WorldWideScience

Sample records for acute nipah virus

  1. Nipah virus transmission in a hamster model.

    Directory of Open Access Journals (Sweden)

    Emmie de Wit

    2011-12-01

    Full Text Available Based on epidemiological data, it is believed that human-to-human transmission plays an important role in Nipah virus outbreaks. No experimental data are currently available on the potential routes of human-to-human transmission of Nipah virus. In a first dose-finding experiment in Syrian hamsters, it was shown that Nipah virus was predominantly shed via the respiratory tract within nasal and oropharyngeal secretions. Although Nipah viral RNA was detected in urogenital and rectal swabs, no infectious virus was recovered from these samples, suggesting no viable virus was shed via these routes. In addition, hamsters inoculated with high doses shed significantly higher amounts of viable Nipah virus particles in comparison with hamsters infected with lower inoculum doses. Using the highest inoculum dose, three potential routes of Nipah virus transmission were investigated in the hamster model: transmission via fomites, transmission via direct contact and transmission via aerosols. It was demonstrated that Nipah virus is transmitted efficiently via direct contact and inefficiently via fomites, but not via aerosols. These findings are in line with epidemiological data which suggest that direct contact with nasal and oropharyngeal secretions of Nipah virus infected individuals resulted in greater risk of Nipah virus infection. The data provide new and much-needed insights into the modes and efficiency of Nipah virus transmission and have important public health implications with regards to the risk assessment and management of future Nipah virus outbreaks.

  2. Nipah Virus Transmission in a Hamster Model

    Science.gov (United States)

    de Wit, Emmie; Bushmaker, Trenton; Scott, Dana; Feldmann, Heinz; Munster, Vincent J.

    2011-01-01

    Based on epidemiological data, it is believed that human-to-human transmission plays an important role in Nipah virus outbreaks. No experimental data are currently available on the potential routes of human-to-human transmission of Nipah virus. In a first dose-finding experiment in Syrian hamsters, it was shown that Nipah virus was predominantly shed via the respiratory tract within nasal and oropharyngeal secretions. Although Nipah viral RNA was detected in urogenital and rectal swabs, no infectious virus was recovered from these samples, suggesting no viable virus was shed via these routes. In addition, hamsters inoculated with high doses shed significantly higher amounts of viable Nipah virus particles in comparison with hamsters infected with lower inoculum doses. Using the highest inoculum dose, three potential routes of Nipah virus transmission were investigated in the hamster model: transmission via fomites, transmission via direct contact and transmission via aerosols. It was demonstrated that Nipah virus is transmitted efficiently via direct contact and inefficiently via fomites, but not via aerosols. These findings are in line with epidemiological data which suggest that direct contact with nasal and oropharyngeal secretions of Nipah virus infected individuals resulted in greater risk of Nipah virus infection. The data provide new and much-needed insights into the modes and efficiency of Nipah virus transmission and have important public health implications with regards to the risk assessment and management of future Nipah virus outbreaks. PMID:22180802

  3. A neutralizing human monoclonal antibody protects against lethal disease in a new ferret model of acute nipah virus infection.

    Directory of Open Access Journals (Sweden)

    Katharine N Bossart

    2009-10-01

    Full Text Available Nipah virus is a broadly tropic and highly pathogenic zoonotic paramyxovirus in the genus Henipavirus whose natural reservoirs are several species of Pteropus fruit bats. Nipah virus has repeatedly caused outbreaks over the past decade associated with a severe and often fatal disease in humans and animals. Here, a new ferret model of Nipah virus pathogenesis is described where both respiratory and neurological disease are present in infected animals. Severe disease occurs with viral doses as low as 500 TCID(50 within 6 to 10 days following infection. The underlying pathology seen in the ferret closely resembles that seen in Nipah virus infected humans, characterized as a widespread multisystemic vasculitis, with virus replicating in highly vascular tissues including lung, spleen and brain, with recoverable virus from a variety of tissues. Using this ferret model a cross-reactive neutralizing human monoclonal antibody, m102.4, targeting the henipavirus G glycoprotein was evaluated in vivo as a potential therapeutic agent. All ferrets that received m102.4 ten hours following a high dose oral-nasal Nipah virus challenge were protected from disease while all controls died. This study is the first successful post-exposure passive antibody therapy for Nipah virus using a human monoclonal antibody.

  4. Nipah Virus: A Public Health Concern

    Directory of Open Access Journals (Sweden)

    Abu Bakar Siddique

    2016-05-01

    Full Text Available Nipah virus, a member of the genus Henipavirus, a new class of virus in the Paramyxoviridae family, has drawn attention as an emerging zoonotic virus in South-East and South Asian region. Case fatality rate of Nipah virus infection ranges from 40–70% although it has been as high as 100% in some outbreaks. Many of the outbreaks were attributed to pigs consuming fruits, partially eaten by fruit bats, and transmission of infection to humans. In Bangladesh, Nipah virus infection was associated with contact with a sick cow, consumption of fresh date palm sap (potentially contaminated with pteropid bat saliva, and person-to-person transmission. In 2014, 18 cases of Nipah virus infection have been reported in Bangladesh, of which 9 cases died. In the most recent epidemic at least 6 people died out of nine cases due to Nipah virus infection in the remote northern Bangladesh in 2015. Human infections range from asymptomatic infection to fatal encephalitis. Some people can also experience atypical pneumonia and severe respiratory problems. The virus is detected by ELISA, PCR, immunofluoroscence assay and isolation by cell culture. Treatment is mostly symptomatic and supportive as the effect of antiviral drugs is not satisfactory, and an effective vaccine is yet to be developed. So the very high case fatality addresses the need for adequate and strict control and preventive measures.

  5. Hendra virus and Nipah virus animal vaccines.

    Science.gov (United States)

    Broder, Christopher C; Weir, Dawn L; Reid, Peter A

    2016-06-24

    Hendra virus (HeV) and Nipah virus (NiV) are zoonotic viruses that emerged in the mid to late 1990s causing disease outbreaks in livestock and people. HeV appeared in Queensland, Australia in 1994 causing a severe respiratory disease in horses along with a human case fatality. NiV emerged a few years later in Malaysia and Singapore in 1998-1999 causing a large outbreak of encephalitis with high mortality in people and also respiratory disease in pigs which served as amplifying hosts. The key pathological elements of HeV and NiV infection in several species of mammals, and also in people, are a severe systemic and often fatal neurologic and/or respiratory disease. In people, both HeV and NiV are also capable of causing relapsed encephalitis following recovery from an acute infection. The known reservoir hosts of HeV and NiV are several species of pteropid fruit bats. Spillovers of HeV into horses continue to occur in Australia and NiV has caused outbreaks in people in Bangladesh and India nearly annually since 2001, making HeV and NiV important transboundary biological threats. NiV in particular possesses several features that underscore its potential as a pandemic threat, including its ability to infect humans directly from natural reservoirs or indirectly from other susceptible animals, along with a capacity of limited human-to-human transmission. Several HeV and NiV animal challenge models have been developed which have facilitated an understanding of pathogenesis and allowed for the successful development of both active and passive immunization countermeasures. Published by Elsevier Ltd.

  6. Nipah virus infection in bats (order Chiroptera) in peninsular Malaysia.

    Science.gov (United States)

    Yob, J. M.; Field, H.; Rashdi, A. M.; Morrissy, C.; van der Heide, B.; Rota, P.; bin Adzhar, A.; White, J.; Daniels, P.; Jamaluddin, A.; Ksiazek, T.

    2001-01-01

    Nipah virus, family Paramyxoviridae, caused disease in pigs and humans in peninsular Malaysia in 1998-99. Because Nipah virus appears closely related to Hendra virus, wildlife surveillance focused primarily on pteropid bats (suborder Megachiroptera), a natural host of Hendra virus in Australia. We collected 324 bats from 14 species on peninsular Malaysia. Neutralizing antibodies to Nipah virus were demonstrated in five species, suggesting widespread infection in bat populations in peninsular Malaysia. PMID:11384522

  7. Quantitative estimation of Nipah virus replication kinetics in vitro

    Directory of Open Access Journals (Sweden)

    Hassan Sharifah

    2006-06-01

    Full Text Available Abstract Background Nipah virus is a zoonotic virus isolated from an outbreak in Malaysia in 1998. The virus causes infections in humans, pigs, and several other domestic animals. It has also been isolated from fruit bats. The pathogenesis of Nipah virus infection is still not well described. In the present study, Nipah virus replication kinetics were estimated from infection of African green monkey kidney cells (Vero using the one-step SYBR® Green I-based quantitative real-time reverse transcriptase-polymerase chain reaction (qRT-PCR assay. Results The qRT-PCR had a dynamic range of at least seven orders of magnitude and can detect Nipah virus from as low as one PFU/μL. Following initiation of infection, it was estimated that Nipah virus RNA doubles at every ~40 minutes and attained peak intracellular virus RNA level of ~8.4 log PFU/μL at about 32 hours post-infection (PI. Significant extracellular Nipah virus RNA release occurred only after 8 hours PI and the level peaked at ~7.9 log PFU/μL at 64 hours PI. The estimated rate of Nipah virus RNA released into the cell culture medium was ~0.07 log PFU/μL per hour and less than 10% of the released Nipah virus RNA was infectious. Conclusion The SYBR® Green I-based qRT-PCR assay enabled quantitative assessment of Nipah virus RNA synthesis in Vero cells. A low rate of Nipah virus extracellular RNA release and low infectious virus yield together with extensive syncytial formation during the infection support a cell-to-cell spread mechanism for Nipah virus infection.

  8. Evaluation of Nipah Virus as a Human and Animal Biological Terrorism and Warfare Agent

    Science.gov (United States)

    2001-09-01

    Molecular analyses have confirmed that Nipah virus and Hendra virus are closely related, but different viruses . The N, C, P. V, M, F and G genes of Nipah...encephalitis and 106 of them have died. The Nipah virus outbreak also devastated Malaysia’s pig-farming industry. The Nipah virus or so-called Hendra ...Nipah virus belongs to the Paramnyxoviirit strain, which shows similarities to the Hendra virus , which was discovered in Australia in 1994

  9. Passive immunization and active vaccination against Hendra and Nipah viruses.

    Science.gov (United States)

    Broder, C C

    2013-01-01

    Hendra virus and Nipah virus are viral zoonoses first recognized in the mid and late 1990's and are now categorized as the type species of the genus Henipavirus within the family Paramyxoviridae. Their broad species tropism together with their capacity to cause severe and often fatal disease in both humans and animals make Hendra and Nipah "overlap agents" and significant biosecurity threats. The development of effective vaccination strategies to prevent or treat henipavirus infection and disease has been an important area of research. Here, henipavirus active and passive vaccination strategies that have been examined in animal challenge models of Hendra and Nipah virus disease are summarized and discussed.

  10. Nipah virus entry can occur by macropinocytosis

    International Nuclear Information System (INIS)

    Pernet, Olivier; Pohl, Christine; Ainouze, Michelle; Kweder, Hasan; Buckland, Robin

    2009-01-01

    Nipah virus (NiV) is a zoonotic biosafety level 4 paramyxovirus that emerged recently in Asia with high mortality in man. NiV is a member, with Hendra virus (HeV), of the Henipavirus genus in the Paramyxoviridae family. Although NiV entry, like that of other paramyxoviruses, is believed to occur via pH-independent fusion with the host cell's plasma membrane we present evidence that entry can occur by an endocytic pathway. The NiV receptor ephrinB2 has receptor kinase activity and we find that ephrinB2's cytoplasmic domain is required for entry but is dispensable for post-entry viral spread. The mutation of a single tyrosine residue (Y304F) in ephrinB2's cytoplasmic tail abrogates NiV entry. Moreover, our results show that NiV entry is inhibited by constructions and drugs specific for the endocytic pathway of macropinocytosis. Our findings could potentially permit the rapid development of novel low-cost antiviral treatments not only for NiV but also HeV.

  11. Identification of a broad-spectrum antiviral small molecule against severe acute respiratory syndrome coronavirus and Ebola, Hendra, and Nipah viruses by using a novel high-throughput screening assay.

    Science.gov (United States)

    Elshabrawy, Hatem A; Fan, Jilao; Haddad, Christine S; Ratia, Kiira; Broder, Christopher C; Caffrey, Michael; Prabhakar, Bellur S

    2014-04-01

    Severe acute respiratory syndrome coronavirus (SARS-CoV) and Ebola, Hendra, and Nipah viruses are members of different viral families and are known causative agents of fatal viral diseases. These viruses depend on cathepsin L for entry into their target cells. The viral glycoproteins need to be primed by protease cleavage, rendering them active for fusion with the host cell membrane. In this study, we developed a novel high-throughput screening assay based on peptides, derived from the glycoproteins of the aforementioned viruses, which contain the cathepsin L cleavage site. We screened a library of 5,000 small molecules and discovered a small molecule that can inhibit the cathepsin L cleavage of all viral peptides with minimal inhibition of cleavage of a host protein-derived peptide (pro-neuropeptide Y). The small molecule inhibited the entry of all pseudotyped viruses in vitro and the cleavage of SARS-CoV spike glycoprotein in an in vitro cleavage assay. In addition, the Hendra and Nipah virus fusion glycoproteins were not cleaved in the presence of the small molecule in a cell-based cleavage assay. Furthermore, we demonstrate that the small molecule is a mixed inhibitor of cathepsin L. Our broad-spectrum antiviral small molecule appears to be an ideal candidate for future optimization and development into a potent antiviral against SARS-CoV and Ebola, Hendra, and Nipah viruses. We developed a novel high-throughput screening assay to identify small molecules that can prevent cathepsin L cleavage of viral glycoproteins derived from SARS-CoV and Ebola, Hendra, and Nipah viruses that are required for their entry into the host cell. We identified a novel broad-spectrum small molecule that could block cathepsin L-mediated cleavage and thus inhibit the entry of pseudotypes bearing the glycoprotein derived from SARS-CoV or Ebola, Hendra, or Nipah virus. The small molecule can be further optimized and developed into a potent broad-spectrum antiviral drug.

  12. Identifying Early Target Cells of Nipah Virus Infection in Syrian Hamsters

    OpenAIRE

    Baseler, Laura; Scott, Dana P.; Saturday, Greg; Horne, Eva; Rosenke, Rebecca; Thomas, Tina; Meade-White, Kimberly; Haddock, Elaine; Feldmann, Heinz; de Wit, Emmie

    2016-01-01

    Background Nipah virus causes respiratory and neurologic disease with case fatality rates up to 100% in individual outbreaks. End stage lesions have been described in the respiratory and nervous systems, vasculature and often lymphoid organs in fatal human cases; however, the initial target organs of Nipah virus infection have not been identified. Here, we detected the initial target tissues and cells of Nipah virus and tracked virus dissemination during the early phase of infection in Syrian...

  13. Antibodies to Nipah-like virus in bats (Pteropus lylei), Cambodia.

    Science.gov (United States)

    Olson, James G; Rupprecht, Charles; Rollin, Pierre E; An, Ung Sam; Niezgoda, Michael; Clemins, Travis; Walston, Joe; Ksiazek, Thomas G

    2002-09-01

    Serum specimens from fruit bats were obtained at restaurants in Cambodia. We detected antibodies cross-reactive to Nipah virus by enzyme immunoassay in 11 (11.5%) of 96 Lyle's flying foxes (Pteropus lylei). Our study suggests that viruses closely related to Nipah or Hendra viruses are more widespread in Southeast Asia than previously documented.

  14. Pathogenesis of Hendra and Nipah virus infection in humans.

    Science.gov (United States)

    Escaffre, Olivier; Borisevich, Viktoriya; Rockx, Barry

    2013-04-17

    Hendra virus (HeV) and Nipah virus (NiV) are emerging zoonotic viruses that cause severe and often lethal respiratory illness and encephalitis in humans. Henipaviruses can infect a wide range of species and human-to-human transmission has been observed for NiV. While the exact route of transmission in humans is not known, experimental infection in different animal species suggests that infection can be efficiently initiated after respiratory challenge. The limited data on histopathological changes in fatal human cases of HeV and NiV suggest that endothelial cells are an important target during the terminal stage of infection; however, it is unknown where these viruses initially establish infection and how the virus disseminates from the respiratory tract to the central nervous system and other organs. Here we review the current concepts in henipavirus pathogenesis in humans.

  15. Hendra and Nipah viruses: why are they so deadly?

    Science.gov (United States)

    Marsh, Glenn A; Wang, Lin-Fa

    2012-06-01

    Henipavirus, including Hendra and Nipah viruses, is a group of emerging bat-borne paramyxoviruses which were responsible for severe disease outbreaks in humans, horses and pigs. The mortality rate of human infection varies between 50 and 100%, making them one of the most deadly viruses known to infect humans. Its use of highly conserved cell surface molecules (ephrin) as entry receptors and its highly effective replication and fusion strategies are believed to be important characteristics responsible for its high pathogenicity. Henipavirus also encodes multiple accessory proteins which play a key role in evasion of host innate immune responses. Our recent study on the mechanism of IFN antagonism by henipaviruses indicated that a better understanding of the virus-host interaction provides great potential to develop new therapeutic strategies against these viruses. Crown Copyright © 2012. Published by Elsevier B.V. All rights reserved.

  16. A treatment for and vaccine against the deadly Hendra and Nipah viruses.

    Science.gov (United States)

    Broder, Christopher C; Xu, Kai; Nikolov, Dimitar B; Zhu, Zhongyu; Dimitrov, Dimiter S; Middleton, Deborah; Pallister, Jackie; Geisbert, Thomas W; Bossart, Katharine N; Wang, Lin-Fa

    2013-10-01

    Hendra virus and Nipah virus are bat-borne paramyxoviruses that are the prototypic members of the genus Henipavirus. The henipaviruses emerged in the 1990s, spilling over from their natural bat hosts and causing serious disease outbreaks in humans and livestock. Hendra virus emerged in Australia and since 1994 there have been 7 human infections with 4 case fatalities. Nipah virus first appeared in Malaysia and subsequent outbreaks have occurred in Bangladesh and India. In total, there have been an estimated 582 human cases of Nipah virus and of these, 54% were fatal. Their broad species tropism and ability to cause fatal respiratory and/or neurologic disease in humans and animals make them important transboundary biological threats. Recent experimental findings in animals have demonstrated that a human monoclonal antibody targeting the viral G glycoprotein is an effective post-exposure treatment against Hendra and Nipah virus infection. In addition, a subunit vaccine based on the G glycoprotein of Hendra virus affords protection against Hendra and Nipah virus challenge. The vaccine has been developed for use in horses in Australia and is the first vaccine against a Biosafety Level-4 (BSL-4) agent to be licensed and commercially deployed. Together, these advances offer viable approaches to address Hendra and Nipah virus infection of livestock and people. Published by Elsevier B.V.

  17. Nipah virus encephalitis: A cause for concern for Indian neurologists?

    Directory of Open Access Journals (Sweden)

    Halder Amit

    2006-01-01

    Full Text Available The first and only recorded outbreak of Nipah virus (NV encephalitis in India occurred in the winter of 2001, although the causative organism could only be identified 5 years down the line in 2006. The first ever-recorded outbreak of NV encephalitis occurred in the Malaysian peninsula in 1998-99; though between 2001 and 2005, at least four outbreaks occurred in our neighboring country of Bangladesh. The threat of further outbreaks of this dangerous disease looms large on the Indian subcontinent, given the natural reservoir of the definitive host, namely, fruit-eating bats of the genus Pteropus. This review would briefly highlight the epidemiology, clinical aspects and diagnosis of NV encephalitis to enlighten the neurological community of the country for early detection and implementation of preventive measures in the event of further outbreaks, especially those which are generally passed of as ′mystery diseases′ in the lay press and even by governmental agencies.

  18. Structural and Functional Studies on the Fusion and Attachment Envelope Glycoproteins of Nipah Virus and Hendra Virus

    National Research Council Canada - National Science Library

    Bossart, Katharine

    2003-01-01

    Nipah virus (NiV) and Hendra (HeV) virus are emerging, biosafety level 4 paramyxoviruses responsible for fatal zoonotic infections of humans from pigs and horses, respectively, and are the prototypic members of a new Paramyxovirinae...

  19. Nipah and hendra virus interactions with the innate immune system.

    Science.gov (United States)

    Basler, Christopher F

    2012-01-01

    Nipah virus and Hendra virus are related, highly pathogenic paramyxoviruses with unusually broad host ranges. Henipaviruses encode several proteins that block innate immune responses, and these are likely to serve as virulence factors. Specfically, four virus-encoded proteins, the phosphoprotein (P), the V protein, the W protein, and the C protein have each been demonstrated to counteract aspects of the interferon (IFN)-α/β response, a key component of the innate immune response to virus infection. The available data indicate that V and W can inhibit the production of IFNα/β in response to various stimuli, while the P, V, and W proteins also block the ability of IFNs to signal and induce an antiviral state in cells. The C protein also inhibits the antiviral effects of IFNα/β by a poorly characterized mechanism. Reverse genetics systems, which allow the generation of recombinant viruses bearing specific mutations, have demonstrated the importance of the viral IFN-antagonists for replication. With these systems in hand, the field is now poised to define how specific viral IFN-antagonist functions influence viral pathogenesis.

  20. A mature and fusogenic form of the Nipah virus fusion protein requires proteolytic processing by cathepsin L

    International Nuclear Information System (INIS)

    Pager, Cara Theresia; Craft, Willie Warren; Patch, Jared; Dutch, Rebecca Ellis

    2006-01-01

    The Nipah virus fusion (F) protein is proteolytically processed to F 1 + F 2 subunits. We demonstrate here that cathepsin L is involved in this important maturation event. Cathepsin inhibitors ablated cleavage of Nipah F. Proteolytic processing of Nipah F and fusion activity was dramatically reduced in cathepsin L shRNA-expressing Vero cells. Additionally, Nipah virus F-mediated fusion was inhibited in cathepsin L-deficient cells, but coexpression of cathepsin L restored fusion activity. Both purified cathepsin L and B could cleave immunopurified Nipah F protein, but only cathepsin L produced products of the correct size. Our results suggest that endosomal cathepsins can cleave Nipah F, but that cathepsin L specifically converts Nipah F to a mature and fusogenic form

  1. Identifying Early Target Cells of Nipah Virus Infection in Syrian Hamsters.

    Directory of Open Access Journals (Sweden)

    Laura Baseler

    2016-11-01

    Full Text Available Nipah virus causes respiratory and neurologic disease with case fatality rates up to 100% in individual outbreaks. End stage lesions have been described in the respiratory and nervous systems, vasculature and often lymphoid organs in fatal human cases; however, the initial target organs of Nipah virus infection have not been identified. Here, we detected the initial target tissues and cells of Nipah virus and tracked virus dissemination during the early phase of infection in Syrian hamsters inoculated with a Nipah virus isolate from Malaysia (NiV-M or Bangladesh (NiV-B.Syrian hamsters were euthanized between 4 and 48 hours post intranasal inoculation and tissues were collected and analyzed for the presence of viral RNA, viral antigen and infectious virus. Virus replication was first detected at 8 hours post inoculation (hpi. Nipah virus initially targeted type I pneumocytes, bronchiolar respiratory epithelium and alveolar macrophages in the lung and respiratory and olfactory epithelium lining the nasal turbinates. By 16 hpi, virus disseminated to epithelial cells lining the larynx and trachea. Although the pattern of viral dissemination was similar for both virus isolates, the rate of spread was slower for NiV-B. Infectious virus was not detected in the nervous system or blood and widespread vascular infection and lesions within lymphoid organs were not observed, even at 48 hpi.Nipah virus initially targets the respiratory system. Virus replication in the brain and infection of blood vessels in non-respiratory tissues does not occur during the early phase of infection. However, virus replicates early in olfactory epithelium and may serve as the first step towards nervous system dissemination, suggesting that development of vaccines that block virus dissemination or treatments that can access the brain and spinal cord and directly inhibit virus replication may be necessary for preventing central nervous system pathology.

  2. Identifying Early Target Cells of Nipah Virus Infection in Syrian Hamsters.

    Science.gov (United States)

    Baseler, Laura; Scott, Dana P; Saturday, Greg; Horne, Eva; Rosenke, Rebecca; Thomas, Tina; Meade-White, Kimberly; Haddock, Elaine; Feldmann, Heinz; de Wit, Emmie

    2016-11-01

    Nipah virus causes respiratory and neurologic disease with case fatality rates up to 100% in individual outbreaks. End stage lesions have been described in the respiratory and nervous systems, vasculature and often lymphoid organs in fatal human cases; however, the initial target organs of Nipah virus infection have not been identified. Here, we detected the initial target tissues and cells of Nipah virus and tracked virus dissemination during the early phase of infection in Syrian hamsters inoculated with a Nipah virus isolate from Malaysia (NiV-M) or Bangladesh (NiV-B). Syrian hamsters were euthanized between 4 and 48 hours post intranasal inoculation and tissues were collected and analyzed for the presence of viral RNA, viral antigen and infectious virus. Virus replication was first detected at 8 hours post inoculation (hpi). Nipah virus initially targeted type I pneumocytes, bronchiolar respiratory epithelium and alveolar macrophages in the lung and respiratory and olfactory epithelium lining the nasal turbinates. By 16 hpi, virus disseminated to epithelial cells lining the larynx and trachea. Although the pattern of viral dissemination was similar for both virus isolates, the rate of spread was slower for NiV-B. Infectious virus was not detected in the nervous system or blood and widespread vascular infection and lesions within lymphoid organs were not observed, even at 48 hpi. Nipah virus initially targets the respiratory system. Virus replication in the brain and infection of blood vessels in non-respiratory tissues does not occur during the early phase of infection. However, virus replicates early in olfactory epithelium and may serve as the first step towards nervous system dissemination, suggesting that development of vaccines that block virus dissemination or treatments that can access the brain and spinal cord and directly inhibit virus replication may be necessary for preventing central nervous system pathology.

  3. Potent Human Monoclonal Antibodies against SARS CoV, Nipah and Hendra Viruses

    Science.gov (United States)

    Prabakaran, Ponraj; Zhongyu, Zhu; Xiao, Xiaodong; Biragyn, Arya; Dimitrov, Antony S.; Broder, Christopher C.; Dimitrov, Dimiter S.

    2009-01-01

    Polyclonal antibodies have a century-old history of being effective against some viruses; recently, monoclonal antibodies (mAbs) have also shown success. The humanized mAb Synagis (palivizumab) remains still the only mAb against respiratory syncytial virus (RSV) infections approved by the U.S. Food and Drug Administration (FDA). Recently, several potent human monoclonal antibodies (hmAbs) targeting the Severe Acute Respiratory Syndrome-Associated coronavirus (SARS CoV) S glycoproteins were developed quickly after the virus was identified in 2003. Among these antibodies, m396 and S230.15 exhibit exceptional potency and cross-reactivity as they neutralize isolates from the first and second outbreaks and from palm civets both in vitroand in mice. Similarly, the first fully hmAbs against two other paramyxoviruses, Hendra virus (HeV) and Nipah virus (NiV), which can cause up to 75% mortality, were recently developed; one of them, m102.4, shows exceptional cross-reactive potency against both NiV and HeV. Three-dimensional molecular structures of envelope glycoproteins from these viruses in complexes with antibodies and/or receptors were recently determined. Structural analyses along with other experiments have provided insights into the molecular mechanisms of receptor recognition and antibody neutralization, and suggested that these antibodies alone or in combination could successfully fight the viruses’ heterogeneity and mutability which is a major problem in the development of effective therapeutic agents against viruses, including therapeutic antibodies. PMID:19216624

  4. Affinity selection of Nipah and Hendra virus-related vaccine candidates from a complex random peptide library displayed on bacteriophage virus-like particles

    Energy Technology Data Exchange (ETDEWEB)

    Peabody, David S.; Chackerian, Bryce; Ashley, Carlee; Carnes, Eric; Negrete, Oscar

    2017-01-24

    The invention relates to virus-like particles of bacteriophage MS2 (MS2 VLPs) displaying peptide epitopes or peptide mimics of epitopes of Nipah Virus envelope glycoprotein that elicit an immune response against Nipah Virus upon vaccination of humans or animals. Affinity selection on Nipah Virus-neutralizing monoclonal antibodies using random sequence peptide libraries on MS2 VLPs selected peptides with sequence similarity to peptide sequences found within the envelope glycoprotein of Nipah itself, thus identifying the epitopes the antibodies recognize. The selected peptide sequences themselves are not necessarily identical in all respects to a sequence within Nipah Virus glycoprotein, and therefore may be referred to as epitope mimics VLPs displaying these epitope mimics can serve as vaccine. On the other hand, display of the corresponding wild-type sequence derived from Nipah Virus and corresponding to the epitope mapped by affinity selection, may also be used as a vaccine.

  5. A review of Nipah and Hendra viruses with an historical aside.

    Science.gov (United States)

    Ksiazek, Thomas G; Rota, Paul A; Rollin, Pierre E

    2011-12-01

    The emergence of Hendra and Nipah viruses in the 1990s has been followed by the further emergence of these viruses in the tropical Old World. The history and current knowledge of the disease, the viruses and their epidemiology is reviewed in this article. A historical aside summarizes the role that Dr. Brian W.J. Mahy played at critical junctures in the early stories of these viruses. Copyright © 2011 Elsevier B.V. All rights reserved.

  6. Comparison of the pathogenicity of Nipah virus isolates from Bangladesh and Malaysia in the Syrian hamster.

    Directory of Open Access Journals (Sweden)

    Blair L DeBuysscher

    Full Text Available Nipah virus is a zoonotic pathogen that causes severe disease in humans. The mechanisms of pathogenesis are not well described. The first Nipah virus outbreak occurred in Malaysia, where human disease had a strong neurological component. Subsequent outbreaks have occurred in Bangladesh and India and transmission and disease processes in these outbreaks appear to be different from those of the Malaysian outbreak. Until this point, virtually all Nipah virus studies in vitro and in vivo, including vaccine and pathogenesis studies, have utilized a virus isolate from the original Malaysian outbreak (NiV-M. To investigate potential differences between NiV-M and a Nipah virus isolate from Bangladesh (NiV-B, we compared NiV-M and NiV-B infection in vitro and in vivo. In hamster kidney cells, NiV-M-infection resulted in extensive syncytia formation and cytopathic effects, whereas NiV-B-infection resulted in little to no morphological changes. In vivo, NiV-M-infected Syrian hamsters had accelerated virus replication, pathology and death when compared to NiV-B-infected animals. NiV-M infection also resulted in the activation of host immune response genes at an earlier time point. Pathogenicity was not only a result of direct effects of virus replication, but likely also had an immunopathogenic component. The differences observed between NiV-M and NiV-B pathogeneis in hamsters may relate to differences observed in human cases. Characterization of the hamster model for NiV-B infection allows for further research of the strain of Nipah virus responsible for the more recent outbreaks in humans. This model can be used to study NiV-B pathogenesis, transmission, and countermeasures that could be used to control outbreaks.

  7. Hendra and Nipah Virus Infection in Cultured Human Olfactory Epithelial Cells.

    Science.gov (United States)

    Borisevich, Viktoriya; Ozdener, Mehmet Hakan; Malik, Bilal; Rockx, Barry

    2017-01-01

    Henipaviruses are emerging zoonotic viruses and causative agents of encephalitis in humans. However, the mechanisms of entry into the central nervous system (CNS) in humans are not known. Here, we evaluated the possible role of olfactory epithelium in virus entry into the CNS. We characterized Hendra virus (HeV) and Nipah virus (NiV) infection of primary human olfactory epithelial cultures. We show that henipaviruses can infect mature olfactory sensory neurons. Henipaviruses replicated efficiently, resulting in cytopathic effect and limited induction of host responses. These results show that human olfactory epithelium is susceptible to infection with henipaviruses, suggesting that this could be a pathway for neuroinvasion in humans. IMPORTANCE Henipaviruses are emerging zoonotic pathogens that can cause acute and severe respiratory and neurological disease in humans. The pathways by which henipaviruses enter the central nervous system (CNS) in humans are still unknown. The observation that human olfactory neurons are highly susceptible to infection with henipaviruses demonstrates that the olfactory epithelium can serve as a site of Henipavirus entry into the CNS.

  8. The Nature of Exposure Drives Transmission of Nipah Viruses from Malaysia and Bangladesh in Ferrets.

    Directory of Open Access Journals (Sweden)

    Bronwyn A Clayton

    2016-06-01

    Full Text Available Person-to-person transmission is a key feature of human Nipah virus outbreaks in Bangladesh. In contrast, in an outbreak of Nipah virus in Malaysia, people acquired infections from pigs. It is not known whether this important epidemiological difference is driven primarily by differences between NiV Bangladesh (NiV-BD and Malaysia (NiV-MY at a virus level, or by environmental or host factors. In a time course study, ferrets were oronasally exposed to equivalent doses of NiV-BD or NiV-MY. More rapid onset of productive infection and higher levels of virus replication in respiratory tract tissues were seen for NiV-BD compared to NiV-MY, corroborating our previous report of increased oral shedding of NiV-BD in ferrets and suggesting a contributory mechanism for increased NiV-BD transmission between people compared to NiV-MY. However, we recognize that transmission occurs within a social and environmental framework that may have an important and differentiating role in NiV transmission rates. With this in mind, ferret-to-ferret transmission of NiV-BD and NiV-MY was assessed under differing viral exposure conditions. Transmission was not identified for either virus when naïve ferrets were cohoused with experimentally-infected animals. In contrast, all naïve ferrets developed acute infection following assisted and direct exposure to oronasal fluid from animals that were shedding either NiV-BD or NiV-MY. Our findings for ferrets indicate that, although NiV-BD may be shed at higher levels than NiV-MY, transmission risk may be equivalently low under exposure conditions provided by cohabitation alone. In contrast, active transfer of infected bodily fluids consistently results in transmission, regardless of the virus strain. These observations suggest that the risk of NiV transmission is underpinned by social and environmental factors, and will have practical implications for managing transmission risk during outbreaks of human disease.

  9. Antiviral activity of gliotoxin, gentian violet and brilliant green against Nipah and Hendra virus in vitro

    Directory of Open Access Journals (Sweden)

    Meyer Adam G

    2009-11-01

    Full Text Available Abstract Background Using a recently described monolayer assay amenable to high throughput screening format for the identification of potential Nipah virus and Hendra virus antivirals, we have partially screened a low molecular weight compound library (>8,000 compounds directly against live virus infection and identified twenty eight promising lead molecules. Initial single blind screens were conducted with 10 μM compound in triplicate with a minimum efficacy of 90% required for lead selection. Lead compounds were then further characterised to determine the median efficacy (IC50, cytotoxicity (CC50 and the in vitro therapeutic index in live virus and pseudotype assay formats. Results While a number of leads were identified, the current work describes three commercially available compounds: brilliant green, gentian violet and gliotoxin, identified as having potent antiviral activity against Nipah and Hendra virus. Similar efficacy was observed against pseudotyped Nipah and Hendra virus, vesicular stomatitis virus and human parainfluenza virus type 3 while only gliotoxin inhibited an influenza A virus suggesting a non-specific, broad spectrum activity for this compound. Conclusion All three of these compounds have been used previously for various aspects of anti-bacterial and anti-fungal therapy and the current results suggest that while unsuitable for internal administration, they may be amenable to topical antiviral applications, or as disinfectants and provide excellent positive controls for future studies.

  10. Hendra and Nipah viruses: pathogenesis, animal models and recent breakthroughs in vaccination

    Directory of Open Access Journals (Sweden)

    Weingartl HM

    2015-09-01

    Full Text Available Hana M Weingartl National Centre for Foreign Animal Disease, Canadian Food Inspection Agency, Winnipeg, MB, Canada Abstract: Hendra and Nipah viruses are two highly pathogenic zoonotic members of the genus Henipavirus, family Paramyxoviridae, requiring work under biosafety level 4 conditions due to a lack of effective therapy and human vaccines. Several vaccine candidates were protective in animal models: recombinant vaccinia virus expressing Nipah virus (NiV F and G proteins in hamsters against NiV; recombinant ALVAC–NiV F and G in swine against NiV; recombinant Hendra virus (HeV soluble G protein (sGHeV against HeV and NiV in cats, ferrets, horses, and African green monkeys (AGM; recombinant vesicular stomatitis virus-based vectors expressing NiV F or G against NiV in hamsters and ferrets; measles virus-based NiV G vaccine candidate in hamsters and AGMs against NiV; and adenoassociated virus expressing NiG protein, which protected hamsters against NiV. The sGHeV was licensed for use in horses (Equivac HeV® in 2012. It is the first vaccine candidate licensed against a biosafety level 4 agent. With the development of suitable animal models (ferret, hamster and, importantly, AGM, progress can be made toward development of a human vaccine.Keywords: henipavirus, equine, swine, human infection, animal models, vaccine candidates

  11. Cytoplasmic Motifs in the Nipah Virus Fusion Protein Modulate Virus Particle Assembly and Egress.

    Science.gov (United States)

    Johnston, Gunner P; Contreras, Erik M; Dabundo, Jeffrey; Henderson, Bryce A; Matz, Keesha M; Ortega, Victoria; Ramirez, Alfredo; Park, Arnold; Aguilar, Hector C

    2017-05-15

    Nipah virus (NiV), a paramyxovirus in the genus Henipavirus , has a mortality rate in humans of approximately 75%. While several studies have begun our understanding of NiV particle formation, the mechanism of this process remains to be fully elucidated. For many paramyxoviruses, M proteins drive viral assembly and egress; however, some paramyxoviral glycoproteins have been reported as important or essential in budding. For NiV the matrix protein (M), the fusion glycoprotein (F) and, to a much lesser extent, the attachment glycoprotein (G) autonomously induce the formation of virus-like particles (VLPs). However, functional interactions between these proteins during assembly and egress remain to be fully understood. Moreover, if the F-driven formation of VLPs occurs through interactions with host cell machinery, the cytoplasmic tail (CT) of F is a likely interactive domain. Therefore, we analyzed NiV F CT deletion and alanine mutants and report that several but not all regions of the F CT are necessary for efficient VLP formation. Two of these regions contain YXXØ or dityrosine motifs previously shown to interact with cellular machinery involved in F endocytosis and transport. Importantly, our results showed that F-driven, M-driven, and M/F-driven viral particle formation enhanced the recruitment of G into VLPs. By identifying key motifs, specific residues, and functional viral protein interactions important for VLP formation, we improve our understanding of the viral assembly/egress process and point to potential interactions with host cell machinery. IMPORTANCE Henipaviruses can cause deadly infections of medical, veterinary, and agricultural importance. With recent discoveries of new henipa-like viruses, understanding the mechanisms by which these viruses reproduce is paramount. We have focused this study on identifying the functional interactions of three Nipah virus proteins during viral assembly and particularly on the role of one of these proteins, the

  12. Use of monoclonal antibodies against Hendra and Nipah viruses in an antigen capture ELISA

    Directory of Open Access Journals (Sweden)

    Spiropoulou Christina F

    2010-06-01

    Full Text Available Abstract Background Outbreaks of Hendra (HeV and Nipah (NiV viruses have been reported starting in 1994 and 1998, respectively. Both viruses are capable of causing fatal disease in humans and effecting great economical loss in the livestock industry. Results Through screening of hybridomas derived from mice immunized with γ-irradiated Nipah virus, we identified two secreted antibodies; one reactive with the nucleocapsid (N protein and the other, the phosphoprotein (P of henipaviruses. Epitope mapping and protein sequence alignments between NiV and HeV suggest the last 14 amino acids of the carboxyl terminus of the N protein is the target of the anti-N antibody. The anti-P antibody recognizes an epitope in the amino-terminal half of P protein. These monoclonal antibodies were used to develop two antigen capture ELISAs, one for virus detection and the other for differentiation between NiV and HeV. The lower limit of detection of the capture assay with both monoclonal antibodies was 400 pfu. The anti-N antibody was used to successfully detect NiV in a lung tissue suspension from an infected pig. Conclusion The antigen capture ELISA developed is potentially affordable tool to provide rapid detection and differentiation between the henipaviruses.

  13. Use of monoclonal antibodies against Hendra and Nipah viruses in an antigen capture ELISA.

    Science.gov (United States)

    Chiang, Cheng-Feng; Lo, Michael K; Rota, Paul A; Spiropoulou, Christina F; Rollin, Pierre E

    2010-06-03

    Outbreaks of Hendra (HeV) and Nipah (NiV) viruses have been reported starting in 1994 and 1998, respectively. Both viruses are capable of causing fatal disease in humans and effecting great economical loss in the livestock industry. Through screening of hybridomas derived from mice immunized with gamma-irradiated Nipah virus, we identified two secreted antibodies; one reactive with the nucleocapsid (N) protein and the other, the phosphoprotein (P) of henipaviruses. Epitope mapping and protein sequence alignments between NiV and HeV suggest the last 14 amino acids of the carboxyl terminus of the N protein is the target of the anti-N antibody. The anti-P antibody recognizes an epitope in the amino-terminal half of P protein. These monoclonal antibodies were used to develop two antigen capture ELISAs, one for virus detection and the other for differentiation between NiV and HeV. The lower limit of detection of the capture assay with both monoclonal antibodies was 400 pfu. The anti-N antibody was used to successfully detect NiV in a lung tissue suspension from an infected pig. The antigen capture ELISA developed is potentially affordable tool to provide rapid detection and differentiation between the henipaviruses.

  14. Matrix proteins of Nipah and Hendra viruses interact with beta subunits of AP-3 complexes.

    Science.gov (United States)

    Sun, Weina; McCrory, Thomas S; Khaw, Wei Young; Petzing, Stephanie; Myers, Terrell; Schmitt, Anthony P

    2014-11-01

    Paramyxoviruses and other negative-strand RNA viruses encode matrix proteins that coordinate the virus assembly process. The matrix proteins link the viral glycoproteins and the viral ribonucleoproteins at virus assembly sites and often recruit host machinery that facilitates the budding process. Using a co-affinity purification strategy, we have identified the beta subunit of the AP-3 adapter protein complex, AP3B1, as a binding partner for the M proteins of the zoonotic paramyxoviruses Nipah virus and Hendra virus. Binding function was localized to the serine-rich and acidic Hinge domain of AP3B1, and a 29-amino-acid Hinge-derived polypeptide was sufficient for M protein binding in coimmunoprecipitation assays. Virus-like particle (VLP) production assays were used to assess the relationship between AP3B1 binding and M protein function. We found that for both Nipah virus and Hendra virus, M protein expression in the absence of any other viral proteins led to the efficient production of VLPs in transfected cells, and this VLP production was potently inhibited upon overexpression of short M-binding polypeptides derived from the Hinge region of AP3B1. Both human and bat (Pteropus alecto) AP3B1-derived polypeptides were highly effective at inhibiting the production of VLPs. VLP production was also impaired through small interfering RNA (siRNA)-mediated depletion of AP3B1 from cells. These findings suggest that AP-3-directed trafficking processes are important for henipavirus particle production and identify a new host protein-virus protein binding interface that could become a useful target in future efforts to develop small molecule inhibitors to combat paramyxoviral infections. Henipaviruses cause deadly infections in humans, with a mortality rate of about 40%. Hendra virus outbreaks in Australia, all involving horses and some involving transmission to humans, have been a continuing problem. Nipah virus caused a large outbreak in Malaysia in 1998, killing 109 people

  15. Novel Functions of Hendra Virus G N-Glycans and Comparisons to Nipah Virus.

    Science.gov (United States)

    Bradel-Tretheway, Birgit G; Liu, Qian; Stone, Jacquelyn A; McInally, Samantha; Aguilar, Hector C

    2015-07-01

    Hendra virus (HeV) and Nipah virus (NiV) are reportedly the most deadly pathogens within the Paramyxoviridae family. These two viruses bind the cellular entry receptors ephrin B2 and/or ephrin B3 via the viral attachment glycoprotein G, and the concerted efforts of G and the viral fusion glycoprotein F result in membrane fusion. Membrane fusion is essential for viral entry into host cells and for cell-cell fusion, a hallmark of the disease pathobiology. HeV G is heavily N-glycosylated, but the functions of the N-glycans remain unknown. We disrupted eight predicted N-glycosylation sites in HeV G by conservative mutations (Asn to Gln) and found that six out of eight sites were actually glycosylated (G2 to G7); one in the stalk (G2) and five in the globular head domain (G3 to G7). We then tested the roles of individual and combined HeV G N-glycan mutants and found functions in the modulation of shielding against neutralizing antibodies, intracellular transport, G-F interactions, cell-cell fusion, and viral entry. Between the highly conserved HeV and NiV G glycoproteins, similar trends in the effects of N-glycans on protein functions were observed, with differences in the levels at which some N-glycan mutants affected such functions. While the N-glycan in the stalk domain (G2) had roles that were highly conserved between HeV and NiV G, individual N-glycans in the head affected the levels of several protein functions differently. Our findings are discussed in the context of their contributions to our understanding of HeV and NiV pathogenesis and immune responses. Viral envelope glycoproteins are important for viral pathogenicity and immune evasion. N-glycan shielding is one mechanism by which immune evasion can be achieved. In paramyxoviruses, viral attachment and membrane fusion are governed by the close interaction of the attachment proteins H/HN/G and the fusion protein F. In this study, we show that the attachment glycoprotein G of Hendra virus (HeV), a deadly

  16. Microsphere suspension array assays for detection and differentiation of Hendra and Nipah viruses.

    Science.gov (United States)

    Foord, Adam J; White, John R; Colling, Axel; Heine, Hans G

    2013-01-01

    Microsphere suspension array systems enable the simultaneous fluorescent identification of multiple separate nucleotide targets in a single reaction. We have utilized commercially available oligo-tagged microspheres (Luminex MagPlex-TAG) to construct and evaluate multiplexed assays for the detection and differentiation of Hendra virus (HeV) and Nipah virus (NiV). Both these agents are bat-borne zoonotic paramyxoviruses of increasing concern for veterinary and human health. Assays were developed targeting multiple sites within the nucleoprotein (N) and phosphoprotein (P) encoding genes. The relative specificities and sensitivities of the assays were determined using reference isolates of each virus type, samples from experimentally infected horses, and archival veterinary diagnostic submissions. Results were assessed in direct comparison with an established qPCR. The microsphere array assays achieved unequivocal differentiation of HeV and NiV and the sensitivity of HeV detection was comparable to qPCR, indicating high analytical and diagnostic specificity and sensitivity.

  17. Inhibition of Henipavirus fusion and infection by heptad-derived peptides of the Nipah virus fusion glycoprotein

    Science.gov (United States)

    Bossart, Katharine N; Mungall, Bruce A; Crameri, Gary; Wang, Lin-Fa; Eaton, Bryan T; Broder, Christopher C

    2005-01-01

    Background The recent emergence of four new members of the paramyxovirus family has heightened the awareness of and re-energized research on new and emerging diseases. In particular, the high mortality and person to person transmission associated with the most recent Nipah virus outbreaks, as well as the very recent re-emergence of Hendra virus, has confirmed the importance of developing effective therapeutic interventions. We have previously shown that peptides corresponding to the C-terminal heptad repeat (HR-2) of the fusion envelope glycoprotein of Hendra virus and Nipah virus were potent inhibitors of both Hendra virus and Nipah virus-mediated membrane fusion using recombinant expression systems. In the current study, we have developed shorter, second generation HR-2 peptides which include a capped peptide via amidation and acetylation and two poly(ethylene glycol)-linked (PEGylated) peptides, one with the PEG moity at the C-terminus and the other at the N-terminus. Here, we have evaluated these peptides as well as the corresponding scrambled peptide controls in Nipah virus and Hendra virus-mediated membrane fusion and against infection by live virus in vitro. Results Unlike their predecessors, the second generation HR-2 peptides exhibited high solubility and improved synthesis yields. Importantly, both Nipah virus and Hendra virus-mediated fusion as well as live virus infection were potently inhibited by both capped and PEGylated peptides with IC50 concentrations similar to the original HR-2 peptides, whereas the scrambled modified peptides had no inhibitory effect. These data also indicate that these chemical modifications did not alter the functional properties of the peptides as inhibitors. Conclusion Nipah virus and Hendra virus infection in vitro can be potently blocked by specific HR-2 peptides. The improved synthesis and solubility characteristics of the second generation HR-2 peptides will facilitate peptide synthesis for pre-clinical trial

  18. Inhibition of Henipavirus fusion and infection by heptad-derived peptides of the Nipah virus fusion glycoprotein

    Directory of Open Access Journals (Sweden)

    Eaton Bryan T

    2005-07-01

    Full Text Available Abstract Background The recent emergence of four new members of the paramyxovirus family has heightened the awareness of and re-energized research on new and emerging diseases. In particular, the high mortality and person to person transmission associated with the most recent Nipah virus outbreaks, as well as the very recent re-emergence of Hendra virus, has confirmed the importance of developing effective therapeutic interventions. We have previously shown that peptides corresponding to the C-terminal heptad repeat (HR-2 of the fusion envelope glycoprotein of Hendra virus and Nipah virus were potent inhibitors of both Hendra virus and Nipah virus-mediated membrane fusion using recombinant expression systems. In the current study, we have developed shorter, second generation HR-2 peptides which include a capped peptide via amidation and acetylation and two poly(ethylene glycol-linked (PEGylated peptides, one with the PEG moity at the C-terminus and the other at the N-terminus. Here, we have evaluated these peptides as well as the corresponding scrambled peptide controls in Nipah virus and Hendra virus-mediated membrane fusion and against infection by live virus in vitro. Results Unlike their predecessors, the second generation HR-2 peptides exhibited high solubility and improved synthesis yields. Importantly, both Nipah virus and Hendra virus-mediated fusion as well as live virus infection were potently inhibited by both capped and PEGylated peptides with IC50 concentrations similar to the original HR-2 peptides, whereas the scrambled modified peptides had no inhibitory effect. These data also indicate that these chemical modifications did not alter the functional properties of the peptides as inhibitors. Conclusion Nipah virus and Hendra virus infection in vitro can be potently blocked by specific HR-2 peptides. The improved synthesis and solubility characteristics of the second generation HR-2 peptides will facilitate peptide synthesis for pre

  19. Transcriptome Profiling of the Virus-Induced Innate Immune Response in Pteropus vampyrus and Its Attenuation by Nipah Virus Interferon Antagonist Functions.

    Science.gov (United States)

    Glennon, Nicole B; Jabado, Omar; Lo, Michael K; Shaw, Megan L

    2015-08-01

    Bats are important reservoirs for several viruses, many of which cause lethal infections in humans but have reduced pathogenicity in bats. As the innate immune response is critical for controlling viruses, the nature of this response in bats and how it may differ from that in other mammals are of great interest. Using next-generation transcriptome sequencing (mRNA-seq), we profiled the transcriptional response of Pteropus vampyrus bat kidney (PVK) cells to Newcastle disease virus (NDV), an avian paramyxovirus known to elicit a strong innate immune response in mammalian cells. The Pteropus genus is a known reservoir of Nipah virus (NiV) and Hendra virus (HeV). Analysis of the 200 to 300 regulated genes showed that genes for interferon (IFN) and antiviral pathways are highly upregulated in NDV-infected PVK cells, including genes for beta IFN, RIG-I, MDA5, ISG15, and IRF1. NDV-infected cells also upregulated several genes not previously characterized to be antiviral, such as RND1, SERTAD1, CHAC1, and MORC3. In fact, we show that MORC3 is induced by both IFN and NDV infection in PVK cells but is not induced by either stimulus in human A549 cells. In contrast to NDV infection, HeV and NiV infection of PVK cells failed to induce these innate immune response genes. Likewise, an attenuated response was observed in PVK cells infected with recombinant NDVs expressing the NiV IFN antagonist proteins V and W. This study provides the first global profile of a robust virus-induced innate immune response in bats and indicates that henipavirus IFN antagonist mechanisms are likely active in bat cells. Bats are the reservoir host for many highly pathogenic human viruses, including henipaviruses, lyssaviruses, severe acute respiratory syndrome coronavirus, and filoviruses, and many other viruses have also been isolated from bats. Viral infections are reportedly asymptomatic or heavily attenuated in bat populations. Despite their ecological importance to viral maintenance, research

  20. The distribution of henipaviruses in Southeast Asia and Australasia: is Wallace's line a barrier to Nipah virus?

    Directory of Open Access Journals (Sweden)

    Andrew C Breed

    Full Text Available Nipah virus (NiV (Genus Henipavirus is a recently emerged zoonotic virus that causes severe disease in humans and has been found in bats of the genus Pteropus. Whilst NiV has not been detected in Australia, evidence for NiV-infection has been found in pteropid bats in some of Australia's closest neighbours. The aim of this study was to determine the occurrence of henipaviruses in fruit bat (Family Pteropodidae populations to the north of Australia. In particular we tested the hypothesis that Nipah virus is restricted to west of Wallace's Line. Fruit bats from Australia, Papua New Guinea, East Timor and Indonesia were tested for the presence of antibodies to Hendra virus (HeV and Nipah virus, and tested for the presence of HeV, NiV or henipavirus RNA by PCR. Evidence was found for the presence of Nipah virus in both Pteropus vampyrus and Rousettus amplexicaudatus populations from East Timor. Serology and PCR also suggested the presence of a henipavirus that was neither HeV nor NiV in Pteropus alecto and Acerodon celebensis. The results demonstrate the presence of NiV in the fruit bat populations on the eastern side of Wallace's Line and within 500 km of Australia. They indicate the presence of non-NiV, non-HeV henipaviruses in fruit bat populations of Sulawesi and Sumba and possibly in Papua New Guinea. It appears that NiV is present where P. vampyrus occurs, such as in the fruit bat populations of Timor, but where this bat species is absent other henipaviruses may be present, as on Sulawesi and Sumba. Evidence was obtained for the presence henipaviruses in the non-Pteropid species R. amplexicaudatus and in A. celebensis. The findings of this work fill some gaps in knowledge in geographical and species distribution of henipaviruses in Australasia which will contribute to planning of risk management and surveillance activities.

  1. The distribution of henipaviruses in Southeast Asia and Australasia: is Wallace's line a barrier to Nipah virus?

    Science.gov (United States)

    Breed, Andrew C; Meers, Joanne; Sendow, Indrawati; Bossart, Katharine N; Barr, Jennifer A; Smith, Ina; Wacharapluesadee, Supaporn; Wang, Linfa; Field, Hume E

    2013-01-01

    Nipah virus (NiV) (Genus Henipavirus) is a recently emerged zoonotic virus that causes severe disease in humans and has been found in bats of the genus Pteropus. Whilst NiV has not been detected in Australia, evidence for NiV-infection has been found in pteropid bats in some of Australia's closest neighbours. The aim of this study was to determine the occurrence of henipaviruses in fruit bat (Family Pteropodidae) populations to the north of Australia. In particular we tested the hypothesis that Nipah virus is restricted to west of Wallace's Line. Fruit bats from Australia, Papua New Guinea, East Timor and Indonesia were tested for the presence of antibodies to Hendra virus (HeV) and Nipah virus, and tested for the presence of HeV, NiV or henipavirus RNA by PCR. Evidence was found for the presence of Nipah virus in both Pteropus vampyrus and Rousettus amplexicaudatus populations from East Timor. Serology and PCR also suggested the presence of a henipavirus that was neither HeV nor NiV in Pteropus alecto and Acerodon celebensis. The results demonstrate the presence of NiV in the fruit bat populations on the eastern side of Wallace's Line and within 500 km of Australia. They indicate the presence of non-NiV, non-HeV henipaviruses in fruit bat populations of Sulawesi and Sumba and possibly in Papua New Guinea. It appears that NiV is present where P. vampyrus occurs, such as in the fruit bat populations of Timor, but where this bat species is absent other henipaviruses may be present, as on Sulawesi and Sumba. Evidence was obtained for the presence henipaviruses in the non-Pteropid species R. amplexicaudatus and in A. celebensis. The findings of this work fill some gaps in knowledge in geographical and species distribution of henipaviruses in Australasia which will contribute to planning of risk management and surveillance activities.

  2. Microsphere Suspension Array Assays for Detection and Differentiation of Hendra and Nipah Viruses

    Directory of Open Access Journals (Sweden)

    Adam J. Foord

    2013-01-01

    Full Text Available Microsphere suspension array systems enable the simultaneous fluorescent identification of multiple separate nucleotide targets in a single reaction. We have utilized commercially available oligo-tagged microspheres (Luminex MagPlex-TAG to construct and evaluate multiplexed assays for the detection and differentiation of Hendra virus (HeV and Nipah virus (NiV. Both these agents are bat-borne zoonotic paramyxoviruses of increasing concern for veterinary and human health. Assays were developed targeting multiple sites within the nucleoprotein (N and phosphoprotein (P encoding genes. The relative specificities and sensitivities of the assays were determined using reference isolates of each virus type, samples from experimentally infected horses, and archival veterinary diagnostic submissions. Results were assessed in direct comparison with an established qPCR. The microsphere array assays achieved unequivocal differentiation of HeV and NiV and the sensitivity of HeV detection was comparable to qPCR, indicating high analytical and diagnostic specificity and sensitivity.

  3. Inhibition of Nipah Virus Infectin In Vivo: Targeting an Early Stage of Paramyxovirus Fusion Activation during Viral Entry

    Energy Technology Data Exchange (ETDEWEB)

    M Porotto; B Rockx; C Yokoyama; A Talekar; I DeVito; l Palermo; J Liu; R Cortese; M Lu; et al.

    2011-12-31

    In the paramyxovirus cell entry process, receptor binding triggers conformational changes in the fusion protein (F) leading to viral and cellular membrane fusion. Peptides derived from C-terminal heptad repeat (HRC) regions in F have been shown to inhibit fusion by preventing formation of the fusogenic six-helix bundle. We recently showed that the addition of a cholesterol group to HRC peptides active against Nipah virus targets these peptides to the membrane where fusion occurs, dramatically increasing their antiviral effect. In this work, we report that unlike the untagged HRC peptides, which bind to the postulated extended intermediate state bridging the viral and cell membranes, the cholesterol tagged HRC-derived peptides interact with F before the fusion peptide inserts into the target cell membrane, thus capturing an earlier stage in the F-activation process. Furthermore, we show that cholesterol tagging renders these peptides active in vivo: the cholesterol-tagged peptides cross the blood brain barrier, and effectively prevent and treat in an established animal model what would otherwise be fatal Nipah virus encephalitis. The in vivo efficacy of cholesterol-tagged peptides, and in particular their ability to penetrate the CNS, suggests that they are promising candidates for the prevention or therapy of infection by Nipah and other lethal paramyxoviruses.

  4. Nipah virus infects specific subsets of porcine peripheral blood mononuclear cells.

    Directory of Open Access Journals (Sweden)

    Beata Stachowiak

    Full Text Available Nipah virus (NiV, a zoonotic paramyxovirus, is highly contagious in swine, and can cause fatal infections in humans following transmission from the swine host. The main viral targets in both species are the respiratory and central nervous systems, with viremia implicated as a mode of dissemination of NiV throughout the host. The presented work focused on the role of peripheral blood mononuclear cells (PBMC in the viremic spread of the virus in the swine host. B lymphocytes, CD4-CD8-, as well as CD4+CD8- T lymphocytes were not permissive to NiV, and expansion of the CD4+CD8- cells early post infection was consistent with functional humoral response to NiV infection observed in swine. In contrast, significant drop in the CD4+CD8- T cell frequency was observed in piglets which succumbed to the experimental infection, supporting the hypothesis that antibody development is the critical component of the protective immune response. Productive viral replication was detected in monocytes, CD6+CD8+ T lymphocytes and NK cells by recovery of infectious virus in the cell supernatants. Virus replication was supported by detection of the structural N and the non-structural C proteins or by detection of genomic RNA increase in the infected cells. Infection of T cells carrying CD6 marker, a strong ligand for the activated leukocyte cell adhesion molecule ALCAM (CD166 highly expressed on the microvascular endothelial cell of the blood-air and the blood-brain barrier may explain NiV preferential tropism for small blood vessels of the lung and brain.

  5. Nipah virus infects specific subsets of porcine peripheral blood mononuclear cells.

    Science.gov (United States)

    Stachowiak, Beata; Weingartl, Hana M

    2012-01-01

    Nipah virus (NiV), a zoonotic paramyxovirus, is highly contagious in swine, and can cause fatal infections in humans following transmission from the swine host. The main viral targets in both species are the respiratory and central nervous systems, with viremia implicated as a mode of dissemination of NiV throughout the host. The presented work focused on the role of peripheral blood mononuclear cells (PBMC) in the viremic spread of the virus in the swine host. B lymphocytes, CD4-CD8-, as well as CD4+CD8- T lymphocytes were not permissive to NiV, and expansion of the CD4+CD8- cells early post infection was consistent with functional humoral response to NiV infection observed in swine. In contrast, significant drop in the CD4+CD8- T cell frequency was observed in piglets which succumbed to the experimental infection, supporting the hypothesis that antibody development is the critical component of the protective immune response. Productive viral replication was detected in monocytes, CD6+CD8+ T lymphocytes and NK cells by recovery of infectious virus in the cell supernatants. Virus replication was supported by detection of the structural N and the non-structural C proteins or by detection of genomic RNA increase in the infected cells. Infection of T cells carrying CD6 marker, a strong ligand for the activated leukocyte cell adhesion molecule ALCAM (CD166) highly expressed on the microvascular endothelial cell of the blood-air and the blood-brain barrier may explain NiV preferential tropism for small blood vessels of the lung and brain.

  6. The YPLGVG sequence of the Nipah virus matrix protein is required for budding

    Directory of Open Access Journals (Sweden)

    Yan Lianying

    2008-11-01

    Full Text Available Abstract Background Nipah virus (NiV is a recently emerged paramyxovirus capable of causing fatal disease in a broad range of mammalian hosts, including humans. Together with Hendra virus (HeV, they comprise the genus Henipavirus in the family Paramyxoviridae. Recombinant expression systems have played a crucial role in studying the cell biology of these Biosafety Level-4 restricted viruses. Henipavirus assembly and budding occurs at the plasma membrane, although the details of this process remain poorly understood. Multivesicular body (MVB proteins have been found to play a role in the budding of several enveloped viruses, including some paramyxoviruses, and the recruitment of MVB proteins by viral proteins possessing late budding domains (L-domains has become an important concept in the viral budding process. Previously we developed a system for producing NiV virus-like particles (VLPs and demonstrated that the matrix (M protein possessed an intrinsic budding ability and played a major role in assembly. Here, we have used this system to further explore the budding process by analyzing elements within the M protein that are critical for particle release. Results Using rationally targeted site-directed mutagenesis we show that a NiV M sequence YPLGVG is required for M budding and that mutation or deletion of the sequence abrogates budding ability. Replacement of the native and overlapping Ebola VP40 L-domains with the NiV sequence failed to rescue VP40 budding; however, it did induce the cellular morphology of extensive filamentous projection consistent with wild-type VP40-expressing cells. Cells expressing wild-type NiV M also displayed this morphology, which was dependent on the YPLGVG sequence, and deletion of the sequence also resulted in nuclear localization of M. Dominant-negative VPS4 proteins had no effect on NiV M budding, suggesting that unlike other viruses such as Ebola, NiV M accomplishes budding independent of MVB cellular proteins

  7. Induction of neutralizing antibodies to Hendra and Nipah glycoproteins using a Venezuelan equine encephalitis virus in vivo expression system.

    Science.gov (United States)

    Defang, Gabriel N; Khetawat, Dimple; Broder, Christopher C; Quinnan, Gerald V

    2010-12-16

    The emergence of Hendra Virus (HeV) and Nipah Virus (NiV) which can cause fatal infections in both animals and humans has triggered a search for an effective vaccine. Here, we have explored the potential for generating an effective humoral immune response to these zoonotic pathogens using an alphavirus-based vaccine platform. Groups of mice were immunized with Venezuelan equine encephalitis virus replicon particles (VRPs) encoding the attachment or fusion glycoproteins of either HeV or NiV. We demonstrate the induction of highly potent cross-reactive neutralizing antibodies to both viruses using this approach. Preliminary study suggested early enhancement in the antibody response with use of a modified version of VRP. Overall, these data suggest that the use of an alphavirus-derived vaccine platform might serve as a viable approach for the development of an effective vaccine against the henipaviruses. Published by Elsevier Ltd.

  8. Quantitative analysis of Nipah virus proteins released as virus-like particles reveals central role for the matrix protein

    Directory of Open Access Journals (Sweden)

    Eaton Bryan T

    2007-01-01

    Full Text Available Abstract Background Nipah virus (NiV is an emerging paramyxovirus distinguished by its ability to cause fatal disease in both animal and human hosts. Together with Hendra virus (HeV, they comprise the genus Henipavirus in the Paramyxoviridae family. NiV and HeV are also restricted to Biosafety Level-4 containment and this has hampered progress towards examining details of their replication and morphogenesis. Here, we have established recombinant expression systems to study NiV particle assembly and budding through the formation of virus-like particles (VLPs. Results When expressed by recombinant Modified Vaccinia virus Ankara (rMVA or plasmid transfection, individual NiV matrix (M, fusion (F and attachment (G proteins were all released into culture supernatants in a membrane-associated state as determined by sucrose density gradient flotation and immunoprecipitation. However, co-expression of F and G along with M revealed a shift in their distribution across the gradient, indicating association with M in VLPs. Protein release was also altered depending on the context of viral proteins being expressed, with F, G and nucleocapsid (N protein reducing M release, and N release dependent on the co-expression of M. Immunoelectron microscopy and density analysis revealed VLPs that were similar to authentic virus. Differences in the budding dynamics of NiV proteins were also noted between rMVA and plasmid based strategies, suggesting that over-expression by poxvirus may not be appropriate for studying the details of recombinant virus particle assembly and release. Conclusion Taken together, the results indicate that NiV M, F, and G each possess some ability to bud from expressing cells, and that co-expression of these viral proteins results in a more organized budding process with M playing a central role. These findings will aid our understanding of paramyxovirus particle assembly in general and could help facilitate the development of a novel vaccine

  9. Molecular characterization of Nipah virus from Pteropus hypomelanus in Southern Thailand.

    Science.gov (United States)

    Wacharapluesadee, Supaporn; Samseeneam, Panumas; Phermpool, Mana; Kaewpom, Thongchai; Rodpan, Apaporn; Maneeorn, Pattarapol; Srongmongkol, Phimchanok; Kanchanasaka, Budsabong; Hemachudha, Thiravat

    2016-03-25

    Nipah virus (NiV) first emerged in Malaysia in 1998, with two bat species (Pteropus hypomelanus and P. vampyrus) as the putative natural reservoirs. In 2002, NiV IgG antibodies were detected in these species from Thailand, but viral RNA could not be detected for strain characterization. Two strains of NiV (Malaysia and Bangladesh) have been found in P. lylei in central Thailand, although Bangladesh strain, the causative strain for the outbreak in Bangladesh since 2001, was dominant. To understand the diversity of NiV in Thailand, this study identified NiV strain, using molecular characterizations, from P. hypomelanus in southern Thailand. Pooled bat urine specimens were collected from plastic sheet underneath bat roosts in April 2010, and then monthly from December 2010 to May 2011 at an island in southern Thailand. Five in 184 specimens were positive for NiV, using duplex nested RT-PCR assay on partial nucleocapsid fragment (357 bp). Whole sequences of nucleocapsid gene from four bats were characterized. All 5 partial fragments and 4 whole nucleocapsid genes formed a monophyletic with NiV-MY. Our study showed that P. hypomelanus in southern Thailand and from Malaysia, a bordering country, harbored similar NiV. This finding indicates that NiV is not limited to central Thailand or P. lylei species, and it may be a source of inter-species transmission. This indicates a higher potential for a widespread NiV outbreak in Thailand. NiV surveillance in Pteropus bats, the major natural reservoirs, should be conducted continuously in countries or regions with high susceptibility to outbreaks.

  10. Nipah Virus Transmission from Bats to Humans Associated with Drinking Traditional Liquor Made from Date Palm Sap, Bangladesh, 2011–2014

    Centers for Disease Control (CDC) Podcasts

    2016-06-30

    Sarah Gregory reads an abridged version of the article, Nipah Virus Transmission from Bats to Humans Associated with Drinking Traditional Liquor Made from Date Palm Sap, Bangladesh, 2011–2014.  Created: 6/30/2016 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 6/30/2016.

  11. Contribution of Human Lung Parenchyma and Leukocyte Influx to Oxidative Stress and Immune System-Mediated Pathology following Nipah Virus Infection.

    Science.gov (United States)

    Escaffre, Olivier; Saito, Tais B; Juelich, Terry L; Ikegami, Tetsuro; Smith, Jennifer K; Perez, David D; Atkins, Colm; Levine, Corri B; Huante, Matthew B; Nusbaum, Rebecca J; Endsley, Janice J; Freiberg, Alexander N; Rockx, Barry

    2017-08-01

    Nipah virus (NiV) is a zoonotic emerging paramyxovirus that can cause fatal respiratory illness or encephalitis in humans. Despite many efforts, the molecular mechanisms of NiV-induced acute lung injury (ALI) remain unclear. We previously showed that NiV replicates to high titers in human lung grafts in NOD-SCID/γ mice, resulting in a robust inflammatory response. Interestingly, these mice can undergo human immune system reconstitution by the bone marrow, liver, and thymus (BLT) reconstitution method, in addition to lung tissue engraftment, giving altogether a realistic model to study human respiratory viral infections. Here, we characterized NiV Bangladesh strain (NiV-B) infection of human lung grafts from human immune system-reconstituted mice in order to identify the overall effect of immune cells on NiV pathogenesis of the lung. We show that NiV-B replicated to high titers in human lung grafts and caused similar cytopathic effects irrespective of the presence of human leukocytes in mice. However, the human immune system interfered with virus spread across lung grafts, responded to infection by leukocyte migration to small airways and alveoli of the lung grafts, and accelerated oxidative stress in lung grafts. In addition, the presence of human leukocytes increased the expression of cytokines and chemokines that regulate inflammatory influx to sites of infection and tissue damage. These results advance our understanding of how the immune system limits NiV dissemination and contributes to ALI and inform efforts to identify therapeutic targets. IMPORTANCE Nipah virus (NiV) is an emerging paramyxovirus that can cause a lethal respiratory and neurological disease in humans. Only limited data are available on NiV pathogenesis in the human lung, and the relative contribution of the innate immune response and NiV to acute lung injury (ALI) is still unknown. Using human lung grafts in a human immune system-reconstituted mouse model, we showed that the NiV Bangladesh

  12. Towards understanding of Nipah virus attachment protein assembly and the role of protein affinity and crowding for membrane curvature events.

    Energy Technology Data Exchange (ETDEWEB)

    Stachowiak, Jeanne C.; Hayden, Carl C.; Negrete, Oscar.; Davis, Ryan Wesley; Sasaki, Darryl Y

    2013-10-01

    Pathogenic viruses are a primary threat to our national security and to the health and economy of our world. Effective defense strategies to combat viral infection and spread require the development of understanding of the mechanisms that these pathogens use to invade the host cell. We present in this report results of our research into viral particle recognition and fusion to cell membranes and the role that protein affinity and confinement in lipid domains plays in membrane curvature in cellular fusion and fission events. Herein, we describe 1) the assembly of the G attachment protein of Nipah virus using point mutation studies to define its role in viral particle fusion to the cell membrane, 2) how lateral pressure of membrane bound proteins induce curvature in model membrane systems, and 3) the role of membrane curvature in the selective partitioning of molecular receptors and specific affinity of associated proteins.

  13. Agricultural intensification, priming for persistence and the emergence of Nipah virus: a lethal bat-borne zoonosis.

    Science.gov (United States)

    Pulliam, Juliet R C; Epstein, Jonathan H; Dushoff, Jonathan; Rahman, Sohayati A; Bunning, Michel; Jamaluddin, Aziz A; Hyatt, Alex D; Field, Hume E; Dobson, Andrew P; Daszak, Peter

    2012-01-07

    Emerging zoonoses threaten global health, yet the processes by which they emerge are complex and poorly understood. Nipah virus (NiV) is an important threat owing to its broad host and geographical range, high case fatality, potential for human-to-human transmission and lack of effective prevention or therapies. Here, we investigate the origin of the first identified outbreak of NiV encephalitis in Malaysia and Singapore. We analyse data on livestock production from the index site (a commercial pig farm in Malaysia) prior to and during the outbreak, on Malaysian agricultural production, and from surveys of NiV's wildlife reservoir (flying foxes). Our analyses suggest that repeated introduction of NiV from wildlife changed infection dynamics in pigs. Initial viral introduction produced an explosive epizootic that drove itself to extinction but primed the population for enzootic persistence upon reintroduction of the virus. The resultant within-farm persistence permitted regional spread and increased the number of human infections. This study refutes an earlier hypothesis that anomalous El Niño Southern Oscillation-related climatic conditions drove emergence and suggests that priming for persistence drove the emergence of a novel zoonotic pathogen. Thus, we provide empirical evidence for a causative mechanism previously proposed as a precursor to widespread infection with H5N1 avian influenza and other emerging pathogens.

  14. Unraveling a three-step spatiotemporal mechanism of triggering of receptor-induced Nipah virus fusion and cell entry.

    Directory of Open Access Journals (Sweden)

    Qian Liu

    Full Text Available Membrane fusion is essential for entry of the biomedically-important paramyxoviruses into their host cells (viral-cell fusion, and for syncytia formation (cell-cell fusion, often induced by paramyxoviral infections [e.g. those of the deadly Nipah virus (NiV]. For most paramyxoviruses, membrane fusion requires two viral glycoproteins. Upon receptor binding, the attachment glycoprotein (HN/H/G triggers the fusion glycoprotein (F to undergo conformational changes that merge viral and/or cell membranes. However, a significant knowledge gap remains on how HN/H/G couples cell receptor binding to F-triggering. Via interdisciplinary approaches we report the first comprehensive mechanism of NiV membrane fusion triggering, involving three spatiotemporally sequential cell receptor-induced conformational steps in NiV-G: two in the head and one in the stalk. Interestingly, a headless NiV-G mutant was able to trigger NiV-F, and the two head conformational steps were required for the exposure of the stalk domain. Moreover, the headless NiV-G prematurely triggered NiV-F on virions, indicating that the NiV-G head prevents premature triggering of NiV-F on virions by concealing a F-triggering stalk domain until the correct time and place: receptor-binding. Based on these and recent paramyxovirus findings, we present a comprehensive and fundamentally conserved mechanistic model of paramyxovirus membrane fusion triggering and cell entry.

  15. Raw Sap Consumption Habits and Its Association with Knowledge of Nipah Virus in Two Endemic Districts in Bangladesh.

    Science.gov (United States)

    Nahar, Nazmun; Paul, Repon C; Sultana, Rebeca; Gurley, Emily S; Garcia, Fernando; Abedin, Jaynal; Sumon, Shariful Amin; Banik, Kajal Chandra; Asaduzzaman, Mohammad; Rimi, Nadia Ali; Rahman, Mahmudur; Luby, Stephen P

    2015-01-01

    Human Nipah virus (NiV) infection in Bangladesh is a fatal disease that can be transmitted from bats to humans who drink contaminated raw date palm sap collected overnight during the cold season. Our study aimed to understand date palm sap consumption habits of rural residents and factors associated with consumption. In November-December 2012 the field team interviewed adult respondents from randomly selected villages from Rajbari and Kushtia Districts in Bangladesh. We calculated the proportion of people who consumed raw sap and had heard about a disease from raw sap consumption. We assessed the factors associated with raw sap consumption by calculating prevalence ratios (PR) adjusted for village level clustering effects. Among the 1,777 respondents interviewed, half (50%) reported drinking raw sap during the previous sap collection season and 37% consumed raw sap at least once per month. Few respondents (5%) heard about NiV. Thirty-seven percent of respondents reported hearing about a disease transmitted through raw sap consumption, inclusive of a 10% who related it with milder illness like diarrhea, vomiting or indigestion rather than NiV. Respondents who harvested date palm trees in their household were more likely to drink sap than those who did not own date palm trees (79% vs. 65% PR 1.2, 95% CI 1.1-1.3, psap was available, respondents who heard about a disease from raw sap consumption were just as likely to drink it as those who did not hear about a disease (69% vs. 67%, PR 1.0, 95% CI 0.9-1.1, p = 0.512). Respondents' knowledge of NiV was low. They might not have properly understood the risk of NiV, and were likely to drink sap when it was available. Implementing strategies to increase awareness about the risks of NiV and protect sap from bats might reduce the risk of NiV transmission.

  16. Hendra and Nipah virus infection in cultured human olfactory epithelial cells

    NARCIS (Netherlands)

    Borisevich, V. (Viktoriya); Ozdener, M.H. (Mehmet Hakan); Malik, B. (Bilal); B. Rockx (Barry)

    2017-01-01

    textabstractHenipaviruses are emerging zoonotic viruses and causative agents of encephalitis in humans. However, the mechanisms of entry into the central nervous system (CNS) in humans are not known. Here, we evaluated the possible role of olfactory epithelium in virus entry into the CNS. We

  17. MRI findings in acute Hendra virus meningoencephalitis

    Energy Technology Data Exchange (ETDEWEB)

    Nakka, P.; Amos, G.J. [Department of Diagnostic Radiology, Princess Alexandra Hospital, Woolloongabba, Qld 4102 (Australia); Saad, N., E-mail: nivena100@hotmail.com [Department of Diagnostic Radiology, Princess Alexandra Hospital, Woolloongabba, Qld 4102 (Australia); Jeavons, S. [Department of Diagnostic Radiology, Princess Alexandra Hospital, Woolloongabba, Qld 4102 (Australia)

    2012-05-15

    Aim: To describe serial changes in brain magnetic resonance imaging (MRI) in acute human infection from two outbreaks of Hendra virus (HeV), relate these changes to disease prognosis, and compare HeV encephalitis to reported cases of Nipah virus encephalitis. Materials and methods: The MRI images of three human cases (two of which were fatal) of acute HeV meningoencephalitis were reviewed. Results: Cortical selectivity early in the disease is evident in all three patients, while deep white matter involvement appears to be a late and possibly premorbid finding. This apparent early grey matter selectivity may be related to viral biology or ribavirin pharmacokinetics. Neuronal loss is evident at MRI, and the rate of progression of MRI abnormalities can predict the outcome of the infection. In both fatal cases, the serial changes in the MRI picture mirrored the clinical course. Conclusion: This is the first comprehensive report of serial MRI findings in acute human cerebral HeV infection from two outbreaks. The cortical selectivity appears to be an early finding while deep white matter involvement a late, and possibly premorbid, finding. In both fatal cases, the serial changes in MRI mirrored the clinical course.

  18. Development and validation of a chemiluminescent immunodetection assay amenable to high throughput screening of antiviral drugs for Nipah and Hendra virus.

    Science.gov (United States)

    Aljofan, Mohamad; Porotto, Matteo; Moscona, Anne; Mungall, Bruce A

    2008-04-01

    There are currently no antiviral drugs approved for the highly lethal Biosafety Level 4 pathogens Nipah and Hendra virus. A number of researchers are developing surrogate assays amenable to Biosafety Level 2 biocontainment but ultimately, the development of a high throughput screening method for directly quantifying these viruses in a Biosafety Level 4 environment will be critical for final evaluation of antiviral drugs identified in surrogate assays, in addition to reducing the time required for effective antiviral drug development. By adapting an existing immunoplaque assay and using enzyme linked immunodetection in a microtitre plate format, the current experiments describe a simple two step assay protocol involving an overnight virus inoculation of Vero cell monolayers (with or without antiviral drug treatment) at Biosafety Level 4, followed by cell fixation and virus inactivation enabling removal of plates from the Biosafety Level 4 laboratory and a subsequent immunodetection assay using a chemiluminescent horse radish peroxidase substrate to be performed at Biosafety Level 2. The analytical sensitivity (limit of detection) of this assay is 100 tissue culture infectious dose50/ml of either Nipah or Hendra virus. In addition this assay enables linear quantitation of virus over three orders of magnitude and is unaffected by dimethyl sulfoxide concentrations of 1% or less. Intra-assay coefficients of variation are acceptable (less than 20%) when detecting a minimum of 1000 tissue culture infectious dose50/ml of either virus although inter-assay variation is considerably greater. By an assessment of efficacies of the broad spectrum antiviral Ribavirin and an experimental fusion inhibitory peptide, this assay reveals a good correlation with previously published fluorescent immunodetection assays. The current experiments describe for the first time, a high throughput screening method amenable for direct assessment of live henipavirus antiviral drug activity.

  19. In silico identification and characterization of common epitope-based peptide vaccine for Nipah and Hendra viruses.

    Science.gov (United States)

    Saha, Chayan Kumar; Mahbub Hasan, Md; Saddam Hossain, Md; Asraful Jahan, Md; Azad, Abul Kalam

    2017-06-01

    To explore a common B- and T-cell epitope-based vaccine that can elicit an immune response against encephalitis causing genus Henipaviruses, Hendra virus (HeV) and Nipah virus (NiV). Membrane proteins F, G and M of HeV and NiV were retrieved from the protein database and subjected to different bioinformatics tools to predict antigenic B-cell epitopes. Best B-cell epitopes were then analyzed to predict their T-cell antigenic potentiality. Antigenic B- and T-cell epitopes that shared maximum identity with HeV and NiV were selected. Stability of the selected epitopes was predicted. Finally, the selected epitopes were subjected to molecular docking simulation with HLA-DR to confirm their antigenic potentiality in silico. One epitope from G proteins, one from M proteins and none from F proteins were selected based on their antigenic potentiality. The epitope from the G proteins was stable whereas that from M was unstable. The M-epitope was made stable by adding flanking dipeptides. The 15-mer G-epitope (VDPLRVQWRNNSVIS) showed at least 66% identity with all NiV and HeV G protein sequences, while the 15-mer M-epitope (GKLEFRRNNAIAFKG) with the dipeptide flanking residues showed 73% identity with all NiV and HeV M protein sequences available in the database. Molecular docking simulation with most frequent MHC class-II (MHC II) and class-I (MHC I) molecules showed that these epitopes could bind within HLA binding grooves to elicit an immune response. Data in our present study revealed the notion that the epitopes from G and M proteins might be the target for peptide-based subunit vaccine design against HeV and NiV. However, the biochemical analysis is necessary to experimentally validate the interaction of epitopes individually with the MHC molecules through elucidation of immunity induction. Copyright © 2017 Hainan Medical University. Production and hosting by Elsevier B.V. All rights reserved.

  20. Structural and Functional Studies on the Fusion and Attachment Envelope Glycoproteins of Nipah Virus and Hendra Virus

    Science.gov (United States)

    2003-01-01

    subcloned into the vaccinia virus promoter driven expression vector pMCO2 (90) and recombinant vaccinia viruses were generated using standard...characteristics and properties of these novel viruses , and may provide insights into membrane fusion mechanisms, the virus infection process, and towards...these novel viruses , and may provide insights into membrane fusion mechanisms, the virus infection process, and towards the development of therapeutics

  1. A Randomized Controlled Trial of Interventions to Impede Date Palm Sap Contamination by Bats to Prevent Nipah Virus Transmission in Bangladesh

    Science.gov (United States)

    Khan, Salah Uddin; Gurley, Emily S.; Hossain, M. Jahangir; Nahar, Nazmun; Sharker, M. A. Yushuf; Luby, Stephen P.

    2012-01-01

    Background Drinking raw date palm sap is a risk factor for human Nipah virus (NiV) infection. Fruit bats, the natural reservoir of NiV, commonly contaminate raw sap with saliva by licking date palm’s sap producing surface. We evaluated four types of physical barriers that may prevent bats from contacting sap. Methods During 2009, we used a crossover design and randomly selected 20 date palm sap producing trees and observed each tree for 2 nights: one night with a bamboo skirt intervention applied and one night without the intervention. During 2010, we selected 120 trees and randomly assigned four types of interventions to 15 trees each: bamboo, dhoincha (local plant), jute stick and polythene skirts covering the shaved part, sap stream, tap and collection pot. We enrolled the remaining 60 trees as controls. We used motion sensor activated infrared cameras to examine bat contact with sap. Results During 2009 bats contacted date palm sap in 85% of observation nights when no intervention was used compared with 35% of nights when the intervention was used [psap when the skirt did not entirely cover the sap producing surface. Therefore, in 2010 we requested the sap harvesters to use larger skirts. During 2010 bats contacted date palm sap [2% vs. 83%, psap in trees with bamboo (psap during one night (7%) with the jute stick skirt (psap producing areas of a tree effectively prevented bat-sap contact. Community interventions should promote applying these skirts to prevent occasional Nipah spillovers to human. PMID:22905160

  2. Human Hendra virus infection causes acute and relapsing encephalitis.

    Science.gov (United States)

    Wong, K T; Robertson, T; Ong, B B; Chong, J W; Yaiw, K C; Wang, L F; Ansford, A J; Tannenberg, A

    2009-06-01

    To study the pathology of two cases of human Hendra virus infection, one with no clinical encephalitis and one with relapsing encephalitis. Autopsy tissues were investigated by light microscopy, immunohistochemistry and in situ hybridization. In the patient with acute pulmonary syndrome but not clinical acute encephalitis, vasculitis was found in the brain, lung, heart and kidney. Occasionally, viral antigens were demonstrated in vascular walls but multinucleated endothelial syncytia were absent. In the lung, there was severe inflammation, necrosis and viral antigens in type II pneumocytes and macrophages. The rare kidney glomerulus showed inflammation and viral antigens in capillary walls and podocytes. Discrete necrotic/vacuolar plaques in the brain parenchyma were associated with antigens and viral RNA. Brain inflammation was mild although CD68(+) microglia/macrophages were significantly increased. Cytoplasmic viral inclusions and antigens and viral RNA in neurones and ependyma suggested viral replication. In the case of relapsing encephalitis, there was severe widespread meningoencephalitis characterized by neuronal loss, macrophages and other inflammatory cells, reactive blood vessels and perivascular cuffing. Antigens and viral RNA were mainly found in neurones. Vasculitis was absent in all the tissues examined. The case of acute Hendra virus infection demonstrated evidence of systemic infection and acute encephalitis. The case of relapsing Hendra virus encephalitis showed no signs of extraneural infection but in the brain, extensive inflammation and infected neurones were observed. Hendra virus can cause acute and relapsing encephalitis and the findings suggest that the pathology and pathogenesis are similar to Nipah virus infection.

  3. Hendra and Nipah Infection: Pathology, Models and Potential Therapies

    Science.gov (United States)

    Vigant, Frederic; Lee, Benhur

    2011-01-01

    The Paramyxoviridae family comprises of several genera that contain emerging or re-emerging threats for human and animal health with no real specific effective treatment available. Hendra and Nipah virus are members of a newly identified genus of emerging paramyxoviruses, Henipavirus. Since their discovery in the 1990s, henipaviruses outbreaks have been associated with high economic and public health threat potential. When compared to other paramyxoviruses, henipaviruses appear to have unique characteristics. Henipaviruses are zoonotic paramyxoviruses with a broader tropism than most other paramyxoviruses, and can cause severe acute encephalitis with unique features among viral encephalitides. There are currently no approved effective prophylactic or therapeutic treatments for henipavirus infections. Although ribavirin was empirically used and seemed beneficial during the biggest outbreak caused by one of these viruses, the Nipah virus, its efficacy is disputed in light of its lack of efficacy in several animal models of henipavirus infection. Nevertheless, because of its highly pathogenic nature, much effort has been spent in developing anti-henipavirus therapeutics. In this review we describe the unique features of henipavirus infections and the different strategies and animal models that have been developed so far in order to identify and test potential drugs to prevent or treat henipavirus infections. Some of these components have the potential to be broad-spectrum antivirals as they target effectors of viral pathogenecity common to other viruses. We will focus on small molecules or biologics, rather than vaccine strategies, that have been developed as anti-henipaviral therapeutics. PMID:21488828

  4. The Role of the Hendra Virus and Nipah Virus Attachment Glycoproteins in Receptor Binding and Antibody Neutralization

    Science.gov (United States)

    2014-01-31

    glycoproteins, such as HIV gp140 and Rabies glycoprotein, its ability to form trimers but not tetramers makes it ineffective for correct oligomerization of...Oldstone MB. 2000. V and C proteins of measles virus function as virulence factors in vivo. Virology 267:80-9.   216 148. Playford EG, McCall B...2005. Stable trimerization of recombinant rabies virus glycoprotein ectodomain is required for interaction with the p75NTR receptor. J Gen Virol 86

  5. Piloting the use of indigenous methods to prevent Nipah virus infection by interrupting bats' access to date palm sap in Bangladesh.

    Science.gov (United States)

    Nahar, Nazmun; Mondal, Utpal Kumar; Sultana, Rebeca; Hossain, M Jahangir; Khan, M Salah Uddin; Gurley, Emily S; Oliveras, Elizabeth; Luby, Stephen P

    2013-09-01

    People in Bangladesh frequently drink fresh date palm sap. Fruit bats (Pteropus giganteus) also drink raw sap and may contaminate the sap by shedding Nipah virus through saliva and urine. In a previous study we identified two indigenous methods to prevent bats accessing the sap, bamboo skirts and lime (calcium carbonate). We conducted a pilot study to assess the acceptability of these two methods among sap harvesters. We used interactive community meetings and group discussions to encourage all the sap harvesters (n = 12) from a village to use either bamboo skirts or lime smear that some of them (n = 4) prepared and applied. We measured the preparation and application time and calculated the cost of bamboo skirts. We conducted interviews after the use of each method. The sap harvesters found skirts effective in preventing bats from accessing sap. They were sceptical that lime would be effective as the lime was washed away by the sap flow. Preparation of the skirt took ∼105 min. The application of each method took ∼1 min. The cost of the bamboo skirt is minimal because bamboo is widely available and they made the skirts with pieces of used bamboo. The bamboo skirt method appeared practical and affordable to the sap harvesters. Further studies should explore its ability to prevent bats from accessing date palm sap and assess if its use produces more or better quality sap, which would provide further incentives to make it more acceptable for its regular use.

  6. Endothelial galectin-1 binds to specific glycans on nipah virus fusion protein and inhibits maturation, mobility, and function to block syncytia formation.

    Directory of Open Access Journals (Sweden)

    Omai B Garner

    2010-07-01

    Full Text Available Nipah virus targets human endothelial cells via NiV-F and NiV-G envelope glycoproteins, resulting in endothelial syncytia formation and vascular compromise. Endothelial cells respond to viral infection by releasing innate immune effectors, including galectins, which are secreted proteins that bind to specific glycan ligands on cell surface glycoproteins. We demonstrate that galectin-1 reduces NiV-F mediated fusion of endothelial cells, and that endogenous galectin-1 in endothelial cells is sufficient to inhibit syncytia formation. Galectin-1 regulates NiV-F mediated cell fusion at three distinct points, including retarding maturation of nascent NiV-F, reducing NiV-F lateral mobility on the plasma membrane, and directly inhibiting the conformational change in NiV-F required for triggering fusion. Characterization of the NiV-F N-glycome showed that the critical site for galectin-1 inhibition is rich in glycan structures known to bind galectin-1. These studies identify a unique set of mechanisms for regulating pathophysiology of NiV infection at the level of the target cell.

  7. Biochemical and structural studies of the oligomerization domain of the Nipah virus phosphoprotein: evidence for an elongated coiled-coil homotrimer.

    Science.gov (United States)

    Blocquel, David; Beltrandi, Matilde; Erales, Jenny; Barbier, Pascale; Longhi, Sonia

    2013-11-01

    Nipah virus (NiV) is a recently emerged severe human pathogen that belongs to the Henipavirus genus within the Paramyxoviridae family. The NiV genome is encapsidated by the nucleoprotein (N) within a helical nucleocapsid that is the substrate used by the polymerase for transcription and replication. The polymerase is recruited onto the nucleocapsid via its cofactor, the phosphoprotein (P). The NiV P protein has a modular organization, with alternating disordered and ordered domains. Among these latter, is the P multimerization domain (PMD) that was predicted to adopt a coiled-coil conformation. Using both biochemical and biophysical approaches, we show that NiV PMD forms a highly stable and elongated coiled-coil trimer, a finding in striking contrast with respect to the PMDs of Paramyxoviridae members investigated so far that were all found to tetramerize. The present results therefore represent the first report of a paramyxoviral P protein forming trimers. © 2013 Elsevier Inc. All rights reserved.

  8. Receptor-Targeted Nipah Virus Glycoproteins Improve Cell-Type Selective Gene Delivery and Reveal a Preference for Membrane-Proximal Cell Attachment.

    Directory of Open Access Journals (Sweden)

    Ruben R Bender

    2016-06-01

    Full Text Available Receptor-targeted lentiviral vectors (LVs can be an effective tool for selective transfer of genes into distinct cell types of choice. Moreover, they can be used to determine the molecular properties that cell surface proteins must fulfill to act as receptors for viral glycoproteins. Here we show that LVs pseudotyped with receptor-targeted Nipah virus (NiV glycoproteins effectively enter into cells when they use cell surface proteins as receptors that bring them closely enough to the cell membrane (less than 100 Å distance. Then, they were flexible in receptor usage as demonstrated by successful targeting of EpCAM, CD20, and CD8, and as selective as LVs pseudotyped with receptor-targeted measles virus (MV glycoproteins, the current standard for cell-type specific gene delivery. Remarkably, NiV-LVs could be produced at up to two orders of magnitude higher titers compared to their MV-based counterparts and were at least 10,000-fold less effectively neutralized than MV glycoprotein pseudotyped LVs by pooled human intravenous immunoglobulin. An important finding for NiV-LVs targeted to Her2/neu was an about 100-fold higher gene transfer activity when particles were targeted to membrane-proximal regions as compared to particles binding to a more membrane-distal epitope. Likewise, the low gene transfer activity mediated by NiV-LV particles bound to the membrane distal domains of CD117 or the glutamate receptor subunit 4 (GluA4 was substantially enhanced by reducing receptor size to below 100 Å. Overall, the data suggest that the NiV glycoproteins are optimally suited for cell-type specific gene delivery with LVs and, in addition, for the first time define which parts of a cell surface protein should be targeted to achieve optimal gene transfer rates with receptor-targeted LVs.

  9. The Matrix Protein of Nipah Virus Targets the E3-Ubiquitin Ligase TRIM6 to Inhibit the IKKε Kinase-Mediated Type-I IFN Antiviral Response.

    Directory of Open Access Journals (Sweden)

    Preeti Bharaj

    2016-09-01

    Full Text Available For efficient replication, viruses have developed mechanisms to evade innate immune responses, including the antiviral type-I interferon (IFN-I system. Nipah virus (NiV, a highly pathogenic member of the Paramyxoviridae family (genus Henipavirus, is known to encode for four P gene-derived viral proteins (P/C/W/V with IFN-I antagonist functions. Here we report that NiV matrix protein (NiV-M, which is important for virus assembly and budding, can also inhibit IFN-I responses. IFN-I production requires activation of multiple signaling components including the IκB kinase epsilon (IKKε. We previously showed that the E3-ubiquitin ligase TRIM6 catalyzes the synthesis of unanchored K48-linked polyubiquitin chains, which are not covalently attached to any protein, and activate IKKε for induction of IFN-I mediated antiviral responses. Using co-immunoprecipitation assays and confocal microscopy we show here that the NiV-M protein interacts with TRIM6 and promotes TRIM6 degradation. Consequently, NiV-M expression results in reduced levels of unanchored K48-linked polyubiquitin chains associated with IKKε leading to impaired IKKε oligomerization, IKKε autophosphorylation and reduced IFN-mediated responses. This IFN antagonist function of NiV-M requires a conserved lysine residue (K258 in the bipartite nuclear localization signal that is found in divergent henipaviruses. Consistent with this, the matrix proteins of Ghana, Hendra and Cedar viruses were also able to inhibit IFNβ induction. Live NiV infection, but not a recombinant NiV lacking the M protein, reduced the levels of endogenous TRIM6 protein expression. To our knowledge, matrix proteins of paramyxoviruses have never been reported to be involved in innate immune antagonism. We report here a novel mechanism of viral innate immune evasion by targeting TRIM6, IKKε and unanchored polyubiquitin chains. These findings expand the universe of viral IFN antagonism strategies and provide a new

  10. Nipah and Hendra Virus Nucleoproteins Inhibit Nuclear Accumulation of Signal Transducer and Activator of Transcription 1 (STAT1) and STAT2 by Interfering with Their Complex Formation.

    Science.gov (United States)

    Sugai, Akihiro; Sato, Hiroki; Takayama, Ikuyo; Yoneda, Misako; Kai, Chieko

    2017-11-01

    Henipaviruses, such as Nipah (NiV) and Hendra (HeV) viruses, are highly pathogenic zoonotic agents within the Paramyxoviridae family. The phosphoprotein (P) gene products of the paramyxoviruses have been well characterized for their interferon (IFN) antagonist activity and their contribution to viral pathogenicity. In this study, we demonstrated that the nucleoprotein (N) of henipaviruses also prevents the host IFN signaling response. Reporter assays demonstrated that the NiV and HeV N proteins (NiV-N and HeV-N, respectively) dose-dependently suppressed both type I and type II IFN responses and that the inhibitory effect was mediated by their core domains. Additionally, NiV-N prevented the nuclear transport of signal transducer and activator of transcription 1 (STAT1) and STAT2. However, NiV-N did not associate with Impα5, Impβ1, or Ran, which are members of the nuclear transport system for STATs. Although P protein is known as a binding partner of N protein and actively retains N protein in the cytoplasm, the IFN antagonist activity of N protein was not abolished by the coexpression of P protein. This suggests that the IFN inhibition by N protein occurs in the cytoplasm. Furthermore, we demonstrated that the complex formation of STATs was hampered in the N protein-expressing cells. As a result, STAT nuclear accumulation was reduced, causing a subsequent downregulation of interferon-stimulated genes (ISGs) due to low promoter occupancy by STAT complexes. This novel route for preventing host IFN responses by henipavirus N proteins provides new insight into the pathogenesis of these viruses. IMPORTANCE Paramyxoviruses are well known for suppressing interferon (IFN)-mediated innate immunity with their phosphoprotein (P) gene products, and the henipaviruses also possess P, V, W, and C proteins for evading host antiviral responses. There are numerous studies providing evidence for the relationship between viral pathogenicity and antagonistic activities against IFN

  11. Hendra and Nipah infection: emerging paramyxoviruses.

    Science.gov (United States)

    Aljofan, Mohamad

    2013-11-06

    Since their first emergence in mid 1990s henipaviruses continued to re emerge in Australia and South East Asia almost every year. In total there has been more than 12 Nipah and 48 Hendra virus outbreaks reported in South East Asia and Australia, respectively. These outbreaks are associated with significant economic and health damages that most high risks countries (particularly in South East Asia) cannot bear the burden of such economical threats. Up until recently, there were no actual therapeutics available to treat or prevent these lethal infections. However, an international collaborative research has resulted in the identification of a potential equine Hendra vaccine capable of providing antibody protection against Hendra virus infections. Consequently, with the current findings and after nearly 2 decades since their first detection, are we there yet? This review recaps the chronicle of the henipavirus emergence and briefly evaluates potential anti-henipavirus vaccines and antivirals. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. Nipah Encephalitis – A Dangerous Zooanthroponosis Of Indo-Malaysian Region Of South-Еast Asia

    Directory of Open Access Journals (Sweden)

    E. P. Lukin

    2014-01-01

    Full Text Available The review provides information on a new zooanthroponosis – Nipah encephalitis. Characteristics of the pathogen and its ecology and clinic are presented. The purpose of the review is to get Russian specialist acquainted with new dangerous disease unknown in Russia. The research method – analytical. Infection by humans were first described in Malaysia (1999, after in Bangladesh (2004 and India (2006. The causative agent was identified as a new member of paramyxoviruses and then, together with related Hendra virus, separated in a new genus Henipavirus of the family Paramyxoviridae (2000. Reservoir in nature – fruit bats, predominantly carnivorous flying foxes of 8 species of the genus Pteropus, secondary reservoir – domestic pigs. Nipah virus is highly contagious for humans and swine. The last act as amplifying and reservoir host. The disease inhumans is characterized by symptoms and signs of acute encephalitis and pulmonary insufficiency. Rapidly developing coma, lethality – up to 92,0%. Outbreaks with transmission of the virus from person-to-person are known. Specific treatment has not been developed, prevention is nonspecific.

  13. Efficient reverse genetics reveals genetic determinants of budding and fusogenic differences between Nipah and Hendra viruses and enables real-time monitoring of viral spread in small animal models of henipavirus infection.

    Science.gov (United States)

    Yun, Tatyana; Park, Arnold; Hill, Terence E; Pernet, Olivier; Beaty, Shannon M; Juelich, Terry L; Smith, Jennifer K; Zhang, Lihong; Wang, Yao E; Vigant, Frederic; Gao, Junling; Wu, Ping; Lee, Benhur; Freiberg, Alexander N

    2015-01-15

    Nipah virus (NiV) and Hendra virus (HeV) are closely related henipaviruses of the Paramyxovirinae. Spillover from their fruit bat reservoirs can cause severe disease in humans and livestock. Despite their high sequence similarity, NiV and HeV exhibit apparent differences in receptor and tissue tropism, envelope-mediated fusogenicity, replicative fitness, and other pathophysiologic manifestations. To investigate the molecular basis for these differences, we first established a highly efficient reverse genetics system that increased rescue titers by ≥3 log units, which offset the difficulty of generating multiple recombinants under constraining biosafety level 4 (BSL-4) conditions. We then replaced, singly and in combination, the matrix (M), fusion (F), and attachment glycoprotein (G) genes in mCherry-expressing recombinant NiV (rNiV) with their HeV counterparts. These chimeric but isogenic rNiVs replicated well in primary human endothelial and neuronal cells, indicating efficient heterotypic complementation. The determinants of budding efficiency, fusogenicity, and replicative fitness were dissociable: HeV-M budded more efficiently than NiV-M, accounting for the higher replicative titers of HeV-M-bearing chimeras at early times, while the enhanced fusogenicity of NiV-G-bearing chimeras did not correlate with increased replicative fitness. Furthermore, to facilitate spatiotemporal studies on henipavirus pathogenesis, we generated a firefly luciferase-expressing NiV and monitored virus replication and spread in infected interferon alpha/beta receptor knockout mice via bioluminescence imaging. While intraperitoneal inoculation resulted in neuroinvasion following systemic spread and replication in the respiratory tract, intranasal inoculation resulted in confined spread to regions corresponding to olfactory bulbs and salivary glands before subsequent neuroinvasion. This optimized henipavirus reverse genetics system will facilitate future investigations into the

  14. Single Assay Detection of Acute Bee Paralysis Virus, Kashmir Bee Virus and Israeli Acute Paralysis Virus

    DEFF Research Database (Denmark)

    Francis, Roy Mathew; Kryger, Per

    2012-01-01

    A new RT-PCR primer pair designed to identify Acute Bee Paralysis Virus (ABPV), Kashmir Bee Virus (KBV) or Israeli Acute Bee Paralysis Virus (IAPV) of honey bees (Apis mellifera L.) in a single assay is described. These primers are used to screen samples for ABPV, KBV, or IAPV in a single RT-PCR ......-PCR reaction saving time and money. The primers are located in the predicted overlapping gene (pog/ORFX) which is highly conserved across ABPV, KBV, IAPV and other dicistroviruses of social insects. This study has also identified the first case of IAPV in Denmark....

  15. Emerging Foodborne and Agriculture-Related Viruses.

    Science.gov (United States)

    Kingsley, David H

    2016-08-01

    Viruses rapidly evolve and can emerge in unpredictable ways. Transmission pathways by which foodborne viruses may enter human populations and evolutionary mechanisms by which viruses can become virulent are discussed in this chapter. A majority of viruses emerge from zoonotic animal reservoirs, often by adapting and infecting intermediate hosts, such as domestic animals and livestock. Viruses that are known foodborne threats include hepatitis E virus, tick-borne encephalitis virus, enteroviruses, adenovirus, and astroviruses, among others. Viruses may potentially evolve and emerge as a result of modern agricultural practices which can concentrate livestock and bring them into contact with wild animals. Examples of viruses that have emerged in this manner are influenza, coronaviruses such as severe acute respiratory syndrome and Middle East respiratory syndrome, and the Nipah virus. The role of bats, bush meat, rodents, pigs, cattle, and poultry as reservoirs from which infectious pathogenic viruses emerge are discussed.

  16. Bat flight and zoonotic viruses

    Science.gov (United States)

    O'Shea, Thomas J.; Cryan, Paul M.; Cunningham, Andrew A.; Fooks, Anthony R.; Hayman, David T.S.; Luis, Angela D.; Peel, Alison J.; Plowright, Raina K.; Wood, James L.N.

    2014-01-01

    Bats are sources of high viral diversity and high-profile zoonotic viruses worldwide. Although apparently not pathogenic in their reservoir hosts, some viruses from bats severely affect other mammals, including humans. Examples include severe acute respiratory syndrome coronaviruses, Ebola and Marburg viruses, and Nipah and Hendra viruses. Factors underlying high viral diversity in bats are the subject of speculation. We hypothesize that flight, a factor common to all bats but to no other mammals, provides an intensive selective force for coexistence with viral parasites through a daily cycle that elevates metabolism and body temperature analogous to the febrile response in other mammals. On an evolutionary scale, this host–virus interaction might have resulted in the large diversity of zoonotic viruses in bats, possibly through bat viruses adapting to be more tolerant of the fever response and less virulent to their natural hosts.

  17. Comparison of in vivo toxicity, antioxidant and immunomodulatory activities of coconut, nipah and pineapple juice vinegars.

    Science.gov (United States)

    Mohamad, Nurul Elyani; Keong Yeap, Swee; Beh, Boon Keen; Romli, Muhammad Firdaus; Yusof, Hamidah Mohd; Kristeen-Teo, Ye Wen; Sharifuddin, Shaiful Adzni; Long, Kamariah; Alitheen, Noorjahan Banu

    2018-01-01

    Vinegar is widely used as a food additive, in food preparation and as a food supplement. This study compared the phenolic acid profiles and in vivo toxicities, and antioxidant and immunomodulatory effects of coconut, nipah and pineapple juice vinegars, which were respectively prepared via a two-step fermentation using Saccharomyces cerevisiae 7013 INRA and Acetobacter aceti vat Europeans. Pineapple juice vinegar, which had the highest total phenolic acid content, also exhibited the greatest in vitro antioxidant capacity compared to coconut juice and nipah juice vinegars. Following acute and sub-chronic in vivo toxicity evaluation, no toxicity and mortality were evident and there were no significant differences in the serum biochemical profiles between mice administered the vinegars versus the control group. In the sub-chronic toxicity evaluation, the highest liver antioxidant levels were found in mice fed with pineapple juice vinegar, followed by coconut juice and nipah juice vinegars. However, compared to the pineapple juice and nipah juice vinegars, the mice fed with coconut juice vinegar, exhibited a higher population of CD4 + and CD8 + T-lymphocytes in the spleen, which was associated with greater levels of serum interleukin-2 and interferon-γ cytokines. Overall, the data suggested that not all vinegar samples cause acute and sub-chronic toxicity in vivo. Moreover, the in vivo immunity and organ antioxidant levels were enhanced, to varying extents, by the phenolic acids present in the vinegars. The results obtained in this study provide appropriate guidelines for further in vivo bioactivity studies and pre-clinical assessments of vinegar consumption. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  18. Virus elimination in acute lymphocytic choriomeningitis virus infection. Correlation with virus-specific delayed-type hypersensitivity rather than cytotoxicity

    DEFF Research Database (Denmark)

    Thomsen, Allan Randrup; Volkert, M; Bro-Jørgensen, K

    1983-01-01

    The immunological effector mechanism responsible for the elimination of virus in murine acute non-fatal extracranial lymphocytic choriomeningitis virus infection was studied. In this infection virus clearance is generally regarded as the result of a direct action of virus-specific cytotoxic T cells...

  19. Acute viral hemorrhage disease: A summary on new viruses

    Directory of Open Access Journals (Sweden)

    Somsri Wiwanitkit

    2015-10-01

    Full Text Available Acute hemorrhagic disease is an important problem in medicine that can be seen in many countries, especially those in tropical world. There are many causes of acute hemorrhagic disease and the viral infection seems to be the common cause. The well-known infection is dengue, however, there are many new identified viruses that can cause acute hemorrhagic diseases. In this specific short review, the authors present and discuss on those new virus diseases that present as “acute hemorrhagic fever”.

  20. An Acute Hemorrhagic Infectious Disease: Ebola Virus Disease

    Directory of Open Access Journals (Sweden)

    JIAO Lei

    2014-09-01

    Full Text Available Ebola virus disease (EVD is an acute hemorrhagic infectious disease caused by ebola virus, with high infectivity and fatality rate. At present, it mainly occurs in areas of Central Africa and West Africa and no effective vaccine and antiviral drugs are available for the clinical treatment.

  1. Importance of Respiratory Viruses in Acute Otitis Media

    OpenAIRE

    Heikkinen, Terho; Chonmaitree, Tasnee

    2003-01-01

    Acute otitis media is usually considered a simple bacterial infection that is treated with antibiotics. However, ample evidence derived from studies ranging from animal experiments to extensive clinical trials supports a crucial role for respiratory viruses in the etiology and pathogenesis of acute otitis media. Viral infection of the upper respiratory mucosa initiates the whole cascade of events that finally leads to the development of acute otitis media as a complication. The pathogenesis o...

  2. Acute hepatitis with nontyphoidal salmonella and hepatitis E virus coinfection

    Directory of Open Access Journals (Sweden)

    Yu-Ting Kuo

    2014-09-01

    Full Text Available A 65-year-old Taiwanese man presented with dark urine for 5 days before admission to hospital and with fever on the 2nd day of admission to hospital. Laboratory studies showed acute hepatitis with hyperbilirubinemia. Acute hepatitis with nontyphoidal salmonella and hepatitis E virus coinfection was diagnosed. The fever subsided after treatment with ceftriaxone and cefepime. His serum bilirubin reached its peak value on the 3rd week after admission to hospital and then gradually returned to the normal range. To the best of our knowledge, acute hepatitis E coinfection with nontyphoidal salmonella has not been reported previously.

  3. Vaccination against acute respiratory virus infections and measles in man.

    NARCIS (Netherlands)

    A.D.M.E. Osterhaus (Albert); P. de Vries (Petra)

    1992-01-01

    textabstractSeveral viruses may cause more or less severe acute respiratory infections in man, some of which are followed by systemic infection. Only for influenza and measles are licensed vaccines available at present. The protection induced by influenza vaccines, which are based on inactivated

  4. Cytokine Signatures Discriminate Highly Frequent Acute Hepatitis a Virus and Hepatitis E Virus Coinfections from Monoinfections in Mexican Pediatric Patients.

    Science.gov (United States)

    Realpe-Quintero, Mauricio; Copado-Villagrana, Edgar Daniel; Trujillo-Ochoa, Jorge Luis; Alvarez, Angel Hilario; Panduro, Arturo; Fierro, Nora Alma

    2017-07-01

    The frequency of hepatitis A virus and hepatitis E virus infections and their cytokine profiles were analyzed in Mexican pediatric patients with acute hepatitis. A high frequency of coinfections was found. Significant overexpression of interleukin (IL)-4, IL-12, IL-13 and interferon-gamma during hepatitis A virus monoinfections and limited secretion of cytokines in hepatitis E virus infections were observed.

  5. [Acute hemorrhagic edema of infancy associated with Coxsackie virus infection].

    Science.gov (United States)

    Debray, A; Ollier, V; Coutard, A; Arditty, F; Bekkar, S; Bodemer, C; Leruez-Ville, M; Mirand, A; Lesage, F; Foucaud, P

    2017-12-01

    Acute hemorrhagic edema of infancy is a rare but benign vasculitis occurring in infants aged from 4 to 24 months. Skin lesions can take various forms, including extensive hemorrhagic purpura, and can therefore be mistaken for purpura fulminans if associated with fever, which leads to initiating broad-spectrum antibiotic treatment. In the present case, we describe a 7-month-old boy with acute hemorrhagic edema of infancy and rapidly extensive purpura lesions that led to intravenous cefotaxime and amikacin treatment. Diagnosis was made on the next day by a dermatologist, based on the typical aspect of skin lesions, hemodynamic stability, and negative bacteriological samples. Coxsackie virus B5, a pathogenic enterovirus, was found by specific PCR in cerebrospinal fluid. The outcome was spontaneously favorable after discontinuation of antibiotics on day 2. We discuss the imputability of the enterovirus in triggering this case of acute hemorrhagic edema of infancy. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  6. Analysis of Aichi virus and Saffold virus association with pediatric acute gastroenteritis.

    Science.gov (United States)

    Li, Li-Li; Liu, Na; Yu, Jei-Mei; Ao, Yuan-Yun; Li, Shan; Stine, O Colin; Duan, Zhao-Jun

    2017-02-01

    Aichi virus (AiV) and Saffold virus (SAFV) have been reported in children with acute gastroenteritis and respiratory disease worldwide; however, their causative role in acute gastroenteritis remains ambiguous. To assess the clinical association of AiV and SAFV with acute gastroenteritis in the pediatric population. A case-control study involving 461 paired stool samples from pediatric cases with diarrhea and healthy controls was conducted in China. Quantitative real-time reverse transcription polymerase chain reaction (RT-PCR) was used to screen AiV and SAFV. In the 461 paired samples, AiV and SAFV were more prevalent among asymptomatic children than children with acute gastroenteritis (0.87% vs. 0.43% and 2.8% vs. 1.5%, respectively), with no significant differences between groups (p=0.142 and p=0.478, respectively). Cox regression model analysis revealed no correlation between AiV (odds ratio, OR=2.24; 95% confidence interval, CI, 0.76-6.54) or SAFV infection (OR=1.36; 95% CI, 0.86-2.15) and diarrhea. High viral loads were found in both AiV- and SAFV-positive groups, with no significant difference in viral load between the groups (p=0.507 and p=0.677, respectively). No other known enteric pathogens were found in the AiV-positive samples but common in SAFV-positive cases. Phylogenetic analysis revealed that all 6 AiV subjects clustered with genotype B. All 7 SAFV-positive cases and 8 of 13 SAFV-positive controls were genotyped successfully; the genotypes identified included SAFV-1, SAFV-2 SAFV-3, and SAFV-6. Our study revealed no association of these viruses in acute gastroenteritis in children. These viruses may have the ability to replicate in humans; however, the infections are usually asymptomatic. Copyright © 2016. Published by Elsevier B.V.

  7. Assembly of recombinant Israeli Acute Paralysis Virus capsids.

    Directory of Open Access Journals (Sweden)

    Junyuan Ren

    Full Text Available The dicistrovirus Israeli Acute Paralysis Virus (IAPV has been implicated in the worldwide decline of honey bees. Studies of IAPV and many other bee viruses in pure culture are restricted by available isolates and permissive cell culture. Here we show that coupling the IAPV major structural precursor protein ORF2 to its cognate 3C-like processing enzyme results in processing of the precursor to the individual structural proteins in a number of insect cell lines following expression by a recombinant baculovirus. The efficiency of expression is influenced by the level of IAPV 3C protein and moderation of its activity is required for optimal expression. The mature IAPV structural proteins assembled into empty capsids that migrated as particles on sucrose velocity gradients and showed typical dicistrovirus like morphology when examined by electron microscopy. Monoclonal antibodies raised to recombinant capsids were configured into a diagnostic test specific for the presence of IAPV. Recombinant capsids for each of the many bee viruses within the picornavirus family may provide virus specific reagents for the on-going investigation of the causes of honeybee loss.

  8. KAJIAN ASPEK TEKNIS DAN FINASIAL USAHA RUMAH TANGGA BRIKET BIOMASSA DARI KULIT NIPAH DENGAN TEMPURUNG KELAPA

    Directory of Open Access Journals (Sweden)

    Martanto Martanto

    2016-04-01

    Full Text Available Nipah merupakan salah satu tanaman  didaerah pasang surut. Di Indonesia terdapat Sekitar tujuh juta hektar (7 Ha  tanaman Nipah. Pemanfaatan kulit nipah  sampai saat ini belum maksimal. Penelitian ini mencoba membuat briket arang dengan campuran arang kelapa. Metode pernelitian ini menggunakan eksperimen untuk pembuatan briket kulit nipah dan metode kuantitatif tehadap nilai ekonomisnya Dari hasil penelitian didapat kadar air 9,2 % ,kadar abu 3,51 % dan kadar zat menguap  2,62 %. Hasil penelitian tersebut layak dan kulaitasnya hampir sama dengan batu bara muda. Dari perhitungan analisa finansial perhitungan NPV, IRR, Payback period  B/C ratio adalah masing-masing menghasilkan nilai masing-masing adalah 8.843.001, 41 %, 3 tahun 7 bulan dan  2,04. Sehingga usaha briket arang dari kulit nipah dengan tempurung kelapa sangat layak untuk dijadikan usaha skala rumah tangga

  9. Rapid and Massive Virus-Specific Plasmablast Responses during Acute Dengue Virus Infection in Humans

    Science.gov (United States)

    Onlamoon, Nattawat; Akondy, Rama S.; Perng, Guey C.; Polsrila, Korakot; Chandele, Anmol; Kwissa, Marcin; Pulendran, Bali; Wilson, Patrick C.; Wittawatmongkol, Orasri; Yoksan, Sutee; Angkasekwinai, Nasikarn; Pattanapanyasat, Kovit; Chokephaibulkit, Kulkanya; Ahmed, Rafi

    2012-01-01

    Humoral immune responses are thought to play a major role in dengue virus-induced immunopathology; however, little is known about the plasmablasts producing these antibodies during an ongoing infection. Herein we present an analysis of plasmablast responses in patients with acute dengue virus infection. We found very potent plasmablast responses that often increased more than 1,000-fold over the baseline levels in healthy volunteers. In many patients, these responses made up as much 30% of the peripheral lymphocyte population. These responses were largely dengue virus specific and almost entirely made up of IgG-secreting cells, and plasmablasts reached very high numbers at a time after fever onset that generally coincided with the window where the most serious dengue virus-induced pathology is observed. The presence of these large, rapid, and virus-specific plasmablast responses raises the question as to whether these cells might have a role in dengue immunopathology during the ongoing infection. These findings clearly illustrate the need for a detailed understanding of the repertoire and specificity of the antibodies that these plasmablasts produce. PMID:22238318

  10. Purpura fulminans associated with acute West Nile virus encephalitis.

    Science.gov (United States)

    Shah, Sheevam; Fite, Laura Paul; Lane, Natalie; Parekh, Palak

    2016-02-01

    Purpura fulminans is a progressive thrombotic disorder that presents with widespread purpura due to deficiency or dysfunction of protein C or protein S. Lesions present as well-demarcated erythematous macules that progress to irregular areas of hemorrhagic necrosis.West Nile virus is a member of the Flaviviridae family transmitted to humans through the bite of various mosquito species. It manifests as West Nile fever in 25% of those infected and less commonly as neuroinvasive disease. An African American man in his fortiespresented with altered mental status and was noted to have evidence of disseminated intravascular coagulation according to his lab data. He then developed dusky skin discoloration and systemic flaccid bullae with desquamation. Biopsy was consistent with purpura fulminans and the patient eventually developed symmetric peripheral gangrene, requiring amputations of all four extremities. Infectious work up revealed positive testing for IgM and IgG antibodies in serum and cerebrospinal fluid leading to the diagnosis of acute West Nile Virus encephalitis. We present this case to describe the rarely reported association of purpura fulminans with West Nile Virus infection. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Varroa destructor, a potential vector of Israeli Acute Paralysis Virus in honey bees, Apis mellifera

    Science.gov (United States)

    Although the role of the parasitic mite, Varroa destructor, as a vector in transmission of viruses between honey bees is well established, no study has shown that it can similarly transmit Israeli Acute Paralysis Virus (IAPV), a virus that was found to be associated with Colony Collapse Disorder (CC...

  12. Acute exacerbation in chronic hepatitis B virus infection

    Directory of Open Access Journals (Sweden)

    Marcio Vieira Santos

    1996-06-01

    Full Text Available A case of an acute exacerbation of liver injury in a chronic HBV infected young male is reported. The correlation between the severe symptomatic hepatitis is done with the histopathologic findings of extense areas of bridging necrosis on the Iwer biopsy. The serological pattern for markers of HBV (HBsAg +, anti HBs g -, HBeAg -, anti HBe +, anti HBcIgG + and IgM - confirm a chronic infection, ana the authors propose that the episode of severe hepatitis relates to the recent spontaneous seroconvertion of HBe Ag to anti HBe. Other causes of hepatitis were excluded, and the control liver biopsy (6 months later showed normalization of hepatic architecture and absence of markers of viral replication in tissue and serum. A review of literature is done in an attempt to elucidate the diagnostic possibilities in this case, with emphasis on new immunoassays useful in differentiating between acute hepatitis B and acute exacerbation of a chronic hepatitis by the same virus.

  13. MAIT cells are activated in acute Dengue virus infection and after in vitro Zika virus infection.

    Science.gov (United States)

    Paquin-Proulx, Dominic; Avelino-Silva, Vivian I; Santos, Bianca A N; Silveira Barsotti, Nathália; Siroma, Fabiana; Fernandes Ramos, Jessica; Coracini Tonacio, Adriana; Song, Alice; Maestri, Alvino; Barros Cerqueira, Natalia; Felix, Alvina Clara; Levi, José Eduardo; Greenspun, Benjamin C; de Mulder Rougvie, Miguel; Rosenberg, Michael G; Nixon, Douglas F; Kallas, Esper G

    2018-01-01

    Dengue virus (DENV) and Zika virus (ZIKV) are members of the Flaviviridae and are predominantly transmitted via mosquito bites. Both viruses are responsible for a growing number of infections in tropical and subtropical regions. DENV infection can cause lethargy with severe morbidity and dengue shock syndrome leading to death in some cases. ZIKV is now linked with Guillain-Barré syndrome and fetal malformations including microcephaly and developmental disorders (congenital Zika syndrome). The protective and pathogenic roles played by the immune response in these infections is unknown. Mucosal-associated invariant T (MAIT) cells are a population of innate T cells with potent anti-bacterial activity. MAIT cells have also been postulated to play a role in the immune response to viral infections. In this study, we evaluated MAIT cell frequency, phenotype, and function in samples from subjects with acute and convalescent DENV infection. We found that in acute DENV infection, MAIT cells had elevated co-expression of the activation markers CD38 and HLA-DR and had a poor IFNγ response following bacterial stimulation. Furthermore, we found that MAIT cells can produce IFNγ in response to in vitro infection with ZIKV. This MAIT cell response was independent of MR1, but dependent on IL-12 and IL-18. Our results suggest that MAIT cells may play an important role in the immune response to Flavivirus infections.

  14. MAIT cells are activated in acute Dengue virus infection and after in vitro Zika virus infection.

    Directory of Open Access Journals (Sweden)

    Dominic Paquin-Proulx

    2018-01-01

    Full Text Available Dengue virus (DENV and Zika virus (ZIKV are members of the Flaviviridae and are predominantly transmitted via mosquito bites. Both viruses are responsible for a growing number of infections in tropical and subtropical regions. DENV infection can cause lethargy with severe morbidity and dengue shock syndrome leading to death in some cases. ZIKV is now linked with Guillain-Barré syndrome and fetal malformations including microcephaly and developmental disorders (congenital Zika syndrome. The protective and pathogenic roles played by the immune response in these infections is unknown. Mucosal-associated invariant T (MAIT cells are a population of innate T cells with potent anti-bacterial activity. MAIT cells have also been postulated to play a role in the immune response to viral infections. In this study, we evaluated MAIT cell frequency, phenotype, and function in samples from subjects with acute and convalescent DENV infection. We found that in acute DENV infection, MAIT cells had elevated co-expression of the activation markers CD38 and HLA-DR and had a poor IFNγ response following bacterial stimulation. Furthermore, we found that MAIT cells can produce IFNγ in response to in vitro infection with ZIKV. This MAIT cell response was independent of MR1, but dependent on IL-12 and IL-18. Our results suggest that MAIT cells may play an important role in the immune response to Flavivirus infections.

  15. Nasopharyngeal Protein Biomarkers of Acute Respiratory Virus Infection

    Directory of Open Access Journals (Sweden)

    Thomas W. Burke

    2017-03-01

    Full Text Available Infection of respiratory mucosa with viral pathogens triggers complex immunologic events in the affected host. We sought to characterize this response through proteomic analysis of nasopharyngeal lavage in human subjects experimentally challenged with influenza A/H3N2 or human rhinovirus, and to develop targeted assays measuring peptides involved in this host response allowing classification of acute respiratory virus infection. Unbiased proteomic discovery analysis identified 3285 peptides corresponding to 438 unique proteins, and revealed that infection with H3N2 induces significant alterations in protein expression. These include proteins involved in acute inflammatory response, innate immune response, and the complement cascade. These data provide insights into the nature of the biological response to viral infection of the upper respiratory tract, and the proteins that are dysregulated by viral infection form the basis of signature that accurately classifies the infected state. Verification of this signature using targeted mass spectrometry in independent cohorts of subjects challenged with influenza or rhinovirus demonstrates that it performs with high accuracy (0.8623 AUROC, 75% TPR, 97.46% TNR. With further development as a clinical diagnostic, this signature may have utility in rapid screening for emerging infections, avoidance of inappropriate antibacterial therapy, and more rapid implementation of appropriate therapeutic and public health strategies.

  16. Israeli acute paralysis virus affects sucrose responsiveness and homing ability of forager bees, Apis mellifera

    Science.gov (United States)

    The honeybee virus, Israeli acute paralysis virus (IAPV), may be one of the most common stressors that are responsible for the colony losses reported worldwide in recent years. IAPV was found to be tightly correlated with honeybee Colony Collapse Disorder (CCD) in the recent outbreak of CCD in the ...

  17. Virus Type and Genomic Load in Acute Bronchiolitis: Severity and Treatment Response With Inhaled Adrenaline.

    Science.gov (United States)

    Skjerven, Håvard O; Megremis, Spyridon; Papadopoulos, Nikolaos G; Mowinckel, Petter; Carlsen, Kai-Håkon; Lødrup Carlsen, Karin C

    2016-03-15

    Acute bronchiolitis frequently causes infant hospitalization. Studies on different viruses or viral genomic load and disease severity or treatment effect have had conflicting results. We aimed to investigate whether the presence or concentration of individual or multiple viruses were associated with disease severity in acute bronchiolitis and to evaluate whether detected viruses modified the response to inhaled racemic adrenaline. Nasopharyngeal aspirates were collected from 363 infants with acute bronchiolitis in a randomized, controlled trial that compared inhaled racemic adrenaline versus saline. Virus genome was identified and quantified by polymerase chain reaction analyses. Severity was assessed on the basis of the length of stay and the use of supportive care. Respiratory syncytial virus (83%) and human rhinovirus (34%) were most commonly detected. Seven other viruses were present in 8%-15% of the patients. Two or more viruses (maximum, 7) were detected in 61% of the infants. Virus type or coinfection was not associated with disease severity. A high genomic load of respiratory syncytial virus was associated with a longer length of stay and with an increased frequency of oxygen and ventilatory support use. Treatment effect of inhaled adrenaline was not modified by virus type, load or coinfection. In infants hospitalized with acute bronchiolitis, disease severity was not associated with specific viruses or the total number of viruses detected. A high RSV genomic load was associated with more-severe disease. NCT00817466 and EudraCT 2009-012667-34. © The Author 2015. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

  18. Acute exacerbation in chronic hepatitis B virus infection

    Directory of Open Access Journals (Sweden)

    Marcio Vieira Santos

    1996-06-01

    Full Text Available A case of an acute exacerbation of liver injury in a chronic HBV infected young male is reported. The correlation between the severe symptomatic hepatitis is done with the histopathologic findings of extense areas of bridging necrosis on the Iwer biopsy. The serological pattern for markers of HBV (HBsAg +, anti HBs g -, HBeAg -, anti HBe +, anti HBcIgG + and IgM - confirm a chronic infection, ana the authors propose that the episode of severe hepatitis relates to the recent spontaneous seroconvertion of HBe Ag to anti HBe. Other causes of hepatitis were excluded, and the control liver biopsy (6 months later showed normalization of hepatic architecture and absence of markers of viral replication in tissue and serum. A review of literature is done in an attempt to elucidate the diagnostic possibilities in this case, with emphasis on new immunoassays useful in differentiating between acute hepatitis B and acute exacerbation of a chronic hepatitis by the same virus.Descreve-se um caso de exacerbação aguda sintomática em um paciente cronicamente infectado pelo VHB, mostrando-se correlação entre o quadro clínico grave (com insuficiência hepática transitória e os achados histopatológicos de hepatite severa com extensas áreas de necrose em ponte. O perfil sorológico para marcadores do VHB (Ag HB S +, anti HB S Ag HBe -, anti HBe +, anti HB C IgG + IgM - confirmou infecção crônica, e os autores levantam a hipótese de que a hepatite tenha se coiTelacionado â recente soroconversão Ag HBe para anti-HBe. Outras etiologias possíveis foram descartadas e se contou com biópsia controle 6 meses depois, mostrando normalização da arquitetura hepática e ausência de marcadores de replicação viral no tecido e no soro. Revisa-se a literatura sobre o diagnóstico diferencial cabível nesta situação, dando ênfase a novos ensaios sorológicos úteis na diferenciação entre infecção aguda pelo VHB e exacerbação aguda de uma hepatite cr

  19. Patterns of hepatitis C virus RNA levels during acute infection: the InC3 study

    NARCIS (Netherlands)

    Hajarizadeh, Behzad; Grady, Bart; Page, Kimberly; Kim, Arthur Y.; McGovern, Barbara H.; Cox, Andrea L.; Rice, Thomas M.; Sacks-Davis, Rachel; Bruneau, Julie; Morris, Meghan; Amin, Janaki; Schinkel, Janke; Applegate, Tanya; Maher, Lisa; Hellard, Margaret; Lloyd, Andrew R.; Prins, Maria; Dore, Gregory J.; Grebely, Jason; Lauer, Georg; Shoukry, Naglaa H.; Hahn, Judy; Shiboski, Steve; Alavi, Maryam; Bouchard, Rachel; Evans, Jennifer; May, Linda; Aneja, Jasneet; Teutsch, Suzy; White, Bethany; Wells, Brittany; Zang, Geng; Matthews, Gail; Yeung, Barbara; Prince, Leslie Erin; Roy, Elise; Bates, Anna; Enriquez, Jarliene; Chow, Sammy; McCredie, Luke; Aitken, Campbell; Doyle, Joseph; Spelman, Tim

    2015-01-01

    Understanding the patterns of HCV RNA levels during acute hepatitis C virus (HCV) infection provides insights into immunopathogenesis and is important for vaccine design. This study evaluated patterns of HCV RNA levels and associated factors among individuals with acute infection. Data were from an

  20. Nuevos virus asociados con gastroenteritis New viruses associated with acute diarrheal disease

    Directory of Open Access Journals (Sweden)

    Carlos Aguirre

    1992-02-01

    Full Text Available

    Se hace un resumen de las características comunes y específicas de los diversos virus asociados con enfermedad diarreica aguda, con énfasis en la importancia que tienen en la génesis de este síndrome y en el hecho de que la mayoría de los casos, aunque sean severos, pueden ser manejados adecuadamente mediante el reemplazo de líquidos y electrolitos.

    A synopsis of the common and specific features of the various viruses associated with acute diarrheal disease is presented; emphasis Is made on their importance as etiologic agents of this syndrome and on the fact that most cases, even If they are severe, can be appropriately treated by fluid and electrolyte replacement.

  1. Three atypical lethal cases associated with acute Zika virus infection in Suriname

    Directory of Open Access Journals (Sweden)

    Rens Zonneveld

    2016-01-01

    Full Text Available Acute Zika virus infection usually presents with a self-limiting triad of fever, rash and arthritis. There is limited information on severe or lethal cases. We report three cases of lethal acute Zika infection, confirmed with polymerase chain reaction, in adult patients with some co-morbidities. The patients showed rapid clinical deterioration with hemorrhagic and septic shock, and exaggerated acute and innate inflammatory responses with pronounced coagulopathy, and died soon after admission to the hospital. It remains unclear whether the fatal outcomes were due to acute Zika virus infection alone or to the combination with exacerbated underlying prior disease or co-infection. Nonetheless, the severity of these cases implies that increased awareness for atypical presentations of Zika virus infection, and careful clinical assessment of patients with symptoms of Zika, is warranted during current and future outbreaks.

  2. Three atypical lethal cases associated with acute Zika virus infection in Suriname.

    Science.gov (United States)

    Zonneveld, Rens; Roosblad, Jimmy; Staveren, Jan Willem van; Wilschut, Jan C; Vreden, Stephen G S; Codrington, John

    2016-01-01

    Acute Zika virus infection usually presents with a self-limiting triad of fever, rash and arthritis. There is limited information on severe or lethal cases. We report three cases of lethal acute Zika infection, confirmed with polymerase chain reaction, in adult patients with some co-morbidities. The patients showed rapid clinical deterioration with hemorrhagic and septic shock, and exaggerated acute and innate inflammatory responses with pronounced coagulopathy, and died soon after admission to the hospital. It remains unclear whether the fatal outcomes were due to acute Zika virus infection alone or to the combination with exacerbated underlying prior disease or co-infection. Nonetheless, the severity of these cases implies that increased awareness for atypical presentations of Zika virus infection, and careful clinical assessment of patients with symptoms of Zika, is warranted during current and future outbreaks.

  3. A potentially novel overlapping gene in the genomes of Israeli acute paralysis virus and its relatives

    Directory of Open Access Journals (Sweden)

    Price Nicholas

    2009-09-01

    Full Text Available Abstract The Israeli acute paralysis virus (IAPV is a honeybee-infecting virus that was found to be associated with colony collapse disorder. The IAPV genome contains two genes encoding a structural and a nonstructural polyprotein. We applied a recently developed method for the estimation of selection in overlapping genes to detect purifying selection and, hence, functionality. We provide evolutionary evidence for the existence of a functional overlapping gene, which is translated in the +1 reading frame of the structural polyprotein gene. Conserved orthologs of this putative gene, which we provisionally call pog (predicted overlapping gene, were also found in the genomes of a monophyletic clade of dicistroviruses that includes IAPV, acute bee paralysis virus, Kashmir bee virus, and Solenopsis invicta (red imported fire ant virus 1.

  4. [Molecular genetic characteristics of the virus isolated from patients with human acute encephalomyelitis and multiple sclerosis].

    Science.gov (United States)

    Barinsky, I F; Grebennikova, T V; Alkhovsky, S V; Kochergin-Nikitsky, K S; Sergeyev, O V; Gribencha, S V; Raev, S A

    2015-01-01

    The study of the antigenic and molecular genetic structure of human acute encephalomyelitis virus (HAEV) showed a high similarity of the HAEV N gene with the homologous gene of the fixed rabies virus strain. The results of the nucleotide sequence analysis indicate that HAEV belongs to the lyssavirus genotype 1. The N gene sequence is the closest to those of the ERA-CB20-M and RV-97 strains of the rabies virus. The need for further research into the role of the human acute encephalomyelitis virus in human pathology stems from past surveys that revealed the presence of the VNAs against this virus in 6 per cent of the blood received from donors in the USA and in each third among the patients with multiple sclerosis in the former USSR.

  5. Mouse model for acute Epstein-Barr virus infection.

    Science.gov (United States)

    Wirtz, Tristan; Weber, Timm; Kracker, Sven; Sommermann, Thomas; Rajewsky, Klaus; Yasuda, Tomoharu

    2016-11-29

    Epstein-Barr Virus (EBV) infects human B cells and drives them into continuous proliferation. Two key viral factors in this process are the latent membrane proteins LMP1 and LMP2A, which mimic constitutively activated CD40 receptor and B-cell receptor signaling, respectively. EBV-infected B cells elicit a powerful T-cell response that clears the infected B cells and leads to life-long immunity. Insufficient immune surveillance of EBV-infected B cells causes life-threatening lymphoproliferative disorders, including mostly germinal center (GC)-derived B-cell lymphomas. We have modeled acute EBV infection of naive and GC B cells in mice through timed expression of LMP1 and LMP2A. Although lethal when induced in all B cells, induction of LMP1 and LMP2A in just a small fraction of naive B cells initiated a phase of rapid B-cell expansion followed by a proliferative T-cell response, clearing the LMP-expressing B cells. Interfering with T-cell activity prevented clearance of LMP-expressing B cells. This was also true for perforin deficiency, which in the human causes a life-threatening EBV-related immunoproliferative syndrome. LMP expression in GC B cells impeded the GC reaction but, upon loss of T-cell surveillance, led to fatal B-cell expansion. Thus, timed expression of LMP1 together with LMP2A in subsets of mouse B cells allows one to study major clinically relevant features of human EBV infection in vivo, opening the way to new therapeutic approaches.

  6. Effect of acute Zika virus infection on sperm and virus clearance in body fluids: a prospective observational study.

    Science.gov (United States)

    Joguet, Guillaume; Mansuy, Jean-Michel; Matusali, Giulia; Hamdi, Safouane; Walschaerts, Marie; Pavili, Lynda; Guyomard, Stefanie; Prisant, Nadia; Lamarre, Pierre; Dejucq-Rainsford, Nathalie; Pasquier, Christophe; Bujan, Louis

    2017-11-01

    Evidence of human sexual transmission during Zika virus emergence is a matter of concern, particularly in procreation, but to date, kinetics of seminal shedding and the effects of infection on human reproductive function have not been described. To investigate the effects of Zika virus infection on semen and clearance of Zika virus from semen and body fluids, we aimed to study a cohort of Zika virus-infected men. This prospective observational study recruited men presenting with acute Zika virus infection at Pointe-à-Pitre University Hospital in Guadeloupe, French Caribbean, where a Zika virus outbreak occurred between April and November, 2016. Blood, urine, and semen were collected at days 7, 11, 20, 30, 60, 90, and 120 after symptom onset, and semen characteristics, such as total sperm count, sperm motility, vitality, and morphology, and reproductive hormone concentrations, such as testosterone, inhibin, follicle-stimulating hormone, and luteinising hormone, were assessed. At days 7, 11, and 20, semen was processed to isolate motile spermatozoa. Zika virus RNA was detected by RT-PCR using whole blood, serum, urine, seminal plasma, semen cells, and motile spermatozoa fractions. Zika virus was isolated from different sperm fractions on Vero E6 cultures. 15 male volunteers (mean age 35 years [SD 5; range 25-44) with acute Zika virus infection and positive Zika virus RNA detection in blood or urine were enrolled. Total sperm count was decreased from median 119 × 10 6 spermatozoa (IQR 22-234) at day 7 to 45·2 × 10 6 (16·5-89·6) at day 30 and 70 × 10 6 (28·5-81·4) at day 60, respectively, after Zika virus infection. Inhibin values increased from 93·5 pg/mL (IQR 55-162) at day 7 to 150 pg/mL (78-209) at day 120 when total sperm count recovered. In motile spermatozoa obtained after density gradient separation, Zika virus RNA was found in three of 14 patients at day 7, four of 15 at day 11, and four of 15 at day 20, and replication-competent virus was

  7. Acute kidney injury in symptomatic primary Epstein-Barr virus infectious mononucleosis: Systematic review.

    Science.gov (United States)

    Moretti, Milena; Lava, Sebastiano A G; Zgraggen, Lorenzo; Simonetti, Giacomo D; Kottanattu, Lisa; Bianchetti, Mario G; Milani, Gregorio P

    2017-06-01

    Textbooks and reviews do not mention the association of symptomatic primary Epstein-Barr virus infectious mononucleosis with acute kidney injury in subjects without immunodeficiency or autoimmunity. Stimulated by our experience with two cases, we performed a review of the literature. The literature documents 38 cases (26 male and 12 female individuals ranging in age from 0.3 to 51, median 18 years) of symptomatic primary Epstein-Barr virus infectious mononucleosis complicated by acute kidney injury: 27 acute interstitial nephritides, 1 jaundice-associated nephropathy, 7 myositides and 3 hemolytic uremic syndromes. Acute kidney injury requiring renal replacement therapy was observed in 18 (47%) cases. Acute kidney injury did not resolve in one patient with acute interstitial nephritis. Two patients died because of systemic complications. The remaining 35 cases fully recovered. In individuals with acute symptomatic Epstein-Barr virus infectious mononucleosis, a relevant kidney injury is rare but the outcome potentially fatal. It results from interstitial nephritis, myositis-associated acute kidney injury, hemolytic uremic syndrome or jaundice-associated nephropathy. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Respiratory viruses in children hospitalized for acute lower respiratory tract infection in Ghana.

    Science.gov (United States)

    Kwofie, Theophilus B; Anane, Yaw A; Nkrumah, Bernard; Annan, Augustina; Nguah, Samuel B; Owusu, Michael

    2012-04-10

    Acute respiratory tract infections are one of the major causes of morbidity and mortality among young children in developing countries. Information on the viral aetiology of acute respiratory infections in developing countries is very limited. The study was done to identify viruses associated with acute lower respiratory tract infection among children less than 5 years. Nasopharyngeal samples and blood cultures were collected from children less than 5 years who have been hospitalized for acute lower respiratory tract infection. Viruses and bacteria were identified using Reverse Transcriptase Real-Time Polymerase Chain Reaction and conventional biochemical techniques. Out of 128 patients recruited, 33(25.88%%, 95%CI: 18.5% to 34.2%) were positive for one or more viruses. Respiratory Syncytial Virus (RSV) was detected in 18(14.1%, 95%CI: 8.5% to 21.3%) patients followed by Adenoviruses (AdV) in 13(10.2%, 95%CI: 5.5% to 16.7%), Parainfluenza (PIV type: 1, 2, 3) in 4(3.1%, 95%CI: 0.9% to 7.8%) and influenza B viruses in 1(0.8%, 95%CI: 0.0 to 4.3). Concomitant viral and bacterial co-infection occurred in two patients. There were no detectable significant differences in the clinical signs, symptoms and severity for the various pathogens isolated. A total of 61.1% (22/36) of positive viruses were detected during the rainy season and Respiratory Syncytial Virus was the most predominant. The study has demonstrated an important burden of respiratory viruses as major causes of childhood acute respiratory infection in a tertiary health institution in Ghana. The data addresses a need for more studies on viral associated respiratory tract infection.

  9. Respiratory viruses in children hospitalized for acute lower respiratory tract infection in Ghana

    Directory of Open Access Journals (Sweden)

    Kwofie Theophilus B

    2012-04-01

    Full Text Available Abstract Background Acute respiratory tract infections are one of the major causes of morbidity and mortality among young children in developing countries. Information on the viral aetiology of acute respiratory infections in developing countries is very limited. The study was done to identify viruses associated with acute lower respiratory tract infection among children less than 5 years. Method Nasopharyngeal samples and blood cultures were collected from children less than 5 years who have been hospitalized for acute lower respiratory tract infection. Viruses and bacteria were identified using Reverse Transcriptase Real-Time Polymerase Chain Reaction and conventional biochemical techniques. Results Out of 128 patients recruited, 33(25.88%%, 95%CI: 18.5% to 34.2% were positive for one or more viruses. Respiratory Syncytial Virus (RSV was detected in 18(14.1%, 95%CI: 8.5% to 21.3% patients followed by Adenoviruses (AdV in 13(10.2%, 95%CI: 5.5% to 16.7%, Parainfluenza (PIV type: 1, 2, 3 in 4(3.1%, 95%CI: 0.9% to 7.8% and influenza B viruses in 1(0.8%, 95%CI: 0.0 to 4.3. Concomitant viral and bacterial co-infection occurred in two patients. There were no detectable significant differences in the clinical signs, symptoms and severity for the various pathogens isolated. A total of 61.1% (22/36 of positive viruses were detected during the rainy season and Respiratory Syncytial Virus was the most predominant. Conclusion The study has demonstrated an important burden of respiratory viruses as major causes of childhood acute respiratory infection in a tertiary health institution in Ghana. The data addresses a need for more studies on viral associated respiratory tract infection.

  10. UJI FITOKIMIA SENYAWA KIMIA AKTIF AKAR NIPAH (Nyfa Fruticans WURMB SEBAGAI TUMBUHAN OBAT DI KALIMANTAN SELATAN

    Directory of Open Access Journals (Sweden)

    Rosidah R Radam

    2017-02-01

    Full Text Available Nipa (Nypa fruticans WURMB classified in Palma family and grow in riptide area. This Research aims to know active Chemical compounds in Nipa root. We Hope that this Research will provide new information about active Chemical compounds in Nipa root, so that we can improve the benefit value of Nipa as One of the medicinal herb. Nipa root samples is taken in Tanah Bumbu District, samples examined in Laboratory of F-MIPA UNLAM. The observed parameters in thus Chemical Test are the active Chemical compounds: alkaloid, steroid, triterpenoid, flavonoid, and tannin. The Content of active Chemical compound is presented in Table and concluded descriptively. The Result of active Chemical compound consist in Nipa’s root shows that Alkaloid, Steroid, Triterpenoid, Flavonoid , and tannin compound is do contains in Nipa root. This active Chemical compound in Nipa root can be Led as the basic Chemical informative to utilize Nipa root as analgesics Medical for such disease. Nipah (nypa fruticans WURMB merupakan tumbuhan yang termasuk famili Palmae dan   tumbuh di daerah  pasang   surut.  Penelitian ini bertujuan untuk mengetahui  kandungan senyawa-senyawa kimia aktif pada akar nipah. Manfaat dari penelitian ini untuk memberikan informasi baru tentang senyawa aktif yang terdapat pada akar nipah, sehingga dapat meningkatkan nilai guna dan manfaat tumbuhan nipah sebagai salah satu tanaman obat. Pengambilan sample akar nipah dilakukan Kabupaten Tanah Bumbu  sedangkan pengujian sample akar nipah dilakukan di Laboratorium F-MIFA UNLAM. Parameter-parameter yang diamati pada pengujian kimia tersebut adalah senyawa-senyawa kimia aktif yaitu alkaloid, steroid, triterpenoid flavonoid, dan tanin. Data hasil uji kandungan senyawa kimia aktif  ditabulasi dan disimpulkan secara diskriptif. Hasil pengujian terhadap senyawa kimia aktif yang terkandung dalam akar Nifah ini menunjukan bahwa senyawa Alkaloid, Steroid, Triterpenoid, Flavonoid , dan tanin memang dikandung

  11. Human immunodeficiency virus seroconversion presenting with acute inflammatory demyelinating polyneuropathy: a case report

    Directory of Open Access Journals (Sweden)

    Sloan Derek J

    2008-12-01

    Full Text Available Abstract Introduction Acute Human Immunodeficiency Virus infection is associated with a range of neurological conditions. Guillain-Barré syndrome is a rare presentation; acute inflammatory demyelinating polyneuropathy is the commonest form of Guillain-Barré syndrome. Acute inflammatory demyelinating polyneuropathy has occasionally been reported in acute Immunodeficiency Virus infection but little data exists on frequency, management and outcome. Case presentation We describe an episode of Guillain-Barré syndrome presenting as acute inflammatory demyelinating polyneuropathy in a 30-year-old man testing positive for Immunodeficiency Virus, probably during acute seroconversion. Clinical suspicion was confirmed by cerebrospinal fluid analysis and nerve conduction studies. Rapid clinical deterioration prompted intravenous immunoglobulin therapy and early commencement of highly active anti-retroviral therapy. All symptoms resolved within nine weeks. Conclusion Unusual neurological presentations in previously fit patients are an appropriate indication for Immunodeficiency-Virus testing. Highly active anti-retroviral therapy with adequate penetration of the central nervous system should be considered as an early intervention, alongside conventional therapies such as intravenous immunoglobulin.

  12. Prevalence of non-influenza respiratory viruses in acute respiratory infection cases in Mexico.

    Directory of Open Access Journals (Sweden)

    Larissa Fernandes-Matano

    Full Text Available Acute respiratory infections are the leading cause of morbidity and mortality worldwide. Although a viral aetiological agent is estimated to be involved in up to 80% of cases, the majority of these agents have never been specifically identified. Since 2009, diagnostic and surveillance efforts for influenza virus have been applied worldwide. However, insufficient epidemiological information is available for the many other respiratory viruses that can cause Acute respiratory infections.This study evaluated the presence of 14 non-influenza respiratory viruses in 872 pharyngeal exudate samples using RT-qPCR. All samples met the operational definition of a probable case of an influenza-like illness or severe acute respiratory infection and had a previous negative result for influenza by RT-qPCR.The presence of at least one non-influenza virus was observed in 312 samples (35.8%. The most frequent viruses were rhinovirus (RV; 33.0%, human respiratory syncytial virus (HRSV; 30.8% and human metapneumovirus (HMPV; 10.6%. A total of 56 cases of co-infection (17.9% caused by 2, 3, or 4 viruses were identified. Approximately 62.5% of all positive cases were in children under 9 years of age.In this study, we identified 13 non-influenza respiratory viruses that could occur in any season of the year. This study provides evidence for the prevalence and seasonality of a wide range of respiratory viruses that circulate in Mexico and constitute a risk for the population. Additionally, our data suggest that including these tests more widely in the diagnostic algorithm for influenza may reduce the use of unnecessary antibiotics, reduce the hospitalisation time, and enrich national epidemiological data with respect to the infections caused by these viruses.

  13. Prevalence of non-influenza respiratory viruses in acute respiratory infection cases in Mexico.

    Science.gov (United States)

    Fernandes-Matano, Larissa; Monroy-Muñoz, Irma Eloísa; Angeles-Martínez, Javier; Sarquiz-Martinez, Brenda; Palomec-Nava, Iliana Donají; Pardavé-Alejandre, Hector Daniel; Santos Coy-Arechavaleta, Andrea; Santacruz-Tinoco, Clara Esperanza; González-Ibarra, Joaquín; González-Bonilla, Cesar Raúl; Muñoz-Medina, José Esteban

    2017-01-01

    Acute respiratory infections are the leading cause of morbidity and mortality worldwide. Although a viral aetiological agent is estimated to be involved in up to 80% of cases, the majority of these agents have never been specifically identified. Since 2009, diagnostic and surveillance efforts for influenza virus have been applied worldwide. However, insufficient epidemiological information is available for the many other respiratory viruses that can cause Acute respiratory infections. This study evaluated the presence of 14 non-influenza respiratory viruses in 872 pharyngeal exudate samples using RT-qPCR. All samples met the operational definition of a probable case of an influenza-like illness or severe acute respiratory infection and had a previous negative result for influenza by RT-qPCR. The presence of at least one non-influenza virus was observed in 312 samples (35.8%). The most frequent viruses were rhinovirus (RV; 33.0%), human respiratory syncytial virus (HRSV; 30.8%) and human metapneumovirus (HMPV; 10.6%). A total of 56 cases of co-infection (17.9%) caused by 2, 3, or 4 viruses were identified. Approximately 62.5% of all positive cases were in children under 9 years of age. In this study, we identified 13 non-influenza respiratory viruses that could occur in any season of the year. This study provides evidence for the prevalence and seasonality of a wide range of respiratory viruses that circulate in Mexico and constitute a risk for the population. Additionally, our data suggest that including these tests more widely in the diagnostic algorithm for influenza may reduce the use of unnecessary antibiotics, reduce the hospitalisation time, and enrich national epidemiological data with respect to the infections caused by these viruses.

  14. Comprehensive detection of viruses in pediatric patients with acute liver failure using next-generation sequencing.

    Science.gov (United States)

    Suzuki, Takako; Kawada, Jun-Ichi; Okuno, Yusuke; Hayano, Satoshi; Horiba, Kazuhiro; Torii, Yuka; Takahashi, Yoshiyuki; Umetsu, Syuichiro; Sogo, Tsuyoshi; Inui, Ayano; Ito, Yoshinori

    2017-11-01

    Pediatric acute liver failure (PALF) is a rare and severe syndrome that frequently requires liver transplantation. Viruses are one of the most frequent causes of this disease, however, pathogenic viruses are not determined in many patients. Recently next-generation sequencing (NGS) has been applied to comprehensively detect pathogens of infectious diseases of unknown etiology. To evaluate an NGS-based approach for detecting pathogenic viruses in patients with PALF or acute hepatitis of unknown etiology. To detect virus-derived DNA and RNA sequences existing in sera/plasma from patients, both DNA and RNA sequencing were performed. First, we validated the ability of NGS to detect viral pathogens in clinical serum/plasma samples, and compared different commercial RNA library preparation methods Then, serum/plasma of fourteen patients with PALF or acute hepatitis of unknown etiology were evaluated using NGS. Among three RNA library preparation methods, Ovation RNA-Seq System V2 had the highest sensitivity to detect RNA viral sequences. Among fourteen patients, sequence reads of torque teno virus, adeno-associated virus, and stealth virus were found in the sera of one patient each, however, the pathophysiological role of these three viruses was not clarified. Significant virus reads were not detected in the remaining 11 patients. This finding might be due to low virus titer in blood at the time of referral or a non-infectious cause might be more frequent. These results suggest an NGS-based approach has potential to detect viral pathogens in clinical samples and would contribute to clarification of the etiology of PALF. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Hepatitis E virus is the leading cause of acute viral hepatitis in Lothian, Scotland

    Directory of Open Access Journals (Sweden)

    I. Kokki

    2016-03-01

    Full Text Available Acute viral hepatitis affects all ages worldwide. Hepatitis E virus (HEV is increasingly recognized as a major cause of acute hepatitis in Europe. Because knowledge of its characteristics is limited, we conducted a retrospective study to outline demographic and clinical features of acute HEV in comparison to hepatitis A, B and C in Lothian over 28 months (January 2012 to April 2014. A total of 3204 blood samples from patients with suspected acute hepatitis were screened for hepatitis A, B and C virus; 913 of these samples were also screened for HEV. Demographic and clinical information on patients with positive samples was gathered from electronic patient records. Confirmed HEV samples were genotyped. Of 82 patients with confirmed viral hepatitis, 48 (59% had acute HEV. These patients were older than those infected by hepatitis A, B or C viruses, were more often male and typically presented with jaundice, nausea, vomiting and/or malaise. Most HEV cases (70% had eaten pork or game meat in the few months before infection, and 14 HEV patients (29% had a recent history of foreign travel. The majority of samples were HEV genotype 3 (27/30, 90%; three were genotype 1. Acute HEV infection is currently the predominant cause of acute viral hepatitis in Lothian and presents clinically in older men. Most of these infections are autochthonous, and further studies confirming the sources of infection (i.e. food or blood transfusion are required.

  16. Acute and latent infection in mice with a virulent strain of Aujeszky?s disease virus

    OpenAIRE

    Flatschart Roberto B.; Resende Maurício

    2000-01-01

    Acute and latent infections with the Brazilian LA031 strain of Aujeszky’s disease virus (ADV) were established in mice. Ultraviolet irradiated ADV administered subcutaneously was a successful way to establish latent infection. The presence of ADV was detected by PCR. Two sets of 22-mer primers were synthesized and used to amplify gG glycoprotein gene sequences in acute and latent infected trigeminal nerve ganglia. The specificity of the amplification was verified by dot-blot hybridization.

  17. Acute and latent infection in mice with a virulent strain of Aujeszky’s disease virus

    Directory of Open Access Journals (Sweden)

    Roberto B. Flatschart

    2000-10-01

    Full Text Available Acute and latent infections with the Brazilian LA031 strain of Aujeszky’s disease virus (ADV were established in mice. Ultraviolet irradiated ADV administered subcutaneously was a successful way to establish latent infection. The presence of ADV was detected by PCR. Two sets of 22-mer primers were synthesized and used to amplify gG glycoprotein gene sequences in acute and latent infected trigeminal nerve ganglia. The specificity of the amplification was verified by dot-blot hybridization.

  18. Acute and latent infection in mice with a virulent strain of Aujeszky?s disease virus

    Directory of Open Access Journals (Sweden)

    Flatschart Roberto B.

    2000-01-01

    Full Text Available Acute and latent infections with the Brazilian LA031 strain of Aujeszky?s disease virus (ADV were established in mice. Ultraviolet irradiated ADV administered subcutaneously was a successful way to establish latent infection. The presence of ADV was detected by PCR. Two sets of 22-mer primers were synthesized and used to amplify gG glycoprotein gene sequences in acute and latent infected trigeminal nerve ganglia. The specificity of the amplification was verified by dot-blot hybridization.

  19. Some points of the X-ray pattern of acute viral primary pneumonia caused by acute respiratory disease viruses

    International Nuclear Information System (INIS)

    Stoyanov, V.

    1991-01-01

    An analysis is made of the results of the X-ray studies as well as of the virological and serological tests in 225 out-patients consulted in the first days of their complaints. A predominance of the viral (70.2%) over the viral-bacterial primary pneumonia is established. The acute viral primary pneumonia are caused mostly by single influenza viruses and more rarely - by single respiratory viruses; in the cases of combined influenza viruses influenza-influenza viruses prevail over the influenza-respiratory ones. The morphological changes in pneumonia due to isolated single influenza viruses involve mostly the interstitium and are projected on X-ray as patchy and stripped densities. The inflamatory changes in pneumonia caused by combined influenza viruses affect both ihe interstitium and the broncho-alveolar substrate of the lungs; they are manifested in two roentgenologic forms: creeping (migrating) and fusing (confluent). In viral-bacterial pneumonia the changes affect mostly the lobe. The right lung and the lower parts of the both lungs are affected in most cases. 5 figs., 21 refs

  20. [Viruses and clinical features associated with hospitalized children with acute respiratory infections in Lhasa, Tibet].

    Science.gov (United States)

    Wu, Hong; Deng, Jie; Qian, Yuan; Zhu, Ru-nan; Sun, Yu; Zhao, Lin-qing; Wang, Fang; Shan, Min-na; Deji, Mei-duo

    2012-10-01

    To investigate the viral etiology and clinical features of hospitalized children with acute respiratory tract infections in Tibet. Nasopharyngeal aspirate samples were collected from children with acute respiratory tract infection hospitalized at the department of Pediatrics, Tibet Autonomous Region People's Hospital from April to July, 2011. The specimens of nasopharyngeal aspirate were screened for antigens of 7 common respiratory viruses by direct immunofluorescence (DIF) [respiratory syncytial virus (RSV), adenovirus (ADV), parainfluenza viruses type I-III, influenza virus A and B] and human metapneumovirus. Clinical data of the children were analyzed by statistical software SPSS16. A total of 167 children with acute respiratory tract infections hospitalized from April to July 2011 were enrolled in this investigation. Sixty-five out of 167 specimens were positive for viral antigens. The virus positive rate for specimens was 38.9% (65/167). Two of 65 positive specimens were positive for 2 virus antigens (RSV + influenza B) and (hMPV + parainfluenza virus type III), respectively. RSV was detected in 45 cases (67.2%, 45/67) which was the most predominant, followed by parainfluenza virus type III detected in 7 cases (10.4%, 7/67), ADV in 6 cases (9.0%, 6/67), parainfluenza virus type I in 4 cases (6.0%, 4/67), influenza virus type B in 3 cases (4.5%, 3/67), and hMPV in 2 cases (3.0%, 2/67). In addition to clinical manifestations of pneumonia, such as cough and shortness of breath, only 3 virus positive cases (6.67%) presented with wheezing, but the signs of severe cyanosis, fine rales in lung were common. Most of the children in this study recovered soon, only a few younger children with underlying diseases or complications had severe illness. Virus is an important pathogen for acute respiratory infections for hospitalized children in Tibet. RSV was the most predominant etiological agent, especially for those younger than 3 years old.

  1. [Fulminant myocarditis and acute gastroenteritis due to Coxsackie virus B6].

    Science.gov (United States)

    Málaga, Germán; Gayoso, Oscar; Lazo, María de Los Angeles; Torres, Nancy

    2011-03-01

    We present the case of a young woman who suffered cardiogenic due to by Coxsackie virus B6. The patient attended a private clinic with an acute gastroenteritis and after one hour of receiving hydratation,she developed hypotension and shock, severe hypoxemia and bilateral lung infiltrate. The patient entered the Intensive Care Unit, where she received hemodynamic support. Due to the clinical picture and cardiac enzymes increase, a cardiac failure was suspected and the echocardiographic findings suggested "myocarditis". The evolution was successful and Coxsackie B6 virus infection diagnosis was made during the follow up by increase of the levels of antibodies for virus Coxsackie B6.

  2. Studies on the role of mononuclear phagocytes in resistance to acute lymphocytic choriomeningitis virus infection

    DEFF Research Database (Denmark)

    Thomsen, Allan Randrup; Volkert, M

    1983-01-01

    killer response was also unimpaired by this treatment. Taken together, these findings suggest that resident macrophages constitute a barrier to the initial multiplication of LCMV. A breakdown of this macrophage barrier results in a more disseminated infection, which the specific immune response has...... with early events in the host response to the virus. Correspondingly, carrageenan enhanced early virus multiplication. Pretreatment with carrageenan apparently did not inhibit induction of the T-cell response and had little or no direct effect on T-cell-dependent anti-viral activity. The LCMV-induced natural......The role of mononuclear phagocytes in various phases of the acute lymphocytic choriomeningitis virus (LCMV) infection was studied. The anti-macrophage agent carrageenan delayed virus clearance. Carrageenan was most effective when given before virus inoculation, suggesting that it interfered...

  3. Nation-wide surveillance of human acute respiratory virus infections between 2013 and 2015 in Korea.

    Science.gov (United States)

    Kim, Jeong-Min; Jung, Hee-Dong; Cheong, Hyang-Min; Lee, Anna; Lee, Nam-Joo; Chu, Hyuk; Kim, Sung Soon; Choi, Jang-Hoon

    2018-02-28

    The prevalence of eight respiratory viruses detected in patients with acute respiratory infections (ARIs) in Korea was investigated through analysis of data recorded by the Korea Influenza and Respiratory Viruses Surveillance System (KINRESS) from 2013 to 2015. Nasal aspirate and throat swabs specimens were collected from 36,915 patients with ARIs, and viral nucleic acids were detected by real-time (reverse-transcription) polymerase chain reaction for eight respiratory viruses, including human respiratory syncytial viruses (HRSVs), influenza viruses (IFVs), human parainfluenza viruses (HPIVs), human coronaviruses (HCoVs), human rhinovirus (HRV), human adenovirus (HAdV), human bocavirus (HBoV), and human metapneumovirus (HMPV). The overall positive rate of patient specimens was 49.4% (18,236/36,915), 5% of which carried two or more viruses simultaneously. HRV (15.6%) was the most predominantly detected virus, followed by IFVs (14.6%), HAdV (7.5%), HPIVs (5.8%), HCoVs (4.2%), HRSVs (3.6%), HBoV (1.9%), and HMPV (1.6%). Most of the ARIs were significantly correlated with clinical symptoms of fever, cough, and runny nose. Although HRV and HAdV were frequently detected throughout the year in patients, other respiratory viruses showed apparent seasonality. HRSVs and IFVs were the major causative agents of acute respiratory diseases in infants and young children. Overall, this study demonstrates a meaningful relationship between viral infection and typical manifestations of known clinical features as well as seasonality, age distribution, and co-infection among respiratory viruses. Therefore, these data could provide useful information for public health management and to enhance patient care for primary clinicians. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  4. Prevalence of hepatitis A virus, hepatitis B virus, hepatitis C virus, hepatitis D virus and hepatitis E virus as causes of acute viral hepatitis in North India: a hospital based study.

    Science.gov (United States)

    Jain, P; Prakash, S; Gupta, S; Singh, K P; Shrivastava, S; Singh, D D; Singh, J; Jain, A

    2013-01-01

    Acute viral hepatitis (AVH) is a major public health problem and is an important cause of morbidity and mortality. The aim of the present study is to determine the prevalence of hepatitis A virus (HAV), hepatitis B virus (HBV), hepatitis C virus (HCV), hepatitis D virus (HDV) and hepatitis E virus (HEV) as causes of AVH in a tertiary care hospital of North India. Blood samples and clinical information was collected from cases of AVH referred to the Grade I viral diagnostic laboratory over a 1-year period. Samples were tested for hepatitis B surface antigen, anti-HCV total antibodies, anti-HAV immunoglobulin M (IgM) and anti-HEV IgM by the enzyme-linked immunosorbent assay. PCR for nucleic acid detection of HBV and HCV was also carried out. Those positive for HBV infection were tested for anti-HDV antibodies. Fisher's exact test was used and a P hepatitis cases, 62 (23.22%) patients presented as acute hepatic failure. HAV (26.96%) was identified as the most common cause of acute hepatitis followed by HEV (17.97%), HBV (16.10%) and HCV (11.98%). Co-infections with more than one virus were present in 34 cases; HAV-HEV co-infection being the most common. HEV was the most important cause of acute hepatic failure followed by co-infection with HAV and HEV. An indication towards epidemiological shift of HAV infection from children to adults with a rise in HAV prevalence was seen. To the best of our knowledge, this is the first report indicating epidemiological shift of HAV in Uttar Pradesh.

  5. Quantitation of respiratory viruses in relation to clinical course in children with acute respiratory tract infections

    NARCIS (Netherlands)

    Jansen, Rogier R.; Schinkel, Janke; dek, Irene; Koekkoek, Sylvie M.; Visser, Caroline E.; de Jong, Menno D.; Molenkamp, Richard; Pajkrt, Dasja

    2010-01-01

    Quantitation of respiratory viruses by PCR could potentially aid in clinical interpretation of PCR results. We conducted a study in children admitted with acute respiratory tract infections to study correlations between the clinical course of illness and semiquantitative detection of 14 respiratory

  6. Response of the honey bee (Apis mellifera L.) proteome to Israeli acute paralysis virus infection

    Science.gov (United States)

    Recent declines in honey bee populations worldwide have spurred significant research into the impact of pathogens on colony health. The role of the Israeli Acute Paralysis Virus (IAPV)on hive mortality has become of particular concern since being correlated with colony losses, although the pathogeni...

  7. Genetic analysis of Israel Acute Paralysis Virus: distinct clusters are circulating into the United States.

    Science.gov (United States)

    Israel acute paralysis virus (IAPV) is associated with colony collapse disorder of honey bees. Nonetheless, its role in the pathogenesis of the disorder and its geographic distribution are unclear. Here, we report phylogenetic analysis of IAPV obtained from bees in the United States, Canada, Austral...

  8. Clinical Features of Adult Patients with Acute Hepatitis B Virus Infection Progressing to Chronic Infection

    Directory of Open Access Journals (Sweden)

    Kojiro Michitaka

    2014-01-01

    Full Text Available Background. Information regarding the progression of acute hepatitis B virus (HBV infection to chronic infection in adults is scarce. Methods. Twenty-five adult patients with acute HBV infection (14 men and 11 women, 18–84 years old, whose clinical features progressed to those of chronic infection (group A or did not (group B, were studied retrospectively. Results. There were 3 and 22 patients in groups A and B, respectively. Two of the 3 patients of group A lacked the typical symptoms of acute hepatitis. No differences were found between groups with respect to age, sex, or HBV genotypes. However, total bilirubin and alanine aminotransaminase levels were significantly lower in group A. Conclusions. Three of the 25 adult patients with acute HBV infection progressed to chronic infection. Hepatitis was mild in these patients. Patients with mild acute hepatitis B or unapparent HBV infection may have a higher risk of progressing to chronic infection.

  9. MAIT cells are activated in acute Dengue virus infection and after in vitro Zika virus infection

    OpenAIRE

    Paquin-Proulx, Dominic; Avelino-Silva, Vivian I.; Santos, Bianca A. N.; Silveira Barsotti, Nathália; Siroma, Fabiana; Fernandes Ramos, Jessica; Coracini Tonacio, Adriana; Song, Alice; Maestri, Alvino; Barros Cerqueira, Natalia; Felix, Alvina Clara; Levi, José Eduardo; Greenspun, Benjamin C.; de Mulder Rougvie, Miguel; Rosenberg, Michael G.

    2018-01-01

    Dengue virus (DENV) and Zika virus (ZIKV) are members of the Flaviviridae and are predominantly transmitted via mosquito bites. Both viruses are responsible for a growing number of infections in tropical and subtropical regions. DENV infection can cause lethargy with severe morbidity and dengue shock syndrome leading to death in some cases. ZIKV is now linked with Guillain-Barré syndrome and fetal malformations including microcephaly and developmental disorders (congenital Zika syndrome). The...

  10. MAIT cells are activated in acute Dengue virus infection and after in vitro Zika virus infection.

    OpenAIRE

    Dominic Paquin-Proulx; Vivian I Avelino-Silva; Bianca A N Santos; Nathália Silveira Barsotti; Fabiana Siroma; Jessica Fernandes Ramos; Adriana Coracini Tonacio; Alice Song; Alvino Maestri; Natalia Barros Cerqueira; Alvina Clara Felix; José Eduardo Levi; Benjamin C Greenspun; Miguel de Mulder Rougvie; Michael G Rosenberg

    2018-01-01

    Dengue virus (DENV) and Zika virus (ZIKV) are members of the Flaviviridae and are predominantly transmitted via mosquito bites. Both viruses are responsible for a growing number of infections in tropical and subtropical regions. DENV infection can cause lethargy with severe morbidity and dengue shock syndrome leading to death in some cases. ZIKV is now linked with Guillain-Barré syndrome and fetal malformations including microcephaly and developmental disorders (congenital Zika syndrome). The...

  11. Multiple Evanescent White Dot Syndrome following Acute Epstein-Barr Virus Infection.

    Science.gov (United States)

    Yang, Chang-Sue; Hsieh, Ming-Hung; Su, Huan-I; Kuo, Yih-Shiuan

    2017-10-11

    To investigate the association between multiple evanescent white dot syndrome (MEWDS) and Epstein-Barr (EB) virus infection. A prospective, consecutive case series study was performed in patients with the characteristic findings of MEWDS. Patients received EB viral-specific antibody serologic tests. Five cases of MEWDS who had prodromal flu-like symptoms were enrolled, comprising 2 women and 3 men with a mean age of 34. Mean diopter of myopia was -7.5. During acute onset of MEWDS, EB virus infection was confirmed by positive EB virus serology test. One showed positive EB viral capsid antigen (EB-VCA) IgM, and the other four showed highly elevated titer of EB-VCA IgG more than 1:160. Two months later, paired serum virus serology data showed negative EB-VCA IgM, or prior EB-VCA IgG titer decreased four-fold in the recovery stage. MEWDS may be associated with acute systemic EB virus infection. Ocular symptoms might develop due to this infection or represent virus-induced autoimmune inflammatory retinitis.

  12. Replication Capacity of Viruses from Acute Infection Drives HIV-1 Disease Progression.

    Science.gov (United States)

    Selhorst, Philippe; Combrinck, Carina; Ndabambi, Nonkululeko; Ismail, Sherazaan D; Abrahams, Melissa-Rose; Lacerda, Miguel; Samsunder, Natasha; Garrett, Nigel; Abdool Karim, Quarraisha; Abdool Karim, Salim S; Williamson, Carolyn

    2017-04-15

    The viral genotype has been shown to play an important role in HIV pathogenesis following transmission. However, the viral phenotypic properties that contribute to disease progression remain unclear. Most studies have been limited to the evaluation of Gag function in the context of a recombinant virus backbone. Using this approach, important biological information may be lost, making the evaluation of viruses obtained during acute infection, representing the transmitted virus, a more biologically relevant model. Here, we evaluate the roles of viral infectivity and the replication capacity of viruses from acute infection in disease progression in women who seroconverted in the CAPRISA 004 tenofovir microbicide trial. We show that viral replication capacity, but not viral infectivity, correlates with the set point viral load (Spearman r = 0.346; P = 0.045) and that replication capacity (hazard ratio [HR] = 4.52; P = 0.01) can predict CD4 decline independently of the viral load (HR = 2.9; P = 0.004) or protective HLA alleles (HR = 0.61; P = 0.36). We further demonstrate that Gag-Pro is not the main driver of this association, suggesting that additional properties of the transmitted virus play a role in disease progression. Finally, we find that although viruses from the tenofovir arm were 2-fold less infectious, they replicated at rates similar to those of viruses from the placebo arm. This indicates that the use of tenofovir gel did not select for viral variants with higher replication capacity. Overall, this study supports a strong influence of the replication capacity in acute infection on disease progression, potentially driven by interaction of multiple genes rather than a dominant role of the major structural gene gag IMPORTANCE HIV disease progression is known to differ between individuals, and defining which fraction of this variation can be attributed to the virus is important both clinically and epidemiologically. In this study, we show that the replication

  13. Molecular evolution of GB virus B hepatitis virus during acute resolving and persistent infections in experimentally infected tamarins

    DEFF Research Database (Denmark)

    Takikawa, Shingo; Engle, Ronald E; Faulk, Kristina N

    2010-01-01

    GB virus B (GBV-B) causes acute hepatitis in experimentally infected tamarins. We compared evolutionary features in acute resolving and persistent GBV-B infection. We detected no evidence of evolution in four animals with clearance during weeks 9-12, whereas three animals with clearance during...... weeks 13-26 had several substitutions in their polyprotein sequence. A single tamarin had long-term GBV-B viraemia; analysis of virus recovered at weeks 2, 5, 12, 20, 26, 52 and 104 demonstrated that mutations accumulated over time. Overall, the amino acid substitution rate was 3.5x10(-3) and 1.1x10......(-3) substitutions per site year(-1) during weeks 1-52 and 53-104, respectively. Thus, there was a significant decrease in evolution over time, as found for hepatitis C virus. The rate of non-synonymous substitution per non-synonymous site compared with that of synonymous substitution per synonymous site decreased...

  14. Defining nervous system susceptibility during acute and latent herpes simplex virus-1 infection.

    Science.gov (United States)

    Menendez, Chandra M; Carr, Daniel J J

    2017-07-15

    Herpes simplex viruses are neurotropic human pathogens that infect and establish latency in peripheral sensory neurons of the host. Herpes Simplex Virus-1 (HSV-1) readily infects the facial mucosa that can result in the establishment of a latent infection in the sensory neurons of the trigeminal ganglia (TG). From latency, HSV-1 can reactivate and cause peripheral pathology following anterograde trafficking from sensory neurons. Under rare circumstances, HSV-1 can migrate into the central nervous system (CNS) and cause Herpes Simplex Encephalitis (HSE), a devastating disease of the CNS. It is unclear whether HSE is the result of viral reactivation within the TG, from direct primary infection of the olfactory mucosa, or from other infected CNS neurons. Areas of the brain that are susceptible to HSV-1 during acute infection are ill-defined. Furthermore, whether the CNS is a true reservoir of viral latency following clearance of virus during acute infection is unknown. In this context, this review will identify sites within the brain that are susceptible to acute infection and harbor latent virus. In addition, we will also address findings of HSV-1 lytic gene expression during latency and comment on the pathophysiological consequences HSV-1 infection may have on long-term neurologic performance in animal models and humans. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. [A new case of acute transverse myelitis following hepatitis A virus infection].

    Science.gov (United States)

    Khemiri, M; Ouederni, M; Barsaoui, S

    2007-04-01

    Transverse myelitis is a rare manifestation of hepatitis A virus infection. We report the case of an eleven-year-old girl who presented a progressive flabby paraplegia with sphincter incontinence, superficial hypoesthesia, without deep involvement. Medullar MRI was suggestive of myelitis. Despite the absence of jaundice and hepatic cytolysis, the serology yielded a high rate of anti-hepatitis A immunoglobulin M. Neurological disorders disappeared within 15 days, after treating with a high dose of corticosteroids and physical rehabilitation. 24 months later she was asymptomatic. Screening for hepatitis A virus infection in patients with acute transverse myelitis should be indicated specially in endemic countries were vaccinal prophylaxis is not common practice.

  16. Pancreatitis and cholecystitis in primary acute symptomatic Epstein-Barr virus infection - Systematic review of the literature.

    Science.gov (United States)

    Kottanattu, Lisa; Lava, Sebastiano A G; Helbling, Rossana; Simonetti, Giacomo D; Bianchetti, Mario G; Milani, Gregorio P

    2016-09-01

    Acute pancreatitis and acalculous cholecystitis have been occasionally reported in primary acute symptomatic Epstein-Barr virus infection. We completed a review of the literature and retained 48 scientific reports published between 1966 and 2016 for the final analysis. Acute pancreatitis was recognized in 14 and acalculous cholecystitis in 37 patients with primary acute symptomatic Epstein-Barr virus infection. In all patients, the features of acute pancreatitis or acalculous cholecystitis concurrently developed with those of primary acute symptomatic Epstein-Barr virus infection. Acute pancreatitis and acalculous cholecystitis resolved following a hospital stay of 25days or less. Acalculous cholecystitis was associated with Gilbert-Meulengracht syndrome in two cases. In conclusion, this thorough analysis indicates that acute pancreatitis and acalculous cholecystitis are unusual but plausible complications of primary acute symptomatic Epstein-Barr virus infection. Pancreatitis and cholecystitis deserve consideration in cases with severe abdominal pain. These complications are usually rather mild and resolve spontaneously without sequelae. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Relapsing acute disseminated encephalomyelitis associated with chronic Epstein-Barr virus infection: MRI findings

    Energy Technology Data Exchange (ETDEWEB)

    Shoji, H.; Kusuhara, T.; Honda, Y.; Hino, H. (1. Dept. (Neurology) of Internal Medicine, Kurume Univ. School of Medicine (Japan)); Kojima, K.; Abe, T. (Dept. of Radiology, Kurume Univ. School of Medicine (Japan)); Watanabe, M. (Dept. of Neurosurgery, Koyanagi Hospital, Saga (Japan))

    1992-08-01

    A 25-year-old women had a fever, left cervical lymphadenopathy, neurological symptoms and signs, CSF pleocytosis and persistent high serum antibodies to the Epstein-Barr virus (EBV); she had a recurrence 1 year later. She was thought to have relapsing acute disseminated encephalomyelitis associated with chronic EBV infection. MRI revealed abnormalities, mainly in the right basal ganglia and left midbrain. At the time of the recurrence, further abnormalities appeared in the opposite basal ganglia and right cerebral white matter. (orig.).

  18. Feline immunodeficiency virus can be experimentally transmitted via milk during acute maternal infection.

    OpenAIRE

    Sellon, R K; Jordan, H L; Kennedy-Stoskopf, S; Tompkins, M B; Tompkins, W A

    1994-01-01

    Postnatal transmission of feline immunodeficiency virus (FIV) in neonates nursed by acutely infected mothers and infection resulting from oral inoculation of kittens with FIV were evaluated. Ten of 16 kittens nursed by four queens with FIV infection established immediately postpartum developed FIV infection. Five of 11 neonates orally administered cell-free FIV culture supernatant developed FIV infection. Kittens that developed FIV infection had greater proportions of CD4+ and Pan-T+ lymphocy...

  19. Acute Respiratory Distress Syndrome Caused by Influenza B Virus Infection in a Patient with Diffuse Large B-Cell Lymphoma

    Directory of Open Access Journals (Sweden)

    Silvio A. Ñamendys-Silva

    2011-01-01

    Full Text Available Influenza B virus infections are less common than infections caused by influenza A virus in critically ill patients, but similar mortality rates have been observed for both influenza types. Pneumonia caused by influenza B virus is uncommon and has been reported in pediatric patients and previously healthy adults. Critically ill patients with pneumonia caused by influenza virus may develop acute respiratory distress syndrome. We describe the clinical course of a critically ill patient with diffuse large B-cell lymphoma nongerminal center B-cell phenotype who developed acute respiratory distress syndrome caused by influenza B virus infection. This paper emphasizes the need to suspect influenza B virus infection in critically ill immunocompromised patients with progressive deterioration of cardiopulmonary function despite treatment with antibiotics. Early initiation of neuraminidase inhibitor and the implementation of guidelines for management of severe sepsis and septic shock should be considered.

  20. Infection with hepatitis A, B, C, and delta viruses among patients with acute hepatitis in Mongolia.

    Science.gov (United States)

    Tsatsralt-Od, Bira; Takahashi, Masaharu; Endo, Kazunori; Buyankhuu, Osorjin; Baatarkhuu, Oidov; Nishizawa, Tsutomu; Okamoto, Hiroaki

    2006-05-01

    One hundred ten consecutive patients (60 males and 50 females; age, mean +/- standard deviation [SD], 22.6 +/- 6.4 years; range 16-48 years) who were clinically diagnosed with sporadic acute hepatitis between December 2004 and January 2005 in Ulaanbaatar, Mongolia, were studied. IgM antibodies to hepatitis A virus were detected in 18 patients (16.4%), IgM antibodies to hepatitis B core (anti-HBc IgM) in 38 patients (34.5%) including two patients with concurrent hepatitis delta virus (HDV) infection, and hepatitis C virus RNA in nine patients (8.2%). There were 30 hepatitis B virus (HBV) carriers who had detectable hepatitis B surface antigen and antibodies to HDV but were negative for anti-HBc IgM, suggesting that they acquired type D acute hepatitis due to superinfection of HDV on a background of chronic HBV infection. None had IgM antibodies to hepatitis E virus (HEV). Consequently, 16.4, 32.7, 6.4, 1.8, and 27.3% of the patients were diagnosed as having acute hepatitis of type A, B, C, type B + D (HBV/HDV coinfection), and type D (superinfection of HDV), respectively. The cause of hepatitis was not known in the remaining 17 patients (15.5%). All 18 HAV isolates were genotyped as IA, all 9 HCV isolates were genotyped as 1b, and all 32 HDV isolates were classified into genotype I. The distribution of HBV genotypes among the 67 HBV isolates was A (1.5%, n = 1) and D (98.5%, n = 66). The present study indicates that de novo infections of HAV, HBV, HCV, and HDV are prevalent among young adults in Mongolia. Copyright 2006 Wiley-Liss, Inc.

  1. Israeli acute paralysis virus: epidemiology, pathogenesis and implications for honey bee health and Colony Collapse Disorder (CCD)

    Science.gov (United States)

    Israeli acute paralysis virus (IAPV) is a widespread RNA virus that was linked with honey bee Colony Collapse Disorder (CCD), the sudden and massive die-off of honey bee colonies in the U.S. in 2006-2007. Here we describe the transmission, prevalence and genetic diversity of IAPV, host transcripti...

  2. Viruses in nondisinfected drinking water from municipal wells and community incidence of acute gastrointestinal illness.

    Science.gov (United States)

    Borchardt, Mark A; Spencer, Susan K; Kieke, Burney A; Lambertini, Elisabetta; Loge, Frank J

    2012-09-01

    Groundwater supplies for drinking water are frequently contaminated with low levels of human enteric virus genomes, yet evidence for waterborne disease transmission is lacking. We related quantitative polymerase chain reaction (qPCR)-measured enteric viruses in the tap water of 14 Wisconsin communities supplied by nondisinfected groundwater to acute gastrointestinal illness (AGI) incidence. AGI incidence was estimated from health diaries completed weekly by households within each study community during four 12-week periods. Water samples were collected monthly from five to eight households per community. Viruses were measured by qPCR, and infectivity assessed by cell culture. AGI incidence was related to virus measures using Poisson regression with random effects. Communities and time periods with the highest virus measures had correspondingly high AGI incidence. This association was particularly strong for norovirus genogroup I (NoV-GI) and between adult AGI and enteroviruses when echovirus serotypes predominated. At mean concentrations of 1 and 0.8 genomic copies/L of NoV-GI and enteroviruses, respectively, the AGI incidence rate ratios (i.e., relative risk) increased by 30%. Adenoviruses were common, but tap-water concentrations were low and not positively associated with AGI. The estimated fraction of AGI attributable to tap-water-borne viruses was between 6% and 22%, depending on the virus exposure-AGI incidence model selected, and could have been as high as 63% among children water. The majority of groundwater-source public water systems in the United States produce water without disinfection, and our findings suggest that populations served by such systems may be exposed to waterborne viruses and consequent health risks.

  3. Twenty years' delay of fellow eye involvement in herpes simplex virus type 2-associated bilateral acute retinal necrosis syndrome

    NARCIS (Netherlands)

    Schlingemann, R. O.; Bruinenberg, M.; Wertheim-van Dillen, P.; Feron, E.

    1996-01-01

    PURPOSE: To describe a case of acute retinal necrosis with concurrent encephalitis and determine the causative virus. The patient had a history of presumed acute retinal necrosis in the left eye at the age of 8 years and recurrent genital herpes. METHODS: Diagnostic anterior chamber puncture of the

  4. Severity of acute Zika virus infection: A prospective emergency room surveillance study during the 2015–2016 outbreak in Suriname

    NARCIS (Netherlands)

    Vroon, P. (Pieter); Roosblad, J. (Jimmy); Poese, F. (Fauzia); J.C. Wilschut (Jan C.); Codrington, J. (John); Vreden, S. (Stephen); Zonneveld, R. (Rens)

    2017-01-01

    textabstractAcute Zika virus (ZIKV) infection is usually mild and self-limiting. Earlier, we reported three cases of fatal acute ZIKV infection in patients without typical signs of ZIKV, but rather with criteria of systemic inflammation response syndrome (SIRS). To follow up these observations, we

  5. Angiographic Features and Cardiovascular Risk Factors in Human Immunodeficiency Virus-Infected Patients With First-Time Acute Coronary Syndrome

    DEFF Research Database (Denmark)

    Knudsen, Andreas; Mathiasen, Anders B; Worck, R.H.

    2013-01-01

    A matched cohort study was conducted comparing patients with first-time acute coronary syndromes infected with human immunodeficiency virus (HIV) to non-HIV-infected patients with and without diabetes matched for smoking, gender, and type of acute coronary syndrome who underwent first-time corona...

  6. Israeli Acute Paralysis Virus: Epidemiology, Pathogenesis and Implications for Honey Bee Health

    Science.gov (United States)

    Chen, Yan Ping; Pettis, Jeffery S.; Corona, Miguel; Chen, Wei Ping; Li, Cong Jun; Spivak, Marla; Visscher, P. Kirk; DeGrandi-Hoffman, Gloria; Boncristiani, Humberto; Zhao, Yan; vanEngelsdorp, Dennis; Delaplane, Keith; Solter, Leellen; Drummond, Francis; Kramer, Matthew; Lipkin, W. Ian; Palacios, Gustavo; Hamilton, Michele C.; Smith, Barton; Huang, Shao Kang; Zheng, Huo Qing; Li, Ji Lian; Zhang, Xuan; Zhou, Ai Fen; Wu, Li You; Zhou, Ji Zhong; Lee, Myeong-L.; Teixeira, Erica W.; Li, Zhi Guo; Evans, Jay D.

    2014-01-01

    Israeli acute paralysis virus (IAPV) is a widespread RNA virus of honey bees that has been linked with colony losses. Here we describe the transmission, prevalence, and genetic traits of this virus, along with host transcriptional responses to infections. Further, we present RNAi-based strategies for limiting an important mechanism used by IAPV to subvert host defenses. Our study shows that IAPV is established as a persistent infection in honey bee populations, likely enabled by both horizontal and vertical transmission pathways. The phenotypic differences in pathology among different strains of IAPV found globally may be due to high levels of standing genetic variation. Microarray profiles of host responses to IAPV infection revealed that mitochondrial function is the most significantly affected biological process, suggesting that viral infection causes significant disturbance in energy-related host processes. The expression of genes involved in immune pathways in adult bees indicates that IAPV infection triggers active immune responses. The evidence that silencing an IAPV-encoded putative suppressor of RNAi reduces IAPV replication suggests a functional assignment for a particular genomic region of IAPV and closely related viruses from the Family Dicistroviridae, and indicates a novel therapeutic strategy for limiting multiple honey bee viruses simultaneously and reducing colony losses due to viral diseases. We believe that the knowledge and insights gained from this study will provide a new platform for continuing studies of the IAPV–host interactions and have positive implications for disease management that will lead to mitigation of escalating honey bee colony losses worldwide. PMID:25079600

  7. Prevalence of human cosavirus and saffold virus with an emergence of saffold virus genotype 6 in patients hospitalized with acute gastroenteritis in Chiang Mai, Thailand, 2014-2016.

    Science.gov (United States)

    Menage, Lucy; Yodmeeklin, Arpaporn; Khamrin, Pattara; Kumthip, Kattareeya; Maneekarn, Niwat

    2017-09-01

    Human cosavirus and saffold virus are both newly discovered members of the Picornaviridae family. It has been suggested that these viruses may be the causative agents of acute gastroenteritis. In this study, 1093 stool samples collected from patients with acute gastroenteritis between January 2014 and December 2016, were screened for cosavirus and saffold virus using reverse transcription-polymerase chain reaction. The viral genotypes were then established via nucleotide sequencing. Here, cosavirus was detected in 16 of 1093 stool samples (1.5%) and saffold virus was detected in 18 of 1093 stool samples (1.6%). The saffold virus genotypes 1 (16.7%), 2 (50%) and 6 (33.3%), and the cosavirus genetic groups A (87.5%), C (6.25%) and D (6.25%), were all identified across the three-year study period. Interestingly, saffold virus genotype 6 has now been detected for the first time in Thailand. The present study provides the prevalence of cosavirus and saffold virus with the emergence of saffold virus genotype 6 in Thailand. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Pharyngeal-cervical-brachial variant of pediatric Guillain-Barré syndrome with antecedent acute hepatitis A virus infection.

    Science.gov (United States)

    Thapa, Rajoo; Biswas, Biawajit; Mallick, Debkrishna; Mukherjee, Swapan

    2009-07-01

    Pharyngeal-cervical-brachial weakness is considered a variant of Guillain-Barré syndrome with limited oropharyngeal, neck, and upper limb muscle involvement. The authors report on a 7-year-old boy, who developed pharyngeal-cervical-brachial type of Guillain-Barré syndrome following an antecedent episode of acute hepatitis A virus infection, 2 weeks prior to admission. The presentation was characterized by acute onset dysphagia, loss of head control, and bilateral arm weakness. The diagnosis was confirmed by acute motor axonal changes in the arm and albuminocytologic dissociation of the cerebrospinal fluid. The child was treated with intravenous immunoglobulin, which resulted in gradual improvement over 3 weeks. Documented instances of this form of Guillain-Barré syndrome remain rare in the pediatric age group, with none existing following antecedent hepatitis A virus infection. The authors emphasize that acute hepatitis A virus infection be included in the triggers responsible for Guillain-Barré syndrome in children.

  9. Clinical implications of hepatitis A virus ribonucleic acid detection and genotyping in acute liver failure in children in Argentina.

    Science.gov (United States)

    Sasbón, Jorge S; Buamscha, Daniel; Gianivelli, Silvina; Imventarza, Oscar; Devictor, Denis; Moreiro, Rita; Cambaceres, Carlos; Salip, Gonzalo; Ciocca, Mirta; Cuarterolo, Miriam; Vladimirsky, Sara; Otegui, Lucio; Castro, Raúl; Brajterman, Leonardo; Soto, Sonia; González, Jorge; Munné, María S

    2010-05-01

    To investigate the detection of hepatitis A virus ribonucleic acid in patients with acute liver failure and to assess if the results have any clinical implications for the evolution of acute liver failure in children. Hepatitis A infection, a vaccine-preventable disease, is an important cause of acute liver failure in children in Argentina. Universal vaccination in 1-yr-old children was implemented in June 2005. Observational study in which patients were divided into Group 1 consisting of positive hepatitis A virus ribonucleic acid and Group 2 consisting of negative hepatitis A virus ribonucleic acid. Pediatric intensive care unit in National Pediatric Hospital "Dr. J. P. Garrahan," Buenos Aires, Argentina. Thirty-three patients with the diagnosis of acute liver failure secondary to hepatitis A virus infection and admitted to the Garrahan Pediatric Hospital between September 2003 and September 2005 were enrolled in the study. Twenty of these children were admitted to the pediatric intensive care unit. None. Samples for total ribonucleic acid detection and genotyping were obtained from serum and/or stools on admission. We found positive hepatitis A virus ribonucleic acid in 13 patients and negative hepatitis A virus ribonucleic acid in 20 patients. The following clinical variables were evaluated: time of evolution, hospital stay, admission to the pediatric intensive care unit, pediatric intensive care unit stay, time on mechanical ventilation, criteria for orthotopic liver transplantation, and mortality. Characterization of the isolates did not reveal differences related to genotype; all cases were IA. No statistical significance was found as to the variables. However, positive hepatitis A virus ribonucleic acid showed lower percentages of pediatric intensive care unit admissions, criteria for orthotopic liver transplantation, number of orthotopic liver transplantation, and mortality than the group of patients with negative hepatitis A virus ribonucleic acid

  10. Elevation of Serum Acid Sphingomyelinase Activity in Children with Acute Respiratory Syncytial Virus Bronchiolitis.

    Science.gov (United States)

    Yoshida, Shuichiro; Noguchi, Atsuko; Kikuchi, Wataru; Fukaya, Hiroshi; Igarashi, Kiyoshi; Takahashi, Tsutomu

    2017-12-01

    Acid sphingomyelinase (ASM) is a lysosomal enzyme that hydrolyzes sphingomyelin into ceramide, a bioactive lipid to regulate cellular physiological functions. Thus, ASM activation has been reported as a key event in pathophysiological reactions including inflammation, cytokine release, oxidative stress, and endothelial damage in human diseases. Since ASM activation is associated with extracellular ASM secretion through unknown mechanisms, it can be detected by recognizing the elevation of secretory ASM (S-ASM) activity. Serum S-ASM activity has been reported to increase in chronic diseases, acute cardiac diseases, and systemic inflammatory diseases. However, the serum S-ASM has not been investigated in common acute illness. This study was designed to evaluate serum S-ASM activity in children with common acute illness. Fifty children with common acute illness and five healthy children were included in this study. The patients were categorized into five groups based on clinical diagnoses: acute respiratory syncytial virus (RSV) bronchiolitis, adenovirus infection, streptococcal infection, asthma, and other infections due to unknown origin. The serum S-ASM activity was significantly elevated at 6.9 ± 1.6 nmol/0.1 mL/6 h in the group of acute RSV bronchiolitis patients compared with healthy children who had a mean level of 1.8 ± 0.8 nmol/0.1 mL/6 h (p ASM activity was not significantly elevated. The results suggest an association of ASM activation with RSV infection, a cause for common acute illness. This is the first report to describe the elevation of serum S-ASM activity in respiratory tract infection.

  11. Development of human monoclonal antibodies against diseases caused by emerging and biodefense-related viruses.

    Science.gov (United States)

    Zhu, Zhongyu; Dimitrov, Antony S; Chakraborti, Samitabh; Dimitrova, Dimana; Xiao, Xiaodong; Broder, Christopher C; Dimitrov, Dimiter S

    2006-02-01

    Polyclonal antibodies have a century-old history of being effective against some viruses; recently, monoclonal antibodies (mAbs) have also shown success. The humanized mAb Synagis (palivizumab), which is still the only mAb against a viral disease approved by the US FDA, has been widely used as a prophylactic measure against respiratory syncytial virus infections in neonates and immunocompromised individuals. The first fully human mAbs against two other paramyxoviruses, Hendra and Nipah virus, which can cause high (up to 75%) mortality, were recently developed; one of them, m101, showed exceptional potency against infectious virus. In an amazing pace of research, several potent human mAbs targeting the severe acute respiratory syndrome coronavirus S glycoprotein that can affect infections in animal models have been developed months after the virus was identified in 2003. A potent humanized mAb with therapeutic potential was recently developed against the West Nile virus. The progress in developing neutralizing human mAbs against Ebola, Crimean-Congo hemorrhagic fever, vaccinia and other emerging and biodefense-related viruses is slow. A major problem in the development of effective therapeutic agents against viruses, including therapeutic antibodies, is the viruses' heterogeneity and mutability. A related problem is the low binding affinity of crossreactive antibodies able to neutralize a variety of primary isolates. Combinations of mAbs or mAbs with other drugs, and/or the identification of potent new mAbs and their derivatives that target highly conserved viral structures, which are critical for virus entry into cells, are some of the possible solutions to these problems, and will continue to be a major focus of antiviral research.

  12. Emerging tropical diseases in Australia. Part 5. Hendra virus.

    Science.gov (United States)

    Tulsiani, S M; Graham, G C; Moore, P R; Jansen, C C; Van Den Hurk, A F; Moore, F A J; Simmons, R J; Craig, S B

    2011-01-01

    Hendra virus (HeV) was first isolated in 1994, from a disease outbreak involving at least 21 horses and two humans in the Brisbane suburb of Hendra, Australia. The affected horses and humans all developed a severe but unidentified respiratory disease that resulted in the deaths of one of the human cases and the deaths or putting down of 14 of the horses. The virus, isolated by culture from a horse and the kidney of the fatal human case, was initially characterised as a new member of the genus Morbillivirus in the family Paramyxoviridae. Comparative sequence analysis of part of the matrix protein gene of the virus and the discovery that the virus had an exceptionally large genome subsequently led to HeV being assigned to a new genus, Henipavirus, along with Nipah virus (a newly emergent virus in pigs). The regular outbreaks of HeV-related disease that have occurred in Australia since 1994 have all been characterised by acute respiratory and neurological manifestations, with high levels of morbidity and mortality in the affected horses and humans. The modes of transmission of HeV remain largely unknown. Although fruit bats have been identified as natural hosts of the virus, direct bat-horse, bat-human or human-human transmission has not been reported. Human infection can occur via exposure to infectious urine, saliva or nasopharyngeal fluid from horses. The treatment options and efficacy are very limited and no vaccine exists. Reports on the outbreaks of HeV in Australia are collated in this review and the available data on the biology, transmission and detection of the pathogen are summarized and discussed.

  13. Cross reactivity of commercial anti-dengue immunoassays in patients with acute Zika virus infection.

    Science.gov (United States)

    Felix, Alvina Clara; Souza, Nathalia C Santiago; Figueiredo, Walter M; Costa, Angela A; Inenami, Marta; da Silva, Rosangela M G; Levi, José Eduardo; Pannuti, Claudio Sergio; Romano, Camila Malta

    2017-08-01

    Several countries have local transmission of multiple arboviruses, in particular, dengue and Zika viruses, which have recently spread through many American countries. Cross reactivity among Flaviviruses is high and present a challenge for accurate identification of the infecting agent. Thus, we evaluated the level of cross reactivity of anti-dengue IgM/G Enzyme-Linked Immunosorbent Assays (ELISA) from three manufacturers against 122 serum samples obtained at two time-points from 61 patients with non-dengue confirmed Zika virus infection. All anti-dengue ELISAs cross reacted with serum from patients with acute Zika infection at some level and a worrisome number of seroconversion for dengue IgG and IgM was observed. These findings may impact the interpretation of currently standard criteria for dengue diagnosis in endemic regions. © 2017 Wiley Periodicals, Inc.

  14. Detection of respiratory viruses and Bordetella bronchiseptica in dogs with acute respiratory tract infections.

    Science.gov (United States)

    Schulz, B S; Kurz, S; Weber, K; Balzer, H-J; Hartmann, K

    2014-09-01

    Canine infectious respiratory disease (CIRD) is an acute, highly contagious disease complex caused by a variety of infectious agents. At present, the role of viral and bacterial components as primary or secondary pathogens in CIRD is not fully understood. The aim of this study was to investigate the prevalence of canine parainfluenza virus (CPIV), canine adenovirus type 2 (CAV-2), canine influenza virus (CIV), canine respiratory coronavirus (CRCoV), canine herpes virus-1 (CHV-1), canine distemper virus (CDV) and Bordetella bronchiseptica in dogs with CIRD and to compare the data with findings in healthy dogs. Sixty-one dogs with CIRD and 90 clinically healthy dogs from Southern Germany were prospectively enrolled in this study. Nasal and pharyngeal swabs were collected from all dogs and were analysed for CPIV, CAV-2, CIV, CRCoV, CHV-1, CDV, and B. bronchiseptica by real-time PCR. In dogs with acute respiratory signs, 37.7% tested positive for CPIV, 9.8% for CRCoV and 78.7% for B. bronchiseptica. Co-infections with more than one agent were detected in 47.9% of B. bronchiseptica-positive, 82.6% of CPIV-positive, and 100% of CRCoV-positive dogs. In clinically healthy dogs, 1.1% tested positive for CAV-2, 7.8% for CPIV and 45.6% for B. bronchiseptica. CPIV and B. bronchiseptica were detected significantly more often in dogs with CIRD than in clinically healthy dogs (P infectious agents in dogs with CIRD in Southern Germany. Mixed infections with several pathogens were common. In conclusion, clinically healthy dogs can carry respiratory pathogens and could act as sources of infection for susceptible dogs. Copyright © 2014 Elsevier Ltd. All rights reserved.

  15. Genetic Analysis of Israel Acute Paralysis Virus: Distinct Clusters Are Circulating in the United States▿

    Science.gov (United States)

    Palacios, G.; Hui, J.; Quan, P. L.; Kalkstein, A.; Honkavuori, K. S.; Bussetti, A. V.; Conlan, S.; Evans, J.; Chen, Y. P.; vanEngelsdorp, D.; Efrat, H.; Pettis, J.; Cox-Foster, D.; Holmes, E. C.; Briese, T.; Lipkin, W. I.

    2008-01-01

    Israel acute paralysis virus (IAPV) is associated with colony collapse disorder of honey bees. Nonetheless, its role in the pathogenesis of the disorder and its geographic distribution are unclear. Here, we report phylogenetic analysis of IAPV obtained from bees in the United States, Canada, Australia, and Israel and the establishment of diagnostic real-time PCR assays for IAPV detection. Our data indicate the existence of at least three distinct IAPV lineages, two of them circulating in the United States. Analysis of representatives from each proposed lineage suggested the possibility of recombination events and revealed differences in coding sequences that may have implications for virulence. PMID:18434396

  16. Human metapneumovirus and respiratory syncytial virus in hospitalized danish children with acute respiratory tract infection

    DEFF Research Database (Denmark)

    von Linstow, Marie-Louise; Henrik Larsen, Hans; Koch, Anders

    2004-01-01

    The newly discovered human metapneumovirus (hMPV) has been shown to be associated with respiratory illness. We determined the frequencies and clinical features of hMPV and respiratory syncytial virus (RSV) infections in 374 Danish children with 383 episodes of acute respiratory tract infection...... children 1-6 months of age. Asthmatic bronchitis was diagnosed in 66.7% of hMPV and 10.6% of RSV-infected children (p respiratory support. hMPV is present in young...

  17. Viruses and bacteria in acute asthma exacerbations - A GA(2) LEN-DARE* systematic review

    DEFF Research Database (Denmark)

    Papadopoulos, N G; Christodoulou, I; Rohde, G

    2011-01-01

    less or not clearly associated. Mycoplasma and Chlamydophila pneumoniae seem to be involved more with asthma persistence rather than with disease exacerbations. Recent data suggest that common bacteria may also be involved, but this should be confirmed. Although current information is considerable...... and bacteria in acute asthma exacerbations - A GA(2) LEN-DARE systematic review. Allergy 2010; DOI: 10.1111/j.1398-9995.2010.02505.x. ABSTRACT: A major part of the burden of asthma is caused by acute exacerbations. Exacerbations have been strongly and consistently associated with respiratory infections....... Respiratory viruses and bacteria are therefore possible treatment targets. To have a reasonable estimate of the burden of disease induced by such infectious agents on asthmatic patients, it is necessary to understand their nature and be able to identify them in clinical samples by employing accurate...

  18. Varicella zoster virus acute retinal necrosis following eye contusion: case report

    Directory of Open Access Journals (Sweden)

    Kovařík Zdeněk

    2005-08-01

    Full Text Available Abstract Background Acute retinal necrosis is a sight-threatening disease caused by the group of herpesviruses. The aim of this paper is to report a case of acute retinal necrosis following ocular trauma in a patient initially treated with vaso-active drugs and corticosteroids for presumed ocular ischemic syndrome. Case presentation A 51-years-old otherwise healthy man, who suffered from sudden visual loss in the left eye following contusion, was commenced on vaso-active drugs and systemic corticosteroids for suspected ocular ischemic syndrome with extensive swelling of the optic disc and macular edema. Subsequently, vision in the initially uninvolved right eye decreased. Polymerase chain reaction of vitreous samples and retinal biopsy confirmed varicella zoster virus. Despite intensive treatment with intravenous antiviral medication, the patient became completely blind in both eyes. Conclusion Initial treatment of acute, unexplained visual decrease with systemic corticosteroids may lead to visual loss in patients with developing acute retinal necrosis. Ocular trauma could have induced and corticosteroid treatment promoted reactivation of a latent viral infection in our patient.

  19. Epstein-Barr virus associated acute hepatitis with cross-reacting antibodies to other herpes viruses in immunocompetent patients: report of two cases.

    Science.gov (United States)

    Gupta, Ekta; Bhatia, Vikram; Choudhary, Aashish; Rastogi, Archana; Gupta, Naveen L

    2013-03-01

    Epstein-Barr virus (EBV) is the causative agent of infectious mononucleosis (IM) which is characterized by the triad of fever, sore throat, and lymphadenopathy. Self-limited, mild liver function test abnormalities are seen in IM. Acute hepatitis in primary EBV infection is uncommon. Serum transaminases are elevated but are less than fivefold the normal levels in most cases and rarely exceed 10 times the normal levels in primary EBV infections especially in elderly. Laboratory diagnosis of acute EBV infection is by serological assays confirming the presence of EBV viral capsid antigen (VCA) IgM antibodies. Due to antigenic cross-reactivity with Herpes viruses, serological assays lack specificity; hence specific molecular diagnostic methods are required for confirmation of the etiology. The present report describes two cases of acute hepatitis caused by infection with EBV which had indistinguishable clinical features and biochemical markers from acute hepatitis caused by hepatotropic viruses such as hepatitis viruses A-E. The diagnosis of infection by EBV was confirmed by detection of EBV DNA in blood of both the patients and EBV DNA in the liver tissue of one of the patients. Copyright © 2013 Wiley Periodicals, Inc.

  20. Rapid Screening for Entry Inhibitors of Highly Pathogenic Viruses under Low-Level Biocontainment

    Science.gov (United States)

    Talekar, Aparna; Pessi, Antonello; Glickman, Fraser; Sengupta, Uttara; Briese, Thomas; Whitt, Michael A.; Mathieu, Cyrille; Horvat, Branka; Moscona, Anne; Porotto, Matteo

    2012-01-01

    Emerging viruses including Nipah, Hendra, Lujo, and Junin viruses have enormous potential to spread rapidly. Nipah virus, after emerging as a zoonosis, has also evolved the capacity for human-to-human transmission. Most of the diseases caused by these pathogens are untreatable and require high biocontainment conditions. Universal methods for rapidly identifying and screening candidate antivirals are urgently needed. We have developed a modular antiviral platform strategy that relies on simple bioinformatic and genetic information about each pathogen. Central to this platform is the use of envelope glycoprotein cDNAs to establish multi-cycle replication systems under BSL2 conditions for viral pathogens that normally require BSL3 and BSL4 facilities. We generated monoclonal antibodies against Nipah G by cDNA immunization in rats, and we showed that these antibodies neutralize both Nipah and Hendra live viruses. We then used these effective Henipavirus inhibitors to validate our screening strategy. Our proposed strategy should contribute to the response capability for emerging infectious diseases, providing a way to initiate antiviral development immediately upon identifying novel viruses. PMID:22396728

  1. Rapid screening for entry inhibitors of highly pathogenic viruses under low-level biocontainment.

    Directory of Open Access Journals (Sweden)

    Aparna Talekar

    Full Text Available Emerging viruses including Nipah, Hendra, Lujo, and Junin viruses have enormous potential to spread rapidly. Nipah virus, after emerging as a zoonosis, has also evolved the capacity for human-to-human transmission. Most of the diseases caused by these pathogens are untreatable and require high biocontainment conditions. Universal methods for rapidly identifying and screening candidate antivirals are urgently needed. We have developed a modular antiviral platform strategy that relies on simple bioinformatic and genetic information about each pathogen. Central to this platform is the use of envelope glycoprotein cDNAs to establish multi-cycle replication systems under BSL2 conditions for viral pathogens that normally require BSL3 and BSL4 facilities. We generated monoclonal antibodies against Nipah G by cDNA immunization in rats, and we showed that these antibodies neutralize both Nipah and Hendra live viruses. We then used these effective Henipavirus inhibitors to validate our screening strategy. Our proposed strategy should contribute to the response capability for emerging infectious diseases, providing a way to initiate antiviral development immediately upon identifying novel viruses.

  2. Respiratory viruses in young South African children with acute lower respiratory infections and interactions with HIV.

    Science.gov (United States)

    Annamalay, Alicia A; Abbott, Salome; Sikazwe, Chisha; Khoo, Siew-Kim; Bizzintino, Joelene; Zhang, Guicheng; Laing, Ingrid; Chidlow, Glenys R; Smith, David W; Gern, James; Goldblatt, Jack; Lehmann, Deborah; Green, Robin J; Le Souëf, Peter N

    2016-08-01

    Human rhinovirus (RV) is the most common respiratory virus and has been associated with frequent and severe acute lower respiratory infections (ALRI). The prevalence of RV species among HIV-infected children in South Africa is unknown. To describe the prevalence of respiratory viruses, including RV species, associated with HIV status and other clinical symptoms in children less than two years of age with and without ALRI in Pretoria, South Africa. Nasopharyngeal aspirates were collected from 105 hospitalized ALRI cases and 53 non-ALRI controls less than two years of age. HIV status was determined. Common respiratory viruses were identified by PCR, and RV species and genotypes were identified by semi-nested PCR, sequencing and phylogenetic tree analyses. Respiratory viruses were more common among ALRI cases than controls (83.8% vs. 69.2%; p=0.041). RV was the most commonly identified virus in cases with pneumonia (45.6%) or bronchiolitis (52.1%), regardless of HIV status, as well as in controls (39.6%). RV-A was identified in 26.7% of cases and 15.1% of controls while RV-C was identified in 21.0% of cases and 18.9% of controls. HIV-infected children were more likely to be diagnosed with pneumonia than bronchiolitis (pHIV-infected cases (n=15) compared with 30.6% of HIV-uninfected cases (n=85, p=0.013), and was identified more frequently in bronchiolitis than in pneumonia cases (43.8% vs. 12.3%; pHIV infection may be protective against RSV and bronchiolitis. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Dynamics of the Presence of Israeli Acute Paralysis Virus in Honey Bee Colonies with Colony Collapse Disorder

    OpenAIRE

    Hou, Chunsheng; Rivkin, Hadassah; Slabezki, Yossi; Chejanovsky, Nor

    2014-01-01

    The determinants of Colony Collapse Disorder (CCD), a particular case of collapse of honey bee colonies, are still unresolved. Viruses including the Israeli acute paralysis virus (IAPV) were associated with CCD. We found an apiary with colonies showing typical CCD characteristics that bore high loads of IAPV, recovered some colonies from collapse and tested the hypothesis if IAPV was actively replicating in them and infectious to healthy bees. We found that IAPV was the dominant pathogen and ...

  4. Liver and spleen MRI findings in virus-associated hemophagocytic syndrome in a patient with acute lymphocytic leukemia

    International Nuclear Information System (INIS)

    Zilkha, A.; Madan, V.; Leonidas, J.C.; Valderrama, E.

    1998-01-01

    Virus-associated hemophagocytic syndrome is characterized by the phagocytosis of erthythrocytes and other blood elements in multiple organ systems, especially the liver and spleen. Magnetic resonance imaging (MRI) can suggest this diagnosis in the proper clinical setting by demonstrating multiple, rounded signal voids in the spleen corresponding to hemosiderin deposition. We report a patient with virus-associated hemophagocytic syndrome during the course of acute lymphocytic leukemia and MRI findings that suggested the preoperative diagnosis. (orig.)

  5. Liver and spleen MRI findings in virus-associated hemophagocytic syndrome in a patient with acute lymphocytic leukemia

    Energy Technology Data Exchange (ETDEWEB)

    Zilkha, A.; Madan, V.; Leonidas, J.C. [Division of Pediatric Radiology, Island Jewish Medical Center, New Hyde Park, NY (United States); Valderrama, E. [Department of Pathology, Long Island Jewish Medical Center, New Hyde Park, NY (United States)

    1998-12-01

    Virus-associated hemophagocytic syndrome is characterized by the phagocytosis of erthythrocytes and other blood elements in multiple organ systems, especially the liver and spleen. Magnetic resonance imaging (MRI) can suggest this diagnosis in the proper clinical setting by demonstrating multiple, rounded signal voids in the spleen corresponding to hemosiderin deposition. We report a patient with virus-associated hemophagocytic syndrome during the course of acute lymphocytic leukemia and MRI findings that suggested the preoperative diagnosis. (orig.) With 1 fig., 4 refs.

  6. Superiority of West Nile Virus RNA Detection in Whole Blood for Diagnosis of Acute Infection.

    Science.gov (United States)

    Lustig, Yaniv; Mannasse, Batya; Koren, Ravit; Katz-Likvornik, Shiri; Hindiyeh, Musa; Mandelboim, Michal; Dovrat, Sara; Sofer, Danit; Mendelson, Ella

    2016-09-01

    The current diagnosis of West Nile virus (WNV) infection is primarily based on serology, since molecular identification of WNV RNA is unreliable due to the short viremia and absence of detectable virus in cerebrospinal fluid (CSF). Recent studies have shown that WNV RNA can be detected in urine for a longer period and at higher concentrations than in plasma. In this study, we examined the presence of WNV RNA in serum, plasma, whole-blood, CSF, and urine samples obtained from patients diagnosed with acute WNV infection during an outbreak which occurred in Israel in 2015. Our results demonstrate that 33 of 38 WNV patients had detectable WNV RNA in whole blood at the time of diagnosis, a higher rate than in any of the other sample types tested. Overall, whole blood was superior to all other samples, with 86.8% sensitivity, 100% specificity, 100% positive predictive value, and 83.9% negative predictive value. Interestingly, WNV viral load in urine was higher than in whole blood, CSF, serum, and plasma despite the lower sensitivity than that of whole blood. This study establishes the utility of whole blood in the routine diagnosis of acute WNV infection and suggests that it may provide the highest sensitivity for WNV RNA detection in suspected cases. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  7. Acute respiratory distress syndrome after convalescent plasma use: treatment of a patient with Ebola virus disease contracted in Madrid, Spain.

    Science.gov (United States)

    Mora-Rillo, Marta; Arsuaga, Marta; Ramírez-Olivencia, Germán; de la Calle, Fernando; Borobia, Alberto M; Sánchez-Seco, Paz; Lago, Mar; Figueira, Juan C; Fernández-Puntero, Belén; Viejo, Aurora; Negredo, Anabel; Nuñez, Concepción; Flores, Eva; Carcas, Antonio J; Jiménez-Yuste, Victor; Lasala, Fátima; García-de-Lorenzo, Abelardo; Arnalich, Francisco; Arribas, Jose R

    2015-07-01

    In the current epidemic of Ebola virus disease, health-care workers have been transferred to Europe and the USA for optimised supportive care and experimental treatments. We describe the clinical course of the first case of Ebola virus disease contracted outside of Africa, in Madrid, Spain. Herein we report clinical, laboratory, and virological findings of the treatment of a female nurse assistant aged 44 years who was infected with Ebola virus around Sept 25-26, 2014, while caring for a Spanish missionary with confirmed Ebola virus disease who had been medically evacuated from Sierra Leone to La Paz-Carlos III University Hospital, Madrid. We also describe the use of experimental treatments for Ebola virus disease in this patient. The patient was symptomatic for 1 week before first hospital admission on Oct 6, 2014. We used supportive treatment with intravenous fluids, broad-spectrum antibiotics, and experimental treatments with convalescent plasma from two survivors of Ebola virus disease and high-dose favipiravir. On day 10 of illness, she had acute respiratory distress syndrome, possibly caused by transfusion-related acute lung injury, which was managed without mechanical ventilation. Discharge was delayed because of the detection of viral RNA in several bodily fluids despite clearance of viraemia. The patient was discharged on day 34 of illness. At the time of discharge, the patient had possible subacute post-viral thyroiditis. None of the people who had contact with the patient before and after admission became infected with Ebola virus. This report emphasises the uncertainties about the efficacy of experimental treatments for Ebola virus disease. Clinicians should be aware of the possibility of transfusion-related acute lung injury when using convalescent plasma for the treatment of Ebola virus disease. La Paz-Carlos III University Hospital. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. Carnosine markedly ameliorates H9N2 swine influenza virus-induced acute lung injury.

    Science.gov (United States)

    Xu, Tong; Wang, Cunlian; Zhang, Ruihua; Xu, Mingju; Liu, Baojian; Wei, Dong; Wang, Guohua; Tian, Shufei

    2015-10-01

    Oxidative stress injury is an important pathogenesis of influenza virus in critically ill patients. The present study investigated the efficacy of carnosine, an antioxidant and free radical scavenger, on a model of acute lung injury (ALI) induced by H9N2 swine influenza virus. Female specific-pathogen-free BALB/c mice were randomized into four groups and treated as follows: (1) H9N2 group, (2) mock control group, (3) H9N2+carnosine group and (4) carnosine control group. The H9N2 group mice were inoculated intranasally with A/Swine/Hebei/012/2008/ (H9N2) virus (100 μl) in allantoic fluid (AF), whilst mock-infected animals were intranasally inoculated with non-infectious AF. Carnosine [10 mg (kg body mass)- 1] was administered orally (100 μl) for 7 days consecutively. The survival rate, lung water content, TNF-α and IL-1β levels, lung histopathology, myeloperoxidase (MPO) activity, and Toll-like receptor (TLR)-4 levels were determined at 2, 4, 6, 8 and 14 days after inoculation. Carnosine treatment effectively decreased the mortality (43 versus 75 %, P lungs and decreased the lung wet/dry mass ratio (P lungs of infected mice (P < 0.05), which supported the use of carnosine for managing severe influenza cases.

  9. Prevalence of IgG Autoantibodies against GD3 Ganglioside in Acute Zika Virus Infection

    Science.gov (United States)

    Nico, Dirlei; Conde, Luciana; Rivera-Correa, Juan L.; Vasconcelos-dos-Santos, Andréia; Mesentier-Louro, Louise; Freire-de-Lima, Leonardo; Arruda, Mônica Barcellos; Freire-de-Lima, Celio Geraldo; Ferreira, Orlando da Costa; Lopes Moreira, Maria Elisabeth; Zin, Andrea Araújo; Vasconcelos, Zilton Farias Meira; Otero, Rosalia Mendez; Palatnik-de-Sousa, Clarisa Beatriz; Tanuri, Amilcar; Todeschini, Adriane Regina; Savino, Wilson; Rodriguez, Ana; Morrot, Alexandre

    2018-01-01

    Zika virus (ZIKV) disease has become a global health emergency with devastating effects on public health. Recent evidences implicate the virus as an emergent neuropathological agent promoting serious pathologies of the human nervous system, that include destructive and malformation consequences such as development of ocular and fetal brain lesions, microcephaly in neonates, and Guillain–Barré syndrome (GBS) in adults. These neurological disorders of both central and peripheral nervous systems are thought to be associated to the neurotropic properties of the virus that has ability to infect neural stem cells as well as peripheral neurons, a hallmark of its pathogenicity. The presence of autoantibodies against gangliosides plays a pivotal role in the etiogenesis of GBS and a variety of neurological disorders. Gangliosides are a class of galactose-containing cerebrosides mainly expressed in nervous system tissues playing a critical role in the physiology of neural cells and neurogenesis. Herein, our findings indicate that patients at acute phase of ZIKV infection without any neurological signs show increased levels of IgG autoantibody against GD3 gangliosides, a class of glycolipid found to be highly expressed in neural stem cell acting in the maintenance of their self-renewal cellular capacity. It is possible that a pathological threshold of these antibodies is only acquired in secondary or subsequent infections. In the light of these evidences, we propose that the target of GD3 by autoimmune responses may possibly has an effect in the neuropathy and neurogenesis disorder seen during ZIKV infection. PMID:29594116

  10. Immune profile and Epstein-Barr virus infection in acute interstitial nephritis: an immunohistochemical study in 78 patients.

    LENUS (Irish Health Repository)

    Mansur, Abdurrezagh

    2011-01-01

    Acute interstitial nephritis (AIN) is a common cause of acute kidney injury and is characterised by a dense interstitial cellular infiltrate, which has not been well defined. Previous studies have demonstrated a correlation between Epstein-Barr virus (EBV) infection and AIN. The purpose of our study was to define the nature of the interstitial immune infiltrate and to investigate the possibility of renal infection with EBV.

  11. Acute renal failure in a child with thrombocytopenic purpura caused by acute Epstein-Barr virus infection after treatment with anti-D immunoglobulin.

    Science.gov (United States)

    Kossiva, Lydia; Kyriakou, Dimitrios; Mitsioni, Andromachi; Garoufi, Anastasia

    2013-06-01

    Immune thrombocytopenia (ITP) in children is usually a benign, self-limiting disorder. An acute Epstein-Barr virus (EBV) infection usually causes atypical lymphocytosis and mild decrease in platelets. Severe thrombocytopenia is an extremely rare complication. Anti-D immunoglobulin has been used for treatment of ITP in Rh(D)-positive nonsplenectomized patients. Severe hemolysis and acute renal failure are extremely rare complications that may be aggravated by the presence of an acute EBV infection. It is believed that anti-D immunoglobulin triggers an unusual virus-induced immune response causing hemolysis. We present a 4-year-old girl with ITP caused by an acute EBV infection that developed acute kidney injury following treatment with anti-D immunoglobulin. The patient recovered completely from thrombocytopenia and renal dysfunction. Intravascular hemolysis and acute kidney injury are consistent with anti-D immunoglobulin mechanism of action. Pediatric patients treated with anti-D immunoglobulin for ITP should be closely monitored for signs and symptoms of hemolysis that may be aggravated by the presence of EBV infection leading to impaired renal function.

  12. Comparative studies on virus detection in acute respiratory diseases in humans by means of RIA and cultivation

    International Nuclear Information System (INIS)

    Ehrlicher, L.

    1982-01-01

    In winter 1981, 146 patients with an acute respiratory infection were examined. Nasopharyngeal specimens were obtained by intranasal catheter. Comparative investigations were performed by cultivation in tissue culture and by a four-layer radioimmunoassay. In the radioimmunoassay, polystyrene beads were used as the solid phase, ginea pig antivirus immunoglobulins as the captive antibodies, rabbit anti-virus immunoglobulins as the secondary antibodies and 125 I-labelled sheep anti-rabbit immunoglobulins were used as the indicator antibodies. The radioimmunoassay was developed for the detection of adenovirus, respiratory syncytial virus, influenza A and B virus and parainfluenza type 1, type 2 and type 3 virus. Tissue culture seems to be more sensitive for detection of adenovirus and influenza A virus, though some infections with influenza A virus could only be diagnosed by the radioimmunoassay. In other cases (respiratory syncytial virus, influenza B virus) antigen detection by radioimmunoassay is more efficient. Presently the combination of both antigen-detection-systems still is the optimal diagnostic procedure for detecting virus infections of the respiratory tract. (orig./MG) [de

  13. Sequential bottlenecks drive viral evolution in early acute hepatitis C virus infection.

    Directory of Open Access Journals (Sweden)

    Rowena A Bull

    2011-09-01

    Full Text Available Hepatitis C is a pandemic human RNA virus, which commonly causes chronic infection and liver disease. The characterization of viral populations that successfully initiate infection, and also those that drive progression to chronicity is instrumental for understanding pathogenesis and vaccine design. A comprehensive and longitudinal analysis of the viral population was conducted in four subjects followed from very early acute infection to resolution of disease outcome. By means of next generation sequencing (NGS and standard cloning/Sanger sequencing, genetic diversity and viral variants were quantified over the course of the infection at frequencies as low as 0.1%. Phylogenetic analysis of reassembled viral variants revealed acute infection was dominated by two sequential bottleneck events, irrespective of subsequent chronicity or clearance. The first bottleneck was associated with transmission, with one to two viral variants successfully establishing infection. The second occurred approximately 100 days post-infection, and was characterized by a decline in viral diversity. In the two subjects who developed chronic infection, this second bottleneck was followed by the emergence of a new viral population, which evolved from the founder variants via a selective sweep with fixation in a small number of mutated sites. The diversity at sites with non-synonymous mutation was higher in predicted cytotoxic T cell epitopes, suggesting immune-driven evolution. These results provide the first detailed analysis of early within-host evolution of HCV, indicating strong selective forces limit viral evolution in the acute phase of infection.

  14. Sequential bottlenecks drive viral evolution in early acute hepatitis C virus infection.

    Science.gov (United States)

    Bull, Rowena A; Luciani, Fabio; McElroy, Kerensa; Gaudieri, Silvana; Pham, Son T; Chopra, Abha; Cameron, Barbara; Maher, Lisa; Dore, Gregory J; White, Peter A; Lloyd, Andrew R

    2011-09-01

    Hepatitis C is a pandemic human RNA virus, which commonly causes chronic infection and liver disease. The characterization of viral populations that successfully initiate infection, and also those that drive progression to chronicity is instrumental for understanding pathogenesis and vaccine design. A comprehensive and longitudinal analysis of the viral population was conducted in four subjects followed from very early acute infection to resolution of disease outcome. By means of next generation sequencing (NGS) and standard cloning/Sanger sequencing, genetic diversity and viral variants were quantified over the course of the infection at frequencies as low as 0.1%. Phylogenetic analysis of reassembled viral variants revealed acute infection was dominated by two sequential bottleneck events, irrespective of subsequent chronicity or clearance. The first bottleneck was associated with transmission, with one to two viral variants successfully establishing infection. The second occurred approximately 100 days post-infection, and was characterized by a decline in viral diversity. In the two subjects who developed chronic infection, this second bottleneck was followed by the emergence of a new viral population, which evolved from the founder variants via a selective sweep with fixation in a small number of mutated sites. The diversity at sites with non-synonymous mutation was higher in predicted cytotoxic T cell epitopes, suggesting immune-driven evolution. These results provide the first detailed analysis of early within-host evolution of HCV, indicating strong selective forces limit viral evolution in the acute phase of infection.

  15. Swine influenza H1N1 virus induces acute inflammatory immune responses in pig lungs: a potential animal model for human H1N1 influenza virus.

    Science.gov (United States)

    Khatri, Mahesh; Dwivedi, Varun; Krakowka, Steven; Manickam, Cordelia; Ali, Ahmed; Wang, Leyi; Qin, Zhuoming; Renukaradhya, Gourapura J; Lee, Chang-Won

    2010-11-01

    Pigs are capable of generating reassortant influenza viruses of pandemic potential, as both the avian and mammalian influenza viruses can infect pig epithelial cells in the respiratory tract. The source of the current influenza pandemic is H1N1 influenza A virus, possibly of swine origin. This study was conducted to understand better the pathogenesis of H1N1 influenza virus and associated host mucosal immune responses during acute infection in humans. Therefore, we chose a H1N1 swine influenza virus, Sw/OH/24366/07 (SwIV), which has a history of transmission to humans. Clinically, inoculated pigs had nasal discharge and fever and shed virus through nasal secretions. Like pandemic H1N1, SwIV also replicated extensively in both the upper and lower respiratory tracts, and lung lesions were typical of H1N1 infection. We detected innate, proinflammatory, Th1, Th2, and Th3 cytokines, as well as SwIV-specific IgA antibody in lungs of the virus-inoculated pigs. Production of IFN-γ by lymphocytes of the tracheobronchial lymph nodes was also detected. Higher frequencies of cytotoxic T lymphocytes, γδ T cells, dendritic cells, activated T cells, and CD4+ and CD8+ T cells were detected in SwIV-infected pig lungs. Concomitantly, higher frequencies of the immunosuppressive T regulatory cells were also detected in the virus-infected pig lungs. The findings of this study have relevance to pathogenesis of the pandemic H1N1 influenza virus in humans; thus, pigs may serve as a useful animal model to design and test effective mucosal vaccines and therapeutics against influenza virus.

  16. (18)F-FDG PET/CT Findings in Acute Epstein-Barr Virus Infection Mimicking Malignant Lymphoma

    DEFF Research Database (Denmark)

    Ørbæk, Mathilde; Graff, Jesper; Markova, Elena

    2016-01-01

    We present a case demonstrating the diagnostic work-up and follow-up of a patient with acute Epstein-Barr virus (EBV) infection in which the clinical picture and imaging on (18)F-FDG PET/CT mimicked malignant lymphoma. Follow-up (18)F-FDG PET/CT scan in the patient performed 7 weeks after...

  17. Elevation of soluble VCAM-1 plasma levels in children with acute dengue virus infection of varying severity.

    NARCIS (Netherlands)

    Koraka, P.; Murgue, B.; Deparis, X.; Gorp, E. van; Setiati, T.E.; Osterhaus, A.D.; Groen, J.

    2004-01-01

    Approximately 1,000 million infections with dengue viruses are estimated to occur annually. The majority of the cases develop mild disease, whereas only small proportion of the infected individuals develop severe hemorrhagic manifestations at the end of the acute phase of illness. In this study, the

  18. Case control study to identify risk factors for acute hepatitis C virus infection in Egypt

    Directory of Open Access Journals (Sweden)

    Kandeel Amr M

    2012-11-01

    Full Text Available Abstract Background Identification of risk factors of acute hepatitis C virus (HCV infection in Egypt is crucial to develop appropriate prevention strategies. Methods We conducted a case–control study, June 2007-September 2008, to investigate risk factors for acute HCV infection in Egypt among 86 patients and 287 age and gender matched controls identified in two infectious disease hospitals in Cairo and Alexandria. Case-patients were defined as: any patient with symptoms of acute hepatitis; lab tested positive for HCV antibodies and negative for HBsAg, HBc IgM, HAV IgM; and 7-fold increase in the upper limit of transaminase levels. Controls were selected from patients’ visitors with negative viral hepatitis markers. Subjects were interviewed about previous exposures within six months, including community-acquired and health-care associated practices. Results Case-patients were more likely than controls to have received injection with a reused syringe (OR=23.1, CI 4.7-153, to have been in prison (OR=21.5, CI 2.5-479.6, to have received IV fluids in a hospital (OR=13.8, CI 5.3-37.2, to have been an IV drug user (OR=12.1, CI 4.6-33.1, to have had minimal surgical procedures (OR=9.7, CI 4.2-22.4, to have received IV fluid as an outpatient (OR=8, CI 4–16.2, or to have been admitted to hospital (OR=7.9, CI 4.2-15 within the last 6 months. Multivariate analysis indicated that unsafe health facility practices are the main risk factors associated with transmission of HCV infection in Egypt. Conclusion In Egypt, focusing acute HCV prevention measures on health-care settings would have a beneficial impact.

  19. Interferon lambda 3 genotype predicts hepatitis C virus RNA levels in early acute infection among people who inject drugs: the InC(3) study

    NARCIS (Netherlands)

    Hajarizadeh, Behzad; Grady, Bart; Page, Kimberly; Kim, Arthur Y.; McGovern, Barbara H.; Cox, Andrea L.; Rice, Thomas M.; Sacks-Davis, Rachel; Bruneau, Julie; Morris, Meghan; Amin, Janaki; Schinkel, Janke; Applegate, Tanya; Maher, Lisa; Hellard, Margaret; Lloyd, Andrew R.; Prins, Maria; Geskus, Ronald B.; Dore, Gregory J.; Grebely, Jason; Lauer, Georg; Shoukry, Naglaa H.; Hahn, Judy; Shiboski, Steve; Alavi, Maryam; Bouchard, Rachel; Evans, Jennifer; Aneja, Jasneet; Teutsch, Suzy; White, Bethany; Wells, Brittany; Zang, Geng; Matthews, Gail; Marks, Pip; Yeung, Barbara; Prince, Leslie Erin; Roy, Elise; Bates, Anna; Enriquez, Jarliene; Chow, Sammy; McCredie, Luke; Aitken, Campbell; Doyle, Joseph; Spelman, Tim

    2014-01-01

    Hepatitis C virus (HCV) RNA level in acute HCV infection is predictive of spontaneous clearance. This study assessed factors associated with HCV RNA levels during early acute infection among people who inject drugs with well-defined acute HCV infection. Data were from International Collaboration of

  20. Prognostic factors for patients with hepatitis B virus-related acute-on-chronic liver failure

    Directory of Open Access Journals (Sweden)

    LI Ying

    2017-03-01

    Full Text Available ObjectiveTo investigate the prognostic factors for patients with hepatitis B virus-related acute-on-chronic liver failure, and to provide a basis for clinical diagnosis and treatment. MethodsA total of 172 patients with hepatitis B virus (HBV-related acute-on-chronic liver failure who were admitted to The First Hospital of Jilin University from January 1, 2006 to January 1, 2016 and had complete medical records and follow-up data were enrolled, and a retrospective analysis was performed for their clinical data and laboratory markers to determine prognostic factors. The independent-samples t test was used for comparison of continuous data between groups, the chi-square test was used for comparison of categorical data between groups, and a multivariate logistic regression analysis was performed for the indices determined to be statistically significant by the univariate analysis to screen out independent risk factors for the prognosis of patients with HBV-related acute-on-chronic liver failure. ResultsThe multivariate logistic regression analysis was performed for the indices determined to be statistically significant by the univariate analysis, and the results showed that the prognostic factors were total bilirubin (TBil, prothrombin time activity (PTA, Na+, total cholesterol (TC, Child-Turcotte-Pugh (CTP score, age ≥50 years, the presence of liver cirrhosis, bilirubin-enzyme separation, and complications. The multivariate regression analysis was performed for the complications determined to affect prognosis by the univariate analysis, and the results showed that the complications as risk factors were hepatic encephalopathy, hepatorenal syndrome, and infection. ConclusionTBil, PTA, Na+, TC, CTP score, age ≥50 years, the presence of liver cirrhosis, bilirubin-enzyme separation, and complications are independent risk factors for the prognosis of patients with HBV-related acute-on-chronic liver failure. Liver failure patients with hepatic

  1. Host cell recognition by the henipaviruses: Crystal structures of the Nipah G attachment glycoprotein and its complex with ephrin-B3

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Kai; Rajashankar, Kanagalaghatta R.; Chan, Yee-Peng; Himanen, Juha P.; Broder, Christopher C.; Nikolov, Dimitar B. (USUHS); (Cornell); (MSKCC)

    2008-07-28

    Nipah virus (NiV) and Hendra virus are the type species of the highly pathogenic paramyxovirus genus Henipavirus, which can cause severe respiratory disease and fatal encephalitis infections in humans, with case fatality rates approaching 75%. NiV contains two envelope glycoproteins, the receptor-binding G glycoprotein (NiV-G) that facilitates attachment to host cells and the fusion (F) glycoprotein that mediates membrane merger. The henipavirus G glycoproteins lack both hemagglutinating and neuraminidase activities and, instead, engage the highly conserved ephrin-B2 and ephrin-B3 cell surface proteins as their entry receptors. Here, we report the crystal structures of the NiV-G both in its receptor-unbound state and in complex with ephrin-B3, providing, to our knowledge, the first view of a paramyxovirus attachment complex in which a cellular protein is used as the virus receptor. Complex formation generates an extensive protein-protein interface around a protruding ephrin loop, which is inserted in the central cavity of the NiV-G {beta}-propeller. Analysis of the structural data reveals the molecular basis for the highly specific interactions of the henipavirus G glycoproteins with only two members (ephrin-B2 and ephrin-B3) of the very large ephrin family and suggests how they mediate in a unique fashion both cell attachment and the initiation of membrane fusion during the virus infection processes. The structures further suggest that the NiV-G/ephrin interactions can be effectively targeted to disrupt viral entry and provide the foundation for structure-based antiviral drug design.

  2. Acute diarrhea in West African children: diverse enteric viruses and a novel parvovirus genus.

    Science.gov (United States)

    Phan, Tung G; Vo, Nguyen P; Bonkoungou, Isidore J O; Kapoor, Amit; Barro, Nicolas; O'Ryan, Miguel; Kapusinszky, Beatrix; Wang, Chunling; Delwart, Eric

    2012-10-01

    Parvoviruses cause a variety of mild to severe symptoms or asymptomatic infections in humans and animals. During a viral metagenomic analysis of feces from children with acute diarrhea in Burkina Faso, we identified in decreasing prevalence nucleic acids from anelloviruses, dependoviruses, sapoviruses, enteroviruses, bocaviruses, noroviruses, adenoviruses, parechoviruses, rotaviruses, cosavirus, astroviruses, and hepatitis B virus. Sequences from a highly divergent parvovirus, provisionally called bufavirus, were also detected whose NS1 and VP1 proteins showed parvoviruses. Four percent of the fecal samples were PCR positive for this new parvovirus, including a related bufavirus species showing only 72% identity in VP1. The high degree of genetic divergence of these related genomes from those of other parvoviruses indicates the presence of a proposed new Parvoviridae genus containing at least two species. Studies of the tropism and pathogenicity of these novel parvoviruses will be facilitated by the availability of their genome sequences.

  3. Kyrieleis plaques associated with Herpes Simplex Virus type 1 acute retinal necrosis

    Directory of Open Access Journals (Sweden)

    Neha Goel

    2016-04-01

    Full Text Available We report the case of a 55-year-old immunocompetent male who presented with features typical of acute retinal necrosis (ARN. Polymerase chain reaction of the aqueous tap was positive for Herpes Simplex Virus (HSV – 1. Following therapy with intravenous Acyclovir, followed by oral Acyclovir and steroids, there was marked improvement in the visual acuity and clinical picture. At one week after initiation of treatment, Kyrieleis plaques were observed in the retinal arteries. They became more prominent despite resolution of the vitritis, retinal necrosis and vasculitis and persisted till six weeks of follow-up, when fluorescein angiography was performed. The appearance of this segmental retinal periarteritis also known as Kyrieleis plaques has not been described in ARN due to HSV-1 earlier.

  4. Acute acalculous cholecystitis by Epstein-Barr virus infection: a rare association

    Directory of Open Access Journals (Sweden)

    Liliana Branco

    2015-12-01

    Full Text Available Acute acalculous cholecystitis (AAC is a rare complication of Epstein Barr virus (EBV infection, with only a few cases reported among pediatric population. This clinical condition is frequently associated with a favorable outcome and, usually, a surgical intervention is not required. We report a 16-year-old girl who presented with AAC following primary EBV infection. The diagnosis of AAC was documented by clinical and ultrasonographic examination, whereas EBV infection was confirmed serologically. A conservative treatment was performed, with a careful monitoring and serial ultrasonographic examinations, which led to the clinical improvement of the patient. Pediatricians should be aware of the possible association between EBV and AAC, in order to offer the patients an appropriate management strategy.

  5. Effect of acute Plasmodium falciparum malaria on reactivation and shedding of the eight human herpes viruses.

    Directory of Open Access Journals (Sweden)

    Arnaud Chêne

    Full Text Available Human herpes viruses (HHVs are widely distributed pathogens. In immuno-competent individuals their clinical outcomes are generally benign but in immuno-compromised hosts, primary infection or extensive viral reactivation can lead to critical diseases. Plasmodium falciparum malaria profoundly affects the host immune system. In this retrospective study, we evaluated the direct effect of acute P. falciparum infection on reactivation and shedding of all known human herpes viruses (HSV-1, HSV-2, VZV, EBV, CMV, HHV-6, HHV-7, HHV-8. We monitored their presence by real time PCR in plasma and saliva of Ugandan children with malaria at the day of admission to the hospital (day-0 and 14 days later (after treatment, or in children with mild infections unrelated to malaria. For each child screened in this study, at least one type of HHV was detected in the saliva. HHV-7 and HHV-6 were detected in more than 70% of the samples and CMV in approximately half. HSV-1, HSV-2, VZV and HHV-8 were detected at lower frequency. During salivary shedding the highest mean viral load was observed for HSV-1 followed by EBV, HHV-7, HHV-6, CMV and HHV-8. After anti-malarial treatment the salivary HSV-1 levels were profoundly diminished or totally cleared. Similarly, four children with malaria had high levels of circulating EBV at day-0, levels that were cleared after anti-malarial treatment confirming the association between P. falciparum infection and EBV reactivation. This study shows that acute P. falciparum infection can contribute to EBV reactivation in the blood and HSV-1 reactivation in the oral cavity. Taken together our results call for further studies investigating the potential clinical implications of HHVs reactivation in children suffering from malaria.

  6. Effect of Acute Plasmodium falciparum Malaria on Reactivation and Shedding of the Eight Human Herpes Viruses

    Science.gov (United States)

    Chêne, Arnaud; Nylén, Susanne; Donati, Daria; Bejarano, Maria Teresa; Kironde, Fred; Wahlgren, Mats; Falk, Kerstin I.

    2011-01-01

    Human herpes viruses (HHVs) are widely distributed pathogens. In immuno-competent individuals their clinical outcomes are generally benign but in immuno-compromised hosts, primary infection or extensive viral reactivation can lead to critical diseases. Plasmodium falciparum malaria profoundly affects the host immune system. In this retrospective study, we evaluated the direct effect of acute P. falciparum infection on reactivation and shedding of all known human herpes viruses (HSV-1, HSV-2, VZV, EBV, CMV, HHV-6, HHV-7, HHV-8). We monitored their presence by real time PCR in plasma and saliva of Ugandan children with malaria at the day of admission to the hospital (day-0) and 14 days later (after treatment), or in children with mild infections unrelated to malaria. For each child screened in this study, at least one type of HHV was detected in the saliva. HHV-7 and HHV-6 were detected in more than 70% of the samples and CMV in approximately half. HSV-1, HSV-2, VZV and HHV-8 were detected at lower frequency. During salivary shedding the highest mean viral load was observed for HSV-1 followed by EBV, HHV-7, HHV-6, CMV and HHV-8. After anti-malarial treatment the salivary HSV-1 levels were profoundly diminished or totally cleared. Similarly, four children with malaria had high levels of circulating EBV at day-0, levels that were cleared after anti-malarial treatment confirming the association between P. falciparum infection and EBV reactivation. This study shows that acute P. falciparum infection can contribute to EBV reactivation in the blood and HSV-1 reactivation in the oral cavity. Taken together our results call for further studies investigating the potential clinical implications of HHVs reactivation in children suffering from malaria. PMID:22039454

  7. Molecular characterization of hepatitis E virus in patients with acute hepatitis in Venezuela.

    Science.gov (United States)

    García, Cristina Gutiérrez; Sánchez, Doneyla; Villalba, Maria Caridad Montalvo; Pujol, Flor Helene; de Los Ángeles Rodríguez Lay, Licel; Pinto, Belquis; Chacón, Elsa Patricia; Guzmán, Maria Guadalupe

    2012-07-01

    Hepatitis E virus (HEV) causes a common infection in developing countries. HEV infection occurs as outbreaks, as sporadic clinical cases and as large epidemics in endemic areas. The objective of this study was to determine the presence of HEV infection in patients with clinical suspicion of hepatitis A virus (HAV) infection, referred to the Instituto Nacional de Higiene "Rafael Rangel" in Venezuela. Seventy-four sera were tested for anti-HAV and anti-HEV IgM antibodies. HEV-RNA was amplified from anti-HEV IgM positive sera using nested reverse transcription polymerase chain reaction for ORF1 (RNA dependent RNA polymerase region) and the amplicons sequenced for phylogenetic analysis. The frequency of anti-HEV IgM was 22/74 (30%) in the samples tested. Dual infection with HAV and HEV was found in 31% (12/39) of anti-HAV IgM positive patients. Viremia was detected in 3/22 (14%) of sera positive for anti-HEV IgM. Two HEV strains were classified as genotype 1 and one as genotype 3, which were closely related to Yam 67 (north of India) and US1 isolates from the USA, respectively. These findings suggest that HEV is an important cause of acute viral hepatitis in Venezuela as a single infection or co-infection with HAV, with high morbidity in children and young adults suggesting that this infection is endemic in Venezuela. Copyright © 2012 Wiley Periodicals, Inc.

  8. Hepatitis E Virus Induced Acute Liver Failure with Scrub Typhus Coinfection in a Pregnant Woman.

    Science.gov (United States)

    Verma, Nipun; Sharma, Megha; Biswal, Manisha; Taneja, Sunil; Batra, Nitya; Kumar, Abhay; Dhiman, Radha K

    2017-06-01

    Coinfections contribute significantly to diagnostic challenges of acute febrile illnesses, especially in endemic areas. The confusion caused by overlapping clinical features impedes timely management. Herein, we report an unusual, previously unreported case of a pregnant woman suffering from a coinfection of scrub typhus and hepatitis E virus. A 25-year-old, 31-week pregnant woman presented with jaundice for 5 days and altered sensorium for 2 days. She had features of both viral acute liver failure (ALF) and tropical infections mimicking ALF, including hyperbilirubinemia, coagulopathy, anemia, thrombocytopenia, intravascular hemolysis, and hepatosplenomegaly. Etiological workup revealed rare coinfection of hepatitis E and scrub typhus. Despite all supportive measures, the patient succumbed to her illness (i.e., absent brainstem reflexes and intracranial bleed secondary to coagulopathy) and had poor fetal outcome, which resulted in stillbirth. ALF in a pregnant woman is a medical and obstetric emergency. It can result from varied etiologies that though differ in their incidence, mode of occurrence, and pregnancy outcome, can clinically masquerade as each other, causing diagnostic dilemma. This unusual case report highlights the significance of keeping all such possibilities in mind while managing a pregnant woman with ALF, especially in a country like India where maternal and perinatal mortality rates, the core indicators of national health, are still among the highest in the world.

  9. CD80 Regulates Th17 Cell Differentiation in Coxsackie Virus B3-Induced Acute Myocarditis.

    Science.gov (United States)

    Huang, Yanlan; Li, Yong; Wei, Bin; Wu, Weifeng; Gao, Xingcui

    2018-02-01

    The cluster of differentiation protein complex, CD80/CD86, regulates Th1/Th2 differentiation in autoimmune disease. In order to establish the effects of CD80/CD86 on Th17 cell differentiation in acute viral myocarditis (VMC), we infected C57BL/6 mice with Coxsackie virus B3 (CVB3) and examined the effects of the treatment with anti-CD80/CD86 monoclonal antibodies (mAbs) on Th17 cell differentiation in vivo. The effects of anti-CD80/CD86 mAbs on Th17 cell differentiation were further evaluated in vitro. The treatment with anti-CD80 mAb induced marked suppression of Th17 cell differentiation and ROR-γt mRNA expression, whereas anti-CD86 mAb alone had no effect, both in vivo and in vitro. Our finding that CD80 regulates Th17 differentiation supports the potential utility of anti-CD80 mAb as an effective new immunotherapeutic target in acute VMC.

  10. Acute hepatitis A virus infection is associated with a limited type I interferon response and persistence of intrahepatic viral RNA.

    Science.gov (United States)

    Lanford, Robert E; Feng, Zongdi; Chavez, Deborah; Guerra, Bernadette; Brasky, Kathleen M; Zhou, Yan; Yamane, Daisuke; Perelson, Alan S; Walker, Christopher M; Lemon, Stanley M

    2011-07-05

    Hepatitis A virus (HAV) is an hepatotropic human picornavirus that is associated only with acute infection. Its pathogenesis is not well understood because there are few studies in animal models using modern methodologies. We characterized HAV infections in three chimpanzees, quantifying viral RNA by quantitative RT-PCR and examining critical aspects of the innate immune response including intrahepatic IFN-stimulated gene expression. We compared these infection profiles with similar studies of chimpanzees infected with hepatitis C virus (HCV), an hepatotropic flavivirus that frequently causes persistent infection. Surprisingly, HAV-infected animals exhibited very limited induction of type I IFN-stimulated genes in the liver compared with chimpanzees with acute resolving HCV infection, despite similar levels of viremia and 100-fold greater quantities of viral RNA in the liver. Minimal IFN-stimulated gene 15 and IFIT1 responses peaked 1-2 wk after HAV challenge and then subsided despite continuing high hepatic viral RNA. An acute inflammatory response at 3-4 wk correlated with the appearance of virus-specific antibodies and apoptosis and proliferation of hepatocytes. Despite this, HAV RNA persisted in the liver for months, remaining present long after clearance from serum and feces and revealing dramatic differences in the kinetics of clearance in the three compartments. Viral RNA was detected in the liver for significantly longer (35 to >48 wk) than HCV RNA in animals with acute resolving HCV infection (10-20 wk). Collectively, these findings indicate that HAV is far stealthier than HCV early in the course of acute resolving infection. HAV infections represent a distinctly different paradigm in virus-host interactions within the liver.

  11. Sin nombre virus (SNV) Ig isotype antibody response during acute and convalescent phases of hantavirus pulmonary syndrome.

    Science.gov (United States)

    Bostik, P; Winter, J; Ksiazek, T G; Rollin, P E; Villinger, F; Zaki, S R; Peters, C J; Ansari, A A

    2000-01-01

    Serum samples from 22 hantavirus pulmonary syndrome (HPS) patients were tested for Sin Nombre virus (SNV)-reactive antibodies. In the acute phase of HPS, 100% and 67% of the samples tested positive for SNV-specific immunoglobulin (Ig) M and IgA, respectively. Among the virus-specific IgG antibodies, the most prevalent were IgG3 (in 97% of samples), followed by IgG1 (70%), IgG2 (30%), and IgG4 (3%).

  12. Efficacy of immunization against hepatitis B virus infection in acute leukemia

    Directory of Open Access Journals (Sweden)

    Tuphan Kanti Dolai

    2010-09-01

    Full Text Available Objective: The aim of this study was to assess the antibody response to combined passive-active immunization versus active immunization against hepatitis B in 71 patients with acute leukemia with negative hepatitis B virus serology at presentation. Materials and Methods: The first group (n=28 received a double dose of hepatitis B vaccine at 0, 1, 2 and 6 months and immunoglobin (HBIG at 0 and 1 month concurrently with vaccine but at a different intramuscular site. The second group (n=43 received double dose of hepatitis B vaccine at 0, 1, 2, and 6 months. HBsAg and anti-HBs titers were determined one month after the 1st, 2nd, 3rd and 4th doses of vaccine. Results: In the vaccine-only group, 2.56%, 8.33%, 14.28% and 34.29% of patients developed anti-HBs titer ≥10 IU/L after the 1st, 2nd, 3rd and 4th doses of vaccine, respectively. In the HBIG group, 91.30%, 91.30%, 69.56% and 73.91% of patients developed anti-HBs titer ≥10 IU/L after the 1st, 2nd, 3rd and 4th doses of vaccine, respectively. Those in the vaccine-HBIG group maintained their anti-HBs titer ≥10 IU/L from the 1st to the 4th doses. In the vaccine-only group, 34.29% of patients gained protective antibody titer after receiving the 4th dose of vaccine. Subgroup analysis of age (pediatric vs adult and disease (acute lymphoblastic leukemia vs acute myeloid leukemia groups showed no effect of either on the development of protective antibody titer. The incidence of HBsAg positivity one month after the 4th dose of vaccine was 8.62%. No patient became positive for anti-HCV or HIV antibody before or after chemo therapy.Conclusion: Combined HBIG and vaccine may protect acute leukemia patients during the intensive chemotherapy period.

  13. Immune and inflammatory response in pigs during acute influenza caused by H1N1 swine influenza virus.

    Science.gov (United States)

    Pomorska-Mól, Małgorzata; Markowska-Daniel, Iwona; Kwit, Krzysztof; Czyżewska, Ewelina; Dors, Arkadiusz; Rachubik, Jarosław; Pejsak, Zygmunt

    2014-10-01

    Swine influenza (SI) is an acute respiratory disease of pigs, caused by swine influenza virus (SIV). Little is known about the inflammatory response in the lung during acute SI and its correlation with clinical signs or lung pathology. Moreover, until now there has been a limited amount of data available on the relationship between the concentrations of pro- and anti-inflammatory cytokines in the lungs and the serum concentration of acute-phase proteins (APPs) in SIV-infected pigs. In the present study, the porcine inflammatory and immune responses during acute influenza caused by H1N1 SIV (SwH1N1) were studied. Nine pigs were infected intratracheally, and five served as controls. Antibodies against SIV were measured by haemagglutination inhibition assay, and the influenza-virus-specific T-cell response was measured using a proliferation assay. C-reactive protein (CRP), haptoglobin (Hp), serum amyloid A (SAA), and pig major acute-phase protein (Pig-MAP) the concentrations in serum and concentration of IL-1β, IL-6, IL-8, IL-10, TNF-α and IFN-γ in lung tissues were measured using commercial ELISAs.

  14. The Central Role of the Matrix Protein in Nipah Virus Assembly and Morphogenesis

    Science.gov (United States)

    2007-03-23

    attention paid to the cytoplasmic domains of these proteins. Co-localization of M and at least one envelope glycoprotein has been observed for SeV (111...from pCP630 (NiV M gene in pFastBac HTa ) using primers 5’- GTTTAAACCACCATGGAGCCGGACATC (NIVMS) and 5’- GTTTAAACTTAGCCCTTTAGAATTCTC (NIVMAS). The NiV...lipid rafts in assembly has received the most attention for MeV. The measles F and H glycoproteins associate with lipid rafts in the trans-Golgi

  15. Prevalence of hepatitis viruses in patients with acute hepatitis and characterization of the detected genotype 4 hepatitis E virus sequences in Mongolia.

    Science.gov (United States)

    Tsatsralt-Od, Bira; Baasanjav, Nachin; Nyamkhuu, Dulmaa; Ohnishi, Hiroshi; Takahashi, Masaharu; Okamoto, Hiroaki

    2016-02-01

    Hepatitis E is considered to be a worldwide public health problem. Although the prevalence of hepatitis E virus (HEV) antibodies in healthy individuals is noted to be 11%, no patients with acute hepatitis E have previously been identified in Mongolia. Three hundred two consecutive patients (183 males and 119 females; median age of 22.0 [Interquartile range: 18.3-25.0] years) who were clinically diagnosed with sporadic acute hepatitis during 2012-2013 in Ulaanbaatar, Mongolia, were studied. By serological and/or molecular approaches, 77 (25.5%), 93 (30.8%), 19 (6.3%), 48 (15.9%), and 12 (4.0%) of the patients were diagnosed with acute hepatitis of types A, B, C, D (superinfection of hepatitis delta virus on a background of chronic hepatitis B virus infection) and E, respectively, while the cause of hepatitis was unknown in the remaining 53 patients (17.5%). The 12 hepatitis E patients had no history of travel abroad in the 3 months before the onset of disease, and lived separately in fixed or movable houses with water supplied via pipe, tank or well, denying transmission from a common water supply. The 12 HEV isolates obtained from the patients showed high nucleotide identities of 99.7-100%, and a representative HEV isolate, MNE13-227, was closest to the Chinese isolates of genotype 4, with the highest identity of 97.3% in the 304-nt ORF2 sequence and 92.1% over the entire genome. The present study revealed the occurrence of autochthonous acute hepatitis E in Mongolia, caused by a monophyletic genotype 4 HEV strain. © 2015 Wiley Periodicals, Inc.

  16. Does Fasciola hepatica infection modify the response of acute hepatitis C virus infection to IFN-α treatment?

    Science.gov (United States)

    Sahin, Mehmet; Isler, Mehmet; Senol, Altug; Demirci, Mustafa; Aydın, Zeynep Dilek

    2005-01-01

    Immunologic response to acute hepatitis C is mainly a Th1 response, whereas fasciolopsiasis is associated with a diverse T-cell response. Interferon-alpha has immunomodulatory effects and enhances Th1 immune response. Fasciola infection could theoretically interfere with the Th1 immune response, even when acquired after an initial response to interferon-alpha treatment for acute hepatitis C virus (HCV) infection. We report here the case of a male patient who acquired Fasciola hepatica infection after an initial response to IFN-alpha therapy with a favorable outcome PMID:16437701

  17. Angiographic Features and Cardiovascular Risk Factors in Human Immunodeficiency Virus-Infected Patients With First-Time Acute Coronary Syndrome

    DEFF Research Database (Denmark)

    Knudsen, Andreas; Mathiasen, Anders B; Worck, R.H.

    2013-01-01

    A matched cohort study was conducted comparing patients with first-time acute coronary syndromes infected with human immunodeficiency virus (HIV) to non-HIV-infected patients with and without diabetes matched for smoking, gender, and type of acute coronary syndrome who underwent first-time coronary...... angiography. A total of 48 HIV-infected patients were identified from a national database. Coronary angiography showed that the HIV-infected patients had significantly fewer lesions with classification B2/C than the 2 control groups (p...

  18. Henipavirus microsphere immuno-assays for detection of antibodies against Hendra virus.

    Science.gov (United States)

    McNabb, Leanne; Barr, J; Crameri, G; Juzva, S; Riddell, S; Colling, A; Boyd, V; Broder, C; Wang, L-F; Lunt, R

    2014-05-01

    Hendra and Nipah viruses (HeV and NiV) are closely related zoonotic pathogens of the Paramyxoviridae family. Both viruses belong to the Henipavirus genus and cause fatal disease in animals and humans, though only HeV is endemic in Australia. In general and due to the acute nature of the disease, agent detection by PCR and virus isolation are the primary tools for diagnostic investigations. Assays for the detection of antibodies against HeV are fit more readily for the purpose of surveillance testing in disease epidemiology and to meet certification requirements in the international movement of horses. The first generation indirect ELISA has been affected by non-specific reactions which must be resolved using virus neutralisation serology conducted at laboratory bio-safety level 4 containment (PC4). Recent developments have enabled improvements in the available serology assays. The production of an expressed recombinant truncated HeV G protein has been utilised in ELISA and in Luminex-based multiplexed microsphere assays. In the latter format, two Luminex assays have been developed for use in henipavirus serology: a binding assay (designed for antibody detection and differentiation) and a blocking assay (designed as a surrogate for virus neutralisation). Equine and canine field sera were used to evaluate the two Luminex assays relative to ELISA and virus neutralisation serology. Results showed that Luminex assays can be effective as rapid, sensitive and specific tests for the detection of HeV antibody in horse and dog sera. The tests do not require PC4 containment and are appropriate for high throughput applications as might be required for disease investigations and other epidemiological surveillance. Also, the results show that the Luminex assays detect effectively HeV vaccine-induced antibodies. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Acute inflammatory demyelinating polyneuropathy associated with pegylated interferon α 2a therapy for chronic hepatitis C virus infection

    OpenAIRE

    Khiani, Vijay; Kelly, Thomas; Shibli, Adeel; Jensen, Donald; Mohanty, Smruti R

    2008-01-01

    The combination of pegylated interferon (Peg-IFN) and ribavirin is the standard of care for chronic hepatitis C virus (HCV) infection treatment. In general, common side effects related to this combination therapy are mild and are very well tolerated. However, peripheral neuropathy including demyelinating polyneuropathy related to Peg-IFN is extremely rare. We present the first case of an acute inflammatory demyelinating polyneuropathy (AIDP) associated with Peg-IFN-α 2a (Pegasys) after 16 wk ...

  20. A Potent Virus-Specific Antibody-Secreting Cell Response to Acute Enterovirus 71 Infection in Children.

    Science.gov (United States)

    Huang, Kuan-Ying Arthur; Lin, Jainn-Jim; Chiu, Cheng-Hsun; Yang, Shuan; Tsao, Kuo-Chien; Huang, Yhu-Chering; Lin, Tzou-Yien

    2015-09-01

    Enterovirus 71 (EV71) remains a leading pathogen for acute infectious diseases in children, especially in Asia. The cellular basis for establishing a virus-specific antibody response to acute EV71 infections is unclear in children. We studied the magnitude of virus-specific antibody-secreting B cells (ASCs) and its relationship with serological response, clinical parameters, and virological parameters among children with laboratory-confirmed EV71 infection. A potent EV71 genogroup B- and virus-specific ASC response was detected in the first week of illness among genotype B5 EV71-infected children. The cross-reactive EV71-specific ASC response to genogroup C viral antigens composed about 10% of the response. The EV71-specific ASC response in children aged ≥3 years produced immunoglobulin G predominantly, but immunoglobulin M was predominant in younger children. Proliferation marker was expressed by the majority of circulating ASCs in the acute phase of EV71 infection. Virus-specific ASC responses significantly correlated with throat viral load, fever duration, and serological genogroup-specific neutralization titer. The presence of a virus-specific ASC response serves an early cellular marker of an EV71-specific antibody response. Further detailed study of EV71-specific ASCs at the monoclonal level is crucial to delineate the specificity and function of antibody immunity in children. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  1. Acute Kidney Injury and Urinary Biomarkers in Human Immunodeficiency Virus-Associated Cryptococcal Meningitis.

    Science.gov (United States)

    Schutz, Charlotte; Boulware, David R; Huppler-Hullsiek, Katherine; von Hohenberg, Maximilian; Rhein, Joshua; Taseera, Kabanda; Thienemann, Friedrich; Muzoora, Conrad; Meya, David B; Meintjes, Graeme

    2017-01-01

    Cryptococcus is the most common etiology of adult meningitis in Africa. Amphotericin B deoxycholate remains paramount to treatment, despite toxicities, including acute kidney injury (AKI). We assessed the ability of the following urine markers to predict AKI in patients who received amphotericin B: urine neutrophil gelatinase-associated lipocalin (NGAL), cystatin C (CysC), tissue inhibitor of metalloproteinases-2 (TIMP-2), and protein. One hundred and thirty human immunodeficiency virus (HIV)-infected participants with cryptococcal meningitis were enrolled and received amphotericin and fluconazole for 2 weeks. We defined AKI as glomerular filtration rate (GFR) < 60 mL/min/1.73 m 2 ; measured urine NGAL, CysC, TIMP-2, and protein; and explored AKI incidence, risk factors, and associations with mortality using Cox proportional hazards models. Participants were 48% female with a median age of 35 years, a median CD4 count of 21 cells/μL, and 44% died within 12 months. Incident AKI occurred in 42% and was associated with mortality (adjusted hazard ratio [aHR] = 2.8; P < .001). Development of AKI was associated with female sex ( P = .04) and with higher CD4 count (49 vs 14 cells/μL; P < .01). Urine protein level in the highest quartile independently predicted AKI and mortality (aHR = 1.64, P = .04; aHR = 2.13, P = .02, respectively). Urine NGAL levels in the highest quartile independently predicted AKI (aHR = 1.65; P = .04). Acute kidney injury occurred in 42% of patients, and AKI was associated with mortality. Urine biomarkers, specifically urine protein, may be useful for antecedent prediction of amphotericin-associated AKI but need further evaluation.

  2. Hepatitis C virus (HCV) antibody dynamics following acute HCV infection and reinfection among HIV-infected men who have sex with men

    NARCIS (Netherlands)

    Vanhommerig, Joost W.; Thomas, Xiomara V.; van der Meer, Jan T. M.; Geskus, Ronald B.; Bruisten, Sylvia M.; Molenkamp, Richard; Prins, Maria; Schinkel, Janke; Arends, J.; van Baarle, D.; van den Berk, G.; Brinkman, K.; Coutinho, R.; van den Ende, M.; Grady, B.; Gras, L.; Ho, C.; Kwa, D.; van de Laar, T.; Lambers, F.; Mulder, J.; Reesink, H.; Smit, C.; van der Valk, M.; van der Veldt, W.; Karlas, J.; Bakker, M.; Visser, G.; Buswell, C.

    2014-01-01

    A decline of hepatitis C virus (HCV) antibody titers (anti-HCV), ultimately resulting in seroreversion, has been reported following clearance of viremia in both acute and chronic HCV infection. However, frequency of seroreversion remains unknown in human immunodeficiency virus (HIV)/HCV-coinfected

  3. Importance of brood maintenance terms in simple models of the honeybee - Varroa destructor - acute bee paralysis virus complex

    Directory of Open Access Journals (Sweden)

    Hermann J. Eberl

    2010-09-01

    Full Text Available We present a simple mathematical model of the infestation of a honeybee colony by the Acute Paralysis Virus, which is carried by parasitic varroa mites (Varroa destructor. This is a system of nonlinear ordinary differential equations for the dependent variables: number of mites that carry the virus, number of healthy bees and number of sick bees. We study this model with a mix of analytical and computational techniques. Our results indicate that, depending on model parameters and initial data, bee colonies in which the virus is present can, over years, function seemingly like healthy colonies before they decline and disappear rapidly (e.g. Colony Collapse Disorder, wintering losses. This is a consequence of the fact that a certain number of worker bees is required in a colony to maintain and care for the brood, in order to ensure continued production of new bees.

  4. The serological markers of acute infection with hepatitis A, B, C, D, E and G viruses revisited.

    Science.gov (United States)

    Pondé, Robério Amorim de Almeida

    2017-12-01

    Viral hepatitis is a liver infection caused by one of the six hepatitis viruses: hepatitis A, B, C, D, E, and G virus (HAV to HEV and HGV). These agents differ in their biological, immunological, pathological and epidemiological characteristics. They cause infections that, when symptomatic, lead to clinical manifestations and laboratory findings that are not specific to a particular virus, often making differential diagnosis difficult, especially when no knowledge is available regarding the patient's medical history or the epidemiological background. A number of acute-phase serological markers, such as anti-HAV, anti-HBc, anti-HDV and anti-HEV IgM antibodies, are able to provide a clear indication of an infection caused by HAV, HBV, HDV or HEV. Anti-HCV antibodies and HGV/RNA are used for the diagnosis of HCV and HGV infections. The importance of each of these markers will be reviewed, and different factors that can interfere with the diagnosis of acute infections caused by these viruses will be described.

  5. Immunohistochemical detection of virus through its nuclear cytopathic effect in idiopathic interstitial pneumonia other than acute exacerbation

    Directory of Open Access Journals (Sweden)

    G.C. dos Santos

    2013-11-01

    Full Text Available Idiopathic interstitial pneumonias include complex diseases that have a strong interaction between genetic makeup and environmental factors. However, in many cases, no infectious agent can be demonstrated, and these clinical diseases rapidly progress to death. Theoretically, idiopathic interstitial pneumonias could be caused by the Epstein-Barr virus, cytomegalovirus, adenovirus, hepatitis C virus, respiratory syncytial virus, and herpesvirus, which may be present in such small amounts or such configuration that routine histopathological analysis or viral culture techniques cannot detect them. To test the hypothesis that immunohistochemistry provides more accurate results than the mere histological demonstration of viral inclusions, this method was applied to 37 open lung biopsies obtained from patients with idiopathic interstitial pneumonias. As a result, immunohistochemistry detected measles virus and cytomegalovirus in diffuse alveolar damage-related histological patterns of acute exacerbation of idiopathic pulmonary fibrosis and nonspecific interstitial pneumonia in 38 and 10% of the cases, respectively. Alveolar epithelium infection by cytomegalovirus was observed in 25% of organizing pneumonia patterns. These findings were coincident with nuclear cytopathic effects but without demonstration of cytomegalovirus inclusions. These data indicate that diffuse alveolar damage-related cytomegalovirus or measles virus infections enhance lung injury, and a direct involvement of these viruses in diffuse alveolar damage-related histological patterns is likely. Immunohistochemistry was more sensitive than the histological demonstration of cytomegalovirus or measles virus inclusions. We concluded that all patients with diffuse alveolar damage-related histological patterns should be investigated for cytomegalovirus and measles virus using sensitive immunohistochemistry in conjunction with routine procedures.

  6. Dominant cross-reactive B cell response during secondary acute dengue virus infection in humans.

    Directory of Open Access Journals (Sweden)

    Simona Zompi

    Full Text Available The four serotypes of dengue virus (DENV cause dengue fever (DF and dengue hemorrhagic fever/dengue shock syndrome (DHF/DSS. Severe disease has been associated with heterotypic secondary DENV infection, mediated by cross-reactive antibodies (Abs and/or cross-reactive T cells. The role of cross-reactive immunity in mediating enhanced disease versus cross-protection against secondary heterotypic DENV infection is not well defined. A better understanding of the cross-reactive immune response in natural infections is critical for development of safe and effective tetravalent vaccines. We studied the B cell phenotype of circulating B cells in the blood of pediatric patients suspected of dengue during the 2010-2011 dengue season in Managua, Nicaragua (n  =  216, which was dominated by the DENV-3 serotype. We found a markedly larger percentage of plasmablast/plasma cells (PB/PCs circulating in DENV-positive patients as compared to patients with Other Febrile Illnesses (OFIs. The percentage of DENV-specific PB/PCs against DENV-3 represented 10% of the circulating antibody-producing cells (ASCs in secondary DENV-3 infections. Importantly, the cross-reactive DENV-specific B cell response was higher against a heterotypic serotype, with 46% of circulating PB/PCs specific to DENV-2 and 10% specific to DENV-3 during acute infection. We also observed a higher cross-reactive DENV-specific IgG serum avidity directed against DENV-2 as compared to DENV-3 during acute infection. The neutralization capacity of the serum was broadly cross-reactive against the four DENV serotypes both during the acute phase and at 3 months post-onset of symptoms. Overall, the cross-reactive B cell immune response dominates during secondary DENV infections in humans. These results reflect our recent findings in a mouse model of DENV cross-protection. In addition, this study enabled the development of increased technical and research capacity of Nicaraguan scientists and the

  7. Hepatitis E Virus Genotype 3 in Sewage and Genotype 1 in Acute Hepatitis Cases, Israel

    Science.gov (United States)

    Ram, Daniela; Manor, Yossi; Gozlan, Yael; Schwartz, Eli; Ben-Ari, Ziv; Mendelson, Ella; Mor, Orna

    2016-01-01

    Hepatitis E virus (HEV) is an emerging infectious agent in developed countries. HEV genotypes 1 (G1) and 3 (G3) have been identified in environmental and clinical samples in Europe. In Israel, the overall prevalence of anti-HEV IgG antibodies was found to be 10.6%; however, reports of HEV infection are scarce. In this study, the presence of HEV in Israel was investigated using 169 sewage samples from 32 treatment facilities and 49 samples from acute hepatitis patients, all collected between 2013 and 2015. Fourteen sewage samples, from Haifa (11/18 samples), Tel Aviv (2/29 samples), and Beer Sheva (1/17 samples), regions with good sanitary conditions and middle-high socioeconomic populations, were HEV positive. Among the patient samples, 6.1% (3/49) were HEV positive, all returning travelers from India. Genotype analysis revealed G1 HEV in patients and G3 HEV sequences in sewage. Evidence that HEV could be establishing itself in our region may justify more active surveillance to monitor its spread. PMID:27246446

  8. Screening for acute human immunodeficiency virus infection in Baltimore public testing sites.

    Science.gov (United States)

    Temkin, Elizabeth; Marsiglia, Vincent C; Hague, Christian; Erbelding, Emily

    2011-05-01

    Human immunodeficiency virus (HIV) RNA testing of pooled HIV antibody-negative specimens can identify acute HIV infection (AHI) and trigger interventions to reduce transmission during this highly infectious period. A Baltimore, MD program serving sexually transmitted disease clinics and other high-risk sites combined HIV testing by third-generation enzyme immunoassay (EIA) with RNA testing of pooled antibody-negative specimens. Laboratory and Disease Intervention Specialists' records were reviewed for program evaluation. A cost analysis was performed. In 22 months, we tested 60,695 specimens for HIV. Of these, 1766 (2.9%) tested positive by EIA. Pooled HIV RNA testing of 58,925 EIA-negative specimens detected 7 cases of AHI (0.01%). Reflex HIV RNA testing of EIA-reactive, Western blot-indeterminate specimens confirmed 4 additional AHI cases (total AHI, 0.02%). Contact tracing detected no additional previously unknown cases of HIV infection. The utility of pooled HIV RNA testing may be limited by advances in HIV testing technology that reduce the seronegative window period and by characteristics of the local HIV epidemic.

  9. ACUTE RESPIRATORY SYNCYTIAL VIRUS INFECTION IN CHILDREN IN THE AGE ASPECT

    Directory of Open Access Journals (Sweden)

    V. B. Rovny

    2013-01-01

    Full Text Available The clinical features of laboratory-confirmed acute respiratory syncytial virus infection (ARSVI are described in 221 children of the age from 1 month to 5 years. Febrile fever has been recorded in 76% of patients with ARSVI, and significantly more often in children in the second year of life (92%, but the difference in the temerature or duration has not been found. 98% of children have had symptoms of the lower respiratory tract lesions. The most common ARSVI manifestations in the patients of the first year of life were obstructive diseases of the lower respiratory tract (obstructive bronchitis in 53% and bronchiolitis in 11% of children, in the patients of the second year of life — pneumonia (28%, p < 0,05 and catarrhal otitis (26%; p < 0,05. Bronchial obstruction syndrome in children of the first year of life was characterized by the significantly higher frequency (73% and the maximal duration (9,7 ± 1,08 days. The largest number of cases of the severe respiratory failure has been recorded among patients of the second year of life (3 degree of respiratory failure in 22% of patients, p < 0,05.

  10. [Acute outbreak of hepatitis C in human immunodeficiency virus-infected patients].

    Science.gov (United States)

    Martínez-Rebollar, Maria; Mallolas, Josep; Pérez, Iñaki; González-Cordón, Ana; Loncà, Montserrat; Torres, Berta; Rojas, Jhon-Fredy; Monteiro, Polyana; Blanco, José-Luis; Martínez, Esteban; Gatell, José-María; Laguno, Montserrat

    2015-01-01

    Recent studies suggest an increased incidence of acute infection with hepatitisC virus (AHC) in men who have sex with men (MSM) co-infected with HIV. Early treatment with interferon-alpha, alone or in combination with ribavirin, significantly reduces the risk of chronic evolution. This retrospective study includes all HIV patients with AHC in our centre from 2003 to March 2013. AHC was defined by seroconversion of HCV antibodies and detection of serum HCV RNA. 93 episodes of AHC were diagnosed in 89 patients. All but three were MSM with a history of unprotected sex. Thirty-seven (40%) patients had other associated sexually transmitted disease. The 29% (27) had any symptoms suggestive of AHC. HCV genotype 4 was the most common (41%), followed by genotype1. Seventy patients started treatment with interferon-alfa and weight-adjusted ribavirin. Currently 46 have completed treatment and follow-up, reaching 26 of them (56.5%) sustained viral response. The incidence of AHC in HIV MSM patients from our centre has increased exponentially in recent years; sexual transmission remains the main route of infection. Early treatment with interferon-alpha and ribavirin achieved a moderate response in these patients. Copyright © 2014 Elsevier España, S.L.U. y Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

  11. Acute and Chronic Hepatitis E Virus Infection in HIV-Infected United States Women

    Science.gov (United States)

    Kuniholm, Mark H.; Ong, Edgar; Hogema, Boris M.; Koppelman, Marco; Anastos, Kathryn; Peters, Marion G.; Seaberg, Eric C.; Chen, Yue; Nelson, Kenrad E.; Linnen, Jeffrey M.

    2015-01-01

    Exposure to hepatitis E virus (HEV) is common in the United States (US) but there are few data on prevalence of HEV/HIV co-infection in US populations. We tested 2,919 plasma samples collected from HIV-infected (HIV+) women and men enrolled in US cohort studies for HEV viremia using a high-throughput nucleic acid testing (NAT) platform. NAT+ samples were confirmed by real-time polymerase chain reaction (PCR). Samples were selected for testing primarily on the basis of biomarkers of liver disease and immune suppression. Prevalence of HEV viremia was 3/2,606 and 0/313 in tested plasma samples collected from HIV+ women and men, respectively. All HEV isolates were genotype 3a. Based on follow-up testing of stored samples, one woman had chronic HEV infection for >4 years while 2 women had acute HEV detectable at only a single study visit. Conclusion To our knowledge this is the first reported case of chronic HEV infection in an HIV+ US individual. We also confirm that chronic HEV infection can persist despite a CD4+ count >200 cells/mm3. These data suggest that HEV infection is rare in the HIV+ US population. PMID:26646162

  12. A diagnostic score for the prediction of spontaneous resolution of acute hepatitis C virus infection.

    Science.gov (United States)

    Beinhardt, Sandra; Payer, Berit Anna; Datz, Christian; Strasser, Michael; Maieron, Andreas; Dorn, Livia; Grilnberger-Franz, Evelyn; Dulic-Lakovic, Emina; Stauber, Rudolf; Laferl, Hermann; Aberle, Judith H; Holzmann, Heidemarie; Krall, Christoph; Vogel, Wolfgang; Ferenci, Peter; Hofer, Harald

    2013-11-01

    IL28B polymorphisms, jaundice, decline in HCV-RNA, IP-10, and gender have been proposed to be indicative of spontaneous clearance of acute hepatitis C virus infection. The aim of this study was to define a score enabling the discrimination of patients with spontaneous clearance of HCV from those with development of viral persistence and need for early antiviral treatment. 136 patients (74 male; 35 ± 15 years) were analyzed. From variables predictive of spontaneous clearance, calculated by univariate analysis, three scores were built. Analogous cut-offs were evaluated by computing area under the receiver operating characteristic curves. Candidate variables and cut-offs were: (I) presence of IL28B C/C (p=0.027), (II) age (p=0.031; cut-off: 35 years), (III) peak-bilirubin (p=0.018; cut-off: 6 mg/dl), (IV) HCV-RNA decline within 4 weeks (p2.5 log), (V) serum IP-10 (p=0.003; cut-off: 546 pg/ml), (VI) presence of CD4(+) Th1 cells (p=0.024). Each variable was allocated to 0 or 1 point, an HCV-RNA decline of ≥ 1 log 10 but discrimination between AHC-patients with high potential for spontaneous clearance from candidates for early therapeutic intervention due to marginal chance of spontaneous resolution. Copyright © 2013 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

  13. Acute flaccid paralysis due to West nile virus infection in adults: A paradigm shift entity

    Directory of Open Access Journals (Sweden)

    Boby Varkey Maramattom

    2014-01-01

    Full Text Available Three cases of acute flaccid paralysis (AFP with preceding fever are described. One patient had a quadriparesis with a florid meningoencephalitic picture and the other two had asymmetric flaccid paralysis with fasciculations at the onset of illness. Magnetic resonance imaging in two cases showed prominent hyperintensitities in the spinal cord and brainstem with prominent involvement of the grey horn (polio-myelitis. Cerebrospinal fluid (CSF polymerase chain reaction was positive for West Nile virus (WNV in the index patient. All three cases had a positive WNV immunoglobulin M antibody in serum/CSF and significantly high titer of WNV neutralizing antibody in serum, clearly distinguishing the infection from other Flaviviridae such as Japanese encephalitis. WNV has been recognized in India for many decades; however, AFP has not been adequately described. WNV is a flavivirus that is spread by Culex mosquitoes while they take blood meals from humans and lineage 1 is capable of causing a devastating neuro-invasive disease with fatal consequences or severe morbidity. We describe the first three laboratory confirmed cases of WNV induced AFP from Kerala and briefly enumerate the salient features of this emerging threat.

  14. Infection of rhesus macaques with a pool of simian immunodeficiency virus with the envelope genes from acute HIV-1 infections.

    Science.gov (United States)

    Krebs, Kendall C; Tian, Meijuan; Asmal, Mohammed; Ling, Binhua; Nelson, Kenneth; Henry, Kenneth; Gibson, Richard; Li, Yuejin; Han, Weining; Shattock, Robin J; Veazey, Ronald S; Letvin, Norman; Arts, Eric J; Gao, Yong

    2016-11-25

    New simian-human immunodeficiency chimeric viruses with an HIV-1 env (SHIVenv) are critical for studies on HIV pathogenesis, vaccine development, and microbicide testing. Macaques are typically exposed to single CCR5-using SHIVenv which in most instances does not reflect the conditions during acute/early HIV infection (AHI) in humans. Instead of individual and serial testing new SHIV constructs, a pool of SHIVenv_B derived from 16 acute HIV-1 infections were constructed using a novel yeast-based SHIV cloning approach and then used to infect macaques. Even though none of the 16 SHIVenvs contained the recently reported mutations in env genes that could significantly enhance their binding affinity to RhCD4, one SHIVenv (i.e. SHIVenv_B3-PRB926) established infection in macaques exposed to this pool. AHI SHIVenv_B viruses as well as their HIVenv_B counterparts were analyzed for viral protein content, function, and fitness to identify possible difference between SHIVenv_B3-PRB926 and the other 15 SHIVenvs in the pool. All of the constructs produced SHIV or HIV chimeric with wild type levels of capsid (p27 and p24) content, reverse transcriptase (RT) activity, and expressed envelope glycoproteins that could bind to cell receptors CD4/CCR5 and mediate virus entry. HIV-1env_B chimeric viruses were propagated in susceptible cell lines but the 16 SHIVenv_B variants showed only limited replication in macaque peripheral blood mononuclear cells (PBMCs) and 174×CEM.CCR5 cell line. AHI chimeric viruses including HIVenv_B3 showed only minor variations in cell entry efficiency and kinetics as well as replicative fitness in human PBMCs. Reduced number of N-link glycosylation sites and slightly greater CCR5 affinity/avidity was the only distinguishing feature of env_B3 versus other AHI env's in the pool, a feature also observed in the HIV establishing new infections in humans. Despite the inability to propagate in primary cells and cell lines, a pool of 16 SHIVenv viruses could

  15. The effects of female sex, viral genotype, and IL28B genotype on spontaneous clearance of acute hepatitis C virus infection

    NARCIS (Netherlands)

    Grebely, Jason; Page, Kimberly; Sacks-Davis, Rachel; van der Loeff, Maarten Schim; Rice, Thomas M.; Bruneau, Julie; Morris, Meghan D.; Hajarizadeh, Behzad; Amin, Janaki; Cox, Andrea L.; Kim, Arthur Y.; McGovern, Barbara H.; Schinkel, Janke; George, Jacob; Shoukry, Naglaa H.; Lauer, Georg M.; Maher, Lisa; Lloyd, Andrew R.; Hellard, Margaret; Dore, Gregory J.; Prins, Maria; Lauer, Georg; Morris, Meghan; Hahn, Judy; Rilla, Megan; Alavi, Maryam; Bouchard, Rachel; Evans, Jennifer; Grady, Bart; Aneja, Jasneet; Teutsch, Suzy; White, Bethany; Wells, Brittany; Zang, Geng; Applegate, Tanya; Matthews, Gail; Yeung, Barbara; Prince, Leslie Erin; Roy, Elise; Bates, Anna; Enriquez, Jarliene; Chow, Sammy; McCredie, Luke; Aitken, Campbell; Doyle, Joseph; Spelman, Tim

    2014-01-01

    Although 20%-40% of persons with acute hepatitis C virus (HCV) infection demonstrate spontaneous clearance, the time course and factors associated with clearance remain poorly understood. We investigated the time to spontaneous clearance and predictors among participants with acute HCV using Cox

  16. Severity of acute Zika virus infection: A prospective emergency room surveillance study during the 2015-2016 outbreak in Suriname.

    Science.gov (United States)

    Vroon, Pieter; Roosblad, Jimmy; Poese, Fauzia; Wilschut, Jan; Codrington, John; Vreden, Stephen; Zonneveld, Rens

    2017-01-01

    Acute Zika virus (ZIKV) infection is usually mild and self-limiting. Earlier, we reported three cases of fatal acute ZIKV infection in patients without typical signs of ZIKV, but rather with criteria of systemic inflammation response syndrome (SIRS). To follow up these observations, we prospectively included patients at the emergency room with temperature instability and suspected to have acute ZIKV infection, SIRS, or both. A total of 102 patients were included of whom N = 21 (21%) were suspected of acute ZIKV infection, N = 56 (55%) of acute ZIKV infection with SIRS criteria, and N = 25 (24%) of SIRS alone. ZIKV-PCR was positive in N = 21 (20%) patients. Eight (38%) ZIKV-positive patients needed admission to the hospital of whom four (50%) presented with SIRS alone. One ZIKV-positive patient had vascular co-morbidity and died following shock and severe coagulopathy. We confirm the hypothesis that acute ZIKV infection can present atypical and severely with systemic inflammation and have lethal course particularly amongst patients with significant prior disease.

  17. In vitro infection of pupae with Israeli acute paralysis virus suggests disturbance of transcriptional homeostasis in honey bees (Apis mellifera.

    Directory of Open Access Journals (Sweden)

    Humberto F Boncristiani

    Full Text Available The ongoing decline of honey bee health worldwide is a serious economic and ecological concern. One major contributor to the decline are pathogens, including several honey bee viruses. However, information is limited on the biology of bee viruses and molecular interactions with their hosts. An experimental protocol to test these systems was developed, using injections of Israeli Acute Paralysis Virus (IAPV into honey bee pupae reared ex-situ under laboratory conditions. The infected pupae developed pronounced but variable patterns of disease. Symptoms varied from complete cessation of development with no visual evidence of disease to rapid darkening of a part or the entire body. Considerable differences in IAPV titer dynamics were observed, suggesting significant variation in resistance to IAPV among and possibly within honey bee colonies. Thus, selective breeding for virus resistance should be possible. Gene expression analyses of three separate experiments suggest IAPV disruption of transcriptional homeostasis of several fundamental cellular functions, including an up-regulation of the ribosomal biogenesis pathway. These results provide first insights into the mechanisms of IAPV pathogenicity. They mirror a transcriptional survey of honey bees afflicted with Colony Collapse Disorder and thus support the hypothesis that viruses play a critical role in declining honey bee health.

  18. N-acetyl-l-cystine (NAC) protects against H9N2 swine influenza virus-induced acute lung injury.

    Science.gov (United States)

    Zhang, Rui-Hua; Li, Chun-Hong; Wang, Cun-Lian; Xu, Ming-Ju; Xu, Tong; Wei, Dong; Liu, Bao-Jian; Wang, Guo-Hua; Tian, Shu-Fei

    2014-09-01

    The antioxidant N-acetyl-l-cysteine (NAC) had been shown to inhibit replication of seasonal human influenza A viruses. Here, the effects of NAC on H9N2 swine influenza virus-induced acute lung injury (ALI) were investigated in mice. BALB/c mice were inoculated intranasally with 10(7) 50% tissue culture infective doses (TCID(50)) of A/swine/HeBei/012/2008/(H9N2) viruses with or without NAC treatments to induce ALI model. The result showed that pulmonary inflammation, pulmonary edema, MPO activity, total cells, neutrophils, macrophages, TNF-α, IL-6, IL-1β and CXCL-10 in BALF were attenuated by NAC. Moreover, our data showed that NAC significantly inhibited the levels of TLR4 protein and TLR4 mRNA in the lungs. Pharmacological inhibitors of TLR4 (E5564) exerted similar effects like those determined for NAC in H9N2 swine influenza virus-infected mice. These results suggest that antioxidants like NAC represent a potential additional treatment option that could be considered in the case of an influenza A virus pandemic. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. In vitro infection of pupae with Israeli acute paralysis virus suggests disturbance of transcriptional homeostasis in honey bees (Apis mellifera).

    Science.gov (United States)

    Boncristiani, Humberto F; Evans, Jay D; Chen, Yanping; Pettis, Jeff; Murphy, Charles; Lopez, Dawn L; Simone-Finstrom, Michael; Strand, Micheline; Tarpy, David R; Rueppell, Olav

    2013-01-01

    The ongoing decline of honey bee health worldwide is a serious economic and ecological concern. One major contributor to the decline are pathogens, including several honey bee viruses. However, information is limited on the biology of bee viruses and molecular interactions with their hosts. An experimental protocol to test these systems was developed, using injections of Israeli Acute Paralysis Virus (IAPV) into honey bee pupae reared ex-situ under laboratory conditions. The infected pupae developed pronounced but variable patterns of disease. Symptoms varied from complete cessation of development with no visual evidence of disease to rapid darkening of a part or the entire body. Considerable differences in IAPV titer dynamics were observed, suggesting significant variation in resistance to IAPV among and possibly within honey bee colonies. Thus, selective breeding for virus resistance should be possible. Gene expression analyses of three separate experiments suggest IAPV disruption of transcriptional homeostasis of several fundamental cellular functions, including an up-regulation of the ribosomal biogenesis pathway. These results provide first insights into the mechanisms of IAPV pathogenicity. They mirror a transcriptional survey of honey bees afflicted with Colony Collapse Disorder and thus support the hypothesis that viruses play a critical role in declining honey bee health.

  20. A Cross-Sectional Analysis of Acute Hepatitis B Virus Reported to the Vancouver Coastal Health Authority from 2000 to 2003

    Directory of Open Access Journals (Sweden)

    Yvette Leung

    2006-01-01

    Full Text Available BACKGROUND: Acute hepatitis B virus (HBV transmission remains a significant public health problem despite effective vaccination and prophylaxis strategies. Vancouver, British Columbia, has a large ethnic community from endemic areas, which may further impact on the epidemiology of acute HBV. A cross-sectional study of factors associated with acute HBV cases reported to the Vancouver Coastal Health Authority (Vancouver, British Columbia from 2000 to 2003 is reported.

  1. Dialysis-Requiring Acute Kidney Injury among Hospitalized Adults with Documented Hepatitis C Virus Infection: A Nationwide Inpatient Sample Analysis

    Science.gov (United States)

    Nadkarni, Girish N; Patel, Achint; Simoes, Priya K; Yacoub, Rabi; Annapureddy, Narender; Kamat, Sunil; Konstantinidis, Ioannis; Perumalswami, Ponni; Branch, Andrea; Coca, Steven G; Wyatt, Christina M

    2015-01-01

    Chronic Hepatitis C virus (HCV) infection may cause kidney injury, particularly in the setting of cryoglobulinemia or cirrhosis; however, few studies have evaluated the epidemiology of acute kidney injury in patients with HCV. We aimed to describe national temporal trends of incidence and impact of severe AKI requiring renal replacement (“dialysis-requiring AKI”) in hospitalized adults with HCV. We extracted our study cohort from the Nationwide Inpatient Sample of the Healthcare Cost and Utilization Project using data from 2004–2012. We defined HCV and dialysis-requiring acute kidney injury based on previously validated ICD-9-CM codes. We analyzed temporal changes in the proportion of hospitalizations complicated by dialysis-requiring AKI and utilized survey multivariable logistic regression models to estimate its impact on in-hospital mortality. We identified a total of 4,603,718 adult hospitalizations with an associated diagnosis of HCV from 2004–2012, of which 51,434 (1.12%) were complicated by dialysis-requiring acute kidney injury. The proportion of hospitalizations complicated by dialysis-requiring acute kidney injury increased significantly from 0.86% in 2004 to 1.28% in 2012. In-hospital mortality was significantly higher in hospitalizations complicated by dialysis-requiring acute kidney injury vs. those without (27.38% vs. 2.95%; adjusted odds ratio 2.09, 95% Confidence Interval 1.74–2.51). The proportion of HCV hospitalizations complicated by dialysis-requiring acute kidney injury increased significantly between 2004–2012. Similar to observations in the general population, dialysis-requiring acute kidney injury was associated with a two-fold increase in odds of in-hospital mortality in adults with HCV. These results highlight the burden of acute kidney injury in hospitalized adults with HCV infection. PMID:26189719

  2. Miocarditis fulminante y enfermedad diarreica aguda por Coxsackie virus B6 Fulminant myocarditis and acute gastroenteritis due to Coxsackie virus B6

    Directory of Open Access Journals (Sweden)

    Germán Málaga

    2011-03-01

    Full Text Available Presentamos el caso de una paciente joven que presentó choque cardiogénico por virus Coxsakie B6. La paciente acudió a una clínica particular con un cuadro clínico compatible con gastroenterocolitis aguda a la que después de una hora de estar recibiendo hidratación y manejo del cuadro diagnosticado, se agregó hipotensión que llegó al estado de choque, hipoxemia severa y compromiso pulmonar bilateral intersticial por lo que ingresó a Unidad de Cuidados Intensivos, donde recibió manejo de soporte. Debido al cuadro clínico y elevación de enzimas cardiacas se sospechó de compromiso cardiaco, la ecocardiografía evidenció cambios sugerentes de miocarditis. La evolución fue favorable y se le pudo dar de alta después de una semana. El diagnóstico etiológico del cuadro se hizo en el seguimiento, presentando serología con elevación de títulos para virus Coxsakie B6.We present the case of a young woman who suffered cardiogenic due to by Coxsackie virus B6. The patient attended a private clinic with an acute gastroenteritis and after one hour of receiving hydratation,she developed hypotension and shock, severe hypoxemia and bilateral lung infiltrate. The patient entered the Intensive Care Unit, where she received hemodynamic support. Due to the clinical picture and cardiac enzymes increase, a cardiac failure was suspected and the echocardiographic findings suggested "myocarditis". The evolution was successful and Coxsackie B6 virus infection diagnosis was made during the follow up by increase of the levels of antibodies for virus Coxsackie B6.

  3. Acute mucosal pathogenesis of feline immunodeficiency virus is independent of viral dose in vaginally infected cats

    Directory of Open Access Journals (Sweden)

    Egan Erin A

    2010-01-01

    Full Text Available Abstract Background The mucosal pathogenesis of HIV has been shown to be an important feature of infection and disease progression. HIV-1 infection causes depletion of intestinal lamina propria CD4+ T cells (LPL, therefore, intestinal CD4+ T cell preservation may be a useful correlate of protection in evaluating vaccine candidates. Vaccine studies employing the cat/FIV and macaque/SIV models frequently use high doses of parenterally administered challenge virus to ensure high plasma viremia in control animals. However, it is unclear if loss of mucosal T cells would occur regardless of initial viral inoculum dose. The objective of this study was to determine the acute effect of viral dose on mucosal leukocytes and associated innate and adaptive immune responses. Results Cats were vaginally inoculated with a high, middle or low dose of cell-associated and cell-free FIV. PBMC, serum and plasma were assessed every two weeks with tissues assessed eight weeks following infection. We found that irrespective of mucosally administered viral dose, FIV infection was induced in all cats. However, viremia was present in only half of the cats, and viral dose was unrelated to the development of viremia. Importantly, regardless of viral dose, all cats experienced significant losses of intestinal CD4+ LPL and CD8+ intraepithelial lymphocytes (IEL. Innate immune responses by CD56+CD3- NK cells correlated with aviremia and apparent occult infection but did not protect mucosal T cells. CD4+ and CD8+ T cells in viremic cats were more likely to produce cytokines in response to Gag stimulation, whereas aviremic cats T cells tended to produce cytokines in response to Env stimulation. However, while cell-mediated immune responses in aviremic cats may have helped reduce viral replication, they could not be correlated to the levels of viremia. Robust production of anti-FIV antibodies was positively correlated with the magnitude of viremia. Conclusions Our results indicate

  4. Comparison of Shear Strength Properties for Undisturbed and Reconstituted Parit Nipah Peat, Johor

    Science.gov (United States)

    Azhar, A. T. S.; Norhaliza, W.; Ismail, B.; Abdullah, M. E.; Zakaria, M. N.

    2016-11-01

    Shear strength of soil is required to determine the soil stability and design the foundations. Peat is known as a soil with complex natural formations which also contributes problems to the researchers, developers, engineers and contractors in constructions and infrastructures. Most researchers conducted experiment and investigation of shear strength on peat using shear box test and simple shear test, but only a few had discovered the behavior of peat using triaxial consolidated undrained test. The aim of this paper is to determine the undrained shear strength properties of reconstituted peat and undisturbed peat of Parit Nipah, Johor for comparison purposes. All the reconstituted peat samples were formed with the size that passed opening sieve 3.35 mm and preconsolidation pressure at 100 kPa. The result of undrained shear strength of reconstituted peat was 21kPa for cohesion with the angle of friction, 41° compare to the undisturbed peat with cohesion 10 kPa and angle of friction, 16°. The undrained shear strength properties result obtained shows that the reconstituted peat has higher strength than undisturbed peat. For relationship deviator stress-strain, σd max and excess pore pressure, Δu, it shows that both of undisturbed and reconstituted gradually increased when σ’ increased, but at the end of the test, the values are slightly dropped. The physical properties of undisturbed and reconstituted peat were also investigated to correlate with the undrained shear strength results.

  5. Partial regulatory T cell depletion prior to acute feline immunodeficiency virus infection does not alter disease pathogenesis.

    Directory of Open Access Journals (Sweden)

    S Rochelle Mikkelsen

    2011-02-01

    Full Text Available Feline immunodeficiency virus (FIV infection in cats follows a disease course similar to HIV-1, including a short acute phase characterized by high viremia, and a prolonged asymptomatic phase characterized by low viremia and generalized immune dysfunction. CD4(+CD25(hiFoxP3(+ immunosuppressive regulatory T (Treg cells have been implicated as a possible cause of immune dysfunction during FIV and HIV-1 infection, as they are capable of modulating virus-specific and inflammatory immune responses. Additionally, the immunosuppressive capacity of feline Treg cells has been shown to be increased during FIV infection. We have previously shown that transient in vivo Treg cell depletion during asymptomatic FIV infection reveals FIV-specific immune responses suppressed by Treg cells. In this study, we sought to determine the immunological influence of Treg cells during acute FIV infection. We asked whether Treg cell depletion prior to infection with the highly pathogenic molecular clone FIV-C36 in cats could alter FIV pathogenesis. We report here that partial Treg cell depletion prior to FIV infection does not significantly change provirus, viremia, or CD4(+ T cell levels in blood and lymphoid tissues during the acute phase of disease. The effects of anti-CD25 mAb treatment are truncated in cats acutely infected with FIV-C36 as compared to chronically infected cats or FIV-naïve cats, as Treg cell levels were heightened in all treatment groups included in the study within two weeks post-FIV infection. Our findings suggest that the influence of Treg cell suppression during FIV pathogenesis is most prominent after Treg cells are activated in the environment of established FIV infection.

  6. Partial regulatory T cell depletion prior to acute feline immunodeficiency virus infection does not alter disease pathogenesis.

    Science.gov (United States)

    Mikkelsen, S Rochelle; Long, Julie M; Zhang, Lin; Galemore, Erin R; VandeWoude, Sue; Dean, Gregg A

    2011-02-25

    Feline immunodeficiency virus (FIV) infection in cats follows a disease course similar to HIV-1, including a short acute phase characterized by high viremia, and a prolonged asymptomatic phase characterized by low viremia and generalized immune dysfunction. CD4(+)CD25(hi)FoxP3(+) immunosuppressive regulatory T (Treg) cells have been implicated as a possible cause of immune dysfunction during FIV and HIV-1 infection, as they are capable of modulating virus-specific and inflammatory immune responses. Additionally, the immunosuppressive capacity of feline Treg cells has been shown to be increased during FIV infection. We have previously shown that transient in vivo Treg cell depletion during asymptomatic FIV infection reveals FIV-specific immune responses suppressed by Treg cells. In this study, we sought to determine the immunological influence of Treg cells during acute FIV infection. We asked whether Treg cell depletion prior to infection with the highly pathogenic molecular clone FIV-C36 in cats could alter FIV pathogenesis. We report here that partial Treg cell depletion prior to FIV infection does not significantly change provirus, viremia, or CD4(+) T cell levels in blood and lymphoid tissues during the acute phase of disease. The effects of anti-CD25 mAb treatment are truncated in cats acutely infected with FIV-C36 as compared to chronically infected cats or FIV-naïve cats, as Treg cell levels were heightened in all treatment groups included in the study within two weeks post-FIV infection. Our findings suggest that the influence of Treg cell suppression during FIV pathogenesis is most prominent after Treg cells are activated in the environment of established FIV infection.

  7. Equine infectious anemia virus replication is upregulated during differentiation of blood monocytes from acutely infected horses.

    OpenAIRE

    Sellon, D C; Walker, K M; Russell, K E; Perry, S T; Covington, P; Fuller, F J

    1996-01-01

    Equine infectious anemia virus is a lentivirus that replicates in mature tissue macrophages of horses. Ponies were infected with equine infectious anemia virus. During febrile episodes, proviral DNA was detectable, but viral mRNA was not detectable. As cultured blood monocytes from these ponies differentiated into macrophages, viral expression was upregulated. In situ hybridization confirmed that viral transcription occurred in mature macrophages.

  8. Follow-up after acute respiratory distress syndrome caused by influenza a (H1N1 virus infection

    Directory of Open Access Journals (Sweden)

    Carlos Toufen Jr.

    2011-01-01

    Full Text Available BACKGROUND: There are no reports on the long-term follow-up of patients with swine-origin influenza A virus infection that progressed to acute respiratory distress syndrome. METHODS: Four patients were prospectively followed up with pulmonary function tests and high-resolution computed tomography for six months after admission to an intensive care unit. RESULTS: Pulmonary function test results assessed two months after admission to the intensive care unit showed reduced forced vital capacity in all patients and low diffusion capacity for carbon monoxide in two patients. At six months, pulmonary function test results were available for three patients. Two patients continued to have a restrictive pattern, and none of the patients presented with abnormal diffusion capacity for carbon monoxide. All of them had a diffuse ground-glass pattern on high-resolution computed tomography that improved after six months. CONCLUSIONS: Despite the marked severity of lung disease at admission, patients with acute respiratory distress syndrome caused by swine-origin influenza A virus infection presented a late but substantial recovery over six months of follow-up.

  9. Bone Marrow-Derived Mesenchymal Stem Cells Attenuate Immune-Mediated Liver Injury and Compromise Virus Control During Acute Hepatitis B Virus Infection in Mice.

    Science.gov (United States)

    Qu, Mengmeng; Yuan, Xu; Liu, Dan; Ma, Yuhong; Zhu, Jun; Cui, Jun; Yu, Mengxue; Li, Changyong; Guo, Deyin

    2017-06-01

    Mesenchymal stem cells (MSCs) have been used as therapeutic tools not only for their ability to differentiate toward different cells, but also for their unique immunomodulatory properties. However, it is still unknown how MSCs may affect immunity during hepatitis B virus (HBV) infection. This study was designed to explore the effect of bone marrow-derived MSCs (BM-MSCs) on hepatic natural killer (NK) cells in a mouse model of acute HBV infection. Mice were injected with 1 × 10 6 BM-MSCs, which stained with chloromethyl derivatives of fluorescein diacetate fluorescent probe, 24 h before hydrodynamic injection of viral DNA (pHBV1.3) through the tail vein. In vivo imaging system revealed that BM-MSCs were accumulated in the injured liver, and they attenuated immune-mediated liver injury during HBV infection, as shown by lower alanine aminotransferase levels, reduced proinflammatory cytokine production, and decreased inflammatory cell infiltration in the liver. Importantly, administration of BM-MSCs restrained the increased expression of natural-killer group 2, member D (NKG2D), an important receptor required for NK cell activation in the liver from HBV-infected mice. BM-MSCs also reduced NKG2D expression on NK cells and suppressed the cytotoxicity of NK cells in vitro. Furthermore, BM-MSC-derived transforming growth factor-β1 suppressed NKG2D expression on NK cells. As a consequence, BM-MSC treatment enhanced HBV gene expression and replication in vivo. These results demonstrate that adoptive transfer of BM-MSCs influences innate immunity and limits immune-mediated liver injury during acute HBV infection by suppressing NK cell activity. Meanwhile, the effect of BM-MSCs on prolonging virus clearance needs to be considered in the future.

  10. Acute retinal necrosis results in low vision in a young patient with a history of herpes simplex virus encephalitis.

    Science.gov (United States)

    Shahi, Sanjeet K

    2017-05-01

    Acute retinal necrosis (ARN), secondary to herpes simplex encephalitis, is a rare syndrome that can present in healthy individuals, as well as immuno-compromised patients. Most cases are caused by a secondary infection from the herpes virus family, with varicella zoster virus being the leading cause of this syndrome. Potential symptoms include blurry vision, floaters, ocular pain and photophobia. Ocular findings may consist of severe uveitis, retinal vasculitis, retinal necrosis, papillitis and retinal detachment. Clinical manifestations of this disease may include increased intraocular pressure, optic disc oedema, optic neuropathy and sheathed retinal arterioles. A complete work up is essential to rule out cytomegalovirus retinitis, herpes simplex encephalitis, herpes virus, syphilis, posterior uveitis and other conditions. Depending on the severity of the disease, the treatment options consist of anticoagulation therapy, cycloplegia, intravenous acyclovir, systemic steroids, prophylactic laser photocoagulation and pars plana vitrectomy with silicon oil for retinal detachment. An extensive history and clinical examination is crucial in making the correct diagnosis. Also, it is very important to be aware of low vision needs and refer the patients, if expressing any sort of functional issues with completing daily living skills, especially reading. In this article, we report one case of unilateral ARN 20 years after herpetic encephalitis. © 2016 Optometry Australia.

  11. Multiploid CD61+ Cells Are the Pre-Dominant Cell Lineage Infected during Acute Dengue Virus Infection in Bone Marrow

    Science.gov (United States)

    Clark, Kristina B.; Noisakran, Sansanee; Onlamoon, Nattawat; Hsiao, Hui-Mien; Roback, John; Villinger, Francois; Ansari, Aftab A.; Perng, Guey Chuen

    2012-01-01

    Depression of the peripheral blood platelet count during acute infection is a hallmark of dengue. This thrombocytopenia has been attributed, in part, to an insufficient level of platelet production by megakaryocytes that reside in the bone marrow (BM). Interestingly, it was observed that dengue patients experience BM suppression at the onset of fever. However, few studies focus on the interaction between dengue virus (DENV) and megakaryocytes and how this interaction can lead to a reduction in platelets. In the studies reported herein, BM cells from normal healthy rhesus monkeys (RM) and humans were utilized to identify the cell lineage(s) that were capable of supporting virus infection and replication. A number of techniques were employed in efforts to address this issue. These included the use of viral RNA quantification, nonstructural protein and infectivity assays, phenotypic studies utilizing immunohistochemical staining, anti-differentiation DEAB treatment, and electron microscopy. Cumulative results from these studies revealed that cells in the BM were indeed highly permissive for DENV infection, with human BM having higher levels of viral production compared to RM. DENV-like particles were predominantly observed in multi-nucleated cells that expressed CD61+. These data suggest that megakaryocytes are likely the predominant cell type infected by DENV in BM, which provides one explanation for the thrombocytopenia and the dysfunctional platelets characteristic of dengue virus infection. PMID:23300812

  12. Analysis of plasma viral RNA levels during acute dengue virus infection using quantitative competitor reverse transcription-polymerase chain reaction.

    Science.gov (United States)

    Sudiro, T M; Zivny, J; Ishiko, H; Green, S; Vaughn, D W; Kalayanarooj, S; Nisalak, A; Norman, J E; Ennis, F A; Rothman, A L

    2001-01-01

    There is increasing recognition of the potential importance of viral burden in the pathogenesis of dengue hemorrhagic fever (DHF). There is little data available, however, describing the kinetics of viral replication in humans with natural dengue virus (DV) infection. Standard procedures for measuring titers of infectious virus in clinical specimens are either laborious or insensitive. We developed a method for measurement of DV RNA in plasma samples based on reverse transcription-polymerase chain reaction (RT-PCR) using a mutant RNA target as a competitor. This technique was reproducible and accurate for samples containing any of the four DV serotypes, and could be applied to samples containing as few as 250 copies of RNA per reaction. We examined plasma viral RNA levels in 80 children with acute DV infection; sequential plasma samples were tested in 34 of these children. Plasma viral RNA levels ranged as high as 10(9) RNA copies/ml, and correlated with titers of infectious virus measured in mosquitoes (r= 0.69). Plasma viral RNA levels fell rapidly during the last several days of the febrile period. We did not find a significant difference in maximal plasma viral RNA levels between children with DHF and children with dengue fever, but peak viral RNA levels were identified in only 16 subjects. We conclude that this quantitative RT-PCR method will be valuable for further studies of natural DV infections.

  13. Cryo-electron Microscopy Study of the Genome Release of the Dicistrovirus Israeli Acute Bee Paralysis Virus.

    Science.gov (United States)

    Mullapudi, Edukondalu; Füzik, Tibor; Přidal, Antonín; Plevka, Pavel

    2017-02-15

    Viruses of the family Dicistroviridae can cause substantial economic damage by infecting agriculturally important insects. Israeli acute bee paralysis virus (IAPV) causes honeybee colony collapse disorder in the United States. High-resolution molecular details of the genome delivery mechanism of dicistroviruses are unknown. Here we present a cryo-electron microscopy analysis of IAPV virions induced to release their genomes in vitro We determined structures of full IAPV virions primed to release their genomes to a resolution of 3.3 Å and of empty capsids to a resolution of 3.9 Å. We show that IAPV does not form expanded A particles before genome release as in the case of related enteroviruses of the family Picornaviridae The structural changes observed in the empty IAPV particles include detachment of the VP4 minor capsid proteins from the inner face of the capsid and partial loss of the structure of the N-terminal arms of the VP2 capsid proteins. Unlike the case for many picornaviruses, the empty particles of IAPV are not expanded relative to the native virions and do not contain pores in their capsids that might serve as channels for genome release. Therefore, rearrangement of a unique region of the capsid is probably required for IAPV genome release. Honeybee populations in Europe and North America are declining due to pressure from pathogens, including viruses. Israeli acute bee paralysis virus (IAPV), a member of the family Dicistroviridae, causes honeybee colony collapse disorder in the United States. The delivery of virus genomes into host cells is necessary for the initiation of infection. Here we present a structural cryo-electron microscopy analysis of IAPV particles induced to release their genomes. We show that genome release is not preceded by an expansion of IAPV virions as in the case of related picornaviruses that infect vertebrates. Furthermore, minor capsid proteins detach from the capsid upon genome release. The genome leaves behind empty

  14. Serum levels of chicken mannan-binding lectin (MBL) during virus infections; indication that chicken MBL is an acute phase reactant

    DEFF Research Database (Denmark)

    Nielsen, O.L.; Jensenius, J. C.; Jørgensen, Poul Henrik

    1999-01-01

    Mannan-binding lectin (MBL) is a serum collectin which is believed to be an opsonin of the innate immune defence against various microorganisms. MBL is a minor acute phase reactant in man. We investigated the concentration of serum MBL in chickens infected with infectious bronchitis virus (IBV...... levels returned to normal values 6-10 days after infection. The results indicated that MBL is a minor acute phase reactant in chickens....

  15. Pengaruh Konsentrasi Asam Sitrat dan Suhu Pengempaan terhadap Kualitas Papan Partikel Pelepah Nipah

    Directory of Open Access Journals (Sweden)

    Ragil Widyorini

    2014-01-01

    Full Text Available Papan partikel tanpa perekat sintesis atau binderlessboard merupakan alternatif produk ramah lingkungan yang potensial dikembangkan di Indonesia. Kelemahan produk tersebut diantaranya adalah kestabilan dimensinya yang relatif rendah. Alternatif perbaikan produk bisa dilakukan dengan menambahkan bahan pengaktif komponen kimia. Asam sitrat memiliki tiga gugus karboksil dan diharapkan dapat membentuk ikatan ester dengan gugus hidroksil pada permukaan kayu. Penelitian menggunakan asam sitrat relatif baru dan belum banyak dikembangkan, oleh karena itu penelitian ini ditujukan untuk pengembangan produk biokomposit dengan menggunakan asam sitrat sebagai bahan pengikat. Bahan yang digunakan adalah pelepah nipah dengan ukuran partikel (halus dan kasar, konsentrasi asam sitrat (0% dan 10%, dan suhu pengempaan (180ºC dan 200°C. Pengujian sifat fisika dan mekanika dilakukan berdasarkan Japanese Industrial Standard untuk papan partikel (JIS A 5908. Penambahan asam sitrat memperlihatkan kenaikan sifat fisika (penyerapan air dan mekanika papan partikel. Perbedaan ukuran partikel mempengaruhi sifat mekanika papan partikel dimana ukuran partikel kasar memberikan nilai mekanika yang lebih baik dibandingkan dengan ukuran partikel halus. Kualitas papan partikel optimum diperoleh pada kondisi pengempaan 180ºC, penambahan asam sitrat 10% dari partikel ukuran kasar dengan nilai pengembangan tebal 2,4%, penyerapan air 41%, kekuatan rekat internal 0,2 MPa, modulus patah 5,5 MPa, dan modulus elastisitas 1,6 GPa. Kata kunci: asam sitrat, pelepah nipah, konsentrasi asam sitrat, suhu pengempa   Effect of Citric Acid Concentration and Pressing Temperature on the Quality of Particleboard from Nypa Frond Abstract Binderlessboard is one of the potential eco friendly products that can be developed in Indonesia. However, its boards usually have low in dimensional stability. Addition of the chemical agent, such as citric acid, that can improve the dimensional stability is

  16. A polymorphism near IL28B is associated with spontaneous clearance of acute hepatitis C virus and jaundice.

    Science.gov (United States)

    Tillmann, Hans L; Thompson, Alex J; Patel, Keyur; Wiese, Manfred; Tenckhoff, Hannelore; Nischalke, Hans D; Lokhnygina, Yuliya; Kullig, Ulrike; Göbel, Uwe; Capka, Emanuela; Wiegand, Johannes; Schiefke, Ingolf; Güthoff, Wolfgang; Grüngreiff, Kurt; König, Ingrid; Spengler, Ulrich; McCarthy, Jeanette; Shianna, Kevin V; Goldstein, David B; McHutchison, John G; Timm, Jörg; Nattermann, Jacob

    2010-11-01

    A single nucleotide polymorphism (SNP) upstream of the IL28B gene has been associated with response of patients with chronic hepatitis C to therapy with pegylated interferon and ribavirin and also with spontaneous clearance of acute hepatitis C in a heterogeneous population. We analyzed the association between IL28B and the clinical presentation of acute hepatitis C virus (HCV) infection in a homogeneous population. We analyzed the SNP rs12979860 in 190 women from the German anti-D cohort (infected with HCV genotype 1b via contaminated rhesus prophylaxis) and its association with spontaneous clearance. Clinical data were available in 136 women with acute infection who were also evaluated for IL28B genotype. Based on results of a TaqMan polymerase chain reaction assay, the rs12979860 SNP genotypes studied were C/C, C/T, or T/T. Spontaneous clearance was more common in patients with the C/C genotype (43/67; 64%) compared with C/T (22/90; 24%) or T/T (2/33; 6%) (P Jaundice during acute infection was more common among patients with C/C genotype (32.7%) than non-C/C patients (with C/T or T/T) (16.1%; P = .032). In C/C patients, jaundice during acute infection was not associated with an increased chance of spontaneous clearance (56.3%) compared with those without jaundice (60.6%). In contrast, in non-C/C patients, jaundice was associated with a higher likelihood of spontaneous clearance (42.9%) compared with those without jaundice (13.7%). The SNP rs12979860 upstream of IL28B is associated with spontaneous clearance of HCV. Women with the C/T or T/T genotype who did not develop jaundice had a lower chance of spontaneous clearance of HCV infection. Copyright © 2010 AGA Institute. Published by Elsevier Inc. All rights reserved.

  17. Preliminary evidence of mitochondrial dysfunction associated with post-infective fatigue after acute infection with Epstein Barr Virus

    Directory of Open Access Journals (Sweden)

    Hickie Ian B

    2006-01-01

    Full Text Available Abstract Background Acute infectious diseases are typically accompanied by non-specific symptoms including fever, malaise, irritability and somnolence that usually resolve on recovery. However, in some individuals these symptoms persist in what is commonly termed post-infective fatigue. The objective of this pilot study was to determine the gene expression correlates of post-infective fatigue following acute Epstein Barr virus (EBV infection. Methods We followed 5 people with acute mononucleosis who developed post-infective fatigue of more than 6 months duration and 5 HLA-matched control subjects who recovered within 3 months. Subjects had peripheral blood mononuclear cell (PBMC samples collected at varying time points including at diagnosis, then every 2 weeks for 3 months, then every 3 months for a year. Total RNA was extracted from the PBMC samples and hybridized to microarrays spotted with 3,800 oligonucleotides. Results Those who developed post-infective fatigue had gene expression profiles indicative of an altered host response during acute mononucleosis compared to those who recovered uneventfully. Several genes including ISG20 (interferon stimulated gene, DNAJB2 (DnaJ [Hsp40] homolog and CD99, CDK8 (cyclin-dependent kinase 8, E2F2 (E2F transcription factor 2, CDK8 (cyclin-dependent kinase 8, and ACTN2 (actinin, alpha 2, known to be regulated during EBV infection, were differentially expressed in post-infective fatigue cases. Several of the differentially expressed genes affect mitochondrial functions including fatty acid metabolism and the cell cycle. Conclusion These preliminary data provide insights into alterations in gene transcripts associated with the varied clinical outcomes from acute infectious mononucleosis.

  18. Characterization of thymus-associated lymphoid depletion in bovine calves acutely or persistently infected with bovine viral diarrhea virus 1, bovine viral diarrhea 2 or HoBi-like pestivirus

    Science.gov (United States)

    Viruses from recognized pestivirus species bovine viral diarrhea 1 (BVDV-1) and BVDV-2 and the proposed pestivirus species HoBi-like virus infect primarily cattle. Exposure of cattle to these viruses can lead to either acute or persistent infections depending on the timing and status of the animal ...

  19. Mesenchymal stromal cell treatment prevents H9N2 avian influenza virus-induced acute lung injury in mice.

    Science.gov (United States)

    Li, Yan; Xu, Jun; Shi, Weiqing; Chen, Cheng; Shao, Yan; Zhu, Limei; Lu, Wei; Han, XiaoDong

    2016-10-28

    The avian influenza virus (AIV) can cross species barriers and expand its host range from birds to mammals, even humans. Avian influenza is characterized by pronounced activation of the proinflammatory cytokine cascade, which perpetuates the inflammatory response, leading to persistent systemic inflammatory response syndrome and pulmonary infection in animals and humans. There are currently no specific treatment strategies for avian influenza. We hypothesized that mesenchymal stromal cells (MSCs) would have beneficial effects in the treatment of H9N2 AIV-induced acute lung injury in mice. Six- to 8-week-old C57BL/6 mice were infected intranasally with 1 × 10 4 MID 50 of A/HONG KONG/2108/2003 [H9N2 (HK)] H9N2 virus to induce acute lung injury. After 30 min, syngeneic MSCs were delivered through the caudal vein. Three days after infection, we measured the survival rate, lung weight, arterial blood gas, and cytokines in both bronchoalveolar lavage fluid (BALF) and serum, and assessed pathological changes to the lungs. MSC administration significantly palliated H9N2 AIV-induced pulmonary inflammation by reducing chemokines and proinflammatory cytokines levels, as well as reducing inflammatory cell recruit into the lungs. Thus, H9N2 AIV-induced lung injury was markedly alleviated in mice treated with MSCs. Lung histopathology and arterial blood gas analysis were improved in mice with H9N2 AIV-induced lung injury following MSC treatment. MSC treatment significantly reduces H9N2 AIV-induced acute lung injury in mice and is associated with reduced pulmonary inflammation. These results indicate a potential role for MSC therapy in the treatment of clinical avian influenza.

  20. Influenza and Other Respiratory Viruses Involved in Severe Acute Respiratory Disease in Northern Italy during the Pandemic and Postpandemic Period (2009–2011

    Directory of Open Access Journals (Sweden)

    Elena Pariani

    2014-01-01

    Full Text Available Since 2009 pandemic, international health authorities recommended monitoring severe and complicated cases of respiratory disease, that is, severe acute respiratory infection (SARI and acute respiratory distress syndrome (ARDS. We evaluated the proportion of SARI/ARDS cases and deaths due to influenza A(H1N1pdm09 infection and the impact of other respiratory viruses during pandemic and postpandemic period (2009–2011 in northern Italy; additionally we searched for unknown viruses in those cases for which diagnosis remained negative. 206 respiratory samples were collected from SARI/ARDS cases and analyzed by real-time RT-PCR/PCR to investigate influenza viruses and other common respiratory pathogens; also, a virus discovery technique (VIDISCA-454 was applied on those samples tested negative to all pathogens. Influenza A(H1N1pdm09 virus was detected in 58.3% of specimens, with a case fatality rate of 11.3%. The impact of other respiratory viruses was 19.4%, and the most commonly detected viruses were human rhinovirus/enterovirus and influenza A(H3N2. VIDISCA-454 enabled the identification of one previously undiagnosed measles infection. Nearly 22% of SARI/ARDS cases did not obtain a definite diagnosis. In clinical practice, great efforts should be dedicated to improving the diagnosis of severe respiratory disease; the introduction of innovative molecular technologies, as VIDISCA-454, will certainly help in reducing such “diagnostic gap.”

  1. Equine infectious anemia virus replication is upregulated during differentiation of blood monocytes from acutely infected horses.

    Science.gov (United States)

    Sellon, D C; Walker, K M; Russell, K E; Perry, S T; Covington, P; Fuller, F J

    1996-01-01

    Equine infectious anemia virus is a lentivirus that replicates in mature tissue macrophages of horses. Ponies were infected with equine infectious anemia virus. During febrile episodes, proviral DNA was detectable, but viral mRNA was not detectable. As cultured blood monocytes from these ponies differentiated into macrophages, viral expression was upregulated. In situ hybridization confirmed that viral transcription occurred in mature macrophages. PMID:8523576

  2. Difficulty swallowing and lack of receipt of highly active antiretroviral therapy predict acute weight loss in human immunodeficiency virus disease.

    Science.gov (United States)

    Jacobson, Denise L; Bica, Ioana; Knox, Tamsin A; Wanke, Christine; Tchetgen, Eric; Spiegelman, Donna; Silva, Marisela; Gorbach, Sherwood; Wilson, Ira B

    2003-11-15

    In human immunodeficiency virus (HIV) disease, symptoms of underlying illness may promote weight loss through decreased caloric intake, increased metabolic needs, or nutrient malabsorption. We evaluated disease symptoms as predictors of acute weight loss (i.e., loss of > or =5% of weight). HIV-infected men and women (n=415) were telephoned every 5 weeks to obtain information about weight and recent symptoms. Weight change between each pair of consecutive calls (telephone intervals, 2814) was calculated. Acute weight loss occurred across 4.5% of intervals and among 24% of individuals. Patients reported > or =1 symptom before 58% of telephone intervals. The most common symptoms or symptom complexes before intervals were diarrhea (21% of patients), anorexia (17%), upper respiratory symptoms (16%), skin symptoms (12%), and abdominal pain (12%). Trouble swallowing (6%) and oral symptoms (7%) were less common. Risk of acute weight loss was significantly increased when oral symptoms or trouble swallowing were present, and it was decreased when highly active antiretroviral therapy (HAART) was used or when diarrhea was not present. Even when HAART is being administered, clinicians should remain vigilant regarding weight loss, oral symptoms, and trouble swallowing.

  3. An Outbreak of Acute Hepatitis Caused by Genotype IB Hepatitis A Viruses Contaminating the Water Supply in Thailand.

    Science.gov (United States)

    Ruchusatsawat, Kriangsak; Wongpiyabovorn, Jongkonnee; Kawidam, Chonthicha; Thiemsing, Laddawan; Sangkitporn, Somchai; Yoshizaki, Sayaka; Tatsumi, Masashi; Takeda, Naokazu; Ishii, Koji

    2016-01-01

    In 2000, an outbreak of acute hepatitis A was reported in a province adjacent to Bangkok, Thailand. To investigate the cause of the 2000 hepatitis A outbreaks in Thailand using molecular epidemiological analysis. Serum and stool specimens were collected from patients who were clinically diagnosed with acute viral hepatitis. Water samples from drinking water and deep-drilled wells were also collected. These specimens were subjected to polymerase chain reaction (PCR) amplification and sequencing of the VP1/2A region of the hepatitis A virus (HAV) genome. The entire genome sequence of one of the fecal specimens was determined and phylogenetically analyzed with those of known HAV sequences. Eleven of 24 fecal specimens collected from acute viral hepatitis patients were positive as determined by semi- nested reverse transcription PCR targeting the VP1/2A region of HAV. The nucleotide sequence of these samples had an identical genotype IB sequence, suggesting that the same causative agent was present. The complete nucleotide sequence derived from one of the samples indicated that the Thai genotype IB strain should be classified in a unique phylogenetic cluster. The analysis using an adjusted odds ratio showed that the consumption of groundwater was the most likely risk factor associated with the disease. © 2017 S. Karger AG, Basel.

  4. Protective Capacity of the Human Anamnestic Antibody Response during Acute Dengue Virus Infection.

    Science.gov (United States)

    Xu, Meihui; Züst, Roland; Toh, Ying Xiu; Pfaff, Jennifer M; Kahle, Kristen M; Davidson, Edgar; Doranz, Benjamin J; Velumani, Sumathy; Tukijan, Farhana; Wang, Cheng-I; Fink, Katja

    2016-12-15

    Half of the world's population is exposed to the risk of dengue virus infection. Although a vaccine for dengue virus is now available in a few countries, its reported overall efficacy of about 60% is not ideal. Protective immune correlates following natural dengue virus infection remain undefined, which makes it difficult to predict the efficacy of new vaccines. In this study, we address the protective capacity of dengue virus-specific antibodies that are produced by plasmablasts a few days after natural secondary infection. Among a panel of 18 dengue virus-reactive human monoclonal antibodies, four groups of antibodies were identified based on their binding properties. While antibodies targeting the fusion loop of the glycoprotein of dengue virus dominated the antibody response, two smaller groups of antibodies bound to previously undescribed epitopes in domain II of the E protein. The latter, largely serotype-cross-reactive antibodies, demonstrated increased stability of binding at pH 5. These antibodies possessed weak to moderate neutralization capacity in vitro but were the most efficacious in promoting the survival of infected mice. Our data suggest that the cross-reactive anamnestic antibody response has a protective capacity despite moderate neutralization in vitro and a moderate decrease of viremia in vivo IMPORTANCE: Antibodies can protect from symptomatic dengue virus infection. However, it is not easy to assess which classes of antibodies provide protection because in vitro assays are not always predictive of in vivo protection. During a repeat infection, dengue virus-specific immune memory cells are reactivated and large amounts of antibodies are produced. By studying antibodies cloned from patients with heterologous secondary infection, we tested the protective value of the serotype-cross-reactive "recall" or "anamnestic" response. We found that results from in vitro neutralization assays did not always correlate with the ability of the antibodies to

  5. Antioxidant and Atibacterial Activities of Nipah (Nypa fruticans against Vibrio sp. Isolated From Mud Crab (Scylla sp.

    Directory of Open Access Journals (Sweden)

    Imra Imra

    2016-12-01

    Full Text Available Nipah (Nypa fruticans is the potential plant for source of active compound such as antioksidant and antibacterial substances. The plants are dispersed in Sumatera, Kalimantan, Sulawesi, Maluku and Papua Island. The aim of this research were determine the antioxidant and antibacterial activity from of nipah (fruit and leaf that it extraction with methanol, and than determine toxicity and active compound contained in this extract. Diffusion agar and DPPH method were use for antibacterial and antioxsidant assay, respectively. Antioxsidant activity from nipah’s leaf extract was more effective (22,5 µg/mL than nipah’s fruit extract (415 µg/mL. This activity to be classified to the strong antioxidant activity (IC50<50 µg/mL. The antibacterial activity from leaf extract was strong to inhibited Vibrio sp. with inhibition zone 8,75 mm. The crude extract of nipah’s leaf was toxic with toxicity value is 663,598 µg/mL. Flavonoids, steroids, tanin, saponin and phenol hidroquinon were the active compounds contained in the extract of nipah’s leaf.

  6. Antioxidant and Atibacterial Activities of Nipah (Nypa fruticans against Vibrio sp. Isolated From Mud Crab (Scylla sp.

    Directory of Open Access Journals (Sweden)

    Imra Imra

    2017-02-01

    Full Text Available AbstractNipah (Nypa fruticans is the potential plant for source of active compound such as antioksidant and antibacterial substances. The plants are dispersed in Sumatera, Kalimantan, Sulawesi, Maluku and Papua Island. The aim of this research were determine the antioxidant and antibacterial activity from of nipah (fruit and leaf that it extraction with methanol, and than determine toxicity and active compound contained in this extract. Diffusion agar and DPPH method were use for antibacterial and antioxsidant assay, respectively. Antioxsidant activity from nipah’s leaf extract was more effective (22,5 μg/mL than nipah’s fruit extract (415 μg/mL. This activity to be classified to the strong antioxidant activity (IC50<50 μg/mL. The antibacterial activity from leaf extract was strong to inhibited Vibrio sp. with inhibition zone 8,75 mm. The crude extract of nipah’s leaf was toxic with toxicity value is 663,598 μg/mL. Flavonoids, steroids, tanin, saponin and phenol hidroquinon were the active compounds contained in the extract of nipah’s leaf.

  7. Dynamics of Persistent and Acute Deformed Wing Virus Infections in Honey Bees, Apis mellifera

    Directory of Open Access Journals (Sweden)

    Jay D. Evans

    2011-12-01

    Full Text Available The dynamics of viruses are critical to our understanding of disease pathogenesis. Using honey bee Deformed wing virus (DWV as a model, we conducted field and laboratory studies to investigate the roles of abiotic and biotic stress factors as well as host health conditions in dynamics of virus replication in honey bees. The results showed that temperature decline could lead to not only significant decrease in the rate for pupae to emerge as adult bees, but also an increased severity of the virus infection in emerged bees, partly explaining the high levels of winter losses of managed honey bees, Apis mellifera, around the world. By experimentally exposing adult bees with variable levels of parasitic mite Varroa destructor, we showed that the severity of DWV infection was positively correlated with the density and time period of Varroa mite infestation, confirming the role of Varroa mites in virus transmission and activation in honey bees. Further, we showed that host conditions have a significant impact on the outcome of DWV infection as bees that originate from strong colonies resist DWV infection and replication significantly better than bee originating from weak colonies. The information obtained from this study has important implications for enhancing our understanding of host‑pathogen interactions and can be used to develop effective disease control strategies for honey bees.

  8. Large-scale field application of RNAi technology reducing Israeli Acute Paralysis Virus Disease in honey bees (Apis mellifera, Hymenoptera; Apidae)

    Science.gov (United States)

    We present the first successful use of RNAi under a large-scale real-world application for disease control. Israeli acute paralysis virus, IAPV, has been linked as a contributing factor in coolly collapse, CCD, of honey bees. IAPV specific homologous dsRNA were designed to reduce impacts from IAPV i...

  9. Acute hepatitis B virus infection with simultaneous high HBsAg and high anti-HBs signals in a previously HBV vaccinated HIV-1 positive patient

    NARCIS (Netherlands)

    van Dommelen, Laura; Verbon, Annelies; van Doorn, H. Rogier; Goossens, Valère J.

    2010-01-01

    We present a case of a clinical manifest hepatitis B virus infection and a potentially misleading HBV serological profile in an HIV-1 positive patient despite previous HBV vaccination. The patient presented with an acute hepatitis B and there was no indication of chronic HBV infection or the

  10. Global, regional, and national disease burden estimates of acute lower respiratory infections due to respiratory syncytial virus in young children in 2015 : A systematic review and modelling study

    NARCIS (Netherlands)

    Shi, Ting; McAllister, David A.; O'Brien, Katherine L.; Simoes, Eric A. F.; Madhi, Shabir A.; Gessner, Bradford D.; Polack, Fernando P.; Balsells, Evelyn; Acacio, Sozinho; Aguayo, Claudia; Alassani, Issifou; Ali, Asad; Antonio, Martin; Awasthi, Shally; Awori, Juliet O.; Azziz-Baumgartner, Eduardo; Baggett, Henry C.; Baillie, Vicky L.; Balmaseda, Angel; Barahona, Alfredo; Basnet, Sudha; Bassat, Quique; Basualdo, Wilma; Bigogo, Godfrey; Bont, Louis; Breiman, Robert F.; Brooks, W. Abdullah; Broor, Shobha; Bruce, Nigel; Bruden, Dana; Buchy, Philippe; Campbell, Stuart; Carosone-Link, Phyllis; Chadha, Mandeep; Chipeta, James; Chou, Monidarin; Clara, Wilfrido; Cohen, Cheryl; de Cuellar, Elizabeth; Dang, Duc Anh; Dash-yandag, Budragchaagiin; Deloria-Knoll, Maria; Dherani, Mukesh; Eap, Tekchheng; Ebruke, Bernard E.; Echavarria, Marcela; de Freitas Lázaro Emediato, Carla Cecília; Fasce, Rodrigo A.; Feikin, Daniel R.; Feng, Luzhao; Gentile, Angela; Gordon, Aubree; Goswami, Doli; Goyet, Sophie; Groome, Michelle J; Halasa, Natasha; Hirve, Siddhivinayak; Homaira, Nusrat; Howie, Stephen R.C.; Jara, Jorge; Jroundi, Imane; Kartasasmita, Cissy B.; Khuri-Bulos, Najwa; Kotloff, Karen L.; Krishnan, Anand; Libster, Romina; Lopez, Olga; Lucero, Marilla G.; Lucion, Florencia; Lupisan, Socorro P.; Marcone, Debora N.; McCracken, John P.; Mejia, Mario; Moisi, Jennifer C.; Montgomery, Joel M.; Moore, David P.; Moraleda, Cinta; Moyes, Jocelyn; Munywoki, Patrick; Mutyara, Kuswandewi; Nicol, Mark P.; Nokes, D. James; Nymadawa, Pagbajabyn; da Costa Oliveira, Maria Tereza; Oshitani, Histoshi; Pandey, Nitin; Paranhos-Baccalà, Gláucia; Phillips, Lia N.; Picot, Valentina Sanchez; Rahman, Mustafizur; Rakoto-Andrianarivelo, Mala; Rasmussen, Zeba A.; Rath, Barbara A.; Robinson, Annick; Romero, Candice; Russomando, Graciela; Salimi, Vahid; Sawatwong, Pongpun; Scheltema, Nienke; Schweiger, Brunhilde; Scott, J. Anthony G.; Seidenberg, Phil; Shen, Kunling; Singleton, Rosalyn; Sotomayor, Viviana; Strand, Tor A.; Sutanto, Agustinus; Sylla, Mariam; Tapia, Milagritos D.; Thamthitiwat, Somsak; Thomas, Elizabeth D.; Tokarz, Rafal; Turner, Claudia; Venter, Marietjie; Waicharoen, Sunthareeya; Wang, Jianwei; Watthanaworawit, Wanitda; Yoshida, Lay Myint; Yu, Hongjie; Zar, Heather J.; Campbell, Harry; Nair, Harish

    2017-01-01

    Background: We have previously estimated that respiratory syncytial virus (RSV) was associated with 22% of all episodes of (severe) acute lower respiratory infection (ALRI) resulting in 55 000 to 199 000 deaths in children younger than 5 years in 2005. In the past 5 years, major research activity on

  11. Novel Alphacoronaviruses and Paramyxoviruses Cocirculate with Type 1 and Severe Acute Respiratory System (SARS)-Related Betacoronaviruses in Synanthropic Bats of Luxembourg.

    Science.gov (United States)

    Pauly, Maude; Pir, Jacques B; Loesch, Catherine; Sausy, Aurélie; Snoeck, Chantal J; Hübschen, Judith M; Muller, Claude P

    2017-09-15

    Several infectious disease outbreaks with high mortality in humans have been attributed to viruses that are thought to have evolved from bat viruses. In this study from Luxembourg, the genetic diversity and epidemiology of paramyxoviruses and coronaviruses shed by the bat species Rhinolophus ferrumequinum and Myotis emarginatus were evaluated. Feces collection ( n = 624) was performed longitudinally in a mixed-species colony in 2015 and 2016. In addition, feces ( n = 254) were collected cross-sectionally from six Myotis emarginatus colonies in 2016. By use of degenerate primers in a nested format, overall prevalences of 1.1% (10/878) and 4.9% (43/878) were determined for paramyxoviruses and coronaviruses. Sequences of the partial RNA-dependent RNA polymerase and spike glycoprotein genes of coronaviruses, as well as sequences of the partial L gene of paramyxoviruses, were obtained. Novel paramyxovirus and Alphacoronavirus strains were identified in different Myotis emarginatus colonies, and severe acute respiratory syndrome (SARS)-related Betacoronavirus strains were shed by Rhinolophus ferrumequinum Logistic regression revealed that the level of Alphacoronavirus shedding was highest in July (odds ratio, 2.8; P bats also host Betacoronavirus 1 strains. The high similarity of the spike gene sequences of these viruses with mammalian Betacoronavirus 1 strains may be of concern. Both the SARS-related and Betacoronavirus 1 strains detected in bats in Luxembourg may cross the species barrier after a host adaptation process. IMPORTANCE Bats are a natural reservoir of a number of zoonotic pathogens. Several severe outbreaks in humans (e.g., a Nipah virus outbreak in Malaysia in 1998, and the almost global spread of severe acute respiratory syndrome in 2003) have been caused by bat-borne viruses that were transmitted to humans mostly after virus adaptation (e.g., in intermediate animal hosts). Despite the indigenousness of bat species that host viruses with suspected

  12. Acute exacerbation of chronic hepatitis B virus infection in renal transplant patients

    Directory of Open Access Journals (Sweden)

    Christini Takemi Emori

    2014-11-01

    Conclusions: Acute exacerbation was a frequent and severe event in HBV-infected renal transplant patients. Prophylactic/preemptive therapy with antiviral drugs should be indicated for all HBsAg-positive renal transplant patients.

  13. Ecological dynamics of emerging bat virus spillover

    Science.gov (United States)

    Plowright, Raina K.; Eby, Peggy; Hudson, Peter J.; Smith, Ina L.; Westcott, David; Bryden, Wayne L.; Middleton, Deborah; Reid, Peter A.; McFarlane, Rosemary A.; Martin, Gerardo; Tabor, Gary M.; Skerratt, Lee F.; Anderson, Dale L.; Crameri, Gary; Quammen, David; Jordan, David; Freeman, Paul; Wang, Lin-Fa; Epstein, Jonathan H.; Marsh, Glenn A.; Kung, Nina Y.; McCallum, Hamish

    2015-01-01

    Viruses that originate in bats may be the most notorious emerging zoonoses that spill over from wildlife into domestic animals and humans. Understanding how these infections filter through ecological systems to cause disease in humans is of profound importance to public health. Transmission of viruses from bats to humans requires a hierarchy of enabling conditions that connect the distribution of reservoir hosts, viral infection within these hosts, and exposure and susceptibility of recipient hosts. For many emerging bat viruses, spillover also requires viral shedding from bats, and survival of the virus in the environment. Focusing on Hendra virus, but also addressing Nipah virus, Ebola virus, Marburg virus and coronaviruses, we delineate this cross-species spillover dynamic from the within-host processes that drive virus excretion to land-use changes that increase interaction among species. We describe how land-use changes may affect co-occurrence and contact between bats and recipient hosts. Two hypotheses may explain temporal and spatial pulses of virus shedding in bat populations: episodic shedding from persistently infected bats or transient epidemics that occur as virus is transmitted among bat populations. Management of livestock also may affect the probability of exposure and disease. Interventions to decrease the probability of virus spillover can be implemented at multiple levels from targeting the reservoir host to managing recipient host exposure and susceptibility. PMID:25392474

  14. Metagenomic detection of viral pathogens in Spanish honeybees: co-infection by Aphid Lethal Paralysis, Israel Acute Paralysis and Lake Sinai Viruses.

    Directory of Open Access Journals (Sweden)

    Fredrik Granberg

    Full Text Available The situation in Europe concerning honeybees has in recent years become increasingly aggravated with steady decline in populations and/or catastrophic winter losses. This has largely been attributed to the occurrence of a variety of known and "unknown", emerging novel diseases. Previous studies have demonstrated that colonies often can harbour more than one pathogen, making identification of etiological agents with classical methods difficult. By employing an unbiased metagenomic approach, which allows the detection of both unexpected and previously unknown infectious agents, the detection of three viruses, Aphid Lethal Paralysis Virus (ALPV, Israel Acute Paralysis Virus (IAPV, and Lake Sinai Virus (LSV, in honeybees from Spain is reported in this article. The existence of a subgroup of ALPV with the ability to infect bees was only recently reported and this is the first identification of such a strain in Europe. Similarly, LSV appear to be a still unclassified group of viruses with unclear impact on colony health and these viruses have not previously been identified outside of the United States. Furthermore, our study also reveals that these bees carried a plant virus, Turnip Ringspot Virus (TuRSV, potentially serving as important vector organisms. Taken together, these results demonstrate the new possibilities opened up by high-throughput sequencing and metagenomic analysis to study emerging new diseases in domestic and wild animal populations, including honeybees.

  15. Acute cerebellar ataxia

    Science.gov (United States)

    Cerebellar ataxia; Ataxia - acute cerebellar; Cerebellitis; Post-varicella acute cerebellar ataxia; PVACA ... Acute cerebellar ataxia in children, particularly younger than age 3, may occur several weeks after an illness caused by a virus. ...

  16. Acute phase protein response during subclinical infection of pigs with H1N1 swine influenza virus.

    Science.gov (United States)

    Pomorska-Mól, Małgorzata; Markowska-Daniel, Iwona; Pejsak, Zygmunt

    2012-10-12

    In the present study acute phase proteins (APPs) responses in pigs after subclinical infection with H1N1 swine influenza virus (SwH1N1) were evaluated. Fourteen 5 weeks old, seronegative piglets, both sexes were used. Ten of them were infected intranasally with SwH1N1. C-reactive protein (CRP), haptoglobin (Hp), serum amyloid A (SAA) and pig major acute phase protein (Pig-MAP) concentrations in serum were measured using commercial ELISAs. No significant clinical signs were observed in any of the infected pigs, however, all infected animals developed specific antibodies against SwH1N1 and viral shedding was observed from 2 to 5 dpi. Only concentrations of Hp and SAA were significantly induced after infection, with mean maximum levels from days 1 to 2 post infection (dpi). The concentrations of CRP and Pig-MAP remained generally unchanged, however in half of infected pigs the concentration of CRP tended to increase at 1 dpi (but without statistical significance). The results of our study confirmed that monitoring of APPs may be useful for detection of subclinically infected pigs. The use of SAA or Hp and Pig-MAP may be a valuable in combination [i.e. Hp (increased concentration) and Pig-MAP (unchanged concentration)] to detect subclinically SIV infected pigs, or to identify pigs actually producing a large amount of virus. Additional studies need to be done in order to confirm these findings. Copyright © 2012 Elsevier B.V. All rights reserved.

  17. Plasma levels of inter-α inhibitor proteins in children with acute dengue virus infection

    NARCIS (Netherlands)

    P. Koraka (Penelope); Y.P. Lim; M.D. Shin (Michael); T.E. Setiati (Tatty); A.T.A. Mairuhu; E.C.M. van Gorp (Eric); A. Soemantri (Augustinus); A.D.M.E. Osterhaus (Albert); B.E.E. Martina (Byron)

    2010-01-01

    textabstractBackground: Inter-α inhibitor proteins (IaIp) belong to a family of protease inhibitors that are involved in the haemostatic and the vascular system. Dengue viruses (DENV) infections are characterized by coagulopathy and increased vascular permeability. In this study we measured the

  18. Detection of immune-complex-dissociated nonstructural-1 antigen in patients with acute dengue virus infections

    NARCIS (Netherlands)

    P. Koraka (Penelope); C.P. Burghoorn-Maas; A. Falconar; T.E. Setiati (Tatty); K. Djamiatun; J. Groen (Jan); A.D.M.E. Osterhaus (Albert)

    2003-01-01

    textabstractAccurate and timely diagnosis of dengue virus (DEN) infections is essential for the differential diagnosis of patients with febrile illness and hemorrhagic fever. In the present study, the diagnostic value of a newly developed immune-complex dissociated nonstructural-1 (NS-1) antigen dot

  19. Detection of immune-complex-dissociated nonstructural-1 antigen in patients with acute dengue virus infections.

    NARCIS (Netherlands)

    Koraka, P.; Burghoorn-Maas, C.P.; Falconar, A.; Setiati, T.E.; Djamiatun, K.; Groen, J.; Osterhaus, A.D.

    2003-01-01

    Accurate and timely diagnosis of dengue virus (DEN) infections is essential for the differential diagnosis of patients with febrile illness and hemorrhagic fever. In the present study, the diagnostic value of a newly developed immune-complex dissociated nonstructural-1 (NS-1) antigen dot blot

  20. Characterization of thymus-associated lymphoid depletion in bovine calves acutely or persistently infected with bovine viral diarrhea virus 1, bovine viral diarrhea virus 2 or HoBi-like pestivirus.

    Science.gov (United States)

    Falkenberg, Shollie M; Bauermann, Fernando V; Ridpath, Julia F

    2017-11-01

    Naïve pregnant cattle exposed to pestiviruses between 40-125 days of gestation can give birth to persistently infected (PI) calves. Clinical presentation and survivability, in PI cattle, is highly variable even with the same pestivirus strain whereas the clinical presentation in acute infections is more uniform with severity of symptoms being primarily a function of virulence of the infecting virus. The aim of this study was to compare thymic depletion, as measured by comparing the area of the thymic cortex to the medulla (corticomedullary ratio), in acute and persistent infections of the same pestivirus isolate. The same general trends were observed with each pestivirus isolate. Thymic depletion was observed in both acutely and persistently infected calves. The average thymic depletion observed in acutely infected calves was greater than that in age matched PI calves. PI calves, regardless of infecting virus, revealed a greater variability in amount of depletion compared to acutely infected calves. A trend was observed between survivability and depletion of the thymus, with PI calves surviving less than 5 weeks having lower corticomedullary ratios and greater depletion. This is the first study to compare PI and acutely infected calves with the same isolates as well as to evaluate PI calves based on survivability. Further, this study identified a quantifiable phenotype associated with potential survivability.

  1. Dynamics of the Presence of Israeli Acute Paralysis Virus in Honey Bee Colonies with Colony Collapse Disorder

    Directory of Open Access Journals (Sweden)

    Chunsheng Hou

    2014-05-01

    Full Text Available The determinants of Colony Collapse Disorder (CCD, a particular case of collapse of honey bee colonies, are still unresolved. Viruses including the Israeli acute paralysis virus (IAPV were associated with CCD. We found an apiary with colonies showing typical CCD characteristics that bore high loads of IAPV, recovered some colonies from collapse and tested the hypothesis if IAPV was actively replicating in them and infectious to healthy bees. We found that IAPV was the dominant pathogen and it replicated actively in the colonies: viral titers decreased from April to September and increased from September to December. IAPV extracted from infected bees was highly infectious to healthy pupae: they showed several-fold amplification of the viral genome and synthesis of the virion protein VP3. The health of recovered colonies was seriously compromised. Interestingly, a rise of IAPV genomic copies in two colonies coincided with their subsequent collapse. Our results do not imply IAPV as the cause of CCD but indicate that once acquired and induced to replication it acts as an infectious factor that affects the health of the colonies and may determine their survival. This is the first follow up outside the US of CCD-colonies bearing IAPV under natural conditions.

  2. Dynamics of the presence of israeli acute paralysis virus in honey bee colonies with colony collapse disorder.

    Science.gov (United States)

    Hou, Chunsheng; Rivkin, Hadassah; Slabezki, Yossi; Chejanovsky, Nor

    2014-05-05

    The determinants of Colony Collapse Disorder (CCD), a particular case of collapse of honey bee colonies, are still unresolved. Viruses including the Israeli acute paralysis virus (IAPV) were associated with CCD. We found an apiary with colonies showing typical CCD characteristics that bore high loads of IAPV, recovered some colonies from collapse and tested the hypothesis if IAPV was actively replicating in them and infectious to healthy bees. We found that IAPV was the dominant pathogen and it replicated actively in the colonies: viral titers decreased from April to September and increased from September to December. IAPV extracted from infected bees was highly infectious to healthy pupae: they showed several-fold amplification of the viral genome and synthesis of the virion protein VP3. The health of recovered colonies was seriously compromised. Interestingly, a rise of IAPV genomic copies in two colonies coincided with their subsequent collapse. Our results do not imply IAPV as the cause of CCD but indicate that once acquired and induced to replication it acts as an infectious factor that affects the health of the colonies and may determine their survival. This is the first follow up outside the US of CCD-colonies bearing IAPV under natural conditions.

  3. Effect of high-dose dexamethasone on the outcome of acute encephalitis due to Japanese encephalitis virus.

    Science.gov (United States)

    Hoke, C H; Vaughn, D W; Nisalak, A; Intralawan, P; Poolsuppasit, S; Jongsawas, V; Titsyakorn, U; Johnson, R T

    1992-04-01

    Death due to Japanese encephalitis usually occurs in the first 5 days of hospitalization as a result of deepening coma with respiratory arrest. Death may result from edema-induced increases in intracranial pressure that might be reduced by the administration of steroids. Sixty-five patients presenting in Thailand to four hospitals with a diagnosis of acute Japanese encephalitis were randomized in a double-masked fashion and stratified by initial mental status into a placebo group (saline) or a treatment group (dexamethasone 0.6 mg/kg intravenously as a loading dose followed by 0.2 mg/kg every 6 h for 5 days). Fifty-five of the 65 had confirmed Japanese encephalitis as demonstrated by detection of virus or by Japanese encephalitis virus-specific IgM antibody. Important outcome measures included mortality (24%, treatment group; 27%, control group), days to alert mental status (3.9 vs. 6.2), and neurologic status 3 months after discharge (45% abnormal in each group). No statistically significant benefit of high-dose dexamethasone could be detected.

  4. Effect of Maxing Shigan Tang on H1N1 Influenza A Virus-Associated Acute Lung Injury in Mice.

    Science.gov (United States)

    Zhong, Yanchun; Zhou, Jie; Liang, Ning; Liu, Bihao; Lu, Ruirui; He, Yu; Liang, Chunlin; Wu, Junbiao; Zhou, Yuan; Hu, Miaomiao; Zhou, Jiuyao

    2016-01-01

    This study is aimed at examining the effects of Maxing Shigan Tang (MST) treatment on H1N1-associated acute lung injury (ALI) and exploring the possible mechanism. Mice were randomly divided into a control group, model group, peroxisomal proliferator activator receptor γ (PPARγ) inhibition group (PPARγ-), PPARγ activation group (PPARγ+), and MST group. Influenza A (H1N1) virus of the Fort Monmouth 1 (FM1) strain was used to induce an ALI mice model. Hematoxylin and eosin staining was performed to investigate the effect of MST treatment on H1N1-associated ALI. Cell apoptosis of lung tissues of each group were conducted through transferase-mediated dUTP nick end-labeling methods. Moreover, the expression level of caspase 3, activity of caspase 3, and serum level of tumor necrosis factor (TNF)-α of each group were also analyzed. Finally, quantitative real-time polymerase chain reaction and Western blotting analysis were carried out to detect angiopoietin-like 4 (ANGPTL4) expression level. We found that mice infected with the FM1 strain of H1N1 influenza A virus developed severe ALI, and MST could improve H1N1-induced ALI. Moreover, MST decreased lung cell apoptosis and reduced the serum content of TNF-α. In addition, MST significantly induced the ANGPTL4 expression in H1N1-induced ALI. MST improves H1N1-associated ALI maybe through targeting ANGPTL4 in mice. © 2017 S. Karger AG, Basel.

  5. Detection of influenza C viruses among outpatients and patients hospitalized for severe acute respiratory infection, Minnesota, 2013-2016.

    Science.gov (United States)

    Thielen, Beth K; Friedlander, Hannah; Bistodeau, Sarah; Shu, Bo; Lynch, Brian; Martin, Karen; Bye, Erica; Como-Sabetti, Kathyrn; Boxrud, David; Strain, Anna K; Chaves, Sandra S; Steffens, Andrea; Fowlkes, Ashley L; Lindstrom, Stephen; Lynfield, Ruth

    2017-10-23

    Existing literature suggests that influenza C typically causes mild respiratory tract disease. However, clinical and epidemiological data are limited. Four outpatient clinics and three hospitals submitted clinical data and respiratory specimens through a surveillance network for acute respiratory infection (ARI) during May 2013 through December 2016. Specimens were tested using multi-target nucleic acid amplification tests (NAAT) for 19-22 respiratory pathogens, including influenza C. Influenza C virus was detected among 59 of 10,202 (0.58%) hospitalized SARI cases and 11 of 2,282 (0.48%) outpatients. Most detections occurred from December to March, with 73% during the 2014-2015 season. Influenza C detections occurred among patients of all ages, with similar rates between inpatients and outpatients. The highest rate of detection occurred among children aged 6 to 24 months (1.2%). Among hospitalized cases, seven required intensive care. Medical co-morbidities were reported in 58% of hospitalized cases and all who required intensive care. At least one other respiratory pathogen was detected in 40 (66%) cases, most commonly rhinovirus/enterovirus (25%) and respiratory syncytial virus (RSV) (20%). The hemagglutinin-esterase-fusion (HEF) gene was sequenced in 37 specimens, and both C/Kanagawa and C/Sao Paulo lineages were detected in inpatients and outpatients. We found seasonal circulation of influenza C with year-to-year variability. Detection was most frequent among young children, but occurred in all ages. Some cases positive for influenza C, particularly those with co-morbid conditions, had severe disease, suggesting a need for further study of the role of influenza C virus in the pathogenesis of respiratory disease.

  6. Acute Ebola virus disease patient treatment and health-related quality of life in health care professionals: A controlled study.

    Science.gov (United States)

    Lehmann, Marco; Bruenahl, Christian A; Addo, Marylyn M; Becker, Stephan; Schmiedel, Stefan; Lohse, Ansgar W; Schramm, Christoph; Löwe, Bernd

    2016-04-01

    This study aimed to identify predictors of health-related quality of life (HrQoL) and to investigate infection-related concerns in health professionals during the acute treatment episode for one Ebola virus disease (EVD) patient in tertiary care. In a cross-sectional controlled study, validated self-report questionnaires were completed by three groups of health care professionals: (1) staff from standard internal medicine inpatient wards of a tertiary care center, (2) staff from the isolation unit of the same center responsible for Ebola patient treatment, and (3) staff from a research laboratory with contact to the Ebola virus and other highly infectious pathogens. Outcomes were HrQoL (SF-12), infection-related concerns, global health status, fatigue (FACIT), depression (PHQ-9), anxiety (GAD-7), and somatic symptoms (SSS-8). Comparisons between groups (n1=42, n2=32, n3=12) yielded no significant differences in HrQoL, subjective risk of infection, and most other psychosocial variables. However, the Ebola patient treatment group experienced significantly higher levels of social isolation than both other groups. The best predictors of poor physical and mental HrQoL were perceived lack of knowledge about the Ebola virus disease (physical: B=-1.2, p=0.05; mental: B=-1.3, p=0.03) and fatigue (physical: B=-0.3, p=0.02; mental: B=-0.53, p<0.001). Ebola patient treatment in tertiary care does not seem to be associated with lower HrQoL and enhanced subjective risk of infection, but seems to yield feelings of social isolation in health-care professionals. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. [Preliminary analysis on respiratory syncytial virus identified in children with acute respiratory infections in Tibet Autonomous Region, China].

    Science.gov (United States)

    Deng, Jie; Zhu, Ru-Nan; Qian, Yuan; Sun, Yu; Zhao, Lin-Qing; Wang, Fang; Wu, Hong; Shan, Min-Na; Deji, Mei-Duo

    2012-03-01

    To understand the role of respiratory syncytial virus (RSV) in children with acute respiratory infections (ARI) in Tibet Autonomous Region and the contribution of two major groups of RSV, nasopharyngeal aspirates (NPA) were collected from hospitalized children with ARI in Department of Pediatrics, Tibet People's Hospital in Lasa, Tibet from April to July in 2011 and tested for seven common respiratory viruses and human metapneumovirus (hMPV) by direct immunofluorescence assay (DFA). Total RNAs were extracted from RSV positive samples by DFA and reverse transcripted to cDNA. Nested-PCR was employed to determine the genogroups of RSV, which were confirmed by real time-PCR and sequence analysis for G protein encoding gene. The Characteristics and variations of G genes from RSV in this project were identified by sequence comparison with those G genes in GenBank. Out of 167 samples, 65 were positive for respiratory viruses with a total positive rate of 38.9%, including 45 (69.2%, 45/65)positive samples for RSV. Among 42 samples that were positive for RSV and genotyped, 40 were identified as group A and 2 as group B. Sequence analysis of full-length G genes for 7 RSV of group A indicated that all of these belonged to subgroup GA2. The nucleotide identities between RSVs from Tibet and prototype A2 strain were 90.7%-91.8%, with 86.5%-87.2% identities of amino acid. The mutations of amino acids were mainly located in both ends of a highly conserved region in the ectodomain of the G proteins. The data indicated that RSV was the most important viral etiologic agent of ARI in spring of 2011 in Tibet and group A of RSV was predominant during the study period. High divergence existed in the ectodomain of G proteins of RSVs from Tibet.

  8. Malignant pleural effusion in acute myeloid leukemia with hepatitis B virus infection.

    Science.gov (United States)

    Suharti, C; Santosa; Setiawan, Budi

    2015-04-01

    Pleural effusions can be the first presentation of a hematologic malignancy. The most common disorders with pleural effusion are Hodgkin and non-Hodgkin lymphoma with a frequency of 20 to 30%, especially if mediastinal involvement. Acute and chronic leukemia are rarely accompanied by pleural involvement. We describe a 46-year-old female with history of progressive dyspnoea. Physical examination was revealed massive left pleural effusion. Complete blood count revealed anemia, trombositopenia and normal leucocyte count. Viral serology test shown positive of HBsAg and total antiHBc. Chest X-ray revealed left pleural effusion. Pleural fluid cytology was myeloblast consistent with acute myeloid leukemia (AML). Bone marrow aspiration smear, bone marrow biopsy smear, and flow cytometry analysis were consistent with acute myeloid leukemia without maturation (AML M0-FAB classification).

  9. Fatal acute hepatic failure in a family infected with the hepatitis A virus subgenotype IB: A case report.

    Science.gov (United States)

    Yoshida, Yuichi; Okada, Yohei; Suzuki, Akiko; Kakisaka, Keisuke; Miyamoto, Yasuhiro; Miyasaka, Akio; Takikawa, Yasuhiro; Nishizawa, Tsutomu; Okamoto, Hiroaki

    2017-09-01

    Hepatitis A viral infection is a well-known cause of subclinical or acute self-limited hepatitis. Few cases of hepatitis A virus (HAV)-associated acute liver failure (ALF) have been reported in low HAV endemic countries annually. To investigate the possible factors that affected the severity of HAV infection, a family cluster infected with the HAV subgenotype IB strain, which is not common in Japan, was described. This family consisted of five members who all were infected with HAV. Four of the five patients hospitalized except for an asymptomatic patient. Two of the five patients, men in their 50s and 60s, developed ALF, and one patient died. Various host factors, including sex (male), age, and a high bilirubin level, may affect the outcomes. Based on viral factors, HAV RNA was higher in the fatal case compared with others, and it decreased within a short period of time. The similarity of the nucleotide sequences was 99.9% among the HAV isolates based on an entire genomic sequence. Deletions and/or insertions on the HAV protein-coding sequences that caused a frameshift were found in surviving cases but not in the fatal case. The rapid clearance of increased HAV and the absence of defective HAV might be closely associated with the onset of liver failure.

  10. Respiratory syncytial virus-induced acute and chronic airway disease is independent of genetic background: An experimental murine model

    Directory of Open Access Journals (Sweden)

    Ramilo Octavio

    2005-05-01

    Full Text Available Abstract Background Respiratory syncytial virus (RSV is the leading respiratory viral pathogen in young children worldwide. RSV disease is associated with acute airway obstruction (AO, long-term airway hyperresponsiveness (AHR, and chronic lung inflammation. Using two different mouse strains, this study was designed to determine whether RSV disease patterns are host-dependent. C57BL/6 and BALB/c mice were inoculated with RSV and followed for 77 days. RSV loads were measured by plaque assay and polymerase chain reaction (PCR in bronchoalveolar lavage (BAL and whole lung samples; cytokines were measured in BAL samples. Lung inflammation was evaluated with a histopathologic score (HPS, and AO and AHR were determined by plethysmography. Results Viral load dynamics, histopathologic score (HPS, cytokine concentrations, AO and long-term AHR were similar in both strains of RSV-infected mice, although RSV-infected C57BL/6 mice developed significantly greater AO compared with RSV-infected BALB/c mice on day 5. PCR detected RSV RNA in BAL samples of RSV infected mice until day 42, and in whole lung samples through day 77. BAL concentrations of cytokines TNF-α, IFN-γ, and chemokines MIG, RANTES and MIP-1α were significantly elevated in both strains of RSV-infected mice compared with their respective controls. Viral load measured by PCR significantly correlated with disease severity on days 14 and 21. Conclusion RSV-induced acute and chronic airway disease is independent of genetic background.

  11. Independent lung ventilation in a newborn with asymmetric acute lung injury due to respiratory syncytial virus: a case report

    Directory of Open Access Journals (Sweden)

    Di Nardo Matteo

    2008-06-01

    Full Text Available Abstract Introduction Independent lung ventilation is a form of protective ventilation strategy used in adult asymmetric acute lung injury, where the application of conventional mechanical ventilation can produce ventilator-induced lung injury and ventilation-perfusion mismatch. Only a few experiences have been published on the use of independent lung ventilation in newborn patients. Case presentation We present a case of independent lung ventilation in a 16-day-old infant of 3.5 kg body weight who had an asymmetric lung injury due to respiratory syncytial virus bronchiolitis. We used independent lung ventilation applying conventional protective pressure controlled ventilation to the less-compromised lung, with a respiratory frequency proportional to the age of the patient, and a pressure controlled high-frequency ventilation to the atelectatic lung. This was done because a single tube conventional ventilation protective strategy would have exposed the less-compromised lung to a high mean airways pressure. The target of independent lung ventilation is to provide adequate gas exchange at a safe mean airways pressure level and to expand the atelectatic lung. Independent lung ventilation was accomplished for 24 hours. Daily chest radiograph and gas exchange were used to evaluate the efficacy of independent lung ventilation. Extubation was performed after 48 hours of conventional single-tube mechanical ventilation following independent lung ventilation. Conclusion This case report demonstrates the feasibility of independent lung ventilation with two separate tubes in neonates as a treatment of an asymmetric acute lung injury.

  12. Hepatitis B virus (HBV genotypes in Egyptian pediatric cancer patients with acute and chronic active HBV infection

    Directory of Open Access Journals (Sweden)

    Khaled Mohsen M

    2007-07-01

    Full Text Available Abstract Background There are eight genotypes of hepatitis B virus (A-H and subgenotypes are recognized. Genotyping can be accomplished based on a partial sequence of HBV genome such as the pre-S or S gene. Several methods have been developed and used for HBV genotyping. This study was undertaken to determine the HBV genotypes in Egyptian pediatric cancer patients with acute and chronic liver disease. Methods HBV genotypes were determined in 22 patients who had acute forms of liver disease (AH and in 48 patients with chronic active hepatitis (CAH. A type-specific primer based the nested-PCR method was employed in the HBV genotyping. Results This study showed that HBV infections in pediatric cancer patients are attributed predominantly to viral genotypes D and B that constituted 37.1% and 25.7%, respectively of the total infections. In addition, there was a relatively high prevalence of mixed infections of 15.7% among the studied group especially mixed A/D genotype infections. Genotype D was found significantly more often in patients with CAH than in patients with AH [23/48(47.9% v 3/22 (13.6%]. Conclusion These findings show the distribution of HBV A-D genotypes in pediatric cancer Egyptian patients. Furthermore, our results indicate a markedly high prevalence of mixed A/D genotype infections in subjects with CAH and a possible association of mixed infections with the severity of liver diseases.

  13. Hepatitis E virus as a Cause of Acute Hepatitis in The Netherlands.

    Directory of Open Access Journals (Sweden)

    Aletta T R Tholen

    Full Text Available Recent studies indicate that 27% of Dutch blood donors have evidence of past infection with HEV. However, the low number of diagnosed HEV infections indicates either an asymptomatic course or under diagnosis.We investigated whether HEV is a cause of acute hepatitis in Dutch patients and which diagnostic modality (serology or PCR should be used for optimal detection.Serum samples were retrospectively selected from non-severely immuno-compromised patients from a university hospital population, suspected of having an infectious hepatitis. Criteria were: elevated alanine aminotransferase (ALT> 34 U/l and request for antibody testing for CMV, EBV or Hepatitis A (HAV.All samples were tested for HEV using ELISA and PCR. Ninety patients/sera were tested, of which 22% were HEV IgG positive. Only one serum was IgM positive. HEV PCR was positive in two patients: one patient was both HEV IgM and IgG positive, the other patient was only IgG positive. Both HEV RNA positive samples belonged to genotype 3. Evidence of recent infection with CMV, EBV and HAV was found in 13%, 10% and 3% respectively.Although our study is limited by small numbers, we conclude that HEV is a cause of acute hepatitis in hospital associated patients in The Netherlands. Moreover, in our study population the prevalence of acute HAV (3% was almost similar to acute HEV (2%. We propose to incorporate HEV testing in panels for acute infectious hepatitis. Negative results obtained for HEV IgM in a HEV PCR positive patient, indicates that antibody testing alone may not be sufficient and argues for PCR as a primary diagnostic tool in hospital associated patients. The high percentage of HEV IgG seropositivity confirms earlier epidemiological studies.

  14. [Herpes simplex virus bronchopneumonitis in patient with acute respiratory failure after surgery].

    Science.gov (United States)

    García-Montesinos-De la Peña, M; Oteiza-López, L; Aldunate-Calvo, S; Gómez-Sánchez, M J; Sáenz-Bañuelos, J J; Tihista-Jiménez, J A

    2010-03-01

    Herpes simplex virus bronchopneumonitis is a clinical entity described in critically ill patients and classically associated to immunosuppression. Recent reports have shown a higher frequency of virus detection from samples obtained by bronchoalveolar lavage of immunocompetent critically ill patients undergoing mechanical ventilation. This fact suggests its role as an independent pathogenic substrate. We report the case of a female patient who was admitted after an elective surgery of rectal tumor with suspected bronchoaspiration during anesthetic induction. The patient presented persistent fever despite broad spectrum antibiotic treatment. All cultures were negative for bacterial growth. The chest X-ray did not show opacifities. Prolonged mechanical ventilation with repeated failures to wean made it mandatory to perform percutaneous tracheostomy. A fibrobronchoscopy with bronchoalveolar lavage, performed previously, showed positive result for herpes simplex virus (PCR and specific nuclear inclusions in cells). Thus, treatment was initiated with acyclovir, with clinical improvement and weaning from mechanical ventilation. Copyright 2009 Elsevier España, S.L. y SEMICYUC. All rights reserved.

  15. Impact of determination of hepatitis B virus subgenotype and pre-core/core-promoter mutation for the prediction of acute exacerbation of asymptomatic carriers.

    Science.gov (United States)

    Ikegami, Tadashi; Matsuki, Yasuhiko; Tanaka, Yasuhito; Mizokami, Masashi; Honda, Akira; Hirayama, Takeshi; Saito, Yoshifumi; Matsuzaki, Yasushi

    2009-04-01

    A large cohort study in Japan revealed that the specific viral profile may influence the fulminant outcome in acute hepatitis B virus (HBV) infections, while the genetic influence on outcome has not been clarified in patients with acute exacerbation of chronic liver disease caused by HBV. We experienced a case of fatal liver failure that developed as the result of chronic HBV infection. To determine possible genetic factor involving acute exacerbation, genetic analysis of serum from the patient and his siblings was performed. HBV subgenotype as well as pre-core/core-promoter mutations of samples mentioned above were determined. Patient had HBV-Bj with pre-core (1896/1899) and core-promoter (1762/1764) mutations, the genomic profile frequently seen in fulminant hepatitis caused by acute HBV infection. This result suggests that determination of the HBV subgenotype and pre-core/core promoter mutations could provide a rationale for development of a treatment strategy in asymptomatic HBV carriers.

  16. Prolonged activation of virus-specific CD8+T cells after acute B19 infection

    DEFF Research Database (Denmark)

    Isa, Adiba; Kasprowicz, Victoria; Norbeck, Oscar

    2005-01-01

    BACKGROUND: Human parvovirus B19 (B19) is a ubiquitous and clinically significant pathogen, causing erythema infectiosum, arthropathy, transient aplastic crisis, and intrauterine fetal death. The phenotype of CD8+ T cells in acute B19 infection has not been studied previously. METHODS AND FINDINGS......: The number and phenotype of B19-specific CD8+ T cell responses during and after acute adult infection was studied using HLA-peptide multimeric complexes. Surprisingly, these responses increased in magnitude over the first year post-infection despite resolution of clinical symptoms and control of viraemia......, with T cell populations specific for individual epitopes comprising up to 4% of CD8+ T cells. B19-specific T cells developed and maintained an activated CD38+ phenotype, with strong expression of perforin and CD57 and downregulation of CD28 and CD27. These cells possessed strong effector function...

  17. Multiple immune factors are involved in controlling acute and chronic chikungunya virus infection.

    Directory of Open Access Journals (Sweden)

    Yee Suan Poo

    2014-12-01

    Full Text Available The recent epidemic of the arthritogenic alphavirus, chikungunya virus (CHIKV has prompted a quest to understand the correlates of protection against virus and disease in order to inform development of new interventions. Herein we highlight the propensity of CHIKV infections to persist long term, both as persistent, steady-state, viraemias in multiple B cell deficient mouse strains, and as persistent RNA (including negative-strand RNA in wild-type mice. The knockout mouse studies provided evidence for a role for T cells (but not NK cells in viraemia suppression, and confirmed the role of T cells in arthritis promotion, with vaccine-induced T cells also shown to be arthritogenic in the absence of antibody responses. However, MHC class II-restricted T cells were not required for production of anti-viral IgG2c responses post CHIKV infection. The anti-viral cytokines, TNF and IFNγ, were persistently elevated in persistently infected B and T cell deficient mice, with adoptive transfer of anti-CHIKV antibodies unable to clear permanently the viraemia from these, or B cell deficient, mice. The NOD background increased viraemia and promoted arthritis, with B, T and NK deficient NOD mice showing high-levels of persistent viraemia and ultimately succumbing to encephalitic disease. In wild-type mice persistent CHIKV RNA and negative strand RNA (detected for up to 100 days post infection was associated with persistence of cellular infiltrates, CHIKV antigen and stimulation of IFNα/β and T cell responses. These studies highlight that, secondary to antibodies, several factors are involved in virus control, and suggest that chronic arthritic disease is a consequence of persistent, replicating and transcriptionally active CHIKV RNA.

  18. Initial weight and virus dose: two factors affecting the onset of acute coxsackievirus B3 myocarditis in C57BL/6 mouse--a histopathology-based study.

    Science.gov (United States)

    Li, Minghui; Wang, Xinggang; Xie, Yuquan; Xie, Yeqing; Zhang, Xian; Zou, Yunzeng; Ge, Junbo; Chen, Ruizhen

    2013-01-01

    C57BL/6 mice have been considered resistant to cardiotropic coxsackievirus B3 (CVB3)-induced myocarditis. However, establishment of viral myocarditis model in C57BL/6 mouse is still a necessity. Here, we discuss the effects of mouse initial body weight and different virus inoculation doses on the onset of acute viral myocarditis in C57BL/6 mouse. According to initial body weight, mice were grouped into group A (3-4 weeks, 11-15 g) and group B (5-6 weeks, 18-20 g). Then, each group was divided into three subgroups inoculated with different virus doses: 1000 50% tissue culture infectious dose (TCID(50))/ml, 10,000 TCID(50)/ml, and 100,000 TCID(50)/ml. Virus existence and myocardium inflammatory infiltration conditions were observed and evaluated 7 days postinfection. Immunohistochemistry staining showed that virus capsid protein VP1 appeared in the myocardia of virus-infected mice. Three subgroups in the lower-body-weight group (group A) came out with a higher mortality (40%-100%), while the higher-body-weight group (group B) showed a tendency for body weight decline. Histopathologically, myocardia of the survival cases in the lower-initial-body-weight group got inflammatory infiltration, while almost no inflammation appeared in the dead cases. In the higher-body-weight group, myocardium inflammatory infiltration deteriorated with the increase of virus doses and bared a relatively sound survival rate. This study indicated that the initial body weight and virus infection dose are two factors affecting the onset of viral myocarditis in C57BL/6 mice. Accordingly, initial body weight of 18-20 g and an inoculation dose of 100,000 TCID(50)/ml × 0.3 ml CVB3 might be an optimal choice to induce acute viral myocarditis in C57BL/6 mice. Copyright © 2013 Elsevier Inc. All rights reserved.

  19. Comparison of the prevalence of respiratory viruses in patients with acute respiratory infections at different hospital settings in North China, 2012-2015.

    Science.gov (United States)

    Yu, Jianxing; Xie, Zhengde; Zhang, Tiegang; Lu, Yanqin; Fan, Hongwei; Yang, Donghong; Bénet, Thomas; Vanhems, Philippe; Shen, Kunling; Huang, Fang; Han, Jinxiang; Li, Taisheng; Gao, Zhancheng; Ren, Lili; Wang, Jianwei

    2018-02-08

    Acute respiratory infections (ARIs) are a great public health challenge globally. The prevalence of respiratory viruses in patients with ARIs attending at different hospital settings is fully undetermined. Laboratory-based surveillance for ARIs was conducted at inpatient and outpatient settings of 11 hospitals in North China. The first 2-5 patients with ARIs were recruited in each hospital weekly from 2012 through 2015. The presence of respiratory viruses was screened by PCR assays. The prevalence of respiratory viruses was determined and compared between patients at different hospital settings. A total of 3487 hospitalized cases and 6437 outpatients/Emergency Department (ED) patients were enrolled. The most commonly detected viruses in the hospitalized cases were respiratory syncytial virus (RSV, 33.3%) in children less than two years old, adenoviruses (13.0%) in patients 15-34 years old, and influenza viruses (IFVs, 9.6%) in patients ≥65 years. IFVs were the most common virus in outpatient/ED patients across all age groups (22.7%). After controlling for the confounders caused by other viruses and covariates, adenoviruses (adjusted odds ratio [aOR]: 3.97, 99% confidence interval [99% CI]: 2.19-7.20) and RSV (aOR: 2.04, 99% CI: 1.34-3.11) were independently associated with increased hospitalization in children, as well as adenoviruses in adults (aOR: 2.14, 99% CI: 1.19-3.85). Additionally, co-infection of RSV with IFVs was associated with increased hospitalization in children (aOR: 12.20, 99% CI: 2.65-56.18). A substantial proportion of ARIs was associated with respiratory viruses in North China. RSV, adenoviruses, and co-infection of RSV and IFVs were more frequent in hospitalized children (or adenoviruses in adults), which might predict the severity of ARIs. Attending clinicians should be more vigilant of these infections.

  20. Corticosteroid treatment ameliorates acute lung injury induced by 2009 swine origin influenza A (H1N1 virus in mice.

    Directory of Open Access Journals (Sweden)

    Chenggang Li

    Full Text Available BACKGROUND: The 2009 influenza pandemic affected people in almost all countries in the world, especially in younger age groups. During this time, the debate over whether to use corticosteroid treatment in severe influenza H1N1 infections patients resurfaced and was disputed by clinicians. There is an urgent need for a susceptible animal model of 2009 H1N1 infection that can be used to evaluate the pathogenesis and the therapeutic effect of corticosteroid treatment during infection. METHODOLOGY/PRINCIPAL FINDINGS: We intranasally inoculated two groups of C57BL/6 and BALB/c mice (using 4- or 6-to 8-week-old mice to compare the pathogenesis of several different H1N1 strains in mice of different ages. Based on the results, a very susceptible 4-week-old C57BL/6 mouse model of Beijing 501 strain of 2009 H1N1 virus infection was established, showing significantly elevated lung edema and cytokine levels compared to controls. Using our established animal model, the cytokine production profile and lung histology were assessed at different times post-infection, revealing increased lung lesions in a time-dependent manner. In additional,the mice were also treated with dexamethasone, which significantly improved survival rate and lung lesions in infected mice compared to those in control mice. Our data showed that corticosteroid treatment ameliorated acute lung injury induced by the 2009 A/H1N1 virus in mice and suggested that corticosteroids are valid drugs for treating 2009 A/H1N1 infection. CONCLUSIONS/SIGNIFICANCE: Using the established, very susceptible 2009 Pandemic Influenza A (H1N1 mouse model, our studies indicate that corticosteroids are a potential therapeutic remedy that may address the increasing concerns over future 2009 A/H1N1 pandemics.

  1. Frequency of viruses associated with acute respiratory infections in children younger than five years of age at a locality of Mexico City

    Directory of Open Access Journals (Sweden)

    C Cabello

    2006-02-01

    Full Text Available A locality in the district of Tlalpan, Mexico City, was selected in order to identify the viral agents in children younger than 5 years of age with acute respiratory infection (ARI. A total of 300 children were randomly selected and were included in this study for a period of 13 months. During this period nasopharyngeal exudates were collected for the isolation of viral agents. Monoclonal fluorescent antibodies were used for viral identification after cell culture. Viral infection was detected in 65% of the specimens. The respiratory syncytial virus (RSV was the most common virus agent detected. Children required an average of two consultations during the study period. Two high incidence peaks were observed, one during the summer and the other during winter; the most frequent viruses during these seasons were influenza A and RSV, respectively. The largest number of viruses was isolated in the group of children between 1 and 2 years of age and in the group between 4 and 5 years of age. This study demonstrated the presence of ARI and of different viruses in a period of 13 months, as well as the most frequent viruses in children younger than 5 years of age from a community of Mexico City.

  2. Acute meningoencephalomyelitis due to varicella-zoster virus in an AIDS patient: report of a case and review of the literature

    Directory of Open Access Journals (Sweden)

    Marcelo Corti

    2011-12-01

    Full Text Available Varicella-zoster virus (VZV meningoencephalomyelitis is a rare but severe neurological complication of VZV reactivation in immunocompromised patients. We report the case of an HIV-infected individual who developed an acute and severe meningoencephalomyelitis accompanied by a disseminated cutaneous eruption due to VZV. The presence of VZV DNA in cerebrospinal fluid was confirmed by polymerase chain reaction (PCR technique. The patient started undergoing an intravenous acyclovir therapy with a mild recovery of neurological manifestations. Varicella-zoster virus should be included as a cause of acute meningoencephalomyelitis in patients with AIDS. Early diagnosis followed by specific therapy should modify the rapid and fulminant course for this kind of patients.

  3. Prognostic factors of the short-term outcomes of patients with hepatitis B virus-associated acute-on-chronic liver failure.

    Science.gov (United States)

    Lei, Qing; Ao, Kangjian; Zhang, Yinhua; Ma, Deqiang; Ding, Deping; Ke, Changzheng; Chen, Yue; Luo, Jie; Meng, Zhongji

    2017-11-01

    To investigate the impact of the baseline status of patients with hepatitis B virus-associated acute-on-chronic liver failure on short-term outcomes. A retrospective study was conducted that included a total of 138 patients with hepatitis B virus-associated acute-on-chronic liver failure admitted to the Department of Infectious Diseases, Taihe Hospital, Hubei University of Medicine, from November 2013 to October 2016. The patients were divided into a poor prognosis group (74 patients) and a good prognosis group (64 patients) based on the disease outcome. General information, clinical indicators and prognostic scores of the patients' baseline status were analyzed, and a prediction model was established accordingly. Elder age, treatment with artificial liver support systems and the frequency of such treatments, high levels of white blood cells, neutrophils, neutrophil count/lymphocyte count ratio, alanine aminotransferase, gamma-glutamyl transferase, total bilirubin, urea, and prognostic scores as well as low levels of albumin and sodium were all significantly associated with the short-term outcomes of hepatitis B virus-associated acute-on-chronic liver failure. The predictive model showed that logit (p) = 3.068 + 1.003 × neutrophil count/lymphocyte count ratio - 0.892 × gamma-glutamyl transferase - 1.138 × albumin - 1.364 × sodium + 1.651 × artificial liver support therapy. The neutrophil count/lymphocyte count ratio and serum levels of gamma-glutamyl transferase, albumin and sodium were independent risk factors predicting short-term outcomes of hepatitis B virus-associated acute-on-chronic liver failure, and the administration of multiple treatments with artificial liver support therapy during the early stage is conducive to improved short-term outcomes.

  4. Acute reactogenicity after intramuscular immunization with recombinant vesicular stomatitis virus is linked to production of IL-1β.

    Directory of Open Access Journals (Sweden)

    Kathleen Athearn

    Full Text Available Vaccines based on live viruses are attractive because they are immunogenic, cost-effective, and can be delivered by multiple routes. However, live virus vaccines also cause reactogenic side effects such as fever, myalgia, and injection site pain that have reduced their acceptance in the clinic. Several recent studies have linked vaccine-induced reactogenic side effects to production of the pro-inflammatory cytokine interleukin-1β (IL-1β in humans. Our objective was therefore to determine whether IL-1β contributed to pathology after immunization with recombinant vesicular stomatitis virus (rVSV vaccine vectors, and if so, to identify strategies by which IL-1β mediated pathology might be reduced without compromising immunogenicity. We found that an rVSV vaccine induced local and systemic production of IL-1β in vivo, and that accumulation of IL-1β correlated with acute pathology after rVSV immunization. rVSV-induced pathology was reduced in mice deficient in the IL-1 receptor Type I, but the IL-1R-/- mice were fully protected from lethal rechallenge with a high dose of VSV. This result demonstrated that IL-1 contributed to reactogenicity of the rVSV, but was dispensable for induction of protective immunity. The amount of IL-1β detected in mice deficient in either caspase-1 or the inflammasome adaptor molecule ASC after rVSV immunization was not significantly different than that produced by wild type animals, and caspase-1-/- and ASC-/- mice were only partially protected from rVSV-induced pathology. Those data support the idea that some of the IL-1β expressed in vivo in response to VSV may be activated by a caspase-1 and ASC-independent mechanism. Together these results suggest that rVSV vectors engineered to suppress the induction of IL-1β, or signaling through the IL-1R would be less reactogenic in vivo, but would retain their immunogenicity and protective capacity. Such rVSV would be highly desirable as either vaccine vectors or

  5. Shedding of soluble glycoprotein 1 detected during acute Lassa virus infection in human subjects

    Directory of Open Access Journals (Sweden)

    Momoh Mambu

    2010-11-01

    Full Text Available Abstract Background Lassa hemorrhagic fever (LHF is a neglected tropical disease with significant impact on the health care system, society, and economy of Western and Central African nations where it is endemic. With a high rate of infection that may lead to morbidity and mortality, understanding how the virus interacts with the host's immune system is of great importance for generating vaccines and therapeutics. Previous work by our group identified a soluble isoform of the Lassa virus (LASV GP1 (sGP1 in vitro resulting from the expression of the glycoprotein complex (GPC gene 12. Though no work has directly been done to demonstrate the function of this soluble isoform in arenaviral infections, evidence points to immunomodulatory effects against the host's immune system mediated by a secreted glycoprotein component in filoviruses, another class of hemorrhagic fever-causing viruses. A significant fraction of shed glycoprotein isoforms during viral infection and biogenesis may attenuate the host's inflammatory response, thereby enhancing viral replication and tissue damage. Such shed glycoprotein mediated effects were previously reported for Ebola virus (EBOV, a filovirus that also causes hemorrhagic fever with nearly 90% fatality rates 345. The identification of an analogous phenomenon in vivo could establish a new correlate of LHF infection leading to the development of sensitive diagnostics targeting the earliest molecular events of the disease. Additionally, the reversal of potentially untoward immunomodulatory functions mediated by sGP1 could potentiate the development of novel therapeutic intervention. To this end, we investigated the presence of sGP1 in the serum of suspected LASV patients admitted to the Kenema Government Hospital (KGH Lassa Fever Ward (LFW, in Kenema, Sierra Leone that tested positive for viral antigen or displayed classical signs of Lassa fever. Results It is reasonable to expect that a narrow window exists for

  6. Elevated levels of cell-free circulating DNA in patients with acute dengue virus infection.

    Directory of Open Access Journals (Sweden)

    Tran Thi Ngoc Ha

    Full Text Available BACKGROUND: Apoptosis is thought to play a role in the pathogenesis of severe dengue and the release of cell-free DNA into the circulatory system in several medical conditions. Therefore, we investigated circulating DNA as a potential biomarker for severe dengue. METHODS AND FINDINGS: A direct fluorometric degradation assay using PicoGreen was performed to quantify cell-free DNA from patient plasma. Circulating DNA levels were significantly higher in patients with dengue virus infection than with other febrile illnesses and healthy controls. Remarkably, the increase of DNA levels correlated with the severity of dengue. Additionally, multivariate logistic regression analysis showed that circulating DNA levels independently correlated with dengue shock syndrome. CONCLUSIONS: Circulating DNA levels were increased in dengue patients and correlated with dengue severity. Additional studies are required to show the benefits of this biomarker in early dengue diagnosis and for the prognosis of shock complication.

  7. Zika Virus Tissue and Blood Compartmentalization in Acute Infection of Rhesus Macaques.

    Science.gov (United States)

    Coffey, Lark L; Pesavento, Patricia A; Keesler, Rebekah I; Singapuri, Anil; Watanabe, Jennifer; Watanabe, Rie; Yee, JoAnn; Bliss-Moreau, Eliza; Cruzen, Christina; Christe, Kari L; Reader, J Rachel; von Morgenland, Wilhelm; Gibbons, Anne M; Allen, A Mark; Linnen, Jeff; Gao, Kui; Delwart, Eric; Simmons, Graham; Stone, Mars; Lanteri, Marion; Bakkour, Sonia; Busch, Michael; Morrison, John; Van Rompay, Koen K A

    2017-01-01

    Animal models of Zika virus (ZIKV) are needed to better understand tropism and pathogenesis and to test candidate vaccines and therapies to curtail the pandemic. Humans and rhesus macaques possess similar fetal development and placental biology that is not shared between humans and rodents. We inoculated 2 non-pregnant rhesus macaques with a 2015 Brazilian ZIKV strain. Consistent with most human infections, the animals experienced no clinical disease but developed short-lived plasma viremias that cleared as neutralizing antibody developed. In 1 animal, viral RNA (vRNA) could be detected longer in whole blood than in plasma. Despite no major histopathologic changes, many adult tissues contained vRNA 14 days post-infection with highest levels in hemolymphatic tissues. These observations warrant further studies to investigate ZIKV persistence and its potential clinical implications for transmission via blood products or tissue and organ transplants.

  8. Zika Virus Tissue and Blood Compartmentalization in Acute Infection of Rhesus Macaques.

    Directory of Open Access Journals (Sweden)

    Lark L Coffey

    Full Text Available Animal models of Zika virus (ZIKV are needed to better understand tropism and pathogenesis and to test candidate vaccines and therapies to curtail the pandemic. Humans and rhesus macaques possess similar fetal development and placental biology that is not shared between humans and rodents. We inoculated 2 non-pregnant rhesus macaques with a 2015 Brazilian ZIKV strain. Consistent with most human infections, the animals experienced no clinical disease but developed short-lived plasma viremias that cleared as neutralizing antibody developed. In 1 animal, viral RNA (vRNA could be detected longer in whole blood than in plasma. Despite no major histopathologic changes, many adult tissues contained vRNA 14 days post-infection with highest levels in hemolymphatic tissues. These observations warrant further studies to investigate ZIKV persistence and its potential clinical implications for transmission via blood products or tissue and organ transplants.

  9. Acute virulent infection with feline immunodeficiency virus (FIV) results in lymphomagenesis via an indirect mechanism.

    Science.gov (United States)

    Magden, Elizabeth; Miller, Craig; MacMillan, Martha; Bielefeldt-Ohmann, Helle; Avery, Anne; Quackenbush, Sandra L; Vandewoude, Sue

    2013-02-20

    Four cats (24%) experimentally infected with FIV unexpectedly developed neoplastic changes within four months of inoculation. While FIV has previously been associated with neoplasia, the rapidity and high attack rate seen here is highly unusual. PCR for antigen receptor rearrangements (PARR) detected clonally rearranged T cells in two animals diagnosed with B cell follicular lymphoma by classical means. All cats were negative for feline leukemia virus; gamma-herpesvirus DNA was not amplified using degenerate primers. FIV proviral load in neoplastic tissue was two orders of magnitude lower than in the periphery, lower in neoplastic vs non-neoplastic lymph node, and clonal integration was not detected. We hypothesize that neoplasia was secondary to FIV immune dysregulation, and show that PARR can augment our capacity to phenotype these tumors and distinguish follicular hyperplasia from lymphoma. Age of exposure and relative virulence of the inoculum likely contributed to this unusual presentation of FIV infection. Copyright © 2012 Elsevier Inc. All rights reserved.

  10. Geldanamycin Reduces Acute Respiratory Distress Syndrome and Promotes the Survival of Mice Infected with the Highly Virulent H5N1 Influenza Virus.

    Science.gov (United States)

    Wang, Chengmin; Liu, Pengpeng; Luo, Jing; Ding, Hua; Gao, Yan; Sun, Lei; Luo, Fubing; Liu, Xiaodong; He, Hongxuan

    2017-01-01

    Infections with lethal influenza viruses lead to acute lung injury (ALI) or acute respiratory distress syndrome (ARDS), which may be related to the activation of the host's immune system. Here, in our study, male C57BL/6 mice were infected with 10 LD 50 of the H5N1 influenza virus and treated with geldanamycin or oseltamivir 2 h after infection. Lung injury was assessed by histopathology on days 4 and 7. The viral load was quantified by measuring the NP gene expression level on days 2, 4, and 7. Levels of cytokines and chemokines in bronchoalveolar lavage fluids and inflammatory cells were analyzed at different time points. Geldanamycin administration prolonged survival in mice and dramatically reduced lung injury and pulmonary inflammatory compared with other mice. Viral loads in geldanamycin-treated mice also significantly reduced compared with non-treated mice, but not to the extent as the oseltamivir-treated mice. Furthermore, the geldanamycin treatment markedly reduced the production of major proinflammatory cytokines and chemokines and attenuated the infiltration and activation of immune cells, but it did not alter the generation of virus-neutralizing antibodies. In conclusion, geldanamycin plays an important role in attenuating virus infection-induced ALI/ARDS by reducing the host's inflammatory responses and may provide an important reference for clinical treatments.

  11. Recombinant VP1 protein as a potential marker for the diagnosis of acute hepatitis A virus infection.

    Science.gov (United States)

    da Silva Junior, Haroldo Cid; da Silva, Edimilson Domingos; Lewis-Ximenez de Souza Rodrigues, Lia Laura; Medeiros, Marco Alberto

    2017-07-01

    Since hepatitis A virus (HAV) production is time-consuming and expensive, the use of recombinant proteins may represent an alternative source of antigens for diagnostic purposes. The present study aimed to express, purify and evaluate the potential of recombinant VP1 protein (rVP1) as a marker for the diagnosis of acute HAV infection. The rVP1 was expressed and purified successfully from Escherichia coli. The purified rVP1 was used to establish an in-house enzyme-linked immunosorbent assay (ELISA-rVP1) for detection of IgM antibodies in sera from HAV-positive patients. For a cut-off point of 0.351, the sensitivity and specificity of ELISA-rVP1 were 100.0% and 95.0%, respectively. These results indicate that rVP1 may be a useful antigen for detection of IgM antibodies against HAV. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Acute phase protein changes in calves during an outbreak of respiratory disease caused by bovine respiratory syncytial virus.

    Science.gov (United States)

    Orro, Toomas; Pohjanvirta, Tarja; Rikula, Ulla; Huovilainen, Anita; Alasuutari, Sakari; Sihvonen, Liisa; Pelkonen, Sinikka; Soveri, Timo

    2011-01-01

    Bovine acute phase proteins (APPs), lipopolysaccharide binding protein (LBP), serum amyloid A (SAA), haptoglobin (Hp) and alpha(1)-acid glycoprotein (AGP) were evaluated as inflammatory markers during an outbreak of bovine respiratory disease (BRD) caused by bovine respiratory syncytial virus (BRSV). Calves (n = 10) presented mild to moderate signs of respiratory disease. Secondary bacterial infections, Pasteurella multocida and Mycoplasma dispar as major species, were detected in tracheobronchial lavage samples. Concentrations of SAA and LBP increased at week 1 had the highest values at week 3 and decreased at week 4 of outbreak. Some calves had high Hp concentrations at week 3, but AGP concentrations did not rise during respiratory disease. Higher SAA, LBP and Hp concentrations at a later stage of BRD (week 3) were associated with the low BRSV-specific IgG(1) production, suggesting that these calves had enhanced inflammatory response to the secondary bacterial infection. In conclusion, APPs (especially SAA and LBP) are sensitive markers of respiratory infection, and they may be useful to explore host response to the respiratory infections in clinical research. Copyright © 2009 Elsevier Ltd. All rights reserved.

  13. Transient widespread cortical and splenial lesions in acute encephalitis/encephalopathy associated with primary Epstein–Barr virus infection

    Directory of Open Access Journals (Sweden)

    Shuo Zhang

    2016-01-01

    Full Text Available Infection with Epstein–Barr virus (EBV is very common and usually occurs in childhood or early adulthood. Encephalitis/encephalopathy is an uncommon but serious neurological complication of EBV. A case of EBV-associated encephalitis/encephalopathy with involvement of reversible widespread cortical and splenial lesions is presented herein. An 8-year-old Chinese girl who presented with fever and headache, followed by seizures and drowsiness, was admitted to the hospital. Magnetic resonance imaging revealed high signal intensities on diffusion-weighted imaging in widespread cortical and splenial lesions. The clinical and laboratory examination results together with the unusual radiology findings suggested acute encephalitis/encephalopathy due to primary EBV infection. After methylprednisolone pulse therapy together with ganciclovir, the patient made a full recovery without any brain lesions. The hallmark clinical–radiological features of this patient included severe encephalitis/encephalopathy at onset, the prompt and complete recovery, and rapidly reversible widespread involvement of the cortex and splenium. Patients with EBV encephalitis/encephalopathy who have multiple lesions, even with the widespread involvement of cortex and splenium of the corpus callosum, may have a favorable outcome with complete disappearance of all brain lesions.

  14. Acute Interstitial Nephritis Proteinuria and Herpes Simplex Virus Hepatitis in Pregnancy Mimic HELLP Syndrome (Hemolysis, Elevated Liver Enzymes, Low Platelets

    Directory of Open Access Journals (Sweden)

    Wendy M. White

    2011-12-01

    Full Text Available Elevated transaminases, hemolysis, and thrombocytopenia in pregnancy are most often caused by a preeclampsia variant—HELLP syndrome (hemolysis, elevated liver enzymes, low platelets. In atypical cases, it is important to consider other causes, such as herpes simplex virus (HSV hepatitis. Acute interstitial nephritis (AIN-induced proteinuria can make distinguishing HELLP from its mimics more difficult. A 43-year-old G4P3 gestational carrier at 28 weeks had abnormal laboratory findings consistent with HELLP, including proteinuria. However, she was normotensive and febrile, prompting an investigation into other possible causes of her signs and symptoms. She ultimately was diagnosed with disseminated HSV infection, started on definitive therapy, and allowed to continue her pregnancy to term. The proteinuria was attributed to AIN. AIN can cause proteinuria in the critically ill pregnant patient. When mimics of HELLP syndrome, such as disseminated HSV infection, are the cause of critical illness, the presence of AIN-induced proteinuria may falsely implicate a hypertensive disorder of pregnancy, resulting in iatrogenic premature delivery of the fetus and failure to initiate definitive potential lifesaving treatment.

  15. [Acute renal failure after dengue virus infection: A pediatric case report].

    Science.gov (United States)

    Nicolon, C; Broustal, E

    2016-01-01

    Dengue is an emerging, rapidly expanding disease, whose clinical and biological manifestations vary. Kidney injury is not usual but can be severe, and it is most often associated with dengue hemorrhagic fever or shock. Guadeloupe, which is located in an endemic area, experienced an epidemic from 2013 to 2014. During this outbreak, a case of renal failure during dengue was observed in a 10-year-old child. No evidence of dengue hemorrhagic fever or shock syndrome was found. The clinical and biological course improved with symptomatic treatment. The association of acute renal failure with hemolytic anemia suggested a diagnosis of hemolytic uremic syndrome. However, this could not be confirmed in the absence of thrombocytopenia and cytopathologic evidence. This case illustrates the diversity of clinical presentations of dengue, and the possibility of severe renal impairment unrelated to the usual factors encountered in dengue. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  16. Acute exacerbation of chronic hepatitis B virus infection in renal transplant patients.

    Science.gov (United States)

    Emori, Christini Takemi; Perez, Renata Melo; Matos, Carla Adriana Loureiro de; Uehara, Silvia Naomi Oliveira; Pereira, Patricia da Silva Fucuta; Feldner, Ana Cristina Amaral; Carvalho-Filho, Roberto José de; Silva, Ivonete Sandra de Souza e; Silva, Antonio Eduardo Benedito; Ferraz, Maria Lucia Gomes

    2014-01-01

    There is scarce information regarding clinical evolution of HBV infection in renal transplant patients. To evaluate the prevalence of acute exacerbation in HBV-infected renal transplant patients and its association with the time after transplantation, presence of viral replication, clinical evolution, and use of antiviral prophylaxis. HBV infected renal transplant patients who underwent regular follow-up visits at 6-month intervals were included in the study. The criteria adopted to characterize exacerbation were: ALT >5× ULN and/or >3× baseline level. Predictive factors of exacerbation evaluated were age, gender, time on dialysis, type of donor, post-transplant time, ALT, HBeAg, HBV-DNA, HCV-RNA, immunosuppressive therapy, and use of antiviral prophylaxis. 140 HBV-infected renal transplant patients were included (71% males; age 46 ± 10 years; post-renal transplant time 8 ± 5 years). During follow-up, 25% (35/140) of the patients presented exacerbation within 3.4 ± 3 years after renal transplant. Viral replication was observed in all patients with exacerbation. Clinical and/or laboratory signs of hepatic insufficiency were present in 17% (6/35) of the patients. Three patients died as a consequence of liver failure. In univariate analysis variables associated with exacerbation were less frequent use of prophylactic/preemptive lamivudine and of mycophenolate mofetil. Lamivudine use was the only variable independently associated with exacerbation, with a protective effect. Acute exacerbation was a frequent and severe event in HBV-infected renal transplant patients. Prophylactic/preemptive therapy with antiviral drugs should be indicated for all HBsAg-positive renal transplant patients. Copyright © 2014 Elsevier Editora Ltda. All rights reserved.

  17. Tissue Sites of Persistent Infection and Active Replication of Equine Infectious Anemia Virus during Acute Disease and Asymptomatic Infection in Experimentally Infected Equids

    Science.gov (United States)

    Harrold, Sharon M.; Cook, Sheila J.; Cook, R. Frank; Rushlow, Keith E.; Issel, Charles J.; Montelaro, Ronald C.

    2000-01-01

    Equine infectious anemia virus (EIAV) infection of horses is characterized by recurring cycles of disease and viremia that typically progress to an inapparent infection in which clinical symptoms are absent as host immune responses maintain control of virus replication indefinitely. The dynamics of EIAV viremia and its association with disease cycles have been well characterized, but there has been to date no comprehensive quantitative analyses of the specific tissue sites of EIAV infection and replication in experimentally infected equids during acute disease episodes and during asymptomatic infections in long-term inapparent carriers. To characterize the in vivo site(s) of viral infection and replication, we developed a quantitative competitive PCR assay capable of detecting 10 copies of viral DNA and a quantitative competitive reverse transcription-PCR assay with a sensitivity of about 30 copies of viral singly spliced mRNA. Animals were experimentally infected with one of two reference viruses: the animal-passaged field isolate designated EIAVWyo and the virulent cell-adapted strain designated EIAVPV. Tissues and blood cells were isolated during the initial acute disease or from asymptomatic animals and analyzed for viral DNA and RNA levels by the respective quantitative assays. The results of these experiments demonstrated that the appearance of clinical symptoms in experimentally infected equids coincided with rapid widespread seeding of viral infection and replication in a variety of tissues. During acute disease, the predominant cellular site of viral infection and replication was the spleen, which typically accounted for over 90% of the cellular viral burden. In asymptomatic animals, viral DNA and RNA persisted in virtually all tissues tested, but at extremely low levels, a finding indicative of tight but incomplete immune control of EIAV replication. During all disease states, peripheral blood mononuclear cells (PBMC) were found to harbor less than 1% of

  18. Analysis of Antiviral Properties of Hexoral In Vitro against Some Viruses that Cause Acute Respiratory Infections and Herpes.

    Science.gov (United States)

    Deryabin, P G; Galegov, G A; Andronova, V A; Botikov, A G

    2016-01-01

    Antiviral properties of Hexoral (0.1% solution and 0.2% aerosol for local application) and its constituent hexetidine against viruses causing human respiratory tract infections and herpes virus were studied in vitro. It was found that non-cytotoxic concentrations of hexetidine (alone and as a component of Hexoral) attenuated infectious properties of highly virulent influenza virus A/H5N1, pandemic influenza virus A/H1N1pdm, respiratory syncytial virus, and herpes simplex virus type 1 after a short-term exposure (30 sec) by 100 or more times. It was found that hexidine mostly contributes to the virucidal effect of Hexoral.

  19. Human respiratory syncytial virus load normalized by cell quantification as predictor of acute respiratory tract infection.

    Science.gov (United States)

    Gómez-Novo, Miriam; Boga, José A; Álvarez-Argüelles, Marta E; Rojo-Alba, Susana; Fernández, Ana; Menéndez, María J; de Oña, María; Melón, Santiago

    2018-01-05

    Human respiratory syncytial virus (HRSV) is a common cause of respiratory infections. The main objective is to analyze the prediction ability of viral load of HRSV normalized by cell number in respiratory symptoms. A prospective, descriptive, and analytical study was performed. From 7307 respiratory samples processed between December 2014 to April 2016, 1019 HRSV-positive samples, were included in this study. Low respiratory tract infection was present in 729 patients (71.54%). Normalized HRSV load was calculated by quantification of HRSV genome and human β-globin gene and expressed as log10 copies/1000 cells. HRSV mean loads were 4.09 ± 2.08 and 4.82 ± 2.09 log10 copies/1000 cells in the 549 pharyngeal and 470 nasopharyngeal samples, respectively (P respiratory tract infection and 4.22 ± 2.28 log10 copies/1000 cells with upper respiratory tract infection or febrile syndrome (P < 0.05). A possible cut off value to predict LRTI evolution was tentatively established. Normalization of viral load by cell number in the samples is essential to ensure an optimal virological molecular diagnosis avoiding that the quality of samples affects the results. A high viral load can be a useful marker to predict disease progression. © 2018 Wiley Periodicals, Inc.

  20. Ebola virus and severe acute respiratory syndrome coronavirus display late cell entry kinetics: evidence that transport to NPC1+ endolysosomes is a rate-defining step.

    Science.gov (United States)

    Mingo, Rebecca M; Simmons, James A; Shoemaker, Charles J; Nelson, Elizabeth A; Schornberg, Kathryn L; D'Souza, Ryan S; Casanova, James E; White, Judith M

    2015-03-01

    Ebola virus (EBOV) causes hemorrhagic fevers with high mortality rates. During cellular entry, the virus is internalized by macropinocytosis and trafficked through endosomes until fusion between the viral and an endosomal membrane is triggered, releasing the RNA genome into the cytoplasm. We found that while macropinocytotic uptake of filamentous EBOV viruslike particles (VLPs) expressing the EBOV glycoprotein (GP) occurs relatively quickly, VLPs only begin to enter the cytoplasm after a 30-min lag, considerably later than particles bearing the influenza hemagglutinin or GP from lymphocytic choriomeningitis virus, which enter through late endosomes (LE). For EBOV, the long lag is not due to the large size or unusual shape of EBOV filaments, the need to prime EBOV GP to the 19-kDa receptor-binding species, or a need for unusually low endosomal pH. In contrast, since we observed that EBOV entry occurs upon arrival in Niemann-Pick C1 (NPC1)-positive endolysosomes (LE/Lys), we propose that trafficking to LE/Lys is a key rate-defining step. Additional experiments revealed, unexpectedly, that severe acute respiratory syndrome (SARS) S-mediated entry also begins only after a 30-min lag. Furthermore, although SARS does not require NPC1 for entry, SARS entry also begins after colocalization with NPC1. Since the only endosomal requirement for SARS entry is cathepsin L activity, we tested and provide evidence that NPC1(+) LE/Lys have higher cathepsin L activity than LE, with no detectable activity in earlier endosomes. Our findings suggest that both EBOV and SARS traffic deep into the endocytic pathway for entry and that they do so to access higher cathepsin activity. Ebola virus is a hemorrhagic fever virus that causes high fatality rates when it spreads from zoonotic vectors into the human population. Infection by severe acute respiratory syndrome coronavirus (SARS-CoV) causes severe respiratory distress in infected patients. A devastating outbreak of EBOV occurred in West

  1. [Lower lymphocyte response in severe cases of acute bronchiolitis due to respiratory syncytial virus].

    Science.gov (United States)

    Ramos-Fernández, José Miguel; Moreno-Pérez, David; Antúnez-Fernández, Cristina; Milano-Manso, Guillermo; Cordón-Martínez, Ana María; Urda-Cardona, Antonio

    2017-08-14

    Acute bronchiolitis (AB) of the infant has a serious outcome in 6-16% of the hospital admitted cases. Its pathogenesis and evolution is related to the response of the T lymphocytes. The objective of the present study is to determine if the lower systemic lymphocytic response is related to a worse outcome of AB in hospitalised infants. Retrospective observational-analytical study of cases-controls nested in a cohort of patients admitted due to RSV-AB between the period from October 2010 to March 2015. Those with a full blood count in the first 48hours of respiratory distress were included. Infants with underlying disease, bacterial superinfection, and premature infants <32 weeks of gestation were excluded. The main dichotomous variable was PICU admission. Other variables were: gender, age, post-menstrual age, gestational and post-natal tobacco exposure, admission month, type of lactation, and days of onset of respiratory distress. Lymphocyte counts were categorised by quartiles. Bivariate analysis was performed with the main variable and then by logistic regression to analyse confounding factors. The study included 252 infants, of whom 6.6% (17) required PICU admission. The difference in mean±SD of lymphocytes for patients admitted to and not admitted to PICU was 4,044±1755 and 5,035±1786, respectively (Student-t test, P<.05). An association was found between PICU admission and lymphocyte count <3700/ml (Chi-squared, P=.019; OR: 3.2) and it was found to be maintained in the logistic regression, regardless of age and all other studied factors (Wald 4.191 P=.041, OR: 3.8). A relationship was found between lymphocytosis <3700/ml in the first days of respiratory distress and a worse outcome in previously healthy infants <12 months and gestational age greater than 32 weeks with RSV-AB. Copyright © 2017. Publicado por Elsevier España, S.L.U.

  2. IRF9 Prevents CD8+T Cell Exhaustion in an Extrinsic Manner during Acute Lymphocytic Choriomeningitis Virus Infection.

    Science.gov (United States)

    Huber, Magdalena; Suprunenko, Tamara; Ashhurst, Thomas; Marbach, Felix; Raifer, Hartmann; Wolff, Svenja; Strecker, Thomas; Viengkhou, Barney; Jung, So Ri; Obermann, Hannah-Lena; Bauer, Stefan; Xu, Haifeng C; Lang, Philipp A; Tom, Adomati; Lang, Karl S; King, Nicholas J C; Campbell, Iain L; Hofer, Markus J

    2017-11-15

    Effective CD8 + T cell responses play an important role in determining the course of a viral infection. Overwhelming antigen exposure can result in suboptimal CD8 + T cell responses, leading to chronic infection. This altered CD8 + T cell differentiation state, termed exhaustion, is characterized by reduced effector function, upregulation of inhibitory receptors, and altered expression of transcription factors. Prevention of overwhelming antigen exposure to limit CD8 + T cell exhaustion is of significant interest for the control of chronic infection. The transcription factor interferon regulatory factor 9 (IRF9) is a component of type I interferon (IFN-I) signaling downstream of the IFN-I receptor (IFNAR). Using acute infection of mice with lymphocytic choriomeningitis virus (LCMV) strain Armstrong, we show here that IRF9 limited early LCMV replication by regulating expression of interferon-stimulated genes and IFN-I and by controlling levels of IRF7, a transcription factor essential for IFN-I production. Infection of IRF9- or IFNAR-deficient mice led to a loss of early restriction of viral replication and impaired antiviral responses in dendritic cells, resulting in CD8 + T cell exhaustion and chronic infection. Differences in the antiviral activities of IRF9- and IFNAR-deficient mice and dendritic cells provided further evidence of IRF9-independent IFN-I signaling. Thus, our findings illustrate a CD8 + T cell-extrinsic function for IRF9, as a signaling factor downstream of IFNAR, in preventing overwhelming antigen exposure resulting in CD8 + T cell exhaustion and, ultimately, chronic infection. IMPORTANCE During early viral infection, overwhelming antigen exposure can cause functional exhaustion of CD8 + T cells and lead to chronic infection. Here we show that the transcription factor interferon regulatory factor 9 (IRF9) plays a decisive role in preventing CD8 + T cell exhaustion. Using acute infection of mice with LCMV strain Armstrong, we found that IRF9

  3. Full-length genome characterization and genetic relatedness analysis of hepatitis A virus outbreak strains associated with acute liver failure among children.

    Science.gov (United States)

    Vaughan, Gilberto; Forbi, Joseph C; Xia, Guo-Liang; Fonseca-Ford, Maureen; Vazquez, Roberto; Khudyakov, Yury E; Montiel, Sonia; Waterman, Steve; Alpuche, Celia; Gonçalves Rossi, Livia Maria; Luna, Norma

    2014-02-01

    Clinical infection by hepatitis A virus (HAV) is generally self-limited but in some cases can progress to liver failure. Here, an HAV outbreak investigation among children with acute liver failure in a highly endemic country is presented. In addition, a sensitive method for HAV whole genome amplification and sequencing suitable for analysis of clinical samples is described. In this setting, two fatal cases attributed to acute liver failure and two asymptomatic cases living in the same household were identified. In a second household, one HAV case was observed with jaundice which resolved spontaneously. Partial molecular characterization showed that both households were infected by HAV subtype IA; however, the infecting strains in the two households were different. The HAV outbreak strains recovered from all cases grouped together within cluster IA1, which contains closely related HAV strains from the United States commonly associated with international travelers. Full-genome HAV sequences obtained from the household with the acute liver failure cases were related (genetic distances ranging from 0.01% to 0.04%), indicating a common-source infection. Interestingly, the strain recovered from the asymptomatic household contact was nearly identical to the strain causing acute liver failure. The whole genome sequence from the case in the second household was distinctly different from the strains associated with acute liver failure. Thus, infection with almost identical HAV strains resulted in drastically different clinical outcomes. © 2013 Wiley Periodicals, Inc.

  4. Hepatitis B Virus-Specific CD8+ T Cells Maintain Functional Exhaustion after Antigen Reexposure in an Acute Activation Immune Environment.

    Science.gov (United States)

    Wang, Qin; Pan, Wen; Liu, Yanan; Luo, Jinzhuo; Zhu, Dan; Lu, Yinping; Feng, Xuemei; Yang, Xuecheng; Dittmer, Ulf; Lu, Mengji; Yang, Dongliang; Liu, Jia

    2018-01-01

    Chronic hepatitis B virus (HBV) infection is characterized by the presence of functionally exhausted HBV-specific CD8+ T cells. To characterize the possible residual effector ability of these cells, we reexposed CD8+ T cells from chronically HBV replicating mice to HBV antigens in an acute activation immune environment. We found that after transfer into naive mice, exhausted CD8+ T cells reexpanded in a comparable magnitude as naive CD8+ T cells in response to acute HBV infection; however, their proliferation intensity was significantly lower than that of CD8+ T cells from acute-resolving HBV replicating mice (AR mice). The differentiation phenotypes driven by acute HBV replication of donor exhausted and naive CD8+ T cells were similar, but were different from those of their counterparts from AR mice. Nevertheless, exhausted CD8+ T cells maintained less activated phenotype, an absence of effector cytokine production and poor antiviral function after HBV reexposure in an acute activation immune environment. We thus conclude that exhausted CD8+ T cells undergo a stable form of dysfunctional differentiation during chronic HBV replication and switching immune environment alone is not sufficient for the antiviral functional reconstitution of these cells.

  5. Adaptive immunity is the primary force driving selection of equine infectious anemia virus envelope SU variants during acute infection.

    Science.gov (United States)

    Mealey, Robert H; Leib, Steven R; Pownder, Sarah L; McGuire, Travis C

    2004-09-01

    Equine infectious anemia virus (EIAV) is a lentivirus that causes persistent infection in horses. The appearance of antigenically distinct viral variants during recurrent viremic episodes is thought to be due to adaptive immune selection pressure. To test this hypothesis, we evaluated envelope SU cloned sequences from five severe combined immunodeficient (SCID) foals infected with EIAV. Within the SU hypervariable V3 region, 8.5% of the clones had amino acid changes, and 6.4% had amino acid changes within the known cytotoxic T lymphocyte (CTL) epitope Env-RW12. Of all the SU clones, only 3.1% had amino acid changes affecting potential N-linked glycosylation sites. In contrast, a much higher degree of variation was evident in SU sequences obtained from four EIAV-infected immunocompetent foals. Within V3, 68.8% of the clones contained amino acid changes, and 50% of the clones had amino acid changes within the Env-RW12 CTL epitope. Notably, 31.9% of the clones had amino acid changes affecting one or more glycosylation sites. Marked amino acid variation occurred in cloned SU sequences from an immune-reconstituted EIAV-infected SCID foal. Of these clones, 100% had amino acid changes within V3, 100% had amino acid changes within Env-RW12, and 97.5% had amino acid changes affecting glycosylation sites. Analysis of synonymous and nonsynonymous nucleotide substitutions revealed statistically significant differences between SCID and immunocompetent foals and between SCID foals and the reconstituted SCID foal. Interestingly, amino acid selection at one site occurred independently of adaptive immune status. Not only do these data indicate that adaptive immunity primarily drives the selection of EIAV SU variants, but also they demonstrate that other selective forces exist during acute infection.

  6. A novel model of lethal Hendra virus infection in African green monkeys and the effectiveness of ribavirin treatment.

    Science.gov (United States)

    Rockx, Barry; Bossart, Katharine N; Feldmann, Friederike; Geisbert, Joan B; Hickey, Andrew C; Brining, Douglas; Callison, Julie; Safronetz, David; Marzi, Andrea; Kercher, Lisa; Long, Dan; Broder, Christopher C; Feldmann, Heinz; Geisbert, Thomas W

    2010-10-01

    The henipaviruses, Hendra virus (HeV) and Nipah virus (NiV), are emerging zoonotic paramyxoviruses that can cause severe and often lethal neurologic and/or respiratory disease in a wide variety of mammalian hosts, including humans. There are presently no licensed vaccines or treatment options approved for human or veterinarian use. Guinea pigs, hamsters, cats, and ferrets, have been evaluated as animal models of human HeV infection, but studies in nonhuman primates (NHP) have not been reported, and the development and approval of any vaccine or antiviral for human use will likely require efficacy studies in an NHP model. Here, we examined the pathogenesis of HeV in the African green monkey (AGM) following intratracheal inoculation. Exposure of AGMs to HeV produced a uniformly lethal infection, and the observed clinical signs and pathology were highly consistent with HeV-mediated disease seen in humans. Ribavirin has been used to treat patients infected with either HeV or NiV; however, its utility in improving outcome remains, at best, uncertain. We examined the antiviral effect of ribavirin in a cohort of nine AGMs before or after exposure to HeV. Ribavirin treatment delayed disease onset by 1 to 2 days, with no significant benefit for disease progression and outcome. Together our findings introduce a new disease model of acute HeV infection suitable for testing antiviral strategies and also demonstrate that, while ribavirin may have some antiviral activity against the henipaviruses, its use as an effective standalone therapy for HeV infection is questionable.

  7. Characterization of thymus-associated lymphoid depletion in bovine calves acutely or persistently infected with bovine viral diarrhea virus 1, bovine viral diarrhea virus 2 or HoBi-like pestivirus

    OpenAIRE

    Falkenberg, Shollie M.; Bauermann, Fernando V.; Ridpath, Julia F.

    2017-01-01

    Naïve pregnant cattle exposed to pestiviruses between 40-125 days of gestation can give birth to persistently infected (PI) calves. Clinical presentation and survivability, in PI cattle, is highly variable even with the same pestivirus strain whereas the clinical presentation in acute infections is more uniform with severity of symptoms being primarily a function of virulence of the infecting virus. The aim of this study was to compare thymic depletion, as measured by comparing the area of th...

  8. Acute Hepatitis E Virus infection with coincident reactivation of Epstein-Barr virus infection in an immunosuppressed patient with rheumatoid arthritis: a case report.

    Science.gov (United States)

    Schultze, Detlev; Mani, Bernhard; Dollenmaier, Günter; Sahli, Roland; Zbinden, Andrea; Krayenbühl, Pierre Alexandre

    2015-10-29

    Hepatitis E virus (HEV) is the most recently discovered of the hepatotropic viruses, and is considered an emerging pathogen in developed countries with the possibility of fulminant hepatitis in immunocompromised patients. Especially in the latter elevated transaminases should be taken as a clue to consider HEV infection, as it can be treated by discontinuation of immunosuppression and/or ribavirin therapy. To our best knowledge, this is a unique case of autochthonous HEV infection with coincident reactivation of Epstein-Barr virus (EBV) infection in an immunosuppressed patient with rheumatoid arthritis (RA). A 68-year-old Swiss woman with RA developed hepatitis initially diagnosed as methotrexate-induced liver injury, but later diagnosed as autochthonous HEV infection accompanied by reactivation of her latent EBV infection. She showed confounding serological results pointing to three hepatotropic viruses (HEV, Hepatitis B virus (HBV) and EBV) that could be resolved by detection of HEV and EBV viraemia. The patient recovered by temporary discontinuation of immunosuppressive therapy. In immunosuppressed patients with RA and signs of liver injury, HEV infection should be considered, as infection can be treated by discontinuation of immunosuppression. Although anti-HEV-IgM antibody assays can be used as first line virological tools, nucleic acid amplification tests (NAAT) for detection of HEV RNA are recommended--as in our case--if confounding serological results from other hepatotropic viruses are obtained. After discontinuation of immunosuppressive therapy, our patient recovered from both HEV infection and reactivation of latent EBV infection without sequelae.

  9. Fatal acute myocarditis and fulminant hepatic failure in an infant with pandemic human influenza A, H1N1 (2009 virus infection

    Directory of Open Access Journals (Sweden)

    Mortada H.F. El-Shabrawi

    2011-04-01

    Full Text Available We report the clinical presentation of a 10 month-old infant who succumbed with acute myocarditis and fulminant hepatic failure associated with a virologically confirmed human influenza A, H1N1 (2009 virus infection. To date, this is the first pediatric patient presenting with this fatal combination of complications during the current H1N1 pandemic. Therefore, we recommend meticulous assessment and follow up of the cardiac status, liver enzymes and coagulation profile in all pediatric patients with severe H1N1 influenza infection.

  10. Preventing acute rejection, Epstein-Barr virus infection, and posttransplant lymphoproliferative disorders after kidney transplantation: Use of aciclovir and mycophenolate mofetil in a steroid-free immunosuppressive protocol

    DEFF Research Database (Denmark)

    Birkeland, S.A.; Andersen, H.K.; Hamilton-Dutoit, Stephen Jacques

    1999-01-01

    Background: A widely held view is that any increase in the potency of an immunosuppressive agent will lead to an increase in infection and malignancy, such as life-threatening Epstein-Barr virus (EBV) induced posttransplant lymphoproliferative disorders (PTLD), We tested this paradigm by studying......; the effect of adding mofetil to a steroid-free protocol under cover of high-dose aciclovir prophylaxis on the number of acute rejections, EBV infections and PTLDs after kidney transplantation. Methods: EBV serology was performed in 267 consecutive renal transplantations (1990-1997), All were treated...

  11. Karyotype analysis of the acute fibrosarcoma from chickens infected with subgroup J avian leukosis virus associated with v-src oncogene.

    Science.gov (United States)

    Dong, Xuan; Ju, Sidi; Chen, Junxia; Meng, Fanfeng; Sun, Peng; Li, Yang; Wang, Xin; Wang, Yixin; Liu, Juan; Chang, Shuang; Zhao, Peng; Cui, Zhizhong

    2016-01-01

    To understand the cytogenetic characteristics of acute fibrosarcoma in chickens infected with the subgroup J avian leukosis virus associated with the v-src oncogene, we performed a karyotype analysis of fibrosarcoma cell cultures. Twenty-nine of 50 qualified cell culture spreads demonstrated polyploidy of some macrochromosomes, 21 of which were trisomic for chromosome 7, and others were trisomic for chromosomes 3, 4, 5 (sex chromosome w), and 10. In addition, one of them was trisomic for both chromosome 7 and the sex chromosome 5 (w). In contrast, no aneuploidy was found for 10 macrochromosomes of 12 spreads of normal chicken embryo fibroblast cells, although aneuploidy for some microchromosomes was demonstrated in five of the 12 spreads. The cytogenetic mosaicism or polymorphism of the aneuploidy in the acute fibrosarcoma described in this study suggests that the analysed cells are polyclonal.

  12. Up-regulation of serum periostin and squamous cell carcinoma antigen levels in infants with acute bronchitis due to respiratory syncytial virus

    Directory of Open Access Journals (Sweden)

    Hiroaki Nakamura

    2018-04-01

    Full Text Available Background: Periostin and squamous cell carcinoma antigen (SCCA are involved in the pathogenesis of asthma. Acute bronchitis due to respiratory syncytial virus (RSV infection during infancy exhibits an asthma-like pathogenesis, suggesting that it may be associated with the subsequent development of asthma. However, the mechanism by which RSV infection leads to development of asthma has not yet been fully elucidated. Methods: Infants younger than 36 months were enrolled and classified into three groups. Group I included patients hospitalized with RSV-induced bronchitis. These patients were further stratified into two sub-groups according to whether the criteria for the modified Asthma Predictive Index (mAPI had been met: Group I consisted of mAPI (+ and mAPI (− patients; Group II included patients with food allergy as a positive control group; and Group III included children with no allergy as a negative control group. Serum periostin and SCCA levels were measured in the groups. This study was registered as a clinical trial (UMIN000012339. Results: We enrolled 14 subjects in Group I mAPI (+, 22 in Group I mAPI (−, 18 in Group II, and 18 in Group III. In Group I, the serum periostin and SCCA levels were significantly higher during the acute phase compared with the recovery phase. However, no significant differences were found between Group I mAPI (+ and mAPI (−. Conclusions: The serum periostin and SCCA levels increased during acute RSV bronchitis. Both periostin and SCCA may play a role in the pathogenesis of acute bronchitis due to RSV. Keywords: Infants, Periostin, Respiratory syncytial virus, Squamous cell carcinoma antigen, T-helper 2 cell cytokines

  13. Deletion of the complement C5a receptor alleviates the severity of acute pneumococcal otitis media following influenza A virus infection in mice.

    Directory of Open Access Journals (Sweden)

    Hua Hua Tong

    Full Text Available There is considerable evidence that influenza A virus (IAV promotes adherence, colonization, and superinfection by S. pneumoniae (Spn and contributes to the pathogenesis of otitis media (OM. The complement system is a critical innate immune defense against both pathogens. To assess the role of the complement system in the host defense and the pathogenesis of acute pneumococcal OM following IAV infection, we employed a well-established transtympanically-induced mouse model of acute pneumococcal OM. We found that antecedent IAV infection enhanced the severity of acute pneumococcal OM. Mice deficient in complement C1qa (C1qa-/- or factor B (Bf -/- exhibited delayed viral and bacterial clearance from the middle ear and developed significant mucosal damage in the eustachian tube and middle ear. This indicates that both the classical and alternative complement pathways are critical for the oto-immune defense against acute pneumococcal OM following influenza infection. We also found that Spn increased complement activation following IAV infection. This was characterized by sustained increased levels of anaphylatoxins C3a and C5a in serum and middle ear lavage samples. In contrast, mice deficient in the complement C5a receptor (C5aR demonstrated enhanced bacterial clearance and reduced severity of OM. Our data support the concept that C5a-C5aR interactions play a significant role in the pathogenesis of acute pneumococcal OM following IAV infection. It is possible that targeting the C5a-C5aR axis might prove useful in attenuating acute pneumococcal OM in patients with influenza infection.

  14. C-reactive protein, haptoglobin and Pig-Major acute phase protein profiles of pigs infected experimentally by different isolates of porcine reproductive and respiratory syndrome virus.

    Science.gov (United States)

    Saco, Y; Martínez-Lobo, F; Cortey, M; Pato, R; Peña, R; Segalés, J; Prieto, C; Bassols, A

    2016-02-01

    Porcine reproductive and respiratory syndrome (PRRS) virus (PRRSV) is the etiologic agent of PRRS, one of the most important diseases in swine worldwide. In the present work, the effects of different PRRSV strains were tested on a piglet experimental model to study the induced acute phase response. For this purpose, pigs (n=15 for each group) were intranasally inoculated with one of five PRRSV strains (isolates EU10, 12, 17, 18 from genotype 1 and isolate JA-142 from genotype 2). The acute phase response was monitored by measuring acute phase proteins (APPs). Specifically, the serum concentration of haptoglobin (Hp), C-reactive protein (CRP) and Pig-Major Acute Protein (Pig-MAP) was determined at 0, 3, 6, 9, 12, 15, 18 and 21 days p.i. Clinical signs and growth performance were also monitored during the experiment. All animals became viremic after inoculation during the study period. The APP response was heterogeneous and dependent on the strain, being strains EU10, EU 18 and JA-142 those that induced the highest response and the strongest clinical signs. In general, Hp was the most sensitive biomarker for PRRSV infection, CRP behaved as moderate and Pig-MAP was the less responsive during the course of PRRSV experimental infection. Hp and CRP were significantly discriminatory between infected and control pigs, but not Pig-MAP. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. European Bats as Carriers of Viruses with Zoonotic Potential

    Directory of Open Access Journals (Sweden)

    Claudia Kohl

    2014-08-01

    Full Text Available Bats are being increasingly recognized as reservoir hosts of highly pathogenic and zoonotic emerging viruses (Marburg virus, Nipah virus, Hendra virus, Rabies virus, and coronaviruses. While numerous studies have focused on the mentioned highly human-pathogenic bat viruses in tropical regions, little is known on similar human-pathogenic viruses that may be present in European bats. Although novel viruses are being detected, their zoonotic potential remains unclear unless further studies are conducted. At present, it is assumed that the risk posed by bats to the general public is rather low. In this review, selected viruses detected and isolated in Europe are discussed from our point of view in regard to their human-pathogenic potential. All European bat species and their roosts are legally protected and some European species are even endangered. Nevertheless, the increasing public fear of bats and their viruses is an obstacle to their protection. Educating the public regarding bat lyssaviruses might result in reduced threats to both the public and the bats.

  16. European bats as carriers of viruses with zoonotic potential.

    Science.gov (United States)

    Kohl, Claudia; Kurth, Andreas

    2014-08-13

    Bats are being increasingly recognized as reservoir hosts of highly pathogenic and zoonotic emerging viruses (Marburg virus, Nipah virus, Hendra virus, Rabies virus, and coronaviruses). While numerous studies have focused on the mentioned highly human-pathogenic bat viruses in tropical regions, little is known on similar human-pathogenic viruses that may be present in European bats. Although novel viruses are being detected, their zoonotic potential remains unclear unless further studies are conducted. At present, it is assumed that the risk posed by bats to the general public is rather low. In this review, selected viruses detected and isolated in Europe are discussed from our point of view in regard to their human-pathogenic potential. All European bat species and their roosts are legally protected and some European species are even endangered. Nevertheless, the increasing public fear of bats and their viruses is an obstacle to their protection. Educating the public regarding bat lyssaviruses might result in reduced threats to both the public and the bats.

  17. Surveillance for highly pathogenic H5 avian influenza virus in synanthropic wildlife associated with poultry farms during an acute outbreak

    Science.gov (United States)

    In November 2014, a Eurasian strain H5N8 highly pathogenic avian influenza virus was detected in poultry in Canada. Introduced viruses were soon detected in the United States and within six months had spread to 21 states with more than 48 million poultry affected. In an effort to study potential mec...

  18. Clinical and epidemiological aspects related to the detection of adenovirus or respiratory syncytial virus in infants hospitalized for acute lower respiratory tract infection

    Directory of Open Access Journals (Sweden)

    Eduardo A. Ferone

    2014-01-01

    Full Text Available OBJECTIVE: To characterize and compare clinical, epidemiological, and laboratory aspects ofinfants with acute lower respiratory infection (ALRI associated with the detection of adenovirus(ADV or respiratory syncytial virus (RSV. METHODS: A preliminary respiratory infection surveillance study collected samples of nasopharyngeal aspirate (NPA for viral research, linked to the completion of a standard protocol, from children younger than two years admitted to a university hospital with ALRI, between March of 2008 and August of 2011. Polymerase chain reaction (PCR was used for eight viruses: ADV, RSV, metapneumovirus, Parainfluenza 1, 2, and 3, and Influenza A and B. Cases with NPA collectedduring the first 24 hours of admission, negative results of blood culture, and exclusive detection of ADV (Gadv group or RSV (Grsv group were selected for comparisons. RESULTS: The preliminary study included collection of 1,121 samples of NPA, 813 collected in thefirst 24 hours of admission, of which 50.3% were positive for at least one virus; RSV was identifiedin 27.3% of cases surveyed, and ADV was identified in 15.8%. Among the aspects analyzed inthe Gadv (n = 58 and Grsv (n = 134 groups, the following are noteworthy: the higher meanage, more frequent prescription of antibiotics, and the highest median of total white blood cellcount and C-reactive protein values in Gadv. CONCLUSIONS: PCR can detect persistent/latent forms of ADV, an aspect to be considered wheninterpreting results. Additional studies with quantitative diagnostic techniques could elucidatethe importance of the high frequency observed.

  19. [Validation of a real time RT-PCR assay to detect foot-and-mouth disease virus and assessment of its performance in acute infection].

    Science.gov (United States)

    Fondevila, Norberto; Compaired, Diego; Maradei, Eduardo; Duffy, Sergio

    2014-01-01

    A specific real time reverse transcription polymerase chain reaction (RT-PCRrt) for the detection of foot-and-mouth disease virus was validated using the LightCycler thermocycler 2.0 and its reagents as recommended by the World Organization for Animal Health and was assessed for the detection of the virus in acute infection of cattle experimentally vaccinated and challenged with virus A Argentina/2001 or A24 Cruzeiro. The technique proved to be robust, showing coefficients of variation lower than 4% for different ARN extractions, days or repetitions and was able to detect up to 0,4 TCID 50%, and/or up to 100 RNA molecules. In probang samples, diagnostic sensitivity was 93.1 (95% CI 86.5-96.6) and diagnostic specificity 100 (95% CI 96.3-100). The results of the challenge in vaccinated or multivaccinated bovines showed that although there were high levels of clinical protection in the vaccinated group, FMDV could be detected in all challenged groups. However, detection was 100 times lower in immunized animals. Copyright © 2014 Asociación Argentina de Microbiología. Publicado por Elsevier España. All rights reserved.

  20. Cerebelite aguda causada por vírus Epstein-Barr: relato de caso Acute cerebellitis caused by Epstein-Barr virus: case report

    Directory of Open Access Journals (Sweden)

    Hélio A.G. Teive

    2001-09-01

    Full Text Available A cerebelite aguda pode ocorrer em associação a infecção pelo vírus da varicela-zoster, enterovirus, caxumba, micoplasma e outros agentes infecciosos. A cerebelite aguda é uma complicação rara da infecção pelo vírus Epstein-Barr (EBV. Relatamos o caso de uma mulher de 21 anos com história de 12 dias de evolução com náuseas, vômitos, ataxia de marcha e membros, tremor cefálico e de membros, opsoclono, mioclonias e rash cutâneo. Sorologia para EBV foi positiva. A infecção pelo EBV, com complicações neurológicas, pode não se apresentar com os sinais e sintomas clássicos da mononucleose infeciosa.Acute cerebellitis can occur in association with varicella-zoster virus, enterovirus, mumps, mycoplasma, and other infective organisms. Acute cerebellitis is a rare complication of Epstein-Barr virus (EBV infection. We report the case of a 21-year-old woman with a 12-day history of nausea and vomiting, gait and limbs ataxia, myoclonus, tremor of head and all four limbs, opsoclonus and cutaneous rash. Anti-EBV IgG and IgM antibodies against antiviral capsid were positive and anti-EBV against virus-associated nuclear antigen was also positive. EBV infection in association with neurological findings can occur without the classic signs and symptoms of infectious mononucleosis.

  1. Immunology of Bats and Their Viruses: Challenges and Opportunities

    Science.gov (United States)

    Schountz, Tony

    2014-01-01

    Bats are reservoir hosts of several high-impact viruses that cause significant human diseases, including Nipah virus, Marburg virus and rabies virus. They also harbor many other viruses that are thought to have caused disease in humans after spillover into intermediate hosts, including SARS and MERS coronaviruses. As is usual with reservoir hosts, these viruses apparently cause little or no pathology in bats. Despite the importance of bats as reservoir hosts of zoonotic and potentially zoonotic agents, virtually nothing is known about the host/virus relationships; principally because few colonies of bats are available for experimental infections, a lack of reagents, methods and expertise for studying bat antiviral responses and immunology, and the difficulty of conducting meaningful field work. These challenges can be addressed, in part, with new technologies that are species-independent that can provide insight into the interactions of bats and viruses, which should clarify how the viruses persist in nature, and what risk factors might facilitate transmission to humans and livestock. PMID:25494448

  2. Immunology of Bats and Their Viruses: Challenges and Opportunities

    Directory of Open Access Journals (Sweden)

    Tony Schountz

    2014-12-01

    Full Text Available Bats are reservoir hosts of several high-impact viruses that cause significant human diseases, including Nipah virus, Marburg virus and rabies virus. They also harbor many other viruses that are thought to have caused disease in humans after spillover into intermediate hosts, including SARS and MERS coronaviruses. As is usual with reservoir hosts, these viruses apparently cause little or no pathology in bats. Despite the importance of bats as reservoir hosts of zoonotic and potentially zoonotic agents, virtually nothing is known about the host/virus relationships; principally because few colonies of bats are available for experimental infections, a lack of reagents, methods and expertise for studying bat antiviral responses and immunology, and the difficulty of conducting meaningful field work. These challenges can be addressed, in part, with new technologies that are species-independent that can provide insight into the interactions of bats and viruses, which should clarify how the viruses persist in nature, and what risk factors might facilitate transmission to humans and livestock.

  3. Immunology of bats and their viruses: challenges and opportunities.

    Science.gov (United States)

    Schountz, Tony

    2014-12-01

    Bats are reservoir hosts of several high-impact viruses that cause significant human diseases, including Nipah virus, Marburg virus and rabies virus. They also harbor many other viruses that are thought to have caused disease in humans after spillover into intermediate hosts, including SARS and MERS coronaviruses. As is usual with reservoir hosts, these viruses apparently cause little or no pathology in bats. Despite the importance of bats as reservoir hosts of zoonotic and potentially zoonotic agents, virtually nothing is known about the host/virus relationships; principally because few colonies of bats are available for experimental infections, a lack of reagents, methods and expertise for studying bat antiviral responses and immunology, and the difficulty of conducting meaningful field work. These challenges can be addressed, in part, with new technologies that are species-independent that can provide insight into the interactions of bats and viruses, which should clarify how the viruses persist in nature, and what risk factors might facilitate transmission to humans and livestock.

  4. Acute rhabdomyolysis and delayed pericardial effusion in an Italian patient with Ebola virus disease: a case report.

    Science.gov (United States)

    Nicastri, Emanuele; Brucato, Antonio; Petrosillo, Nicola; Biava, Gianluigi; Uyeki, Timothy M; Ippolito, Giuseppe

    2017-08-30

    During the 2013-2016 West Africa Ebola virus disease (EVD) epidemic, some EVD patients, mostly health care workers, were evacuated to Europe and the USA. In May 2015, a 37-year old male nurse contracted Ebola virus disease in Sierra Leone. After Ebola virus detection in plasma, he was medically-evacuated to Italy. At admission, rhabdomyolysis was clinically and laboratory-diagnosed and was treated with aggressive hydration, oral favipiravir and intravenous investigational monoclonal antibodies against Ebola virus. The recovery clinical phase was complicated by a febrile thrombocytopenic syndrome with pericardial effusion treated with corticosteroids for 10 days and indomethacin for 2 months. No evidence of recurrence is reported. A febrile thrombocytopenic syndrome with pericardial effusion during the recovery phase of EVD appears to be uncommon. Clinical improvement with corticosteroid treatment suggests that an immune-mediated mechanism contributed to the pericardial effusion.

  5. [The potential effects of endoplasmic reticulum stress on the apoptosis of myocardial cells from mice with heart failure induced by acute viral myocarditis caused by B 3 Coxsackie virus].

    Science.gov (United States)

    Liu, Lei; Wang, Hong-Jun; Xin, Qing; Zhou, Xiao-Min; Zhao, Ya-Jun; Huang, Xia; Zhao, Ming

    2014-09-01

    To explore the apoptotic pathway mediated by endoplasmic reticulum stress in the mouse myocardium with heart failure induced by acute viral myocarditis caused by B-3 Coxsackie virus. Forty BALB/c male mice were randomly divided into 2 groups (n = 20): the control group and the virus infection group. The BALB/c mouse myocarditis was induced by B-3 Coxsackie virus and the mouse behavior was observed conventionally. All the mice were sacrificed on day 7 and the changes of left ventricular pressure (LVP) and the rate of change of left ventricular pressure (LV dp/dt) were measured. The cardiomyocytic apoptosis was analyzed by TUNEL method and the mRNA expression level of endoplasmic reticulum haperones glucose-regulated protein (GRP)78 and GRP94 was detected by RT-PCR. (1) Compared with those of control group, the parameters of cardiac hemodynamics in the virus infection group were significantly decreased (P Coxsackie virus.

  6. Differential impact of respiratory syncytial virus and parainfluenza virus on the frequency of acute otitis media is explained by lower adaptive and innate immune responses in otitis-prone children.

    Science.gov (United States)

    Verhoeven, David; Xu, Qingfu; Pichichero, Michael E

    2014-08-01

    Acute otitis media (AOM) is a leading cause of bacterial pediatric infections associated with viral upper respiratory infections (URIs). We examined the differential impact of respiratory syncytial virus (RSV) and parainfluenza virus URIs on the frequency of AOM caused by Streptococcus pneumoniae (Spn) and nontypeable Haemophilus influenzae (NTHi) in stringently defined otitis-prone (sOP) and non-otitis-prone (NOP) children as a potential mechanism to explain increased susceptibility to AOM. Peripheral blood and nasal washes were obtained from sOP and NOP children (n = 309). Colonization events and antiviral responses consisting of total specific immunoglobulin G (IgG) responses, neutralizing antibody responses, and T-cell responses were determined. Isolated neutrophils were infected with varying multiplicities of infection of both viruses, and opsonophagocytosis potential was measured. A significant increase was found in frequency of AOM events caused by Spn and NTHi, with a concurrent RSV infection in sOP children. These results correlated with diminished total RSV-specific IgG, higher viral nasal burdens, and lower IgG neutralizing capacity. The sOP children had diminished T-cell responses to RSV that correlated with lower Toll-like receptor 3/7 transcript and decreased expression of HLA-DR on antigen-presenting cells. RSV interfered with the Spn phagocytic capacity of neutrophils in a dose-dependent manner. Parainfluenza virus infections did not differentially affect AOM events in sOP and NOP children. Lower innate and adaptive immune responses to RSV in sOP children may slow the kinetics of viral clearance from the nasopharynx and allow for viral interference with antibacterial immune responses, thus contributing to increased frequency of AOMs. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  7. Glycopeptide Antibiotics Potently Inhibit Cathepsin L in the Late Endosome/Lysosome and Block the Entry of Ebola Virus, Middle East Respiratory Syndrome Coronavirus (MERS-CoV), and Severe Acute Respiratory Syndrome Coronavirus (SARS-CoV)*

    Science.gov (United States)

    Zhou, Nan; Pan, Ting; Zhang, Junsong; Li, Qianwen; Zhang, Xue; Bai, Chuan; Huang, Feng; Peng, Tao; Zhang, Jianhua; Liu, Chao; Tao, Liang; Zhang, Hui

    2016-01-01

    Ebola virus infection can cause severe hemorrhagic fever with a high mortality in humans. The outbreaks of Ebola viruses in 2014 represented the most serious Ebola epidemics in history and greatly threatened public health worldwide. The development of additional effective anti-Ebola therapeutic agents is therefore quite urgent. In this study, via high throughput screening of Food and Drug Administration-approved drugs, we identified that teicoplanin, a glycopeptide antibiotic, potently prevents the entry of Ebola envelope pseudotyped viruses into the cytoplasm. Furthermore, teicoplanin also has an inhibitory effect on transcription- and replication-competent virus-like particles, with an IC50 as low as 330 nm. Comparative analysis further demonstrated that teicoplanin is able to block the entry of Middle East respiratory syndrome (MERS) and severe acute respiratory syndrome (SARS) envelope pseudotyped viruses as well. Teicoplanin derivatives such as dalbavancin, oritavancin, and telavancin can also inhibit the entry of Ebola, MERS, and SARS viruses. Mechanistic studies showed that teicoplanin blocks Ebola virus entry by specifically inhibiting the activity of cathepsin L, opening a novel avenue for the development of additional glycopeptides as potential inhibitors of cathepsin L-dependent viruses. Notably, given that teicoplanin has routinely been used in the clinic with low toxicity, our work provides a promising prospect for the prophylaxis and treatment of Ebola, MERS, and SARS virus infection. PMID:26953343

  8. Retinopathy in a patient with acute Epstein-Barr virus infection: follow-up analysis using spectral domain optical coherence tomography.

    Science.gov (United States)

    Weller, Julia M; Bergua, Antonio; Mardin, Christian Y

    2015-01-01

    To describe the clinical findings, diagnostics, and differential diagnosis in a patient with retinopathy in acute systemic Epstein-Barr virus (EBV) infection. Description of the clinical course of the EBV retinopathy was based on the medical record, photographs, and visual fields of the patient. Retinal morphology was visualized using spectral domain optical coherence tomography (Heidelberg Engineering), and fluorescein angiography. Multiple serologic tests were performed to exclude different infectious agents. A 30-year-old male patient presented with a focal scotoma in his right visual field. One week ago, he suffered from high fever, joint pain, neck stiffness, and hepatitis; 2 weeks later, he had returned from a trip to Malaysia. Visual acuity was 20/20 in both eyes. Fundoscopy showed a paravascular sharp-edged white lesion with a corresponding crescent-shaped retinal nerve fiber defect. Serology revealed high titers for EBV immunoglobulin M (IgM), but no EBV immunoglobulin G (IgG), indicating an acute infectious mononucleosis. Other reasons for noninfectious or infectious retinochoroiditis including tropical microorganisms could be excluded serologically and by imaging. Treatment with systemic acyclovir and prednisolone acetate eye drops was initiated leading to recovery of systemic and ocular findings. Acute systemic EBV infection can affect the retina leading to focal thickening of the inner retinal layers because of focal microinfarction (cotton-wool spot) or focal infectious infiltration. Spectral domain optical coherence tomography is capable of detecting changes in retinal morphology in such cases.

  9. Acute Acalculous Cholecystitis: A Rare Presentation of Primary Epstein-Barr Virus Infection in Adults—Case Report and Review of the Literature

    Directory of Open Access Journals (Sweden)

    Zuhal Yesilbag

    2017-01-01

    Full Text Available Primary Epstein-Barr virus (EBV infection is almost always a self-limited disease characterized by sore throat, fever, and lymphadenopathy. Hepatic involvement is usually characterized by mild elevations of aminotransferases and resolves spontaneously. Although isolated gallbladder wall thickness has been reported in these patients, acute acalculous cholecystitis is an atypical presentation of primary EBV infection. We presented a young women admitted with a 10-day history of fever, nausea, malaise who had jaundice and right upper quadrant tenderness on the physical examination. Based on diagnostic laboratory tests and abdominal ultrasonographic findings, cholestasis and acute acalculous cholecystitis were diagnosed. Serology performed for EBV revealed the acute EBV infection. Symptoms and clinical course gradually improved with the conservative therapy, and at the 1-month follow-up laboratory findings were normal. We reviewed 16 adult cases with EBV-associated AAC in the literature. Classic symptoms of EBV infection were not predominant and all cases experienced gastrointestinal symptoms. Only one patient underwent surgery and all other patients recovered with conservative therapy. The development of AAC should be kept in mind in patients with cholestatic hepatitis due to EBV infection to avoid unnecessary surgical therapy and overuse of antibiotics.

  10. Comparison of acute infection of calves exposed to a high-virulence or low-virulence bovine viral diarrhea virus or a HoBi-like virus

    Science.gov (United States)

    The objective of this research was to compare clinical presentation following acute infection of cattle with either a high virulence (HV) BVDV or a low virulence (LV) BVDV to clinical presentation following infection with a viral strain that belongs to an emerging species of pestivirus. The viral st...

  11. De Novo Herpes Simplex Virus VP16 Expression Gates a Dynamic Programmatic Transition and Sets the Latent/Lytic Balance during Acute Infection in Trigeminal Ganglia.

    Science.gov (United States)

    Sawtell, Nancy M; Thompson, Richard L

    2016-09-01

    The life long relationship between herpes simplex virus and its host hinges on the ability of the virus to aggressively replicate in epithelial cells at the site of infection and transport into the nervous system through axons innervating the infection site. Interaction between the virus and the sensory neuron represents a pivot point where largely unknown mechanisms lead to a latent or a lytic infection in the neuron. Regulation at this pivot point is critical for balancing two objectives, efficient widespread seeding of the nervous system and host survival. By combining genetic and in vivo in approaches, our studies reveal that the balance between latent and lytic programs is a process occurring early in the trigeminal ganglion. Unexpectedly, activation of the latent program precedes entry into the lytic program by 12 -14hrs. Importantly, at the individual neuronal level, the lytic program begins as a transition out of this acute stage latent program and this escape from the default latent program is regulated by de novo VP16 expression. Our findings support a model in which regulated de novo VP16 expression in the neuron mediates entry into the lytic cycle during the earliest stages of virus infection in vivo. These findings support the hypothesis that the loose association of VP16 with the viral tegument combined with sensory axon length and transport mechanisms serve to limit arrival of virion associated VP16 into neuronal nuclei favoring latency. Further, our findings point to specialized features of the VP16 promoter that control the de novo expression of VP16 in neurons and this regulation is a key component in setting the balance between lytic and latent infections in the nervous system.

  12. An evaluation of the emerging interventions against Respiratory Syncytial Virus (RSV-associated acute lower respiratory infections in children

    Directory of Open Access Journals (Sweden)

    Simões Eric AF

    2011-04-01

    Full Text Available Abstract Background Respiratory Syncytial Virus (RSV is the leading cause of acute lower respiratory infections (ALRI in children. It is estimated to cause approximately 33.8 million new episodes of ALRI in children annually, 96% of these occurring in developing countries. It is also estimated to result in about 53,000 to 199,000 deaths annually in young children. Currently there are several vaccine and immunoprophylaxis candidates against RSV in the developmental phase targeting active and passive immunization. Methods We used a modified CHNRI methodology for setting priorities in health research investments. This was done in two stages. In Stage I, we systematically reviewed the literature related to emerging vaccines against RSV relevant to 12 criteria of interest. In Stage II, we conducted an expert opinion exercise by inviting 20 experts (leading basic scientists, international public health researchers, international policy makers and representatives of pharmaceutical companies. The policy makers and industry representatives accepted our invitation on the condition of anonymity, due to the sensitive nature of their involvement in such exercises. They answered questions from the CHNRI framework and their “collective optimism” towards each criterion was documented on a scale from 0 to 100%. Results In the case of candidate vaccines for active immunization of infants against RSV, the experts expressed very low levels of optimism for low product cost, affordability and low cost of development; moderate levels of optimism regarding the criteria of answerability, likelihood of efficacy, deliverability, sustainability and acceptance to end users for the interventions; and high levels of optimism regarding impact on equity and acceptance to health workers. While considering the candidate vaccines targeting pregnant women, the panel expressed low levels of optimism for low product cost, affordability, answerability and low development cost

  13. An evaluation of the emerging interventions against Respiratory Syncytial Virus (RSV)-associated acute lower respiratory infections in children.

    Science.gov (United States)

    Nair, Harish; Verma, Vasundhara R; Theodoratou, Evropi; Zgaga, Lina; Huda, Tanvir; Simões, Eric A F; Wright, Peter F; Rudan, Igor; Campbell, Harry

    2011-04-13

    Respiratory Syncytial Virus (RSV) is the leading cause of acute lower respiratory infections (ALRI) in children. It is estimated to cause approximately 33.8 million new episodes of ALRI in children annually, 96% of these occurring in developing countries. It is also estimated to result in about 53,000 to 199,000 deaths annually in young children. Currently there are several vaccine and immunoprophylaxis candidates against RSV in the developmental phase targeting active and passive immunization. We used a modified CHNRI methodology for setting priorities in health research investments. This was done in two stages. In Stage I, we systematically reviewed the literature related to emerging vaccines against RSV relevant to 12 criteria of interest. In Stage II, we conducted an expert opinion exercise by inviting 20 experts (leading basic scientists, international public health researchers, international policy makers and representatives of pharmaceutical companies). The policy makers and industry representatives accepted our invitation on the condition of anonymity, due to the sensitive nature of their involvement in such exercises. They answered questions from the CHNRI framework and their "collective optimism" towards each criterion was documented on a scale from 0 to 100%. In the case of candidate vaccines for active immunization of infants against RSV, the experts expressed very low levels of optimism for low product cost, affordability and low cost of development; moderate levels of optimism regarding the criteria of answerability, likelihood of efficacy, deliverability, sustainability and acceptance to end users for the interventions; and high levels of optimism regarding impact on equity and acceptance to health workers. While considering the candidate vaccines targeting pregnant women, the panel expressed low levels of optimism for low product cost, affordability, answerability and low development cost; moderate levels of optimism for likelihood of efficacy

  14. Synthetic protocells interact with viral nanomachinery and inactivate pathogenic human virus.

    Directory of Open Access Journals (Sweden)

    Matteo Porotto

    Full Text Available We present a new antiviral strategy and research tool that could be applied to a wide range of enveloped viruses that infect human beings via membrane fusion. We test this strategy on two emerging zoonotic henipaviruses that cause fatal encephalitis in humans, Nipah (NiV and Hendra (HeV viruses. In the new approach, artificial cell-like particles (protocells presenting membrane receptors in a biomimetic manner were developed and found to attract and inactivate henipavirus envelope glycoprotein pseudovirus particles, preventing infection. The protocells do not accumulate virus during the inactivation process. The use of protocells that interact with, but do not accumulate, viruses may provide significant advantages over current antiviral drugs, and this general approach may have wide potential for antiviral development.

  15. Immune- and Nonimmune-Compartment-Specific Interferon Responses Are Critical Determinants of Herpes Simplex Virus-Induced Generalized Infections and Acute Liver Failure.

    Science.gov (United States)

    Parker, Zachary M; Pasieka, Tracy Jo; Parker, George A; Leib, David A

    2016-12-01

    The interferon (IFN) response to viral pathogens is critical for host survival. In humans and mouse models, defects in IFN responses can result in lethal herpes simplex virus 1 (HSV-1) infections, usually from encephalitis. Although rare, HSV-1 can also cause fulminant hepatic failure, which is often fatal. Although herpes simplex encephalitis has been extensively studied, HSV-1 generalized infections and subsequent acute liver failure are less well understood. We previously demonstrated that IFN-αβγR -/- mice are exquisitely susceptible to liver infection following corneal infection with HSV-1. In this study, we used bone marrow chimeras of IFN-αβγR -/- (AG129) and wild-type (WT; 129SvEv) mice to probe the underlying IFN-dependent mechanisms that control HSV-1 pathogenesis. After infection, WT mice with either IFN-αβγR -/- or WT marrow exhibited comparable survival, while IFN-αβγR -/- mice with WT marrow had a significant survival advantage over their counterparts with IFN-αβγR -/- marrow. Furthermore, using bioluminescent imaging to maximize data acquisition, we showed that the transfer of IFN-competent hematopoietic cells controlled HSV-1 replication and damage in the livers of IFN-αβγR -/- mice. Consistent with this, the inability of IFN-αβγR -/- immune cells to control liver infection in IFN-αβγR -/- mice manifested as profoundly elevated aspartate transaminase (AST) and alanine transaminase (ALT) levels, indicative of severe liver damage. In contrast, IFN-αβγR -/- mice receiving WT marrow exhibited only modest elevations of AST and ALT levels. These studies indicate that IFN responsiveness of the immune system is a major determinant of viral tropism and damage during visceral HSV infections. Herpes simplex virus 1 (HSV-1) infection is an incurable viral infection with the most significant morbidity and mortality occurring in neonates and patients with compromised immune systems. Severe pathologies from HSV include the blindness

  16. Schmallenberg Virus

    Indian Academy of Sciences (India)

    IAS Admin

    combat many infectious-disease-causing agents over the years. However, evolution is a continuous process ... newly emerging virus infection that poses threat to the livestock industries. In addition to describing the life ... are the Symptoms of Infection by SBV. The first clinical signs in adult animals are acute diarrhoea, a dip.

  17. Synchronous advanced pulmonary tuberculosis and acute virus myocarditis mimicked wegener granulomatosis in a 26-year-old man: A case report

    Directory of Open Access Journals (Sweden)

    Pešut Dragica P.

    2016-01-01

    Full Text Available Introduction. Tuberculosis patients are rarely asymptomatic. Acute virus myocarditis presents with a wide range of symptoms, from mild dyspnea or chest pain to cardiogenic shock and death. Case Outline. A 26-year-old Caucasian man non-smoker presented with one-week history of lower extremities’ swelling. The patient’s medical history also revealed a two-day episode of subfebrile temperature with scanty hemoptysis three weeks prior to admission. The episode had not provoked him to seek medical care. Physical examination revealed generalized oedema, and laboratory analysis showed signs of acute renal insufficiency. Enlarged heart and hilar shadows, bilateral massive cavitary pulmonary opacities and pleural effusion were found at chest radiography. Sputum smears were Mycobacteria negative on direct microscopy. Electrocardiogram changes and echocardiography were suggestive of acute myocarditis with dilated cardiomyopathy. IgM titer to adenovirus was positive. Under diuretics, angiotensin-converting-enzyme inhibitor, beta-blocker, antibiotics and bed rest, fast heart compensation and renal function repair were achieved. Radiographic pulmonary changes promptly regressed except for a cavity in the right upper lobe. Bronchial aspirate from the affected lobe was Mycobacteria positive on direct microscopy and culture positive for Mycobacterium tuberculosis. Standard anti-tuberculosis drug regimen led to recovery. Conclusion. In the unusual common existence of two diseases whose presentation initially mimicked Wegener’s granulomatosis, acute dilated cardiomyopathy contributed to pulmonary tuberculosis detection. To prevent diagnostic delay in tuberculosis, further efforts in population education are necessary together with continual medical education. [Projekat Ministarstva nauke Republike Srbije, br. 175095

  18. Dimeric architecture of the Hendra virus attachment glycoprotein: evidence for a conserved mode of assembly.

    Science.gov (United States)

    Bowden, Thomas A; Crispin, Max; Harvey, David J; Jones, E Yvonne; Stuart, David I

    2010-06-01

    Hendra virus is a negative-sense single-stranded RNA virus within the Paramyxoviridae family which, together with Nipah virus, forms the Henipavirus genus. Infection with bat-borne Hendra virus leads to a disease with high mortality rates in humans. We determined the crystal structure of the unliganded six-bladed beta-propeller domain and compared it to the previously reported structure of Hendra virus attachment glycoprotein (HeV-G) in complex with its cellular receptor, ephrin-B2. As observed for the related unliganded Nipah virus structure, there is plasticity in the Glu579-Pro590 and Lys236-Ala245 ephrin-binding loops prior to receptor engagement. These data reveal that henipaviral attachment glycoproteins undergo common structural transitions upon receptor binding and further define the structural template for antihenipaviral drug design. Our analysis also provides experimental evidence for a dimeric arrangement of HeV-G that exhibits striking similarity to those observed in crystal structures of related paramyxovirus receptor-binding glycoproteins. The biological relevance of this dimer is further supported by the positional analysis of glycosylation sites from across the paramyxoviruses. In HeV-G, the sites lie away from the putative dimer interface and remain accessible to alpha-mannosidase processing on oligomerization. We therefore propose that the overall mode of dimer assembly is conserved for all paramyxoviruses; however, while the geometry of dimerization is rather closely similar for those viruses that bind flexible glycan receptors, significant (up to 60 degrees ) and different reconfigurations of the subunit packing (associated with a significant decrease in the size of the dimer interface) have accompanied the independent switching to high-affinity protein receptor binding in Hendra and measles viruses.

  19. Treatment of Acute Viral Bronchiolitis

    OpenAIRE

    Eber, Ernst

    2011-01-01

    Acute viral bronchiolitis represents the most common lower respiratory tract infection in infants and young children and is associated with substantial morbidity and mortality. Respiratory syncytial virus is the most frequently identified virus, but many other viruses may also cause acute bronchiolitis. There is no common definition of acute viral bronchiolitis used internationally, and this may explain part of the confusion in the literature. Most children with bronchiolitis have a self limi...

  20. Analysis of the acute phase responses of Serum Amyloid A, Haptoglobin and Type 1 Interferon in cattle experimentally infected with foot-and-mouth disease virus serotype O

    DEFF Research Database (Denmark)

    Stenfeldt, Carolina; Heegaard, Peter M. H.; Stockmarr, Anders

    2011-01-01

    A series of challenge experiments were performed in order to investigate the acute phase responses to foot-and-mouth disease virus (FMDV) infection in cattle and possible implications for the development of persistently infected "carriers". The host response to infection was investigated through...... periods exceeding 28 days in order to determine the carrier-status of individual animals. The systemic host response to FMDV in infected animals was evaluated in comparison to similar measurements in sera from 6 mock-inoculated control animals.There was a significant increase in serum concentrations...... of both APPs and type 1 IFN in infected animals coinciding with the onset of viremia and clinical disease. The measured parameters declined to baseline levels within 21 days after inoculation, indicating that there was no systemically measurable inflammatory reaction related to the carrier state of FMD...

  1. Acute hepatitis B virus infection with simultaneous high HBsAg and high anti-HBs signals in a previously HBV vaccinated HIV-1 positive patient.

    Science.gov (United States)

    van Dommelen, Laura; Verbon, Annelies; van Doorn, H Rogier; Goossens, Valère J

    2010-03-01

    We present a case of a clinical manifest hepatitis B virus infection and a potentially misleading HBV serological profile in an HIV-1 positive patient despite previous HBV vaccination. The patient presented with an acute hepatitis B and there was no indication of chronic HBV infection or the presence of a mutation in the 'a' determinant. Remarkably, simultaneously with high HBV surface antigen and HBV viral load, high anti-HBs antibodies were present. If, due to previous HBV vaccination only anti-HBs was tested in this patient, the result of the high anti-HBs antibodies could be very misleading and offering a false sense of security. Our findings contribute to the ongoing discussion on how to assess HBV specific immunological memory and determining the role of HBV booster vaccinations in immunocompromised individuals.

  2. A novel multiplex real-time PCR assay for the concurrent detection of hepatitis A, B and C viruses in patients with acute hepatitis.

    Science.gov (United States)

    Park, Yongjung; Kim, Beom Seok; Choi, Kyu Hun; Shin, Dong Ho; Lee, Mi Jung; Cho, Yonggeun; Kim, Hyon-Suk

    2012-01-01

    A novel multiplex real-time PCR assay for concurrent detection of hepatitis viruses was evaluated for its clinical performance in screening patients with acute hepatitis. A total of 648 serum samples were collected from patients with acute symptoms of hepatitis. Concurrent detection of nucleic acids of HAV, HBV and HCV was performed using the Magicplex™ HepaTrio Real-time Detection test. Serum nucleic acid levels of HBV and HCV were also quantified by the Cobas® AmpliPrep/Cobas® TaqMan® (CAP/CTM) HBV and HCV tests. Patients' medical records were also reviewed. Concordance rates between the results from the HepaTrio and the CAP/CTM tests for the detection of HBV and HCV were 94.9% (k = 0.88) and 99.2% (k = 0.98), respectively. The cycle threshold values with the HepaTrio test were also correlated well with the levels of HBV DNA (r = -0.9230) and HCV RNA (r = -0.8458). The sensitivity and specificity of the HepaTrio test were 93.8% and 98.2%, respectively, for detecting HBV infection, and 99.1% and 100.0%, respectively, for HCV infection. For the HepaTrio test, 21 (3.2%) cases were positive for both HBV and HCV. Among the positive cases, 6 (0.9%) were true coinfections. This test also detected 18 (2.8%) HAV positives. The HepaTrio test demonstrated good clinical performance and produced results that agreed well with those of the CAP/CTM assays, especially for the detection of HCV. This assay was also able to detect HAV RNA from anti-HAV IgM-positive individuals. Therefore, this new multiplex PCR assay could be useful for the concurrent detection of the three hepatitis viruses.

  3. A novel multiplex real-time PCR assay for the concurrent detection of hepatitis A, B and C viruses in patients with acute hepatitis.

    Directory of Open Access Journals (Sweden)

    Yongjung Park

    Full Text Available A novel multiplex real-time PCR assay for concurrent detection of hepatitis viruses was evaluated for its clinical performance in screening patients with acute hepatitis. A total of 648 serum samples were collected from patients with acute symptoms of hepatitis. Concurrent detection of nucleic acids of HAV, HBV and HCV was performed using the Magicplex™ HepaTrio Real-time Detection test. Serum nucleic acid levels of HBV and HCV were also quantified by the Cobas® AmpliPrep/Cobas® TaqMan® (CAP/CTM HBV and HCV tests. Patients' medical records were also reviewed. Concordance rates between the results from the HepaTrio and the CAP/CTM tests for the detection of HBV and HCV were 94.9% (k = 0.88 and 99.2% (k = 0.98, respectively. The cycle threshold values with the HepaTrio test were also correlated well with the levels of HBV DNA (r = -0.9230 and HCV RNA (r = -0.8458. The sensitivity and specificity of the HepaTrio test were 93.8% and 98.2%, respectively, for detecting HBV infection, and 99.1% and 100.0%, respectively, for HCV infection. For the HepaTrio test, 21 (3.2% cases were positive for both HBV and HCV. Among the positive cases, 6 (0.9% were true coinfections. This test also detected 18 (2.8% HAV positives. The HepaTrio test demonstrated good clinical performance and produced results that agreed well with those of the CAP/CTM assays, especially for the detection of HCV. This assay was also able to detect HAV RNA from anti-HAV IgM-positive individuals. Therefore, this new multiplex PCR assay could be useful for the concurrent detection of the three hepatitis viruses.

  4. Lymphotropism and host responses during acute wild-type canine distemper virus infections in a highly susceptible natural host

    DEFF Research Database (Denmark)

    Nielsen, Line; Søgaard, Mette; Jensen, Trine Hammer

    2009-01-01

    The mechanisms behind the in vivo virulence of immunosuppressive wild-type Morbillivirus infections are still not fully understood. To investigate lymphotropism and host responses we have selected the natural host model of canine distemper virus (CDV) infection in mink. This model displays...

  5. Five cases of acute Zika virus infection in French women of reproductive age returning from Central and South America.

    Science.gov (United States)

    Penot, P; Balavoine, S; Leplatois, A; Brichler, S; Leparc-Goffart, I; Alloui, A-C; Flusin, O; Guilleminot, J; Amellou, M; Molina, J-M

    2017-08-01

    The favorable season for Aedes albopictus circulation has started in Europe and may lead to autochthonous transmission of Zika virus. Health care providers should be familiar with evocative clinical presentations and able to give updated information to women of reproductive age infected by Zika virus. We report five laboratory-confirmed Zika virus infections imported to metropolitan France from Central and South America between January and April, 2016. The five young women were not connected and not pregnant; common presentation combined a rash with persistent arthralgia. Zika virus was identified by RT-PCR from serum or urines, between two and eight days after the onset of the symptoms. As the duration of potential materno-foetal infectivity is still unknown, we were unable to answer with certitude to the patients' questions about the time interval to respect before attempting a pregnancy: one of them became pregnant one month after the diagnosis. Copyright © 2016 Société Nationale Française de Médecine Interne (SNFMI). Published by Elsevier SAS. All rights reserved.

  6. Detection of Immune-Complex Dissociated Nonstructural-1 (NS-1) Antigen in Patients with Acute Dengue Virus Infections

    NARCIS (Netherlands)

    P. Koraka (Penelope); C.P. Burghoorn-Maas; A. Falconar; T.E. Setiati (Tatty); K. Djamiatun; J. Groen (Jan); A.D.M.E. Osterhaus (Albert)

    2003-01-01

    textabstractAccurate and timely diagnosis of dengue virus (DEN) infections is essential for the differential diagnosis of patients with febrile illness and hemorrhagic fever. In the present study, the diagnostic value of a newly developed immune-complex dissociated nonstructural-1 (NS-1) antigen dot

  7. Induction of anti-viral genes during acute infection with Viral hemorrhagic septicemia virus (VHSV) genogroup IVa in Pacific herring (Clupea pallasii)

    Science.gov (United States)

    Hansen, John D.; Woodson, James C.; Hershberger, Paul K.; Grady, Courtney; Gregg, Jacob L.; Purcell, Maureen K.

    2012-01-01

    Infection with the aquatic rhabdovirus Viral hemorrhagic septicemia virus (VHSV) genogroup IVa results in high mortality in Pacific herring (Clupea pallasii) and is hypothesized to be a potential limiting factor for herring recovery. To investigate anti-viral immunity in the Pacific herring, four immune response genes were identified: the myxovirus resistance (Clpa-Mx), a major histocompatibility complex IB (named Clpa-UAA.001), the inducible immunoproteosome subunit 9 (Clpa-PSMB9) and the neutrophil chemotactic factor (Clpa-LECT2). Reverse transcriptase quantitative PCR (RT-qPCR) assays were developed based on these gene sequences to investigate the host immune response to acute VHSV infection following both injection and immersion challenge. Virus levels were measured by both plaque assay and RT-qPCR and peaked at day 6 during the 10-day exposure period for both groups of fish. The interferon stimulated genes (Clpa-Mx, −UAA.001, and −PSMB9) were significantly up-regulated in response to VHSV infection at both 6 and 10 days post-infection in both spleen and fin. Results from this study indicate that Pacific herring mount a robust, early antiviral response in both fin and spleen tissues. The immunological tools developed in this study will be useful for future studies to investigate antiviral immunity in Pacific herring.

  8. Large-scale field application of RNAi technology reducing Israeli acute paralysis virus disease in honey bees (Apis mellifera, Hymenoptera: Apidae.

    Directory of Open Access Journals (Sweden)

    Wayne Hunter

    Full Text Available The importance of honey bees to the world economy far surpasses their contribution in terms of honey production; they are responsible for up to 30% of the world's food production through pollination of crops. Since fall 2006, honey bees in the U.S. have faced a serious population decline, due in part to a phenomenon called Colony Collapse Disorder (CCD, which is a disease syndrome that is likely caused by several factors. Data from an initial study in which investigators compared pathogens in honey bees affected by CCD suggested a putative role for Israeli Acute Paralysis Virus, IAPV. This is a single stranded RNA virus with no DNA stage placed taxonomically within the family Dicistroviridae. Although subsequent studies have failed to find IAPV in all CCD diagnosed colonies, IAPV has been shown to cause honey bee mortality. RNA interference technology (RNAi has been used successfully to silence endogenous insect (including honey bee genes both by injection and feeding. Moreover, RNAi was shown to prevent bees from succumbing to infection from IAPV under laboratory conditions. In the current study IAPV specific homologous dsRNA was used in the field, under natural beekeeping conditions in order to prevent mortality and improve the overall health of bees infected with IAPV. This controlled study included a total of 160 honey bee hives in two discrete climates, seasons and geographical locations (Florida and Pennsylvania. To our knowledge, this is the first successful large-scale real world use of RNAi for disease control.

  9. Large-scale field application of RNAi technology reducing Israeli acute paralysis virus disease in honey bees (Apis mellifera, Hymenoptera: Apidae).

    Science.gov (United States)

    Hunter, Wayne; Ellis, James; Vanengelsdorp, Dennis; Hayes, Jerry; Westervelt, Dave; Glick, Eitan; Williams, Michael; Sela, Ilan; Maori, Eyal; Pettis, Jeffery; Cox-Foster, Diana; Paldi, Nitzan

    2010-12-23

    The importance of honey bees to the world economy far surpasses their contribution in terms of honey production; they are responsible for up to 30% of the world's food production through pollination of crops. Since fall 2006, honey bees in the U.S. have faced a serious population decline, due in part to a phenomenon called Colony Collapse Disorder (CCD), which is a disease syndrome that is likely caused by several factors. Data from an initial study in which investigators compared pathogens in honey bees affected by CCD suggested a putative role for Israeli Acute Paralysis Virus, IAPV. This is a single stranded RNA virus with no DNA stage placed taxonomically within the family Dicistroviridae. Although subsequent studies have failed to find IAPV in all CCD diagnosed colonies, IAPV has been shown to cause honey bee mortality. RNA interference technology (RNAi) has been used successfully to silence endogenous insect (including honey bee) genes both by injection and feeding. Moreover, RNAi was shown to prevent bees from succumbing to infection from IAPV under laboratory conditions. In the current study IAPV specific homologous dsRNA was used in the field, under natural beekeeping conditions in order to prevent mortality and improve the overall health of bees infected with IAPV. This controlled study included a total of 160 honey bee hives in two discrete climates, seasons and geographical locations (Florida and Pennsylvania). To our knowledge, this is the first successful large-scale real world use of RNAi for disease control.

  10. Two distinct subtypes of hepatitis B virus-related acute liver failure are separable by quantitative serum immunoglobulin M anti-hepatitis B core antibody and hepatitis B virus DNA levels

    DEFF Research Database (Denmark)

    Dao, Doan Y; Hynan, Linda S; Yuan, He-Jun

    2012-01-01

    Hepatitis B virus (HBV)-related acute liver failure (HBV-ALF) may occur after acute HBV infection (AHBV-ALF) or during an exacerbation of chronic HBV infection (CHBV-ALF). Clinical differentiation of the two is often difficult if a previous history of HBV is not available. Quantitative measurements...... of immunoglobulin M (IgM) anti-hepatitis B core antibody (anti-HBc) titers and of HBV viral loads (VLs) might allow the separation of AHBV-ALF from CHBV-ALF. Of 1,602 patients with ALF, 60 met clinical criteria for AHBV-ALF and 27 for CHBV-ALF. Sera were available on 47 and 23 patients, respectively. A quantitative...... immunoassay was used to determine IgM anti-HBc levels, and real-time polymerase chain reaction (rtPCR) was used to determine HBV VLs. AHBV-ALFs had much higher IgM anti-HBc titers than CHBV-ALFs (signal-to-noise [S/N] ratio median: 88.5; range, 0-1,120 versus 1.3, 0-750; P

  11. Roles of p38 MAPK in the regulation of the inflammatory response to swine influenza virus-induced acute lung injury in mice.

    Science.gov (United States)

    Wei, D; Huang, Z H; Zhang, R H; Wang, C L; Xu, M J; Liu, B J; Wang, G H; Xu, T

    2014-01-01

    Swine influenza virus (SIV), one of the most important zoonotic agents, is associated with major public health concerns. The current study was conducted to investigate the role of p38 mitogen-activated protein kinase (p38 MAPK) in the regulation of the inflammatory response to acute lung injury (ALI) induced by SIV of H9N2 subtype (H9N2-SIV) in mice. For this purpose, BALB/c mice were intranasally infected with 20 LD(50) of H9N2-SIV (infected group), while non-infected mice served as control (control group). To assess the effect of p38 MAPK, its specific inhibitor SB203580 was employed followed by SIV infection (SB group). At various times after infection, mouse lungs were subjected to pathological and histological observations and detection of inflammatory cytokines tumor necrosis factor α (TNF)-α, interleukin (IL)-1β, IL-6, and IL-10 and phosphorylated p38 MAPK. The obtained results showed obvious inflammatory responses, injury and raised levels of inflammatory cytokines and phosphorylated p38 MAPK in the lungs of virus-infected mice. In the mice inoculated with the virus alone, the level of phosphorylated p38 MAPK increased from day 2 and peaked at day 6 post infection (p.i.). However, SB203580 caused lower increases in inflammatory cytokines and phosphorylated p38 MAPK and a milder lung injury. These findings indicate that the activation of p38 MAPK upregulated the inflammatory responses to H9N2-SIV-induced ALI, increased its severity and promoted the production of inflammatory cytokines.

  12. Usefulness of Ct value in acute respiratory infections caused by respiratory syncytial virus A and B and influenza virus A (H1N1)pdm09, A (H3N2) and B.

    Science.gov (United States)

    Reina, Jordi; Morales, Carmen; Busquets, María; Norte, Cristina

    2017-06-07

    Acute respiratory infections of viral cause are very frequent entities. The difficulty in evaluating the detection of a virus in these entities could be solved by determining the viral load. A prospective study on the mean Ct value (cycle threshold value) detected against RSV-A, RSV-B and influenza A (H1N1)pdm09, A (H3N2) and B viruses in patients of different origin and age was performed. Detection was performed using a commercial molecular amplification (RT-PCR) technique. Different mean Ct values were detected for each virus. In RSV infections, no differences were observed between those caused by RSV-A or RSV-B in children. Depending on the patient's age, the only statistical significance was observed in those included in the 0-4 month groups for RSV-A and this group and the 5-12 months group for RSV-B (higher values). A lower viral load was detected in adult patients than in paediatric patients. In influenza infections, no statistical significance was observed in the mean values detected in patients from the Red Centinela («sentinel network», a Spanish network of doctors aimed at research and surveillance of diseases), those diagnosed in the adult emergency room or in hospital admissions. In the adult patients admitted to the ICU, only a slightly lower mean value was observed in those infected with influenza A (H1N1)pdm09, but without statistical significance. There were no patients admitted to the ICU with influenza B infection. The detection of viral load could be a good tool for the evaluation, monitoring and prognosis of acute viral respiratory infections. With the exception of those caused by RSV, no significant differences were observed in influenza infections except in younger paediatric patients. Copyright © 2017 Elsevier España, S.L.U. and Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

  13. Volatile Organic Compound Gamma-Butyrolactone Released upon Herpes Simplex Virus Type -1 Acute Infection Modulated Membrane Potential and Repressed Viral Infection in Human Neuron-Like Cells.

    Science.gov (United States)

    Rochford, Kevin; Chen, Feng; Waguespack, Yan; Figliozzi, Robert W; Kharel, Madan K; Zhang, Qiaojuan; Martin-Caraballo, Miguel; Hsia, S Victor

    2016-01-01

    Herpes Simplex Virus Type -1 (HSV-1) infections can cause serious complications such as keratitis and encephalitis. The goal of this study was to identify any changes in the concentrations of volatile organic compounds (VOCs) produced during HSV-1 infection of epithelial cells that could potentially be used as an indicator of a response to stress. An additional objective was to study if any VOCs released from acute epithelial infection may influence subsequent neuronal infection to facilitate latency. To investigate these hypotheses, Vero cells were infected with HSV-1 and the emission of VOCs was analyzed using two-dimensional gas chromatograph/mass spectrometry (2D GC/MS). It was observed that the concentrations of gamma-butyrolactone (GBL) in particular changed significantly after a 24-hour infection. Since HSV-1 may establish latency in neurons after the acute infection, GBL was tested to determine if it exerts neuronal regulation of infection. The results indicated that GBL altered the resting membrane potential of differentiated LNCaP cells and promoted a non-permissive state of HSV-1 infection by repressing viral replication. These observations may provide useful clues towards understanding the complex signaling pathways that occur during the HSV-1 primary infection and establishment of viral latency.

  14. Chronic but not acute virus infection induces sustained expansion of myeloid suppressor cell numbers that inhibit viral-specific T cell immunity.

    Science.gov (United States)

    Norris, Brian A; Uebelhoer, Luke S; Nakaya, Helder I; Price, Aryn A; Grakoui, Arash; Pulendran, Bali

    2013-02-21

    Resolution of acute and chronic viral infections requires activation of innate cells to initiate and maintain adaptive immune responses. Here we report that infection with acute Armstrong (ARM) or chronic Clone 13 (C13) strains of lymphocytic choriomeningitis virus (LCMV) led to two distinct phases of innate immune response. During the first 72 hr of infection, dendritic cells upregulated activation markers and stimulated antiviral CD8(+) T cells, independent of viral strain. Seven days after infection, there was an increase in Ly6C(hi) monocytic and Gr-1(hi) neutrophilic cells in lymphoid organs and blood. This expansion in cell numbers was enhanced and sustained in C13 infection, whereas it occurred only transiently with ARM infection. These cells resembled myeloid-derived suppressor cells and potently suppressed T cell proliferation. The reduction of monocytic cells in Ccr2(-/-) mice or after Gr-1 antibody depletion enhanced antiviral T cell function. Thus, innate cells have an important immunomodulatory role throughout chronic infection. Copyright © 2013 Elsevier Inc. All rights reserved.

  15. Vγ4+γδT Cells Aggravate Severe H1N1 Influenza Virus Infection-Induced Acute Pulmonary Immunopathological Injury via Secreting Interleukin-17A

    Directory of Open Access Journals (Sweden)

    Chunxue Xue

    2017-08-01

    Full Text Available The influenza A (H1N1 pdm09 virus remains a critical global health concern and causes high levels of morbidity and mortality. Severe acute lung injury (ALI and acute respiratory distress syndrome (ARDS are the major outcomes among severely infected patients. Our previous study found that interleukin (IL-17A production by humans or mice infected with influenza A (H1N1 pdm09 substantially contributes to ALI and subsequent morbidity and mortality. However, the cell types responsible for IL-17A production during the early stage of severe influenza A (H1N1 pdm09 infection remained unknown. In this study, a mouse model of severe influenza A (H1N1 pdm09 infection was established. Our results show that, in the lungs of infected mice, the percentage of γδT cells, but not the percentages of CD4+Th and CD8+Tc cells, gradually increased and peaked at 3 days post-infection (dpi. Further analysis revealed that the Vγ4+γδT subset, but not the Vγ1+γδT subset, was significantly increased among the γδT cells. At 3 dpi, the virus induced significant increases in IL-17A in the bronchoalveolar lavage fluid (BALF and serum. IL-17A was predominantly secreted by γδT cells (especially the Vγ4+γδT subset, but not CD4+Th and CD8+Tc cells at the early stage of infection, and IL-1β and/or IL-23 were sufficient to induce IL-17A production by γδT cells. In addition to secreting IL-17A, γδT cells secreted interferon (IFN-γ and expressed both an activation-associated molecule, natural killer group 2, member D (NKG2D, and an apoptosis-associated molecule, FasL. Depletion of γδT cells or the Vγ4+γδT subset significantly rescued the virus-induced weight loss and improved the survival rate by decreasing IL-17A secretion and reducing immunopathological injury. This study demonstrated that, by secreting IL-17A, lung Vγ4+γδT cells, at least, in part mediated influenza A (H1N1 pdm09-induced immunopathological injury. This mechanism might serve as a

  16. Heliox delivered by high flow nasal cannula improves oxygenation in infants with respiratory syncytial virus acute bronchiolitis

    Directory of Open Access Journals (Sweden)

    Wael Seliem

    2018-01-01

    Conclusion: Transient improvement of oxygenation in infants with RSV acute bronchiolitis during the initial phase of the therapy is associated with heliox when provided with HFNC, may provide a precious time for other therapeutic agents to work or for the disease to resolve naturally, avoiding other aggressive interventions.

  17. A Mathematical Model of the Honeybee-Varroa destructor-Acute Bee Paralysis Virus System with Seasonal Effects.

    Science.gov (United States)

    Ratti, Vardayani; Kevan, Peter G; Eberl, Hermann J

    2015-08-01

    A mathematical model for the honeybee-varroa mite-ABPV system is proposed in terms of four differential equations for the: infected and uninfected bees in the colony, number of mites overall, and of mites carrying the virus. To account for seasonal variability, all parameters are time periodic. We obtain linearized stability conditions for the disease-free periodic solutions. Numerically, we illustrate that, for appropriate parameters, mites can establish themselves in colonies that are not treated with varroacides, leading to colonies with slightly reduced number of bees. If some of these mites carry the virus, however, the colony might fail suddenly after several years without a noticeable sign of stress leading up to the failure. The immediate cause of failure is that at the end of fall, colonies are not strong enough to survive the winter in viable numbers. We investigate the effect of the initial disease infestation on collapse time, and how varroacide treatment affects long-term behavior. We find that to control the virus epidemic, the mites as disease vector should be controlled.

  18. [Mechanisms of viral emergence and interspecies transmission: the exemple of simian foamy viruses in Central Africa].

    Science.gov (United States)

    Gessain, Antoine

    2013-12-01

    A large proportion of viral pathogens that have emerged during the last decades in humans are considered to have originated from various animal species. This is well exemplified by several recent epidemics such as those of Nipah, Severe Acute Respiratory Syndrome, Avian flu, Ebola, Monkeypox, and Hantaviruses. After the initial interspecies transmission per se, the viruses can disseminate into the human population through various and distinct mechanisms. Some of them are well characterized and understood, thus allowing a certain level of risk control and prevention. Surprisingly and in contrast, the initial steps that lead to the emergence of several viruses, and of their associated diseases, remain still poorly understood. Epidemiological field studies conducted in certain specific high-risk populations are thus necessary to obtain new insights into the early events of this emergence process. Human infections by simian viruses represent increasing public health concerns. Indeed, by virtue of their genetic andphysiological similarities, non-human primates (NHPs) are considered to be likely the sources of viruses that can infect humans and thus may pose a significant threat to human population. This is well illustrated by retroviruses, which have the ability to cross species, adapt to a new host and sometimes spread within these new species. Sequence comparison and phylogenetic studies have thus clearly showed that the emergence of human immunodeficiency virus type 1 (HIV-1) and HIV-2 in humans have resulted from several independent interspecies transmissions of different SIV types from Chimpanzees and African monkeys (including sooty mangabeys), respectively, probably during the first part of the last century. The situation for Human T cell Lymphotropic virus type 1 (HTLV-1) is, for certain aspects, quite comparable. Indeed, the origin of most HTLV-1 subtypes appears to be linked to interspecies transmission between STLV-1-infected monkeys and humans, followed by

  19. Molecular point-of-care testing for respiratory viruses versus routine clinical care in adults with acute respiratory illness presenting to secondary care: a pragmatic randomised controlled trial protocol (ResPOC).

    Science.gov (United States)

    Brendish, Nathan J; Malachira, Ahalya K; Clark, Tristan W

    2017-02-06

    Respiratory viruses are associated with a huge socio-economic burden and are responsible for a large proportion of acute respiratory illness in hospitalised adults. Laboratory PCR is accurate but takes at least 24 h to generate a result to clinicians and antigen-based point-of-care tests (POCT) lack sensitivity. Rapid molecular platforms, such as the FilmArray Respiratory Panel, have equivalent diagnostic accuracy to laboratory PCR and can generate a result in 1 h making them deployable as POCT. Molecular point-of-care testing for respiratory viruses in hospital has the potential to improve the detection rate of respiratory viruses, improve the use of influenza antivirals and reduce unnecessary antibiotic use, but high quality randomised trials with clinically relevant endpoints are needed. The ResPOC study is a pragmatic randomised controlled trial of molecular point-of-care testing for respiratory viruses in adults with acute respiratory illness presenting to a large teaching hospital in the United Kingdom. Eligible participants are adults presenting with acute respiratory illness to the emergency department or the acute medicine unit. Participants are allocated 1:1 by internet-based randomisation service to either the intervention of a nose and throat swab analysed immediately on the FilmArray Respiratory Panel as a POCT or receive routine clinical care. The primary outcome is the proportion of patients treated with antibiotics. Secondary outcomes include turnaround time, virus detection, neuraminidase inhibitor use, length of hospital stay and side room use. Analysis of the primary outcome will be by intention-to-treat and all enrolled participants will be included in safety analysis. Multiple novel molecular POCT platforms for infections including respiratory viruses have been developed and licensed in the last few years and many more are in development but the evidence base for clinical benefit above standard practice is minimal. This randomised controlled

  20. Insights into the coiled-coil organization of the Hendra virus phosphoprotein from combined biochemical and SAXS studies.

    Science.gov (United States)

    Beltrandi, Matilde; Blocquel, David; Erales, Jenny; Barbier, Pascale; Cavalli, Andrea; Longhi, Sonia

    2015-03-01

    Nipah and Hendra viruses are recently emerged paramyxoviruses belonging to the Henipavirus genus. The Henipavirus phosphoprotein (P) consists of a large intrinsically disordered domain and a C-terminal domain (PCT) containing alternating disordered and ordered regions. Among these latter is the P multimerization domain (PMD). Using biochemical, analytical ultracentrifugation and small-angle X-ray scattering (SAXS) studies, we show that Hendra virus (HeV) PMD forms an elongated coiled-coil homotrimer in solution, in agreement with our previous findings on Nipah virus (NiV) PMD. However, the orientation of the N-terminal region differs from that observed in solution for NiV PMD, consistent with the ability of this region to adopt different conformations. SAXS studies provided evidence for a trimeric organization also in the case of PCT, thus extending and strengthening our findings on PMD. The present results are discussed in light of conflicting reports in the literature pointing to a tetrameric organization of paramyxoviral P proteins. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. The role of influenza, RSV and other common respiratory viruses in severe acute respiratory infections and influenza-like illness in a population with a high HIV sero-prevalence, South Africa 2012-2015.

    Science.gov (United States)

    Pretorius, Marthi A; Tempia, Stefano; Walaza, Sibongile; Cohen, Adam L; Moyes, Jocelyn; Variava, Ebrahim; Dawood, Halima; Seleka, Mpho; Hellferscee, Orienka; Treurnicht, Florette; Cohen, Cheryl; Venter, Marietjie

    2016-02-01

    Viruses detected in patients with acute respiratory infections may be the cause of illness or asymptomatic shedding. To estimate the attributable fraction (AF) and the detection rate attributable to illness for each of the different respiratory viruses We compared the prevalence of 10 common respiratory viruses (influenza A and B viruses, parainfluenza virus 1-3; respiratory syncytial virus (RSV); adenovirus, rhinovirus, human metapneumovirus (hMPV) and enterovirus) in both HIV positive and negative patients hospitalized with severe acute respiratory illness (SARI), outpatients with influenza-like illness (ILI), and control subjects who did not report any febrile, respiratory or gastrointestinal illness during 2012-2015 in South Africa. We enrolled 1959 SARI, 3784 ILI and 1793 controls with a HIV sero-prevalence of 26%, 30% and 43%, respectively. Influenza virus (AF: 86.3%; 95%CI: 77.7-91.6%), hMPV (AF: 85.6%; 95%CI: 72.0-92.6%), and RSV (AF: 83.7%; 95%CI: 77.5-88.2%) infections were associated with severe disease., while rhinovirus (AF: 46.9%; 95%CI: 37.6-56.5%) and adenovirus (AF: 36.4%; 95%CI: 20.6-49.0%) were only moderately associated. Influenza, RSV and hMPV can be considered pathogens if detected in ILI and SARI while rhinovirus and adenovirus were commonly identified in controls suggesting that they may cause only a proportion of clinical disease observed in positive patients. Nonetheless, they may be important contributors to disease. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Acute Pancreatitis in acute viral hepatitis

    Directory of Open Access Journals (Sweden)

    S K.C.

    2011-03-01

    Full Text Available Introduction: The association of acute viral hepatitis and acute pancreatitis is well described. This study was conducted to find out the frequency of pancreatic involvement in acute viral hepatitis in the Nepalese population. Methods: Consecutive patients of acute viral hepatitis presenting with severe abdominal pain between January 2005 and April 2010 were studied. Patients with history of significant alcohol consumption and gall stones were excluded. Acute viral hepatitis was diagnosed by clinical examination, liver function test, ultrasound examination and confirmed by viral serology. Pancreatitis was diagnosed by clinical presentation, biochemistry, ultrasound examination and CT scan. Results: Severe abdominal pain was present in 38 of 382 serologically-confirmed acute viral hepatitis patients. Twenty five patients were diagnosed to have acute pancreatitis. The pancreatitis was mild in 14 and severe in 11 patients. The etiology of pancreatitis was hepatitis E virus in 18 and hepatitis A virus in 7 patients. Two patients died of complications secondary to shock. The remaining patients recovered from both pancreatitis and hepatitis on conservative treatment. Conclusions: Acute pancreatitis occurred in 6.5 % of patients with acute viral hepatitis. Cholelithiasis and gastric ulcers are the other causes of severe abdominal pain. The majority of the patients recover with conservative management. Keywords: acute viral hepatitis, acute pancreatitis, pain abdomen, hepatitis E, hepatitis A, endemic zone

  3. Possibility of using combined treatment of processing and ionizing radiation to eliminate contaminated viruses from non-screened donor of tissue allografts

    International Nuclear Information System (INIS)

    Nazly Hilmy; Paramita Pandansari

    2008-01-01

    Full text: New emerging and re- emerging infectious diseases caused by viruses are outbreak and re- outbreak around the world. Most of the viruses come from animals ( zoonoses) and jump to human beings ( host jumping ) such as corona virus ( SARS), HIV, bird flu/ Avian flu H5N1, hepatitis viruses, Dengue fever virus, West Nile virus/WNV, Hantavirus, Marburg haemorrhagic fever virus, Hendra virus, Nipah virus etc. Transmission of those diseases through transplantation of contaminated tissue allograft to recipient can happened if the donor could not be screened properly. The donor can be well screened from some of those viruses such as HIV, hepatitis viruses and WNV. Processing of tissue allografts by pasteurization, washing and soaking in H 2 O 2 and soap can eliminate contaminated viruses to a certain amount, have been reported by several authors. Viruses are very small microbes, they have DNA/RNA, resistant to radiation but to a certain degree they can be well eliminated by radiation. Their D10 - values vary from 4 to 13 kGy. This paper discribes briefly the possibility of using combined treatment of processing, lyophilization and sterilisation by radiation to overcome problems of non screened donor from some contaminated viruses. (Author)

  4. Underutilization of aspirin in people living with human immunodeficiency virus at increased risk for acute myocardial infarction: Systematic review and meta-analysis

    Directory of Open Access Journals (Sweden)

    Stella Pak

    2017-01-01

    Full Text Available Context: With the increased availability of potent combination antiretroviral therapies, the life expectancy of people living with human immunodeficiency virus (PLHIV has greatly increased. This rapid improvement in lifespan has served as a catalyst for a paradigm shift in human immunodeficiency virus (HIV care. The focus of HIV care models has transitioned from the sole treatment of acute opportunistic infections to comprehensive management of chronic diseases, such as cardiovascular disease (CVD. Multiple studies have demonstrated that PLHIV are 50% more likely to develop acute myocardial infarction (AMI, compared to the general population. Cardiovascular risk prevention is becoming an essential component of the overarching HIV treatment plan. Aims: This meta-analysis aims to compare the rate of aspirin use for AMI prevention in indicated patients between PLHIV and general population. Methods: PubMed, EMBASE, Web of Science, Cochrane Library, CINAHL, and MEDLINE databases were used to identify observational cohort trials. Studies were assessed by two reviewers for inclusion criteria. Two separate random-effects meta-analyses' models were performed using the DerSimonian and Laird method. Heterogeneity was assessed using the I2 value. Meta-regression with study level variables was used to explore potential sources of heterogeneity. The funnel-plot-based trim-and-fill method was applied to detect and adjust for potential publication bias. Statistical tests were two-sided and P< 0.05 was considered statistically significant. Results: A total of 13 studies were included for analysis. In these trials, 30.4% of PLHIV with increased risk for coronary heart disease (CHD used aspirin for AMI prevention, compared to 36.9% of patients at risk of CHD in the general population. Conclusions: The results of this meta-analysis provide evidence that aspirin is underutilized in both PLHIV and the general population across broad geographical zones. Aspirin use

  5. Vaccines for viral and bacterial pathogens causing acute gastroenteritis: Part I: Overview, vaccines for enteric viruses and Vibrio cholerae.

    Science.gov (United States)

    O'Ryan, Miguel; Vidal, Roberto; del Canto, Felipe; Salazar, Juan Carlos; Montero, David

    2015-01-01

    Efforts to develop vaccines for prevention of acute diarrhea have been going on for more than 40 y with partial success. The myriad of pathogens, more than 20, that have been identified as a cause of acute diarrhea throughout the years pose a significant challenge for selecting and further developing the most relevant vaccine candidates. Based on pathogen distribution as identified in epidemiological studies performed mostly in low-resource countries, rotavirus, Cryptosporidium, Shigella, diarrheogenic E. coli and V. cholerae are predominant, and thus the main targets for vaccine development and implementation. Vaccination against norovirus is most relevant in middle/high-income countries and possibly in resource-deprived countries, pending a more precise characterization of disease impact. Only a few licensed vaccines are currently available, of which rotavirus vaccines have been the most outstanding in demonstrating a significant impact in a short time period. This is a comprehensive review, divided into 2 articles, of nearly 50 vaccine candidates against the most relevant viral and bacterial pathogens that cause acute gastroenteritis. In order to facilitate reading, sections for each pathogen are organized as follows: i) a discussion of the main epidemiological and pathogenic features; and ii) a discussion of vaccines based on their stage of development, moving from current licensed vaccines to vaccines in advanced stage of development (in phase IIb or III trials) to vaccines in early stages of clinical development (in phase I/II) or preclinical development in animal models. In this first article we discuss rotavirus, norovirus and Vibrio cholerae. In the following article we will discuss Shigella, Salmonella (non-typhoidal), diarrheogenic E. coli (enterotoxigenic and enterohemorragic), and Campylobacter jejuni.

  6. Deep Sequencing of RNA from Blood and Oral Swab Samples Reveals the Presence of Nucleic Acid from a Number of Pathogens in Patients with Acute Ebola Virus Disease and Is Consistent with Bacterial Translocation across the Gut.

    Science.gov (United States)

    Carroll, Miles W; Haldenby, Sam; Rickett, Natasha Y; Pályi, Bernadett; Garcia-Dorival, Isabel; Liu, Xuan; Barker, Gary; Bore, Joseph Akoi; Koundouno, Fara Raymond; Williamson, E Diane; Laws, Thomas R; Kerber, Romy; Sissoko, Daouda; Magyar, Nóra; Di Caro, Antonino; Biava, Mirella; Fletcher, Tom E; Sprecher, Armand; Ng, Lisa F P; Rénia, Laurent; Magassouba, N'faly; Günther, Stephan; Wölfel, Roman; Stoecker, Kilian; Matthews, David A; Hiscox, Julian A

    2017-01-01

    In this study, samples from the 2013-2016 West African Ebola virus outbreak from patients in Guinea with Ebola virus disease (EVD) were analyzed to discover and classify what other pathogens were present. Throat swabs were taken from deceased EVD patients, and peripheral blood samples were analyzed that had been taken from patients when they presented at the treatment center with acute illness. High-throughput RNA sequencing (RNA-seq) and bioinformatics were used to identify the potential microorganisms. This approach confirmed Ebola virus (EBOV) in all samples from patients diagnosed as acute positive for the virus by quantitative reverse transcription-PCR in deployed field laboratories. Nucleic acid mapping to Plasmodium was also used on the patient samples, confirming results obtained with an antigen-based rapid diagnostic test (RDT) conducted in the field laboratories. The data suggested that a high Plasmodium load, as determined by sequence read depth, was associated with mortality and influenced the host response, whereas a lower parasite load did not appear to affect outcome. The identifications of selected bacteria from throat swabs via RNA-seq were confirmed by culture. The data indicated that the potential pathogens identified in the blood samples were associated with translocation from the gut, suggesting the presence of bacteremia, which transcriptome data suggested may induce or aggravate the acute-phase response observed during EVD. Transcripts mapping to different viruses were also identified, including those indicative of lytic infections. The development of high-resolution analysis of samples from patients with EVD will help inform care pathways and the most appropriate general antimicrobial therapy to be used in a resource-poor setting. IMPORTANCE Our results highlight the identification of an array of pathogens in the blood of patients with Ebola virus disease (EVD). This has not been done before, and the data have important implications for the

  7. Antibody producing B lineage cells invade the central nervous system predominantly at the time of and triggered by acute Epstein-Barr virus infection: A hypothesis on the origin of intrathecal immunoglobulin synthesis in multiple sclerosis.

    Science.gov (United States)

    Otto, Carolin; Hofmann, Jörg; Ruprecht, Klemens

    2016-06-01

    Patients with multiple sclerosis (MS), a chronic inflammatory disease of the central nervous system (CNS), typically have an intrathecal synthesis of immunoglobulin (Ig)G. Intrathecal IgG is produced by B lineage cells that entered the CNS, but why and when these cells invade the CNS of patients with MS is unknown. The intrathecal IgG response in patients with MS is polyspecific and part of it is directed against different common viruses (e.g. measles virus, rubella virus, varicella zoster virus). Strong and consistent evidence suggests an association of MS and Epstein-Barr virus (EBV) infection and EBV seroprevalence in patients with MS is practically 100%. However, intriguingly, despite of the universal EBV seroprevalence, the frequency of intrathecally produced IgG to EBV in patients with MS is much lower than that of intrathecally produced IgG to other common viruses. The acute phase of primary EBV infection is characterized by a strong polyclonal B cell activation. As typical for humoral immune responses against viruses, EBV specific IgG is produced only with a temporal delay after acute EBV infection. Aiming to put the above facts into a logical structure, we here propose the hypothesis that in individuals going on to develop MS antibody producing B lineage cells invade the CNS predominantly at the time of and triggered by acute primary EBV infection. Because at the time of acute EBV infection EBV IgG producing B lineage cells have not yet occurred, the hypothesis could explain the universal EBV seroprevalence and the low frequency of intrathecally produced IgG to EBV in patients with MS. Evidence supporting the hypothesis could be provided by large prospective follow-up studies of individuals with symptomatic primary EBV infection (infectious mononucleosis). Furthermore, the clarification of the molecular mechanism underlying an EBV induced invasion of B lineage cells into the CNS of individuals going on to develop MS could corroborate it, too. If true, our

  8. A temporal role of type I interferon signaling in CD8+ T cell maturation during acute West Nile virus infection.

    Directory of Open Access Journals (Sweden)

    Amelia K Pinto

    2011-12-01

    Full Text Available A genetic absence of the common IFN-α/β signaling receptor (IFNAR in mice is associated with enhanced viral replication and altered adaptive immune responses. However, analysis of IFNAR(-/- mice is limited for studying the functions of type I IFN at discrete stages of viral infection. To define the temporal functions of type I IFN signaling in the context of infection by West Nile virus (WNV, we treated mice with MAR1-5A3, a neutralizing, non cell-depleting anti-IFNAR antibody. Inhibition of type I IFN signaling at or before day 2 after infection was associated with markedly enhanced viral burden, whereas treatment at day 4 had substantially less effect on WNV dissemination. While antibody treatment prior to infection resulted in massive expansion of virus-specific CD8(+ T cells, blockade of type I IFN signaling starting at day 4 induced dysfunctional CD8(+ T cells with depressed cytokine responses and expression of phenotypic markers suggesting exhaustion. Thus, only the later maturation phase of anti-WNV CD8(+ T cell development requires type I IFN signaling. WNV infection experiments in BATF3(-/- mice, which lack CD8-α dendritic cells and have impaired priming due to inefficient antigen cross-presentation, revealed a similar effect of blocking IFN signaling on CD8(+ T cell maturation. Collectively, our results suggest that cell non-autonomous type I IFN signaling shapes maturation of antiviral CD8(+ T cell response at a stage distinct from the initial priming event.

  9. Hepatitis viruses overview

    African Journals Online (AJOL)

    Hepatitis is major cause of morbidity or mortality worldwide, particularly in the developing world. The major causes of infective hepatitis are hepatitis viruses. A, B, C, D or E. In the acute phase, there are no clinical features that can reliably differentiate between these viruses. Infection may be asymptomatic or can present as.

  10. Hepatitis E Virus

    African Journals Online (AJOL)

    Abstract. Hepatitis E virus (HEV) is the most common cause of acute viral hepatitis in the developing world. It is a waterborne virus that can cause epidemics in the face of overcrowding and poor sanitation. Although the hepatitis illness is usually self-limiting, it has a high mortality in pregnant women and can become a ...

  11. Hendra virus.

    Science.gov (United States)

    Middleton, Deborah

    2014-12-01

    Hendra virus infection of horses occurred sporadically between 1994 and 2010 as a result of spill-over from the viral reservoir in Australian mainland flying-foxes, and occasional onward transmission to people also followed from exposure to affected horses. An unprecedented number of outbreaks were recorded in 2011 leading to heightened community concern. Release of an inactivated subunit vaccine for horses against Hendra virus represents the first commercially available product that is focused on mitigating the impact of a Biosafety Level 4 pathogen. Through preventing the development of acute Hendra virus disease in horses, vaccine use is also expected to reduce the risk of transmission of infection to people. Crown Copyright © 2014. Published by Elsevier Inc. All rights reserved.

  12. Lower IgG somatic hypermutation rates during acute dengue virus infection is compatible with a germinal center-independent B cell response.

    Science.gov (United States)

    Godoy-Lozano, Elizabeth Ernestina; Téllez-Sosa, Juan; Sánchez-González, Gilberto; Sámano-Sánchez, Hugo; Aguilar-Salgado, Andrés; Salinas-Rodríguez, Aarón; Cortina-Ceballos, Bernardo; Vivanco-Cid, Héctor; Hernández-Flores, Karina; Pfaff, Jennifer M; Kahle, Kristen M; Doranz, Benjamin J; Gómez-Barreto, Rosa Elena; Valdovinos-Torres, Humberto; López-Martínez, Irma; Rodriguez, Mario H; Martínez-Barnetche, Jesús

    2016-02-25

    The study of human B cell response to dengue virus (DENV) infection is critical to understand serotype-specific protection and the cross-reactive sub-neutralizing response. Whereas the first is beneficial and thus represents the ultimate goal of vaccination, the latter has been implicated in the development of severe disease, which occurs in a small, albeit significant, fraction of secondary DENV infections. Both primary and secondary infections are associated with the production of poly-reactive and cross-reactive IgG antibodies. To gain insight into the effect of DENV infection on the B cell repertoire, we used VH region high-throughput cDNA sequencing of the peripheral blood IgG B cell compartment of 19 individuals during the acute phase of infection. For 11 individuals, a second sample obtained 6 months later was analyzed for comparison. Probabilities of sequencing antibody secreting cells or memory B cells were estimated using second-order Monte Carlo simulation. We found that in acute disease there is an increase in IgG B cell diversity and changes in the relative use of segments IGHV1-2, IGHV1-18, and IGHV1-69. Somewhat unexpectedly, an overall low proportion of somatic hypermutated antibody genes was observed during the acute phase plasmablasts, particularly in secondary infections and those cases with more severe disease. Our data are consistent with an innate-like antiviral recognition system mediated by B cells using defined germ-line coded B cell receptors, which could provide a rapid germinal center-independent antibody response during the early phase of infection. A model describing concurrent T-dependent and T-independent B cell responses in the context of DENV infection is proposed, which incorporates the selection of B cells using hypomutated IGHV segments and their potential role in poly/cross-reactivity. Its formal demonstration could lead to a definition of its potential implication in antibody-dependent enhancement, and may contribute to

  13. Cynomolgus monkeys (Macaca fascicularis) experimentally infected with B19V and hepatitis A virus: no evidence of the co-infection as a cause of acute liver failure.

    Science.gov (United States)

    Leon, Luciane Almeida Amado; Marchevsky, Renato Sergio; Gaspar, Ana Maria Coimbra; Garcia, Rita de Cassia Nasser Cubel; Almeida, Adilson José de; Pelajo-Machado, Marcelo; Castro, Tatiana Xavier de; Nascimento, Jussara Pereira do; Brown, Kevin E; Pinto, Marcelo Alves

    2016-04-01

    This study was conducted to analyse the course and the outcome of the liver disease in the co-infected animals in order to evaluate a possible synergic effect of human parvovirus B19 (B19V) and hepatitis A virus (HAV) co-infection. Nine adult cynomolgus monkeys were inoculated with serum obtained from a fatal case of B19V infection and/or a faecal suspension of acute HAV. The presence of specific antibodies to HAV and B19V, liver enzyme levels, viraemia, haematological changes, and necroinflammatory liver lesions were used for monitoring the infections. Seroconversion was confirmed in all infected groups. A similar pattern of B19V infection to human disease was observed, which was characterised by high and persistent viraemia in association with reticulocytopenia and mild to moderate anaemia during the period of investigation (59 days). Additionally, the intranuclear inclusion bodies were observed in pro-erythroblast cell from an infected cynomolgus and B19V Ag in hepatocytes. The erythroid hypoplasia and decrease in lymphocyte counts were more evident in the co-infected group. The present results demonstrated, for the first time, the susceptibility of cynomolgus to B19V infection, but it did not show a worsening of liver histopathology in the co-infected group.

  14. Development of a monoclonal antibody specific to granulocytes and its application for variation of granulocytes in scallop Chlamys farreri after acute viral necrobiotic virus (AVNV) infection.

    Science.gov (United States)

    Lin, Tingting; Xing, Jing; Sheng, Xiuzhen; Tang, Xiaoqian; Zhan, Wenbin

    2011-06-01

    A monoclonal antibody (MAb 6H7) specific to granulocytes of scallop Chlamys farreri was produced by immunising mice with separated granulocytes as an antigen. Characterised using a flow cytometric immunofluorescence assay, MAb 6H7 reacted to granulocytes by 87.1% of total positive haemocytes. At the ultrastructural level, MAb 6H7 demonstrated epitope in cytoplasmic granules of granulocytes. Western blotting analysis indicated that a peptide of 155 kDa was recognised by MAb 6H7. It was therefore used to investigate granulocyte variation in C. farreri after acute viral necrobiotic virus (AVNV) infection using an enzyme-linked immunosorbent assay. The result illustrated that granulocytes varied greatly by AVNV infection, and their amount significantly increased on day 1 post-injection, then decreased on days 2, 3 and 4, thereafter, rebounded and approached to a second peak on day 6, finally went down gradually to the control level on day 8. Copyright © 2011 Elsevier Ltd. All rights reserved.

  15. Predictive role of acute phase reactants in the response to therapy in patients with chronic hepatitis C virus infection.

    Science.gov (United States)

    Oguz, Ayten; Atay, Ahmet Engin; Tas, Adnan; Seven, Gulseren; Koruk, Mehmet

    2013-01-01

    Biochemical parameters and acute-phase proteins (APPs) may provide complementary data in patients with chronic hepatitis C (CHC). We aimed to evaluate the predictive role of APPs in the response to antiviral therapy. Forty-five patients underwent antiviral therapy. Serum ferritin, C-reactive protein (CRP), transferrin, albumin, alpha-1 acid glycoprotein (A1AG), and alpha-2 macroglobulin (A2MG) levels were examined at the initial evaluation and at the 4th, 12th, and 48th weeks. HCV RNA levels were examined at the initial evaluation and at the 12th and 48th weeks. Ferritin, transferrin, A1AG, and A2MG levels were significantly higher in the patient group (pacute-phase reactants may provide supplementary data for evaluating responses to antiviral therapy.

  16. Association between feline immunodeficiency virus (FIV) plasma viral RNA load, concentration of acute phase proteins and disease severity.

    Science.gov (United States)

    Kann, Rebecca K C; Seddon, Jennifer M; Kyaw-Tanner, Myat T; Henning, Joerg; Meers, Joanne

    2014-08-01

    Veterinarians have few tools to predict the rate of disease progression in FIV-infected cats. In contrast, in HIV infection, plasma viral RNA load and acute phase protein concentrations are commonly used as predictors of disease progression. This study evaluated these predictors in cats naturally infected with FIV. In older cats (>5 years), log10 FIV RNA load was higher in the terminal stages of disease compared to the asymptomatic stage. There was a significant association between log10 FIV RNA load and both log10 serum amyloid A concentration and age in unwell FIV-infected cats. This study suggests that viral RNA load and serum amyloid A warrant further investigation as predictors of disease status and prognosis in FIV-infected cats. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. Heliox delivered by high flow nasal cannula improves oxygenation in infants with respiratory syncytial virus acute bronchiolitis

    Directory of Open Access Journals (Sweden)

    Wael Seliem

    Full Text Available Abstract Objective: The objective of this study is to evaluate the hypothesis that use of heliox would result in improvement of gas exchange when used with high flow nasal cannula in infants with RSV acute bronchiolitis. Methods: All patients that met the inclusion criteria were randomized to either heliox (70:30 or air-oxygen mixture 30% via high flow nasal cannula at 8 L/min for a continuous 24 h. Measurements were taken at baseline, after 2 h, and at the end of the 24 h. Results: This prospective study included 48 patients. After 2 h of treatment with heliox, the oxygen saturation and PaO2 significantly improved when compared with the air-oxygen group, 98.3% vs. 92.9%, 62.0 mmHg vs. 43.6 mmHg (p = 0.04 and 0.01, respectively. Furthermore, PaO2/FiO2 ratio was significantly higher in the heliox group when compared with the air-oxygen group, 206.7 vs. 145.3. Nevertheless, CO2 showed better elimination when heliox was used, without significance. MWCA score dropped significantly in the heliox group, 2.2 points vs. 4.0 points in air-oxygen (p = 0.04, 2 h after starting the therapy. Conclusion: Transient improvement of oxygenation in infants with RSV acute bronchiolitis during the initial phase of the therapy is associated with heliox when provided with HFNC, may provide a precious time for other therapeutic agents to work or for the disease to resolve naturally, avoiding other aggressive interventions.

  18. Adaptive Immune Responses in a Multiple Sclerosis Patient with Acute Varicella-Zoster Virus Reactivation during Treatment with Fingolimod

    Directory of Open Access Journals (Sweden)

    Andrea Harrer

    2015-09-01

    Full Text Available Fingolimod, an oral sphingosine 1-phosphate (S1P receptor modulator, is approved for the treatment of relapsing forms of multiple sclerosis (MS. The interference with S1P signaling leads to retention particularly of chemokine receptor-7 (CCR7 expressing T cells in lymph nodes. The immunological basis of varicella zoster virus (VZV infections during fingolimod treatment is unclear. Here, we studied the dynamics of systemic and intrathecal immune responses associated with symptomatic VZV reactivation including cessation of fingolimod and initiation of antiviral therapy. Key features in peripheral blood were an about two-fold increase of VZV-specific IgG at diagnosis of VZV reactivation as compared to the previous months, a relative enrichment of effector CD4+ T cells (36% versus mean 12% in controls, and an accelerated reconstitution of absolute lymphocytes counts including a normalized CD4+/CD8+ ratio and reappearance of CCR7+ T cells. In cerebrospinal fluid (CSF the lymphocytic pleocytosis and CD4+/CD8+ ratios at diagnosis of reactivation and after nine days of fingolimod discontinuation remained unchanged. During this time CCR7+ T cells were not observed in CSF. Further research into fingolimod-associated VZV reactivation and immune reconstitution is mandatory to prevent morbidity and mortality associated with this potentially life-threatening condition.

  19. Herpes Virus Entry Mediator Signaling in the Brain Is Imperative in Acute Inflammation-Induced Anorexia and Body Weight Loss

    Directory of Open Access Journals (Sweden)

    Kwang Kon Kim

    2013-09-01

    Full Text Available BackgroundReduced appetite and body weight loss are typical symptoms of inflammatory diseases. A number of inflammatory stimuli are responsible for the imbalance in energy homeostasis, leading to metabolic disorders. The herpes virus entry mediator (HVEM protein plays an important role in the development of various inflammatory diseases, such as intestinal inflammation and diet-induced obesity. However, the role of HVEM in the brain is largely unknown. This study aims to investigate whether HVEM signaling in the brain is involved in inflammation-induced anorexia and body weight loss.MethodsFood intake and body weight were measured at 24 hours after intraperitoneal injection of lipopolysaccharide (LPS or intracerebroventricular injection of recombinant mouse LIGHT (also called tumor necrosis factor receptor superfamily 14, TNFSF14, an HVEM ligand, into 8- to 10-week-old male C57BL/6 mice and mice lacking HVEM expression (HVEM-/-. We also assessed LPS-induced change in hypothalamic expression of HVEM using immunohistochemistry.ResultsAdministration of LPS significantly reduced food intake and body weight, and moreover, increased expression of HVEM in the hypothalamic arcuate nucleus. However, LPS induced only minor decreases in food intake and body weight in HVEM-/- mice. Administration of LIGHT into the brain was very effective at decreasing food intake and body weight in wild-type mice, but was less effective in HVEM-/- mice.ConclusionActivation of brain HVEM signaling is responsible for inflammation-induced anorexia and body weight loss.

  20. [Summary of research works on viruses in the Vietnam Research Station, Institute of Tropical Medicine, Nagasaki University].

    Science.gov (United States)

    Yamashiro, Tetsu

    2013-01-01

    Institute of Tropical Medicine, Nagasaki University (NEKKEN) and National Institute of Hygiene and Epidemiology, Vietnam (NIHE) jointly conducted a project from 2006 on Emerging and Re-emerging Infectious Diseases (ERID) granted by the Ministry of Education, Science, Culture and Technology (MEXT) of Japan. Fifteen independent researches have been carried out by 7 scientists who stationed in the Vietnam Research Station (VRS), and by approximately 60 visiting scientists. A wide variety of viruses have been studied in the research activities in the VRS, of those, topics of'' Nipah virus infection in bats in Vietnam'', ''Nam Dinh virus, a newly discovered insect nidovirus'', and'' Risk factors of dengue fever in southern Vietnam'' were summarized. It is important to develop a mechanism to facilitate young scientists to use the VRS in their research works, and then a scope to establish the VRS as a gateway to a successful career path for young scientists in the field of the infectious diseases would be realized.

  1. Duration of Maternal Antibodies against Canine Distemper Virus and Hendra Virus in Pteropid Bats

    Science.gov (United States)

    Zambrana-Torrelio, Carlos; Middleton, Deborah; Barr, Jennifer A.; DuBovi, Edward; Boyd, Victoria; Pope, Brian; Todd, Shawn; Crameri, Gary; Walsh, Allyson; Pelican, Katey; Fielder, Mark D.; Davies, Angela J.; Wang, Lin-Fa; Daszak, Peter

    2013-01-01

    Old World frugivorous bats have been identified as natural hosts for emerging zoonotic viruses of significant public health concern, including henipaviruses (Nipah and Hendra virus), Ebola virus, and Marburg virus. Epidemiological studies of these viruses in bats often utilize serology to describe viral dynamics, with particular attention paid to juveniles, whose birth increases the overall susceptibility of the population to a viral outbreak once maternal immunity wanes. However, little is understood about bat immunology, including the duration of maternal antibodies in neonates. Understanding duration of maternally derived immunity is critical for characterizing viral dynamics in bat populations, which may help assess the risk of spillover to humans. We conducted two separate studies of pregnant Pteropus bat species and their offspring to measure the half-life and duration of antibodies to 1) canine distemper virus antigen in vaccinated captive Pteropus hypomelanus; and 2) Hendra virus in wild-caught, naturally infected Pteropus alecto. Both of these pteropid bat species are known reservoirs for henipaviruses. We found that in both species, antibodies were transferred from dam to pup. In P. hypomelanus pups, titers against CDV waned over a mean period of 228.6 days (95% CI: 185.4–271.8) and had a mean terminal phase half-life of 96.0 days (CI 95%: 30.7–299.7). In P. alecto pups, antibodies waned over 255.13 days (95% CI: 221.0–289.3) and had a mean terminal phase half-life of 52.24 days (CI 95%: 33.76–80.83). Each species showed a duration of transferred maternal immunity of between 7.5 and 8.5 months, which was longer than has been previously estimated. These data will allow for more accurate interpretation of age-related Henipavirus serological data collected from wild pteropid bats. PMID:23826322

  2. Duration of Maternal Antibodies against Canine Distemper Virus and Hendra Virus in Pteropid Bats.

    Directory of Open Access Journals (Sweden)

    Jonathan H Epstein

    Full Text Available Old World frugivorous bats have been identified as natural hosts for emerging zoonotic viruses of significant public health concern, including henipaviruses (Nipah and Hendra virus, Ebola virus, and Marburg virus. Epidemiological studies of these viruses in bats often utilize serology to describe viral dynamics, with particular attention paid to juveniles, whose birth increases the overall susceptibility of the population to a viral outbreak once maternal immunity wanes. However, little is understood about bat immunology, including the duration of maternal antibodies in neonates. Understanding duration of maternally derived immunity is critical for characterizing viral dynamics in bat populations, which may help assess the risk of spillover to humans. We conducted two separate studies of pregnant Pteropus bat species and their offspring to measure the half-life and duration of antibodies to 1 canine distemper virus antigen in vaccinated captive Pteropus hypomelanus; and 2 Hendra virus in wild-caught, naturally infected Pteropus alecto. Both of these pteropid bat species are known reservoirs for henipaviruses. We found that in both species, antibodies were transferred from dam to pup. In P. hypomelanus pups, titers against CDV waned over a mean period of 228.6 days (95% CI: 185.4-271.8 and had a mean terminal phase half-life of 96.0 days (CI 95%: 30.7-299.7. In P. alecto pups, antibodies waned over 255.13 days (95% CI: 221.0-289.3 and had a mean terminal phase half-life of 52.24 days (CI 95%: 33.76-80.83. Each species showed a duration of transferred maternal immunity of between 7.5 and 8.5 months, which was longer than has been previously estimated. These data will allow for more accurate interpretation of age-related Henipavirus serological data collected from wild pteropid bats.

  3. Duration of Maternal Antibodies against Canine Distemper Virus and Hendra Virus in Pteropid Bats.

    Science.gov (United States)

    Epstein, Jonathan H; Baker, Michelle L; Zambrana-Torrelio, Carlos; Middleton, Deborah; Barr, Jennifer A; Dubovi, Edward; Boyd, Victoria; Pope, Brian; Todd, Shawn; Crameri, Gary; Walsh, Allyson; Pelican, Katey; Fielder, Mark D; Davies, Angela J; Wang, Lin-Fa; Daszak, Peter

    2013-01-01

    Old World frugivorous bats have been identified as natural hosts for emerging zoonotic viruses of significant public health concern, including henipaviruses (Nipah and Hendra virus), Ebola virus, and Marburg virus. Epidemiological studies of these viruses in bats often utilize serology to describe viral dynamics, with particular attention paid to juveniles, whose birth increases the overall susceptibility of the population to a viral outbreak once maternal immunity wanes. However, little is understood about bat immunology, including the duration of maternal antibodies in neonates. Understanding duration of maternally derived immunity is critical for characterizing viral dynamics in bat populations, which may help assess the risk of spillover to humans. We conducted two separate studies of pregnant Pteropus bat species and their offspring to measure the half-life and duration of antibodies to 1) canine distemper virus antigen in vaccinated captive Pteropus hypomelanus; and 2) Hendra virus in wild-caught, naturally infected Pteropus alecto. Both of these pteropid bat species are known reservoirs for henipaviruses. We found that in both species, antibodies were transferred from dam to pup. In P. hypomelanus pups, titers against CDV waned over a mean period of 228.6 days (95% CI: 185.4-271.8) and had a mean terminal phase half-life of 96.0 days (CI 95%: 30.7-299.7). In P. alecto pups, antibodies waned over 255.13 days (95% CI: 221.0-289.3) and had a mean terminal phase half-life of 52.24 days (CI 95%: 33.76-80.83). Each species showed a duration of transferred maternal immunity of between 7.5 and 8.5 months, which was longer than has been previously estimated. These data will allow for more accurate interpretation of age-related Henipavirus serological data collected from wild pteropid bats.

  4. Potential for Introduction of Bat-Borne Zoonotic Viruses into the EU: A Review

    Directory of Open Access Journals (Sweden)

    Robin R. L. Simons

    2014-05-01

    Full Text Available Bat-borne viruses can pose a serious threat to human health, with examples including Nipah virus (NiV in Bangladesh and Malaysia, and Marburg virus (MARV in Africa. To date, significant human outbreaks of such viruses have not been reported in the European Union (EU. However, EU countries have strong historical links with many of the countries where NiV and MARV are present and a corresponding high volume of commercial trade and human travel, which poses a potential risk of introduction of these viruses into the EU. In assessing the risks of introduction of these bat-borne zoonotic viruses to the EU, it is important to consider the location and range of bat species known to be susceptible to infection, together with the virus prevalence, seasonality of viral pulses, duration of infection and titre of virus in different bat tissues. In this paper, we review the current scientific knowledge of all these factors, in relation to the introduction of NiV and MARV into the EU.

  5. Ocular tropism of respiratory viruses.

    Science.gov (United States)

    Belser, Jessica A; Rota, Paul A; Tumpey, Terrence M

    2013-03-01

    Respiratory viruses (including adenovirus, influenza virus, respiratory syncytial virus, coronavirus, and rhinovirus) cause a broad spectrum of disease in humans, ranging from mild influenza-like symptoms to acute respiratory failure. While species D adenoviruses and subtype H7 influenza viruses are known to possess an ocular tropism, documented human ocular disease has been reported following infection with all principal respiratory viruses. In this review, we describe the anatomical proximity and cellular receptor distribution between ocular and respiratory tissues. All major respiratory viruses and their association with human ocular disease are discussed. Research utilizing in vitro and in vivo models to study the ability of respiratory viruses to use the eye as a portal of entry as well as a primary site of virus replication is highlighted. Identification of shared receptor-binding preferences, host responses, and laboratory modeling protocols among these viruses provides a needed bridge between clinical and laboratory studies of virus tropism.

  6. Molecular Characterisation of Chikungunya Virus Infections in Trinidad and Comparison of Clinical and Laboratory Features with Dengue and Other Acute Febrile Cases.

    Science.gov (United States)

    Sahadeo, Nikita; Mohammed, Hamish; Allicock, Orchid M; Auguste, Albert J; Widen, Steven G; Badal, Kimberly; Pulchan, Krishna; Foster, Jerome E; Weaver, Scott C; Carrington, Christine V F

    2015-11-01

    Local transmission of Chikungunya virus (CHIKV) was first documented in Trinidad and Tobago (T&T) in July 2014 preceding a large epidemic. At initial presentation, it is difficult to distinguish chikungunya fever (CHIKF) from other acute undifferentiated febrile illnesses (AUFIs), including life-threatening dengue disease. We characterised and compared dengue virus (DENV) and CHIKV infections in 158 patients presenting with suspected dengue fever (DF) and CHIKF at a major hospital in T&T, and performed phylogenetic analyses on CHIKV genomic sequences recovered from 8 individuals. The characteristics of patients with and without PCR-confirmed CHIKV were compared using Pearson's χ2 and student's t-tests, and adjusted odds ratios (aORs) and 95% confidence intervals (CIs) were determined using logistic regression. We then compared signs and symptoms of people with RT-qPCR-confirmed CHIKV and DENV infections using the Mann-Whitney U, Pearson's χ2 and Fisher's exact tests. Among the 158 persons there were 8 (6%) RT-qPCR-confirmed DENV and 30 (22%) RT-qPCR-confirmed CHIKV infections. Phylogenetic analyses showed that the CHIKV strains belonged to the Asian genotype and were most closely related to a British Virgin Islands strain isolated at the beginning of the 2013/14 outbreak in the Americas. Compared to persons who were RT-qPCR-negative for CHIKV, RT-qPCR-positive individuals were significantly more likely to have joint pain (aOR: 4.52 [95% CI: 1.28-16.00]), less likely to be interviewed at a later stage of illness (days post onset of fever--aOR: 0.56 [0.40-0.78]) and had a lower white blood cell count (aOR: 0.83 [0.71-0.96]). Among the 38 patients with RT-qPCR-confirmed CHIKV or DENV, there were no significant differences in symptomatic presentation. However when individuals with serological evidence of recent DENV or CHIKV infection were included in the analyses, there were key differences in clinical presentation between CHIKF and other AUFIs including DF, which

  7. Kecernaan In Vitro Fraksi Serat (NDF, ADF dan Selulosa Lima Jenis Rumput Laut Coklat dari Pantai Sungai Nipah Kabupaten Pesisir Selatan Sumatera Barat

    Directory of Open Access Journals (Sweden)

    Y.L. Dewi

    2015-10-01

    Full Text Available Penelitian ini bertujuan untuk mengetahui kecernaan fraksi serat (NDF, ADF dan Selulosa lima jenis rumput laut coklat dari Pantai Sungai Nipah Kabupaten Pesisir Selatan Sumatera Barat secara in vitro. Metode penelitian yang digunakan adalah metode eksperimen dengan Rancangan Acak Kelompok (RAK terdiri dari lima perlakuan rumput laut coklat yang berbeda jenis ( A = Padina australis, B = Turbinaria decurrens, C = Turbinaria murayana, D = Sargassum crassifolium dan E = Sargassum binderi dan masing-masing perlakuan diulang 3 kali sebagai kelompok. Kelompok didasarkan atas tiga kali pengambilan cairan rumen kambing yang berbeda. Parameter yang diamati pada penelitian ini adalah kecernaan NDF, kecernaan ADF dan kecernaan selulosa. Hasil penelitian menunjukkan 5 jenis rumput laut coklat berpengaruh sangat nyata (P<0,01 terhadap kecernaan NDF, kecernaan ADF dan kecernaan selulosa. Hasil penelitian ini dapat disimpulkan bahwa rumput laut Sargassum crassifolium dan Sargassum binderi memiliki kecernaan NDF tertinggi (15,65% dan 20,56% dan ADF tertinggi (15,43% dan 17,80% dibandingkan dengan jenis rumput laut coklat lainnya.

  8. Determination of respiratory virus by RT-PCR in people with acute respiratory infection of the Area de Salud Pavas, Area de Salud Paraiso and Hospital Nacional de Ninos 'Dr. Carlos Saenz Herrera', in the period January 2012 to September 2012

    International Nuclear Information System (INIS)

    Montero Bonilla, Andrei

    2014-01-01

    Respiratory viruses are diagnosed through reverse transcriptase polymerase chain reaction (RT-PCR) in people with acute respiratory disease of the Area de Salud Pavas, Area de Salud Paraiso and Hospital Nacional de Ninos. The frequency of respiratory viruses are determined in the samples analyzed in the study population. The presence of viral coinfections is identified in the samples analyzed. The frequency of patients with respiratory viruses is categorized according to age in the study population. The frequency of respiratory viruses is examined between the studied geographic regions (Pavas and Paraiso). The results found by RT-PCR are compared with the frequency data reported with the direct immunofluorescence technique [es

  9. Herpes Simplex Virus 1 Mutant with Point Mutations in UL39 Is Impaired for Acute Viral Replication in Mice, Establishment of Latency, and Explant-Induced Reactivation.

    Science.gov (United States)

    Mostafa, Heba H; Thompson, Thornton W; Konen, Adam J; Haenchen, Steve D; Hilliard, Joshua G; Macdonald, Stuart J; Morrison, Lynda A; Davido, David J

    2018-04-01

    In the process of generating herpes simplex virus 1 (HSV-1) mutations in the viral regulatory gene encoding infected cell protein 0 (ICP0), we isolated a viral mutant, termed KOS-NA, that was severely impaired for acute replication in the eyes and trigeminal ganglia (TG) of mice, defective in establishing a latent infection, and reactivated poorly from explanted TG. To identify the secondary mutation(s) responsible for the impaired phenotypes of this mutant, we sequenced the KOS-NA genome and noted that it contained two nonsynonymous mutations in UL39 , which encodes the large subunit of ribonucleotide reductase, ICP6. These mutations resulted in lysine-to-proline (residue 393) and arginine-to-histidine (residue 950) substitutions in ICP6. To determine whether alteration of these amino acids was responsible for the KOS-NA phenotypes in vivo , we recombined the wild-type UL39 gene into the KOS-NA genome and rescued its acute replication phenotypes in mice. To further establish the role of UL39 in KOS-NA's decreased pathogenicity, the UL39 mutations were recombined into HSV-1 (generating UL39 mut ), and this mutant virus showed reduced ocular and TG replication in mice comparable to that of KOS-NA. Interestingly, ICP6 protein levels were reduced in KOS-NA-infected cells relative to the wild-type protein. Moreover, we observed that KOS-NA does not counteract caspase 8-induced apoptosis, unlike wild-type strain KOS. Based on alignment studies with other HSV-1 ICP6 homologs, our data suggest that amino acid 950 of ICP6 likely plays an important role in ICP6 accumulation and inhibition of apoptosis, consequently impairing HSV-1 pathogenesis in a mouse model of HSV-1 infection. IMPORTANCE HSV-1 is a major human pathogen that infects ∼80% of the human population and can be life threatening to infected neonates or immunocompromised individuals. Effective therapies for treatment of recurrent HSV-1 infections are limited, which emphasizes a critical need to understand in

  10. Therapeutic plasma exchange versus double plasma molecular absorption system in hepatitis B virus-infected acute-on-chronic liver failure treated by entercavir: A prospective study.

    Science.gov (United States)

    Wan, Yue-Meng; Li, Yu-Hua; Xu, Zhi-Yuan; Yang, Jing; Yang, Li-Hong; Xu, Ying; Yang, Jin-Hui

    2017-12-01

    Therapeutic plasma exchange (TPE) and double plasma molecular absorption system (DPMAS) were two extracorporeal liver support systems. Few studies compared their efficacy profile. This study was to compare the efficacy of TPE and DPMAS on acute-on-chronic liver failure (ACLF) caused by hepatitis B virus (HBV-ACLF). 60 HBV-ACLF patients were enrolled and prospectively studied. All patients received entecavir therapy, and were assigned to TPE group (n = 33) and DPMAS group (n = 27). Primary end-points were the effects of TPE and DPMAS on liver function and serum inflammatory markers. Serum procalcitonin, interleukin (IL)-6, and high sensitive C-reactive protein (hsCRP) were significantly elevated in patients with HBV-ACLF. TPE achieved significantly higher removal rates of total bilirubin (TBIL, P = .002), direct bilirubin (DBIL, P = .006), and hsCRP (P = .010) than DPMAS, but DPMAS displayed lower loss rate of albumin (P = .000). TPE and DPMAS resulted in similarly increased serum IL-6 levels and comparable 12-week survivals (P > .05). Multivariate analysis showed that hospital stay (Relative Risk [RR]: 1.062, 95% Confidence Interval [CI]: 1.011-1.115, P = .016), prothrombin time (RR: 1.346, 95% CI: 1.077-1.726, P = .010), and international normalized ratio (RR: 0.013, 95% CI: 0.006-0.788, P = .041) were independent predictors for 12-week survival. Both TPE and DPMAS treatments were well-tolerated. Compared to DPMAS, TPE was more efficient in eliminating TBIL, DBIL, and hsCRP, but it was associated with higher loss rate of albumin. TPE and DPMAS were similar in improving 12-week survivals in HBV-ACLF. © 2017 Wiley Periodicals, Inc.

  11. A comparative hospital-based observational study of mono- and co-infections of malaria, dengue virus and scrub typhus causing acute undifferentiated fever.

    Science.gov (United States)

    Ahmad, S; Dhar, M; Mittal, G; Bhat, N K; Shirazi, N; Kalra, V; Sati, H C; Gupta, V

    2016-04-01

    Positive serology for dengue and/or scrub typhus infection with/without positive malarial smear (designated as mixed or co-infection) is being increasingly observed during epidemics of acute undifferentiated febrile illnesses (AUFIs). We planned to study the clinical and biochemical spectrum of co-infections with Plasmodium sp., dengue virus and scrub typhus and compare these with mono-infection by the same organisms. During the period from December 2012 to December 2013, all cases presenting with AUFIs to a single medical unit of a referral centre in Garhwal region of the north Indian state of Uttarakhand were retrospectively selected and categorised aetiologically as co-infections, malaria, dengue or scrub typhus. The groups thus created were compared in terms of demographic, clinical, biochemical and outcome parameters. The co-infection group (n = 49) was associated with milder clinical manifestations, fewer, milder and non-progressive organ dysfunction, and lesser need for intensive care, mechanical ventilation and dialysis as compared to mono-infections. When co-infections were sub-grouped and compared with the relevant mono-infections, there were differences in certain haematological and biochemical parameters; however, this difference did not translate into differential outcomes. Scrub typhus mono-infection was associated with severe disease in terms of both morbidity and mortality. Malaria, dengue and scrub typhus should be routinely tested in all patients with AUFIs. Co-infections, whether true or due to serological cross-reactivity, appear to be a separate entity so far as presentation and morbidity is concerned. Further insight is needed into the mechanism and identification of the protective infection.

  12. Molecular evidence for the occurrence of Japanese encephalitis virus genotype I and III infection associated with acute Encephalitis in Patients of West Bengal, India, 2010

    Directory of Open Access Journals (Sweden)

    Sarkar Arindam

    2012-11-01

    Full Text Available Abstract Background Japanese encephalitis virus (JEV, a mosquito-borne zoonotic pathogen, is the sole etiologic agent of Japanese Encephalitis (JE; a neurotropic killer disease which is one of the major causes of viral encephalitis worldwide with prime public health concern. JE was first reported in the state of West Bengal, India in 1973. Since then it is being reported every year from different districts of the state, though the vaccination has already been done. Therefore, it indicates that there might be either partial coverage of the vaccine or the emergence of mutated/new strain of JEV. Considering this fact, to understand the JEV genotype distribution, we conducted a molecular epidemiological study on a total of 135 serum/cerebrospinal fluid (CSF samples referred and/or collected from the clinically suspected patients with Acute encephalitis syndrome (AES, admitted in different district hospitals of West Bengal, India, 2010. Findings JEV etiology was confirmed in 36/135 (26.6% and 13/61 (21.3% 2–15 days’ febrile illness samples from AES cases by analyzing Mac-ELISA followed by RT-PCR test respectively. Phylogenetic analysis based on complete envelope gene sequences of 13 isolates showed the emergence of JEV genotype I (GI, co-circulating with genotype III (GIII. Conclusion This study represents the first report of JEV GI with GIII, co-circulating in West Bengal. The efficacy of the vaccine (derived from JEV GIII strain SA-14-14-2 to protect against emerging JEV GI needs careful evaluation. In future, JE outbreak is quite likely in the state, if this vaccine fails to protect sufficiently against GI of JEV.

  13. Epidemiology, clinical characteristics, laboratory findings and severity of respiratory syncytial virus acute lower respiratory infection in Malaysian children, 2008-2013.

    Science.gov (United States)

    Ng, Khuen F; Tan, Kah K; Sam, Zhi H; Ting, Grace Ss; Gan, Wan Y

    2017-04-01

    The aim of this study is to describe epidemiology, clinical features, laboratory data and severity of respiratory syncytial virus (RSV) acute lower respiratory infection (ALRI) in Malaysian children and to determine risk factors associated with prolonged hospital stay, paediatric intensive care unit (PICU) admission and mortality. Retrospective data on demographics, clinical presentation, outcomes and laboratory findings of 450 children admitted into Tuanku Jaafar Hospital in Seremban, Malaysia from 2008 to 2013 with documented diagnosis of RSV ALRI were collected and analysed. Most admissions were children below 2 years old (85.8%; 386/450). Commonest symptoms were fever (84.2%; 379/450), cough (97.8%; 440/450) and rhinorrhea (83.6%; 376/450). The median age among febrile patients (n = 379) was 9.0 months with interquartile range (IQR) of 4.0-19.0 months whereas the median age among those who were apyrexial (n = 71) was 2 months with IQR of 1-6 months (P-value history of prematurity, chronic comorbidity and thrombocytosis were significantly associated with prolonged hospital stay, PICU admission and mortality. Infants less than 6 months old with RSV ALRI tend to be afebrile at presentation. Younger age, history of prematurity, chronic comorbidity and thrombocytosis are predictors of severe RSV ALRI among Malaysian children. Case fatality rate for Malaysian children below 5 years of age with RSV ALRI in our centre is higher than what is seen in developed countries, suggesting that there is room for improvement. © 2016 Paediatrics and Child Health Division (The Royal Australasian College of Physicians).

  14. The immune evasion function of J and Beilong virus V proteins is distinct from that of other paramyxoviruses, consistent with their inclusion in the proposed genus Jeilongvirus.

    Science.gov (United States)

    Audsley, Michelle D; Marsh, Glenn A; Lieu, Kim G; Tachedjian, Mary; Joubert, D Albert; Wang, Lin-Fa; Jans, David A; Moseley, Gregory W

    2016-03-01

    IFN-antagonist function is a major determinant of pathogenicity and cross-species infection by viruses, but remains poorly defined for many potentially zoonotic viruses resident in animal species. The paramyxovirus family contains several zoonotic viruses, including highly pathogenic viruses such as Nipah virus and Hendra virus, and an increasing number of largely uncharacterized animal viruses. Here, we report the characterization of IFN antagonism by the rodent viruses J virus (JPV) and Beilong virus (BeiPV) of the proposed genus Jeilongvirus of the paramyxoviruses. Infection of cells by JPV and BeiPV was found to inhibit IFN-activated nuclear translocation of signal transducer and activator of transcription 1 (STAT1). However, in contrast to most other paramyxoviruses, the JPV and BeiPV V proteins did not interact with or inhibit signalling by STAT1 or STAT2, suggesting that JPV/BeiPV use an atypical V protein-independent strategy to target STATs, consistent with their inclusion in a separate genus. Nevertheless, the V proteins of both viruses interacted with melanoma differentiation-associated protein 5 (MDA5) and robustly inhibited MDA5-dependent activation of the IFN-β promoter. This supports a growing body of evidence that MDA5 is a universal target of paramyxovirus V proteins, such that the V-MDA5 interaction represents a potential target for broad-spectrum antiviral approaches.

  15. [Bats and Viruses: complex relationships].

    Science.gov (United States)

    Rodhain, F

    2015-10-01

    With more than 1 200 species, bats and flying foxes (Order Chiroptera) constitute the most important and diverse order of Mammals after Rodents. Many species of bats are insectivorous while others are frugivorous and few of them are hematophagous. Some of these animals fly during the night, others are crepuscular or diurnal. Some fly long distances during seasonal migrations. Many species are colonial cave-dwelling, living in a rather small home range while others are relatively solitary. However, in spite of the importance of bats for terrestrial biotic communities and ecosystem ecology, the diversity in their biology and lifestyles remain poorly known and underappreciated. More than sixty viruses have been detected or isolated in bats; these animals are therefore involved in the natural cycles of many of them. This is the case, for instance, of rabies virus and other Lyssavirus (Family Rhabdoviridae), Nipah and Hendra viruses (Paramyxoviridae), Ebola and Marburg viruses (Filoviridae), SARS-CoV and MERS-CoV (Coronaviridae). For these zoonotic viruses, a number of bat species are considered as important reservoir hosts, efficient disseminators or even directly responsible of the transmission. Some of these bat-borne viruses cause highly pathogenic diseases while others are of potential significance for humans and domestic or wild animals; so, bats are an important risk in human and animal public health. Moreover, some groups of viruses developed through different phylogenetic mechanisms of coevolution between viruses and bats. The fact that most of these viral infections are asymptomatic in bats has been observed since a long time but the mechanisms of the viral persistence are not clearly understood. The various bioecology of the different bat populations allows exchange of virus between migrating and non-migrating conspecific species. For a better understanding of the role of bats in the circulation of these viral zoonoses, epidemiologists must pay attention to

  16. Full-length genomic sequence analysis of new subtype 3k hepatitis E virus isolates with 99.97% nucleotide identity obtained from two consecutive acute hepatitis patients in a city in northeast Japan.

    Science.gov (United States)

    Miura, Masahito; Inoue, Jun; Tsuruoka, Mio; Nishizawa, Tsutomu; Nagashima, Shigeo; Takahashi, Masaharu; Shimosegawa, Tooru; Okamoto, Hiroaki

    2017-06-01

    Full-length genomic sequences of hepatitis E virus (HEV) obtained from two consecutive cases of acute self-limiting hepatitis E in a city in northeast Japan were determined. Interestingly, two HEV isolates from each patient shared nucleotide identity of 99.97% in 7 225 nucleotides, and a phylogenetic analysis showed that they formed a cluster of Japanese isolates that is considered as a new HEV subtype 3k. The high similarity of HEV sequences of two isolates from these patients in this study suggested that a subtype 3k HEV strain had spread via a commonly distributed food in the city, possibly pig liver. © 2016 Wiley Periodicals, Inc.

  17. Performance of a Novel Point-of-Care Molecular Assay for Detection of Influenza A and B Viruses and Respiratory Syncytial Virus (Enigma MiniLab) in Children with Acute Respiratory Infection.

    Science.gov (United States)

    Douthwaite, Sam T; Walker, Charlotte; Adams, Elisabeth J; Mak, Catherine; Vecino Ortiz, Andres; Martinez-Alier, Nuria; Goldenberg, Simon D

    2016-01-01

    The performance of the Enigma MiniLab assay for influenza A and B viruses and respiratory syncytial virus (RSV) was compared to a centralized laboratory respiratory virus panel. The positive and negative percent agreement for influenza A virus, influenza B virus, and RSV were 79.2% (95% confidence interval [95% CI], 57.8 to 92.9%) and 99.4% (95% CI, 98.4 to 99.9), 100% (95% CI, 47.8 to 100%) and 100% (95% CI, 99.3 to 100%), 98.5% (95% CI, 94.6 to 99.8%) and 94.5% (95% CI, 91.9 to 96.4%), respectively. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  18. Risk factors for respiratory syncytial virus associated with acute lower respiratory infection in children under five years: Systematic review and meta–analysis

    Directory of Open Access Journals (Sweden)

    Ting Shi

    2015-12-01

    Full Text Available Respiratory syncytial virus (RSV is the most common pathogen identified in young children with acute lower respiratory infection (ALRI as well as an important cause of hospital admission. The high incidence of RSV infection and its potential severe outcome make it important to identify and prioritise children who are at higher risk of developing RSV–associated ALRI. We aimed to identify risk factors for RSV–associated ALRI in young children. We carried out a systematic literature review across 4 databases and obtained unpublished studies from RSV Global Epidemiology Network (RSV GEN collaborators. Quality of all eligible studies was assessed according to modified GRADE criteria. We conducted meta–analyses to estimate odds ratios with 95% confidence intervals (CI for individual risk factors. We identified 20 studies (3 were unpublished data with “good quality” that investigated 18 risk factors for RSV–associated ALRI in children younger than five years old. Among them, 8 risk factors were significantly associated with RSV–associated ALRI. The meta–estimates of their odds ratio (ORs with corresponding 95% confidence intervals (CI are prematurity 1.96 (95% CI 1.44–2.67, low birth weight 1.91 (95% CI 1.45–2.53, being male 1.23 (95% CI 1.13–1.33, having siblings 1.60 (95% CI 1.32–1.95, maternal smoking 1.36 (95% CI 1.24–1.50, history of atopy 1.47 (95% CI 1.16–1.87, no breastfeeding 2.24 (95% CI 1.56–3.20 and crowding 1.94 (95% CI 1.29–2.93. Although there were insufficient studies available to generate a meta–estimate for HIV, all articles (irrespective of quality scores reported significant associations between HIV and RSV–associated ALRI. This study presents a comprehensive report of the strength of association between various socio–demographic risk factors and RSV–associated ALRI in young children. Some of these amenable risk factors are similar to those that have been identified for (all cause ALRI and

  19. Serum testosterone levels and androgen receptor CAG polymorphism correlate with hepatitis B virus (HBV-related acute liver failure in male HBV carriers.

    Directory of Open Access Journals (Sweden)

    Bao-Yan Xu

    Full Text Available BACKGROUND: Augmentation of androgen/androgen receptor (AR pathway may influence chronic hepatitis B (CHB more likely in males. AR activity is modulated by a polymorphic CAG repeat sequence in AR exon 1. This study aimed to investigate the relationship between serum testosterone levels, CAG repeat numbers and hepatitis B virus (HBV-related acute liver failure (ALF. METHODS: Three hundred and seventy eight male CHB patients with ALF and 441 asymptomatic HBV carriers (AsCs were recruited. AR CAG repeats numbers were analyzed. The serum testosterone levels of AsCs, ALFs and patients with hepatitis B flare groups, and sequential serum samples, were assessed quantitatively. RESULTS: The median CAG repeat (M-CAG frequency was significantly higher in ALF patients than AsCs (P<0.001. Patients with M-CAG alleles (P<0.001, OR 3.0, 95% CI 2.1-4.2 had the highest risk for ALF. Serum testosterone levels were significantly higher (P<0.001 at hepatitis flare point (8.2 ± 3.0 ng/mL than inactive phase (6.4 ± 2.0 ng/mL. CHB (8.30 ± 2.71 ng/mL, P = 7.6 × 10(-6 and ALF group (2.61 ± 1.83 ng/mL, P = 1.7 × 10(-17 had significantly different levels of testosterone in comparison with AsCs group (6.56 ± 2.36 ng/mL. The serum testosterone levels sharply decreased from hepatitis flare phase to liver failure phase, and tended to be normal at the recovery phase. Male AsCs with M-CAG alleles had significantly lower serum testosterone levels (P<0.05. CONCLUSIONS: There was a serum testosterone fluctuation during hepatitis B flare and HBV-related ALF, and the median CAG repeats in AR gene exon 1 were associated with lower serum testosterone levels in asymptomatic HBV carriers and an increased susceptibility to HBV-related ALF.

  20. In-vitro infection of pupae with Israeli Acute Paralysis Virus suggests variation for susceptibility and disturbance of transcriptional homeostasis in honey bees (Apis mellifera)

    Science.gov (United States)

    The ongoing decline of honey bee health worldwide is a serious economic and ecological concern. One major contributor to the decline are pathogens, including several honey bee viruses. However, information is limited on the biology of bee viruses and molecular interactions with their hosts. An exper...

  1. Kaempferol ameliorates H9N2 swine influenza virus-induced acute lung injury by inactivation of TLR4/MyD88-mediated NF-κB and MAPK signaling pathways.

    Science.gov (United States)

    Zhang, Ruihua; Ai, Xia; Duan, Yongjie; Xue, Man; He, Wenxiao; Wang, Cunlian; Xu, Tong; Xu, Mingju; Liu, Baojian; Li, Chunhong; Wang, Zhijun; Zhang, Ruihong; Wang, Guohua; Tian, Shufei; Liu, Huifeng

    2017-05-01

    Kaempferol, a very common type of dietary flavonoids, has been found to exert antioxidative and anti-inflammatory properties. The purpose of our investigation was designed to reveal the effect of kaempferol on H9N2 influenza virus-induced inflammation in vivo and in vitro. In vivo, BALB/C mice were infected intranasally with H9N2 influenza virus with or without kaempferol treatment to induce acute lung injury (ALI) model. In vitro, MH-S cells were infected with H9N2 influenza virus with or without kaempferol treatment. In vivo, kaempferol treatment attenuated pulmonary edema, the W/D mass ratio, pulmonary capillary permeability, myeloperoxidase (MPO) activity, and the numbers of inflammatory cells. Kaempferol reduced ROS and Malondialdehyde (MDA) production, and increased the superoxide dismutase (SOD) activity. Kaempferol also reduced overproduction of TNF-α, IL-1β and IL-6. In addition, kaempferol decreased the H9N2 viral titre. In vitro, ROS, MDA, TNF-α, IL-1β and IL-6 was also reduced by kaempferol. Moreover, our data showed that kaempferol significantly inhibited the upregulation of toll-like receptor 4 (TLR4), myeloid differentiation factor 88 (MyD88), phosphorylation level of IκBα and nuclear factor-κB (NF-κB) p65, NF-κB p65 DNA binding activity, and phosphorylation level of MAPKs, both in vivo and in vitro. These results suggest that kaempferol exhibits a protective effect on H9N2 virus-induced inflammation via suppression of TLR4/MyD88-mediated NF-κB and MAPKs pathways, and kaempferol may be considered as an effective drug for the potential treatment of influenza virus-induced ALI. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  2. Ebola Virus and Marburg Virus

    Science.gov (United States)

    Ebola virus and Marburg virus Overview Ebola virus and Marburg virus are related viruses that cause hemorrhagic fevers — illnesses marked by severe bleeding (hemorrhage), organ failure and, in many ...

  3. Efficacy of four commercially available multivalent modified-live virus vaccines against clinical disease, viremia, and viral shedding in early-weaned beef calves exposed simultaneously to cattle persistently infected with bovine viral diarrhea virus and cattle acutely infected with bovine herpesvirus 1.

    Science.gov (United States)

    Chamorro, Manuel F; Walz, Paul H; Passler, Thomas; Palomares, Roberto; Newcomer, Benjamin W; Riddell, Kay P; Gard, Julie; Zhang, Yijing; Galik, Patricia

    2016-01-01

    To evaluate the efficacy of 4 commercially available multivalent modified-live virus vaccines against clinical disease, viremia, and viral shedding caused by bovine viral diarrhea virus (BVDV) and bovine herpesvirus 1 (BHV1) in early-weaned beef calves. 54 early-weaned beef steers (median age, 95 days). Calves were randomly assigned to 1 of 5 groups and administered PBSS (group A [control]; n = 11) or 1 of 4 commercially available modified-live virus vaccines that contained antigens against BHV1, BVDV types 1 (BVDV1) and 2 (BVDV2), parainfluenza type 3 virus, and bovine respiratory syncytial virus (groups B [11], C [10], D [11], and E [11]). Forty-five days after vaccination, calves were exposed simultaneously to 6 cattle persistently infected with BVDV and 8 calves acutely infected with BHV1 for 28 days (challenge exposure). For each calf, serum antibody titers against BVDV and BHV1 were determined before vaccination and before and after challenge exposure. Virus isolation was performed on nasal secretions, serum, and WBCs at predetermined times during the 28-day challenge exposure. None of the calves developed severe clinical disease or died. Mean serum anti-BHV1 antibody titers did not differ significantly among the treatment groups at any time and gradually declined during the study. Mean serum anti-BVDV antibody titers appeared to be negatively associated with the incidence of viremia and BVDV shedding. The unvaccinated group (A) had the lowest mean serum anti-BVDV antibody titers. The mean serum anti-BVDV antibody titers for group D were generally lower than those for groups B, C, and E. Results indicated differences in vaccine efficacy for the prevention of BVDV viremia and shedding in early-weaned beef calves.

  4. Hepatitis E Virus

    Directory of Open Access Journals (Sweden)

    Christina Levick

    2014-05-01

    Full Text Available Hepatitis E virus (HEV is the most common cause of acute viral hepatitis in the developing world. It is a waterborne virus that can cause epidemics in the face of overcrowding and poor sanitation. Although the hepatitis illness is usually self-limiting, it has a high mortality in pregnant women and can become a chronic infection in the immunosuppressed. Treatment is mostly supportive and prevention is by good water hygiene.

  5. [Emergence of new viruses in Asia: is climate change involved?].

    Science.gov (United States)

    Chastel, C

    2004-11-01

    Tropical Africa is not the only area where deadly viruses have recently emerged. In South-East Asia severe epidemics of dengue hemorrhagic fever started in 1954 and flu pandemics have originated from China such as the Asian flu (H2N2) in 1957, the Hong-Kong flu (H3N2) in 1968, and the Russian flu (H1N1) in 1977. However, it is especially during the last ten years that very dangerous viruses for mankind have repeatedly developed in Asia, with the occurrence of Alkhurma hemorrhagic fever in Saudi Arabia (1995), avian flu (H5N1) in Hong-Kong (1997), Nipah virus encephalitis in Malaysia (1998,) and, above all, the SARS pandemic fever from Southern China (2002). The evolution of these viral diseases was probably not directly affected by climate change. In fact, their emergential success may be better explained by the development of large industry poultry flocks increasing the risks of epizootics, dietary habits, economic and demographic constraints, and negligence in the surveillance and reporting of the first cases.

  6. Intestinal TSH production is localized in crypt enterocytes and in villus 'hotblocks' and is coupled to IL-7 production: evidence for involvement of TSH during acute enteric virus infection.

    Science.gov (United States)

    Scofield, Virginia L; Montufar-Solis, Dina; Cheng, Elly; Estes, Mary K; Klein, John R

    2005-06-15

    The immune and neuroendocrine systems have been shown to work conjointly in a number of ways. One aspect of this has to do with a potential role for thyroid stimulating hormone (TSH) in the regulation of the mucosal immune system, although the mechanisms by which this occurs remain vague. To more thoroughly understand how TSH participates in intestinal intraepithelial lymphocyte (IEL) development and immunity, experiments have been conducted to define local sites of intestinal TSH production, and to characterize changes that occur in the synthesis of TSH during acute enteric virus infection. Here, we demonstrate that TSH in the small intestine is specifically localized to regions below villus crypts as seen by immunocytochemical staining, which revealed high-level TSH staining in lower crypts in the absence of IL-7 staining, and TSH and IL-7 co-staining in upper crypt regions. Additionally, prominent TSH staining was evident in TSH 'hotblocks' sparsely dispersed throughout the epithelial layer. In rotavirus-infected mice, the TSH staining pattern differed significantly from that of non-infected animals. Notably, at 2 and 3 days post-infection, TSH expression was high in and near apical villi where virus infection was greatest. These findings lend credence to the notion that TSH plays a role both in the development of intestinal T cells, and in the process of local immunity during enteric virus infection.

  7. Influenza and other respiratory viruses involved in severe acute respiratory disease in northern Italy during the pandemic and postpandemic period (2009-2011)

    NARCIS (Netherlands)

    Pariani, Elena; Martinelli, Marianna; Canuti, Marta; Jazaeri Farsani, Seyed Mohammad; Oude Munnink, Bas B.; Deijs, Martin; Tanzi, Elisabetta; Zanetti, Alessandro; van der Hoek, Lia; Amendola, Antonella

    2014-01-01

    Since 2009 pandemic, international health authorities recommended monitoring severe and complicated cases of respiratory disease, that is, severe acute respiratory infection (SARI) and acute respiratory distress syndrome (ARDS). We evaluated the proportion of SARI/ARDS cases and deaths due to

  8. Chronic herpes simplex virus encephalitis in childhood.

    NARCIS (Netherlands)

    Leen, W.G.; Weemaes, C.M.R.; Verbeek, M.M.; Willemsen, M.A.A.P.; Rotteveel, J.J.

    2006-01-01

    Although herpes simplex virus is a major cause of acute encephalitis in childhood, chronic herpes simplex virus encephalitis has only rarely been reported. This report presents a case of chronic herpes simplex virus encephalitis in a 6-year-old female. Diagnosis was based on the detection of herpes

  9. Kanyawara Virus: A Novel Rhabdovirus Infecting Newly Discovered Nycteribiid Bat Flies Infesting Previously Unknown Pteropodid Bats in Uganda.

    Science.gov (United States)

    Goldberg, Tony L; Bennett, Andrew J; Kityo, Robert; Kuhn, Jens H; Chapman, Colin A

    2017-07-13

    Bats are natural reservoir hosts of highly virulent pathogens such as Marburg virus, Nipah virus, and SARS coronavirus. However, little is known about the role of bat ectoparasites in transmitting and maintaining such viruses. The intricate relationship between bats and their ectoparasites suggests that ectoparasites might serve as viral vectors, but evidence to date is scant. Bat flies, in particular, are highly specialized obligate hematophagous ectoparasites that incidentally bite humans. Using next-generation sequencing, we discovered a novel ledantevirus (mononegaviral family Rhabdoviridae, genus Ledantevirus) in nycteribiid bat flies infesting pteropodid bats in western Uganda. Mitochondrial DNA analyses revealed that both the bat flies and their bat hosts belong to putative new species. The coding-complete genome of the new virus, named Kanyawara virus (KYAV), is only distantly related to that of its closest known relative, Mount Elgon bat virus, and was found at high titers in bat flies but not in blood or on mucosal surfaces of host bats. Viral genome analysis indicates unusually low CpG dinucleotide depletion in KYAV compared to other ledanteviruses and rhabdovirus groups, with KYAV displaying values similar to rhabdoviruses of arthropods. Our findings highlight the possibility of a yet-to-be-discovered diversity of potentially pathogenic viruses in bat ectoparasites.

  10. Meeting the Challenge of Zoonotic Emerging Infectious Diseases in ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Over one third of the world's EIDs have emerged there, including severe acute respiratory syndrome (SARS), highly pathogenic avian influenza (HPAI) or bird flu, and the Nipah virus. This grant will allow the International Livestock Research Institute (ILRI), in collaboration with research teams from Cambodia, China, ...

  11. Protection from Hendra virus infection with Canarypox recombinant vaccine.

    Science.gov (United States)

    Guillaume-Vasselin, Vanessa; Lemaitre, Laurent; Dhondt, Kévin P; Tedeschi, Laurence; Poulard, Amelie; Charreyre, Catherine; Horvat, Branka

    2016-01-01

    Hendra virus (HeV) is an emerging zoonotic pathogen, which causes severe respiratory illness and encephalitis in humans and horses. Since its first appearance in 1994, spillovers of HeV from its natural reservoir fruit bats occur on almost an annual basis. The high mortality rate in both humans and horses and the wide-ranging reservoir distribution are making HeV a serious public health problem, especially for people exposed to sick horses. This study has aimed to develop an efficient low-cost HeV vaccine for horses based on Canarypox recombinant vector expressing HeV glycoproteins, attachment glycoprotein (G) and fusion protein (F). This vaccine was used to immunise hamsters and then challenged intraperitoneally with HeV 3 weeks later. The higher tested dose of the vaccine efficiently prevented oropharyngeal virus shedding and protected animals from clinical disease and virus-induced mortality. Vaccine induced generation of seroneutralising antibodies and prevented virus-induced histopathological changes and a production of viral RNA and antigens in animal tissues. Interestingly, some vaccinated animals, including those immunised at a lower dose, were protected in the absence of detectable specific antibodies, suggesting the induction of an efficient virus-specific cellular immunity. Finally, ponies immunised using the same vaccination protocol as hamsters developed strong seroneutralising titres against both HeV and closely related Nipah virus, indicating that this vaccine may have the ability to induce cross-protection against Henipavirus infection. These data suggest that Canarypox-based vectors encoding for HeV glycoproteins present very promising new vaccine candidate to prevent infection and shedding of the highly lethal HeV.

  12. Cedar virus: a novel Henipavirus isolated from Australian bats.

    Directory of Open Access Journals (Sweden)

    Glenn A Marsh

    Full Text Available The genus Henipavirus in the family Paramyxoviridae contains two viruses, Hendra virus (HeV and Nipah virus (NiV for which pteropid bats act as the main natural reservoir. Each virus also causes serious and commonly lethal infection of people as well as various species of domestic animals, however little is known about the associated mechanisms of pathogenesis. Here, we report the isolation and characterization of a new paramyxovirus from pteropid bats, Cedar virus (CedPV, which shares significant features with the known henipaviruses. The genome size (18,162 nt and organization of CedPV is very similar to that of HeV and NiV; its nucleocapsid protein displays antigenic cross-reactivity with henipaviruses; and it uses the same receptor molecule (ephrin-B2 for entry during infection. Preliminary challenge studies with CedPV in ferrets and guinea pigs, both susceptible to infection and disease with known henipaviruses, confirmed virus replication and production of neutralizing antibodies although clinical disease was not observed. In this context, it is interesting to note that the major genetic difference between CedPV and HeV or NiV lies within the coding strategy of the P gene, which is known to play an important role in evading the host innate immune system. Unlike HeV, NiV, and almost all known paramyxoviruses, the CedPV P gene lacks both RNA editing and also the coding capacity for the highly conserved V protein. Preliminary study indicated that CedPV infection of human cells induces a more robust IFN-β response than HeV.

  13. The nucleocapsid proteins of mouse hepatitis virus and severe acute respiratory syndrome coronavirus share the same IFN-β antagonizing mechanism: attenuation of PACT-mediated RIG-I/ MDA5 activation.

    Science.gov (United States)

    Ding, Zhen; Fang, Liurong; Yuan, Shuangling; Zhao, Ling; Wang, Xunlei; Long, Siwen; Wang, Mohan; Wang, Dang; Foda, Mohamed Frahat; Xiao, Shaobo

    2017-07-25

    Coronaviruses (CoVs) are a huge threat to both humans and animals and have evolved elaborate mechanisms to antagonize interferons (IFNs). Nucleocapsid (N) protein is the most abundant viral protein in CoV-infected cells, and has been identified as an innate immunity antagonist in several CoVs, including mouse hepatitis virus (MHV) and severe acute respiratory syndrome (SARS)-CoV. However, the underlying molecular mechanism(s) remain unclear. In this study, we found that MHV N protein inhibited Sendai virus and poly(I:C)-induced IFN-β production by targeting a molecule upstream of retinoic acid-induced gene I (RIG-I) and melanoma differentiation gene 5 (MDA5). Further studies showed that both MHV and SARS-CoV N proteins directly interacted with protein activator of protein kinase R (PACT), a cellular dsRNA-binding protein that can bind to RIG-I and MDA5 to activate IFN production. The N-PACT interaction sequestered the association of PACT and RIG-I/MDA5, which in turn inhibited IFN-β production. However, the N proteins from porcine epidemic diarrhea virus (PEDV) and porcine reproductive and respiratory syndrome virus (PRRSV), which are also classified in the order Nidovirales, did not interact and counteract with PACT. Taken together, our present study confirms that both MHV and SARS-CoV N proteins can perturb the function of cellular PACT to circumvent the innate antiviral response. However, this strategy does not appear to be used by all CoVs N proteins.

  14. High-Dose Mannose-Binding Lectin Therapy for Ebola Virus Infection

    Science.gov (United States)

    2010-06-01

    viruses . N-glycosylation of viral envelopes is an important such target shared between in- fluenza, HIV, HCV, West Nile virus , SARS-CoV, Hendra virus ...host cells. Therefore, MBL preferentially recognizes glycosylated viruses including influenza virus , human immunodeficiency virus , severe acute...are heavily glycosylated and contain high-mannose. As a result, MBL binds to Ebola and Marburg viruses and mediates com- plement-dependent virus

  15. Global, regional, and national disease burden estimates of acute lower respiratory infections due to respiratory syncytial virus in young children in 2015: a systematic review and modelling study.

    Science.gov (United States)

    Shi, Ting; McAllister, David A; O'Brien, Katherine L; Simoes, Eric A F; Madhi, Shabir A; Gessner, Bradford D; Polack, Fernando P; Balsells, Evelyn; Acacio, Sozinho; Aguayo, Claudia; Alassani, Issifou; Ali, Asad; Antonio, Martin; Awasthi, Shally; Awori, Juliet O; Azziz-Baumgartner, Eduardo; Baggett, Henry C; Baillie, Vicky L; Balmaseda, Angel; Barahona, Alfredo; Basnet, Sudha; Bassat, Quique; Basualdo, Wilma; Bigogo, Godfrey; Bont, Louis; Breiman, Robert F; Brooks, W Abdullah; Broor, Shobha; Bruce, Nigel; Bruden, Dana; Buchy, Philippe; Campbell, Stuart; Carosone-Link, Phyllis; Chadha, Mandeep; Chipeta, James; Chou, Monidarin; Clara, Wilfrido; Cohen, Cheryl; de Cuellar, Elizabeth; Dang, Duc-Anh; Dash-Yandag, Budragchaagiin; Deloria-Knoll, Maria; Dherani, Mukesh; Eap, Tekchheng; Ebruke, Bernard E; Echavarria, Marcela; de Freitas Lázaro Emediato, Carla Cecília; Fasce, Rodrigo A; Feikin, Daniel R; Feng, Luzhao; Gentile, Angela; Gordon, Aubree; Goswami, Doli; Goyet, Sophie; Groome, Michelle; Halasa, Natasha; Hirve, Siddhivinayak; Homaira, Nusrat; Howie, Stephen R C; Jara, Jorge; Jroundi, Imane; Kartasasmita, Cissy B; Khuri-Bulos, Najwa; Kotloff, Karen L; Krishnan, Anand; Libster, Romina; Lopez, Olga; Lucero, Marilla G; Lucion, Florencia; Lupisan, Socorro P; Marcone, Debora N; McCracken, John P; Mejia, Mario; Moisi, Jennifer C; Montgomery, Joel M; Moore, David P; Moraleda, Cinta; Moyes, Jocelyn; Munywoki, Patrick; Mutyara, Kuswandewi; Nicol, Mark P; Nokes, D James; Nymadawa, Pagbajabyn; da Costa Oliveira, Maria Tereza; Oshitani, Histoshi; Pandey, Nitin; Paranhos-Baccalà, Gláucia; Phillips, Lia N; Picot, Valentina Sanchez; Rahman, Mustafizur; Rakoto-Andrianarivelo, Mala; Rasmussen, Zeba A; Rath, Barbara A; Robinson, Annick; Romero, Candice; Russomando, Graciela; Salimi, Vahid; Sawatwong, Pongpun; Scheltema, Nienke; Schweiger, Brunhilde; Scott, J Anthony G; Seidenberg, Phil; Shen, Kunling; Singleton, Rosalyn; Sotomayor, Viviana; Strand, Tor A; Sutanto, Agustinus; Sylla, Mariam; Tapia, Milagritos D; Thamthitiwat, Somsak; Thomas, Elizabeth D; Tokarz, Rafal; Turner, Claudia; Venter, Marietjie; Waicharoen, Sunthareeya; Wang, Jianwei; Watthanaworawit, Wanitda; Yoshida, Lay-Myint; Yu, Hongjie; Zar, Heather J; Campbell, Harry; Nair, Harish

    2017-09-02

    We have previously estimated that respiratory syncytial virus (RSV) was associated with 22% of all episodes of (severe) acute lower respiratory infection (ALRI) resulting in 55 000 to 199 000 deaths in children younger than 5 years in 2005. In the past 5 years, major research activity on RSV has yielded substantial new data from developing countries. With a considerably expanded dataset from a large international collaboration, we aimed to estimate the global incidence, hospital admission rate, and mortality from RSV-ALRI episodes in young children in 2015. We estimated the incidence and hospital admission rate of RSV-associated ALRI (RSV-ALRI) in children younger than 5 years stratified by age and World Bank income regions from a systematic review of studies published between Jan 1, 1995, and Dec 31, 2016, and unpublished data from 76 high quality population-based studies. We estimated the RSV-ALRI incidence for 132 developing countries using a risk factor-based model and 2015 population estimates. We estimated the in-hospital RSV-ALRI mortality by combining in-hospital case fatality ratios with hospital admission estimates from hospital-based (published and unpublished) studies. We also estimated overall RSV-ALRI mortality by identifying studies reporting monthly data for ALRI mortality in the community and RSV activity. We estimated that globally in 2015, 33·1 million (uncertainty range [UR] 21·6-50·3) episodes of RSV-ALRI, resulted in about 3·2 million (2·7-3·8) hospital admissions, and 59 600 (48 000-74 500) in-hospital deaths in children younger than 5 years. In children younger than 6 months, 1·4 million (UR 1·2-1·7) hospital admissions, and 27 300 (UR 20 700-36 200) in-hospital deaths were due to RSV-ALRI. We also estimated that the overall RSV-ALRI mortality could be as high as 118 200 (UR 94 600-149 400). Incidence and mortality varied substantially from year to year in any given population. Globally, RSV is a common cause

  16. Transmission or Within-Host Dynamics Driving Pulses of Zoonotic Viruses in Reservoir–Host Populations

    Science.gov (United States)

    Plowright, Raina K.; Peel, Alison J.; Streicker, Daniel G.; Gilbert, Amy T.; McCallum, Hamish; Wood, James; Baker, Michelle L.; Restif, Olivier

    2016-01-01

    Progress in combatting zoonoses that emerge from wildlife is often constrained by limited knowledge of the biology of pathogens within reservoir hosts. We focus on the host–pathogen dynamics of four emerging viruses associated with bats: Hendra, Nipah, Ebola, and Marburg viruses. Spillover of bat infections to humans and domestic animals often coincides with pulses of viral excretion within bat populations, but the mechanisms driving such pulses are unclear. Three hypotheses dominate current research on these emerging bat infections. First, pulses of viral excretion could reflect seasonal epidemic cycles driven by natural variations in population densities and contact rates among hosts. If lifelong immunity follows recovery, viruses may disappear locally but persist globally through migration; in either case, new outbreaks occur once births replenish the susceptible pool. Second, epidemic cycles could be the result of waning immunity within bats, allowing local circulation of viruses through oscillating herd immunity. Third, pulses could be generated by episodic shedding from persistently infected bats through a combination of physiological and ecological factors. The three scenarios can yield similar patterns in epidemiological surveys, but strategies to predict or manage spillover risk resulting from each scenario will be different. We outline an agenda for research on viruses emerging from bats that would allow for differentiation among the scenarios and inform development of evidence-based interventions to limit threats to human and animal health. These concepts and methods are applicable to a wide range of pathogens that affect humans, domestic animals, and wildlife. PMID:27489944

  17. Potential risk factors and seroprevalence of hepatitis C virus ...

    African Journals Online (AJOL)

    Hepatitis is a liver disease that is highly contagious. The disease usually results from infection with the virus, Hepatitis C virus (HCV). Infection with Hepatitis C virus is among themajor causes of chronic liver disease globally. The infection can begin as acute infection but in some people, the virus remains in the body for a ...

  18. Molecular biology and pathogenesis of hepatitis E virus

    Indian Academy of Sciences (India)

    2008-10-15

    Oct 15, 2008 ... The hepatitis E virus (HEV) is a small RNA virus and the etiological agent for hepatitis E, a form of acute viral hepatitis. The virus has a feco-oral transmission cycle and is transmitted through environmental contamination, mainly through drinking water. Recent studies on the isolation of HEV-like viruses from ...

  19. Detection of three honeybee viruses simultaneously by a single ...

    African Journals Online (AJOL)

    A single multiplex reverse transcriptase (RT) polymerase chain reaction (PCR) assay was developed for the simultaneous detection of three honeybee viruses: acute bee paralysis virus (ABPV), sacbrood virus (SBV) and black queen cell virus (BQCV). Unique PCR primers were designed from the complete genome ...

  20. Acta Medica Indonesiana - The Indonesian Journal of Internal Medicine 153 Malignant Pleural Effusion in Acute Myeloid Leukemia with Hepatitis B Virus Infection

    Directory of Open Access Journals (Sweden)

    C Suharti

    2016-05-01

    Full Text Available Pleural effusions can be the first presentation of a hematologic malignancy. The most common disorders with pleural effusion are Hodgkin and non-Hodgkin lymphoma with a frequency of 20 to 30%, especially if mediastinal involvement. Acute and chronic leukemia are rarely accompanied by pleural involvement. We describe a 46-year-old female with history of progressive dyspnoea. Physical examination was revealed massive left pleural effusion. Complete blood count revealed anemia, trombositopenia and normal leucocyte count. Viral serology test shown positive of HBsAg and total antiHBc. Chest X-ray revealed left pleural effusion. Pleural fluid cytology was myeloblast consistent with acute myeloid leukemia (AML. Bone marrow aspiration smear, bone marrow biopsy smear, and flow cytometry analysis were consistent with acute myeloid leukemia without maturation (AML M0-FAB classification. Key words: Acute myeloid leukemia, pleural effusion, infection.

  1. Clinical, epidemiological and virological features of dengue virus infections in vietnamese patients presenting to primary care facilities with acute undifferentiated fever

    NARCIS (Netherlands)

    Thai, Khoa T. D.; Phuong, Hoang Lan; Thanh Nga, Tran Thi; Giao, Phan Trong; Hung, Le Quoc; van Nam, Nguyen; Binh, Tran Quang; Simmons, Cameron; Farrar, Jeremy; Hien, Tran Thinh; Rogier van Doorn, H.; de Jong, Menno D.; de Vries, Peter J.

    2010-01-01

    Objectives: To explore clinical and virological characteristics and describe the epidemiology of dengue in patients who presented with acute undifferentiated fever (AUF) at primary health centers (PHC) in Binh Thuan Province, Vietnam. Methods: A prospective observational study was conducted from

  2. Patterns of Human Respiratory Viruses and Lack of MERS-Coronavirus in Patients with Acute Upper Respiratory Tract Infections in Southwestern Province of Saudi Arabia

    Directory of Open Access Journals (Sweden)

    Ahmed A. Abdulhaq

    2017-01-01

    Full Text Available We undertook enhanced surveillance of those presenting with respiratory symptoms at five healthcare centers by testing all symptomatic outpatients between November 2013 and January 2014 (winter time. Nasal swabs were collected from 182 patients and screened for MERS-CoV as well as other respiratory viruses using RT-PCR and multiplex microarray. A total of 75 (41.2% of these patients had positive viral infection. MERS-CoV was not detected in any of the samples. Human rhinovirus (hRV was the most detected pathogen (40.9% followed by non-MERS-CoV human coronaviruses (19.3%, influenza (Flu viruses (15.9%, and human respiratory syncytial virus (hRSV (13.6%. Viruses differed markedly depending on age in which hRV, Flu A, and hCoV-OC43 were more prevalent in adults and RSV, hCoV-HKU1, and hCoV-NL63 were mostly restricted to children under the age of 15. Moreover, coinfection was not uncommon in this study, in which 17.3% of the infected patients had dual infections due to several combinations of viruses. Dual infections decreased with age and completely disappeared in people older than 45 years. Our study confirms that MERS-CoV is not common in the southwestern region of Saudi Arabia and shows high diversity and prevalence of other common respiratory viruses. This study also highlights the importance and contribution of enhanced surveillance systems for better infection control.

  3. C-reactive protein, haptoglobin, serum amyloid A and pig major acute phase protein response in pigs simultaneously infected with H1N1 swine influenza virus and Pasteurella multocida.

    Science.gov (United States)

    Pomorska-Mól, Małgorzata; Markowska-Daniel, Iwona; Kwit, Krzysztof; Stępniewska, Katarzyna; Pejsak, Zygmunt

    2013-01-18

    Swine influenza (SI) is an acute respiratory disease caused by swine influenza virus (SIV). Swine influenza is generally characterized by acute onset of fever and respiratory symptoms. The most frequent complications of influenza are secondary bacterial pneumonia. The objective of this work was to study the acute phase proteins (APP) responses after coinfection of piglets with H1N1 swine influenza virus (SwH1N1) and Pasteurella multocida (Pm) in order to identify whether the individual APP response correlate with disease severity and whether APP could be used as markers of the health status of coinfected pigs. In all coinfected pigs clinical sings, including fever, coughing and dyspnea, were seen. Viral shedding was observed from 2 to 7 dpi. The mean level of antibodies against Pm dermonecrotoxin in infected piglets increase significantly from 7 dpi. Anti-SwH1N1 antibodies in the serum were detected from 7 dpi. The concentration of C-reactive protein (CRP) increased significantly at 1 dpi as compared to control pigs, and remained significantly higher to 3 dpi. Level of serum amyloid A (SAA) was significantly higher from 2 to 3 dpi. Haptoglobin (Hp) was significantly elevated from 3 dpi to the end of study, while pig major acute phase protein (Pig-MAP) from 3 to 7 dpi. The concentrations of CRP, Hp and SAA significantly increased before specific antibodies were detected. Positive correlations were found between serum concentration of Hp and SAA and lung scores, and between clinical score and concentrations of Pig-MAP and SAA. The results of current study confirmed that monitoring of APP may revealed ongoing infection, and in this way may be useful in selecting clinically healthy pigs (i.e. before integration into an uninfected herd). Present results corroborated our previous findings that SAA could be a potentially useful indicator in experimental infection studies (e.g. vaccine efficiency investigations) or as a marker for disease severity, because of correlation

  4. Henipavirus Mediated Membrane Fusion, Virus Entry and Targeted Therapeutics

    Directory of Open Access Journals (Sweden)

    Dimitar B. Nikolov

    2012-02-01

    Full Text Available The Paramyxoviridae genus Henipavirus is presently represented by the type species Hendra and Nipah viruses which are both recently emerged zoonotic viral pathogens responsible for repeated outbreaks associated with high morbidity and mortality in Australia, Southeast Asia, India and Bangladesh. These enveloped viruses bind and enter host target cells through the coordinated activities of their attachment (G and class I fusion (F envelope glycoproteins. The henipavirus G glycoprotein interacts with host cellular B class ephrins, triggering conformational alterations in G that lead to the activation of the F glycoprotein, which facilitates the membrane fusion process. Using the recently published structures of HeV-G and NiV-G and other paramyxovirus glycoproteins, we review the features of the henipavirus envelope glycoproteins that appear essential for mediating the viral fusion process, including receptor binding, G-F interaction, F activation, with an emphasis on G and the mutations that disrupt viral infectivity. Finally, recent candidate therapeutics for henipavirus-mediated disease are summarized in light of their ability to inhibit HeV and NiV entry by targeting their G and F glycoproteins.

  5. Hashimoto's Thyroiditis Presenting as Acute Painful Thyroiditis and as a Manifestation of an Immune Reconstitution Inflammatory Syndrome in a Human Immunodeficiency Virus-Seropositive Patient.

    NARCIS (Netherlands)

    Visser, R.; Mast, Q. de; Netea-Maier, R.T.; Ven, A.J.A.M. van der

    2012-01-01

    Background: An immune reconstitution inflammatory syndrome (IRIS) may complicate immune restoration following start of antiretroviral therapy (ART) in human immunodeficiency virus (HIV)-infected patients. The occurrence of Graves' disease in the setting of an IRIS is well recognized. We hereby

  6. A recombinant Hendra virus G glycoprotein-based subunit vaccine protects ferrets from lethal Hendra virus challenge.

    Science.gov (United States)

    Pallister, Jackie; Middleton, Deborah; Wang, Lin-Fa; Klein, Reuben; Haining, Jessica; Robinson, Rachel; Yamada, Manabu; White, John; Payne, Jean; Feng, Yan-Ru; Chan, Yee-Peng; Broder, Christopher C

    2011-08-05

    The henipaviruses, Hendra virus (HeV) and Nipah virus (NiV), are two deadly zoonotic viruses for which no vaccines or therapeutics have yet been approved for human or livestock use. In 14 outbreaks since 1994 HeV has been responsible for multiple fatalities in horses and humans, with all known human infections resulting from close contact with infected horses. A vaccine that prevents virus shedding in infected horses could interrupt the chain of transmission to humans and therefore prevent HeV disease in both. Here we characterise HeV infection in a ferret model and show that it closely mirrors the disease seen in humans and horses with induction of systemic vasculitis, including involvement of the pulmonary and central nervous systems. This model of HeV infection in the ferret was used to assess the immunogenicity and protective efficacy of a subunit vaccine based on a recombinant soluble version of the HeV attachment glycoprotein G (HeVsG), adjuvanted with CpG. We report that ferrets vaccinated with a 100 μg, 20 μg or 4 μg dose of HeVsG remained free of clinical signs of HeV infection following a challenge with 5000 TCID₅₀ of HeV. In addition, and of considerable importance, no evidence of virus or viral genome was detected in any tissues or body fluids in any ferret in the 100 and 20 μg groups, while genome was detected in the nasal washes only of one animal in the 4 μg group. Together, our findings indicate that 100 μg or 20 μg doses of HeVsG vaccine can completely prevent a productive HeV infection in the ferret, suggesting that vaccination to prevent the infection and shedding of HeV is possible. Copyright © 2011 Elsevier Ltd. All rights reserved.

  7. First report of Israeli acute paralysis virus in asymptomatic hives of Argentina Primera comunciación del virus israelí de la parálisis aguda en colmenas asintomáticas de la República Argentina

    Directory of Open Access Journals (Sweden)

    Francisco J. Reynaldi

    2011-06-01

    Full Text Available Honey bee mortality has recently been associated with Israeli acute paralysis virus (IAPV, a proposed etiological agent for a new syndrome known as Colony Collapse Disorder. Bees infected with this virus show shivering wings, progress into paralysis, and finally die outside the hive. During the last years, honey bee mortality became a serious problem for Argentinean beekeepers. We herein report the preliminary results of a survey carried out to detect IAPV in samples taken from several Argentine provinces, by using a reverse transcription Polymerase Chain Reaction assay. Our data indicate the existence of high frequency of IAPV in asymptomatic hives of Argentina.Recientemente la mortalidad de las abejas melíferas ha sido asociada al virus israelí de la parálisis aguda (IAPV, propuesto como agente etiológico del denominado síndrome de despoblamiento de las colmenas. Las abejas infectadas con este virus presentan temblores en las alas que progresan hasta convertirse en parálisis, y finalmente mueren fuera de la colmena. Durante los últimos años, la mortalidad de las abejas melíferas se ha transformado en un serio problema para los productores de miel de la Argentina. Nosotros informamos aquí los resultados preliminares de un estudio realizado para detectar IAPV en muestras de colmenas provenientes de varias provincias argentinas utilizando la técnica de transcripción reversa-reacción en cadena de la polimerasa. Nuestros datos indican la presencia de IAPV en un alto porcentaje de las colonias estudiadas.

  8. Acute pancreatitis

    Science.gov (United States)

    ... its blood vessels. This problem is called acute pancreatitis. Acute pancreatitis affects men more often than women. Certain ... well it can be treated. Complications of acute pancreatitis may include: Acute kidney failure Long-term lung damage (ARDS) Buildup ...

  9. Full-Length Characterization of Hepatitis C Virus Subtype 3a Reveals Novel Hypervariable Regions under Positive Selection during Acute Infection▿

    OpenAIRE

    Humphreys, Isla; Fleming, Vicki; Fabris, Paolo; Parker, Joe; Schulenberg, Bodo; Brown, Anthony; Demetriou, Charis; Gaudieri, Silvana; Pfafferott, Katja; Lucas, Michaela; Collier, Jane; Huang, Kuan-Hsiang Gary; Pybus, Oliver G.; Klenerman, Paul; Barnes, Eleanor

    2009-01-01

    Hepatitis C virus subtype 3a is a highly prevalent and globally distributed strain that is often associated with infection via injection drug use. This subtype exhibits particular phenotypic characteristics. In spite of this, detailed genetic analysis of this subtype has rarely been performed. We performed full-length viral sequence analysis in 18 patients with chronic HCV subtype 3a infection and assessed genomic viral variability in comparison to other HCV subtypes. Two novel regions of int...

  10. Preemptive CD8 T-Cell Immunotherapy of Acute Cytomegalovirus Infection Prevents Lethal Disease, Limits the Burden of Latent Viral Genomes, and Reduces the Risk of Virus Recurrence

    OpenAIRE

    Steffens, Hans-Peter; Kurz, Sabine; Holtappels, Rafaela; Reddehase, Matthias J.

    1998-01-01

    In the immunocompetent host, primary cytomegalovirus (CMV) infection is resolved by the immune response without causing overt disease. The viral genome, however, is not cleared but is maintained in a latent state that entails a risk of virus recurrence and consequent organ disease. By using murine CMV as a model, we have shown previously that multiple organs harbor latent CMV and that reactivation occurs with an incidence that is determined by the viral DNA load in the respective organ (M. J....

  11. ECHO virus

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/001340.htm ECHO virus To use the sharing features on this page, please enable JavaScript. Enteric cytopathic human orphan (ECHO) viruses are a group of viruses that can lead ...

  12. New insights into the Hendra virus attachment and entry process from structures of the virus G glycoprotein and its complex with Ephrin-B2.

    Directory of Open Access Journals (Sweden)

    Kai Xu

    Full Text Available Hendra virus and Nipah virus, comprising the genus Henipavirus, are recently emerged, highly pathogenic and often lethal zoonotic agents against which there are no approved therapeutics. Two surface glycoproteins, the attachment (G and fusion (F, mediate host cell entry. The crystal structures of the Hendra G glycoprotein alone and in complex with the ephrin-B2 receptor reveal that henipavirus uses Tryptophan 122 on ephrin-B2/B3 as a "latch" to facilitate the G-receptor association. Structural-based mutagenesis of residues in the Hendra G glycoprotein at the receptor binding interface document their importance for viral attachments and entry, and suggest that the stability of the Hendra-G-ephrin attachment complex does not strongly correlate with the efficiency of viral entry. In addition, our data indicates that conformational rearrangements of the G glycoprotein head domain upon receptor binding may be the trigger leading to the activation of the viral F fusion glycoprotein during virus infection.

  13. Molecular cloning of a feline leukemia virus that induces fatal immunodeficiency disease in cats.

    Science.gov (United States)

    Overbaugh, J; Donahue, P R; Quackenbush, S L; Hoover, E A; Mullins, J I

    1988-02-19

    A replication-defective variant of feline leukemia virus was molecularly cloned directly from infected tissue and found to induce a rapid and fatal immunodeficiency syndrome in cats. Studies with cloned viruses also showed that subtle mutational changes would convert a minimally pathogenic virus into one that would induce an acute form of immunodeficiency. The data suggest that acutely pathogenic viruses may be selected against by current methods for isolation of the human and simian immunodeficiency viruses.

  14. A rare case of acute pancreatitis and life-threatening hemolytic anemia associated with Epstein-Barr virus infection in a young healthy adult.

    Science.gov (United States)

    Singh, Sukhchain; Khosla, Pam

    2016-01-01

    Epstein-Barr virus (EBV) is a common infection that affects 95% of adults worldwide at some point during life. It is usually asymptomatic or causes a self-limiting clinical syndrome known as infectious mononucleosis. It rarely causes complications. Here, we present a case of a healthy 21-year-old female college student who suffered from severe pancreatitis and life-threatening autoimmune hemolytic anemia in association with EBV infection, and we also discuss the common presentation of EBV infection and the diagnosis and treatment of simple and complicated EBV infection. Copyright © 2015 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.

  15. [Acute hemorrhagic viral conjunctivitis].

    Science.gov (United States)

    Haicl, P; Vanista, J; Danes, L

    1992-10-01

    Two cases of acute hemorrhagic conjunctivitis are described, in which the enterovirus Coxsackie 24 was found by serological examination to be the etiological agent. The virus was important from Nigeria. The patients suffered by the acute hemorrhagic keratoconjuntivitis with transient iritic irritation without the systemic symptoms. Since now this disease with serological verification was not diagnosed in our country. The question of the viral hemorrhagic conjunctivitis and their treatment is discussed. The necessity of virological investigation in inflammations of the anterior segment is stressed.

  16. Virus infections of honeybees Apis Mellifera

    Directory of Open Access Journals (Sweden)

    Giuseppina Tantillo

    2015-09-01

    Full Text Available The health and vigour of honeybee colonies are threatened by numerous parasites (such as Varroa destructor and Nosema spp. and pathogens, including viruses, bacteria, protozoa. Among honeybee pathogens, viruses are one of the major threats to the health and wellbeing of honeybees and cause serious concern for researchers and beekeepers. To tone down the threats posed by these invasive organisms, a better understanding of bee viral infections will be of crucial importance in developing effective and environmentally benign disease control strategies. Here we summarize recent progress in the understanding of the morphology, genome organization, transmission, epidemiology and pathogenesis of eight honeybee viruses: Deformed wing virus (DWV and Kakugo virus (KV; Sacbrood virus (SBV; Black Queen cell virus (BQCV; Acute bee paralysis virus (ABPV; Kashmir bee virus (KBV; Israeli Acute Paralysis Virus (IAPV; Chronic bee paralysis virus (CBPV. The review has been designed to provide researchers in the field with updated information about honeybee viruses and to serve as a starting point for future research.

  17. Virus Infections of Honeybees Apis Mellifera

    Science.gov (United States)

    Tantillo, Giuseppina; Bottaro, Marilisa; Di Pinto, Angela; Martella, Vito; Di Pinto, Pietro

    2015-01-01

    The health and vigour of honeybee colonies are threatened by numerous parasites (such as Varroa destructor and Nosema spp.) and pathogens, including viruses, bacteria, protozoa. Among honeybee pathogens, viruses are one of the major threats to the health and well-being of honeybees and cause serious concern for researchers and beekeepers. To tone down the threats posed by these invasive organisms, a better understanding of bee viral infections will be of crucial importance in developing effective and environmentally benign disease control strategies. Here we summarize recent progress in the understanding of the morphology, genome organization, transmission, epidemiology and pathogenesis of eight honeybee viruses: Deformed wing virus (DWV) and Kakugo virus (KV); Sacbrood virus (SBV); Black Queen cell virus (BQCV); Acute bee paralysis virus (ABPV); Kashmir bee virus (KBV); Israeli Acute Paralysis Virus (IAPV); Chronic bee paralysis virus (CBPV). The review has been designed to provide researchers in the field with updated information about honeybee viruses and to serve as a starting point for future research. PMID:27800411

  18. Clinical and radiological features of pandemic H1N1 2009 influenza virus infection manifesting as acute febrile respiratory illness at their initial presentations: comparison with contemporaneous non-H1N1 patients

    Energy Technology Data Exchange (ETDEWEB)

    Yun, Tae Jin (Dept. of Radiology, Armed Force Byukjae Hospital, Gyeonggi-do (Korea, Republic of); Dept. of Radiology, Seoul National Univ. Hospital, Seoul (Korea, Republic of)); Park, Chang Min; Choi, Seung Hong; Lee, Hyun Ju; Goo, Jin Mo (Dept. of Radiology, Seoul National Univ. Hospital, Seoul (Korea, Republic of)), email: cmpark@radiol.snu.ac.kr; Kwon, Gu Jin (Dept. of Family Medicine, Armed Force Byukjae Hospital, Gyeonggi-do (Korea, Republic of); Dept. of Family Medicine, Gangneung Asan Hospital, Gangneung (Korea, Republic of)); Woo, Sung Koo (Dept. of Radiology, Armed Force Byukjae Hospital, Gyeonggi-do (Korea, Republic of)); Park, Seung Hoon (Dept. of Internal Medicine, Armed Force Byukjae Hospital, Gyeonggi-do (Korea, Republic of))

    2011-05-15

    Background Since the first outbreak caused by the pandemic H1N1 2009 influenza in Mexico, the virus has spread widely across the world with meaningful morbidity and mortality. However, there are few data on the comparative investigations to assess the clinical and radiological features between the H1N1 patient and non-H1N1 patients. Purpose To assess the clinical and radiological features of patients infected by the pandemic H1N1 2009 flu virus at their initial presentation and to compare them with contemporaneous non-H1N1 patients with acute febrile respiratory illness. Material and Methods This retrospective study was approved by the ethics committee of the Armed Forces Medical Command, South Korea. From August to September 2009, 337 consecutive patients presented with an acute febrile respiratory illness in a tertiary military hospital. Reverse-transcriptase polymerase-chain-reaction tests were performed in 62 of these patients under the impression of H1N1 infection. Clinical and radiological features at their initial presentation were described for the H1N1 group (n = 35) and non-H1N1 group (n = 27) and compared between the two groups. Results Increased C-reactive protein level (97%) without leukocytosis (9%) or increased erythrocyte sedimentation rate (0%) was common in the H1N1 group at their initial presentation. On chest radiographs, 12 of 35 (34%) H1N1 patients had abnormal findings; nodules in 10 patients (83%) and consolidations in two (17%). Of the 28 H1N1 patients who underwent thin-section CT 16 patients (57%) showed abnormal findings; ground-glass opacities (GGOs) in 15 (94%), and nodules in 13 (81%). However, there were no significant differences between the H1N1 group and non-H1N1 group in terms of symptoms, laboratory results, or radiological findings (P > 0.05). Conclusion Patients with H1N1 infection show consistent clinical and radiological features at their initial presentation, however, clinical and radiological features of the H1N1 group are

  19. Clinical and radiological features of pandemic H1N1 2009 influenza virus infection manifesting as acute febrile respiratory illness at their initial presentations: comparison with contemporaneous non-H1N1 patients

    International Nuclear Information System (INIS)

    Yun, Tae Jin; Park, Chang Min; Choi, Seung Hong; Lee, Hyun Ju; Goo, Jin Mo; Kwon, Gu Jin; Woo, Sung Koo; Park, Seung Hoon

    2011-01-01

    Background Since the first outbreak caused by the pandemic H1N1 2009 influenza in Mexico, the virus has spread widely across the world with meaningful morbidity and mortality. However, there are few data on the comparative investigations to assess the clinical and radiological features between the H1N1 patient and non-H1N1 patients. Purpose To assess the clinical and radiological features of patients infected by the pandemic H1N1 2009 flu virus at their initial presentation and to compare them with contemporaneous non-H1N1 patients with acute febrile respiratory illness. Material and Methods This retrospective study was approved by the ethics committee of the Armed Forces Medical Command, South Korea. From August to September 2009, 337 consecutive patients presented with an acute febrile respiratory illness in a tertiary military hospital. Reverse-transcriptase polymerase-chain-reaction tests were performed in 62 of these patients under the impression of H1N1 infection. Clinical and radiological features at their initial presentation were described for the H1N1 group (n = 35) and non-H1N1 group (n = 27) and compared between the two groups. Results Increased C-reactive protein level (97%) without leukocytosis (9%) or increased erythrocyte sedimentation rate (0%) was common in the H1N1 group at their initial presentation. On chest radiographs, 12 of 35 (34%) H1N1 patients had abnormal findings; nodules in 10 patients (83%) and consolidations in two (17%). Of the 28 H1N1 patients who underwent thin-section CT 16 patients (57%) showed abnormal findings; ground-glass opacities (GGOs) in 15 (94%), and nodules in 13 (81%). However, there were no significant differences between the H1N1 group and non-H1N1 group in terms of symptoms, laboratory results, or radiological findings (P > 0.05). Conclusion Patients with H1N1 infection show consistent clinical and radiological features at their initial presentation, however, clinical and radiological features of the H1N1 group are

  20. Encefalitis aguda: Manifestaciones neuropsiquiátricas como expresión de infección por virus de influenza Acute encephalitis: Neuropsychiatric manifestations as expression of influenza virus infection

    Directory of Open Access Journals (Sweden)

    Noris Moreno-Flagge

    2009-01-01

    Full Text Available El objetivo fue revisar la encefalitis en niños y adolescentes, su etiología, manifestaciones clínicas, fisiopatología, métodos diagnósticos y tratamiento, enfatizando las manifestaciones neuropsiquiátricas de la encefalitis durante una epidemia de influenza. La encefalitis se considera una inflamación del sistema nervioso central (SNC que compromete el cerebro. Se manifiesta usualmente por cefaleas, fiebre y trastorno del estado de conciencia. Puede además manifestarse por convulsiones, cambios en la personalidad y manifestaciones obsesivas (síntomas neuropsiquiátricos. Las manifestaciones dependerán del tipo de virus y las células afectadas. La encefalitis puede ser causada por una gran variedad de agentes infecciosos incluyendo virus, bacterias, hongos y parásitos. Causas virales de encefalitis incluyen herpesvirus, arbovirus, rabia y enterovirus. Casos establecidos de bacterias incluyen Borrelia burgdorferi y rickettsia y el Mycoplasma neumoniae, al cual se atribuyen varios casos de encefalitis. Otros agentes como el hongo Coccidioides immitis e Histoplasma capsulatum pueden también generarla. Más de 100 agentes se han asociado a encefalitis. El diagnóstico de encefalitis constituye un reto para el clínico, y su etiología infecciosa usualmente se identifica entre el 40% al 70% de casos. El diagnóstico se hace con absoluta certeza sólo con una biopsia cerebral. La epidemiología depende de ciertos factores como la edad, la localización geográfica, la época del año, las condiciones climáticas y la inmunocompetencia del huésped. El tratamiento temprano puede disminuir el riesgo de muerte y las secuelas. Describimos cuatro pacientes con encefalitis y manifestaciones neuropsiquiátricas durante una epidemia de influenza, con el fin de alertar sobre esta asociación.The aim is to review the encephalitis in infants and adolescents as well as its etiology, clinical manifestation, epidemiology, physiopathology, diagnostic

  1. Structure and stabilization of the Hendra virus F glycoprotein in its prefusion form.

    Science.gov (United States)

    Wong, Joyce J W; Paterson, Reay G; Lamb, Robert A; Jardetzky, Theodore S

    2016-01-26

    Hendra virus (HeV) is one of the two prototypical members of the Henipavirus genus of paramyxoviruses, which are designated biosafety level 4 (BSL-4) organisms due to the high mortality rate of Nipah virus (NiV) and HeV in humans. Paramyxovirus cell entry is mediated by the fusion protein, F, in response to binding of a host receptor by the attachment protein. During posttranslational processing, the fusion peptide of F is released and, upon receptor-induced triggering, inserts into the host cell membrane. As F undergoes a dramatic refolding from its prefusion to postfusion conformation, the fusion peptide brings the host and viral membranes together, allowing entry of the viral RNA. Here, we present the crystal structure of the prefusion form of the HeV F ectodomain. The structure shows very high similarity to the structure of prefusion parainfluenza virus 5 (PIV5) F, with the main structural differences in the membrane distal apical loops and the fusion peptide cleavage loop. Functional assays of mutants show that the apical loop can tolerate perturbation in length and surface residues without loss of function, except for residues involved in the stability and conservation of the F protein fold. Structure-based disulfide mutants were designed to anchor the fusion peptide to conformationally invariant residues of the F head. Two mutants were identified that inhibit F-mediated fusion by stabilizing F in its prefusion conformation.

  2. Antibodies to henipavirus or henipa-like viruses in domestic pigs in Ghana, West Africa.

    Directory of Open Access Journals (Sweden)

    David T S Hayman

    Full Text Available Henipaviruses, Hendra virus (HeV and Nipah virus (NiV, have Pteropid bats as their known natural reservoirs. Antibodies against henipaviruses have been found in Eidolon helvum, an old world fruit bat species, and henipavirus-like nucleic acid has been detected in faecal samples from E. helvum in Ghana. The initial outbreak of NiV in Malaysia led to over 265 human encephalitis cases, including 105 deaths, with infected pigs acting as amplifier hosts for NiV during the outbreak. We detected non-neutralizing antibodies against viruses of the genus Henipavirus in approximately 5% of pig sera (N = 97 tested in Ghana, but not in a small sample of other domestic species sampled under a E. helvum roost. Although we did not detect neutralizing antibody, our results suggest prior exposure of the Ghana pig population to henipavirus(es. Because a wide diversity of henipavirus-like nucleic acid sequences have been found in Ghanaian E. helvum, we hypothesise that these pigs might have been infected by henipavirus(es sufficiently divergent enough from HeVor NiV to produce cross-reactive, but not cross-neutralizing antibodies to HeV or NiV.

  3. Low frequency of acute hepatitis E virus (HEV) infections but high past HEV exposure in subjects from Cambodia with mild liver enzyme elevations, unexplained fever or immunodeficiency due to HIV-1 infection.

    Science.gov (United States)

    Nouhin, Janin; Barennes, Hubert; Madec, Yoann; Prak, Sophearot; Hou, Serey Vannak; Kerleguer, Alexandra; Kim, Saorin; Pean, Polidy; Rouet, François

    2015-10-01

    In Cambodia, previous studies conducted on hepatitis E virus (HEV) infection are scant, sometimes old, and showed inconsistent results. Moreover, there is no data about HEV infection in Cambodian HIV-1-infected patients. To assess the occurrence of acute HEV infections and the level of past HEV exposure in one Mekong country. Using anti-HEV IgM and HEV RNA detection, we retrospectively investigated the presence of acute HEV infection in 825 individuals, including 350 subjects with or without fever, 300 subjects with or without liver enzyme elevations (LEE) and 175 antiretroviral treatment (ART)-naïve, severely immunocompromised HIV-1-infected patients. The detection of anti-HEV IgG was also performed to assess ancient HEV exposure. Nine individuals tested positive for anti-HEV IgM yielding an overall rate of 1.1% (95% confidence interval (CI), 0.5-2.0). We did not find significant differences for anti-HEV IgM rates between subjects with unexplained fevers (1.5%) and those with malaria or dengue-associated fever (1.7%) or non-febrile individuals (0%) (P=0.49), and between subjects with (1.5%) and without (2.0%) LEE (P=0.87). No HIV-infected patient tested positive for anti-HEV IgM. HEV RNA was not detected in all tested plasma specimens (n=578). Overall, the anti-HEV IgG prevalence rate was 30.1% (95% CI, 27.0-33.2). The scarcity of recent HEV infection contrasted with the high level of past HEV exposure. The role of HEV in liver disease is likely minor in Cambodia since no HEV RNA was detected in our studied populations, including HIV-positive patients with severe immunodepression. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Canine respiratory viruses

    OpenAIRE

    Buonavoglia , Canio; Martella , Vito

    2007-01-01

    International audience; Acute contagious respiratory disease (kennel cough) is commonly described in dogs worldwide. The disease appears to be multifactorial and a number of viral and bacterial pathogens have been reported as potential aetiological agents, including canine parainfluenza virus, canine adenovirus and Bordetella bronchiseptica, as well as mycoplasmas, Streptococcus equi subsp. zooepidemicus, canine herpesvirus and reovirus-1,-2 and -3. Enhancement of pathogenicity by multiple in...

  5. Analysis of the acute-phase protein response in pigs to clinical and subclinical infection with H3N2 swine influenza virus.

    Science.gov (United States)

    Pomorska-Mól, Małgorzata; Kwit, Krzysztof; Pejsak, Zygmunt; Markowska-Daniel, Iwona

    2014-03-01

    Swine influenza (SI) is a contagious, important respiratory disease. Diagnosis of SI is based on the clinical signs, confirmed by the detection of viral RNA or specific antibodies. However, the infection is much more frequent than the disease. The aim of study was to investigate the kinetics of acute-phase protein (APP) response during subclinical and clinical influenza in pigs. The utility of APP measurements in identification of infected animals was also evaluated. Twenty-eight piglets were used. C-reactive protein (CRP), haptoglobin (Hp), serum amyloid A (SAA) and pig major acute-phase protein (Pig-MAP) concentrations in serum were measured using commercial ELISAs. No relevant clinical signs were observed in intranasally infected pigs. In contrast, coughing, nasal discharge, and fever were observed in pigs infected intratracheally. All infected pigs exhibited specific antibodies in the serum at 10 dpi, and viral shedding was confirmed. The concentrations of CRP, Hp and SAA were significantly increased after infection. The level of Pig-MAP remained constant during subclinical and clinical infection. The concentrations of CRP, Hp and SAA were higher in pigs with clinical disease. Although not specific, strategic APP measurements may reveal ongoing clinical and subclinical infection. A close relationship between the magnitude of serum APP response with the severity of disease, providing an objective tool for validation the severity of infection. The maximum concentration of SAA in serum was closely correlated with lung score and makes this APP potential indicator for disease progress or estimation of treatment strategy.

  6. Preemptive CD8 T-cell immunotherapy of acute cytomegalovirus infection prevents lethal disease, limits the burden of latent viral genomes, and reduces the risk of virus recurrence.

    Science.gov (United States)

    Steffens, H P; Kurz, S; Holtappels, R; Reddehase, M J

    1998-03-01

    In the immunocompetent host, primary cytomegalovirus (CMV) infection is resolved by the immune response without causing overt disease. The viral genome, however, is not cleared but is maintained in a latent state that entails a risk of virus recurrence and consequent organ disease. By using murine CMV as a model, we have shown previously that multiple organs harbor latent CMV and that reactivation occurs with an incidence that is determined by the viral DNA load in the respective organ (M. J. Reddehase, M. Balthesen, M. Rapp, S. Jonjic, I. Pavic, and U. H. Koszinowski. J. Exp. Med. 179:185-193, 1994). This predicts that a therapeutic intervention capable of limiting the load of latent viral genome should also reduce the risk of virus recurrence. Here we demonstrate the benefits and the limits of a preemptive CD8 T-cell immunotherapy of CMV infection in the immunocompromised bone marrow transplantation recipient. Antiviral CD8 T cells prevented CMV disease and accelerated the resolution of productive infection. The therapy also resulted in a lower load of latent CMV DNA in organs and consequently reduced the incidence of recurrence. The data thus provide a further supporting argument for clinical trials of preemptive cytoimmunotherapy of human CMV disease with CD8 T cells. However, CD8 T cells failed to clear the viral DNA. The therapy-susceptible portion of the DNA load differed between organs and was highest in the lungs. The existence of an invariant, therapy-resistant load suggests a role for immune system evasion mechanisms in the establishment of CMV latency.

  7. BIOLOGY OF HUMAN RESPIRATORY SYNCYTIAL VIRUS: A ...

    African Journals Online (AJOL)

    DR. AMINU

    information about its biology which may be useful to the present and future researchers. Key words: Respiratory virus, Human Respiratory syncytial virus, biology, genome, epidemiology, immunity. INTRODUCTION. Acute lower ..... of respiratory infections in bone marrow transplant. Pneumonia develops in about one-half of ...

  8. La experiencia de los virus emergentes en el Caribe colombiano

    Directory of Open Access Journals (Sweden)

    Salim Máttar V

    2010-04-01

    Full Text Available Existe una interrelación muy estrecha entre el hombre, su ecología y el mundo microbiano, tanto el ser humano como los agentes infecciosos han coevolucionado durante milenios (1. La historia demuestra que ha existido una confluencia de diferentes enfermedades infecciosas y las principales civilizaciones. En los últimos años las enfermedades zoonoticas emergentes han ido cobrando una importancia creciente en el terreno de la salud humana y animal, surgiendo nuevas enfermedades procedentes siempre de lugares insospechados y causantes de graves problemas para el hombre o los animales (2. La mayoría de patógenos involucrados en las enfermedades infecciosas emergentes (EIE son de origen bacteriano o rickettsial (54.3%. En este grupo están incluidos los patógenos bacterianos resistentes a los antibióticos. Los patógenos de origen viral y los priones, constituyen el 25.4% de eventos de las EIE, los protozoarios representan el 10.7%, seguido de los hongos 6.3% y los helmintos en un 3.3%. El 60.3% de las enfermedades infecciosas emergentes son causadas por patógenos zoonoticos (2. El 71.8% de estas zoonosis son causados por patógenos que se originan de la fauna silvestre, como la emergencia del virus de Nipah en Malasia y el síndrome respiratorio agudo severo (SARS en China (3.

  9. Epidemiology of Hepatitis B and Hepatitis C Virus infections among ...

    African Journals Online (AJOL)

    Hepatitis B and hepatitis C virus infection are common in Nigeria; where they are a major cause of both acute and chronic liver disease, as well as hepatocellular cancer. Persons at risk of acquisition of Human Immunodeficiency Virus (HIV) infection are also at risk of acquisition of infection with Hepatitis B virus (HBV) and ...

  10. TLR2 Expression in Peripheral CD4+ T Cells Promotes Th17 Response and Is Associated with Disease Aggravation of Hepatitis B Virus-Related Acute-On-Chronic Liver Failure

    Directory of Open Access Journals (Sweden)

    Chunli Xu

    2017-11-01

    Full Text Available Th17 responses have been shown to play crucial roles in the pathogenesis of hepatitis B virus (HBV-associated acute-on-chronic liver failure (ACLF. The mechanism underlying the enhanced Th17 responses in these patients remains largely unclear. Here we investigated toll-like receptors (TLRs expression in peripheral T cells and their roles in Th17 cell differentiation and disease aggravation in ACLF patients. 18 healthy subjects (HS, 20 chronic HBV-infected (CHB patients, and 26 ACLF patients were enrolled and examined for TLRs expression in peripheral blood mononuclear cells (PBMCs. The correlations of T cell TLR2 expression with the antigen non-specific Th17 responses and disease aggravation, as well as the Th17 response to TLR2 ligand stimulation were evaluated in ACLF patients. Compared to HS and CHB patients, ACLF patients showed a distinct TLRs expression pattern in PBMCs. Significantly increased TLR2 expression in T cells was observed in ACLF patients. The TLR2 expression in CD4+ T cells was correlated with the Th17 responses and the clinical markers for disease aggravation in ACLF patients. Moreover, TLR2 ligands stimulation promoted Th17 cell differentiation and response in PBMCs of ACLF patients. These findings implicate that TLR2 signaling plays critical roles in Th17 cell differentiation and disease aggravation of HBV-related ACLF.

  11. Physiological stress and Hendra virus in flying-foxes (Pteropus spp., Australia.

    Directory of Open Access Journals (Sweden)

    Lee McMichael

    Full Text Available Pteropid bats (flying-foxes are the natural reservoir of Hendra virus, an emergent paramyxovirus responsible for fatal infection in horses and humans in Australia. Pteropus alecto (the Black flying-fox and the paraphyletic P. conspicillatus (the Spectacled flying-fox appear to be the primary reservoir hosts. Previous studies have suggested that physiological and ecological factors may underpin infection dynamics in flying-foxes, and subsequent spillover to horses and in turn humans. We sought to examine temporal trends in urinary cortisol concentration in wild Australian flying-fox populations, to elucidate the putative relationship between Hendra virus infection and physiological stress. Pooled and individual urine samples were non-invasively collected from under roosting flying-foxes at two latitudinally disparate regions in the eastern Australian state of Queensland. Hendra virus detection, and (in individual urine samples sex and species determination were PCR-based. Urinary cortisol measurement used a validated enzyme immunoassay. We found no direct correlation between increased urinary cortisol and Hendra virus excretion, but our findings do suggest a biologically plausible association between low winter temperatures and elevated cortisol levels in P. alecto in the lower latitude Southeast Queensland roosts. We hypothesize an indirect association between low winter temperatures and increased Hendra virus infection and excretion, mediated by the physiological cost of thermoregulation. Our findings and our approach are directly relevant to elaboration of the disease ecology of Nipah virus and other emerging henipaviruses in bats. More broadly, they inform investigation of emerging disease infection dynamics across the wildlife/livestock/human interface.

  12. Physiological stress and Hendra virus in flying-foxes (Pteropus spp.), Australia.

    Science.gov (United States)

    McMichael, Lee; Edson, Daniel; Smith, Craig; Mayer, David; Smith, Ina; Kopp, Steven; Meers, Joanne; Field, Hume

    2017-01-01

    Pteropid bats (flying-foxes) are the natural reservoir of Hendra virus, an emergent paramyxovirus responsible for fatal infection in horses and humans in Australia. Pteropus alecto (the Black flying-fox) and the paraphyletic P. conspicillatus (the Spectacled flying-fox) appear to be the primary reservoir hosts. Previous studies have suggested that physiological and ecological factors may underpin infection dynamics in flying-foxes, and subsequent spillover to horses and in turn humans. We sought to examine temporal trends in urinary cortisol concentration in wild Australian flying-fox populations, to elucidate the putative relationship between Hendra virus infection and physiological stress. Pooled and individual urine samples were non-invasively collected from under roosting flying-foxes at two latitudinally disparate regions in the eastern Australian state of Queensland. Hendra virus detection, and (in individual urine samples) sex and species determination were PCR-based. Urinary cortisol measurement used a validated enzyme immunoassay. We found no direct correlation between increased urinary cortisol and Hendra virus excretion, but our findings do suggest a biologically plausible association between low winter temperatures and elevated cortisol levels in P. alecto in the lower latitude Southeast Queensland roosts. We hypothesize an indirect association between low winter temperatures and increased Hendra virus infection and excretion, mediated by the physiological cost of thermoregulation. Our findings and our approach are directly relevant to elaboration of the disease ecology of Nipah virus and other emerging henipaviruses in bats. More broadly, they inform investigation of emerging disease infection dynamics across the wildlife/livestock/human interface.

  13. Impact of Donor Epstein-Barr Virus Serostatus on the Incidence of Graft-Versus-Host Disease in Patients With Acute Leukemia After Hematopoietic Stem-Cell Transplantation: A Study From the Acute Leukemia and Infectious Diseases Working Parties of the European Society for Blood and Marrow Transplantation.

    Science.gov (United States)

    Styczynski, Jan; Tridello, Gloria; Gil, Lidia; Ljungman, Per; Hoek, Jennifer; Iacobelli, Simona; Ward, Katherine N; Cordonnier, Catherine; Einsele, Hermann; Socie, Gerard; Milpied, Noel; Veelken, Hendrik; Chevallier, Patrice; Yakoub-Agha, Ibrahim; Maertens, Johan; Blaise, Didier; Cornelissen, Jan; Michallet, Mauricette; Daguindau, Etienne; Petersen, Eefke; Passweg, Jakob; Greinix, Hildegard; Duarte, Rafael F; Kröger, Nicolaus; Dreger, Peter; Mohty, Mohamad; Nagler, Arnon; Cesaro, Simone

    2016-07-01

    We investigated the effect of Epstein-Barr virus (EBV) serostatus on the overall outcome of allogeneic hematopoietic stem-cell transplantation (allo-HSCT). The study included 11,364 patients who underwent allogeneic peripheral-blood or bone marrow transplantation for acute leukemia between 1997 and 2012. We analyzed the impact of donor and recipient EBV serologic status on overall survival, relapse-free survival, relapse incidence, nonrelapse mortality, and incidence of graft-versus-host disease (GVHD) after allo-HSCT. Patients receiving grafts from EBV-seropositive donors had the same overall survival as patients who received grafts from EBV-seronegative donors (hazard ratio [HR], 1.05; 95% CI, 0.97 to 1.12; P = .23). Seropositive donors also had no influence on relapse-free survival (HR, 1.04; 95% CI, 0.97 to 1.11; P = 0.31), relapse incidence (HR, 1.03; 95% CI, 0.94 to 1.12; P = .58), and nonrelapse mortality (HR, 1.05; 95% CI, 0.94 to 1.17; P = .37). However, in univariate analysis, recipients receiving grafts from seropositive donors had a higher risk of chronic GVHD than those with seronegative donors (40.8% v 31.0%, respectively; P < .001; HR, 1.42; 95% CI, 1.30 to 1.56). When adjusting for confounders, higher risk was identified for both acute and chronic GVHD. In seronegative patients with seropositive donors, the HR for chronic GVHD was 1.30 (95% CI, 1.06 to 1.59; P = .039). In seropositive patients with seropositive donors, the HR was 1.24 (95% CI, 1.07 to 1.45; P = .016) for acute GVHD and 1.43 (95% CI, 1.23 to 1.67; P < .001) for chronic GVHD. Seropositive patients with seronegative donors did not have an increased risk of GVHD. Our data suggest that donor EBV status significantly influences development of acute and chronic GVHD after allo-HSCT. © 2016 by American Society of Clinical Oncology.

  14. Crystal Structure of the Marburg Virus VP35 Oligomerization Domain

    Energy Technology Data Exchange (ETDEWEB)

    Bruhn, Jessica F.; Kirchdoerfer, Robert N.; Urata, Sarah M.; Li, Sheng; Tickle, Ian J.; Bricogne, Gérard; Saphire, Erica Ollmann (Scripps); (Globel Phasing); (UCSD)

    2016-11-09

    ABSTRACT

    Marburg virus (MARV) is a highly pathogenic filovirus that is classified in a genus distinct from that of Ebola virus (EBOV) (generaMarburgvirusandEbolavirus, respectively). Both viruses produce a multifunctional protein termed VP35, which acts as a polymerase cofactor, a viral protein chaperone, and an antagonist of the innate immune response. VP35 contains a central oligomerization domain with a predicted coiled-coil motif. This domain has been shown to be essential for RNA polymerase function. Here we present crystal structures of the MARV VP35 oligomerization domain. These structures and accompanying biophysical characterization suggest that MARV VP35 is a trimer. In contrast, EBOV VP35 is likely a tetramer in solution. Differences in the oligomeric state of this protein may explain mechanistic differences in replication and immune evasion observed for MARV and EBOV.

    IMPORTANCEMarburg virus can cause severe disease, with up to 90% human lethality. Its genome is concise, only producing seven proteins. One of the proteins, VP35, is essential for replication of the viral genome and for evasion of host immune responses. VP35 oligomerizes (self-assembles) in order to function, yet the structure by which it assembles has not been visualized. Here we present two crystal structures of this oligomerization domain. In both structures, three copies of VP35 twist about each other to form a coiled coil. This trimeric assembly is in contrast to tetrameric predictions for VP35 of Ebola virus and to known structures of homologous proteins in the measles, mumps, and Nipah viruses. Distinct oligomeric states of the Marburg and Ebola virus VP35 proteins may explain differences between them in polymerase function and immune evasion. These findings may provide a more accurate understanding of the

  15. This could be the start of something big—20 years since the identification of bats as the natural host of Hendra virus

    Directory of Open Access Journals (Sweden)

    Peter Black

    2015-12-01

    Full Text Available Hendra virus was first described in 1994 in Australia, causally associated with a cluster of fatal equine and human cases at a thoroughbred racing stable in the Brisbane suburb of Hendra. This year marks the twentieth anniversary of the identification of pteropid bats (flying-foxes as the natural host of the virus, and it is timely to reflect on a pivotal meeting of an eclectic group of scientists in that process. They included animal and public health experts, environmental scientists, veterinary and horse industry representatives, and wildlife experts. The task was to review and prioritise wildlife surveillance seeking the origin of the previously unknown virus. The group determined that the likely reservoir must occur in disparate locations, and be capable of moving between locations, or exist in continuous, overlapping populations spanning multiple locations. Flying-foxes were considered to be a more probable source of the novel virus than birds. Within weeks, antibodies were detected in several species of flying-fox, and the virus was subsequently isolated. While the identification of the natural host of Hendra virus within 18 months of its description was remarkable in itself, a broader legacy followed. In the subsequent years, a suite of zoonotic viruses including Australian bat lyssavirus, Nipah virus, SARS coronavirus, and Ebola and Marburg viruses have been detected in bats. Bats are now the “go to” taxa for novel viruses. History has repeatedly demonstrated that knowledge begets knowledge. This simple notion of bringing a diverse group of people together in an environment of mutual respect reinforced this principle and proves that the sum is often so much more powerful than the parts.

  16. This could be the start of something big-20 years since the identification of bats as the natural host of Hendra virus.

    Science.gov (United States)

    Black, Peter; Douglas, Ian; Field, Hume

    2015-12-01

    Hendra virus was first described in 1994 in Australia, causally associated with a cluster of fatal equine and human cases at a thoroughbred racing stable in the Brisbane suburb of Hendra. This year marks the twentieth anniversary of the identification of pteropid bats (flying-foxes) as the natural host of the virus, and it is timely to reflect on a pivotal meeting of an eclectic group of scientists in that process. They included animal and public health experts, environmental scientists, veterinary and horse industry representatives, and wildlife experts. The task was to review and prioritise wildlife surveillance seeking the origin of the previously unknown virus. The group determined that the likely reservoir must occur in disparate locations, and be capable of moving between locations, or exist in continuous, overlapping populations spanning multiple locations. Flying-foxes were considered to be a more probable source of the novel virus than birds. Within weeks, antibodies were detected in several species of flying-fox, and the virus was subsequently isolated. While the identification of the natural host of Hendra virus within 18 months of its description was remarkable in itself, a broader legacy followed. In the subsequent years, a suite of zoonotic viruses including Australian bat lyssavirus, Nipah virus, SARS coronavirus, and Ebola and Marburg viruses have been detected in bats. Bats are now the "go to" taxa for novel viruses. History has repeatedly demonstrated that knowledge begets knowledge. This simple notion of bringing a diverse group of people together in an environment of mutual respect reinforced this principle and proves that the sum is often so much more powerful than the parts.

  17. HOMOLOGY BETWEEN SEGMENTS OF HUMAN HEMOSTATIC PROTEINS AND PROTEINS OF VIRUSES WHICH CAUSE ACUTE RESPIRATORY INFECTIONS OR DISEASES WITH SIMILAR SYMPTOMS

    Directory of Open Access Journals (Sweden)

    I. N. Zhilinskaya

    2017-01-01

    Full Text Available Objectives: To identify homologous segments of human hemostatic and viral proteins and to assess the role of human hemostatic proteins in viral replication. Materials and Methods: The following viruses were chosen for comparison: influenza B (B/Astrakhan/2/2017, coronaviruses (Hcov229E and SARS-Co, type 1 adenovirus (adenoid 71, measles (ICHINOSE-BA and rubella (Therien. The primary structures of viral proteins and 41 human hemostatic proteins were obtained from open–access www.ncbi.nlm.nih. gov and www.nextprot.org databases, respectively. Sequence homology was determined by comparing 12-amino-acid segments. Those sequences identical in ≥ 8 positions were considered homologous. Results: The analysis shows that viral proteins contain segments which mimic a number of human hemostatic proteins. Most of these segments, except those of adenovirus proteins, are homologous with coagulation factors. The increase in viral virulence, as in case of SARS-Co, correlates with an increased number of segments homologous with hemostatic proteins. Conclusion: Hemostasis plays an important role in viral replication and pathogenesis. The conclusion is consistent with the literature data about the relationship of hemostasis and inflammatory response to viral infections.

  18. A pilot study on expression of toll like receptors (TLRs in response to herpes simplex virus (HSV infection in acute retinal pigment epithelial cells (ARPE cells

    Directory of Open Access Journals (Sweden)

    S Moses

    2014-01-01

    Full Text Available Introduction: Toll like receptors (TLRs have been proven to play an important role in mounting the innate immune response in an infected host. The expression of TLRs against herpes simplex virus (HSV have not been studied in retinitis. Therefore, the current study was undertaken to determine the same using the retinal pigment epithelial (ARPE-19 cell line. Materials and Methods: APRE cells cultured in vitro were challenged with HSV 1 and 2 standard strains and 20 other clinical isolates. The cells were observed for cytopathic changes. The cell culture harvest was subjected to RNA extraction using a Total RNA mini kit. The RNA was subjected to reverse transcriptase polymerase chain reaction (PCR for the amplification of TLRs 3, 4 and 9 and GAPDH housekeeping gene. The amplified products were subjected to electrophoresis on a 2% agarose gel and viewed under a transilluminator. Results: TLR 3 and 4 were expressed by ARPE treated with all the 22 isolates. TLR 9 expression was seen in 16 of the 22 isolates. Bacterial contamination was ruled out by subjecting the harvests to PCR amplification of 16sRNA gene amplification of the eubacterial genome. Conclusions: The expression of TLR 4 has been reported for the first time in HSV infection. TLR 4 along with TLR 3 and 9 is responsible for the antiviral response in HSV infections.

  19. A pilot study on expression of toll like receptors (TLRs) in response to herpes simplex virus (HSV) infection in acute retinal pigment epithelial cells (ARPE) cells.

    Science.gov (United States)

    Moses, S; Jambulingam, M; Madhavan, H N

    2014-01-01

    Toll like receptors (TLRs) have been proven to play an important role in mounting the innate immune response in an infected host. The expression of TLRs against herpes simplex virus (HSV) have not been studied in retinitis. Therefore, the current study was undertaken to determine the same using the retinal pigment epithelial (ARPE-19) cell line. APRE cells cultured in vitro were challenged with HSV 1 and 2 standard strains and 20 other clinical isolates. The cells were observed for cytopathic changes. The cell culture harvest was subjected to RNA extraction using a Total RNA mini kit. The RNA was subjected to reverse transcriptase polymerase chain reaction (PCR) for the amplification of TLRs 3, 4 and 9 and GAPDH housekeeping gene. The amplified products were subjected to electrophoresis on a 2% agarose gel and viewed under a transilluminator. TLR 3 and 4 were expressed by ARPE treated with all the 22 isolates. TLR 9 expression was seen in 16 of the 22 isolates. Bacterial contamination was ruled out by subjecting the harvests to PCR amplification of 16sRNA gene amplification of the eubacterial genome. The expression of TLR 4 has been reported for the first time in HSV infection. TLR 4 along with TLR 3 and 9 is responsible for the antiviral response in HSV infections.

  20. Virus isolation for diagnosing dengue virus infections in returning travelers

    NARCIS (Netherlands)

    Teichmann, D.; Göbels, K.; Niedrig, M.; Sim-Brandenburg, J.-W.; Làge-Stehr, J.; Grobusch, M. P.

    2003-01-01

    Dengue fever is recognized as one of the most frequent imported acute febrile illnesses affecting European tourists returning from the tropics. In order to assess the value of virus isolation for the diagnosis of dengue fever, 70 cases of dengue fever confirmed in German travelers during the period

  1. Vesicular stomatitis virus (indiana 2 serotype as experimental model to study acute encephalitis – morphological features Vírus da estomatite vesicular (sorotipo indiana 2 como modelo experimental para o estudo de encefalite aguda – aspectos morfológicos

    Directory of Open Access Journals (Sweden)

    Florêncio Figueiredo Cavalcanti Neto

    2003-10-01

    Full Text Available The Vesicular Stomatitis Virus (VSV is a Vesiculovirus of the Rhabdoviridae family that infects mammals and causes vesicular lesions similar to those of foot-and-mouth disease. VSV experimental encephalitis can be induced in rodents and the symptoms are similar to those observed in rabies. However, the lesions observed in the animals´ encephalon are different. Inclusion bodies are not observed. There is necrosis, particularly in the region of the olfactory bulb, and, in some cases, ventriculitis. It was observed that the time pattern of VSV dissemination and the morphological aspects of the lesions are similar to those described in literature. The virus seems to be disseminated through the brain ventricles, being multiplied in the ependyma cells and in the neurons, besides using retrograde and anterograde transport. It was noticed that, due to the facility of virus manipulation, this experimental model has been used in innumerable research studies in several fields. If, on the one hand there are plenty of reports on the infection pathogenesis, on the other hand there are many gaps involving, for instance, aspects about virus transmission, recovery of infected animals and participation of glial cells in the acute as well as in the recovery phases.   O vírus da estomatite vesicular (VEV é um Vesiculovírus da família Rhabdoviridae que infecta mamíferos e causa lesões vesiculares semelhantes às observadas na febre aftosa. A encefalite experimental pode ser induzida em roedores e os sintomas são semelhantes aos observados na raiva; entretanto, as lesões observadas no encéfalo dos animais são diferentes. Corpúsculos de inclusão não são observados, há necrose especialmente da região do bulbo olfatório e em alguns casos, ventriculite. Observamos que o padrão temporal de disseminação do VEV e os aspectos morfológicos das lesões são similares aos descritos na literatura. O vírus parece se disseminar através dos ventr

  2. Acute Bronchitis

    Science.gov (United States)

    ... Table of Contents1. Overview2. Symptoms3. Diagnosis4. Prevention5. Treatment6. Everyday Life7. Questions8. Resources What is acute bronchitis? Acute ... heartburn, you can get acute bronchitis when stomach acid gets into the bronchial tree. How is acute ...

  3. Prolonged Detection of Zika Virus in Vaginal Secretions and Whole Blood.

    Science.gov (United States)

    Murray, Kristy O; Gorchakov, Rodion; Carlson, Anna R; Berry, Rebecca; Lai, Lilin; Natrajan, Muktha; Garcia, Melissa N; Correa, Armando; Patel, Shital M; Aagaard, Kjersti; Mulligan, Mark J

    2017-01-01

    Infection with Zika virus is an emerging public health crisis. We observed prolonged detection of virus RNA in vaginal mucosal swab specimens and whole blood for a US traveler with acute Zika virus infection who had visited Honduras. These findings advance understanding of Zika virus infection and provide data for additional testing strategies.

  4. Risk of viral acute gastrointestinal illness from non-disinfected drinking water distribution systems

    Science.gov (United States)

    Acute gastrointestinal illness (AGI) resulting from pathogens directly entering the piping of drinking water distribution systems is insufficiently understood. Here, we estimate AGI incidence attributable to virus intrusions into non-disinfecting municipal distribution systems. Viruses were enumerat...

  5. Prospective evaluation of nonstructural 1 enzyme-linked immunosorbent assay and rapid immunochromatographic tests to detect dengue virus in patients with acute febrile illness.

    Science.gov (United States)

    Najioullah, Fatiha; Combet, Emilie; Paturel, Laure; Martial, Jenny; Koulmann, Laurence; Thomas, Laurent; Hatchuel, Yves; Cabié, André; Cesaire, Raymond

    2011-02-01

    We prospectively evaluated the Bio-Rad nonstructural 1 (NS1) enzyme-linked immunosorbent assay (ELISA) and lateral flow immunochromatographic assay (LFIA) in comparison to an in-place reverse transcription-polymerase chain reaction for dengue diagnosis. Among 537 consecutive samples from patients with acute febrile disease, 264 (49.2%) tested positive in reverse transcription-polymerase chain reaction (RT-PCR), 156 (29.1%) in NS1-antigen (Ag) ELISA, and 125 (23.3%) in NS1-Ag LFIA. Compared to the RT-PCR status, the specificity was 100% for the NS1-Ag ELISA and LFIA, but their respective sensitivities were 61.2% [95% confidence interval (CI), 55.2-67.2] and 49.4% (95% CI, 43.2-55.6), with nadirs of 37.9% and 24.1% on day 6 of illness. The NS1-Ag ELISA and LFIA were positive, respectively, for 48.0% and 40.7% of the secondary infections versus 85.0% and 66.7% of the primary infections. For patients LFIA reached respective sensitivities of 100% and 90.5%. Reports of results of dengue NS1-Ag assays should specify that negativity does not preclude DENV infection, and require further investigations in the case of severe disease. Copyright © 2011 Elsevier Inc. All rights reserved.

  6. [Epileptic encephalopathy associated with human herpes virus 6 (HHV-6) encephalitis after the second cord blood transplantation in a patient with pediatric acute lymphoblastic leukemia].

    Science.gov (United States)

    Kouzuki, Kagehiro; Kato, Itaru; Kato, Takeo; Daifu, Tomoo; Saida, Satoshi; Umeda, Katsutsugu; Hiramatsu, Hidefumi; Watanabe, Ken-Ichiro; Ide, Minako; Yoshida, Takeshi; Imamura, Toshihiko; Ito, Kiminari; Heike, Toshio; Adachi, Souichi

    2014-12-01

    The incidence of HHV-6 encephalitis during hematopoietic stem cell transplantation (HSCT) in children is thought to be less than that in adults and risk factors, prognosis and complications are virtually unknown. Herein, we report a pediatric case developing epileptic encephalopathy following HHV-6 encephalitis after a second cord blood transplantation (CBT). A 7-year-old boy with relapsed B-precursor acute lymphoblastic leukemia in second remission underwent CBT. However, he received a second CBT due to graft failure. On day 25 after the second CBT, he developed short-term memory defects and seizures. He was diagnosed with HHV-6 encephalitis because HHV-6 DNA was detected in his blood and cerebrospinal fluid and abnormal hippocampal signals were seen on cranial magnetic resonance imaging (MRI). After treatment with foscarnet, HHV-6 DNA levels and MRI findings improved; however, he developed epileptic encephalopathy five months after the onset of encephalitis. There are very few reports on pediatric epileptic encephalopathy associated with HHV-6 encephalitis after HSCT. Detailed studies are needed to analyze risk factors, prognosis, and complications.

  7. Chronic administration of Δ9-tetrahydrocannabinol induces intestinal anti-inflammatory microRNA expression during acute simian immunodeficiency virus infection of rhesus macaques.

    Science.gov (United States)

    Chandra, Lawrance C; Kumar, Vinay; Torben, Workineh; Vande Stouwe, Curtis; Winsauer, Peter; Amedee, Angela; Molina, Patricia E; Mohan, Mahesh

    2015-01-15

    Recreational and medical use of cannabis among human immunodeficiency virus (HIV)-infected individuals has increased in recent years. In simian immunodeficiency virus (SIV)-infected macaques, chronic administration of Δ9-tetrahydrocannabinol (Δ9-THC) inhibited viral replication and intestinal inflammation and slowed disease progression. Persistent gastrointestinal disease/inflammation has been proposed to facilitate microbial translocation and systemic immune activation and promote disease progression. Cannabinoids including Δ9-THC attenuated intestinal inflammation in mouse colitis models and SIV-infected rhesus macaques. To determine if the anti-inflammatory effects of Δ9-THC involved differential microRNA (miRNA) modulation, we profiled miRNA expression at 14, 30, and 60 days postinfection (days p.i.) in the intestine of uninfected macaques receiving Δ9-THC (n=3) and SIV-infected macaques administered either vehicle (VEH/SIV; n=4) or THC (THC/SIV; n=4). Chronic Δ9-THC administration to uninfected macaques significantly and positively modulated intestinal miRNA expression by increasing the total number of differentially expressed miRNAs from 14 to 60 days p.i. At 60 days p.i., ∼28% of miRNAs showed decreased expression in the VEH/SIV group compared to none showing decrease in the THC/SIV group. Furthermore, compared to the VEH/SIV group, THC selectively upregulated the expression of miR-10a, miR-24, miR-99b, miR-145, miR-149, and miR-187, previously been shown to target proinflammatory molecules. NOX4, a potent reactive oxygen species generator, was confirmed as a direct miR-99b target. A significant increase in NOX4+ crypt epithelial cells was detected in VEH/SIV macaques compared to the THC/SIV group. We speculate that miR-99b-mediated NOX4 downregulation may protect the intestinal epithelium from oxidative stress-induced damage. These results support a role for differential miRNA induction in THC-mediated suppression of intestinal inflammation. Whether

  8. Influenza Virus-specific CD8+ T Cells : -longevity, cross-reactivity and viral evasion-

    NARCIS (Netherlands)

    C.E. van de Sandt (Carolien)

    2016-01-01

    markdownabstractInfluenza viruses are among the leading causes of acute respiratory tract infections worldwide. Natural influenza virus infections elicit both humoral and cellular immune responses. Although, neutralizing antibodies directed to the hemagglutinin (HA) globular head domain prevent

  9. Acute bacterial rhinosinusitis in adults: part I. Evaluation | Scheid ...

    African Journals Online (AJOL)

    Acute rhinosinusitis is one of the most common conditions that physicians treat in ambulatory practice. Although often caused by viruses, it sometimes is caused by bacteria, a condition that is called acute bacterial rhinosinusitis. The signs and symptoms of acute bacterial rhinosinusitis and prolonged viral upper respiratory ...

  10. Zika Virus

    Science.gov (United States)

    ... through blood transfusions. There have been outbreaks of Zika virus in the United States, Africa, Southeast Asia, the ... not travel to areas where there is a Zika virus outbreak. If you do decide to travel, first ...

  11. Zika Virus

    Science.gov (United States)

    ... which is responsible for transmitting Zika virus. Photo Courtesy of: James Gathany, Centers for Disease Control and ... National Institute of Allergy and Infectious Diseases. Photo Courtesy of NIH "You could have a Zika virus ...

  12. Chikungunya Virus

    Science.gov (United States)

    ... Gaines, PhD, MPH, MA, CHES Differentiating Chikungunya From Dengue: A Clinical Challenge For Travelers CDC Travelers' Health Chikungunya Virus Home Prevention Transmission Symptoms & Treatment Geographic Distribution Chikungunya virus in the United States ...

  13. Hepadna viruses

    Energy Technology Data Exchange (ETDEWEB)

    Robinson, W.; Koike, K.; Will, H.

    1987-01-01

    This book examines the molecular biology, disease pathogenesis, epidemiology, and clinical features of hepadna and other viruses with hepatic tropism and outlines future directions and approaches for their management. The volume's six sections provide a review of the various features, mechanisms, and functions of these viruses, ranging from hepadna virus replication and regulation of gene expression to the structure and function of hepadna-virus gene products.