheng-Ping; Lu, Shun; Chen, Zhi-Wei

    2015-03-01

    The large tumour suppressor 1 (LATS1) signalling network has been proved to be an essential regulator within the cell, participating in multiple cellular phenotypes. However, it is unclear concerning the clinical significance of LATS1 and the regulatory mechanisms of 17-Allylamino-17- demethoxygeldanamycin (17-AAG) in lung adenocarcinoma (LAC). The aim of the present study was to investigate the correlation of LATS1 and yes-associated protein (YAP) expression with clinicopathological characteristics in LAC patients, and the effects of 17-AAG on biological behaviours of LAC cells. Subcutaneous LAC tumour models were further established to observe the tumour growth in nude mice. The results showed that the positive expression of LATS1 was significantly lowered (26.7% versus 68.0%, P AAG inhibited proliferation and invasion, and induced cell apoptosis and cycle arrest in LAC cells together with increased expression of E-cadherin and p-LATS1, and decreased expression of YAP and connective tissue growth factor. Tumour volumes and weight were much smaller in 17-AAG-treated groups than those in untreated group (P AAG suppresses growth and invasion of LAC cells via regulation of the LATS1/YAP pathway in vitro and in vivo, suggesting that we may provide a promising therapeutic strategy for the treatment of human LAC. © 2015 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

  12. 17-AAG suppresses growth and invasion of lung adenocarcinoma cells via regulation of the LATS1/YAP pathway

    Science.gov (United States)

    Ye, Xiang-Yun; Luo, Qing-Quan; Xu, Yun-Hua; Tang, Nai-Wang; Niu, Xiao-Min; Li, Zi-Ming; Shen, Sheng-Ping; Lu, Shun; Chen, Zhi-Wei

    2015-01-01

    The large tumour suppressor 1 (LATS1) signalling network has been proved to be an essential regulator within the cell, participating in multiple cellular phenotypes. However, it is unclear concerning the clinical significance of LATS1 and the regulatory mechanisms of 17-Allylamino-17- demethoxygeldanamycin (17-AAG) in lung adenocarcinoma (LAC). The aim of the present study was to investigate the correlation of LATS1 and yes-associated protein (YAP) expression with clinicopathological characteristics in LAC patients, and the effects of 17-AAG on biological behaviours of LAC cells. Subcutaneous LAC tumour models were further established to observe the tumour growth in nude mice. The results showed that the positive expression of LATS1 was significantly lowered (26.7% versus 68.0%, P AAG inhibited proliferation and invasion, and induced cell apoptosis and cycle arrest in LAC cells together with increased expression of E-cadherin and p-LATS1, and decreased expression of YAP and connective tissue growth factor. Tumour volumes and weight were much smaller in 17-AAG-treated groups than those in untreated group (P AAG suppresses growth and invasion of LAC cells via regulation of the LATS1/YAP pathway in vitro and in vivo, suggesting that we may provide a promising therapeutic strategy for the treatment of human LAC. PMID:25712415

  13. A Lactose-Binding Lectin from the Marine Sponge Cinachyrella Apion (Cal Induces Cell Death in Human Cervical Adenocarcinoma Cells

    Directory of Open Access Journals (Sweden)

    Adriana Uchoa

    2012-03-01

    Full Text Available Cancer represents a set of more than 100 diseases, including malignant tumors from different locations. Strategies inducing differentiation have had limited success in the treatment of established cancers. Marine sponges are a biological reservoir of bioactive molecules, especially lectins. Several animal and plant lectins were purified with antitumor activity, mitogenic, anti-inflammatory and antiviral, but there are few reports in the literature describing the mechanism of action of lectins purified from marine sponges to induce apoptosis in human tumor cells. In this work, a lectin purified from the marine sponge Cinachyrella apion (CaL was evaluated with respect to its hemolytic, cytotoxic and antiproliferative properties, besides the ability to induce cell death in tumor cells. The antiproliferative activity of CaL was tested against HeLa, PC3 and 3T3 cell lines, with highest growth inhibition for HeLa, reducing cell growth at a dose dependent manner (0.5–10 µg/mL. Hemolytic activity and toxicity against peripheral blood cells were tested using the concentration of IC50 (10 µg/mL for both trials and twice the IC50 for analysis in flow cytometry, indicating that CaL is not toxic to these cells. To assess the mechanism of cell death caused by CaL in HeLa cells, we performed flow cytometry and western blotting. Results showed that lectin probably induces cell death by apoptosis activation by pro-apoptotic protein Bax, promoting mitochondrial membrane permeabilization, cell cycle arrest in S phase and acting as both dependent and/or independent of caspases pathway. These results indicate the potential of CaL in studies of medicine for treating cancer.

  14. Susceptibility testing of fish cell lines for virus isolation

    DEFF Research Database (Denmark)

    Ariel, Ellen; Skall, Helle Frank; Olesen, Niels Jørgen

    2009-01-01

    compare susceptibility between cell lines and between lineages within a laboratory and between laboratories (Inter-laboratory Proficiency Test). The objective being that the most sensitive cell line and lineages are routinely selected for diagnostic purposes.In comparing cell lines, we simulated "non......-cell-culture-adapted" virus by propagating the virus in heterologous cell lines to the one tested. A stock of test virus was produced and stored at - 80 °C and tests were conducted biannually. This procedure becomes complicated when several cell lines are in use and does not account for variation among lineages. In comparing...... cell lineages, we increased the number of isolates of each virus, propagated stocks in a given cell line and tested all lineages of that line in use in the laboratory. Testing of relative cell line susceptibility between laboratories is carried out annually via the Inter-laboratory Proficiency Test...

  15. Biomimetic and enzyme-responsive dynamic hydrogels for studying cell-matrix interactions in pancreatic ductal adenocarcinoma.

    Science.gov (United States)

    Liu, Hung-Yi; Korc, Murray; Lin, Chien-Chi

    2018-04-01

    The tumor microenvironment (TME) governs all aspects of cancer progression and in vitro 3D cell culture platforms are increasingly developed to emulate the interactions between components of the stromal tissues and cancer cells. However, conventional cell culture platforms are inadequate in recapitulating the TME, which has complex compositions and dynamically changing matrix mechanics. In this study, we developed a dynamic gelatin-hyaluronic acid hybrid hydrogel system through integrating modular thiol-norbornene photopolymerization and enzyme-triggered on-demand matrix stiffening. In particular, gelatin was dually modified with norbornene and 4-hydroxyphenylacetic acid to render this bioactive protein photo-crosslinkable (through thiol-norbornene gelation) and responsive to tyrosinase-triggered on-demand stiffening (through HPA dimerization). In addition to the modified gelatin that provides basic cell adhesive motifs and protease cleavable sequences, hyaluronic acid (HA), an essential tumor matrix, was modularly and covalently incorporated into the cell-laden gel network. We systematically characterized macromer modification, gel crosslinking, as well as enzyme-triggered stiffening and degradation. We also evaluated the influence of matrix composition and dynamic stiffening on pancreatic ductal adenocarcinoma (PDAC) cell fate in 3D. We found that either HA-containing matrix or a dynamically stiffened microenvironment inhibited PDAC cell growth. Interestingly, these two factors synergistically induced cell phenotypic changes that resembled cell migration and/or invasion in 3D. Additional mRNA expression array analyses revealed changes unique to the presence of HA, to a stiffened microenvironment, or to the combination of both. Finally, we presented immunostaining and mRNA expression data to demonstrate that these irregular PDAC cell phenotypes were a result of matrix-induced epithelial-mesenchymal transition (EMT). Copyright © 2018 Elsevier Ltd. All rights

  16. Mitochondrial thiol modification by a targeted electrophile inhibits metabolism in breast adenocarcinoma cells by inhibiting enzyme activity and protein levels

    Directory of Open Access Journals (Sweden)

    M. Ryan Smith

    2016-08-01

    Full Text Available Many cancer cells follow an aberrant metabolic program to maintain energy for rapid cell proliferation. Metabolic reprogramming often involves the upregulation of glutaminolysis to generate reducing equivalents for the electron transport chain and amino acids for protein synthesis. Critical enzymes involved in metabolism possess a reactive thiolate group, which can be modified by certain oxidants. In the current study, we show that modification of mitochondrial protein thiols by a model compound, iodobutyl triphenylphosphonium (IBTP, decreased mitochondrial metabolism and ATP in MDA-MB 231 (MB231 breast adenocarcinoma cells up to 6 days after an initial 24 h treatment. Mitochondrial thiol modification also depressed oxygen consumption rates (OCR in a dose-dependent manner to a greater extent than a non-thiol modifying analog, suggesting that thiol reactivity is an important factor in the inhibition of cancer cell metabolism. In non-tumorigenic MCF-10A cells, IBTP also decreased OCR; however the extracellular acidification rate was significantly increased at all but the highest concentration (10 µM of IBTP indicating that thiol modification can have significantly different effects on bioenergetics in tumorigenic versus non-tumorigenic cells. ATP and other adenonucleotide levels were also decreased by thiol modification up to 6 days post-treatment, indicating a decreased overall energetic state in MB231 cells. Cellular proliferation of MB231 cells was also inhibited up to 6 days post-treatment with little change to cell viability. Targeted metabolomic analyses revealed that thiol modification caused depletion of both Krebs cycle and glutaminolysis intermediates. Further experiments revealed that the activity of the Krebs cycle enzyme, aconitase, was attenuated in response to thiol modification. Additionally, the inhibition of glutaminolysis corresponded to decreased glutaminase C (GAC protein levels, although other protein levels were

  17. Antiproliferative activity of New Zealand propolis and phenolic compounds vs human colorectal adenocarcinoma cells.

    Science.gov (United States)

    Catchpole, Owen; Mitchell, Kevin; Bloor, Stephen; Davis, Paul; Suddes, Amanda

    2015-10-01

    New Zealand propolis is a "European" type propolis obtained by honey bees mainly from exudates of poplar. European type propolis is known to have anti-inflammatory and anti-cancer properties and this activity has been attributed to some of the main constituents such as chrysin and CAPE (caffeic acid phenethyl ester). As part of our studies on how New Zealand propolis might benefit gastro-intestinal health, we carried out in vitro bioactivity-guided fractionation of "Bio30™" propolis using both anti-inflammatory (TNF-α, COX-1, COX-2) and anti-colon cancer (DLD-1 colon cancer cell viability) assays; and determined the phenolic compounds responsible for the activity. The New Zealand wax-free Bio30™ propolis tincture solids had very high levels of the dihydroflavonoids pinocembrin and pinobanksin-3-O-acetate, and high levels of the dimethylallyl, benzyl and 3-methyl-3-butenyl caffeates relative to CAPE. The DLD-1 assays identified strong anti-proliferative activity associated with these components as well as chrysin, galangin and CAPE and a number of lesser known or lower concentration compounds including benzyl ferulate, benzyl isoferulate, pinostrobin, 5-phenylpenta-2,4-dienoic acid and tectochrysin. The phenolic compounds pinocembrin, pinobanksin-3-O-acetate, tectochrysin, dimethylallyl caffeate, 3-methyl-3-butenyl caffeate, benzyl ferulate and benzyl isoferulate also showed good broad spectrum activity in anti-proliferative assays against three other gastro-intestinal cancer cell lines; HCT-116 colon carcinoma, KYSE-30 oesophageal squamous cancer, and NCI-N87 gastric carcinoma. Activity is also observed in anti-inflammatory assays although it appears to be limited to one of the first cytokines in the inflammatory cascade, TNF-α. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Engineered cell lines for fish health research.

    Science.gov (United States)

    Collet, Bertrand; Collins, Catherine; Lester, Katherine

    2018-03-01

    As fish farming continues to increase worldwide, the related research areas of fish disease and immunology are also expanding, aided by the revolution in access to genomic information and molecular technology. The genomes of most fish species of economic importance are now available and annotation based on sequence homology with characterised genomes is underway. However, while useful, functional homology is more difficult to determine, there being a lack of widely distributed and well characterised reagents such as monoclonal antibodies, traditionally used in mammalian studies, to help with confirming functions and cellular interactions of fish molecules. In this context, fish cell lines and the possibility of their genetic engineering offer good prospects for studying functional genomics with respect to fish diseases. In this review, we will give an overview of available permanently genetically engineered fish cell lines, as cell-based reporter systems or platforms for expression of endogenous immune or pathogen genes, to investigate interactions and function. The advantages of such systems and the technical challenge for their development will be discussed. Crown Copyright © 2017. Published by Elsevier Ltd. All rights reserved.

  19. (2Alpha,3beta)-2,3-dihydroxyolean-12-en-28-oic acid, a new natural triterpene from Olea europea, induces caspase dependent apoptosis selectively in colon adenocarcinoma cells.

    Science.gov (United States)

    Reyes, Fernando J; Centelles, Josep J; Lupiáñez, José A; Cascante, Marta

    2006-11-27

    Triterpenoids are known to induce apoptosis and to be anti-tumoural. Maslinic acid, a pentacyclic triterpene, is present in high concentrations in olive pomace. This study examines the response of HT29 and Caco-2 colon-cancer cell lines to maslinic-acid treatment. At concentrations inhibiting cell growth by 50-80% (IC50HT29=61+/-1 microM, IC80HT29=76+/-1 microM and IC50Caco-2=85+/-5 microM, IC80Caco-2=116+/-5 microM), maslinic acid induced strong G0/G1 cell-cycle arrest and DNA fragmentation, and increased caspase-3 activity. However, maslinic acid did not alter the cell cycle or induce apoptosis in the non-tumoural intestine cell lines IEC-6 and IEC-18. Moreover, maslinic acid induced cell differentiation in colon adenocarcinoma cells. These findings support a role for maslinic acid as a tumour suppressant and as a possible new therapeutic tool for aberrant cell proliferation in the colon. In this report, we demonstrate for the first time that, in tumoural cancer cells, maslinic acid exerts a significant anti-proliferation effect by inducing an apoptotic process characterized by caspase-3 activation by a p53-independent mechanism, which occurs via mitochondrial disturbances and cytochrome c release.

  20. Verteporfin suppresses cell survival, angiogenesis and vasculogenic mimicry of pancreatic ductal adenocarcinoma via disrupting the YAP-TEAD complex.

    Science.gov (United States)

    Wei, Honglong; Wang, Fuhai; Wang, Yong; Li, Tao; Xiu, Peng; Zhong, Jingtao; Sun, Xueying; Li, Jie

    2017-03-01

    Pancreatic ductal adenocarcinoma (PDAC) is one of the most aggressive human malignancies. The Yes-associated protein-1 (YAP) plays a critical role in cell proliferation, apoptosis and angiogenesis. Verteporfin is a photosensitizer used in photodynamic therapy and also a small molecular inhibitor of the Hippo-YAP pathway. However, little is known about whether verteporfin could inhibit YAP activity in PDAC cells. Our present results showed that verteporfin suppressed the proliferation of human PDAC PANC-1 and SW1990 cells by arresting cells at the G1 phase, and inducing apoptosis in dose- and time-dependent manners. Verteporfin also inhibited the tumor growth on the PDAC xenograft model. Treatment with verteporfin led to downregulation of cyclinD1 and cyclinE1, modulation of Bcl-2 family proteins and activation of PARP. In addition, verteporfin exhibited an inhibitory effect on angiogenesis and vasculogenic mimicry via suppressing Ang2, MMP2, VE-cadherin, and α-SMA expression in vitro and in vivo. Mechanism studies demonstrated that verteporfin impaired YAP and TEAD interaction to suppress the expression of targeted genes. Our results provide a foundation for repurposing verteporfin as a promising anti-tumor drug in the treatment of pancreatic cancer by targeting the Hippo pathway. © 2017 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

  1. Expression, localization and polymorphisms of the nuclear receptor PXR in Barrett's esophagus and esophageal adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Kusters Johannes G

    2011-10-01

    Full Text Available Abstract Background The continuous exposure of esophageal epithelium to refluxate may induce ectopic expression of bile-responsive genes and contribute to the development of Barrett's esophagus (BE and esophageal adenocarcinoma. In normal physiology of the gut and liver, the nuclear receptor Pregnane × Receptor (PXR is an important factor in the detoxification of xenobiotics and bile acid homeostasis. This study aimed to investigate the expression and genetic variation of PXR in reflux esophagitis (RE, Barrett's esophagus (BE and esophageal adenocarcinoma. Methods PXR mRNA levels and protein expression were determined in biopsies from patients with adenocarcinoma, BE, or RE, and healthy controls. Esophageal cell lines were stimulated with lithocholic acid and rifampicin. PXR polymorphisms 25385C/T, 7635A/G, and 8055C/T were genotyped in 249 BE patients, 233 RE patients, and 201 controls matched for age and gender. Results PXR mRNA levels were significantly higher in adenocarcinoma tissue and columnar Barrett's epithelium, compared to squamous epithelium of these BE patients (P P = 0.003. Immunohistochemical staining of PXR showed predominantly cytoplasmic expression in BE tissue, whereas nuclear expression was found in adenocarcinoma tissue. In cell lines, stimulation with lithocholic acid did not increase PXR mRNA levels, but did induce nuclear translocation of PXR protein. Genotyping of the PXR 7635A/G polymorphism revealed that the G allele was significantly more prevalent in BE than in RE or controls (P = 0.037. Conclusions PXR expresses in BE and adenocarcinoma tissue, and showed nuclear localization in adenocarcinoma tissue. Upon stimulation with lithocholic acid, PXR translocates to the nuclei of OE19 adenocarcinoma cells. Together with the observed association of a PXR polymorphism and BE, this data implies that PXR may have a function in prediction and treatment of esophageal disease.

  2. Doublecortin-like kinase 1 is elevated serologically in pancreatic ductal adenocarcinoma and widely expressed on circulating tumor cells.

    Directory of Open Access Journals (Sweden)

    Dongfeng Qu

    Full Text Available Doublecortin-like kinase 1 (DCLK1 is a putative pancreatic stem cell marker and is upregulated in pancreatic cancer, colorectal cancer, and many other solid tumors. It marks tumor stem cells in mouse models of intestinal neoplasia. Here we sought to determine whether DCLK1 protein can be detected in the bloodstream and if its levels in archived serum samples could be quantitatively assessed in pancreatic cancer patients. DCLK1 specific ELISA, western blotting, and immunohistochemical analyses were used to determine expression levels in the serum and staining intensity in archived tumor tissues of pancreatic ductal adenocarcinoma (PDAC patients and in pancreatic cancer mouse models. DCLK1 levels in the serum were elevated in early stages of PDAC (stages I and II compared to healthy volunteers (normal controls. No differences were observed between stages III/IV and normal controls. In resected surgical tissues, DCLK1 expression intensity in the stromal cells was significantly higher than that observed in tumor epithelial cells. Circulating tumor cells were isolated from KPCY mice and approximately 52% of these cells were positive for Dclk1 staining. Dclk1 levels in the serum of KPC mice were also elevated. We have previously demonstrated that DCLK1 plays a potential role in regulating epithelial mesenchymal transition (EMT. Given the increasingly recognized role of EMT derived stem cells in cancer progression and metastasis, we hypothesize that DCLK1 may contribute to the metastatic process. Taken together, our results suggest that DCLK1 serum levels and DCLK1 positive circulating tumor cells should be further assessed for their potential diagnostic and prognostic significance.

  3. Radiosensitivity of Human Melanoma Cell Lines

    Energy Technology Data Exchange (ETDEWEB)

    Bergoc, R. M.; Medina, V.; Cricco, G.; Mohamed, N.; Martin, G.; Nunez, M.; Croci, M.; Crescenti, E. J.; Rivera, E. S.

    2004-07-01

    Cutaneous melanoma is a skin cancer resulting from the malign transformation of skin-pigment cells, the melanocytes. The radiotherapy, alone or in combination with other treatment, is an important therapy for this disease. the objective of this paper was to determine in vitro the radiosensitivity of two human melanoma cell lines with different metastatic capability: WM35 and MI/15, and to study the effect of drugs on radiobiological parameters. The Survival Curves were adjusted to the mathematical Linear-quadratic model using GrapsPad Prism software. Cells were seeded in RPMI medium (3000-3500 cells/flask), in triplicate and irradiated 24 h later. The irradiation was performed using an IBL 437C H Type equipment (189 TBq, 7.7 Gy/min) calibrated with a TLD 700 dosimeter. The range of Doses covered from 0 to 10 Gy and the colonies formed were counted at day 7th post-irradiation. Results obtained were: for WM35, {alpha}=0.37{+-}0.07 Gy''-1 and {beta}=0.06{+-}0.02 Gy''-2, for M1/15m {alpha}=0.47{+-}0.03 Gy''-1 and {beta}=0.06{+-}0.01 Gy''-2. The {alpha}/{beta} values WM35: {alpha}/{beta} values WM35: {alpha}/{beta}=6.07 Gy and M1/15: {alpha}/{beta}{sub 7}.33 Gy were similar, independently of their metastatic capabillity and indicate that both lines exhibit high radioresistance. Microscopic observation of irradiated cells showed multinuclear cells with few morphologic changes non-compatible with apoptosis. By means of specific fluorescent dyes and flow cytometry analysis we determined the intracellular levels of the radicals superoxide and hydrogen peroxide and their modulation in response to ionizing radiation. The results showed a marked decreased in H{sub 2}O{sub 2} intracellular levels with a simultaneous increase in superoxide that will be part of a mechanism responsible for induction of cell radioresistance. This response triggered by irradiated cells could not be abrogated by different treatments like histamine or the

  4. Histone signature of metanephric mesenchyme cell lines.

    Science.gov (United States)

    McLaughlin, Nathan; Yao, Xiao; Li, Yuwen; Saifudeen, Zubaida; El-Dahr, Samir S

    2013-09-01

    The metanephric mesenchyme (MM) gives rise to nephrons, the filtering units of the mature kidney. The MM is composed of uninduced (Six2(high)/Lhx1(low)) and induced (Wnt-stimulated, Six2(low)/Lhx1(high)) cells. The global epigenetic state of MM cells is unknown, partly due to technical difficulty in isolating sufficient numbers of homogenous cell populations. We therefore took advantage of two mouse clonal cell lines representing the uninduced (mK3) and induced (mK4) metanephric mesenchyme (based on gene expression profiles and ability to induce branching of ureteric bud). ChIP-Seq revealed that whereas H3K4me3 active region "peaks" are enriched in metabolic genes, H3K27me3 peaks decorate mesenchyme and epithelial cell fate commitment genes. In uninduced mK3 cells, promoters of "stemness" genes (e.g., Six2, Osr1) are enriched with H3K4me3 peaks; these are lost in induced mK4 cells. ChIP-qPCR confirmed this finding and further demonstrated that G9a/H3K9me2 occupy the promoter region of Six2 in induced cells, consistent with the inactive state of transcription. Conversely, genes that mark the induced epithelialized state (e.g., Lhx1, Pax8), transition from a non-permissive to an active chromatin signature in mK3 vs. mK4 cells, respectively. Importantly, stimulation of Wnt signaling in uninduced mK3 cells provokes an active chromatin state (high H3K4me3, low H3K27me3), recruitment of β-catenin, and loss of pre-bound histone methyltransferase Ezh2 in silent induced genes followed by activation of transcription. We conclude that the chromatin signature of uninduced and induced cells correlates strongly with their gene expression states, suggesting a role of chromatin-based mechanisms in MM cell fate.

  5. Anticancer Effects of Extracts from the Fruit of Morinda Citrifolia (Noni) in Breast Cancer Cell Lines.

    Science.gov (United States)

    Sharma, K; Pachauri, S D; Khandelwal, K; Ahmad, H; Arya, A; Biala, P; Agrawal, S; Pandey, R R; Srivastava, A; Srivastav, A; Saxena, J K; Dwivedi, A K

    2016-03-01

    Morinda citrifolia L. (NONI) fruits have been used for thousands of years for the treatment of many health problems including cancer, cold, diabetes, flu, hypertension, and pain. Plant extracts have reported several therapeutic benefits, but extraction of individual compound from the extract often exhibits limited clinical utility as the synergistic effect of various natural ingredients gets lost. They generally constitute polyphenols and flavonoids. Studies have suggested that these phytochemicals, especially polyphenols, display high antioxidant properties, which help to reduce the risk of degenerative diseases, such as cancer and cardiovascular diseases. Several in-vitro and in-vivo studies have shown that Noni fruits have antioxidant, anti-inflammatory, anti-dementia, liver-protective, anticancer, analgesic, and immunomodulatory effects. Till date about 7 in vitro cancer studies have been done, but a detailed in vitro study including cell cycle and caspase activation assay on breast cancer cell line has not been done. In the present study different Noni fruit fractions have tested on cancer cell lines MCF-7, MDA-MB-231 (breast adenocarcinoma) and one non-cancer cell line HEK-293 (Human embryonic kidney). Out of which ethylacetate extract showed a higher order of in vitro anticancer activity profile. The ethylacetate extract strongly inhibited the proliferation of MCF-7, MDA-MB-231 and HEK-293 cell lines with IC50 values of 25, 35, 60 µg/ml respectively. The extract showed increase in apoptotic cells in MCF-7 and MDA-MB-231 cells and arrested the cell cycle in the G1/S phase in MCF-7 and G0/G1 phase in MDA-MB-231 cells. Noni extract also decreases the intracellular ROS generation and mitochondrial membrane potential. © Georg Thieme Verlag KG Stuttgart · New York.

  6. Inhibitory effect of Nodal on the expression of aldehyde dehydrogenase 1 in endometrioid adenocarcinoma of uterus.

    Science.gov (United States)

    Wang, Yi; Jiang, Yang; Tian, Tian; Hori, Yumiko; Wada, Naoki; Ikeda, Jun-ichiro; Morii, Eiichi

    2013-11-01

    Cancers consist of heterogeneous populations. Recently, it has been demonstrated that cells with tumorigenic potential are limited to a small population, called cancer-initiating cells (CICs). Aldehyde dehydrogenase 1 (ALDH1) is one of the markers of CICs. We previously reported that ALDH1-high cases of uterine endometrioid adenocarcinoma showed poor prognosis, and ALDH1-high population of endometrioid adenocarcinoma cell line was more tumorigenic, resistant to anti-cancer drugs, and invasive than ALDH1-low population. Here, the regulatory signaling for ALDH1 was examined. The inhibition of TGF-β signaling increased ALDH1-high population. Among TGF-β family members, Nodal expression and ALDH1 expression levels were mutually exclusive. Immunohistochemical analysis on clinical samples revealed Nodal-high tumor cells to be ALDH-low and vise versa, suggesting that Nodal may inhibit ALDH1 expression via stimulating TGF-β signaling in uterine endometrioid adenocarcinoma. In fact, the addition of Nodal to endometrioid adenocarcinoma cell line reduced ALDH1-high population. Although ALDH1 mRNA level was not affected, the amount of ALDH1 protein appeared to be reduce by Nodal through ubiquitine-proteasome pathway. The regulation of TGF-β signaling might be a novel therapeutic target of CICs in endometrioid adenocarcinoma. Copyright © 2013. Published by Elsevier Inc.

  7. Cytotoxicity of Portuguese propolis: the proximity of the in vitro doses for tumor and normal cell lines.

    Science.gov (United States)

    Calhelha, Ricardo C; Falcão, Soraia; Queiroz, Maria João R P; Vilas-Boas, Miguel; Ferreira, Isabel C F R

    2014-01-01

    With a complex chemical composition rich in phenolic compounds, propolis (resinous substance collected by Apis mellifera from various tree buds) exhibits a broad spectrum of biological activities. Recently, in vitro and in vivo data suggest that propolis has anticancer properties, but is the cytoxicity of propolis specific for tumor cells? To answer this question, the cytotoxicity of phenolic extracts from Portuguese propolis of different origins was evaluated using human tumor cell lines (MCF7-breast adenocarcinoma, NCI-H460-non-small cell lung carcinoma, HCT15-colon carcinoma, HeLa-cervical carcinoma, and HepG2-hepatocellular carcinoma), and non-tumor primary cells (PLP2). The studied propolis presented high cytotoxic potential for human tumor cell lines, mostly for HCT15. Nevertheless, excluding HCT15 cell line, the extracts at the GI50 obtained for tumor cell lines showed, in general, cytotoxicity for normal cells (PLP2). Propolis phenolic extracts comprise phytochemicals that should be further studied for their bioactive properties against human colon carcinoma. In the other cases, the proximity of the in vitro cytotoxic doses for tumor and normal cell lines should be confirmed by in vivo tests and may highlight the need for selection of specific compounds within the propolis extract.

  8. Cytotoxicity of Portuguese Propolis: The Proximity of the In Vitro Doses for Tumor and Normal Cell Lines

    Directory of Open Access Journals (Sweden)

    Ricardo C. Calhelha

    2014-01-01

    Full Text Available With a complex chemical composition rich in phenolic compounds, propolis (resinous substance collected by Apis mellifera from various tree buds exhibits a broad spectrum of biological activities. Recently, in vitro and in vivo data suggest that propolis has anticancer properties, but is the cytoxicity of propolis specific for tumor cells? To answer this question, the cytotoxicity of phenolic extracts from Portuguese propolis of different origins was evaluated using human tumor cell lines (MCF7—breast adenocarcinoma, NCI-H460—non-small cell lung carcinoma, HCT15—colon carcinoma, HeLa—cervical carcinoma, and HepG2—hepatocellular carcinoma, and non-tumor primary cells (PLP2. The studied propolis presented high cytotoxic potential for human tumor cell lines, mostly for HCT15. Nevertheless, excluding HCT15 cell line, the extracts at the GI50 obtained for tumor cell lines showed, in general, cytotoxicity for normal cells (PLP2. Propolis phenolic extracts comprise phytochemicals that should be further studied for their bioactive properties against human colon carcinoma. In the other cases, the proximity of the in vitro cytotoxic doses for tumor and normal cell lines should be confirmed by in vivo tests and may highlight the need for selection of specific compounds within the propolis extract.

  9. Menadione inhibits MIBG uptake in two neuroendocrine cell lines

    NARCIS (Netherlands)

    Cornelissen, J.; Tytgat, G. A.; van den Brug, M.; van Kuilenburg, A. B.; Voûte, P. A.; van Gennip, A. H.

    1997-01-01

    In this paper we report on our studies of the effect of menadione on the uptake of MIBG in the neuroendocrine cell lines PC12 and SK-N-SH. Menadione inhibits the uptake of MIBG in both cell lines in a dose-dependent manner. Inhibition of MIBG uptake is most pronounced in the PC12 cell line.

  10. 77 FR 5489 - Identification of Human Cell Lines Project

    Science.gov (United States)

    2012-02-03

    ... selection of this technology over other possible candidates for this project include: (i) The ability to... cell line, whether the cell line is misidentified, cross- contaminated, or genetically unstable... database. Submission Process: Submitters should contact Margaret Kline with a list of proposed cell lines...

  11. Efficacy and Safety of Nintedanib Plus Docetaxel in Patients with Advanced Lung Adenocarcinoma

    DEFF Research Database (Denmark)

    Gottfried, Maya; Bennouna, Jaafar; Bondarenko, Igor

    2017-01-01

    BACKGROUND: Nintedanib is a triple angiokinase inhibitor approved with docetaxel for adenocarcinoma non-small cell lung cancer after first-line chemotherapy (FLT). In the phase III LUME-Lung 1 study, overall survival (OS) was significantly longer with nintedanib/docetaxel than with placebo....../docetaxel in all adenocarcinoma patients and those with time from start of FLT (TSFLT) Lung 1 study, specifically for adenocarcinoma patients, to explore the impact of clinically relevant characteristics on outcomes such as time...... to progression after FLT. PATIENTS AND METHODS: Exploratory analyses were conducted of the overall and European LUME-Lung 1 adenocarcinoma population according to age, prior therapy, and tumor dynamics. Analyses also used TSFLT and time from end of FLT (TEFLT). RESULTS: Treatment with nintedanib...

  12. In vitro cytotoxicity of silver nanoparticles and zinc oxide nanoparticles to human epithelial colorectal adenocarcinoma (Caco-2) cells

    International Nuclear Information System (INIS)

    Song, Yijuan; Guan, Rongfa; Lyu, Fei; Kang, Tianshu; Wu, Yihang; Chen, Xiaoqiang

    2014-01-01

    Highlights: • The characterization of Ag NPs and ZnO NPs. • The various morphologies of Caco-2 cells stained with AO/EB. • The viability of Caco-2 cells after Ag NPs and ZnO NPs exposure. • The cytotoxicity of Ag NPs and ZnO NPs on Caco-2 cells by oxidative stress assays. - Abstract: With the increasing applications of silver nanoparticles (Ag NPs) and zinc oxide nanoparticles (ZnO NPs) in foods and cosmetics, the concerns about the potential toxicities to human have been raised. The aims of this study are to observe the cytotoxicity of Ag NPs and ZnO NPs to human epithelial colorectal adenocarcinoma (Caco-2) cells in vitro, and to discover the toxicity mechanism of nanoparticles on Caco-2 cells. Caco-2 cells were exposed to 10, 25, 50, 100, 200 μg/mL of Ag NPs and ZnO NPs (90 nm). AO/EB double staining was used to characterize the morphology of the treated cells. The cell counting kit-8 (CCK-8) assay was used to detect the proliferation of the cells. Reactive oxygen species (ROS), superoxide dismutase (SOD) and glutathione (GSH) assay were used to explore the oxidative damage of Caco-2 cells. The results showed that Ag NPs and ZnO NPs (0–200 μg/mL) had highly significant effect on the Caco-2 cells activity. ZnO NPs exerted higher cytotoxicity than Ag NPs in the same concentration range. ZnO NPs have dose-depended toxicity. The LD 50 of ZnO NPs in Caco-2 cells is 0.431 mg/L. Significant depletion of SOD level, variation in GSH level and release of ROS in cells treated by ZnO NPs were observed, which suggests that cytotoxicity of ZnO NPs in intestine cells might be mediated through cellular oxidative stress. While Caco-2 cells treated with Ag NPs at all experimental concentrations showed no cellular oxidative damage. Moreover, the cells’ antioxidant capacity increased, and reached the highest level when the concentration of Ag NPs was 50 μg/mL. Therefore, it can be concluded that Ag NPs are safer antibacterial material in food packaging materials than

  13. In vitro cytotoxicity of silver nanoparticles and zinc oxide nanoparticles to human epithelial colorectal adenocarcinoma (Caco-2) cells

    Energy Technology Data Exchange (ETDEWEB)

    Song, Yijuan [Zhejiang Provincial Key Laboratory of Biometrology and Inspection and Quarantine, China Jiliang University, Hangzhou 310018 (China); Guan, Rongfa, E-mail: rongfaguan@163.com [Zhejiang Provincial Key Laboratory of Biometrology and Inspection and Quarantine, China Jiliang University, Hangzhou 310018 (China); Lyu, Fei [Department of Food Science and Technology, Zhejiang University of Technology, Hangzhou 310014 (China); Kang, Tianshu; Wu, Yihang [Zhejiang Provincial Key Laboratory of Biometrology and Inspection and Quarantine, China Jiliang University, Hangzhou 310018 (China); Chen, Xiaoqiang [Hubei University of Technology, Wuhan 430068 (China)

    2014-11-15

    Highlights: • The characterization of Ag NPs and ZnO NPs. • The various morphologies of Caco-2 cells stained with AO/EB. • The viability of Caco-2 cells after Ag NPs and ZnO NPs exposure. • The cytotoxicity of Ag NPs and ZnO NPs on Caco-2 cells by oxidative stress assays. - Abstract: With the increasing applications of silver nanoparticles (Ag NPs) and zinc oxide nanoparticles (ZnO NPs) in foods and cosmetics, the concerns about the potential toxicities to human have been raised. The aims of this study are to observe the cytotoxicity of Ag NPs and ZnO NPs to human epithelial colorectal adenocarcinoma (Caco-2) cells in vitro, and to discover the toxicity mechanism of nanoparticles on Caco-2 cells. Caco-2 cells were exposed to 10, 25, 50, 100, 200 μg/mL of Ag NPs and ZnO NPs (90 nm). AO/EB double staining was used to characterize the morphology of the treated cells. The cell counting kit-8 (CCK-8) assay was used to detect the proliferation of the cells. Reactive oxygen species (ROS), superoxide dismutase (SOD) and glutathione (GSH) assay were used to explore the oxidative damage of Caco-2 cells. The results showed that Ag NPs and ZnO NPs (0–200 μg/mL) had highly significant effect on the Caco-2 cells activity. ZnO NPs exerted higher cytotoxicity than Ag NPs in the same concentration range. ZnO NPs have dose-depended toxicity. The LD{sub 50} of ZnO NPs in Caco-2 cells is 0.431 mg/L. Significant depletion of SOD level, variation in GSH level and release of ROS in cells treated by ZnO NPs were observed, which suggests that cytotoxicity of ZnO NPs in intestine cells might be mediated through cellular oxidative stress. While Caco-2 cells treated with Ag NPs at all experimental concentrations showed no cellular oxidative damage. Moreover, the cells’ antioxidant capacity increased, and reached the highest level when the concentration of Ag NPs was 50 μg/mL. Therefore, it can be concluded that Ag NPs are safer antibacterial material in food packaging materials

  14. Long noncoding RNA ROR regulates chemoresistance in docetaxel-resistant lung adenocarcinoma cells via epithelial mesenchymal transition pathway.

    Science.gov (United States)

    Pan, Yan; Chen, Jing; Tao, Leilei; Zhang, Kai; Wang, Rui; Chu, Xiaoyuan; Chen, Longbang

    2017-05-16

    Emerging evidence indicates that the dysregulation of long non-coding RNAs (lncRNAs) contributes to the development and progression of lung adenocarcinoma (LAD), however the underlying mechanism of action of lncRNAs remains unclear. It is well known that the effective treatment of cancers has been hindered by drug resistance in the clinical setting. Epithelial-mesenchymal transition (EMT) has been recognized to be involved in acquiring drug resistance, cell migration and invasion properties in several types of cancer. Docetaxel-resistant LAD cells established previously in our lab present chemoresistant and mesenchymal features. Long intergenic non-protein coding RNA, regulator of reprogramming (linc-ROR), was first discovered in induced pluripotent stem cells (iPSCs) and was upregulated in docetaxel-resistant LAD cells. In this study, we tried to make clarification of lincRNA-related mechanisms underlying EMT followed by acquired resistance to chemotherapy in LAD. In order to hit the mark, we made use of multiple methods including microarray analysis, qRT-PCR, western blotting analysis, loss/gain-of-function analysis, luciferase assays, drug sensitivity assays, wound-healing assay and invasion assay. We found that decreased expression of linc-ROR effectively reversed EMT in docetaxel-resistant LAD cells and sensitized them to chemotherapy. The function of linc-ROR exerted in LAD cells depended on the sponging of miR-145, therefore, releasing the miR-145 target FSCN1, and thus contributing to the acquisition of chemoresistance and EMT phenotypes of docetaxel-resistant LAD cells. Our findings revealed that linc-ROR might act as potential therapeutic target to overcome chemotherapy resistance in LAD.

  15. In vitro evaluation of antitumoral efficacy of catalase in combination with traditional chemotherapeutic drugs against human lung adenocarcinoma cells.

    Science.gov (United States)

    de Oliveira, Valeska Aguiar; da Motta, Leonardo Lisbôa; De Bastiani, Marco Antônio; Lopes, Fernanda Martins; Müller, Carolina Beatriz; Gabiatti, Bernardo Papini; França, Fernanda Stapenhorst; Castro, Mauro Antônio Alves; Klamt, Fabio

    2016-08-01

    Lung cancer is the most lethal cancer-related disease worldwide. Since survival rates remain poor, there is an urgent need for more effective therapies that could increase the overall survival of lung cancer patients. Lung tumors exhibit increased levels of oxidative markers with altered levels of antioxidant defenses, and previous studies demonstrated that the overexpression of the antioxidant enzyme catalase (CAT) might control tumor proliferation and aggressiveness. Herein, we evaluated the effect of CAT treatment on the sensitivity of A549 human lung adenocarcinoma cells toward various anticancer treatments, aiming to establish the best drug combination for further therapeutic management of this disease. Exponentially growing A549 cells were treated with CAT alone or in combination with chemotherapeutic drugs (cisplatin, 5-fluorouracil, paclitaxel, daunorubicin, and hydroxyurea). CalcuSyn(®) software was used to assess CAT/drug interactions (synergism or antagonism). Growth inhibition, NFκB activation status, and redox parameters were also evaluated in CAT-treated A549 cells. CAT treatment caused a cytostatic effect, decreased NFκB activation, and modulated the redox parameters evaluated. CAT treatment exhibited a synergistic effect among most of the anticancer drugs tested, which is significantly correlated with an increased H2O2 production. Moreover, CAT combination caused an antagonism in paclitaxel anticancer effect. These data suggest that combining CAT (or CAT analogs) with traditional chemotherapeutic drugs, especially cisplatin, is a promising therapeutic strategy for the treatment of lung cancer.

  16. Deleterious effects on MDAMB-231 breast adenocarcinoma cell lineage submitted to Ho-166 radioactive seeds at very low activity

    Energy Technology Data Exchange (ETDEWEB)

    Falcao, Patricia L.; Campos, Tarcisio P.R., E-mail: campos@nuclear.ufmg.br [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Engenharia Nuclear; Sarmento, Eduardo V. [Centro de Desenvolvimento de Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil); Cuperschmid, Ethel M. [Universidade Federal de Minas Gerais (CEMEMOR/UFMG), Belo Horizonte, BR (Brazil). Fac. de Medicina. Centro de Memoria da Medicina

    2011-07-01

    Herein, the deleterious effect of ionizing radiation provided by Ho-166 radioactive seeds at low activity were addressed, based on experimental in vitro assays at the MDA MB231 cell lineage, a breast adenocarcinoma, compared to PBMC - peripheral blood cells. The methodology involves of the MDBMB-231 and PBMC expansion in culture in suitable environment in 30mm well plates and T-25 flasks. Seeds were synthesized with Ho-165 incorporated and characterized previously. Activation was processed at IPR1 reactor at the peripheral table, at 8h exposition. Three groups of seeds were tested: 0,34 mCi, 0,12 mCi activity, and control group. Such seeds were placed on culture and held to a period of 05 half-lives of the radionuclide. The biological responses at these exposure were documented by inverse microscopic photographic in time. Also, MTT essay were performed. A fast response in producing deleterious effects at cancer cell was observed even if for the low activity seeds. Also, a biological response dependent to a radial distance of the seed was observed. At conclusion, viability clonogenic control of MDAMB231 is identified at the exposition to Ho-166 ceramic seeds, even if at low activity of 0,1 to 0,3mCi. (author)

  17. Cyto- and genotoxicity assessment of Gold nanoparticles obtained by laser ablation in A549 lung adenocarcinoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Bucchianico, Sebastiano Di [Karolinska Institutet, Institute of Environmental Medicine (Sweden); Migliore, Lucia [University of Pisa, Department of Translational Research and New Technologies in Medicine and Surgery, Division of Medical Genetics (Italy); Marsili, Paolo [Institute of Complex Systems (ISC-CNR) (Italy); Vergari, Chiara [Plasma Diagnostics and Technologies s.r.l. (Italy); Giammanco, Francesco [University of Pisa, Department of Physics “E. Fermi” (Italy); Giorgetti, Emilia, E-mail: emilia.giorgetti@fi.isc.cnr.it [Institute of Complex Systems (ISC-CNR) (Italy)

    2015-05-15

    Gold nanoparticles have attracted enormous interest in biomedical applications, based on their unique optical properties. However, their toxicity on human tissues is still an open issue. Beyond the potential intrinsic toxicity of nanostructured gold, a non-negligible contribution of stabilizers or reaction by-products related to current wet chemical synthesis procedures can be expected. Aimed at isolating gold contribution from that of any other contaminant, we produced colloidal suspensions of Gold nanoparticles having average size <10 nm in deionized water or acetone by pulsed laser ablation, that permits preparation of uncoated and highly stable Gold nanoparticles in pure solvents. Subsequently, we investigated the role of surface chemistry, size, and dispersivity of synthesized Gold nanoparticles in exerting toxicity in a cell model system of deep respiratory tract, representing the main route of exposure to NPs, namely adenocarcinoma epithelial A549 cells. Gold nanoparticles prepared in water showed no particular signs of cytotoxicity, cytostasis, and/or genotoxicity as assessed by MTT colorimetric viability test and Cytokinesis-block micronucleus cytome assay up to concentrations of the order of 5 μg/mL. In contrast, Gold nanoparticles produced in pure acetone and then transferred into deionized water showed impaired cell viability, apoptosis responses, micronuclei, and dicentric chromosomes induction as well as nuclear budding, as a function of the amount of surface contaminants like amorphous carbon and enolate ions.

  18. Cyto- and genotoxicity assessment of Gold nanoparticles obtained by laser ablation in A549 lung adenocarcinoma cells

    International Nuclear Information System (INIS)

    Bucchianico, Sebastiano Di; Migliore, Lucia; Marsili, Paolo; Vergari, Chiara; Giammanco, Francesco; Giorgetti, Emilia

    2015-01-01

    Gold nanoparticles have attracted enormous interest in biomedical applications, based on their unique optical properties. However, their toxicity on human tissues is still an open issue. Beyond the potential intrinsic toxicity of nanostructured gold, a non-negligible contribution of stabilizers or reaction by-products related to current wet chemical synthesis procedures can be expected. Aimed at isolating gold contribution from that of any other contaminant, we produced colloidal suspensions of Gold nanoparticles having average size <10 nm in deionized water or acetone by pulsed laser ablation, that permits preparation of uncoated and highly stable Gold nanoparticles in pure solvents. Subsequently, we investigated the role of surface chemistry, size, and dispersivity of synthesized Gold nanoparticles in exerting toxicity in a cell model system of deep respiratory tract, representing the main route of exposure to NPs, namely adenocarcinoma epithelial A549 cells. Gold nanoparticles prepared in water showed no particular signs of cytotoxicity, cytostasis, and/or genotoxicity as assessed by MTT colorimetric viability test and Cytokinesis-block micronucleus cytome assay up to concentrations of the order of 5 μg/mL. In contrast, Gold nanoparticles produced in pure acetone and then transferred into deionized water showed impaired cell viability, apoptosis responses, micronuclei, and dicentric chromosomes induction as well as nuclear budding, as a function of the amount of surface contaminants like amorphous carbon and enolate ions

  19. Claudin-1 promotes TNF-α-induced epithelial-mesenchymal transition and migration in colorectal adenocarcinoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Bhat, Ajaz A. [Surgery, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Ahmad, Rizwan; Uppada, SrijayaPrakash B. [Departments of Biochemistry and Molecular Biology, University of Nebraska Medical Center, Omaha, NE 68022 (United States); Singh, Amar B. [From the Department of Veterans Affairs, University of Nebraska Medical Center, Omaha, NE 68022 (United States); Departments of Biochemistry and Molecular Biology, University of Nebraska Medical Center, Omaha, NE 68022 (United States); Buffet Cancer Center, University of Nebraska Medical Center, Omaha, NE 68022 (United States); Dhawan, Punita, E-mail: punita.dhawan@unmc.edu [From the Department of Veterans Affairs, University of Nebraska Medical Center, Omaha, NE 68022 (United States); Departments of Biochemistry and Molecular Biology, University of Nebraska Medical Center, Omaha, NE 68022 (United States); Buffet Cancer Center, University of Nebraska Medical Center, Omaha, NE 68022 (United States)

    2016-11-15

    Epithelial-mesenchymal transition (EMT) is an important mechanism in cancer progression and malignancy including colorectal cancer (CRC). Importantly, inflammatory mediators are critical constituents of the local tumor environment and an intimate link between CRC progression and inflammation is now validated. We and others have reported key role of the deregulated claudin-1 expression in colon carcinogenesis including colitis-associated colon cancer (CAC). However, the causal association between claudin-1 expression and inflammation-induced colon cancer progression remains unclear. Here we demonstrate, TNF-α, a pro-inflammatory cytokine, regulates claudin-1 to modulate epithelial to mesenchymal transition (EMT) and migration in colon adenocarcinoma cells. Importantly, colon cancer cells cultured in the presence of TNF-α (10 ng/ml), demonstrated a sharp decrease in E-cadherin expression and an increase in vimentin expression (versus control cells). Interestingly, TNF-α treatment also upregulated (and delocalized) claudin-1 expression in a time-dependent manner accompanied by increase in proliferation and wound healing. Furthermore, similar to our previous observation that claudin-1 overexpression in CRC cells induces ERK1/2 and Src- activation, signaling associated with colon cancer cell survival and transformation, TNF-α-treatment induced upregulation of phospho-ERK1/2 and -Src expression. The shRNA-mediated inhibition of claudin-1 expression largely abrogated the TNF-α-induced changes in EMT, proliferation, migration, p-Erk and p-Src expression. Taken together, our data demonstrate TNF-α mediated regulation of claudin-1 and tumorigenic abilities of colon cancer cells and highlights a key role of deregulated claudin-1 expression in inflammation-induced colorectal cancer growth and progression, through the regulation of the ERK and Src-signaling.

  20. Circulating tumor cells as a biomarker of response to treatment in patient-derived xenograft mouse models of pancreatic adenocarcinoma.

    Directory of Open Access Journals (Sweden)

    Robert J Torphy

    Full Text Available Circulating tumor cells (CTCs are cells shed from solid tumors into circulation and have been shown to be prognostic in the setting of metastatic disease. These cells are obtained through a routine blood draw and may serve as an easily accessible marker for monitoring treatment effectiveness. Because of the rapid progression of pancreatic ductal adenocarcinoma (PDAC, early insight into treatment effectiveness may allow for necessary and timely changes in treatment regimens. The objective of this study was to evaluate CTC burden as a biomarker of response to treatment with a oral phosphatidylinositol-3-kinase inhibitor, BKM120, in patient-derived xenograft (PDX mouse models of PDAC. PDX mice were randomized to receive vehicle or BKM120 treatment for 28 days and CTCs were enumerated from whole blood before and after treatment using a microfluidic chip that selected for EpCAM (epithelial cell adhesion molecule positive cells. This microfluidic device allowed for the release of captured CTCs and enumeration of these cells via their electrical impedance signatures. Median CTC counts significantly decreased in the BKM120 group from pre- to post-treatment (26.61 to 2.21 CTCs/250 µL, p = 0.0207 while no significant change was observed in the vehicle group (23.26 to 11.89 CTCs/250 µL, p = 0.8081. This reduction in CTC burden in the treatment group correlated with tumor growth inhibition indicating CTC burden is a promising biomarker of response to treatment in preclinical models. Mutant enriched sequencing of isolated CTCs confirmed that they harbored KRAS G12V mutations, identical to the matched tumors. In the long-term, PDX mice are a useful preclinical model for furthering our understanding of CTCs. Clinically, mutational analysis of CTCs and serial monitoring of CTC burden may be used as a minimally invasive approach to predict and monitor treatment response to guide therapeutic regimens.

  1. Claudin-1 promotes TNF-α-induced epithelial-mesenchymal transition and migration in colorectal adenocarcinoma cells

    International Nuclear Information System (INIS)

    Bhat, Ajaz A.; Ahmad, Rizwan; Uppada, SrijayaPrakash B.; Singh, Amar B.; Dhawan, Punita

    2016-01-01

    Epithelial-mesenchymal transition (EMT) is an important mechanism in cancer progression and malignancy including colorectal cancer (CRC). Importantly, inflammatory mediators are critical constituents of the local tumor environment and an intimate link between CRC progression and inflammation is now validated. We and others have reported key role of the deregulated claudin-1 expression in colon carcinogenesis including colitis-associated colon cancer (CAC). However, the causal association between claudin-1 expression and inflammation-induced colon cancer progression remains unclear. Here we demonstrate, TNF-α, a pro-inflammatory cytokine, regulates claudin-1 to modulate epithelial to mesenchymal transition (EMT) and migration in colon adenocarcinoma cells. Importantly, colon cancer cells cultured in the presence of TNF-α (10 ng/ml), demonstrated a sharp decrease in E-cadherin expression and an increase in vimentin expression (versus control cells). Interestingly, TNF-α treatment also upregulated (and delocalized) claudin-1 expression in a time-dependent manner accompanied by increase in proliferation and wound healing. Furthermore, similar to our previous observation that claudin-1 overexpression in CRC cells induces ERK1/2 and Src- activation, signaling associated with colon cancer cell survival and transformation, TNF-α-treatment induced upregulation of phospho-ERK1/2 and -Src expression. The shRNA-mediated inhibition of claudin-1 expression largely abrogated the TNF-α-induced changes in EMT, proliferation, migration, p-Erk and p-Src expression. Taken together, our data demonstrate TNF-α mediated regulation of claudin-1 and tumorigenic abilities of colon cancer cells and highlights a key role of deregulated claudin-1 expression in inflammation-induced colorectal cancer growth and progression, through the regulation of the ERK and Src-signaling.

  2. Laser capture microdissection of pancreatic ductal adeno-carcinoma cells to analyze EzH2 by Western Blot analysis.

    Science.gov (United States)

    Qazi, Aamer M; Aggarwal, Sita; Steffer, Christopher S; Bouwman, David L; Weaver, Donald W; Gruber, Scott A; Batchu, Ramesh B

    2011-01-01

    Pure populations of tumor cells are essential for the identification of tumor-associated proteins for the development of targeted therapy. In recent years, laser capture microdissection (LCM) has been used successfully to obtain distinct populations of cells for subsequent molecular analysis. The polycomb group (PcG) protein, enhancer of zeste homolog 2 (EzH2), a methyl-transferase that plays a key role in -transcriptional gene repression, is frequently overexpressed in several malignant tumors. High levels of EzH2 are often associated with advanced disease stage in many solid tumors; however, its role in the pathogenesis of pancreatic ductal adeno-carcinoma (PDAC) is poorly understood. Because of the limited sample availability and the absence of in vitro amplification steps for proteins, the use of LCM for proteomics studies largely depends on highly sensitive protein detection methods. Here, we developed a faster and sensitive Western blot protocol and validated it for the detection of EzH2 in ∼2,000 cells. Initially, cultured PANC-1 cells were used to optimize protein electrophoresis and western blotting conditions. Gradient gel electrophoresis in combination with optimized antibody concentrations, and a sensitive chemiluminescent assay provided a strong signal. In order to further confirm the role of EzH2 in PDAC, employing siRNA-mediated gene silencing via long lasting plasmid vectors containing shRNA, we investigated the potential role of EzH2 gene silencing in pancreatic cancer regression. Positive correlation of EzH2 expression was observed with advanced stage, serous histology, and increasing grade in pancreatic cancer patient tissues. Further EzH2 knockdown resulted in decreased cell growth and invasiveness. The findings of this study emphasize that western blotting of a LCM-generated pure population of cancer cells may be a valuable technique for the study of tumor-specific proteins.

  3. Different morphological changes of two colorectal adenocarcinoma cell lines after sodium butyrate treatment

    Czech Academy of Sciences Publication Activity Database

    Štokrová, Jitka; Sovová, Vlasta; Šloncová, Eva; Korb, Jan

    1999-01-01

    Roč. 4, č. 6 (1999), s. 669-674 ISSN 1107-3756 R&D Projects: GA ČR GV312/96/K205; GA ČR GA312/97/1188 Institutional research plan: CEZ:AV0Z5052915 Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.058, year: 1999

  4. Radiosensitivity of different human tumor cells lines grown as multicellular spheroids determined from growth curves and survival data

    International Nuclear Information System (INIS)

    Schwachoefer, J.H.C.; Crooijmans, R.P.; van Gasteren, J.J.; Hoogenhout, J.; Jerusalem, C.R.; Kal, H.B.; Theeuwes, A.G.

    1989-01-01

    Five human tumor cell lines were grown as multicellular tumor spheroids (MTS) to determine whether multicellular tumor spheroids derived from different types of tumors would show tumor-type dependent differences in response to single-dose irradiation, and whether these differences paralleled clinical behavior. Multicellular tumor spheroids of two neuroblastoma, one lung adenocarcinoma, one melanoma, and a squamous cell carcinoma of the oral tongue, were studied in terms of growth delay, calculated cell survival, and spheroid control dose50 (SCD50). Growth delay and cell survival analysis for the tumor cell lines showed sensitivities that correlated well with clinical behavior of the tumor types of origin. Similar to other studies on melanoma multicellular tumor spheroids our spheroid control dose50 results for the melanoma cell line deviated from the general pattern of sensitivity. This might be due to the location of surviving cells, which prohibits proliferation of surviving cells and hence growth of melanoma multicellular tumor spheroids. This study demonstrates that radiosensitivity of human tumor cell lines can be evaluated in terms of growth delay, calculated cell survival, and spheroid control dose50 when grown as multicellular tumor spheroids. The sensitivity established from these evaluations parallels clinical behavior, thus offering a unique tool for the in vitro analysis of human tumor radiosensitivity

  5. Scaffold-Free Coculture Spheroids of Human Colonic Adenocarcinoma Cells and Normal Colonic Fibroblasts Promote Tumorigenicity in Nude Mice

    Directory of Open Access Journals (Sweden)

    Jong-il Park

    2016-02-01

    Full Text Available The aim of this study was to form a scaffold-free coculture spheroid model of colonic adenocarcinoma cells (CACs and normal colonic fibroblasts (NCFs and to use the spheroids to investigate the role of NCFs in the tumorigenicity of CACs in nude mice. We analysed three-dimensional (3D scaffold-free coculture spheroids of CACs and NCFs. CAC Matrigel invasion assays and tumorigenicity assays in nude mice were performed to examine the effect of NCFs on CAC invasive behaviour and tumorigenicity in 3D spheroids. We investigated the expression pattern of fibroblast activation protein-α (FAP-α by immunohistochemical staining. CAC monocultures did not form densely-packed 3D spheroids, whereas cocultured CACs and NCFs formed 3D spheroids. The 3D coculture spheroids seeded on a Matrigel extracellular matrix showed higher CAC invasiveness compared to CACs alone or CACs and NCFs in suspension. 3D spheroids injected into nude mice generated more and faster-growing tumors compared to CACs alone or mixed suspensions consisting of CACs and NCFs. FAP-α was expressed in NCFs-CACs cocultures and xenograft tumors, whereas monocultures of NCFs or CACs were negative for FAP-α expression. Our findings provide evidence that the interaction between CACs and NCFs is essential for the tumorigenicity of cancer cells as well as for tumor propagation.

  6. The critical roles of activated stellate cells-mediated paracrine signaling, metabolism and onco-immunology in pancreatic ductal adenocarcinoma.

    Science.gov (United States)

    Fu, Yaojie; Liu, Shanshan; Zeng, Shan; Shen, Hong

    2018-02-19

    Pancreatic ductal adenocarcinoma (PDAC) is one of the most lethal malignant diseases worldwide. It is refractory to conventional treatments, and consequently has a documented 5-year survival rate as low as 7%. Increasing evidence indicates that activated pancreatic stellate cells (PSCs), one of the stromal components in tumor microenvironment (TME), play a crucial part in the desmoplasia, carcinogenesis, aggressiveness, metastasis associated with PDAC. Despite the current understanding of PSCs as a "partner in crime" to PDAC, detailed regulatory roles of PSCs and related microenvironment remain obscure. In addition to multiple paracrine signaling pathways, recent research has confirmed that PSCs-mediated tumor microenvironment may influence behaviors of PDAC via diverse mechanisms, such as rewiring metabolic networks, suppressing immune responses. These new activities are closely linked with treatment and prognosis of PDAC. In this review, we discuss the recent advances regarding new functions of activated PSCs, including PSCs-cancer cells interaction, mechanisms involved in immunosuppressive regulation, and metabolic reprogramming. It's clear that these updated experimental or clinical studies of PSCs may provide a promising approach for PDAC treatment in the near future.

  7. Inhibition of human colorectal adenocarcinoma cells with AdCMV-p53 gene transfection induced by irradiation

    International Nuclear Information System (INIS)

    Liu Bing; Min Fengling; Xie Yi; Zhou Qingming; Duan Xin; Chinese Academy of Sciences, Beijing; Zhang Hong; Li Wenjian; Hao Jifang; Zhou Guangming; Gao Qingxiang

    2006-01-01

    The effect of AdCMV-p53 gene transfection induced by γ-ray irradiation on human colorectal adenocarcinoma cells was investigated. The HT-29 cells were irradiated by 0.5, 1.0, 2.0 Gy 60 Co γ-rays, then were transfected with AdCMV-GFP (a replication of deficient recombinant adenoviral vector containing a CMV promoter and green fluorescent protein) or AdCMV-p53 (a replication of deficient recombinant adenoviral vector containing a CMV promoter and carrying human wild p53 gene). Cytotoxity was measured by clonogenic survival assay; apoptosis and the p53 expression were determined by flow cytometry. The results show that the pre-exposure of 0.5 Gy 60 Co γ-rays significantly enhanced the inhibition of HT-29 cells with AdCMV-53 transfection and promoted cell apoptosis. The inhibition rates for the groups of pre-exposure with 0.5 Gy and transfection with 40 and 80 MOI AdCMV-p53 were 50% and 20% higher than those for the groups of the mere transfection, and 40% more than the mere irradiation group. In the case of higher than 0.5 Gy pre-exposure, no significant difference was found between the pre-exposure with transfection group and the mere irradiation group. So 0.5 Gy pre-irradiation and AdCMV-p53 transfection obviously increases the inhibition of HT-29 cells with AdCMV-p53 transfection. The optimum condition is the lower than 1.0 Gy pre-exposure combined with the lower than 80 MOI AdCMV-p53 transfection. (authors)

  8. Effects of exogenous IL-37 on the biological characteristics of human lung adenocarcinoma A549 cells and the chemotaxis of regulatory T cells.

    Science.gov (United States)

    Chen, Yu-Hua; Zhou, Bi-Yun; Wu, Guo-Cai; Liao, De-Quan; Li, Jing; Liang, Si-Si; Wu, Xian-Jin; Xu, Jun-Fa; Chen, Yong-Hua; Di, Xiao-Qing; Lin, Qiong-Yan

    2018-02-14

    This study aims to investigate the effects of exogenous interleukin (IL)-37 on the biological characteristics of human lung adenocarcinoma A549 cells and the chemotaxis of regulatory T (Treg) cells. After isolating the CD4+ CD25+ Treg cells from the peripheral blood, flow cytometry was used to detect the purity of the Treg cells. A549 cells were divided into blank (no transfection), empty plasmid (transfection with pIRES2-EGFP empty plasmid) or IL-37 group (transfection with pIRES2-EGFP-IL-37 plasmid). RT-PCR was used to detect mRNA expression of IL-37 and ELISA to determine IL-37 and MMP-9 expressions. Western blotting was applied to detect the protein expressions of PCNA, Ki-67, Cyclin D1, CDK4, cleaved caspase-3 and cleaved caspase-9. MTT assay, flow cytometry, scratch test and transwell assay were performed to detect cell proliferation, cycle, apoptosis, migration and invasion. Effect of exogenous IL-37 on the chemotaxis of Treg cells was measured through transwell assay. Xenograft models in nude mice were eastablished to detect the impact of IL-37 on A549 cells. The IL-37 group had a higher IL-37 expression, cell apoptosis in the early stage and percentage of cells in the G0/G1 phase than the blank and empty plasmid groups. The IL-37 group had a lower MMP-9 expression, optical density (OD), percentage of cells in the S and G2/M phases, migration, invasion and chemotaxis of CD4+CD25+ Foxp3+ Treg cells. The xenograft volume and weight of nude mice in the IL-37 group were lower than those in the blank and empty plasmid groups. Compared with the blank and empty plasmid groups, the IL-37 group had significantly reduced expression of PCNA, Ki-67, Cyclin D1 and CDK4 but elevated expression of cleaved caspase-3 and cleaved caspase-9. Therefore, exogenous IL-37 inhibits the proliferation, migration and invasion of human lung adenocarcinoma A549 cells as well as the chemotaxis of Treg cells while promoting the apoptosis of A549 cells.

  9. Cellular radiosensitivity of small-cell lung cancer cell lines

    International Nuclear Information System (INIS)

    Krarup, Marianne; Poulsen, Hans Skovgaard; Spang-Thomsen, Mogens

    1997-01-01

    Purpose: The objective of this study was to determine the radiobiological characteristics of a panel of small-cell lung cancer (SCLC) cell lines by use of a clonogenic assay. In addition, we tested whether comparable results could be obtained by employing a growth extrapolation method based on the construction of continuous exponential growth curves. Methods and Materials: Fifteen SCLC cell lines were studied, applying a slightly modified clonogenic assay and a growth extrapolation method. A dose-survival curve was obtained for each experiment and used for calculating several survival parameters. The multitarget single hit model was applied to calculate the cellular radiosensitivity (D 0 ), the capacity for sublethal damage repair (D q ), and the extrapolation number (n). Values for α and β were determined from best-fit curves according to the linear-quadratic model and these values were applied to calculate the surviving fraction after 2-Gy irradiation (SF 2 ). Results: In our investigation, the extrapolation method proved to be inappropriate for the study of in vitro cellular radiosensitivity due to lack of reproducibility. The results obtained by the clonogenic assay showed that the cell lines studied were radiobiologically heterogeneous with no discrete features of the examined parameters including the repair capacity. Conclusion: The results indicate that SCLC tumors per se are not generally candidates for hyperfractionated radiotherapy

  10. Clear Cell Adenocarcinoma Arising from Endometriosis in the Groin: Wide Resection and Reconstruction with a Fascia Lata Tensor Muscle Skin Flap

    Directory of Open Access Journals (Sweden)

    Shozo Yoshida

    2018-01-01

    Full Text Available We herein report a case of clear cell carcinoma arising from endometriosis in the groin in a 53-year-old woman. The findings of MRI and FDG/PET-CT indicated a malignant tumor, and surgical biopsy confirmed adenocarcinoma of the female genital tract. The tumor including a part of the abdominal rectus muscle and rectus sheath, subcutaneous fat, skin, and the right inguinal ligament was resected en bloc. The defect in the abdominal wall was reconstructed with a fascia lata tensor muscle skin flap. The tumor was composed of clear cell adenocarcinoma arising from extrapelvic endometriosis. The patient received chemotherapy with gemcitabine and carboplatin for 6 cycles and had no evidence of recurrence 7 months after the treatment. We herein described the diagnosis and surgical management of endometriosis-associated carcinoma in the groin.

  11. In vitro radiosensitivity of human leukemia cell lines

    International Nuclear Information System (INIS)

    Weichselbaum, R.R.; Greenberger, J.S.; Schmidt, A.; Karpas, A.; Moloney, W.C.; Little, J.B.

    1981-01-01

    The in vitro radiobiologic survival values (anti n, D 0 ) of four tumor lines derived from human hematopoietic tumors were studied. These cell lines were HL60 promyelocytic leukemia; K562 erythroleukemia; 45 acute lymphocytic leukemia; and 176 acute monomyelogenous leukemia. More cell lines must be examined before the exact relationship between in vitro radiosensitivity and clinical radiocurability is firmly established

  12. Cytotoxic and Apoptosis-Inducing Activity of Plants from the Family Asparagaceae in Relation to Human Alveolar Adenocarcinoma Cells

    Directory of Open Access Journals (Sweden)

    Y.N. Kamalova

    2016-06-01

    Full Text Available Cancer is known as the second major mortality cause. The number of new cases is increasing every year. Thus, it is urgent for scientists to search for alternative drugs with selective antitumor action and minimal side effects. It is known that some plant metabolites exhibit antioxidant, cytotoxic, and antitumor activity, while at the same time being less toxic than modern allopathic drugs. In this work, we have investigated the cytotoxic and apoptosis-inducing effects of extracts obtained from plants of the family Asparagaceae on A549 human lung adenocarcinoma cells. The analysis has been performed using flow cytofluorometry. If extracts showed cytotoxicity, the apoptosis-inducing action has been evaluated at the concentration of 50 μg/mL; in other cases, the analyzed concentration range was 50–300 μg/mL. On the basis of the experiments carried out, the following conclusions have been made. Extracts of the leaves and rhizomes of Sansevieria cylindrica and Sansevieria trifasciata do not possess antitumor activity. Extracts of the leaves of Polianthes tuberosa and Furcraea gigantea, which were cytotoxic at high concentrations, cause cell death at 50 μg/mL in the amount of 21.35 ± 1.86 and 15.6 ± 3.23, respectively. Extracts of Polianthes tuberosa bulbs and Yucca filamentosa leaves are able to induce apoptosis at higher concentrations. When the concentration reaches 100 μg/mL, the proportion of apoptotic cells for these plants is 45.76 ± 1.34 and 11.33 ± 0.07, respectively. The number of dead cells at the concentration of 300 μg/mL increased up to 73.33 ± 3.05 and 81.75 ± 4.07. The results have great importance for development of new drugs based on metabolites from these plant extracts.

  13. Rho Kinase ROCK2 Mediates Acid-Induced NADPH Oxidase NOX5-S Expression in Human Esophageal Adenocarcinoma Cells.

    Directory of Open Access Journals (Sweden)

    Jie Hong

    Full Text Available Mechanisms of the progression from Barrett's esophagus (BE to esophageal adenocarcinoma (EA are not fully understood. We have shown that NOX5-S may be involved in this progression. However, how acid upregulates NOX5-S is not well known. We found that acid-induced increase in NOX5-S expression was significantly decreased by the Rho kinase (ROCK inhibitor Y27632 in BE mucosal biopsies and FLO-1 EA cells. In addition, acid treatment significantly increased the Rho kinase activity in FLO-1 cells. The acid-induced increase in NOX5-S expression and H2O2 production was significantly decreased by knockdown of Rho kinase ROCK2, but not by knockdown of ROCK1. Conversely, the overexpression of the constitutively active ROCK2, but not the constitutively active ROCK1, significantly enhanced the NOX5-S expression and H2O2 production. Moreover, the acid-induced increase in Rho kinase activity and in NOX5-S mRNA expression was blocked by the removal of calcium in both FLO-1 and OE33 cells. The calcium ionophore A23187 significantly increased the Rho kinase activity and NOX5-S mRNA expression. We conclude that acid-induced increase in NOX5-S expression and H2O2 production may depend on the activation of ROCK2, but not ROCK1, in EA cells. The acid-induced activation of Rho kinase may be mediated by the intracellular calcium increase. It is possible that persistent acid reflux present in BE patients may increase the intracellular calcium, activate ROCK2 and thereby upregulate NOX5-S. High levels of reactive oxygen species derived from NOX5-S may cause DNA damage and thereby contribute to the progression from BE to EA.

  14. Comparison of intracellular signalling by insulin and the hypermitogenic AspB10 analogue in MCF-7 breast adenocarcinoma cells.

    Science.gov (United States)

    Oleksiewicz, Martin B; Bonnesen, Christine; Hegelund, Anne Charlotte; Lundby, Anders; Holm, Gitte-Mai Nelander; Jensen, Marianne B; Krabbe, Jonas S

    2011-05-01

    We compared mitogenicity and intracellular signalling by human insulin and the AspB10 (X-10) human insulin analogue in MCF-7 human mammary adenocarcinoma cells. By flow analysis of phosphorylated histone H3 or cell cycle distributions, insulin and X-10 were mitogenic at physiologically relevant concentrations (2 nm to 74 pm range), with X-10 being approximately 3-fold more mitogenic than insulin. By western blotting with phospho-specific antibodies, insulin induced phosphorylation of IRS-1, Akt, p70S6K, S6 ribosomal protein, 4E-BP1, FoxO3a, FoxO1, p44/42 MAPK and the EGFR. Blocking with wortmannin, rapamycin and U0126 showed that these signalling events conformed to the canonical PI3K pathway. IRS-1 (Ser302) phosphorylation was abolished by wortmannin and rapamycin, suggesting a feedback from the PI3K pathway on insulin signalling. Compared with equimolar insulin, X-10 caused up to 2-fold higher phosphorylation of all proteins examined in this study. The phosphorylation sites that responded most strongly to insulin were not generally the same as those responding most strongly to X-10. In the PI3K pathway, the most X-10-sensitive protein localized to the translation-regulating arm (p70S6K), with FoxO3a and FoxO1 transcription factors showing a more comparable response to insulin and X-10. Using flow analysis, we confirmed the correlation between insulin-triggered translational activation in G0/G1 (S6 phosphorylation) and S-phase entry by MCF-7 cells. In summary, our findings implicate asymmetrical PI3K pathway activation and specifically stimulation of protein translation in the hypermitogenic effect of insulin analogues such as X-10. It remains to be shown whether these findings are relevant to other human mammary cancer cell types. Copyright © 2010 John Wiley & Sons, Ltd.

  15. Prostatic adenocarcinoma (PCa metastasizing to renal cell carcinoma (RCC with periureteral tumor deposit: A case of tumor-to-tumor metastasis (TTM

    Directory of Open Access Journals (Sweden)

    Jenissa Amor Dionisio Arceño, MD

    2017-06-01

    Full Text Available Renal cell carcinoma (RCC and prostatic adenocarcinoma (PCa, occurring as a double primary is uncommon, but well documented. However, metastatic PCa in a RCC is quite rare. We report a case of an 81-year old male chemical engineer with history of hematuria and prostatomegaly suspicious for carcinoma, who underwent left radical nephrectomy for a renal mass. Histopathology revealed RCC that harbored an undiagnosed PCa. Periureteral tumor deposit likewise showed combined metastasis of RCC and PCa.

  16. Analysis of renal cancer cell lines from two major resources enables genomics-guided cell line selection

    Science.gov (United States)

    Sinha, Rileen; Winer, Andrew G.; Chevinsky, Michael; Jakubowski, Christopher; Chen, Ying-Bei; Dong, Yiyu; Tickoo, Satish K.; Reuter, Victor E.; Russo, Paul; Coleman, Jonathan A.; Sander, Chris; Hsieh, James J.; Hakimi, A. Ari

    2017-05-01

    The utility of cancer cell lines is affected by the similarity to endogenous tumour cells. Here we compare genomic data from 65 kidney-derived cell lines from the Cancer Cell Line Encyclopedia and the COSMIC Cell Lines Project to three renal cancer subtypes from The Cancer Genome Atlas: clear cell renal cell carcinoma (ccRCC, also known as kidney renal clear cell carcinoma), papillary (pRCC, also known as kidney papillary) and chromophobe (chRCC, also known as kidney chromophobe) renal cell carcinoma. Clustering copy number alterations shows that most cell lines resemble ccRCC, a few (including some often used as models of ccRCC) resemble pRCC, and none resemble chRCC. Human ccRCC tumours clustering with cell lines display clinical and genomic features of more aggressive disease, suggesting that cell lines best represent aggressive tumours. We stratify mutations and copy number alterations for important kidney cancer genes by the consistency between databases, and classify cell lines into established gene expression-based indolent and aggressive subtypes. Our results could aid investigators in analysing appropriate renal cancer cell lines.

  17. Extracts of Opuntia humifusa Fruits Inhibit the Growth of AGS Human Gastric Adenocarcinoma Cells.

    Science.gov (United States)

    Hahm, Sahng-Wook; Park, Jieun; Park, Kun-Young; Son, Yong-Suk; Han, Hyungchul

    2016-03-01

    Opuntia humifusa (OHF) has been used as a nutraceutical source for the prevention of chronic diseases. In the present study, the inhibitory effects of ethyl acetate extracts of OHF on the proliferation of AGS human gastric cancer cells and the mode of action were investigated. To elucidate the antiproliferative mechanisms of OHF in cancer cells, the expression of genes related to apoptosis and cell cycle arrest were determined with real-time PCR and western blot. The cytotoxic effect of OHF on AGS cells was observed in a dose-dependent manner. Exposure to OHF (100 μg/mL) significantly induced (P<0.05) the G1 phase cell cycle arrest. Additionally, the apoptotic cell population was greater (P<0.05) in OHF (200 μg/mL) treated AGS cells when compared to the control. The expression of genes associated with cell cycle progression (Cdk4, Cdk2, and cyclin E) was significantly downregulated (P<0.05) by the OHF treatment. Moreover, the expression of Bax and caspase-3 in OHF treated cells was higher (P<0.05) than in the control. These findings suggest that OHF induces the G1 phase cell cycle arrest and activation of mitochondria-mediated apoptosis pathway in AGS human gastric cancer cells.

  18. Cytological Study of Grade 3 Endometrioid Adenocarcinoma of Endometrial Origin: Cytoarchitecture and Features of Cell Clusters Assessed With Endometrial Brushing Cytology--Focusing on a comparison with endometrioid adenocarcinoma Grade 1, 2.

    Science.gov (United States)

    Matsui, Naruaki; Kajiwara, Hiroshi; Morishita, Akihiro; Tsukada, Hitomi; Nakazawa, Kazumi; Miyazawa, Masaki; Mikami, Mikio; Nakamura, Naoya; Sato, Shinkichi

    2015-06-20

    Aim of study was to clarify the cytological characteristics of grade 3 endometrioid adenocarcinoma of endometrial origin (G3 EA) by endometrial brushing cytology. The subjects were 11 patients in whom G3 EA was diagnosed by review of preoperative cytological specimens obtained at our hospital and related institutions between 2000 and 2010. These patients were investigated with respect to the preoperative cytological diagnosis, background changes, cell cluster patterns, and individual cellular findings. Background changes were classified as inflammatory or tumorous, while cell clusters were classified as overlapping cell cluster, sheet-like cell cluster, clump of high dense gland, papillary, or other cell cluster. Cellular findings were investigated by comparing the incidence of squamous and clear cell metaplasia, the nuclear rounding rate, and the nuclear area with the findings in a control group (35 patients with G1-2 EA). Background changes were classified as inflammatory in 63.6% and necrotic in 36.4%. The cell clusters were classified as overlapping cell cluster in 44.8%, cell cluster in 21.7%, clump of high dense gland in 10.0%, papillary in 4.0%, and other cell cluster in 19.5%. The incidence of squamous and clear cell metaplasia was 27.2% and 18.1%, respectively. The mean nuclear rounding rate was 0.97, and the mean nuclear area was 55.98 µm2. Investigation of the cytoarchitecture of G3 EA with endometrial brushing cytology revealed overlapping cell cluster and tumor cells of a relatively uniform size. These findings suggest that it is necessary to recognize that there are differences between the cytological findings of G3 EA and the usual features of G1-2 EA.

  19. Renal cell carcinoma

    Science.gov (United States)

    ... lining of very small tubes (tubules) in the kidney. ... Kidney cancer; Hypernephroma; Adenocarcinoma of renal cells; Cancer - kidney ... Follow your provider's recommendations in the treatment of kidney disorders, especially those that may require dialysis.

  20. The extracellular matrix and focal adhesion kinase signaling regulate cancer stem cell function in pancreatic ductal adenocarcinoma.

    Directory of Open Access Journals (Sweden)

    Asma Begum

    Full Text Available Cancer stem cells (CSCs play an important role in the clonogenic growth and metastasis of pancreatic ductal adenocarcinoma (PDAC. A hallmark of PDAC is the desmoplastic reaction, but the impact of the tumor microenvironment (TME on CSCs is unknown. In order to better understand the mechanisms, we examined the impact of extracellular matrix (ECM proteins on PDAC CSCs. We quantified the effect of ECM proteins, β1-integrin, and focal adhesion kinase (FAK on clonogenic PDAC growth and migration in vitro and tumor initiation, growth, and metastasis in vivo in nude mice using shRNA and overexpression constructs as well as small molecule FAK inhibitors. Type I collagen increased PDAC tumor initiating potential, self-renewal, and the frequency of CSCs through the activation of FAK. FAK overexpression increased tumor initiation, whereas a dominant negative FAK mutant or FAK kinase inhibitors reduced clonogenic PDAC growth in vitro and in vivo. Moreover, the FAK inhibitor VS-4718 extended the anti-tumor response to gemcitabine and nab-paclitaxel in patient-derived PDAC xenografts, and the loss of FAK expression limited metastatic dissemination of orthotopic xenografts. Type I collagen enhances PDAC CSCs, and both kinase-dependent and independent activities of FAK impact PDAC tumor initiation, self-renewal, and metastasis. The anti-tumor impact of FAK inhibitors in combination with standard chemotherapy support the clinical testing of this combination.

  1. A comparative Analysis by SAGE of Gene Expression Profiles of Esophageal Adenocarcinoma and Esophageal Squamous Cell Carcinoma

    Directory of Open Access Journals (Sweden)

    Jantine W. P. M. van Baal

    2008-01-01

    Full Text Available Esophageal adenocarcinoma (EA and esophageal squamous cell carcinoma (ESCC are the two main types of esophageal cancer. Despite extensive research the exact molecular basis of these cancers is unclear. Therefore we evaluated the transcriptome of EA in comparison to non-dysplastic Barrett’s esophagus (BE, the metaplastic epithelium that predisposes for EA, and compared the transcriptome of ESCC to normal esophageal squamous epithelium. For obtaining the transcriptomes tissue biopsies were used and serial analysis of gene expression (SAGE was applied. Validation of results by RT-PCR and immunoblotting was performed using tissues of an additional 23 EA and ESCC patients. Over 58,000 tags were sequenced. Between EA and BE 1013, and between ESCC and normal squamous epithelium 1235 tags were significantly differentially expressed (p < 0.05. The most up-regulated genes in EA compared to BE were SRY-box 4 and Lipocalin2, whereas the most down-regulated genes in EA were Trefoil factors and Annexin A10. The most up-regulated genes in ESCC compared to normal squamous epithelium were BMP4, E-Cadherin and TFF3. The results could suggest that the BE expression profile is closer related to normal squamous esophagus then to EA. In addition, several uniquely expressed genes are identified.

  2. SUN1 silencing inhibits cell growth through G0/G1 phase arrest in lung adenocarcinoma [Retraction

    Directory of Open Access Journals (Sweden)

    Huang W

    2017-12-01

    Full Text Available Huang W, Huang H, Wang L, Hu J, Song W. SUN1 silencing inhibits cell growth through G0/G1 phase arrest in lung adenocarcinoma. OncoTargets and Therapy. 2017;10:2825–2833.This article has been retracted at the request of the Editor-in-Chief of OncoTargets and Therapy. It was brought to the attention of the Editorial team by the authors that in Lentivirus package and transfection part of the Materials and Methods section, the authors noted “a nontargeting shRNA (5′-GCGGAGGGTTTGAAAGAATATCTCGAGATATTCTTTCAAACCCTCCGCTTTTTT-3′ was used as control”. Recently the authors were advised by the supplier of the lentivirus there was an error in the illustration concerning the control group sequence. The correct sequence should be TTCTCCGAACGTGTCACGTCTCGAGACGTGACACGTTCGGAGAATTTTT rather than GCGGAGGGTTTGAAAGAATATCTCGAGATATTCTTTCAAACCCTCCGCTTTTTT. The authors cannot confirm that the sequence carried by the control group lentivirus was TTCTCCGAACGTGTCACGTCTCGA GACGTGACACGTTCGGAGAATTTTT so they have decided to respectfully retract this original research paper and perform the experiments again to retest the data. This retraction relates to

  3. Extracts of Opuntia humifusa Fruits Inhibit the Growth of AGS Human Gastric Adenocarcinoma Cells

    OpenAIRE

    Hahm, Sahng-Wook; Park, Jieun; Park, Kun-Young; Son, Yong-Suk; Han, Hyungchul

    2016-01-01

    Opuntia humifusa (OHF) has been used as a nutraceutical source for the prevention of chronic diseases. In the present study, the inhibitory effects of ethyl acetate extracts of OHF on the proliferation of AGS human gastric cancer cells and the mode of action were investigated. To elucidate the antiproliferative mechanisms of OHF in cancer cells, the expression of genes related to apoptosis and cell cycle arrest were determined with real-time PCR and western blot. The cytotoxic effect of OHF o...

  4. Promoter hypermethylation of DNA repair genes MLH1 and MSH2 in adenocarcinomas and squamous cell carcinomas of the lung

    Directory of Open Access Journals (Sweden)

    A. Gomes

    2014-01-01

    Full Text Available Five years survival of lung cancer is 16%, significantly lower than in prostate (99.9%, breast (88.5% and colon (64.1% carcinomas. When diagnosed in the surgical stage it increases to 50% but this group only comprises 14–16% of the cases. DNA methylation has emerged as a potential cancer-specific biomarker. Hypermethylation of CpG islands located in the promoter regions of tumour suppressor genes is now firmly established as an important mechanism for gene inactivation.This retrospective study included 40 squamous cell carcinomas and 40 adenocarcinomas in various surgical TNM stages to define methylation profile and possible silencing of DNA repair genes – MLH1 and MSH2 – using Methylation-Specific PCR and protein expression by immunohistochemistry in tumoural tissue, preneoplastic lesions and respiratory epithelium with normal histological features.The protein expression of MLH1 and MSH2 genes, in the available preneoplastic lesions and in normal cylindrical respiratory epithelium appeared reduced. The frequency of promoter hypermethylation found on these DNA repair genes was elevated, with a higher prevalence of methylation of MLH1 gene in 72% of squamous cell carcinoma. The differences are not so obvious for MSH2 promoter hypermethylation. No correlation was found among the status of methylation, the protein expression and the clinicopathological characteristics.With a larger study, a better characterization of the hypermethylation status of neoplastic and preneoplastic lesions in small biopsies would be achieved, inherent to tumour histology, heterogeneity and preservation, and finally differences in the study population to elucidate other possible mechanisms of altered expression of the hMLH1 and hMSH. Resumo: A sobrevivência aos cinco anos no cancro do pulmão é de 16%, significativamente inferior que nos carcinomas na próstata (99,9%, mama (88,5% e cólon (64,1%. Quando diagnosticado na fase cir

  5. Antiproliferative and Proapoptotic Activities of Marine Sponge Hyrtios erectus Extract on Breast Carcinoma Cell Line (MCF-7)

    Science.gov (United States)

    Muthiyan, Ramachandran; Nambikkairaj, Balwin; Mahanta, Nilkamal; Immanuel, Titus; Mandal, Rahul Shubhra; Kumaran, Kubendiran; De, Arun Kumar

    2017-01-01

    Background: Marine sponge is a rich natural resource of many pharmacologically important compounds. Objective: Marine sponge Hyrtios erectus, collected from North Bay, South Andaman Sea, India, was screened for potential antiproliferative and proapoptotic properties on a breast adenocarcinoma cell line (MCF-7). Materials and Methods: 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay was used to test the antiproliferative and cytotoxicity effects of the sponge extract. Analysis of apoptosis and cell cycle stages were done by flow cytometry. The expression of several apoptotic-related proteins in MCF-7 cells treated by the extract was evaluated by Western blot analysis. Various analytical techniques including Fourier transform infrared spectroscopy, gas chromatography-mass spectrometry, and nuclear magnetic resonance were employed to determine the identity of the active compounds in the sponge extract. Results: N-Hexane extract of the sponge inhibited proliferation of the MCF-7 cell line in a dose- and time-dependent manner. Exposure of the sponge extract triggered apoptosis of the MCF-7 cells, induced DNA fragmentation, and arrested the cells in G2/M phase. Treatment of the sponge extract induced downregulation of antiapoptotic Bcl-2 protein and upregulation of Bax, caspase-3, caspase-9, and fragmented poly(ADP ribose)polymerase proteins in MCF-7 cells. Five bioactive compounds have been identified in the extract. Conclusion: The antiproliferative and proapoptotic activities of the tested extract suggested the pharmacologic potential of the identified compounds. Further characterization of the identified compounds are in progress. SUMMARY The N-hexane extract of the marine sponge Hyrtios erectus, collected from North Bay, South Andaman Sea, India, showed potential antiproliferative and proapoptotic properties against a breast adenocarcinoma cell line (MCF-7).The sponge extract retarded the growth of breast carcinoma cell line MCF-7 cells in a time

  6. Antiproliferative and Proapoptotic Activities of Marine SpongeHyrtios erectusExtract on Breast Carcinoma Cell Line (MCF-7).

    Science.gov (United States)

    Muthiyan, Ramachandran; Nambikkairaj, Balwin; Mahanta, Nilkamal; Immanuel, Titus; Mandal, Rahul Shubhra; Kumaran, Kubendiran; De, Arun Kumar

    2017-01-01

    Marine sponge is a rich natural resource of many pharmacologically important compounds. Marine sponge Hyrtios erectus , collected from North Bay, South Andaman Sea, India, was screened for potential antiproliferative and proapoptotic properties on a breast adenocarcinoma cell line (MCF-7). 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay was used to test the antiproliferative and cytotoxicity effects of the sponge extract. Analysis of apoptosis and cell cycle stages were done by flow cytometry. The expression of several apoptotic-related proteins in MCF-7 cells treated by the extract was evaluated by Western blot analysis. Various analytical techniques including Fourier transform infrared spectroscopy, gas chromatography-mass spectrometry, and nuclear magnetic resonance were employed to determine the identity of the active compounds in the sponge extract. N -Hexane extract of the sponge inhibited proliferation of the MCF-7 cell line in a dose- and time-dependent manner. Exposure of the sponge extract triggered apoptosis of the MCF-7 cells, induced DNA fragmentation, and arrested the cells in G 2 /M phase. Treatment of the sponge extract induced downregulation of antiapoptotic Bcl-2 protein and upregulation of Bax, caspase-3, caspase-9, and fragmented poly(ADP ribose)polymerase proteins in MCF-7 cells. Five bioactive compounds have been identified in the extract. The antiproliferative and proapoptotic activities of the tested extract suggested the pharmacologic potential of the identified compounds. Further characterization of the identified compounds are in progress. The N -hexane extract of the marine sponge Hyrtios erectus , collected from North Bay, South Andaman Sea, India, showed potential antiproliferative and proapoptotic properties against a breast adenocarcinoma cell line (MCF-7).The sponge extract retarded the growth of breast carcinoma cell line MCF-7 cells in a time- and dose-dependent manner.The sponge extract induced apoptosis of

  7. Effects of Urtica dioica dichloromethane extract on cell apoptosis and related gene expression in human breast cancer cell line (MDA-MB-468).

    Science.gov (United States)

    Mohammadi, A; Mansoori, B; Goldar, S; Shanehbandi, D; Khaze, V; Mohammadnejad, L; Baghbani, E; Baradaran, B

    2016-02-29

    Breast cancer is the most common cancer among women in worldwide, especially in developing countries. Therefore, a large number of anticancer agents with herbal origins have been reported against this deadly disease. This study is the first to examine the cytotoxic and apoptotic effects of Urtica dioica in MDA-MB-468, human breast adenocarcinoma cells. The 3-(4,5-dimethylethiazol-2 yl)-2,5- diphenyltetrazolium (MTT) reduction and trypan-blue exclusion assay were performed in MDA-MB-468 cells as well as control cell line L929 to analyze the cytotoxic activity of the dichloromethane extract. In addition, Apoptosis induction of Urtica dioica on the MDA-MB-468 cells was assessed using TUNEL (terminal deoxy transferase (TdT)-mediated dUTP nick- end labeling) assay and DNA fragmentation analysis and real-time polymerase chain reaction (PCR). The results showed that the extract significantly inhibited cell growth and viability without inducing damage to normal control cells. Nuclei Staining in TUNEL and DNA fragments in DNA fragmentation assay and increase in the mRNA expression levels of caspase-3, caspase-9, decrease in the bcl2 and no significant change in the caspase-8 mRNA expression level, showed that the induction of apoptosis was the main mechanism of cell death that induce by Urtica dioica extract. Our results suggest that urtica dioica dichloromethane extract may contain potential bioactive compound(s) for the treatment of breast adenocarcinoma.

  8. Urokinase plasminogen activator receptor on invasive cancer cells: A prognostic factor in distal gastric adenocarcinoma

    DEFF Research Database (Denmark)

    Alpizar, Warner Enrique Alpizar; Christensen, Ib Jarle; Santoni-Rugiu, Eric

    2012-01-01

    association between the expression of uPAR on tumor cells in the peripheral invasion zone and overall survival of gastric cancer patients (HR = 2.16; 95% CI: 1.13-4.14; p = 0.02). Multivariate analysis showed that uPAR immunoreactivity in cancer cells at the invasive front is an independent prognostic factor...

  9. Effects of radiation on the expression of antigens on the membranes of human adenocarcinoma cells

    International Nuclear Information System (INIS)

    Hareyama, Masato; Imai, Kozo; Oouchi, Atsushi; Shidou, Mitsuo; Takahashi, Hiroki; Koshiba, Hirohumi; Yachi, Akira; Morita, Kazuo

    1992-01-01

    We have investigated the effects of irradiation on the membranes of tumor cells. X-ray irradiation caused remarkable increases in the expression of tumor-associated antigens (YH206, CEA) and c-erbB-2 protein by flow cytometry, whereas IFN had no obvious effect on the expression of tumor-associated antigens and c-erbB-2 protein. On the other hand, the expression of MHC Class I and ICAM-1 antigen on the membrane by flow cytometry was enhanced by both irradiation and IFN. In addition, the irradiated cells, when analyzed using a CEA specific probe, showed remarkable increases in the CEA mRNA compared to IFN-treated cells. It is possible that enhancement of the expression of tumor-associated antigens and c-erbB-2 protein, together with the enhancement of that of MHC-Class I and ICAM-1, would help cytotoxic killer cells recognize the tumor cells. (author)

  10. Cellular uptake and cytotoxicity of positively charged chitosan gold nanoparticles in human lung adenocarcinoma cells

    International Nuclear Information System (INIS)

    Choi, Seon Young; Jang, Soo Hwa; Park, Jin; Jeong, Saeromi; Park, Jin Ho; Ock, Kwang Su; Lee, Kangtaek; Yang, Sung Ik; Joo, Sang-Woo; Ryu, Pan Dong; Lee, So Yeong

    2012-01-01

    Cellular uptake, cytotoxicity, and mechanisms of cytotoxicity of the positively charged Au nanoparticles (NPs) were examined in A549 cells, which are one of the most characterized pulmonary cellular systems. Positively charged Au NPs were prepared by chemical reduction using chitosan. The dimension and surface charge of Au NPs were examined by transmission electron microscopy (TEM), dynamic light scattering, and zeta potential measurements. The uptake of Au NPs into A549 cells was also monitored using TEM and dark-field microscopy (DFM) and z-stack confocal microRaman spectroscopy. DFM live cell imaging was also performed to monitor the entry of chitosan Au NPs in real time. The cytotoxic assay, using both methylthiazol tetrazolium and lactate dehydrogenase assays revealed that positively charged Au NPs decreased cell viability. Flow cytometry, DNA fragmentation, real-time PCR, and western blot analysis suggest that positively charged chitosan Au NPs provoke cell damage through both apoptotic and necrotic pathways.

  11. Cellular uptake and cytotoxicity of positively charged chitosan gold nanoparticles in human lung adenocarcinoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Seon Young; Jang, Soo Hwa [Seoul National University, Laboratory of Veterinary Pharmacology, College of Veterinary Medicine and Institute for Veterinary Science (Korea, Republic of); Park, Jin; Jeong, Saeromi; Park, Jin Ho; Ock, Kwang Su [Soongsil University, Department of Chemistry (Korea, Republic of); Lee, Kangtaek [Yonsei University, Department of Chemical and Biomolecular Engineering (Korea, Republic of); Yang, Sung Ik [Kyung Hee University, College of Environment and Applied Chemistry (Korea, Republic of); Joo, Sang-Woo, E-mail: sjoo@ssu.ac.kr [Soongsil University, Department of Chemistry (Korea, Republic of); Ryu, Pan Dong; Lee, So Yeong, E-mail: leeso@snu.ac.kr [Seoul National University, Laboratory of Veterinary Pharmacology, College of Veterinary Medicine and Institute for Veterinary Science (Korea, Republic of)

    2012-12-15

    Cellular uptake, cytotoxicity, and mechanisms of cytotoxicity of the positively charged Au nanoparticles (NPs) were examined in A549 cells, which are one of the most characterized pulmonary cellular systems. Positively charged Au NPs were prepared by chemical reduction using chitosan. The dimension and surface charge of Au NPs were examined by transmission electron microscopy (TEM), dynamic light scattering, and zeta potential measurements. The uptake of Au NPs into A549 cells was also monitored using TEM and dark-field microscopy (DFM) and z-stack confocal microRaman spectroscopy. DFM live cell imaging was also performed to monitor the entry of chitosan Au NPs in real time. The cytotoxic assay, using both methylthiazol tetrazolium and lactate dehydrogenase assays revealed that positively charged Au NPs decreased cell viability. Flow cytometry, DNA fragmentation, real-time PCR, and western blot analysis suggest that positively charged chitosan Au NPs provoke cell damage through both apoptotic and necrotic pathways.

  12. Nanostructured delivery system for zinc phthalocyanine: preparation, characterization, and phototoxicity study against human lung adenocarcinoma A549 cells

    Directory of Open Access Journals (Sweden)

    Mariana da Volta Soares

    2011-01-01

    Full Text Available Mariana da Volta Soares1, Mainara Rangel Oliveira1, Elisabete Pereira dos Santos1, Lycia de Brito Gitirana2, Gleyce Moreno Barbosa3, Carla Holandino Quaresma3, Eduardo Ricci-Júnior11Department of Medicines, Laboratório de Desenvolvimento Galênico (LADEG, Faculty of Pharmacy, 2Laboratory of Animal and Comparative Histology, Glycobiology Research Program, Institute of Biomedical Science, 3Department of Medicines, Laboratório Multidisciplinar de Ciências Farmacêuticas, Faculty of Pharmacy, Federal University of Rio de Janeiro (UFRJ, Rio de Janeiro, BrazilAbstract: In this study, zinc phthalocyanine (ZnPc was loaded onto poly-ε-caprolactone (PCL nanoparticles (NPs using a solvent emulsification–evaporation method. The process yield and encapsulation efficiency were 74.2% ± 1.2% and 67.1% ± 0.9%, respectively. The NPs had a mean diameter of 187.4 ± 2.1 nm, narrow distribution size with a polydispersity index of 0.096 ± 0.004, zeta potential of -4.85 ± 0.21 mV, and spherical shape. ZnPc has sustained release, following Higuchi’s kinetics. The photobiological activity of the ZnPc-loaded NPs was evaluated on human lung adenocarcinoma A549 cells. Cells were incubated with free ZnPc or ZnPc-loaded NPs for 4 h and then washed with phosphate-buffered saline. Culture medium was added to the wells containing the cells. Finally, the cells were exposed to red light (660 nm with a light dose of 100 J/cm2. The cellular viability was determined after 24 h of incubation. ZnPc-loaded NPs and free photosensitizer eliminated about 95.9% ± 1.8% and 28.7% ± 2.2% of A549 cells, respectively. The phototoxicity was time dependent up to 4 h and concentration dependent at 0–5 µg ZnPc. The cells viability decreased with the increase of the light dose in the range of 10–100 J/cm2. Intense lysis was observed in the cells incubated with the ZnPc-loaded NPs and irradiated with red light. ZnPc-loaded PCL NPs are the release systems that promise photodynamic

  13. MODERATE CYTOTOXICITY OF PROANTHOCYANIDINS TO HUMAN TUMOR-CELL LINES

    NARCIS (Netherlands)

    KOLODZIEJ, H; HABERLAND, C; WOERDENBAG, HJ; KONINGS, AWT

    In the present study the cytotoxicity of 16 proanthocyanidins was evaluated in GLC(4), a human small cell lung carcinoma cell line, and in COLO 320, a human colorectal cancer cell line, using the microculture tetrazolium (MTT) assay. With IC50 values ranging from 18 to >200 mu m following continuous

  14. Identification of Epigenetic Biomarkers of Lung Adenocarcinoma through Multi-Omics Data Analysis.

    Science.gov (United States)

    Kikutake, Chie; Yahara, Koji

    2016-01-01

    Epigenetic mechanisms such as DNA methylation or histone modifications are essential for the regulation of gene expression and development of tissues. Alteration of epigenetic modifications can be used as an epigenetic biomarker for diagnosis and as promising targets for epigenetic therapy. A recent study explored cancer-cell specific epigenetic biomarkers by examining different types of epigenetic modifications simultaneously. However, it was based on microarrays and reported biomarkers that were also present in normal cells at a low frequency. Here, we first analyzed multi-omics data (including ChIP-Seq data of six types of histone modifications: H3K27ac, H3K4me1, H3K9me3, H3K36me3, H3K27me3, and H3K4me3) obtained from 26 lung adenocarcinoma cell lines and a normal cell line. We identified six genes with both H3K27ac and H3K4me3 histone modifications in their promoter regions, which were not present in the normal cell line, but present in ≥85% (22 out of 26) and ≤96% (25 out of 26) of the lung adenocarcinoma cell lines. Of these genes, NUP210 (encoding a main component of the nuclear pore complex) was the only gene in which the two modifications were not detected in another normal cell line. RNA-Seq analysis revealed that NUP210 was aberrantly overexpressed among the 26 lung adenocarcinoma cell lines, although the frequency of NUP210 overexpression was lower (19.3%) in 57 lung adenocarcinoma tissue samples studied and stored in another database. This study provides a basis to discover epigenetic biomarkers highly specific to a certain cancer, based on multi-omics data at the cell population level.

  15. Anticancer Effects of Sinulariolide-Conjugated Hyaluronan Nanoparticles on Lung Adenocarcinoma Cells

    Directory of Open Access Journals (Sweden)

    Kuan Yin Hsiao

    2016-03-01

    Full Text Available Lung cancer is one of the most clinically challenging malignant diseases worldwide. Sinulariolide (SNL, extracted from the farmed coral species Sinularia flexibilis, has been used for suppressing malignant cells. For developing anticancer therapeutic agents, we aimed to find an alternative for non-small cell lung cancer treatment by using SNL as the target drug. We investigated the SNL bioactivity on A549 lung cancer cells by conjugating SNL with hyaluronan nanoparticles to form HA/SNL aggregates by using a high-voltage electrostatic field system. SNL was toxic on A549 cells with an IC50 of 75 µg/mL. The anticancer effects of HA/SNL aggregates were assessed through cell viability assay, apoptosis assays, cell cycle analyses, and western blotting. The size of HA/SNL aggregates was approximately 33–77 nm in diameter with a thin continuous layer after aggregating numerous HA nanoparticles. Flow cytometric analysis revealed that the HA/SNL aggregate-induced apoptosis was more effective at a lower SNL dose of 25 µg/mL than pure SNL. Western blotting indicated that caspases-3, -8, and -9 and Bcl-xL and Bax played crucial roles in the apoptotic signal transduction pathway. In summary, HA/SNL aggregates exerted stronger anticancer effects on A549 cells than did pure SNL via mitochondria-related pathways.

  16. CytoregR inhibits growth and proliferation of human adenocarcinoma cells via induction of apoptosis

    Directory of Open Access Journals (Sweden)

    Hassanhi M

    2006-01-01

    Full Text Available Abstract Background Cancer is one of the devastating neovascular diseases that incapacitate so many people the world over. Recent reports from the National Cancer Institute indicate some significant gain therapy and cancer management as seen in the increase in the 5-year survival rate over the past two decades. Although near-perfect cure rate have been reported in the early-stage disease, these data reveal high recurrence rate and serious side effects including second malignancies and fatalities. Most of the currently used anticancer agents are only effective against proliferating cancer cells. Thus attention has been focused on potential anti-cancer agents capable of killing cancer cells independent of the cell cycle state, to ensure effective elimination of most cancer cells. The objective of this study was to test the chemosensitivity and potential mechanism of action of a novel cancer drug, CytoregR, in a panel of human cancer cells. Methods the study was performed using a series of bioassays including Trypan blue exclusion, MTS Growth inhibition, LDH-cytotoxicity, TUNEL-Terminal DNA fragmentation Apoptosis Assay, and the Caspase protease CPP32 activity assays. Results CytoregR induced significant dose- and time-dependent inhibition of growth in all the cells; with significant differences in chemosensitivity (P < 0.05 between the target cells becoming more apparent at 48 hr exposure. CytoregR showed no significant effect on normal cells relative to the tumor cells. Growth inhibition in all the cells was due to induction of apoptosis at lower concentrations of cytoregR (> 1:300. CytoregR-induced caspase protease-3 (CPP32 activation significantly and positively correlated with apoptosis induction and growth inhibition; thus implicating CPP32 as the principal death pathway in cytoregR-induced apoptosis. Conclusion CytoregR exerted a dose-and time-dependent growth inhibitory effect in all the target cells through induction of apoptosis via the

  17. Modeling Adenovirus Latency in Human Lymphocyte Cell Lines ▿ †

    OpenAIRE

    Zhang, Yange; Huang, Wen; Ornelles, David A.; Gooding, Linda R.

    2010-01-01

    Species C adenovirus establishes a latent infection in lymphocytes of the tonsils and adenoids. To understand how this lytic virus is maintained in these cells, four human lymphocytic cell lines that support the entire virus life cycle were examined. The T-cell line Jurkat ceased proliferation and died shortly after virus infection. BJAB, Ramos (B cells), and KE37 (T cells) continued to divide at nearly normal rates while replicating the virus genome. Viral genome numbers peaked and then decl...

  18. Proteomic inventory of "anchorless" proteins on the colon adenocarcinoma cell surface.

    NARCIS (Netherlands)

    Tjalsma, H.; Pluk, W.J.G.; Heuvel, L.P.W.J. van den; Peters, W.H.M.; Roelofs, R.H.W.M.; Swinkels, D.W.

    2006-01-01

    Surface proteins play important pathophysiological roles in health and disease, and accumulating proteomics-based studies suggest that several "non-membrane" proteins are sorted to the cell surface by unconventional mechanisms. Importantly, these proteins may comprise attractive therapeutic targets

  19. Apoptotic Effect of the Urtica Dioica Plant Extracts on Breast Cancer Cell Line (MDA- MB- 468

    Directory of Open Access Journals (Sweden)

    A Mohammadi

    2015-09-01

    Full Text Available Background & objectives: Cancer is one of the most causes of mortality in worldwide. Components derived from natural plants that induce apoptosis are used for cancer treatment. Therefore investigation of different herbal components for new anti-cancer drug is one of the main research activities throughout the world. According to low cost, oral consumption and easy access to the public extracts of Urtica dioica, in this study we aimed to investigate the effectiveness of this herb on MDA-MB-468 breast cancer cells.   Methods: Cytotoxic effect of Urtica dioica extract was measured using MTT assays. To show induction of apoptosis by this plant TUNEL and DNA Fragmentation test were performed.   Results: In the present study dichloromethane extracts noticeably killed cancer cells. IC50 values related to human breast adenocarcinoma cell line MDA-MB-468 were 29.46±1.05 µg/ml in 24 hours and 15.54±1.04 µg/ml in 48 hours. TUNEL test and DNA Fragmentation assay showed apoptotic characteristic in the extract treated cells.   Conclusion: The results showed that MDA-MB-468 cells after treatment with dichloromethane extract of Urtica dioica, induces apoptosis in MDA-MB-468 cancer cells which may be useful in the treatment of cancer.

  20. Primary clear cell ductal adenocarcinoma of the pancreas: A case report and clinicopathologic literature review

    Directory of Open Access Journals (Sweden)

    Yashpal Modi

    2014-01-01

    Full Text Available We present a very rare, interesting case of a carcinoma of the pancreas with predominantly abundant clear cell morphology. According to the WHO classification, primary clear cell carcinoma of the pancreas is classified as a rare "miscellaneous" carcinoma. The tumor was observed in the distal body and tail of the pancreas of a 74-year-old woman. The histopathology of tumor cells showed well-defined cell membranes, clear cytoplasm, and prominent cell boundaries. Immunohistochemical (IHC staining showed positive reactions to antibodies against vimentin, cytokeratin 7 (CK-7, mucicarmine (MUC-1, periodic acid-Schiff (PAS, periodic acid-Schiff with diastase (PASD, carcinoembryonic antigen (CEA, and Carbohydrate Antigen 19-9 (CA 19-9. On the other hand, IHC staining was negative for alpha-fetoprotein (AFP, cytokeratin 20 (CK-20, HMB45, chromogranin, and synaptophysin. The patient was subsequently diagnosed with a primary solid-type pancreatic clear cell carcinoma with hepatic metastasis. Herein, we report this rare case and include a review of the current literature of this tumor.

  1. A comparison study of pancreatic acinar cell carcinoma with ductal adenocarcinoma using computed tomography in Chinese patients

    Directory of Open Access Journals (Sweden)

    Wang Q

    2016-09-01

    Full Text Available Qingbing Wang,1,2 Xiaolin Wang,1,2 Rongfang Guo,2,3 Guoping Li1,2 1Department of Interventional Radiology, Zhongshan Hospital, Fudan University, 2Shanghai Institute of Medical Imaging, 3Department of Radiology, Zhongshan Hospital, Fudan University, Shanghai, People’s Republic of China Abstract: Pancreatic acinar cell carcinoma (ACC is a rare tumor that is difficult to diagnose preoperatively. The aim of this study was to evaluate and describe the computed tomography (CT features of ACC and compare the results with pancreatic ductal adenocarcinoma (DAC for improving preoperative diagnosis. The control group consisted of 34 patients with DAC collected from the pathology electronic database. The CT imaging from nine patients with pathologically confirmed ACC was retrospectively reviewed. Two radiologists independently assessed the tumor location, size, texture, and enhancement patterns. We found that 64.3% (9/14 of ACC tumors were homogeneous and 35.7% (5/14 had necrosis. The percentage of common bile duct and pancreatic ductal dilation was 14.3% (2/14 and 7.1% (1/14, respectively. The mean size of ACC was 50.1±24.2 mm. The mean attenuation of ACC was 35.4±3.9 Hounsfield unit (HU before enhancement, 73.1±42.9 HU in arterial phase, and 71.8±15.6 HU in port venous phase. It is difficult to distinguish ACC from DAC preoperatively only based on CT findings. However, compared with DAC, we found that ACC tumors are likely to be larger and contain more heterogeneous intratumoral necrotic hypovascular regions, and less pancreatic ductal and common biliary dilation. Keywords: acinar cell carcinoma, computed tomography, pancreatic ductal carcinoma, pancreas

  2. Isolation of a Wheat Cell Line with Altered Membrane Properties

    Science.gov (United States)

    Erdei, László; Vigh, László; Dudits, Dénes

    1982-01-01

    A spontaneous dimethylsulfoxide (DMSO)-tolerant cell line was isolated from a cell culture of wheat (Triticum monococcum L.). The tolerant cells were able to grow in the presence of 4% DMSO. Cells formed from protoplasts of the tolerant line required DMSO for division in culture medium of high osmotic value. Fatty acid composition and the molar ratio of phospholipids/sterols suggest a more ordered membrane structure in the tolerant line. Accordingly, a lower K+ influx rate was detected in the tolerant cells in comparison with the original line. These characteristics were maintained after 6 months' cultivation of the cells in DMSO-free growth medium. This suggested that genetic changes could be responsible for differences between the two cell lines. PMID:16662251

  3. Curcuminoids and ω-3 fatty acids with anti-oxidants potentiate cytotoxicity of natural killer cells against pancreatic ductal adenocarcinoma cells and inhibit interferon γ production

    Directory of Open Access Journals (Sweden)

    Milan eFiala

    2015-05-01

    Full Text Available Pancreatic cancer has a poor prognosis attributed in part to immune suppression and deactivation of natural killer (NK cells. Curcuminoids have a potential for improving the therapy of pancreatic cancer given promising results in cancer models and a clinical trial, but their oral absorption is limited. Our objective in this study is to show curcuminoid anti-oncogenic effects alone and together with human NK cells. We tested curcuminoids in an emulsion of ω-3 fatty acids and anti-oxidants (Smartfish regarding their direct cytocidal effect and enhancement of the cytocidal activity of NK cells in pancreatic ductal adenocarcinoma (PDAC cells (Mia Paca 2 and L3.6. Curcuminoids (at > 10 microM with ω-3 fatty acids and anti-oxidants or with the lipidic mediator resolvin D1 (RvD1 (26 nM induced high caspase-3 activity in PDAC cells. Importantly, curcuminoids with ω-3 fatty acids and anti-oxidants or with RvD1 significantly potentiated NK cell cytocidal function and protected them against degradation. In a co-culture of cancer cells with NK cells, interferon-γ ( IFN-γ production by NK cells was not altered by ω-3 fatty acids with anti-oxidants or by RvD1 but was inhibited by curcuminoids. The inhibition was not eliminated by ω-3 fatty acids or RvD1 but was relieved by removing curcuminoids after adding NK cells. In conclusion, curcuminoids with ω-3 fatty acids and anti-oxidants or with RvD1 have increased cytotoxic activity on PDAC cells alone and with NK cells. The effects of curcuminoids with ω-3 fatty acids and anti-oxidants on pancreatic cancer will be investigated in a mouse model with humanized immune system.

  4. pCramoll and rCramoll lectins induce cell death in human prostate adenocarcinoma (PC-3) cells by impairment of mitochondrial homeostasis.

    Science.gov (United States)

    de Oliveira Figueirôa, Evellyne; Aranda-Souza, Mary Ângela; Varejão, Nathalia; Rossato, Franco Aparecido; Costa, Rute Alves Pereira; Figueira, Tiago Rezende; da Silva, Luís Cláudio Nascimento; Castilho, Roger Frigério; Vercesi, Aníbal Eugênio; Dos Santos Correia, Maria Tereza

    2017-09-01

    Lectins from Cratylia mollis seed have shown potential in vivo antitumor actions, however the mechanism have not yet been addressed. Here we evaluated the antitumor effects of native (pCramoll) and recombinant (rCramoll) lectins from C. mollis against human prostate adenocarcinoma (PC-3) cells. The viability of PC-3 cells was analyzed with the MTT assay and ANNEXIN V/propidium iodide staining. The actions of pCramoll or rCramoll on mitochondrial superoxide production, free cytosolic calcium concentration and mitochondrial membrane potential were evaluated using fluorescent probes (MitoSox Red, Fura 2-AM and safranin O, respectively). pCramoll and rCramoll reduced the viability of PC-3 cells in a dose-dependent manner. Both lectins increased the generation of mitochondrial superoxide as well as the concentration of cytosolic calcium. These changes led to a decrease in oxidative phosphorylation, which impaired the formation of ATP. The resulting cell death was not blocked by MPT (mitochondrial permeability transition) inhibitors (Debio 025 or bongkrekic acid). Thus pCramoll and rCramoll promote PC-3 cell death through calcium signaling, leading to mitochondrial collapse. This work provides more insights into the action of pCramoll and rCramoll against cancer cells. These lectins represent valuable tools for biomedical research. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Investigation of the selenium metabolism in cancer cell lines

    DEFF Research Database (Denmark)

    Lunøe, Kristoffer; Gabel-Jensen, Charlotte; Stürup, Stefan

    2011-01-01

    incubated with cells for 24 h and the induction of cell death was measured using flow cytometry. The amounts of total selenium in cell medium, cell lysate and the insoluble fractions was determined by ICP-MS. Speciation analysis of cellular fractions was performed by reversed phase, anion exchange and size......The aim of this work was to compare different selenium species for their ability to induce cell death in different cancer cell lines, while investigating the underlying chemistry by speciation analysis. A prostate cancer cell line (PC-3), a colon cancer cell line (HT-29) and a leukaemia cell line...... (Jurkat E6-1) were incubated with five selenium compounds representing inorganic as well as organic Se compounds in different oxidation states. Selenomethionine (SeMet), Se-methylselenocysteine (MeSeCys), methylseleninic acid (MeSeA), selenite and selenate in the concentration range 5-100 mu M were...

  6. Significance of CD133 positive cells in four novel HPV-16 positive cervical cancer-derived cell lines and biopsies of invasive cervical cancer.

    Science.gov (United States)

    Javed, Shifa; Sharma, Bal Krishan; Sood, Swati; Sharma, Sanjeev; Bagga, Rashmi; Bhattacharyya, Shalmoli; Rayat, Charan Singh; Dhaliwal, Lakhbir; Srinivasan, Radhika

    2018-04-02

    Cervical cancer is a major cause of cancer-related mortality in women in the developing world. Cancer Stem cells (CSC) have been implicated in treatment resistance and metastases development; hence understanding their significance is important. Primary culture from tissue biopsies of invasive cervical cancer and serial passaging was performed for establishing cell lines. Variable Number Tandem Repeat (VNTR) assay was performed for comparison of cell lines with their parental tissue. Tumorsphere and Aldefluor assays enabled isolation of cancer stem cells (CSC); immunofluorescence and flow cytometry were performed for their surface phenotypic expression in cell lines and in 28 tissue samples. Quantitative real-time PCR for stemness and epithelial-mesenchymal transition (EMT) markers, MTT cytotoxicity assay, cell cycle analysis and cell kinetic studies were performed. Four low-passage novel cell lines designated RSBS-9, - 14 and - 23 from squamous cell carcinoma and RSBS-43 from adenocarcinoma of the uterine cervix were established. All were HPV16+. VNTR assay confirmed their uniqueness and derivation from respective parental tissue. CSC isolated from these cell lines showed CD133 + phenotype. In tissue samples of untreated invasive cervical cancer, CD133 + CSCs ranged from 1.3-23% of the total population which increased 2.8-fold in radiation-resistant cases. Comparison of CD133 + with CD133 - bulk population cells revealed increased tumorsphere formation and upregulation of stemness and epithelial-mesenchymal transition (EMT) markers with no significant difference in cisplatin sensitivity. Low-passage cell lines developed would serve as models for studying tumor biology. Cancer Stem Cells in cervical cancer display CD133 + phenotype and are increased in relapsed cases and hence should be targeted for achieving remission.

  7. Reference genes for quantitative RT-PCR data in gastric tissues and cell lines

    Science.gov (United States)

    Wisnieski, Fernanda; Calcagno, Danielle Queiroz; Leal, Mariana Ferreira; dos Santos, Leonardo Caires; Gigek, Carolina de Oliveira; Chen, Elizabeth Suchi; Pontes, Thaís Brilhante; Assumpção, Paulo Pimentel; de Assumpção, Mônica Barauna; Demachki, Sâmia; Burbano, Rommel Rodríguez; Smith, Marília de Arruda Cardoso

    2013-01-01

    AIM: To evaluate the suitability of reference genes in gastric tissue samples and cell lines. METHODS: The suitability of genes ACTB, B2M, GAPDH, RPL29, and 18S rRNA was assessed in 21 matched pairs of neoplastic and adjacent non-neoplastic gastric tissues from patients with gastric adenocarcinoma, 27 normal gastric tissues from patients without cancer, and 4 cell lines using reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR). The ranking of the best single and combination of reference genes was determined by NormFinder, geNorm™, BestKeeper, and DataAssist™. In addition, GenEx software was used to determine the optimal number of reference genes. To validate the results, the mRNA expression of a target gene, DNMT1, was quantified using the different reference gene combinations suggested by the various software packages for normalization. RESULTS: ACTB was the best reference gene for all gastric tissues, cell lines and all gastric tissues plus cell lines. GAPDH + B2M or ACTB + B2M was the best combination of reference genes for all the gastric tissues. On the other hand, ACTB + B2M was the best combination for all the cell lines tested and was also the best combination for analyses involving all the gastric tissues plus cell lines. According to the GenEx software, 2 or 3 genes were the optimal number of references genes for all the gastric tissues. The relative quantification of DNMT1 showed similar patterns when normalized by each combination of reference genes. The level of expression of DNMT1 in neoplastic, adjacent non-neoplastic and normal gastric tissues did not differ when these samples were normalized using GAPDH + B2M (P = 0.32), ACTB + B2M (P = 0.61), or GAPDH + B2M + ACTB (P = 0.44). CONCLUSION: GAPDH + B2M or ACTB + B2M is the best combination of reference gene for all the gastric tissues, and ACTB + B2M is the best combination for the cell lines tested. PMID:24222956

  8. Binase Immobilized on Halloysite Nanotubes Exerts Enhanced Cytotoxicity toward Human Colon Adenocarcinoma Cells

    Directory of Open Access Journals (Sweden)

    Vera Khodzhaeva

    2017-09-01

    Full Text Available Many ribonucleases (RNases are considered as promising tools for antitumor therapy because of their selective cytotoxicity toward cancer cells. Binase, the RNase from Bacillus pumilus, triggers apoptotic response in cancer cells expressing RAS oncogene which is mutated in a large percentage of prevalent and deadly malignancies including colorectal cancer. The specific antitumor effect of binase toward RAS-transformed cells is due to its direct binding of RAS protein and inhibition of downstream signaling. However, the delivery of proteins to the intestine is complicated by their degradation in the digestive tract and subsequent loss of therapeutic activity. Therefore, the search of new systems for effective delivery of therapeutic proteins is an actual task. This study is aimed to the investigation of antitumor effect of binase immobilized on natural halloysite nanotubes (HNTs. Here, we have developed the method of binase immobilization on HNTs and optimized the conditions for the enzyme loading and release (i; we have found the non-toxic concentration of pure HNTs which allows to distinguish HNTs- and binase-induced cytotoxic effects (ii; using dark-field and fluorescent microscopy we have proved the absorption of binase-loaded HNTs on the cell surface (iii and demonstrated that binase-halloysite nanoformulations possessed twice enhanced cytotoxicity toward tumor colon cells as compared to the cytotoxicity of binase itself (iv. The enhanced antitumor activity of biocompatible binase-HNTs complex confirms the advisability of its future development for clinical practice.

  9. The pursuit of ES cell lines of domesticated ungulates

    Science.gov (United States)

    In contrast to differentiated cells, embryonic stem cells (ESC) maintain an undifferentiated state, have the ability to self-renew, and exhibit pluripotency, i.e., they can give rise to most if not all somatic cell types and to the germ cells, egg and sperm. These characteristics make ES cell lines...

  10. The effect and mechanism of endothelin-1-induced intracellular free calcium in human lung adenocarcinoma cells SPC-A1

    Directory of Open Access Journals (Sweden)

    Juan ZHOU

    2008-08-01

    Full Text Available Background and objective Endothelin-1 (ET-1 is a potent mitogen involved in cell growth in human lung adenocarcinoma cells SPC-A1. The increase in intracellular free calcium ([Ca2+]i plays a great role in this process. The aim of this study is to investigate the ET-1-induced [Ca2+]i responses in SPC-A1 cells and to explore its cellular mechanism. Methods [Ca2+]i was measured by Fura-2/AM fluorescent assay. Endothelin receptors antagonists, calcium channel blockers and intracellular signal transduction blockers were used to study the underlying mechanism of ET-1-induced [Ca2+]i responses in SPC-A1 cells. Results At the concentration of 1×10-15 mol/L-1×10-8 mol/L, ET-1 caused a dose-dependent increase of [Ca2+]i in SPC-A1 cells (P0.05, a highly selective endothelin receptor B (ETBR antagonist. Depletion of extracellular Ca2+ with free Ca2+ solution and 0.1mmol/L ethyleneglycol bis (2-aminoethyl ether tetraacetic acid (EGTA or blockade of voltage dependent calcium channel with nifedipine at 1×10-6 mol/L significantly reduced the ET-1-induced increase of [Ca2+]i. The ET-1-induced (1×10-10 mol/L increase of [Ca2+]i was also significantly attenuated by U73122 at 1×10-5 mol/L (P<0.05, a phospholipase C inhibitor, and by Ryanodine at 50×10-6 mol/L. However, Staurosporine (2×10-9 mol/L, a protein kinas C inhibitor, exerted no significant effect on the ET-1-induced (1×10-10 mol/L increase of [Ca2+]i. Conclusion ET-1 elevates [Ca2+]i via activation of ETA receptor. Both phospholipase C/Ca2+ pathway and Ca2+ influx through voltage dependent Ca2+ channel activate by ETAR contribute to this process.

  11. Differentiation of colon adenocarcinoma HT29 cells potentates photodynamic therapy with hypericin

    International Nuclear Information System (INIS)

    Mikes, J.; Kleban, J.; Koval, J.; Fedorocko, P.; Hyzdalova, M.

    2006-01-01

    Photodynamic therapy (PDT) is a therapeutical approach for the treatment of malignant as well as non-malignant disorders based on administration of nontoxic/weakly toxic photosensitive compound and its activation with light. The phototoxicity of PDT depends on generation of superoxide radicals (Type-I reaction), which in turn might form peroxide and hydroxyl radicals, and production of singlet oxygen ( 1 O 2 ) (Type-II reaction) after irradiation with light of appropriate wavelength which properly overlaps the photosensitizer's absorbing spectra. Oxidative damage in the cell induced by reactive oxygen species depends on the intracellular localization and affects different cell organelles. In our study, effectiveness of PDT with hypericin in differentiated versus undifferentiated HT29 cells in the relation to differentiation status has been evaluated. (authors)

  12. VOLIN and KJON-Two novel hyperdiploid myeloma cell lines.

    Science.gov (United States)

    Våtsveen, Thea Kristin; Børset, Magne; Dikic, Aida; Tian, Erming; Micci, Francesca; Lid, Ana H B; Meza-Zepeda, Leonardo A; Coward, Eivind; Waage, Anders; Sundan, Anders; Kuehl, W Michael; Holien, Toril

    2016-11-01

    Multiple myeloma can be divided into two distinct genetic subgroups: hyperdiploid (HRD) or nonhyperdiploid (NHRD) myeloma. Myeloma cell lines are important tools to study myeloma cell biology and are commonly used for preclinical screening and testing of new drugs. With few exceptions human myeloma cell lines are derived from NHRD patients, even though about half of the patients have HRD myeloma. Thus, there is a need for cell lines of HRD origin to enable more representative preclinical studies. Here, we present two novel myeloma cell lines, VOLIN and KJON. Both of them were derived from patients with HRD disease and shared the same genotype as their corresponding primary tumors. The cell lines' chromosomal content, genetic aberrations, gene expression, immunophenotype as well as some of their growth characteristics are described. Neither of the cell lines was found to harbor immunoglobulin heavy chain translocations. The VOLIN cell line was established from a bone marrow aspirate and KJON from peripheral blood. We propose that these unique cell lines may be used as tools to increase our understanding of myeloma cell biology. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  13. Ajwa Date (Phoenix dactylifera L.) Extract Inhibits Human Breast Adenocarcinoma (MCF7) Cells In Vitro by Inducing Apoptosis and Cell Cycle Arrest.

    Science.gov (United States)

    Khan, Fazal; Ahmed, Farid; Pushparaj, Peter Natesan; Abuzenadah, Adel; Kumosani, Taha; Barbour, Elie; AlQahtani, Mohammed; Gauthaman, Kalamegam

    2016-01-01

    Phoenix dactylifera L (Date palm) is a native plant of the Kingdom of Saudi Arabia (KSA) and other Middle Eastern countries. Ajwa date has been described in the traditional and alternative medicine to provide several health benefits including anticholesteremic, antioxidant, hepatoprotective and anticancer effects, but most remains to be scientifically validated. Herein, we evaluated the anticancer effects of the Methanolic Extract of Ajwa Date (MEAD) on human breast adenocarcinoma (MCF7) cells in vitro. MCF7 cells were treated with various concentrations (5, 10, 15, 20 and 25 mg/ml) of MEAD for 24, 48 and 72 h and changes in cell morphology, cell cycle, apoptosis related protein and gene expression were studied. Phase contrast microscopy showed various morphological changes such as cell shrinkage, vacuolation, blebbing and fragmentation. MTT (2-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay demonstrated statistically significant dose-dependent inhibitions of MCF7 cell proliferation from 35% to 95%. Annexin V-FITC and TUNEL assays showed positive staining for apoptosis of MCF7 cells treated with MEAD (15 mg and 25 mg for 48 h). Flow cytometric analyses of MCF7 cells with MEAD (15 mg/ml and 20 mg/ml) for 24 h demonstrated cell cycle arrest at 'S' phase; increased p53, Bax protein expression; caspase 3activation and decreased the mitochondrial membrane potential (MMP). Quantitative real time PCR (qRT-PCR) analysis showed up-regulation of p53, Bax, Fas, and FasL and down-regulation of Bcl-2. MEAD inhibited MCF7 cells in vitro by the inducing cell cycle arrest and apoptosis. Our results indicate the anticancer effects of Ajwa dates, which therefore may be used as an adjunct therapy with conventional chemotherapeutics to achieve a synergistic effect against breast cancer.

  14. Ajwa Date (Phoenix dactylifera L. Extract Inhibits Human Breast Adenocarcinoma (MCF7 Cells In Vitro by Inducing Apoptosis and Cell Cycle Arrest.

    Directory of Open Access Journals (Sweden)

    Fazal Khan

    Full Text Available Phoenix dactylifera L (Date palm is a native plant of the Kingdom of Saudi Arabia (KSA and other Middle Eastern countries. Ajwa date has been described in the traditional and alternative medicine to provide several health benefits including anticholesteremic, antioxidant, hepatoprotective and anticancer effects, but most remains to be scientifically validated. Herein, we evaluated the anticancer effects of the Methanolic Extract of Ajwa Date (MEAD on human breast adenocarcinoma (MCF7 cells in vitro.MCF7 cells were treated with various concentrations (5, 10, 15, 20 and 25 mg/ml of MEAD for 24, 48 and 72 h and changes in cell morphology, cell cycle, apoptosis related protein and gene expression were studied.Phase contrast microscopy showed various morphological changes such as cell shrinkage, vacuolation, blebbing and fragmentation. MTT (2-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide assay demonstrated statistically significant dose-dependent inhibitions of MCF7 cell proliferation from 35% to 95%. Annexin V-FITC and TUNEL assays showed positive staining for apoptosis of MCF7 cells treated with MEAD (15 mg and 25 mg for 48 h. Flow cytometric analyses of MCF7 cells with MEAD (15 mg/ml and 20 mg/ml for 24 h demonstrated cell cycle arrest at 'S' phase; increased p53, Bax protein expression; caspase 3activation and decreased the mitochondrial membrane potential (MMP. Quantitative real time PCR (qRT-PCR analysis showed up-regulation of p53, Bax, Fas, and FasL and down-regulation of Bcl-2.MEAD inhibited MCF7 cells in vitro by the inducing cell cycle arrest and apoptosis. Our results indicate the anticancer effects of Ajwa dates, which therefore may be used as an adjunct therapy with conventional chemotherapeutics to achieve a synergistic effect against breast cancer.

  15. Upregulation of Peroxideroxin-6 in human renal adenocarcinoma cells 786-0, after ionizing radiation

    Energy Technology Data Exchange (ETDEWEB)

    Silva, Evelin Caroline da; Bellini, Maria Helena [Instituto de Pesquisas Energéticas e Nucleares (IPEN/CNEN-SP), São Paulo, SP (Brazil)

    2017-07-01

    Full text: Introduction: Renal cell carcinoma (RCC) accounts for 3% of human malignancies and approximately 90% of renal malignancies and among urological tumors. RCC is quite resistant to conventional radiotherapy. This technique allows the dose of radiation, in a single fraction, to be precisely applied to the tumor and the tissues adjacent to it, most of the time, are spared. Proteomics has allowed large-scale studies of protein expression in different tissues and body fluids, under different conditions and / or times. Mass spectrometry allows the identification and quantification of thousands of proteins and peptides in a biological fluid or lysed cells, and is analyzed on a platform to identify differences in the expression of proteins associated with cancer cell proliferation and to establish potential biomarkers predictive of the response therapy. The peroxideroxin- 6 (PRDX 6) protein encoded by this gene is a member of the antioxidant protein family. The PRDX family contains six members that function in detoxifying ROS and providing cytoprotection from internal and It may play a role in the regulation of phospholipid turnover as well as in protection against oxidative injury. Aim: To analyze the expression of PRDX6 in 786-0 cells, after radiation. Methods: A cell culture of the 786-0 cells was performed and to evaluate the mitotic potential, the clonogenic assay was performed with doses of 2 to 10 Gy irradiated in GammaCell (CTR, IPEN) and incubated for 10 days in normoxia conditions. After 10 days, the colonies of the respective doses were stained with methanol 20% and crystal violet 0,5% and counted, and the multiple comparisons was analyzed by One-way ANOVA followed by Bonferroni's test and at the defined dose the cells were irradiated and the cytoplasmic proteins were extracted by the PE kit Subcellular proteome extraction (Merck, USA), dosed by the Lowry method and stored at -20 °. For the qualitative analysis of proteins, SDS-PAGE was performed

  16. CERUMINOUS ADENOCARCINOMA OF THE EXTERNAL AUDITORY CANAL: A RARE ENTITY

    Directory of Open Access Journals (Sweden)

    Geeta Yadav

    2016-06-01

    Full Text Available Ceruminous adenocarcinoma is an extremely rare malignant tumour arising from apocrine ceruminous glands of the external auditory canal. Histologically, ceruminous adenocarcinomas are similar to adenocarcinomas elsewhere, except that the glandular luminal tumour cells show apical snouts or blebs indicating an apocrine origin. Central comedo necrosis and stromal invasion helps differentiate these tumours from benign ceruminous adenomas. It may be difficult to differentiate ceruminous adenocarcinomas from other adenocarcinomas occurring in the external auditory canal and from benign ceruminous adenoma if small samples are submitted for histopathological examination. We report on a case of ceruminous adenocarcinoma in a 70- year-old male who presented with an infiltrating growth involving his left external auditory canal along with longstanding painless ear discharge. Incisional biopsy was suggestive of adenocarcinoma; however, postoperative histopathological examination confirmed the tumour to be ceruminous adenocarcinoma.

  17. Increased numbers of Foxp3-positive regulatory T cells in gastritis, peptic ulcer and gastric adenocarcinoma

    Science.gov (United States)

    Cheng, Hsin-Hung; Tseng, Guan-Ying; Yang, Hsiao-Bai; Wang, Hung-Jung; Lin, Hwai-Jeng; Wang, Wen-Ching

    2012-01-01

    AIM: To determine the number of regulatory T cells (Tregs) in gastric mucosa of patients with gastritis, peptic ulcers and gastric cancer. METHODS: This study was a retrospective analysis of gastric antrum biopsy specimens from healthy controls (n = 22) and patients with gastritis (n = 30), peptic ulcer (n = 83), or gastric cancer (n = 32). Expression of CD4, CD25 and Foxp3 was determined by immunohistochemistry in three consecutive sections per sample. RESULTS: Compared with healthy controls, there was an increased number of CD25+ and Foxp3+ cells in patients with gastritis (P = 0.004 and P = 0.008), peptic ulcer (P cancer (P gastritis (P gastritis and peptic ulcer groups. PMID:22228968

  18. Curcumin promotes apoptosis in A549/DDP multidrug-resistant human lung adenocarcinoma cells through an miRNA signaling pathway

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Jian, E-mail: zhangjian197011@yahoo.com [Department of Respiratory Medicine, Xijing Hospital, The Fourth Military Medical University, Xi' an 710032 (China); Zhang, Tao [Department of Thoracic Surgery, Tangdu Hospital, The Fourth Military Medical University, Xi' an 710038 (China); Ti, Xinyu; Shi, Jieran; Wu, Changgui; Ren, Xinling [Department of Respiratory Medicine, Xijing Hospital, The Fourth Military Medical University, Xi' an 710032 (China); Yin, Hong, E-mail: yinnhong@yahoo.com [The Medical Image Center, Xijing Hospital, The Fourth Military Medical University, Xi' an 710032 (China)

    2010-08-13

    Research highlights: {yields} Curcumin had anti-cancer effects on A549/DDP multidrug-resistant human lung adenocarcinoma cells {yields} Curcumin promotes apoptosis in A549/DDP cells through a miRNA signaling pathway {yields} Curcumin induces A549/DDP cell apoptosis by downregulating miR-186* {yields} miR-186* may serve as a potential gene therapy target for refractory lung cancer that is sensitive to curcumin -- Abstract: Curcumin extracted from the rhizomes of Curcuma longa L. has been shown to have inhibitory effects on cancers through its anti-proliferative and pro-apoptotic activities. Emerging evidence demonstrates that curcumin can overcome drug resistance to classical chemotherapies. Thus, the mechanisms underlying the anti-tumor activities of curcumin require further study. In our study, we first demonstrated that curcumin had anti-cancer effects on A549/DDP multidrug-resistant human lung adenocarcinoma cells. Further studies showed that curcumin altered miRNA expression; in particular, significantly downregulated the expression of miR-186* in A549/DDP. In addition, transfection of cells with a miR-186* inhibitor promoted A549/DDP apoptosis, and overexpression of miR-186* significantly inhibited curcumin-induced apoptosis in A549/DDP cells. These observations suggest that miR-186* may serve as a potential gene therapy target for refractory lung cancer that is sensitive to curcumin.

  19. Curcumin promotes apoptosis in A549/DDP multidrug-resistant human lung adenocarcinoma cells through an miRNA signaling pathway

    International Nuclear Information System (INIS)

    Zhang, Jian; Zhang, Tao; Ti, Xinyu; Shi, Jieran; Wu, Changgui; Ren, Xinling; Yin, Hong

    2010-01-01

    Research highlights: → Curcumin had anti-cancer effects on A549/DDP multidrug-resistant human lung adenocarcinoma cells → Curcumin promotes apoptosis in A549/DDP cells through a miRNA signaling pathway → Curcumin induces A549/DDP cell apoptosis by downregulating miR-186* → miR-186* may serve as a potential gene therapy target for refractory lung cancer that is sensitive to curcumin -- Abstract: Curcumin extracted from the rhizomes of Curcuma longa L. has been shown to have inhibitory effects on cancers through its anti-proliferative and pro-apoptotic activities. Emerging evidence demonstrates that curcumin can overcome drug resistance to classical chemotherapies. Thus, the mechanisms underlying the anti-tumor activities of curcumin require further study. In our study, we first demonstrated that curcumin had anti-cancer effects on A549/DDP multidrug-resistant human lung adenocarcinoma cells. Further studies showed that curcumin altered miRNA expression; in particular, significantly downregulated the expression of miR-186* in A549/DDP. In addition, transfection of cells with a miR-186* inhibitor promoted A549/DDP apoptosis, and overexpression of miR-186* significantly inhibited curcumin-induced apoptosis in A549/DDP cells. These observations suggest that miR-186* may serve as a potential gene therapy target for refractory lung cancer that is sensitive to curcumin.

  20. Authentication of M14 melanoma cell line proves misidentification of MDA-MB-435 breast cancer cell line.

    Science.gov (United States)

    Korch, Christopher; Hall, Erin M; Dirks, Wilhelm G; Ewing, Margaret; Faries, Mark; Varella-Garcia, Marileila; Robinson, Steven; Storts, Douglas; Turner, Jacqueline A; Wang, Ying; Burnett, Edward C; Healy, Lyn; Kniss, Douglas; Neve, Richard M; Nims, Raymond W; Reid, Yvonne A; Robinson, William A; Capes-Davis, Amanda

    2018-02-01

    A variety of analytical approaches have indicated that melanoma cell line UCLA-SO-M14 (M14) and breast carcinoma cell line MDA-MB-435 originate from a common donor. This indicates that at some point in the past, one of these cell lines became misidentified, meaning that it ceased to correspond to the reported donor and instead became falsely identified (through cross-contamination or other means) as a cell line from a different donor. Initial studies concluded that MDA-MB-435 was the misidentified cell line and M14 was the authentic cell line, although contradictory evidence has been published, resulting in further confusion. To address this question, we obtained early samples of the melanoma cell line (M14), a lymphoblastoid cell line from the same donor (ML14), and donor serum preserved at the originator's institution. M14 samples were cryopreserved in December 1975, before MDA-MB-435 cells were established in culture. Through a series of molecular characterizations, including short tandem repeat (STR) profiling and cytogenetic analysis, we demonstrated that later samples of M14 and MDA-MB-435 correspond to samples of M14 frozen in 1975, to the lymphoblastoid cell line ML14, and to the melanoma donor's STR profile, sex and blood type. This work demonstrates conclusively that M14 is the authentic cell line and MDA-MB-435 is misidentified. With clear provenance information and authentication testing of early samples, it is possible to resolve debates regarding the origins of problematic cell lines that are widely used in cancer research. © 2017 The Authors International Journal of Cancer published by John Wiley & Sons Ltd on behalf of UICC.

  1. Authentication of M14 melanoma cell line proves misidentification of MDA‐MB‐435 breast cancer cell line

    Science.gov (United States)

    Korch, Christopher; Hall, Erin M.; Dirks, Wilhelm G.; Ewing, Margaret; Faries, Mark; Varella‐Garcia, Marileila; Robinson, Steven; Storts, Douglas; Turner, Jacqueline A.; Wang, Ying; Burnett, Edward C.; Healy, Lyn; Kniss, Douglas; Neve, Richard M.; Nims, Raymond W.; Reid, Yvonne A.; Robinson, William A.

    2017-01-01

    A variety of analytical approaches have indicated that melanoma cell line UCLA‐SO‐M14 (M14) and breast carcinoma cell line MDA‐MB‐435 originate from a common donor. This indicates that at some point in the past, one of these cell lines became misidentified, meaning that it ceased to correspond to the reported donor and instead became falsely identified (through cross‐contamination or other means) as a cell line from a different donor. Initial studies concluded that MDA‐MB‐435 was the misidentified cell line and M14 was the authentic cell line, although contradictory evidence has been published, resulting in further confusion. To address this question, we obtained early samples of the melanoma cell line (M14), a lymphoblastoid cell line from the same donor (ML14), and donor serum preserved at the originator's institution. M14 samples were cryopreserved in December 1975, before MDA‐MB‐435 cells were established in culture. Through a series of molecular characterizations, including short tandem repeat (STR) profiling and cytogenetic analysis, we demonstrated that later samples of M14 and MDA‐MB‐435 correspond to samples of M14 frozen in 1975, to the lymphoblastoid cell line ML14, and to the melanoma donor's STR profile, sex and blood type. This work demonstrates conclusively that M14 is the authentic cell line and MDA‐MB‐435 is misidentified. With clear provenance information and authentication testing of early samples, it is possible to resolve debates regarding the origins of problematic cell lines that are widely used in cancer research. PMID:28940260

  2. Change from lung adenocarcinoma to small cell lung cancer as a mechanism of resistance to afatinib.

    Science.gov (United States)

    Manca, Paolo; Russano, Marco; Pantano, Francesco; Tonini, Giuseppe; Santini, Daniele

    2017-08-29

    We report the case of a patient affected by advanced EGFR mutation-positive lung who experienced resistance to therapy during treatment with Afatinib through the occurrence of a switch of tumor histotype to small cell lung cancer (SCLC) with features of a G3 neuroendocrine carcinoma. Unexpectedly, the switch to SCLC histotype occurred in the only site not responsive to afatinib and subsequently the most responsive to chemotherapy. Our case shows that occurrence of switch to SCLC is a possible mechanism of resistance during treatment with Afatinib.

  3. Derivation of the human embryonic stem cell line RCM1

    Directory of Open Access Journals (Sweden)

    P.A. De Sousa

    2016-03-01

    Full Text Available The human embryonic stem cell line RCM-1 was derived from a failed to fertilise egg undergoing parthenogenetic stimulation. The cell line shows normal pluripotency marker expression and differentiation to three germ layers in vitro and in vivo. It has a normal 46XX female karyotype and microsatellite PCR identity, HLA and blood group typing data is available.

  4. Synergistic cytotoxicity against human tumor cell lines by oncolytic adenovirus dl1520 (ONYX-015) and melphalan.

    Science.gov (United States)

    Ferguson, Peter J; Sykelyk, Alexander; Figueredo, Rene; Koropatnick, James

    2016-01-01

    In light of the need for more selective anticancer therapy, much work has been directed at developing compounds or biological agents that target functions specific to cancer cells. To this end, numerous viruses have been engineered to exploit the dependence of cancer cells on particular anomalies that contribute to their rogue proliferative activity, such as dysfunctional p53, overactive mitogenic signaling, or a defective interferon response. The oncolytic human adenovirus dl1520 (ONYX-015) was engineered to propagate specifically in p53-deficient tumors, which comprise over half of all tumors. Based on successes in clinical trials, the full potential of dl1520 and other oncolytic viruses may be even better realized by using them in combination with conventional chemotherapy drugs. As a model system in which to test this potential, representative cell lines from 2 common cancer types, oral squamous cell carcinoma (HN-5a) and colon adenocarcinoma (HT-29), were chosen, as well as platinum-drug-resistant variants of each. Following preliminary screening of virus and drug combinations, dl1520 and melphalan were found to synergistically inhibit proliferation of all the cancer cell lines. Melphalan pretreatment or cotreatment with dl1520 enhanced inhibition of proliferation by dl1520 by up to 60% and increased apoptosis by up to 25%. The tight-junction protein CAR (coxsackie and adenovirus receptor), via which adenovirus enters cells, was not upregulated by treatment with melphalan, suggesting that other mechanisms contribute to synergy. The synergy between melphalan and dl1520 suggests that tumor-selective cell killing by oncolytic viruses may be augmented by combining with cytotoxic drugs.

  5. Beryllium-stimulated apoptosis in macrophage cell lines.

    Science.gov (United States)

    Sawyer, R T; Fadok, V A; Kittle, L A; Maier, L A; Newman, L S

    2000-08-21

    In vitro stimulation of bronchoalveolar lavage cells from patients with chronic beryllium disease (CBD) induces the production of TNF-alpha. We tested the hypothesis that beryllium (Be)-stimulated TNF-alpha might induce apoptosis in mouse and human macrophage cell lines. These cell lines were selected because they produce a range of Be-stimulated TNF-alpha. The mouse macrophage cell line H36.12j produces high levels of Be-stimulated TNF-alpha. The mouse macrophage cell line P388D.1 produces low, constitutive, levels of TNF-alpha and does not up-regulate Be-stimulated TNF-alpha production. The DEOHS-1 human CBD macrophage cell line does not produce constitutive or Be-stimulated TNF-alpha. Apoptosis was determined by microscopic observation of propidium iodide stained fragmented nuclei in unstimulated and BeSO(4)-stimulated macrophage cell lines. BeSO(4) induced apoptosis in all macrophage cell lines tested. Beryllium-stimulated apoptosis was dose-responsive and maximal after 24 h of exposure to 100 microM BeSO(4). In contrast, unstimulated and Al(2)(SO(4))(3)-stimulated macrophage cell lines did not undergo apoptosis. The general caspase inhibitor BD-fmk inhibited Be-stimulated macrophage cell line apoptosis at concentrations above 50 microM. Our data show that Be-stimulated macrophage cell line apoptosis was caspase-dependent and not solely dependent on Be-stimulated TNF-alpha levels. We speculate that the release of Be-antigen from apoptotic macrophages may serve to re-introduce Be material back into the lung microenvironment, make it available for uptake by new macrophages, and thereby amplify Be-stimulated cytokine production, promoting ongoing inflammation and granuloma maintenance in CBD.

  6. Inhibition of cellular proliferation and induction of apoptosis in human lung adenocarcinoma A549 cells by T-type calcium channel antagonist.

    Science.gov (United States)

    Choi, Doo Li; Jang, Sun Jeong; Cho, Sehyeon; Choi, Hye-Eun; Rim, Hong-Kun; Lee, Kyung-Tae; Lee, Jae Yeol

    2014-03-15

    The anti-proliferative and apoptotic activities of new T-type calcium channel antagonist, 6e (BK10040) on human lung adenocarcinoma A549 cells were investigated. The MTT assay results indicated that BK10040 was cytotoxic against human lung adenocarcinoma (A549) and pancreatic cancer (MiaPaCa2) cells in a dose-dependent manner with IC50 of 2.25 and 0.93μM, respectively, which is ca. 2-fold more potent than lead compound KYS05090 despite of its decreased T-type calcium channel blockade. As a mode of action for cytotoxic effect of BK10040 on lung cancer (A549) cells, this cancer cell death was found to have the typical features of apoptosis, as evidenced by the accumulation of positive cells for annexin V. In addition, BK10040 triggered the activations of caspases 3 and 9, and the cleavages of poly (ADP-ribose) polymerase (PARP). Moreover, the treatment with z-VAD-fmk (a broad spectrum caspase inhibitor) significantly prevented BK10040-induced apoptosis. Based on these results, BK10040 may be used as a potential therapeutic agent for human lung cancer via the potent apoptotic activity. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. Expression of epithelial-mesenchymal transition and cancer stem cell markers in colorectal adenocarcinoma: Clinicopathological significance.

    Science.gov (United States)

    Choi, Ji Eun; Bae, Jun Sang; Kang, Myoung Jae; Chung, Myoung Ja; Jang, Kyu Yun; Park, Ho Sung; Moon, Woo Sung

    2017-09-01

    Epithelial-mesenchymal transition (EMT) is known to be associated with cancer progression, metastatic spread, and therapeutic resistance and to occur at the invasive front. Cancer stem cells (CSCs) display stemness features and might be implicated in tumor initiation, local recurrence and metastasis. The present study was conducted to examine the expression status and relationships between EMT- and CSC-related proteins in the different tumor areas of primary colorectal cancer (CRC), along with their clinicopathological significance. We performed immunohistochemical staining for 4 EMT-related proteins, namely E-cadherin, β-catenin, snail and vimentin, and two CSC-related proteins, namely CD44 and CD133, in two different tumor areas (the representative tumor center and the deepest invasive front) in 286 cases of primary CRC using tissue microarrays. Altered expression of all EMT-related proteins was more frequently observed in the invasive front than in the tumor center. Altered expression of E-cadherin, β-catenin and vimentin significantly associated with aggressive tumor characteristics. In particular, loss of E-cadherin expression in the invasive front significantly associated with shorter disease-free survival (DFS, P=0.002) and overall survival (OS, P=0.007). Overexpression of vimentin in the invasive front significantly correlated with poor OS (P=0.028). Loss of CD44 expression both in the tumor center and in the invasive front significantly associated with unfavorable clinicopathological characteristics. In the invasive front, but not in the tumor center, combination of the altered protein expression patterns of E-cadherin, β-catenin, vimentin, snail and CD133 significantly associated with aggressive clinicopathological factors and shorter DFS (P=0.003) and OS (P=0.005). The present data suggest that cancer cells expressing a combination of altered EMT- and CSC-related proteins may represent a potential biomarker for aggressive tumor behavior and may be a

  8. Trastuzumab Mediated T-Cell Response against HER-2/Neu Overexpressing Esophageal Adenocarcinoma Depends on Intact Antigen Processing Machinery

    NARCIS (Netherlands)

    Milano, Francesca; Guarriera, Mirta; Rygiel, Agnieszka M.; Krishnadath, Kausilia K.

    2010-01-01

    BACKGROUND: Esophageal adenocarcinoma (EAC) is a highly aggressive disease with poor prognosis, which frequently exhibits HER-2 gene amplification. Trastuzumab, the humanized antibody against HER-2, has potent growth inhibitory effects on HER-2 overexpressing cancers. One effect of trastuzumab is

  9. Anti-tumor effect of bisphosphonate (YM529 on non-small cell lung cancer cell lines

    Directory of Open Access Journals (Sweden)

    Date Hiroshi

    2007-01-01

    Full Text Available Abstract Background YM529 is a newly developed nitrogen-containing bisphosphonate (BP classified as a third-generation BP that shows a 100-fold greater potency against bone resorption than pamidronate, a second-generation BP. This agent is, therefore expected to be extremely useful clinically for the treatment of osteoporosis and hypercalcemia. Recently, YM529 as well as other third-generation BPs have also been shown to exert anti-tumor effects against various types of cancer cells both in vitro or/and in vivo. In this study, we investigate the anti-tumor effect of YM529 on non-small cell lung cancer (NSCLC. Methods Direct anti-tumor effect of YM529 against 8 NSCLC cell lines (adenocarcinoma: H23, H1299, NCI-H1819, NCI-H2009, H44, A549, adenosquamous cell carcinoma: NCI-H125, squamous cell carcinoma: NCI-H157 were measured by MTS assay and calculated inhibition concentration 50 % (IC50 values. YM529 induced apoptosis of NCI-H1819 was examined by DNA fragmentation of 2 % agarose gel electrophoresis and flowcytometric analysis (sub-G1 method. We examined where YM529 given effect to apoptosis of NSCLC cells in signaling pathway of the mevalonate pathway by western blotting analysis. Results We found that there was direct anti-tumor effect of YM529 on 8 NSCLC cell lines in a dose-dependent manner and their IC50 values were 2.1 to 7.9 μM and YM529 induced apoptosis and G1 arrest cell cycle with dose-dependent manner and YM529 caused down regulation of phospholyration of ERK1/2 in signaling pathways of NSCLC cell line (NCI-H1819. Conclusion Our study demonstrate that YM529 showed direct anti-tumor effect on NSCLC cell lines in vitro, which supports the possibility that third-generation BPs including YM529 can be one of therapeutic options for NSCLC.

  10. Binding of the transcription factor Slug to the L1CAM promoter is essential for transforming growth factor-β1 (TGF-β)-induced L1CAM expression in human pancreatic ductal adenocarcinoma cells.

    Science.gov (United States)

    Geismann, Claudia; Arlt, Alexander; Bauer, Iris; Pfeifer, Marco; Schirmer, Uwe; Altevogt, Peter; Müerköster, Susanne Sebens; Schäfer, Heiner

    2011-01-01

    Members of the Slug/Snail family of transcription factors are thought to drive epithelial-mesenchymal-transition (EMT) in preneoplastic epithelial cells, thereby contributing to malignant transformation. One mediator in the EMT of pancreatic ductal adenocarcinoma (PDAC) cells and a potential target gene of Slug is the cellular adhesion molecule L1CAM. Using the human pancreatic ductal epithelial cell line H6c7 and the PDAC cell line Panc1, we could show that along with TGF-β1-induced EMT, L1CAM expression is increased in a Slug- but not Snail-dependent fashion. Two E-box recognition motifs in the L1CAM promoter upstream of the most distal transcriptional start site could be verified by gel shift and supershift assay to interact with Slug. ChIP assays detected an increased interaction of Slug with both recognition motifs of the human L1CAM promoter in TGF-β1-treated H6c7 cells, whereas binding of Snail was downregulated. Moreover, ChIP assays with Panc1 cells confirmed this interaction of Slug with the human L1CAM promoter and further detected an interaction of both recognition sites with RNA-polymerase II in a Slug-dependent fashion. Luciferase reporter gene assays using wild-type or single- and double-mutated variants of the L1CAM promoter confirmed transcriptional activation by Slug involving both recognition motifs. By demonstrating the direct transcriptional control of L1CAM expression through Slug during TGF-β1-induced EMT of PDAC cells, our findings point to a novel mechanism by which Slug contributes quite early to tumorigenesis. Moreover, our study is the first one describing the control of the human L1CAM promoter in tumor cells.

  11. Antiproliferative effects on colon adenocarcinoma cells induced by co-administration of vitamin K1 and Lactobacillus rhamnosus GG.

    Science.gov (United States)

    Orlando, Antonella; Linsalata, Michele; Russo, Francesco

    2016-06-01

    Vitamin K (VK), an essential nutrient associated with the clotting cascade, has also been demonstrated to have anticancer properties in various cancer cells including colon cancer cells. Also probiotics have gained interest as potential anticancer agents. Among them, Lactobacillus rhamnosus GG (L.GG) has been shown to inhibit cell proliferation and polyamine biosynthesis as well as to induce apoptosis in different human gastrointestinal cancer cells. Nevertheless, the exact mechanisms involved in these actions are not completely elucidated. Therefore, the aims of the present study were to evaluate in three differently graded human colon cancer cells (namely Caco-2, HT-29 and SW480) the effects of increasing VK1 concentrations, administered alone or in combination with viable L.GG, on the cell proliferation evaluated by MTT test, apoptosis investigated by Bax/Bcl-2 ratio and the percentage of the apoptotic cells, and the cell cycle evaluated by MUSE cell analyzer. Both VK1 and L.GG administered alone up to 72 h, caused inhibition of proliferation, induction of apoptosis and the cell cycle arrest in all the tested colon cancer cells. When VK1 and L.GG were co-administered, the addition of increasing VK1 concentrations potentiated the probiotic antiproliferative effect in a dose-dependent manner, being also related to the individual features of each cell line. The effect was more evident in Caco-2 and HT-29 cells compared to the less differentiated SW480. The enhanced antiproliferative efficacy due to co-administration of L.GG and VK1 could represent a suitable option in a functional food strategy for cancer growth inhibition and chemoprevention.

  12. Susceptibility of various cell lines to Neospora caninum tachyzoites cultivation

    Directory of Open Access Journals (Sweden)

    Khordadmehr, M.,

    2014-05-01

    Full Text Available Neospora caninum is a coccidian protozoan parasite which is a major cause of bovine abortions and neonatal mortality in cattle, sheep, goat and horse. Occasionally, cultured cells are used for isolation and multiplication of the agent in vitro with several purposes. In this study the tachyzoite yields of N. caninum were compared in various cell cultures as the host cell lines. Among the cell cultures tested, two presented good susceptibility to the agent: cell lines Vero and MA-104. SW742 and TLI (in vitro suspension culture of lymphoid cells infected with Theileria lestoquardi showed moderate sensitivity. No viable tachyzoite were detected in the culture of MDCK and McCoy cell lines. These results demonstrate that MA-104 and SW742 cells present adequate susceptibility to N. caninum compared to Vero cells, which have been largely used to multiply the parasite in vitro. Moreover, these have easy manipulation, fast multiplication and relatively low nutritional requirements. In addition, the result of this study showed that TLI cell line as a suspension cell culture is susceptible to Nc-1 tachyzoites infection and could be used as an alternative host cell line for tachyzoites culture in vitro studies.

  13. Neferine augments therapeutic efficacy of cisplatin through ROS- mediated non-canonical autophagy in human lung adenocarcinoma (A549 cells).

    Science.gov (United States)

    Kalai Selvi, Sivalingam; Vinoth, Amirthalingam; Varadharajan, Thiyagarajan; Weng, Ching Feng; Vijaya Padma, Viswanadha

    2017-05-01

    Combination of dietary components with chemotherapy drugs is an emerging new strategy for cancer therapy to increase antitumor responses. Neferine, major bisbenzylisoquinoline alkaloid isolated from the seed embryo of Nelumbo nucifera (Lotus). In the present study, we investigated the efficacy of the combinatorial regimen of neferine and cisplatin compared to cisplatin high dose in human lung adenocarcinoma (A549) cells. Co-treatment with neferine enhanced cisplatin-induced autophagy in A549 cells was accompanied by Acidic vesicular accumulation (AVO), enhanced generation of reactive oxygen species (ROS) and depletion of intracellular glutathione (GSH), down regulation of PI3K/AKT/mTOR pathway, conversion of LC3B-I to LC3B-II. This enhanced autophagy developed via a non-canonical mechanism that did not require Beclin-1, PI3KCIII. In conclusion, these results suggest that neferine enhances cisplatin -induced autophagic cancer cell death through downregulation of PI3K/Akt/mTOR signaling pro-survival pathway and ROS- mediated Beclin-1 and PI3K CIII independent autophagy in human lung adenocarcinoma (A549 cells). Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Natural killer cells for immunotherapy – Advantages of cell lines over blood NK cells

    Directory of Open Access Journals (Sweden)

    Hans eKlingemann

    2016-03-01

    Full Text Available Natural killer cells are potent cytotoxic effector cells for cancer therapy and potentially for severe viral infections. However, there are technical challenges to obtain sufficient numbers of functionally active NK cells form a patient’s blood since they represent only 10% of the lymphocytes. Especially, cancer patients are known to have dysfunctional NK cells. The alternative is to obtain cells from a healthy donor, which requires depletion of the allogeneic T-cells. Establishing cell lines from donor blood NK cells have not been successful, in contrast to blood NK cells obtained from patients with a clonal NK cell lymphoma. Those cells can be expanded in culture in the presence of IL-2. However, except for the NK-92 cell line none of the other six known cell lines has consistent and reproducibly high anti-tumor cytotoxicity, nor can they be easily genetically manipulated to recognize specific tumor antigens or to augment monoclonal antibody activity through ADCC. NK-92 is also the only cell line product that has been widely given to patients with advanced cancer with demonstrated efficiency and minimal side effects.

  15. Metformin inhibits 17β-estradiol-induced epithelial-to-mesenchymal transition via βKlotho-related ERK1/2 signaling and AMPKα signaling in endometrial adenocarcinoma cells.

    Science.gov (United States)

    Liu, Zhao; Qi, Shasha; Zhao, Xingbo; Li, Mingjiang; Ding, Sentai; Lu, Jiaju; Zhang, Hui

    2016-04-19

    The potential role of metformin in treating endometrial cancer remains to be explored. The current study investigated the role of metformin in 17β-estradiol-induced epithelial-mesenchymal transition (EMT) in endometrial adenocarcinoma cells. We found that 17β-estradiol promoted proliferation and migration, attenuated apoptosis in both estrogen receptor (ER) positive and ER negative endometrial adenocarcinoma cells (Ishikawa and KLE cells, respectively). Metformin abolished 17β-estradiol-induced cell proliferation and reversed 17β-estradiol-induced EMT in Ishikawa cells. In addition, metformin increased the expression of βKlotho, a fibroblast growth factors (FGFs) coreceptor, and decreased ERK1/2 phosphorylation in both Ishikawa and KLE cells. Decreased expression of βKlotho was noted in human endometrial adenocarcinomas, and plasmid-driven expression of βKlotho in Ishikawa cells abolished 17β-estradiol-induced EMT via inhibiting ERK1/2 signaling. βKlotho expression and metformin show synergetic effects on the proliferation and the EMT in Ishikawa cells. Furthermore, we demonstrated that the anti-EMT effects of metformin could be partly abolished by introducing Compound C, a specific AMPKα signaling inhibitor. In conclusion, metformin abolishes 17β-estradiol-induced cell proliferation and EMT in endometrial adenocarcinoma cells by upregulating βKlotho expression, inhibiting ERK1/2 signaling, and activating AMPKα signaling. Our study provides novel mechanistic insight into the anti-tumor effects of metformin.

  16. Characterization and development of UCI 107, a primary human ovarian carcinoma cell line.

    Science.gov (United States)

    Gamboa, G; Carpenter, P M; Podnos, Y D; Dorion, G; Iravani, L; Bolton, D; Mascarello, J T; Manetta, A

    1995-09-01

    We introduce a new epithelial ovarian carcinoma cell line (UCI 107) from a patient with papillary adenocarcinoma of the ovary who had not been previously treated. The growth characteristics, chemosensitivity, tumorgenicity, cytogenetics, antigen expression, and receptor status were examined. A standardized photometric assay was implemented to determine the response to single drug agents including doxorubicin (ADR), cisplatin (CDDP), and Taxol. Tumorgenicity was determined utilizing female athymic mice implanted either subcutaneously (sc) or intraperitoneally (ip) with 1 x 10(7) UCI 107 cells. UCI 107 cells grow rapidly in culture with lag phase of approximately 48 hr, population doubling time of 24-36 hr, and saturation density of 4.8 x 10(5) cells/cm2. The 50% inhibitory concentration values for the chemotherapeutic agents were 0.170, 0.029, and 0.330 microM for ADR, Taxol, and CDDP, respectively. Nude mice produced ip tumors within 15 days, resulting in death from carcinomatosis 40-45 days postimplantation. Subcutaneous tumor nodules (100 mm3) were observed in nude mice 12-13 days post-tumor implantation reaching a maximum tumor volume of approximately 10,000 mm3 by Day 30. The cytogenetic composite karyotype is as follows: 46, X, der (X) t (X;7) (p11;q22), inv dup (1) (q12;q32), t (6;6;11;22) (p21.3;q16;q23.3;q13.3), del (13) (q14.1). The cell line expresses progesterone receptor, increased levels of p53 protein, and cytokeratins. It does not appear to express Her-2/neu protein, estrogen receptor, nor the CA 125 tumor marker. In conclusion, UCI 107 displays unique cellular properties which make it an attractive model for the study of ovarian cancer.

  17. SU-F-T-678: Clotrimazole Sensitizes MCF-7 Breast Cancer Cell Line to Radiation

    International Nuclear Information System (INIS)

    Garcia, L; Tambasco, M

    2016-01-01

    Purpose: To study the effects of Clotrimazole (CLT) on radiosensitivity of MCF-7 Cells in correlation to detachment of Hexokinase II from the Voltage Dependent Anion Channel on the outer membrane of the mitochondria. Apoptotic fractions were also analyzed in relation to the detachment of Hexokinase. Methods: This study focused on the mammary adenocarcinoma cell line, MCF-7. Colony forming assays were used to analyze radiosensitization by CLT. Flow cytometry methods were used to analyze apoptotic vs necrotic fractions after treatment with CLT. Spectrophotometery was used to analyze the mitochondrial bound and soluble fraction of Hexokinase by means of relative enzymatic activity. Results: Our preliminary data have shown that CLT sensitizes MCF-7 cells to radiation in a dose and incubation time dependent manner up. We have also demonstrated that there are two radiosensitizing periods in MCF-7 cells with the first corresponding to the cycle arrest after 24 hours observed in other cell lines. The second radiosensitizing period occurs with incubation in CLT after irradiation which reaches maximum effect around 24 hours of incubation time. Preliminary data from our Hexokinase detachment assay show a factor of two increase in the ratio of unbound to bound Hexokinase when comparing incubation for 24 hours in media containing 0 and 20 µM CLT. Conclusion: This study and others indicate CLT as a possible radiosensitizing agent in cancer therapies. While CLT itself shows toxicity to the liver in high doses, this study further demonstrates that disruption of the Warburg Effect and unbinding of mitochondrial bound Hexokinase as a possible pathway for cancer treatment.

  18. SU-F-T-678: Clotrimazole Sensitizes MCF-7 Breast Cancer Cell Line to Radiation

    Energy Technology Data Exchange (ETDEWEB)

    Garcia, L; Tambasco, M [San Diego State University, San Diego, CA (United States)

    2016-06-15

    Purpose: To study the effects of Clotrimazole (CLT) on radiosensitivity of MCF-7 Cells in correlation to detachment of Hexokinase II from the Voltage Dependent Anion Channel on the outer membrane of the mitochondria. Apoptotic fractions were also analyzed in relation to the detachment of Hexokinase. Methods: This study focused on the mammary adenocarcinoma cell line, MCF-7. Colony forming assays were used to analyze radiosensitization by CLT. Flow cytometry methods were used to analyze apoptotic vs necrotic fractions after treatment with CLT. Spectrophotometery was used to analyze the mitochondrial bound and soluble fraction of Hexokinase by means of relative enzymatic activity. Results: Our preliminary data have shown that CLT sensitizes MCF-7 cells to radiation in a dose and incubation time dependent manner up. We have also demonstrated that there are two radiosensitizing periods in MCF-7 cells with the first corresponding to the cycle arrest after 24 hours observed in other cell lines. The second radiosensitizing period occurs with incubation in CLT after irradiation which reaches maximum effect around 24 hours of incubation time. Preliminary data from our Hexokinase detachment assay show a factor of two increase in the ratio of unbound to bound Hexokinase when comparing incubation for 24 hours in media containing 0 and 20 µM CLT. Conclusion: This study and others indicate CLT as a possible radiosensitizing agent in cancer therapies. While CLT itself shows toxicity to the liver in high doses, this study further demonstrates that disruption of the Warburg Effect and unbinding of mitochondrial bound Hexokinase as a possible pathway for cancer treatment.

  19. Radiation sensitivity of human lung cancer cell lines

    International Nuclear Information System (INIS)

    Carmichael, J.; Degraff, W.G.; Gamson, J.; Russo, G.; Mitchell, J.B.; Gazdar, A.F.; Minna, J.D.; Levitt, M.L.

    1989-01-01

    X-Ray survival curves were determined using a panel of 17 human lung cancer cell lines, with emphasis on non-small cell lung cancer (NSCLC). In contrast to classic small cell lung cancer (SCLC) cell lines, NSCLC cell lines were generally less sensitive to radiation as evidenced by higher radiation survival curve extrapolation numbers, surviving fraction values following a 2Gy dose (SF2) and the mean inactivation dose values (D) values. The spectrum of in vitro radiation responses observed was similar to that expected in clinical practice, although mesothelioma was unexpectedly sensitive in vitro. Differences in radiosensitivity were best distinguished by comparison of SF2 values. Some NSCLC lines were relatively sensitive, and in view of this demonstrable variability in radiation sensitivity, the SF2 value may be useful for in vitro predictive assay testing of clinical specimens. (author)

  20. Small interference RNA targeting tissue factor inhibits human lung adenocarcinoma growth in vitro and in vivo

    Directory of Open Access Journals (Sweden)

    Wang Jianing

    2011-05-01

    Full Text Available Abstract Background The human coagulation trigger tissue factor (TF is overexpressed in several types of cancer and involved in tumor growth, vascularization, and metastasis. To explore the role of TF in biological processes of lung adenocarcinoma, we used RNA interference (RNAi technology to silence TF in a lung adenocarcinoma cell line A549 with high-level expression of TF and evaluate its antitumor effects in vitro and in vivo. Methods The specific small interfering RNA (siRNA designed for targeting human TF was transfected into A549 cells. The expression of TF was detected by reverse transcription-PCR and Western blot. Cell proliferation was measured by MTT and clonogenic assays. Cell apoptosis was assessed by flow cytometry. The metastatic potential of A549 cells was determined by wound healing, the mobility and Matrigel invasion assays. Expressions of PI3K/Akt, Erk1/2, VEGF and MMP-2/-9 in transfected cells were detected by Western blot. In vivo, the effect of TF-siRNA on the growth of A549 lung adenocarcinoma xenografts in nude mice was investigated. Results TF -siRNA significantly reduced the expression of TF in the mRNA and protein levels. The down-regulation of TF in A549 cells resulted in the suppression of cell proliferation, invasion and metastasis and induced cell apoptosis in dose-dependent manner. Erk MAPK, PI3K/Akt pathways as well as VEGF and MMP-2/-9 expressions were inhibited in TF-siRNA transfected cells. Moreover, intratumoral injection of siRNA targeting TF suppressed the tumor growth of A549 cells in vivo model of lung adenocarcinoma. Conclusions Down-regulation of TF using siRNA could provide a potential approach for gene therapy against lung adenocarcinoma, and the antitumor effects may be associated with inhibition of Erk MAPK, PI3K/Akt pathways.

  1. Clear cell adenocarcinoma of the vagina and cervix. An update of the central Netherlands registry showing twin age incidence peaks.

    Science.gov (United States)

    Hanselaar, A; van Loosbroek, M; Schuurbiers, O; Helmerhorst, T; Bulten, J; Bernhelm, J

    1997-06-01

    The objective of this study was to update the registry of women in the Netherlands with clear cell adenocarcinoma (CCAC) of the cervix or vagina with or without intrauterine exposure to diethylstilbestrol (DES). From a nationwide search in PALGA, the automated pathology registry in the Netherlands, data were gathered on women with CCAC born after 1947. Information obtained from the clinical files of the patients included reported exposure to DES, patterns of complaints previous to diagnosis, the current status of the patients, and the results of cytopathologic examinations previous to histopathologic diagnosis. After review of the histopathologic slides, the specific pathologic characteristics of CCAC were determined. The age distribution of women born after 1947 was compared with that of women born before 1947. Information about possible exposure to DES during pregnancy was available for 73 of 88 women with CCAC born after 1947. Exposure to DES was reported for 47 (64%) of these women. The DES medication was most often reported as having started before the 18th week of pregnancy. Cytopathologic examination was informative in 81% of the cases of CCAC of the cervix, but only in 41% of the cases of CCAC of the vagina. Most patients had Stage I or II tumors at diagnosis. Tumor Stage III and IV and a high grade of nuclear atypia were related to unfavorable outcome. The age distribution of all patients with CCAC showed two distinct peaks; one at young age, (a mean age of 26 years), and one at older age (a mean age of 71 years). This bimodal age distribution still applied when the cases in which DES exposure was reported had been excluded. Despite the fact that DES has not been prescribed to pregnant women in the Netherlands in the last 20 years, CCAC is still relevant in our times. It is important to stay alert and periodically to update and evaluate the data of this registry, including data on women born outside the DES exposure period. The bimodal age distribution in

  2. Establishment and characterization of rat portal myofibroblast cell lines.

    Directory of Open Access Journals (Sweden)

    Michel Fausther

    Full Text Available The major sources of scar-forming myofibroblasts during liver fibrosis are activated hepatic stellate cells (HSC and portal fibroblasts (PF. In contrast to well-characterized HSC, PF remain understudied and poorly defined. This is largely due to the facts that isolation of rodent PF for functional studies is technically challenging and that PF cell lines had not been established. To address this, we have generated two polyclonal portal myofibroblast cell lines, RGF and RGF-N2. RGF and RGF-N2 were established from primary PF isolated from adult rat livers that underwent culture activation and subsequent SV40-mediated immortalization. Specifically, Ntpdase2/Cd39l1-sorted primary PF were used to generate the RGF-N2 cell line. Both cell lines were functionally characterized by RT-PCR, immunofluorescence, immunoblot and bromodeoxyuridine-based proliferation assay. First, immortalized RGF and RGF-N2 cells are positive for phenotypic myofibroblast markers alpha smooth muscle actin, type I collagen alpha-1, tissue inhibitor of metalloproteinases-1, PF-specific markers elastin, type XV collagen alpha-1 and Ntpdase2/Cd39l1, and mesenchymal cell marker ecto-5'-nucleotidase/Cd73, while negative for HSC-specific markers desmin and lecithin retinol acyltransferase. Second, both RGF and RGF-N2 cell lines are readily transfectable using standard methods. Finally, RGF and RGF-N2 cells attenuate the growth of Mz-ChA-1 cholangiocarcinoma cells in co-culture, as previously demonstrated for primary PF. Immortalized rat portal myofibroblast RGF and RGF-N2 cell lines express typical markers of activated PF-derived myofibroblasts, are suitable for DNA transfection, and can effectively inhibit cholangiocyte proliferation. Both RGF and RGF-N2 cell lines represent novel in vitro cellular models for the functional studies of portal (myofibroblasts and their contribution to the progression of liver fibrosis.

  3. UCI-VULV-1, a vulvar squamous carcinoma cell line.

    Science.gov (United States)

    Carpenter, P M; Gamboa-Vujicic, G; Mascarello, J T; Wilczynski, S; Bhaumik, M; Dorion, G; Manetta, A

    1995-05-01

    Squamous carcinoma of the vulva (SCV) is an uncommon neoplasm of uncertain etiology. There is evidence that t