
Sample records for adenine nucleotide translocase

  1. Two adenine nucleotide translocase paralogues involved in cell proliferation and spermatogenesis in the silkworm Bombyx mori.

    Directory of Open Access Journals (Sweden)

    Ryohei Sugahara

    Full Text Available Mitochondrial adenine nucleotide translocase (ANT specifically acts in ADP/ATP exchange through the mitochondrial inner membrane. This transporter protein thereby plays a significant role in energy metabolism in eukaryotic cells. Most mammals have four paralogous ANT genes (ANT1-4 and utilize these paralogues in different types of cells. The fourth paralogue of ANT (ANT4 is present only in mammals and reptiles and is exclusively expressed in testicular germ cells where it is required for meiotic progression in the spermatocytes. Here, we report that silkworms harbor two ANT paralogues, the homeostatic paralogue (BmANTI1 and the testis-specific paralogue (BmANTI2. The BmANTI2 protein has an N-terminal extension in which the positions of lysine residues in the amino acid sequence are distributed as in human ANT4. An expression analysis showed that BmANTI2 transcripts were restricted to the testis, suggesting the protein has a role in the progression of spermatogenesis. By contrast, BmANTI1 was expressed in all tissues tested, suggesting it has an important role in homeostasis. We also observed that cultured silkworm cells required BmANTI1 for proliferation. The ANTI1 protein of the lepidopteran Plutella xylostella (PxANTI1, but not those of other insect species (or PxANTI2, restored cell proliferation in BmANTI1-knockdown cells suggesting that ANTI1 has similar energy metabolism functions across the Lepidoptera. Our results suggest that BmANTI2 is evolutionarily divergent from BmANTI1 and has developed a specific role in spermatogenesis similar to that of mammalian ANT4.

  2. Evaluation of Porin Interaction with Adenine Nucleotide Translocase and Cyclophilin-D Proteins after Brain Ischemia and Reperfusion

    Directory of Open Access Journals (Sweden)

    Mohammad Ali Atlasi


    Full Text Available Objective (s Porin is a mitochondrial outer membrane channel, which usually functions as the pathway for the movement of various substances in and out of the mitochondria and is considered to be a component of the permeability transition (PT pore complex that plays a role in the PT. We addressed the hypothesis that porin interacts with other mitochondrial proteins after ischemic injury.Materials and MethodsFor this purpose, we used in vivo 4-vessel occlusion model of rat brain and porin purification method by hydroxyapatite column. After SDS gel electrophoresis and silver nitrate staining, Western blotting was done for porin, adenine nucleotide translocase and cyclophilin-D proteins.Results Porin was purified from mitochondrial mixture in ischemic brain and control groups. Investigation of interaction of adenine nucleotide transposes (ANT and cyclophilin-D with porin by Western blotting showed no proteins co-purified with porin from injured tissues.Conclusion The present study implies that there may not be interaction between porin, and ANT or cyclophilin-D, and if there is any, it is not maintained during the purification procedure.

  3. Over-expression of Adenine Nucleotide Translocase 1 (ANT1) Induces Apoptosis and Tumor Regression in vivo

    International Nuclear Information System (INIS)

    Adenine nucleotide translocase (ANT) is located in the inner mitochondrial membrane and catalyzes the exchange of mitochondrial ATP for cytosolic ADP. ANT has been known to be a major component of the permeability transition pore complex of mitochondria and contributes to mitochondria-mediated apoptosis. Human ANT has four isoforms (ANT1, ANT2, ANT3, and ANT4), and the expression of the ANT isoforms is variable depending on the tissue and cell type, developmental stage, and proliferation status. Among the isoforms, ANT1 is highly expressed in terminally-differentiated tissues, but expressed in low levels in proliferating cells, such as cancer cells. In particular, over-expression of ANT1 induces apoptosis in cultured tumor cells. We applied an ANT1 gene transfer approach to induce apoptosis and to evaluate the anti-tumor effect of ANT1 in a nude mouse model. We demonstrated that ANT1 transfection induced apoptosis of MDA-MB-231 cells, inactivated NF-κB activity, and increased Bax expression. ANT1-inducing apoptosis was accompanied by the disruption of mitochondrial membrane potential, cytochrome c release and the activation of caspases-9 and -3. Moreover, ANT1 transfection significantly suppressed tumor growth in vivo. Our results suggest that ANT1 transfection may be a useful therapeutic modality for the treatment of cancer

  4. Over-expression of Adenine Nucleotide Translocase 1 (ANT1 Induces Apoptosis and Tumor Regression in vivo

    Directory of Open Access Journals (Sweden)

    Kim Chul-Woo


    Full Text Available Abstract Background Adenine nucleotide translocase (ANT is located in the inner mitochondrial membrane and catalyzes the exchange of mitochondrial ATP for cytosolic ADP. ANT has been known to be a major component of the permeability transition pore complex of mitochondria and contributes to mitochondria-mediated apoptosis. Human ANT has four isoforms (ANT1, ANT2, ANT3, and ANT4, and the expression of the ANT isoforms is variable depending on the tissue and cell type, developmental stage, and proliferation status. Among the isoforms, ANT1 is highly expressed in terminally-differentiated tissues, but expressed in low levels in proliferating cells, such as cancer cells. In particular, over-expression of ANT1 induces apoptosis in cultured tumor cells. Methods We applied an ANT1 gene transfer approach to induce apoptosis and to evaluate the anti-tumor effect of ANT1 in a nude mouse model. Results We demonstrated that ANT1 transfection induced apoptosis of MDA-MB-231 cells, inactivated NF-κB activity, and increased Bax expression. ANT1-inducing apoptosis was accompanied by the disruption of mitochondrial membrane potential, cytochrome c release and the activation of caspases-9 and -3. Moreover, ANT1 transfection significantly suppressed tumor growth in vivo. Conclusion Our results suggest that ANT1 transfection may be a useful therapeutic modality for the treatment of cancer.

  5. Data supporting the involvement of the adenine nucleotide translocase conformation in opening the Tl(+)-induced permeability transition pore in Ca(2+)-loaded rat liver mitochondria. (United States)

    Korotkov, Sergey M


    There we made available information about the effects of the adenine nucleotide translocase (ANT) 'c' conformation fixers (phenylarsine oxide (PAO), tert-butylhydroperoxide (tBHP), and carboxyatractyloside) as well as thiol reagent (4,4'-diisothiocyanostilbene-2,2'-disulfonate (DIDS)) on isolated rat liver mitochondria. We observed a decrease in A540 (mitochondrial swelling) and respiratory control rates (RCRADP [state 3/state 4] and RCRDNP [2,4-dinitrophenol-uncoupled state/basal state or state 4]), as well as an increase in Ca(2+)-induced safranin fluorescence (F485/590, arbitrary units), showed a dissipation in the inner membrane potential (ΔΨmito), in experiments with energized rat liver mitochondria, injected into the buffer containing 25-75 mM TlNO3, 125 mM KNO3, and 100 µM Ca(2+). The fixers and DIDS, in comparison to Ca(2+) alone, greatly increased A540 decline and the rate of Ca(2+)-induced ΔΨmito dissipation. These reagents also markedly decreased RCRADP and RCRDNP. The MPTP inhibitors (ADP, cyclosporin A, bongkrekic acid, and N-ethylmaleimide) fixing the ANT in 'm' conformation significantly hindered the above-mentioned effects of the fixers and DIDS. A more complete scientific analysis of these findings may be obtained from the manuscript "To involvement the conformation of the adenine nucleotide translocase in opening the Tl(+)-induced permeability transition pore in Ca(2+)-loaded rat liver mitochondria" (Korotkov et al., 2016 [1]). PMID:27054168

  6. To involvement the conformation of the adenine nucleotide translocase in opening the Tl(+)-induced permeability transition pore in Ca(2+)-loaded rat liver mitochondria. (United States)

    Korotkov, Sergey M; Konovalova, Svetlana A; Brailovskaya, Irina V; Saris, Nils-Erik L


    The conformation of adenine nucleotide translocase (ANT) has a profound impact in opening the mitochondrial permeability transition pore (MPTP) in the inner membrane. Fixing the ANT in 'c' conformation by phenylarsine oxide (PAO), tert-butylhydroperoxide (tBHP), and carboxyatractyloside as well as the interaction of 4,4'-diisothiocyanostilbene-2,2'-disulfonate (DIDS) with mitochondrial thiols markedly attenuated the ability of ADP to inhibit the MPTP opening. We earlier found (Korotkov and Saris, 2011) that calcium load of rat liver mitochondria in medium containing TlNO3 and KNO3 stimulated the Tl(+)-induced MPTP opening in the inner mitochondrial membrane. The MPTP opening as well as followed increase in swelling, a drop in membrane potential (ΔΨmito), and a decrease in state 3, state 4, and 2,4-dinitrophenol-uncoupled respiration were visibly enhanced in the presence of PAO, tBHP, DIDS, and carboxyatractyloside. However, these effects were markedly inhibited by ADP and membrane-penetrant hydrophobic thiol reagent, N-ethylmaleimide (NEM) which fix the ANT in 'm' conformation. Cyclosporine A additionally potentiated these effects of ADP and NEM. Our data suggest that conformational changes of the ANT may be directly involved in the opening of the Tl(+)-induced MPTP in the inner membrane of Ca(2+)-loaded rat liver mitochondria. Using the Tl(+)-induced MPTP model is discussed in terms finding new transition pore inhibitors and inducers among different chemical and natural compounds. PMID:26835787

  7. An adenine nucleotide translocase (ANT) gene from Apostichopus japonicus; molecular cloning and expression analysis in response to lipopolysaccharide (LPS) challenge and thermal stress. (United States)

    Liu, Qiu-Ning; Chai, Xin-Yue; Tu, Jie; Xin, Zhao-Zhe; Li, Chao-Feng; Jiang, Sen-Hao; Zhou, Chun-Lin; Tang, Bo-Ping


    The adenine nucleotide translocases (ANTs) play a vital role in energy metabolism via ADP/ATP exchange in eukaryotic cells. Apostichopus japonicus (Echinodermata: Holothuroidea) is an important economic species in China. Here, a cDNA representing an ANT gene of A. japonicus was isolated and characterized from respiratory tree and named AjANT. The full-length AjANT cDNA is 1924 bp, including a 5'-untranslated region (UTR) of 38 bp, 3'-UTR of 980 bp and an open reading frame (ORF) of 906 bp encoding a polypeptide of 301 amino acids. The protein contains three homologous repeat Mito_carr domains (Pfam00153). The deduced AjANT protein sequence has 49-81% in comparison to ANT proteins from other individuals. The predicted tertiary structure of AjANT protein is highly similar to animal ANT proteins. Phylogenetic analysis showed that the AjANT is closely related to Holothuroidea ANT genes. Real-time quantitative reverse transcription-PCR (qPCR) analysis showed that AjANT expression is higher in the respiratory tree than in other examined tissues. After thermal stress or LPS challenge, expression of AjANT was significantly fluctuant compared to the control. These results suggested that changes in the expression of ANT gene might be involved in immune defense and in protecting A. japonicus against thermal stress. PMID:26706223

  8. Short-hairpin RNA-induced suppression of adenine nucleotide translocase-2 in breast cancer cells restores their susceptibility to TRAIL-induced apoptosis by activating JNK and modulating TRAIL receptor expression

    Directory of Open Access Journals (Sweden)

    Kim Chul-Woo


    Full Text Available Abstract Background Tumor necrosis factor (TNF-related apoptosis-inducing ligand (TRAIL; apo2 ligand induces apoptosis in cancer cells but has little effect on normal cells. However, many cancer cell types are resistant to TRAIL-induced apoptosis, limiting the clinical utility of TRAIL as an anti-cancer agent. We previously reported that the suppression of adenine nucleotide translocase-2 (ANT2 by short-hairpin RNA (shRNA induces apoptosis of breast cancer cells, which frequently express high levels of ANT2. In the present study, we examined the effect of RNA shRNA-induced suppression of ANT2 on the resistance of breast cancer cells to TRAIL-induced apoptosis in vitro and in vivo. Results ANT2 shRNA treatment sensitized MCF7, T47 D, and BT474 cells to TRAIL-induced apoptosis by up-regulating the expression of TRAIL death receptors 4 and 5 (DR4 and DR5 and down-regulating the TRAIL decoy receptor 2 (DcR2. In MCF7 cells, ANT2 knockdown activated the stress kinase c-Jun N-terminal kinase (JNK, subsequently stabilizing and increasing the transcriptional activity of p53 by phosphorylating it at Thr81; it also enhanced the expression and activity of DNA methyltransferase 1 (DNMT1. ANT2 shRNA-induced overexpression of DR4/DR5 and TRAIL sensitization were blocked by a p53 inhibitor, suggesting that p53 activation plays an important role in the transcriptional up-regulation of DR4/DR5. However, ANT2 knockdown also up-regulated DR4/DR5 in the p53-mutant cell lines BT474 and T47 D. In MCF7 cells, ANT2 shRNA treatment led to DcR2 promoter methylation and concomitant down-regulation of DcR2 expression, consistent with the observed activation of DNMT1. Treatment of the cells with a demethylating agent or JNK inhibitor prevented the ANT2 shRNA-induced down-regulation of DcR2 and activation of both p53 and DNMT1. In in vivo experiments using nude mice, ANT2 shRNA caused TRAIL-resistant MCF7 xenografts to undergo TRAIL-induced cell death, up-regulated DR4/DR5

  9. 斑节对虾腺苷酸转移酶(PmANT)基因的cDNA克隆与表达分析%Molecular cloning and expression analysis of adenine nucleotide translocase (PmANT) in Penaeus monodon

    Institute of Scientific and Technical Information of China (English)

    孙文文; 周发林; 黄建华; 邱丽华; 杨其彬; 江世贵


    利用RACE技术获得了斑节对虾(Penaeus monodon)ANT基因(PmANT)的cDNA序列.该序列全长1 388 bp,开放阅读框(ORF)为930 bp,3’非编码区(UTR)为393 bp,5 '非编码区(UTR)为65 bp.ORF可编码309个氨基酸,分子量大约为33.622 ku.与所有ANT家族成员一样,PmANT蛋白具有3个重复同源的线粒体跨膜结构域,但不含信号肽和糖基化位点.相似性、同源性及系统进化树分析显示,斑节对虾的ANT基因与凡纳滨对虾的同源性和相似性最高,并与其聚为一支.采用荧光定量的方法研究了ANT基因在雌雄个体不同组织、卵巢不同发育阶段及未成熟和成熟精巢的差异表达情况.结果表明:PmANT的mRNA在各组织中都有表达,其中,在雄性个体的肌肉中表达量最高,其次为雌性肌肉,在精巢的表达量最低,且未成熟精巢低于成熟精巢.PmANT的mRNA在卵巢的表达量高于精巢,且在Ⅲ期卵巢表达量最高,Ⅳ期最低.为今后进一步研究该基因在斑节对虾性腺发育中的作用提供基础材料.%The adenine nucleotide translocase (ANT) is the most abundant mitochondrial inner membrane protein, which catalyzes the exchange of ADP and ATP between cytosol and mitochondria and participates in many models of mitochondrial apoptosis. In the present study, the full sequence of P. Monodon ANT gene was cloned and named PmANT. The full length cDNA of PmANT contained a 5' untranslated region (UTR) of 65 bp, a 3' UTR of 393 bp and an ORF of 930 bp encoding a polypeptide of 309 amino acids with an estimated molecular mass of 33. 622 ku. Like other animal ANTs, the structure of the PmANT protein consists of three homologous repeated domains. But there are no signal peptide and glycosylation sites in PmANT protein. Sequence alignment analysis showed that the PmANT with the ANT of Litopenaeus vannamei shared a similarity of 98. 7% and the homology of 97. 4%. Analysis of the tissue expression pattern of the PmANT showed that the PmANT m

  10. Mitochondrial Adenine Nucleotide Transport and Cardioprotection


    Das, Samarjit; Steenbergen, Charles


    Mitochondria are highly metabolically active cell organelles that not only act as the powerhouse of the cell by supplying energy through ATP production, but also play a destructive role by initiating cell death pathways. Growing evidence recognizes that mitochondrial dysfunction is one of the major causes of cardiovascular disease. Under de-energized conditions, slowing of adenine nucleotide transport in and out of the mitochondria significantly attenuates myocardial ischemia-reperfusion inju...

  11. Applications of adenine nucleotide measurements in oceanography (United States)

    Holm-Hansen, O.; Hodson, R.; Azam, F.


    The methodology involved in nucleotide measurements is outlined, along with data to support the premise that ATP concentrations in microbial cells can be extrapolated to biomass parameters. ATP concentrations in microorganisms and nucleotide analyses are studied.

  12. Effects of hypobaric hypoxia on adenine nucleotide pools, adenine nucleotide transporter activity and protein expression in rat liver

    Institute of Scientific and Technical Information of China (English)

    Cong-Yang Li; Jun-Ze Liu; Li-Ping Wu; Bing Li; Li-Fen Chen


    AIM: To explore the effect of hypobaric hypoxia on mitochondrial energy metabolism in rat liver.METHODS: Adult male Wistar rats were exposed to a hypobaric chamber simulating 5000 m high altitude for 23 h every day for 0 (HO), 1 (H1), 5 (HS), 15 (H15) and 30 d (H30) respectively. Rats were sacrificed by decapitation and liver was removed. Liver mitochondria were isolated by differential centrifugation program. The size of adenine nucleotide pool (ATP, ADP, and AMP) in tissue and mitochondria was separated and measured by high performance liquid chromatography (HPLC). The adenine nucleotide transporter (ANT) activity was determined by isotopic technique. The ANT total protein level was determined by Western blot. RESULTS: Compared with HO group, intra-mitochondrial ATP content decreased in all hypoxia groups. However,the H5 group reached the lowest point (70.6%) (P< 0.01)when compared to the control group. Intra-mitochondrial ADP and AMP level showed similar change in all hypoxia groups and were significantly lower than that in HO group. In addition, extra-mitochondrial ATP and ADP content decreased significantly in all hypoxia groups.Furthermore, extra-mitochondrial AMP in groups H5, H15and H30 was significantly lower than that in HO group,whereas H1 group had no marked change compared to the control situation. The activity of ANT in hypoxia groups decreased significantly, which was the lowest in H5 group (55.7%) (P<0.01) when compared to HO group. ANT activity in H30 group was higher than in H15 group, but still lower than that in HO group. ANT protein level in H5, H15, H30 groups, compared with HO group decreased significantly, which in H5 group was the lowest, being 27.1% of that in HO group (P<0.01). ANT protein level in H30 group was higher than in H15 group,but still lower than in HO group.CONCLUSION: Hypobaric hypoxia decreases the mitochondrial ATP content in rat liver, while mitochondrial ATP level recovers during long-term hypoxia exposure.The lower

  13. Pleiotropic effects of the yeast Sal1 and Aac2 carriers on mitochondrial function via an activity distinct from adenine nucleotide transport (United States)

    Kucejova, Blanka; Li, Li; Wang, Xiaowen; Giannattasio, Sergio; Chen, Xin Jie


    In Saccharomyces cerevisiae, SAL1 encodes a Ca2+-binding mitochondrial carrier. Disruption of SAL1 is synthetically lethal with the loss of a specific function associated with the Aac2 isoform of the ATP/ADP translocase. This novel activity of Aac2 is defined as the V function (for Viability of aac2 sal1 double mutant), which is independent of the ATP/ADP exchange activity required for respiratory growth (the R function). We found that co-inactivation of SAL1 and AAC2 leads to defects in mitochondrial translation and mitochondrial DNA (mtDNA) maintenance. Additionally, sal1Δ exacerbates the respiratory deficiency and mtDNA instability of ggc1Δ, shy1Δ and mtg1Δ mutants, which are known to reduce mitochondrial protein synthesis or protein complex assembly. The V function is complemented by the human Short Ca2+-binding Mitochondrial Carrier (SCaMC) protein, SCaMC-2, a putative ATP-Mg/Pi exchangers on the inner membrane. However, mitochondria lacking both Sal1p and Aac2p are not depleted of adenine nucleotides. The Aac2R252I and Aac2R253I variants mutated at the R252-254 triplet critical for nucleotide transport retain the V function. Likewise, Sal1p remains functionally active when the R479I and R481I mutations were introduced into the structurally equivalent R479-T480-R481 motif. Finally, we found that the naturally occurring V-R+ Aac1 isoform of adenine nucleotide translocase partially gains the V function at the expense of the R function by introducing the mutations P89L and A96V. Thus, our data support the view that the V function is independent of adenine nucleotide transport associated with Sal1p and Aac2p and this evolutionarily conserved activity affects multiple processes in mitochondria. PMID:18431598

  14. De novo synthesis of adenine nucleotides in different skeletal muscle fiber types

    International Nuclear Information System (INIS)

    Management of adenine nucleotide catabolism differs among skeletal muscle fiber types. This study evaluated whether there are corresponding differences in the rates of de novo synthesis of adenine nucleotide among fiber type sections of skeletal muscle using an isolated perfused rat hindquarter preparation. Label incorporation into adenine nucleotides from the [1-14C]glycine precursor was determined and used to calculate synthesis rates based on the intracellular glycine specific radioactivity. Results show that intracellular glycine is closely related to the direct precursor pool. Rates of de novo synthesis were highest in fast-twitch red muscle (57.0 +/- 4.0, 58.2 +/- 4.4 nmol.h-1.g-1; deep red gastrocnemius and vastus lateralis), relatively high in slow-twitch red muscle (47.0 +/- 3.1; soleus), and low in fast-twitch white muscle (26.1 +/- 2.0 and 21.6 +/- 2.3; superficial white gastrocnemius and vastus lateralis). Rates for four mixed muscles were intermediate, ranging between 32.3 and 37.3. Specific de novo synthesis rates exhibited a strong correlation (r = 0.986) with muscle section citrate synthase activity. Turnover rates (de novo synthesis rate/adenine nucleotide pool size) were highest in high oxidative muscle (0.82-1.06%/h), lowest in low oxidative muscle (0.30-0.35%/h), and intermediate in mixed muscle (0.44-0.55%/h). Our results demonstrate that differences in adenine nucleotide management among fiber types extends to the process of de novo adenine nucleotide synthesis

  15. Raw coffee based dietary supplements contain carboxyatractyligenin derivatives inhibiting mitochondrial adenine-nucleotide-translocase. (United States)

    Lang, Roman; Fromme, Tobias; Beusch, Anja; Lang, Tatjana; Klingenspor, Martin; Hofmann, Thomas


    Capsules, powders and tablets containing raw coffee extract are advertised to the consumer as antioxidant rich dietary supplements as part of a healthy diet. We isolated carboxyatractyligenin (4), 2-O-β-d-glucopyranosyl carboxyatractyligenin (6) and 3'-O-β-d-glucopyranosyl-2'-O-isovaleryl-2β-(2-desoxy-carboxyatractyligenin)-β-d-glucopyranoside (8) from green coffee and found strong inhibitory effects on phosphorylating respiration in isolated mitochondria similar to the effects of the known phytotoxin carboxyatractyloside. LC-MS/MS analysis of commercial green coffee based dietary supplements revealed the occurrence of carboxyatractyligenin, 3'-O-β-d-glucopyranosyl-2'-O-isovaleryl-2β-(2-desoxy-carboxyatractyligenin)-β-d-glucopyranoside, and 2-O-β-d-glucopyranosyl carboxyatractyligenin in concentrations up to 4.0, 5.7, and 41.6μmol/g, respectively. These data might help to gain first insight into potential physiological side-effects of green coffee containing dietary supplement. PMID:24863614

  16. The adsorption and reaction of adenine nucleotides on montmorillonite (United States)

    Ferris, James P.; Hagan, William J., Jr.


    The binding of AMP to Zn(2+)-montmorillonite is investigated in the presence of salts and Good's zwitterion buffers, PIPES and MES. The initial concentrations of nucleotide and the percent adsorbtion are used to calculate the adsorption isotherms, and the Langmuir adsorption equation is used for the analysis of data. The adsorption coefficient was found to be three times greater in the presence of 0.2 M PIPES than in its absence. In addition, basal spacings measured by X-ray diffraction were increased by the buffer. These results are interpreted in terms of a model in which the adsorption of AMP is mediated by a Zn(2+) complex of PIPES in different orientations in the interlamellar region of the montmorillonite. Mixed ligand complexes of this type are reminiscent of the complexes observed between metal ions and biological molecules in living systems.

  17. Downregulation of adenine nucleotide translocator 1 exacerbates tumor necrosis factor-α-mediated cardiac inflammatory responses


    Pan, Shi; Wang, Nadan; Bisetto, Sara; Yi, Bing; Sheu, Shey-Shing


    Inflammation contributes significantly to cardiac dysfunction. Although the initial phase of inflammation is essential for repair and healing, excessive proinflammatory cytokines are detrimental to the heart. We found that adenine nucleotide translocator isoform-1 (ANT1) protein levels were significantly decreased in the inflamed heart of C57BL/6 mice following cecal ligation and puncture. To understand the molecular mechanisms involved, we performed small-interfering RNA-mediated knockdown o...

  18. L-Arginine Intake Effect on Adenine Nucleotide Metabolism in Rat Parenchymal and Reproductive Tissues

    Directory of Open Access Journals (Sweden)

    G. Kocic


    Full Text Available L-arginine is conditionally essetcial amino acid, required for normal cell growth, protein synthesis, ammonia detoxification, tissue growth and general performance, proposed in the treatment of men sterility and prevention of male impotence. The aim of the present paper was to estimate the activity of the enzymes of adenine nucleotide metabolism: 5′-nucleotidase (5′-NU, adenosine deaminase (ADA, AMP deaminase, and xanthine oxidase (XO, during dietary intake of L-arginine for a period of four weeks of male Wistar rats. Adenosine concentration in tissues is maintained by the relative activities of the adenosine-producing enzyme, 5′-NU and the adenosine-degrading enzyme-ADA adenosine deaminase. Dietary L-arginine intake directed adenine nucleotide metabolism in liver, kidney, and testis tissue toward the activation of adenosine production, by increased 5′-NU activity and decreased ADA activity. Stimulation of adenosine accumulation could be of importance in mediating arginine antiatherosclerotic, vasoactive, immunomodulatory, and antioxidant effects. Assuming that the XO activity reflects the rate of purine catabolism in the cell, while the activity of AMP deaminase is of importance in ATP regeneration, reduced activity of XO, together with the increased AMP-deaminase activity, may suggest that adenine nucleotides are presumably directed to the ATP regenerating process during dietary L-arginine intake.

  19. 5-azacytidine and purine nucleotide synthesis in guinea-pig cerebral cortex slices by salvage pathway from adenine

    International Nuclear Information System (INIS)

    The effect of the cytostatic, immunosuppressive and antiviral drug 5-azacytidine was studied on the synthesis of purine nucleotides and the total RNA fraction by the salvage pathway of adenine in in vitro experiments on slices from the brain cortex while the azapyrimidine nucleoside only decreased the specific radioactivity of nucleotide adenine and quanine in a relatively high resulting concentration (10-2M), no differences were found between the slices of the brain cortex incubated with and without 5-azacytidine. The comparison of the specific radioactivities of adenine of the total RNA fraction gave a similar picture. No substantial differences were observed between the levels of adenine nucleotides and the total RNA fraction in slices incubated with and without 5-azacytidine. (author)

  20. Severity of cardiomyopathy associated with adenine nucleotide translocator-1 deficiency correlates with mtDNA haplogroup


    Strauss, Kevin A.; DuBiner, Lauren; Simon, Mariella; Zaragoza, Michael; Sengupta, Partho P.; Li, Peng; Narula, Navneet; Dreike, Sandra; Platt, Julia; Procaccio, Vincent; Ortiz-Gonzalez, Xilma R.; Puffenberger, Erik G.; Kelley, Richard I.; Morton, D. Holmes; Narula, Jagat


    Mutations of both nuclear and mitochondrial DNA (mtDNA)–encoded mitochondrial proteins can cause cardiomyopathy associated with mitochondrial dysfunction. Hence, the cardiac phenotype of nuclear DNA mitochondrial mutations might be modulated by mtDNA variation. We studied a 13-generation Mennonite pedigree with autosomal recessive myopathy and cardiomyopathy due to an SLC25A4 frameshift null mutation (c.523delC, p.Q175RfsX38), which codes for the heart-muscle isoform of the adenine nucleotide...

  1. [Corrective effect of trimethylglycine on the nicotinamide coenzyme and adenine nucleotide content of the tissues in experimental atherosclerosis]. (United States)

    Zapadniuk, V I; Chekman, I S; Panteleĭmonova, T N; Tumanov, V A


    Experiments on adult rabbits with experimental atherosclerosis induced by cholesterol (0.25 g/kg for 90 days) showed that chronic administration of trimethylglycine (1.5 g/kg for 30 days) prevented a decrease of the liver and myocardium content of nicotinamide coenzymes and adenine nucleotides. PMID:3758334

  2. Adenine nucleotide-dependent and redox-independent control of mitochondrial malate dehydrogenase activity in Arabidopsis thaliana. (United States)

    Yoshida, Keisuke; Hisabori, Toru


    Mitochondrial metabolism is important for sustaining cellular growth and maintenance; however, the regulatory mechanisms underlying individual processes in plant mitochondria remain largely uncharacterized. Previous redox-proteomics studies have suggested that mitochondrial malate dehydrogenase (mMDH), a key enzyme in the tricarboxylic acid (TCA) cycle and redox shuttling, is under thiol-based redox regulation as a target candidate of thioredoxin (Trx). In addition, the adenine nucleotide status may be another factor controlling mitochondrial metabolism, as respiratory ATP production in mitochondria is believed to be influenced by several environmental stimuli. Using biochemical and reverse-genetic approaches, we addressed the redox- and adenine nucleotide-dependent regulation of mMDH in Arabidopsis thaliana. Recombinant mMDH protein formed intramolecular disulfide bonds under oxidative conditions, but these bonds did not have a considerable effect on mMDH activity. Mitochondria-localized o-type Trx (Trx-o) did not facilitate re-reduction of oxidized mMDH. Determination of the in vivo redox state revealed that mMDH was stably present in the reduced form even in Trx-o-deficient plants. Accordingly, we concluded that mMDH is not in the class of redox-regulated enzymes. By contrast, mMDH activity was lowered by adenine nucleotides (AMP, ADP, and ATP). Each adenine nucleotide suppressed mMDH activity with different potencies and ATP exerted the largest inhibitory effect with a significantly lower Ki. Correspondingly, mMDH activity was inhibited by the increase in ATP/ADP ratio within the physiological range. These results suggest that mMDH activity is finely controlled in response to variations in mitochondrial adenine nucleotide balance. PMID:26946085

  3. Oral, subcutaneous, and intramuscular bioavailabilities of the antiviral nucleotide analog 9-(2-phosphonylmethoxyethyl) adenine in cynomolgus monkeys.


    Cundy, K C; Shaw, J P; Lee, W A


    Intravenous, subcutaneous, intramuscular, and oral pharmacokinetics of the antiretroviral nucleotide analog [9-(2-phosphonylmethoxyethyl)adenine] (PMEA) were examined in a crossover study with four cynomolgus monkeys using 14C-labelled drug at 10 mg/kg of body weight (20 microCi/kg). Plasma radioactivity declined biexponentially following intravenous administration. Radiochromatography of plasma revealed an absence of PMEA metabolites. Intramuscular and subcutaneous bioavailabilities of PMEA ...


    Adenylate energy charge is an indication of the amount of energy available to an organism from the adenylate pool. t is calculated from measured concentrations of three adenine nucleotides, adenosine triphosphate (ATP), adenosine diphosphate (ADP) and adenosine monophosphate (AMP...

  5. An alternative membrane transport pathway for phosphate and adenine nucleotides in mitochondria and its possible function. (United States)

    Reynafarje, B; Lehninger, A L


    This paper describes the properties and a possible biological role of a transport process across the inner membrane of rat liver mitochondria resulting in the exchange of ATP(4-) (out) for ADP(3-) (in) + 0.5 phosphate(2-) (in). This transmembrane exchange reaction, designated as the ATP-ADP-phosphate exchange, is specific for the ligands shown, electroneutral, insensitive to N-ethylmaleimide or mersalyl, inhibited by atractyloside, and appears to occur only in the direction as written. It is thus distinct from the well-known phosphate-hydroxide and phosphate-dicarboxylate exchange systems, which are inhibited by mersalyl, and from the ATP-ADP exchanger, which does not transport phosphate. During ATP hydrolysis by mitochondria, half of the phosphate formed from ATP passes from the matrix to the medium by the mersalyl-insensitive ATP-ADP-phosphate exchange and the other half by the well-known mersalyl-sensitive phosphate-hydroxide exchange. These and other considerations have led to a hypothesis for the pathway and stoichiometry of ATP-dependent reverse electron transport, characterized by a requirement of 1.33 molecules of ATP per pair of electrons reversed and by the utilization of a different membrane transport pathway for phosphate and adenine nucleotides than is taken in forward electron flow and oxidative phosphorylation. The possible occurrence of independent pathways for ATP-forming forward electron flow and ATP-consuming reverse electron flow is consonant with the fact that the opposing degradative and synthetic pathways in the central routes of cell metabolism generally have different pathways that are independently regulated. PMID:283393

  6. Inhibition of the adenine nucleotide translocator by N-acetyl perfluorooctane sulfonamides in vitro. (United States)

    O'Brien, Timothy M; Oliveira, Paulo J; Wallace, Kendall B


    N-alkyl perfluorooctane sulfonamides have been widely used as surfactants on fabrics and papers, fire retardants, and anti-corrosion agents, among many other commercial applications. The global distribution and environmental persistence of these compounds has generated considerable interest regarding potential toxic effects. We have previously reported that perfluorooctanesulfonamidoacetate (FOSAA) and N-ethylperfluorooctanesulfonamidoacetate (N-EtFOSAA) induce the mitochondrial permeability transition (MPT) in vitro. In this study we tested the hypothesis that FOSAA and N-EtFOSAA interact with the adenine nucleotide translocator (ANT) resulting in a functional inhibition of the translocator and induction of the MPT. Respiration and membrane potential of freshly isolated liver mitochondria from Sprague-Dawley rats were measured using an oxygen electrode and a tetraphenylphosphonium-selective (TPP(+)) electrode, respectively. Mitochondrial swelling was measured spectrophotometrically. The ANT ligands bongkregkic acid (BKA) and carboxyatractyloside (cATR) inhibited uncoupling of mitochondrial respiration caused by 10 microM N-EtFOSAA, 40 microM FOSAA, and the positive control 8 microM oleic acid. ADP-stimulated respiration and depolarization of mitochondrial membrane potential were inhibited by cATR, FOSAA, N-EtFOSAA, and oleic acid, but not by FCCP. BKA inhibited calcium-dependent mitochondrial swelling induced by FOSAA, N-EtFOSAA, and oleic acid. Seventy-five micromolar ADP also inhibited swelling induced by the test compounds, but cATR induced swelling was not inhibited by ADP. Results of this investigation indicate that N-acetyl perfluorooctane sulfonamides interact directly with the ANT to inhibit ADP translocation and induce the MPT, one or both of which may account for the metabolic dysfunction observed in vivo. PMID:18048072

  7. Deficiency in the mouse mitochondrial adenine nucleotide translocator isoform 2 gene is associated with cardiac noncompaction. (United States)

    Kokoszka, Jason E; Waymire, Katrina G; Flierl, Adrian; Sweeney, Katelyn M; Angelin, Alessia; MacGregor, Grant R; Wallace, Douglas C


    The mouse fetal and adult hearts express two adenine nucleotide translocator (ANT) isoform genes. The predominant isoform is the heart-muscle-brain ANT-isoform gene 1 (Ant1) while the other is the systemic Ant2 gene. Genetic inactivation of the Ant1 gene does not impair fetal development but results in hypertrophic cardiomyopathy in postnatal mice. Using a knockin X-linked Ant2 allele in which exons 3 and 4 are flanked by loxP sites combined in males with a protamine 1 promoter driven Cre recombinase we created females heterozygous for a null Ant2 allele. Crossing the heterozygous females with the Ant2(fl), PrmCre(+) males resulted in male and female ANT2-null embryos. These fetuses proved to be embryonic lethal by day E14.5 in association with cardiac developmental failure, immature cardiomyocytes having swollen mitochondria, cardiomyocyte hyperproliferation, and cardiac failure due to hypertrabeculation/noncompaction. ANTs have two main functions, mitochondrial-cytosol ATP/ADP exchange and modulation of the mitochondrial permeability transition pore (mtPTP). Previous studies imply that ANT2 biases the mtPTP toward closed while ANT1 biases the mtPTP toward open. It has been reported that immature cardiomyocytes have a constitutively opened mtPTP, the closure of which signals the maturation of cardiomyocytes. Therefore, we hypothesize that the developmental toxicity of the Ant2 null mutation may be the result of biasing the cardiomyocyte mtPTP to remain open thus impairing cardiomyocyte maturation and resulting in cardiomyocyte hyperproliferation and failure of trabecular maturation. This article is part of a Special Issue entitled 'EBEC 2016: 19th European Bioenergetics Conference, Riva del Garda, Italy, July 2-6, 2016', edited by Prof. Paolo Bernardi. PMID:27048932

  8. A weak pulsed magnetic field affects adenine nucleotide oscillations, and related parameters in aggregating Dictyostelium discoideum amoebae. (United States)

    Davies, E; Olliff, C; Wright, I; Woodward, A; Kell, D


    A model eukaryotic cell system was used to explore the effect of a weak pulsed magnetic field (PMF) on time-varying physiological parameters. Dictyostelium discoideum cells (V12 strain) were exposed to a pulsed magnetic field (PMF) of flux density 0.4 mT, generated via air-cored coils in trains of 2 ms pulses gated at 20 ms. This signal is similar to those used to treat non-uniting fractures. Samples were taken over periods of 20 min from harvested suspensions of amoebae during early aggregation phase, extracted and derivatised for HPLC fluorescent assay of adenine nucleotides. Analysis of variance showed a significant athermal damping effect (P < 0.002, n = 22) of the PMF on natural adenine nucleotide oscillations and some consistent changes in phase relationships. The technique of nonlinear dielectric spectroscopy (NLDS) revealed a distinctive effect of PMF, caffeine and EGTA in modulating the cellular harmonic response to an applied weak signal. Light scattering studies also showed altered frequency response of cells to PMF, EGTA and caffeine. PMF caused a significant reduction of caffeine induced cell contraction (P < 0.0006, n = 19 by paired t-test) as shown by Malvern particle size analyser, suggesting that intracellular calcium may be involved in mediating the effect of the PMF. PMID:10228582

  9. Mapping the Ultrafast Dynamics of Adenine onto Its Nucleotide and Oligonucleotides by Time-Resolved Photoelectron Imaging. (United States)

    Chatterley, Adam S; West, Christopher W; Roberts, Gareth M; Stavros, Vasilios G; Verlet, Jan R R


    The intrinsic photophysics of nucleobases and nucleotides following UV absorption presents a key reductionist step toward understanding the complex photodamage mechanisms occurring in DNA. The decay mechanism of adenine in particular has been the focus of intense investigation, as has how these correlate to those of its more biologically relevant nucleotide and oligonucleotides in aqueous solution. Here, we report on time-resolved photoelectron imaging of the deprotonated 3'-deoxy-adenosine-5'-monophosphate nucleotide and the adenosine di- and trinucleotides. Through a comparison of gas- and solution-phase experiments and available theoretical studies, the dynamics of the base are shown to be relatively insensitive to the surrounding environment. The decay mechanism primarily involves internal conversion from the initially populated (1)ππ* states to the ground state. The relaxation dynamics of the adenosine oligonucleotides are similar to those of the nucleobase, in contrast to the aqueous oligonucleotides, where a fraction of the ensemble forms long-lived excimer states. PMID:26274076

  10. Modular kinetic analysis of the adenine nucleotide translocator-mediated effects of palmitoyl-CoA on the oxidative phosphorylation in isolated rat liver mitochondria

    NARCIS (Netherlands)

    Ciapaite, J; Van Eikenhorst, G; Bakker, SJL; Diamant, M; Heine, RJ; Wagner, MJ; Westerhoff, HV; Krab, K


    To test whether long-chain fatty acyl-CoA esters link obesity with type 2 diabetes through inhibition of the mitochondrial adenine nucleotide translocator, we applied a system-biology approach, dual modular kinetic analysis, with mitochondrial membrane potential (Delta psi) and the fraction of matri

  11. Metabolic control of mitochondrial properties by adenine nucleotide translocator determines palmitoyl-CoA effects - Implications for a mechanism linking obesity and type 2 diabetes

    NARCIS (Netherlands)

    Ciapaite, Jolita; Bakker, Stephan J. L.; Diamant, Michaela; van Eikenhorst, Gerco; Heine, Robert J.; Westerhoff, Hans V.; Krab, Klaas


    Inhibition of the mitochondrial adenine nucleotide translocator (ANT) by long-chain acyl-CoA esters has been proposed to contribute to cellular dysfunction in obesity and type 2 diabetes by increasing formation of reactive oxygen species and adenosine via effects on the coenzyme Q redox state, mitoc

  12. Genetic mapping of human heart-skeletal muscle adenine nucleotide translocator and its relationship to the facioscapulohumeral muscular dystrophy locus

    Energy Technology Data Exchange (ETDEWEB)

    Haraguchi, Y.; Chung, A.B.; Torroni, A.; Stepien, G.; Shoffner, J.M.; Costigan, D.A.; Polak, M. [Emory Univ. School of Medicine, Atlanta, GA (United States); Wasmuth, J.J.; Altherr, M.R.; Winokur, S.T. [Univ. of California, Irvine, CA (United States)] [and others


    The mitochondrial heart-skeletal muscle adenine nucleotide translocator (ANT1) was regionally mapped to 4q35-qter using somatic cell hybrids containing deleted chromosome 4. The regional location was further refined through family studies using ANT1 intron and promoter nucleotide polymorphisms recognized by the restriction endonucleases MboII, NdeI, and HaeIII. Two alleles were found, each at a frequency of 0.5. The ANT1 locus was found to be closely linked to D4S139, D4S171, and the dominant skeletal muscle disease locus facioscapulohumeral muscular dystrophy (FSHD). A crossover that separated D4S171 and ANT1 from D4S139 was found. Since previous studies have established the chromosome 4 map order as centromere-D4S171-D4S139-FSHD, it was concluded that ANT1 is located on the side of D4S139, that is opposite from FSHD. This conclusion was confirmed by sequencing the exons and analyzing the transcripts of ANT1 from several FSHD patients and finding no evidence of aberration. 35 refs., 5 figs., 1 tab.

  13. [Dependence of creatine kinase and glycogen synthetase activities of skeletal muscles on state of adenine nucleotide phosphorylation and cAMP metabolism]. (United States)

    Iakovlev, N N; Chagovets, N R; Maksimova, L V


    Changes in the contents of adenine nucleotides, creatine phosphate, inorganic phosphate, creatine, glucose-6-phosphate and glycogen and the activity of adenylate cyclase, creatine kinase, glycogen phosphorylase 31:51-AMP-phosphodiesterase and glycogen synthetase in muscles and of blood catecholamines were studied in adult rats before loading, immediately after the cessation of the muscular activity, and at rest. Adenine nucleotides are established to play a regulatory role in catabolic and anabolic processes nucleotides are established to play a regulatory role in catabolic and anabolic processes related to the muscular activity. It is established that compensation and supercompensation of the working losses of muscular creatine phosphate and glycogen are due to activation of anabolic processes under conditions of higher phosphorylation of the adenylic system. PMID:6247797

  14. Effect of UV-irradiation in vitro on adenin nucleotides metabolism, Na+ and K+ concentration, osmotic properties and submicroscopic structure of pigeon red blood cells

    International Nuclear Information System (INIS)

    Effect of UV-irradiation in vitro on metabolism of adenine nucleotides: ADP, ATP and AXP, osmotic properties and submicroscopic structure of nucleated pigeon red blood cell was investigated. Irradiation was carried out for 60, 120, 180, 240 and 300 minutes. Hanau S-500 lamp with efficiency 4.34 x 108 erg/sec was used. A decrease of ATP content with a simultaneous increase of ADP and AXP contents and a rather constant level of the sum of adenine compounds was observed. UV-irradiation caused a decrease of reversal of hemolysis and osmotic resistance to hypotonic NaCl solutions. An equivalent exchange of Na+ and K+ ions and an increase of hematocrit value, following UV-irradiation was observed. Electron microscope studies demonstrated changes of ultrastructure concerning both cell nucleus and thickness and granulation of cell membrane. (orig.)

  15. P2Y13 receptors mediate presynaptic inhibition of acetylcholine release induced by adenine nucleotides at the mouse neuromuscular junction. (United States)

    Guarracino, Juan F; Cinalli, Alejandro R; Fernández, Verónica; Roquel, Liliana I; Losavio, Adriana S


    It is known that adenosine 5'-triphosphate (ATP) is released along with the neurotransmitter acetylcholine (ACh) from motor nerve terminals. At mammalian neuromuscular junctions (NMJs), we have previously demonstrated that ATP is able to decrease ACh secretion by activation of P2Y receptors coupled to pertussis toxin-sensitive Gi/o protein. In this group, the receptor subtypes activated by adenine nucleotides are P2Y12 and P2Y13. Here, we investigated, by means of pharmacological and immunohistochemical assays, the P2Y receptor subtype that mediates the modulation of spontaneous and evoked ACh release in mouse phrenic nerve-diaphragm preparations. First, we confirmed that the preferential agonist for P2Y12-13 receptors, 2-methylthioadenosine 5'-diphosphate trisodium salt hydrate (2-MeSADP), reduced MEPP frequency without affecting MEPP amplitude as well as the amplitude and quantal content of end-plate potentials (EPPs). The effect on spontaneous secretion disappeared after the application of the selective P2Y12-13 antagonists AR-C69931MX or 2-methylthioadenosine 5'-monophosphate triethylammonium salt hydrate (2-MeSAMP). 2-MeSADP was more potent than ADP and ATP in reducing MEPP frequency. Then we demonstrated that the selective P2Y13 antagonist MRS-2211 completely prevented the inhibitory effect of 2-MeSADP on MEPP frequency and EPP amplitude, whereas the P2Y12 antagonist MRS-2395 failed to do this. The preferential agonist for P2Y13 receptors inosine 5'-diphosphate sodium salt (IDP) reduced spontaneous and evoked ACh secretion and MRS-2211 abolished IDP-mediated modulation. Immunohistochemical studies confirmed the presence of P2Y13 but not P2Y12 receptors at the end-plate region. Disappearance of P2Y13 receptors after denervation suggests the presynaptic localization of the receptors. We conclude that, at motor nerve terminals, the Gi/o protein-coupled P2Y receptors implicated in presynaptic inhibition of spontaneous and evoked ACh release are of the subtype P2Y

  16. Rotations of the 2B Sub-domain of E. coli UvrD Helicase/Translocase Coupled to Nucleotide and DNA Binding


    Jia, Haifeng; Korolev, Sergey; Niedziela-Majka, Anita; Maluf, Nasib K.; Gauss, George H.; Myong, Sua; Ha, Taekjip; Waksman, Gabriel; Lohman, Timothy M.


    E. coli UvrD is a superfamily 1 (SF1) DNA helicase and single stranded (ss) DNA translocase that functions in DNA repair, plasmid replication and as an anti-recombinase by removing RecA protein from ssDNA. UvrD couples ATP binding and hydrolysis to unwind double-stranded DNA (dsDNA) and translocate along ssDNA with 3′ to 5′ directionality. Although a UvrD monomer is able to translocate along ssDNA rapidly and processively, DNA helicase activity in vitro requires a minimum of a UvrD dimer. Pre...

  17. Studies on the energy metabolism of opossum (Didelphis virginiana) erythrocytes: V. Utilization of hypoxanthine for the synthesis of adenine and guanine nucleotides in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Bethlenfalvay, N.C.; White, J.C.; Chadwick, E.; Lima, J.E. (Fitzsimons Army Medical Center, Aurora, CO (USA))


    High pressure liquid radiochromatography was used to test the ability of opossum erythrocytes to incorporate tracer amounts of (G-{sup 3}H) hypoxanthine (Hy) into ({sup 3}H) labelled triphosphates of adenine and guanine. In the presence of supraphysiologic (30 mM) phosphate which is optimal for PRPP synthesis, both ATP and GTP are extensively labelled. When physiologic (1 mM) medium phosphate is used, red cells incubated under an atmosphere of nitrogen accumulate ({sup 3}H) ATP in a linear fashion suggesting ongoing PRPP synthesis in red cells whose hemoglobin is deoxygenated. In contrast, a lesser increase of labelled ATP is observed in cells incubated under oxygen, suggesting that conditions for purine nucleotide formation from ambient Hy are more favorable in the venous circulation.

  18. Studies on the energy metabolism of opossum (Didelphis virginiana) erythrocytes: V. Utilization of hypoxanthine for the synthesis of adenine and guanine nucleotides in vitro

    International Nuclear Information System (INIS)

    High pressure liquid radiochromatography was used to test the ability of opossum erythrocytes to incorporate tracer amounts of [G-3H] hypoxanthine (Hy) into [3H] labelled triphosphates of adenine and guanine. In the presence of supraphysiologic (30 mM) phosphate which is optimal for PRPP synthesis, both ATP and GTP are extensively labelled. When physiologic (1 mM) medium phosphate is used, red cells incubated under an atmosphere of nitrogen accumulate [3H] ATP in a linear fashion suggesting ongoing PRPP synthesis in red cells whose hemoglobin is deoxygenated. In contrast, a lesser increase of labelled ATP is observed in cells incubated under oxygen, suggesting that conditions for purine nucleotide formation from ambient Hy are more favorable in the venous circulation

  19. Rotations of the 2B Sub-domain of E. coli UvrD Helicase/Translocase Coupled to Nucleotide and DNA Binding

    Energy Technology Data Exchange (ETDEWEB)

    Jia, Haifeng; Korolev, Sergey; Niedziela-Majka, Anita; Maluf, Nasib K.; Gauss, George H.; Myong, Sua; Ha, Taekjip; Waksman, Gabriel; Lohman, Timothy M. (UIUC); (St. Louis-MED); (WU-MED); (UCL)


    Escherichia coli UvrD is a superfamily 1 DNA helicase and single-stranded DNA (ssDNA) translocase that functions in DNA repair and plasmid replication and as an anti-recombinase by removing RecA protein from ssDNA. UvrD couples ATP binding and hydrolysis to unwind double-stranded DNA and translocate along ssDNA with 3'-to-5' directionality. Although a UvrD monomer is able to translocate along ssDNA rapidly and processively, DNA helicase activity in vitro requires a minimum of a UvrD dimer. Previous crystal structures of UvrD bound to a ssDNA/duplex DNA junction show that its 2B sub-domain exists in a 'closed' state and interacts with the duplex DNA. Here, we report a crystal structure of an apo form of UvrD in which the 2B sub-domain is in an 'open' state that differs by an {approx} 160{sup o} rotation of the 2B sub-domain. To study the rotational conformational states of the 2B sub-domain in various ligation states, we constructed a series of double-cysteine UvrD mutants and labeled them with fluorophores such that rotation of the 2B sub-domain results in changes in fluorescence resonance energy transfer. These studies show that the open and closed forms can interconvert in solution, with low salt favoring the closed conformation and high salt favoring the open conformation in the absence of DNA. Binding of UvrD to DNA and ATP binding and hydrolysis also affect the rotational conformational state of the 2B sub-domain, suggesting that 2B sub-domain rotation is coupled to the function of this nucleic acid motor enzyme.

  20. Rotations of the 2B sub-domain of E. coli UvrD helicase/translocase coupled to nucleotide and DNA binding. (United States)

    Jia, Haifeng; Korolev, Sergey; Niedziela-Majka, Anita; Maluf, Nasib K; Gauss, George H; Myong, Sua; Ha, Taekjip; Waksman, Gabriel; Lohman, Timothy M


    Escherichia coli UvrD is a superfamily 1 DNA helicase and single-stranded DNA (ssDNA) translocase that functions in DNA repair and plasmid replication and as an anti-recombinase by removing RecA protein from ssDNA. UvrD couples ATP binding and hydrolysis to unwind double-stranded DNA and translocate along ssDNA with 3'-to-5' directionality. Although a UvrD monomer is able to translocate along ssDNA rapidly and processively, DNA helicase activity in vitro requires a minimum of a UvrD dimer. Previous crystal structures of UvrD bound to a ssDNA/duplex DNA junction show that its 2B sub-domain exists in a "closed" state and interacts with the duplex DNA. Here, we report a crystal structure of an apo form of UvrD in which the 2B sub-domain is in an "open" state that differs by an ∼160° rotation of the 2B sub-domain. To study the rotational conformational states of the 2B sub-domain in various ligation states, we constructed a series of double-cysteine UvrD mutants and labeled them with fluorophores such that rotation of the 2B sub-domain results in changes in fluorescence resonance energy transfer. These studies show that the open and closed forms can interconvert in solution, with low salt favoring the closed conformation and high salt favoring the open conformation in the absence of DNA. Binding of UvrD to DNA and ATP binding and hydrolysis also affect the rotational conformational state of the 2B sub-domain, suggesting that 2B sub-domain rotation is coupled to the function of this nucleic acid motor enzyme. PMID:21704638

  1. TGF-β1 induction of the adenine nucleotide translocator 1 in astrocytes occurs through Smads and Sp1 transcription factors

    Directory of Open Access Journals (Sweden)

    Wallace Douglas C


    Full Text Available Abstract Background The adenine nucleotide translocator 1 (Ant1 is an inner mitochondrial membrane protein involved with energy mobilization during oxidative phosphorylation. We recently showed that rodent Ant1 is upregulated by transforming growth factor-beta (TGF-β in reactive astrocytes following CNS injury. In the present study, we describe the molecular mechanisms by which TGF-β1 regulates Ant1 gene expression in cultured primary rodent astrocytes. Results Transcription reporter analysis verified that TGF-β1 regulates transcription of the mouse Ant1 gene, but not the gene encoding the closely related Ant2 isoform. A 69 basepair TGF-β1 responsive element of the Ant1 promoter was also identified. Electrophoretic mobility shift assays demonstrated that astrocyte nuclear proteins bind to this response element and TGF-β1 treatment recruits additional nuclear protein binding to this element. Antibody supershift and promoter deletion analyses demonstrated that Sp1 consensus binding sites in the RE are important for TGF-β1 regulation of Ant1 in astrocytes. Additionally, we demonstrate that Smad 2, 3 and 4 transcription factors are expressed in injured cerebral cortex and in primary astrocyte cultures. TGF-β1 activated Smad transcription factors also contribute to Ant1 regulation since transcription reporter assays in the presence of dominant negative (DN-Smads 3 and 4 significantly reduced induction of Ant1 by TGF-β1. Conclusion The specific regulation of Ant1 by TGF-β1 in astrocytes involves a cooperative interaction of both Smad and Sp1 binding elements located immediately upstream of the transcriptional start site. The first report of expression of Smads 2, 3 and 4 in astrocytes provided here is consistent with a regulation of Ant1 gene expression by these transcription factors in reactive astrocytes. Given the similarity in TGF-β1 regulation of Ant1 with other genes that are thought to promote neuronal survival, this interaction may

  2. Specificities and pH profiles of adenine and hypoxanthine-guanine-xanthine phosphoribosyltransferases (nucleotide synthases) of the thermoacidophile archaeon Sulfolobus solfataricus

    DEFF Research Database (Denmark)

    Hansen, Michael Riis; Jensen, Kristine Steen; Rasmussen, Mads Skytte;


    Two open reading frames in the genome of Sulfolobus solfataricus (SSO2341 and SSO2424) were cloned and expressed in E. coli. The protein products were purified and their enzymatic activity characterized. Although SSO2341 was annotated as a gene (gpT-1) encoding a 6-oxopurine phosphoribosyltransfe......Two open reading frames in the genome of Sulfolobus solfataricus (SSO2341 and SSO2424) were cloned and expressed in E. coli. The protein products were purified and their enzymatic activity characterized. Although SSO2341 was annotated as a gene (gpT-1) encoding a 6-oxopurine...... phosphoribosyltransferase (PRTase), the protein product turned out to be a PRTase highly specific for adenine and we suggest that the reading frame should be renamed apT. The other reading frame SSO2424 (gpT-2) proved to be a true 6-oxopurine PRTase active with hypoxanthine, xanthine and guanine as substrates, and we.......5, while maximal activity with xanthine was observed at pH 7.5. We discuss likely reasons why SSO2341 in S. solfataricus and similar open reading frames in other Crenarchaeota could not be identified as genes encoding APRTase....

  3. An adenine-to-guanine nucleotide change in the IRES SL-IV domain of picornavirus/hepatitis C chimeric viruses leads to a nonviable phenotype

    International Nuclear Information System (INIS)

    The inability for the internal ribosomal entry site (IRES) of hepatitis C virus (HCV) to be readily studied in the context of viral replication has been circumvented by constructing chimeras such as with poliovirus (PV), in which translation of the genome polyprotein is under control of the HCV IRES. During our attempts to configure the PV/HCV chimera for our drug discovery efforts, we discovered that an adenine- (A) to-guanine (G) change at nt 350 in domain IV of the HCV IRES resulted in a nonviable phenotype. Similarly, a mengovirus (MV)/HCV chimera using the same configuration with a G at nt 350 (G-350) was found to be nonviable. In contrast, a bovine viral diarrhea virus (BVDV)/HCV chimera remained viable with G-350 in the HCV IRES insert. Second-site, resuscitating mutations were identified from the G-350 PV/HCV and MV/HCV viruses after blind passaging. For both viruses, the resuscitating mutations involved destabilization of domain IV in the HCV IRES. The nonviability of G-350 in the picornavirus/HCV chimeric background might be linked to translation efficiency as indicated by analyses with dual reporter and PV/HCV replicon constructs

  4. Properties of the mitochondrial carrier of adenine-nucleotide after purification. Study of the transport protein under isolated form and reincorporated form in phospho-lipidic vesicles

    International Nuclear Information System (INIS)

    The first part of this research thesis addresses the reconstitution of the ADP/ATP transport by incorporation of the specific carrier, isolated in presence of detergent, in phospholipids vesicles. Fundamental properties of the reconstituted transport are identical to that of transport in mitochondria, notably as far as the exchange stoichiometry, the turn over and the transport Km are concerned, as well as the asymmetric orientation of the carrier in the membrane. The second part of this research addresses the study of interactions of specific ligands with the ADP/ATP transport protein in presence of detergent. The study of the variations of the intrinsic fluorescence of the isolated ADP/ATP carrier highlights conformational changes exclusively induced by the presence of transportable nucleotides which are modulated in a different manner by carboxy-atractyloside or bongkrekic acid. Moreover, by using the isolated protein, a detailed analysis of binding parameters of fluorescent analogues of ATP is reported

  5. Biochemical evidence of the interactions of membrane type-1 matrix metalloproteinase (MT1-MMP) with adenine nucleotide translocator (ANT): potential implications linking proteolysis with energy metabolism in cancer cells. (United States)

    Radichev, Ilian A; Remacle, Albert G; Sounni, Nor Eddine; Shiryaev, Sergey A; Rozanov, Dmitri V; Zhu, Wenhong; Golubkova, Natalya V; Postnova, Tatiana I; Golubkov, Vladislav S; Strongin, Alex Y


    Invasion-promoting MT1-MMP (membrane type-1 matrix metalloproteinase) is a key element in cell migration processes. To identify the proteins that interact and therefore co-precipitate with this proteinase from cancer cells, we used the proteolytically active WT (wild-type), the catalytically inert E240A and the C-end truncated (tailless; DeltaCT) MT1-MMP-FLAG constructs as baits. The identity of the pulled-down proteins was determined by LC-MS/MS (liquid chromatography tandem MS) and then confirmed by Western blotting using specific antibodies. We determined that, in breast carcinoma MCF cells (MCF-7 cells), ANT (adenine nucleotide translocator) efficiently interacted with the WT, E240A and DeltaCT constructs. The WT and E240A constructs also interacted with alpha-tubulin, an essential component of clathrin-mediated endocytosis. In turn, tubulin did not co-precipitate with the DeltaCT construct because of the inefficient endocytosis of the latter, thus suggesting a high level of selectivity of our test system. To corroborate these results, we then successfully used the ANT2-FLAG construct as a bait to pull-down MT1-MMP, which was naturally produced by fibrosarcoma HT1080 cells. We determined that the presence of the functionally inert catalytic domain alone was sufficient to cause the proteinase to interact with ANT2, thus indicating that there is a non-proteolytic mode of these interactions. Overall, it is tempting to hypothesize that by interacting with pro-invasive MT1-MMP, ANT plays a yet to be identified role in a coupling mechanism between energy metabolism and pericellular proteolysis in migrating cancer cells. PMID:19232058

  6. Comparison of lipid oxidation, messenger ribonucleic acid levels of avian uncoupling protein, avian adenine nucleotide translocator, and avian peroxisome proliferator-activated receptor-γ coactivator-1α in skeletal muscles from electrical- and gas-stunned broilers. (United States)

    Xu, L; Wu, S G; Zhang, H J; Zhang, L; Yue, H Y; Ji, F; Qi, G H


    The aim of this study was to compare the effects of stunning methods [electrical stunning (ES) vs. gas stunning (GS)] on lipid oxidation in broiler meat and to investigate possible mechanisms of lipid oxidation by measuring plasma variables, muscle reactive oxygen species (ROS), and TBA reactive substance (TBARS) concentrations, muscle fiber ratios, and mRNA levels of avian uncoupling protein (avUCP), avian adenine nucleotide translocator, and avian peroxisome proliferator-activated receptor-γ coactivator-1α (avPGC-1α). Arbor Acres broilers (n = 36) were not stunned (control) or were exposed to the following stunning treatments: 40% CO(2) + 21% O(2) + N(2); 60% CO(2) + 21% O(2) + N(2); 35 V, 47 mA, 400 Hz; 50 V, 67 mA, 160 Hz; and 65 V, 86 mA, 1,000 Hz. The ROS level in tibialis anterior (TA; P < 0.05) and the TBARS concentration in pectoralis major (PM; P < 0.01) were decreased in the GS groups compared with the ES groups at 45 min postmortem. However, the TBARS concentrations at 24 h postmortem in the PM and TA groups were not affected by stunning method (ES or GS). Compared with ES, GS caused greater expression of avUCP mRNA (1.47-fold in PM, and 2.41-fold in TA) and avPGC-1α mRNA (1.42-fold in PM, and 2.08-fold in TA). In conclusion, the upregulation of avUCP and avPGC-1α reduced ROS accumulation and lipid oxidation at 45 min postmortem in the skeletal muscles of broilers stunned with hypercapnic moderate oxygenation GS. However, these changes were not sufficient to cause a difference in meat lipid oxidation at 24 h postmortem between broilers stunned with hypercapnic moderate oxygenation GS and those stunned with low-current, high-frequency ES. PMID:21844275

  7. Fate of prebiotic adenine. (United States)

    Cohn, C A; Hansson, T K; Larsson, H S; Sowerby, S J; Holm, N G


    Equilibrium adsorption isotherm data for the purine base adenine has been obtained on several prebiotically relevant minerals by frontal analysis using water as a mobile phase. Adenine is far displaced toward adsorption on pyrite (FeS2), quartz (SiO2), and pyrrhotite (FeS), but somewhat less for magnetite (Fe3O4) and forsterite (Mg2SiO4). The prebiotic prevalence of these minerals would have allowed them to act as a sink for adenine; removal from the aqueous phase would confer protection from hydrolysis as well, establishing a nonequilibrium thermodynamic framework for increased adenine synthesis. Our results provide evidence that adsorption phenomena may have been critical for the primordial genetic architecture. PMID:12448980

  8. Molecular dynamics simulations and coupled nucleotide substitution experiments indicate the nature of A·A base pairing and a putative structure of the coralyne-induced homo-adenine duplex


    Joung, In Suk; Persil Çetinkol, Özgül; Hud, Nicholas V.; Cheatham, Thomas E.


    Coralyne is an alkaloid drug that binds homo-adenine DNA (and RNA) oligonucleotides more tightly than it does Watson–Crick DNA. Hud’s laboratory has shown that poly(dA) in the presence of coralyne forms an anti-parallel duplex, however attempts to determine the structure by NMR spectroscopy and X-ray crystallography have been unsuccessful. Assuming adenine–adenine hydrogen bonding between the two poly(dA) strands, we constructed 40 hypothetical homo-(dA) anti-parallel duplexes and docked cora...

  9. Preparation of /sup 14/C-labelled AMP, ADP and ATP from adenine-8-/sup 14/C by using Brevibacterium ammoniagenes

    Energy Technology Data Exchange (ETDEWEB)

    Pande, V.N. (Bhabha Atomic Research Centre, Bombay (India). Biochemistry and Food Technology Div.)


    High radiochemical yields of /sup 14/C-labelled adenine nucleotides (AMP, 4.6%, ADP, 15.5% and ATP 59.5%) could be obtained by growing the cells of Brevibacterium ammoniagenes in the presence of /sup 14/C-adenine. The specific radioactivity of the adenine nucleotides almost reached that of /sup 14/C-adenine indicating negligible dilution of the label. The procedure is convenient and especially suited for commercial preparation of the radiolabelled nucleotides directly from labelled adenine. Preliminary results indicate that the organism could also be used for the preparation of radiolabelled guanine nucleotides.

  10. Interaction of ADP, atractyloside, and gummiferin on the ADP translocase of the inner mitochondrial membrane

    Energy Technology Data Exchange (ETDEWEB)

    Vignais, P.V.; Vignais, P.M.; Defaye, G.; Lauquin, G.; Doussiere, J.; Chabert, J.; Brandolin, G.


    From international conference on mechanism in bioenergetica; Bari, Italy (1 May 1972). Two specific inhibitors of the adenine nucleotide translocation, gummiferin (GUM), identified to 4-carboxyatractyloside and atractyloside (ATR), were labeled with /sup 35/S and their binding properties to whole mitochondria and inner mitochondrial membrane vesicles used to monitor changes of membrane conformation induced by ADP. (auth)

  11. Extent of Intramolecular p-Stacks in Aqueous Solution in Mixed-Ligand Copper(II) Complexes Formed by Heteroaromatic Amines and Several 2-Aminopurine Derivatives of the Antivirally Active Nucleotide Analog 9-[2-(Phosphonomethoxy)ethyl]adenine (PMEA)

    Czech Academy of Sciences Publication Activity Database

    Gómez-Coca, R. B.; Blindauer, C. A.; Sigel, A.; Operschall, B. P.; Holý, Antonín; Sigel, H.


    Roč. 9, č. 9 (2012), s. 2008-2034. ISSN 1612-1872 R&D Projects: GA MŠk 1M0508 Institutional research plan: CEZ:AV0Z40550506 Keywords : copper complexes * nucleotides * acyclic nucleoside phosphonates * ANPs * antiviral activity Subject RIV: CE - Biochemistry Impact factor: 1.808, year: 2012

  12. 5′-Single-stranded/duplex DNA junctions are loading sites for E. coli UvrD translocase


    Tomko, Eric J.; Jia, Haifeng; Park, Jeehae; Maluf, Nasib K.; Ha, Taekjip; Lohman, Timothy M.


    Single-molecule analyses of the dual DNA helicase/translocase enzyme UvrD reveal the particular substrate preferences of its monomeric, translocase form, with implications for understanding UvrD's translocase and anti-recombinase roles.

  13. Design and synthesis of ATP-based nucleotide analogues and profiling of nucleotide-binding proteins

    NARCIS (Netherlands)

    Wolters, Justina. C.; Roelfes, Johannes; Poolman, Bert


    Two nucleotide-based probes were designed and synthesized in order to enrich samples for specific classes of proteins by affinity-based protein profiling. We focused on the profiling of adenine nucleotide-binding proteins. Two properties were considered in the design of the probes: the bait needs to

  14. Bound anionic states of adenine


    Harańczyk, Maciej; Gutowski, Maciej; Li, Xiang; Bowen, Kit H.


    Anionic states of nucleic acid bases are involved in DNA damage by low-energy electrons and in charge transfer through DNA. Previous gas phase studies of free, unsolvated nucleic acid base parent anions probed only dipole-bound states, which are not present in condensed phase environments, but did not observe valence anionic states, which for purine bases are thought to be adiabatically unbound. Contrary to this expectation, we have demonstrated that some thus far ignored tautomers of adenine...

  15. Exploitation of the Low Fidelity of Human Immunodeficiency Virus Type 1 (HIV-1) Reverse Transcriptase and the Nucleotide Composition Bias in the HIV-1 Genome To Alter the Drug Resistance Development of HIV


    Balzarini, Jan; Camarasa, Maria-José; Pérez-Pérez, Maria-Jesus; San-Félix, Ana; Velázquez, Sonsoles; Perno, Carlo-Federico; De Clercq, Erik; Anderson, John N.; Karlsson, Anna


    The RNA genome of the lentivirus human immunodeficiency virus type 1 (HIV-1) is significantly richer in adenine nucleotides than the statistically equal distribution of the four different nucleotides that is expected. This compositional bias may be due to the guanine-to-adenine (G→A) nucleotide hypermutation of the HIV genome, which has been explained by dCTP pool imbalances during reverse transcription. The adenine nucleotide bias together with the poor fidelity of HIV-1 reverse transcriptas...

  16. Formation of functional Tat translocases from heterologous components


    Widdick David A; Buchanan Grant; Guymer David; Hicks Matthew G; Caldelari Isabelle; Berks Ben C; Palmer Tracy


    Abstract Background The Tat pathway transports folded proteins across the cytoplasmic membrane of bacteria and the thylakoid membrane of plants. In Eschericha coli, Tat transport requires the integral membrane proteins TatA, TatB and TatC. In this study we have tested the ability of tat genes from the eubacterial species Pseudomonas syringae, Streptomyces coelicolor and Aquifex aeolicus, to compensate for the absence of the cognate E. coli tat gene, and thus to form functional Tat translocase...

  17. The bacterial Sec-translocase: structure and mechanism


    Lycklama a Nijeholt, Jelger A.; Driessen, Arnold J. M.


    Most bacterial secretory proteins pass across the cytoplasmic membrane via the translocase, which consists of a protein-conducting channel SecYEG and an ATP-dependent motor protein SecA. The ancillary SecDF membrane protein complex promotes the final stages of translocation. Recent years have seen a major advance in our understanding of the structural and biochemical basis of protein translocation, and this has led to a detailed model of the translocation mechanism.

  18. Carnitine-acylcarnitine translocase deficiency with severe hypoglycemia and auriculo ventricular block. Translocase assay in permeabilized fibroblasts.


    Pande, S V; Brivet, M; Slama, A.; Demaugre, F; Aufrant, C; Saudubray, J.M.


    Deficiency of the enzymes of mitochondrial fatty acid oxidation and related carnitine dependent steps have been shown to be one of the causes of the fasting-induced hypoketotic hypoglycemia. We describe here carnitine-acylcarnitine translocase deficiency in a neonate who died eight days after birth. The proband showed severe fasting-induced hypoketotic hypoglycemia, high plasma creatine kinase, heartbeat disorder, hypothermia, and hyperammonemia. The plasma-free carnitine on day three was onl...

  19. Nucleotide Capacitance Calculation for DNA Sequencing


    Lu, Jun-Qiang; Zhang, X.-G.


    Using a first-principles linear response theory, the capacitance of the DNA nucleotides, adenine, cytosine, guanine, and thymine, are calculated. The difference in the capacitance between the nucleotides is studied with respect to conformational distortion. The result suggests that although an alternate current capacitance measurement of a single-stranded DNA chain threaded through a nanogap electrode may not be sufficient to be used as a standalone method for rapid DNA sequencing, the capaci...

  20. Cleavage of nicotinamide adenine dinucleotide by the ribosome-inactivating protein from Momordica charantia. (United States)

    Vinkovic, M; Dunn, G; Wood, G E; Husain, J; Wood, S P; Gill, R


    The interaction of momordin, a type 1 ribosome-inactivating protein from Momordica charantia, with NADP(+) and NADPH has been investigated by X-ray diffraction analysis of complexes generated by co-crystallization and crystal soaking. It is known that the proteins of this family readily cleave the adenine-ribose bond of adenosine and related nucleotides in the crystal, leaving the product, adenine, bound to the enzyme active site. Surprisingly, the nicotinamide-ribose bond of oxidized NADP(+) is cleaved, leaving nicotinamide bound in the active site in the same position but in a slightly different orientation to that of the five-membered ring of adenine. No binding or cleavage of NADPH was observed at pH 7.4 in these experiments. These observations are in accord with current views of the enzyme mechanism and may contribute to ongoing searches for effective inhibitors. PMID:26323301

  1. Mitochondrial OXA Translocase Plays a Major Role in Biogenesis of Inner-Membrane Proteins. (United States)

    Stiller, Sebastian B; Höpker, Jan; Oeljeklaus, Silke; Schütze, Conny; Schrempp, Sandra G; Vent-Schmidt, Jens; Horvath, Susanne E; Frazier, Ann E; Gebert, Natalia; van der Laan, Martin; Bohnert, Maria; Warscheid, Bettina; Pfanner, Nikolaus; Wiedemann, Nils


    The mitochondrial inner membrane harbors three protein translocases. Presequence translocase and carrier translocase are essential for importing nuclear-encoded proteins. The oxidase assembly (OXA) translocase is required for exporting mitochondrial-encoded proteins; however, different views exist about its relevance for nuclear-encoded proteins. We report that OXA plays a dual role in the biogenesis of nuclear-encoded mitochondrial proteins. First, a systematic analysis of OXA-deficient mitochondria led to an unexpected expansion of the spectrum of OXA substrates imported via the presequence pathway. Second, biogenesis of numerous metabolite carriers depends on OXA, although they are not imported by the presequence pathway. We show that OXA is crucial for the biogenesis of the Tim18-Sdh3 module of the carrier translocase. The export translocase OXA is thus required for the import of metabolite carriers by promoting assembly of the carrier translocase. We conclude that OXA is of central importance for the biogenesis of the mitochondrial inner membrane. PMID:27166948

  2. Formation of functional Tat translocases from heterologous components

    Directory of Open Access Journals (Sweden)

    Widdick David A


    Full Text Available Abstract Background The Tat pathway transports folded proteins across the cytoplasmic membrane of bacteria and the thylakoid membrane of plants. In Eschericha coli, Tat transport requires the integral membrane proteins TatA, TatB and TatC. In this study we have tested the ability of tat genes from the eubacterial species Pseudomonas syringae, Streptomyces coelicolor and Aquifex aeolicus, to compensate for the absence of the cognate E. coli tat gene, and thus to form functional Tat translocases with E. coli Tat components. Results All three subunits of the Tat system from the Gram positive organism Streptomyces coelicolor were able to form heterologous translocases with substantive Tat transport activity. However, only the TatA and TatB proteins of Pseudomonas syringae were able to functionally interact with the E. coli Tat system even though the two organisms are closely related. Of the Tat components from the phylogenetically distant hyperthermophillic bacterium Aquifex aeolicus only the TatA proteins showed any detectable level of heterologous functionality. The heterologously expressed TatA proteins of S. coelicolor and A. aeolicus were found exclusively in the membrane fraction. Conclusion Our results show that of the three Tat proteins, TatA is most likely to show cross-species complementation. By contrast, TatB and TatC do not always show cross-complementation, probably because they must recognise heterologous signal peptides. Since heterologously-expressed S. coelicolor TatA protein was functional and found only in the membrane fraction, it suggests that soluble forms of Streptomyces TatA reported by others do not play a role in protein export.

  3. Nucleotide Metabolism

    DEFF Research Database (Denmark)

    Martinussen, Jan; Willemoës, M.; Kilstrup, Mogens


    Metabolic pathways are connected through their utilization of nucleotides as supplier of energy, allosteric effectors, and their role in activation of intermediates. Therefore, any attempt to exploit a given living organism in a biotechnological process will have an impact on nucleotide metabolis...

  4. Second-Generation Fluorescent Quadracyclic Adenine Analogues

    DEFF Research Database (Denmark)

    Dumat, Blaise; Bood, Mattias; Wranne, Moa S.;


    quadracyclic adenine analogues. The compounds were efficiently synthesized from a common intermediate through a two-step pathway with the Suzuki-Miyaura coupling as the key step. Two of the compounds, qAN1 and qAN4, display brightnesses (epsilon Phi(F)) of 1700 and 2300, respectively, in water and behave as...

  5. Graphene-Enhanced Raman Scattering from the Adenine Molecules. (United States)

    Dolgov, Leonid; Pidhirnyi, Denys; Dovbeshko, Galyna; Lebedieva, Tetiana; Kiisk, Valter; Heinsalu, Siim; Lange, Sven; Jaaniso, Raivo; Sildos, Ilmo


    An enhanced Raman scattering from a thin layer of adenine molecules deposited on graphene substrate was detected. The value of enhancement depends on the photon energy of the exciting light. The benzene ring in the structure of adenine molecule suggests π-stacking of adenine molecule on top of graphene. So, it is proposed that the enhancement in the adenine Raman signal is explained by the resonance electron transfer from the Fermi level of graphene to the lowest unoccupied molecular orbital (LUMO) level of adenine. PMID:27075339

  6. Graphene-Enhanced Raman Scattering from the Adenine Molecules (United States)

    Dolgov, Leonid; Pidhirnyi, Denys; Dovbeshko, Galyna; Lebedieva, Tetiana; Kiisk, Valter; Heinsalu, Siim; Lange, Sven; Jaaniso, Raivo; Sildos, Ilmo


    An enhanced Raman scattering from a thin layer of adenine molecules deposited on graphene substrate was detected. The value of enhancement depends on the photon energy of the exciting light. The benzene ring in the structure of adenine molecule suggests π-stacking of adenine molecule on top of graphene. So, it is proposed that the enhancement in the adenine Raman signal is explained by the resonance electron transfer from the Fermi level of graphene to the lowest unoccupied molecular orbital (LUMO) level of adenine.

  7. Carnitine/acylcarnitine translocase and carnitine palmitoyltransferase 2 form a complex in the inner mitochondrial membrane. (United States)

    Console, Lara; Giangregorio, Nicola; Indiveri, Cesare; Tonazzi, Annamaria


    Carnitine/acylcarnitine translocase and carnitine palmitoyltransferase 2 are members of the carnitine system, which are responsible of the regulation of the mitochondrial CoA/acyl-CoA ratio and of supplying substrates for the ß-oxidation to mitochondria. This study, using cross-Linking reagent, Blue native electrophoresis and immunoprecipitation followed by detection with immunoblotting, shows conclusive evidence about the interaction between carnitine palmitoyltransferase 2 and carnitine/acylcarnitine translocase supporting the channeling of acylcarnitines and carnitine at level of the inner mitochondrial membrane. PMID:24898781

  8. Carnitine-acylcarnitine translocase deficiency, clinical, biochemical and genetic aspects. (United States)

    Rubio-Gozalbo, M E; Bakker, J A; Waterham, H R; Wanders, R J A


    The carnitine-acylcarnitine translocase (CACT) is one of the components of the carnitine cycle. The carnitine cycle is necessary to shuttle long-chain fatty acids from the cytosol into the intramitochondrial space where mitochondrial beta-oxidation of fatty acids takes place. The oxidation of fatty acids yields acetyl-coenzyme A (CoA) units, which may either be degraded to CO(2) and H(2)O in the citric acid cycle to produce ATP or converted into ketone bodies which occurs in liver and kidneys. Metabolic consequences of a defective CACT are hypoketotic hypoglycaemia under fasting conditions, hyperammonemia, elevated creatine kinase and transaminases, dicarboxylic aciduria, very low free carnitine and an abnormal acylcarnitine profile with marked elevation of the long-chain acylcarnitines. Clinical signs and symptoms in CACT deficient patients, are a combination of energy depletion and endogenous toxicity. The predominantly affected organs are brain, heart and skeletal muscle, and liver, leading to neurological abnormalities, cardiomyopathy and arrythmias, skeletal muscle damage and liver dysfunction. Most patients become symptomatic in the neonatal period with a rapidly progressive deterioration and a high mortality rate. However, presentations at a later age with a milder phenotype have also been reported. The therapeutic approach is the same as in other long-chain fatty acid disorders and includes intravenous glucose (+/- insulin) administration to maximally inhibit lipolysis and subsequent fatty acid oxidation during the acute deterioration, along with other measures such as ammonia detoxification, depending on the clinical features. Long-term strategy consists of avoidance of fasting with frequent meals and a special diet with restriction of long-chain fatty acids. Due to the extremely low free carnitine concentrations, carnitine supplementation is often needed. Acylcarnitine profiling in plasma is the assay of choice for the diagnosis at a metabolite level

  9. Synthesis and Characterization of Oligodeoxyribonucleotides Modified with 2'-Amino-α-l-LNA Adenine Monomers

    DEFF Research Database (Denmark)

    Andersen, Nicolai K; Anderson, Brooke A; Wengel, Jesper;


    The development of conformationally restricted nucleotide building blocks continues to attract considerable interest because of their successful use within antisense, antigene, and other gene-targeting strategies. Locked nucleic acid (LNA) and its diastereomer α-l-LNA are two interesting examples....... ONs modified with pyrene-functionalized 2'-amino-α-l-LNA adenine monomers X-Z display greatly increased affinity toward DNA targets (ΔTm/modification up to +14 °C). Results from absorption and fluorescence spectroscopy suggest that the duplex stabilization is a result of pyrene intercalation. These...

  10. The presence of disulfide bonds reveals an evolutionarily conserved mechanism involved in mitochondrial protein translocase assembly (United States)

    Wrobel, Lidia; Sokol, Anna M.; Chojnacka, Magdalena; Chacinska, Agnieszka


    Disulfide bond formation is crucial for the biogenesis and structure of many proteins that are localized in the intermembrane space of mitochondria. The importance of disulfide bond formation within mitochondrial proteins was extended beyond soluble intermembrane space proteins. Tim22, a membrane protein and core component of the mitochondrial translocase TIM22, forms an intramolecular disulfide bond in yeast. Tim22 belongs to the Tim17/Tim22/Tim23 family of protein translocases. Here, we present evidence of the high evolutionary conservation of disulfide bond formation in Tim17 and Tim22 among fungi and metazoa. Topological models are proposed that include the location of disulfide bonds relative to the predicted transmembrane regions. Yeast and human Tim22 variants that are not oxidized do not properly integrate into the membrane complex. Moreover, the lack of Tim17 oxidation disrupts the TIM23 translocase complex. This underlines the importance of disulfide bond formation for mature translocase assembly through membrane stabilization of weak transmembrane domains. PMID:27265872

  11. Characterization of an ATP translocase identified in the plant pathogen, Candidatus Liberibacter asiaticus (United States)

    ATP/ADP translocases allow for the transport of ATP across a lipid bilayer, which is normally impermeable to this molecule due to its size and charge. These transport proteins appear to be unique to mitochondria, plant plastids, and obligate-intracellular bacteria. Of the bacterial ATP/ADP translo...

  12. Study of the five Rickettsia prowazekii proteins annotated as ATP/ADP translocases (Tlc): Only Tlc1 transports ATP/ADP, while Tlc4 and Tlc5 transport other ribonucleotides. (United States)

    Audia, Jonathon P; Winkler, Herbert H


    The obligate intracytoplasmic pathogen Rickettsia prowazekii relies on the transport of many essential compounds from the cytoplasm of the eukaryotic host cell in lieu of de novo synthesis, an evolutionary outcome undoubtedly linked to obligatory growth in this metabolite-replete niche. The paradigm for the study of rickettsial transport systems is the ATP/ADP translocase Tlc1, which exchanges bacterial ADP for host cell ATP as a source of energy, rather than as a source of adenylate. Interestingly, the R. prowazekii genome encodes four open reading frames that are highly homologous to the well-characterized ATP/ADP translocase Tlc1. Therefore, by annotation, the R. prowazekii genome encodes a total of five ATP/ADP translocases: Tlc1, Tlc2, Tlc3, Tlc4, and Tlc5. We have confirmed by quantitative reverse transcriptase PCR that mRNAs corresponding to all five tlc homologues are expressed in R. prowazekii growing in L-929 cells and have shown their heterologous protein expression in Escherichia coli, suggesting that none of the tlc genes are pseudogenes in the process of evolutionary meltdown. However, we demonstrate by heterologous expression in E. coli that only Tlc1 functions as an ATP/ADP transporter. A survey of nucleotides and nucleosides has determined that Tlc4 transports CTP, UTP, and GDP. Intriguingly, although GTP was not transported by Tlc4, it was an inhibitor of CTP and UTP uptake and demonstrated a K(i) similar to that of GDP. In addition, we demonstrate that Tlc5 transports GTP and GDP. We postulate that Tlc4 and Tlc5 serve the primary function of maintaining intracellular pools of nucleotides for rickettsial nucleic acid biosynthesis and do not provide the cell with nucleoside triphosphates as an energy source, as is the case for Tlc1. Although heterologous expression of Tlc2 and Tlc3 was observed in E. coli, we were unable to identify substrates for these proteins. PMID:16923893

  13. 5'-Single-stranded/duplex DNA junctions are loading sites for E. coli UvrD translocase. (United States)

    Tomko, Eric J; Jia, Haifeng; Park, Jeehae; Maluf, Nasib K; Ha, Taekjip; Lohman, Timothy M


    Escherichia coli UvrD is a 3'-5' superfamily 1A helicase/translocase involved in a variety of DNA metabolic processes. UvrD can function either as a helicase or only as an single-stranded DNA (ssDNA) translocase. The switch between these activities is controlled in vitro by the UvrD oligomeric state; a monomer has ssDNA translocase activity, whereas at least a dimer is needed for helicase activity. Although a 3'-ssDNA partial duplex provides a high-affinity site for a UvrD monomer, here we show that a monomer also binds with specificity to DNA junctions possessing a 5'-ssDNA flanking region and can initiate translocation from this site. Thus, a 5'-ss-duplex DNA junction can serve as a high-affinity loading site for the monomeric UvrD translocase, whereas a 3'-ss-duplex DNA junction inhibits both translocase and helicase activity of the UvrD monomer. Furthermore, the 2B subdomain of UvrD is important for this junction specificity. This highlights a separation of helicase and translocase function for UvrD and suggests that a monomeric UvrD translocase can be loaded at a 5'-ssDNA junction when translocation activity alone is needed. PMID:20877334

  14. Spectroscopic assessment of argon gas discharge induced radiolysis of aqueous adenine and thymine

    Energy Technology Data Exchange (ETDEWEB)

    Su Xi [Key Laboratory of Ion Beam Bio-engineering, Hefei Institutes of Physical Science, Chinese Academy of Sciences, P.O. Box 1138, Shushanhu Road 350, Hefei 230031 (China); Huang Qing, E-mail: [Key Laboratory of Ion Beam Bio-engineering, Hefei Institutes of Physical Science, Chinese Academy of Sciences, P.O. Box 1138, Shushanhu Road 350, Hefei 230031 (China); Dang Bingrong [Institute of Modern Physics, Chinese Academy of Sciences, 509 Nanchang Road, Lanzhou 730000 (China); Wang Xiangqin; Yu Zengliang [Key Laboratory of Ion Beam Bio-engineering, Hefei Institutes of Physical Science, Chinese Academy of Sciences, P.O. Box 1138, Shushanhu Road 350, Hefei 230031 (China)


    Ionizing radiation influences life profoundly for it can modify genetic materials. It is a long-standing task to investigate the interaction between energetic particles and DNA together with its components such as nucleotides, nucleosides and bases so as to predict and assess the potential biological effects. In this study, argon gas discharge was employed to produce energetic ions and electrons. The gas discharge caused the radiolysis of aqueous bases and the involved reactions were analyzed by means of spectroscopic tools including UV-vis absorption, fluorescence and Fourier transformation infrared (FTIR) spectroscopy, also assisted by liquid chromatography/mass spectrometry (LC/MS). It was found that the discharge resulted in the adenine-derived lesions such as 4,6-diamino-5-formamidopyrimidine, 8-OH-Ade and 2-OH-Ade in the radiolysis of aqueous adenine, as well as the thymine-derived lesions such as thymine glycol, 5-hydroxy-6-hydrothymine and/or 6-hydroxy-5-hydrothymine, 5-hydroxymethyluracil and 5-formyluracil in the radiolysis of aqueous thymine. The study of radio-sensitivity showed that adenine was more resistant to the discharge. The mechanisms of the involved reactions were studied in detail, confirming that the hydroxyl radical played a dominant role. - Highlights: > Effective new way to study radiolysis of bases via a home-made argon discharge apparatus. > Quantitative analysis of base radiolysis employing spectroscopic tools combined with HPLC/MS. > Discovery of different radiolysis effect compared with other forms of ionizing radiations.

  15. Spectroscopic assessment of argon gas discharge induced radiolysis of aqueous adenine and thymine

    International Nuclear Information System (INIS)

    Ionizing radiation influences life profoundly for it can modify genetic materials. It is a long-standing task to investigate the interaction between energetic particles and DNA together with its components such as nucleotides, nucleosides and bases so as to predict and assess the potential biological effects. In this study, argon gas discharge was employed to produce energetic ions and electrons. The gas discharge caused the radiolysis of aqueous bases and the involved reactions were analyzed by means of spectroscopic tools including UV-vis absorption, fluorescence and Fourier transformation infrared (FTIR) spectroscopy, also assisted by liquid chromatography/mass spectrometry (LC/MS). It was found that the discharge resulted in the adenine-derived lesions such as 4,6-diamino-5-formamidopyrimidine, 8-OH-Ade and 2-OH-Ade in the radiolysis of aqueous adenine, as well as the thymine-derived lesions such as thymine glycol, 5-hydroxy-6-hydrothymine and/or 6-hydroxy-5-hydrothymine, 5-hydroxymethyluracil and 5-formyluracil in the radiolysis of aqueous thymine. The study of radio-sensitivity showed that adenine was more resistant to the discharge. The mechanisms of the involved reactions were studied in detail, confirming that the hydroxyl radical played a dominant role. - Highlights: → Effective new way to study radiolysis of bases via a home-made argon discharge apparatus. → Quantitative analysis of base radiolysis employing spectroscopic tools combined with HPLC/MS. Discovery of different radiolysis effect compared with other forms of ionizing radiations.

  16. Influence of Magnetic Microparticles Isolation on Adenine Homonucleotides Structure

    Directory of Open Access Journals (Sweden)

    Monika Kremplova


    Full Text Available The electroactivity of purine and pyrimidine bases is the most important property of nucleic acids that is very useful for determining oligonucleotides using square wave voltammetry. This study was focused on the electrochemical behavior of adenine-containing oligonucleotides before and after their isolation using paramagnetic particles. Two peaks were detected—peak A related to the reduction of adenine base and another peak B involved in the interactions between individual adenine strands and contributes to the formation of various spatial structures. The influence of the number of adenine bases in the strand in the isolation process using paramagnetic particles was investigated too.

  17. Identification of oligonucleotide sequences that direct the movement of the Escherichia coli FtsK translocase


    Levy, Oren; Ptacin, Jerod L.; Pease, Paul J.; Gore, Jeff; Eisen, Michael B.; Bustamante, Carlos; Cozzarelli, Nicholas R.


    FtsK from Escherichia coli is a fast and sequence-directed DNA translocase with roles in chromosome dimer resolution, segregation, and decatenation. From the movement of single FtsK particles on defined DNA substrates and an analysis of skewed DNA sequences in bacteria, we identify GNGNAGGG, its complement, or both as a sequence motif that controls translocation directionality. GNGNAGGG is skewed so that it is predominantly on the leading strand of chromosomal replication. Translocation acros...

  18. Evolutionary conservation of dual Sec translocases in the cyanelles of Cyanophora paradoxa

    Directory of Open Access Journals (Sweden)

    Löffelhardt Wolfgang


    Full Text Available Abstract Background Cyanelles, the peptidoglycan-armored plastids of glaucocystophytes, occupy a unique bridge position in between free-living cyanobacteria and chloroplasts. In some respects they side with cyanobacteria whereas other features are clearly shared with chloroplasts. The Sec translocase, an example for "conservative sorting" in the course of evolution, is found in the plasma membrane of all prokaryotes, in the thylakoid membrane of chloroplasts and in both these membrane types of cyanobacteria. Results In this paper we present evidence for a dual location of the Sec translocon in the thylakoid as well as inner envelope membranes of the cyanelles from Cyanophora paradoxa, i. e. conservative sorting sensu stricto. The prerequisite was the generation of specific antisera directed against cyanelle SecY that allowed immunodetection of the protein on SDS gels from both membrane types separated by sucrose density gradient floatation centrifugation. Immunoblotting of blue-native gels yielded positive but differential results for both the thylakoid and envelope Sec complexes, respectively. In addition, heterologous antisera directed against components of the Toc/Tic translocons and binding of a labeled precursor protein were used to discriminate between inner and outer envelope membranes. Conclusion The envelope translocase can be envisaged as a prokaryotic feature missing in higher plant chloroplasts but retained in cyanelles, likely for protein transport to the periplasm. Candidate passengers are cytochrome c6 and enzymes of peptidoglycan metabolism. The minimal set of subunits of the Toc/Tic translocase of a primitive plastid is proposed.

  19. Engineered tryptophan in the adenine-binding pocket of catalytic subunit A of A-ATP synthase demonstrates the importance of aromatic residues in adenine binding, forming a tool for steady-state and time-resolved fluorescence spectroscopy

    International Nuclear Information System (INIS)

    The crystallographic structures of the subunit B mutants F427W and F508W of the Pyrococcus horikoshii OT3 of the A1AO ATP synthase reveal that the exact volume of the adenine ribose binding pocket is essential for ATP-/ADP-binding. A reporter tryptophan residue was individually introduced by site-directed mutagenesis into the adenine-binding pocket of the catalytic subunit A (F427W and F508W mutants) of the motor protein A1AO ATP synthase from Pyrococcus horikoshii OT3. The crystal structures of the F427W and F508W mutant proteins were determined to 2.5 and 2.6 Å resolution, respectively. The tryptophan substitution caused the fluorescence signal to increase by 28% (F427W) and 33% (F508W), with a shift from 333 nm in the wild-type protein to 339 nm in the mutant proteins. Tryptophan emission spectra showed binding of Mg-ATP to the F427W mutant with a Kd of 8.5 µM. In contrast, no significant binding of nucleotide could be observed for the F508W mutant. A closer inspection of the crystal structure of the F427W mutant showed that the adenine-binding pocket had widened by 0.7 Å (to 8.70 Å) in comparison to the wild-type subunit A (8.07 Å) owing to tryptophan substitution, as a result of which it was able to bind ATP. In contrast, the adenine-binding pocket had narrowed in the F508W mutant. The two mutants presented demonstrate that the exact volume of the adenine ribose binding pocket is essential for nucleotide binding and even minor narrowing makes it unfit for nucleotide binding. In addition, structural and fluorescence data confirmed the viability of the fluorescently active mutant F427W, which had ideal tryptophan spectra for future structure-based time-resolved dynamic measurements of the catalytic subunit A of the ATP-synthesizing enzyme A-ATP synthase

  20. Adenine adlayers on Cu(111): XPS and NEXAFS study

    Energy Technology Data Exchange (ETDEWEB)

    Tsud, Nataliya; Bercha, Sofiia; Ševčíková, Klára; Matolín, Vladimír [Department of Surface and Plasma Science, Faculty of Mathematics and Physics, Charles University in Prague, V Holešovičkách 2, 18000 Prague 8 (Czech Republic); Acres, Robert G. [Elettra-Sincrotrone Trieste S.C.p.A., Area Science Park, Strada Statale 14, km 163.5, 34149 Basovizza, Trieste (Italy); Prince, Kevin C. [Elettra-Sincrotrone Trieste S.C.p.A., Area Science Park, Strada Statale 14, km 163.5, 34149 Basovizza, Trieste (Italy); Istituto Officina dei Materiali, Consiglio Nazionale delle Ricerche, 34149 Basovizza, Trieste (Italy)


    The adsorption of adenine on Cu(111) was studied by photoelectron and near edge x-ray absorption fine structure spectroscopy. Disordered molecular films were deposited by means of physical vapor deposition on the substrate at room temperature. Adenine chemisorbs on the Cu(111) surface with strong rehybridization of the molecular orbitals and the Cu 3d states. Annealing at 150 °C caused the desorption of weakly bonded molecules accompanied by formation of a short-range ordered molecular adlayer. The interface is characterized by the formation of new states in the valence band at 1.5, 7, and 9 eV. The present work complements and refines existing knowledge of adenine interaction with this surface. The coverage is not the main parameter that defines the adenine geometry and adsorption properties on Cu(111). Excess thermal energy can further rearrange the molecular adlayer and, independent of the initial coverage, the flat lying stable molecular adlayer is formed.

  1. The sonolysis and radiolysis of adenine and related biomolecules

    International Nuclear Information System (INIS)

    The sonolysis of adenine, its nucleoside adenosine and the carbohydrates glucose, fructose and ribose were investigated at 459 Hz. The insonation of air-saturated aqueous adenine solutions degrades adenine at a rate that is linear with time and independent of the initial concentration. The radiolytic decomposition of air-saturated aqueous adenine solutions were also investigated and the degradation products found to be essentially identical to those obtained by sonolysis. since the products derived from sonolysis and radiolysis were similar, a degradation mechanism can be proposed that accounts for all the observed products. The major feature of this mechanism is that the principal loci of attack are the C(8) position and the central C(4)-C(5) double bond. The sonolysis of air-saturated aqueous solutions of the carbohydrates results in the formation of products analogous to those produced by ionizing radiation. While two types of products are formed in the radiolysis of carbohydrate solutions, depending on the initial presence or absence of oxygen, the sonolysis of air-saturated carbohydrate solutions leads to the formation of both types of products. This is due to the depletion of oxygen from the solution during insonation. Existing mechanisms for the radiolytic decomposition of carbohydrates in the presence and absence of oxygen can be modified to rationalize the sonolysis products. Insonation of an aqueous solution of adenosine resulted in the production of adenine and ribose. The other products are consistent with those obtained in the ultrasonic degradation of adenine and ribose

  2. Synthesis and hybridization of oligonucleotides modified at AMP sites with adenine pyrrolidine phosphonate nucleotides

    Czech Academy of Sciences Publication Activity Database

    Rejman, Dominik; Kočalka, Petr; Pohl, Radek; Točík, Zdeněk; Rosenberg, Ivan


    Roč. 74, č. 6 (2009), s. 935-955. ISSN 0010-0765 R&D Projects: GA MŠk 2B06065; GA MŠk(CZ) LC06077; GA MŠk(CZ) LC06061; GA AV ČR KAN200520801 Institutional research plan: CEZ:AV0Z40550506 Keywords : oligonucleotide * pyrrolidine * phosphonate Subject RIV: CC - Organic Chemistry Impact factor: 0.856, year: 2009


    After 10 weeks treatment with 10 micrograms Ni/kg seawater, the concentration of ATP in Mytilus edulis adductor muscles was significently less than that in muscles from control and 5 micrograms Ni/kg treated mussels. Mussels sampled in August after exposure for 12 weeks to pollut...

  4. Effects of adenine nucleotide and sterol depletion on tight junction structure and function in MDCK cells

    International Nuclear Information System (INIS)

    The antitumor agent Hadacidin (H), N-formyl-hydroxyamino-acetic acid, reversibly inhibited the multiplication of clone 4 Madin-Darby canine kidney (MDCK) cells at a 4 mM concentration within 24-48 hours. Treated cells were arrested in the S phase of the cell cycle. Accompanying this action was a 16-fold increase in the area occupied b the cells and a refractoriness to trypsin treatment. To test whether this effect was due to an increase in tight junction integrity, electrical resistance (TER) was measured across H-treated monolayers. Addition of H at the onset of junction formation reversibly prevented the development of TER. ATP and cAMP levels were decreased by H, as well as the rate of [3H]-leucine incorporation into protein. When 1 mM dibutyryl-cAMP (d.cAMP) and theophylline were added, H had no effect on cell division or protein synthesis, and TER was partially restored. The addition of 1 mM d.cAMP and 1 mM theophylline to control cultures decreased TER, indicating a biphasic effect on TER development/maintenance. In a separate study, the effect of sterol depletion on tight junctions formation/maintenance in wild-type MDCK cells was investigated

  5. Uncovering the polymerase-induced cytotoxicity of an oxidized nucleotide (United States)

    Freudenthal, Bret D.; Beard, William A.; Perera, Lalith; Shock, David D.; Kim, Taejin; Schlick, Tamar; Wilson, Samuel H.


    Oxidative stress promotes genomic instability and human diseases. A common oxidized nucleoside is 8-oxo-7,8-dihydro-2'-deoxyguanosine, which is found both in DNA (8-oxo-G) and as a free nucleotide (8-oxo-dGTP). Nucleotide pools are especially vulnerable to oxidative damage. Therefore cells encode an enzyme (MutT/MTH1) that removes free oxidized nucleotides. This cleansing function is required for cancer cell survival and to modulate Escherichia coli antibiotic sensitivity in a DNA polymerase (pol)-dependent manner. How polymerases discriminate between damaged and non-damaged nucleotides is not well understood. This analysis is essential given the role of oxidized nucleotides in mutagenesis, cancer therapeutics, and bacterial antibiotics. Even with cellular sanitizing activities, nucleotide pools contain enough 8-oxo-dGTP to promote mutagenesis. This arises from the dual coding potential where 8-oxo-dGTP(anti) base pairs with cytosine and 8-oxo-dGTP(syn) uses its Hoogsteen edge to base pair with adenine. Here we use time-lapse crystallography to follow 8-oxo-dGTP insertion opposite adenine or cytosine with human pol β, to reveal that insertion is accommodated in either the syn- or anti-conformation, respectively. For 8-oxo-dGTP(anti) insertion, a novel divalent metal relieves repulsive interactions between the adducted guanine base and the triphosphate of the oxidized nucleotide. With either templating base, hydrogen-bonding interactions between the bases are lost as the enzyme reopens after catalysis, leading to a cytotoxic nicked DNA repair intermediate. Combining structural snapshots with kinetic and computational analysis reveals how 8-oxo-dGTP uses charge modulation during insertion that can lead to a blocked DNA repair intermediate.

  6. The nucleotide sequence of the uvrD gene of E. coli.


    Finch, P W; Emmerson, P T


    The nucleotide sequence of a cloned section of the E. coli chromosome containing the uvrD gene has been determined. The coding region for the UvrD protein consists of 2,160 nucleotides which would direct the synthesis of a polypeptide 720 amino acids long with a calculated molecular weight of 82 kd. The predicted amino acid sequence of the UvrD protein has been compared with the amino acid sequences of other known adenine nucleotide binding proteins and a common sequence has been identified, ...

  7. Detection of electronically equivalent tautomers of adenine base: DFT study

    International Nuclear Information System (INIS)

    Graphical abstract: - Highlights: • DFT calculations have been performed on adenine and its rare tautomer Cu2+ complexes. • Interaction of A-Cu2+ and rA-Cu2+ complexes with AlN modified fullerene (C60) have been studied briefly. • It is found that AlN modified C60 could be used as a nanoscale sensor to detect these two A-Cu2+ and rA-Cu2+ complexes. - Abstract: In the present study, quantum chemical calculations were carried out to investigate the electronic structures and stabilities of adenine and its rare tautomer along with their Cu2+ complexes. Density Functional Theory (B3LYP method) was used in all calculations. The two Cu2+ complexes of adenine have almost similar energies and electronic structures; hence, their chemical differentiation is very difficult. For this purpose, interactions of these complexes with AlN modified fullerene (C60) have been studied. Theoretical investigations reveal that AlN-doped C60 may serve as a potentially viable nanoscale sensor for detection of the two Cu2+ complexes of adenine

  8. The Role of Gene Duplication in the Evolution of Purine Nucleotide Salvage Pathways (United States)

    Becerra, Arturo; Lazcano, Antonio


    Purine nucleotides are formed de novo by a widespread biochemical route that may be of monophyletic origin, or are synthesized from preformed purine bases and nucleosides through different salvage pathways. Three monophyletic sets of purine salvage enzymes, each of which catalyzes mechanistically similar reactions, can be identified: (a) adenine-, xanthine-, hypoxanthine- and guanine-phosphoribosyltransferases, which are all homologous among themselves, as well as to nucleoside phosphorylases; (b) adenine deaminase, adenosine deaminase, and adenosine monophophate deaminase; and (c) guanine reductase and inosine monophosphate dehydrogenase. These homologies support the idea that substrate specificity is the outcome of gene duplication, and that the purine nucleotide salvage pathways were assembled by a patchwork process that probably took place before the divergence of the three cell domains (Bacteria, Archaea, and Eucarya). Based on the ability of adenine PRTase to catalyze the condensation of PRPP with 4-aminoimidazole-5-carboxamide (AICA), a simpler scheme of purine nucleotide biosynthesis is presented. This hypothetical route requires the prior evolution of PRPP biosynthesis. Since it has been argued that PRPP, nucleosides, and nucleotides are susceptible to hydrolysis, they are very unlikely prebiotic compounds. If this is the case, it implies that many purine salvage pathways appeared only after the evolution of phosphorylated sugar biosynthetic pathways made ribosides available.

  9. A TatABC-type Tat translocase is required for unimpaired aerobic growth of Corynebacterium glutamicum ATCC13032.

    Directory of Open Access Journals (Sweden)

    Dan Oertel

    Full Text Available The twin-arginine translocation (Tat system transports folded proteins across the cytoplasmic membrane of bacteria and the thylakoid membrane of plant chloroplasts. Escherichia coli and other Gram-negative bacteria possess a TatABC-type Tat translocase in which each of the three inner membrane proteins TatA, TatB, and TatC performs a mechanistically distinct function. In contrast, low-GC Gram-positive bacteria, such as Bacillus subtilis, use a TatAC-type minimal Tat translocase in which the TatB function is carried out by a bifunctional TatA. In high-GC Gram-positive Actinobacteria, such as Mycobacterium tuberculosis and Corynebacterium glutamicum, tatA, tatB, and tatC genes can be identified, suggesting that these organisms, just like E. coli, might use TatABC-type Tat translocases as well. However, since contrary to this view a previous study has suggested that C. glutamicum might in fact use a TatAC translocase with TatB only playing a minor role, we reexamined the requirement of TatB for Tat-dependent protein translocation in this microorganism. Under aerobic conditions, the misassembly of the Rieske iron-sulfur protein QcrA was identified as a major reason for the severe growth defect of Tat-defective C. glutamicum mutant strains. Furthermore, our results clearly show that TatB, besides TatA and TatC, is strictly required for unimpaired aerobic growth. In addition, TatB was also found to be essential for the secretion of a heterologous Tat-dependent model protein into the C. glutamicum culture supernatant. Together with our finding that expression of the C. glutamicum TatB in an E. coli ΔtatB mutant strain resulted in the formation of an active Tat translocase, our results clearly indicate that a TatABC translocase is used as the physiologically relevant functional unit for Tat-dependent protein translocation in C. glutamicum and, most likely, also in other TatB-containing Actinobacteria.

  10. Excited-State Deactivation of Adenine by Electron-Driven Proton-Transfer Reactions in Adenine-Water Clusters: A Computational Study. (United States)

    Wu, Xiuxiu; Karsili, Tolga N V; Domcke, Wolfgang


    The reactivity of photoexcited 9H-adenine with hydrogen-bonded water molecules in the 9H-adenine-(H2 O)5 cluster is investigated by using ab initio electronic structure methods, focusing on the photoreactivity of the three basic sites of 9H-adenine. The energy profiles of excited-state reaction paths for electron/proton transfer from water to adenine are computed. For two of the three sites, a barrierless or nearly barrierless reaction path towards a low-lying S1 -S0 conical intersection is found. This reaction mechanism, which is specific for adenine in an aqueous environment, can explain the substantially shortened excited-state lifetime of 9H-adenine in water. Depending on the branching ratio of the nonadiabatic dynamics at the S1 -S0 conical intersection, the electron/proton transfer process can enhance the photostability of 9H-adenine in water or can lead to the generation of adenine-H(⋅) and OH(⋅) free radicals. Although the branching ratio is yet unknown, these findings indicate that adenine might have served as a catalyst for energy harvesting by water splitting in the early stages of the evolution of life. PMID:26833826

  11. {8-14C}-Adenine and {1-14C}-isopentenyl pyrophosphate - precursors for root-produced cytokinins in the tomato (Lycopersicon esculentum mill.)

    International Nuclear Information System (INIS)

    Following the detection of reasonable levels of biologically active cytokinin-like compounds in one-month-old tomato plants, the possible involvement of {8-14C}-adenine and {1-14C}-isopentenyl pyrophosphate in the biosynthetic pathway leading to an accumulation of free zeatin derivatives, was studied. Intact tomato plants were used for a time-course study involving the uptake of {8-14C}-adenine and the tentative identification of compounds into which the 14C became incorporated. Using high performance liquid chromatography, radioactive trans-zeatin was identified as being present in the Dowex 50 root extract. The 12-hour time interval was used and the roots of the tomato plants were immersed in a more heavily radiolabelled medium. Modified separation techniques were used to achieve enhanced radioactivity recovery rates. This experiment demonstrated the presence of relatively high levels of tentatively identified radioactive zeatin in the Dowex 50 root and stem extracts. Radioactivity in the aqueous extracts was found not to be contributed by cytokinin nucleotides. A final experiment was carried out using decapitated root systems to determine if the root tissue alone could be implicated in the synthesis of cytokinins. Decapitated tomato root systems were supplied with either {8-14C}-adenine or {1-14C}-isopentenyl pyrophosphate. The ratio of incorporation of {1-14C}-isopentenyl pyrophosphate into identified cytokinins was higher than for {8-14C}-adenine. It was concluded that both adenine and isopentenyl pyrophosphate are involved in the biosynthetic pathway leading to an accumulation of free zeatin derivatives in tomato roots

  12. Classifying Coding DNA with Nucleotide Statistics

    Directory of Open Access Journals (Sweden)

    Nicolas Carels


    Full Text Available In this report, we compared the success rate of classification of coding sequences (CDS vs. introns by Codon Structure Factor (CSF and by a method that we called Universal Feature Method (UFM. UFM is based on the scoring of purine bias (Rrr and stop codon frequency. We show that the success rate of CDS/intron classification by UFM is higher than by CSF. UFM classifies ORFs as coding or non-coding through a score based on (i the stop codon distribution, (ii the product of purine probabilities in the three positions of nucleotide triplets, (iii the product of Cytosine (C, Guanine (G, and Adenine (A probabilities in the 1st, 2nd, and 3rd positions of triplets, respectively, (iv the probabilities of G in 1st and 2nd position of triplets and (v the distance of their GC3 vs. GC2 levels to the regression line of the universal correlation. More than 80% of CDSs (true positives of Homo sapiens (>250 bp, Drosophila melanogaster (>250 bp and Arabidopsis thaliana (>200 bp are successfully classified with a false positive rate lower or equal to 5%. The method releases coding sequences in their coding strand and coding frame, which allows their automatic translation into protein sequences with 95% confidence. The method is a natural consequence of the compositional bias of nucleotides in coding sequences.

  13. Piperidine nucleosides and nucleotides

    Czech Academy of Sciences Publication Activity Database

    Kovačková, Soňa; Dračínský, Martin; Rosenberg, Ivan; Rejman, Dominik

    Lyon : Université de Lyon, 2010, s. 315-316. [International Roundtable on Nucleosides, Nucleotides and Nucleic Acids. IRT 2010. Lyon (FR), 29.08.2010-03.09.2010] Institutional research plan: CEZ:AV0Z40550506 Keywords : phosphonate analogs * piperidine nucleosides * piperidine nucleotides Subject RIV: CC - Organic Chemistry

  14. Mutagenic specificity of solar UV light in nucleotide excision repair-deficient rodent cells.


    Sage, E.; Lamolet, B; Brulay, E; Moustacchi, E; Chteauneuf, A; Drobetsky, E A


    To investigate the role of nucleotide excision repair (NER) in the cellular processing of carcinogenic DNA photoproducts induced by defined, environmentally relevant portions of the solar wavelength spectrum, we have determined the mutagenic specificity of simulated sunlight (310-1100 nm), UVA (350-400 nm), and UVB (290-320 nm), as well as of the "nonsolar" model mutagen 254-nm UVC, at the adenine phosphoribosyltransferase (aprt) locus in NER-deficient (ERCC1) Chinese hamster ovary (CHO) cell...

  15. OmpF, a nucleotide-sensing nanoprobe, computational evaluation of single channel activities (United States)

    Abdolvahab, R. H.; Mobasheri, H.; Nikouee, A.; Ejtehadi, M. R.


    The results of highthroughput practical single channel experiments should be formulated and validated by signal analysis approaches to increase the recognition precision of translocating molecules. For this purpose, the activities of the single nano-pore forming protein, OmpF, in the presence of nucleotides were recorded in real time by the voltage clamp technique and used as a means for nucleotide recognition. The results were analyzed based on the permutation entropy of current Time Series (TS), fractality, autocorrelation, structure function, spectral density, and peak fraction to recognize each nucleotide, based on its signature effect on the conductance, gating frequency and voltage sensitivity of channel at different concentrations and membrane potentials. The amplitude and frequency of ion current fluctuation increased in the presence of Adenine more than Cytosine and Thymine in milli-molar (0.5 mM) concentrations. The variance of the current TS at various applied voltages showed a non-monotonic trend whose initial increasing slope in the presence of Thymine changed to a decreasing one in the second phase and was different from that of Adenine and Cytosine; e.g., by increasing the voltage from 40 to 140 mV in the 0.5 mM concentration of Adenine or Cytosine, the variance decreased by one third while for the case of Thymine it was doubled. Moreover, according to the structure function of TS, the fractality of current TS differed as a function of varying membrane potentials (pd) and nucleotide concentrations. Accordingly, the calculated permutation entropy of the TS, validated the biophysical approach defined for the recognition of different nucleotides at various concentrations, pd's and polarities. Thus, the promising outcomes of the combined experimental and theoretical methodologies presented here can be implemented as a complementary means in pore-based nucleotide recognition approaches.

  16. The family of N9-adenine: New entry for adenine-benzamide conjugates linked via versatile spacers

    Indian Academy of Sciences (India)

    Prabhpreet Singh


    We have prepared 4-nitrobenzamide-adenine conjugates (8, 13 and 14) linked with versatile spacer such as triethylene glycol (TEG), aminocaproic acid and ethyl chains which were eventually reduced to obtain the corresponding 4-aminobenzamide-adenine conjugates (1-3) in good yields. These conjugates bear a nucleobase for DNA recognition or self-assembly through base-pair complementarity, a biocompatible linker for interfacing with biological system, and a p-aminobenzamide moiety for pharmacological applications. The use of hydrophilic or lipophilic linkers may tune the dispersibility of these conjugates in different solvents, as well as impart different properties. In the preliminary experiments the versatility and application of these linkers has been tested for functionalization of SWCNTs.

  17. Remodeling and Control of Homologous Recombination by DNA Helicases and Translocases that Target Recombinases and Synapsis. (United States)

    Northall, Sarah J; Ivančić-Baće, Ivana; Soultanas, Panos; Bolt, Edward L


    Recombinase enzymes catalyse invasion of single-stranded DNA (ssDNA) into homologous duplex DNA forming "Displacement loops" (D-loops), a process called synapsis. This triggers homologous recombination (HR), which can follow several possible paths to underpin DNA repair and restart of blocked and collapsed DNA replication forks. Therefore, synapsis can be a checkpoint for controlling whether or not, how far, and by which pathway, HR proceeds to overcome an obstacle or break in a replication fork. Synapsis can be antagonized by limiting access of a recombinase to ssDNA and by dissociation of D-loops or heteroduplex formed by synapsis. Antagonists include DNA helicases and translocases that are identifiable in eukaryotes, bacteria and archaea, and which target synaptic and pre-synaptic DNA structures thereby controlling HR at early stages. Here we survey these events with emphasis on enabling DNA replication to be resumed from sites of blockage or collapse. We also note how knowledge of anti-recombination activities could be useful to improve efficiency of CRISPR-based genome editing. PMID:27548227

  18. Cryo-electron microscopy structure of a yeast mitochondrial preprotein translocase. (United States)

    Model, Kirstin; Meisinger, Chris; Kühlbrandt, Werner


    The translocase of the outer mitochondrial membrane (TOM) complex is the main entry gate for proteins imported into mitochondria. We determined the structure of the native, unstained approximately 550-kDa core-Tom20 complex from Saccharomycescerevisiae by cryo-electron microscopy at 18-A resolution. The complex is triangular, measuring 145 A on edge, and has near-3-fold symmetry. Its bulk is made up of three globular approximately 50-A domains. Three elliptical pores on the c-face merge into one central approximately 70-A cavity with a cage-like assembly on the opposite t-face. Nitrilotriacetic acid-gold labeling indicates that three Tom22 subunits in the TOM complex are located at the perimeter of the complex near the interface of the globular domains. We assign Tom22, which controls complex assembly, to three peripheral protrusions on the c-face, while the Tom20 subunit is tentatively assigned to the central protrusion on this surface. Based on our three-dimensional map, we propose a model of transient interactions and functional dynamics of the TOM assembly. PMID:18706915

  19. Active displacement of RecA filaments by UvrD translocase activity. (United States)

    Petrova, Vessela; Chen, Stefanie H; Molzberger, Eileen T; Tomko, Eric; Chitteni-Pattu, Sindhu; Jia, Haifeng; Ordabayev, Yerdos; Lohman, Timothy M; Cox, Michael M


    The UvrD helicase has been implicated in the disassembly of RecA nucleoprotein filaments in vivo and in vitro. We demonstrate that UvrD utilizes an active mechanism to remove RecA from the DNA. Efficient RecA removal depends on the availability of DNA binding sites for UvrD and/or the accessibility of the RecA filament ends. The removal of RecA from DNA also requires ATP hydrolysis by the UvrD helicase but not by RecA protein. The RecA-removal activity of UvrD is slowed by RecA variants with enhanced DNA-binding properties. The ATPase rate of UvrD during RecA removal is much slower than the ATPase activity of UvrD when it is functioning either as a translocase or a helicase on DNA in the absence of RecA. Thus, in this context UvrD may operate in a specialized disassembly mode. PMID:25824953

  20. Main: Nucleotide Analysis [KOME

    Lifescience Database Archive (English)

    Full Text Available Nucleotide Analysis GenBank blastx search ... result Result of blastx search ... against GenBank amino a ... cid sequence kome_genbank_blastx_search kome_genbank_blastx_search _result ...

  1. Main: Nucleotide Analysis [KOME

    Lifescience Database Archive (English)

    Full Text Available Nucleotide Analysis GenBank blastn search ... result Result of blastn search ... against GenBank nucleot ... ide sequence kome_genbank_blastn_search kome_genbank_blastn_search _result ...

  2. Main: Nucleotide Analysis [KOME

    Lifescience Database Archive (English)

    Full Text Available Nucleotide Analysis PLACE search result Result of signal search against PLACE : cis-acting regul ... atory DNA elements Database ... kome_place_search_res ...

  3. Main: Nucleotide Analysis [KOME

    Lifescience Database Archive (English)

    Full Text Available Nucleotide Analysis Japonica genome blast search result Result of blastn search against japonica genome... sequence kome_japonica_genome_blast_search_result ...

  4. Main: Nucleotide Analysis [KOME

    Lifescience Database Archive (English)

    Full Text Available Nucleotide Analysis Indica genome blast search result Result of blastn search against Indica genome... sequence (top hit only) kome_indica_genome_blast_search_result ...

  5. Sequence-specific interaction of Hoechst 33258 with the minor groove of an adenine-tract DNA duplex studied in solution by 1H NMR spectroscopy.


    Searle, M S; Embrey, K J


    The interaction of Hoechst 33258 with the minor groove of the adenine-tract DNA duplex d(CTTTTGCAAAAG)2 has been studied in both D2O and H2O solutions by 1D and 2D 1H NMR spectroscopy. Thirty-one nuclear Overhauser effects between drug and nucleotide protons within the minor groove of the duplex, together with ring-current induced perturbations to the chemical shifts of basepair and deoxyribose protons, define the position and orientation of the bound dye molecules. Two drug molecules bind co...

  6. Influence of dietary nucleotide restriction on bacterial sepsis and phagocytic cell function in mice. (United States)

    Kulkarni, A D; Fanslow, W C; Drath, D B; Rudolph, F B; Van Buren, C T


    Although enzyme defects in purine metabolism have revealed the importance of these substrates to maintenance of a normal immune response, the role of exogenous nucleotides on the cells that mediate the host defense system has remained largely unexplored. Recent investigations have revealed that dietary nucleotides are vital to the maintenance of cell-mediated responses to antigen stimulation. To test the influence of dietary nucleotide deprivation on resistance to infection, Balb/c mice were maintained on chow, a nucleotide-free (NF) diet, or an NF diet repleted with adenine, uracil, or RNA. Mice on the NF diet suffered 100% mortality following intravenous challenge with Staphylococcus aureus, while chow-fed and RNA- or uracil-repleted mice demonstrated significantly greater resistance to this bacterial challenge. Macrophages from mice on the NF diet had decreased phagocytic activity as measured by uptake of radiolabeled bacteria compared with mice maintained on the NF diet supplemented with adenine, uracil, or RNA. No change in S aureus antibody response was noted on the various diets. Although the mechanism of this suppression of nonspecific immunity remains unclear, provision of nucleotides to defined diets appears vital to maintain host resistance to bacterial challenge. PMID:3947217

  7. Nucleotide diversity in gorillas.


    Yu, Ning; Jensen-Seaman, Michael I.; Chemnick, Leona; Ryder, Oliver; Li, Wen-Hsiung


    Comparison of the levels of nucleotide diversity in humans and apes may provide valuable information for inferring the demographic history of these species, the effect of social structure on genetic diversity, patterns of past migration, and signatures of past selection events. Previous DNA sequence data from both the mitochondrial and the nuclear genomes suggested a much higher level of nucleotide diversity in the African apes than in humans. Noting that the nuclear DNA data from the apes we...

  8. Ligation-triggered fluorescent silver nanoclusters system for the detection of nicotinamide adenine dinucleotide. (United States)

    Cao, Zhijuan; Wang, Pei; Qiu, Xue; Lau, Choiwan; Lu, Jianzhong


    Herein, we demonstrate a novel silver nanocluster-based fluorescent system for the detection of nicotinamide adenine dinucleotide (NAD(+)), an important biological small molecule involved in a wide range of biological processes. A single-stranded dumbbell DNA probe was designed and used for the assay, which contained a nick in the stem, a poly-cytosine nucleotide loop close to 5' end as the template for the formation of highly fluorescent silver nanoclusters (Ag NCs) and another loop close to 3' end. Only in the presence of NAD(+), the probe was linked at 5' and 3' ends by Escherichia coli DNA ligase, which blocked the DNA polymerase-based extension reaction, ensuring the formation of fluorescent Ag NCs. This technique provided a logarithmic linear relationship in the range of 1 pM-500 nM with a detection limit of as low as 1 pM NAD(+), and exhibited high selectivity against its analogues, and was then successfully used for the detection of NAD(+) level in four kinds of cell homogenates. In addition, this new approach was conducted in an isothermal and homogeneous condition without the need of any thermal cycling, washing, and separation steps, making it very simple. Overall, this label-free protocol offers a promising alternative for the detection of NAD(+), taking advantage of specificity, sensitivity, cost-efficiency, and simplicity. PMID:24442015

  9. Influence of hydrogen bonding on the geometry of the adenine fragment (United States)

    Słowikowska, Joanna Maria; Woźniak, Krzysztof


    The crystal structures of two adenine derivatives, N(6),9-dimethyl-8-butyladenine (I) and its hydrate (1 : 1) (II), have been determined by single-crystal X-ray diffraction. The geometrical features of both structures are discussed. The influence of protonation, substitution and hydrogen bond formation on the geometry of the adenine fragment was studied, based on data retrieved from the Cambridge Structural Database. Total correlation analysis showed mutual correlation between the structural parameters in the adenine ring system; partial correlation calculations for the adenine nucleoside fragments suggest intercorrelation between the parameters of the hydrogen bonding involved in base pairing and the N(adenine)-C(sugar) bond through the adenine fragment; few such correlations were found for fragments without the sugar substituent.

  10. PGC-1β regulates mouse carnitine–acylcarnitine translocase through estrogen-related receptor α

    International Nuclear Information System (INIS)

    Highlights: ► The Cact gene is induced in mouse skeletal muscle after 24 h of fasting. ► The Cact gene contains a functional consensus sequence for ERR. ► This sequence binds ERRα both in vivo and in vitro. ► This ERRE is required for the activation of Cact expression by the PGC-1/ERR axis. ► Our results add Cact as a genuine gene target of these transcriptional regulators. -- Abstract: Carnitine/acylcarnitine translocase (CACT) is a mitochondrial-membrane carrier proteins that mediates the transport of acylcarnitines into the mitochondrial matrix for their oxidation by the mitochondrial fatty acid-oxidation pathway. CACT deficiency causes a variety of pathological conditions, such as hypoketotic hypoglycemia, cardiac arrest, hepatomegaly, hepatic dysfunction and muscle weakness, and it can be fatal in newborns and infants. Here we report that expression of the Cact gene is induced in mouse skeletal muscle after 24 h of fasting. To gain insight into the control of Cact gene expression, we examine the transcriptional regulation of the mouse Cact gene. We show that the 5′-flanking region of this gene is transcriptionally active and contains a consensus sequence for the estrogen-related receptor (ERR), a member of the nuclear receptor family of transcription factors. This sequence binds ERRαin vivo and in vitro and is required for the activation of Cact expression by the peroxisome proliferator-activated receptor gamma coactivator (PGC)-1/ERR axis. We also demonstrate that XTC790, the inverse agonist of ERRα, specifically blocks Cact activation by PGC-1β in C2C12 cells.

  11. PGC-1{beta} regulates mouse carnitine-acylcarnitine translocase through estrogen-related receptor {alpha}

    Energy Technology Data Exchange (ETDEWEB)

    Gacias, Mar; Perez-Marti, Albert; Pujol-Vidal, Magdalena; Marrero, Pedro F. [Department of Biochemistry and Molecular Biology, School of Pharmacy and the Institute of Biomedicine of the University of Barcelona (IBUB) (Spain); Haro, Diego, E-mail: [Department of Biochemistry and Molecular Biology, School of Pharmacy and the Institute of Biomedicine of the University of Barcelona (IBUB) (Spain); Relat, Joana [Department of Biochemistry and Molecular Biology, School of Pharmacy and the Institute of Biomedicine of the University of Barcelona (IBUB) (Spain)


    Highlights: Black-Right-Pointing-Pointer The Cact gene is induced in mouse skeletal muscle after 24 h of fasting. Black-Right-Pointing-Pointer The Cact gene contains a functional consensus sequence for ERR. Black-Right-Pointing-Pointer This sequence binds ERR{alpha} both in vivo and in vitro. Black-Right-Pointing-Pointer This ERRE is required for the activation of Cact expression by the PGC-1/ERR axis. Black-Right-Pointing-Pointer Our results add Cact as a genuine gene target of these transcriptional regulators. -- Abstract: Carnitine/acylcarnitine translocase (CACT) is a mitochondrial-membrane carrier proteins that mediates the transport of acylcarnitines into the mitochondrial matrix for their oxidation by the mitochondrial fatty acid-oxidation pathway. CACT deficiency causes a variety of pathological conditions, such as hypoketotic hypoglycemia, cardiac arrest, hepatomegaly, hepatic dysfunction and muscle weakness, and it can be fatal in newborns and infants. Here we report that expression of the Cact gene is induced in mouse skeletal muscle after 24 h of fasting. To gain insight into the control of Cact gene expression, we examine the transcriptional regulation of the mouse Cact gene. We show that the 5 Prime -flanking region of this gene is transcriptionally active and contains a consensus sequence for the estrogen-related receptor (ERR), a member of the nuclear receptor family of transcription factors. This sequence binds ERR{alpha}in vivo and in vitro and is required for the activation of Cact expression by the peroxisome proliferator-activated receptor gamma coactivator (PGC)-1/ERR axis. We also demonstrate that XTC790, the inverse agonist of ERR{alpha}, specifically blocks Cact activation by PGC-1{beta} in C2C12 cells.

  12. Piperidine nucleosides and nucleotides

    Czech Academy of Sciences Publication Activity Database

    Kovačková, Soňa; Pačes, Ondřej; Dračínský, Martin; Rosenberg, Ivan; Rejman, Dominik

    Manchester : University of Manchester, 2009. s. 50-50. [Nucleic Acids at the Chemistry - Biology Interface. 07.09.2009-08.09.2009, Manchester] R&D Projects: GA MZd NR9138; GA MŠk 2B06065 Institutional research plan: CEZ:AV0Z40550506 Keywords : phosphonate * piperidine nucleosides * nucleotides Subject RIV: CC - Organic Chemistry

  13. Unraveling the complexity of the interactions of DNA nucleotides with gold by single molecule force spectroscopy (United States)

    Bano, Fouzia; Sluysmans, Damien; Wislez, Arnaud; Duwez, Anne-Sophie


    Addressing the effect of different environmental factors on the adsorption of DNA to solid supports is critical for the development of robust miniaturized devices for applications ranging from biosensors to next generation molecular technology. Most of the time, thiol-based chemistry is used to anchor DNA on gold - a substrate commonly used in nanotechnology - and little is known about the direct interaction between DNA and gold. So far there have been no systematic studies on the direct adsorption behavior of the deoxyribonucleotides (i.e., a nitrogenous base, a deoxyribose sugar, and a phosphate group) and on the factors that govern the DNA-gold bond strength. Here, using single molecule force spectroscopy, we investigated the interaction of the four individual nucleotides, adenine, guanine, cytosine, and thymine, with gold. Experiments were performed in three salinity conditions and two surface dwell times to reveal the factors that influence nucleotide-Au bond strength. Force data show that, at physiological ionic strength, adenine-Au interactions are stronger, asymmetrical and independent of surface dwell time as compared to cytosine-Au and guanine-Au interactions. We suggest that in these conditions only adenine is able to chemisorb on gold. A decrease of the ionic strength significantly increases the bond strength for all nucleotides. We show that moderate ionic strength along with longer surface dwell period suggest weak chemisorption also for cytosine and guanine.Addressing the effect of different environmental factors on the adsorption of DNA to solid supports is critical for the development of robust miniaturized devices for applications ranging from biosensors to next generation molecular technology. Most of the time, thiol-based chemistry is used to anchor DNA on gold - a substrate commonly used in nanotechnology - and little is known about the direct interaction between DNA and gold. So far there have been no systematic studies on the direct

  14. Interaction of porphyrins with adenine and adenosine complexes. Effect of a metal nature

    International Nuclear Information System (INIS)

    Reactions of complex formation of 5,10,15,20-tetraphenylporphine (H2TPP) and tetra-tert-butylphthalocyanine (H2(t-Bu)4Pc) with adenine and adenosine complexes of d-metals (M=Cd, Co, Cu, Hg, Zn) in DMSO and ethanol are studied. It was found that H2TPP reacts with Cu(II) and Hg(II) adeninates and adenosinates in DMSO, but does not react with Zn(II), Co(II), and Cd(II) adeninates and adenosinates (with both bridging and monodentate type of the ligand coordination). H2(t-Bu)4Pc enters the complex formation reaction with adeninates and adenosinates of all studied metals in DMSO at almost equal rates. The states of adenine and adenosine complexes of different d-metals in DMSO and ethanol are proposed on the basis of kinetic data obtained

  15. Nucleotide Variability in the 5-Enolpyruvylshikimate-3-Phosphate Synthase Gene from Eleusine indica (L.) Gaertn


    J.L. Chong; R. Wickneswari; Ismail, B. S.; S. Salmijah


    This study reports the results of the partial DNA sequence analysis of the 5-enolpyruvyl-shikimate-3-phosphate synthase (EPSPS) gene in glyphosate-resistant (R) and glyphosate-susceptible (S) biotypes of Eleusine indica (L.) Gaertn from Peninsular Malaysia. Sequencing results revealed point mutation at nucleotide position 875 in the R biotypes of Bidor, Chaah and Temerloh. In the Chaah R population, substitution of cytosine (C) to adenine (A) resulted in the change of threonine (Thr106) to pr...

  16. De novo synthesis of purine nucleotides in different fiber types of rat skeletal muscle

    International Nuclear Information System (INIS)

    The contribution of de novo purine nucleotide synthesis to nucleotide metabolism in skeletal muscles is not known. The authors have determined rates of de novo synthesis in soleus (slow-twitch red), red gastrocnemius (fast-twitch red), and white gastrocnemius (fast-twitch white) using the perfused rat hindquarter. 14C glycine incorporation into ATP was linear after 1 and 2 hours of perfusion with 0.2 mM added glycine. The intracellular (I) and extracellular (E) specific activity of 14C glycine was determined by HPLC of phenylisothiocyanate derivatives of neutralized PCA extracts. The rates of de novo synthesis when expressed relative to muscle ATP content show slow and fast-twitch red muscles to be similar and about twice as great as fast-twitch white muscles. This could represent a greater turnover of the adenine nucleotide pool in more oxidative red muscle types

  17. MDR3 P-glycoprotein, a phosphatidylcholine translocase, transports several cytotoxic drugs and directly interacts with drags as judged by interference with nucleotide trapping


    Smith, A.J.; van Helvoort, A.; van Meer, G; Szabó, K.; Welker, E; Szakács, G; Váradi, A; Sarkadi, B.; Borst, P


    The human MDR3 gene is a member of the multidrug resistance (MDR) gene family. The MDR3 P-glycoprotein is a transmembrane protein that translocates phosphatidylcholine. The MDR1 P-glycoprotein related transports cytotoxic drugs. Its overexpression can make cells resistant to a variety of drugs. Attempts to show that MDR3 P-glycoprotein can cause MDR have been unsuccessful thus far. Here, we report an increased directional transport of several MDR1 P-glycoprotein substrates, such as digoxin, p...

  18. Mechanisms of Berberine (Natural Yellow 18)–Induced Mitochondrial Dysfunction: Interaction with the Adenine Nucleotide Translocator


    Pereira, Cláudia V.; Machado, Nuno G; Oliveira, Paulo J


    Berberine [Natural Yellow 18, 5,6-dihydro-9,10-dimethoxybenzo(g)-1,3-benzodioxolo (5,6-a) quinolizinium] is an alkaloid present in plants of the Berberidaceae family and used in traditional Chinese and North American medicine. We have previously demonstrated that berberine causes mitochondrial depolarization and fragmentation, with simultaneous increase in oxidative stress. We also demonstrated that berberine causes an inhibition of mitochondrial respiration and a decrease on calcium loading ...

  19. Effect of antiretroviral therapy in thromboregulation through the hydrolysis of adenine nucleotides in platelets of HIV patients. (United States)

    Rezer, João Felipe P; Souza, Viviane C G; Thorstenberg, Maria Luiza P; Ruchel, Jader B; Bertoldo, Tatiana M D; Zanini, Daniela; Silveira, Karine L; Leal, Claudio A M; Passos, Daniela F; Gonçalves, Jamile F; Abdalla, Fátima H; Schetinger, Maria Rosa C; Leal, Daniela B R


    The human immunodeficiency virus (HIV) infection results in biochemical and vascular dysfunctions. The highly active antiretroviral therapy (HAART) markedly reduces mortality and opportunistic diseases associated with acquired immunodeficiency syndrome (AIDS). This increased survival time predisposes the development of cardiovascular diseases. Platelets present purinergic system ectoenzymes such as E-NTPDase, E-5'-nucleotidase and E-ADA on its surface. In view of this, the aim of this study was to evaluate the activity of these ectoenzymes in platelets as well as the platelet aggregation and lipid profile of patients with HIV infection and also patients receiving HAART. The results showed an increase in the E-NTPDase activity for ATP hydrolysis in the HIV group compared with the control group and the HIV/HAART group. When assessing the activity E-NTPDase hydrolysis to ADP, the results revealed an increase in activity in the HIV group when compared to the control group, and a decrease in activity when in the HIV/HAART group when compared to the control and HIV groups. The activity of E-5'-nucleotidase revealed an increase in AMP hydrolysis in the HIV group, as the results from control and HIV/HAART groups showed no statistical difference. Regarding the E-ADA activity, the HIV and HIV/HAART groups revealed a decreased deamination of adenosine when compared with the control group. Furthermore, we observed an increased platelet aggregation of HIV/HAART group compared with the control group. Thus, our results suggest that antiretroviral treatment against HIV has a significant effect on the activity of purinergic system ectoenzymes demonstrating that thromboregulation is involved in the process. PMID:27044844

  20. Charges of Nicotinamide Adenine nucleotides and Adenylate Energy Charge as regulatory parameters of the metabolism in Eschericia coli

    DEFF Research Database (Denmark)

    Andersen, Klaus Bahl; von Meyenburg, Kaspar


    NADH/(NADH+NAD), NADPH/(NADPH+NADP) and (ATP+½ADP)/(ATP+ADP+AMP) respectively has the values 0.05, 0.45 and 0.9 during steady state growth. The changes of the charges during changes of growth are examined.......NADH/(NADH+NAD), NADPH/(NADPH+NADP) and (ATP+½ADP)/(ATP+ADP+AMP) respectively has the values 0.05, 0.45 and 0.9 during steady state growth. The changes of the charges during changes of growth are examined....

  1. Generation of reducing power in chemosynthesis. 3. Energy-linked reduction of pyridine nucleotides in Thiobacillus novellus. (United States)

    Aleem, M I


    Aleem, M. I. H. (Research Institute for Advanced Studies, Baltimore, Md.). Generation of reducing power in chemosynthesis. III. Energy-linked reduction of pyridine nucleotides in Thiobacillus novellus. J. Bacteriol. 91:729-736. 1966.-Cell-free extracts from Thiobacillus novellus. catalyzed an adenosine triphosphate (ATP)-dependent reduction of pyridine nucleotides anaerobically, or aerobically when the respiratory chain was inhibited by azide. The exogenous electron donor employed for the reduction of nicotinamide adenine dinucleotide or nicotinamide adenine dinucleotide phosphate (NADP) was thiosulfate, formate, or mammalian ferrocytochrome c. In the latter case, the oxidation of ferrocytochrome c was observed with the concomitant reduction of the pyridine nucleotide. Values calculated for the molar ratios of ATP utilized-NADP reduced and of cytochrome c oxidized-NADP reduced were 1:1 and 2:1, respectively. The energy-dependent reduction of the pyridine nucleotides was inhibited by Atabrine or amytal and by low concentrations of the uncouplers of oxidative phosphorylation such as 2,4-dinitrophenol and carbonyl cyanide m-chlorophenyl hydrazone. Evidence is presented showing that the reduced pyridine nucleotides are essential for providing the reducing power for the energy-dependent reduction of carbon dioxide in T. novellus. PMID:4379907

  2. Renoprotective effect of the xanthine oxidoreductase inhibitor topiroxostat on adenine-induced renal injury. (United States)

    Kamijo-Ikemori, Atsuko; Sugaya, Takeshi; Hibi, Chihiro; Nakamura, Takashi; Murase, Takayo; Oikawa, Tsuyoshi; Hoshino, Seiko; Hisamichi, Mikako; Hirata, Kazuaki; Kimura, Kenjiro; Shibagaki, Yugo


    The aim of the present study was to reveal the effect of a xanthine oxidoreductase (XOR) inhibitor, topiroxostat (Top), compared with another inhibitor, febuxostat (Feb), in an adenine-induced renal injury model. We used human liver-type fatty acid-binding protein (L-FABP) chromosomal transgenic mice, and urinary L-FABP, a biomarker of tubulointerstitial damage, was used to evaluate tubulointerstitial damage. Male transgenic mice (n = 24) were fed a 0.2% (wt/wt) adenine-containing diet. Two weeks after the start of this diet, renal dysfunction was confirmed, and the mice were divided into the following four groups: the adenine group was given only the diet containing adenine, and the Feb, high-dose Top (Top-H), and low-dose Top (Top-L) groups were given diets containing Feb (3 mg/kg), Top-H (3 mg/kg), and Top-L (1 mg/kg) in addition to adenine for another 2 wk. After withdrawal of the adenine diet, each medication was continued for 2 wk. Serum creatinine levels, the degree of macrophage infiltration, tubulointerstitial damage, renal fibrosis, urinary 15-F2t-isoprostane levels, and renal XOR activity were significantly attenuated in the kidneys of the Feb, Top-L, and Top-H groups compared with the adenine group. Serum creatinine levels in the Top-L and Top-H groups as well as renal XOR in the Top-H group were significantly lower than those in the Feb group. Urinary excretion of L-FABP in both the Top-H and Top-L groups was significantly lower than in the adenine and Feb groups. In conclusion, Top attenuated renal damage in an adenine-induced renal injury model. PMID:27029427

  3. Piperidine nucleosides and nucleotides

    Czech Academy of Sciences Publication Activity Database

    Kovačková, Soňa; Pačes, Ondřej; Dračínský, Martin; Rosenberg, Ivan; Rejman, Dominik

    -, č. 52 (2008), s. 587-587. ISSN 0261-3166. [Joint Symposium of the International Roundtable on Nucleosides, Nucleotides and Nucleic Acids /18./ and the International Symposium on Nucleic Acid Chemistry /35./. Kyoto, 08.09.2008-12.09.2008] R&D Projects: GA MŠk(CZ) LC06077; GA MŠk 2B06065; GA MŠk LC512 Grant ostatní: GA MZd(CZ) NR9138 Institutional research plan: CEZ:AV0Z40550506 Keywords : piperidine * nucleosidation * phosphonate Subject RIV: CC - Organic Chemistry

  4. Single Nucleotide Polymorphism

    DEFF Research Database (Denmark)

    Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg;


    Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification and...... briefly describe the methods that are preferred for SNP typing in forensic genetics. In addition, we will illustrate how SNPs can be used as investigative leads in the police investigation by discussing the use of ancestry informative markers and forensic DNA phenotyping. Modern DNA sequencing...

  5. Cardiac Na+ Current Regulation by Pyridine Nucleotides (United States)

    Liu, Man; Sanyal, Shamarendra; Gao, Ge; Gurung, Iman S.; Zhu, Xiaodong; Gaconnet, Georgia; Kerchner, Laurie J.; Shang, Lijuan L.; Huang, Christopher L-H.; Grace, Andrew; London, Barry; Dudley, Samuel C.


    Rationale Mutations in glycerol-3-phosphate dehydrogenase 1-like (GPD1-L) protein reduce cardiac Na+ current (INa) and cause Brugada Syndrome (BrS). GPD1-L has >80% amino acid homology with glycerol-3-phosphate dehydrogenase, which is involved in nicotinamide adenine dinucleotide (NAD)-dependent energy metabolism. Objective Therefore, we tested whether NAD(H) could regulate human cardiac sodium channels (Nav1.5). Methods and Results HEK293 cells stably expressing Nav1.5 and rat neonatal cardiomyocytes were used. The influence of NADH/NAD+ on arrhythmic risk was evaluated in wild-type or SCN5A+/− mouse heart. A280V GPD1-L caused a 2.48 ± 0.17-fold increase in intracellular NADH level (P<0.001). NADH application or co-transfection with A280V GPD1-L resulted in decreased INa (0.48 ± 0.09 or 0.19 ±0.04 of control group, respectively; P<0.01), which was reversed by NAD+, chelerythrine, or superoxide dismutase (SOD). NAD+ antagonism of the Na+ channel downregulation by A280V GPD1-L or NADH was prevented by a protein kinase A (PKA) inhibitor, PKAI6–22. The effects of NADH and NAD+ were mimicked by a phorbol ester and forskolin, respectively. Increasing intracellular NADH was associated with an increased risk of ventricular tachycardia (VT) in wild-type mouse hearts. Extracellular application of NAD+ to SCN5A+/− mouse hearts ameliorated the risk of VT. Conclusions Our results show that Nav1.5 is regulated by pyridine nucleotides, suggesting a link between metabolism and INa. This effect required protein kinase C (PKC) activation and was mediated by oxidative stress. NAD+ could prevent this effect by activating PKA. Mutations of GPD1-L may downregulate Nav1.5 by altering the oxidized to reduced NAD(H) balance. PMID:19745168

  6. Heat-processed ginseng saponin ameliorates the adenine-induced renal failure in rats


    Kim, Eun Jin; Oh, Hyun-A; Choi, Hyuck Jai; Park, Jeong Hill; Kim, Dong-Hyun; Kim, Nam Jae


    To evaluate the effect of the saponin of heat-processed ginseng (Sun ginseng, SG), we investigated the protective effect of SG total saponin fraction against adenine-induced chronic renal failure in rats. SG saponin significantly decreased the levels of urea nitrogen and creatinine in the serum, but increased the urinary excretion of urea nitrogen and creatinine, indicating an improvement of renal function. SG saponin also inhibited adenine-induced kidney hypertrophy and edema. SG saponin red...

  7. Protonation mechanism and location of rate-determining steps for the Ascaris suum nicotinamide adenine dinucleotide-malic enzyme reaction from isotope effects and pH studies

    Energy Technology Data Exchange (ETDEWEB)

    Kiick, D.M.; Harris, B.G.; Cook, P.F.


    The pH dependence of the kinetic parameters and the primary deuterium isotope effects with nicotinamide adenine dinucleotide (NAD) and also thionicotinamide adenine dinucleotide (thio-NAD) as the nucleotide substrates were determined in order to obtain information about the chemical mechanism and location of rate-determining steps for the Ascaris suum NAD-malic enzyme reaction. The maximum velocity with thio-NAD as the nucleotide is pH-independent from pH 4.2 to 9.6, while with NAD, V decreases below a pK of 4.8. V/K for both nucleotides decreases below a pK of 5.6 and above a pK of 8.9. Both the tartronate pKi and V/Kmalate decrease below a pK of 4.8 and above a pK of 8.9. Oxalate is competitive vs. malate above pH 7 and noncompetitive below pH 7 with NAD as the nucleotide. The oxalate Kis increases from a constant value above a pK of 4.9 to another constant value above a pK of 6.7. The oxalate Kii also increases above a pK of 4.9, and this inhibition is enhanced by NADH. In the presence of thio-NAD the inhibition by oxalate is competitive vs. malate below pH 7. For thio-NAD, both DV and D(V/K) are pH-independent and equal to 1.7. With NAD as the nucleotide, DV decreases to 1.0 below a pK of 4.9, while D(V/KNAD) and D(V/Kmalate) are pH-independent. Above pH 7 the isotope effects on V and the V/K values for NAD and malate are equal to 1.45, the pH-independent value of DV above pH 7. Results indicate that substrates bind to only the correctly protonated form of the enzyme. Two enzyme groups are necessary for binding of substrates and catalysis. Both NAD and malate are released from the Michaelis complex at equal rates which are equal to the rate of NADH release from E-NADH above pH 7. Below pH 7 NADH release becomes more rate-determining as the pH decreases until at pH 4.0 it completely limits the overall rate of the reaction.

  8. Protonation mechanism and location of rate-determining steps for the Ascaris suum nicotinamide adenine dinucleotide-malic enzyme reaction from isotope effects and pH studies

    International Nuclear Information System (INIS)

    The pH dependence of the kinetic parameters and the primary deuterium isotope effects with nicotinamide adenine dinucleotide (NAD) and also thionicotinamide adenine dinucleotide (thio-NAD) as the nucleotide substrates were determined in order to obtain information about the chemical mechanism and location of rate-determining steps for the Ascaris suum NAD-malic enzyme reaction. The maximum velocity with thio-NAD as the nucleotide is pH-independent from pH 4.2 to 9.6, while with NAD, V decreases below a pK of 4.8. V/K for both nucleotides decreases below a pK of 5.6 and above a pK of 8.9. Both the tartronate pKi and V/Kmalate decrease below a pK of 4.8 and above a pK of 8.9. Oxalate is competitive vs. malate above pH 7 and noncompetitive below pH 7 with NAD as the nucleotide. The oxalate Kis increases from a constant value above a pK of 4.9 to another constant value above a pK of 6.7. The oxalate Kii also increases above a pK of 4.9, and this inhibition is enhanced by NADH. In the presence of thio-NAD the inhibition by oxalate is competitive vs. malate below pH 7. For thio-NAD, both DV and D(V/K) are pH-independent and equal to 1.7. With NAD as the nucleotide, DV decreases to 1.0 below a pK of 4.9, while D(V/KNAD) and D(V/Kmalate) are pH-independent. Above pH 7 the isotope effects on V and the V/K values for NAD and malate are equal to 1.45, the pH-independent value of DV above pH 7. Results indicate that substrates bind to only the correctly protonated form of the enzyme. Two enzyme groups are necessary for binding of substrates and catalysis. Both NAD and malate are released from the Michaelis complex at equal rates which are equal to the rate of NADH release from E-NADH above pH 7. Below pH 7 NADH release becomes more rate-determining as the pH decreases until at pH 4.0 it completely limits the overall rate of the reaction

  9. Improved Growth and Stress Tolerance in the Arabidopsis oxt1 Mutant Triggered by Altered Adenine Metabolism

    Institute of Scientific and Technical Information of China (English)

    Suchada Sukrong; Kil-Young Yun; Patrizia Stadler; Charan Kumar; Tony Facciuolo; Barbara A.Moffatt; Deane L.Falcone


    Plants perceive and respond to environmental stresses with complex mechanisms that are often associated with the activation of antioxidant defenses.A genetic screen aimed at isolating oxidative stress-tolerant lines of Arabidopsis thaliana has identified oxt1,a line that exhibits improved tolerance to oxidative stress and elevated temperature but displays no apparent deleterious growth effects under non-stress conditions.Oxt1 harbors a mutation that arises from the altered expression of a gene encoding adenine phosphoribosyltransferase (APT1),an enzyme that converts adenine to adenosine monophosphate (AMP),indicating a link between purine metabolism,whole-plant growth responses,and stress acclimation.The oxt1 mutation results in decreased APT1 expression that leads to reduced enzymatic activity.Correspondingly,oxt1 plants possess elevated levels of adenine.Decreased APT enzyme activity directly correlates with stress resistance in transgenic lines that ectopically express APT1.The metabolic alteration in oxt1 plants also alters the expression of several antioxidant defense genes and the response of these genes to oxidative challenge.Finally,it is shown that manipulation of adenine levels can induce stress tolerance to wild-type plants.Collectively,these results show that alterations in cellular adenine levels can trigger stress tolerance and improve growth,leading to increases in plant biomass.The results also suggest that adenine might play a part in the signals that modulate responses to abiotic stress and plant growth.

  10. Template polymerization of nucleotide analogues (United States)

    Orgel, L. E.


    Recent work on the template-directed reactions of the natural D-nucleotides has made it clear that l-nucleotides and nucleotide-like derivatives of other sugars would strongly inhibit the formation of long oligonucleotides. Consequently, attention is focusing on molecules simpler than nucleotides that might have acted as monomers of an information transfer system. We have begun a general exploration of the template directed reactions of diverse peptide analogues. I will present work by Dr. Taifeng Wu on oxidative oligomerization of phosphorothioates and of Dr. Mary Tohidi on the cyclic polymerization of nucleoside and related cyclic pyrophosphates.

  11. Sequence-dependent folding landscapes of adenine riboswitch aptamers (United States)

    Lin, Jong-Chin; Hyeon, Changbong; Thirumalai, D.

    Prediction of the functions of riboswitches requires a quantitative description of the folding landscape so that the barriers and time scales for the conformational change in the switching region in the aptamer can be estimated. Using a combination of all atom molecular dynamics and coarse-grained model simulations we studied the response of adenine (A) binding add and pbuE A-riboswitches to mechanical force. The two riboswitches contain a structurally similar three-way junction formed by three paired helices, P1, P2, and P3, but carry out different functions. Using pulling simulations, with structures generated in MD simulations, we show that after P1 rips the dominant unfolding pathway in add A-riboswitch is the rupture of P2 followed by unraveling of P3. In the pbuE A-riboswitch, after P1 unfolds P3 ruptures ahead of P2. The order of unfolding of the helices, which is in accord with single molecule pulling experiments, is determined by the relative stabilities of the individual helices. Our results show that the stability of isolated helices determines the order of assembly and response to force in these non-coding regions. We use the simulated free energy profile for pbuE A-riboswitch to estimate the time scale for allosteric switching, which shows that this riboswitch is under kinetic control lending additional support to the conclusion based on single molecule pulling experiments. A consequence of the stability hypothesis is that a single point mutation (U28C) in the P2 helix of the add A-riboswitch, which increases the stability of P2, would make the folding landscapes of the two riboswitches similar. This prediction can be tested in single molecule pulling experiments.


    Institute of Scientific and Technical Information of China (English)

    DING Dalian; JIANG Haiyan; FU Yong; LI Yongqi; Richard Salvi; Shinichi Someya; Masaru Tanokura


    Oxaliplatin, an anticancer drug commonly used to treat colorectal cancer and other tumors, has a number of serious side effects, most notably neuropathy and ototoxicity. To gain insights into its ototoxic profile, oxaliplatin was applied to rat cochlear organ cultures. Consistent with it neurotoxic propensity, oxaliplatin selectively damaged nerve fibers at a very low dose 1 µM. In contrast, the dose required to damage hair cells and spiral ganglion neurons was 50 fold higher (50 µM). Oxailiplatin-induced cochlear lesions initial-ly increased with dose, but unexpectedly decreased at very high doses. This non-linear dose response could be related to depressed oxaliplatin uptake via active transport mechanisms. Previous studies have demon-strated that axonal degeneration involves biologically active processes which can be greatly attenuated by nicotinamide adenine dinucleotide (NAD+). To determine if NAD+would protect spiral ganglion axons and the hair cells from oxaliplatin damage, cochlear cultures were treated with oxaliplatin alone at doses of 10 µM or 50 µM respectively as controls or combined with 20 mM NAD+. Treatment with 10 µM oxaliplatin for 48 hours resulted in minor damage to auditory nerve fibers, but spared cochlear hair cells. However, when cochlear cultures were treated with 10 µM oxaliplatin plus 20 mM NAD+, most auditory nerve fibers were intact. 50 µM oxaliplatin destroyed most of spiral ganglion neurons and cochlear hair cells with apop-totic characteristics of cell fragmentations. However, 50 µM oxaliplatin plus 20 mM NAD+treatment great-ly reduced neuronal degenerations and hair cell missing. The results suggested that NAD+provides signifi-cant protection against oxaliplatin-induced neurotoxicity and ototoxicity, which may be due to its actions of antioxidant, antiapoptosis, and energy supply.

  13. The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara


    Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

  14. Molecularly imprinted polymer (MIP) based piezoelectric microgravimetry chemosensor for selective determination of adenine. (United States)

    Pietrzyk, Agnieszka; Suriyanarayanan, Subramanian; Kutner, Wlodzimierz; Chitta, Raghu; Zandler, Melvin E; D'Souza, Francis


    An adenine-templated molecularly imprinted polymer (MIP) film, deposited on a poly(bithiophene) barrier film, served as the recognition element of a piezomicrogravimetric (acoustic) chemosensor. A 10MHz AT-cut shear-thickness-mode bulk-acoustic-wave quartz crystal resonator with Pt film electrodes was used as the signal transducer. Adenine electrooxidation was prevented by the barrier film. The MIP film was deposited by electrochemical co-polymerization of two functional monomers of bis(bithiophene) derivatives, bearing either the 18-crown-6 or dioxaborinane substituent, in the presence of the adenine template. A strong base solution was then used to extract the template. Completeness of the template removal was substantiated by the UV-vis, XPS, DPV, and EIS measurements. The chemosensor performance was evaluated with the piezoelectric microgravimetry detection at QCM under FIA conditions using a carrier acetonitrile-water (1:1, v:v) mixed solvent solution. The linear dynamic concentration range extended from at least 0.1 to 1mM for the 35 microL/min flow rate, and 100 microL volume of the injected adenine solution. The chemosensor selectivity allowed for discrimination of the adenine analyte from structurally and functionally related interferants, such as 2-aminopurine, guanine, and ascorbic acid. The determined from the FIA kinetic studies stability constant of the MIP-adenine complex, (18+/-2.4)x10(4)M(-1), was much higher than that of the MIP-(2-aminopurine), (650+/-90)M(-1), MIP-guanine, (122+/-11)M(-1), and MIP-(ascorbic acid), (92+/-10)M(-1), complexes. The concentration limit of detection was as low as 5 nM adenine for the 35 microL/min flow rate, and 1 mL volume of the injected sample solution. PMID:20483586

  15. Nucleotide discrimination with DNA immobilized in the MspA nanopore. (United States)

    Manrao, Elizabeth A; Derrington, Ian M; Pavlenok, Mikhail; Niederweis, Michael; Gundlach, Jens H


    Nanopore sequencing has the potential to become a fast and low-cost DNA sequencing platform. An ionic current passing through a small pore would directly map the sequence of single stranded DNA (ssDNA) driven through the constriction. The pore protein, MspA, derived from Mycobacterium smegmatis, has a short and narrow channel constriction ideally suited for nanopore sequencing. To study MspA's ability to resolve nucleotides, we held ssDNA within the pore using a biotin-NeutrAvidin complex. We show that homopolymers of adenine, cytosine, thymine, and guanine in MspA exhibit much larger current differences than in α-hemolysin. Additionally, methylated cytosine is distinguishable from unmethylated cytosine. We establish that single nucleotide substitutions within homopolymer ssDNA can be detected when held in MspA's constriction. Using genomic single nucleotide polymorphisms, we demonstrate that single nucleotides within random DNA can be identified. Our results indicate that MspA has high signal-to-noise ratio and the single nucleotide sensitivity desired for nanopore sequencing devices. PMID:21991340

  16. A computational study of adenine, uracil, and cytosine adsorption upon AlN and BN nano-cages

    International Nuclear Information System (INIS)

    Density-functional theory calculations are used to investigate the interaction of Al12N12 and B12N12 clusters with the adenine (A), uracil (U), and cytosine (C) molecules. The current calculations demonstrate that these hybrid adsorbent materials are able to adsorb the adenine, uracil, and cytosine molecules through exothermic processes. Our theoretical results reveal improvement in the adsorption of adenine, uracil, and cytosine on Al12N12 and B12N12. It is observed that B12N12 is highly sensitive to adenine, uracil, and cytosine compared with Al12N12 to serve as a biochemical sensor.

  17. Determination of adenine based on the fluorescence recovery of the L-Tryptophan-Cu2+ complex (United States)

    Duan, Ruilin; Li, Chunyan; Liu, Shaopu; Liu, Zhongfang; Li, Yuanfang; Yuan, Yusheng; Hu, Xiaoli


    A simple and sensitive method for determination of adenine was developed based on fluorescence quenching and recovery of L-Tryptophan (L-Trp). The fluorescence of L-Trp could efficiently quenched by copper ion compared with other common metal ions. Upon addition of adenine (Ade) in L-Trp-Cu(II) system, the fluorescence was reoccurred. Under the optimum conditions, the recovery fluorescence intensity was linearly correlated with the concentration of adenine in the range from 0.34 to 25.0 μmol L-1, with a correlation coefficient (R2) of 0.9994. The detection limit (3σ/k) was 0.046 μmol L-1, indicating that this method could applied to detect trace adenine. In this study, amino acids including L-Trp, D-Trp, L-Tyr, D-Tyr, L-Phe, D-Phe were investigated and only L-Trp could well chelated copper ion. Additionally, the mechanism of quench and recovery also were discussed and the method was successfully applied to detect the adenine in DNA with satisfactory results.

  18. Carnitine palmitoyltransferase 2 and carnitine/acylcarnitine translocase are involved in the mitochondrial synthesis and export of acylcarnitines. (United States)

    Violante, Sara; Ijlst, Lodewijk; Te Brinke, Heleen; Tavares de Almeida, Isabel; Wanders, Ronald J A; Ventura, Fátima V; Houten, Sander M


    Acylcarnitines are commonly used in the diagnosis of mitochondrial fatty acid β-oxidation disorders (mFAODs). It is generally assumed that this plasma acylcarnitine profile reflects the mitochondrial accumulation of acyl-CoAs. The identity of the enzymes and the mitochondrial and plasmalemmal transporters involved in the synthesis and export of these metabolites have remained undefined. We used lentiviral shRNA to knock down the expression of medium-chain acyl-CoA dehydrogenase (MCAD) in control and carnitine palmitoyltransferase 2 (CPT2)-, carnitine/acylcarnitine translocase (CACT)-, and plasmalemmal carnitine transporter (OCTN2)-deficient human fibroblasts. These cell lines, including mock-transduced controls, were loaded with decanoic acid and carnitine, followed by the measurement of the acylcarnitine profile in the extracellular medium. In control fibroblasts, MCAD knockdown markedly increased the production of octanoylcarnitine (3-fold, P<0.01). OCTN2-deficient cell lines also showed extracellular accumulation of octanoylcarnitine (2.8-fold, P<0.01), suggesting that the cellular export of acylcarnitines does not depend on OCTN2. In contrast, in CPT2- and CACT-deficient cells, the accumulation of octanoylcarnitine in the medium did not significantly increase in the MCAD knockdown. Similar results were obtained using pharmacological inhibition of CPT2 in fibroblasts from MCAD-deficient individuals. This shows that CPT2 and CACT are crucial for mitochondrial acylcarnitine formation and export to the extracellular fluids in mFAOD. PMID:23322164

  19. Intramolecular interactions in aminoacyl nucleotides: Implications regarding the origin of genetic coding and protein synthesis (United States)

    Lacey, J. C., Jr.; Mullins, D. W., Jr.; Watkins, C. L.; Hall, L. M.


    Cellular organisms store information as sequences of nucleotides in double stranded DNA. This information is useless unless it can be converted into the active molecular species, protein. This is done in contemporary creatures first by transcription of one strand to give a complementary strand of mRNA. The sequence of nucleotides is then translated into a specific sequence of amino acids in a protein. Translation is made possible by a genetic coding system in which a sequence of three nucleotides codes for a specific amino acid. The origin and evolution of any chemical system can be understood through elucidation of the properties of the chemical entities which make up the system. There is an underlying logic to the coding system revealed by a correlation of the hydrophobicities of amino acids and their anticodonic nucleotides (i.e., the complement of the codon). Its importance lies in the fact that every amino acid going into protein synthesis must first be activated. This is universally accomplished with ATP. Past studies have concentrated on the chemistry of the adenylates, but more recently we have found, through the use of NMR, that we can observe intramolecular interactions even at low concentrations, between amino acid side chains and nucleotide base rings in these adenylates. The use of this type of compound thus affords a novel way of elucidating the manner in which amino acids and nucleotides interact with each other. In aqueous solution, when a hydrophobic amino acid is attached to the most hydrophobic nucleotide, AMP, a hydrophobic interaction takes place between the amino acid side chain and the adenine ring. The studies to be reported concern these hydrophobic interactions.

  20. Absorption by DNA single strands of adenine isolated in vacuo: The role of multiple chromophores

    DEFF Research Database (Denmark)

    Nielsen, L.M.; Pedersen, S.O.; Kirketerp, M.-B.S.;


    The degree of electronic coupling between DNA bases is a topic being up for much debate. Here we report on the intrinsic electronic properties of isolated DNA strands in vacuo free of solvent, which is a good starting point for high-level excited states calculations. Action spectra of DNA single...... strands of adenine reveal sign of exciton coupling between stacked bases from blueshifted absorption bands (~3 nm) relative to that of the dAMP mononucleotide (one adenine base). The bands are blueshifted by about 10 nm compared to those of solvated strands, which is a shift similar to that for the...

  1. Bioenergetics and gene silencing approaches for unraveling nucleotide recognition by the human EIF2C2/Ago2 PAZ domain.

    Directory of Open Access Journals (Sweden)

    Mahmoud Kandeel

    Full Text Available Gene silencing and RNA interference are major cellular processes that control gene expression via the cleavage of target mRNA. Eukaryotic translation initiation factor 2C2 (EIF2C2, Argonaute protein 2, Ago2 is considered to be the major player of RNAi as it is the core component of RISC complexes. While a considerable amount of research has focused on RNA interference and its associated mechanisms, the nature and mechanisms of nucleotide recognition by the PAZ domain of EIF2C2/Ago2 have not yet been characterized. Here, we demonstrate that the EIF2C2/Ago2 PAZ domain has an inherent lack of binding to adenine nucleotides, a feature that highlights the poor binding of 3'-adenylated RNAs with the PAZ domain as well as the selective high trimming of the 3'-ends of miRNA containing adenine nucleotides. We further show that the PAZ domain selectively binds all ribonucleotides (except adenosine, whereas it poorly recognizes deoxyribonucleotides. In this context, the modification of dTMP to its ribonucleotide analogue gave a drastic improvement of binding enthalpy and, hence, binding affinity. Additionally, higher in vivo gene silencing efficacy was correlated with the stronger PAZ domain binders. These findings provide new insights into the nature of the interactions of the EIF2C2/Ago2 PAZ domain.

  2. Dietary nucleotides prevent decrease in cellular immunity in ground-based microgravity analog (United States)

    Yamauchi, Keiko; Hales, Nathan W.; Robinson, Sandra M.; Niehoff, Michael L.; Ramesh, Vani; Pellis, Neal R.; Kulkarni, Anil D.


    Microgravity and stress of spaceflights result in immune dysfunction. The role of nutrition, especially nucleotide supplementation, has become an area of intensive research and significant interest in immunomodulation for maintenance of cellular immune responses. The studies presented here evaluate the plausibility of administering nucleotides to obviate immune dysfunction in an Earth-based in vivo analog of microgravity as studied in anti-orthostatic tail suspension (AOS) of mice. Mice were divided into three housing groups: group, isolation, and AOS. Mice were fed either control chow diet (CD), or RNA-, adenine-, or uracil-supplemented CD for the 1-wk duration of the experiments. In AOS mice, supplemental nucleotides significantly increased in vivo lymph node proliferation and ex vivo lymphoproliferation response to alloantigen and mitogens, respectively, and interleukin-2 and interferon-gamma production. A lower corticosterone level was observed in uracil-supplemented CD compared with CD. These results suggest that exogenous nucleotide supplementation, especially uracil, of normal diet is beneficial in the maintenance and restoration of the immune response during the microgravity analog conditions.

  3. Nucleotide sequence analysis of the hypervariable region III of mitochondrial DNA in Thais. (United States)

    Thongngam, Punlop; Leewattanapasuk, Worraanong; Bhoopat, Tanin; Sangthong, Padchanee


    This study analyzed the nucleotide sequences of the hypervariable region III (HVRIII) of mitochondrial DNA in Thai individuals. Buccal swab samples were randomly obtained from 100 healthy, unrelated, adult (18-60 years old), volunteer donors living in Thailand. Eighteen different haplotypes were found, of which 11 haplotypes were unique. The most frequent haplotypes observed were 522D-523D. Nucleotide transition from Thymine (T) to Cytosine (C) at position 489 (43%) was the most frequent substitution. Nucleotide transversions were also observed at position 433 (Adenine (A) to C, 1%) and position 499 (Guanine (G) to C, 1%). Fifty-three samples presented nucleotide insertion and deletion of C and A (CA) at position 514-523. Insertion of 1AC (3%) and 2AC (2%) were observed. Deletion of 1CA (53%) and 2CA (2%) at position 514-523 were revealed. The deletion of T at position 459 was observed. The haplotype diversity, random match probability, and discrimination power were calculated to be 0.7770, 0.2308, and 0.7692, respectively. PMID:27107562

  4. Wolbachia prophage DNA adenine methyltransferase genes in different Drosophila-Wolbachia associations

    DEFF Research Database (Denmark)

    Saridaki, Aggeliki; Sapountzis, Panagiotis; Harris, Harriet L;


    . The importance of DNA methylation in cell fate and biology calls for in depth studying of putative methylation-related genes. We present a molecular and phylogenetic analysis of a putative DNA adenine methyltransferase encoded by a prophage in the Wolbachia genome. Two slightly different copies of the gene, met1...

  5. Loss of Hoogsteen Pairing Ability upon N1 Adenine Platinum Binding

    Czech Academy of Sciences Publication Activity Database

    Schmidt, K. S.; Reedijk, J.; Weisz, K.; Janke, E. M. B.; Šponer, Judit E.; Šponer, Jiří; Lippert, B.


    Roč. 41, č. 11 (2002), s. 2855-2863. ISSN 0020-1669 R&D Projects: GA MŠk LN00A016; GA AV ČR IAA4040903 Institutional research plan: CEZ:AV0Z4040901 Keywords : adenine * thymine * Hoogsteen pairing ability Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.950, year: 2002

  6. Assembly of an antiparallel homo-adenine DNA duplex by small-molecule binding. (United States)

    Persil, Ozgül; Santai, Catherine T; Jain, Swapan S; Hud, Nicholas V


    Molecules that reversibly bind DNA and trigger the formation of non-Watson-Crick secondary structures would be useful in the design of dynamic DNA nanostructures and as potential leads for new therapeutic agents. We demonstrate that coralyne, a small crescent-shaped molecule, promotes the formation of a duplex secondary structure from homo-adenine oligonucleotides. AFM studies reveal that the staggered alignment of homo-adenine oligonucleotides upon coralyne binding produces polymers of micrometers in length, but only 2 nm in height. A DNA duplex was also studied that contained eight A.A mismatches between two flanking 7-bp Watson-Crick helices. CD spectra confirm that the multiple A.A mismatches of this duplex bind coralyne in manner similar to that of homo-adenine oligonucleotides. Furthermore, the melting temperature of this hybrid duplex increases by 13 degrees C upon coralyne binding. These observations illustrate that the helical structure of the homo-adenine-coralyne duplex is compatible with the B-form DNA helix. PMID:15250704

  7. Utilization of FIA-UV/ED for detection of adenine derivates


    Ondrej Zitka; Libuse Trnkova; Frantisek Jelen; Vojtech Adam; Rene Kizek


    A purine derivative adenine poses many biological functions.Besides the fact that this molecule is one of the building blocks forRNA and DNA, there are many derivates with their specificsattributes. 2-aminopurine is well known as mutagen. 2,6-diaminopurine is able to replace purine basis in nucleic acids.Benzylaminopurine belongs to phytohormones.

  8. The effect of caffeine and adenine on radiation induced suppression of DNA synthesis, and cell survival

    International Nuclear Information System (INIS)

    Exposure of cultured mammalian cells to ionizing radiation or UV light results in a transient decrease in the rate of DNA synthesis. This depression in synthetic rate may be attenuated or deferred via a post-irradiation treatment with caffeine or adenine. It has been suggested that this attenuation may increase the fixation of damage and, therefore, increase radiation sensitivity. However, it has been previously reported that, for V79 cells treated with caffeine or adenine, no correlation exists between the extent of depression and cell survival. The present investigation expands upon these findings by examining the effect of caffeine or adenine post-irradiation treatment on two cell lines with normal UV sensitivity, mouse 3T3 and CHO AA8 cells, and one UV sensitive cell line, CHO UV5 cells. Both caffeine and adenine have been found to reduce, or delay, the suppression in DNA synthesis in all three cell lines. Surprisingly, caffeine appeared to induced even the UV5 cells to recover DNA synthetic ability. The amount of reduction in suppression of DNA synthesis, however, varies between the different cell lines and no consistent relationship with cell survival has emerged

  9. Effect of AST-120 on Endothelial Dysfunction in Adenine-Induced Uremic Rats

    Directory of Open Access Journals (Sweden)

    Yuko Inami


    Full Text Available Aim. Chronic kidney disease (CKD represents endothelial dysfunction. Monocyte adhesion is recognized as the initial step of arteriosclerosis. Indoxyl sulfate (IS is considered to be a risk factor for arteriosclerosis in CKD. Oral adsorbent AST-120 retards deterioration of renal function, reducing accumulation of IS. In the present study, we determined the monocyte adhesion in the adenine-induced uremic rats in vivo and effects of AST-120 on the adhesion molecules. Methods. Twenty-four rats were divided into control, control+AST-120, adenine, and adenine+AST-120 groups. The number of monocytes adherent to the endothelium of thoracic aorta by imaging the entire endothelial surface and the mRNA expressions of adhesion and atherosclerosis-related molecules were examined on day 49. The mRNA expressions of ICAM-1 and VCAM-1 in human umbilical vein endothelial cells were also examined. Results. Adenine increased the number of adherent monocytes, and AST-120 suppressed the increase. The monocyte adhesion was related to serum creatinine and IS in sera. Overexpression of VCAM-1 and TGF-β1 mRNA in the arterial walls was observed in uremic rats. IS induced increase of the ICAM-1 and VCAM-1 mRNA expressions in vitro. Conclusion. It appears that uremic condition introduces the monocyte adhesion to arterial wall and AST-120 might inhibit increasing of the monocyte adherence with CKD progression.

  10. Rhomboid protease AarA mediates quorum-sensing in Providencia stuartii by activating TatA of the twin-arginine translocase


    Stevenson, Lindsay G.; Strisovsky, Kvido; Clemmer, Katy M.; Bhatt, Shantanu; Freeman, Matthew; Rather, Philip N.


    The Providencia stuartii AarA protein is a member of the rhomboid family of intramembrane serine proteases and is required for the production of an unknown quorum-sensing molecule. In a screen to identify rhomboid-encoding genes from Proteus mirabilis, tatA was identified as a multicopy suppressor and restored extracellular signal production as well as complementing all other phenotypes of a Prov. stuartii aarA mutant. TatA is a component of the twin-arginine translocase (Tat) protein secreti...


    International Nuclear Information System (INIS)

    The molecular inventory available on the prebiotic Earth was likely derived from both terrestrial and extraterrestrial sources. A complete description of which extraterrestrial molecules may have seeded early Earth is therefore necessary to fully understand the prebiotic evolution which led to life. Galactic cosmic rays (GCRs) are expected to cause both the formation and destruction of important biomolecules-including nucleic acid bases such as adenine-in the interstellar medium within the ices condensed on interstellar grains. The interstellar ultraviolet (UV) component is expected to photochemically degrade gas-phase adenine on a short timescale of only several years. However, the destruction rate is expected to be significantly reduced when adenine is shielded in dense molecular clouds or even within the ices of interstellar grains. Here, biomolecule destruction by the energetic charged particle component of the GCR becomes important as it is not fully attenuated. Presented here are results on the destruction rate of the nucleobase adenine in the solid state at 10 K by energetic electrons, as generated in the track of cosmic ray particles as they penetrate ices. When both UV and energetic charged particle destructive processes are taken into account, the half-life of adenine within dense interstellar clouds is found to be ∼6 Myr, which is on the order of a star-forming molecular cloud. We also discuss chemical reaction pathways within the ices to explain the production of observed species, including the formation of nitriles (R-C≡N), epoxides (C-O-C), and carbonyl functions (R-C=O).

  12. [Interaction of divalent cadmium ions with nucleotides and native DNA]. (United States)

    Sorokin, V A; Valeev, V A; Gladchenko, G O; Sysa, I V


    Complex formation of Cd2+ ions with 2'-deoxy-5'-phosphates of canonical bases and their riboanalogues in water solution is studied by the method of differential UV-spectroscopy. It is stated that the atoms coordinating Cd2+ in complexes are N7 of dGMP and GMP, dAMP and AMP, N1 of adenine derivatives, N3 of dCMP. No interaction with base heteroatoms of UMP and dTMP is found. O2' present in the structure of the sugar ring has a weak influence on the Cd2+ ion binding to purine nucleotides. It manifests itself strongly in the complexes with cytosine derivatives: cadmium does not interact with N3 of CMP and poly-C practically. In the last case O2 is a centre coordinating Cd2+ ions. The interaction with this atom induces the melting of polynucleotide helical parts. At the high cadmium concentration poly-C forms compact particles. The main centre binding Cd2+ ions in DNA is N7 of guanines. Noncooperative interaction with these centres results in the internal protonation of N3C of GC-pairs. This is not followed with the disordering of the DNA helical structure. PMID:9181783

  13. It takes two to tango: two TatA paralogues and two redox enzyme-specific chaperones are involved in the localization of twin-arginine translocase substrates in Campylobacter jejuni.


    Liu, Y.W.; Hitchcock, A.; Salmon, R.C.; Kelly, D J


    The food-borne zoonotic pathogen Campylobacter jejuni has complex electron transport chains required for growth in the host, many of which contain cofactored periplasmic enzymes localized by the twin-arginine translocase (TAT). We report here the identification of two paralogues of the TatA translocase component in C. jejuni strain NCTC 11168, encoded by cj1176c (tatA1) and cj0786 (tatA2). Deletion mutants constructed in either or both of the tatA1 and tatA2 genes displayed distinct growth an...

  14. Single nucleotide polymorphism of prolactin gene exon two in ducks of Pekin, Mojosari and Pekin Mojosari crossbred

    Directory of Open Access Journals (Sweden)



    Full Text Available Prolactin gene plays crucial role in the reproduction and egg production of birds. The objectives of this study were to characterize single nucleotide polymorphism in partial intron and coding region of duck prolactin gene. Blood samples were collected from 168 ducks consisted of 19 Pekin, 36 Mojosari, and 113 of their crossbreds collected from Indonesian Research Institute for Animal Production (IRIAP. Primer pairs for the coding regions in prolactin gene were self designed based on the duck genomic sequence database (GeneBank: AB158611.1. PCR products based on DNA of prolactin gene exon two was amplified approximately 400 bp. There is one base insertion of Adenin at the position of 2001 bp intron two region of duck prolactin. Homology test based on BLAST method indicated 99% identity with duck refference (Code Access GeneBank: AB158611.1. Adenin composition in all of duck samples was higher than refference. Triplet hydrogen bonds between Guanine and Cytosin pairs was higher than those at duplet hydrogen bonds between Adenine and Thymine. All duck samples were homozigous and monomorphyc.

  15. The Mitochondrial Phosphate Carrier Interacts with Cyclophilin D and May Play a Key Role in the Permeability Transition*S⃞


    Leung, Anna W. C.; Varanyuwatana, Pinadda; Halestrap, Andrew P.


    The mitochondrial permeability transition pore (MPTP) plays a key role in cell death, yet its molecular identity remains uncertain. Although knock-out studies have confirmed critical roles for both cyclophilin-D (CyP-D) and the adenine nucleotide translocase (ANT), given a strong enough stimulus MPTP opening can occur in the absence of either. Here we provide evidence that the mitochondrial phosphate carrier (PiC) may also be a critical component of the MPTP. Phenylars...

  16. Mitochondrial phospholipase A2 activated by reactive oxygen species in heart mitochondria induces mild uncoupling

    Czech Academy of Sciences Publication Activity Database

    Ježek, Jan; Jabůrek, Martin; Zelenka, Jaroslav; Ježek, Petr


    Roč. 59, č. 5 (2010), s. 737-747. ISSN 0862-8408 R&D Projects: GA ČR(CZ) GA303/07/0105; GA MŠk ME09018; GA AV ČR(CZ) KJB500110902 Institutional research plan: CEZ:AV0Z50110509 Keywords : Heart mitochondrial phospholipase A2 * Fatty Acids * Adenine nucleotide translocase Subject RIV: ED - Physiology Impact factor: 1.646, year: 2010

  17. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit


    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  18. DNA homoduplexes containing no pyrimidine nucleotide

    Czech Academy of Sciences Publication Activity Database

    Kypr, Jaroslav; Kejnovská, Iva; Vorlíčková, Michaela


    Roč. 32, č. 2 (2003), s. 154-158. ISSN 0175-7571 R&D Projects: GA ČR GA301/01/0590; GA AV ČR IAA4004201 Institutional research plan: CEZ:AV0Z5004920 Keywords : adenine * base pairing * circular dichroism spectroscopy Subject RIV: BO - Biophysics Impact factor: 1.769, year: 2003

  19. Influence of gamma irradiation and benzyl adenine on keeping quality of custard apple fruits during storage

    International Nuclear Information System (INIS)

    The custard apple (Annona squamosa) fruits were procured from local market, irradiated with radiation doses 0, 0.25, 0.50, 0.75, 1.00, 1.25, 1.50, 1.75 kGy and then treated with benzyl adenine (50 and 100 part per million) and stored at ambient temperature (25±5 °C, Relative Humidity 90±2%) for 12 days. The treated fruits were evaluated for sensory (viz; flavour, texture, internal and external colour) and chemical constituents (viz; Total Soluble Solids, titrable acidity, ascorbic acid, free soluble sugar, reducing sugar, non reducing sugar, carbohydrate) during storage. The study concluded that radiation dose of 1.5 kilo Gray along with 50 ppm benzyl adenine enhanced in shelf-life of custard apple fruits by 6 days at ambient temperature with good pulp texture, flavour, colour and nutritional quality as compared to control. (author)

  20. Expression of microRNAs in Horse Plasma and Their Characteristic Nucleotide Composition. (United States)

    Lee, Seungwoo; Hwang, Seungwoo; Yu, Hee Jeong; Oh, Dayoung; Choi, Yu Jung; Kim, Myung-Chul; Kim, Yongbaek; Ryu, Doug-Young


    MicroRNAs (miRNAs) in blood plasma are stable under high levels of ribonuclease activity and could function in tissue-to-tissue communication, suggesting that they may have distinctive structural characteristics compared with non-circulating miRNAs. In this study, the expression of miRNAs in horse plasma and their characteristic nucleotide composition were examined and compared with non-plasma miRNAs. Highly expressed plasma miRNA species were not part of the abundant group of miRNAs in non-plasma tissues, except for the eca-let-7 family. eca-miR-486-5p, -92a, and -21 were among the most abundant plasma miRNAs, and their human orthologs also belong to the most abundant group of miRNAs in human plasma. Uracil and guanine were the most common nucleotides of both plasma and non-plasma miRNAs. Cytosine was the least common in plasma and non-plasma miRNAs, although levels were higher in plasma miRNAs. Plasma miRNAs also showed higher expression levels of miRNAs containing adenine and cytosine repeats, compared with non-plasma miRNAs. These observations indicate that miRNAs in the plasma have a unique nucleotide composition. PMID:26731407

  1. Expression of microRNAs in Horse Plasma and Their Characteristic Nucleotide Composition.

    Directory of Open Access Journals (Sweden)

    Seungwoo Lee

    Full Text Available MicroRNAs (miRNAs in blood plasma are stable under high levels of ribonuclease activity and could function in tissue-to-tissue communication, suggesting that they may have distinctive structural characteristics compared with non-circulating miRNAs. In this study, the expression of miRNAs in horse plasma and their characteristic nucleotide composition were examined and compared with non-plasma miRNAs. Highly expressed plasma miRNA species were not part of the abundant group of miRNAs in non-plasma tissues, except for the eca-let-7 family. eca-miR-486-5p, -92a, and -21 were among the most abundant plasma miRNAs, and their human orthologs also belong to the most abundant group of miRNAs in human plasma. Uracil and guanine were the most common nucleotides of both plasma and non-plasma miRNAs. Cytosine was the least common in plasma and non-plasma miRNAs, although levels were higher in plasma miRNAs. Plasma miRNAs also showed higher expression levels of miRNAs containing adenine and cytosine repeats, compared with non-plasma miRNAs. These observations indicate that miRNAs in the plasma have a unique nucleotide composition.

  2. Expression of microRNAs in Horse Plasma and Their Characteristic Nucleotide Composition (United States)

    Lee, Seungwoo; Hwang, Seungwoo; Yu, Hee Jeong; Oh, Dayoung; Choi, Yu Jung; Kim, Myung-Chul; Kim, Yongbaek; Ryu, Doug-Young


    MicroRNAs (miRNAs) in blood plasma are stable under high levels of ribonuclease activity and could function in tissue-to-tissue communication, suggesting that they may have distinctive structural characteristics compared with non-circulating miRNAs. In this study, the expression of miRNAs in horse plasma and their characteristic nucleotide composition were examined and compared with non-plasma miRNAs. Highly expressed plasma miRNA species were not part of the abundant group of miRNAs in non-plasma tissues, except for the eca-let-7 family. eca-miR-486-5p, -92a, and -21 were among the most abundant plasma miRNAs, and their human orthologs also belong to the most abundant group of miRNAs in human plasma. Uracil and guanine were the most common nucleotides of both plasma and non-plasma miRNAs. Cytosine was the least common in plasma and non-plasma miRNAs, although levels were higher in plasma miRNAs. Plasma miRNAs also showed higher expression levels of miRNAs containing adenine and cytosine repeats, compared with non-plasma miRNAs. These observations indicate that miRNAs in the plasma have a unique nucleotide composition. PMID:26731407

  3. Synthesis of metal-adeninate frameworks with high separation capacity on C2/C1 hydrocarbons (United States)

    He, Yan-Ping; Zhou, Nan; Tan, Yan-Xi; Wang, Fei; Zhang, Jian


    By introducing isophthalic acid or 2,5-thiophenedicarboxylic acid to assemble with adenine and cadmium salt, two isostructural and anionic porous metal-organic frameworks (1 and 2) possessing the novel (4,8)-connected sqc topology are presented here. 1 shows permanent porosity with Langmuir surface area of 770.1 m2/g and exhibits high separation capacity on C2/C1 hydrocarbons.

  4. Insulin resistance and dysregulation of tryptophan – kynurenine and kynurenine – nicotinamide adenine dinucleotide metabolic pathways


    Oxenkrug, Gregory


    Insulin resistance (IR) underlines aging and aging-associated medical (diabetes, obesity, dyslipidemia, hypertension) and psychiatric (depression, cognitive decline) disorders (AAMPD). Molecular mechanisms of IR in genetically or metabolically predisposed individuals remain uncertain. Current review of literature and our data presents the evidences that dysregulation of tryptophan (TRP) – kynurenine (KYN) and KYN – nicotinamide adenine dinucleotide (NAD) metabolic pathways is one of the mecha...

  5. Effect of Atracylodes Rhizome Polysaccharide in Rats with Adenine-Induced Chronic Renal Failure


    Yang, C.; C. Liu; Zhou, Q.; Xie, Y. C.; Qiu, X. M.; X. Feng


    The aim of the study was to elucidate the therapeutic effects of Atracylodes rhizome polysaccharide on adenine-induced chronic renal failure in rats. Fifty male Sprague Dawley rats were selected and randomly divided in to 5 groups (n=10 rats per group): The normal control group, the chronic renal failure pathological control group, the dexamethasone treatment group and two Atracylodes rhizome polysaccharide treatment groups, treated with two different concentrations of the polysaccharide, the...

  6. Deviant Nicotinic Acid Adenine Dinucleotide Phosphate (NAADP)-mediated Ca2+ Signaling upon Lysosome Proliferation*


    Dickinson, G. D.; Churchill, G. C.; Brailoiu, E; Patel, S.


    Accumulating evidence suggests that the endolysosomal system is a novel intracellular Ca2+ pool mobilized by the second messenger, nicotinic acid adenine dinucleotide phosphate (NAADP). Although lysosomes in neurons are known to proliferate in numerous neurodegenerative diseases and during the normal course of aging, little is known concerning the effect of lysosomal proliferation on Ca2+ homeostasis. Here, we induce proliferation of lysosomes in primary cultures of rat hippocampal neurons an...

  7. Adenine ribbon stabilized by Watson–Crick and Hoogsteen hydrogen Bonds: WFT and DFT study

    Czech Academy of Sciences Publication Activity Database

    Zierkiewicz, W.; Michalska, D.; Hobza, Pavel


    Roč. 12, č. 12 (2010), s. 2888-2894. ISSN 1463-9076 R&D Projects: GA MŠk LC512 Grant ostatní: Wroclaw University of Technology(PL) 343974/Z0304 Institutional research plan: CEZ:AV0Z40550506 Keywords : adenine ribbon * ab initio correlated calculations * self- organization Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.454, year: 2010

  8. Kissing loop interaction in adenine riboswitch: insights from umbrella sampling simulations


    Di Palma, Francesco; Bottaro, Sandro; Bussi, Giovanni


    Introduction Riboswitches are cis-acting regulatory RNA elements prevalently located in the leader sequences of bacterial mRNA. An adenine sensing riboswitch cis-regulates adeninosine deaminase gene (add) in Vibrio vulnificus. The structural mechanism regulating its conformational changes upon ligand binding mostly remains to be elucidated. In this open framework it has been suggested that the ligand stabilizes the interaction of the distal "kissing loop" complex. Using accurate full-atom mol...

  9. Long-Range Charge Transport in Adenine-Stacked RNA:DNA Hybrids. (United States)

    Li, Yuanhui; Artés, Juan M; Hihath, Joshua


    An extremely important biological component, RNA:DNA can also be used to design nanoscale structures such as molecular wires. The conductance of single adenine-stacked RNA:DNA hybrids is rapidly and reproducibly measured using the break junction approach. The conductance decreases slightly over a large range of molecular lengths, suggesting that RNA:DNA can be used as an oligonucleotide wire. PMID:26596516

  10. Thermodynamic Potential for the Abiotic Synthesis of Adenine, Cytosine, Guanine, Thymine, Uracil, Ribose, and Deoxyribose in Hydrothermal Systems

    NARCIS (Netherlands)

    LaRowe, D.E.; Regnier, P.


    The thermodynamic potential for the abiotic synthesis of the five common nucleobases (adenine, cytosine, guanine, thymine, and uracil) and two monosaccharides (ribose and deoxyribose) from formaldehyde and hydrogen cyanide has been quantified under temperature, pressure, and bulk composition conditi

  11. Nucleotides in neuroregeneration and neuroprotection. (United States)

    Miras-Portugal, M Teresa; Gomez-Villafuertes, Rosa; Gualix, Javier; Diaz-Hernandez, Juan Ignacio; Artalejo, Antonio R; Ortega, Felipe; Delicado, Esmerilda G; Perez-Sen, Raquel


    Brain injury generates the release of a multitude of factors including extracellular nucleotides, which exhibit bi-functional properties and contribute to both detrimental actions in the acute phase and also protective and reparative actions in the later recovery phase to allow neuroregeneration. A promising strategy toward restoration of neuronal function is based on activation of endogenous adult neural stem/progenitor cells. The implication of purinergic signaling in stem cell biology, including regulation of proliferation, differentiation, and cell death has become evident in the last decade. In this regard, current strategies of acute transplantation of ependymal stem/progenitor cells after spinal cord injury restore altered expression of P2X4 and P2X7 receptors and improve functional locomotor recovery. The expression of both receptors is transcriptionally regulated by Sp1 factor, which plays a key role in the startup of the transcription machinery to induce regeneration-associated genes expression. Finally, general signaling pathways triggered by nucleotide receptors in neuronal populations converge on several intracellular kinases, such as PI3K/Akt, GSK3 and ERK1,2, as well as the Nrf-2/heme oxigenase-1 axis, which specifically link them to neuroprotection. In this regard, regulation of dual specificity protein phosphatases can become novel mechanism of actions for nucleotide receptors that associate them to cell homeostasis regulation. This article is part of the Special Issue entitled 'Purines in Neurodegeneration and Neuroregeneration'. PMID:26359530

  12. Selective self-assembly of adenine-silver nanoparticles forms rings resembling the size of cells (United States)

    Choi, Sungmoon; Park, Soonyoung; Yang, Seon-Ah; Jeong, Yujin; Yu, Junhua


    Self-assembly has played critical roles in the construction of functional nanomaterials. However, the structure of the macroscale multicomponent materials built by the self-assembly of nanoscale building blocks is hard to predict due to multiple intermolecular interactions of great complexity. Evaporation of solvents is usually an important approach to induce kinetically stable assemblies of building blocks with a large-scale specific arrangement. During such a deweting process, we tried to monitor the possible interactions between silver nanoparticles and nucleobases at a larger scale by epifluorescence microscopy, thanks to the doping of silver nanoparticles with luminescent silver nanodots. ssDNA oligomer-stabilized silver nanoparticles and adenine self-assemble to form ring-like compartments similar to the size of modern cells. However, the silver ions only dismantle the self-assembly of adenine. The rings are thermodynamically stable as the drying process only enrich the nanoparticles-nucleobase mixture to a concentration that activates the self-assembly. The permeable membrane-like edge of the ring is composed of adenine filaments glued together by silver nanoparticles. Interestingly, chemicals are partially confined and accumulated inside the ring, suggesting that this might be used as a microreactor to speed up chemical reactions during a dewetting process.

  13. Interaction of an adenine molecule with a Ag-terminated Si(111) surface

    International Nuclear Information System (INIS)

    The adsorption of an adenine molecule, one of four DNA bases, on a Ag/Si(111) √3 x √3 surface is investigated using a first-principles total-energy calculation. Extensive search of the adsorption structures reveals that two structures are energetically competing. One is a structure with a hexagonal ring of adenine on a large Ag triangle (LT) of the substrate. The molecular plane is inclined at a tilt angle of 10.2 .deg. with respect to the surface plane due to weak bonds between N and substrate Ag atoms. The other is a structure with N just above a Ag atom (T) with the molecular plane vertical to the surface. The N... Ag bond energy in the LT structure is of similar magnitude to the N...H hydrogen bonds of an adenine dimer. The local-density approximation (LDA) and the generalized-gradient approximation (GGA) produce different energy orders between the LT and the T structures. An incorrect treatment of the van der Waals interaction in the density-functional theory could be the origin of the difference.

  14. Effect of gum arabic on oxidative stress and inflammation in adenine-induced chronic renal failure in rats.

    Directory of Open Access Journals (Sweden)

    Badreldin H Ali

    Full Text Available Inflammation and oxidative stress are known to be involved in the pathogenesis of chronic kidney disease in humans, and in chronic renal failure (CRF in rats. The aim of this work was to study the role of inflammation and oxidative stress in adenine-induced CRF and the effect thereon of the purported nephroprotective agent gum arabic (GA. Rats were divided into four groups and treated for 4 weeks as follows: control, adenine in feed (0.75%, w/w, GA in drinking water (15%, w/v and adenine+GA, as before. Urine, blood and kidneys were collected from the rats at the end of the treatment for analysis of conventional renal function tests (plasma creatinine and urea concentration. In addition, the concentrations of the pro-inflammatory cytokine TNF-α and the oxidative stress markers glutathione and superoxide dismutase, renal apoptosis, superoxide formation and DNA double strand break frequency, detected by immunohistochemistry for γ-H2AX, were measured. Adenine significantly increased the concentrations of urea and creatinine in plasma, significantly decreased the creatinine clearance and induced significant increases in the concentration of the measured inflammatory mediators. Further, it caused oxidative stress and DNA damage. Treatment with GA significantly ameliorated these actions. The mechanism of the reported salutary effect of GA in adenine-induced CRF is associated with mitigation of the adenine-induced inflammation and generation of free radicals.

  15. Prolonged Pulmonary Exposure to Diesel Exhaust Particles Exacerbates Renal Oxidative Stress, Inflammation and DNA Damage in Mice with Adenine-Induced Chronic Renal Failure

    Directory of Open Access Journals (Sweden)

    Abderrahim Nemmar


    Full Text Available Background/Aims: Epidemiological evidence indicates that patients with chronic kidney diseases have increased susceptibility to adverse outcomes related to long-term exposure to particulate air pollution. However, mechanisms underlying these effects are not fully understood. Methods: Presently, we assessed the effect of prolonged exposure to diesel exhaust particles (DEP on chronic renal failure induced by adenine (0.25% w/w in feed for 4 weeks, which is known to involve inflammation and oxidative stress. DEP (0.5m/kg was intratracheally (i.t. instilled every 4th day for 4 weeks (7 i.t. instillation. Four days following the last exposure to either DEP or saline (control, various renal endpoints were measured. Results: While body weight was decreased, kidney weight increased in DEP+adenine versus saline+adenine or DEP. Water intake, urine volume, relative kidney weight were significantly increased in adenine+DEP versus DEP and adenine+saline versus saline. Plasma creatinine and urea increased and creatinine clearance decreased in adenine+DEP versus DEP and adenine+saline versus saline. Tumor necrosis factor α, lipid peroxidation and reactive oxygen species were significantly increased in adenine+DEP compared with either DEP or adenine+saline. The antioxidant calase was significantly decreased in adenine+DEP compared with either adenine+saline or DEP. Notably, renal DNA damage was significantly potentiated in adenine+DEP compared with either adenine+saline or DEP. Similarly, systolic blood pressure was increased in adenine+DEP versus adenine+saline or DEP, and in DEP versus saline. Histological evaluation revealed more collagen deposition, higher number of necrotic cell counts and dilated tubules, cast formation and collapsing glomeruli in adenine+DEP versus adenine+saline or DEP. Conclusion: Prolonged pulmonary exposure to diesel exhaust particles worsen renal oxidative stress, inflammation and DNA damage in mice with adenine-induced chronic

  16. Running out of time: the decline of channel activity and nucleotide activation in adenosine triphosphate-sensitive K-channels. (United States)

    Proks, Peter; Puljung, Michael C; Vedovato, Natascia; Sachse, Gregor; Mulvaney, Rachel; Ashcroft, Frances M


    KATP channels act as key regulators of electrical excitability by coupling metabolic cues-mainly intracellular adenine nucleotide concentrations-to cellular potassium ion efflux. However, their study has been hindered by their rapid loss of activity in excised membrane patches (rundown), and by a second phenomenon, the decline of activation by Mg-nucleotides (DAMN). Degradation of PI(4,5)P2 and other phosphoinositides is the strongest candidate for the molecular cause of rundown. Broad evidence indicates that most other determinants of rundown (e.g. phosphorylation, intracellular calcium, channel mutations that affect rundown) also act by influencing KATP channel regulation by phosphoinositides. Unfortunately, experimental conditions that reproducibly prevent rundown have remained elusive, necessitating post hoc data compensation. Rundown is clearly distinct from DAMN. While the former is associated with pore-forming Kir6.2 subunits, DAMN is generally a slower process involving the regulatory sulfonylurea receptor (SUR) subunits. We speculate that it arises when SUR subunits enter non-physiological conformational states associated with the loss of SUR nucleotide-binding domain dimerization following prolonged exposure to nucleotide-free conditions. This review presents new information on both rundown and DAMN, summarizes our current understanding of these processes and considers their physiological roles.This article is part of the themed issue 'Evolution brings Ca(2+) and ATP together to control life and death'. PMID:27377720

  17. Fragmentation of the adenine and guanine molecules induced by electron collisions

    International Nuclear Information System (INIS)

    Secondary electron emission is the most important stage in the mechanism of radiation damage to DNA biopolymers induced by primary ionizing radiation. These secondary electrons ejected by the primary electron impacts can produce further ionizations, initiating an avalanche effect, leading to genome damage through the energy transfer from the primary objects to sensitive biomolecular targets, such as nitrogenous bases, saccharides, and other DNA and peptide components. In this work, the formation of positive and negative ions of purine bases of nucleic acids (adenine and guanine molecules) under the impact of slow electrons (from 0.1 till 200 eV) is studied by the crossed electron and molecular beams technique. The method used makes it possible to measure the molecular beam intensity and determine the total cross-sections for the formation of positive and negative ions of the studied molecules, their energy dependences, and absolute values. It is found that the maximum cross section for formation of the adenine and guanine positive ions is reached at about 90 eV energy of the electron beam and their absolute values are equal to 2.8 × 10−15 and 3.2 × 10−15 cm2, respectively. The total cross section for formation of the negative ions is 6.1 × 10−18 and 7.6 × 10−18 cm2 at the energy of 1.1 eV for adenine and guanine, respectively. The absolute cross-section values for the molecular ions are measured and the cross-sections of dissociative ionization are determined. Quantum chemical calculations are performed for the studied molecules, ions and fragments for interpretation of the crossed beams experiments

  18. Purine salvage in Methanocaldococcus jannaschii: Elucidating the role of a conserved cysteine in adenine deaminase. (United States)

    Miller, Danielle V; Brown, Anne M; Xu, Huimin; Bevan, David R; White, Robert H


    Adenine deaminases (Ade) and hypoxanthine/guanine phosphoribosyltransferases (Hpt) are widely distributed enzymes involved in purine salvage. Characterization of the previously uncharacterized Ade (MJ1459 gene product) and Hpt (MJ1655 gene product) are discussed here and provide insight into purine salvage in Methanocaldococcus jannaschii. Ade was demonstrated to use either Fe(II) and/or Mn(II) as the catalytic metal. Hpt demonstrated no detectable activity with adenine, but was equally specific for hypoxanthine and guanine with a kcat /KM of 3.2 × 10(7) and 3.0 × 10(7) s(- 1) M(- 1) , respectively. These results demonstrate that hypoxanthine and IMP are the central metabolites in purine salvage in M. jannaschii for AMP and GMP production. A conserved cysteine (C127, M. jannaschii numbering) was examined due to its high conservation in bacterial and archaeal homologues. To assess the role of this highly conserved cysteine in M. jannaschii Ade, site-directed mutagenesis was performed. It was determined that mutation to serine (C127S) completely abolished Ade activity and mutation to alanine (C127A) exhibited 10-fold decrease in kcat over the wild type Ade. To further investigate the role of C127, detailed molecular docking and dynamics studies were performed and revealed adenine was unable to properly orient in the active site in the C127A and C127S Ade model structures due to distinct differences in active site conformation and rotation of D261. Together this work illuminates purine salvage in M. jannaschii and the critical role of a cysteine residue in maintaining active site conformation of Ade. Proteins 2016; 84:828-840. © 2016 Wiley Periodicals, Inc. PMID:26990095

  19. Fabrication of a Complex Two-Dimensional Adenine-Perylene-3,4,9, 10-tetracarboxylic Dianhydride Chiral Nanoarchitecture through Molecular Self-Assembly


    Sun, Xiaonan; Mura, Manuela; Jonkman, Harry T.; Kantorovich, Lev N.; Silly, Fabien


    The two-dimensional self-assembly of a nonsyrnmetric adenine DNA base mixed with symmetric perylene-3,4,9,10-tetracarboxylic dianhydride (PTCDA) molecules is investigated using scanning tunneling microscopy (STM). We experimentally observe that these two building blocks form a complex close-packed chiral supramolecular network on Au(111). The unit cell of the adenine PTCDA nanoarchitecture is composed of 14 molecules. The high stability of this structure relies on PTCDA-PTCDA and PTCDA-adenin...

  20. The effect of pi-stacking, h-bonding, and electrostatic interactions on the ionization energies of nucleic acid bases: adenine-adenine, thymine-thymine and adenine-thymine dimers

    Energy Technology Data Exchange (ETDEWEB)

    Bravaya, Ksenia B.; Kostko, Oleg; Ahmed, Musahid; Krylov, Anna I.


    A combined theoretical and experimental study of the ionized dimers of thymine and adenine, TT, AA, and AT, is presented. Adiabatic and vertical ionization energies(IEs) for monomers and dimers as well as thresholds for the appearance of the protonated species are reported and analyzed. Non-covalent interactions stronglyaffect the observed IEs. The magnitude and the nature of the effect is different for different isomers of the dimers. The computations reveal that for TT, the largestchanges in vertical IEs (0.4 eV) occur in asymmetric h-bonded and symmetric pi- stacked isomers, whereas in the lowest-energy symmetric h-bonded dimer the shiftin IEs is much smaller (0.1 eV). The origin of the shift and the character of the ionized states is different in asymmetric h-bonded and symmetric stacked isomers. Inthe former, the initial hole is localized on one of the fragments, and the shift is due to the electrostatic stabilization of the positive charge of the ionized fragment by thedipole moment of the neutral fragment. In the latter, the hole is delocalized, and the change in IE is proportional to the overlap of the fragments' MOs. The shifts in AAare much smaller due to a less effcient overlap and a smaller dipole moment. The ionization of the h-bonded dimers results in barrierless (or nearly barrierless) protontransfer, whereas the pi-stacked dimers relax to structures with the hole stabilized by the delocalization or electrostatic interactions.

  1. Synthesis, spectroscopic, structural and thermal characterizations of vanadyl(IV) adenine complex prospective as antidiabetic drug agent (United States)

    El-Megharbel, Samy M.; Hamza, Reham Z.; Refat, Moamen S.


    The vanadyl(IV) adenine complex; [VO(Adn)2]ṡSO4; was synthesized and characterized. The molar conductivity of this complex was measured in DMSO solution that showed an electrolyte nature. Spectroscopic investigation of the green solid complex studied here indicate that the adenine acts as a bidentate ligand, coordinated to vanadyl(IV) ions through the nitrogen atoms N7 and nitrogen atom of amino group. Thus, from the results presented the vanadyl(IV) complex has square pyramid geometry. Further characterizations using thermal analyses and scanning electron techniques was useful. The aim of this paper was to introduce a new drug model for the diabetic complications by synthesized a novel mononuclear vanadyl(IV) adenine complex to mimic insulin action and reducing blood sugar level. The antidiabetic ability of this complex was investigated in STZ-induced diabetic mice. The results suggested that VO(IV)/adenine complex has antidiabetic activity, it improved the lipid profile, it improved liver and kidney functions, also it ameliorated insulin hormone and blood glucose levels. The vanadyl(IV) complex possesses an antioxidant activity and this was clear through studying SOD, CAT, MDA, GSH and methionine synthase. The current results support the therapeutic potentiality of vanadyl(IV)/adenine complex for the management and treatment of diabetes.

  2. A dose-response study on opening of imidazole ring of adenine in DNA by ionizing radiation

    International Nuclear Information System (INIS)

    A dose-response relationship between γ-irradiation and the cleavage of the imidazole ring of adenine in DNA to form formamidopyrimidine has been demonstrated. When the DNA aqueous solution was irradiated with 0.1 Gy under N2O there is little evidence of imidazole ring cleavage. A significant increase in cleavage begins to be noticed above 1 Gy reaching a plateau at 1000 Gy. No formamidopyrimidine was formed when 2'-deoxyadenosine was irradiated with up to 1000 Gy. A dose of 100 Gy converts 18 per cent of adenine in DNA to formamidopyrimidine. In irradiated DNA aqueous solution 1000 Gy convert 25 per cent of adenine to formamidopyrimidine under N2O. Some of the adenine was converted to 7,8-dihydro-8-oxoadenine but in amount that is 20 per cent of that converted to formamidopyrimidine under N2O. There was more adenine in DNA converted to formamidopyrimidine under N2O than under N2. (author)

  3. Trichomonas vaginalis NTPDase and ecto-5'-nucleotidase hydrolyze guanine nucleotides and increase extracellular guanosine levels under serum restriction. (United States)

    Menezes, Camila Braz; Durgante, Juliano; de Oliveira, Rafael Rodrigues; Dos Santos, Victor Hugo Jacks Mendes; Rodrigues, Luiz Frederico; Garcia, Solange Cristina; Dos Santos, Odelta; Tasca, Tiana


    Trichomonas vaginalis is the aethiologic agent of trichomoniasis, the most common non-viral sexually transmitted disease in the world. The purinergic signaling pathway is mediated by extracellular nucleotides and nucleosides that are involved in many biological effects as neurotransmission, immunomodulation and inflammation. Extracellular nucleotides can be hydrolyzed by a family of enzymes known as ectonucleotidases including the ecto-nucleoside triphosphate diphosphohydrolases (E-NTPDases) family which hydrolyses nucleosides triphosphate and diphosphate as preferential substrates and ecto-5'-nucleotidase which catalyzes the conversion of monophosphates into nucleosides. In T. vaginalis the E-NTPDase and ecto-5'-nucleotidase activities upon adenine nucleotides have already been characterized in intact trophozoites but little is known concerning guanine nucleotides and nucleoside. These enzymes may exert a crucial role on nucleoside generation, providing the purine sources for the synthesis de novo of these essential nutrients, sustaining parasite growth and survival. In this study, we investigated the hydrolysis profile of guanine-related nucleotides and nucleoside in intact trophozoites from long-term-grown and fresh clinical isolates of T. vaginalis. Knowing that guanine nucleotides are also substrates for T. vaginalis ectoenzymes, we evaluated the profile of nucleotides consumption and guanosine uptake in trophozoites submitted to a serum limitation condition. Results show that guanine nucleotides (GTP, GDP, GMP) were substrates for T. vaginalis ectonucleotidases, with expected kinetic parameters for this enzyme family. Different T. vaginalis isolates (two from the ATCC and nine fresh clinical isolates) presented a heterogeneous hydrolysis profile. The serum culture condition increased E-NTPDase and ecto-5'-nucleotidase activities with high consumption of extracellular GTP generating enhanced GDP, GMP and guanosine levels as demonstrated by HPLC, with final

  4. Nucleotide excision repair in humans. (United States)

    Spivak, Graciela


    The demonstration of DNA damage excision and repair replication by Setlow, Howard-Flanders, Hanawalt and their colleagues in the early 1960s, constituted the discovery of the ubiquitous pathway of nucleotide excision repair (NER). The serial steps in NER are similar in organisms from unicellular bacteria to complex mammals and plants, and involve recognition of lesions, adducts or structures that disrupt the DNA double helix, removal of a short oligonucleotide containing the offending lesion, synthesis of a repair patch copying the opposite undamaged strand, and ligation, to restore the DNA to its original form. The transcription-coupled repair (TCR) subpathway of NER, discovered nearly two decades later, is dedicated to the removal of lesions from the template DNA strands of actively transcribed genes. In this review I will outline the essential factors and complexes involved in NER in humans, and will comment on additional factors and metabolic processes that affect the efficiency of this important process. PMID:26388429

  5. Thymine- and Adenine-Functionalized Polystyrene Form Self-Assembled Structures through Multiple Complementary Hydrogen Bonds

    Directory of Open Access Journals (Sweden)

    Yu-Shian Wu


    Full Text Available In this study, we investigated the self-assembly of two homopolymers of the same molecular weight, but containing complementary nucleobases. After employing nitroxide-mediated radical polymerization to synthesize poly(vinylbenzyl chloride, we converted the polymer into poly(vinylbenzyl azide through a reaction with NaN3 and then performed click chemistry with propargyl thymine and propargyl adenine to yield the homopolymers, poly(vinylbenzyl triazolylmethyl methylthymine (PVBT and poly(vinylbenzyl triazolylmethyl methyladenine (PVBA, respectively. This PVBT/PVBA blend system exhibited a single glass transition temperature over the entire range of compositions, indicative of a miscible phase arising from the formation of multiple strong complementary hydrogen bonds between the thymine and adenine groups of PVBT and PVBA, respectively; Fourier transform infrared and 1H nuclear magnetic resonance spectroscopy confirmed the presence of these noncovalent interactions. In addition, dynamic rheology, dynamic light scattering and transmission electron microscopy provided evidence for the formation of supramolecular network structures in these binary PVBT/PVBA blend systems.

  6. Bacteriophage adenine methyltransferase: a life cycle regulator? Modelled using Vibrio harveyi myovirus like. (United States)

    Bochow, S; Elliman, J; Owens, L


    The adenine methyltransferase (DAM) gene methylates GATC sequences that have been demonstrated in various bacteria to be a powerful gene regulator functioning as an epigenetic switch, particularly with virulence gene regulation. However, overproduction of DAM can lead to mutations, giving rise to variability that may be important for adaptation to environmental change. While most bacterial hosts carry a DAM gene, not all bacteriophage carry this gene. Currently, there is no literature regarding the role DAM plays in life cycle regulation of bacteriophage. Vibrio campbellii strain 642 carries the bacteriophage Vibrio harveyi myovirus like (VHML) that has been proven to increase virulence. The complete genome sequence of VHML bacteriophage revealed a putative adenine methyltransferase gene. Using VHML, a new model of phage life cycle regulation, where DAM plays a central role between the lysogenic and lytic states, will be hypothesized. In short, DAM methylates the rha antirepressor gene and once methylation is removed, homologous CI repressor protein becomes repressed and non-functional leading to the switching to the lytic cycle. Greater understanding of life cycle regulation at the genetic level can, in the future, lead to the genesis of chimeric bacteriophage with greater control over their life cycle for their safe use as probiotics within the aquaculture industry. PMID:22681538

  7. Probing ultrafast dynamics in adenine with mid-UV four-wave mixing spectroscopies. (United States)

    West, Brantley A; Womick, Jordan M; Moran, Andrew M


    Heterodyne-detected transient grating (TG) and two-dimensional photon echo (2DPE) spectroscopies are extended to the mid-UV spectral range in this investigation of photoinduced relaxation processes of adenine in aqueous solution. These experiments are the first to combine a new method for generating 25 fs laser pulses (at 263 nm) with the passive phase stability afforded by diffractive optics-based interferometry. We establish a set of conditions (e.g., laser power density, solute concentration) appropriate for the study of dynamics involving the neutral solute. Undesired solute photoionization is shown to take hold at higher peak powers of the laser pulses. Signatures of internal conversion and vibrational cooling dynamics are examined using TG measurements with signal-to-noise ratios as high as 350 at short delay times. In addition, 2DPE line shapes reveal correlations between excitation and emission frequencies in adenine, which reflect electronic and nuclear relaxation processes associated with particular tautomers. Overall, this study demonstrates the feasibility of techniques that will hold many advantages for the study of biomolecules whose lowest-energy electronic resonances are found in the mid-UV (e.g., DNA bases, amino acids). PMID:21756005

  8. High-NaCl diet impairs dynamic renal blood flow autoregulation in rats with adenine-induced chronic renal failure

    DEFF Research Database (Denmark)

    Saeed, Aso; DiBona, Gerald F; Grimberg, Elisabeth;


    This study examined the effects of 2 wk of high-NaCl diet on kidney function and dynamic renal blood flow autoregulation (RBFA) in rats with adenine-induced chronic renal failure (ACRF). Male Sprague-Dawley rats received either chow containing adenine or were pair-fed an identical diet without...... increase the susceptibility to hypertensive end-organ injury and progressive renal failure by facilitating pressure transmission to the microvasculature....... adenine (controls). After 10 wk, rats were randomized to either remain on the same diet (0.6% NaCl) or to be switched to high 4% NaCl chow. Two weeks after randomization, renal clearance experiments were performed under isoflurane anesthesia and dynamic RBFA, baroreflex sensitivity (BRS), systolic...

  9. Cross sections of negative ion production in electron collisions with adenine molecules

    International Nuclear Information System (INIS)

    Full text: We report absolute cross sections for the formation negative ions resulting from electron interactions with adenine. Interest in experimental studies of the processes of electron impact ion production in the molecules of biological relevance is related, first of all, to the significance of the problem of intracellular irradiation of biological structures by secondary electrons produced in the substance in quite considerable amounts under the influence of different-type radiation. It has been shown in our preliminary experiments carried out with the heterocyclic components of the above molecules that under electron impact different physical processes occur: molecules excitation, ionization, dissociative excitation and dissociative ionization. Physical modeling of these processes and estimation of their radiobiological consequences require knowledge of their basic characteristics - absolute ionization cross sections. Reliable data on the ionization cross sections could be obtained only in a precise experiment, in which the role of environment is minimized. Such approach was applied in this work. Production of negative ions of adenine molecules (nucleic acid base) has been studied using a crossed electron and molecular beam technique. The method developed by the authors enabled the molecular beam intensity to be measured and the electron dependences and the absolute values of the total cross sections of production of negative adenine ions to be determined. A five-electrode electron gun with a thoriated tungsten cathode was used as an electron beam source. Electron gun temperature was about 400 K providing gun parameter stability during operation. Electrons having passed the interaction region were trapped by a Faraday cup kept at the positive potential. Measurements were carried out at the 10-7 - 10-6 AA electron beam current and the ΔE1/2 ∼ 0.3 eV (FWHM) energy spread. Electron gun was immersed into the longitudinal magnetic field (induction B = 1

  10. Development of a new model for the induction of chronic kidney disease via intraperitoneal adenine administration, and the effect of treatment with gum acacia thereon. (United States)

    Al Za'abi, Mohammed; Al Busaidi, Mahfouda; Yasin, Javid; Schupp, Nicole; Nemmar, Abderrahim; Ali, Badreldin H


    Oral adenine (0.75% w/w in feed), is an established model for human chronic kidney disease (CKD). Gum acacia (GA) has been shown to be a nephroprotective agent in this model. Here we aimed at developing a new adenine-induced CKD model in rats via a systemic route (intraperitoneal, i.p.) and to test it with GA to obviate the possibility of a physical interaction between GA and adenine in the gut. Adenine was injected i.p. (50 or 100 mg/Kg for four weeks), and GA was given concomitantly in drinking water at a concentration of 15%, w/v. Several plasma and urinary biomarkers of oxidative stress were measured and the renal damage was assessed histopathologically. Adenine, at the two given i.p. doses, significantly reduced body weight, and increased relative kidney weight, water intake and urine output. It dose-dependently increased plasma and urinary inflammatory and oxidative stress biomarkers, and caused morphological and histological damage resembling that which has been reported with oral adenine. Concomitant treatment with GA significantly mitigated almost all the above measured indices. Administration of adenine i.p. induced CKD signs very similar to those induced by oral adenine. Therefore, this new model is quicker, more practical and accurate than the original (oral) model. GA ameliorates the CKD effects caused by adenine given i.p. suggesting that the antioxidant and anti-inflammatory properties possessed by oral GA are the main mechanism for its salutary action in adenine-induced CKD, an action that is independent of its possible interaction with adenine in the gut. PMID:25755826

  11. Study of the Five Rickettsia prowazekii Proteins Annotated as ATP/ADP Translocases (Tlc): Only Tlc1 Transports ATP/ADP, While Tlc4 and Tlc5 Transport Other Ribonucleotides


    Audia, Jonathon P.; Winkler, Herbert H.


    The obligate intracytoplasmic pathogen Rickettsia prowazekii relies on the transport of many essential compounds from the cytoplasm of the eukaryotic host cell in lieu of de novo synthesis, an evolutionary outcome undoubtedly linked to obligatory growth in this metabolite-replete niche. The paradigm for the study of rickettsial transport systems is the ATP/ADP translocase Tlc1, which exchanges bacterial ADP for host cell ATP as a source of energy, rather than as a source of adenylate. Interes...

  12. Interfacial molecular recognition of adenine, adenosine and ATP by a C60-uracil adduct via complementary base pairing (United States)

    Marczak, Renata; Hoang, Vu T.; Noworyta, Krzysztof; Zandler, Melvin E.; Kutner, Wlodzimierz; D'Souza, Francis


    A new C60-uracil adduct was demonstrated to recognize adenine, adenosine, or adenosine 5'-triphosphate (ATP) via complementary base pairing which led to complex formation. The base-pairing mechanism was modeled by ab initio B3LYP/3-21G(*) calculations which revealed the Watson-Crick (A-T) interactions. Stable "expanded liquid" Langmuir films of the complexes were prepared with the limiting area per molecule increasing for different subphase composition in the order: water < adenine < adenosine < ATP solution. Comparison of experimental and calculated areas per molecule and dipole moments suggest both prevailing horizontal orientation of the complexes in films.

  13. Nucleotide sequence preservation of human mitochondrial DNA

    International Nuclear Information System (INIS)

    Recombinant DNA techniques have been used to quantitate the amount of nucleotide sequence divergence in the mitochondrial DNA population of individual normal humans. Mitochondrial DNA was isolated from the peripheral blood lymphocytes of five normal humans and cloned in M13 mp11; 49 kilobases of nucleotide sequence information was obtained from 248 independently isolated clones from the five normal donors. Both between- and within-individual differences were identified. Between-individual differences were identified in approximately = to 1/200 nucleotides. In contrast, only one within-individual difference was identified in 49 kilobases of nucleotide sequence information. This high degree of mitochondrial nucleotide sequence homogeneity in human somatic cells is in marked contrast to the rapid evolutionary divergence of human mitochondrial DNA and suggests the existence of mechanisms for the concerted preservation of mammalian mitochondrial DNA sequences in single organisms

  14. Sublingual nucleotides and immune response to exercise

    Directory of Open Access Journals (Sweden)

    Ostojic Sergej M


    Full Text Available Abstract Evidence exists regarding the potential role of exogenous nucleotides as regulators of the immune function in physically active humans, yet the potential use of nucleotides has been hindered by their low bioavailability after oral administration. We conducted a double-blind, placebo-controlled, randomized trial to assess the effect of sublingual nucleotides (50 mg/day on salivary and serum immunity indicators as compared to placebo, both administered to healthy males aged 20 to 25 years for 14 days. Sublingual administration of nucleotides for 14 days increased serum immunoglobulin A, natural killer cells count and cytotoxic activity, and offset the post-exercise drop of salivary immunoglobulins and lactoferrin (P  0.05. It seems that sublingual administration of nucleotides for two weeks considerably affected immune function in healthy males.

  15. On the existence of the H3 tautomer of adenine in aqueous solution. Rationalizations based on hybrid quantum mechanics/molecular mechanics predictions

    DEFF Research Database (Denmark)

    Aidas, Kestutis; Mikkelsen, Kurt V; Kongsted, Jacob


    The (15)N NMR spectrum of adenine in aqueous solution has been modeled using high-level combined density functional theory/molecular mechanics techniques coupled to a dynamical averaging scheme. The explicit consideration of the three lowest-energy tautomers of adenine-H9, H7 and H3-allows for a...

  16. Few-layer graphene sheets with embedded gold nanoparticles for electrochemical analysis of adenine

    Directory of Open Access Journals (Sweden)

    Biris AR


    Full Text Available Alexandru R Biris,1 Stela Pruneanu,1 Florina Pogacean,1 Mihaela D Lazar,1 Gheorghe Borodi,1 Stefania Ardelean,1 Enkeleda Dervishi,2 Fumiya Watanabe,2 Alexandru S Biris2 1National Institute for Research and Development of Isotopic and Molecular Technologies, Cluj-Napoca, Romania; 2Center for Integrative Nanotechnology Sciences, University of Arkansas at Little Rock, Little Rock, AR, USA Abstract: This work describes the synthesis of few-layer graphene sheets embedded with various amounts of gold nanoparticles (Gr-Au-x over an Aux/MgO catalytic system (where x = 1, 2, or 3 wt%. The sheet-like morphology of the Gr-Au-x nanostructures was confirmed by transmission electron microscopy and high resolution transmission electron microscopy, which also demonstrated that the number of layers within the sheets varied from two to seven. The sample with the highest percentage of gold nanoparticles embedded within the graphitic layers (Gr-Au-3 showed the highest degree of crystallinity. This distinct feature, along with the large number of edge-planes seen in high resolution transmission electron microscopic images, has a crucial effect on the electrocatalytic properties of this material. The reaction yields (40%–50% and the final purity (96%–98% of the Gr-Au-x composites were obtained by thermogravimetric analysis. The Gr-Au-x composites were used to modify platinum substrates and subsequently to detect adenine, one of the DNA bases. For the bare electrode, no oxidation signal was recorded. In contrast, all of the modified electrodes showed a strong electrocatalytic effect, and a clear peak for adenine oxidation was recorded at approximately +1.05 V. The highest increase in the electrochemical signal was obtained using a platinum/Gr-Au-3-modified electrode. In addition, this modified electrode had an exchange current density (I0, obtained from the Tafel plot one order of magnitude higher than that of the bare platinum electrode, which also confirmed that

  17. Modeling the high-energy electronic state manifold of adenine: Calibration for nonlinear electronic spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Nenov, Artur, E-mail:; Giussani, Angelo; Segarra-Martí, Javier; Jaiswal, Vishal K. [Dipartimento di Chimica “G. Ciamician,” Università di Bologna, Via Selmi 2, IT-40126 Bologna (Italy); Rivalta, Ivan [Université de Lyon, CNRS, Institut de Chimie de Lyon, École Normale Supérieure de Lyon, 46 Allée d’Italie, F-69364 Lyon Cedex 07 (France); Cerullo, Giulio [Dipartimento di Fisica, Politecnico di Milano, IFN-CNR, Piazza Leonardo Da Vinci 32, IT-20133 Milano (Italy); Mukamel, Shaul [Department of Chemistry, University of California, Irvine, California 92697-2025 (United States); Garavelli, Marco, E-mail:, E-mail: [Dipartimento di Chimica “G. Ciamician,” Università di Bologna, Via Selmi 2, IT-40126 Bologna (Italy); Université de Lyon, CNRS, Institut de Chimie de Lyon, École Normale Supérieure de Lyon, 46 Allée d’Italie, F-69364 Lyon Cedex 07 (France)


    Pump-probe electronic spectroscopy using femtosecond laser pulses has evolved into a standard tool for tracking ultrafast excited state dynamics. Its two-dimensional (2D) counterpart is becoming an increasingly available and promising technique for resolving many of the limitations of pump-probe caused by spectral congestion. The ability to simulate pump-probe and 2D spectra from ab initio computations would allow one to link mechanistic observables like molecular motions and the making/breaking of chemical bonds to experimental observables like excited state lifetimes and quantum yields. From a theoretical standpoint, the characterization of the electronic transitions in the visible (Vis)/ultraviolet (UV), which are excited via the interaction of a molecular system with the incoming pump/probe pulses, translates into the determination of a computationally challenging number of excited states (going over 100) even for small/medium sized systems. A protocol is therefore required to evaluate the fluctuations of spectral properties like transition energies and dipole moments as a function of the computational parameters and to estimate the effect of these fluctuations on the transient spectral appearance. In the present contribution such a protocol is presented within the framework of complete and restricted active space self-consistent field theory and its second-order perturbation theory extensions. The electronic excited states of adenine have been carefully characterized through a previously presented computational recipe [Nenov et al., Comput. Theor. Chem. 1040–1041, 295-303 (2014)]. A wise reduction of the level of theory has then been performed in order to obtain a computationally less demanding approach that is still able to reproduce the characteristic features of the reference data. Foreseeing the potentiality of 2D electronic spectroscopy to track polynucleotide ground and excited state dynamics, and in particular its expected ability to provide

  18. Modeling the high-energy electronic state manifold of adenine: Calibration for nonlinear electronic spectroscopy

    International Nuclear Information System (INIS)

    Pump-probe electronic spectroscopy using femtosecond laser pulses has evolved into a standard tool for tracking ultrafast excited state dynamics. Its two-dimensional (2D) counterpart is becoming an increasingly available and promising technique for resolving many of the limitations of pump-probe caused by spectral congestion. The ability to simulate pump-probe and 2D spectra from ab initio computations would allow one to link mechanistic observables like molecular motions and the making/breaking of chemical bonds to experimental observables like excited state lifetimes and quantum yields. From a theoretical standpoint, the characterization of the electronic transitions in the visible (Vis)/ultraviolet (UV), which are excited via the interaction of a molecular system with the incoming pump/probe pulses, translates into the determination of a computationally challenging number of excited states (going over 100) even for small/medium sized systems. A protocol is therefore required to evaluate the fluctuations of spectral properties like transition energies and dipole moments as a function of the computational parameters and to estimate the effect of these fluctuations on the transient spectral appearance. In the present contribution such a protocol is presented within the framework of complete and restricted active space self-consistent field theory and its second-order perturbation theory extensions. The electronic excited states of adenine have been carefully characterized through a previously presented computational recipe [Nenov et al., Comput. Theor. Chem. 1040–1041, 295-303 (2014)]. A wise reduction of the level of theory has then been performed in order to obtain a computationally less demanding approach that is still able to reproduce the characteristic features of the reference data. Foreseeing the potentiality of 2D electronic spectroscopy to track polynucleotide ground and excited state dynamics, and in particular its expected ability to provide

  19. A DNA-templated silver nanocluster probe for label-free, turn-on fluorescence-based screening of homo-adenine binding molecules. (United States)

    Park, Ki Soo; Park, Hyun Gyu


    A novel, label-free, turn-on fluorescence strategy to detect molecules that bind to adenine-rich DNA sequences has been developed. The probe employs DNA-templated silver nanoclusters (DNA-AgNCs) as the key detection component. The new strategy relies on the formation of non-Watson-Crick homo-adenine DNA duplex, triggered by strong interactions with homo-adenine binding molecules, which brings a guanine-rich sequence in one strand close to DNA-AgNCs located on the opposite strand. This phenomenon transforms weakly fluorescent AgNCs into highly emissive species that display bright red fluorescence. Finally, we have shown that the new fluorescence turn-on strategy can be employed to detect coralyne, the most representative homo-adenine binding molecule that triggers formation of a non-Watson-Crick homo-adenine DNA duplex. PMID:25441410

  20. Adsorption of nucleotides on biomimetic apatite: The case of adenosine 5‧ monophosphate (AMP) (United States)

    Hammami, K.; Feki, H. El; Marsan, O.; Drouet, C.


    This work investigates the interaction between the nucleotide adenosine 5‧ monophosphate molecule (AMP) and a biomimetic nanocrystalline carbonated apatite as a model for bone mineral. The analogy of the apatite phase used in this work with biological apatite was first pointed out by complementary techniques. AMP adsorption isotherms were then investigated. Obtained data were fitted to a Sips isotherm with an exponent greater than one suggesting positive cooperativity among adsorbed molecules. The data were compared to a previous study relative to the adsorption of another nucleotide, cytidine monophosphate (CMP) onto a similar substrate, evidencing some effect of the chemical nature of the nucleic base. An enhanced adsorption was observed under acidic (pH 6) conditions as opposed to pH 7.4, which parallels the case of DNA adsorption on biomimetic apatite. An estimated standard Gibbs free energy associated to the adsorption process (ΔG°ads ≅ -22 kJ/mol) intermediate between "physisorption" and "chemisorption" was found. The analysis of the solids after adsorption pointed to the preservation of the main characteristics of the apatite substrate but shifts or enhancements of Raman bands attributed to AMP showed the existence of chemical interactions involving both the phosphate and adenine parts of AMP. This contribution adds to the works conducted in view of better understanding the interaction of DNA/RNA and their constitutive nucleotides and the surface of biomimetic apatites. It could prove helpful in disciplines such as bone diagenesis (DNA/apatite interface in aged bones) or nanomedicine (setup of DNA- or RNA-loaded apatite systems). Also, the adsorption of nucleic acids on minerals like apatites could have played a role in the preservation of such biomolecules in the varying conditions known to exist at the origin of life on Earth, underlining the importance of dedicated adsorption studies.

  1. Nucleotide Salvage Deficiencies, DNA Damage and Neurodegeneration

    Directory of Open Access Journals (Sweden)

    Michael Fasullo


    Full Text Available Nucleotide balance is critically important not only in replicating cells but also in quiescent cells. This is especially true in the nervous system, where there is a high demand for adenosine triphosphate (ATP produced from mitochondria. Mitochondria are particularly prone to oxidative stress-associated DNA damage because nucleotide imbalance can lead to mitochondrial depletion due to low replication fidelity. Failure to maintain nucleotide balance due to genetic defects can result in infantile death; however there is great variability in clinical presentation for particular diseases. This review compares genetic diseases that result from defects in specific nucleotide salvage enzymes and a signaling kinase that activates nucleotide salvage after DNA damage exposure. These diseases include Lesch-Nyhan syndrome, mitochondrial depletion syndromes, and ataxia telangiectasia. Although treatment options are available to palliate symptoms of these diseases, there is no cure. The conclusions drawn from this review include the critical role of guanine nucleotides in preventing neurodegeneration, the limitations of animals as disease models, and the need to further understand nucleotide imbalances in treatment regimens. Such knowledge will hopefully guide future studies into clinical therapies for genetic diseases.

  2. Ultraviolet hypersensitivity of Cockayne syndrome lymphoblastoid lines - the effects of exogenous β-nicotinamide adenine dinucleotide

    International Nuclear Information System (INIS)

    Four Cockayne Syndrome (CS) lymphoblastoid lines were tested for the lethal effects of UV radiation (254 nm) with or without addition of exogenous β-nicotinamide adenine dinucleotide (β-NAD+) to their culture medium. Two of them exhibited a small but significantly increased resistance to UV radiation when β-NAD+ was added to the culture. However, their UV sensitivity after β-NAD+ addition was still much greater than that of normal control lines. Normal control lymphoblastoid lines and those from complementation group A and group C of xeroderma pigmentosum (XP) did not reveal any differences in post-UV sensitivity after the addition of exogenous β-NAD+. Thus the abnormal response to the lethal effects of UV radiation of CS lymphoblastoid lines could not be rectified by β-NAD+ addition. However, β-NAD+ does appear to play some partial role in reducing the high UV sensitivity of some CS lymphoblastoid lines. (author)

  3. Conducting polymer and its composite materials based electrochemical sensor for Nicotinamide Adenine Dinucleotide (NADH). (United States)

    Omar, Fatin Saiha; Duraisamy, Navaneethan; Ramesh, K; Ramesh, S


    Nicotinamide Adenine Dinucleotide (NADH) is an important coenzyme in the human body that participates in many metabolic reactions. The impact of abnormal concentrations of NADH significantly causes different diseases in human body. Electrochemical detection of NADH using bare electrode is a challenging task especially in the presence of main electroactive interferences such as ascorbic acid (AA), uric acid (UA) and dopamine (DA). Modified electrodes have been widely explored to overcome the problems of poor sensitivity and selectivity occurred from bare electrodes. This review gives an overview on the progress of using conducting polymers, polyelectrolyte and its composites (co-polymer, carbonaceous, metal, metal oxide and clay) based modified electrodes for the sensing of NADH. In addition, developments on the fabrication of numerous conducting polymer composites based modified electrodes are clearly described. PMID:26774092

  4. [Absolute bioavailability of the adenine derivative VMA-99-82 possessing antiviral activity]. (United States)

    Smirnova, L A; Suchkov, E A; Riabukha, A F; Kuznetsov, K A; Ozerov, A A


    Investigation of the main pharmacokinetic parameters of adenine derivative VMA-99-82 in rats showed large values of the half-life (T1/2 = 11.03 h) and the mean retention time of drug molecules in the organism (MRT = 9.53 h). A high rate of the drug concentration decrease in the plasma determines a small value of the area under the pharmacokinetic curve (AUC = 74.96 mg h/ml). The total distribution volume (V(d) = 10.61 l/kg) is 15.8 times greater than the volume of extracellular fluid in the body of rat, which is indicative of a high ability of VMA-99-82 to be distributed and accumulated in the organs and tissues. The absolute bioavailability of VMA-99-82 is 66%. PMID:24605425

  5. Prebiotic Synthesis of Adenine and Amino Acids Under Europa-like Conditions (United States)

    Levy, Matthew; Miller, Stanley L.; Brinton, Karen; Bada, Jeffrey L.


    In order to simulate prebiotic synthetic processes on Europa and other ice-covered planets and satellites. we have investigated the prebiotic synthesis of organic compounds from dilute solutions of NH4CN frozen for 25 year at -20 and -78 C. In addition the aqueous products of spark discharge reactions from a reducing atmosphere were frozen for 5 years at -20%. We find that both adenine and guanine, as well as a simple set of amino acids dominated by glycine, are produced in substantial yields under these conditions. These results indicate that some of the key components necessary for the origin of life may have been available on Europa throughout its history and suggest that the circumstellar zone where life might arise may be m der than previously thought.

  6. Surface enhanced Raman scattering investigation of protein-bound flavin adenine dinucleotide structure (United States)

    Maskevich, S. A.; Strekal, N. D.; Artsukevich, I. M.; Kivach, L. N.; Chernikevich, I. P.


    The SERS spectra of alcohol oxidase from Pichia pastoris adsorbed on a silver electrode were obtained. The similarities and differences of these spectra with the SERS spectrum of free flavin adenine dinucleiotide were considered. The dependence of relative intensity of 1258 cm -1 band from the electrode potential in the protein SERS spectra differed from that of free flavin. From the data on this band being sensitive to the protein-flavin interaction a suggestion was made about incomplete dissociation of flavin from the protein. This conclusion is confirmed both by the fluorescence data and the SERS data on alcohol oxidase purified from Candida boidinii. The results of the SERS investigation of the interaction between the substrate, ethanol and the cofactor, FAD, as well as between protein-bound cofactor with the substrate are presented. The problem of retaining the protein enzyme activity is discussed.

  7. Effect of adenine on bacterial translocation using technetium-99m labeled E. coli in an intestinal obstruction model in rats

    International Nuclear Information System (INIS)

    This study aims to investigate effects of adenine on bacterial translocation (BT) using 99mTc-labeled E. coli in an intestinal obstruction rat model. In the study twenty-one rats were used. The rats were divided into three groups according to different feeding patterns. The control group (CG) was fed with a standard chow diet for 7 days. Group A1 and group A2 were fed with adenine supplemented chow diet for 7 days. At the end of the feeding period, after all groups was submitted intestinal obstruction. 99mTc-E. coli was injected into the rats' terminal ileum under anesthetic. The rats were sacrificed under aseptic conditions at 24th h after the surgery. The uptake of 99mTc-E. coli was determined in organs such as the liver, mesenteric lymph nodes, spleen and ileum. Group A1 and group A2 results show that the uptake of 99mTc-E. coli decreased in the blood and organs comparing to the CG. As a result, it was observed that adenine reduced the level of BT when compared with CG. The beneficial effect of adenine on BT in intestinal obstruction was observed. However, further studies are needed to more clearly assess how this benefit can be achieved. (author)

  8. The effects of tautomerization and protonation on the adenine-cytosine mismatches: a density functional theory study. (United States)

    Masoodi, Hamid Reza; Bagheri, Sotoodeh; Abareghi, Mahsa


    In the present work, we demonstrate the results of a theoretical study concerned with the question how tautomerization and protonation of adenine affect the various properties of adenine-cytosine mismatches. The calculations, in gas phase and in water, are performed at B3LYP/6-311++G(d,p) level. In gas phase, it is observed that any tautomeric form of investigated mismatches is more stabilized when adenine is protonated. As for the neutral mismatches, the mismatches containing amino form of cytosine and imino form of protonated adenine are more stable. The role of aromaticity on the stability of tautomeric forms of mismatches is investigated by NICS(1)ZZ index. The stability of mispairs decreases by going from gas phase to water. It can be explained using dipole moment parameter. The influence of hydrogen bonds on the stability of mismatches is examined by atoms in molecules and natural bond orbital analyses. In addition to geometrical parameters and binding energies, the study of the topological properties of electron charge density aids in better understanding of these mispairs. PMID:26198186

  9. Adenine adsorption on Au(1 1 1) and Au(1 0 0) electrodes: Characterisation, surface reconstruction effects and thermodynamic study

    International Nuclear Information System (INIS)

    Adsorption of adenine on Au(1 1 1) and Au(1 0 0) electrodes is studied by cyclic voltammetry, impedance and chronoamperometric measurements in 0.1 M and 0.01 M KClO4 and in 0.5 M NaF solutions. The experiments performed with flame-annealed electrodes at different contact potentials, scan potential limits and scan rates, suggest different adsorption behaviour on the unreconstructed and reconstructed surface domains. This is confirmed by comparing the results obtained with electrochemically annealed unreconstructed and with flame-annealed reconstructed surfaces. In both cases the initial electrode surface state is characterised by the E pzc values. The adsorption on reconstructed surfaces takes place at more positive potentials than on the unreconstructed surfaces and induces the lifting of the reconstruction. The thermodynamic analysis is performed on the chronoamperometric data for adenine desorption on well characterised unreconstructed Au(1 1 1) surfaces. To this end a new methodology of the chronoamperometric experiments is introduced. Quantitative thermodynamic adsorption parameters such as surface tension, Gibbs surface excess, Gibbs energy of adsorption, potential versus Gibbs excess slope and electrosorption valency are determined. Weak chemisorption of adenine is inferred with a molecular orientation independent on the coverage and on the electrode potential. It is proposed that adsorbed adenine molecules adopt a tilted orientation at the surface to facilitate the coordination to the gold atoms

  10. Effects of Low-Molecular-Weight-Chitosan on the Adenine- Induced Chronic Renal Failure Ratsin vitro andin vivo

    Institute of Scientific and Technical Information of China (English)

    ZHI Xuan; HAN Baoqin; SUI Xianxian; HU Rui; LIU Wanshun


    Theeffects of low-molecular-weight-chitosan (LMWC) on chronic renal failure (CRF) rats induced by adenine were investigatedin vivoand in vitro. Chitosan were hydrolyzed using chitosanase at pH 6–7 and 37℃ for 24h to obtain LMWC.In vitro, the effect of LMWC on the proliferation of renal tubular epithelial cells (RTEC) showed that it had no cytotoxic effect and could promote cell growth. For theinvivo experiment, chronic renal failure rats induced by adenine were randomly divided into control group, Niaoduqing group, and high-, medium- and low-dose LMWC groups. For each group, we detected serum creatinine (SCR), blood urea nitrogen (BUN), and total superoxide dismutase (T-SOD), glutathione oxidase (GSH-Px) activities of renal tissue, and obtained the ratio of kidney weight/body weight, pathological changes of kidney. The levels of serum SCR, BUN were higher in the adenine-induced rats than those in the controlgroup, indicating that the rat chronic renal failure model worked successfully. The re-sults after treatment showed that LMWC could reduce the SCR and BUN levels and enhance the activities/levels of T-SOD and GSH-PX in kidney compared to control group. Histopathological examination revealed that adenine-induced renal alterations were restored by LMWC at three tested dosages, especially at the low dosage of 100mgkg−1d−1.

  11. Thermodynamic potential for the abiotic synthesis of Adenine, Cytosine, Guanine, Thymine, Uracil, Ribose, and Deoxyribose in hydrothermal systems


    Larowe, D. E.; Regnier, P.


    The thermodynamic potential for the abiotic synthesis of the five common nucleobases (adenine, cytosine, guanine, thymine, and uracil) and two monosaccharides (ribose and deoxyribose) from formaldehyde and hydrogen cyanide has been quantified under temperature, pressure, and bulk composition conditions that are representative of hydrothermal systems. The activities of the precursor molecules (formaldehyde and hydrogen cyanide) required to evaluate the thermodynamics of biomolecule synthesis w...

  12. Nicotinamide adenine dinucleotide assisted shape-controlled synthesis of catalytically active raspberry-like gold nanostructures

    International Nuclear Information System (INIS)

    Graphical abstract: A facile method was developed for the synthesis of raspberry-like Au nanostructure and it was used as an electrocatalyst for the oxidation of methanol and reduction of oxygen. - Highlights: • Raspberry-like gold nanostructures have been synthesized. • Nicotinamide adenine dinucleotide plays an important role in the synthesis. • Raspberry-like Au nanostructure has an excellent electrocatalytic activity in methanol oxidation and oxygen reduction. - Abstract: We describe the shape-controlled growth of raspberry-like gold (Au) nanostructures and their application in the electrochemical oxidation of methanol and reduction of oxygen. Nicotinamide adenine dinucleotide (NAD+) plays a vital role in the growth of raspberry-like Au nanostructures. The preferential adsorption of NAD+ onto the (011) facets of Au favors the growth of raspberry-like morphology. In the absence of NAD+, icosahedral Au nanostructures were obtained. The raspberry-like Au nanostructures have been characterized by UV-visible spectroscopy, X-ray diffraction (XRD), field emission scanning electron microscopy (FESEM), and electrochemical measurements. The FESEM image shows that the raspberry-like morphology has an average size of 170 nm. The spectral profile shows a broad band between 650 and 795 nm. Compared to Au nanoseeds and icosahedral Au nanostructures that were grown in the absence of NAD+, the raspberry-like morphology has excellent catalytic activity towards the electrochemical oxidation of methanol and reduction of oxygen. On the raspberry-like nanoparticle-based electrode, the oxidation of methanol was observed at 0.35 V in alkaline pH, and the reduction of oxygen was observed at -0.06 and -0.4 V in 0.1 M PBS. The electrochemical reduction of oxygen occurs in two steps: (i) reduction of oxygen to H2O2 and (ii) further reduction of electrogenerated H2O2 to water. The electrochemical performance of the raspberry-like nanostructure-based electrode is highly stable

  13. Pyridine Nucleotide Cycling and Control of Intracellular Redox State in Relation to Poly (ADP-Ribose) Polymerase Activity and Nuclear Localization of Glutathione during Exponential Growth of Arabidopsis Cells in Culture

    Institute of Scientific and Technical Information of China (English)

    Till K.Pellny; Vittoria Locato; Pedro Diaz Vivancos; Jelena Markovic; Laura De Gara; Federico V.Pallardó; Christine H.Foyer


    Pyridine nucleotides,ascorbate and glutathione are major redox metabolites in plant cells,with specific roles in cellular redox homeostasis and the regulation of the cell cycle.However,the regulation of these metabolite pools during exponential growth and their precise functions in the cell cycle remain to be characterized.The present analysis of the abundance of ascorbate,glutathione,and pyridine nucleotides during exponential growth of Arabidopsis cells in culture provides evidence for the differential regulation of each of these redox pools.Ascorbate was most abundant early in the growth cycle,but glutathione was low at this point.The cellular ascorbate to dehydroascorbate and reduced glutathione (GSH) to glutathione disulphide ratios were high and constant but the pyridine nucleotide pools were largely oxidized over the period of exponential growth and only became more reduced once growth had ceased.The glutathione pool increased in parallel with poly (ADP-ribose) polymerase (PARP) activities and with increases in the abundance of PARP1 and PARP2 mRNAs at a time of high cell cycle activity as indicated by transcriptome information.Marked changes in the intracellular partitioning of GSH between the cytoplasm and nucleus were observed.Extension of the exponential growth phase by dilution or changing the media led to increases in the glutathione and nicotinamide adenine dinucleotide,ox-idized form (NAD)-plus-nicotinamide adenine dinucleotide,reduced form (NADH) pools and to higher NAD/NADH ratios but the nicotinamide adenine dinucleotide phosphate,oxidized form (NADP)-plus-nicotinamide adenine dinucleotide phosphate,reduced form (NADPH) pool sizes,and NAPD/NADPH ratios were much less affected.The ascorbate,glutathi-one,and pyridine nucleotide pools and PARP activity decreased before the exponential growth phase ended.We concludethat there are marked changes in intracellular redox state during the growth cycle but that redox homeostasis is main-rained by interplay

  14. Identification of novel inhibitors of phospho-MurNAc-pentapeptide translocase MraY from library screening: Isoquinoline alkaloid michellamine B and xanthene dye phloxine B. (United States)

    Mihalyi, Agnes; Jamshidi, Shirin; Slikas, Justinas; Bugg, Timothy D H


    The National Cancer Institute (NCI) Diversity Set was screened for potential inhibitors of phospho-MurNAc-pentapeptide translocase MraY from Escherichia coli using a primary fluorescence enhancement assay, followed by a secondary radiochemical assay. One new MraY inhibitor was identified from this screen, a naphthylisoquinoline alkaloid michellamine B, which inhibited E. coli MraY (IC50 456μM) and Bacillus subtilis MraY (IC50 386μM), and which showed antimicrobial activity against B. subtilis (MIC 16μg/mL). Following an earlier report of halogenated fluoresceins identified from a combined MraY/MurG screen, three halogenated fluoresceins were tested as inhibitors of E. coli MraY and E. coli MurG, and phloxine B was identified as an inhibitor of E. coli MraY (IC50 32μM). Molecular docking of inhibitor structures against the structure of Aquifex aeolicus MraY indicates that phloxine B appears to bind to the Mg(2+) cofactor in the enzyme active site, while michellamine B binds to a hydrophobic groove formed between transmembrane helices 5 and 9. PMID:25127465

  15. Effects of nucleotides and nucleosides on coagulation

    DEFF Research Database (Denmark)

    Bune, Laurids; Thaning, Pia; Johansson, Pär I;


    Nucleotides, including ADP, ATP and uridine triphosphate (UTP), are discharged profusely in the circulation during many pathological conditions including sepsis. Sepsis can cause hypotension and systemic activation of the coagulation and fibrinolytic systems in humans, which may cause disseminate...

  16. Nucleotide excision repair in the test tube.

    NARCIS (Netherlands)

    N.G.J. Jaspers (Nicolaas); J.H.J. Hoeijmakers (Jan)


    textabstractThe eukaryotic nucleotide excision-repair pathway has been reconstituted in vitro, an achievement that should hasten the full enzymological characterization of this highly complex DNA-repair pathway.

  17. In vitro incorporation of LNA nucleotides. (United States)

    Veedu, Rakesh N; Vester, Birte; Wengel, Jesper


    An LNA modified nucleoside triphosphate 1 was synthesized in order to investigate its potential to act as substrate for DNA strand synthesis by polymerases. Primer extension assays for the incorporation experiments revealed that Phusion High Fidelity DNA polymerase is an efficient enzyme for incorporation of the LNA nucleotide and for extending strand to full length. It was also observed that pfu DNA polymerase could incorporate the LNA nucleotide but it failed to extend the strand to a full length product. PMID:18058567

  18. Analysis of Sequence Conservation at Nucleotide Resolution


    Asthana, Saurabh; Roytberg, Mikhail; Stamatoyannopoulos, John; Sunyaev, Shamil R.


    One of the major goals of comparative genomics is to understand the evolutionary history of each nucleotide in the human genome sequence, and the degree to which it is under selective pressure. Ascertainment of selective constraint at nucleotide resolution is particularly important for predicting the functional significance of human genetic variation and for analyzing the sequence substructure of cis-regulatory sequences and other functional elements. Current methods for analysis of sequence ...

  19. Regulation of mammalian nucleotide metabolism and biosynthesis. (United States)

    Lane, Andrew N; Fan, Teresa W-M


    Nucleotides are required for a wide variety of biological processes and are constantly synthesized de novo in all cells. When cells proliferate, increased nucleotide synthesis is necessary for DNA replication and for RNA production to support protein synthesis at different stages of the cell cycle, during which these events are regulated at multiple levels. Therefore the synthesis of the precursor nucleotides is also strongly regulated at multiple levels. Nucleotide synthesis is an energy intensive process that uses multiple metabolic pathways across different cell compartments and several sources of carbon and nitrogen. The processes are regulated at the transcription level by a set of master transcription factors but also at the enzyme level by allosteric regulation and feedback inhibition. Here we review the cellular demands of nucleotide biosynthesis, their metabolic pathways and mechanisms of regulation during the cell cycle. The use of stable isotope tracers for delineating the biosynthetic routes of the multiple intersecting pathways and how these are quantitatively controlled under different conditions is also highlighted. Moreover, the importance of nucleotide synthesis for cell viability is discussed and how this may lead to potential new approaches to drug development in diseases such as cancer. PMID:25628363

  20. Rigid Adenine Nucleoside Derivatives as Novel Modulators of the Human Sodium Symporters for Dopamine and Norepinephrine. (United States)

    Janowsky, Aaron; Tosh, Dilip K; Eshleman, Amy J; Jacobson, Kenneth A


    Thirty-two congeneric rigid adenine nucleoside derivatives containing a North (N)-methanocarba ribose substitution and a 2-arylethynyl group either enhanced (up to 760% of control) or inhibited [(125)I] methyl (1R,2S,3S)-3-(4-iodophenyl)-8-methyl-8-azabicyclo[3.2.1]octane-2-carboxylate (RTI-55) binding at the human dopamine (DA) transporter (DAT) and inhibited DA uptake. Several nucleosides also enhanced [(3)H]mazindol [(±)-5-(4-chlorophenyl)-3,5-dihydro-2H-imidazo[2,1-a]isoindol-5-ol] binding to the DAT. The combination of binding enhancement and functional inhibition suggests possible allosteric interaction with the tropanes. The structure-activity relationship of this novel class of DAT ligands was explored: small N(6)-substition (methyl or ethyl) was favored, while the N1 of the adenine ring was essential. Effective terminal aryl groups include thien-2-yl (compounds 9 and 16), with EC50 values of 35.1 and 9.1 nM, respectively, in [(125)I]RTI-55 binding enhancement, and 3,4-difluorophenyl as in the most potent DA uptake inhibitor (compound 6) with an IC50 value of 92 nM (3-fold more potent than cocaine), but not nitrogen heterocycles. Several compounds inhibited or enhanced binding at the norepinephrine transporter (NET) and serotonin transporter (SERT) and inhibited function in the micromolar range; truncation at the 4'-position in compound 23 allowed for weak inhibition of the SERT. We have not yet eliminated adenosine receptor affinity from this class of DAT modulators, but we identified modifications that remove DAT inhibition as an off-target effect of potent adenosine receptor agonists. Thus, we have identified a new class of allosteric DAT ligands, rigidified adenosine derivatives, and explored their initial structural requirements. They display a very atypical pharmacological profile, i.e., either enhancement by increasing affinity or inhibition of radioligand binding at the DAT, and in some cases the NET and SERT, and inhibition of neurotransmitter

  1. Rigid Adenine Nucleoside Derivatives as Novel Modulators of the Human Sodium Symporters for Dopamine and Norepinephrine (United States)

    Tosh, Dilip K.; Eshleman, Amy J.; Jacobson, Kenneth A.


    Thirty-two congeneric rigid adenine nucleoside derivatives containing a North (N)-methanocarba ribose substitution and a 2-arylethynyl group either enhanced (up to 760% of control) or inhibited [125I] methyl (1R,2S,3S)-3-(4-iodophenyl)-8-methyl-8-azabicyclo[3.2.1]octane-2-carboxylate (RTI-55) binding at the human dopamine (DA) transporter (DAT) and inhibited DA uptake. Several nucleosides also enhanced [3H]mazindol [(±)-5-(4-chlorophenyl)-3,5-dihydro-2H-imidazo[2,1-a]isoindol-5-ol] binding to the DAT. The combination of binding enhancement and functional inhibition suggests possible allosteric interaction with the tropanes. The structure-activity relationship of this novel class of DAT ligands was explored: small N6-substition (methyl or ethyl) was favored, while the N1 of the adenine ring was essential. Effective terminal aryl groups include thien-2-yl (compounds 9 and 16), with EC50 values of 35.1 and 9.1 nM, respectively, in [125I]RTI-55 binding enhancement, and 3,4-difluorophenyl as in the most potent DA uptake inhibitor (compound 6) with an IC50 value of 92 nM (3-fold more potent than cocaine), but not nitrogen heterocycles. Several compounds inhibited or enhanced binding at the norepinephrine transporter (NET) and serotonin transporter (SERT) and inhibited function in the micromolar range; truncation at the 4′-position in compound 23 allowed for weak inhibition of the SERT. We have not yet eliminated adenosine receptor affinity from this class of DAT modulators, but we identified modifications that remove DAT inhibition as an off-target effect of potent adenosine receptor agonists. Thus, we have identified a new class of allosteric DAT ligands, rigidified adenosine derivatives, and explored their initial structural requirements. They display a very atypical pharmacological profile, i.e., either enhancement by increasing affinity or inhibition of radioligand binding at the DAT, and in some cases the NET and SERT, and inhibition of neurotransmitter uptake

  2. Polymerization of amino acids containing nucleotide bases (United States)

    Ben Cheikh, Azzouz; Orgel, Leslie E.


    The nucleoamino acids 1-(3'-amino,3'-carboxypropyl)uracil (3) and 9-(3'-amino,3'-carboxypropyl)adenine (4) have been prepared as (L)-en-antiomers and as racemic mixtures. When 3 or 4 is suspended in water and treated with N,N'-carbon-yldiimidazole, peptides are formed in good yield. The products formed from the (L)-enantiomers are hydrolyzed to the monomeric amino acids by pronase. Attempts to improve the efficiency of these oligomerizations by including a polyuridylate template in the reaction mixture were not successful. Similarly, oligomers derived from the (L)-enantiomer of 3 did not act as templates to facilitate the oligomerization of 4.

  3. Actinides and rare earths complexation with adenosine phosphate nucleotides

    International Nuclear Information System (INIS)

    Organophosphorus compounds are important molecules in both nuclear industry and living systems fields. Indeed, several extractants of organophosphorus compounds (such as TBP, HDEHP) are used in the nuclear fuel cycle reprocessing and in the biological field. For instance, the nucleotides are organophosphates which play a very important role in various metabolic processes. Although the literature on the interactions of actinides with inorganic phosphate is abundant, published studies with organophosphate compounds are generally limited to macroscopic and / or physiological approaches. The objective of this thesis is to study the structure of several organophosphorus compounds with actinides to reach a better understanding and develop new specific buildings blocks. The family of the chosen molecules for this procedure consists of three adenine nucleotides mono, bi and triphosphate (AMP, adenosine monophosphate - ADP, adenosine diphosphate - ATP, adenosine triphosphate) and an amino-alkylphosphate (AEP O-phosphoryl-ethanolamine). Complexes synthesis was conducted in aqueous and weakly acidic medium (2.8-4) for several lanthanides (III) (Lu, Yb, Eu) and actinides (U (VI), Th (IV) and Am (III)). Several analytical and spectroscopic techniques have been used to describe the organization of the synthesized complexes: spectrometric analysis performed by FTIR and NMR were used to identify the functional groups involved in the complexation, analysis by ESI-MS and pH-metric titration were used to determine the solution speciation and EXAFS analyzes were performed on Mars beamline of the SOLEIL synchrotron, have described the local cation environment, for both solution and solid compounds. Some theoretical approaches of DFT were conducted to identify stable structures in purpose of completing the experimental studies. All solid complexes (AMP, ADP, ATP and AEP) have polynuclear structures, while soluble ATP complexes are mononuclear. For all synthesized complexes, it has been

  4. Three ways in, one way out: water dynamics in the trans-membrane domains of the inner membrane translocase AcrB. (United States)

    Fischer, Nadine; Kandt, Christian


    Powered by proton-motive force, the inner membrane translocase AcrB is the engine of the AcrAB-TolC efflux pump in Escherichia coli. As proton conduction in proteins occurs along hydrogen-bonded networks of polar residues and water molecules, knowledge of the protein-internal water distribution and water-interacting residues allows drawing conclusions to possible pathways of proton conduction. Here, we report a series of 6× 50 ns independent molecular dynamics simulations of asymmetric AcrB embedded in a phospholipid/water environment. Simulating each monomer in its proposed protonation state, we calculated for each trans-membrane domain the average water distribution, identified residues interacting with these waters and quantified each residue's frequency of water hydrogen bond contact. Combining this information we find three possible routes of proton transfer connecting a continuously hydrated region of known key residues in the TMD interior to bulk water by one cytoplasmic and up to three periplasm water channels in monomer B and A. We find that water access of the trans-membrane domains is regulated by four groups of residues in a combination of side chain re-orientations and shifts of trans-membrane helices. Our findings support a proton release event via Arg971 during the C intermediate or in the transition to A, and proton uptake occurring in the A or B state or during a so far unknown intermediate in between B and C where cytoplasmic water access is still possible. Our simulations suggest experimentally testable hypotheses, which have not been investigated so far. PMID:21905112

  5. Rosiglitazone increases fatty acid oxidation and fatty acid translocase (FAT/CD36) but not carnitine palmitoyltransferase I in rat muscle mitochondria (United States)

    Benton, Carley R; Holloway, Graham P; Campbell, S E; Yoshida, Yuko; Tandon, Narendra N; Glatz, Jan F C; Luiken, Joost J J F P; Spriet, Lawrence L; Bonen, Arend


    Peroxisome proliferator-activated receptors (PPARs) alter the expression of genes involved in regulating lipid metabolism. Rosiglitazone, a PPARγ agonist, induces tissue-specific effects on lipid metabolism; however, its mode of action in skeletal muscle remains unclear. Since fatty acid translocase (FAT/CD36) was recently identified as a possible regulator of skeletal muscle fatty acid transport and mitochondrial fatty acid oxidation, we examined in this tissue the effects of rosiglitazone infusion (7 days, 1 mg day−1) on FAT/CD36 mRNA and protein, its plasmalemmal content and fatty acid transport. In addition, in isolated subsarcolemmal (SS) and intermyofibrillar (IMF) mitochondria we examined rates of fatty acid oxidation, FAT/CD36 and carnitine palmitoyltransferase I (CPTI) protein, and CPTI and β-hydroxyacyl CoA dehydrogenase (β-HAD) activities. Rosiglitazone did not alter FAT/CD36 mRNA or protein expression, FAT/CD36 plasmalemmal content, or the rate of fatty acid transport into muscle (P > 0.05). In contrast, rosiglitazone increased the rates of fatty acid oxidation in both SS (+21%) and IMF mitochondria (+36%). This was accompanied by concomitant increases in FAT/CD36 in subsarcolemmal (SS) (+43%) and intermyofibrillar (IMF) mitochondria (+46%), while SS and IMF CPTI protein content, and CPTI submaximal and maximal activities (P > 0.05) were not altered. Similarly, citrate synthase (CS) and β-HAD activities were also not altered by rosiglitazone in SS and IMF mitochondria (P > 0.05). These studies provide another example whereby changes in mitochondrial fatty oxidation are associated with concomitant changes in mitochondrial FAT/CD36 independent of any changes in CPTI. Moreover, these studies identify for the first time a mechanism by which rosiglitazone stimulates fatty acid oxidation in skeletal muscle, namely the chronic, subcellular relocation of FAT/CD36 to mitochondria. PMID:18238811

  6. Proofreading of misincorporated nucleotides in DNA transcription. (United States)

    Voliotis, Margaritis; Cohen, Netta; Molina-París, Carmen; Liverpool, Tanniemola B


    The accuracy of DNA transcription is crucial for the proper functioning of the cell. Although RNA polymerases demonstrate selectivity for correct nucleotides, additional active mechanisms of transcriptional error correction are required to achieve observed levels of fidelity. Recent experimental findings have shed light on a particular mechanism of transcriptional error correction involving: (i) diffusive translocation of the RNA polymerase along the DNA (backtracking) and (ii) irreversible RNA cleavage. This mechanism achieves preferential cleavage of misincorporated nucleotides by biasing the local rates of translocation. Here, we study how misincorporated nucleotides affect backtracking dynamics and how this effect determines the level of transcriptional fidelity. We consider backtracking as a diffusive process in a periodic, one-dimensional energy landscape, which at a coarse-grained level gives rise to a hopping process between neighboring local minima. We propose a model for how misincorporated nucleotides deform this energy landscape and hence affect the hopping rates. In particular, we show that this model can be used to derive both the theoretical limit on the fidelity (i.e. the minimum fraction of misincorporated nucleotides) and the actual fidelity relative to this optimum, achieved for specific combinations of the cleavage and polymerization rates. Finally, we study how external factors influencing backtracking dynamics affect transcriptional fidelity. We show that biologically relevant loads, similar to those exerted by nucleosomes or other transcriptional barriers, increase error correction. PMID:22643861

  7. Conversion of adenine to 5-amino-4-pyrimidinylimidazole caused by acetyl capping during solid phase oligonucleotide synthesis. (United States)

    Rodriguez, Andrew A; Cedillo, Isaiah; McPherson, Andrew K


    The acetyl capping reaction used throughout solid phase oligonucleotide synthesis is meant to minimize n-1 deletionmer impurities by terminating sequences that fail to couple to a phosphoramidite. However, the reaction is also responsible for the formation of a number of impurities. One capping-related impurity has an additional mass of 98amu from the parent oligonucleotide. The n+98 amu impurity was found to result from modification of an adenine nucleobase. The structure of the impurity was determined by preparation of an oligonucleotide enriched in n+98 amu, enzymatic digestion to individual nucleosides, isolation of the pure nucleoside+98 amu species, crystallization, and X-ray crystallographic analysis. The n+98 amu impurity is an oligonucleotide in which one adenine residue has been converted to 5-amino-4-pyrimidinylimidazole. The mechanism of formation of the impurity was investigated, and a mechanism is proposed. PMID:27353533

  8. Adenine methylation in eukaryotes: Apprehending the complex evolutionary history and functional potential of an epigenetic modification. (United States)

    Iyer, Lakshminarayan M; Zhang, Dapeng; Aravind, L


    While N(6) -methyladenosine (m(6) A) is a well-known epigenetic modification in bacterial DNA, it remained largely unstudied in eukaryotes. Recent studies have brought to fore its potential epigenetic role across diverse eukaryotes with biological consequences, which are distinct and possibly even opposite to the well-studied 5-methylcytosine mark. Adenine methyltransferases appear to have been independently acquired by eukaryotes on at least 13 occasions from prokaryotic restriction-modification and counter-restriction systems. On at least four to five instances, these methyltransferases were recruited as RNA methylases. Thus, m(6) A marks in eukaryotic DNA and RNA might be more widespread and diversified than previously believed. Several m(6) A-binding protein domains from prokaryotes were also acquired by eukaryotes, facilitating prediction of potential readers for these marks. Further, multiple lineages of the AlkB family of dioxygenases have been recruited as m(6) A demethylases. Although members of the TET/JBP family of dioxygenases have also been suggested to be m(6) A demethylases, this proposal needs more careful evaluation. Also watch the Video Abstract. PMID:26660621

  9. Tools for DNA adenine methyltransferase identification analysis of nuclear organization during C. elegans development. (United States)

    Sharma, Rahul; Ritler, Dominic; Meister, Peter


    C. elegans has recently emerged as a valuable model to understand the link between nuclear organization and cell fate, by combining microscopy approaches, genome-wide mapping techniques with advanced genetics. Crucial to these analyses are techniques to determine the genome-wide interaction pattern of proteins with DNA. Chromatin immunoprecipitation has proven valuable but it requires considerable amounts of starting material. This is sometimes difficult to achieve, in particular for specific genotypes (balanced strains, different sexes, severe phenotypes…). As an alternative to ChIP, DNA adenine methyltransferase identification by sequencing (DamID-seq) was recently shown to be able to characterize binding sites in single mammalian cells. Additionally, DamID can be achieved for cell-type specific analysis by expressing Dam fusion proteins under tissue specific promoters in a controlled manner. In this report, we present a user-friendly pipeline to analyse DamID-seq data in C. elegans. Based upon this pipeline, we provide a comparative analysis of libraries generated with different starting material and discuss important library features. Moreover, we introduce an adaptation of an imaging based tool to visualize in vivo the cell-specific tridimensional binding pattern of any protein of interest. genesis 54:151-159, 2016. © 2016 Wiley Periodicals, Inc. PMID:26845390

  10. Magnitude of malate-aspartate reduced nicotinamide adenine dinucleotide shuttle activity in intact respiring tumor cells. (United States)

    Greenhouse, W V; Lehninger, A L


    Measurements of respiration, CO2 and lactate production, and changes in the levels of various key metabolites of the glycolytic sequence and tricarboxylic acid cycle were made on five lines of rodent ascites tumor cells (two strains of Ehrlich ascites tumor cells, Krebs II carcinoma, AS-30D carcinoma, and L1210 cells) incubated aerobically in the presence of uniformly labeled D-[14C]glucose. From these data, as well as earlier evidence demonstrating that the reduced nicotinamide adenine dinucleotide (NADH) shuttle in these cells requires a transaminase step and is thus identified as the malate-aspartate shuttle (W.V.V. Greenhouse and A.L. Lehninger, Cancer Res., 36: 1392-1396, 1976), metabolic flux diagrams were constructed for the five cell lines. These diagrams show the relative rates of glycolysis, the tricarboxylic acid cycle, electron transport, and the malate-aspartate shuttle in these tumors. Large amounts of cytosolic NADH were oxidized by the mitochondrial respiratory chain via the NADH shuttle, comprising anywhere from about 20 to 80% of the total flow of reducing equivalents to oxygen in these tumors. Calculations of the sources of energy for adenosine triphosphate synthesis indicated that on the average about one-third of the respiratory adenosine triphosphate is generated by electron flow originating from cytosolic NADH via the malate-aspartate shuttle. PMID:198130

  11. DNA adenine methylation is required to replicate both Vibrio cholerae chromosomes once per cell cycle.

    Directory of Open Access Journals (Sweden)

    Gaëlle Demarre


    Full Text Available DNA adenine methylation is widely used to control many DNA transactions, including replication. In Escherichia coli, methylation serves to silence newly synthesized (hemimethylated sister origins. SeqA, a protein that binds to hemimethylated DNA, mediates the silencing, and this is necessary to restrict replication to once per cell cycle. The methylation, however, is not essential for replication initiation per se but appeared so when the origins (oriI and oriII of the two Vibrio cholerae chromosomes were used to drive plasmid replication in E. coli. Here we show that, as in the case of E. coli, methylation is not essential for oriI when it drives chromosomal replication and is needed for once-per-cell-cycle replication in a SeqA-dependent fashion. We found that oriII also needs SeqA for once-per-cell-cycle replication and, additionally, full methylation for efficient initiator binding. The requirement for initiator binding might suffice to make methylation an essential function in V. cholerae. The structure of oriII suggests that it originated from a plasmid, but unlike plasmids, oriII makes use of methylation for once-per-cell-cycle replication, the norm for chromosomal but not plasmid replication.

  12. Probing the ATP Site of GRP78 with Nucleotide Triphosphate Analogs (United States)

    Chen, Yun; Lu, Hua; Pizarro, Juan C.; Park, Hee-Won


    GRP78, a member of the ER stress protein family, can relocate to the surface of cancer cells, playing key roles in promoting cell proliferation and metastasis. GRP78 consists of two major functional domains: the ATPase and protein/peptide-binding domains. The protein/peptide-binding domain of cell-surface GRP78 has served as a novel functional receptor for delivering cytotoxic agents (e.g., a apoptosis-inducing peptide or taxol) across the cell membrane. Here, we report our study on the ATPase domain of GRP78 (GRP78ATPase), whose potential as a transmembrane delivery system of cytotoxic agents (e.g., ATP-based nucleotide triphosphate analogs) remains unexploited. As the binding of ligands (ATP analogs) to a receptor (GRP78ATPase) is a pre-requisite for internalization, we determined the binding affinities and modes of GRP78ATPase for ADP, ATP and several ATP analogs using surface plasmon resonance and x-ray crystallography. The tested ATP analogs contain one of the following modifications: the nitrogen at the adenine ring 7-position to a carbon atom (7-deazaATP), the oxygen at the β-γ bridge position to a carbon atom (AMPPCP), or the removal of the 2’-OH group (2’-deoxyATP). We found that 7-deazaATP displays an affinity and a binding mode that resemble those of ATP regardless of magnesium ion (Mg++) concentration, suggesting that GRP78 is tolerant to modifications at the 7-position. By comparison, AMPPCP’s binding affinity was lower than ATP and Mg++-dependent, as the removal of Mg++ nearly abolished binding to GRP78ATPase. The AMPPCP-Mg++ structure showed evidence for the critical role of Mg++ in AMPPCP binding affinity, suggesting that while GRP78 is sensitive to modifications at the β-γ bridge position, these can be tolerated in the presence of Mg++. Furthermore, 2’-deoxyATP’s binding affinity was significantly lower than those for all other nucleotides tested, even in the presence of Mg++. The 2’-deoxyATP structure showed the conformation of the

  13. Probing the ATP Site of GRP78 with Nucleotide Triphosphate Analogs.

    Directory of Open Access Journals (Sweden)

    Scott J Hughes

    Full Text Available GRP78, a member of the ER stress protein family, can relocate to the surface of cancer cells, playing key roles in promoting cell proliferation and metastasis. GRP78 consists of two major functional domains: the ATPase and protein/peptide-binding domains. The protein/peptide-binding domain of cell-surface GRP78 has served as a novel functional receptor for delivering cytotoxic agents (e.g., a apoptosis-inducing peptide or taxol across the cell membrane. Here, we report our study on the ATPase domain of GRP78 (GRP78ATPase, whose potential as a transmembrane delivery system of cytotoxic agents (e.g., ATP-based nucleotide triphosphate analogs remains unexploited. As the binding of ligands (ATP analogs to a receptor (GRP78ATPase is a pre-requisite for internalization, we determined the binding affinities and modes of GRP78ATPase for ADP, ATP and several ATP analogs using surface plasmon resonance and x-ray crystallography. The tested ATP analogs contain one of the following modifications: the nitrogen at the adenine ring 7-position to a carbon atom (7-deazaATP, the oxygen at the β-γ bridge position to a carbon atom (AMPPCP, or the removal of the 2'-OH group (2'-deoxyATP. We found that 7-deazaATP displays an affinity and a binding mode that resemble those of ATP regardless of magnesium ion (Mg++ concentration, suggesting that GRP78 is tolerant to modifications at the 7-position. By comparison, AMPPCP's binding affinity was lower than ATP and Mg++-dependent, as the removal of Mg++ nearly abolished binding to GRP78ATPase. The AMPPCP-Mg++ structure showed evidence for the critical role of Mg++ in AMPPCP binding affinity, suggesting that while GRP78 is sensitive to modifications at the β-γ bridge position, these can be tolerated in the presence of Mg++. Furthermore, 2'-deoxyATP's binding affinity was significantly lower than those for all other nucleotides tested, even in the presence of Mg++. The 2'-deoxyATP structure showed the conformation of the

  14. Probing the ATP Site of GRP78 with Nucleotide Triphosphate Analogs. (United States)

    Hughes, Scott J; Antoshchenko, Tetyana; Chen, Yun; Lu, Hua; Pizarro, Juan C; Park, Hee-Won


    GRP78, a member of the ER stress protein family, can relocate to the surface of cancer cells, playing key roles in promoting cell proliferation and metastasis. GRP78 consists of two major functional domains: the ATPase and protein/peptide-binding domains. The protein/peptide-binding domain of cell-surface GRP78 has served as a novel functional receptor for delivering cytotoxic agents (e.g., a apoptosis-inducing peptide or taxol) across the cell membrane. Here, we report our study on the ATPase domain of GRP78 (GRP78ATPase), whose potential as a transmembrane delivery system of cytotoxic agents (e.g., ATP-based nucleotide triphosphate analogs) remains unexploited. As the binding of ligands (ATP analogs) to a receptor (GRP78ATPase) is a pre-requisite for internalization, we determined the binding affinities and modes of GRP78ATPase for ADP, ATP and several ATP analogs using surface plasmon resonance and x-ray crystallography. The tested ATP analogs contain one of the following modifications: the nitrogen at the adenine ring 7-position to a carbon atom (7-deazaATP), the oxygen at the β-γ bridge position to a carbon atom (AMPPCP), or the removal of the 2'-OH group (2'-deoxyATP). We found that 7-deazaATP displays an affinity and a binding mode that resemble those of ATP regardless of magnesium ion (Mg++) concentration, suggesting that GRP78 is tolerant to modifications at the 7-position. By comparison, AMPPCP's binding affinity was lower than ATP and Mg++-dependent, as the removal of Mg++ nearly abolished binding to GRP78ATPase. The AMPPCP-Mg++ structure showed evidence for the critical role of Mg++ in AMPPCP binding affinity, suggesting that while GRP78 is sensitive to modifications at the β-γ bridge position, these can be tolerated in the presence of Mg++. Furthermore, 2'-deoxyATP's binding affinity was significantly lower than those for all other nucleotides tested, even in the presence of Mg++. The 2'-deoxyATP structure showed the conformation of the bound

  15. The functional relationship between the Cdc50p-Drs2p putative aminophospholipid translocase and the Arf GAP Gcs1p in vesicle formation in the retrieval pathway from yeast early endosomes to the TGN.


    Sakane, Hiroshi; Yamamoto, Takaharu; Tanaka, Kazuma


    Drs2p, the catalytic subunit of the Cdc50p-Drs2p putative aminophospholipid translocase, has been implicated in conjunction with the Arf1 signaling pathway in the formation of clathrin-coated vesicles (CCVs) from the TGN. Herein, we searched for Arf regulator genes whose mutations were synthetically lethal with cdc50Δ, and identified the Arf GAP gene GCS1. Most of the examined transport pathways in the Cdc50p-depleted gcs1Δ mutant were nearly normal, including endocytic transport to vacuoles,...

  16. N-6-Adenine-Specific DNA Methyltransferase 1 (N6AMT1) Polymorphisms and Arsenic Methylation in Andean Women


    Harari, Florencia; Engström, Karin; Concha, Gabriela; Colque, Graciela; Vahter, Marie; Broberg, Karin


    BACKGROUND: In humans, inorganic arsenic is metabolized to methylated metabolites mainly by arsenic (+3 oxidation state) methyltransferase (AS3MT). AS3MT polymorphisms are associated with arsenic metabolism efficiency. Recently, a putative N-6-adenine-specific DNA methyltransferase 1 (N6AMT1) was found to methylate arsenic in vitro. OBJECTIVE: We evaluated the role of N6AMT1 polymorphisms in arsenic methylation efficiency in humans. METHODS: We assessed arsenic methylation efficiency in 188 w...

  17. N6-benzyl and phenyl substituted adenines and their use as cosmetics, pharmaceutical preparations and plant growth regulators


    Doležal, K. (Karel); Popa, I.; Holub, J.; Lenobel, R.; Werbrouck, S.; M. Strnad; Zatloukal, M.


    New heterocyclic derivatives based on N6-substituted adenine, having anticancer, mitotic, imunosuppressive and antisenescent propoerties for plant, animal and human cells and methods of their preparation. Included are also pharmaceutical compositions, cosmetic preparations and growth regulators, which contain these derivatives as active compound and the use of these derivatives for the preparation of drugs, cosmetic preparations, in biotechnological processes, in cosmetics and in agricu...

  18. Nicotinamide Adenine Dinucleotide Phosphate-Diaphorase (NADPH-d) Histochemistry Detecting NOS in Healthy and Chronically Inflamed Pulp


    Jukić, S.; Talan-Hranilović, J.; Buković, D.; Miletić, I.; Neziri, E.


    The aim of this study was to examine the expression of nicotinamide adenine dinucleotide phosphate-diaphorase (NADPH-d) activity in human dental pulps and determine whether there are changes of the activity in chronically inflamed pulp tissue. Nineteen pulps with clinical diagnosis of chronic pulpitis were collected during endodontic treatment. The healthy controls were obtained from teeth extracted for orthodontic therapy. The clinical diagnosis was confirmed by histological a...

  19. A novel twist on molecular interactions between thioredoxin and nicotinamide adenine dinucleotide phosphate-dependent thioredoxin reductase

    DEFF Research Database (Denmark)

    Kirkensgaard, Kristine Groth; Hägglund, Per; Shahpiri, Azar;


    The ubiquitous disulfide reductase thioredoxin (Trx) regulates several important biological processes such as seed germination in plants. Oxidized cytosolic Trx is regenerated by nicotinamide adenine dinucleotide phosphate (NADPH)-dependent thioredoxin reductase (NTR) in a multistep transfer of r....... Overall, the findings suggest that NTR:Trx interactions in different biological systems are fine-tuned by multiple intermolecular contacts. Proteins 2014; 82:607-619. (c) 2013 Wiley Periodicals, Inc....

  20. Dispensability of the [4Fe-4S] cluster in novel homologues of adenine glycosylase MutY. (United States)

    Trasviña-Arenas, Carlos H; Lopez-Castillo, Laura M; Sanchez-Sandoval, Eugenia; Brieba, Luis G


    7,8-Dihydro-8-deoxyguanine (8oG) is one of the most common oxidative lesions in DNA. DNA polymerases misincorporate an adenine across from this lesion. Thus, 8oG is a highly mutagenic lesion responsible for G:C→T:A transversions. MutY is an adenine glycosylase, part of the base excision repair pathway that removes adenines, when mispaired with 8oG or guanine. Its catalytic domain includes a [4Fe-4S] cluster motif coordinated by cysteinyl ligands. When this cluster is absent, MutY activity is depleted and several studies concluded that the [4Fe-4S] cluster motif is an indispensable component for DNA binding, substrate recognition and enzymatic activity. In the present study, we identified 46 MutY homologues that lack the canonical cysteinyl ligands, suggesting an absence of the [4Fe-4S] cluster. A phylogenetic analysis groups these novel MutYs into two different clades. One clade is exclusive of the order Lactobacillales and another clade has a mixed composition of anaerobic and microaerophilic bacteria and species from the protozoan genus Entamoeba. Structural modeling and sequence analysis suggests that the loss of the [4Fe-4S] cluster is compensated by a convergent solution in which bulky amino acids substitute the [4Fe-4S] cluster. We functionally characterized MutYs from Lactobacillus brevis and Entamoeba histolytica as representative members from each clade and found that both enzymes are active adenine glycosylases. Furthermore, chimeric glycosylases, in which the [4Fe-4S] cluster of Escherichia coli MutY is replaced by the corresponding amino acids of LbY and EhY, are also active. Our data indicates that the [4Fe-4S] cluster plays a structural role in MutYs and evidences the existence of alternative functional solutions in nature. PMID:26613369

  1. Long-term incorporation of tritiated adenine into deoxyribonucleic acid and ribonucleic acid by Treponema pallidum (Nichols strain).


    Norris, S J; Miller, J N; Sykes, J A


    Treponema pallidum (Nichols strain), extracted in medium containing Eagle minimal essential medium 50% fresh, heat-inactivated normal rabbit serum, and 1.0 mM dithiothreitol, was incubated under 3% oxygen in the presence of tritiated nucleic acid precursors. [8-3H]adenine was incorporated with high efficiency into trichloroacetic acid-insoluble material; 2'-deoxyadenosine and uridine were incorporated in lower quantities, and thymine and thymidine were not incorporated. Incorporation of [3H]a...

  2. Role of Nicotinamide Adenine Dinucleotide Phosphate–Reduced Oxidase Proteins in Pseudomonas aeruginosa–Induced Lung Inflammation and Permeability


    Fu, Panfeng; Mohan, Vijay; Mansoor, Syed; Tiruppathi, Chinnaswamy; Sadikot, Ruxana T.; Natarajan, Viswanathan


    Earlier studies indicated a role for reactive oxygen species (ROS) in host defense against Pseudomonas aeruginosa infection. However, the role of nicotinamide adenine dinucleotide phosphate–reduced (NADPH) oxidase (NOX) proteins and the mechanism of activation for NADPH oxidase in P. aeruginosa infection are not well-defined. Here, we investigated the role of NOX2 and NOX4 proteins in P. aeruginosa infection, ROS generation, and endothelial barrier function in murine lungs and in human lung m...

  3. Purification and characterization of the enzymes involved in nicotinamide adenine dinucleotide degradation by Penicillium brevicompactum NRC 829


    Ali, Thanaa Hamed; El-Ghonemy, Dina Helmy


    The present study was conducted to investigate a new pathway for the degradation of nicotinamide adenine dinucleotide (NAD) by Penicillium brevicompactum NRC 829 extracts. Enzymes involved in the hydrolysis of NAD, i.e. alkaline phosphatase, aminohydrolase and glycohydrolase were determined. Alkaline phosphatase was found to catalyse the sequential hydrolysis of two phosphate moieties of NAD molecule to nicotinamide riboside plus adenosine. Adenosine was then deaminated by aminohydrolase to i...

  4. Back Electron Transfer Suppresses the Periodic Length Dependence of DNA-mediated Charge Transport Across Adenine Tracts


    Genereux, Joseph C.; Augustyn, Katherine E.; Davis, Molly L.; Shao, Fangwei; Barton, Jacqueline K.


    DNA-mediated charge transport (CT) is exquisitely sensitive to the integrity of the bridging π-stack and is characterized by a shallow distance dependence. These properties are obscured by poor coupling between the donor/acceptor pair and the DNA bridge, or by convolution with other processes. Previously, we found a surprising periodic length dependence for the rate of DNA-mediated CT across adenine tracts monitored by 2-aminopurine fluorescence. Here we report a similar periodicity by monito...

  5. Complex formation of cadmium with sugar residues, nucleobases, phosphates, nucleotides, and nucleic acids. (United States)

    Sigel, Roland K O; Skilandat, Miriam; Sigel, Astrid; Operschall, Bert P; Sigel, Helmut


    Cadmium(II), commonly classified as a relatively soft metal ion, prefers indeed aromatic-nitrogen sites (e.g., N7 of purines) over oxygen sites (like sugar-hydroxyl groups). However, matters are not that simple, though it is true that the affinity of Cd(2+) towards ribose-hydroxyl groups is very small; yet, a correct orientation brought about by a suitable primary binding site and a reduced solvent polarity, as it is expected to occur in a folded nucleic acid, may facilitate metal ion-hydroxyl group binding very effectively. Cd(2+) prefers the guanine(N7) over the adenine(N7), mainly because of the steric hindrance of the (C6)NH(2) group in the adenine residue. This Cd(2+)-(N7) interaction in a guanine moiety leads to a significant acidification of the (N1)H meaning that the deprotonation reaction occurs now in the physiological pH range. N3 of the cytosine residue, together with the neighboring (C2)O, is also a remarkable Cd(2+) binding site, though replacement of (C2)O by (C2)S enhances the affinity towards Cd(2+) dramatically, giving in addition rise to the deprotonation of the (C4)NH(2) group. The phosphodiester bridge is only a weak binding site but the affinity increases further from the mono- to the di- and the triphosphate. The same also holds for the corresponding nucleotides. Complex stability of the pyrimidine-nucleotides is solely determined by the coordination tendency of the phosphate group(s), whereas in the case of purine-nucleotides macrochelate formation takes place by the interaction of the phosphate-coordinated Cd(2+) with N7. The extents of the formation degrees of these chelates are summarized and the effect of a non-bridging sulfur atom in a thiophosphate group (versus a normal phosphate group) is considered. Mixed ligand complexes containing a nucleotide and a further mono- or bidentate ligand are covered and it is concluded that in these species N7 is released from the coordination sphere of Cd(2+). In the case that the other ligand

  6. DNA synthesis and cell survival after X-irradiation of mammalian cells treated with caffeine or adenine

    International Nuclear Information System (INIS)

    The expression of the transient depression in the rate of DNA synthesis normally observed after exposure of randomly-dividing Chinese hamster V-79 or Chinese hamster CHO cells to ionizing radiation could be postponed by a post-irradiation treatment with 1.0 to 2.0 mM adenine or 1.5 mM caffeine. Caffeine may exert its effect by creating additional sites for replication in irradiated cells. Cells treated with caffeine or adenine for 2 or 4 hours after exposure to 3000 rad of 300 kVp X-rays exhibited depressed synthesis only after the removal of caffeine or adenine. These alterations in the timing of the X-ray-induced depression of the rate of DNA synthesis had no effect on X-ray-induced cell killing. Although a 4 hour post-irradiation treatment of randomly-dividing Chinese hamster V-79 cells with 1.0 or 2.0 mM caffeine potentiated X-ray-induced cell killing, this reduction in survival was due primarily to effects on cells not in S-phase. (author)

  7. Pyrrolidine analogues of nucleosides and nucleotides

    Czech Academy of Sciences Publication Activity Database

    Rejman, Dominik; Pohl, Radek; Kovačková, Soňa; Kočalka, Petr; Švenková, Alžběta; Šanderová, Hana; Krásný, Libor; Rosenberg, Ivan

    -, č. 52 (2008), s. 577-578. ISSN 0261-3166. [Joint Symposium of the International Roundtable on Nucleosides, Nucleotides and Nucleic Acids /18./ and the International Symposium on Nucleic Acid Chemistry /35./. Kyoto, 08.09.2008-12.09.2008] R&D Projects: GA MŠk(CZ) LC06077; GA MŠk 2B06065; GA MZd NR9138 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50200510; CEZ:AV0Z50520514 Keywords : pyrrolidine * nucleoside * nucleotide Subject RIV: CC - Organic Chemistry

  8. Determination of the major tautomeric form of the covalently modified adenine in the (+)-CC-1065-DNA adduct by 1H and 15N NMR studies

    International Nuclear Information System (INIS)

    (+)-CC-1065 is an extremely potent antitumor antibiotic produced by Streptomyces zelensis. The potent cytotoxic effects of the drug are thought to be due to the formation of a covalent adduct with DNA through N3 of adenine. Although the covalent linkage sites between (+)-CC-1065 and DNA have been determined, the tautomeric form of the covalently modified adenine in the (+)-CC-1065-DNA duplex adduct was not defined. The [6-15N]deoxyadenosine-labeled 12-mer duplex adduct was then studied by 1H and 15N NMR. One-dimensional NOE difference and two-dimensional NOESY 1H NMR experiments on the nonisotopically labeled 12-mer duplex adduct demonstrate that the 6-amino protons of the covalently modified adenine exhibit two signals at 9.19 and 9.08 ppm. Proton NMR experiments on the [6-15N]deoxyadenosine-labeled 12-mer duplex adduct show that the two resonance signals for adenine H6 observed on the nonisotopically labeled duplex adduct were split into doublets by the 15N nucleus with coupling constants of 91.3 Hz for non-hydrogen-bonded and 86.8 Hz for hydrogen-bonded amino protons. The authors conclude that the covalently modified adenine N6 of the (+)-CC-1065-12-mer duplex adduct is predominantly in the doubly protonated form, in which calculations predict that the C6-N6 bond is shortened and the positive charge is delocalized over the entire adenine molecule

  9. Preparation of a sol-gel-derived carbon nanotube ceramic electrode by microwave irradiation and its application for the determination of adenine and guanine

    Energy Technology Data Exchange (ETDEWEB)

    Abbaspour, Abdolkarim, E-mail: [Department of Chemistry, College of Sciences, Shiraz University, Shiraz, Fars 71456-85464 (Iran, Islamic Republic of); Ghaffarinejad, Ali [Department of Chemistry, College of Sciences, Shiraz University, Shiraz, Fars 71456-85464 (Iran, Islamic Republic of)


    In this study, microwave irradiation was used for the fast preparation (min) of a sol-gel-derived carbon nanotube ceramic electrode (MW-CNCE). For confirmation of the preparation of the ceramic by MW irradiation, Fourier transform infrared, X-ray diffraction spectra and scanning electron microscopy images of the produced ceramic were compared with those of conventional ceramic (which is produced by drying the ceramic in air for 48 h). The electrochemical behavior of MW-CNCE in nicotinamide adenine dinucleotide, L-cysteine, adenine and guanine was compared with that of a conventional sol-gel-derived carbon nanotube ceramic electrode (CNCE). In all systems, similar peak potentials and lower background currents were obtained with respect to CNCE. Finally, the MW-CNCE was used for the simultaneous determination of adenine and guanine using differential pulse voltammetry. The linear ranges of 0.1-10 and 0.1-20 muM were obtained for adenine and guanine, respectively. These results are comparable with some modified electrodes that have recently been reported for the determination of adenine and guanine, with the advantage that the proposed electrode did not contain modifier. In addition, the proposed electrode was successfully used for the oxidation of adenine and guanine in DNA, and the detection limit for this measurement was 0.05 mug mL{sup -1} DNA.

  10. A new microplatform based on titanium dioxide nanofibers/graphene oxide nanosheets nanocomposite modified screen printed carbon electrode for electrochemical determination of adenine in the presence of guanine. (United States)

    Arvand, Majid; Ghodsi, Navid; Zanjanchi, Mohammad Ali


    The current techniques for determining adenine have several shortcomings such as high cost, high time consumption, tedious pretreatment steps and the requirements for highly skilled personnel often restrict their use in routine analytical practice. This paper describes the development and utilization of a new nanocomposite consisting of titanium dioxide nanofibers (TNFs) and graphene oxide nanosheets (GONs) for screen printed carbon electrode (SPCE) modification. The synthesized GONs and TNFs were characterized by transmission electron microscopy (TEM), scanning electron microscopy (SEM), X-ray diffraction (XRD) and Fourier transform infrared spectroscopy (FT-IR). The modified electrode (TNFs/GONs/SPCE) was used for electrochemical characterization of adenine. The TNFs/GONs/SPCE exhibited an increase in peak current and the electron transfer kinetics and decrease in the overpotential for the oxidation reaction of adenine. Using differential pulse voltammetry (DPV), the prepared sensor showed good sensitivity for determining adenine in two ranges from 0.1-1 and 1-10 μM, with a detection limit (DL) of 1.71 nM. Electrochemical studies suggested that the TNFs/GONs/SPCE provided a synergistic augmentation on the voltammetric behavior of electrochemical oxidation of adenine, which was indicated by the improvement of anodic peak current and a decrease in anodic peak potential. The amount of adenine in pBudCE4.1 plasmid was determined via the proposed sensor and the result was in good compatibility with the sequence data of pBudCE4.1 plasmid. PMID:26556182

  11. Three new double-headed nucleotides with additional nucleobases connected to C-5 of pyrimidines; synthesis, duplex and triplex studies. (United States)

    Kumar, Pawan; Sharma, Pawan K; Hansen, Jonas; Jedinak, Lukas; Reslow-Jacobsen, Charlotte; Hornum, Mick; Nielsen, Poul


    In the search for double-coding DNA-systems, three new pyrimidine nucleosides, each coded with an additional nucleobase anchored to the major groove face, are synthesized. Two of these building blocks carry a thymine at the 5-position of 2'-deoxyuridine through a methylene linker and a triazolomethylene linker, respectively. The third building block carries an adenine at the 6-position of pyrrolo-2'-deoxycytidine through a methylene linker. These double-headed nucleosides are introduced into oligonucleotides and their effects on the thermal stabilities of duplexes are studied. All studied double-headed nucleotide monomers reduce the thermal stability of the modified duplexes, which is partially compensated by using consecutive incorporations of the modified monomers or by flanking the new double-headed analogs with members of our former series containing propyne linkers. Also their potential in triplex-forming oligonucleotides is studied for two of the new double-headed nucleotides as well as the series of analogs with propyne linkers. The most stable triplexes are obtained with single incorporations of additional pyrimidine nucleobases connected via the propyne linker. PMID:26778611

  12. Palindromic-nucleotide substitutions (PNS) of hepatitis C virus genotypes 1 and 5a from South Africa. (United States)

    Prabdial-Sing, N; Giangaspero, M; Puren, A J; Mahlangu, J; Barrow, P; Bowyer, S M


    The HCV stem-loop subdomains III-a, -b and -c have been shown to reflect the characteristics of the virus and identify isolates by genus, genotype and subtype. The aim of this study was to investigate the genotype-specific PNS within the 5'UTR of prevalent HCV genotypes (1 and 5a) found in South Africa. The genotype 5a (N = 35) and genotype 1 sequences (N=20) were from patients presenting with liver disease or haemophilia, respectively. PNS HCV typing characteristics, defined previously, were observed. The PNS method differentiated subtypes 1a and 1c from subtype 1b by the base change at nucleotide position 243. A lack of structural data from the variable loci V1 of the 5'UTR did not allow us to further differentiate the subtypes of 1. A nucleotide change from a thymine (T) to a cytosine (C) at position 183 was found among genotype 5a sequences. This mutation changed the stable U-AA bond to a Y AA bulge at base-pair position 32. There was an insertion of a single adenine (A) at position 207. At present PNS analysis is labour intensive but, with development of further software to aid the computer analysis, it has the potential to provide a rapid, reliable alternative to phylogenetic analysis. PMID:21600241

  13. 腺嘌呤致不同性别大鼠骨质疏松的差异%Sex Difference in Osteopenia Induced by Adenine in Rats

    Institute of Scientific and Technical Information of China (English)

    小切间猛史; 田野香; 金原正幸; 高明; 王晓明; 郭义; 张艳军; 郭利平; 石田寅夫


    Adenine, which is common and essential to creatures, is widely used in clinical field. However,abundance of adenine is harmful to the living body. So far the male animals have been used for the research on adenine influence. In male rats, feeding of adenine-rich diet induces renal failure. Because of very few studies of adenine influence to female animals, we investigated the influence of adenine treatment between male and female rats and discussed the sex difference on adenine treatment. Young male and female rats were administrated each adjusted adenine (6, 50 and 100 mg/mL) for 8 weeks (3 times/week). In male rats, the renal failure was induced by 100 mg/mL adenine treatment and renal dysfunction was induced by 50 mg/mL adenine treatment. In female rats, however renal dysfunction was induced by 100 mg/mL group only, and that was somewhat different compared to that in male rats.Serum testosterone level and BMD in male rats were decreased by adenine treatment with or without renal dysfunction. On the contrary, serum 17-beta estradiol level and BMD in female rats were not affected by adenine treatment at all regardless of renal dysfunction. As abovementioned, this study could shed light on adenine effect on bone metabolism through sex hormone synthesis. Adenine is commonly contained in clinical medicines and general food. Abundant ingestion of nucleic acid including adenine may affect the internal secretion function.%肌酸尿时多见而又为主要病因的腺嘌呤广泛地应用于临床,但是腺嘌呤过多对人体是有害的.到目前为止,只有应用雄性动物研究腺嘌呤影响的报告.在雄鼠发现喂饲富含腺嘌呤的饲料会引起肾衰竭.由于腺嘌呤对雌性动物的影响的报告还甚少,本实验研究了腺嘌呤处理对不同性别大鼠的影响,并进行了讨论.年轻雄性和雌性大鼠分别给与一种预定浓度的腺嘌呤(6、60及100mg/mL)共8周(3次/周).结果100mg/mL腺嘌呤处理能引起雄鼠肾衰,50mg/m

  14. Nicotinamide adenine dinucleotide assisted direct electrodeposition of gold nanodendrites and its electrochemical applications

    International Nuclear Information System (INIS)

    The shape tailoring in gold (Au) nanostructures is vital for tuning their optical and catalytic properties. Herein, we describe nicotinamide adenine dinucleotide (NAD+) assisted direct electrochemical growth of surface-confined Au nanodendrites as well as the application of these nanodendrites in the non-enzymatic detection of glucose in neutral pH and the oxidation of methanol in alkaline pH. NAD+ plays an important role in the growth of Au nanodendrites. The specific adsorption of NAD+ onto the Au (011) facet aids in the growth of Au nanodendrites. In the absence of NAD+, interconnected wall-like morphology is obtained. The Au nanodendrites are characterized by UV–visible spectroscopy, X-ray diffraction (XRD), field emission scanning electron microscopy (FESEM), transmission electron microscopy (TEM) and electrochemical methods. FESEM and TEM analysis confirm that the Au nanostructures are dendritic, consisting of a trunk from which several branches evolve; the presence of NAD+ in the supporting electrolyte solution plays a vital role in the evolution of this morphology. The electrode based on Au dendrites has an electrochemically accessible surface area of 0.281 cm2 and shows excellent electrocatalytic activity for both glucose and methanol. In alkaline pH, the Au nanodendrite-based electrode oxidized methanol at 0.3 V with a highly-stable response. This electrode oxidizes glucose at 0.4 V in neutral pH without the use of enzymes. The sensitivity and limit of detection of the electrode are calculated to be 0.037 ± 0.02 μA mM−1 cm−2 and 7.29 μM (S/N = 3), respectively. The surface morphology of the Au nanostructure plays an important role in the electrocatalytic performance

  15. Electrochemical oxidation of dihydronicotinamide adenine dinucleotide at nitrogen-doped carbon nanotube electrodes. (United States)

    Goran, Jacob M; Favela, Carlos A; Stevenson, Keith J


    Nitrogen-doped carbon nanotubes (N-CNTs) substantially lower the overpotential necessary for dihydronicotinamide adenine dinucleotide (NADH) oxidation compared to nondoped CNTs or traditional carbon electrodes such as glassy carbon (GC). We observe a 370 mV shift in the peak potential (Ep) from GC to CNTs and another 170 mV shift from CNTs to 7.4 atom % N-CNTs in a sodium phosphate buffer solution (pH 7.0) with 2.0 mM NADH (scan rate 10 mV/s). The sensitivity of 7.4 atom % N-CNTs to NADH was measured at 0.30 ± 0.04 A M(-1) cm(-2), with a limit of detection at 1.1 ± 0.3 μM and a linear range of 70 ± 10 μM poised at a low potential of -0.32 V (vs Hg/Hg2SO4). NADH fouling, known to occur to the electrode surface during NADH oxidation, was investigated by measuring both the change in Ep and the resulting loss of electrode sensitivity. NADH degradation, known to occur in phosphate buffer, was characterized by absorbance at 340 nm and correlated with the loss of NADH electroactivity. N-CNTs are further demonstrated to be an effective platform for dehydrogenase-based biosensing by allowing glucose dehydrogenase to spontaneously adsorb onto the N-CNT surface and measuring the resulting electrode's sensitivity to glucose. The glucose biosensor had a sensitivity of 0.032 ± 0.003 A M(-1) cm(-2), a limit of detection at 6 ± 1 μM, and a linear range of 440 ± 50 μM. PMID:23991631

  16. Mitochondrial long chain fatty acid oxidation, fatty acid translocase/CD36 content and carnitine palmitoyltransferase I activity in human skeletal muscle during aerobic exercise (United States)

    Holloway, Graham P; Bezaire, Veronic; Heigenhauser, George J F; Tandon, Narendra N; Glatz, Jan F C; Luiken, Joost J F P; Bonen, Arend; Spriet, Lawrence L


    Mitochondrial fatty acid transport is a rate-limiting step in long chain fatty acid (LCFA) oxidation. In rat skeletal muscle, the transport of LCFA at the level of mitochondria is regulated by carnitine palmitoyltransferase I (CPTI) activity and the content of malonyl-CoA (M-CoA); however, this relationship is not consistently observed in humans. Recently, fatty acid translocase (FAT)/CD36 was identified on mitochondria isolated from rat and human skeletal muscle and found to be involved in LCFA oxidation. The present study investigated the effects of exercise (120 min of cycling at ∼60% V̇O2peak) on CPTI palmitoyl-CoA and M-CoA kinetics, and on the presence and functional significance of FAT/CD36 on skeletal muscle mitochondria. Whole body fat oxidation rates progressively increased during exercise (P < 0.05), and concomitantly M-CoA inhibition of CPTI was progressively attenuated. Compared to rest, 120 min of cycling reduced (P < 0.05) the inhibition of 0.7, 2, 5 and 10 μm M-CoA by 16%, 21%, 30% and 34%, respectively. Whole body fat oxidation and palmitate oxidation rates in isolated mitochondria progressively increased (P < 0.05) during exercise, and were positively correlated (r = 0.78). Mitochondrial FAT/CD36 protein increased by 63% (P < 0.05) during exercise and was significantly (P < 0.05) correlated with mitochondrial palmitate oxidation rates at all time points (r= 0.41). However, the strongest (P < 0.05) correlation was observed following 120 min of cycling (r= 0.63). Importantly, the addition of sulfo-N-succimidyloleate, a specific inhibitor of FAT/CD36, reduced mitochondrial palmitate oxidation to ∼20%, indicating FAT/CD36 is functionally significant with respect to LCFA oxidation. We hypothesize that exercise-induced increases in fatty acid oxidation occur as a result of an increased ability to transport LCFA into mitochondria. We further suggest that decreased CPTI M-CoA sensitivity and increased mitochondrial FAT/CD36 protein are both

  17. Measurements of single nucleotide electronic states as nanoelectronic fingerprints for identification of DNA nucleobases, their protonated and unprotonated states, isomers, and tautomers. (United States)

    Ribot, Josep Casamada; Chatterjee, Anushree; Nagpal, Prashant


    Several nanoelectronic techniques have been explored to distinguish the sequence of nucleic acids in DNA macromolecules. Identification of unique electronic signatures using nanopore conductance, tunneling spectroscopy, or other nanoelectronic techniques depends on electronic states of the DNA nucleotides. While several experimental and computational studies have focused on interaction of nucleobases with different substrates, the effect of nucleic acid biochemistry on its electronic properties has been largely unexplored. Here, we present correlated measurements of frontier molecular orbitals and higher-order electronic states for four DNA nucleobases (adenine, cytosine, thymine, and guanine), and first-principle quantum chemical density functional theoretical (DFT) computations. Using different pH conditions in our experiments, we show that small changes in the biochemical state of these nucleic acids strongly affect the intrinsic electronic structure, measured using scanning tunneling spectroscopy (STS). In our experimental measurements and computations, significant differences were observed between the position of frontier orbitals and higher-energy states between protonated and unprotonated nucleic acids, isomers, and different keto-enol tautomer's formed in these nucleotides, leading to their facile identification. Furthermore, we show unique "electronic fingerprints" for all nucleotides (A, G, T, C) using STS, with most distinct states identified at acidic pH. These results can have important implications for identification of nucleic acid sequences in DNA molecules using a high-throughput nanoelectronic identification technique. PMID:25793310

  18. Clay catalysis of oligonucleotide formation: kinetics of the reaction of the 5'-phosphorimidazolides of nucleotides with the non-basic heterocycles uracil and hypoxanthine (United States)

    Kawamura, K.; Ferris, J. P.


    The montmorillonite clay catalyzed condensation of activated monocleotides to oligomers of RNA is a possible first step in the formation of the proposed RNA world. The rate constants for the condensation of the phosphorimidazolide of adenosine were measured previously and these studies have been extended to the phosphorimidazolides of inosine and uridine in the present work to determine of substitution of neutral heterocycles for the basic adenine ring changes the reaction rate or regioselectivity. The oligomerization reactions of the 5'-phosphoromidazolides of uridine (ImpU) and inosine (ImpI) on montmorillonite yield oligo(U)s and oligo(I)s as long as heptamers. The rate constants for oligonucleotide formation were determined by measuring the rates of formation of the oligomers by HPLC. Both the apparent rate constants in the reaction mixture and the rate constants on the clay surface were calculated using the partition coefficients of the oligomers between the aqueous and clay phases. The rate constants for trimer formation are much greater than those dimer synthesis but there was little difference in the rate constants for the formation of trimers and higher oligomers. The overall rates of oligomerization of the phosphorimidazolides of purine and pyrimidine nucleosides in the presence of montmorillonite clay are the same suggesting that RNA formed on the primitive Earth could have contained a variety of heterocyclic bases. The rate constants for oligomerization of pyrimidine nucleotides on the clay surface are significantly higher than those of purine nucleotides since the pyrimidine nucleotides bind less strongly to the clay than do the purine nucleotides. The differences in the binding is probably due to Van der Waals interactions between the purine bases and the clay surface. Differences in the basicity of the heterocyclic ring in the nucleotide have little effect on the oligomerization process.

  19. Pyrrolidine nucleotides conformationally constrained via hydrogen bonding

    Czech Academy of Sciences Publication Activity Database

    Pohl, Radek; Poštová Slavětínská, Lenka; Rejman, Dominik

    Praha : Institute of Organic Chemistry and Biochemistry AS CR, v. v. i, 2014 - (Hocek, M.), s. 352-353 ISBN 978-80-86241-50-0. - (Collection Symposium Series. 14). [Symposium on Chemistry of Nucleic Acid Components /16./. Český Krumlov (CZ), 08.06.2014-13.06.2014] R&D Projects: GA ČR GA13-24880S Institutional support: RVO:61388963 Keywords : pyrrolidine nucleotides * PMEA * hydrogen bond Subject RIV: CC - Organic Chemistry

  20. Pyrrolidine nucleotide analogs with a tunable conformation

    Czech Academy of Sciences Publication Activity Database

    Poštová Slavětínská, Lenka; Rejman, Dominik; Pohl, Radek


    Roč. 10, Aug 22 (2014), s. 1967-1980. ISSN 1860-5397 R&D Projects: GA ČR GA13-24880S Institutional support: RVO:61388963 Keywords : conformation * NMR * nucleic acids * nucleotide analog * phosphonic acid * pseudorotation * pyrrolidine Subject RIV: CC - Organic Chemistry Impact factor: 2.762, year: 2014

  1. Nucleotide Manipulatives to Illustrate the Central Dogma

    Directory of Open Access Journals (Sweden)

    Sonja B. Yung


    Full Text Available The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.

  2. Nucleotide Manipulatives to Illustrate the Central Dogma†


    Sonja B. Yung; Todd P. Primm


    The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.

  3. TGF- β /NF1/Smad4-mediated suppression of ANT2 contributes to oxidative stress in cellular senescence

    Czech Academy of Sciences Publication Activity Database

    Kretová, M.; Sabová, L.; Hodný, Zdeněk; Bartek, Jiří; Kollárovič, G.; Nelson, B. D.; Hubáčková, Soňa; Luciaková, K.


    Roč. 26, č. 12 (2014), s. 2903-2911. ISSN 0898-6568 R&D Projects: GA ČR GA13-17658S; GA ČR GA13-17555S Grant ostatní: Slovak Grant Agency VEGA(SK) [2/0107/11; Academy of Sciences of the Czech Republic(CZ) L200521301 Institutional support: RVO:68378050 Keywords : Smad * Nuclear factor 1 * Senescence * Adenine nucleotide translocase-2 * Transforming growth factor- β * Oxidative stress Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.315, year: 2014

  4. TGF-β/NF1/Smad4-mediated suppression of ANT2 contributes to oxidative stress in cellular senescence

    Czech Academy of Sciences Publication Activity Database

    Kretová, M.; Šabová, L.; Hodný, Zdeněk; Bartek, Jiří; Kollárovič, G.; Nelson, B. D.; Hubáčková, Soňa; Luciaková, K.


    Roč. 26, č. 12 (2014), s. 2903-2911. ISSN 0898-6568 R&D Projects: GA ČR GA13-17658S; GA ČR GA13-17555S Grant ostatní: Slovak Grant Agency(SK) VEGA [2/0107/11] Institutional support: RVO:68378050 Keywords : Smad * Nuclear factor 1 * Senescence * Adenine nucleotide translocase-2 * Transforming growth factor-β * Oxidative stress Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.315, year: 2014

  5. Autoradiographic study on the incorporation of carbon-14 labeled formate and adenine into nucleic acid in blood-forming cells

    International Nuclear Information System (INIS)

    The incorporation of [14C]formate and [8-14C]adenine into nucleic acid in blood-forming cells was studied by the autoradiographic technique. The isotopic markers were injected subcutaneously into young rats weighting from 100 to 150 g three times every 24 hours and the animals were examined 3 hours after the last injection. In the case of [14C]formate injection, erythroblasts exhibited extremely strong labeling in contrast to weaker labeling of other blood-forming cells. In the case of [14C]adenine administration, on the other hand, immature cells of the granuclocytic series as well as immature reticulum cells (proliferating cells of reticular tissue) were much more heavily labeled than were other blood-forming cells, particularly the erythroblasts which revealed weak or no labeling. By digestion or extraction of DNA, RNA or both from cells with DNase, RNase or hot 10% perchloric acid treatment, respectively, it was confirmed that the observed heavy labeling of any type of cells with either [14C]formate or [14C]adenine was due chiefly to incorporation of the radioactive materials into nuclear DNA. The present results are discussed together with the findings of earlier studies on lymphoid cells which indicate that, in certain cell types, the patterns of [3H]deoxycytidine labeling differ considerably from the corresponding patterns of [3H]deoxycytidine labeling. The present and earlier findings provide evidence to substantiate that, among blood-forming cells, there are considerable variations in the labeling patterns of nuclear DNA depending on differences in the radioactive DNA precursors used as well as in the cell types. (author)

  6. Multiple Decay Mechanisms and 2D-UV Spectroscopic Fingerprints of Singlet Excited Solvated Adenine-Uracil Monophosphate. (United States)

    Li, Quansong; Giussani, Angelo; Segarra-Martí, Javier; Nenov, Artur; Rivalta, Ivan; Voityuk, Alexander A; Mukamel, Shaul; Roca-Sanjuán, Daniel; Garavelli, Marco; Blancafort, Lluís


    The decay channels of singlet excited adenine uracil monophosphate (ApU) in water are studied with CASPT2//CASSCF:MM potential energy calculations and simulation of the 2D-UV spectroscopic fingerprints with the aim of elucidating the role of the different electronic states of the stacked conformer in the excited state dynamics. The adenine (1) La state can decay without a barrier to a conical intersection with the ground state. In contrast, the adenine (1) Lb and uracil S(U) states have minima that are separated from the intersections by sizeable barriers. Depending on the backbone conformation, the CT state can undergo inter-base hydrogen transfer and decay to the ground state through a conical intersection, or it can yield a long-lived minimum stabilized by a hydrogen bond between the two ribose rings. This suggests that the (1) Lb , S(U) and CT states of the stacked conformer may all contribute to the experimental lifetimes of 18 and 240 ps. We have also simulated the time evolution of the 2D-UV spectra and provide the specific fingerprint of each species in a recommended probe window between 25 000 and 38 000 cm(-1) in which decongested, clearly distinguishable spectra can be obtained. This is expected to allow the mechanistic scenarios to be discerned in the near future with the help of the corresponding experiments. Our results reveal the complexity of the photophysics of the relatively small ApU system, and the potential of 2D-UV spectroscopy to disentangle the photophysics of multichromophoric systems. PMID:27113273

  7. Photochemical decoration of gold nanoparticles on polymer stabilized magnetic microspheres for determination of adenine by surface-enhanced Raman spectroscopy

    International Nuclear Information System (INIS)

    Magnetic microspheres decorated with gold nanoparticles (AuNPs) were prepared and used for the determination of adenine by surface-enhanced Raman scattering (SERS). Magnetic particles were first synthesized by coprecipitation of solutions containing iron(II) and iron(III) ions with ammonium hydroxide. Subsequently, the magnetic particles were suspended into a solution of poly(divinylbenzene-co-methyl methacrylate) to yield polymer-stabilized magnetic microspheres. These were further decorated with AuNPs via a new photochemical reduction method. The magnetic microspheres were characterized by XRD patterns and SEM images. They are shown to represent highly SERS-active substrates by giving an enhancement by almost 7 orders of magnitude compared to conventional Raman spectroscopy. Several factors that affect the photochemical reduction to form the AuNPs were examined. It is found that the concentration of gold ion, UV irradiation time, and citrate concentration have more impact on the reaction rate than on the morphologies of the AuNPs. The gold-decorated magnetic microspheres are highly stable in aqueous solution and capable of concentrating nucleobases. A linear response of the SERS signal to adenine in concentrations up to 10 μM is found, with a linear regression coefficient of 0.997. The detection limit is estimated to a few hundreds of nM (at an SNR of 3). Based on its specific Raman peak at 734 cm−1, adenine can be selectively determined without interference by other nucleobases, and a recovery higher than 95 % could be obtained. (author)

  8. Visualization of cyclic nucleotide dynamics in neurons

    Directory of Open Access Journals (Sweden)

    Kirill eGorshkov


    Full Text Available The second messengers cAMP and cGMP transduce many neuromodulatory signals from hormones and neurotransmitters into specific functional outputs. Their production, degradation and signaling are spatiotemporally regulated to achieve high specificity in signal transduction. The development of genetically encodable fluorescent biosensors has provided researchers with useful tools to study these versatile second messengers and their downstream effectors with unparalleled spatial and temporal resolution in cultured cells and living animals. In this review, we introduce the general design of these fluorescent biosensors and describe several of them in more detail. Then we discuss a few examples of using cyclic nucleotide fluorescent biosensors to study regulation of neuronal function and finish with a discussion of advances in the field. Although there has been significant progress made in understanding how the specific signaling of cyclic nucleotide second messengers is achieved, the mechanistic details in complex cell types like neurons are only just beginning to surface. Current and future fluorescent protein reporters will be essential to elucidate the role of cyclic nucleotide signaling dynamics in the functions of individual neurons and their networks.

  9. Multiphasic interactions between nucleotides and target proteins

    CERN Document Server

    Nissen, Per


    The nucleotides guanosine tetraphosphate (ppGpp) and guanosine pentaphosphate (pppGpp) bind to target proteins to promote bacterial survival (Corrigan et al. 2016). Thus, the binding of the nucleotides to RsgA, a GTPase, inhibits the hydrolysis of GTP. The dose response, taken to be curvilinear with respect to the logarithm of the inhibitor concentration, is instead much better (P<0.001 when the 6 experiments are combined) represented as multiphasic, with high to exceedingly high absolute r values for the straight lines, and with transitions in the form of non-contiguities (jumps). Profiles for the binding of radiolabeled nucleotides to HprT and Gmk, GTP synthesis enzymes, were, similarly, taken to be curvilinear with respect to the logarithm of the protein concentration. However, the profiles are again much better represented as multiphasic than as curvilinear (the P values range from 0.047 to <0.001 for each of the 8 experiments for binding of ppGpp and pppGpp to HprT). The binding of GTP to HprT and ...

  10. The GC-Rich Mitochondrial and Plastid Genomes of the Green Alga Coccomyxa Give Insight into the Evolution of Organelle DNA Nucleotide Landscape

    Energy Technology Data Exchange (ETDEWEB)

    Smith, David Roy; Burki, Fabien; Yamada, Takashi; Grimwood, Jane; Grigoriev, Igor V.; Van Etten, James L.; Keeling, Patrick J.


    Most of the available mitochondrial and plastid genome sequences are biased towards adenine and thymine (AT) over guanine and cytosine (GC). Examples of GC-rich organelle DNAs are limited to a small but eclectic list of species, including certain green algae. Here, to gain insight in the evolution of organelle nucleotide landscape, we present the GC-rich mitochondrial and plastid DNAs from the trebouxiophyte green alga Coccomyxa sp. C-169. We compare these sequences with other GC-rich organelle DNAs and argue that the forces biasing them towards G and C are nonadaptive and linked to the metabolic and/or life history features of this species. The Coccomyxa organelle genomes are also used for phylogenetic analyses, which highlight the complexities in trying to resolve the interrelationships among the core chlorophyte green algae, but ultimately favour a sister relationship between the Ulvophyceae and Chlorophyceae, with the Trebouxiophyceae branching at the base of the chlorophyte crown.

  11. A Sensitive Cyclic Nucleotide Phosphodiesterase Assay for Transient Enzyme Kinetics

    NARCIS (Netherlands)

    Lookeren Campagne, Michiel M. van; Haastert, Peter J.M. van


    A new assay for cyclic nucleotide phosphodiesterase has been developed by using reverse-phase column chromatography for the separation of product and substrate of the enzymatic reaction. The polar 5'-nucleotides are not retarded by the column, while the more lipophilic cyclic nucleotides bind to the

  12. Reactivity of nitrogen atoms in adenine and (Ade)2Cu complexes towards ribose and 2-furanmethanol: Formation of adenosine and kinetin. (United States)

    Nashalian, Ossanna; Yaylayan, Varoujan A


    To explore the interaction of nucleosides and nucleobases in the context of the Maillard reaction and to identify the selectivity of purine nitrogen atoms towards various electrophiles, model systems composed of adenine or adenosine, glycine, ribose and/or 2-furanmethanol (with and without copper) were studied in aqueous solutions heated at 110°C for 2h and subsequently analyzed by ESI/qTOF/MS/MS in addition to isotope labelling techniques. The results indicated that ribose selectively formed mono-ribosylated N(6) adenine, but in the presence of (Ade)2Cu complex the reaction mixture generated mono-, di- and tri-substituted sugar complexes and their hydrolysis products of mono-ribosylated N(6) and N(9) adenine adducts and di-ribosylated N(6,9) adenine. Furthermore, the reaction of 2-furanmethanol with adenine in the presence of ribose generated kinetin and its isomer, while its reaction with adenosine generated kinetin riboside, as confirmed by comparing the MS/MS profiles of these adducts to those of commercial standards. PMID:27542499

  13. Kinetic and thermodynamic study of the reaction catalyzed by glucose-6-phosphate dehydrogenase with nicotinamide adenine dinucleotide

    Energy Technology Data Exchange (ETDEWEB)

    Martin del Campo, Julia S. [Departamento de Fisica Aplicada, Centro de Investigacion y de Estudios Avanzados - Unidad Merida, Carretera antigua a Progreso Km. 6, A.P. 73 Cordemex, 97310, Merida, Yucatan (Mexico); Patino, Rodrigo, E-mail: [Departamento de Fisica Aplicada, Centro de Investigacion y de Estudios Avanzados - Unidad Merida, Carretera antigua a Progreso Km. 6, A.P. 73 Cordemex, 97310, Merida, Yucatan (Mexico)


    Research highlights: {yields} The reaction catalyzed by one enzyme of the pentose phosphate pathway was studied. {yields} A spectrophotometric method is proposed for kinetic and thermodynamic analysis. {yields} The pH and the temperature influences are reported on physical chemical properties. {yields} Relative concentrations of substrates are also important in the catalytic process. - Abstract: The enzyme glucose-6-phosphate dehydrogenase (G6PD, EC from Leuconostoc mesenteroides has a dual coenzyme specificity with oxidized nicotinamide adenine dinucleotide (NAD{sub ox}) and oxidized nicotinamide adenine dinucleotide phosphate as electron acceptors. The G6PD coenzyme selection is determined by the metabolic cellular prevailing conditions. In this study a kinetic and thermodynamic analysis is presented for the reaction catalyzed by G6PD from L. mesenteroides with NAD{sub ox} as coenzyme in phosphate buffer. For this work, an in situ spectrophotometric technique was employed based on the detection of one product of the reaction. Substrate and coenzyme concentrations as well as temperature and pH effects were evaluated. The apparent equilibrium constant, the Michaelis constant, and the turnover number were determined as a function of each experimental condition. The standard transformed Gibbs energy of reaction was determined from equilibrium constants at different initial conditions. For the product 6-phospho-D-glucono-1,5-lactone, a value of the standard Gibbs energy of formation is proposed, {Delta}{sub f}G{sup o} = -1784 {+-} 5 kJ mol{sup -1}.

  14. Characterization of a DNA Adenine Methyltransferase Gene of Borrelia hermsii and Its Dispensability for Murine Infection and Persistence (United States)

    James, Allison E.; Rogovskyy, Artem S.; Crowley, Michael A.; Bankhead, Troy


    DNA methyltransferases have been implicated in the regulation of virulence genes in a number of pathogens. Relapsing fever Borrelia species harbor a conserved, putative DNA methyltransferase gene on their chromosome, while no such ortholog can be found in the annotated genome of the Lyme disease agent, Borrelia burgdorferi. In the relapsing fever species Borrelia hermsii, the locus bh0463A encodes this putative DNA adenine methyltransferase (dam). To verify the function of the BH0463A protein product as a Dam, the gene was cloned into a Dam-deficient strain of Escherichia coli. Restriction fragment analysis subsequently demonstrated that complementation of this E. coli mutant with bh0463A restored adenine methylation, verifying bh0463A as a Dam. The requirement of bh0463A for B. hermsii viability, infectivity, and persistence was then investigated by genetically disrupting the gene. The dam- mutant was capable of infecting immunocompetent mice, and the mean level of spirochetemia in immunocompetent mice was not significantly different from wild type B. hermsii. Collectively, the data indicate that dam is dispensable for B. hermsii viability, infectivity, and persistence. PMID:27195796

  15. Targeted disruption of the mouse adenine phosphoribosyltransferase (aprt) gene and the production of APRT-deficient mice

    Energy Technology Data Exchange (ETDEWEB)

    Engle, S.J.; Chen, J.; Tischfield, J.A. [Indiana Univ., School of Medicine, Indianapolis, IN (United States)] [and others


    Adenine phosphoribosyltransferase (APRT: EC, a ubiquitously expressed purine salvage enzyme, catalyzes the synthesis of AMP and inorganic pyrophosphate from existing adenine and 5-phosphoribosyl-1-pyrophosphate. Deficiency of this enzyme in humans results in the accumulation of 2,8-dihydroxyadenine leading to crystalluria and nephrolithiasis. In order to facilitate our study of this rare, autosomal recessive disorder, we applied the advances in gene targeting technology and mouse embryonic stem (ES) cell culture to the production of APRT-deficient mice. A positive-negative targeting strategy was used. The tageting vector contain 5.6 kb of the mouse APRT gene, a neomycin resistance gene in exon 3 as a positive selection marker, and a HSV thymidine kinase gene at the 3{prime} end of the homology as a negative selection marker. The vector was introduced into D3 ES cells by electroporation and the cells were selected for G418 and ganciclovir (GANC) resistance. G418-GANC resistant clones were screened by Southern blot. One of several correctly targeted clones was expanded and used for blastocyst microinjection to produce chimeric mice. Chimeric animals were bred and agouti progeny heterozygous for the targeted allele were obtained. Heterozygous animals have been bred to produce APRT-deficient animals. Matings are currently underway to determine the phenotype of APRT/HPRT-deficient animals.

  16. The conserved baculovirus protein p33 (Ac92) is a flavin adenine dinucleotide-linked sulfhydryl oxidase

    International Nuclear Information System (INIS)

    Open reading frame 92 of the Autographa californica baculovirus (Ac92) is one of about 30 core genes present in all sequenced baculovirus genomes. Computer analyses predicted that the Ac92 encoded protein (called p33) and several of its baculovirus orthologs were related to a family of flavin adenine dinucleotide (FAD)-linked sulfhydryl oxidases. Alignment of these proteins indicated that, although they were highly diverse, a number of amino acids in common with the Erv1p/Alrp family of sulfhydryl oxidases are present. Some of these conserved amino acids are predicted to stack against the isoalloxazine and adenine components of FAD, whereas others are involved in electron transfer. To investigate this relationship, Ac92 was expressed in bacteria as a His-tagged fusion protein, purified, and characterized both spectrophotometrically and for its enzymatic activity. The purified protein was found to have the color (yellow) and absorption spectrum consistent with it being a FAD-containing protein. Furthermore, it was demonstrated to have sulfhydryl oxidase activity using dithiothreitol and thioredoxin as substrates.

  17. Nucleotide Excision Repair in Caenorhabditis elegans


    Hannes Lans; Wim Vermeulen


    Nucleotide excision repair (NER) plays an essential role in many organisms across life domains to preserve and faithfully transmit DNA to the next generation. In humans, NER is essential to prevent DNA damage-induced mutation accumulation and cell death leading to cancer and aging. NER is a versatile DNA repair pathway that repairs many types of DNA damage which distort the DNA helix, such as those induced by solar UV light. A detailed molecular model of the NER pathway has emerged from in vi...

  18. Nucleotide sequence of Klebsiella pneumoniae lac genes.


    Buvinger, W E; Riley, M


    The nucleotide sequences of the Klebsiella pneumoniae lacI and lacZ genes and part of the lacY gene were determined, and these genes were located and oriented relative to one another. The K. pneumoniae lac operon is divergent in that the lacI and lacZ genes are oriented head to head, and complementary strands are transcribed. Besides base substitutions, the lacZ genes of K. pneumoniae and Escherichia coli have suffered short distance shifts of reading frame caused by additions or deletions or...

  19. Histone displacement during nucleotide excision repair

    DEFF Research Database (Denmark)

    Dinant, C.; Bartek, J.; Bekker-Jensen, S.


    Nucleotide excision repair (NER) is an important DNA repair mechanism required for cellular resistance against UV light and toxic chemicals such as those found in tobacco smoke. In living cells, NER efficiently detects and removes DNA lesions within the large nuclear macromolecular complex called......, thus allowing repair proteins to efficiently access DNA. On the other hand, after completion of the repair, the chromatin must be returned to its previous undamaged state. Chromatin remodeling can refer to three separate but interconnected processes, histone post-translational modifications, insertion...

  20. Synthesis of a Novel Benzoyl Adenosine Analog Containing a 1, 4-Dioxane Sugar Analog and the Synthesis of a Corresponding Uracil Adenine Dinucleotide

    Directory of Open Access Journals (Sweden)

    Per Carlsen


    Full Text Available Adenosine analogs in which the sugar unit was replaced by a 1,4-dioxane sugar equivalent, were prepared by coupling the 1,4-dioxane sugar analog as its anomeric acetates, with N6-benzoyl protected adenine. The 1,4-dioxane system was obtained in an enantioselective synthesis from (R,R-dimethyl tartrate. Using standard phosphorimidite methodology, the adenine analog was further reacted with a 1,4-dioxane uridine analog to give the corresponding, protected dinucleotide, set-up for further condensation into larger oligonucleotides.

  1. Molecular cloning and characterization of the gene encoding the adenine methyltransferase M.CviRI from Chlorella virus XZ-6E.


    Stefan, C; Xia, Y N; Van Etten, J L


    The gene encoding the DNA methyltransferase M.CviRI from Chlorella virus XZ-6E was cloned and expressed in Escherichia coli. M.CviRI methylates adenine in TGCA sequences. DNA containing the M.CviRI gene was sequenced and a single open reading frame of 1137 bp was identified which could code for a polypeptide of 379 amino acids with a predicted molecular weight of 42,814. Comparison of the M.CviRI predicted amino acid sequence with another Chlorella virus and 14 bacterial adenine methyltransfe...

  2. Heterocyclic compounds based on N6-substituted adenine, methods of their preparation, their use for preparation of drugs, cosmetic preparations and growth regulators, pharmaceutical preparations, cosmetic preparations and growth regulators containing these compounds


    Zatloukal, M.; Lenobel, R.; Holub, J.; Doležal, K. (Karel); Werbrouck, S.; Popa, I.; M. Strnad


    Heterocyclic compounds based on N6 -substituted adenine, methods of their preparation, their use for preparation of drugs, cosmetic preparations and growth regulators, pharmaceutical preparations, cosmetic preparations and growth regulators containing these compounds New heterocyclic derivatives based on N6-substituted adenine, having anticancer, mitotic, imunosuppressive and antisenescent properties for plant, animal and human cells and methods of their preparation. Included are also pharmac...

  3. CysLT1 leukotriene receptor antagonists inhibit the effects of nucleotides acting at P2Y receptors (United States)

    Mamedova, Liaman; Capra, Valérie; Accomazzo, Maria Rosa; Gao, Zhan-Guo; Ferrario, Silvia; Fumagalli, Marta; Abbracchio, Maria P.; Rovati, G. Enrico; Jacobson, Kenneth A.


    Montelukast and pranlukast are orally active leukotriene receptor antagonists selective for the CysLT1 receptor. Conversely, the hP2Y1,2,4,6,11,12,13,14 receptors represent a large family of GPCRs responding to either adenine or uracil nucleotides, or to sugar-nucleotides. Montelukast and pranlukast were found to inhibit nucleotide-induced calcium mobilization in a human monocyte-macrophage like cell line, DMSO-differentiated U937 (dU937). Montelukast and pranlukast inhibited the effects of UTP with IC50 values of 7.7 and 4.3 μM, respectively, and inhibited the effects of UDP with IC50 values of 4.5 and 1.6 μM, respectively, in an insurmountable manner. Furthermore, ligand binding studies using [3H]LTD4 excluded the possibility of orthosteric nucleotide binding to the CysLT1 receptor. dU937 cells were shown to express P2Y2, P2Y4, P2Y6, P2Y11, P2Y13 and P2Y14 receptors. Therefore, these antagonists were studied functionally in a heterologous expression system for the human P2Y receptors. In 1321N1 astrocytoma cells stably expressing human P2Y1,2,4,6 receptors, CysLT1 antagonists inhibited both the P2Y agonist-induced activation of phospholipase C and intracellular Ca2+ mobilization. IC50 values at P2Y1 and P2Y6 receptors were astrocytoma cells expressing an endogenous M3 muscarinic receptor, 10 μM montelukast had no effect on the carbachol-induced rise in intracellular Ca2+. These data demonstrated that CysLT1 receptor antagonists interact functionally with signaling pathways of P2Y receptors, and this should foster the study of possible implications for the clinical use of these compounds in asthma or in other inflammatory conditions. PMID:16280122

  4. Structure of the Hsp110:Hsc70 Nucleotide Exchange Machine


    Schuermann, Jonathan P.; Jiang, Jianwen; Cuellar, Jorge; Llorca, Oscar; Wang, Liping; Gimenez, Luis E.; Jin, Suping; Taylor, Alexander B.; Demeler, Borries; Morano, Kevin A.; Hart, P. John; Valpuesta, Jose M.; Lafer, Eileen M.; Sousa, Rui


    Hsp70s mediate protein folding, translocation, and macromolecular complex remodeling reactions. Their activities are regulated by proteins that exchange ADP for ATP from the nucleotide-binding domain (NBD) of the Hsp70. These nucleotide exchange factors (NEFs) include the Hsp110s, which are themselves members of the Hsp70 family. We report the structure of an Hsp110:Hsc70 nucleotide exchange complex. The complex is characterized by extensive protein:protein interactions and symmetric bridging...

  5. Kinetics and thermodynamics of the reaction between the •OH radical and adenine – a theoretical investigation

    DEFF Research Database (Denmark)

    Milhøj, Birgitte Olai; Sauer, Stephan P. A.


    The accessibility of all possible reaction paths for the reaction between the nucleobase adenine and the •OH radical is investigated through quantum chemical calculations of barrier heights and rate constants at the wB97X-D/6-311++G(2df,2pd) level with Eckart tunneling corrections. First the...... Pople and Dunning basis sets, all of which have been employed in similar investigations in the literature. Improved energies are obtained through single point calculations with CCSD(T) and the same basis sets, and reaction rate constants are calculated for all methods both without tunneling corrections...... and with the Wigner, Bell and Eckart corrections. Compared to CCSD(T)//BHandHLYP/aug-cc-pVTZ reference results, the wB97XD/6-311++G(2df,2pd) method combined with Eckart tunneling corrections provides a sensible compromise between accuracy and time. Using this method all sub-reactions of the reaction...

  6. Hydrogen peroxide formation photoinduced by near-UV radiation in aqueous solutions of adenine derivatives at 77 K (United States)

    Lozinova, T. A.; Lobanov, A. V.; Lander, A. V.


    An estimate of the content of free radicals in aqueous solutions of adenosine (Ado), adenosine-5'-diphosphate (ADP) and guanosine-5'-monophosphate (GMP) irradiated with near-UV radiation at 77 K is obtained by interpreting EPR spectra. It is established that in the presence of NaCl (0.1 M), the total number of peroxyl radicals O{2/-·} and HO{2/·} in samples of the studied compounds was 15-45% of the total quantity of produced free radicals and was affected by the conditions of exposure. The estimates are compared with the results from hydrogen peroxide (H2O2) determination in the same samples after thawing. Although the number of peroxyl radicals in the samples of adenine derivatives (A) and GMP are comparable, the formation of H2O2 is observed only in the case of A derivatives, but not in GMP. Possible reasons for these differences are discussed.

  7. Regulation of nucleotide excision repair through ubiquitination

    Institute of Scientific and Technical Information of China (English)

    Jia Li; Audesh Bhat; Wei Xiao


    Nucleotide excision repair (NER) is the most versatile DNA-repair pathway in all organisms.While bacteria require only three proteins to complete the incision step of NER,eukaryotes employ about 30 proteins to complete the same step.Here we summarize recent studies demonstrating that ubiquitination,a post-translational modification,plays critical roles in regulating the NER activity either dependent on or independent of ubiquitin-proteolysis.Several NER components have been shown as targets of ubiquitination while others are actively involved in the ubiquitination process.We argue through this analysis that ubiquitination serves to coordinate various steps of NER and meanwhile connect NER with other related pathways to achieve the efficient global DNA-damage response.

  8. Signal transduction by guanine nucleotide binding proteins. (United States)

    Spiegel, A M


    High affinity binding of guanine nucleotides and the ability to hydrolyze bound GTP to GDP are characteristics of an extended family of intracellular proteins. Subsets of this family include cytosolic initiation and elongation factors involved in protein synthesis, and cytoskeletal proteins such as tubulin (Hughes, S.M. (1983) FEBS Lett. 164, 1-8). A distinct subset of guanine nucleotide binding proteins is membrane-associated; members of this subset include the ras gene products (Ellis, R.W. et al. (1981) Nature 292, 506-511) and the heterotrimeric G-proteins (also termed N-proteins) (Gilman, A.G. (1984) Cell 36, 577-579). Substantial evidence indicates that G-proteins act as signal transducers by coupling receptors (R) to effectors (E). A similar function has been suggested but not proven for the ras gene products. Known G-proteins include Gs and Gi, the G-proteins associated with stimulation and inhibition, respectively, of adenylate cyclase; transducin (TD), the G-protein coupling rhodopsin to cGMP phosphodiesterase in rod photoreceptors (Bitensky, M.W. et al. (1981) Curr. Top. Membr. Transp. 15, 237-271; Stryer, L. (1986) Annu. Rev. Neurosci. 9, 87-119), and Go, a G-protein of unknown function that is highly abundant in brain (Sternweis, P.C. and Robishaw, J.D. (1984) J. Biol. Chem. 259, 13806-13813; Neer, E.J. et al. (1984) J. Biol. Chem. 259, 14222-14229). G-proteins also participate in other signal transduction pathways, notably that involving phosphoinositide breakdown. In this review, I highlight recent progress in our understanding of the structure, function, and diversity of G-proteins. PMID:2435586

  9. Dynamics of dipole- and valence bound anions in iodide-adenine binary complexes: A time-resolved photoelectron imaging and quantum mechanical investigation

    International Nuclear Information System (INIS)

    Dipole bound (DB) and valence bound (VB) anions of binary iodide-adenine complexes have been studied using one-color and time-resolved photoelectron imaging at excitation energies near the vertical detachment energy. The experiments are complemented by quantum chemical calculations. One-color spectra show evidence for two adenine tautomers, the canonical, biologically relevant A9 tautomer and the A3 tautomer. In the UV-pump/IR-probe time-resolved experiments, transient adenine anions can be formed by electron transfer from the iodide. These experiments show signals from both DB and VB states of adenine anions formed on femto- and picosecond time scales, respectively. Analysis of the spectra and comparison with calculations suggest that while both the A9 and A3 tautomers contribute to the DB signal, only the DB state of the A3 tautomer undergoes a transition to the VB anion. The VB anion of A9 is higher in energy than both the DB anion and the neutral, and the VB anion is therefore not accessible through the DB state. Experimental evidence of the metastable A9 VB anion is instead observed as a shape resonance in the one-color photoelectron spectra, as a result of UV absorption by A9 and subsequent electron transfer from iodide into the empty π-orbital. In contrast, the iodide-A3 complex constitutes an excellent example of how DB states can act as doorway state for VB anion formation when the VB state is energetically available

  10. Dynamics of dipole- and valence bound anions in iodide-adenine binary complexes: A time-resolved photoelectron imaging and quantum mechanical investigation

    Energy Technology Data Exchange (ETDEWEB)

    Stephansen, Anne B. [Department of Chemistry, University of Copenhagen, Universitetsparken 5, DK-2100 København Ø (Denmark); King, Sarah B.; Li, Wei-Li; Kunin, Alice [Department of Chemistry, University of California, Berkeley, California 94720 (United States); Yokoi, Yuki; Minoshima, Yusuke; Takayanagi, Toshiyuki [Department of Chemistry, Saitama University, 255 Shimo-Okubo, Sakura-ku, Saitama City, Saitama 338-8570 (Japan); Neumark, Daniel M., E-mail: [Department of Chemistry, University of California, Berkeley, California 94720 (United States); Chemical Sciences Division, Lawrence Berkeley National Laboratory, Berkeley, California 94720 (United States)


    Dipole bound (DB) and valence bound (VB) anions of binary iodide-adenine complexes have been studied using one-color and time-resolved photoelectron imaging at excitation energies near the vertical detachment energy. The experiments are complemented by quantum chemical calculations. One-color spectra show evidence for two adenine tautomers, the canonical, biologically relevant A9 tautomer and the A3 tautomer. In the UV-pump/IR-probe time-resolved experiments, transient adenine anions can be formed by electron transfer from the iodide. These experiments show signals from both DB and VB states of adenine anions formed on femto- and picosecond time scales, respectively. Analysis of the spectra and comparison with calculations suggest that while both the A9 and A3 tautomers contribute to the DB signal, only the DB state of the A3 tautomer undergoes a transition to the VB anion. The VB anion of A9 is higher in energy than both the DB anion and the neutral, and the VB anion is therefore not accessible through the DB state. Experimental evidence of the metastable A9 VB anion is instead observed as a shape resonance in the one-color photoelectron spectra, as a result of UV absorption by A9 and subsequent electron transfer from iodide into the empty π-orbital. In contrast, the iodide-A3 complex constitutes an excellent example of how DB states can act as doorway state for VB anion formation when the VB state is energetically available.

  11. Effects of low-molecular-weight-chitosan on the adenine-induced chronic renal failure rats in vitro and in vivo (United States)

    Zhi, Xuan; Han, Baoqin; Sui, Xianxian; Hu, Rui; Liu, Wanshun


    The effects of low-molecular-weight-chitosan (LMWC) on chronic renal failure (CRF) rats induced by adenine were investigated in vivo and in vitro. Chitosan were hydrolyzed using chitosanase at pH 6-7 and 37° for 24 h to obtain LMWC. In vitro, the effect of LMWC on the proliferation of renal tubular epithelial cells (RTEC) showed that it had no cytotoxic effect and could promote cell growth. For the in vivo experiment, chronic renal failure rats induced by adenine were randomly divided into control group, Niaoduqing group, and high-, medium- and low-dose LMWC groups. For each group, we detected serum creatinine (SCR), blood urea nitrogen (BUN), and total superoxide dismutase (T-SOD), glutathione oxidase (GSH-Px) activities of renal tissue, and obtained the ratio of kidney weight/body weight, pathological changes of kidney. The levels of serum SCR, BUN were higher in the adenine-induced rats than those in the control group, indicating that the rat chronic renal failure model worked successfully. The results after treatment showed that LMWC could reduce the SCR and BUN levels and enhance the activities/levels of T-SOD and GSH-PX in kidney compared to control group. Histopathological examination revealed that adenine-induced renal alterations were restored by LMWC at three tested dosages, especially at the low dosage of 100 mg kg-1 d-1.

  12. Stacked base-pair structures of adenine nucleosides stabilized by the formation of hydrogen-bonding network involving the two sugar groups

    International Nuclear Information System (INIS)

    Highlights: ► A combination of laser desorption and supersonic jet-cooling is used to produce base pairs of adenine nucleosides. ► Stacked base-pair structure of N6,N6-dimethyladnosine is identified by IR vibrational spectroscopy. ► Anharmonic vibrational calculation is employed to analyze the vibrational mode coupling in the stacked base pair. - Abstract: We have employed a laser desorption technique combined with supersonic-jet cooling for producing base pairs of adenine nucleosides, adenosine (Ado) and N6,N6-dimethyladenosine (DMAdo) under low-temperature conditions. The resulting base pairs are then ionized through resonant two-photon ionization (R2PI) and analyzed by time-of-flight mass spectrometry. It is found that dimers of these adenine nucleosides are stable, especially in the case of DMAdo, with respect to those of the corresponding bases, i.e., adenine and N6,N6-dimethyladenine. Structural analysis of the DMAdo dimer is performed based on the IR–UV double resonance measurements and theoretical calculations. The result demonstrates that the dimer possesses a stacked structure being stabilized by the formation of hydrogen-bonding network involving the two sugar groups. The occurrence of the frequency shift and broadening is explained satisfactorily based on the anharmonic coupling of the OH stretching modes with specific bending modes and low-frequency modes of base and sugar moieties

  13. A concise and simple synthesis of 1-hydroxy-phenethylamine derivatives: Formal synthesis of naturally occurring norephedrine, virolin and 3-hydroxy-2-phosphonylmethoxypropyl adenine

    Indian Academy of Sciences (India)

    S Saha; P Chakraborty; S C Roy


    A concise and simple synthesis of 1-hydroxy-phenethylamine derivatives has been achieved following classical organic transformations using commercially available chiral pools. The said derivatives were explored for the synthesis of naturally occurring bio-active small molecules. Formal synthesis of norephedrine, virolin and 3-hydroxy-2-phosphonylmethoxypropyl adenine has been demonstrated.

  14. Genetic Control of Biosynthesis and Transport of Riboflavin and Flavin Nucleotides and Construction of Robust Biotechnological Producers† (United States)

    Abbas, Charles A.; Sibirny, Andriy A.


    Summary: Riboflavin [7,8-dimethyl-10-(1′-d-ribityl)isoalloxazine, vitamin B2] is an obligatory component of human and animal diets, as it serves as the precursor of flavin coenzymes, flavin mononucleotide, and flavin adenine dinucleotide, which are involved in oxidative metabolism and other processes. Commercially produced riboflavin is used in agriculture, medicine, and the food industry. Riboflavin synthesis starts from GTP and ribulose-5-phosphate and proceeds through pyrimidine and pteridine intermediates. Flavin nucleotides are synthesized in two consecutive reactions from riboflavin. Some microorganisms and all animal cells are capable of riboflavin uptake, whereas many microorganisms have distinct systems for riboflavin excretion to the medium. Regulation of riboflavin synthesis in bacteria occurs by repression at the transcriptional level by flavin mononucleotide, which binds to nascent noncoding mRNA and blocks further transcription (named the riboswitch). In flavinogenic molds, riboflavin overproduction starts at the stationary phase and is accompanied by derepression of enzymes involved in riboflavin synthesis, sporulation, and mycelial lysis. In flavinogenic yeasts, transcriptional repression of riboflavin synthesis is exerted by iron ions and not by flavins. The putative transcription factor encoded by SEF1 is somehow involved in this regulation. Most commercial riboflavin is currently produced or was produced earlier by microbial synthesis using special selected strains of Bacillus subtilis, Ashbya gossypii, and Candida famata. Whereas earlier RF overproducers were isolated by classical selection, current producers of riboflavin and flavin nucleotides have been developed using modern approaches of metabolic engineering that involve overexpression of structural and regulatory genes of the RF biosynthetic pathway as well as genes involved in the overproduction of the purine precursor of riboflavin, GTP. PMID:21646432

  15. Genetic control of biosynthesis and transport of riboflavin and flavin nucleotides and construction of robust biotechnological producers. (United States)

    Abbas, Charles A; Sibirny, Andriy A


    Riboflavin [7,8-dimethyl-10-(1'-d-ribityl)isoalloxazine, vitamin B₂] is an obligatory component of human and animal diets, as it serves as the precursor of flavin coenzymes, flavin mononucleotide, and flavin adenine dinucleotide, which are involved in oxidative metabolism and other processes. Commercially produced riboflavin is used in agriculture, medicine, and the food industry. Riboflavin synthesis starts from GTP and ribulose-5-phosphate and proceeds through pyrimidine and pteridine intermediates. Flavin nucleotides are synthesized in two consecutive reactions from riboflavin. Some microorganisms and all animal cells are capable of riboflavin uptake, whereas many microorganisms have distinct systems for riboflavin excretion to the medium. Regulation of riboflavin synthesis in bacteria occurs by repression at the transcriptional level by flavin mononucleotide, which binds to nascent noncoding mRNA and blocks further transcription (named the riboswitch). In flavinogenic molds, riboflavin overproduction starts at the stationary phase and is accompanied by derepression of enzymes involved in riboflavin synthesis, sporulation, and mycelial lysis. In flavinogenic yeasts, transcriptional repression of riboflavin synthesis is exerted by iron ions and not by flavins. The putative transcription factor encoded by SEF1 is somehow involved in this regulation. Most commercial riboflavin is currently produced or was produced earlier by microbial synthesis using special selected strains of Bacillus subtilis, Ashbya gossypii, and Candida famata. Whereas earlier RF overproducers were isolated by classical selection, current producers of riboflavin and flavin nucleotides have been developed using modern approaches of metabolic engineering that involve overexpression of structural and regulatory genes of the RF biosynthetic pathway as well as genes involved in the overproduction of the purine precursor of riboflavin, GTP. PMID:21646432

  16. Nucleotide-Induced Conformational Changes in Escherichia coli DnaA Protein Are Required for Bacterial ORC to Pre-RC Conversion at the Chromosomal Origin. (United States)

    Saxena, Rahul; Vasudevan, Sona; Patil, Digvijay; Ashoura, Norah; Grimwade, Julia E; Crooke, Elliott


    DnaA oligomerizes when bound to origins of chromosomal replication. Structural analysis of a truncated form of DnaA from Aquifex aeolicus has provided insight into crucial conformational differences within the AAA+ domain that are specific to the ATP- versus ADP- bound form of DnaA. In this study molecular docking of ATP and ADP onto Escherichia coli DnaA, modeled on the crystal structure of Aquifex aeolicus DnaA, reveals changes in the orientation of amino acid residues within or near the vicinity of the nucleotide-binding pocket. Upon limited proteolysis with trypsin or chymotrypsin ADP-DnaA, but not ATP-DnaA generated relatively stable proteolytic fragments of various sizes. Examined sites of limited protease susceptibility that differ between ATP-DnaA and ADP-DnaA largely reside in the amino terminal half of DnaA. The concentration of adenine nucleotide needed to induce conformational changes, as detected by these protease susceptibilities of DnaA, coincides with the conversion of an inactive bacterial origin recognition complex (bORC) to a replication efficient pre-replication complex (pre-RC) at the E. coli chromosomal origin of replication (oriC). PMID:26610483

  17. Nucleotide-Induced Conformational Changes in Escherichia coli DnaA Protein Are Required for Bacterial ORC to Pre-RC Conversion at the Chromosomal Origin

    Directory of Open Access Journals (Sweden)

    Rahul Saxena


    Full Text Available DnaA oligomerizes when bound to origins of chromosomal replication. Structural analysis of a truncated form of DnaA from Aquifex aeolicus has provided insight into crucial conformational differences within the AAA+ domain that are specific to the ATP- versus ADP- bound form of DnaA. In this study molecular docking of ATP and ADP onto Escherichia coli DnaA, modeled on the crystal structure of Aquifex aeolicus DnaA, reveals changes in the orientation of amino acid residues within or near the vicinity of the nucleotide-binding pocket. Upon limited proteolysis with trypsin or chymotrypsin ADP-DnaA, but not ATP-DnaA generated relatively stable proteolytic fragments of various sizes. Examined sites of limited protease susceptibility that differ between ATP-DnaA and ADP-DnaA largely reside in the amino terminal half of DnaA. The concentration of adenine nucleotide needed to induce conformational changes, as detected by these protease susceptibilities of DnaA, coincides with the conversion of an inactive bacterial origin recognition complex (bORC to a replication efficient pre-replication complex (pre-RC at the E. coli chromosomal origin of replication (oriC.

  18. Cyclic nucleotide specific phosphodiesterases of Leishmania major

    Directory of Open Access Journals (Sweden)

    Linder Markus


    Full Text Available Abstract Background Leishmania represent a complex of important human pathogens that belong to the systematic order of the kinetoplastida. They are transmitted between their human and mammalian hosts by different bloodsucking sandfly vectors. In their hosts, the Leishmania undergo several differentiation steps, and their coordination and optimization crucially depend on numerous interactions between the parasites and the physiological environment presented by the fly and human hosts. Little is still known about the signalling networks involved in these functions. In an attempt to better understand the role of cyclic nucleotide signalling in Leishmania differentiation and host-parasite interaction, we here present an initial study on the cyclic nucleotide-specific phosphodiesterases of Leishmania major. Results This paper presents the identification of three class I cyclic-nucleotide-specific phosphodiesterases (PDEs from L. major, PDEs whose catalytic domains exhibit considerable sequence conservation with, among other, all eleven human PDE families. In contrast to other protozoa such as Dictyostelium, or fungi such as Saccharomyces cerevisiae, Candida ssp or Neurospora, no genes for class II PDEs were found in the Leishmania genomes. LmjPDEA contains a class I catalytic domain at the C-terminus of the polypeptide, with no other discernible functional domains elsewhere. LmjPDEB1 and LmjPDEB2 are coded for by closely related, tandemly linked genes on chromosome 15. Both PDEs contain two GAF domains in their N-terminal region, and their almost identical catalytic domains are located at the C-terminus of the polypeptide. LmjPDEA, LmjPDEB1 and LmjPDEB2 were further characterized by functional complementation in a PDE-deficient S. cerevisiae strain. All three enzymes conferred complementation, demonstrating that all three can hydrolyze cAMP. Recombinant LmjPDEB1 and LmjPDEB2 were shown to be cAMP-specific, with Km values in the low micromolar range

  19. Prebiotic nucleotide synthesis demonstration of a geologically plausible pathway

    NARCIS (Netherlands)

    Schwartz, A.W.; Veen, van der M.; Bisseling, T.; Chittenden, G.J.


    Mineral phosphate (apatite) is activated for the synthesis of nucleotides when dilute solutions containing nucleoside and ammonium oxalate are evaporated in its presence. A natural, igneous fluorapatite was found to be even more effective in nucleotide synthesis than the more soluble hydroxylapatite

  20. Nucleotide sequence of cloned rat serum albumin messenger RNA.


    Sargent, T D; Yang, M; Bonner, J.


    The nucleotide sequences of the recombinant DNA inserts of three bacterial plasmid clones containing nearly all of the rat serum albumin mRNA have been determined. A statistical analysis of the nucleotide sequence reveals a pattern of repeated internal homology that confirms the "intragenic triplication" model of albumin evolution.

  1. On the thyroid hormone-induced increase in respiratory capacity of isolated rat hepatocytes. (United States)

    Gregory, R B; Berry, M N


    The respiratory capacities of hepatocytes, derived from hypothyroid, euthyroid and hyperthyroid rats, have been compared by measuring rates of oxygen uptake and by titrating components of the respiratory chain with specific inhibitors. Thyroid hormone increased the maximal rate of substrate-stimulated respiration and also increased the degree of ionophore-stimulated oxygen uptake. In titration experiments, similar concentrations of oligomycin or antimycin were required for maximal inhibition of respiration regardless of thyroid state, suggesting that the changes in respiratory capacity were not the result of variation in the amounts of ATP synthase or cytochrome b. However, less rotenone was required for maximal inhibition of respiration in the hypothyroid state than in cells from euthyroid or hyperthyroid rats, implying that hepatocytes from hypothyroid animals contain less NADH dehydrogenase. The concentration of carboxyatractyloside necessary for maximal inhibition of respiration was 100 microM in hepatocytes from hypothyroid rats, but 200 microM and 300 microM in hepatocytes from euthyroid and hyperthyroid rats, respectively, indicating a possible correlation between levels of thyroid hormone and the amount or activity of adenine nucleotide translocase. The increased capacity for coupled respiration in response to thyroid hormone is not associated with an increase in the components of the electron transport chain or ATP synthase, but correlates with an increased activity of adenine nucleotide translocase. PMID:1751550

  2. Nucleotide Excision Repair in Caenorhabditis elegans

    Directory of Open Access Journals (Sweden)

    Hannes Lans


    Full Text Available Nucleotide excision repair (NER plays an essential role in many organisms across life domains to preserve and faithfully transmit DNA to the next generation. In humans, NER is essential to prevent DNA damage-induced mutation accumulation and cell death leading to cancer and aging. NER is a versatile DNA repair pathway that repairs many types of DNA damage which distort the DNA helix, such as those induced by solar UV light. A detailed molecular model of the NER pathway has emerged from in vitro and live cell experiments, particularly using model systems such as bacteria, yeast, and mammalian cell cultures. In recent years, the versatility of the nematode C. elegans to study DNA damage response (DDR mechanisms including NER has become increasingly clear. In particular, C. elegans seems to be a convenient tool to study NER during the UV response in vivo, to analyze this process in the context of a developing and multicellular organism, and to perform genetic screening. Here, we will discuss current knowledge gained from the use of C. elegans to study NER and the response to UV-induced DNA damage.

  3. Software for tag single nucleotide polymorphism selection

    Directory of Open Access Journals (Sweden)

    Stram Daniel O


    Full Text Available Abstract This paper reviews the theoretical basis for single nucleotide polymorphism (SNP tagging and considers the use of current software made freely available for this task. A distinction between haplotype block-based and non-block-based approaches yields two classes of procedures. Analysis of two different sets of SNP genotype data from the HapMap is used to judge the practical aspects of using each of the programs considered, as well as to make some general observations about the performance of the programs in finding optimal sets of tagging SNPs. Pairwise R2 methods, while the simplest of those considered, do tend to pick more tagging SNPs than are strictly needed to predict unmeasured (non-tagging SNPs, since a combination of two or more tagging SNPs can form a prediction of SNPs that have no direct (pairwise surrogate. Block-based methods that exploit the linkage disequilibrium structure within haplotype blocks exploit this sort of redundancy, but run a risk of over-fitting if used without some care. A compromise approach which eliminates the need first to analyse block structure, but which still exploits simple relationships between SNPs, appears promising.

  4. Nucleotide Phosphohydrolase in Purified Vaccinia Virus (United States)

    Munyon, William; Paoletti, Enzo; Ospina, Julio; Grace, James T.


    Purified infectious vaccinia virus has been shown to contain an enzyme or enzymes that remove the terminal phosphate group from adenosine triphosphate (ATP), guanosine triphosphate (GTP), uridine triphosphate (UTP), and cytidine triphosphate (CTP). The Km for ATP of this enzyme is 5.5 × 10−4m, and the relative rates of the reaction with ATP, GTP, UTP, and CTP are 1.00, 0.34, 0.15, and 0.29, respectively. The virus enzyme does not react with any of the diphosphates. The rate of the reaction is proportional to the amount of virus added and is linear for 130 min. The virus nucleotide phosphohydrolase activity is greatly stimulated by Mg++ and very slightly stimulated by Ca++. The small residual activity observed in the absence of divalent cations is completely inhibited by ethylenediaminetetraacetic acid. Neither Na+ nor K+ ions, nor any mixture of these, was found to stimulate the reaction significantly, and ouabain, at 10−4m, inhibited the reaction by only 27%. The response of the vaccinia enzyme to mono- and divalent cations and to ouabain indicates that the vaccinia enzyme has different properties from those associated with microsomes and mitochondria. PMID:4986904

  5. A flow injection analysis coupled dual electrochemical detector for selective and simultaneous detection of guanine and adenine

    International Nuclear Information System (INIS)

    Graphical abstract: - Highlights: • First study for simultaneous determination of guanine (G) and adenine (A) using a dual electrode. • Separation-less flow-injection analysis technique was introduced for G and A. • This method is selective and no interference by the presence of other DNA bases (T and C). • DNA hybridization process and meat real sample analysis were demonstrated. - Abstract: Adenine (A) and guanine (G), important bases of nucleic acids, are often analyzed by separation coupled spectroscopic detection methods. Herein, we are demonstrated a new flow-injection analysis (FIA) coupled dual electrochemical detector (DECD), where a chitosan-carbon nanofiber (Chit-CNF) modified glassy carbon electrode prepared by a simple technique and pH 7 phosphate buffer solution as a carrier system, for separation-less quantification of G and A. This method is highly selective and no interference by the presence of the other DNA bases (Thymine and Cytosine). The FIA-DECD was operated at two different operating potentials, E1 = 0.80 V and E2 = 0.95 V vs Ag/AgCl, where G and {G + A} get oxidized, respectively. Amount of A was calculated from the difference between the FIA current signals, measured at E20.95V and E10.80V. The GCE/Chit-CNF was characterized by cyclic voltammetry with potassium ferricyanide system and Raman spectroscopy. The modified electrode showed unique electron-transfer feature with metal like conductivity. Under an optimal condition, FIA-DECD showed linear calibration plots for G and A in a concentration range, 200 nM—50 μM with current sensitivity values 13.83 ± 0.48 and 4.84 ± 0.11 nA μM−1 respectively. Calculated detection limit (signal-to-noise ratio = 3) values were 46.8 nM and 73.8 nM for G and A respectively. Applicability of the present technique was further demonstrated by detecting G and A in beef kidney sample and DNA hybridization process

  6. Recognition and repair of the CC-1065-(N3-Adenine)-DNA adduct by the UVRABC nuclease

    Energy Technology Data Exchange (ETDEWEB)

    Tang, M.; Lee, C.S.; Doisy, R.; Ross, L.; Needham-VanDevanter, D.R.; Hurley, L.H.


    The recognition and repair of the helix-stabilizing and relatively nondistortive CC-1065-(N3-adenine)-DNA adduct by UVRABC nuclease has been investigated both in vivo with phi X174RFI DNA by a transfection assay and in vitro by a site-directed adduct in a 117 base pair fragment from M13mp1. CC-1065 is a potent antitumor antibiotic produced by Streptomyces zelensis which binds within the minor groove of DNA through N3 of adenine. In contrast to the helix-destabilizing and distortive modifications of DNA caused by ultraviolet light or N-acetoxy-2-(acetylamino)fluorene, CC-1065 increases the melting point of DNA and decreases the S1 nuclease activity. Using a viral DNA-Escherichia coli transfection system, the authors have found that the uvrA, uvrB, and uvrC genes, which code for the major excision repair proteins for UV- and NAAAF-induced DNA damage, are also involved in the repair of CC-1065-DNA adducts. In contrast, the uvrD gene product, which has been found to be involved in the repair of UV damage, has no effect in repairing CC-1065-DNA adducts. Purified UVRA, UVRB, and UVRC proteins must work in concert to incise the drug-modified phi X174RFI DNA. Using a site-directed and multiple CC-1065 modified (MspI-BstNI) 117 base pair fragment from M13mp1, they have found that UVRABC nuclease incises at the eight phosphodiester bond on the 5' side of the CC-1065-DNA adduct on the drug-modified strand. The enzymes do not cut the noncovalently modified strand. The DNA sequence and/or helix-stabilizing effect of multiple adducts may determine the recognition and/or incision of the drug-DNA adduct by UVRABC nuclease. These results are discussed in relation to the structure of the CC-1065-DNA adduct and the effect of drug binding on local DNA structure.

  7. Recognition and repair of the CC-1065-(N3-Adenine)-DNA adduct by the UVRABC nuclease

    International Nuclear Information System (INIS)

    The recognition and repair of the helix-stabilizing and relatively nondistortive CC-1065-(N3-adenine)-DNA adduct by UVRABC nuclease has been investigated both in vivo with phi X174RFI DNA by a transfection assay and in vitro by a site-directed adduct in a 117 base pair fragment from M13mp1. CC-1065 is a potent antitumor antibiotic produced by Streptomyces zelensis which binds within the minor groove of DNA through N3 of adenine. In contrast to the helix-destabilizing and distortive modifications of DNA caused by ultraviolet light or N-acetoxy-2-(acetylamino)fluorene, CC-1065 increases the melting point of DNA and decreases the S1 nuclease activity. Using a viral DNA-Escherichia coli transfection system, the authors have found that the uvrA, uvrB, and uvrC genes, which code for the major excision repair proteins for UV- and NAAAF-induced DNA damage, are also involved in the repair of CC-1065-DNA adducts. In contrast, the uvrD gene product, which has been found to be involved in the repair of UV damage, has no effect in repairing CC-1065-DNA adducts. Purified UVRA, UVRB, and UVRC proteins must work in concert to incise the drug-modified phi X174RFI DNA. Using a site-directed and multiple CC-1065 modified (MspI-BstNI) 117 base pair fragment from M13mp1, they have found that UVRABC nuclease incises at the eight phosphodiester bond on the 5' side of the CC-1065-DNA adduct on the drug-modified strand. The enzymes do not cut the noncovalently modified strand. The DNA sequence and/or helix-stabilizing effect of multiple adducts may determine the recognition and/or incision of the drug-DNA adduct by UVRABC nuclease. These results are discussed in relation to the structure of the CC-1065-DNA adduct and the effect of drug binding on local DNA structure

  8. Heteronuclear multidimensional NMR and homology modelling studies of the C-terminal nucleotide-binding domain of the human mitochondrial ABC transporter ABCB6

    International Nuclear Information System (INIS)

    Human ATP-binding cassette, sub-family B, member 6 (ABCB6) is a mitochondrial ABC transporter, and presumably contributes to iron homeostasis. Aimed at understanding the structural basis for the conformational changes accompanying the substrate-transportation cycle, we have studied the C-terminal nucleotide-binding domain of ABCB6 (ABCB6-C) in both the nucleotide-free and ADP-bound states by heteronuclear multidimensional NMR and homology modelling. A non-linear sampling scheme was utilised for indirectly acquired 13C and 15N dimensions of all 3D triple-resonance NMR experiments, in order to overcome the instability and the low solubility of ABCB6-C. The backbone resonances for approximately 25% of non-proline residues, which are mostly distributed around the functionally important loops and in the Helical domain, were not observed for nucleotide-free form of ABCB6-C. From the pH, temperature and magnetic field strength dependencies of the resonance intensities, we concluded that this incompleteness in the assignments is mainly due to the exchange between multiple conformations at an intermediate rate on the NMR timescale. These localised conformational dynamics remained in ADP-bound ABCB6-C except for the loops responsible for adenine base and α/β-phosphate binding. These results revealed that the localised dynamic cooperativity, which was recently proposed for a prokaryotic ABC MJ1267, also exists in a higher eukaryotic ABC, and is presumably shared by all members of the ABC family. Since the Helical domain is the putative interface to the transmembrane domain, this cooperativity may explain the coupled functions between domains in the substrate-transportation cycle

  9. Empirical Bayes analysis of single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Ickstadt Katja


    Full Text Available Abstract Background An important goal of whole-genome studies concerned with single nucleotide polymorphisms (SNPs is the identification of SNPs associated with a covariate of interest such as the case-control status or the type of cancer. Since these studies often comprise the genotypes of hundreds of thousands of SNPs, methods are required that can cope with the corresponding multiple testing problem. For the analysis of gene expression data, approaches such as the empirical Bayes analysis of microarrays have been developed particularly for the detection of genes associated with the response. However, the empirical Bayes analysis of microarrays has only been suggested for binary responses when considering expression values, i.e. continuous predictors. Results In this paper, we propose a modification of this empirical Bayes analysis that can be used to analyze high-dimensional categorical SNP data. This approach along with a generalized version of the original empirical Bayes method are available in the R package siggenes version 1.10.0 and later that can be downloaded from Conclusion As applications to two subsets of the HapMap data show, the empirical Bayes analysis of microarrays cannot only be used to analyze continuous gene expression data, but also be applied to categorical SNP data, where the response is not restricted to be binary. In association studies in which typically several ten to a few hundred SNPs are considered, our approach can furthermore be employed to test interactions of SNPs. Moreover, the posterior probabilities resulting from the empirical Bayes analysis of (prespecified interactions/genotypes can also be used to quantify the importance of these interactions.

  10. Nucleotide Excision Repair in Cellular Chromatin: Studies with Yeast from Nucleotide to Gene to Genome

    Directory of Open Access Journals (Sweden)

    Simon Reed


    Full Text Available Here we review our development of, and results with, high resolution studies on global genome nucleotide excision repair (GGNER in Saccharomyces cerevisiae. We have focused on how GGNER relates to histone acetylation for its functioning and we have identified the histone acetyl tranferase Gcn5 and acetylation at lysines 9/14 of histone H3 as a major factor in enabling efficient repair. We consider results employing primarily MFA2 as a model gene, but also those with URA3 located at subtelomeric sequences. In the latter case we also see a role for acetylation at histone H4. We then go on to outline the development of a high resolution genome-wide approach that enables one to examine correlations between histone modifications and the nucleotide excision repair (NER of UV-induced cyclobutane pyrimidine dimers throughout entire genomes. This is an approach that will enable rapid advances in understanding the complexities of how compacted chromatin in chromosomes is processed to access DNA damage and then returned to its pre-damaged status to maintain epigenetic codes.

  11. A glassy carbon electrode modified with poly(eriochrome black T) for sensitive determination of adenine and guanine

    International Nuclear Information System (INIS)

    A thin film of poly(eriochrome black T) was deposited on the surface of glassy carbon electrode by cyclic voltammetry, and this system is shown to enable the sensitive determination of adenine (A) and guanine (G). Scanning electron microscopy, Fourier transform infrared spectroscopy and electrochemical impedance spectroscopy were carried out to characterize the film which exhibits excellent electrocatalytic activity toward the oxidation of A and G in 0.1 M phosphate buffer solution (pH 4.0). Square wave voltammetry reveals an oxidation peak at 1084 mV whose current is linearly related to the concentration of A in the range from 0.05 to 1.00 μM. The oxidation peak for G occurs at 788 mV, and its current is linearly related to the concentration of G in the range from 0.025 to 1.00 μM. The detection limits are 0.017 μM for A and 0.008 μM for G (at S/N = 3), respectively. The modified electrode displays good reproducibility and selectivity for the determination of A and G. The sensor was applied to quantify A and G in fish sperm DNA with satisfactory results. (author)

  12. Drought-Stimulated Activity of Plasma Membrane Nicotinamide Adenine Dinucleotide Phosphate Oxidase and Its Catalytic Properties in Rice

    Institute of Scientific and Technical Information of China (English)

    Zhuang-Qin Duan; Lei Bai; Zhi-Guang Zhao; Guo-Ping Zhang; Fang-Min Cheng; Li-Xi Jiang; Kun-Ming Chen


    The activity of plasma membrane (PM) nicoUnamide adenine dinucleotide phosphate (NADPH) oxidase and Its catalytic properties in rice was investigated under drought stress conditions. Drought stress led to decreased leaf relative water content (RWC) and, as a result of drought-induced oxidative stress, the activities of antioxidant enzymes increased significantly. More interestingly, the intensity of applied water stress was correlated with increased production of H_2O_2and O_2~- and elevated activity of PM NADPH oxidase, a key enzyme of reactive oxygen species generation in plants.Histochemlcal analyses also revealed increased H_2O_2 and O_2~- production in drought-stressed leaves. Application of dlphenylene iodonium (DPI), an Inhibitor of PM NADPH oxidasa, did not alleviate drought-induced production of H_2O_2 and O_2~-. Catalysis experiments indicated that the dce PM NADPH oxidass was partially fiavin-dependent. The pH and temperature optima for this enzyme were 9.8 and 40 ℃, respectively. In addition, drought stress enhanced the activity under alkaline pH and high temperature conditions. These results suggest that a complex regulatory mechanism, associated with the NADPH oxidase-H_2O_2 system, is involved in the response of rice to drought stress.

  13. Study of the chemical evolution and spectral signatures of some interstellar precursor molecules of adenine, glycine alanine

    CERN Document Server

    Majumdar, Liton; Chakrabarti, Sandip K; Chakrabarti, Sonali; 10.1016/j.newast.2012.09.002


    We carry out a quantum chemical calculation to obtain the infrared and electronic absorption spectra of several complex molecules of the interstellar medium (ISM). These molecules are the precursors of adenine, glycine & alanine. They could be produced in the gas phase as well as in the ice phase. We carried out a hydro-chemical simulation to predict the abundances of these species in the gas as well as in the ice phase. Gas and grains are assumed to be interacting through the accretion of various species from the gas phase on to the grain surface and desorption (thermal evaporation and photo-evaporation) from the grain surface to the gas phase. Depending on the physical properties of the cloud, the calculated abundances varies. The influence of ice on vibrational frequencies of different pre-biotic molecules was obtained using Polarizable Continuum Model (PCM) model with the integral equation formalism variant (IEFPCM) as default SCRF method with a dielectric constant of 78.5. Time dependent density func...

  14. Silver nanoparticles coated with adenine: preparation, self-assembly and application in surface-enhanced Raman scattering

    International Nuclear Information System (INIS)

    We describe herein the preparation of silver nanoparticles (AgNPs) using nucleobase adenine as protecting agent through the in situ chemical reduction of AgNO3 with NaBH4 in an aqueous medium at room temperature. As-prepared AgNPs were characterized by UV-visible spectra, transmission electron microscopy and x-ray photoelectron spectroscopy. All these data confirmed the formation of AgNPs. On the basis of electrostatic interactions between as-prepared AgNPs and anionic polyelectrolyte poly(sodium 4-styrenesulfonate) (PSS), we successfully fabricated (PSS/AgNP)n (n = 0-9) multilayers on a 3-mercaptopropyltrimethoxysilane/AgNP functionalized indium tin oxide (ITO) substrate via the layer-by-layer self-assembly technique and characterized as-formed multilayers with UV-visible spectra. Furthermore, these ITO substrates coated with multilayers of different thickness were investigated as surface-enhanced Raman scattering (SERS)-active substrates using p-aminothiophenol as a probe molecule, implying that these multilayers substrates may be promising for a new type of SERS-active substrate

  15. Continuing Exposure to Low-Dose Nonylphenol Aggravates Adenine-Induced Chronic Renal Dysfunction and Role of Rosuvastatin Therapy

    Directory of Open Access Journals (Sweden)

    Yen Chia-Hung


    Full Text Available Abstract Background Nonylphenol (NP, an environmental organic compound, has been demonstrated to enhance reactive-oxygen species (ROS synthesis. Chronic exposure to low-dose adenine (AD has been reported to induce chronic kidney disease (CKD. Methods In this study, we tested the hypothesis that chronic exposure to NP will aggravate AD-induced CKD through increasing generations of inflammation, ROS, and apoptosis that could be attenuated by rosuvastatin. Fifty male Wistar rats were equally divided into group 1 (control, group 2 (AD in fodder at a concentration of 0.25%, group 3 (NP: 2 mg/kg/day, group 4 (combined AD & NP, and group 5 (AD-NP + rosuvastatin: 20 mg/kg/day. Treatment was continued for 24 weeks for all animals before being sacrificed. Results By the end of 24 weeks, serum blood urea nitrogen (BUN and creatinine levels were increased in group 4 than in groups 1–3, but significantly reduced in group 5 as compared with group 4 (all p  Conclusion NP worsened AD-induced CKD that could be reversed by rosuvastatin therapy.

  16. Deficiency of the iron-sulfur clusters of mitochondrial reduced nicotinamide-adenine dinucleotide-ubiquinone oxidoreductase (complex I) in an infant with congenital lactic acidosis.


    Moreadith, R W; Batshaw, M L; Ohnishi, T.; Kerr, D.; Knox, B; Jackson, D; Hruban, R; Olson, J; Reynafarje, B; Lehninger, A L


    We report the case of an infant with hypoglycemia, progressive lactic acidosis, an increased serum lactate/pyruvate ratio, and elevated plasma alanine, who had a moderate to profound decrease in the ability of mitochondria from four organs to oxidize pyruvate, malate plus glutamate, citrate, and other NAD+-linked respiratory substrates. The capacity to oxidize the flavin adenine dinucleotide-linked substrate, succinate, was normal. The most pronounced deficiency was in skeletal muscle, the le...

  17. {sup 19}F-labeling of the adenine H2-site to study large RNAs by NMR spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Sochor, F. [Johann Wolfgang Goethe-University Frankfurt, Institut für Organische Chemie und Chemische Biologie, Center for Biomolecular Magnetic Resonance (BMRZ) (Germany); Silvers, R. [Massachusetts Institute of Technology, Department of Chemistry, Francis Bitter Magnet Laboratory (United States); Müller, D.; Richter, C.; Fürtig, B., E-mail:; Schwalbe, H., E-mail: [Johann Wolfgang Goethe-University Frankfurt, Institut für Organische Chemie und Chemische Biologie, Center for Biomolecular Magnetic Resonance (BMRZ) (Germany)


    In comparison to proteins and protein complexes, the size of RNA amenable to NMR studies is limited despite the development of new isotopic labeling strategies including deuteration and ligation of differentially labeled RNAs. Due to the restricted chemical shift dispersion in only four different nucleotides spectral resolution remains limited in larger RNAs. Labeling RNAs with the NMR-active nucleus {sup 19}F has previously been introduced for small RNAs up to 40 nucleotides (nt). In the presented work, we study the natural occurring RNA aptamer domain of the guanine-sensing riboswitch comprising 73 nucleotides from Bacillus subtilis. The work includes protocols for improved in vitro transcription of 2-fluoroadenosine-5′-triphosphat (2F-ATP) using the mutant P266L of the T7 RNA polymerase. Our NMR analysis shows that the secondary and tertiary structure of the riboswitch is fully maintained and that the specific binding of the cognate ligand hypoxanthine is not impaired by the introduction of the {sup 19}F isotope. The thermal stability of the {sup 19}F-labeled riboswitch is not altered compared to the unmodified sequence, but local base pair stabilities, as measured by hydrogen exchange experiments, are modulated. The characteristic change in the chemical shift of the imino resonances detected in a {sup 1}H,{sup 15}N-HSQC allow the identification of Watson–Crick base paired uridine signals and the {sup 19}F resonances can be used as reporters for tertiary and secondary structure transitions, confirming the potential of {sup 19}F-labeling even for sizeable RNAs in the range of 70 nucleotides.

  18. Nucleotide Sequence - KOME | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available [ Credits ] BLAST Search Image Search Home About Archive Update History Contact us ...rtio About This Database Database Description Download License Update History of This Database Site Policy | Contact Us Nucleotide Sequence - KOME | LSDB Archive ...

  19. Nucleotide Metabolism and its Control in Lactic Acid Bacteria

    DEFF Research Database (Denmark)

    Kilstrup, Mogens; Hammer, Karin; Jensen, Peter Ruhdal;


    Most metabolic reactions are connected through either their utilization of nucleotides or their utilization of nucleotides or their regulation by these metabolites. In this review the biosynthetic pathways for pyrimidine and purine metabolism in lactic acid bacteria are described including the...... interconversion pathways, the formation of deoxyribonucleotides and the salvage pathways for use of exogenous precursors. The data for the enzymatic and the genetic regulation of these pathways are reviewed, as well as the gene organizations in different lactic acid bacteria. Mutant phenotypes and methods for...... manipulation of nucleotide pools are also discussed. Our aim is to provide an overview of the physiology and genetics of nucleotide metabolism and its regulation that will facilitate the interpretation of data arising from genetics, metabolomics, proteomics, and transcriptomics in lactic acid bacteria....

  20. Association study of nonsynonymous single nucleotide polymorphisms in schizophrenia

    DEFF Research Database (Denmark)

    Carrera, Noa; Arrojo, Manuel; Sanjuán, Julio;


    Genome-wide association studies using several hundred thousand anonymous markers present limited statistical power. Alternatively, association studies restricted to common nonsynonymous single nucleotide polymorphisms (nsSNPs) have the advantage of strongly reducing the multiple testing problem...

  1. Tissue-specific accelerated aging in nucleotide excision repair deficiency


    Laura J. Niedernhofer


    Nucleotide excision repair (NER) is a multi-step DNA repair mechanism that removes helix-distorting modified nucleotides from the genome. NER is divided into two subpathways depending on the location of DNA damage in the genome and how it is first detected. Global genome NER identifies and repairs DNA lesions throughout the genome. This subpathway of NER primarily protects against the accumulation of mutations in the genome. Transcription-coupled (TC) NER rapidly repairs lesions in the transc...

  2. Nucleotide sequence and genome organization of carnation mottle virus RNA.


    Guilley, H; Carrington, J C; Balàzs, E; Jonard, G; Richards, K; Morris, T J


    The complete nucleotide sequence of carnation mottle genomic RNA (4003 nucleotides) is presented. The sequence was determined for cloned cDNA copies of viral RNA containing over 99% of the sequence and was completed by direct sequence analysis of RNA and cDNA transcripts. The sequence contains two long open reading frames which together can account for observed translation products. One translation product would arise by suppression of an amber termination codon and the sequence raises the po...

  3. Quantitative Analysis of Guanine Nucleotide Exchange Factors (GEFs) as Enzymes


    Randazzo, Paul A.; Jian, Xiaoying; Chen, Pei-Wen; Zhai, Peng; Soubias, Olivier; Northup, John K.


    The proteins that possess guanine nucleotide exchange factor (GEF) activity, which include about ~800 G protein coupled receptors (GPCRs), 1 15 Arf GEFs, 2 81 Rho GEFs, 3 8 Ras GEFs, 4 and others for other families of GTPases, 5 catalyze the exchange of GTP for GDP on all regulatory guanine nucleotide binding proteins. Despite their importance as catalysts, relatively few exchange factors (we are aware of only eight for ras superfamily members) have been rigorously characterized kinetically. ...

  4. Thermodynamics of RNA duplexes modified with unlocked nucleic acid nucleotides


    Pasternak, Anna; Wengel, Jesper


    Thermodynamics provides insights into the influence of modified nucleotide residues on stability of nucleic acids and is crucial for designing duplexes with given properties. In this article, we introduce detailed thermodynamic analysis of RNA duplexes modified with unlocked nucleic acid (UNA) nucleotide residues. We investigate UNA single substitutions as well as model mismatch and dangling end effects. UNA residues placed in a central position makes RNA duplex structure less favourable by 4...

  5. An introduction to recurrent nucleotide interactions in RNA. (United States)

    Sweeney, Blake A; Roy, Poorna; Leontis, Neocles B


    RNA secondary structure diagrams familiar to molecular biologists summarize at a glance the folding of RNA chains to form Watson–Crick paired double helices. However, they can be misleading: First of all, they imply that the nucleotides in loops and linker segments, which can amount to 35% to 50% of a structured RNA, do not significantly interact with other nucleotides. Secondly, they give the impression that RNA molecules are loosely organized in three-dimensional (3D) space. In fact, structured RNAs are compactly folded as a result of numerous long-range, sequence-specific interactions, many of which involve loop or linker nucleotides. Here, we provide an introduction for students and researchers of RNA on the types, prevalence, and sequence variations of inter-nucleotide interactions that structure and stabilize RNA 3D motifs and architectures, using Escherichia coli (E. coli) 16S ribosomal RNA as a concrete example. The picture that emerges is that almost all nucleotides in structured RNA molecules, including those in nominally single-stranded loop or linker regions, form specific interactions that stabilize functional structures or mediate interactions with other molecules. The small number of noninteracting, ‘looped-out’ nucleotides make it possible for the RNA chain to form sharp turns. Base-pairing is the most specific interaction in RNA as it involves edge-to-edge hydrogen bonding (H-bonding) of the bases. Non-Watson–Crick base pairs are a significant fraction (30% or more) of base pairs in structured RNAs. PMID:25664365

  6. Nucleotide-sugar transporters: structure, function and roles in vivo

    Directory of Open Access Journals (Sweden)

    Handford M.


    Full Text Available The glycosylation of glycoconjugates and the biosynthesis of polysaccharides depend on nucleotide-sugars which are the substrates for glycosyltransferases. A large proportion of these enzymes are located within the lumen of the Golgi apparatus as well as the endoplasmic reticulum, while many of the nucleotide-sugars are synthesized in the cytosol. Thus, nucleotide-sugars are translocated from the cytosol to the lumen of the Golgi apparatus and endoplasmic reticulum by multiple spanning domain proteins known as nucleotide-sugar transporters (NSTs. These proteins were first identified biochemically and some of them were cloned by complementation of mutants. Genome and expressed sequence tag sequencing allowed the identification of a number of sequences that may encode for NSTs in different organisms. The functional characterization of some of these genes has shown that some of them can be highly specific in their substrate specificity while others can utilize up to three different nucleotide-sugars containing the same nucleotide. Mutations in genes encoding for NSTs can lead to changes in development in Drosophila melanogaster or Caenorhabditis elegans, as well as alterations in the infectivity of Leishmania donovani. In humans, the mutation of a GDP-fucose transporter is responsible for an impaired immune response as well as retarded growth. These results suggest that, even though there appear to be a fair number of genes encoding for NSTs, they are not functionally redundant and seem to play specific roles in glycosylation.

  7. 心肌线粒体腺苷酸配体门控钙离子释放通道%A pathway for adenine nucleotide ligand gating Ca2+ efflux of myocadial mitochondria

    Institute of Scientific and Technical Information of China (English)

    康少平; 李旭光; 董嘉良; 张艳君; 康英姿; 于公元



  8. In vivo study of the effect of antiviral acyclic nucleotide phosphonate (R)-9-[2 -(phosphonomethoxy)propyl]adenine (PMPA, tenofovir) and its prodrug tenofovir disoproxil fumarate on rat microsomal cytochrome P450

    Czech Academy of Sciences Publication Activity Database

    Anzenbacherová, E.; Anzenbacher, P.; Zídek, Zdeněk; Buchar, Evžen; Kmoníčková, Eva; Potměšil, Petr; Nekvindová, J.; Veinlichová, A.; Holý, Antonín


    Roč. 57, č. 5 (2008), s. 761-767. ISSN 0862-8408 R&D Projects: GA MŠk 1M0508 Grant ostatní: GA MŠk(CZ) MSM6198959216 Institutional research plan: CEZ:AV0Z50390512; CEZ:AV0Z40550506 Keywords : Tenofovir * PMPA * Cytochrome P450 Subject RIV: CE - Biochemistry Impact factor: 1.653, year: 2008

  9. Exceptionally high glucose current on a hierarchically structured porous carbon electrode with "wired" flavin adenine dinucleotide-dependent glucose dehydrogenase. (United States)

    Tsujimura, Seiya; Murata, Kazuki; Akatsuka, Wataru


    This article introduces a carbon electrode designed to achieve efficient enzymatic electrolysis by exploiting a hierarchical pore structure based on macropores for efficient mass transfer and mesopores for high enzyme loading. Magnesium oxide-templated mesoporous carbon (MgOC, mean pore diameter 38 nm) was used to increase the effective specific surface area for enzyme immobilization. MgOC particles were deposited on a current collector by an electrophoretic deposition method to generate micrometer-scale macropores to improve the mass transfer of glucose and electrolyte (buffer) ions. To create a glucose bioanode, the porous-carbon-modified electrode was further coated with a biocatalytic hydrogel composed of a conductive redox polymer, deglycosylated flavin adenine dinucleotide-dependent glucose dehydrogenase (d-FAD-GDH), and a cross-linker. Carbohydrate chains on the peripheral surfaces of the FAD-GDH molecules were removed by periodate oxidation before cross-linking. The current density for the oxidation of glucose was 100 mA cm(-2) at 25 °C and pH 7, with a hydrogel loading of 1.0 mg cm(-2). For the same hydrogel composition and loading, the current density on the MgOC-modified electrode was more than 30 times higher than that on a flat carbon electrode. On increasing the solution temperature to 45 °C, the catalytic current increased to 300 mA cm(-2), with a hydrogel loading of 1.6 mg cm(-2). Furthermore, the stability of the hydrogel electrode was improved by using the mesoporous carbon materials; more than 95% of the initial catalytic current remained after a 220-day storage test in 4 °C phosphate buffer, and 80% was observed after 7 days of continuous operation at 25 °C. PMID:25244161

  10. A comparative cluster analysis of nicotinamide adenine dinucleotide phosphate (NADPH)-diaphorase histochemistry in the brains of amphibians. (United States)

    Pinelli, Claudia; Rastogi, Rakesh K; Scandurra, Anna; Jadhao, Arun G; Aria, Massimo; D'Aniello, Biagio


    Nicotinamide adenine dinucleotide phosphate-diaphorase (NADPH-d) is a key enzyme in the synthesis of the gaseous neurotransmitter nitric oxide. We compare the distribution of NADPH-d in the brain of four species of hylid frogs. NADPH-d-positive fibers are present throughout much of the brain, whereas stained cell groups are distributed in well-defined regions. Whereas most brain areas consistently show positive neurons in all species, in some areas species-specific differences occur. We analyzed our data and those available for other amphibian species to build a matrix on NADPH-d brain distribution for a multivariate analysis. Brain dissimilarities were quantified by using the Jaccard index in a hierarchical clustering procedure. The whole brain dendrogram was compared with that of its main subdivisions by applying the Fowlkes-Mallows index for dendrogram similarity, followed by bootstrap replications and a permutation test. Despite the differences in the distribution map of the NADPH-d system among species, cluster analysis of data from the whole brain and hindbrain faithfully reflected the evolutionary history (framework) of amphibians. Dendrograms from the secondary prosencephalon, diencephalon, mesencephalon, and isthmus showed some deviation from the main scheme. Thus, the present analysis supports the major evolutionary stability of the hindbrain. We provide evidence that the NADPH-d system in main brain subdivisions should be cautiously approached for comparative purposes because specific adaptations of a single species could occur and may affect the NADPH-d distribution pattern in a brain subdivision. The minor differences in staining pattern of particular subdivisions apparently do not affect the general patterns of staining across species. PMID:24549578

  11. Induction of ischemic tolerance in rat liver via reduced nicotinamide adenine dinucleotide phosphate oxidase in Kupffer cells

    Institute of Scientific and Technical Information of China (English)


    AIM: To elucidate the mechanisms of hepatocyte preconditioning by H2O2 to better understand the pathophysiology of ischemic preconditioning.METHODS: The in vitro effect of H2O2 pretreatment was investigated in rat isolated hepatocytes subjected to anoxia/reoxygenation. Cell viability was assessed with propidium iodide fluorometry. In other experiments, rat livers were excised and subjected to warm ischemia/reperfusion in an isolated perfused liver system to determine leakage of liver enzymes. Preconditioning was performed by H2O2 perfusion, or by stopping the perfusion for 10 min followed by 10 min of reperfusion.To inhibit Kupffer cell function or reduced nicotinamide adenine dinucleotide phosphate (NADPH) oxidase,gadolinium chloride was injected prior to liver excision, or diphenyleneiodonium, an inhibitor of NADPH oxidase, was added to the perfusate, respectively. Histological detection of o~gen radical formation in Kupffer cells was performed by perfusion with nitro blue tetrazolium.RESULTS: Anoxia/reoxygenation decreased hepatocyte viability compared to the controls. Pretreatment with H2O2 did not improve such hepatocyte injury. In liver perfusion experiments, however, H2O2 preconditioning reduced warm ischemia/reperfusion injury, which was reversed by inhibition of Kupffer cell function or NADPH oxidase. Histological examination revealed that H2O2 preconditioning induced oxygen radical formation in Kupffer cells. NADPH oxidase inhibition also reversed hepatoprotection by ischemic preconditioning.CONCLUSION: H2O2 preconditioning protects hepatocytes against warm ischemia/reperfusion injury via NADPH oxidase in Kupffer cells, and not directly. NADPH oxidase also mediates hepatoprotection by ischemic preconditioning.

  12. Correlation between single nucleotide polymorphisms of NADPH oxidase p22phox gene and ischemic stroke in Shanghai Han population

    Directory of Open Access Journals (Sweden)

    Wei XU


    Full Text Available Objective This paper aims to investigate the distribution of genotypes and alleles of nicotinamide adenine dinucleotide phosphate (NADPH oxidase p22phox -930A/G, 242C/T and -675A/T, so as to evaluate the association between three single-nucleotide polymorphisms (SNPs and risk of atherosclerotic ischemic stroke in permanent resident population of Han nationality living in Shanghai area. Methods The genotypes and allele frequencies of NADPH oxidase p22phox subunit -930A/G, 242C/T and -675A/T were detected by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP analysis in 205 patients with ischemic stroke and 136 healthy controls. Results In patients with ischemic stroke, the results of PCR-RFLP in variant genetic loci were different. For -930A/G, one band appeared at 268 bp of genotype AA; 2 bands appeared at 197 and 71 bp of genotype GG; 3 bands appeared at 268, 197 and 71 bp of genotype AG. For 242C/T, one band appeared at 348 bp of genotype CC; 2 bands appeared at 188 and 160 bp of genotype TT; 3 bands appeared at 348, 188 and 160 bp of genotype CT. For -675A/T, 2 bands appeared at 158 and 54 bp of genotype TT; 3 bands appeared at 212, 158 and 54 bp of genotype AT. The genotypes and allele frequency of all three SNPs of NADPH oxidase p22phox gene had no significant difference between ischemic stroke patients and healthy controls (P > 0.05. Conclusions The genetic polymorphism of NADPH oxidase p22phox gene -930A/G, 242C/T and -675A/T might have no association with ischemic stroke. DOI: 10.3969/j.issn.1672-6731.2015.09.011

  13. Phosphorus-33-labeled nucleotide 5'-triphosphates: Applications in DNA analysis

    International Nuclear Information System (INIS)

    Synthesis of [γ-33P] adenosine 5'-triphosphate and [α-33P]2'-deoxyadenosine 5'-triphosphate was accomplished in a way similar to the preparation of 32P-labeled nucleotides. These nucleotides were then used in a variety of molecular biological applications. The techniques of DNA sequencing and nucleic acid hybridization were used to evaluate potential applications for 33P labeled nucleotides. The 33P nucleotides were compared with the 32P and 35S nucleotide equivalents for the ability to serve as substrates for various enzymes used to label DNA, T4-bacteriophage polynucleotide kinase, E. coli DNA polymerase, and T7 DNA polymerase. The products of there reactions were either separated by polyacrylamide gel electrophoresis (DNA sequencing) or used as hybridization probes on a nylon membrane. The isotopically labeled DNA was detected by autoradiography on X-ray film. The film was evaluated for relative sensitivity of the film versus time for each isotope and the sharpness or resolution of the exposed bands on the film

  14. Temperature dependence of the atractyloside-induced mitochondrial Ca2+ release. (United States)

    Chávez, E; Osornio, A


    1. Mitochondrial Ca2+, accumulated by succinate oxidation was released by addition of 50 microM atractyloside. Beside this Ca2+ efflux, a large oxidation of pyridine nucleotides and sustained membrane depolarization occurs. An absolute requirement for acetate to support Ca2+ release is demonstrated. 2. Membrane de-energization, NAD(P)H oxidation, and Ca2+ efflux as induced by atractyloside were temperature-dependent, since it occurs when mitochondria are incubated at 22 degrees C and was abolished at 4 degrees C. 3. Taking into account this latter, the effects of atractyloside on mitochondrial Ca2+ release appears not to be a simple result of the binding of the inhibitor to adenine nucleotide translocase. 4. It is proposed that the mechanism involved in atractyloside-driven membrane permeability to Ca2+ must be related with the transference of the conformational change of the carrier, to another membrane structure responsible for the maintenance permeability to ions. PMID:3181602

  15. Dynamics of Charge Transfer in Ordered and Chaotic Nucleotide Sequences

    CERN Document Server

    Fialko, N S


    Charge transfer is considered in systems composed of a donor, an acceptor and bridge sites of (AT) nucleotide pairs. For a bridge consisting of 180 (AT) pairs, three cases are dealt with: a uniform case, when all the nucleotides in each strand are identical; an ordered case, when nucleotides in each DNA strand are arranged in an orderly fashion; a chaotic case, when (AT) and (TA) pairs are arranged randomly. It is shown that in all the cases a charge transfer from a donor to an acceptor can take place. All other factors being equal, the transfer is the most efficient in the uniform case, the ordered and chaotic cases are less and the least efficient, accordingly. The results obtained are in agreement with experimental data on long-range charge transfer in DNA.

  16. Analysis of Guanine Nucleotide Binding and Exchange Kinetics of the Escherichia coli GTPase Era


    Sullivan, S M; Mishra, R.; Neubig, R. R.; Maddock, J. R.


    Era is an essential Escherichia coli guanine nucleotide binding protein that appears to play a number of cellular roles. Although the kinetics of Era guanine nucleotide binding and hydrolysis have been described, guanine nucleotide exchange rates have never been reported. Here we describe a kinetic analysis of guanine nucleotide binding, exchange, and hydrolysis by Era using the fluorescent mant (N-methyl-3′-O-anthraniloyl) guanine nucleotide analogs. The equilibrium binding constants (KD) fo...

  17. Catalytic activity of iron hexacyanoosmate(II) towards hydrogen peroxide and nicotinamide adenine dinucleotide and its use in amperometric biosensors

    Energy Technology Data Exchange (ETDEWEB)

    Kotzian, Petr; Janku, Tereza [Department of Analytical Chemistry, University of Pardubice, Nam. Cs. Legii 565, CZ-532 10 Pardubice (Czech Republic); Kalcher, Kurt [Institute of Chemistry - Analytical Chemistry, Karl-Franzens University, Universitaetsplatz 1, A-8010 Graz (Austria); Vytras, Karel [Department of Analytical Chemistry, University of Pardubice, Nam. Cs. Legii 565, CZ-532 10 Pardubice (Czech Republic)], E-mail:


    Hydrogen peroxide and nicotinamide adenine dinucleotide (NADH) may be determined amperometrically using screen-printed electrodes chemically modified with iron(III) hexacyanoosmate(II) (Osmium purple) in flow injection analysis (FIA). The determination is based on the exploitation of catalytic currents resulting from the oxidation/reduction of the modifier. The performance of the sensor was characterized and optimized by controlling several operational parameters (applied potential, pH and flow rate of the phosphate buffer). Comparison has been made with analogous complexes of ruthenium (Ruthenium purple) and iron (Prussian blue). Taking into account the sensitivity and stability of corresponding sensors, the best results were obtained with the use of Osmium purple. The sensor exhibited a linear increase of the amperometric signal with the concentration of hydrogen peroxide in the range of 0.1-100 mg L{sup -1} with a detection limit (evaluated as 3{sigma}) of 0.024 mg L{sup -1} with a R.S.D. 1.5% for 10 mg L{sup -1} H{sub 2}O{sub 2} under optimized flow rate of 0.4 mL min{sup -1} in 0.1 M phosphate buffer carrier (pH 6) and a working potential of +0.15 V versus Ag/AgCl. Afterwards, a biological recognition element - either glucose oxidase or ethanol dehydrogenase - was incorporated to achieve a sensor facilitating the determination of glucose or ethanol, respectively. The glucose sensor gave linearity between current and concentration in the range from 1 to 250 mg L{sup -1} with a R.S.D. 2.4% for 100 mg L{sup -1} glucose, detection limit 0.02 mg L{sup -1} (3{sigma}) and retained its original activity after 3 weeks when stored at 6 deg. C. Optimal parameters in the determination of ethanol were selected as: applied potential +0.45 V versus Ag/AgCl, flow rate 0.2 mL min{sup -1} in 0.1 M phosphate buffer carrier (pH 7). Different structural designs of the ethanol sensor were tested and linearity obtained was up to 1000 mg L{sup -1} with a maximum R.S.D. of 5

  18. Experimental study on the fragmentation of Adenine and Porphyrin molecules induced by low energy multicharged ion impact

    International Nuclear Information System (INIS)

    Since the dissociation of small molecules might play key roles in the understanding of radiation induced damages of living tissues at the primary steps and at the molecular levels, fragmentation dynamics of small biomolecules have drawn much attention. The knowledge of the internal energy is of fundamental importance for understanding its fragmentation dynamics following external excitation. For a long time however, it was difficult to measure this parameter in coincidence with the fragmentation patterns until the development of CIDEC (Collision Induced Dissociation under Energy Control) method in 2007. In this work, the CIDEC method was extended to study the fragmentation of gas-phase biomolecules adenine (Ade: H5C5N5) and porphyrin chloride FeTPPCl (C44H28N4FeCl). The population distribution for each dissociation channel as a function of the excitation energy of the parent molecular ions at a well-determined initial charge state has been experimentally determined, which could shed some light on the fragmentation dynamics of these molecules. In collisions between Cl+ and Ade at 3 keV, the fragmentation pattern of Ade2+ is dominated by the loss of H2CN+ and the successive emission of HCN. The energy distribution of the parent dication confirms the successive emission dynamics. A specific decay channel is observed, i.e. the emission of a charged H2CN+ followed by the emission of HC2N2. The measured mean excitation energies of this channel and other competitive channels are compared. In Kr8+ - FeTPPCl collisions at 80 keV, parent ions FeTPPCL1+,2+,3+ are observed, along with the corresponding decay patterns. It is found that, in the first step the dominant low-energy-cost decay channel is the emission of Cl0 independent of the initial charge state of FeTPPClr+. For the resulted dication FeTPP2+, the dominant fragmentation channel is the neutral evaporation; for the tri-cation however, the dominant fragmentation channel is the asymmetrical fission by emission of a

  19. Fluorescence chemosensors with pyrene and their interaction with nucleotide phosphate

    Institute of Scientific and Technical Information of China (English)

    李华平; 汪鹏飞; 吴世康


    A group of fluorescence chemosensor with pyrene, compounds (Ⅰ), (Ⅱ) and (Ⅲ), were synthesized The fluorescence spectra and the lifetime of these compounds were carefully measured. The fluorescence quenching spec tra of pyrenyl butyric acid, compounds (Ⅰ), (Ⅱ) and (Ⅲ) by different nucleotide phosphates, AMP ADP, ATP dTTP, were also recorded and studied. The quenching and the stability constants were calculated by Stern-Volmer equa tion and eq. (2), respectively. The mechanism of interaction between fluorescence chemosensor and nucleotide phos phate was didscussed based on the comparison of the results obtained with the CPK model of free molecules of these com pounds in the ground state.

  20. Exogenous Nucleotides Antagonize the Developmental Toxicity of Ethanol In Vitro


    Jie Zhao; Jia-Xi Zhao; Ya-Jun Xu


    The objective of this study was to assess whether nucleotides supplementation in vitro could suppress ethanol-induced developmental toxicity in mouse. The models of whole embryo culture (WEC) and midbrain (MB) cell micromass culture were used in this study. In WEC system, exposure to 4.0 mg/mL ethanol for 48 h yielded various developmental malformations of the mice embryos. Nucleotides supplementation (0.16, 0.80, 4.00, 20.00, and 100.00 mg/L) improved the growth parameters to some extent, an...

  1. Activated Ras interacts with the Ral guanine nucleotide dissociation stimulator.


    Hofer, F.; Fields, S; Schneider, C; Martin, G S


    The yeast two-hybrid system was used to identify proteins that interact with Ras. The H-Ras protein was found to interact with a guanine nucleotide dissociation stimulator (GDS) that has been previously shown to regulate guanine nucleotide exchange on another member of the Ras protein family, Ral. The interaction is mediated by the C-terminal, noncatalytic segment of the RalGDS and can be detected both in vivo, using the two-hybrid system, and in vitro, with purified recombinant proteins. The...

  2. Biocuration of functional annotation at the European nucleotide archive. (United States)

    Gibson, Richard; Alako, Blaise; Amid, Clara; Cerdeño-Tárraga, Ana; Cleland, Iain; Goodgame, Neil; Ten Hoopen, Petra; Jayathilaka, Suran; Kay, Simon; Leinonen, Rasko; Liu, Xin; Pallreddy, Swapna; Pakseresht, Nima; Rajan, Jeena; Rosselló, Marc; Silvester, Nicole; Smirnov, Dmitriy; Toribio, Ana Luisa; Vaughan, Daniel; Zalunin, Vadim; Cochrane, Guy


    The European Nucleotide Archive (ENA; is a repository for the submission, maintenance and presentation of nucleotide sequence data and related sample and experimental information. In this article we report on ENA in 2015 regarding general activity, notable published data sets and major achievements. This is followed by a focus on sustainable biocuration of functional annotation, an area which has particularly felt the pressure of sequencing growth. The importance of functional annotation, how it can be submitted and the shifting role of the biocurator in the context of increasing volumes of data are all discussed. PMID:26615190

  3. 腺嘌呤-5-溴尿嘧啶复合物中的卤键%Halogen Bonds in Adenine-5-Bromouracil Complexes

    Institute of Scientific and Technical Information of China (English)

    王艳花; 李立; 卢运祥; 邹建卫


    Ab initio and density functional calculations were employed to investigate the bonding patterns in the adenine-5-bromouracil(AT+)complexes.It is shown that the Br atom in 5-bromouracil(T+)is involved in bonding both with the hydrogen atom of the amino group of adenine(A)and with N7(A)(or N1(A)).With this motif,the Br atom interacts with a nucleophile(H)in a"head-on"fashion and an electrophile(N)in a"side-on"fashion,forming both hydrogen and halogen bonds.Electrostatic attraction between the Br atom in T+and N7(or N1)of adenine was found via the electrostatic potential analysis.The existence of A bond critical point is identified for the halogen bonds and the topological parameters at the bond critical point indicate the typical closed-shellinteractions in the pairs.Natural bond orbital analysis suggests that the charge transfer from the lone pair of the nitrogen atom of adenine is mainly directed to the C-Br antibonding orbital.Finally,halogen bonds in the T+AT+A tetrads were also explored.%利用从头算和密度泛函理论研究了腺嘌呤(A)-5-溴尿嘧啶复合物中(T+)中的键合模式.研究结果表明,T+中的Br原子同时与A分子中的氨基氢和氮原子存在弱的相互作用,在这种结合模式中,Br原子与亲核基团H正面结合,同时与来电基团N侧面结合,分别形成氢键和卤键.静电势分析发现:T+中的Br原子与A中的N7(或N1)是通过静电相互吸引的.Br与N原子之间的相互作用通过分了中的原子理论得以证实.关键点的拓扑参数显示卤键是闭壳层相互作用.自然键轨道分析说明,A中N原子上孤对电子的电荷主要转移到C-Br的反键轨道.另外在T+AT+A四面体结构中也发现了卤键.

  4. XRD and optical microscopic studies of Co(III) complexes containing 5-cyano-6-(4-pyridyl)-2-thiouracil, thymine and adenine bases

    Indian Academy of Sciences (India)

    Lallan Mishra; Brajesh Pathak; R K Mandal


    Multifunctional ligand 5-cyano-6-(-4-pyridyl)-2-thiouracil (L) was prepared and allowed to react with trans [Co(en)2Cl2]+Cl– resulting into [Co(en)2LCl]2+.2Cl– which upon further reaction with equimolar ratio of ligand [L] gave the complex [Co(en)2L2]3+.3Cl–. These metal complexes were then separately reacted with thymine and adenine bases. Complexes thus prepared after characterization by their elemental analysis, FAB mass and spectral (IR, 1HNMR, UV-visible) data were studied for their powder X-ray diffraction and optical microscopic characteristics.

  5. Comparative anatomy of the human APRT gene and enzyme: nucleotide sequence divergence and conservation of a nonrandom CpG dinucleotide arrangement

    International Nuclear Information System (INIS)

    The functional human adenine phosphoribosyltransferase (APRT) gene is <2.6 kilobases in length and contains five exons. The amino acid sequences of APRTs have been highly conserved throughout evolution. The human enzyme is 82%, 90%, and 40% identical to the mouse, hamster, and Escherichia coli enzymes, respectively. The promoter region of the human APRT gene, like that of several other housekeeping genes, lacks TATA and CCAAT boxes but contains five GC boxes that are potential binding sites for the Sp1 transcription factor. The distal three, however, are dispensable for gene expression. Comparison between human and mouse APRT gene nucleotide sequences reveals a high degree of homology within protein coding regions but an absence of significant homology in 5' flanking, 3' untranslated, and intron sequences, except for similarly positioned GC boxes in the promoter region and a 26-base-pair region in intron 3. This 26-base-pair sequence is 92% identical with a similarly positioned sequence in the mouse gene and is also found in intron 3 of the hamster gene, suggesting that its retention may be a consequence of stringent selection. The positions of all introns have been precisely retained in the human and both rodent genes. Retention of an elevated CpG dinucleotide content, despite loss of sequence homology, suggests that there may be selection for CpG dinucleotides in these regions and that their maintenance may be important for APRT gene function

  6. The nucleotide sequences of two leghemoglobin genes from soybean

    DEFF Research Database (Denmark)

    Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O; Paludan, K; Marcker, K A


    We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...

  7. A Laboratory Exercise for Genotyping Two Human Single Nucleotide Polymorphisms (United States)

    Fernando, James; Carlson, Bradley; LeBard, Timothy; McCarthy, Michael; Umali, Finianne; Ashton, Bryce; Rose, Ferrill F., Jr.


    The dramatic decrease in the cost of sequencing a human genome is leading to an era in which a wide range of students will benefit from having an understanding of human genetic variation. Since over 90% of sequence variation between humans is in the form of single nucleotide polymorphisms (SNPs), a laboratory exercise has been devised in order to…

  8. Nucleotide excision repair I: from E.coli to yeast.

    NARCIS (Netherlands)

    J.H.J. Hoeijmakers (Jan)


    textabstractGenetic information is constantly deteriorating, mainly as a consequence of the action of numerous genotoxic agents. In order to cope with this fundamental problem, all living organisms have acquired a complex network of DNA repair systems to safeguard their genetic integrity. Nucleotide

  9. DNA Nucleotides Detection via capacitance properties of Graphene (United States)

    Khadempar, Nahid; Berahman, Masoud; Yazdanpanah, Arash


    In the present paper a new method is suggested to detect the DNA nucleotides on a first-principles calculation of the electronic features of DNA bases which chemisorbed to a graphene sheet placed between two gold electrodes in a contact-channel-contact system. The capacitance properties of graphene in the channel are surveyed using non-equilibrium Green's function coupled with the Density Functional Theory. Thus, the capacitance properties of graphene are theoretically investigated in a biological environment, and, using a novel method, the effect of the chemisorbed DNA nucleotides on electrical charges on the surface of graphene is deciphered. Several parameters in this method are also extracted including Electrostatic energy, Induced density, induced electrostatic potential, Electron difference potential and Electron difference density. The qualitative and quantitative differences among these parameters can be used to identify DNA nucleotides. Some of the advantages of this approach include its ease and high accuracy. What distinguishes the current research is that it is the first experiment to investigate the capacitance properties of gaphene changes in the biological environment and the effect of chemisorbed DNA nucleotides on the surface of graphene on the charge.

  10. Extracellular nucleotide derivatives protect cardiomyctes against hypoxic stress

    DEFF Research Database (Denmark)

    Golan, O; Issan, Y; Isak, A;


    protective effect is not mediated via those receptors. We found that a wide variety of triphosphate and diphosphate nucleotides (TTP, ITP, deoxyGTP, and GDP), provided significant cardioprotective effect. GMP, guanosine, and ribose phosphate provided no cardioprotective effect. Moreover, we observed that tri...

  11. NMR study of conformationally restricted acylic phosphonate nucleotides

    Czech Academy of Sciences Publication Activity Database

    Poštová Slavětínská, Lenka; Pohl, Radek; Rejman, Dominik

    Hersonissos : -, 2013. s. 609-609. [EUROMAR 2013. A European Magnetic Resonance Meeting. 30.06.2013-05.07.2013, Hersonissos] R&D Projects: GA ČR GA13-24880S Institutional support: RVO:61388963 Keywords : acyclic phosphonate nucleotides * conformation * pyrrolidine ring * NMR spectra * PSEUROT program * pD dependence * molecular modeling Subject RIV: CB - Analytical Chemistry, Separation

  12. Nucleotide diversity and linkage disequilibrium in balsam poplar (Populus balsamifera). (United States)

    Olson, Matthew S; Robertson, Amanda L; Takebayashi, Naoki; Silim, Salim; Schroeder, William R; Tiffin, Peter


    *Current perceptions that poplars have high levels of nucleotide variation, large effective population sizes, and rapid decay of linkage disequilibrium are based primarily on studies from one poplar species, Populus tremula. *We analysed 590 gene fragments (average length 565 bp) from each of 15 individuals from different populations from throughout the range of Populus balsamifera. *Nucleotide diversity (theta(total) = 0.0028, pi = 0.0027) was low compared with other trees and model agricultural systems. Patterns of nucleotide diversity and site frequency spectra were consistent with purifying selection on replacement and intron sites. When averaged across all loci we found no evidence for decay of linkage disequilibrium across 750 bp, consistent with the low estimates of the scaled recombination parameter, rho = 0.0092. *Compared with P. tremula, a well studied congener with a similar distribution, P. balsamifera has low diversity and low effective recombination, both of which indicate a lower effective population size in P. balsamifera. Patterns of diversity and linkage indicate that there is considerable variation in population genomic patterns among poplar species and unlike P. tremula, association mapping techniques in balsam poplar should consider sampling single nucleotide polymorphisms (SNPs) at well-spaced intervals. PMID:20122131

  13. Single nucleotide polymorphism (SNP) detection on a magnetoresistive sensor

    DEFF Research Database (Denmark)

    Rizzi, Giovanni; Østerberg, Frederik Westergaard; Dufva, Martin;


    We present a magnetoresistive sensor platform for hybridization assays and demonstrate its applicability on single nucleotide polymorphism (SNP) genotyping. The sensor relies on anisotropic magnetoresistance in a new geometry with a local negative reference and uses the magnetic field from the...

  14. Nucleotide excision repair by dual incisions in plants. (United States)

    Canturk, Fazile; Karaman, Muhammet; Selby, Christopher P; Kemp, Michael G; Kulaksiz-Erkmen, Gulnihal; Hu, Jinchuan; Li, Wentao; Lindsey-Boltz, Laura A; Sancar, Aziz


    Plants use light for photosynthesis and for various signaling purposes. The UV wavelengths in sunlight also introduce DNA damage in the form of cyclobutane pyrimidine dimers (CPDs) and pyrimidine (6-4) pyrimidone photoproducts [(6-4)PPs] that must be repaired for the survival of the plant. Genome sequencing has revealed the presence of genes for both CPD and (6-4)PP photolyases, as well as genes for nucleotide excision repair in plants, such as Arabidopsis and rice. Plant photolyases have been purified, characterized, and have been shown to play an important role in plant survival. In contrast, even though nucleotide excision repair gene homologs have been found in plants, the mechanism of nucleotide excision repair has not been investigated. Here we used the in vivo excision repair assay developed in our laboratory to demonstrate that Arabidopsis removes CPDs and (6-4)PPs by a dual-incision mechanism that is essentially identical to the mechanism of dual incisions in humans and other eukaryotes, in which oligonucleotides with a mean length of 26-27 nucleotides are removed by incising ∼20 phosphodiester bonds 5' and 5 phosphodiester bonds 3' to the photoproduct. PMID:27071131

  15. Cyclization of nucleotide analogues as an obstacle to polymerization (United States)

    Hill, A. R. Jr; Nord, L. D.; Orgel, L. E.; Robins, R. K.


    Cyclization of activated nucleotide analogues by intramolecular phosphodiester-bond formation is likely to compete very effectively with template-directed condensation except in the cases of ribo- and arabinonucleotides. This could have excluded derivatives of most sugars from growing polyribonucleotide chains and thus reduced chain-termination in prebiotic polynucleotide synthesis.

  16. Single Nucleotide Polymorphisms Predict Symptom Severity of Autism Spectrum Disorder (United States)

    Jiao, Yun; Chen, Rong; Ke, Xiaoyan; Cheng, Lu; Chu, Kangkang; Lu, Zuhong; Herskovits, Edward H.


    Autism is widely believed to be a heterogeneous disorder; diagnosis is currently based solely on clinical criteria, although genetic, as well as environmental, influences are thought to be prominent factors in the etiology of most forms of autism. Our goal is to determine whether a predictive model based on single-nucleotide polymorphisms (SNPs)…

  17. Novel modified nucleobases, nucleosides and nucleotides: biological activity and applications

    Czech Academy of Sciences Publication Activity Database

    Hocek, Michal

    Louvain-La Neuve : -, 2007. PL4. [ Organic Chemistry , Present and Future. 10.04.2007-13.04.2007, Louvain-La-Neuve] R&D Projects: GA MŠk 1M0508; GA MŠk LC512 Institutional research plan: CEZ:AV0Z40550506 Keywords : nucleobases * nucleosides * nucleotides Subject RIV: CC - Organic Chemistry

  18. Spatiotemporal regulation of Rap guanine nucleotide exchange factors

    NARCIS (Netherlands)

    Consonni, S.V.


    Guanine nucleotide exchange factors (GEFs) and GTPase activating proteins (GAPs) orchestrate the activity of small G-proteins. In response to extracellular stimuli, GEFs and GAPs activate signaling cascades regulated by G-proteins by controlling their regulation in time and in space. Generally, GEFs


    NARCIS (Netherlands)



    1 The response of C2C12 mouse myotubes to stimulation with adenosine triphosphate (ATP) and other nucleotides was studied by measuring changes in membrane potential. 2 A transient hyperpolarization followed by a slowly declining depolarization of the cells was observed in the presence of ATP (10-mu-

  20. Guanosine nucleotide precursor for flavinogenesis of Eremothecium Ashbyii. (United States)

    Mitsuda, H; Nakajima, K


    The purine precursor in the riboflavin biosynthetic pathway in Eremothecium ashbyii was examined using a guanine analogue, 8-azaguanine, with non-growing cell systems. 1. Riboflavin formation in the culture filtrate was determined at 0, 5, 10 and 20 hr after start of the incubation of the non-growing cells in the presence of xanthine or 8-azaguanine (1 mM, respectively). At 20 hr of incubation, the addition of xanthine stimulated riboflavin formation by 36% and the addition of 8-azaguanine inhibited the formation by 57%. 2. Acid soluble nucleotide pools in the cells were followed at 0, 5, 10 and 20 hr of the incubation period in the presence of xanthine or 8-azaguanine by means of anion exchange column chromatography. The result showed that the GTP pool changed markedly despite the fact that the adenosine nucleotide pool was almost constant irrespective of the presence or absence of these purines till 10 hr of incubation. But, the decrease of the former was overcome in part by the addition of flavinogenic xanthine. Furthermore, the total amounts of GTP and guanosine accumulated in cells in the presence of 8-azaguanine reached the maximum already at 5 hr, attaining a level twice as much as the GTP contents of the control. 3. The role of guanosine nucleotide pool in riboflavin formation was further examined using 8-azaguanine. In this experiment the drug was added to the suspension of non-growing cells at 3 hr or 6 hr after the incubation was started and the reaction was continued till the 12th hr. A more clear-cut correlationship between riboflavin formation and guanosine nucleotide pool was oberved by this experiment. The guanosine nucleotide pool (consisting of GMP, GDP and GTP) increased simultaneously with the inhibition of riboflavin formation. Of the guanosine nucleotides pools, the GMP pool increased 2.7 times above normal upon the addition of 8-azaguanine during the incubation for 6 hr and 5.3 fold for 9 hr. While, the GTP pool increased 1.9 fold above

  1. Global regulation of nucleotide biosynthetic genes by c-Myc.

    Directory of Open Access Journals (Sweden)

    Yen-Chun Liu

    Full Text Available BACKGROUND: The c-Myc transcription factor is a master regulator and integrates cell proliferation, cell growth and metabolism through activating thousands of target genes. Our identification of direct c-Myc target genes by chromatin immunoprecipitation (ChIP coupled with pair-end ditag sequencing analysis (ChIP-PET revealed that nucleotide metabolic genes are enriched among c-Myc targets, but the role of Myc in regulating nucleotide metabolic genes has not been comprehensively delineated. METHODOLOGY/PRINCIPAL FINDINGS: Here, we report that the majority of genes in human purine and pyrimidine biosynthesis pathway were induced and directly bound by c-Myc in the P493-6 human Burkitt's lymphoma model cell line. The majority of these genes were also responsive to the ligand-activated Myc-estrogen receptor fusion protein, Myc-ER, in a Myc null rat fibroblast cell line, HO.15 MYC-ER. Furthermore, these targets are also responsive to Myc activation in transgenic mouse livers in vivo. To determine the functional significance of c-Myc regulation of nucleotide metabolism, we sought to determine the effect of loss of function of direct Myc targets inosine monophosphate dehydrogenases (IMPDH1 and IMPDH2 on c-Myc-induced cell growth and proliferation. In this regard, we used a specific IMPDH inhibitor mycophenolic acid (MPA and found that MPA dramatically inhibits c-Myc-induced P493-6 cell proliferation through S-phase arrest and apoptosis. CONCLUSIONS/SIGNIFICANCE: Taken together, these results demonstrate the direct induction of nucleotide metabolic genes by c-Myc in multiple systems. Our finding of an S-phase arrest in cells with diminished IMPDH activity suggests that nucleotide pool balance is essential for c-Myc's orchestration of DNA replication, such that uncoupling of these two processes create DNA replication stress and apoptosis.

  2. Physicochemical studies of the reaction of (99m)Tc with 5,5'-diethyl barbituric acid, adenine, d-glucose and thiobarbituric acid at different temperatures. (United States)

    Masoud, M S; El-Shahat, M F; Elkholany, A S


    The reaction of (99m)Tc pertechnetate with 5,5'-diethyl barbituric acid, adenine, d-glucose and thiobarbituric acid at different temperatures was studied. The solvent effect on the electronic absorption spectra of the reactions was recorded. The reaction mixtures have been analyzed at different times using TLC and a radiodetctor to show the peaks at the plates. (99m)Tc pertechnetate is obtained from the Mo generators. It is difficult to separate the complexes in the solid state. The percentage of (99m)Tc involved in the complexes can be determined. Characterization of the (99m)Tc complexes as well as the determination of the extent of radiolabeling was done by thin layer chromatography using 0.9% NaCl solution as a solvent. The Rf value of (99m)TcO4(-) is (≈1). The solvatochromism for the reaction of (99m)Tc with d-glucose was mainly affected by solute permanent dipole-solvent permanent dipole interaction, the dipolar interaction for the reaction of (99m)Tc with of 5,5'-diethyl barbituric acid and for the reaction of (99m)Tc with adenine and thiobarbituric was solute-solvent hydrogen bonding. PMID:24632174

  3. Determination of the recognition site for adenine-specific methylase of Shigella sonnei 47 by hydazinolysis of DNA, followed by separation of the purine oligonucleotides by thin-layer chromatography on DEAE-cellulose

    International Nuclear Information System (INIS)

    A method has been developed for the separation of oligopurine units according to length and composition by two-dimensional thin-layer chromatography on plates with DEAE-cellulose, permitting a comparative analysis of the content of various purine isopliths in DNA of different origin. In the case of the analysis of methylated DNA, the method permits a comparison of the substrate specificity of various enzymes of methylation of the adenine residues in DNA. In conjunction with enzymatic treatment of labeled methylated isopliths, the method permits determination of the methylatable sequence and in a number of cases an ascertainment of the recognition site for adenine-specific methylase as a whole. The proposed method was used to establish the fact that the methylase Ssol recognizes the sequence 5'...G-A-A-T-T-C...3' and methylates the adenine residue closest to its 5'-end

  4. High-throughput profiling of nucleotides and nucleotide sugars to evaluate their impact on antibody N-glycosylation. (United States)

    Villiger, Thomas K; Steinhoff, Robert F; Ivarsson, Marija; Solacroup, Thomas; Stettler, Matthieu; Broly, Hervé; Krismer, Jasmin; Pabst, Martin; Zenobi, Renato; Morbidelli, Massimo; Soos, Miroslav


    Recent advances in miniaturized cell culture systems have facilitated the screening of media additives on productivity and protein quality attributes of mammalian cell cultures. However, intracellular components are not routinely measured due to the limited throughput of available analytical techniques. In this work, time profiling of intracellular nucleotides and nucleotide sugars of CHO-S cell fed-batch processes in a micro-scale bioreactor system was carried out using a recently developed high-throughput method based on matrix-assisted laser desorption/ionization (MALDI) time-of-flight mass spectrometry (TOF-MS). Supplementation of various media additives significantly altered the intracellular nucleotides and nucleotide sugars that are inextricably linked to the process of glycosylation. The results revealed that UDP-Gal synthesis appeared to be particularly limiting whereas the impact of elevated UDP-GlcNAc and GDP-Fuc levels on the final glycosylation patterns was only marginally important. In contrast, manganese and asparagine supplementation altered the glycan profiles without affecting intracellular components. The combination of miniaturized cell cultures and high-throughput analytical techniques serves therefore as a useful tool for future quality driven media optimization studies. PMID:27131894

  5. Modification of survival of gamma irradiated mice by adenosine nucleotides

    International Nuclear Information System (INIS)

    The administration prior to irradiation of adenosine triphosphate (ATP) or other adenosine nucleotides, singly or in combination, increased the radioresistance of mice. Post-irradiation treatment with the adenosine nucleotides had no effect on the survival of the irradiated mice. Dose reduction factors of 2.32 could be obtained by pretreatment of mice with the following combination of protective agents: S-2(4-aminobutylamino)ethyl phosphorothioic aced (WR 2822), cysteamine (MEA) and ATP. Since cyclic AMP levels were unchanged in the spleen or gut by administration of cysteamine and other protectors it is unlikely that the increase in protection was due to changes in cyclic AMP levels. The calcium salt of ATP provided a higher level of protection than the ATP alone, indicating that the protective mechanism of ATP is probably not related to anoxia. (orig.)

  6. Genome-wide patterns of nucleotide polymorphism in domesticated rice

    DEFF Research Database (Denmark)

    Caicedo, Ana L; Williamson, Scott H; Hernandez, Ryan D;


    Domesticated Asian rice (Oryza sativa) is one of the oldest domesticated crop species in the world, having fed more people than any other plant in human history. We report the patterns of DNA sequence variation in rice and its wild ancestor, O. rufipogon, across 111 randomly chosen gene fragments......, and use these to infer the evolutionary dynamics that led to the origins of rice. There is a genome-wide excess of high-frequency derived single nucleotide polymorphisms (SNPs) in O. sativa varieties, a pattern that has not been reported for other crop species. We developed several alternative models...... plausible explanations for patterns of variation in domesticated rice varieties. If selective sweeps are indeed the explanation for the observed nucleotide data of domesticated rice, it suggests that strong selection can leave its imprint on genome-wide polymorphism patterns, contrary to expectations that...

  7. Nucleotide analogs based on pentaerythritol — An hypothesis (United States)

    Schwartz, Alan W.


    The synthesis of ribose and ribose-based nucleotides under reasonable prebiotic conditions has not been achieved. Glycerol has been suggested as a structural unit that might have preceded ribose in the evolutionary emergence of RNA. Template-directed oligomerizations of nucleotide analogs based on glycerol, however, have been only partially successful. Recent studies on the effect of ultraviolet irradiation of formaldehyde solutions have shown that the reduced sugar pentaerythritol is formed with great specificity. I argue that pentaerythritol is potentially capable of being converted by simple chemistry into a series of nucleoside analogs related to barbituric acid. These analogs may be able to take part in nucleic acid-like interactions and could therefore be of potential interest as a new class of candidates as RNA precursors.

  8. Identification of cyclic nucleotide gated channels using regular expressions

    KAUST Repository

    Zelman, Alice K.


    Cyclic nucleotide-gated channels (CNGCs) are nonselective cation channels found in plants, animals, and some bacteria. They have a six-transmembrane/one- pore structure, a cytosolic cyclic nucleotide-binding domain, and a cytosolic calmodulin-binding domain. Despite their functional similarities, the plant CNGC family members appear to have different conserved amino acid motifs within corresponding functional domains than animal and bacterial CNGCs do. Here we describe the development and application of methods employing plant CNGC-specific sequence motifs as diagnostic tools to identify novel candidate channels in different plants. These methods are used to evaluate the validity of annotations of putative orthologs of CNGCs from plant genomes. The methods detail how to employ regular expressions of conserved amino acids in functional domains of annotated CNGCs and together with Web tools such as PHI-BLAST and ScanProsite to identify novel candidate CNGCs in species including Physcomitrella patens. © Springer Science+Business Media New York 2013.

  9. The nucleotide exchange factors of Hsp70 molecular chaperone

    Directory of Open Access Journals (Sweden)

    Andreas eBracher


    Full Text Available Molecular chaperones of the Hsp70 family form an important hub in the cellular protein folding networks in bacteria and eukaryotes, connecting translation with the downstream machineries of protein folding and degradation. The Hsp70 folding cycle is driven by two types of cochaperones: J-domain proteins stimulate ATP hydrolysis by Hsp70, while nucleotide exchange factors (NEFs promote replacement of Hsp70-bound ADP with ATP. Bacteria and organelles of bacterial origin have only one known NEF type for Hsp70, GrpE. In contrast, a large diversity of Hsp70 NEFs has been discovered in the eukaryotic cell. These NEFs belong to the Hsp110/Grp170, HspBP1/Sil1 and BAG domain protein families. In this short review we compare the structures and molecular mechanisms of nucleotide exchange factors for Hsp70 and discuss how these cochaperones contribute to protein folding and quality control in the cell.

  10. Evidence for the existence of a tyrosyl residue in the nicotinamide adenine dinucleotide binding site of chicken liver xanthine dehydrogenase

    International Nuclear Information System (INIS)

    Xanthine-NAD and NADH-methylene blue oxidoreductase activities of chicken liver xanthine dehydrogenase were inactivated by incubation with 5'-[p-(fluorosulfonyl)benzoyl]adenosine (5'-FSBA), an active site directed reagent for nucleotide binding sites. The inactivation reaction displayed pseudo-first-order kinetics. A double-reciprocal plot of inactivation velocity vs. 5'-FSBA concentration showed that 5'-FSBA and enzyme formed a complex prior to inactivation. NAD protected the enzyme from inactivation by 5'-FSBA in a competitive fashion. The modified enzyme had the same xanthine-dichlorophenolindophenol and xanthine-O2 oxidoreductase activities as the native enzyme, and on addition of xanthine to the modified enzyme, bleaching of the spectrum occurred in the visible region. The amount of radioactivity incorporated into the enzyme by incubation with [14C]-5'-FSBA was parallel to the loss of xanthine-NAD oxidoreductase activity, and the stoichiometry was 1 mol/mol of enzyme-bound FAD for complete inactivation. These results indicated that 5'-FSBA modified specifically the binding site for NAD of chicken liver xanthine dehydrogenase. The incorporated radioactivity was released slowly from 14C-labeled enzyme by incubation with dithiothreitol with concomitant restoration of catalytic activity. The modified residue responsible for inactivation was identified as a tyrosine

  11. The Role of Cyclic Nucleotide Signaling Pathways in Cancer: Targets for Prevention and Treatment

    Energy Technology Data Exchange (ETDEWEB)

    Fajardo, Alexandra M.; Piazza, Gary A. [Drug Discovery Research Center, Mitchell Cancer Institute, University of South Alabama, 1660 Springhill Ave, Suite 3029, Mobile, AL 36604 (United States); Tinsley, Heather N., E-mail: [Department of Biology, Chemistry, and Mathematics, University of Montevallo, Station 6480, Montevallo, AL 35115 (United States)


    For more than four decades, the cyclic nucleotides cyclic AMP (cAMP) and cyclic GMP (cGMP) have been recognized as important signaling molecules within cells. Under normal physiological conditions, cyclic nucleotides regulate a myriad of biological processes such as cell growth and adhesion, energy homeostasis, neuronal signaling, and muscle relaxation. In addition, altered cyclic nucleotide signaling has been observed in a number of pathophysiological conditions, including cancer. While the distinct molecular alterations responsible for these effects vary depending on the specific cancer type, several studies have demonstrated that activation of cyclic nucleotide signaling through one of three mechanisms—induction of cyclic nucleotide synthesis, inhibition of cyclic nucleotide degradation, or activation of cyclic nucleotide receptors—is sufficient to inhibit proliferation and activate apoptosis in many types of cancer cells. These findings suggest that targeting cyclic nucleotide signaling can provide a strategy for the discovery of novel agents for the prevention and/or treatment of selected cancers.

  12. Spontaneous formation and base pairing of plausible prebiotic nucleotides in water. (United States)

    Cafferty, Brian J; Fialho, David M; Khanam, Jaheda; Krishnamurthy, Ramanarayanan; Hud, Nicholas V


    The RNA World hypothesis presupposes that abiotic reactions originally produced nucleotides, the monomers of RNA and universal constituents of metabolism. However, compatible prebiotic reactions for the synthesis of complementary (that is, base pairing) nucleotides and mechanisms for their mutual selection within a complex chemical environment have not been reported. Here we show that two plausible prebiotic heterocycles, melamine and barbituric acid, form glycosidic linkages with ribose and ribose-5-phosphate in water to produce nucleosides and nucleotides in good yields. Even without purification, these nucleotides base pair in aqueous solution to create linear supramolecular assemblies containing thousands of ordered nucleotides. Nucleotide anomerization and supramolecular assemblies favour the biologically relevant β-anomer form of these ribonucleotides, revealing abiotic mechanisms by which nucleotide structure and configuration could have been originally favoured. These findings indicate that nucleotide formation and selection may have been robust processes on the prebiotic Earth, if other nucleobases preceded those of extant life. PMID:27108699

  13. Spontaneous formation and base pairing of plausible prebiotic nucleotides in water (United States)

    Cafferty, Brian J.; Fialho, David M.; Khanam, Jaheda; Krishnamurthy, Ramanarayanan; Hud, Nicholas V.


    The RNA World hypothesis presupposes that abiotic reactions originally produced nucleotides, the monomers of RNA and universal constituents of metabolism. However, compatible prebiotic reactions for the synthesis of complementary (that is, base pairing) nucleotides and mechanisms for their mutual selection within a complex chemical environment have not been reported. Here we show that two plausible prebiotic heterocycles, melamine and barbituric acid, form glycosidic linkages with ribose and ribose-5-phosphate in water to produce nucleosides and nucleotides in good yields. Even without purification, these nucleotides base pair in aqueous solution to create linear supramolecular assemblies containing thousands of ordered nucleotides. Nucleotide anomerization and supramolecular assemblies favour the biologically relevant β-anomer form of these ribonucleotides, revealing abiotic mechanisms by which nucleotide structure and configuration could have been originally favoured. These findings indicate that nucleotide formation and selection may have been robust processes on the prebiotic Earth, if other nucleobases preceded those of extant life. PMID:27108699

  14. iCLIP: Protein–RNA interactions at nucleotide resolution


    Huppertz I; Attig J; D'Ambrogio A.; Eastonb L; Sibley CR; Sugimoto Y; Tajnik M; K\\xf6nig J; Ule J


    RNA-binding proteins (RBPs) are key players in the post-transcriptional regulation of gene expression. Precise knowledge about their binding sites is therefore critical to unravel their molecular function and to understand their role in development and disease. Individual-nucleotide resolution UV crosslinking and immunoprecipitation (iCLIP) identifies protein-RNA crosslink sites on a genome-wide scale. The high resolution and specificity of this method are achieved by an intramolecular cDNA c...

  15. Synthesis of sugar-nucleotide analogs as potential glycosyltransferase inhibitors

    Czech Academy of Sciences Publication Activity Database

    Kóšiová, Ivana; Koiš, P.; Rosenberg, Ivan


    Roč. 101, č. 11 (2007), s. 949-950. ISSN 0009-2770. [Pokroky v organické, bioorganické a farmaceutické chemii /42./. 16.11.2007-18.11.2007, Liblice] R&D Projects: GA ČR GA202/05/0628 Grant ostatní: SSTAA(SK) APVV-51-046505 Institutional research plan: CEZ:AV0Z40550506 Keywords : glycosylation * glycosyltransferase * nucleotide analogs * nucleoside phosphonates Subject RIV: CC - Organic Chemistry

  16. Conformation of pyrrolidine ring in pyrrolidine nucleotide analogues

    Czech Academy of Sciences Publication Activity Database

    Pohl, Radek; Buděšínský, Miloš; Rejman, Dominik; Kočalka, Petr; Rosenberg, Ivan

    Praha : Institute of Organic Chemistry and Biochemistry ASCR, 2008 - (Hocek, M.), s. 435-436 ISBN 978-80-86241-29-6. - (Collection Symposium Series. 10). [Symposium on Chemistry of Nucleic Acid Components /14./. Český Krumlov (CZ), 08.06.2008-13.06.2008] R&D Projects: GA MŠk 2B06065 Institutional research plan: CEZ:AV0Z40550506 Keywords : NMR spectroscopy * conformation analysis * nucleotides Subject RIV: CC - Organic Chemistry

  17. Isolation and nucleotide sequence of the gene encoding human rhodopsin.


    Nathans, J; Hogness, D S


    We have isolated and completely sequenced the gene encoding human rhodopsin. The coding region of the human rhodopsin gene is interrupted by four introns, which are located at positions analogous to those found in the previously characterized bovine rhodopsin gene. The amino acid sequence of human rhodopsin, deduced from the nucleotide sequence of its gene, is 348 residues long and is 93.4% homologous to that of bovine rhodopsin. Interestingly, those portions of the polypeptide chain predicte...

  18. Single nucleotide polymorphisms of complement component 5 and periodontitis


    L. Chai; Zee, KY; Song, YQ; Leung, WK


    BACKGROUND AND OBJECTIVE: Polymorphisms of host defence genes might increase one's risks for periodontitis. This study investigated whether tagging single nucleotide polymorphisms (SNPs) of the gene encoding complement component 5 (C5) are associated with periodontitis in a Hong Kong Chinese population. MATERIAL AND METHODS: Eleven tagging SNPs of 229 patients with at least moderate periodontitis and 207 control subjects without periodontitis were genotyped using an i-plexGOLD MassARRAY mass-...

  19. Utilizing Single Nucleotide Polymorphism Analysis in Determining Parentage of Cattle


    Elbert, Nicole M.


    Parentage identification within cattle herds is an important aspect of record keeping. It is essential for accurate registration within a purebred association and decision making for production purposes, such as replacement heifer and sire selection. Methods used to identify parentage have evolved from utilizing blood protein antigens, restriction fragment length polymorphism (RFLP) and microsatellites to the current technology of analyzing DNA profiles for differing single nucleotide polymor...

  20. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    Energy Technology Data Exchange (ETDEWEB)

    Lo, A.; Yang, H.L.


    This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.

  1. Haplotype Information and Linkage Disequilibrium Mapping for Single Nucleotide Polymorphisms


    Lu, Xin; Niu, Tianhua; Liu, Jun


    Single nucleotide polymorphisms in the human genome have become an increasingly popular topic in that their analyses promise to be a key step toward personalized medicine. We investigate two related questions, how much the haplotype information contributes to linkage disequilibrium (LD) mapping and whether an in silico haplotype construction preceding the LD analysis can help. For disease gene mapping, using both simulated and real data sets on cystic fibrosis and the Alzheimer disease, we re...

  2. Haplotype Information and Linkage Disequilibrium Mapping for Single Nucleotide Polymorphisms


    Lu, Xin; Niu, Tianhua; Liu, Jun S.


    Single nucleotide polymorphisms in the human genome have become an increasingly popular topic in that their analyses promise to be a key step toward personalized medicine. We investigate two related questions, how much the haplotype information contributes to linkage disequilibrium (LD) mapping and whether an in silico haplotype construction preceding the LD analysis can help. For disease gene mapping, using both simulated and real data sets on cystic fibrosis and the Alzheimer disease,...

  3. Expression of Vesicular Nucleotide Transporter in Rat Odontoblasts


    Ikeda, Erina; Goto, Tetsuya; Gunjigake, Kaori; Kuroishi, Kayoko; Ueda, Masae; Kataoka, Shinji; Toyono, Takashi; Nakatomi, Mitsushiro; Seta, Yuji; Kitamura, Chiaki; NISHIHARA, Tatsuji; Kawamoto, Tatsuo


    Several theories have been proposed regarding pain transmission mechanisms in tooth. However, the exact signaling mechanism from odontoblasts to pulp nerves remains to be clarified. Recently, ATP-associated pain transmission has been reported, but it is unclear whether ATP is involved in tooth pain transmission. In the present study, we focused on the vesicular nucleotide transporter (VNUT), a transporter of ATP into vesicles, and examined whether VNUT was involved in ATP release from odontob...

  4. MGMT expression: insights into its regulation. 2. Single nucleotide polymorphisms


    Iatsyshyna A. P.; Pidpala O. V.; Lukash L. L.


    High intra- and interindividual variations in the expression levels of the human O6-methylguanine-DNA methyltransferase (MGMT) gene have been observed. This DNA repair enzyme can be a cause of resistance of cancer cells to alkylating chemotherapy. It has been studied the association of single nucleotide polymorphisms (SNPs) of MGMT with the risk for different types of cancer, progression-free survival in patients with cancer treated with alkylating chemotherapy, as well as an effect of SNPs o...

  5. A Simple Strategy for Glycosyltransferase-Catalyzed Aminosugar Nucleotide Synthesis


    Zhang, Jianjun; Singh, Shanteri; Hughes, Ryan R.; Zhou, Maoquan; Sunkara, Manjula; Morris, Andrew J.; Thorson, Jon S.


    A set of 2-chloro-4-nitrophenyl glucosamino/xylosaminosides were synthesized and assessed as potential substrates in the context of glycosyltransferase-catalyzed formation of the corresponding UDP/TDP-α-D-glucosamino-/xylosaminosugars and single vessel transglycosylation reactions with a model acceptor. This study highlights a robust platform for aminosugar nucleotide synthesis and reveals OleD Loki as a proficient catalyst for U/TDP-aminosugar synthesis and utilization.

  6. Single nucleotide polymorphisms predict symptom severity of autism spectrum disorder


    Jiao, Yun; Chen, Rong; Ke, Xiaoyan; Cheng, Lu; Chu, Kangkang; Lu, Zuhong; Herskovits, Edward H


    Autism is widely believed to be a heterogeneous disorder; diagnosis is currently based solely on clinical criteria, although genetic, as well as environmental, influences are thought to be prominent factors in the etiology of most forms of autism. Our goal is to determine whether a predictive model based on single-nucleotide polymorphisms (SNPs) can predict symptom severity of autism spectrum disorder (ASD). We divided 118 ASD children into a mild/moderate autism group (n = 65) and a severe a...

  7. SSE: a nucleotide and amino acid sequence analysis platform


    Simmonds Peter


    Abstract Background There is an increasing need to develop bioinformatic tools to organise and analyse the rapidly growing amount of nucleotide and amino acid sequence data in organisms ranging from viruses to eukaryotes. Finding A simple sequence editor (SSE) was developed to create an integrated environment where sequences can be aligned, annotated, classified and directly analysed by a number of built-in bioinformatic programs. SSE incorporates a sequence editor for the creation of sequenc...

  8. Analysis of Single Nucleotide Polymorphism Panels for Bovine DNA Identification


    Blanchard, Kimberly A.


    Single nucleotide polymorphisms (SNPs) are single base-pair variations that exist between individuals. There are approximately a million or more SNPs located throughout the genome of each individual animal. Therefore, by taking advantage of these unique polymorphisms, SNPs can be used to resolve questions of unknown parentage in the livestock industry. Currently a panel of 88 SNPs, obtained from a panel of 121 SNPs originally created by USDA-MARC, is commercially available from Fluidigm®. The...

  9. Scambio, a novel guanine nucleotide exchange factor for Rho


    Groffen John; Senadheera Dinithi; Haataja Leena; Hemmeryckx Bianca; Curtis Christina; Heisterkamp Nora


    Abstract Background Small GTPases of the Rho family are critical regulators of various cellular functions including actin cytoskeleton organization, activation of kinase cascades and mitogenesis. For this reason, a major objective has been to understand the mechanisms of Rho GTPase regulation. Here, we examine the function of a novel protein, Scambio, which shares homology with the DH-PH domains of several known guanine nucleotide exchange factors for Rho family members. Results Scambio is lo...

  10. Spatiotemporal regulation of Rap guanine nucleotide exchange factors


    Consonni, S.V.


    Guanine nucleotide exchange factors (GEFs) and GTPase activating proteins (GAPs) orchestrate the activity of small G-proteins. In response to extracellular stimuli, GEFs and GAPs activate signaling cascades regulated by G-proteins by controlling their regulation in time and in space. Generally, GEFs function as activators of G-proteins by promoting their GTP-bound state while GAPs serve as inhibitors by increasing the rate of GTP hydrolysis. Our understanding of the mechanisms of regulation o...

  11. Monovar: single-nucleotide variant detection in single cells. (United States)

    Zafar, Hamim; Wang, Yong; Nakhleh, Luay; Navin, Nicholas; Chen, Ken


    Current variant callers are not suitable for single-cell DNA sequencing, as they do not account for allelic dropout, false-positive errors and coverage nonuniformity. We developed Monovar (, a statistical method for detecting and genotyping single-nucleotide variants in single-cell data. Monovar exhibited superior performance over standard algorithms on benchmarks and in identifying driver mutations and delineating clonal substructure in three different human tumor data sets. PMID:27088313

  12. The effect of mitochondrial dysfunction on cytosolic nucleotide metabolism

    DEFF Research Database (Denmark)

    Madsen, Claus Desler; Lykke, Anne; Rasmussen, Lene Juel


    Several enzymes of the metabolic pathways responsible for metabolism of cytosolic ribonucleotides and deoxyribonucleotides are located in mitochondria. Studies described in this paper suggest dysfunction of the mitochondria to affect these metabolic pathways and limit the available levels of...... cytosolic ribonucleotides and deoxyribonucleotides, which in turn can result in aberrant RNA and DNA synthesis. Mitochondrial dysfunction has been linked to genomic instability, and it is possible that the limiting effect of mitochondrial dysfunction on the levels of nucleotides and resulting aberrant RNA...

  13. Single-nucleotide polymorphism identification and genotyping in Camelina sativa


    Singh, Ravinder; Bollina, Venkatesh; Higgins, Erin E.; Clarke, Wayne E.; Eynck, Christina; Sidebottom, Christine; Gugel, Richard; Snowdon, Rod; Parkin, Isobel A. P.


    Camelina sativa, a largely relict crop, has recently returned to interest due to its potential as an industrial oilseed. Molecular markers are key tools that will allow C. sativa to benefit from modern breeding approaches. Two complementary methodologies, capture of 3′ cDNA tags and genomic reduced-representation libraries, both of which exploited second generation sequencing platforms, were used to develop a low density (768) Illumina GoldenGate single nucleotide polymorphism (SNP) array. Th...

  14. Mechanisms and energetics for N-glycosidic bond cleavage of protonated adenine nucleosides: N3 protonation induces base rotation and enhances N-glycosidic bond stability. (United States)

    Wu, R R; Rodgers, M T


    Our previous gas-phase infrared multiple photon dissociation action spectroscopy study of protonated 2'-deoxyadenosine and adenosine, [dAdo+H](+) and [Ado+H](+), found that both N3 and N1 protonated conformers are populated with the N3 protonated ground-state conformers predominant in the experiments. Therefore, N-glycosidic bond dissociation mechanisms of N3 and N1 protonated [dAdo+H](+) and [Ado+H](+) and the associated quantitative thermochemical values are investigated here using both experimental and theoretical approaches. Threshold collision-induced dissociation (TCID) of [dAdo+H](+) and [Ado+H](+) with Xe is studied using guided ion beam tandem mass spectrometry techniques. For both systems, N-glycosidic bond cleavage reactions are observed as the major dissociation pathways resulting in production of protonated adenine or elimination of neutral adenine. Electronic structure calculations are performed at the B3LYP/6-311+G(d,p) level of theory to probe the potential energy surfaces (PESs) for N-glycosidic bond cleavage of [dAdo+H](+) and [Ado+H](+). Relative energetics of the reactants, transition states, intermediates and products along the PESs for N-glycosidic bond cleavage are determined at the B3LYP/6-311+G(2d,2p), B3LYP-GD3BJ/6-311+G(2d,2p), and MP2(full)/6-311+G(2d,2p) levels of theory. The predicted N-glycosidic bond dissociation mechanisms for the N3 and N1 protonated species differ. Base rotation of the adenine residue enables formation of a strong N3H(+)O5' hydrogen-bonding interaction that stabilizes the N3 protonated species and its glycosidic bond. Comparison between experiment and theory indicates that the N3 protonated species determine the threshold energies, as excellent agreement between the measured and B3LYP computed activation energies (AEs) and reaction enthalpies (ΔHrxns) for N-glycosidic bond cleavage of the N3 protonated species is found. PMID:27240654

  15. Genome-wide patterns of nucleotide polymorphism in domesticated rice.

    Directory of Open Access Journals (Sweden)

    Ana L Caicedo


    Full Text Available Domesticated Asian rice (Oryza sativa is one of the oldest domesticated crop species in the world, having fed more people than any other plant in human history. We report the patterns of DNA sequence variation in rice and its wild ancestor, O. rufipogon, across 111 randomly chosen gene fragments, and use these to infer the evolutionary dynamics that led to the origins of rice. There is a genome-wide excess of high-frequency derived single nucleotide polymorphisms (SNPs in O. sativa varieties, a pattern that has not been reported for other crop species. We developed several alternative models to explain contemporary patterns of polymorphisms in rice, including a (i selectively neutral population bottleneck model, (ii bottleneck plus migration model, (iii multiple selective sweeps model, and (iv bottleneck plus selective sweeps model. We find that a simple bottleneck model, which has been the dominant demographic model for domesticated species, cannot explain the derived nucleotide polymorphism site frequency spectrum in rice. Instead, a bottleneck model that incorporates selective sweeps, or a more complex demographic model that includes subdivision and gene flow, are more plausible explanations for patterns of variation in domesticated rice varieties. If selective sweeps are indeed the explanation for the observed nucleotide data of domesticated rice, it suggests that strong selection can leave its imprint on genome-wide polymorphism patterns, contrary to expectations that selection results only in a local signature of variation.

  16. Nucleotide Sequencing and Identification of Some Wild Mushrooms

    Directory of Open Access Journals (Sweden)

    Sudip Kumar Das


    Full Text Available The rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers fragment of the genomic DNA of 8 wild edible mushrooms (collected from Eastern Chota Nagpur Plateau of West Bengal, India was amplified using ITS1 (Internal Transcribed Spacers 1 and ITS2 primers and subjected to nucleotide sequence determination for identification of mushrooms as mentioned. The sequences were aligned using ClustalW software program. The aligned sequences revealed identity (homology percentage from GenBank data base of Amanita hemibapha [CN (Chota Nagpur 1, % identity 99 (JX844716.1], Amanita sp. [CN 2, % identity 98 (JX844763.1], Astraeus hygrometricus [CN 3, % identity 87 (FJ536664.1], Termitomyces sp. [CN 4, % identity 90 (JF746992.1], Termitomyces sp. [CN 5, % identity 99 (GU001667.1], T. microcarpus [CN 6, % identity 82 (EF421077.1], Termitomyces sp. [CN 7, % identity 76 (JF746993.1], and Volvariella volvacea [CN 8, % identity 100 (JN086680.1]. Although out of 8 mushrooms 4 could be identified up to species level, the nucleotide sequences of the rest may be relevant to further characterization. A phylogenetic tree is constructed using Neighbor-Joining method showing interrelationship between/among the mushrooms. The determined nucleotide sequences of the mushrooms may provide additional information enriching GenBank database aiding to molecular taxonomy and facilitating its domestication and characterization for human benefits.

  17. Scambio, a novel guanine nucleotide exchange factor for Rho

    Directory of Open Access Journals (Sweden)

    Groffen John


    Full Text Available Abstract Background Small GTPases of the Rho family are critical regulators of various cellular functions including actin cytoskeleton organization, activation of kinase cascades and mitogenesis. For this reason, a major objective has been to understand the mechanisms of Rho GTPase regulation. Here, we examine the function of a novel protein, Scambio, which shares homology with the DH-PH domains of several known guanine nucleotide exchange factors for Rho family members. Results Scambio is located on human chromosome 14q11.1, encodes a protein of around 181 kDa, and is highly expressed in both heart and skeletal muscle. In contrast to most DH-PH-domain containing proteins, it binds the activated, GTP-bound forms of Rac and Cdc42. However, it fails to associate with V14RhoA. Immunofluorescence studies indicate that Scambio and activated Rac3 colocalize in membrane ruffles at the cell periphery. In accordance with these findings, Scambio does not activate either Rac or Cdc42 but rather, stimulates guanine nucleotide exchange on RhoA and its close relative, RhoC. Conclusion Scambio associates with Rac in its activated conformation and functions as a guanine nucleotide exchange factor for Rho.

  18. Cyclic nucleotide regulation of cardiac sympatho-vagal responsiveness. (United States)

    Li, Dan; Paterson, David J


    Cyclic adenosine monophosphate (cAMP) and cyclic guanosine monophosphate (cGMP) are now recognized as important intracellular signalling molecules that modulate cardiac sympatho-vagal balance in the progression of heart disease. Recent studies have identified that a significant component of autonomic dysfunction associated with several cardiovascular pathologies resides at the end organ, and is coupled to impairment of cyclic nucleotide targeted pathways linked to abnormal intracellular calcium handling and cardiac neurotransmission. Emerging evidence also suggests that cyclic nucleotide coupled phosphodiesterases (PDEs) play a key role limiting the hydrolysis of cAMP and cGMP in disease, and as a consequence this influences the action of the nucleotide on its downstream biological target. In this review, we illustrate the action of nitric oxide-CAPON signalling and brain natriuretic peptide on cGMP and cAMP regulation of cardiac sympatho-vagal transmission in hypertension and ischaemic heart disease. Moreover, we address how PDE2A is now emerging as a major target that affects the efficacy of soluble/particulate guanylate cyclase coupling to cGMP in cardiac dysautonomia. PMID:26915722

  19. A Fluorimetric Readout Reporting the Kinetics of Nucleotide-Induced Human Ribonucleotide Reductase Oligomerization


    Fu, Yuan; Lin, Hongyu; Wisitpitthaya, Somsinee; Blessing, William A.; Aye, Yimon


    Human ribonucleotide reductase (hRNR) is a target of nucleotide chemotherapeutics in clinical use. The nucleotide-induced oligomeric regulation of hRNR subunit α is increasingly being recognized as an innate and drug-relevant mechanism for enzyme activity modulation. In the presence of negative feedback inhibitor dATP and leukemia drug clofarabine nucleotides, hRNR-α assembles into catalytically inert hexameric complexes, whereas nucleotide effectors that govern substrate specificity typicall...

  20. Performance-enhancing effects of dietary nucleotides: do mitochondria play a role?

    Directory of Open Access Journals (Sweden)

    Sergej M. Ostojic


    Full Text Available Nucleotides are group of natural biomonomeric molecules and novel dietary supplements with performance-enhancing attributes. However, their mechanisms of action and target biological structures are poorly understood and identified. This short paper overviews the possible role of mitochondria during the utilization of nucleotides for exercise performance. Mitochondria-related effects of nucleotides have been identified, along with obstacles for dietary nucleotides delivery to the organelle.

  1. Nucleotide sequences specific to Brucella and methods for the detection of Brucella

    Energy Technology Data Exchange (ETDEWEB)

    McCready, Paula M. (Tracy, CA); Radnedge, Lyndsay (San Mateo, CA); Andersen, Gary L. (Berkeley, CA); Ott, Linda L. (Livermore, CA); Slezak, Thomas R. (Livermore, CA); Kuczmarski, Thomas A. (Livermore, CA)


    Nucleotide sequences specific to Brucella that serves as a marker or signature for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

  2. n-Nucleotide circular codes in graph theory. (United States)

    Fimmel, Elena; Michel, Christian J; Strüngmann, Lutz


    The circular code theory proposes that genes are constituted of two trinucleotide codes: the classical genetic code with 61 trinucleotides for coding the 20 amino acids (except the three stop codons {TAA,TAG,TGA}) and a circular code based on 20 trinucleotides for retrieving, maintaining and synchronizing the reading frame. It relies on two main results: the identification of a maximal C(3) self-complementary trinucleotide circular code X in genes of bacteria, eukaryotes, plasmids and viruses (Michel 2015 J. Theor. Biol. 380, 156-177. (doi:10.1016/j.jtbi.2015.04.009); Arquès & Michel 1996 J. Theor. Biol. 182, 45-58. (doi:10.1006/jtbi.1996.0142)) and the finding of X circular code motifs in tRNAs and rRNAs, in particular in the ribosome decoding centre (Michel 2012 Comput. Biol. Chem. 37, 24-37. (doi:10.1016/j.compbiolchem.2011.10.002); El Soufi & Michel 2014 Comput. Biol. Chem. 52, 9-17. (doi:10.1016/j.compbiolchem.2014.08.001)). The univerally conserved nucleotides A1492 and A1493 and the conserved nucleotide G530 are included in X circular code motifs. Recently, dinucleotide circular codes were also investigated (Michel & Pirillo 2013 ISRN Biomath. 2013, 538631. (doi:10.1155/2013/538631); Fimmel et al. 2015 J. Theor. Biol. 386, 159-165. (doi:10.1016/j.jtbi.2015.08.034)). As the genetic motifs of different lengths are ubiquitous in genes and genomes, we introduce a new approach based on graph theory to study in full generality n-nucleotide circular codes X, i.e. of length 2 (dinucleotide), 3 (trinucleotide), 4 (tetranucleotide), etc. Indeed, we prove that an n-nucleotide code X is circular if and only if the corresponding graph [Formula: see text] is acyclic. Moreover, the maximal length of a path in [Formula: see text] corresponds to the window of nucleotides in a sequence for detecting the correct reading frame. Finally, the graph theory of tournaments is applied to the study of dinucleotide circular codes. It has full equivalence between the combinatorics

  3. The nucleotide sequence and genome organization of Plasmopara halstedii virus

    Directory of Open Access Journals (Sweden)

    Göpfert Jens C


    Full Text Available Abstract Background Only very few viruses of Oomycetes have been studied in detail. Isometric virions were found in different isolates of the oomycete Plasmopara halstedii, the downy mildew pathogen of sunflower. However, complete nucleotide sequences and data on the genome organization were lacking. Methods Viral RNA of different P. halstedii isolates was subjected to nucleotide sequencing and analysis of the viral genome. The N-terminal sequence of the viral coat protein was determined using Top-Down MALDI-TOF analysis. Results The complete nucleotide sequences of both single-stranded RNA segments (RNA1 and RNA2 were established. RNA1 consisted of 2793 nucleotides (nt exclusive its 3' poly(A tract and a single open-reading frame (ORF1 of 2745 nt. ORF1 was framed by a 5' untranslated region (5' UTR of 18 nt and a 3' untranslated region (3' UTR of 30 nt. ORF1 contained motifs of RNA-dependent RNA polymerases (RdRp and showed similarities to RdRp of Scleropthora macrospora virus A (SmV A and viruses within the Nodaviridae family. RNA2 consisted of 1526 nt exclusive its 3' poly(A tract and a second ORF (ORF2 of 1128 nt. ORF2 coded for the single viral coat protein (CP and was framed by a 5' UTR of 164 nt and a 3' UTR of 234 nt. The deduced amino acid sequence of ORF2 was verified by nano-LC-ESI-MS/MS experiments. Top-Down MALDI-TOF analysis revealed the N-terminal sequence of the CP. The N-terminal sequence represented a region within ORF2 suggesting a proteolytic processing of the CP in vivo. The CP showed similarities to CP of SmV A and viruses within the Tombusviridae family. Fragments of RNA1 (ca. 1.9 kb and RNA2 (ca. 1.4 kb were used to analyze the nucleotide sequence variation of virions in different P. halstedii isolates. Viral sequence variation was 0.3% or less regardless of their host's pathotypes, the geographical origin and the sensitivity towards the fungicide metalaxyl. Conclusions The results showed the presence of a single and new

  4. A Method for Quantification of Nucleotides and Nucleotide Analogues in Thymidine Kinase Assays Utilizing Lanthanum Phosphate Co-Precipitation


    Gammon, ST; Bernstein, M; Schuster, DP; Piwnica-Worms, D


    Current methodologies for quantifying radiolabeled nucleoside monophosphates and nucleoside analogues result in high retention of unphosphorylated guanosine nucleosides in the case of lanthanum chloride precipitation or inconsistent retention of nucleotides in the case of DEAE cellulose filter papers. This study describes an innovative method for quantifying TK activity that is compatible with both purine and pyrimidine nucleoside analogues by utilizing lanthanum phosphate co-precipitation at...

  5. Genetics Home Reference: ornithine translocase deficiency (United States)

    ... coma. Episodes of illness may coincide with the introduction of high-protein formulas or solid foods into ... Library of Medicine Lister Hill National Center for Biomedical Communications 8600 Rockville Pike, Bethesda, MD 20894, USA ...

  6. 日粮核苷酸对化学性肝损伤过程中肝组织腺苷酸池的影响%Effects of Dietary Nucleotides on Adenine Nucleotide Pool in Liver Tissue with Chemical Liver Injury

    Institute of Scientific and Technical Information of China (English)

    朱善良; 孙文; 许晓风



  7. A possible prebiotic synthesis of purine, adenine, cytosine, and 4(3H)-pyrimidinone from formamide: implications for the origin of life. (United States)

    Saladino, R; Crestini, C; Costanzo, G; Negri, R; Di Mauro, E


    The synthesis of prebiotic molecules is a major problem in chemical evolution as well as in any origin-of-life theory. We report here a plausible new prebiotic synthesis of naturally occurring purine and pyrimidine derivatives from formamide under catalytic conditions. In the presence of CaCO(3) and different inorganic oxides, namely silica, alumine, kaolin, and zeolite (Y type), neat formamide undergoes the formation of purine, adenine, cytosine, and 4(3H)-pyrimidinone, from acceptable to good yields. The role of catalysts showed to be not limited to the improvement of the yield but it is also relevant in providing a high selectivity in the products distribution. PMID:11377183

  8. Biocomposite based on reduced graphene oxide film modified with phenothiazone and flavin adenine dinucleotide-dependent glucose dehydrogenase for glucose sensing and biofuel cell applications. (United States)

    Ravenna, Yehonatan; Xia, Lin; Gun, Jenny; Mikhaylov, Alexey A; Medvedev, Alexander G; Lev, Ovadia; Alfonta, Lital


    A novel composite material for the encapsulation of redox enzymes was prepared. Reduced graphene oxide film with adsorbed phenothiazone was used as a highly efficient composite for electron transfer between flavin adenine dinucleotide (FAD)-dependent glucose dehydrogenase and electrodes. Measured redox potential for glucose oxidation was lower than 0 V vs Ag/AgCl electrode. The fabricated biosensor showed high sensitivity of 42 mA M(-1) cm(-2), a linear range of glucose detection of 0.5-12 mM, and good reproducibility and stability as well as high selectivity for different interfering compounds. In a semibiofuel cell configuration, the hybrid film generated high power output of 345 μW cm(-2). These results demonstrate a promising potential for this composition in various bioelectronic applications. PMID:26334692

  9. Reactivities of radicals of adenine and guanine towards reactive oxygen species and reactive nitrogen oxide species: OH rad and NO 2rad (United States)

    Agnihotri, Neha; Mishra, P. C.


    Reactions of radicals of the DNA bases with reactive oxygen species and reactive nitrogen oxide species produce mutagenic products. We have studied reactivities of all the carbon sites of radicals of adenine A(-H) rad and guanine G(-H) rad obtained by removal of H-atoms from their nitrogen sites towards OH rad and NO 2rad . We studied stabilities of A(-H) rad and G(-H) rad and binding energies of their adducts with each of OH rad and NO 2rad using density functional theoretic and MP2 calculations employing the AUG-cc-pVDZ basis set. Solvation in aqueous media was treated using the polarization continuum model. The results obtained explain experimental observations.

  10. Adenine phosphoribosyltransferase from Sulfolobus solfataricus is an enzyme with unusual kinetic properties and a crystal structure that suggests it evolved from a 6-oxopurine phosphoribosyltransferase

    DEFF Research Database (Denmark)

    Jensen, Kaj Frank; Hansen, Michael Riis; Jensen, Kristine Steen;


    The adenine phosphoribosyltransferase (APRTase) encoded by the open reading frame SSO2342 of Sulfolobus solfataricus P2, was subjected to crystallographic, kinetic and ligand binding analyses. The enzyme forms dimers in solution and in the crystals, and binds one molecule of the reactants 5...

  11. Diabetic complications within the context of aging: Nicotinamide adenine dinucleotide redox, insulin C-peptide, sirtuin 1-liver kinase B1-adenosine monophosphate-activated protein kinase positive feedback and forkhead box O3. (United States)

    Ido, Yasuo


    Recent research in nutritional control of aging suggests that cytosolic increases in the reduced form of nicotinamide adenine dinucleotide and decreasing nicotinamide adenine dinucleotide metabolism plays a central role in controlling the longevity gene products sirtuin 1 (SIRT1), adenosine monophosphate-activated protein kinase (AMPK) and forkhead box O3 (FOXO3). High nutrition conditions, such as the diabetic milieu, increase the ratio of reduced to oxidized forms of cytosolic nicotinamide adenine dinucleotide through cascades including the polyol pathway. This redox change is associated with insulin resistance and the development of diabetic complications, and might be counteracted by insulin C-peptide. My research and others' suggest that the SIRT1-liver kinase B1-AMPK cascade creates positive feedback through nicotinamide adenine dinucleotide synthesis to help cells cope with metabolic stress. SIRT1 and AMPK can upregulate liver kinase B1 and FOXO3, key factors that help residential stem cells cope with oxidative stress. FOXO3 directly changes epigenetics around transcription start sites, maintaining the health of stem cells. 'Diabetic memory' is likely a result of epigenetic changes caused by high nutritional conditions, which disturb the quiescent state of residential stem cells and impair tissue repair. This could be prevented by restoring SIRT1-AMPK positive feedback through activating FOXO3. PMID:27181414

  12. Specificity of the ModA11, ModA12 and ModD1 epigenetic regulator N6-adenine DNA methyltransferases of Neisseria meningitidis (United States)

    Seib, Kate L.; Jen, Freda E.-C.; Tan, Aimee; Scott, Adeana L.; Kumar, Ritesh; Power, Peter M.; Chen, Li-Tzu; Wu, Hsing-Ju; Wang, Andrew H.-J.; Hill, Dorothea M. C.; Luyten, Yvette A.; Morgan, Richard D.; Roberts, Richard J.; Maiden, Martin C. J.; Boitano, Matthew; Clark, Tyson A.; Korlach, Jonas; Rao, Desirazu N.; Jennings, Michael P.


    Phase variation (random ON/OFF switching) of gene expression is a common feature of host-adapted pathogenic bacteria. Phase variably expressed N6-adenine DNA methyltransferases (Mod) alter global methylation patterns resulting in changes in gene expression. These systems constitute phase variable regulons called phasevarions. Neisseria meningitidis phasevarions regulate genes including virulence factors and vaccine candidates, and alter phenotypes including antibiotic resistance. The target site recognized by these Type III N6-adenine DNA methyltransferases is not known. Single molecule, real-time (SMRT) methylome analysis was used to identify the recognition site for three key N. meningitidis methyltransferases: ModA11 (exemplified by M.NmeMC58I) (5′-CGYm6AG-3′), ModA12 (exemplified by M.Nme77I, M.Nme18I and M.Nme579II) (5′-ACm6ACC-3′) and ModD1 (exemplified by M.Nme579I) (5′-CCm6AGC-3′). Restriction inhibition assays and mutagenesis confirmed the SMRT methylome analysis. The ModA11 site is complex and atypical and is dependent on the type of pyrimidine at the central position, in combination with the bases flanking the core recognition sequence 5′-CGYm6AG-3′. The observed efficiency of methylation in the modA11 strain (MC58) genome ranged from 4.6% at 5′-GCGCm6AGG-3′ sites, to 100% at 5′-ACGTm6AGG-3′ sites. Analysis of the distribution of modified sites in the respective genomes shows many cases of association with intergenic regions of genes with altered expression due to phasevarion switching. PMID:25845594

  13. Changes in phosphorylation of adenosine phosphate and redox state of nicotinamide-adenine dinucleotide (phosphate) in Geobacter sulfurreducens in response to electron acceptor and anode potential variation

    KAUST Repository

    Rose, Nicholas D.


    © 2015 Elsevier B.V. Geobacter sulfurreducens is one of the dominant bacterial species found in biofilms growing on anodes in bioelectrochemical systems. The intracellular concentrations of reduced and oxidized forms of nicotinamide-adenine dinucleotide (NADH and NAD+, respectively) and nicotinamide-adenine dinucleotide phosphate (NADPH and NADP+, respectively) as well as adenosine triphosphate (ATP), adenosine diphosphate (ADP), and adenosine monophosphate (AMP) were measured in G. sulfurreducens using fumarate, Fe(III)-citrate, or anodes poised at different potentials (110, 10, -90, and -190mV (vs. SHE)) as the electron acceptor. The ratios of CNADH/CNAD+ (0.088±0.022) and CNADPH/CNADP+ (0.268±0.098) were similar under all anode potentials tested and with Fe(III)-citrate (reduced extracellularly). Both ratios significantly increased with fumarate as the electron acceptor (0.331±0.094 for NAD and 1.96±0.37 for NADP). The adenylate energy charge (the fraction of phosphorylation in intracellular adenosine phosphates) was maintained near 0.47 under almost all conditions. Anode-growing biofilms demonstrated a significantly higher molar ratio of ATP/ADP relative to suspended cultures grown on fumarate or Fe(III)-citrate. These results provide evidence that the cellular location of reduction and not the redox potential of the electron acceptor controls the intracellular redox potential in G. sulfurreducens and that biofilm growth alters adenylate phosphorylation.

  14. Binding of nucleotides to nucleoside diphosphate kinase: a calorimetric study. (United States)

    Cervoni, L; Lascu, I; Xu, Y; Gonin, P; Morr, M; Merouani, M; Janin, J; Giartosio, A


    The source of affinity for substrates of human nucleoside diphosphate (NDP) kinases is particularly important in that its knowledge could be used to design more effective antiviral nucleoside drugs (e.g., AZT). We carried out a microcalorimetric study of the binding of enzymes from two organisms to various nucleotides. Isothermal titration calorimetry has been used to characterize the binding in terms of Delta G degrees, Delta H degrees and Delta S degrees. Thermodynamic parameters of the interaction of ADP with the hexameric NDP kinase from Dictyostelium discoideum and with the tetrameric enzyme from Myxococcus xanthus, at 20 degrees C, were similar and, in both cases, binding was enthalpy-driven. The interactions of ADP, 2'deoxyADP, GDP, and IDP with the eukaryotic enzyme differed in enthalpic and entropic terms, whereas the Delta G degrees values obtained were similar due to enthalpy--entropy compensation. The binding of the enzyme to nonphysiological nucleotides, such as AMP--PNP, 3'deoxyADP, and 3'-deoxy-3'-amino-ADP, appears to differ in several respects. Crystallography of the protein bound to 3'-deoxy-3'-amino-ADP showed that the drug was in a distorted position, and was unable to interact correctly with active site side chains. The interaction of pyrimidine nucleoside diphosphates with the hexameric enzyme is characterized by a lower affinity than that with purine nucleotides. Titration showed the stoichiometry of the interaction to be abnormal, with 9--12 binding sites/hexamer. The presence of supplementary binding sites might have physiological implications. PMID:11294625

  15. Study of sperm cell phosphorylating systems using nucleotide photoaffinity probes

    International Nuclear Information System (INIS)

    The major thrust of the research presented in this thesis was to identify specific nucleotide binding proteins and phosphoproteins of rat caput and cauda sperm. Also, the differences in these proteins between caput and cauda sperm were investigated as well as determination of the membrane sidedness of the proteins and their location in either the head or tail/mid-piece region. In addition, the effects of small molecular weight modifers such as cGMP, cAMP and Ca2+ on the detection of binding proteins and phosphorylated proteins was studied. The technique used to identify and locate nucleotide binding proteins was photoaffinity labeling using the proven 8-azidopurine nucleotide analogs of cAMP, ATP and GTP in radioactive form. The first study presented involved the use of [32P]8-N 3cAMP which showed that both caput and cauda sperm contained both type I and type II regulatory subunits (R/sub I/ and R/sub II/, respectively) of the cAMP dependent kinases and that the great majority of the regulatory subunits were located in the tail/mid-piece section and not in the sperm head. The second phase of this study involved the use of [γ32P]8-azidoadensosine triphosphate ([γ32P]8-N3ATP) and (γ32P)8-azidoguanosine triphosphate ([γ32P]8-N3GTP) to photolable specific ATP and GTP binding proteins and to phosphorylate specific phosphoproteins. Again, this was done on caput versus cauda sperm and the location of the majority of the photolabeled or phosphorylated proteins was shown to be in the tail/mid-piece fraction. In addition, considerable differences were found in both the phosphorylated and photolabeled proteins of caput versus cauda sperm

  16. Comparative nucleotide diversity across North American and European populus species. (United States)

    Ismail, Mohamed; Soolanayakanahally, Raju Y; Ingvarsson, Pär K; Guy, Robert D; Jansson, Stefan; Silim, Salim N; El-Kassaby, Yousry A


    Nucleotide polymorphisms in two North American balsam poplars (Populus trichocarpa Torr. & Gray and P. balsamifera L.; section Tacamahaca), and one Eurasian aspen (P. tremula L.; section Populus) were compared using nine loci involved in defense, stress response, photoperiodism, freezing tolerance, and housekeeping. Nucleotide diversity varied among species and was highest for P. tremula (θ(w) = 0.005, π(T) = 0.007) as compared to P. balsamifera (θ(w) = 0.004, π(T) = 0.005) or P. trichocarpa (θ(w) = 0.002, π(T) = 0.003). Across species, the defense and the stress response loci accounted for the majority of the observed level of nucleotide diversity. In general, the studied loci did not deviate from neutral expectation either at the individual locus (non-significant normalized Fay and Wu's H) or at the multi-locus level (non-significant HKA test). Using molecular clock analysis, section Tacamahaca probably shared a common ancestor with section Populus approximately 4.5 million year ago. Divergence between the two closely related balsam poplars was about 0.8 million years ago, a pattern consistent with an isolation-with-migration (IM) model. As expected, P. tremula showed a five-fold higher substitution rate (2 × 10(-8) substitution/site/year) compared to the North American species (0.4 × 10(-8) substitution/site/year), probably reflecting its complex demographic history. Linkage disequilibrium (LD) varied among species with a more rapid decay in the North American species (balsam poplar species likely reflects the recent time of their divergence. PMID:22562720

  17. Bioinformatics comparison of sulfate-reducing metabolism nucleotide sequences (United States)

    Tremberger, G.; Dehipawala, Sunil; Nguyen, A.; Cheung, E.; Sullivan, R.; Holden, T.; Lieberman, D.; Cheung, T.


    The sulfate-reducing bacteria can be traced back to 3.5 billion years ago. The thermodynamics details of the sulfur cycle have been well documented. A recent sulfate-reducing bacteria report (Robator, Jungbluth, et al , 2015 Jan, Front. Microbiol) with Genbank nucleotide data has been analyzed in terms of the sulfite reductase (dsrAB) via fractal dimension and entropy values. Comparison to oil field sulfate-reducing sequences was included. The AUCG translational mass fractal dimension versus ATCG transcriptional mass fractal dimension for the low temperature dsrB and dsrA sequences reported in Reference Thirteen shows correlation R-sq ~ 0.79 , with a probably of about 3% in simulation. A recent report of using Cystathionine gamma-lyase sequence to produce CdS quantum dot in a biological method, where the sulfur is reduced just like in the H2S production process, was included for comparison. The AUCG mass fractal dimension versus ATCG mass fractal dimension for the Cystathionine gamma-lyase sequences was found to have R-sq of 0.72, similar to the low temperature dissimilatory sulfite reductase dsr group with 3% probability, in contrary to the oil field group having R-sq ~ 0.94, a high probable outcome in the simulation. The other two simulation histograms, namely, fractal dimension versus entropy R-sq outcome values, and di-nucleotide entropy versus mono-nucleotide entropy R-sq outcome values are also discussed in the data analysis focusing on low probability outcomes.

  18. Nucleotide sequence of the triosephosphate isomerase gene from Macaca mulatta

    Energy Technology Data Exchange (ETDEWEB)

    Old, S.E.; Mohrenweiser, H.W. (Univ. of Michigan, Ann Arbor (USA))


    The triosephosphate isomerase gene from a rhesus monkey, Macaca mulatta, charon 34 library was sequenced. The human and chimpanzee enzymes differ from the rhesus enzyme at ASN 20 and GLU 198. The nucleotide sequence identity between rhesus and human is 97% in the coding region and >94% in the flanking regions. Comparison of the rhesus and chimp genes, including the intron and flanking sequences, does not suggest a mechanism for generating the two TPI peptides of proliferating cells from hominoids and a single peptide from the rhesus gene.

  19. Usefulness of single nucleotide polymorphism data for estimating population parameters.


    Kuhner, M K; Beerli, P; Yamato, J; Felsenstein, J


    Single nucleotide polymorphism (SNP) data can be used for parameter estimation via maximum likelihood methods as long as the way in which the SNPs were determined is known, so that an appropriate likelihood formula can be constructed. We present such likelihoods for several sampling methods. As a test of these approaches, we consider use of SNPs to estimate the parameter Theta = 4N(e)micro (the scaled product of effective population size and per-site mutation rate), which is related to the br...

  20. Metal-based chemosensors for amino acids, peptides, and nucleotides


    Buryak, Andrey


    An organometallic 4d transition metal complex [Cp*RhCl2]2, together with commercially available dyes, was used to construct indicator displacement assays (IDAs) for the detection of peptides, amino acids, and nucleotides. The combination of the Cp*Rh complex with the dye azophloxine was found to form a chemosensing ensemble for the sequence-selective detection of histidine- and methionine-containing peptides in water at neutral pH. A strong interaction of the rhodium complex with peptides bea...

  1. Metal-based chemosensors for amino acids, peptides, and nucleotides


    Buryak, Andrey; Severin, Kay


    An organometallic 4d transition metal complex [Cp*RhCl2]2, together with commercially available dyes, was used to construct indicator displacement assays (IDAs) for the detection of peptides, amino acids, and nucleotides. The combination of the Cp*Rh complex with the dye azophloxine was found to form a chemosensing ensemble for the sequence-selective detection of histidine- and methionine-containing peptides in water at neutral pH. A strong interaction of the rhodium complex with peptides bea...

  2. Purine nucleotide synthesis in cultured rat embryos undergoing organogenesis

    International Nuclear Information System (INIS)

    The authors show that de n ovo synthesis is the sole source of the purine nucleotides required for in vitro rat embryonic growth during organogenesis. The presence of high levels of activity of purine catabolic enzymes in the homologous serum essential for culture prohibits the salvage of purine. While the 3-carbon atom of serine is the major source of one carbon units for purine ring synthesis there is a significant contribution from the 2-ring carbon atom of tryptophan. The paper describes in detail the incorporation of (1-14C)glycine into the acid soluble phase and other processes connected with de novo purine synthesis

  3. Nucleotide sequence of a spinach chloroplast valine tRNA.


    Sprouse, H M; Kashdan, M; Otis, L; Dudock, B


    The nucleotide sequence of a spinach chloroplast valine tRNA (sp. chl. tRNA Val) has been determined. This tRNA shows essentially equal homology to prokaryotic valine tRNAs (58-65% homology) and to the mitochondrial valine tRNAs of lower eukaryotes (yeast and N. crassa, 61-62% homology). Sp. chl. tRNA Val shows distinctly lower homology to mouse mitochondrial valine tRNA (53% homology) and to eukaryotic cytoplasmic valine tRNAs (47-53% homology). Sp. chl. tRNA Val, like all other chloroplast ...

  4. Effects of acute and chronic endurance exercise on mitochondrial uncoupling in human skeletal muscle

    DEFF Research Database (Denmark)

    Fernström, Maria; Tonkonogi, Michail; Sahlin, Kent


    increased uncoupled respiration (UCR). Subjects were investigated with muscle biopsies before and after acute exercise (75 min of cycling at 70% of .VO2peak) or 6 weeks endurance training. Mitochondria were isolated and respiration measured in the absence (UCR or state 4) and presence of ADP (coupled...... of CS (a marker of mitochondrial volume) UCP3 and UCR decreased by 54% and 18%(P < 0.05). CS increased by 43% after acute exercise and remained elevated after 3 h of recovery (P < 0.05), whereas the other muscle parameters remained unchanged. An intriguing finding was that acute exercise reversibly......Mitochondrial proteins such as uncoupling protein 3 (UCP3) and adenine nucleotide translocase (ANT) may mediate back-leakage of protons and serve as uncouplers of oxidative phosphorylation. We hypothesized that UCP3 and ANT increase after prolonged exercise and/or endurance training, resulting in...

  5. Assay of cyclic nucleotide phosphodiesterase using radiolabeled and fluorescent substrates

    International Nuclear Information System (INIS)

    There are four major classes of phosphodiesterase with different specificities for cAMP and cGMP and different allosteric regulators. Type I phosphodiesterase is activated by calmodulin plus Ca/sup 2+/ and has a higher affinity for cGMP than cAMP. Type II phosphodiesterase likewise has a higher affinity for cGMP than cAMP, but the activity toward one substrate is markedly stimulated by low (micromolar) concentrations of the other nucleotide. Type III phosphodiesterase has a higher affinity for cAMP than cGMP; its activity is increased in responsive cells by certain hormones, e.g., insulin, isoproterenol. Type IV phosphodiesterase is the cGMP-specific enzyme, which also has an allosteric binding site for cGMP. An example of this class of enzyme is the one from retinal rod outer segments, which is activated by light via rhodopsin and the guanine nucleotide-binding protein transducin. There appears to be little structural relatedness among these enzymes based on immunologic analysis, consistent with the possibility that divergent forms evolved from an ancestral enzyme. Determination of the amount of a specific form of phosphodiesterase in crude material is often difficult. Modification of assay conditions by judicious choice of substrate and/or inhibitor concentrations may selectively favor (or reduce) the activity of a particular form; in many instances, however, some fractionation of enzymes may be necessary. This is discussed more fully in the final section of this chapter

  6. Single Nucleotide Polymorphism Analysis of Protamine Genes in Infertile Men

    Directory of Open Access Journals (Sweden)

    Ahamad Salamian


    Full Text Available Background: Single nucleotide polymorphism (SNPs are considered as one of the underlyingcauses of male infertility. Proper sperm chromatin packaging which involves replacement ofhistones with protamines has profound effect on male fertility. Over 20 SNPs have been reportedfor the protamine 1 and 2.Materials and Methods: The aim of this study was to evaluate the frequency of two previouslyreported SNPs using polymerase chain reaction (PCR-restriction fragment length polymorphism(RFLP approach in 35, 96 and 177 normal, oligozoospermic and azoospermic individuals. TheseSNPs are: 1. A base pair substitution (G at position 197 instead of T in protamine type 1 Openreading frame (ORF including untranslated region, which causes an Arg residue change to Serresidue in a highly conserved region. 2. cytidine nucleotide change to thymidine in position of 248of protamine type 2 ORF which caused a nonsense point mutation.Results: The two mentioned SNPs were not present in the studied population, thus concluding thatthese SNPs can not serves as molecular markers for male infertility diagnosis.Conclusion: The results of our study reveal that in a selected Iranian population, the SNP G197Tand C248T are completely absent and are not associated with male infertility and therefore theseSNPs may not represent a molecular marker for genetic diagnosis of male infertility.

  7. Single nucleotide polymorphism analysis of European archaeological M. leprae DNA.

    Directory of Open Access Journals (Sweden)

    Claire L Watson

    Full Text Available BACKGROUND: Leprosy was common in Europe eight to twelve centuries ago but molecular confirmation of this has been lacking. We have extracted M. leprae ancient DNA (aDNA from medieval bones and single nucleotide polymorphism (SNP typed the DNA, this provides insight into the pattern of leprosy transmission in Europe and may assist in the understanding of M. leprae evolution. METHODS AND FINDINGS: Skeletons have been exhumed from 3 European countries (the United Kingdom, Denmark and Croatia and are dated around the medieval period (476 to 1350 A.D.. we tested for the presence of 3 previously identified single nucleotide polymorphisms (SNPs in 10 aDNA extractions. M. leprae aDNA was extracted from 6 of the 10 bone samples. SNP analysis of these 6 extractions were compared to previously analysed European SNP data using the same PCR assays and were found to be the same. Testing for the presence of SNPs in M. leprae DNA extracted from ancient bone samples is a novel approach to analysing European M. leprae DNA and the findings concur with the previously published data that European M. leprae strains fall in to one group (SNP group 3. CONCLUSIONS: These findings support the suggestion that the M. leprae genome is extremely stable and show that archaeological M. leprae DNA can be analysed to gain detailed information about the genotypic make-up of European leprosy, which may assist in the understanding of leprosy transmission worldwide.

  8. Nucleotide variation in the Toxoplasma gondii micronemal protein 8 gene. (United States)

    Li, Z Y; Song, H Q; Wang, C R; Zhu, X Q


    Toxoplasma gondii is a successful opportunistic protozoan distributed worldwide, which can infect all vertebrates, leading to serious infection, blindness, and abortion. Micronemal (MIC) proteins are critically important for T. gondii infection, as they participate in various stages of the Toxoplasma life cycle, including invasion and attachment to host cells. MIC8 secretion relies on the concentration of intracellular calcium, and can mediate the invasion of T. gondii by interacting with soluble MIC3. To investigate genetic diversity of the MIC8 gene, 16 T. gondii strains from different hosts and geographical locations, and two reference isolates (ToxoDB: TGME49_245490 and TGVEG_245490) were examined in this study. The results showed that all the examined MIC8 genes are 2055 bp, with an A+T content ranging from 50.2 to 50.6%. Conversely, lower levels of variation were detected within their nucleotide and amino acid sequences. Phylogenetic analyses indicated that three classical genotypes of T. gondii and the ToxoDB#9 genotype did not group exclusively via Bayesian inference, maximum parsimony, neighbor joining, and/or maximum likelihood assays based on the nucleotide and amino acid sequences of the MIC8 gene. In summary, the T. gondii MIC8 gene is not a suitable marker for population genetic studies of this parasite. PMID:27173337

  9. Structure and function of nucleotide sugar transporters: Current progress

    Directory of Open Access Journals (Sweden)

    Barbara Hadley


    Full Text Available The proteomes of eukaryotes, bacteria and archaea are highly diverse due, in part, to the complex post-translational modification of protein glycosylation. The diversity of glycosylation in eukaryotes is reliant on nucleotide sugar transporters to translocate specific nucleotide sugars that are synthesised in the cytosol and nucleus, into the endoplasmic reticulum and Golgi apparatus where glycosylation reactions occur. Thirty years of research utilising multidisciplinary approaches has contributed to our current understanding of NST function and structure. In this review, the structure and function, with reference to various disease states, of several NSTs including the UDP-galactose, UDP-N-acetylglucosamine, UDP-N-acetylgalactosamine, GDP-fucose, UDP-N-acetylglucosamine/UDP-glucose/GDP-mannose and CMP-sialic acid transporters will be described. Little is known regarding the exact structure of NSTs due to difficulties associated with crystallising membrane proteins. To date, no three-dimensional structure of any NST has been elucidated. What is known is based on computer predictions, mutagenesis experiments, epitope-tagging studies, in-vitro assays and phylogenetic analysis. In this regard the best-characterised NST to date is the CMP-sialic acid transporter (CST. Therefore in this review we will provide the current state-of-play with respect to the structure–function relationship of the (CST. In particular we have summarised work performed by a number groups detailing the affect of various mutations on CST transport activity, efficiency, and substrate specificity.

  10. Evaluation of published single nucleotide polymorphisms associated with acute GVHD. (United States)

    Chien, Jason W; Zhang, Xinyi Cindy; Fan, Wenhong; Wang, Hongwei; Zhao, Lue Ping; Martin, Paul J; Storer, Barry E; Boeckh, Michael; Warren, Edus H; Hansen, John A


    Candidate genetic associations with acute GVHD (aGVHD) were evaluated with the use of genotyped and imputed single-nucleotide polymorphism data from genome-wide scans of 1298 allogeneic hematopoietic cell transplantation (HCT) donors and recipients. Of 40 previously reported candidate SNPs, 6 were successfully genotyped, and 10 were imputed and passed criteria for analysis. Patient and donor genotypes were assessed for association with grades IIb-IV and III-IV aGVHD, stratified by donor type, in univariate and multivariate allelic, recessive and dominant models. Use of imputed genotypes to replicate previous IL10 associations was validated. Similar to previous publications, the IL6 donor genotype for rs1800795 was associated with a 20%-50% increased risk for grade IIb-IV aGVHD after unrelated HCT in the allelic (adjusted P = .011) and recessive (adjusted P = .0013) models. The donor genotype was associated with a 60% increase in risk for grade III-IV aGVHD after related HCT (adjusted P = .028). Other associations were found for IL2, CTLA4, HPSE, and MTHFR but were inconsistent with original publications. These results illustrate the advantages of using imputed single-nucleotide polymorphism data in genetic analyses and demonstrate the importance of validation in genetic association studies. PMID:22282500

  11. Formate supplementation enhances folate-dependent nucleotide biosynthesis and prevents spina bifida in a mouse model of folic acid-resistant neural tube defects. (United States)

    Sudiwala, Sonia; De Castro, Sandra C P; Leung, Kit-Yi; Brosnan, John T; Brosnan, Margaret E; Mills, Kevin; Copp, Andrew J; Greene, Nicholas D E


    The curly tail mouse provides a model for neural tube defects (spina bifida and exencephaly) that are resistant to prevention by folic acid. The major ct gene, responsible for spina bifida, corresponds to a hypomorphic allele of grainyhead-like 3 (Grhl3) but the frequency of NTDs is strongly influenced by modifiers in the genetic background. Moreover, exencephaly in the curly tail strain is not prevented by reinstatement of Grhl3 expression. In the current study we found that expression of Mthfd1L, encoding a key component of mitochondrial folate one-carbon metabolism (FOCM), is significantly reduced in ct/ct embryos compared to a partially congenic wild-type strain. This expression change is not attributable to regulation by Grhl3 or the genetic background at the Mthfd1L locus. Mitochondrial FOCM provides one-carbon units as formate for FOCM reactions in the cytosol. We found that maternal supplementation with formate prevented NTDs in curly tail embryos and also resulted in increased litter size. Analysis of the folate profile of neurulation-stage embryos showed that formate supplementation resulted in an increased proportion of formyl-THF and THF but a reduction in proportion of 5-methyl THF. In contrast, THF decreased and 5-methyl THF was relatively more abundant in the liver of supplemented dams than in controls. In embryos cultured through the period of spinal neurulation, incorporation of labelled thymidine and adenine into genomic DNA was suppressed by supplemental formate, suggesting that de novo folate-dependent biosynthesis of nucleotides (thymidylate and purines) was enhanced. We hypothesise that reduced Mthfd1L expression may contribute to susceptibility to NTDs in the curly tail strain and that formate acts as a one-carbon donor to prevent NTDs. PMID:26924399

  12. Myocarditis in CD8-depleted SIV-infected rhesus macaques after short-term dual therapy with nucleoside and nucleotide reverse transcriptase inhibitors.

    Directory of Open Access Journals (Sweden)

    Lakshmanan Annamalai

    Full Text Available BACKGROUND: Although highly active antiretroviral therapy (HAART has dramatically reduced the morbidity and mortality associated with HIV infection, a number of antiretroviral toxicities have been described, including myocardial toxicity resulting from the use of nucleotide and nucleoside reverse transcriptase inhibitors (NRTIs. Current treatment guidelines recommend the use of HAART regimens containing two NRTIs for initial therapy of HIV-1 positive individuals; however, potential cardiotoxicity resulting from treatment with multiple NRTIs has not been addressed. METHODOLOGY/PRINCIPAL FINDINGS: We examined myocardial tissue from twelve CD8 lymphocyte-depleted adult rhesus macaques, including eight animals infected with simian immunodeficiency virus, four of which received combined antiretroviral therapy (CART consisting of two NRTIs [(9-R-2-Phosphonomethoxypropyl Adenine (PMPA and (+/--beta-2',3'-dideoxy-5-fluoro-3'-thiacytidine (RCV] for 28 days. Multifocal infiltrates of mononuclear inflammatory cells were present in the myocardium of all macaques that received CART, but not untreated SIV-positive animals or SIV-negative controls. Macrophages were the predominant inflammatory cells within lesions, as shown by immunoreactivity for the macrophage markers Iba1 and CD68. Heart specimens from monkeys that received CART had significantly lower virus burdens than untreated animals (p<0.05, but significantly greater quantities of TNF-α mRNA than either SIV-positive untreated animals or uninfected controls (p<0.05. Interferon-γ (IFN-γ, IL-1β and CXCL11 mRNA were upregulated in heart tissue from SIV-positive monkeys, independent of antiretroviral treatment, but CXCL9 mRNA was only upregulated in heart tissue from macaques that received CART. CONCLUSIONS/SIGNIFICANCE: These results suggest that short-term treatment with multiple NRTIs may be associated with myocarditis, and demonstrate that the CD8-depleted SIV-positive rhesus monkey is a useful

  13. Nucleotide sequences of the Acinetobacter calcoaceticus benABC genes for benzoate 1,2-dioxygenase reveal evolutionary relationships among multicomponent oxygenases. (United States)

    Neidle, E L; Hartnett, C; Ornston, L N; Bairoch, A; Rekik, M; Harayama, S


    The nucleotide sequences of the Acinetobacter calcoaceticus benABC genes encoding a multicomponent oxygenase for the conversion of benzoate to a nonaromatic cis-diol were determined. The enzyme, benzoate 1,2-dioxygenase, is composed of a hydroxylase component, encoded by benAB, and an electron transfer component, encoded by benC. Comparison of the deduced amino acid sequences of BenABC with related sequences, including those for the multicomponent toluate, toluene, benzene, and naphthalene 1,2-dioxygenases, indicated that the similarly sized subunits of the hydroxylase components were derived from a common ancestor. Conserved cysteine and histidine residues may bind a [2Fe-2S] Rieske-type cluster to the alpha-subunits of all the hydroxylases. Conserved histidines and tyrosines may coordinate a mononuclear Fe(II) ion. The less conserved beta-subunits of the hydroxylases may be responsible for determining substrate specificity. Each dioxygenase had either one or two electron transfer proteins. The electron transfer component of benzoate dioxygenase, encoded by benC, and the corresponding protein of the toluate 1,2-dioxygenase, encoded by xylZ, were each found to have an N-terminal region which resembled chloroplast-type ferredoxins and a C-terminal region which resembled several oxidoreductases. These BenC and XylZ proteins had regions similar to certain monooxygenase components but did not appear to be evolutionarily related to the two-protein electron transfer systems of the benzene, toluene, and naphthalene 1,2-dioxygenases. Regions of possible NAD and flavin adenine dinucleotide binding were identified. PMID:1885518

  14. Action of ''Bipenst'' preparation and dimethylsulfoxide on the adenyl nucleotide content in liver of irradiated animals

    International Nuclear Information System (INIS)

    Action of parenteral administration of a biostimulator ''Bipenst'' and a 10; dimethylsulfoxide solution on the level of adenyl nucleotides in the liver of rats subjected to a single whole-body irradiation (243 R) has been studied. It has been found that the level of adenyl nucleotides in the liver of irradiated animals decreases, and adenyl nucleotide content normalizes under the action of the preparations under study

  15. Neutralizing monoclonal antibody against ras oncogene product p21 which impairs guanine nucleotide exchange.


    Hattori, S; Clanton, D J; Satoh, T.; Nakamura, S.; Kaziro, Y; Kawakita, M; Shih, T Y


    The neutralizing monoclonal antibody Y13-259 severely hampers the nucleotide exchange reaction between p21-bound and exogenous guanine nucleotides but does not interfere with the association of GDP to p21. These results suggest that the nucleotide exchange reaction is critical for p21 function. Interestingly, the v-ras p21 has a much faster dissociation rate than the p21 of the c-ras proto-oncogene.

  16. The complete nucleotide sequence of the RNA coding for the primary translation product of foot and mouth disease virus.



    The complete nucleotide sequence of the coding region of foot and mouth disease virus RNA (strain A1061) is presented. The sequence extends from the primary initiation site, approximately 1200 nucleotide from the 5' end of the genome, in an open translational reading frame of 6,999 nucleotides to a termination codon 93 nucleotides from the 3' terminal poly (A). Available amino acid sequence data correlates with that predicted from the nucleotide sequence. The amino acid sequence around cleava...

  17. Enzymatic polymerisation involving 2'-amino-LNA nucleotides. (United States)

    Johannsen, Marie W; Veedu, Rakesh N; Madsen, Andreas Stahl; Wengel, Jesper


    The triphosphate of the thymine derivative of 2'-amino-LNA (2'-amino-LNA-TTP) was synthesised and found to be a good substrate for Phusion® HF DNA polymerase, allowing enzymatic synthesis of modified DNA encoded by an unmodified template. To complement this, 2'-amino-LNA-T phosphoramidites were incorporated into DNA oligonucleotides which were used as templates for enzymatic synthesis of unmodified DNA using either KOD, KOD XL or Phusion polymerases. 2'-Amino-LNA-T in the template and 2'-amino-LNA-TTP as a substrate both decreased reaction rate and yield compared to unmodified DNA, especially for sequences with multiple 2'-amino-LNA-T nucleotides. PMID:22503454

  18. Radicals of DNA and DNA nucleotides generated by ionising radiation

    International Nuclear Information System (INIS)

    A first stage of cell processes leading to DNA damage of initiated by radical reactions. In a model system such transformations were generated by ionising radiation which involves production of electron loss and electron gain centers of the substrate and radical formation. Using cryogenic ESR spectroscopy it was found that the DNA nucleotides, which convert to radical anions upon electron capture undergo the separation of unpaired spin and charge due to protonation. Circular and linear dichroism studies enabled to conclude that iron ions(III) induce strong changes in the DNA helical structure indicating their coordination with nitrogen bases. The repair of DNA radicals produced via radiolytic oxidation, i.e. the guanine radical cation and the allyl type radical of thymine, is possible at elevated temperatures due to the involvement of sulphydryl groups. The influence of the thiol charge is then limited

  19. Pinched flow fractionation devices for detection of single nucleotide polymorphisms

    DEFF Research Database (Denmark)

    Larsen, A.V.; Poulsen, L.; Birgens, H.;


    We demonstrate a new and flexible micro fluidic based method for genotyping single nucleotide polymorphisms ( SNPs). The method relies on size separation of selectively hybridized polystyrene microspheres in a micro fluidic pinched flow fractionation (PFF) device. The micro fluidic PFF devices with......, synthesized using human DNA samples from individuals with point mutations in the HBB gene. Following a stringent wash, the beads were separated in a PFF device and the fluorescent signal from the beads was analyzed. Patients being wildtypes, heterozygotes or mutated respectively for the investigated mutation...... could reliably be diagnosed in the PFF device. This indicates that the PFF technique can be used for accurate and fast genotyping of SNPs Udgivelsesdato: 2008...

  20. Single nucleotide variations: biological impact and theoretical interpretation. (United States)

    Katsonis, Panagiotis; Koire, Amanda; Wilson, Stephen Joseph; Hsu, Teng-Kuei; Lua, Rhonald C; Wilkins, Angela Dawn; Lichtarge, Olivier


    Genome-wide association studies (GWAS) and whole-exome sequencing (WES) generate massive amounts of genomic variant information, and a major challenge is to identify which variations drive disease or contribute to phenotypic traits. Because the majority of known disease-causing mutations are exonic non-synonymous single nucleotide variations (nsSNVs), most studies focus on whether these nsSNVs affect protein function. Computational studies show that the impact of nsSNVs on protein function reflects sequence homology and structural information and predict the impact through statistical methods, machine learning techniques, or models of protein evolution. Here, we review impact prediction methods and discuss their underlying principles, their advantages and limitations, and how they compare to and complement one another. Finally, we present current applications and future directions for these methods in biological research and medical genetics. PMID:25234433

  1. Efficient fidelity control by stepwise nucleotide selection in polymerase elongation

    CERN Document Server

    Yu, Jin


    Polymerases select nucleotides before incorporating them for chemical synthesis during gene replication or transcription. How the selection proceeds stepwise efficiently to achieve sufficiently high fidelity and speed is essential for polymerase function. We examined step-by-step selections that have conformational transition rates tuned one at time in the polymerase elongation cycle, with a controlled differentiation free energy at each checkpoint. The elongation is sustained at non-equilibrium steady state with constant free energy input and heat dissipation. It is found that error reduction capability does not improve for selection checkpoints down the reaction path. Hence, it is essential to select early to achieve an efficient fidelity control. In particular, for two consecutive selections that reject the wrong substrate back and inhibit it forward from a same kinetic state, the same error rates are obtained at the same free energy differentiation. The initial screening is indispensible for maintaining t...

  2. The nucleotide sequence of the bacteriophage T5 ltf gene. (United States)

    Kaliman, A V; Kulshin, V E; Shlyapnikov, M G; Ksenzenko, V N; Kryukov, V M


    The nucleotide sequence of the bacteriophage T5 Bg/II-BamHI fragment (4,835 bp in length) known to carry a gene encoding the LTF protein which forms the phage L-shaped tail fibers was determined. It was shown to contain an open reading frame for 1,396 amino acid residues that corresponds to a protein of 147.8 kDa. The coding region of ltf gene is preceded by a typical Shine-Dalgarno sequence. Downstream from the ltf gene there is a strong transcription terminator. Data bank analysis of the LTF protein sequence reveals 55.1% identity to the hypothetical protein ORF 401 of bacteriophage lambda in a segment of 118 amino acids overlap. PMID:7789514

  3. Fluorogenic Labeling of 5-Formylpyrimidine Nucleotides in DNA and RNA. (United States)

    Samanta, Biswajit; Seikowski, Jan; Höbartner, Claudia


    5-Formylcytosine (5fC) and 5-formyluracil (5fU) are natural nucleobase modifications that are generated by oxidative modification of 5-methylcytosine and thymine (or 5-methyluracil). Herein, we describe chemoselective labeling of 5-formylpyrimidine nucleotides in DNA and RNA by fluorogenic aldol-type condensation reactions with 2,3,3-trimethylindole derivatives. Mild and specific reaction conditions were developed for 5fU and 5fC to produce hemicyanine-like chromophores with distinct photophysical properties. Residue-specific detection was established by fluorescence readout as well as primer-extension assays. The reactions were optimized on DNA oligonucleotides and were equally suitable for the modification of 5fU- and 5fC-modified RNA. This direct labeling approach of 5-formylpyrimidines is expected to help in elucidating the occurrence, enzymatic transformations, and functional roles of these epigenetic/epitranscriptomic nucleobase modifications in DNA and RNA. PMID:26679556

  4. Computational learning on specificity-determining residue-nucleotide interactions

    KAUST Repository

    Wong, Ka-Chun


    The protein–DNA interactions between transcription factors and transcription factor binding sites are essential activities in gene regulation. To decipher the binding codes, it is a long-standing challenge to understand the binding mechanism across different transcription factor DNA binding families. Past computational learning studies usually focus on learning and predicting the DNA binding residues on protein side. Taking into account both sides (protein and DNA), we propose and describe a computational study for learning the specificity-determining residue-nucleotide interactions of different known DNA-binding domain families. The proposed learning models are compared to state-of-the-art models comprehensively, demonstrating its competitive learning performance. In addition, we describe and propose two applications which demonstrate how the learnt models can provide meaningful insights into protein–DNA interactions across different DNA binding families.

  5. A nucleotide-level coarse-grained model of RNA

    CERN Document Server

    Šulc, Petr; Ouldridge, Thomas E; Doye, Jonathan P K; Louis, Ard A


    We present a new, nucleotide-level model for RNA, oxRNA, based on the coarse-graining methodology recently developed for the oxDNA model of DNA. The model is designed to reproduce structural, mechanical and thermodynamic properties of RNA, and the coarse-graining level aims to retain the relevant physics for RNA hybridization and the structure of single- and double-stranded RNA. In order to explore its strengths and weaknesses, we test the model in a range of nanotechnological and biological settings. Applications explored include the folding thermodynamics of a pseudoknot, the formation of a kissing loop complex, the structure of a hexagonal RNA nanoring, and the unzipping of a hairpin motif. We argue that the model can be used for efficient simulations of the structure of systems with thousands of base pairs, and for the assembly of systems of up to hundreds of base pairs. The source code implementing the model is released for public use.

  6. Computational identification of candidate nucleotide cyclases in higher plants

    KAUST Repository

    Wong, Aloysius Tze


    In higher plants guanylyl cyclases (GCs) and adenylyl cyclases (ACs) cannot be identified using BLAST homology searches based on annotated cyclic nucleotide cyclases (CNCs) of prokaryotes, lower eukaryotes, or animals. The reason is that CNCs are often part of complex multifunctional proteins with different domain organizations and biological functions that are not conserved in higher plants. For this reason, we have developed CNC search strategies based on functionally conserved amino acids in the catalytic center of annotated and/or experimentally confirmed CNCs. Here we detail this method which has led to the identification of >25 novel candidate CNCs in Arabidopsis thaliana, several of which have been experimentally confirmed in vitro and in vivo. We foresee that the application of this method can be used to identify many more members of the growing family of CNCs in higher plants. © Springer Science+Business Media New York 2013.

  7. Nucleotide sequence of Streptomyces griseus initiator tRNA.


    Kuchino, Y; Yamamoto, I.; Nishimura, S.


    The primary structure of initiator tRNA from Streptomyces griseus was determined by post-labeling procedures. The nucleotide sequence is pC-G-C-G-G-G-G-U-G-G-A-G-C-A-G-C-U-C-G-G-D-A-G-C-U-C-G-C-U-G-G-G-C-U-C-A-U-A-A-C-C- C-A-G-A-G-G-U-C-G-C-A-G-G-U-psi-C-A-m1A-A-U-C-C-U-G-U-C-C-C-C-G-C-U-A-C-C-A0H. The unique feature of the sequence of this tRNA is that residue 54 is occupied by unmodified U, while ribothymidine is located in that position in most initiator tRNAs from eubacteria.

  8. Current research status, databases and application of single nucleotide polymorphism. (United States)

    Javed, R; Mukesh


    Single Nucleotide Polymorphisms (SNPs) are the most frequent form of DNA variation in the genome. SNPs are genetic markers which are bi-allelic in nature and grow at a very fast rate. Current genomic databases contain information on several million SNPs. More than 6 million SNPs have been identified and the information is publicly available through the efforts of the SNP Consortium and others data bases. The NCBI plays a major role in facillating the identification and cataloging of SNPs through creation and maintenance of the public SNP database (dbSNP) by the biomedical community worldwide and stimulate many areas of biological research including the identification of the genetic components of disease. In this review article, we are compiling the existing SNP databases, research status and their application. PMID:21717869

  9. Environmental heat stress, hyperammonemia and nucleotide metabolism during intermittent exercise

    DEFF Research Database (Denmark)

    Mohr, Magni; Rasmussen, Peter; Drust, Barry;


    glycogen, CP, ATP and IMP levels were similar across trials. In conclusion, altered levels of "classical peripheral fatiguing agents" does apparently not explain the reduced capacity for performing repeated sprints following intermittent exercise in the heat, whereas the augmented systemic NH3 response may......Abstract  This study investigated the influence of environmental heat stress on ammonia (NH3) accumulation in relation to nucleotide metabolism and fatigue during intermittent exercise. Eight males performed 40 min of intermittent exercise (15 s at 306±22 W alternating with 15 s of unloaded cycling......) followed by five 15 s all-out sprints. Control trials were conducted in a 20°C environment while heat stress trials were performed at an ambient temperature of 40°C. Muscle biopsies and venous blood samples were obtained at rest, after 40 min of exercise and following the maximal sprints. Following...

  10. Morphine enhances purine nucleotide catabolism in rive and in vitro

    Institute of Scientific and Technical Information of China (English)

    Chang LIU; Jian-kai LIU; Mu-jie KAN; Lin GAO; Hai-ying FU; Hang ZHOU; Min HONG


    Aim: To investigate the effect and mechanism of morphine on purine nucleotide catabolism. Methods: The rat model of morphine dependence and withdrawal and rat C6 glioma cells in culture were used. Concentrations of uric acid in the plasma were measured by the uricase-rap method, adenosine deaminase (ADA) and xan- thine oxidase (XO) in the plasma and tissues were measured by the ADA and XO test kit. RT-PCR and RT-PCR-Southern blotting were used to examine the relative amount of ADA and XO gene transcripts in tissues and C6 cells. Results: (i) the concentration of plasma uric acid in the morphine-administered group was signifi-cantly higher (P<0.05) than the control group; (ii) during morphine administration and withdrawal periods, the ADA and XO concentrations in the plasma increased significantly (P<0.05); (iii) the amount of ADA and XO in the parietal lobe, liver, small intestine, and skeletal muscles of the morphine-administered groups increased, while the level of ADA and XO in those tissues of the withdrawal groups decreased; (iv) the transcripts of the ADA and XO genes in the parietal lobe, liver, small intestine, and skeletal muscles were higher in the morphine-administered group. The expression of the ADA and XO genes in those tissues returned to the control level during morphine withdrawal, with the exception of the skeletal muscles; and (v) the upregulation of the expression of the ADA and XO genes induced by morphine treatment could be reversed by naloxone. Conclusion: The effects of morphine on purine nucleotide metabolism might be an important, new biochemical pharmacological mechanism of morphine action.

  11. Structural basis for a six nucleotide genetic alphabet. (United States)

    Georgiadis, Millie M; Singh, Isha; Kellett, Whitney F; Hoshika, Shuichi; Benner, Steven A; Richards, Nigel G J


    Expanded genetic systems are most likely to work with natural enzymes if the added nucleotides pair with geometries that are similar to those displayed by standard duplex DNA. Here, we present crystal structures of 16-mer duplexes showing this to be the case with two nonstandard nucleobases (Z, 6-amino-5-nitro-2(1H)-pyridone and P, 2-amino-imidazo[1,2-a]-1,3,5-triazin-4(8H)one) that were designed to form a Z:P pair with a standard "edge on" Watson-Crick geometry, but joined by rearranged hydrogen bond donor and acceptor groups. One duplex, with four Z:P pairs, was crystallized with a reverse transcriptase host and adopts primarily a B-form. Another contained six consecutive Z:P pairs; it crystallized without a host in an A-form. In both structures, Z:P pairs fit canonical nucleobase hydrogen-bonding parameters and known DNA helical forms. Unique features include stacking of the nitro group on Z with the adjacent nucleobase ring in the A-form duplex. In both B- and A-duplexes, major groove widths for the Z:P pairs are approximately 1 Å wider than those of comparable G:C pairs, perhaps to accommodate the large nitro group on Z. Otherwise, ZP-rich DNA had many of the same properties as CG-rich DNA, a conclusion supported by circular dichroism studies in solution. The ability of standard duplexes to accommodate multiple and consecutive Z:P pairs is consistent with the ability of natural polymerases to biosynthesize those pairs. This, in turn, implies that the GACTZP synthetic genetic system can explore the entire expanded sequence space that additional nucleotides create, a major step forward in this area of synthetic biology. PMID:25961938

  12. 77 FR 65537 - Requirements for Patent Applications Containing Nucleotide Sequence and/or Amino Acid Sequence... (United States)


    ... Amino Acid Sequence Disclosures ACTION: Proposed collection; comment request. SUMMARY: The United States....'' SUPPLEMENTARY INFORMATION: I. Abstract Patent applications that contain nucleotide and/or amino acid...

  13. Enzymatic synthesis of radioisotope-labeled nucleotides from the corresponding labeled nitrogen bases

    International Nuclear Information System (INIS)

    The authors have developed a procedure that permits the production of nucleotides multiply labeled with various radioisotopes, with a molar radioactivity equal to the molar radioactivity of the original nitrogen bases. The methods of isolation and purification of the enzyme preparations were studied on the enzyme systems converting nitrogen bases to nucleoside triphosphates in the presence of phosphoribosyl pyrophosphate or ribose-5-phosphate. The presence of nucleotide impurities in the enzyme preparation was determined spectrophotometrically. The authors were able to practically avoid nucleotide impurities by salting out the protein fraction of interest with ammonium sulfate. The authors succeeded in reducing the content of nucleotides in the enzyme preparation by a factor of 40

  14. Enhanced-oxidation and highly-sensitive detection of acetaminophen, guanine and adenine using NMP-exfoliated graphene nanosheets-modified electrode

    International Nuclear Information System (INIS)

    Graphical abstract: Display Omitted - Highlights: • Compared with RGO, NMP-exfoliated GS possessed lower electron transfer resistance. • Oxidation activity of AC, G and A on NMP-exfoliated GS surface increased greatly. • A highly-sensitive electrochemical sensing platform was constructed for AC, G and A. - Abstract: Graphene nanosheets (GS) were easily prepared by one-step ultrasonic exfoliation of graphite powder in N-methyl-2-pyrrolidone (NMP). Compared with the widely-used reduced graphene oxides that prepared via chemical methods, the NMP-exfoliated GS exhibited higher electron transfer ability. Moreover, the resulting GS displayed higher electrochemical reactivity toward the oxidation of acetaminophen (AC), guanine (G) and adenine (A). In pH 6.5 phosphate buffer, three well-defined oxidation waves at 0.41 V, 0.69 V and 0.96 V were observed, and the oxidation peak currents were greatly enhanced on the surface of GS. As a result, a highly-sensitive electrochemical sensing platform was developed for the simultaneous detection of AC, G and A. The detection limits of AC, G and A on GS-modified electrode were evaluated to be 2.5 nM, 10 nM and 10 nM, respectively. Besides, the proposed method was successfully applied in the detection of tablet and DNA samples

  15. Deficiency of the iron-sulfur clusters of mitochondrial reduced nicotinamide-adenine dinucleotide-ubiquinone oxidoreductase (complex I) in an infant with congenital lactic acidosis. (United States)

    Moreadith, R W; Batshaw, M L; Ohnishi, T; Kerr, D; Knox, B; Jackson, D; Hruban, R; Olson, J; Reynafarje, B; Lehninger, A L


    We report the case of an infant with hypoglycemia, progressive lactic acidosis, an increased serum lactate/pyruvate ratio, and elevated plasma alanine, who had a moderate to profound decrease in the ability of mitochondria from four organs to oxidize pyruvate, malate plus glutamate, citrate, and other NAD+-linked respiratory substrates. The capacity to oxidize the flavin adenine dinucleotide-linked substrate, succinate, was normal. The most pronounced deficiency was in skeletal muscle, the least in kidney mitochondria. Enzymatic assays on isolated mitochondria ruled out defects in complexes II, III, and IV of the respiratory chain. Further studies showed that the defect was localized in the inner membrane mitochondrial NADH-ubiquinone oxidoreductase (complex I). When ferricyanide was used as an artificial electron acceptor, complex I activity was normal, indicating that electrons from NADH could reduce the flavin mononucleotide cofactor. However, electron paramagnetic resonance spectroscopy performed on liver submitochondrial particles showed an almost total loss of the iron-sulfur clusters characteristic of complex I, whereas normal signals were noted for other mitochondrial iron-sulfur clusters. This infant is presented as the first reported case of congenital lactic acidosis caused by a deficiency of the iron-sulfur clusters of complex I of the mitochondrial electron transport chain. PMID:6432847

  16. Nitrogen Substituted Polycyclic Aromatic Hydrocarbon As Capable Interstellar Infrared Spectrum Source Considering Astronomical Chemical Evolution Step To Biological Organic Purine And Adenine

    CERN Document Server

    Ota, Norio


    In order to find out capable chemical evolution step from astronomically created organic in interstellar space to biological organic on the earth, infrared spectrum of nitrogen substituted carbon pentagon-hexagon coupled polycyclic aromatic hydrocarbon was analyzed by the density functional theory. Ionization was modeled from neutral to tri-cation. Among one nitrogen and two nitrogen substituted NPAH, we could find good examples showing similar IR behavior with astronomically well observed one as like C8H6N1, C7H5N2, and C7H5N2. We can imagine that such ionized NPAH may be created in interstellar space by attacks of high energy nitrogen and photon. Whereas, in case of three and four nitrogen substituted cases as like C6H4N3 and C5H3N4, there were no candidate showing similar behavior with observed one. Also, IR of typical biological organic with four and five nitrogen substituted one as like purine and adenine resulted no good similarity with observed one. By such theoretical comparison, one capable story of ...

  17. Wear Particles Promote Reactive Oxygen Species-Mediated Inflammation via the Nicotinamide Adenine Dinucleotide Phosphate Oxidase Pathway in Macrophages Surrounding Loosened Implants

    Directory of Open Access Journals (Sweden)

    Weishen Chen


    Full Text Available Background/Aims: Prosthesis loosening is closely associated with chronic inflammatory cytokine secretion by macrophages, which are activated by wear particles or inflammatory stimulants such as lipopolysaccharide (LPS. Reactive oxygen species (ROS are critical regulators of inflammation, but their enzymatic sources in response to wear particles and their effects on peri-implant LPS-tolerance remain unclear. Methods: Three ROS-related enzymes—nicotinamide adenine dinucleotide phosphate oxidase (NOX-1 and -2 and catalase—were investigated in interface membrane tissues and in titanium (Ti particle-stimulated macrophages in vitro. The generation of ROS and downstream inflammatory effects were measured with or without pre-incubation with apocynin, an NOX inhibitor. Results: Pre-exposure to Ti particles attenuated NF-κB activation in LPS-stimulated macrophages, indicating that wear particles suppress immune response, which may lead to chronic inflammation. NOX-1 and -2 were highly expressed in aseptically loosened interface membranes and in macrophages stimulated with Ti particles; the particles induced a moderate amount of ROS generation, NF-κB activation, and TNF-a secretion in macrophages, and these effects were suppressed by apocynin. Conclusion: Wear particles induce ROS generation through the NOX signaling pathway, resulting in persistent inflammation and delayed loosening. Thus, the suppression of NOX activity may be a useful strategy for preventing prosthesis loosening.

  18. Determination of guanine and adenine by high-performance liquid chromatography with a self-fabricated wall-jet/thin-layer electrochemical detector at a glassy carbon electrode. (United States)

    Zhou, Yaping; Yan, Hongling; Xie, Qingji; Yao, Shouzhuo


    A sensitive wall-jet/thin-layer amperometric electrochemical detector (ECD) coupled to high-performance liquid chromatography (HPLC) was developed for simultaneous determination of guanine (G) and adenine (A). The analytes were detected at a glassy carbon electrode (GCE) and the HPLC-ECD calibration curves showed good linearity (R(2)>0.997) under optimized conditions. Limits of detection for G and A are 0.6 nM and 1.4 nM (S/N=3), respectively, which are lower than those obtained with an UV-vis detector and a commercial electrochemical detector. We have successfully applied this HPLC-ECD to assess the contents of G and A in hydrochloric acid-digested calf thymus double-stranded DNA. In addition, we compared in detail the analysis of G and A by cyclic voltammetry (CV) and by the HPLC-ECD system on both bare GCE and electroreduced graphene oxide (ERGO) modified GCE. We found that the adsorption of G and A on the electrode surfaces can vary their anodic CV peaks and the competitive adsorption of G and A on the limited sites of the electrode surfaces can cause crosstalk effects on their anodic CV peak signals, but the HPLC-ECD system is insensitive to such electrode-adsorption and can give more reliable analytical results. PMID:25618679

  19. Gender and chronological age affect erythrocyte membrane oxidative indices in citrate phosphate dextrose adenine-formula 1 (CPDA-1) blood bank storage condition. (United States)

    Erman, Hayriye; Aksu, Uğur; Belce, Ahmet; Atukeren, Pınar; Uzun, Duygu; Cebe, Tamer; Kansu, Ahmet D; Gelişgen, Remisa; Uslu, Ezel; Aydın, Seval; Çakatay, Ufuk


    It is well known that in vitro storage lesions lead to membrane dysfunction and decreased number of functional erythrocytes. As erythrocytes get older, in storage media as well as in peripheral circulation, they undergo a variety of biochemical changes. In our study, the erythrocytes with different age groups in citrate phosphate dextrose adenine-formula 1 (CPDA-1) storage solution were used in order to investigate the possible effect of gender factor on oxidative damage. Oxidative damage biomarkers in erythrocyte membranes such as ferric reducing antioxidant power, pro-oxidant-antioxidant balance, protein-bound advance glycation end products, and sialic acid were analyzed. Current study reveals that change in membrane redox status during blood-bank storage condition also depends on both gender depended homeostatic factors and the presence of CPDA-1. During the storage period in CPDA-1, erythrocytes from the male donors are mostly affected by free radical-mediated oxidative stress but erythrocytes obtained from females are severely affected by glyoxidative stress. PMID:27045670

  20. A study of fast and metastable dissociations of adenine-thymine binary-base oligonucleotides by using positive-ion MALDI-TOF mass spectrometry. (United States)

    Chan, T W Dominic; Fung, Y M Eva; Li, Y C Leo


    In the present study, fast and metastable dissociations of a number of adenine-thymine binary-base oligonucleotides under the conditions of UV matrix-assisted laser desorption/ionization mass spectrometry were investigated. 2-Aminobenzoic acid/ammonium fluoride (ABA/NH4F) matrix system was used. The spectra obtained under metastable and fast dissociation conditions exhibit distinctive dissociation products. From the post-source-decay analysis, all oligonucleotides underwent predominantly metastable dissociations at the 3' C-O linkages to form [a(n)-B]+ and w(n)+ complimentary ion series. Based on the present results, the so-called "[wn+80]+" ions were postulated to be the complimentary [Z(8-n)AH]+ ions rather than the expected phosphate rearrangement products. In addition, these oligonucleotides were found to generate fast dissociation products of b(n)+, d(N)+, w(N)+ and y(N)+ ions through backbone cleavages at 5' C-O, 5' O-P, 3' C-O and 3' P-O linkages, respectively. Product ion series formed under PSD conditions were not observed. The implications of this mutually exclusive occurrence of the two sets of fragment ions under fast and metastable conditions using ABA/NH4F matrix would be discussed. A model of ion activation under UV-MALDI conditions was also proposed. PMID:12322953

  1. Excessive Copper Induces the Production of Reactive Oxygen Species, which is Mediated by Phospholipase D, Nicotinamide Adenine Dinucleotide Phosphate Oxidase and Antioxidant Systems

    Institute of Scientific and Technical Information of China (English)

    Zhong-Lian Yu; Jin-Guang Zhang; Xue-Chen Wang; Jia Chen


    Tobacco BY-2 suspension cells were used to study the chemical damage and its associated mechanisms caused by Cu2+. Treatment with 100 μmol/L Cu2+ generated a large amount of H2O2 and thiobarbituric acid-reactive substances (TBARS) in cells. Using phospholipase D (PLD) specific inhibitor (1-butanol) or phosphatidic acid (PA), we demonstrated that PLD plays an important role in the generation of H2O2 and TBARS. Semi-quantitative reverse-transcriptase polymerase chain reaction and enzyme activity assays with wild type and nicotinamide adenine dinucleotide phosphate (NADPH) oxidase- overexpressing BY-2 cells revealed that PLD and PA are the key factors leading to NADPH oxidase activation, which is responsible for H2O2 and TBARS production induced by Cu2+. Moreover, the content of ascorbic acid (AsA), an effective antioxidant, was sharply reduced in BY-2 cells exposed to excessive Cu2+. Furthermore, a significant downregulation of the enzymes of AsA biosynthesis and the antioxidant system was found. This evidencesuggests that excessive Cu2+-elevated reactive oxygen species (ROS) production is caused by upregulated PLD that elevates the activity of NADPH oxidase and its collapsed antioxidant systems that scavenges ROS.

  2. Heterocyclic compounds based on N6-substituted adenine, methods of their preparation, their use for preparation of drugs, cosmetic preparations and growth regulators, pharmaceutical preparations, cosmetic preparations and growth regulators containing these compounds


    Popa, I.; Holub, J.; Lenobel, R.; Werbrouck, S.; Doležal, K. (Karel); M. Strnad; Zatloukal, M.; Massino, F. J.


    Novel heterocyclic derivatives based on N6-substituted adenine, having anticancer, mitotic, immunosuppressive and antisenescent properties for plant, animal and human cells and methods of their preparation. Included are also pharmaceutical compositions, cosmetic preparations and growth regulators, which contain these derivatives as active compound and the use of these derivatives for the preparation of drugs, cosmetic preparations, in biotechnological processes, in cosmetics and in agriculture.

  3. Synthesis of N9- and N7-[2-hydroxy-3-(phosphonomethoxy)-propyl] derivatives of N6-substituted adenines, 2,6-diaminopurines and related compounds

    Czech Academy of Sciences Publication Activity Database

    Krečmerová, Marcela; Masojídková, Milena; Holý, Antonín


    Roč. 69, č. 10 (2004), s. 1889-1913. ISSN 0010-0765 R&D Projects: GA AV ČR IBS4055109 Grant ostatní: Descartes Prize 2001(XE) 106456-34-RGNT Institutional research plan: CEZ:AV0Z4055905 Keywords : acyclic nucleotide analogues * phosphonates * purines Subject RIV: CC - Organic Chemistry Impact factor: 1.062, year: 2004

  4. The nucleotide sequence of 5S rRNA from Mycoplasma capricolum.


    Hori, H; Sawada, M.; Osawa, S; Murao, K; Ishikura, H


    The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to those of the gram-positive bacteria than those of the gram-negative bacteria.

  5. Energy efficiency trade-offs drive nucleotide usage in transcribed regions (United States)

    Chen, Wei-Hua; Lu, Guanting; Bork, Peer; Hu, Songnian; Lercher, Martin J.


    Efficient nutrient usage is a trait under universal selection. A substantial part of cellular resources is spent on making nucleotides. We thus expect preferential use of cheaper nucleotides especially in transcribed sequences, which are often amplified thousand-fold compared with genomic sequences. To test this hypothesis, we derive a mutation-selection-drift equilibrium model for nucleotide skews (strand-specific usage of ‘A' versus ‘T' and ‘G' versus ‘C'), which explains nucleotide skews across 1,550 prokaryotic genomes as a consequence of selection on efficient resource usage. Transcription-related selection generally favours the cheaper nucleotides ‘U' and ‘C' at synonymous sites. However, the information encoded in mRNA is further amplified through translation. Due to unexpected trade-offs in the codon table, cheaper nucleotides encode on average energetically more expensive amino acids. These trade-offs apply to both strand-specific nucleotide usage and GC content, causing a universal bias towards the more expensive nucleotides ‘A' and ‘G' at non-synonymous coding sites. PMID:27098217

  6. Comparative Nucleotide Sequence Analysis of Polymorphic Variable-Number Tandem-Repeat Loci in Mycobacterium ulcerans


    Ablordey, A; Hilty, M.; Stragier, Pieter; Swings, Jean; Portaels, F.


    We analyzed a set of variable-number tandem-repeat (VNTR) loci to assess their nucleotide sequence diversity in isolates of three Mycobacterium ulcerans genotypes. Sequence variants in two loci resulted in intraspecies resolution of Southeast Asian and Asian genotypes in contrast to a homogenous sequence composition among African isolates. Nucleotide sequence polymorphism in repeat units can enhance discrimination of VNTR loci.

  7. Direct detection of single-nucleotide polymorphisms in bacterial DNA by SNPtrap

    DEFF Research Database (Denmark)

    Grønlund, Hugo Ahlm; Moen, Birgitte; Hoorfar, Jeffrey; Rådstrøm, Peter; Malorny, Burkhard; Rudi, Knut


    A major challenge with single-nucleotide polymorphism (SNP) fingerprinting of bacteria and higher organisms is the combination of genome-wide screenings with the potential of multiplexing and accurate SNP detection. Single-nucleotide extension by the minisequencing principle represents a technology...

  8. Regulation of Salmonella typhimurium pyr Gene Expression: Effect of Changing Both Purine and Pyrimidine Nucleotide Pools

    DEFF Research Database (Denmark)

    Jensen, Kaj Frank


    permit manipulation of the intracellular pools of both pyrimidine and purine nucleotides. The results identify the effectory purine compound as being a guanine nucleotide; it is probably GTP, but it may be GDP or GMP. The synthesis of carbamoylphosphate synthase, encoded by pyrA, and particularly...

  9. Single Nucleotide Polymorphism Clustering in Systemic Autoimmune Diseases (United States)

    Charlon, Thomas; Bossini-Castillo, Lara; Carmona, F. David; Di Cara, Alessandro; Wojcik, Jérôme; Voloshynovskiy, Sviatoslav


    Systemic Autoimmune Diseases, a group of chronic inflammatory conditions, have variable symptoms and difficult diagnosis. In order to reclassify them based on genetic markers rather than clinical criteria, we performed clustering of Single Nucleotide Polymorphisms. However naive approaches tend to group patients primarily by their geographic origin. To reduce this “ancestry signal”, we developed SNPClust, a method to select large sources of ancestry-independent genetic variations from all variations detected by Principal Component Analysis. Applied to a Systemic Lupus Erythematosus case control dataset, SNPClust successfully reduced the ancestry signal. Results were compared with association studies between the cases and controls without or with reference population stratification correction methods. SNPClust amplified the disease discriminating signal and the ratio of significant associations outside the HLA locus was greater compared to population stratification correction methods. SNPClust will enable the use of ancestry-independent genetic information in the reclassification of Systemic Autoimmune Diseases. SNPClust is available as an R package and demonstrated on the public Human Genome Diversity Project dataset at PMID:27490238

  10. Chlamydial entry involves TARP binding of guanine nucleotide exchange factors.

    Directory of Open Access Journals (Sweden)

    B Josh Lane


    Full Text Available Chlamydia trachomatis attachment to cells induces the secretion of the elementary body-associated protein TARP (Translocated Actin Recruiting Protein. TARP crosses the plasma membrane where it is immediately phosphorylated at tyrosine residues by unknown host kinases. The Rac GTPase is also activated, resulting in WAVE2 and Arp2/3-dependent recruitment of actin to the sites of chlamydia attachment. We show that TARP participates directly in chlamydial invasion activating the Rac-dependent signaling cascade to recruit actin. TARP functions by binding two distinct Rac guanine nucleotide exchange factors (GEFs, Sos1 and Vav2, in a phosphotyrosine-dependent manner. The tyrosine phosphorylation profile of the sequence YEPISTENIYESI within TARP, as well as the transient activation of the phosphatidylinositol 3-kinase (PI3-K, appears to determine which GEF is utilized to activate Rac. The first and second tyrosine residues, when phosphorylated, are utilized by the Sos1/Abi1/Eps8 and Vav2, respectively, with the latter requiring the lipid phosphatidylinositol 3,4,5-triphosphate. Depletion of these critical signaling molecules by siRNA resulted in inhibition of chlamydial invasion to varying degrees, owing to a possible functional redundancy of the two pathways. Collectively, these data implicate TARP in signaling to the actin cytoskeleton remodeling machinery, demonstrating a mechanism by which C.trachomatis invades non-phagocytic cells.

  11. Single Nucleotide Polymorphism Clustering in Systemic Autoimmune Diseases. (United States)

    Charlon, Thomas; Martínez-Bueno, Manuel; Bossini-Castillo, Lara; Carmona, F David; Di Cara, Alessandro; Wojcik, Jérôme; Voloshynovskiy, Sviatoslav; Martín, Javier; Alarcón-Riquelme, Marta E


    Systemic Autoimmune Diseases, a group of chronic inflammatory conditions, have variable symptoms and difficult diagnosis. In order to reclassify them based on genetic markers rather than clinical criteria, we performed clustering of Single Nucleotide Polymorphisms. However naive approaches tend to group patients primarily by their geographic origin. To reduce this "ancestry signal", we developed SNPClust, a method to select large sources of ancestry-independent genetic variations from all variations detected by Principal Component Analysis. Applied to a Systemic Lupus Erythematosus case control dataset, SNPClust successfully reduced the ancestry signal. Results were compared with association studies between the cases and controls without or with reference population stratification correction methods. SNPClust amplified the disease discriminating signal and the ratio of significant associations outside the HLA locus was greater compared to population stratification correction methods. SNPClust will enable the use of ancestry-independent genetic information in the reclassification of Systemic Autoimmune Diseases. SNPClust is available as an R package and demonstrated on the public Human Genome Diversity Project dataset at PMID:27490238

  12. Expression of Vesicular Nucleotide Transporter in Rat Odontoblasts. (United States)

    Ikeda, Erina; Goto, Tetsuya; Gunjigake, Kaori; Kuroishi, Kayoko; Ueda, Masae; Kataoka, Shinji; Toyono, Takashi; Nakatomi, Mitsushiro; Seta, Yuji; Kitamura, Chiaki; Nishihara, Tatsuji; Kawamoto, Tatsuo


    Several theories have been proposed regarding pain transmission mechanisms in tooth. However, the exact signaling mechanism from odontoblasts to pulp nerves remains to be clarified. Recently, ATP-associated pain transmission has been reported, but it is unclear whether ATP is involved in tooth pain transmission. In the present study, we focused on the vesicular nucleotide transporter (VNUT), a transporter of ATP into vesicles, and examined whether VNUT was involved in ATP release from odontoblasts. We examined the expression of VNUT in rat pulp by RT-PCR and immunostaining. ATP release from cultured odontoblast-like cells with heat stimulation was evaluated using ATP luciferase methods. VNUT was expressed in pulp tissue, and the distribution of VNUT-immunopositive vesicles was confirmed in odontoblasts. In odontoblasts, some VNUT-immunopositive vesicles were colocalized with membrane fusion proteins. Additionally P2X3, an ATP receptor, immunopositive axons were distributed between odontoblasts. The ATP release by thermal stimulation from odontoblast-like cells was inhibited by the addition of siRNA for VNUT. These findings suggest that cytosolic ATP is transported by VNUT and that the ATP in the vesicles is then released from odontoblasts to ATP receptors on axons. ATP vesicle transport in odontoblasts seems to be a key mechanism for signal transduction from odontoblasts to axons in the pulp. PMID:27006518

  13. Single nucleotide polymorphisms in clinics: Fantasy or reality for cancer? (United States)

    Srinivasan, Srilakshmi; Clements, Judith A; Batra, Jyotsna


    Single nucleotide polymorphisms (SNPs) have been classically used for dissecting various human complex disorders using candidate gene studies. During the last decade, large scale SNP analysis, i.e. genome-wide association studies (GWAS) have provided an agnostic approach to identify possible genetic loci associated with heterogeneous disease such as cancer susceptibility, prognosis of survival or drug response. Further, the advent of new technologies, including microarray-based genotyping as well as high throughput next generation sequencing has opened new avenues for SNPs to be used in clinical practice. It is speculated that the utility of SNPs to understand the mechanisms, biology of variable drug response and ultimately treatment individualization based on the individual's genome composition will be indispensable in the near future. In the current review, we discuss the advantages and disadvantages of the clinical utility of genetic variants in disease risk-prediction, prognosis, clinical outcome and pharmacogenomics. The lessons and challenges for the utility of SNP-based biomarkers are also discussed, including the need for additional functional validation studies. PMID:26398894

  14. Single nucleotide polymorphisms of Kit gene in Chinese indigenous horses. (United States)

    Han, Haoyuan; Mao, Chunchun; Chen, Ningbo; Lan, Xianyong; Chen, Hong; Lei, Chuzhao; Dang, Ruihua


    Kit gene is a genetic determinant of horse white coat color which has been a highly valued trait in horses for at least 2,000 years. Single nucleotide polymorphisms (SNPs) in Kit are of importance due to their strong associations with melanoblast survival during embryonic development. In this study, a mutation analysis of all 21 Kit exons in 14 Chinese domestic horse breeds revealed six SNPs (g.91214T>G, g.143245T>G, g.164297C>T, g.170189C>T, g.171356C>G, and g.171471G>A), which located in 5'-UTR region, intron 6, exon 15, exon 20, intron 20, and exon 21 of the equine Kit gene, respectively. Subsequently, these six SNPs loci were genotyped in 632 Chinese horses by PCR-RFLP or direct sequencing. The six SNPs together defined 18 haplotypes, demonstrating abundant haplotype diversities in Chinese horses. All the mutant alleles and haplotypes were shared among different breeds. But fewer mutations were detected in horses from China than that from abroad, indicating that Chinese horses belong to a more ancient genetic pool. This study will provide fundamental genetic information for evaluating the genetic diversity of Kit gene in Chinese indigenous horse breeds. PMID:27348891

  15. MGMT expression: insights into its regulation. 2. Single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Iatsyshyna A. P.


    Full Text Available High intra- and interindividual variations in the expression levels of the human O6-methylguanine-DNA methyltransferase (MGMT gene have been observed. This DNA repair enzyme can be a cause of resistance of cancer cells to alkylating chemotherapy. It has been studied the association of single nucleotide polymorphisms (SNPs of MGMT with the risk for different types of cancer, progression-free survival in patients with cancer treated with alkylating chemotherapy, as well as an effect of SNPs on the MGMT gene expression and activity of the enzyme. SNPs have been suggested to be the factors which influence the levels of interindividual variability of the MGMT expression. Therefore, the aim of this paper was to review the experimental data on SNPs of the human MGMT gene, which are associated with cancer, as well as on location of MGMT-SNPs in regulatory and protein-coding regions of the gene in relation to its regulation. Lots of MGMT SNPs, which could affect the gene expression and result in interindividual MGMT variability or the enzyme resistance to pseudosubstrate inhibitors, have been re- vealed within the promoter and enhancer regions, the 5'- and 3'-UTRs and introns of the MGMT gene, as well as within the protein-coding region. Many of them may have regulatory effect.

  16. Magnetic Iron Oxide Nanoparticle Seeded Growth of Nucleotide Coordinated Polymers. (United States)

    Liang, Hao; Liu, Biwu; Yuan, Qipeng; Liu, Juewen


    The introduction of functional molecules to the surface of magnetic iron oxide nanoparticles (NPs) is of critical importance. Most previously reported methods were focused on surface ligand attachment either by physisorption or covalent conjugation, resulting in limited ligand loading capacity. In this work, we report the seeded growth of a nucleotide coordinated polymer shell, which can be considered as a special form of adsorption by forming a complete shell. Among all of the tested metal ions, Fe(3+) is the most efficient for this seeded growth. A diverse range of guest molecules, including small organic dyes, proteins, DNA, and gold NPs, can be encapsulated in the shell. All of these molecules were loaded at a much higher capacity compared to that on the naked iron oxide NP core, confirming the advantage of the coordination polymer (CP) shell. In addition, the CP shell provides better guest protein stability compared to that of simple physisorption while retaining guest activity as confirmed by the entrapped glucose oxidase assay. Use of this system as a peroxidase nanozyme and glucose biosensor was demonstrated, detecting glucose as low as 1.4 μM with excellent stability. This work describes a new way to functionalize inorganic materials with a biocompatible shell. PMID:27248668

  17. Unique nucleotide polymorphism of ankyrin gene cluster in Arabidopsis

    Indian Academy of Sciences (India)

    Jianchang Du; Xingna Wang; Mingsheng Zhang; Dacheng Tian; Yong-Hua Yang


    The ankyrin (ANK) gene cluster is a part of a multigene family encoding ANK transmembrane proteins in Arabidopsis thaliana, and plays an important role in protein–protein interactions and in signal pathways. In contrast to other regions of a genome, the ANK gene cluster exhibits an extremely high level of DNA polymorphism in an ∼5-kb region, without apparent decay. Phylogenetic analysis detects two clear, deeply differentiated haplotypes (dimorphism). The divergence between haplotypes of accession Col-0 and Ler-0 (Hap-C and Hap-L) is estimated to be 10.7%, approximately equal to the 10.5% average divergence between A. thaliana and A. lyrata. Sequence comparisons for the ANK gene cluster homologues in Col-0 indicate that the members evolve independently, and that the similarity among paralogues is lower than between alleles. Very little intralocus recombination or gene conversion is detected in ANK regions. All these characteristics of the ANK gene cluster are consistent with a tandem gene duplication and birth-and-death process. The possible mechanisms for and implications of this elevated nucleotide variation are also discussed, including the suggestion of balancing selection.

  18. β-Nicotinamide adenine dinucleotide acts at prejunctional adenosine A1 receptors to suppress inhibitory musculomotor neurotransmission in guinea pig colon and human jejunum. (United States)

    Wang, Guo-Du; Wang, Xi-Yu; Liu, Sumei; Xia, Yun; Zou, Fei; Qu, Meihua; Needleman, Bradley J; Mikami, Dean J; Wood, Jackie D


    Intracellular microelectrodes were used to record neurogenic inhibitory junction potentials in the intestinal circular muscle coat. Electrical field stimulation was used to stimulate intramural neurons and evoke contraction of the smooth musculature. Exposure to β-nicotinamide adenine dinucleotide (β-NAD) did not alter smooth muscle membrane potential in guinea pig colon or human jejunum. ATP, ADP, β-NAD, and adenosine, as well as the purinergic P2Y1 receptor antagonists MRS 2179 and MRS 2500 and the adenosine A1 receptor agonist 2-chloro-N6-cyclopentyladenosine, each suppressed inhibitory junction potentials in guinea pig and human preparations. β-NAD suppressed contractile force of twitch-like contractions evoked by electrical field stimulation in guinea pig and human preparations. P2Y1 receptor antagonists did not reverse this action. Stimulation of adenosine A1 receptors with 2-chloro-N6-cyclopentyladenosine suppressed the force of twitch contractions evoked by electrical field stimulation in like manner to the action of β-NAD. Blockade of adenosine A1 receptors with 8-cyclopentyl-1,3-dipropylxanthine suppressed the inhibitory action of β-NAD on the force of electrically evoked contractions. The results do not support an inhibitory neurotransmitter role for β-NAD at intestinal neuromuscular junctions. The data suggest that β-NAD is a ligand for the adenosine A1 receptor subtype expressed by neurons in the enteric nervous system. The influence of β-NAD on intestinal motility emerges from adenosine A1 receptor-mediated suppression of neurotransmitter release at inhibitory neuromuscular junctions. PMID:25813057

  19. Effect of telmisartan on the expression of adiponectin receptors and nicotinamide adenine dinucleotide phosphate oxidase in the heart and aorta in type 2 diabetic rats

    Directory of Open Access Journals (Sweden)

    Guo Zhixin


    Full Text Available Abstract Background Diabetic cardiovascular disease is associated with decreased adiponectin and increased oxidative stress. This study investigated the effect of telmisartan on the expression of adiponectin receptor 2 (adipoR2 and nicotinamide adenine dinucleotide phosphate (NADPH oxidase subunits in the heart and the expression of adiponectin receptor 1 (adipoR1 in aorta in type 2 diabetic rats. Methods Type 2 diabetes was induced by high-fat and high-sugar diet and intraperitoneal injection of a low dose of streptozotocin (STZ. Heart function, adipoR2, p22phox, NOX4, glucose transporter 4(GLUT4, monocyte chemoattractant protein-1(MCP-1 and connective tissue growth factor (CTGFin the heart, and adipoR1, MCP-1 and nuclear factor kappa B (NF-κB in aorta were analyzed in controls and diabetic rats treated with or without telmisartan (5mg/kg/d by gavage for 12 weeks. Results Heart function, plasma and myocardial adiponectin levels, the expression of myocardial adipoR2 and GLUT4 were significantly decreased in diabetic rats (P Conclusions Our results suggest that telmisartan upregulates the expression of myocardial adiponectin, its receptor 2 and GLUT4. Simultaneously, it downregulates the expression of myocardial p22phox, NOX4, MCP-1, and CTGF, contributing so to the improvement of heart function in diabetic rats. Telmisartan also induces a protective role on the vascular system by upregulating the expression of adipoR1 and downregulating the expression of MCP-1 and NF-κB in the abdominal aorta in diabetic rats.

  20. Single nucleotide polymorphism mining and nucleotide sequence analysis of Mx1 gene in exonic regions of Japanese quail

    Directory of Open Access Journals (Sweden)

    Diwesh Kumar Niraj


    Full Text Available Aim: An attempt has been made to study the Myxovirus resistant (Mx1 gene polymorphism in Japanese quail. Materials and Methods: In the present, investigation four fragments viz. Fragment I of 185 bp (Exon 3 region, Fragment II of 148 bp (Exon 5 region, Fragment III of 161 bp (Exon 7 region, and Fragment IV of 176 bp (Exon 13 region of Mx1 gene were amplified and screened for polymorphism by polymerase chain reaction-single-strand conformation polymorphism technique in 170 Japanese quail birds. Results: Out of the four fragments, one fragment (Fragment II was found to be polymorphic. Remaining three fragments (Fragment I, III, and IV were found to be monomorphic which was confirmed by custom sequencing. Overall nucleotide sequence analysis of Mx1 gene of Japanese quail showed 100% homology with common quail and more than 80% homology with reported sequence of chicken breeds. Conclusion: The Mx1 gene is mostly conserved in Japanese quail. There is an urgent need of comprehensive analysis of other regions of Mx1 gene along with its possible association with the traits of economic importance in Japanese quail.

  1. Eukaryotic nucleotide excision repair: from understanding mechanisms to influencing biology

    Institute of Scientific and Technical Information of China (English)

    Sarah C Shuck; Emily A Short; John J Turchi


    Repair of bulky DNA adducts by the nucleotide excision repair (NER) pathway is one of the more versatile DNA repair pathways for the removal of DNA lesions. There are two subsets of the NER pathway, global genomic-NER (GG-NER) and transcription-coupled NER (TC-NER), which differ only in the step involving recognition of the DNA lesion. Following recognition of the damage, the sub-pathways then converge for the incision/excision steps and subsequent gap filling and ligation steps. This review will focus on the GGR sub-pathway of NER while the TCR sub-pathway will be covered in another article in this issue. The ability of the NER pathway to repair a wide array of adducts stems, in part, from the mechanisms involved in the initial recognition step of the damaged DNA and results in NER impacting an equally wide array of human physiological responses and events. In this review, the impact of NER on carcinogenesis, neurological function, sensitivity to environmental factors and sensitivity to cancer therapeutics will be discussed. The knowledge generated in our understanding of the NER pathway over the past 40 years has resulted from advances in the fields of animal model systems, mammalian genetics and in vitro biochemistry, as well as from reconstitution studies and structural analyses of the proteins and enzymes that participate in this pathway. Each of these avenues of research has contributed significantly to our understanding of how the NER pathway works and how alterations in NER activity, both positive and negative, influence human biology.

  2. Analysis of codon usage and nucleotide composition bias in polioviruses

    Directory of Open Access Journals (Sweden)

    Gu Yuan-xing


    Full Text Available Abstract Background Poliovirus, the causative agent of poliomyelitis, is a human enterovirus and a member of the family of Picornaviridae and among the most rapidly evolving viruses known. Analysis of codon usage can reveal much about the molecular evolution of the viruses. However, little information about synonymous codon usage pattern of polioviruses genome has been acquired to date. Methods The relative synonymous codon usage (RSCU values, effective number of codon (ENC values, nucleotide contents and dinucleotides were investigated and a comparative analysis of codon usage pattern for open reading frames (ORFs among 48 polioviruses isolates including 31 of genotype 1, 13 of genotype 2 and 4 of genotype 3. Results The result shows that the overall extent of codon usage bias in poliovirus samples is low (mean ENC = 53.754 > 40. The general correlation between base composition and codon usage bias suggests that mutational pressure rather than natural selection is the main factor that determines the codon usage bias in those polioviruses. Depending on the RSCU data, it was found that there was a significant variation in bias of codon usage among three genotypes. Geographic factor also has some effect on the codon usage pattern (exists in the genotype-1 of polioviruses. No significant effect in gene length or vaccine derived polioviruses (DVPVs, wild viruses and live attenuated virus was observed on the variations of synonymous codon usage in the virus genes. The relative abundance of dinucleotide (CpG in the ORFs of polioviruses are far below expected values especially in DVPVs and attenuated virus of polioviruses genotype 1. Conclusion The information from this study may not only have theoretical value in understanding poliovirus evolution, especially for DVPVs genotype 1, but also have potential value for the development of poliovirus vaccines.

  3. Sequencing genes in silico using single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Zhang Xinyi


    Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate

  4. Cortisol promotes endoplasmic glucose production via pyridine nucleotide redox. (United States)

    Wang, Zengmin; Mick, Gail J; Xie, Rongrong; Wang, Xudong; Xie, Xuemei; Li, Guimei; McCormick, Kenneth L


    Both increased adrenal and peripheral cortisol production, the latter governed by 11β-hydroxysteroid dehydrogenase type 1 (11β-HSD1), contribute to the maintenance of fasting blood glucose. In the endoplasmic reticulum (ER), the pyridine nucleotide redox state (NADP/NADPH) is dictated by the concentration of glucose-6-phosphate (G6P) and the coordinated activities of two enzymes, hexose-6-phosphate dehydrogenase (H6PDH) and 11β-HSD1. However, luminal G6P may similarly serve as a substrate for hepatic glucose-6-phophatase (G6Pase). A tacit belief is that the G6P pool in the ER is equally accessible to both H6PDH and G6Pase. Based on our inhibition studies and kinetic analysis in isolated rat liver microsomes, these two aforesaid luminal enzymes do share the G6P pool in the ER, but not equally. Based on the kinetic modeling of G6P flux, the ER transporter for G6P (T1) preferentially delivers this substrate to G6Pase; hence, the luminal enzymes do not share G6P equally. Moreover, cortisol, acting through 11β-HSD1, begets a more reduced pyridine redox ratio. By altering this luminal redox ratio, G6P flux through H6PDH is restrained, allowing more G6P for the competing enzyme G6Pase. And, at low G6P concentrations in the ER lumen, which occur during fasting, this acute cortisol-induced redox adjustment promotes glucose production. This reproducible cortisol-driven mechanism has been heretofore unrecognized. PMID:26860459

  5. Resistance issues with new nucleoside/nucleotide backbone options. (United States)

    Wainberg, Mark A; Turner, Dan


    The nucleoside and nucleotide reverse transcriptase inhibitors (NRTIs/NtRTIs) remain an enduring feature of combination therapy. As NRTI/NtRTI options continue to expand, questions arise about how best to combine these agents to create effective dual NRTI/NtRTI backbones in antiretroviral regimens while avoiding treatment-emergent drug resistance. Clinicians must consider how NRTIs/NtRTIs such as tenofovir DF (TDF), abacavir (ABC), and emtricitabine (FTC), as well as new once-daily and coformulated NRTIs/NtRTIs, interact with older agents when combined in novel regimens and how sequencing the new NRTIs can preserve future treatment options. Resistance data from clinical trials have revealed important information on the patterns, prevalence, and effects of resistance seen among patients experiencing virologic failure. In recent years, the prevalence of some mutations such as M184V and Q151M has remained relatively constant, while the L74V mutation, the 69 insertions, and thymidine analogue mutations have decreased in prevalence. Other mutations such as K65R and Y115F, while still relatively uncommon, are increasing in prevalence. This increase may be due to the use of new treatment combinations that select for these mutations at a higher rate. Clinical trials suggest that new regimens containing TDF or ABC select for K65R and that this mutation is observed more frequently with TDF; in contrast, L74V is observed more frequently in ABC-containing regimens but is not commonly selected by TDF-containing regimens. Several lines of evidence are converging to suggest that the presence of zidovudine may decrease the risk of L74V and K65R in ABC- or TDF-containing regimens. This review summarizes the clinical implications of resistance profiles associated with new NRTI/NtRTI regimens in current use and in advanced clinical studies. PMID:15319668

  6. Antithrombotic activities of ferulic acid via intracellular cyclic nucleotide signaling. (United States)

    Hong, Qian; Ma, Zeng-Chun; Huang, Hao; Wang, Yu-Guang; Tan, Hong-Ling; Xiao, Cheng-Rong; Liang, Qian-De; Zhang, Han-Ting; Gao, Yue


    Ferulic acid (FA) produces protective effects against cardiovascular dysfunctions. However, the mechanisms of FA is still not known. Here we examined the antithrombotic effects of FA and its potential mechanisms. Anticoagulation assays and platelet aggregation was evaluated in vitro and in vivo. Thromboxane B2 (TXB2), cyclic adenosine monophosphate(cAMP), and cyclic guanosine monophosphate (cGMP) was determined using enzyme immunoassay kits. Nitric oxide (NO) production was measured using the Griess reaction. Protein expression was detected by Western blotting analysis. Oral administration of FA prevented death caused by pulmonary thrombosis and prolonged the tail bleeding and clotting time in mice,while, it did not alter the coagulation parameters, including the activated partial thromboplastin time (APTT), prothrombin time (PT), and thrombin time (TT). In addition, FA (50-200µM) dose-dependently inhibited platelet aggregation induced by various platelet agonists, including adenosine diphosphate (ADP), thrombin, collagen, arachidonic acid (AA), and U46619. Further, FA attenuated intracellular Ca(2)(+) mobilization and TXB2 production induced by the platelet agonists. FA increased the levels of cAMP and cGMP and phosphorylated vasodilator-stimulated phosphoprotein (VASP) while decreased phospho-MAPK (mitogen-activated protein kinase) and phosphodiesterase (PDE) in washed rat platelets, VASP is a substrate of cyclic nucleotide and PDE is an enzyme family responsible for hydrolysis of cAMP/cGMP. These results suggest that antithrombotic activities of FA may be regulated by inhibition of platelet aggregation, rather than through inhibiting the release of thromboplastin or formation of thrombin. The mechanism of this action may involve activation of cAMP and cGMP signaling. PMID:26948317

  7. Dietary Nucleotides Supplementation and Liver Injury in Alcohol-Treated Rats: A Metabolomics Investigation

    Directory of Open Access Journals (Sweden)

    Xiaxia Cai


    Full Text Available Background: Previous studies suggested that nucleotides were beneficial for liver function, lipid metabolism and so on. The present study aimed to investigate the metabolic response of dietary nucleotides supplementation in alcohol-induced liver injury rats. Methods: Five groups of male Wistar rats were used: normal control group (basal diet, equivalent distilled water, alcohol control group (basal diet, 50% alcohol (v/v, dextrose control group (basal diet, isocaloric amount of dextrose, and 0.04% and 0.16% nucleotides groups (basal diet supplemented with 0.4 g and 1.6 g nucleotides kg−1 respectively, 50% alcohol (v/v. The liver injury was measured through traditional liver enzymes, expression of oxidative stress markers and histopathological examination. Ultra-performance liquid chromatography quadrupole-time-flight mass spectrometry (UPLC-Q-TOF-MS was applied to identify liver metabolite profiles. Results: Nucleotides supplementation prevented the progression of hepatocyte steatosis. The levels of total proteins, globulin, alanine aminotransferase, aspartate aminotransferase, total cholesterol triglyceride, as well as the oxidative stress markers altered by alcohol, were improved by nucleotides supplementation. Elevated levels of liver bile acids (glycocholic acid, chenodeoxyglycocholic acid, and taurodeoxycholic acid, as well as lipids (stearic acid, palmitic acid, oleic acid, phosphatidylcholine, and lysophosphatidylethanolamine in alcohol-treated rats were reversed by nucleotides supplementation. In addition, supplementation with nucleotides could increase the levels of amino acids, including valyl-Leucine, l-leucine, alanyl-leucine and l-phenylalanine. Conclusion: These data indicate potential biomarkers and confirm the benefit of dietary nucleotides on alcoholic liver injury.

  8. Kinetic Analysis of the Guanine Nucleotide Exchange Activity of TRAPP, a Multimeric Ypt1p Exchange Factor


    Chin, Harvey F.; Cai, Yiying; Menon, Shekar; Ferro-Novick, Susan; Reinisch, Karin M; De La Cruz, Enrique M.


    The TRAPP complexes, large multimeric assemblies that function in membrane traffic, are guanine nucleotide exchange factors (GEF) that activate the Rab GTPase Ypt1p. Here we measured the rate and equilibrium constants that define the interaction of Ypt1p with guanine nucleotide (GDP and GTP/GMPPNP) and the core TRAPP subunits required for GEF activity. These parameters allowed us to identify the kinetic and thermodynamic basis by which TRAPP catalyzes nucleotide exchange from Ypt1p. Nucleotid...

  9. Completion of the nucleotide sequence of sunn-hemp mosaic virus: a tobamovirus pathogenic to legumes. (United States)

    Silver, S; Quan, S; Deom, C M


    Sunn-hemp mosaic virus (SHMV) is a member of the tobamovirus group of plant viruses. The nucleotide sequence of the 5'-untranslated region, the 129 kD protein gene, and a portion of the 186 kD protein gene of SHMV was determined. The 4,683 nucleotides (nts) reported here completes the sequence of the SHMV genome and complements previous work (Meshi, Ohno, and Okada, Nucleic Acids Res. 10, 6111-6117 [1982]; Mol. Gen. Genet. 184, 20-25 [1981]) to provide the first complete nucleotide sequence for a tobamovirus that is pathogenic to leguminous plants. PMID:8938983

  10. Complete nucleotide sequence of the genomic RNA of tobacco mosaic virus strain Cg. (United States)

    Yamanaka, T; Komatani, H; Meshi, T; Naito, S; Ishikawa, M; Ohno, T


    Tobacco mosaic virus (TMV)-Cg is a crucifer-infecting tobamovirus that was isolated from field-grown garlic. We determined the complete nucleotide sequence of the genomic RNA of TMV-Cg. The genomic RNA of TMV-Cg consists of 6303 nucleotides and encodes four large open reading frames, organized basically in the same way as that of other tobamoviruses. The nucleotide and deduced amino acid sequences are very similar to those of the other crucifer-infecting tobamoviruses that have been sequenced so far. PMID:9608662

  11. Interaction of mammalian mitochondrial elongation factor EF-Tu with guanine nucleotides.


    Cai, Y. C.; Bullard, J. M.; Thompson, N L; Spremulli, L L


    Elongation factor Tu (EF-Tu) promotes the binding of aminoacyl-tRNA (aa-tRNA) to the acceptor site of the ribosome. During the elongation cycle, EF-Tu interacts with guanine nucleotides, aa-tRNA and its nucleotide exchange factor (EF-Ts). Quantitative determination of the equilibrium dissociation constants that govern the interactions of mammalian mitochondrial EF-Tu (EF-Tu(mt)) with guanine nucleotides was the focus of the work reported here. Equilibrium dialysis with [3H]GDP was used to mea...

  12. 37 CFR 1.822 - Symbols and format to be used for nucleotide and/or amino acid sequence data. (United States)


    ... for nucleotide and/or amino acid sequence data. 1.822 Section 1.822 Patents, Trademarks, and... Amino Acid Sequences § 1.822 Symbols and format to be used for nucleotide and/or amino acid sequence data. (a) The symbols and format to be used for nucleotide and/or amino acid sequence data...

  13. Myosin individualized: single nucleotide polymorphisms in energy transduction

    Directory of Open Access Journals (Sweden)

    Wieben Eric D


    Full Text Available Abstract Background Myosin performs ATP free energy transduction into mechanical work in the motor domain of the myosin heavy chain (MHC. Energy transduction is the definitive systemic feature of the myosin motor performed by coordinating in a time ordered sequence: ATP hydrolysis at the active site, actin affinity modulation at the actin binding site, and the lever-arm rotation of the power stroke. These functions are carried out by several conserved sub-domains within the motor domain. Single nucleotide polymorphisms (SNPs affect the MHC sequence of many isoforms expressed in striated muscle, smooth muscle, and non-muscle tissue. The purpose of this work is to provide a rationale for using SNPs as a functional genomics tool to investigate structurefunction relationships in myosin. In particular, to discover SNP distribution over the conserved sub-domains and surmise what it implies about sub-domain stability and criticality in the energy transduction mechanism. Results An automated routine identifying human nonsynonymous SNP amino acid missense substitutions for any MHC gene mined the NCBI SNP data base. The routine tested 22 MHC genes coding muscle and non-muscle isoforms and identified 89 missense mutation positions in the motor domain with 10 already implicated in heart disease and another 8 lacking sequence homology with a skeletal MHC isoform for which a crystallographic model is available. The remaining 71 SNP substitutions were found to be distributed over MHC with 22 falling outside identified functional sub-domains and 49 in or very near to myosin sub-domains assigned specific crucial functions in energy transduction. The latter includes the active site, the actin binding site, the rigid lever-arm, and regions facilitating their communication. Most MHC isoforms contained SNPs somewhere in the motor domain. Conclusions Several functional-crucial sub-domains are infiltrated by a large number of SNP substitution sites suggesting these

  14. Nicotinamide Adenine Dinucleotide Phosphate Oxidase-Mediated Redox Signaling and Vascular Remodeling by 16α-Hydroxyestrone in Human Pulmonary Artery Cells: Implications in Pulmonary Arterial Hypertension. (United States)

    Hood, Katie Y; Montezano, Augusto C; Harvey, Adam P; Nilsen, Margaret; MacLean, Margaret R; Touyz, Rhian M


    Estrogen and oxidative stress have been implicated in pulmonary arterial hypertension (PAH). Mechanisms linking these systems are elusive. We hypothesized that estrogen metabolite, 16α-hydroxyestrone (16αOHE1), stimulates nicotinamide adenine dinucleotide phosphate oxidase (Nox)-induced reactive oxygen species (ROS) generation and proliferative responses in human pulmonary artery smooth muscle cells (hPASMCs) and that in PAH aberrant growth signaling promotes vascular remodeling. The pathophysiological significance of estrogen-Nox-dependent processes was studied in female Nox1(-/-) and Nox4(-/-) mice with PAH. PASMCs from control subjects (control hPASMCs) and PAH patients (PAH-hPASMCs) were exposed to estrogen and 16αOHE1 in the presence/absence of inhibitors of Nox, cytochrome P450 1B1, and estrogen receptors. Estrogen, through estrogen receptor-α, increased Nox-derived ROS and redox-sensitive growth in hPASMCs, with greater effects in PAH-hPASMCs versus control hPASMCs. Estrogen effects were inhibited by cytochrome P450 1B1 blockade. 16αOHE1 stimulated transient ROS production in hPASMCs, with sustained responses in PAH-hPASMCs. Basal expression of Nox1/Nox4 was potentiated in PAH-hPASMCs. In hPASMCs, 16αOHE1 increased Nox1 expression, stimulated irreversible oxidation of protein tyrosine phosphatases, decreased nuclear factor erythroid-related factor 2 activity and expression of nuclear factor erythroid-related factor 2-regulated antioxidant genes, and promoted proliferation. This was further amplified in PAH-hPASMCs. Nox1(-/-) but not Nox4(-/-) mice were protected against PAH and vascular remodeling. Our findings demonstrate that in PAH-hPASMCs, 16αOHE1 stimulates redox-sensitive cell growth primarily through Nox1. Supporting this, in vivo studies exhibited protection against pulmonary hypertension and remodeling in Nox1(-/-) mice. This study provides new insights through Nox1/ROS and nuclear factor erythroid-related factor 2 whereby 16αOHE1 influences

  15. Database of amino acid-nucleotide contacts in the DNA complexes with homeodomain family proteins

    International Nuclear Information System (INIS)

    The analysis of amino acid-nucleotide contacts in interfaces of the protein-DNA complexes, intended to find consistencies in the protein-DNA recognition, is a complex problem that requires analysis of the physicochemical characteristics of these contacts, of the positions of the participating amino acids and nucleotides in the chains of the protein and the DNA, respectively, as well as conservatism of these contacts. Thus, those heterogeneous data should be systematized. For this purpose we have developed a database of amino acid-nucleotide contacts ANTPC (Amino acid Nucleotide Type Position Conservation) following the archetypal example of the proteins in the homeodomain family. We show that it can be used for comparison and classification of interfaces of the protein-DNA complexes

  16. A novel Access to Nucleotide-activated Oligosaccharides by Enzymatic Synthesis

    Czech Academy of Sciences Publication Activity Database

    Nieder, V.; Gallego, R.; Kutzer, M.; Kamerling, J.; Vliegenthart, J.; Marx, S.; Křen, Vladimír; Elling, L.

    Hamburg, 2000. s. 152. [International Carbohydrate Symposium /20./. 27.08.2000-01.09.2000, Hamburg] Institutional research plan: CEZ:AV0Z5020903 Keywords : nucleotide * activated * enzymatic Subject RIV: EE - Microbiology, Virology

  17. Changing the acceptor identity of a transfer RNA by altering nucleotides in a "variable pocket". (United States)

    McClain, W H; Foss, K


    The specificity of tRNA(Arg) (arginine transfer RNA) for aminoacylation (its acceptor identity) were first identified by computer analysis and then examined with amber suppressor tRNAs in Escherichia coli. On replacing two nucleotides in tRNA(Phe) (phenylalanine transfer RNA) with the corresponding nucleotides from tRNA(Arg), the acceptor identity of the resulting tRNA was changed to that of tRNA(Arg). The nucleotides used in the identity transformation occupy a "variable pocket" structure on the surface of the tRNA molecule where two single-stranded loop segments interact. The middle nucleotide in the anticodon also probably contributes to the interaction, since an amber suppressor of tRNA(Arg) had an acceptor identity for lysine as well as arginine. PMID:2459773

  18. Activity of different classes of nucleoside and nucleotide analogues against adenovirus in cell culture

    Czech Academy of Sciences Publication Activity Database

    Naesens, L.; Lenaerts, L.; Holý, Antonín; Balzarini, J.; De Clercq, E.

    Elsevier. Roč. 62, č. 2 (2004), s. A74. ISSN 0166-3542. [International Conference on Antiviral Research /17./. 02.05.2004-06.05.2004, Tucson] Keywords : nucleosides * nucleotides Subject RIV: CC - Organic Chemistry

  19. The nucleotide sequence of threonine transfer RNA coded by bacteriophage T4

    International Nuclear Information System (INIS)

    The nucleotide sequence of a low molecular weight RNA coded by bacteriophage T4 (and previously identified as species α) has been determined. The molecule is of particular biological interest for its associated biosynthetic properties. This RNA is 76 nucleotides in length, contains eight modified bases, and can be arranged in a cloverleaf configuration common to tRNAs. The anticodon sequence is UGU, which corresponds to the threonine-specific codons ACsub(G)sup(A). The nucleotide sequence was determined primarily by nearest-neighbour analysis of RNA synthesized in vitro using [α-32P] nucleoside triphosphates. Using the single-strand specific nuclease S1, two in vivo labelled half-molecules were generated and analysed. This information together with restrictions imposed by nearest-neighbour data, provided a unique linear sequence of nucleotides with the features of secondary structure common to tRNA molecules. (author)

  20. Regulation of Nucleotide Metabolism by Mutant p53 Contributes to its Gain-of-Function Activities


    Kollareddy, Madhusudhan; Dimitrova, Elizabeth; Vallabhaneni, Krishna C.; Chan, Adriano; Le, Thuc; Chauhan, Krishna M.; Zunamys I. Carrero; Ramakrishnan, Gopalakrishnan; Watabe, Kounosuke; Haupt, Ygal; Haupt, Sue; Pochampally, Radhika; Boss, Gerard R.; Romero, Damian G.; Radu, Caius G.


    SUMMARY Mutant p53 (mtp53) is an oncogene that drives cancer cell proliferation. Here we report that mtp53 associates with the promoters of numerous nucleotide metabolism genes (NMG). Mtp53 knockdown reduces NMG expression and substantially depletes nucleotide pools, which attenuates GTP dependent protein (GTPase) activity and cell invasion. Addition of exogenous guanosine or GTP restores the invasiveness of mtp53 knockdown cells, suggesting that mtp53 promotes invasion by increasing GTP. Add...