WorldWideScience

Sample records for actinoid series elements

  1. MOLECULAR-STRUCTURE AND CHARGE-DISTRIBUTION OF THE 4F AND 5F ELEMENTS .3. DIPOLE-MOMENTS AND CHARGE-DISTRIBUTION OF 1/1-ADDUCTS OF TRIS(CYCLOPENTADIENYL)LANTHANOIDS(III) AND TRIS(CYCLOPENTADIENYL) ACTINOIDS(III) WITH TETRAHYDROFURAN - X-RAY STRUCTURAL-ANALYSIS OF (C5H5)3DY.THF

    NARCIS (Netherlands)

    MAIER, R; KANELLAKOPULOS, B; APOSTOLIDIS, C; NUBER, B

    1992-01-01

    The dielectricity constant and the dipole moment of the 1:1 adducts of the tris(cyclopentadienyl)compounds of the trivalent lanthanoids La to Lu (with exception of the Pm compound) and of the lighter actinoids Th, U, Np, and Pu with tetrahydrofuran, (C5H5)3M(III).THF, were measured and the charge di

  2. Material Development for Nuclear Fusion and Energy Development Using Actinoids

    OpenAIRE

    Kayano, Hideo

    1994-01-01

    In our Facilities. fundamental researches on nuclear fuels and reactor materials have been performed by making use of JMTR and JOYO. Authors outline original studies among them currently performed by having myself as the core. Research fields in progress are material developments for the nuclear fusion such as ferritic steel and V alloy and energy development using Actinoids. As the material development for practical nuclear fusion, we do those of low activation V alloys, ferritic steels and ...

  3. Development of partitioning process: back-extraction of actinoid and lanthanoid with hydrazine carbonate

    International Nuclear Information System (INIS)

    In the present study the back extraction of actinoid, lanthanoid, Y, Zr, and Mo from DIDPA [Diisodecylphosphoric Acid] and HDEHP [Di(2-ethylhexylphosphoric) Acid] was investigated by using hydrazine carbonate solution. Hydrazine carbonate is a salt-free reagent and easy to decompose. If it is possible to apply this reagent to the 4-group partitioning process, more sophisticated process would be constructed, because of the reduction of secondary wastes. All the elements other than Y could be back-extracted from HDEHP and all the elements other than Y and Mo could be back-extracted from DIDPA by hydrazine carbonate. It was found that the nature of alcohol which was added to avoid emulsification affects on the distribution ratio more than the added amount. (author)

  4. Recovery of actinoids from waste solutions of fuel reprocessing

    International Nuclear Information System (INIS)

    In part II of the literature survey, characteristics of the principal separation methods, i.e., solvent extraction and ion exchange, for plutonium(IV), americium(III) and lanthanoids(III) are first described to help understand essentials in the actual examples of applications of the methods. Then, some examples of recoverying actinoids from liquid wastes, especially on a large scale, are presented. Finally, flowsheets being developed in the world for partitioning high-level liquid wastes in fuel reprocessing are given with discussion on their respective problems. (author)

  5. JAEA thermodynamic database for performance assessment of geological disposal of high-level and TRU wastes. Refinement of thermodynamic data for trivalent actinoids and samarium

    International Nuclear Information System (INIS)

    Within the scope of the JAEA thermodynamic database project for performance assessment of geological disposal of high-level radioactive and TRU wastes, the refinement of the thermodynamic data for the inorganic compounds and complexes of trivalent actinoids (actinium(III), plutonium(III), americium(III) and curium(III)) and samarium(III) was carried out. Refinement of thermodynamic data for these elements was based on the thermodynamic database for americium published by the Nuclear Energy Agency in the Organisation for Economic Co-operation and Development (OECD/NEA). Based on the similarity of chemical properties among trivalent actinoids and samarium, complementary thermodynamic data for their species expected under the geological disposal conditions were selected to complete the thermodynamic data set for the performance assessment of geological disposal of radioactive wastes. (author)

  6. Study on thermodynamic properties of actinoid oxides

    Energy Technology Data Exchange (ETDEWEB)

    Tsuji, Toshihide; Miyajima, Nobuyoshi; Kato, Tetsuya; Ochida, Manabu [Nagoya Univ. (Japan). School of Engineering; Mumomura, Tadasumi; Yamashita, Toshiyuki; Nitani, Noriko; Ouchi, Kinji

    1996-01-01

    Since long-life transuranium elements (TRU) accumulate associated with a progress of high-burnup of fuel, TRU quenching in a reactor or an accelerator has been examined in Japan. To design a fuel for TRU quenching, thermal expansion is an important thermal parameter along with thermal capacity and heat transfer coefficient. Here, lattice constants of PuO{sub 2} ThO{sub 2}, UO{sub 2} and NpO{sub 2} were investigated by high temperature X-ray diffraction, showing that the lattice constants of these dioxides but UO{sub 2} obtained in this study were well coincident with Tailor`s values. The linear expansion coefficients for ThO{sub 2}, UO{sub 2} and PuO{sub 2} agreed with TPRC data and that of NpO{sub 2} with Fahey`s measurement. The linear expansion coefficient of NpO{sub 2} was found to be temperature dependent as well as other three dioxides. Those values were in inverse proportion to their melting points in a higher temperature range, whereas in a lower temperature one, the coefficient of UO{sub 2} was larger than those of NpO{sub 2} and PuO{sub 2}. Therefore, such abnormal behavior of the coefficient in a low temperature range was considered to be related to the lower Debye temperature of UO{sub 2} compared with the other dioxides. (M.N.)

  7. Neutron Nuclear Data Evaluation of Actinoid Nuclei for CENDL-3.1

    CERN Document Server

    Guo-Chang, Chen; Bao-Sheng, Yu; Guo-You, Tang; Zhao-Min, Shi; Xi, Tao

    2011-01-01

    New evaluations for several actinoids of the third version of China Evaluated Nuclear Data Library (CENDL-3.1) have been completed during the period between 2000 and 2005. The evaluations are for all neutron induced reactions with Uranium, Neptunium, Plutonium and Americium in the mass range A=232-241, 236-239, 236-246 and 240-244, respectively, and cover the incident neutron energy up to 20 MeV. In present evaluation, much more efforts were devoted to improve reliability of nuclide for available new measured data, especially scarce experimental data. A general description for the evaluation of several actinoids data were presented.

  8. Effects of natural organic compounds on adsorption of actinoid on solid phase and interaction between colloid

    Energy Technology Data Exchange (ETDEWEB)

    Tominaga, Takeshi; Minai, Yoshitaka; Takahashi, Yoshio; Kohashi, Asaya [Tokyo Univ. (Japan); Yoshida, Zenko; Meguro, Yoshihiro; Kimura, Takaumi

    1996-01-01

    Two problems were studied such as, at first, the effects of calcium and magnesium on formation of complex of actinoid (III) and humic acid and, second, estimation of number of hydrate of europium (III) in polycarbonic acid complex by fluorescence lifetime measurements. With adding calcium and magnesium, the solubility of humic acid and apparent complex formation constant of actinoid (III)-humic acid complex decreased and amount of adsorption of humic acid on kaolinite increased. Apparent complex formation constant increased with increasing the dissociation degree but decreased with increasing the concentration of supporting electrolyte as same as that of humic acid. This result can be explained by the model of polymer electrolyte on the static electrical interaction with metal ions, because polycarbonic acid is polymer electrolyte with many dissociation groups in a molecule. (S.Y.)

  9. Study on actinoids in boundary ion transfer from an aspect of solution chemistry

    Energy Technology Data Exchange (ETDEWEB)

    Kihara, Sorin; Shirai, Makoto; Matsui, Masakazu [Kyoto Univ., Uji (Japan). Inst. for Chemical Research; Yoshida, Zenko; Aoyagi, Hisao; Kitatsuji, Yoshihiro

    1996-01-01

    This study aimed to elucidate the fundamental properties of boundary ion transfer between water (W) and organic solvent (O) and to apply the results to the study on actinoid ions. First, dissolved states of ion in W and O in relation to boundary transfer were investigated and the transfer stimulation effects by an addition of some agents which can induce their complex formation were examined. Then, a theoretical equation which expresses a relationship between ion-pair extraction reaction and {Delta}Gtr was proposed and proved with {Delta}Gtr of single ion obtained by the use of VITIES, which is an apparatus for voltammetric determination of boundary ion transfer developed by the authors. Single ion transfer in W/O was estimated from the voltammogram based on I-{Delta}V curve (I; electric current which corresponds to the amount of ion transfer and {Delta}V; phase boundary voltage). In addition, determination of actinoid ion transfer in W/O boundary was made by VITIES to clarify the ion transfer energy, velocity and transferred molecular species. Thus, developments of a new isolation method and a trial sensor for actinoid ions were undertaken based on these results. (M.N.)

  10. Supergene mobility of noble metal elements in black rock series

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    In order to discuss the supergene mobility of noble metal elements in black rock series, measurements have been conducted with ICP-MS method for the contents of Ru, Rh, Pd, Ir, Pt, Au and Ag in the primary jordisite-rich black shale ore, in the supergene leached jordisite-rich black shale ore, in the pyrite-rich black shale ore and in the water of pit, well and stream of the mining area near Zhongnan Village, Zunyi District of Guizhou Province. The temperature, pH, electric conductivity, dissolved oxygen of the water were also measured. The pit water is acidic with high electrical conductivity and low dissolved oxygen. The total content of platinum group elements in the primary pyrite-rich black shale ore is only 1/13 of that in the primary jordisite-rich black shale ore. The Ag content in the former is only a half of that in the latter while the Au contents in the two kinds of ores are almost the same. Being leached under supergene condition, the contents of most of the noble metal elements except Au in the jordisite-rich black shale ore greatly decrease; the leaching rates of Rh, Pd, Pt, the total platinum group elements and Ag reach as high as 66.72%~74.79%, revealing that under supergene condition, platinum group elements and Ag can migrate along with water; the ratios of Ag/Au, Pd/Ru, Pt/Ir and(Pt+Pd)/(Ru+Rh+Ir) are remarkably decreased, displaying that Pt and Pd relative to Ru, Rh and Ir, Ag relative to Au bear more active mobility. The noble metal elements in the black rock series near Zhongnan Village might be mobilized and migrate under the procession of "cold water" rich in [SO4]2- with pH value being about 2.4 at a temperature below 50 ℃.

  11. Effects of organic compounds on actinoid transfer in natural environment

    Energy Technology Data Exchange (ETDEWEB)

    Hiraki, Keizo; Nakaguchi, Yuzuru; Suzuki, Yasuhiro [Kinki Univ., Higashi-Osaka, Osaka (Japan). Faculty of Science and Technology; Senoo, Muneaki; Nagao, Seiya; Sakamoto, Yoshiaki

    1996-01-01

    For safety evaluation of geological disposal of radioactive wastes, it seems necessary to elucidate the geological transfer of radioactive nuclides in the soil and the undersea sediments. It has been known that there exist various organic compounds highly potential to form a complex with TRU elements, uranium, copper etc. in the soil and the sediments and those compounds may play an important role for geological transfer of nuclides. In this study, fluorescent substances contained in underground and river water were focused as the measures to identify the molecular species of organic compounds in natural water and their interactions with radionuclides and minor metals, and their geological transfers were investigated. Spectrophotometric properties of humic acid obtained in the market were examined. Its fluorescent intensity was strongest at pH 10 and stable for 2 weeks or more. Then, highly polluted river water was taken from Yamato river to determine the contents of humic acid and other fluorescent substances. Further, the effects of the additions of Cu and Fe on the fluorescent intensity were examined. (M.N.)

  12. Lie-series for orbital elements -- II. The spatial case

    CERN Document Server

    Pál, András

    2016-01-01

    If one has to attain high accuracy over long timescales during the numerical computation of the N-body problem, the method called Lie-integration is one of the most effective algorithms. In this paper we present a set of recurrence relations with which the coefficients needed by the Lie-integration of the orbital elements related to the spatial N-body problem can be derived up to arbitrary order. Similarly to the planar case, these formulae yields identically zero series in the case of no perturbations. In addition, the derivation of the formulae has two stages, analogously to the planar problem. Namely, the formulae are obtained to the first order, and then, higher order relations are expanded by involving directly the multilinear and fractional properties of the Lie-operator.

  13. Study on radiation-induced oxide-reduction of actinoid ions in acid solution

    Energy Technology Data Exchange (ETDEWEB)

    Ishigure, Kenkichi; Katsumura, Yosuke; Hiroishi, Daisuke [Tokyo Univ. (Japan). Faculty of Engineering] [and others

    1996-01-01

    Many studies have been made on the application of actinoid ion, especially UO{sub 2}{sup 2+} to change atomic valance but the mechanism of photoreduction has not yet been solved. In this study, the mechanism of photoreduction of UO{sub 2}{sup 2+} in acid solution was investigated. As functions of alcohol and acid concentrations, {phi}(U{sup IV}) was determined and photoreduction of UO{sub 2}{sup 2+} was investigated as well as NpO{sub 2}{sup 2+}. As an increase of alcohol content (EtOH, MtOH, iso-PrOH), {phi}(U{sup IV}) increased to reach a plateau ({approx}0.6). In addition, {phi}(U{sup IV}) increased linearly with an increase of acid content and the value became smaller in the order, H{sub 3}PO{sub 4}, H{sub 2}SO{sub 4}, HClO{sub 4} solution. Comparing with these results of UO{sub 2}{sup 2+}, photoreduction of NpO{sub 2}{sup 2+} was investigated. Only NpO{sub 2}{sup +} was produced as the final products, but not Np{sup IV} and NP{sup III}. Alcohol dependency of NpO{sub 2}{sup 2+} photoreduction was similar to that of UO{sub 2}{sup 2+} system but the plateau level of {phi} (NpO{sub 2}{sup 2+}) was lower ({approx}0.15) than the latter. (M.N.)

  14. Diagram of measurement series elements deviation from local linear approximations

    OpenAIRE

    Lande, D. V.; Snarskii, A. A.

    2009-01-01

    Method for detection and visualization of trends, periodicities, local peculiarities in measurement series (dL-method) based on DFA technology (Detrended fluctuation analysis) is proposed. The essence of the method lies in reflecting the values of absolute deviation of measurement accumulation series points from the respective values of linear approximation. It is shown that dL-method in some cases allows better determination of local peculiarities than wavelet-analysis. Easy-to-realize appro...

  15. Assembly, integration, and verification (AIV) in ALMA: series processing of array elements

    Science.gov (United States)

    Lopez, Bernhard; Jager, Rieks; Whyborn, Nicholas D.; Knee, Lewis B. G.; McMullin, Joseph P.

    2012-09-01

    The Atacama Large Millimeter/submillimeter Array (ALMA) is a joint project between astronomical organizations in Europe, North America, and East Asia, in collaboration with the Republic of Chile. ALMA will consist of at least 54 twelve-meter antennas and 12 seven-meter antennas operating as an aperture synthesis array in the (sub)millimeter wavelength range. It is the responsibility of ALMA AIV to deliver the fully assembled, integrated, and verified antennas (array elements) to the telescope array. After an initial phase of infrastructure setup AIV activities began when the first ALMA antenna and subsystems became available in mid 2008. During the second semester of 2009 a project-wide effort was made to put in operation a first 3- antenna interferometer at the Array Operations Site (AOS). In 2010 the AIV focus was the transition from event-driven activities towards routine series production. Also, due to the ramp-up of operations activities, AIV underwent an organizational change from an autonomous department into a project within a strong matrix management structure. When the subsystem deliveries stabilized in early 2011, steady-state series processing could be achieved in an efficient and reliable manner. The challenge today is to maintain this production pace until completion towards the end of 2013. This paper describes the way ALMA AIV evolved successfully from the initial phase to the present steady-state of array element series processing. It elaborates on the different project phases and their relationships, presents processing statistics, illustrates the lessons learned and relevant best practices, and concludes with an outlook of the path towards completion.

  16. Chromatographic generator systems for the actinides and natural decay series elements

    Energy Technology Data Exchange (ETDEWEB)

    McAlister, D.R.; Horwitz, E.P. [PG Research Foundation, Lisle, IL (United States)

    2011-07-01

    This work describes chromatographic radionuclide generator systems for the production of actinides and natural decay series elements. The generator systems begin with alpha emitting parent radioisotopes with half-lives (T{sub 1/2}) of greater than one year and produce alpha or beta emitting radioisotopes with half-lives of hours to days. Chromatographic systems were chosen to minimize radiolytic damage to chromatographic supports, preserve the parent activity for repeated use, provide high purity daughter radionuclide tracers, and to minimize or eliminate the need for evaporation of solutions of the parent or daughter nuclides. Useful secondary separations involving the daughters of the initial parent radionuclide are also described. Separation systems for {sup 210}Bi, {sup 210}Po, {sup 211}Pb, {sup 212}Pb, {sup 223}Ra, {sup 224}Ra, {sup 225}Ra, {sup 225}Ac, {sup 227}Th, {sup 228}Th, {sup 231}Th, {sup 234}Th, and {sup 239}Np are outlined in detail. (orig.)

  17. Physical properties of the 6d-series elements from density functional theory: Close similarity to lighter transition metals

    Science.gov (United States)

    Gyanchandani, Jyoti; Sikka, S. K.

    2011-05-01

    We have calculated some of the physical properties of the recently discovered 6d elements by density functional theory. Comparison with those of the 5d metals shows that there is a close analogy for the crystal structures, for parabolic variation of equilibrium atomic volumes and bulk moduli, and an almost linearly increasing behavior of the pressure derivative of the bulk modulus across the 6d series. The Friedel model that is used to explain these trends for homologous series also holds for 6d metals. These elements also seem to be placed correctly in the Periodic Table.

  18. Source tracing of noble metal elements in Lower Cambrian black rock series of Guizhou-Hunan Provinces, China

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    The Lower Cambrian black rock series of South China is abnormally rich in noble metal elements. According to the concentrations, the ratios, the relations, the distribution and partition patterns of noble metal elements, the authors think that the noble metals and other elements are neither directly from extraterrestrial materials, nor from the products of normal marine sedimentation. The abnormal enrichment of noble metal elements is closely related with hydrothermal fluid that flew out on the sea floor through deep cycling and reaction with Proterozoic ultramafic-mafic igneous rocks forming noble metal rich fluid. It is possible to form industrial multiple-element- ore-deposits, especially hydrothermal type platinum-group-element-ore-deposits in the region with strong hydrothermal action.

  19. Source tracing of noble metal elements in Lower Cambrian black rock series of Guizhou-Hunan Provinces, China

    Institute of Scientific and Technical Information of China (English)

    李胜荣; 高振敏

    2000-01-01

    The Lower Cambrian black rock series of South China is abnormally rich in noble metal elements. According to the concentrations, the ratios, the relations, the distribution and partition patterns of noble metal elements, the authors think that the noble metals and other elements are neither directly from extraterrestrial materials, nor from the products of normal marine sedimentation. The abnormal enrichment of noble metal elements is closely related with hydrothermal fluid that flew out on the sea floor through deep cycling and reaction with Proterozoic ultramafic-mafic igneous rocks forming noble metal rich fluid. It is possible to form industrial multiple-element-ore-deposits, especially hydrothermal type platinum-group-element-ore-deposits in the region with strong hydrothermal action.

  20. Postirradiation examinations of element G-3 from the GCFR F-1 series of mixed-oxide elements after approx. 3 at. % burnup

    International Nuclear Information System (INIS)

    Postirradiation examinations were performed on element G-3, from the GCFR F-1 series of mixed-oxide elements, after 2.6 at. % burnup in EBR-II. The 20% cold-worked Type 316 stainless steel clad G-3 element was irradiated as an encapsulated element using a stainless steel thermal barrier to achieve peak cladding temperatures of 6900C at a peak power of 14.4 kW/ft. The maximum diametral increase of the element was 0.2% ΔD/D0. The volatile fission products were found just above the top of the fuel column and in a gap between the bottom and next higher fuel pellet. Annular pellets were used in the element, and at 2.6 at. % burnup, the central hole was closed by fuel material at both the top and the bottom of the fuel column. Fission-product attack of the cladding was minimal; a uniform matrix attack of only 0.3 mil was found along most of the length of the fuel column

  1. Study of Noble Metal Elements in Lower Cambrian Black Rock Series of Guizhou-Hunan Provinces, China

    Institute of Scientific and Technical Information of China (English)

    1999-01-01

    Systematic analyses of noble metal elements in the Lower Cambrian black rock series of South China are reported. Correlations of w(Os)/w(Ir), w(Au)/w(Ir), w(Ag)/w(Au), w(Pt+Pd)/w(Os+Ru+Rh+Ir), relations of noble metal and platinum group element (PGE) distribution patterns reveal that the noble metals are not directly from extraterrestrial materials. Studying the data of 9 aspects, the authors conclude that the noble metals were mainly from ultramafic-mafic igneous rocks and their enrichment in black rocks is mainly controlled by hydrothermal fluid.

  2. Separation methods used for large-scale production of transplutonium elements

    International Nuclear Information System (INIS)

    The production of transplutonium elements by fission reactor in countries of the world is by combination of reactor technology and chemical engineering. A review is made of the chemical processes for production of transplutonium elements on a large scale from neutron-irradiated actinoids; first, historical progress of the production in macro quantities of transplutonium elements in the world, and then the principal processes developed in respective countries and organizations. Finally, these methods are discussed with emphasis placed on the possibility of application to the partitioning of high-level liquid wastes in fuel reprocessing. (author)

  3. The use of Rich and Suter diagrams to explain the electron configurations of transition elements

    Directory of Open Access Journals (Sweden)

    Hugo Orofino

    2013-01-01

    Full Text Available Rich and Suter diagrams are a very useful tool to explain the electron configurations of all transition elements, and in particular, the s¹ and s0 configurations of the elements Cr, Cu, Nb, Mo, Ru, Rh, Pd, Ag, and Pt. The application of these diagrams to the inner transition elements also explains the electron configurations of lanthanoids and actinoids, except for Ce, Pa, U, Np, and Cm, whose electron configurations are indeed very special because they are a mixture of several configurations.

  4. The use of Rich and Suter diagrams to explain the electron configurations of transition elements

    Energy Technology Data Exchange (ETDEWEB)

    Orofino, Hugo; Machado, Sergio P.; Faria, Roberto B., E-mail: faria@iq.ufrj.br [Instituto de Quimica, Universidade Federal do Rio de Janeiro, Rio de Janeiro, RJ (Brazil)

    2013-09-01

    Rich and Suter diagrams are a very useful tool to explain the electron configurations of all transition elements, and in particular, the s{sup 1} and s{sup 0} configurations of the elements Cr, Cu, Nb, Mo, Ru, Rh, Pd, Ag, and Pt. The application of these diagrams to the inner transition elements also explains the electron configurations of lanthanoids and actinoids, except for Ce, Pa, U, Np, and Cm, whose electron configurations are indeed very special because they are a mixture of several configurations. (author)

  5. The Evolutionary Modeling and Short-range Climatic Prediction for Meteorological Element Time Series

    Institute of Scientific and Technical Information of China (English)

    YU Kangqing; ZHOU Yuehua; YANG Jing'an; KANG Zhuo

    2005-01-01

    The time series of precipitation in flood season (May-September) at Wuhan Station, which is set as an example of the kind of time series with chaos characters, is split into two parts: One includes macro climatic timescale period waves that are affected by some relatively steady climatic factors such as astronomical factors (sunspot, etc.), some other known and/or unknown factors, and the other includes micro climatic timescale period waves superimposed on the macro one. The evolutionary modeling (EM), which develops from genetic programming (GP), is supposed to be adept at simulating the former part because it creates the nonlinear ordinary differential equation (NODE) based upon the data series. The natural fractals (NF)are used to simulate the latter part. The final prediction is the sum of results from both methods, thus the model can reflect multi-time scale effects of forcing factors in the climate system. The results of this example for 2002 and 2003 are satisfactory for climatic prediction operation. The NODE can suggest that the data vary with time, which is beneficial to think over short-range climatic analysis and prediction. Comparison in principle between evolutionary modeling and linear modeling indicates that the evolutionary one is a better way to simulate the complex time series with nonlinear characteristics.

  6. Emergence of californium as the second transitional element in the actinide series.

    Science.gov (United States)

    Cary, Samantha K; Vasiliu, Monica; Baumbach, Ryan E; Stritzinger, Jared T; Green, Thomas D; Diefenbach, Kariem; Cross, Justin N; Knappenberger, Kenneth L; Liu, Guokui; Silver, Mark A; DePrince, A Eugene; Polinski, Matthew J; Van Cleve, Shelley M; House, Jane H; Kikugawa, Naoki; Gallagher, Andrew; Arico, Alexandra A; Dixon, David A; Albrecht-Schmitt, Thomas E

    2015-01-01

    A break in periodicity occurs in the actinide series between plutonium and americium as the result of the localization of 5f electrons. The subsequent chemistry of later actinides is thought to closely parallel lanthanides in that bonding is expected to be ionic and complexation should not substantially alter the electronic structure of the metal ions. Here we demonstrate that ligation of californium(III) by a pyridine derivative results in significant deviations in the properties of the resultant complex with respect to that predicted for the free ion. We expand on this by characterizing the americium and curium analogues for comparison, and show that these pronounced effects result from a second transition in periodicity in the actinide series that occurs, in part, because of the stabilization of the divalent oxidation state. The metastability of californium(II) is responsible for many of the unusual properties of californium including the green photoluminescence. PMID:25880116

  7. Emergence of californium as the second transitional element in the actinide series

    OpenAIRE

    Cary, Samantha K.; Vasiliu, Monica; Baumbach, Ryan E.; Stritzinger, Jared T.; GREEN, THOMAS D.; Diefenbach, Kariem; Cross, Justin N.; Knappenberger, Kenneth L.; Liu, Guokui; Silver, Mark A.; DePrince, A. Eugene; Polinski, Matthew J.; Van Cleve, Shelley M.; House, Jane H.; Kikugawa, Naoki

    2015-01-01

    A break in periodicity occurs in the actinide series between plutonium and americium as the result of the localization of 5f electrons. The subsequent chemistry of later actinides is thought to closely parallel lanthanides in that bonding is expected to be ionic and complexation should not substantially alter the electronic structure of the metal ions. Here we demonstrate that ligation of californium(III) by a pyridine derivative results in significant deviations in the properties of the resu...

  8. Developing common information elements for renewable energy systems: summary and proceedings of the SERI/AID workshop

    Energy Technology Data Exchange (ETDEWEB)

    Ashworth, J.H.; Neuendorffer, J.W.

    1980-06-01

    This report describes the activities, conclusions, and recommendations of the Workshop on Evaluation Systems for Renewable Energy Systems sponsored by the Agency for International Development and SERI, held 20-22 February 1980 in Golden, Colorado. The primary objectives of the workshop was to explore whether it was possible to establish common information elements that would describe the operation and impact of renewable energy projects in developing countries. The workshop provided a forum for development program managers to discuss the information they would like to receive about renewable energy projects and to determine whether common data could be agreed on to facilitate information exchange among development organizations. Such information could be shared among institutions and used to make informed judyments on the economic, technical, and social feasibility of the technologies. Because developing countries and foreign assistance agencies will be financing an increasing number of renewable energy projects, these organizations need information on the field experience of renewable energy technologies. The report describes the substance of the workshop discussions and includes the papers presented on information systems and technology evaluation and provides lists of important information elements generated by both the plenary sessions and the small working groups.

  9. Element enrichment and U-series isotopic characteristics of the hydrothermal sulfides at Jade site in the Okinawa Trough

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    The geochemical and U-series isotopic characteristics of hydrothermal sulfide samples from the Jade site (127°04.5′E, 27°15′N, water depth 1300-1450 m) at Jade site in the Okinawa Trough were analyzed. In the hydrothermal sulfide samples bearing sulfate (samples HOK1 and HOK2), the LREEs are relatively enriched. All the hydrothermal sulfide samples except HOK1 belong to Zn-rich hydrothermal sulfide. In comparison with Zn-rich hydrothermal sulfides from other fields, the contents of Zn, Pb, Ag, Cd, Au and Hg are higher, the contents of Fe, Al, Cr, Co, Ni, Sr, Te, Cs, Ti and U lower, and the 210Pb radioactivity ratios and 210Pb/Pb ratios very low. In the hydrothermal sulfide mainly composed of sphalerite, the correlations between rare elements Hf and U, and Hf and Mn as well as that between dispersive elements Ga and Zn, are strongly positive; also the contents of Au and Ag are related to Fe-sulfide, because the low temperature promotes enrichment of Au and Ag. Meanwhile, the positive correlations between Fe and Bi and between Zn and Cd are not affected by the change of mineral assemblage. Based on the 210Pb/Pb ratios of hydrothermal sulfide samples (3.99×10-5-5.42×10?5), their U isotopic composition (238U content 1.15-2.53 ppm, 238U activity 1.07-1.87 dpm/g, 234U activity 1.15-2.09 dpm/g and 234U/238U ratio 1.07-1.14) and their 232Th and 230Th contents are at base level, and the chronological age of hydrothermal sulfide at Jade site in the Okinawa Trough is between 200 and 2000 yr.

  10. Element enrichment and U-series isotopic characteristics of the hydrothermal sulfides at Jade site in the Okinawa Trough

    Institute of Scientific and Technical Information of China (English)

    ZENG ZhiGangi; YU ShaoXiong; YIN XueBo; WANG XiaoYuan; ZHANG GuoLiang; WANG XiaoMei; CHEN DaiGeng

    2009-01-01

    The geochemical and U-series isotopic characteristics of hydrothermal sulfide samples from the Jade site (127°04.5'E, 27°15'N, water depth 1300-1450 m) at Jade site in the Okinawa Trough were analyzed. In the hydrothermal sulfide samples bearing sulfate (samples HOK1 and HOK2), the LREEs are rela- tively enriched. All the hydrothermal sulfide samples except HOK1 belong to Zn-rich hydrothermal sul- fide. In comparison with Zn-rich hydrothermal sulfides from other fields, the contents of Zn, Pb, Ag, Cd, Au and Hg are higher, the contents of Fe, Al, Cr, Co, Ni, Sr, Te, Ca, Ti and U lower, and the 210Pb radio- activity ratios and 210Pb/Pb ratios very low. In the hydrothermal sulfide mainly composed of sphalerite, the correlations between rare elements Hf and U, and Hf and Mn as well as that between dispersive elements Ga and Zn, are strongly positive; also the contents of Au and Ag are related to Fe-aulfide, because the low temperature promotes enrichment of Au and Ag. Meanwhile, the positive correlations between Fe and Bi and between Zn and Cd are not affected by the change of mineral assemblage. Based on the 210Pb/Pb ratios of hydrothermal sulfide samples (3.99x10-5-.42x10-5), their U isotopic composition (238 U content 1.15-2.53 ppm, 238U activity 1.07-1.87 dpm/g, 234U activity 1.15-2.09 dpm/g and 234U/238U ratio 1.07-1.14) and their 222Th and 230Th contents are at base level, and the chronological age of hydrothermal sulfide at Jade site in the Okinawa Trough is between 200 and 2000 yr.

  11. A Comparative Analysis of Series And Finite Element Solutions For Flow In Multi-layer Aquifers With Contiguous Layers

    Science.gov (United States)

    Wong, S.; Craig, J. R.

    2009-05-01

    Recently, Wong S. & J.R. Craig [Computational Methods in Water Resources XVII International Conference, 2008] have developed a semi-analytic series (SAS) solution method for simulating 2D steady-state groundwater flow in multi-layer aquifers with natural unconformity. The advantages of the approach include the capability to predict groundwater flow in aquifer systems with a geometrically complex structure, i.e., layers that are contiguous but vary (sometimes dramatically) in thickness across the modelled domain. The SAS approach is unorthodox compared to numerical scheme such as finite element (FE) method when handling an aquifer basin with contiguous layers. This research attempts to compare the robustness of the SAS solution with that of the FE solution under variety of different geometric conditions, including the increasing of system aspect ratios and the inclusion of pinching layers. It was found that the SAS approach is a useful benchmarking tool and that for contiguous layers, both FE methods continue to be highly accurate at even large aspect ratios. Based on the benchmarking experiments, some rules of thumb for mesh generation in FE models of regional aquifer systems with both contiguous and discontiguous layering are identified.

  12. Estimation of the Primary Magma Compositions of an Igneous Rock Series Petrogenetically Associated with Fractional Crystallization with Special Reference to Element Abundance Relationships

    Institute of Scientific and Technical Information of China (English)

    汪云亮; 张万林; 等

    1994-01-01

    A primary magma not only represents the starting point of a fractional crystallization process, but also is the product of an equilibrium or fractional partial melting process in a mantle.Element abundance relationships in the primary magma obey both law of power function for fractional crystallization and the law of fractional linear function for equilibrium partial melting .Based on this double nature of the primary magma, the authors advanced a principle to restore the primary magma composition from that of an igneous rock series with petrogenesis of fractional crystallization and put forward an approach of estimating the element abundance of the primary magma, exempli-fied by the rar-earth elements in the Andes volcanic rock series.

  13. Validation and Verification the Expanded Table for Transition Metal Carbonyl and Main Group Element Cluster Series which obey the 18-Electron and 8-Electron (octet Rules respectively

    Directory of Open Access Journals (Sweden)

    Enos Masheija Kiremire

    2014-12-01

    Full Text Available The transition metal carbonyl clusters and Main group element clusters belong to natural series based on the number theory. The number series of the cluster series have been generated using the empirical formula k = ½ (E-V where k represents the linkages or bonds that glue together the cluster elements which obey the eighteen electron rule or the octet rule and E is related to the sum of eighteen electrons or the eight electrons and V is the sum of the valence electrons. An expanded cluster table been constructed to accommodate the analysis of medium to relatively large clusters of high nuclearity. Using the knowledge of k-value and the cluster table it is possible for a given cluster formula to be categorized into its type of series and its geometry deduced. This is relatively easy for simple to medium clusters. It is hoped that this simple approach to be adapted to categorize and deduce structures of clusters with high nuclearity. This approach to clusters using number theory will complement the existing clusters theories such as Wade-Mingos rules1-7, Jemmismno rules8-9 and topology rules10.

  14. Aerosol time-series measurements over the tropical Northeast Atlantic Ocean: Dust sources, elemental composition and mineralogy

    NARCIS (Netherlands)

    Patey, M.D.; Achterberg, E.P.; Rijkenberg, M.J.; Pearce, R.

    2015-01-01

    The North Atlantic receives the largest dust loading of any of the world's oceans due to its proximity to North African deserts and prevailing wind patterns. The supply of biologically important trace elements and nutrients via aerosols has an important influence on biogeochemical processes and ecos

  15. Generation Mini-Series: Contemporary German Historical Event-Television and the Implications of its Interactive Elements

    OpenAIRE

    Hall, Sara F.

    2016-01-01

    The controversial 2012 ZDF mini-series Unsere Mütter, unsere Väter/Generation War epitomizes German “historical event television,” a broadcasting trend aligned with the recent tendency to normalize the nation’s relationship with its past. Reaching beyond the borders of the narrative drama, the series’ producers created and promoted collateral content encouraging viewers to interact with the fictional characters and other audience members in such new media platforms as Facebook, a pu...

  16. 初等函数Taylor级数的向量形式%On Vector Forms of Elemental Functions with Taylor Series

    Institute of Scientific and Technical Information of China (English)

    李庆宏; 吴新元

    2003-01-01

    Some results on special vector forms of elemental functions with Taylor series involving three complex vectors developed in [4,7,8] are generalized. An application to the second order initial value problems of ordinary differential equations is considered.%推广了初等函数Taylor级数的向量形式的一些结果,所考虑的初等函数Taylor级数的向量形式涉及了三个复向量.给出了在二阶常微分方程初值问题中的一个应用.

  17. Chemistry and origin of minor and trace elements in vitrinite concentrates from a rank series from the eastern United States, England, and Australia

    Science.gov (United States)

    Lyons, P.C.; Palmer, C.A.; Bostick, N.H.; Fletcher, J.D.; Dulong, F.T.; Brown, F.W.; Brown, Z.A.; Krasnow, M.R.; Romankiw, L.A.

    1989-01-01

    A rank series consisting of twelve vitrinite concentrates and companion whole-coal samples from mined coal beds in the eastern United States, England, and Australia were analyzed for C, H, N, O, ash, and 47 trace and minor elements by standard elemental, instrumental neutron activation analysis (INAA), and direct-current-arc spectrographic (DCAS) techniques. The reflectance of vitrinite, atomic H:C and O:C, and ash-free carbon data were used to determine ranks that range from high-volatile C bituminous coal to meta-anthracite. A van Krevelen (atomic H:C vs. O:C) diagram of the vitrinite concentrates shows a smooth curve having its lowest point at H:C = 0.18 and O:C = 0.01. This improves the van Krevelen diagram by the addition of our vitrinite concentrate from meta-anthracite from the Narragansett basin of New England. Boron content (400-450 ppm) in two Illinois basin vitrinite concentrates was about an order of magnitude higher than B contents in other concentrates analyzed. We attribute this to marine origin or hydrothermal activity. The alkaline-earth elements Ca, Mg and Ba (DCAS) have higher concentrations in our vitrinite concentrates from bituminous coals of the Appalachian basin, than they do in vitrinite concentrates from the marine-roofed bituminous coals of the Illinois basin; therefore, a nonmarine origin for these alkaline-earth elements is postulated for the Appalachian basin coals. An ion-exchange mechanism due to high concentrations of these elements as ions in diagenetic water, but probably not recent ground water, may be responsible for the relatively high values of these elements in Appalachian concentrates. Higher concentrations of Ni and Cr in one of the English vitrinite concentrates and of Zr in the Australian concentrate probably indicate organic association and detrital influence, respectively. ?? 1989.

  18. Determination of natural radionuclides from 238U and 232Th series, trace and major elements in sediment cores from baixada Santista and evaluation of impacted areas

    International Nuclear Information System (INIS)

    Baixada Santista is the region of higher population of the coast of Sao Paulo State, where it is located the largest port in Latin America, in the city of Santos, and the most important industrial complex of Latin America, in the city of Cubatao. This region has received in recent years a considerable load of industrial and domestic effluents in its water bodies, as a direct result of the industrial and port activities and the large population growth in recent decades, and is considered nowadays highly impacted. In the present study sediment cores were collected in the estuary of Santos-Cubatao, in the estuary of Sao Vicente, in the channel of Bertioga and Santos Bay, in order to determine the concentration of trace and major elements and natural radionuclides from the 238U and 232Th series. The techniques used were neutron activation analysis, X-ray fluorescence and gamma spectrometry, respectively. The obtained values for the elements Cr, Sb, Ta and Zn in some cores, are higher than data from literature, and can indicate a possible anthropic contribution. Comparing the obtained values of Cr and Zn elements determined in the sediment cores with the values of TEL and PEL index for sediment quality, it was verified that the studied region presents Cr levels higher than TEL in Santos-Cubatao estuary and Bertioga channel and Zn element presented values higher than TEL for some core slices of Santos-Cubatao estuary, for one core of Sao Vicente estuary, one core in Bertioga channel and Santos Bay. For the other elements, the values obtained in this study can be considered as reference values for the region. Although the element As presented higher values than the TEL in all the studied environments, the concentrations obtained are of the same order of magnitude as literature data and, therefore, can be considered also as reference values for the region. No enrichment was found for the major elements in all the ecosystems studied, with the exception for the element P

  19. Theoretical aspects and methods of the parameters identification of the electric traction system devices. the instantaneous powers method; series connection of elements

    Directory of Open Access Journals (Sweden)

    T.M. Mishchenko

    2012-12-01

    Full Text Available Introduction: By means of the mathematical or computer (imitating modeling the emergency, especially stochastic, transient electromagnetic and / or electro energetic processes in the electric traction system of the alternating current should be investigated. It allows expanding the research opportunities, as well as simplifying and reducing the actual testing, because it permits the wide variation of values and parameters reality of the elements of electric power circuits in the traction system without considerable material costs. Purpose: For this purpose the mathematical model of the nonlinear dynamical system "traction substation – electric traction network – electric rolling stock» as a passive two-terminal network with the given input voltage and input current is proposed. Task: The identification problem of the device under study, therefore the two-terminal network, is the determination electrical parameters (active resistance to inductance and capacity of the passive elements, which substitute the two-terminal network. The scheme of its substitution looks like the series connection of passive elements. Methodology: The method of solving this problem for the passive two-terminal network in the traction mode with alternating, nonsinusoidal, deterministic periodic input voltage and input current is proposed. The calculations are executed for the electric locomotives DS3 and 2ES5K. Results: The results for the parameters can be applied in the further calculations of the more complex electric traction systems of the alternating current.

  20. Phases of Environmental Evolution Indicated by Primary Chemical Elements and Paleontological Records in the Upper Pleistocene-Holocene Series for the Salawusu River Valley, China

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Studies of lithology, sedimentary facies and the distribution regularity of SiO2 and Al2O3 contents and Al2O3/SiO2 ratio allow us to divide the Upper Pleistocene-Holocene Series represented by the Milanggouwan section in China's Salawusu River valley into six segments: MGS1, MGS2, MGS3,MGS4, MGS5 and MGS6. The boundary ages for MGS1 (the Dishaogouwan and Dagouwan Formations), MGS2 (the upper Chengchuan Formation), MGS3 (the middle Chengchuan Formation),MGS4 (the lower Chengchuan Formation), MGS5 (most strata of the Salawusu Formation) and MGS6 (the bottom of the Salawusu Formation and the top of the Lishi Formation) correspond to those of MIS1, MIS2, MIS3, MIS4, MIS5 and MIS6, respectively, from deep sea sediments or continental glaciers. MGS5 can be subdivided into five subsegments (MGS5a, MGS5b, MGS5c,MGS5d and MGS5e) and the boundary ages of these subsegments correspond to those of MIS5a,MIS5b, MIS5c, MIS5d and MIS5e, respectively. Based on the paleoenvironment and paleoecology indicated by the primary chemical elements, fossil vertebrates, mollusks and pollen grains, we hypothesize that MGS1, MGS2, MGS3, MGS4, MGS5 and MGS6 and the subsegments of MGS5 match the corresponding stages for oxygen isotopes in the deep sea sediments and continental glaciers,and the substages of MIS5 in terms of climatic characters, further explaining the phenomena that determined the formation of the late Quaternary strata and the paleontology of the Salawusu River valley. These phenomena relate to fluctuations in the global climate (and particularly in the East Asian monsoon) during the glacial and interglacial periods.

  1. Comparative Study of f-Element Electronic Structure across a Series of Multimetallic Actinide, Lanthanide-Actinide and Lanthanum-Actinide Complexes Possessing Redox-Active Bridging Ligands

    Energy Technology Data Exchange (ETDEWEB)

    Schelter, Eric J.; Wu, Ruilian; Veauthier, Jacqueline M.; Bauer, Eric D.; Booth, Corwin H.; Thomson, Robert K.; Graves, Christopher R.; John, Kevin D.; Scott, Brian L.; Thompson, Joe D.; Morris, David E.; Kiplinger, Jaqueline L.

    2010-02-24

    A comparative examination of the electronic interactions across a series of trimetallic actinide and mixed lanthanide-actinide and lanthanum-actinide complexes is presented. Using reduced, radical terpyridyl ligands as conduits in a bridging framework to promote intramolecular metal-metal communication, studies containing structural, electrochemical, and X-ray absorption spectroscopy are presented for (C{sub 5}Me{sub 5}){sub 2}An[-N=C(Bn)(tpy-M{l_brace}C{sub 5}Me4R{r_brace}{sub 2})]{sub 2} (where An = Th{sup IV}, U{sup IV}; Bn = CH{sub 2}C{sub 6}H{sub 5}; M = La{sup III}, Sm{sup III}, Yb{sup III}, U{sup III}; R = H, Me, Et) to reveal effects dependent on the identities of the metal ions and R-groups. The electrochemical results show differences in redox energetics at the peripheral 'M' site between complexes and significant wave splitting of the metal- and ligand-based processes indicating substantial electronic interactions between multiple redox sites across the actinide-containing bridge. Most striking is the appearance of strong electronic coupling for the trimetallic Yb{sup III}-U{sup IV}-Yb{sup III}, Sm{sup III}-U{sup IV}-Sm{sup III}, and La{sup III}-U{sup IV}-La{sup III} complexes, [8]{sup -}, [9b]{sup -} and [10b]{sup -}, respectively, whose calculated comproportionation constant K{sub c} is slightly larger than that reported for the benchmark Creutz-Taube ion. X-ray absorption studies for monometallic metallocene complexes of U{sup III}, U{sup IV}, and U{sup V} reveal small but detectable energy differences in the 'white-line' feature of the uranium L{sub III}-edges consistent with these variations in nominal oxidation state. The sum of this data provides evidence of 5f/6d-orbital participation in bonding and electronic delocalization in these multimetallic f-element complexes. An improved, high-yielding synthesis of 4{prime}-cyano-2,2{prime}:6{prime},2{double_prime}-terpyridine is also reported.

  2. U-series Dating of Syntectonic Calcite Veins Constrains the Time Scales of the Elements of the Seismic Cycle in an Intraplate Normal Fault

    Science.gov (United States)

    Goodwin, L. B.; Williams, R. T.; Mozley, P.; Sharp, W. D.

    2015-12-01

    The link between fluid overpressure and the earthquake cycle has been documented through previous studies of vein arrays associated with faults and carefully designed experimental work. In the interseismic period, elevated pore fluid pressure (overpressure) will reduce the effective fault-normal stress, weakening the fault and promoting seismic rupture. Fractures produced during faulting will serve as fluid migration pathways until they are sealed by either collapse or precipitation of cement. Following sealing, pore fluid pressure is inferred to progressively increase until it reaches a level sufficient to start the cycle again. Though the rock record of this overpressure-driven seismic cycle is clear, the timescales of the different elements of the cycle have not been quantified. We have addressed this problem by dating calcite veins in the hanging wall damage zone of the Loma Blanca fault zone of the Socorro Basin, Rio Grande rift, New Mexico. These veins exhibit crack-seal microstructures that record repeated episodes of fracture opening, fluid migration, and fracture sealing, suggesting a prolonged history of recurrent seismicity and post-failure fluid migration. Stable isotope analyses of these veins reveal distinct fluid chemistries associated with individual fluid migration events. Carbon isotope values as high as +6.00‰ suggest depressurization and degassing of CO2 charged fluids, supporting the interpretation that fracturing was associated with fault slip. Preliminary U-series dating of calcite veins show a well-defined periodicity of fault slip and fracture formation, with a slip recurrence interval of approximately 73 ± 17 ka, consistent with previous studies of other faults in the Rio Grande rift. Analyses of cements deposited during single crack-seal events record sealing times of approximately 16 ± 4 ka. These results suggest that the time required to re-establish sufficient pore fluid pressure for failure following sealing of damage zone

  3. Complex Fuzzy-valued Function's Series Based on Fuzzy Structured Element%基于结构元线性生成的复Fuzzy值函数项级数

    Institute of Scientific and Technical Information of China (English)

    陈孝国

    2012-01-01

    文献[1]中提出了基于结构元理论的Fuzzy数项级数的概念,文献[2]、文献[3]、文献[4]对其收敛性进行了探讨,文献[5]、文献[6]对模糊值函数项数列及级数进行了研究.本文在此基础上给出了基于结构元线性生成的复Fuzzy值函数项数列及级数的定义,同时对复Fuzzy值函数项级数的一些重要性质进行了研究,并给出了相应定理.%The definition of fuzzy series based on fuzzy structured element is advanced in paper [1]. Then the convergence of fuzzy series is discussed in papers [2], [3] and [4], At the same time, the fuzzy-valued function sequence and series are studied in papers [5] and [6]. In this paper,the definitions of linear complex fuzzy-valued function's sequence and series are given based on structured element. At the same time,some important properties of complex fuzzy-valued function's series are studied. Finally, some corresponding theorems are given.

  4. Transuranium elements

    International Nuclear Information System (INIS)

    This paper reports that neutron irradiation of uranium, beginning in 1934, led to the reported discovery of such transuranium elements as eka-rhenium. After a few years of investigation these were correctly identified, in December 1938, as fission products. The first real transuranium elements, with atomic numbers 93 and 94 (neptumiun and plutionium), were discovered in 1940-1941. Plutomiun-239 was shown to be fission-able with slow neutrons, and chemical methods for its separation in quantity were developed. Not until it was recognized that transuranium elements should be part of a 14-member actinide series could elements 95 and 96 (americium and curium) be chemically identified after their nuclear synthesis. This new view was the key to the synthesis and identified after their nuclear synthesis. This new view was the key to the synthesis and identification of the next seven transuranium elements, resulting in the completion of the actinide series at element 103 in 1961. The transactinide elements could, according to the actinide concept, also be correctly placed in the periodic table, and the chemical properties of the first transactinide elements, elements 104 and 105 (rutherfordium and hafnium), confirm this point of view. Transuranium elements through number 109 are now known

  5. 浅谈单相串激电机电枢元件的借偏%On the Def lection of Single-Phase Series Motor Armature Element

    Institute of Scientific and Technical Information of China (English)

    庄晓龙

    2014-01-01

    以电刷的放置原则为切入点,引出串激电机电枢元件的借偏概念,介绍电枢元件借偏大小判断的原理和基本步骤。%With the principle of placing the brush as a starting point, the concept of universal motor armature element def lection is pointed, and the principle and basic steps of armature elements def lection judgment is introduced.

  6. 浅谈单相串激电机电枢元件的借偏%On the Def lection of Single-Phase Series Motor Armature Element

    Institute of Scientific and Technical Information of China (English)

    庄晓龙

    2014-01-01

    With the principle of placing the brush as a starting point, the concept of universal motor armature element def lection is pointed, and the principle and basic steps of armature elements def lection judgment is introduced.%以电刷的放置原则为切入点,引出串激电机电枢元件的借偏概念,介绍电枢元件借偏大小判断的原理和基本步骤。

  7. Fourier series

    CERN Document Server

    Tolstov, Georgi P

    1962-01-01

    Richard A. Silverman's series of translations of outstanding Russian textbooks and monographs is well-known to people in the fields of mathematics, physics, and engineering. The present book is another excellent text from this series, a valuable addition to the English-language literature on Fourier series.This edition is organized into nine well-defined chapters: Trigonometric Fourier Series, Orthogonal Systems, Convergence of Trigonometric Fourier Series, Trigonometric Series with Decreasing Coefficients, Operations on Fourier Series, Summation of Trigonometric Fourier Series, Double Fourie

  8. The Regression Analysis of Dynamic Characteristic for Series Nanofiltration Membrane Elements%系列纳滤膜元件动态特性的回归分析

    Institute of Scientific and Technical Information of China (English)

    杨宇星; 靖大为; 韩力伟; 李菁杨

    2013-01-01

      明确了纳滤膜元件运行特性与动态特性的概念,给出了膜系统运行状态方程及膜元件动态特性表达式的求解方法,并说明了纳滤膜元件脱盐率特性曲线的变化规律,为纳滤膜系统软件的设计及运行分析提供了数据基础。%The concepts of operation and dynamic characteristics of the nanofiltration membrane elements are clarified. Meanwhile, the solving methods of operation state equation of membrane system and dynamic characteristic expression of membrane element are also given in this paper. Besides, the authors illustrate the change rules of desalination rate level char-acteristic curve of nanofiltration membrane element, which provides data basis for the software design and operation analysis of nanofiltration membrane system.

  9. The Regression Analysis of Dynamic Characteristic for Series Nanofiltration Membrane Elements%系列纳滤膜元件动态特性的回归分析

    Institute of Scientific and Technical Information of China (English)

    杨宇星; 靖大为; 韩力伟; 李菁杨

    2013-01-01

    The concepts of operation and dynamic characteristics of the nanofiltration membrane elements are clarified. Meanwhile, the solving methods of operation state equation of membrane system and dynamic characteristic expression of membrane element are also given in this paper. Besides, the authors illustrate the change rules of desalination rate level char-acteristic curve of nanofiltration membrane element, which provides data basis for the software design and operation analysis of nanofiltration membrane system.%  明确了纳滤膜元件运行特性与动态特性的概念,给出了膜系统运行状态方程及膜元件动态特性表达式的求解方法,并说明了纳滤膜元件脱盐率特性曲线的变化规律,为纳滤膜系统软件的设计及运行分析提供了数据基础。

  10. Time-scales of erosion and weathering processes in the Himalayan river system: Element and isotope approach using the U-series

    International Nuclear Information System (INIS)

    The time-scales of erosion and weathering processes are key parameters which need to be determined to understand the response of the reliefs to external forcing like tectonics, climate and human activities. They were recovered by using U-series nuclides analyzed in sediments and suspended materials carried by the Himalayan rivers of the Ganges and Brahmaputra basins. In the Ganges basin, the time-scales of weathering determined from the study of coarse sediments carried by the Kali Gandaki range from several ky, where the uplift is located, to 350 ky. Such values indicate that the bed-rocks are in situ weathered for a long period before the weathering residual products get transported in the rivers as coarse sediments. At the outlet of the high range, these sediments are carried by the tributaries of the Ganges, the Gandak and Ghaghara, during a transfer period of about 100 ka. The study of the sediments at the outlet of the Brahmaputra tributaries allows to propose time-scales of weathering ranging from 110 to 270 ky. Such long periods confirm that during their transfer in the plains, the sediments are temporarily trapped at several places in the basins. In the Ganges and Brahmaputra rivers, the time-scales of sedimentary transfer are 575 and 160 ky, respectively. These values, which are of the same order as their response times, are much longer than the timescales of the Quaternary climate oscillations. It confirms the buffering action of the asiatic alluvial plains for the high-frequency sediment flux variations in response to external forcing in the chain. The study of suspended materials suggests that their chemical compositions result from the mixing of coarse river sediments with fine particles from various locations in the basin which are affected by vegetation recycling. By contrast to coarse sediments, the time-scales of transfer for the suspended materials are fast, e.g. a few ky, pointing the potential of U-series nuclides to assess particle transport

  11. Infinite series

    CERN Document Server

    Hyslop, James M

    2006-01-01

    Intended for advanced undergraduates and graduate students, this concise text focuses on the convergence of real series. Definitions of the terms and summaries of those results in analysis that are of special importance in the theory of series are specified at the outset. In the interests of maintaining a succinct presentation, discussion of the question of the upper and lower limits of a function is confined to an outline of those properties with a direct bearing on the convergence of series.The central subject of this text is the convergence of real series, but series with complex terms and

  12. Chart Series

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Centers for Medicare and Medicaid Services (CMS) offers several different Chart Series with data on beneficiary health status, spending, operations, and quality...

  13. Time Series Explorer

    Science.gov (United States)

    Loredo, Thomas

    The key, central objectives of the proposed Time Series Explorer project are to develop an organized collection of software tools for analysis of time series data in current and future NASA astrophysics data archives, and to make the tools available in two ways: as a library (the Time Series Toolbox) that individual science users can use to write their own data analysis pipelines, and as an application (the Time Series Automaton) providing an accessible, data-ready interface to many Toolbox algorithms, facilitating rapid exploration and automatic processing of time series databases. A number of time series analysis methods will be implemented, including techniques that range from standard ones to state-of-the-art developments by the proposers and others. Most of the algorithms will be able to handle time series data subject to real-world problems such as data gaps, sampling that is otherwise irregular, asynchronous sampling (in multi-wavelength settings), and data with non-Gaussian measurement errors. The proposed research responds to the ADAP element supporting the development of tools for mining the vast reservoir of information residing in NASA databases. The tools that will be provided to the community of astronomers studying variability of astronomical objects (from nearby stars and extrasolar planets, through galactic and extragalactic sources) will revolutionize the quality of timing analyses that can be carried out, and greatly enhance the scientific throughput of all NASA astrophysics missions past, present, and future. The Automaton will let scientists explore time series - individual records or large data bases -- with the most informative and useful analysis methods available, without having to develop the tools themselves or understand the computational details. Both elements, the Toolbox and the Automaton, will enable deep but efficient exploratory time series data analysis, which is why we have named the project the Time Series Explorer. Science

  14. DCP Series

    OpenAIRE

    Philip Stearns

    2011-01-01

    Photo essay. A collection of Images produced by intentionally corrupting the circuitry of a Kodak DC280 2 MP digitalcamera. By rewiring the electronics of a digital camera, glitched images are produced in a manner that parallels chemically processing unexposed film or photographic paper to produce photographic images without exposure to light. The DCP Series of Digital Images are direct visualizations of data generated by a digital camera as it takes a picture. Electronic processes associated...

  15. SERI Biomass Program. FY 1983 annual report

    Energy Technology Data Exchange (ETDEWEB)

    Corder, R.E.; Hill, A.M.; Lindsey, H.; Lowenstein, M.Z.; McIntosh, R.P.

    1984-02-01

    This report summarizes the progress and research accomplishments of the SERI Biomass Program during FY 1983. The SERI Biomass Program consists of three elements: Aquatic Species, Anaerobic Digestion, and Photo/Biological Hydrogen. Each element has been indexed separately. 2 references, 44 figures, 22 tables.

  16. Preparation and Catalytic Activity of Pt Based Hydrophobic Catalysts Adulterated with Fe Series Elements%铁系元素掺杂的Pt基疏水催化剂的制备及活性研究

    Institute of Scientific and Technical Information of China (English)

    熊亮萍; 胡胜; 侯京伟; 翁葵萍; 罗阳明; 杨通在

    2011-01-01

    Pt based binary catalysts, which were adulterated with Fe series elements, viz Fe, Co, and Ni, were prepared using microwave heating method, with carbon black as carrier and glycol as solvent. Microstructure of the catalysts was characterized by TEM, XRD, EDX and XPS. Results showed that active metal particles were evenly distributed on carrier's surface. After adulterated by Fe, Co, Ni, the distribution of active metal particles' size became narrower and average size decreased from 4.57nm to 2.17nm, 2.41nm, 2.55nm, respectively. The catalysts were loaded on foam nickel (FN) with polytetrafluoroethylene latex to obtain Pt based hydrophobic catalysts, and then their activity for hydrogen-water liquid phase catalytic exchange (LPCE) was tested. Compared with Pt/C/FN hydrophobic catalyst, the catalytic activity of Pt based binary hydrophobic catalysts adulterated with transition metals increased in evidence. The sequence of these catalysts' activity was as follows,PtFe/C/FN>PtCo/C/FN> PtNi/C/FN>Pt/C/FN. The increase of catalytic activity results from the decrease of active metals particles' size, moreover, it could be attributed to the dissociation property of water on Fe series metals' surface to some extent.%以炭黑为载体、乙二醇为溶剂,利用高压微波加热法分别制备了铁系元素(即Fe、Co、Ni三种元素)掺杂的Pt基二元催化剂.采用TEM、XRD、EDX、XPS等手段分析了催化剂的微观结构.活性金属粒子在炭黑载体表面分布均匀;Fe、Co、Ni掺杂后,催化剂中活性金属粒子的粒径分布变窄,平均粒径明显减小(由4.57nm分别降低至2.17、2.41、2.55nm);催化剂中Pt存在Pt(0)、Pt(Ⅱ)、Pt(Ⅳ)三种价态.将催化剂分散于聚四氟乙烯乳液中,采用自然浸渍法负载于泡沫镍,制得Pt基疏水催化剂,考查了其对氢-水液相交换反应的催化活性.与单一Pt基疏水催化剂相比,过渡金属掺杂后的二元疏水催化剂对氢-水液相交换反应的催化

  17. DCP Series

    Directory of Open Access Journals (Sweden)

    Philip Stearns

    2011-06-01

    Full Text Available Photo essay. A collection of Images produced by intentionally corrupting the circuitry of a Kodak DC280 2 MP digitalcamera. By rewiring the electronics of a digital camera, glitched images are produced in a manner that parallels chemically processing unexposed film or photographic paper to produce photographic images without exposure to light. The DCP Series of Digital Images are direct visualizations of data generated by a digital camera as it takes a picture. Electronic processes associated with the normal operations of the camera, which are usually taken for granted, are revealed through an act of intervention. The camera is turned inside­out through complexes of short­circuits, selected by the artist, transforming the camera from a picture taking device to a data capturing device that renders raw data (electronic signals as images. In essence, these images are snap­shots of electronic signals dancing through the camera's circuits, manually rerouted, written directly to the on­board memory device. Rather than seeing images of the world through a lens, we catch a glimpse of what the camera sees when it is forced to peer inside its own mind.

  18. Creativity Management Key Elements

    OpenAIRE

    Fuchs Ángeles, Rosa María; Franceso Tonetti, Federico Carlo

    2015-01-01

    Organizations are constantly looking towards innovation. In order to reach it they must foment creativity. This paper analyzes a series of elements considered in the organizational creativity management and proposes a model with the indispensable factors that organizations should consider to reach it. These elements are: culture and organizational environment, strategy, structure, communication, relation with customers, human resources (recruiting, training, job design, compensation, promotio...

  19. Uranium series, volcanic rocks

    Science.gov (United States)

    Vazquez, Jorge A.

    2014-01-01

    Application of U-series dating to volcanic rocks provides unique and valuable information about the absolute timing of crystallization and differentiation of magmas prior to eruption. The 238U–230Th and 230Th-226Ra methods are the most commonly employed for dating the crystallization of mafic to silicic magmas that erupt at volcanoes. Dates derived from the U–Th and Ra–Th methods reflect crystallization because diffusion of these elements at magmatic temperatures is sluggish (Cherniak 2010) and diffusive re-equilibration is insignificant over the timescales (less than or equal to 10^5 years) typically associated with pre-eruptive storage of nearly all magma compositions (Cooper and Reid 2008). Other dating methods based on elements that diffuse rapidly at magmatic temperatures, such as the 40Ar/39Ar and (U–Th)/He methods, yield dates for the cooling of magma at the time of eruption. Disequilibrium of some short-lived daughters of the uranium series such as 210Po may be fractionated by saturation of a volatile phase and can be employed to date magmatic gas loss that is synchronous with volcanic eruption (e.g., Rubin et al. 1994).

  20. Mechanism of fission of neutron-deficient actinoids nuclides

    Energy Technology Data Exchange (ETDEWEB)

    Sueki, Keisuke; Nakahara, Hiromichi [Tokyo Metropolitan Univ., Hachioji (Japan). Faculty of Science; Tanase, Masakazu; Nagame, Yuichiro; Shinohara, Nobuo; Tsukada, Kazuaki

    1996-01-01

    A heavy ion reaction ({sup 19}F+{sup 209}Bi) is selected. The reaction produces neutron-deficient {sup 228}U which is compound nucleus with a pair of Rb(z=37) and Cs(Z=55). Energy dissipation problem of nucleus was studied by measuring the isotope distribution of two fissile nuclides. Bismuth metal evaporated on aluminium foil was irradiated by {sup 19}F with the incident energy of 105-128 MeV. We concluded from the results that the excess energy of reaction system obtained with increasing the incident energy is consumed by (1) light Rb much more than Cs and (2) about 60% of energy is given to two fission fragments and the rest 40% to the translational kinetic energy or unknown anomalous {gamma}-ray irradiation. (S.Y.)

  1. Study on actinoid isolation by antimonide ion exchanger

    Energy Technology Data Exchange (ETDEWEB)

    Tsuji, Masamichi [Tokyo Inst. of Tech. (Japan). Faculty of Science; Kubota, Masumitsu; Yamagishi, Isao

    1996-01-01

    To establish a containment of long-life nuclides and an effective reduction of waste volume is important to reduce the loadings on the natural environment. Chemical isolation of radioactive nuclides from wastes was attempted by using inorganic ion exchanger with high specificity and thermal stability. In this study, titanium antimonide was used as an ion exchanger to investigate the adsorption of trivalent metallic ions according to Kielland plot curves. When the ionic equivalent fraction (X-bar{sub M}) was around 0.005, Kielland plot curve of either of 3-valent metallic ions was bent, suggesting the exchanger had two different adsorption sites. The slope of the curve became smaller as an elevation of temperature. These results show that the ion radius was decreased resulting from partial elimination of the hydrated water of ion and thus, the steric conditions around the exchange site might be improved. (M.N.)

  2. Locations in television drama series

    DEFF Research Database (Denmark)

    Waade, Anne Marit

    I take the popular Scandinavian crime series and the Danish television drama series as the starting point, and reflect analytical, theoretical and methodological approaches to location, setting and landscape in television productions. For example ‘Nordic noir’ has become a trademark...... for Scandinavian television series and include both stylistic and narrative characteristics, in which the regions’ landscape, climate, nature and provincial culture play a significant role in the series’ plot and cinematic style beside the region’s gender and welfare specific cultures (Jensen & Waade, 2013). In my...... paper I will emphasize three different but interrelated perspectives: a) How can we theoretically understand locations in drama series, both as aesthetic, economic and praxis elements? b) How can we study the production of locations empirically? And finally c) How can we analyse the significance...

  3. Dow Introduces "Human Element" to China

    Institute of Scientific and Technical Information of China (English)

    Jenny Du

    2007-01-01

    @@ Recently, the DOW Chemical Company of the United States introduced the "Human Element" to China. The "Human Element" series campaignwas launched in North America and Europe respectively from 2006 and the Q2 of 2007.

  4. Transuranium elements

    International Nuclear Information System (INIS)

    In this paper, the authors introduce this volume of historical and research papers on the transuranium elements by reviewing the period of discovery of elements 93 and beyond. Then the authors highlight the research achievements that focus on the unique properties of the 5f elements. Finally, the authors outline the technology and applications of transuranium elements and their radiobiology

  5. An element

    Energy Technology Data Exchange (ETDEWEB)

    Nakamura, K.; Iidzima, K.

    1983-03-30

    An anode of a light metal is used in the element, along with an electrolyte which consists of an ether solvent and an ionogenic additive in the form of a salt of dithiocarbamic acid. The element has good discharge characteristics.

  6. New mesogenic homologous series of -methylcinnamates

    Indian Academy of Sciences (India)

    R A Vora; A K Prajapati

    2001-04-01

    Compounds of a new smectogenic homologous series of -methylcinnamates were prepared by condensing different 4--alkoxybenzoyl chloride with methoxyethyl trans-4-hydroxy- -methylcinnamate. In this series, the first six members are non-mesogenic. -Heptyloxy derivative exhibits monotropic smectic A phase whereas rest of the members exhibit enantiotropic smectic A mesophase. The compounds are characterized by combination of elemental analysis and spectroscopic techniques. Enthalpies of few homologues are measured by DSC techniques. Fluorescent properties are also observed. The thermal stabilities of the present series are compared with those of other structurally related mesogenic homologous series.

  7. Harry Potter Series and Gothic Traditions

    Institute of Scientific and Technical Information of China (English)

    ZHU Hong-rui

    2015-01-01

    Since the first book—Harry Potter and the Philosopher’s Stone of Harry Potter series was published in 1997, it has caused a series of magic storm around the world. Why Harry Potter series can transcend ages and nationality, and have created so much global repercussion? The reason can partially due to the wonderful magic world described by Rowling. The more profound reason is that Rowling applied Gothic traditions in Harry Potter series to make her works more attractive. The thesis is based on Gothic traditions, and has discussed status and influence of Gothic novel, and Gothic elements, like situation, environment and character.

  8. Summation of series

    CERN Document Server

    Jolley, LB W

    2004-01-01

    Over 1,100 common series, all grouped for easy reference. Arranged by category, these series include arithmetical and geometrical progressions, powers and products of natural numbers, figurate and polygonal numbers, inverse natural numbers, exponential and logarithmic series, binomials, simple inverse products, factorials, trigonometrical and hyperbolic expansions, and additional series. 1961 edition.

  9. Improved 206Pb/238U microprobe geochronology by the monitoring of a trace-element-related matrix effect; SHRIMP, ID-TIMS, ELA-ICP-MS and oxygen isotope documentation for a series of zircon standards

    Science.gov (United States)

    Black, L.P.; Kamo, S.L.; Allen, C.M.; Davis, D.W.; Aleinikoff, J.N.; Valley, J.W.; Mundil, R.; Campbell, I.H.; Korsch, R.J.; Williams, I.S.; Foudoulis, C.

    2004-01-01

    Precise isotope dilution-thermal ionisation mass spectrometry (ID-TIMS) documentation is given for two new Palaeozoic zircon standards (TEMORA 2 and R33). These data, in combination with results for previously documented standards (AS3, SL13, QGNG and TEMORA 1), provide the basis for a detailed investigation of inconsistencies in 206Pb/238U ages measured by microprobe. Although these ages are normally consistent between any two standards, their relative age offsets are often different from those established by ID-TIMS. This is true for both sensitive high-resolution ion-microprobe (SHRIMP) and excimer laser ablation-inductively coupled plasma-mass spectrometry (ELA-ICP-MS) dating, although the age offsets are in the opposite sense for the two techniques. Various factors have been investigated for possible correlations with age bias, in an attempt to resolve why the accuracy of the method is worse than the indicated precision. Crystallographic orientation, position on the grain-mount and oxygen isotopic composition are unrelated to the bias. There are, however, striking correlations between the 206Pb/238U age offsets and P, Sm and, most particularly, Nd abundances in the zircons. Although these are not believed to be the primary cause of this apparent matrix effect, they indicate that ionisation of 206Pb/238U is influenced, at least in part, by a combination of trace elements. Nd is sufficiently representative of the controlling trace elements that it provides a quantitative means of correcting for the microprobe age bias. This approach has the potential to reduce age biases associated with different techniques, different instrumentation and different standards within and between laboratories. Crown Copyright ?? 2004 Published by Elsevier B.V. All rights reserved.

  10. 合金元素Ga对Al-Zn-Bi系阳极材料腐蚀机理的影响%Effect of gallium element on corrosion mechanism of Al-Zn-Bi series anode materials

    Institute of Scientific and Technical Information of China (English)

    郝庆国; 文九巴; 贺俊光; 马景灵

    2011-01-01

    采用恒电流法测定了添加Ga元素前后的Al-Zn-Bi系合金在人造海水中的开路电位、工作电位和电流效率,观察了该试验过程后合金的表面腐蚀形貌;利用极化曲线和电化学阻抗谱研究了该阳极合金在3.5%NaCl溶液中腐蚀过程的演变规律。结果表明:Ga能使Al-Zn-Bi系合金开路电位负移,工作电位稳定,电流效率升高,腐蚀形貌更加均匀;Ga可均匀固溶于铝合金中,并与回沉积的阳离子形成Ga基汞齐,使得阳极合金的活化控制步骤由第二相粒子优先溶解-脱落机理转变为金属阳离子的溶解-再沉积机理,促进阳极合金的均匀溶解,从而提高%The open circuit potential,working potential,current efficiency and surface corrosion morphology of Al-Zn-Bi alloy before and after adding Ga element in artificial seawater were tested and observed by constant current method.The corrosion characteristics of the anode alloys in 3.5% NaCl solution were investigated by polarization curves and electrochemical impedance spectra.The results show that the open circuit potential shifts towards negative,working potential becomes stable,the current efficiency improves and corrosion morphology becomes uniform through the addition of gallium in the alloy.Gallium can be uniformly dissolved into aluminum alloy and the cations can deposit back to the anode surface forming into the Ga-Al amalgam.The activation control step of anode alloy transforms from the preferential dissolution-shed mechanism of second phase particles to the dissolution-redeposition mechanism of metal cations,which promotes its homogeneous dissolution and improve comprehensive electrochemical performance.Through analysis,the different activation mechanism can be characterized by the equivalent circuits of RL(Cs(CpRp)(Q1Rd1)(LRa)) and RL(Cs(CpRp)(Q1Rd1)(LRa)(Q2Rd2)) fitted the EIS in 3.5% NaCl solution of those two alloys.

  11. Time-scales of erosion and weathering processes in the Himalayan river system: Element and isotope approach using the U-series; Constantes de temps des processus d'erosion et d'alteration dans le systeme himalayen: approche geochimique elementaire et isotopique par les series de l'uranium

    Energy Technology Data Exchange (ETDEWEB)

    Granet, M

    2007-06-15

    The time-scales of erosion and weathering processes are key parameters which need to be determined to understand the response of the reliefs to external forcing like tectonics, climate and human activities. They were recovered by using U-series nuclides analyzed in sediments and suspended materials carried by the Himalayan rivers of the Ganges and Brahmaputra basins. In the Ganges basin, the time-scales of weathering determined from the study of coarse sediments carried by the Kali Gandaki range from several ky, where the uplift is located, to 350 ky. Such values indicate that the bed-rocks are in situ weathered for a long period before the weathering residual products get transported in the rivers as coarse sediments. At the outlet of the high range, these sediments are carried by the tributaries of the Ganges, the Gandak and Ghaghara, during a transfer period of about 100 ka. The study of the sediments at the outlet of the Brahmaputra tributaries allows to propose time-scales of weathering ranging from 110 to 270 ky. Such long periods confirm that during their transfer in the plains, the sediments are temporarily trapped at several places in the basins. In the Ganges and Brahmaputra rivers, the time-scales of sedimentary transfer are 575 and 160 ky, respectively. These values, which are of the same order as their response times, are much longer than the timescales of the Quaternary climate oscillations. It confirms the buffering action of the asiatic alluvial plains for the high-frequency sediment flux variations in response to external forcing in the chain. The study of suspended materials suggests that their chemical compositions result from the mixing of coarse river sediments with fine particles from various locations in the basin which are affected by vegetation recycling. By contrast to coarse sediments, the time-scales of transfer for the suspended materials are fast, e.g. a few ky, pointing the potential of U-series nuclides to assess particle transport

  12. Time series analysis.

    NARCIS (Netherlands)

    2013-01-01

    Time series analysis can be used to quantitatively monitor, describe, explain, and predict road safety developments. Time series analysis techniques offer the possibility of quantitatively modelling road safety developments in such a way that the dependencies between the observations of time series

  13. Geometric Series via Probability

    Science.gov (United States)

    Tesman, Barry

    2012-01-01

    Infinite series is a challenging topic in the undergraduate mathematics curriculum for many students. In fact, there is a vast literature in mathematics education research on convergence issues. One of the most important types of infinite series is the geometric series. Their beauty lies in the fact that they can be evaluated explicitly and that…

  14. 秦岭山阳水沟口组黑色岩系微量元素地球化学及其沉积成矿背景的指示意义%Trace element geochemical characteristics of the Shuigoukou Formation black rock series in Shanyang area of the Qinling Mountains and their indication significance for sedimentation-mineralization

    Institute of Scientific and Technical Information of China (English)

    王立社; 张复新; 侯俊富; 房波; 周燕

    2012-01-01

    According to field investigation, it is found that the black rock series of Shuigoukou Formation in Shanyang area of the Qinling Mountains is made up of micritic limestone,carbonaceous argillite, claystone, carbonaceous siliceous argillite, carbonaceous limestone and silicalite. Phosphatic nodule and barite are commonly seen in these rocks. The abundances of rare earth elements and some trace elements such as V,Ni,Co,U,Th in the black rock series were measured using ICP-MS method. Some conclusions have been reached; 1) The average concentrations of ore-forming elements (such as V,Mo,Ni,Ba,Pb,Zn,U,Ag,Cu,Cd,Tl,Bi and Cr) are several times to dozen times higher than their crustal abundances), showing that they are rich in the rock series, especially in silicolites and argilloid. Higher content of trace elements and rare earth elements is closely related to phosphorus,TOC and barium. 2)Different concentrations of rare earth elements are connected with different types of rock. The black rock series is usually of the LPvEE -enriched type. 3) The samples are characterized by slight or intermediate negative Ce anomalies (δ Ce =0.40~1.00) and distinct positive Eu anomalies, exclusively with high δ Eu (>2.1). 4)The ratios of U/Th display a large variation from 0.31 to 28.7, the ratios of w (V) /w (V +Ni) ( 0.51~1) and w (Ni) /w (Co) (4.8~49) are relatively high,the ratios of w (Ce) / w (La) (0.68~1.89) are normal, and the average rate of?w (Co) /w (Zn) is 0.21. According to a comparison of these related parameters of PvEE and trace elements with the available data in the references and the La/Yb- Ce/ La and La/Yb - PvEE diagrams, it is suggested that the black rock series of Shuigoukou Formation was formed in the environment of a dry, anoxic and profundal to semi-profundal faulted depression sea basin belonging to a passive continental margin, with the action of hydrothermal fluids.%通过野外调研发现,秦岭造山带山阳地区水沟口组黑色岩系主要由黑

  15. 南秦岭-北大巴山镇坪地区黑色岩系多金属元素赋存状态研究%On the Poly Metal Elements Occurrence of Black Rock Series in Zhenping Region of South Qinling-North Dabashan

    Institute of Scientific and Technical Information of China (English)

    高熙贺

    2015-01-01

    Through the detailed inspection of the mineralization field geological characteristics of black rock series in Zhenping region of south Qinling-north Dabashan, combined with the studies of rock ore characteristics, test analysis of mineralization elements, electron probe analysis under the in indoor microscope, the occurrence of Fe, Cu, Zn and the other metallic elements in carbonaceous shale is found out. It is speculated that there is the two phases of mineralization here, and it has larger mineralization potential.%通过对南秦岭-北大巴山镇坪地区黑色岩系矿化点野外地质特征的详细观察,结合室内显微镜下岩矿特征、成矿元素测试分析、电子探针分析等研究,查明了Fe、Cu、Zn等金属元素在碳质页岩中的赋存状态,推测本区存在两期成矿作用,具有较大的成矿潜力。

  16. PELTIER ELEMENTS

    CERN Document Server

    Tani, Laurits

    2015-01-01

    To control Peltier elements, temperature controller was used. I used TEC-1091 that was manufactured my Meerstetter Engineering. To gain control with the temperature controller, software had to be intalled on a controlling PC. There were different modes to control the Peltier: Tempererature controller to control temperature, Static current/voltage to control voltage and current and LIVE ON/OFF to auto-tune the controller respectively to the system. Also, since near the collision pipe there is much radiation, radiation-proof Peltier elements have to be used. To gain the best results, I had to find the most efficient Peltier elements and try to get their cold side to -40 degrees Celsius.

  17. Radiographic element

    International Nuclear Information System (INIS)

    Radiographic elements are disclosed having first and second silver halide emulsion layers comprised of a dispersing medium and radiation-sensitive silver halide grains, and a support interposed between said silver halide emulsion layers capable of transmitting radiation to which said second silver halide emulsion layer is responsive. These elements are characterized in that at least said first silver halide emulsion layer contains tabular silver halide grains and spectral sensitizing dye adsorbed to the surface of the grains. Crossover can be improved in relation to the imaging characteristics. (author)

  18. Testing research on overvoltage waveshape measurements using capacitor element C3 in series connection within 500kV CVT%500kV CVT内置低压电容C3测量过电压波形的试验研究

    Institute of Scientific and Technical Information of China (English)

    司文荣; 贺林; 金珩; 傅晨钊; 黄华

    2013-01-01

    为验证基于内置低压电容C3电容式试验互感器(Capacitor Voltage Transformer,CVT)测量电力系统过电压波形的分压方式,即低压电容C3与高压电容C1和中压电容C2进行串联分压作为低压臂输出,基于无锡日新厂500kV CVT进行设备改造,串入了自制大容量无感电容单元(54μF)C3,分别进行了模拟工频过电压试验、操作冲击试验和雷电冲击试验.对采集获取的C3两端输出的数字电压波形信号进行了时、频域分析,以及分压比稳定性验证.试验和数据分析结果表明,串接自制大容量无感电容C3两端输出的电压波形光滑平稳,基本无过冲和振荡,分压比与设计值的相对偏差小于1%,即该分压方式适合用于超高压电网系统单次过电压波形的测量.%To validate a novel voltage-divider based on the capacitive voltage transformer (CVT) to measure over-voltage waveshape for power system, an element C3 in series connection with high-voltage capacitance C1 and media-voltage capacitance C2 as the low voltage part of sensor (LVPS) is used. A CVT of 500kV level provided by Nissin Electric Wuxi CO. , LTD was modified within a element C3 of 54μF in series connection. Lots of tests with ac simulation overvoltage, switch impulse and lightning impulse are done respectively to the modified CVT. Voltage waveshapes from the element C3 with digital sampling are analyzed in both time and frequency domains, and the stabilization of the voltage division ratio is also verified. The results of tests and data analysis show that the voltage waveshapes from the element C3 developed in series connection within CVT have a good characteristic with stable waveshape parameters, no overshoot and oscillation, and the relative deviation is lower than 1 % . It is feasible to be used in overvoltage waveshape measurements of power system with ultra-high voltage level.

  19. Series Transmission Line Transformer

    Science.gov (United States)

    Buckles, Robert A.; Booth, Rex; Yen, Boris T.

    2004-06-29

    A series transmission line transformer is set forth which includes two or more of impedance matched sets of at least two transmissions lines such as shielded cables, connected in parallel at one end ans series at the other in a cascading fashion. The cables are wound about a magnetic core. The series transmission line transformer (STLT) which can provide for higher impedance ratios and bandwidths, which is scalable, and which is of simpler design and construction.

  20. The construction of TRIGA-TRAP and direct high-precision Penning trap mass measurements on rare-earth elements and americium

    Energy Technology Data Exchange (ETDEWEB)

    Ketelaer, Jens

    2010-06-14

    The construction of TRIGA-TRAP and direct high-precision Penning trap mass measurements on rare-earth elements and americium: Nuclear masses are an important quantity to study nuclear structure since they reflect the sum of all nucleonic interactions. Many experimental possibilities exist to precisely measure masses, out of which the Penning trap is the tool to reach the highest precision. Moreover, absolute mass measurements can be performed using carbon, the atomic-mass standard, as a reference. The new double-Penning trap mass spectrometer TRIGA-TRAP has been installed and commissioned within this thesis work, which is the very first experimental setup of this kind located at a nuclear reactor. New technical developments have been carried out such as a reliable non-resonant laser ablation ion source for the production of carbon cluster ions and are still continued, like a non-destructive ion detection technique for single-ion measurements. Neutron-rich fission products will be available by the reactor that are important for nuclear astrophysics, especially the r-process. Prior to the on-line coupling to the reactor, TRIGA-TRAP already performed off-line mass measurements on stable and long-lived isotopes and will continue this program. The main focus within this thesis was on certain rare-earth nuclides in the well-established region of deformation around N {proportional_to} 90. Another field of interest are mass measurements on actinoids to test mass models and to provide direct links to the mass standard. Within this thesis, the mass of {sup 241}Am could be measured directly for the first time. (orig.)

  1. Welfare. Opposing Viewpoints Series.

    Science.gov (United States)

    Cozic, Charles P., Ed.; Winters, Paul A., Ed.

    Books in the Opposing Viewpoints Series present debates about current issues that can be used to teach critical reading and thinking skills. The opinions expressed in the selections in each series title examine many different aspects of a single issue. Detractors of the welfare system have long argued that the system promotes dependency. They…

  2. Seri Kinship Terminology.

    Science.gov (United States)

    Moser, Mary B.; Marlett, Stephen A.

    The Seri language contains over 50 kinship terms and represents one of the most highly elaborated kinship systems described to date. This paper discusses Seri kinship terminology and centers around, but is not limited to, the set of obligatory possessed noun stems that are inflected with the following possessive prefixes": "hi-,""ma-," and "a-."…

  3. Rheumatoid Arthritis Educational Video Series

    Medline Plus

    Full Text Available ... Rheumatoid Arthritis Educational Video Series Rheumatoid Arthritis Educational Video Series This series of five videos was designed ... Activity Role of Body Weight in Osteoarthritis Educational Videos for Patients Rheumatoid Arthritis Educational Video Series Psoriatic ...

  4. Accounting Issues: An Essay Series Part VII--Liabilities

    Science.gov (United States)

    Laux, Judy

    2008-01-01

    This article, the seventh in the series, presents accounting for liabilities along with some related conceptual and measurement issues. Additional coverage is devoted to potential ethical dilemmas and both theoretical and empirical literature related to this set of accounting elements.

  5. Radiographic element

    International Nuclear Information System (INIS)

    Radiographic elements are disclosed comprised of first and second silver halide emulsion layers separated by an interposed support capable of transmitting radiation to which the second image portion is responsive. At least the first imaging portion contains a silver halide emulsion in which thin tubular silver halide grains of intermediate aspect ratios (from 5:1 to 8:1) are present. Spectral sensitizing dye is adsorbed to the surface of the tubular grains. Increased photographic speeds can be realized at comparable levels of crossover. (author)

  6. Time Series Momentum

    DEFF Research Database (Denmark)

    Moskowitz, Tobias J.; Ooi, Yao Hua; Heje Pedersen, Lasse

    2012-01-01

    We document significant “time series momentum” in equity index, currency, commodity, and bond futures for each of the 58 liquid instruments we consider. We find persistence in returns for one to 12 months that partially reverses over longer horizons, consistent with sentiment theories of initial...... under-reaction and delayed over-reaction. A diversified portfolio of time series momentum strategies across all asset classes delivers substantial abnormal returns with little exposure to standard asset pricing factors and performs best during extreme markets. Examining the trading activities...... of speculators and hedgers, we find that speculators profit from time series momentum at the expense of hedgers....

  7. Superheavy elements

    CERN Document Server

    Hofmann, S

    1999-01-01

    The outstanding aim of experimental investigations of heavy nuclei is the exploration of spherical 'SuperHeavy Elements' (SHEs). On the basis of the nuclear shell model, the next double magic shell-closure beyond sup 2 sup 0 sup 8 Pb is predicted at proton numbers between Z=114 and 126 and at neutron number N=184. All experimental efforts aiming at identifying SHEs (Z>=114) were negative so far. A highly sensitive search experiment was performed in November-December 1995 at SHIP. The isotope sup 2 sup 9 sup 0 116 produced by 'radiative capture' was searched for in the course of a 33 days irradiation of a sup 2 sup 0 sup 8 Pb target with sup 8 sup 2 Se projectiles, however, only cross-section limits were measured. Positive results were obtained in experiments searching for elements from 110 to 112 using cold fusion and the 1n evaporation channel. The produced isotopes were unambiguously identified by means of alpha-alpha correlations. Not fission, but alpha emission is the dominant decay mode. The measurement ...

  8. Thematic Unity Across a Video Game Series.

    Directory of Open Access Journals (Sweden)

    Jason Brame

    2011-07-01

    Full Text Available Koji Kondo’s music is among the most recognized video game music ever written. As the composer for both Super Mario Bros. (Nintendo, 1984 and The Legend of Zelda (Nintendo, 1986, he has received international fame and recognition for his game compositions. With The Legend of Zelda series, Kondo has managed to create new music for each iteration of the series while maintaining a sense of unity across the series as a whole. Through the use of motivic and prolongational analysis, this article demonstrates how Kondo created this unity across the entire Zelda franchise, while making each game’s score unique by examining one musical element, the overworld theme, from each of the main entries in the Zelda series. A Schenkerian-like analysis is used to identify structural and motivic relationships between the various themes. This essay concludes with an examination of semiotic implications of this analysis and its impact on other aspects of the Zelda series and game music analysis as a whole. Using concepts from Barthes Elements of Semiology, I discuss the implication of the musical analysis to show how this approach can provide the basis for an in-depth look at musical signs in video games. In this discussion of thematic unity, I’m exploring both musical theme and a semiological theme.

  9. Historical Climatology Series

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Historical Climatology Series (HCS) is a set of climate-related publications published by NOAA's National Climatic Data Center beginning in 1978. HCS is...

  10. Multivariate Time Series Search

    Data.gov (United States)

    National Aeronautics and Space Administration — Multivariate Time-Series (MTS) are ubiquitous, and are generated in areas as disparate as sensor recordings in aerospace systems, music and video streams, medical...

  11. A multivariate approach to modeling univariate seasonal time series

    NARCIS (Netherlands)

    Ph.H.B.F. Franses (Philip Hans)

    1994-01-01

    textabstractA seasonal time series can be represented by a vector autoregressive model for the annual series containing the seasonal observations. This model allows for periodically varying coefficients. When the vector elements are integrated, the maximum likelihood cointegration method can be used

  12. Long time series

    DEFF Research Database (Denmark)

    Hisdal, H.; Holmqvist, E.; Hyvärinen, V.;

    Awareness that emission of greenhouse gases will raise the global temperature and change the climate has led to studies trying to identify such changes in long-term climate and hydrologic time series. This report, written by the......Awareness that emission of greenhouse gases will raise the global temperature and change the climate has led to studies trying to identify such changes in long-term climate and hydrologic time series. This report, written by the...

  13. Series connection of IGBT

    OpenAIRE

    Nguyen, The Van; Jeannin, Pierre-Olivier; Vagnon, Eric; Frey, David; Crébier, Jean-Christophe

    2010-01-01

    International audience This article analyzes the effects of parasitic capacitances in the series connection of IGBT, which exist naturally due to gate driver and power circuit geometry. Two solutions, that can be combined, are proposed to minimize these effects in order to achieve a better voltage balancing. The first one is based on gate driver self-powering technique. The second one is based on a vertical structure assembly of IGBT connected in series. The performance offered by these tw...

  14. Multivariate Generalized Gram-Charlier Series in Vector Notations

    OpenAIRE

    C, Dharmani Bhaveshkumar

    2015-01-01

    The article derives multivariate Generalized Gram-Charlier (GGC) series that expands an unknown joint probability density function (\\textit{pdf}) of a random vector in terms of the differentiations of the joint \\textit{pdf} of a reference random vector. Conventionally, the higher order differentiations of a multivariate \\textit{pdf} in GGC series will require multi-element array or tensor representations. But, the current article derives the GGC series in vector notations. The required higher...

  15. The Statistical Analysis of Time Series

    CERN Document Server

    Anderson, T W

    2011-01-01

    The Wiley Classics Library consists of selected books that have become recognized classics in their respective fields. With these new unabridged and inexpensive editions, Wiley hopes to extend the life of these important works by making them available to future generations of mathematicians and scientists. Currently available in the Series: T. W. Anderson Statistical Analysis of Time Series T. S. Arthanari & Yadolah Dodge Mathematical Programming in Statistics Emil Artin Geometric Algebra Norman T. J. Bailey The Elements of Stochastic Processes with Applications to the Natural Sciences George

  16. The elemental composition of the Sun I. The intermediate mass elements Na to Ca

    OpenAIRE

    Scott, Pat; Grevesse, Nicolas; Asplund, Martin; Sauval, A. Jacques; Lind, Karin; Takeda, Yoichi; Collet, Remo; Trampedach, Regner; Hayek, Wolfgang

    2014-01-01

    The composition of the Sun is an essential piece of reference data for astronomy, cosmology, astroparticle, space and geo-physics. This article, dealing with the intermediate-mass elements Na to Ca, is the first in a series describing the comprehensive re-determination of the solar composition. In this series we severely scrutinise all ingredients of the analysis across all elements, to obtain the most accurate, homogeneous and reliable results possible. We employ a highly realistic 3D hydrod...

  17. Locations in Television Drama Series (special issue)

    DEFF Research Database (Denmark)

    Waade, Anne Marit

    2017-01-01

    This special issue is dedicated to the analysis of the increasingly significant role of location as a key element in television drama. In recent years, the popularity of serial television has progressively been tied to the expanded use of location as a central element in productions, both...... as setting and as part of a wider audience engagement driven by social media and marketing. Popular television series and brands as for example Game of Thrones, Sex and the city, Nordic Noir, The Fall, Cities and The Wire illustrate how location has become a significant production value. This emerging field...... mainly been considered as a practical term in film and television productions....

  18. Transient voltage sharing in series-coupled high voltage switches

    Directory of Open Access Journals (Sweden)

    Editorial Office

    1992-07-01

    Full Text Available For switching voltages in excess of the maximum blocking voltage of a switching element (for example, thyristor, MOSFET or bipolar transistor such elements are often coupled in series - and additional circuitry has to be provided to ensure equal voltage sharing. Between each such series element and system ground there is a certain parasitic capacitance that may draw a significant current during high-speed voltage transients. The "open" switch is modelled as a ladder network. Analy­sis reveals an exponential progression in the distribution of the applied voltage across the elements. Overstressing thus oc­curs in some of the elements at levels of the total voltage that are significantly below the design value. This difficulty is overcome by grading the voltage sharing circuitry, coupled in parallel with each element, in a prescribed manner, as set out here.

  19. Transition edge sensor series array bolometer

    International Nuclear Information System (INIS)

    A transition edge sensor series array (TES-SA) is an array of identical TESs that are connected in series by low-inductance superconducting wiring. The array elements are equally and well thermally coupled to the absorber and respond to changes in the absorber temperature in synchronization. The TES-SA total resistance increases compared to a single TES while the shape of the superconducting transition is preserved. We are developing a TES-SA with a large number, hundreds to thousands, of array elements with the goal of enabling the readout of a TES-based bolometer operated at 4.2 K with a semiconductor-based amplifier located at room temperature. The noise and dynamic performance of a TES-SA bolometer based on a niobium/aluminum bilayer is analyzed. It is shown that stable readout of the bolometer with a low-noise transimpedance amplifier is feasible.

  20. Visual time series analysis

    DEFF Research Database (Denmark)

    Fischer, Paul; Hilbert, Astrid

    2012-01-01

    We introduce a platform which supplies an easy-to-handle, interactive, extendable, and fast analysis tool for time series analysis. In contrast to other software suits like Maple, Matlab, or R, which use a command-line-like interface and where the user has to memorize/look-up the appropriate...... commands, our application is select-and-click-driven. It allows to derive many different sequences of deviations for a given time series and to visualize them in different ways in order to judge their expressive power and to reuse the procedure found. For many transformations or model-ts, the user may...... choose between manual and automated parameter selection. The user can dene new transformations and add them to the system. The application contains efficient implementations of advanced and recent techniques for time series analysis including techniques related to extreme value analysis and filtering...

  1. Time series analysis

    CERN Document Server

    Madsen, Henrik

    2007-01-01

    ""In this book the author gives a detailed account of estimation, identification methodologies for univariate and multivariate stationary time-series models. The interesting aspect of this introductory book is that it contains several real data sets and the author made an effort to explain and motivate the methodology with real data. … this introductory book will be interesting and useful not only to undergraduate students in the UK universities but also to statisticians who are keen to learn time-series techniques and keen to apply them. I have no hesitation in recommending the book.""-Journa

  2. Applied time series analysis

    CERN Document Server

    Woodward, Wayne A; Elliott, Alan C

    2011-01-01

    ""There is scarcely a standard technique that the reader will find left out … this book is highly recommended for those requiring a ready introduction to applicable methods in time series and serves as a useful resource for pedagogical purposes.""-International Statistical Review (2014), 82""Current time series theory for practice is well summarized in this book.""-Emmanuel Parzen, Texas A&M University""What an extraordinary range of topics covered, all very insightfully. I like [the authors'] innovations very much, such as the AR factor table.""-David Findley, U.S. Census Bureau (retired)""…

  3. Rheumatoid Arthritis Educational Video Series

    Science.gov (United States)

    ... Corner / Patient Webcasts / Rheumatoid Arthritis Educational Video Series Rheumatoid Arthritis Educational Video Series This series of five videos ... Your Arthritis Managing Chronic Pain and Depression in Arthritis Nutrition & Rheumatoid Arthritis Arthritis and Health-related Quality of Life ...

  4. Rheumatoid Arthritis Educational Video Series

    Medline Plus

    Full Text Available ... Patient Webcasts / Rheumatoid Arthritis Educational Video Series Rheumatoid Arthritis Educational Video Series This series of five videos ... member of our patient care team. Managing Your Arthritis Managing Your Arthritis Managing Chronic Pain and Depression ...

  5. Impedance matching through a single passive fractional element

    KAUST Repository

    Radwan, Ahmed Gomaa

    2012-07-01

    For the first time, a generalized admittance Smith chart theory is introduced to represent fractional order circuit elements. The principles of fractional order matching circuits are described. We show that for fractional order α < 1, a single parallel fractional element can match a wider range of load impedances as compared to its series counterpart. Several matching examples demonstrate the versatility of fractional order series and parallel element matching as compared to the conventional approach. © 2012 IEEE.

  6. Methods to create series of technology

    Directory of Open Access Journals (Sweden)

    R. Rząsiński

    2009-10-01

    Full Text Available Purpose: The main reason to commence research concerning new methods of transformation technology into structure was introduced in the process of creating ordered technologies on the basis of series of structure. The worked out datum for these methods is as elaborated ordered families of structure in the form of series of types or modular series of elements structure.Design/methodology/approach: This paper shows algorithmic understanding to get input data in the process of technology creation based on data of structure. Basic tool to realize data selection for the process of manufacture is the theory of technological similarity, algorithmic method and use of advanced graphic programme.Findings: The basic result of the analyzed problem is to realize relations between structure and technology for specified series of machine engines elements types. Moreover, the theory of technological similarity with its essential constituents which determine input date for selection processes algorythmisation of technological features on the basis of constructional features was introduced.Research limitations/implications: Analyzed methods develop algorythmisation of designing environment and support integration with the process preparing production. Further analyses will be carried out on in order to specify the theory of technological similarity in new forms of computer-aided (relational databases, theory of automatic classification.Practical implications: Described methods were developed based on practical examples of the technological module systems creation for hydraulic cylinders used in mining, slag cars used in metallurgy and series of gears types. The represented methods are applied to the unit’s types of hydraulic servo-motors used in mining.Originality/value: Method of the technological similarity, the algorithmic method and CAM method are the basis for selection of technological features in the process, which creates the as ordered technology

  7. Gangs. Opposing Viewpoints Series.

    Science.gov (United States)

    Cozic, Charles P., Ed.

    Books in the Opposing Viewpoints Series present debates about current issues that can be used to teach critical reading and thinking skills. The variety of opinions expressed in this collection of articles and book excerpts explore many aspects of juvenile gangs. Some youths join gangs of their own free choice, to satisfy ego or greed. Others are…

  8. Poverty. Opposing Viewpoints Series.

    Science.gov (United States)

    Leone, Bruno, Ed.

    Books in the Opposing Viewpoints Series present debates about current issues that can be used to teach critical reading and thinking skills. The varied opinions in each collection explore aspects of a social, cultural, or political issue. A great deal of money has been spent in this country to eradicate poverty, but the problem remains. Some…

  9. Discrimination. Opposing Viewpoints Series.

    Science.gov (United States)

    Williams, Mary E., Ed.

    Books in the Opposing Viewpoints series challenge readers to question their own opinions and assumptions. By reading carefully balanced views, readers confront new ideas on the topic of interest. The Civil Rights Act of 1964, which prohibited job discrimination based on age, race, religion, gender, or national origin, provided the groundwork for…

  10. Lower GI Series

    Science.gov (United States)

    ... more detailed view of the large intestine The health care provider and radiologist—a doctor who specializes in medical imaging— will ... the large intestine with the barium • if the health care provider has ... GI series, the radiologist will inject air through the tube to inflate ...

  11. Composition: Unity - Diversity series

    DEFF Research Database (Denmark)

    Bergstrøm-Nielsen, Carl

    2015-01-01

    Unity-Diversity series are open compositions to be realised by improvising musicians. See more about my composition practise in the entry "Composition - General Introduction". This work is licensed under a Creative Commons "by-nc" License. You may for non-commercial purposes use and distribute it...

  12. From Fourier Series to Rapidly Convergent Series for Zeta(3)

    DEFF Research Database (Denmark)

    Scheufens, Ernst E

    2011-01-01

    The article presents a mathematical study which investigates the exact values of the Riemann zeta (ζ) function. It states that exact values can be determined from Fourier series for periodic versions of even power functions. It notes that using power series for logarithmic functions...... on this such series, a rapidly convergent series for ζ (3) is obtained....

  13. SOME PROPERTIES OF MULTIPLE TAYLOR SERIES AND RANDOM TAYLOR SERIES

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    Some polar coordinates are used to determine the domain and the ball of convergence of a multiple Taylor series. In this domain and in this ball the series converges,converges absolutely and converges uniformly on any compact set. Growth and other properties of the series may also be studied. For some random multiple Taylor series there are some corresponding properties.

  14. The dynamic stiffness matrix of two-dimensional elements: application to Kirchhoff's plate continuous elements

    Science.gov (United States)

    Casimir, J. B.; Kevorkian, S.; Vinh, T.

    2005-10-01

    This paper describes a procedure for building the dynamic stiffness matrix of two-dimensional elements with free edge boundary conditions. The dynamic stiffness matrix is the basis of the continuous element method. Then, the formulation is used to build a Kirchhoff rectangular plate element. Gorman's method of boundary condition decomposition and Levy's series are used to obtain the strong solution of the elementary problem. A symbolic computation software partially performs the construction of the dynamic stiffness matrix from this solution. The performances of the element are evaluated from comparisons with harmonic responses of plates obtained by the finite element method.

  15. Mechanical Analogies of Fractional Elements

    Institute of Scientific and Technical Information of China (English)

    HU Kai-Xin; ZHU Ke-Qin

    2009-01-01

    A Fractional element model describes a special kind of viscoelastic material.Its stress is proportional to the fractional-order derivative of strain. Physically the mechanical analogies of fractional elements can be represented by spring-dashpot fractal networks. We introduce a constitutive operator in the constitutive equations of viscoelastic materials.To derive constitutive operators for spring-dashpot fractal networks, we use Heaviside operational calculus, which provides explicit answers not otherwise obtainable simply.Then the series-parallel formulas for the constitutive operator are derived. Using these formulas, a constitutive equation of fractional element with 1/2-order derivative is obtained.Finally we find the way to derive the constitutive equations with other fractional-order derivatives and their mechanical analogies.

  16. Causality between time series

    CERN Document Server

    Liang, X San

    2014-01-01

    Given two time series, can one tell, in a rigorous and quantitative way, the cause and effect between them? Based on a recently rigorized physical notion namely information flow, we arrive at a concise formula and give this challenging question, which is of wide concern in different disciplines, a positive answer. Here causality is measured by the time rate of change of information flowing from one series, say, X2, to another, X1. The measure is asymmetric between the two parties and, particularly, if the process underlying X1 does not depend on X2, then the resulting causality from X2 to X1 vanishes. The formula is tight in form, involving only the commonly used statistics, sample covariances. It has been validated with touchstone series purportedly generated with one-way causality. It has also been applied to the investigation of real world problems; an example presented here is the cause-effect relation between two climate modes, El Ni\\~no and Indian Ocean Dipole, which have been linked to the hazards in f...

  17. Spacer for supporting fuel element boxes

    International Nuclear Information System (INIS)

    A spacer plate unit arranged externally on each side and at a predetermined level of a polygonal fuel element box for mutually supporting, with respect to one another, a plurality of the fuel element boxes forming a fuel element bundle, is formed of a first and a second spacer plate part each having the same length and the same width and being constituted of unlike first and second materials, respectively. The first and second spacer plate parts of the several spacer plate units situated at the predetermined level are arranged in an alternating continuous series when viewed in the peripheral direction of the fuel element box, so that any two spacer plate units belonging to face-to-face oriented sides of two adjoining fuel element boxes in the fuel element bundle define interfaces of unlike materials

  18. Square summable power series

    CERN Document Server

    de Branges, Louis

    2015-01-01

    This text for advanced undergraduate and graduate students introduces Hilbert space and analytic function theory, which is centered around the invariant subspace concept. The book's principal feature is the extensive use of formal power series methods to obtain and sometimes reformulate results of analytic function theory. The presentation is elementary in that it requires little previous knowledge of analysis, but it is designed to lead students to an advanced level of performance. This is achieved chiefly through the use of problems, many of which were proposed by former students. The book's

  19. Cost calculation of constructions series of types

    Directory of Open Access Journals (Sweden)

    P. Gendarz

    2010-05-01

    Full Text Available Purpose: The main aim of research was to elaborate methods to estimate costs in construction series of types production process.Design/methodology/approach: Based on manufacturing cost of one element it is possible to determine cost of other elements belonged to the same construction series of types. The four main cost estimating methods were distinguished. The first method is feature-based. The technological operations are dedicated to specified pieces of element. Cost manufacturing of every piece is specified. Based on elementary costs the manufacturing cost of whole part is calculated. The second method uses construction similarity theory. The selected part manufacturing costs are functionally depended on main part manufacturing costs. The CAM method is based on time calculation from manufacturing process simulation. The simplified method uses normalized masses of analyzed parts pieces. The balance coefficients of those pieces are specified.Findings: Manufacturing cost estimation methods were analyzed. Those methods are based on construction and manufacturing technology. The main conclusion is that CAM method is most accurate.Research limitations/implications: The CAM method is limited to analyze only manufacturing process based on numerically controlled machines. The Feature-based method require developed database for analyzed part family.Practical implications: Presented method was applied in hydraulic props manufacturing cost analysis.Originality/value: Described analysis puts together and compares different cost estimating methods which allows choosing most suitable method for analyzed manufacturing process.

  20. Series of Reciprocal Triangular Numbers

    Science.gov (United States)

    Bruckman, Paul; Dence, Joseph B.; Dence, Thomas P.; Young, Justin

    2013-01-01

    Reciprocal triangular numbers have appeared in series since the very first infinite series were summed. Here we attack a number of subseries of the reciprocal triangular numbers by methodically expressing them as integrals.

  1. GPS Position Time Series @ JPL

    Science.gov (United States)

    Owen, Susan; Moore, Angelyn; Kedar, Sharon; Liu, Zhen; Webb, Frank; Heflin, Mike; Desai, Shailen

    2013-01-01

    Different flavors of GPS time series analysis at JPL - Use same GPS Precise Point Positioning Analysis raw time series - Variations in time series analysis/post-processing driven by different users. center dot JPL Global Time Series/Velocities - researchers studying reference frame, combining with VLBI/SLR/DORIS center dot JPL/SOPAC Combined Time Series/Velocities - crustal deformation for tectonic, volcanic, ground water studies center dot ARIA Time Series/Coseismic Data Products - Hazard monitoring and response focused center dot ARIA data system designed to integrate GPS and InSAR - GPS tropospheric delay used for correcting InSAR - Caltech's GIANT time series analysis uses GPS to correct orbital errors in InSAR - Zhen Liu's talking tomorrow on InSAR Time Series analysis

  2. Magnetic Field Emission Comparison for Series-Parallel and Series-Series Wireless Power Transfer to Vehicles – PART 1/2

    DEFF Research Database (Denmark)

    Batra, Tushar; Schaltz, Erik

    2014-01-01

    -series counterpart at steady state resonant operation. First of all analytical expressions for the above mentioned statement are presented and is later substantiated with simulations on a finite element solver (Comsol). Results for variation of the magnetic emissions ratio for the two topologies are presented...

  3. SERI Biomass Program

    Science.gov (United States)

    Bergeron, P. W.; Corder, R. E.; Hill, A. M.; Lindsey, H.; Lowenstein, M. Z.

    1983-02-01

    The biomass with which this report is concerned includes aquatic plants, which can be converted into liquid fuels and chemicals; organic wastes (crop residues as well as animal and municipal wastes), from which biogas can be produced via anerobic digestion; and organic or inorganic waste streams, from which hydrogen can be produced by photobiological processes. The Biomass Program Office supports research in three areas which, although distinct, all use living organisms to create the desired products. The Aquatic Species Program (ASP) supports research on organisms that are themselves processed into the final products, while the Anaerobic Digestion (ADP) and Photo/Biological Hydrogen Program (P/BHP) deals with organisms that transform waste streams into energy products. The P/BHP is also investigating systems using water as a feedstock and cell-free systems which do not utilize living organisms. This report summarizes the progress and research accomplishments of the SERI Biomass Program during FY 1982.

  4. Globe: Lecture series

    CERN Multimedia

    2007-01-01

    The LHC: an accelerator of science This series of lectures is all about understanding the scientific and technological challenges of the phenomenal LHC project and assessing its innovations through their everyday applications. Come and take a sneak preview of the LHC! Communicate: the Grid, a computer of global dimensions François Grey, head of communication in CERN’s Information Technology Department How will it be possible for the 15 million billion bytes of data generated by the LHC every year to be handled and stored by a computer that doesn’t have to be the size of a skyscraper? The computer scientists have the answer: the Grid, which will harness the power of tens of thousands of computers all over the world by creating a network of computers and making them operate as one. >>> Lectures are free and require no specialist knowledge. In french. 
 >>> By reservation only: tel. +41 (0)22 767 76 76

  5. Finite Dynamic Elements and Modal Analysis

    Directory of Open Access Journals (Sweden)

    N.J. Fergusson

    1993-01-01

    Full Text Available A general modal analysis scheme is derived for forced response that makes use of high accuracy modes computed by the dynamic element method. The new procedure differs from the usual modal analysis in that the modes are obtained from a power series expansion for the dynamic stiffness matrix that includes an extra dynamic correction term in addition to the static stiffness matrix and the consistent mass matrix based on static displacement. A cantilevered beam example is used to demonstrate the relative accuracies of the dynamic element and the traditional finite element methods.

  6. Harmonic Series Meets Fibonacci Sequence

    Science.gov (United States)

    Chen, Hongwei; Kennedy, Chris

    2012-01-01

    The terms of a conditionally convergent series may be rearranged to converge to any prescribed real value. What if the harmonic series is grouped into Fibonacci length blocks? Or the harmonic series is arranged in alternating Fibonacci length blocks? Or rearranged and alternated into separate blocks of even and odd terms of Fibonacci length?

  7. The diagram for phyllotactic series

    Directory of Open Access Journals (Sweden)

    Joanna Szymanowska-Pułka

    2014-02-01

    Full Text Available Many authors studying phyllotaxis in various plant species have reported the occurrence of many different numbers of contact parastichy pairs that are members of different Fibonacci-like series. On the basis of these reports a diagram was constructed in which any theoretically possible series was represented by the two first members of a given series.

  8. Nonketotic hyperglycinemia case series

    Directory of Open Access Journals (Sweden)

    Mehtab Iqbal

    2015-01-01

    Full Text Available To present three cases who presented with neonatal hiccups and who were later diagnosed with nonketotic hyperglycinemia (NKH. Case series. We present three babies who presented in neonatal life with hiccups who later were diagnosed with NKH. Two babies presented on the 2nd day of life with hypotonia, poor feeding, and abnormal movements including jitteriness, hiccups, and twitching. The third baby only had transient hiccups lasting for a couple of days in the 1st week of life but later presented at 3 months of age with poor feeding, drowsiness, and jerky movements. All three cases needed extensive investigations before reaching the diagnosis including metabolic screen, lumbar puncture, electroencephalography, and computed tomography/magnetic resonance imaging. The first two babies needed intubation on their 2nd day of life because of apneas in whom later, the care was withdrawn after reaching the diagnosis of NKH because of poor prognosis. The third baby was discharged home on oral dextromethorphan and ketogenic diet. We discuss the importance of early recognition of symptoms (frequent hiccups and investigation needed to reach the diagnosis early as it helps in making decision to either carry on treatment or withdraw care because of poor prognosis. It also helps in genetic counseling and prenatal diagnosis can be offered at the subsequent pregnancy.

  9. The Ekamanganese elements

    International Nuclear Information System (INIS)

    A recent study tends to revalidate the search for element 43 done in 1925. In ores with properties similar to the hypothetical chemical properties of the missing elements 43 and 75, the unknown elements were concentrated by chemical means. Roentgen-ray spectroscopy was applied in order to observe the characteristic Roentgen L lines for element 75 and K lines for element 43. Element 43 was observed in sperrylith, gadolinit, fergusonit and columbit. The name masurium was proposed. Similarly, element 75 was observed in tantalit, wolframit and platinit. The name rhenium was chosen. (MCB)

  10. Analytical series representing DE431 ephemerides of terrestrial planets

    Science.gov (United States)

    Kudryavtsev, Sergey M.

    2016-03-01

    This paper describes the new analytical series DEA431, which comprise orbital elements of terrestrial planets obtained from the long-term numerical ephemerides DE431. The series are obtained from a modified frequency analysis of the ephemerides over 30 000 yr [-13 000, 17 000], the total time interval covered by DE431. Unlike the procedure involving classical Fourier analysis, the development here is made to trigonometric series in which both the amplitudes and the arguments of the series terms are high-degree polynomials of time. A comparison of the new series with those given by the most accurate analytical theory of planetary motion VSOP2013 is performed. The two analytical solutions find very similar major fundamental frequencies of planetary motion; however, the number of terms for orbital elements in the DEA431 development is about one order of magnitude lower than that in the VSOP2013 theory. VSOP2013 is still the best analytical solution when predicting the motion of terrestrial planets over 100 years or so, but DEA431 gives a much better prediction over long intervals, up to several tens of thousands of years. Over 24 000 yr centred at epoch J2000, the maximum differences between the rectangular ecliptic coordinates of terrestrial planets calculated using the DEA431 analytical series and the corresponding coordinates given by DE431 numerical ephemerides are 0.5 km for Mercury, 14.0 km for Venus, 12.7 km for the Earth-Moon barycentre, and 76.5 km for Mars. All coefficients of the DEA431 series and FORTRAN routines for calculating both orbital elements and rectangular coordinates of the terrestrial planets on the basis of the new series are available on the SAI web-server.

  11. `Indoor` series vending machines; `Indoor` series jido hanbaiki

    Energy Technology Data Exchange (ETDEWEB)

    Gensui, T.; Kida, A. [Fuji Electric Co. Ltd., Tokyo (Japan); Okumura, H. [Fuji Denki Reiki Co. Ltd., Tokyo (Japan)

    1996-07-10

    This paper introduces three series of vending machines that were designed to match the interior of an office building. The three series are vending machines for cups, paper packs, cans, and tobacco. Among the three series, `Interior` series has a symmetric design that was coated in a grain pattern. The inside of the `Interior` series is coated by laser satin to ensure a sense of superior quality and a refined style. The push-button used for product selection is hot-stamped on the plastic surface to ensure the hair-line luster. `Interior Phase II` series has a bay window design with a sense of superior quality and lightness. The inside of the `Interior Phase II` series is coated by laser satin. `Interior 21` series is integrated with the wall except the sales operation panel. The upper and lower dress panels can be detached and attached. The door lock is a wire-type structure with high operativity. The operation block is coated by titanium color. The dimensions of three series are standardized. 6 figs., 1 tab.

  12. Bootstrapping High Dimensional Time Series

    OpenAIRE

    Zhang, Xianyang; Cheng, Guang

    2014-01-01

    This article studies bootstrap inference for high dimensional weakly dependent time series in a general framework of approximately linear statistics. The following high dimensional applications are covered: (1) uniform confidence band for mean vector; (2) specification testing on the second order property of time series such as white noise testing and bandedness testing of covariance matrix; (3) specification testing on the spectral property of time series. In theory, we first derive a Gaussi...

  13. Autoencoding Time Series for Visualisation

    OpenAIRE

    Gianniotis, Nikolaos; Kügler, Dennis; Tino, Peter; Polsterer, Kai; Misra, Ranjeev

    2015-01-01

    We present an algorithm for the visualisation of time series. To that end we employ echo state networks to convert time series into a suitable vector representation which is capable of capturing the latent dynamics of the time series. Subsequently, the obtained vector representations are put through an autoencoder and the visualisation is constructed using the activations of the bottleneck. The crux of the work lies with defining an objective function that quantifies the reconstruction error ...

  14. FROG: Time-series analysis

    Science.gov (United States)

    Allan, Alasdair

    2014-06-01

    FROG performs time series analysis and display. It provides a simple user interface for astronomers wanting to do time-domain astrophysics but still offers the powerful features found in packages such as PERIOD (ascl:1406.005). FROG includes a number of tools for manipulation of time series. Among other things, the user can combine individual time series, detrend series (multiple methods) and perform basic arithmetic functions. The data can also be exported directly into the TOPCAT (ascl:1101.010) application for further manipulation if needed.

  15. Benchmarking the QUAD4/TRIA3 element

    Science.gov (United States)

    Pitrof, Stephen M.; Venkayya, Vipperla B.

    1993-09-01

    The QUAD4 and TRIA3 elements are the primary plate/shell elements in NASTRAN. These elements enable the user to analyze thin plate/shell structures for membrane, bending and shear phenomena. They are also very new elements in the NASTRAN library. These elements are extremely versatile and constitute a substantially enhanced analysis capability in NASTRAN. However, with the versatility comes the burden of understanding a myriad of modeling implications and their effect on accuracy and analysis quality. The validity of many aspects of these elements were established through a series of benchmark problem results and comparison with those available in the literature and obtained from other programs like MSC/NASTRAN and CSAR/NASTRAN. Never-the-less such a comparison is never complete because of the new and creative use of these elements in complex modeling situations. One of the important features of QUAD4 and TRIA3 elements is the offset capability which allows the midsurface of the plate to be noncoincident with the surface of the grid points. None of the previous elements, with the exception of bar (beam), has this capability. The offset capability played a crucial role in the design of QUAD4 and TRIA3 elements. It allowed modeling layered composites, laminated plates and sandwich plates with the metal and composite face sheets. Even though the basic implementation of the offset capability is found to be sound in the previous applications, there is some uncertainty in relatively simple applications. The main purpose of this paper is to test the integrity of the offset capability and provide guidelines for its effective use. For the purpose of simplicity, references in this paper to the QUAD4 element will also include the TRIA3 element.

  16. Fuel element design handbook

    Energy Technology Data Exchange (ETDEWEB)

    Merckx, K.R.

    1958-09-01

    The economic development of nuclear reactors depends upon the integrated progress in the fields of reactor design, fuel element design, reactor operation, and fuel production and separation. Broad criteria, which restrict the fuel element design, are determined by the mutual consideration of the problems encountered in all the above fields. Hence, no stage of reactor design or operation is independent of the fuel element problem, nor can the fuel element designer disregard the interest of any one field. As an introduction to the fuel element design problem, this chapter describes how the general criteria for a fuel element are determined.

  17. A COMBINED HYBRID FINITE ELEMENT METHOD FOR PLATE BENDING PROBLEMS

    Institute of Scientific and Technical Information of China (English)

    Tian-xiao Zhou; Xiao-ping Xie

    2003-01-01

    In this paper, a combined hybrid method is applied to finite element discretization ofplate bending problems. It is shown that the resultant schemes are stabilized, i.e., theconvergence of the schemes is independent of inf-sup conditions and any other patch test.Based on this, two new series of plate elements are proposed.

  18. Element-ary Development.

    Science.gov (United States)

    Schamp, Homer W., Jr.

    1989-01-01

    Describes the historic development of the periodic table from the four-element theory to the Lavoisier's table. Presents a table listing the old and new names of chemicals and the Lavoisier's table of elements. Lists two references. (YP)

  19. Data Element Registry Services

    Data.gov (United States)

    U.S. Environmental Protection Agency — Data Element Registry Services (DERS) is a resource for information about value lists (aka code sets / pick lists), data dictionaries, data elements, and EPA data...

  20. Advances in time series forecasting

    CERN Document Server

    Cagdas, Hakan Aladag

    2012-01-01

    Readers will learn how these methods work and how these approaches can be used to forecast real life time series. The hybrid forecasting model is also explained. Data presented in this e-book is problem based and is taken from real life situations. It is a valuable resource for students, statisticians and working professionals interested in advanced time series analysis.

  1. Complex Landscape Terms in Seri

    Science.gov (United States)

    O'Meara, Carolyn; Bohnemeyer, Jurgen

    2008-01-01

    The nominal lexicon of Seri is characterized by a prevalence of analytical descriptive terms. We explore the consequences of this typological trait in the landscape domain. The complex landscape terms of Seri classify geographic entities in terms of their material make-up and spatial properties such as shape, orientation, and merological…

  2. Students' Conception of Infinite Series

    Science.gov (United States)

    Martinez-Planell, Rafael; Gonzalez, Ana Carmen; DiCristina, Gladys; Acevedo, Vanessa

    2012-01-01

    This is a report of a study of students' understanding of infinite series. It has a three-fold purpose: to show that students may construct two essentially different notions of infinite series, to show that one of the constructions is particularly difficult for students, and to examine the way in which these two different constructions may be…

  3. Inversion of the perturbation series

    Energy Technology Data Exchange (ETDEWEB)

    Amore, Paolo [Facultad de Ciencias, Universidad de Colima, Bernal DIaz del Castillo 340, Colima, Colima (Mexico); Fernandez, Francisco M [INIFTA (Conicet, UNLP), Division Quimica Teorica, Diag 113 S/N, Sucursal 4, Casilla de Correo 16, 1900 La Plata (Argentina)

    2008-01-18

    We investigate the inversion of the perturbation series and its resummation, and prove that it is related to a recently developed parametric perturbation theory. Results for some illustrative examples show that in some cases series reversion may improve the accuracy of the results.

  4. Variational formulation of high performance finite elements: Parametrized variational principles

    Science.gov (United States)

    Felippa, Carlos A.; Militello, Carmello

    1991-01-01

    High performance elements are simple finite elements constructed to deliver engineering accuracy with coarse arbitrary grids. This is part of a series on the variational basis of high-performance elements, with emphasis on those constructed with the free formulation (FF) and assumed natural strain (ANS) methods. Parametrized variational principles that provide a foundation for the FF and ANS methods, as well as for a combination of both are presented.

  5. Stress and Deformation Analysis in Base Isolation Elements Using the Finite Element Method

    OpenAIRE

    Claudiu Iavornic; Gilbert-Rainer Gillich; Vasile Iancu; Zeno-Iosif Praisach; Ovidiu Vasile

    2011-01-01

    In Modern tools as Finite Element Method can be used to study the behavior of elastomeric isolation systems. The simulation results obtained in this way provide a large series of data about the behavior of elastomeric isolation bearings under different types of loads and help in taking right decisions regarding geometrical optimizations needed for improve such kind of devices.

  6. Stress and Deformation Analysis in Base Isolation Elements Using the Finite Element Method

    Directory of Open Access Journals (Sweden)

    Claudiu Iavornic

    2011-01-01

    Full Text Available In Modern tools as Finite Element Method can be used to study the behavior of elastomeric isolation systems. The simulation results obtained in this way provide a large series of data about the behavior of elastomeric isolation bearings under different types of loads and help in taking right decisions regarding geometrical optimizations needed for improve such kind of devices.

  7. A finite element parametric modeling technique of aircraft wing structures

    Institute of Scientific and Technical Information of China (English)

    Tang Jiapeng; Xi Ping; Zhang Baoyuan; Hu Bifu

    2013-01-01

    A finite element parametric modeling method of aircraft wing structures is proposed in this paper because of time-consuming characteristics of finite element analysis pre-processing. The main research is positioned during the preliminary design phase of aircraft structures. A knowledge-driven system of fast finite element modeling is built. Based on this method, employing a template parametric technique, knowledge including design methods, rules, and expert experience in the process of modeling is encapsulated and a finite element model is established automatically, which greatly improves the speed, accuracy, and standardization degree of modeling. Skeleton model, geometric mesh model, and finite element model including finite element mesh and property data are established on parametric description and automatic update. The outcomes of research show that the method settles a series of problems of parameter association and model update in the pro-cess of finite element modeling which establishes a key technical basis for finite element parametric analysis and optimization design.

  8. Rare (Earth Elements [score

    Directory of Open Access Journals (Sweden)

    Camilo Méndez

    2014-12-01

    Full Text Available Rare (Earth Elements is a cycle of works for solo piano. The cycle was inspired by James Dillon’s Book of Elements (Vol. I-V. The complete cycle will consist of 14 pieces; one for each selected rare (earth element. The chosen elements are Neodymium, Erbium, Tellurium, Hafnium, Tantalum, Technetium, Indium, Dysprosium, Lanthanium, Cerium, Europium, Terbium, Yttrium and Darmstadtium. These elements were selected due to their special atomic properties that in many cases make them extremely valuable for the development of new technologies, and also because of their scarcity. To date, only 4 works have been completed Yttrium, Technetium, Indium and Tellurium.

  9. Urban series automatic vending machine; Urban series jido hanbaiki

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2000-01-10

    In place of the 'Phase II' series automatic vending machine for exclusively indoor use with interior decoration design, which has enjoyed good reputation, development was made on a new series having been completely changed in its design concept. Its major features are as follows: (1) the new series has added vending machine lines for cans, cups and paper-packs; (2) adoption was made on construction that allows outdoor installation matching with scenery in addition to the indoor installation (only for cans and cigarettes); (3) adoption was made on removable panels that will coordinate with the environment of installation; and (4) either a one-thousand yen note or a card can be used on the same machine. The new series has also acquired good reputation because of its design that machines can be installed in any place, diverse kinds of merchandises can be handled, and the energy saving function has been improved. (translated by NEDO)

  10. Fractal and Multifractal Time Series

    CERN Document Server

    Kantelhardt, Jan W

    2008-01-01

    Data series generated by complex systems exhibit fluctuations on many time scales and/or broad distributions of the values. In both equilibrium and non-equilibrium situations, the natural fluctuations are often found to follow a scaling relation over several orders of magnitude, allowing for a characterisation of the data and the generating complex system by fractal (or multifractal) scaling exponents. In addition, fractal and multifractal approaches can be used for modelling time series and deriving predictions regarding extreme events. This review article describes and exemplifies several methods originating from Statistical Physics and Applied Mathematics, which have been used for fractal and multifractal time series analysis.

  11. Time Series with Tailored Nonlinearities

    CERN Document Server

    Raeth, C

    2015-01-01

    It is demonstrated how to generate time series with tailored nonlinearities by inducing well- defined constraints on the Fourier phases. Correlations between the phase information of adjacent phases and (static and dynamic) measures of nonlinearities are established and their origin is explained. By applying a set of simple constraints on the phases of an originally linear and uncor- related Gaussian time series, the observed scaling behavior of the intensity distribution of empirical time series can be reproduced. The power law character of the intensity distributions being typical for e.g. turbulence and financial data can thus be explained in terms of phase correlations.

  12. Models for dependent time series

    CERN Document Server

    Tunnicliffe Wilson, Granville; Haywood, John

    2015-01-01

    Models for Dependent Time Series addresses the issues that arise and the methodology that can be applied when the dependence between time series is described and modeled. Whether you work in the economic, physical, or life sciences, the book shows you how to draw meaningful, applicable, and statistically valid conclusions from multivariate (or vector) time series data.The first four chapters discuss the two main pillars of the subject that have been developed over the last 60 years: vector autoregressive modeling and multivariate spectral analysis. These chapters provide the foundational mater

  13. Autoencoding Time Series for Visualisation

    CERN Document Server

    Gianniotis, Nikolaos; Tino, Peter; Polsterer, Kai; Misra, Ranjeev

    2015-01-01

    We present an algorithm for the visualisation of time series. To that end we employ echo state networks to convert time series into a suitable vector representation which is capable of capturing the latent dynamics of the time series. Subsequently, the obtained vector representations are put through an autoencoder and the visualisation is constructed using the activations of the bottleneck. The crux of the work lies with defining an objective function that quantifies the reconstruction error of these representations in a principled manner. We demonstrate the method on synthetic and real data.

  14. "Feeling" Series and Parallel Resistances.

    Science.gov (United States)

    Morse, Robert A.

    1993-01-01

    Equipped with drinking straws and stirring straws, a teacher can help students understand how resistances in electric circuits combine in series and in parallel. Follow-up suggestions are provided. (ZWH)

  15. Clustering of financial time series

    Science.gov (United States)

    D'Urso, Pierpaolo; Cappelli, Carmela; Di Lallo, Dario; Massari, Riccardo

    2013-05-01

    This paper addresses the topic of classifying financial time series in a fuzzy framework proposing two fuzzy clustering models both based on GARCH models. In general clustering of financial time series, due to their peculiar features, needs the definition of suitable distance measures. At this aim, the first fuzzy clustering model exploits the autoregressive representation of GARCH models and employs, in the framework of a partitioning around medoids algorithm, the classical autoregressive metric. The second fuzzy clustering model, also based on partitioning around medoids algorithm, uses the Caiado distance, a Mahalanobis-like distance, based on estimated GARCH parameters and covariances that takes into account the information about the volatility structure of time series. In order to illustrate the merits of the proposed fuzzy approaches an application to the problem of classifying 29 time series of Euro exchange rates against international currencies is presented and discussed, also comparing the fuzzy models with their crisp version.

  16. Lower GI Series (Barium Enema)

    Science.gov (United States)

    ... barium into a bedpan or nearby toilet. A health care professional may give you an enema to flush out the rest of the barium. An x-ray technician and a radiologist perform a lower gastrointestinal (GI) series at a ...

  17. Some general random Taylor series

    Institute of Scientific and Technical Information of China (English)

    孙道椿; 余家荣

    1996-01-01

    Kahane has studied the value distribution of Gauss-Taylor series where is a complex Gauss sequence and The value distribution of more general random Taylor series is considered, where {Xn} is a sequence of real or complex random variables of independent, symmetric and equally distributed with finite non-zero fourth moment (the classical Gauss, Steinhaus and Rademacher random variables are special cases of such variables). First a theorem on the growth of characteristic functions is proved by a method which is completely different from Kahane’s. Then it is applied to proving that the range of general random Taylor series is almost surely dense everywhere in the complex plane and that if the random variable is bounded and continuous, the random series surely has no finite Nevanlinna deficient value.

  18. Eisenstein series for SL(2)

    Institute of Scientific and Technical Information of China (English)

    KUDLA; Stephen; S.

    2010-01-01

    This paper gives explicit formulas for the Fourier expansion of general Eisenstein series and local Whittaker functions over SL2.They are used to compute both the value and derivatives of these functions at critical points.

  19. The Harvey lectures, Series 82

    Energy Technology Data Exchange (ETDEWEB)

    Botstein, D.; Cech, T.R.; Hille, B.; Lodish, H.F.; Majerus, P.W.

    1988-01-01

    The Harvey Lecture Series is published annually and provides reviews of research topics in the biomedical sciences. Eight lectures by investigators are included in the volume representing the most recent work in the major laboratories.

  20. Forlic. First series of visions

    NARCIS (Netherlands)

    Gijs, Govert; Leendertse, Mathijs; Leis, Miriam; Kirschner, Paul A.; Hoogveld, Bert; Stoyanov, Slavi; Weber, Mark

    2012-01-01

    Govert, T., Leendertse, M., Leis, M., Kirschner, P. A., Hoogveld, A. W. M., Stoyanov, S., & Weber, M. (2011, 24 March). Forlic. First series of visions. Presentation at the Future of Education Policymakers Meeting, Amsterdam, The Netherlands.

  1. Accounting Issues: An Essay Series Part I--Introduction to Accounting Theory and Cash

    Science.gov (United States)

    Laux, Judy

    2007-01-01

    Recent accounting scandals challenge academics to refocus the educational process on the theoretical underpinnings of accounting. This is the first in a series of articles designed to facilitate this realignment. Intended as a supplement for the introductory accounting course, the essay series connects each of the primary accounting elements to…

  2. Stochastic modelling of regional archaeomagnetic series

    CERN Document Server

    Hellio, G; Bouligand, C; Jault, D

    2015-01-01

    SUMMARY We report a new method to infer continuous time series of the declination, inclination and intensity of the magnetic field from archeomagnetic data. Adopting a Bayesian perspective, we need to specify a priori knowledge about the time evolution of the magnetic field. It consists in a time correlation function that we choose to be compatible with present knowledge about the geomagnetic time spectra. The results are presented as distributions of possible values for the declination, inclination or intensity. We find that the methodology can be adapted to account for the age uncertainties of archeological artefacts and we use Markov Chain Monte Carlo to explore the possible dates of observations. We apply the method to intensity datasets from Mari, Syria and to intensity and directional datasets from Paris, France. Our reconstructions display more rapid variations than previous studies and we find that the possible values of geomagnetic field elements are not necessarily normally distributed. Another outp...

  3. Correlation filtering in financial time series

    CERN Document Server

    Aste, T; Tumminello, M; Mantegna, R N

    2005-01-01

    We apply a method to filter relevant information from the correlation coefficient matrix by extracting a network of relevant interactions. This method succeeds to generate networks with the same hierarchical structure of the Minimum Spanning Tree but containing a larger amount of links resulting in a richer network topology allowing loops and cliques. In Tumminello et al. \\cite{TumminielloPNAS05}, we have shown that this method, applied to a financial portfolio of 100 stocks in the USA equity markets, is pretty efficient in filtering relevant information about the clustering of the system and its hierarchical structure both on the whole system and within each cluster. In particular, we have found that triangular loops and 4 element cliques have important and significant relations with the market structure and properties. Here we apply this filtering procedure to the analysis of correlation in two different kind of interest rate time series (16 Eurodollars and 34 US interest rates).

  4. Multivariate Time Series Similarity Searching

    OpenAIRE

    Jimin Wang; Yuelong Zhu; Shijin Li; Dingsheng Wan; Pengcheng Zhang

    2014-01-01

    Multivariate time series (MTS) datasets are very common in various financial, multimedia, and hydrological fields. In this paper, a dimension-combination method is proposed to search similar sequences for MTS. Firstly, the similarity of single-dimension series is calculated; then the overall similarity of the MTS is obtained by synthesizing each of the single-dimension similarity based on weighted BORDA voting method. The dimension-combination method could use the existing similarity searchin...

  5. The socle series of a Leavitt path algebra

    CERN Document Server

    Abrams, Gene; Molina, Mercedes Siles

    2009-01-01

    We investigate the ascending Loewy socle series of Leavitt path algebras $L_K(E)$ for an arbitrary graph $E$ and field $K$. We classify those graphs $E$ for which $L_K(E)=S_{\\lambda}$ for some element $S_{\\lambda}$ of the Loewy socle series. We then show that for any ordinal $\\lambda$ there exists a graph $E$ so that the Loewy length of $L_K(E)$ is $\\lambda$. Moreover, $\\lambda \\leq \\omega $ (the first infinite ordinal) if $E$ is a row-finite graph.

  6. The synthetic elements

    International Nuclear Information System (INIS)

    Prior to 1940, the heaviest element known was uranium, discovered in 1789. Since that time the elements 93 through 109 have been synthesized and identified and the elements 43, 61, 85, and 87 which were missing form the periodic tables of the 1930's have been discovered. The techniques and problems involved in these discoveries and the placement of the transuranium elements in the periodic table will be discussed. The production and positive identification of elements heavier than Md (Z=101), which have very short half-lives and can only be produced an atom-at-a-time, are very difficult and there have been controversies concerning their discovery. Some of the new methods which have been developed and used in these studies will be described. The prospects for production of still heavier elements will be considered

  7. Elements in biological AMS

    International Nuclear Information System (INIS)

    AMS (Accelerator Mass Spectrometry) provides high detection sensitivity for isotopes whose half-lives are between 10 years and 100 million years. 14C is the most developed of such isotopes and is used in tracing natural and anthropogenic organic compounds in the Earth's biosphere. Thirty-three elements in the main periodic table and 17 lanthanides or actinides have long lived isotopes, providing potential tracers for research in elemental biochemistry. Overlap of biologically interesting heavy elements and possible AMS tracers is discussed

  8. Finite element procedures

    CERN Document Server

    Bathe, Klaus-Jürgen

    2015-01-01

    Finite element procedures are now an important and frequently indispensable part of engineering analyses and scientific investigations. This book focuses on finite element procedures that are very useful and are widely employed. Formulations for the linear and nonlinear analyses of solids and structures, fluids, and multiphysics problems are presented, appropriate finite elements are discussed, and solution techniques for the governing finite element equations are given. The book presents general, reliable, and effective procedures that are fundamental and can be expected to be in use for a long time. The given procedures form also the foundations of recent developments in the field.

  9. Series-Fed Microstrip Array Antenna with Circular Polarization

    OpenAIRE

    Tuan-Yung Han

    2012-01-01

    This study proposes a novel 2 × 2 array antenna design with broadband and circularly-polarized (CP) operation. The proposed design uses a simple series-fed network to increase the CP bandwidth without requiring one-by-one adjustment of each array element or a complex feed network. Selecting the appropriate spacing between each array element allows the proposed array antenna to generate CP radiation with a low axial ratio. Experimental results based on a prototype show that this 2 × 2 microstr...

  10. Formation of heterogeneous magmatic series beneath North Santorini, South Aegean island arc

    DEFF Research Database (Denmark)

    Bailey, John C; Jensen, E.S.; Hansen, A.;

    2008-01-01

    The geochemistry of basaltic to dacitic lavas and dykes in the volcanic centres of NorthSantorini (Greece) has been investigated using elemental and Sr-Nd-Pb isotopic data andthree main magmatic series with sub-parallel trace element patterns for basalts can bedistinguished. The basalts have Sr...... and Nd isotopic values consistent with varying levels of incompatible-element mantle depletion. A fourth magma group with only two basalt samples has a trace element pattern with even lower contents of incompatible elements, especially Th, and with lower 87Sr/86Sr but higher 206Pb/ 204Pb. Heterogeneous...

  11. BSCW Unstructured Mixed Element Grids

    Data.gov (United States)

    National Aeronautics and Space Administration — Corase Grid: Quad Surface Faces= 9360 Tria Surface Faces= 128928 Nodes = 2869187 Total Elements = 9099201 Hex Elements = 0 Pent_5 Elements = 0 Pent_6 Elements =...

  12. Elements of life

    OpenAIRE

    Samuel, J.

    2004-01-01

    A Biography of J.M.W. Turner's life told through the use of the elements. A five screen video installation. This is the Main Screen which was complimented by four video screens to represent each element.Shown at the Community Pharmacy Gallery May 2004.

  13. A dry element

    Energy Technology Data Exchange (ETDEWEB)

    Kimura, T.; Ota, A.

    1983-08-11

    The agglomerate for the element is made from activated charcoal powder, an electrically conducting additive and a neutral electrolyte. The activated charcoal makes up 30 to 50 percent of the weight of the agglomerate. It is a mixture of hydrophobized and unhydrophobized powder in a ratio of 85 to 70 to 15 to 30. The element has high discharge characteristics.

  14. A battery element

    Energy Technology Data Exchange (ETDEWEB)

    Nakai, M.; Koboyasi, S.; Oisi, K.; Okadzaki, R.; Ota, A.

    1983-07-29

    An anode made of an alkaline or an alkaline earth metal and an electrolyte based on an organic solvent are used in the element. A mixture of Mn203 and Mn304 in a 9 to 1 to 3 to 7 ratio serves as the cathode. The element has a stable discharge curve at a nominal voltage of 1.5 volts.

  15. The solar element

    DEFF Research Database (Denmark)

    Kragh, Helge

    2009-01-01

    Apart from hydrogen, helium is the most abundant chemical element in the universe, and yet it was only discovered on the Earth in 1895. Its early history is unique because it encompasses astronomy as well as chemistry, two sciences which the spectroscope brought into contact during the second half...... of the nineteenth century. In the modest form of a yellow spectral line known as D3, 'helium' was sometimes supposed to exist in the Sun's atmosphere, an idea which is traditionally ascribed to J. Norman Lockyer. Did Lockyer discover helium as a solar element? How was the suggestion received by chemists, physicists...... elements might be different. The complex story of how helium became established as both a solar and terrestrial element involves precise observations as well as airy speculations. It is a story that is unique among the discovery histories of the chemical elements....

  16. SERI advanced wind turbine blades

    Science.gov (United States)

    Tangler, J.; Smith, B.; Jager, D.

    1992-02-01

    The primary goal of the Solar Energy Research Institute's (SERI) advanced wind turbine blades is to convert the kinetic energy in the wind into mechanical energy in an inexpensive and efficient manner. To accomplish this goal, advanced wind turbine blades have been developed by SERI that utilize unique airfoil technology. Performance characteristics of the advanced blades were verified through atmospheric testing on fixed-pitch, stall-regulated horizontal-axis wind turbines (HAWTs). Of the various wind turbine configurations, the stall-regulated HAWT dominates the market because of its simplicity and low cost. Results of the atmospheric tests show that the SERI advanced blades produce 10 percent to 30 percent more energy than conventional blades.

  17. Eisenstein Series on Loop Groups

    CERN Document Server

    Liu, Dongwen

    2011-01-01

    Based on Garland's work, in this paper we construct the Eisenstein series on the adelic loop groups over a number field, induced from either a cusp form or a quasi-character which is assumed to be unramified. We compute the constant terms, prove their absolute and uniform convergence under the affine analog of Godement's criterion. For the case of quasi-characters the resulting formula is an affine Gindikin-Karpelevich formula. Then we prove the convergence of Eisenstein series themselves in certain analogs of Siegel subsets.

  18. On series of dilated functions

    CERN Document Server

    Berkes, Istvan

    2012-01-01

    Given a periodic function $f$, we study the almost everywhere and norm convergence of series $\\sum_{k=1}^\\infty c_k f(kx)$. As the classical theory shows, the behavior of such series is determined by a combination of analytic and number theoretic factors, but precise results exist only in a few special cases. In this paper we use connections with orthogonal function theory and GCD sums to prove several new results, improve old ones and also to simplify and unify the theory.

  19. Volterra Series Based Distortion Effect

    DEFF Research Database (Denmark)

    Agerkvist, Finn T.

    2010-01-01

    A large part of the characteristic sound of the electric guitar comes from nonlinearities in the signal path. Such nonlinearities may come from the input- or output-stage of the amplier, which is often equipped with vacuum tubes or a dedicated distortion pedal. In this paper the Volterra series...... expansion for non linear systems is investigated with respect to generating good distortion. The Volterra series allows for unlimited adjustment of the level and frequency dependency of each distortion component. Subjectively relevant ways of linking the dierent orders are discussed....

  20. 中国元素在国际运动品牌产品外观设计中的应用与思考--以网球系列产品为例%Application and Consideration of Chinese Element in International Sports Brand’s Product Appearance De-sign:For Example Tennis Series Products

    Institute of Scientific and Technical Information of China (English)

    陕威; 孙娣

    2015-01-01

    The use of literature, case analysis and others research methods to study of the application that the Chi-nese elements in international sports brand’s product de-sign. Research shows that the international sports brand product design for the Chinese market often use of Chi-nese color create a consumption atmosphere,cause the e-motional resonance with consumers;use of Chinese graph-ic symbols to build brand image of the personality,to en-hance the efficiency of brand appeal, narrow the psycho-logical distance with consumers;clever use of Chinese characters enhance the implications of brand cultural,en-hance the cultural identity with consumers. The major is-sues about the international sports brand product design is that split the link between“inside”and“outside”on Chi-nese element and the use of representation,this brings me some enlightenment in our local sports brand. Through this research to provide a theoretical reference for our local sports brand to accurate develop and reasonable use of Chinese elements in product design.%运用文献资料和案例分析等研究方法,对国际运动品牌产品外观设计中中国元素的应用进行分析。研究表明国际运动品牌针对中国市场的产品外观设计,常常使用中国色彩营造消费氛围,引起消费者的情感共鸣;运用中国图形符号塑造品牌个性形象,提升品牌诉求效率,拉近同消费者的心理距离;巧用中国汉字提升品牌文化意蕴,增进消费者的文化认同。当前国际运动品牌产品外观设计中主要存在割裂中国元素“内”与“外”之间的联系及运用表象化问题,这带给我国本土运动品牌一些启示。以期为我国本土运动品牌在产品外观设计中准确的开发与合理的运用中国元素提供理论参考。

  1. Discovery of element 112

    Energy Technology Data Exchange (ETDEWEB)

    Hofmann, S. [GSI, Darmstadt (Germany)

    1996-12-31

    The new elements 110, 111, and 112 were synthesized and unambiguously identified in experiments at SHIP. Due to strong shell effects the dominant decay mode is not fission, but emission of alpha particles. Theoretical investigations predict that maximum shell effects should exist in nuclei near proton number 114 and neutron number 184. Measurements give hope that isotopes of element 114 close to the island of spherical Superheavy Elements could be produced by fusion reactions using {sup 118}Pb as target. systematic studies of the reaction cross-sections indicate that transfer of nucleons is the important process to initiate the fusion.

  2. System Elements Heterogeneity

    Directory of Open Access Journals (Sweden)

    Stanislav A. Kuja

    2013-01-01

    Full Text Available The paper deals with the features of the systematic approach development, shows that the systematic approach lacks the definition of system elements divisibility. This fact simplifies the system description. The article shows that, depending on the selection of the criterion of divisibility, different types of elements with different properties are got. Depending on the selection of the criterion of divisibility, the system structure becomes multidimensional. The paper recommends to indicate the criterion of the system divisibility during the systems research. It increases the certainty of the description of a complex system and characterizes the system elements.

  3. Flow Element Models

    DEFF Research Database (Denmark)

    Heiselberg, Per; Nielsen, Peter V.

    Air distribution in ventilated rooms is a flow process that can be divided into different elements such as supply air jets, exhaust flows, thermal plumes, boundary layer flows, infiltration and gravity currents. These flow elements are isolated volumes where the air movement is controlled...... by a restricted number of parameters, and the air movement is fairly independent of the general flow in the enclosure. In many practical situations, the most convenient· method is to design the air distribution system using flow element theory....

  4. Juvenile Crime. Opposing Viewpoints Series.

    Science.gov (United States)

    Sadler, A. E., Ed.

    Books in the Opposing Viewpoints Series present debates about current issues that can be used to teach critical reading and thinking skills. The variety of opinions expressed in this collection of articles and book excerpts explores many aspects of juvenile crime. It is a commonly held view that the number of crimes committed by juveniles is…

  5. The Homeless. Opposing Viewpoints Series.

    Science.gov (United States)

    Roleff, Tamara L., Ed.

    Books in the Opposing Viewpoints Series present debates about current issues that can be used to teach critical reading and thinking skills. The variety of opinions expressed in this collection of articles and book excerpts explore many aspects of the problem of homelessness. According to a 1994 report by the U..S. Conference of Mayors, the number…

  6. Interracial America. Opposing Viewpoints Series.

    Science.gov (United States)

    Szumski, Bonnie, Ed.

    Books in the Opposing Viewpoints Series present debates about current issues that can be used to teach critical reading and thinking skills. The varied opinions in each book examine different aspects of a single issue. The topics covered in this volume explore the racial and ethnic tensions that concern many Americans today. The racial divide…

  7. Teenage Pregnancy. Opposing Viewpoints Series.

    Science.gov (United States)

    Thompson, Stephen P.

    Books in the Opposing Viewpoints series challenge readers to question their own opinions and assumptions. By reading carefully balanced views, readers confront new ideas on the topic of interest. Although some experts believe that the problem of teenage pregnancy has been overstated, other recent studies have led many people to believe that…

  8. Illegal Immigration. Opposing Viewpoints Series.

    Science.gov (United States)

    Cozic, Charles P., Ed.

    Books in the Opposing Viewpoints Series present debates about current issues that can be used to teach critical reading and thinking skills. The variety of opinions expressed in this collection of articles and book excerpts explore many aspects of illegal immigration. Contrary depictions of the aspirations and attitudes of illegal immigrants fuel…

  9. Cosmetology Series. Duty Task List.

    Science.gov (United States)

    Oklahoma State Dept. of Vocational and Technical Education, Stillwater. Curriculum and Instructional Materials Center.

    This document contains the occupational duty/task lists for three occupations in the cosmetology series. Each occupation is divided into a number of duties. A separate page for each duty in the occupation lists the tasks in that duty along with its code number and columns to indicate whether that particular duty has been taught and to provide…

  10. Flora Malesiana, Series III: Bryophyta

    NARCIS (Netherlands)

    Wijk, van der R.

    1951-01-01

    Scope, organization, and purpose of Series III, Flora Malesiana (Musci and Hepaticae) are explained. Collaboration is asked on the following points: (a) To collect Mosses and Hepaticae in Malaysia and to add extensive and detailed data to the specimens (directions available on application to the Edi

  11. Series BK contactless DC motors

    Energy Technology Data Exchange (ETDEWEB)

    Buss, V.A.; Vevyurko, I.A.; Ivanov, G.V.; Kuzmin, V.N.; Mikhaylov, E.M.; Stoma, A.S.

    1985-05-01

    Implementation of principles described in a previous work has allowed development and introduction to series production of a motor series including 36 standard types and sizes. The series is designed to operate at a nominal voltage of 27 V and includes two main versions: the BK-1 for fans and BK-2 for pumps. The BK-2 motor differs from the BK-1 in that it has a thin sealed sleeve of high impedance nonmagnetic metal separating the rotor and stator cavities, allowing the rotor of the BK-2 to operate in the fluids or other media being pumped. Characteristics of the motors are presented. The BK-1316 has an operating life of about 50,000 hours at nominal speed of 6000 rpm. The experience of series production of the BK motors has shown the need for further improvement of the design and technology in order to decrease the number of metal cutting, winding and assembly operations required. The use of plastic structures is suggested to this end.

  12. Scholars’ Comments On the Series

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    The collection embodies the highest academic standard of China’s research on international politics. The publication of the collection is very timely and the series tells about how China can look upon the world appropriately and how the world can look upon China appropriately.—Fan Jingyi, Professor and Dean of the School of Journalism and Communication, Tsinghua University

  13. Peaceful Schools. By Request Series.

    Science.gov (United States)

    Fager, Jennifer; Boss, Suzie

    This booklet is part of a series of reports on "hot topics" in education. It presents information intended to cut through the hype and hysteria that often surrounds the subject of school violence. The booklet offers an overview of current research on school violence prevention, outlines some practical ideas for use in the classroom, and takes a…

  14. Series expansions and sudden singularities

    CERN Document Server

    Barrow, John D; Tsokaros, A

    2013-01-01

    We construct solutions of the Friedmann equations near a sudden singularity using generalized series expansions for the scale factor, the density, and the pressure of the fluid content. In this way, we are able to arrive at a solution with a sudden singularity containing two free constants, as required for a general solution of the cosmological equations.

  15. Stochastic Time-Series Spectroscopy

    CERN Document Server

    Scoville, John

    2015-01-01

    Spectroscopically measuring low levels of non-equilibrium phenomena (e.g. emission in the presence of a large thermal background) can be problematic due to an unfavorable signal-to-noise ratio. An approach is presented to use time-series spectroscopy to separate non-equilibrium quantities from slowly varying equilibria. A stochastic process associated with the non-equilibrium part of the spectrum is characterized in terms of its central moments or cumulants, which may vary over time. This parameterization encodes information about the non-equilibrium behavior of the system. Stochastic time-series spectroscopy (STSS) can be implemented at very little expense in many settings since a series of scans are typically recorded in order to generate a low-noise averaged spectrum. Higher moments or cumulants may be readily calculated from this series, enabling the observation of quantities that would be difficult or impossible to determine from an average spectrum or from prinicipal components analysis (PCA). This meth...

  16. Electronic structure of ternary hydrides based on light elements

    Energy Technology Data Exchange (ETDEWEB)

    Orgaz, E. [Departamento de Fisica y Quimica Teorica, Facultad de Quimica, Universidad Nacional Autonoma de Mexico, CP 04510 Coyoacan, Mexico, D.F. (Mexico)]. E-mail: orgaz@eros.pquim.unam.mx; Membrillo, A. [Departamento de Fisica y Quimica Teorica, Facultad de Quimica, Universidad Nacional Autonoma de Mexico, CP 04510 Coyoacan, Mexico, D.F. (Mexico); Castaneda, R. [Departamento de Fisica y Quimica Teorica, Facultad de Quimica, Universidad Nacional Autonoma de Mexico, CP 04510 Coyoacan, Mexico, D.F. (Mexico); Aburto, A. [Departamento de Fisica, Facultad de Ciencias, Universidad Nacional Autonoma de Mexico, CP 04510 Coyoacan, Mexico, D.F. (Mexico)

    2005-12-08

    Ternary hydrides based on light elements are interesting owing to the high available energy density. In this work we focused into the electronic structure of a series of known systems having the general formula AMH{sub 4}(A=Li,Na,M=B,Al). We computed the energy bands and the total and partial density of states using the linear-augmented plane waves method. In this report, we discuss the chemical bonding in this series of complex hydrides.

  17. Multi-Element Airfoil System

    Science.gov (United States)

    Turner, Travis L. (Inventor); Khorrami, Mehdi R. (Inventor); Lockard, David P. (Inventor); McKenney, Martin J. (Inventor); Atherley, Raymond D. (Inventor); Kidd, Reggie T. (Inventor)

    2014-01-01

    A multi-element airfoil system includes an airfoil element having a leading edge region and a skin element coupled to the airfoil element. A slat deployment system is coupled to the slat and the skin element, and is capable of deploying and retracting the slat and the skin element. The skin element substantially fills the lateral gap formed between the slat and the airfoil element when the slat is deployed. The system further includes an uncoupling device and a sensor to remove the skin element from the gap based on a critical angle-of-attack of the airfoil element. The system can alternatively comprise a trailing edge flap, where a skin element substantially fills the lateral gap between the flap and the trailing edge region of the airfoil element. In each case, the skin element fills a gap between the airfoil element and the deployed flap or slat to reduce airframe noise.

  18. Solar cell element

    Energy Technology Data Exchange (ETDEWEB)

    Nakano, Akihiko; Matsumoto, Hitoshi; Uda, Hiroshi; Komatsu, Yasumitsu; Ikegami, Kiyoharu.

    1989-05-18

    In the existing CdS/CdTe-based solar cell element, nothing is formed except the component effective for generating electromotive force and the components necessary for leading, collecting and extracting the generated electricity, hence even when the element shows deterioration of its performance during its usage, it has been difficult to analyze the above situation. In addition, it has also a defect that its characteristic such as the transfer efficiency in the neighborhood of its glass substrate in connection also with its manufacturing process. In order to solve the above problematical points, this invention proposes, with regard to a CdS-based solar cell element composed by forming a thin film on its substrate, to make a blank space on the above substrate and form thereon a thin film which composes the solar cell element concerned alone or in a piling up manner. 4 figs.

  19. Structural elements design manual

    CERN Document Server

    Draycott, Trevor

    2012-01-01

    Gives clear explanations of the logical design sequence for structural elements. The Structural Engineer says: `The book explains, in simple terms, and with many examples, Code of Practice methods for sizing structural sections in timber, concrete,masonry and steel. It is the combination into one book of section sizing methods in each of these materials that makes this text so useful....Students will find this an essential support text to the Codes of Practice in their study of element sizing'.

  20. New roof element system

    DEFF Research Database (Denmark)

    Ditlev, Jesper; Rudbeck, Claus Christian

    1997-01-01

    The aim of the project has been to develop an element system for warm deck roofs which, from a thermal and economical point of view, can deal with the future demands for heat loss coefficients for low slope roofs.......The aim of the project has been to develop an element system for warm deck roofs which, from a thermal and economical point of view, can deal with the future demands for heat loss coefficients for low slope roofs....

  1. Atoms, molecules & elements

    CERN Document Server

    Graybill, George

    2007-01-01

    Young scientists will be thrilled to explore the invisible world of atoms, molecules and elements. Our resource provides ready-to-use information and activities for remedial students using simplified language and vocabulary. Students will label each part of the atom, learn what compounds are, and explore the patterns in the periodic table of elements to find calcium (Ca), chlorine (Cl), and helium (He) through hands-on activities.

  2. A battery element

    Energy Technology Data Exchange (ETDEWEB)

    Vatanabe, U.; Aoki, K.; Ito, K.; Ogava, K.; Okadzaki, R.

    1983-07-29

    An anode made of a light metal is used in the element, along with an anhydrous liquid electrolyte and a cathode made of CuC12(CFn)x or another material. The current tap of the anode is made from aluminum, gold, silver or another metal of the platinum group and the current tap may be coated with this metal. The thickness of the coating is 0.1 to 1 micrometer. The element has a long storage life.

  3. Analysis of series resonant converter with series-parallel connection

    Science.gov (United States)

    Lin, Bor-Ren; Huang, Chien-Lan

    2011-02-01

    In this study, a parallel inductor-inductor-capacitor (LLC) resonant converter series-connected on the primary side and parallel-connected on the secondary side is presented for server power supply systems. Based on series resonant behaviour, the power metal-oxide-semiconductor field-effect transistors are turned on at zero voltage switching and the rectifier diodes are turned off at zero current switching. Thus, the switching losses on the power semiconductors are reduced. In the proposed converter, the primary windings of the two LLC converters are connected in series. Thus, the two converters have the same primary currents to ensure that they can supply the balance load current. On the output side, two LLC converters are connected in parallel to share the load current and to reduce the current stress on the secondary windings and the rectifier diodes. In this article, the principle of operation, steady-state analysis and design considerations of the proposed converter are provided and discussed. Experiments with a laboratory prototype with a 24 V/21 A output for server power supply were performed to verify the effectiveness of the proposed converter.

  4. The Middle Pivot Element Algorithm

    OpenAIRE

    Anchala Kumari; Soubhik Chakraborty

    2012-01-01

    This paper is an improvement over the previous work on New Sorting Algorithm first proposed by Sundararajan and Chakraborty (2007). Here we have taken the pivot element as the middle element of the array. We call this improved version Middle Pivot Element Algorithm (MPA) and it is found that MPA is much faster than the two algorithms RPA (Random Pivot element Algorithm) and FPA (First Pivot element Algorithm) in which the pivot element was selected either randomly or as the first element, res...

  5. The elemental composition of the Sun I. The intermediate mass elements Na to Ca

    CERN Document Server

    Scott, Pat; Asplund, Martin; Sauval, A Jacques; Lind, Karin; Takeda, Yoichi; Collet, Remo; Trampedach, Regner; Hayek, Wolfgang

    2014-01-01

    The composition of the Sun is an essential piece of reference data for astronomy, cosmology, astroparticle, space and geo-physics. This article, dealing with the intermediate-mass elements Na to Ca, is the first in a series describing the comprehensive re-determination of the solar composition. In this series we severely scrutinise all ingredients of the analysis across all elements, to obtain the most accurate, homogeneous and reliable results possible. We employ a highly realistic 3D hydrodynamic solar photospheric model, which has successfully passed an arsenal of observational diagnostics. To quantify systematic errors, we repeat the analysis with three 1D hydrostatic model atmospheres (MARCS, MISS and Holweger & M\\"uller 1974) and a horizontally and temporally-averaged version of the 3D model ($\\langle$3D$\\rangle$). We account for departures from LTE wherever possible. We have scoured the literature for the best transition probabilities, partition functions, hyperfine and other data, and stringently ...

  6. Solar energy - design element

    International Nuclear Information System (INIS)

    The main focus of this study is the theoretical examination of the possibilities of applying technological, functional, aesthetic and energy resources in elements of urban design. Designed solutions are treated as part of the overall optimization of architectural elements and urban space, in which technological development enables the use of certain energy potentials of elements of urban design. The paper presents student hypothetical design models of urban architectural elements with integrated photovoltaic modules. The analytical procedure was applied in the analysis of student work in a seminar of the first year of master studies at the Faculty of Architecture. The aim is to improve students' awareness of the need for proper handling of energy and the possibility of integration with other architectural elements. The research and the results have enabled further work on the sustainable development of architectural elements with a focus on the use of solar energy by promoting the modern design approach. Key words: PV module, teaching, solar energy, urban design

  7. Learning time series evolution by unsupervised extraction of correlations

    Science.gov (United States)

    Deco, Gustavo; Schürmann, Bernd

    1995-03-01

    We focus on the problem of modeling time series by learning statistical correlations between the past and present elements of the series in an unsupervised fashion. This kind of correlation is, in general, nonlinear, especially in the chaotic domain. Therefore the learning algorithm should be able to extract statistical correlations, i.e., higher-order correlations between the elements of the time signal. This problem can be viewed as a special case of factorial learning. Factorial learning may be formulated as an unsupervised redundancy reduction between the output components of a transformation that conserves the transmitted information. An information-theoretic-based architecture and learning paradigm are introduced. The neural architecture has only one layer and a triangular structure in order to transform elements by observing only the past and to conserve the volume. In this fashion, a transformation that guarantees transmission of information without loss is formulated. The learning rule decorrelates the output components of the network. Two methods are used: higher-order decorrelation by explicit evaluation of higher-order cumulants of the output distributions, and minimization of the sum of entropies of each output component in order to minimize the mutual information between them, assuming that the entropies have an upper bound given by Gibbs second theorem. After decorrelation between the output components, the correlation between the elements of the time series can be extracted by analyzing the trained neural architecture. As a consequence, we are able to model chaotic and nonchaotic time series. Furthermore, one critical point in modeling time series is the determination of the dimension of the embedding vector used, i.e., the number of components of the past that are needed to predict the future. With this method we can detect the embedding dimension by extracting the influence of the past on the future, i.e., the correlation of remote past and future

  8. Application of a nonlinear spring element to analysis of circumferentially cracked pipe under dynamic loading

    International Nuclear Information System (INIS)

    As part of the US NRC's Degraded Piping Program, the concept of using a nonlinear spring element to simulate the response of cracked pipe in dynamic finite element pipe evaluations was initially proposed. The nonlinear spring element is used to represent the moment versus rotation response of the cracked pipe section. The moment-rotation relationship for the crack size and material of interest is determined from either J-estimation scheme analyses or experimental data. In this paper, a number of possible approaches for modeling the nonlinear stiffness of the cracked pipe section are introduced. One approach, modeling the cracked section moment rotation response with a series of spring-slider elements, is discussed in detail. As part of this discussion, results from a series of finite element predictions using the spring-slider nonlinear spring element are compared with the results from a series of dynamic cracked pipe system experiments from the International Piping Integrity Research Group (IPIRG) program

  9. Random time series in astronomy.

    Science.gov (United States)

    Vaughan, Simon

    2013-02-13

    Progress in astronomy comes from interpreting the signals encoded in the light received from distant objects: the distribution of light over the sky (images), over photon wavelength (spectrum), over polarization angle and over time (usually called light curves by astronomers). In the time domain, we see transient events such as supernovae, gamma-ray bursts and other powerful explosions; we see periodic phenomena such as the orbits of planets around nearby stars, radio pulsars and pulsations of stars in nearby galaxies; and we see persistent aperiodic variations ('noise') from powerful systems such as accreting black holes. I review just a few of the recent and future challenges in the burgeoning area of time domain astrophysics, with particular attention to persistently variable sources, the recovery of reliable noise power spectra from sparsely sampled time series, higher order properties of accreting black holes, and time delays and correlations in multi-variate time series. PMID:23277606

  10. Random time series in Astronomy

    CERN Document Server

    Vaughan, Simon

    2013-01-01

    Progress in astronomy comes from interpreting the signals encoded in the light received from distant objects: the distribution of light over the sky (images), over photon wavelength (spectrum), over polarization angle, and over time (usually called light curves by astronomers). In the time domain we see transient events such as supernovae, gamma-ray bursts, and other powerful explosions; we see periodic phenomena such as the orbits of planets around nearby stars, radio pulsars, and pulsations of stars in nearby galaxies; and persistent aperiodic variations (`noise') from powerful systems like accreting black holes. I review just a few of the recent and future challenges in the burgeoning area of Time Domain Astrophysics, with particular attention to persistently variable sources, the recovery of reliable noise power spectra from sparsely sampled time series, higher-order properties of accreting black holes, and time delays and correlations in multivariate time series.

  11. Random time series in astronomy.

    Science.gov (United States)

    Vaughan, Simon

    2013-02-13

    Progress in astronomy comes from interpreting the signals encoded in the light received from distant objects: the distribution of light over the sky (images), over photon wavelength (spectrum), over polarization angle and over time (usually called light curves by astronomers). In the time domain, we see transient events such as supernovae, gamma-ray bursts and other powerful explosions; we see periodic phenomena such as the orbits of planets around nearby stars, radio pulsars and pulsations of stars in nearby galaxies; and we see persistent aperiodic variations ('noise') from powerful systems such as accreting black holes. I review just a few of the recent and future challenges in the burgeoning area of time domain astrophysics, with particular attention to persistently variable sources, the recovery of reliable noise power spectra from sparsely sampled time series, higher order properties of accreting black holes, and time delays and correlations in multi-variate time series.

  12. Aerial Image Series Quality Assessment

    International Nuclear Information System (INIS)

    With the growing demand for geospatial data, the aerial imagery with high spatial, spectral, and temporal resolution achieves great development. It is imperative to evaluate whether the acquired images are qualified enough, since the further image mosaic asks for strict time consistency and a re-flight involves considerable resources. In this paper, we address the problem of quick aerial image series quality assessment. An image series quality analysis system is proposed, which includes single image quality assessment, image series quality assessment based on the image matching, and offering a visual matching result in real time for human validation when the computer achieves dubious results. For two images, the affine matrix is different for different parts of images, especially for images of wide field. Therefore we calculate transfer matrixes by using even-distributed control points from different image parts with the RANSAC technology, and use the image rotation angle for image mosaic for human validation. Extensive experiments conducted on aerial images show that the proposed method can obtain similar results with experts

  13. Travel Series as TV Entertainment: Genre characteristics and touristic views on foreign countries

    Directory of Open Access Journals (Sweden)

    Anne Marit Waade

    2009-04-01

    Full Text Available Why is it not the deprived developing country, but rather the tempting destination the host arrives in when guiding the audience in a travel series? And how can we explore the specific combination of entertainment and education that travel series represent? Basically the travel series genre is a hybrid of journalistic documentary, entertaining lifestyle series and TV ads and the different series put different emphasis on the different genre elements. Travel series represent a certain kind of mediated consumption and they reflect lifestyle identity in relation to touristic consumer cultures. Like other lifestyle series dealing with consumption products and lifestyle markers encompassing fashion, food, garden, design and interior that balance somewhere between journalism and advertising, travel series typically deal with destinations, travel modes, cultural experiences and food as commodities. To understand the cultural and democratic value of travel series as a popular TV genre in the context of public service broadcasting, it is not the fact that the series contain educative and enlightening information about foreign cultures told in an entertaining and popular way that are of my interest. Rather it is tourism and media consumer culture as such, one has to expound as valuable democratic and cultural practice. The article presents different matrices of the respectively cultural and consumer knowledge that the different types of travel series include.

  14. Advanced finite element technologies

    CERN Document Server

    Wriggers, Peter

    2016-01-01

    The book presents an overview of the state of research of advanced finite element technologies. Besides the mathematical analysis, the finite element development and their engineering applications are shown to the reader. The authors give a survey of the methods and technologies concerning efficiency, robustness and performance aspects. The book covers the topics of mathematical foundations for variational approaches and the mathematical understanding of the analytical requirements of modern finite element methods. Special attention is paid to finite deformations, adaptive strategies, incompressible, isotropic or anisotropic material behavior and the mathematical and numerical treatment of the well-known locking phenomenon. Beyond that new results for the introduced approaches are presented especially for challenging nonlinear problems.

  15. Computing Heavy Elements

    CERN Document Server

    Schunck, N; Kortelainen, M; McDonnell, J; Moré, J; Nazarewicz, W; Pei, J; Sarich, J; Sheikh, J; Staszczak, A; Stoitsov, M; Wild, S M

    2011-01-01

    Reliable calculations of the structure of heavy elements are crucial to address fundamental science questions such as the origin of the elements in the universe. Applications relevant for energy production, medicine, or national security also rely on theoretical predictions of basic properties of atomic nuclei. Heavy elements are best described within the nuclear density functional theory (DFT) and its various extensions. While relatively mature, DFT has never been implemented in its full power, as it relies on a very large number (~ 10^9-10^12) of expensive calculations (~ day). The advent of leadership-class computers, as well as dedicated large-scale collaborative efforts such as the SciDAC 2 UNEDF project, have dramatically changed the field. This article gives an overview of the various computational challenges related to the nuclear DFT, as well as some of the recent achievements.

  16. Elemental analysis in biotechnology.

    Science.gov (United States)

    Hann, Stephan; Dernovics, Mihaly; Koellensperger, Gunda

    2015-02-01

    This article focuses on analytical strategies integrating atomic spectroscopy in biotechnology. The rationale behind developing such methods is inherently linked to unique features of the key technique in elemental analysis, which is inductively coupled plasma mass spectrometry: (1) the high sensitivity and selectivity of state of the art instrumentation, (2) the possibility of accurate absolute quantification even in complex matrices, (3) the capability of combining elemental detectors with chromatographic separation methods and the versatility of the latter approach, (4) the complementarity of inorganic and organic mass spectrometry, (5) the multi-element capability and finally (6) the capability of isotopic analysis. The article highlights the most recent bio-analytical developments exploiting these methodological advantages and shows the potential in biotechnological applications.

  17. Osteoporosis and trace elements

    DEFF Research Database (Denmark)

    Aaseth, J.; Boivin, G.; Andersen, Ole

    2012-01-01

    More than 200 million people are affected by osteoporosis worldwide, as estimated by 2 million annual hip fractures and other debilitating bone fractures (vertebrae compression and Colles' fractures). Osteoporosis is a multi-factorial disease with potential contributions from genetic, endocrine...... functional, exercise related and nutritional factors. Of particular considerations are calcium (Ca) status, vitamin D, fluoride, magnesium and other trace elements. Several trace elements such as zinc and copper are essential for normal development of the skeleton in humans and animals. Fluoride accumulates...... in new bone and results in a net gain in bone mass, but may be associated with a tissue of poor quality. Aluminum induces impairment of bone formation. Gallium and cadmium suppresses bone turnover. However, exact involvements of the trace elements in osteoporosis have not yet been fully clarified...

  18. An alkaline element

    Energy Technology Data Exchange (ETDEWEB)

    Arita, T.; Murakami, K.; Okha, K.

    1983-04-28

    A cathode with a dual layer active mass is installed in the disk shaped alkaline silver and zinc element. The first layer, which is turned towards the anode, contains 85 parts Ag2O, 5 parts electrolytic MnO2 and 10 parts graphite. The second layer, which contacts the bottom of the element, contains 35 parts Ag2O, 60 parts electrolytic MnO2 and 5 parts graphite. The electrical capacity of the first and second layers is 60 and 40, respectively. The first layer may be discharged with a high current density and the second layer with less current density. The element has high characteristics with comparatively low cost.

  19. Fuel Element Technical Manual

    Energy Technology Data Exchange (ETDEWEB)

    Burley, H.H. [ed.

    1956-08-01

    It is the purpose of the Fuel Element Technical Manual to Provide a single document describing the fabrication processes used in the manufacture of the fuel element as well as the technical bases for these processes. The manual will be instrumental in the indoctrination of personnel new to the field and will provide a single data reference for all personnel involved in the design or manufacture of the fuel element. The material contained in this manual was assembled by members of the Engineering Department and the Manufacturing Department at the Hanford Atomic Products Operation between the dates October, 1955 and June, 1956. Arrangement of the manual. The manual is divided into six parts: Part I--introduction; Part II--technical bases; Part III--process; Part IV--plant and equipment; Part V--process control and improvement; and VI--safety.

  20. Intelligent Elements for ISHM

    Science.gov (United States)

    Schmalzel, John L.; Morris, Jon; Turowski, Mark; Figueroa, Fernando; Oostdyk, Rebecca

    2008-01-01

    There are a number of architecture models for implementing Integrated Systems Health Management (ISHM) capabilities. For example, approaches based on the OSA-CBM and OSA-EAI models, or specific architectures developed in response to local needs. NASA s John C. Stennis Space Center (SSC) has developed one such version of an extensible architecture in support of rocket engine testing that integrates a palette of functions in order to achieve an ISHM capability. Among the functional capabilities that are supported by the framework are: prognostic models, anomaly detection, a data base of supporting health information, root cause analysis, intelligent elements, and integrated awareness. This paper focuses on the role that intelligent elements can play in ISHM architectures. We define an intelligent element as a smart element with sufficient computing capacity to support anomaly detection or other algorithms in support of ISHM functions. A smart element has the capabilities of supporting networked implementations of IEEE 1451.x smart sensor and actuator protocols. The ISHM group at SSC has been actively developing intelligent elements in conjunction with several partners at other Centers, universities, and companies as part of our ISHM approach for better supporting rocket engine testing. We have developed several implementations. Among the key features for these intelligent sensors is support for IEEE 1451.1 and incorporation of a suite of algorithms for determination of sensor health. Regardless of the potential advantages that can be achieved using intelligent sensors, existing large-scale systems are still based on conventional sensors and data acquisition systems. In order to bring the benefits of intelligent sensors to these environments, we have also developed virtual implementations of intelligent sensors.

  1. Elements of linear space

    CERN Document Server

    Amir-Moez, A R; Sneddon, I N

    1962-01-01

    Elements of Linear Space is a detailed treatment of the elements of linear spaces, including real spaces with no more than three dimensions and complex n-dimensional spaces. The geometry of conic sections and quadric surfaces is considered, along with algebraic structures, especially vector spaces and transformations. Problems drawn from various branches of geometry are given.Comprised of 12 chapters, this volume begins with an introduction to real Euclidean space, followed by a discussion on linear transformations and matrices. The addition and multiplication of transformations and matrices a

  2. Finite elements and approximation

    CERN Document Server

    Zienkiewicz, O C

    2006-01-01

    A powerful tool for the approximate solution of differential equations, the finite element is extensively used in industry and research. This book offers students of engineering and physics a comprehensive view of the principles involved, with numerous illustrative examples and exercises.Starting with continuum boundary value problems and the need for numerical discretization, the text examines finite difference methods, weighted residual methods in the context of continuous trial functions, and piecewise defined trial functions and the finite element method. Additional topics include higher o

  3. Finite element analysis

    CERN Document Server

    2010-01-01

    Finite element analysis is an engineering method for the numerical analysis of complex structures. This book provides a bird's eye view on this very broad matter through 27 original and innovative research studies exhibiting various investigation directions. Through its chapters the reader will have access to works related to Biomedical Engineering, Materials Engineering, Process Analysis and Civil Engineering. The text is addressed not only to researchers, but also to professional engineers, engineering lecturers and students seeking to gain a better understanding of where Finite Element Analysis stands today.

  4. Rocket propulsion elements

    CERN Document Server

    Sutton, George P

    2011-01-01

    The definitive text on rocket propulsion-now revised to reflect advancements in the field For sixty years, Sutton's Rocket Propulsion Elements has been regarded as the single most authoritative sourcebook on rocket propulsion technology. As with the previous edition, coauthored with Oscar Biblarz, the Eighth Edition of Rocket Propulsion Elements offers a thorough introduction to basic principles of rocket propulsion for guided missiles, space flight, or satellite flight. It describes the physical mechanisms and designs for various types of rockets' and provides an unders

  5. An alkaline element

    Energy Technology Data Exchange (ETDEWEB)

    Obi, F.

    1983-09-29

    A current tap pressed into the anode is installed in the central part of the top of the element. There is an internal top made of plastic under the top. There is a projection in the center of the top with an opening, through which the current tap is passed. The edge of the plastic top serves as an insulation lining between the metallic top and the body, which serves as the current tap for the cathode. A separator is placed between the anode and the cathode. Electrolyte leaks are prevented in the slotted disk elements.

  6. Theory of fractional order elements based impedance matching networks

    KAUST Repository

    Radwan, Ahmed

    2011-03-01

    Fractional order circuit elements (inductors and capacitors) based impedance matching networks are introduced for the first time. In comparison to the conventional integer based L-type matching networks, fractional matching networks are much simpler and versatile. Any complex load can be matched utilizing a single series fractional element, which generally requires two elements for matching in the conventional approach. It is shown that all the Smith chart circles (resistance and reactance) are actually pairs of completely identical circles. They appear to be single for the conventional integer order case, where the identical circles completely overlap each other. The concept is supported by design equations and impedance matching examples. © 2010 IEEE.

  7. The EU network on trace element speciation in full swing

    DEFF Research Database (Denmark)

    Cornelis, R.; Camara, C.; Ebdon, L.;

    2000-01-01

    health and hygiene. The network covers a number of important issues including organotin compounds, chromium and nickel species, chemical characterisation of environmental and industrial particulate samples, risk assessment, selenium and a series of other essential and toxic elements in food, as well...... as the influence of packing materials. Once the analytical methodology for the measurement of the trace element species has been optimised, the importance of trace element speciation will grow enormously. Food sciences, material sciences, medicine and occupational health, environmental sciences and related fields...

  8. Finite element solutions of free surface flows

    Science.gov (United States)

    Zarda, P. R.; Marcus, M. S.

    1977-01-01

    A procedure is presented for using NASTRAN to determine the flow field about arbitrarily shaped bodies in the presence of a free surface. The fundamental unknown of the problem is the velocity potential which must satisfy Laplace's equation in the fluid region. Boundary conditions on the free surface may involve second order derivatives in space and time. In cases involving infinite domains either a tractable radiation condition is applied at a truncated boundary or a series expansion is used and matched to the local finite elements. Solutions are presented for harmonic, transient, and steady state problems and compared to either exact solutions or other numerical solutions.

  9. Trend prediction of chaotic time series

    Institute of Scientific and Technical Information of China (English)

    Li Aiguo; Zhao Cai; Li Zhanhuai

    2007-01-01

    To predict the trend of chaotic time series in time series analysis and time series data mining fields, a novel predicting algorithm of chaotic time series trend is presented, and an on-line segmenting algorithm is proposed to convert a time series into a binary string according to ascending or descending trend of each subsequence. The on-line segmenting algorithm is independent of the prior knowledge about time series. The naive Bayesian algorithm is then employed to predict the trend of chaotic time series according to the binary string. The experimental results of three chaotic time series demonstrate that the proposed method predicts the ascending or descending trend of chaotic time series with few error.

  10. 'Rotten Boroughs' relief (print) series

    OpenAIRE

    Mumberson, Stephen

    2012-01-01

    Series of ten mono-colour relief prints on a contemporary update of the 18th Century electoral scam of boroughs with a small population or area owned by a family that could send the eldest son into government by fixing the election of such a small populated constituency. These works were a contemporary view of the helpless situation that many urban populations felt themselves in during the late 1980s to the present day. They were also a reflection on the state of modern Britain that has suffe...

  11. Numerical Sequence of Borane Series

    Directory of Open Access Journals (Sweden)

    Enos Masheija Kiremire

    2014-09-01

    Full Text Available A table of hydroborane families has been created. The table links boranes of different families(homologous series and members of the same family based on k number. The table is useful deducing straight away whether a borane( molecular formula is closo, nido or arachno or something else. The table also indicates that boranes are formed according to natural periodic function (arithmetical progression. The empirical formula utilized is extremely versatile, simple and based on the principle of Nobel gas configuration. It could be used in both simple and complex boranes and carboranes. The closo members which portray characteristic shapes also have characteristic k1 numbers.

  12. Borel Summability and Lindstedt Series

    Science.gov (United States)

    Costin, O.; Gallavotti, G.; Gentile, G.; Giuliani, A.

    2007-01-01

    Resonant motions of integrable systems subject to perturbations may continue to exist and to cover surfaces with parametric equations admitting a formal power expansion in the strength of the perturbation. Such series may be, sometimes, summed via suitable sum rules defining C ∞ functions of the perturbation strength: here we find sufficient conditions for the Borel summability of their sums in the case of two-dimensional rotation vectors with Diophantine exponent τ =1 (e.g. with ratio of the two independent frequencies equal to the golden mean).

  13. Application examples of EFPACS series

    Energy Technology Data Exchange (ETDEWEB)

    Tsuchiya, Yasunori; Aoki, Makoto; Yamahata, Noboru (Fuji Electric Co. Ltd., Tokyo (Japan))

    1989-10-01

    This paper introduces some application examples of picture archiving and communications system EFPACS series which achieves efficient management of a volume of image data generated in a hospital, and powerfully support image diagnosis using multi-modality. EFPACS can be applied to various objectives of system installation, and can meet the scale of a hospital and the way of image filing. EFPACS has been installed in a middle-scale hospital for image conference, in a general hospital for long-term archiving of MRI data and for referring in the outpatient clinic, in a dental hospital for dental image processing, and so on. (author).

  14. Application examples of EFPACS series

    International Nuclear Information System (INIS)

    This paper introduces some application examples of picture archiving and communications system EFPACS series which achieves efficient management of a volume of image data generated in a hospital, and powerfully support image diagnosis using multi-modality. EFPACS can be applied to various objectives of system installation, and can meet the scale of a hospital and the way of image filing. EFPACS has been installed in a middle-scale hospital for image conference, in a general hospital for long-term archiving of MRI data and for referring in the outpatient clinic, in a dental hospital for dental image processing, and so on. (author)

  15. Moduli interpretation of Eisenstein series

    OpenAIRE

    Khuri-Makdisi, Kamal

    2009-01-01

    Let L >= 3. Using the moduli interpretation, we define certain elliptic modular forms of level Gamma(L) over any field k where 6L is invertible and k contains the Lth roots of unity. These forms generate a graded algebra R_L, which, over C, is generated by the Eisenstein series of weight 1 on Gamma(L). The main result of this article is that, when k=C, the ring R_L contains all modular forms on Gamma(L) in weights >= 2. The proof combines algebraic and analytic techniques, including the actio...

  16. Series fault limiting resistors for Atlas Marx modules

    Energy Technology Data Exchange (ETDEWEB)

    Thompson, C.; Bowman, D.; Gribble, R.F.; Griego, J.; Hinckley, W.B.; Kasik, R.J.; Reass, W.A.; Parsons, W.M. [Los Alamos National Lab., NM (United States); Cooper, R.A. [Maxwell Lab., San Diego, CA (United States)

    1995-09-01

    The proposed Atlas design provides a current pulse to the experiment chamber from a set of 20, 3-Marx-unit-wide modules radially positioned around a retangular disk transmission-line system (total of 60 Marxes in parallel){sup 1}. The Atlas circuit is designed to be near-critically-damped network with a total erected capacitance of 200 {mu}F at 600 KV. The justification for the necessary circuit resistance in this approach is based on reliability, fault tolerance and operational maintenance{sup 1}. Also the use of high energy- density capacitors that have lower tolerance to voltage reversal is a primary reason for the damping provided by significant series resistance. To obtain the damping there are two system resistors in the Atlas design. One resistor is a shunt element designed to damp the resonance caused by the relatively high-Q disk transmission-line capacitance and the Marx bank inductance. The second, more significant resistor is a series, fault-current limiting element that also performs the necessary damping for voltage reversal at the bank capacitors. The Series resistor is the subject of this paper.

  17. Electric dipole moments of superheavy elements

    CERN Document Server

    Radžiūtė, Laima; Jönsson, Per; Bieroń, Jacek

    2015-01-01

    The multiconfiguration Dirac-Hartree-Fock (MCDHF) method was employed to calculate atomic electric dipole moments (EDM) of the superheavy element copernicium (Cn, $Z=112$). The EDM enhancement factors of Cn, here calculated for the first time, are about one order of magnitude larger than those of Hg. The exponential dependence of enhancement factors on atomic number $Z$ along group 12 of the periodic table was derived from the EDMs of the entire homolog series, $^{69}_{30}$Zn, $^{111}_{\\phantom{1}48}$Cd, $^{199}_{\\phantom{1}80}$Hg, $^{285}_{112}$Cn, and $^{482}_{162}$Uhb. These results show that superheavy elements with sufficiently large half-lives are good candidates for EDM searches.

  18. An Investigation on the Behaviour of a Solar Facade Element

    DEFF Research Database (Denmark)

    Grudzińska, M.; Heiselberg, Per; Pedersen, R.

    2007-01-01

    A series of experiments were conducted to determine the performance of a solar façade element in a real environment conditions. Set-ups with a varying number and width of air channels were investigated. The research enabled to analyse the importance of environmental factors determining the...

  19. Beam transport elements

    CERN Multimedia

    1965-01-01

    Two of the beam transport elements for the slow ejection system. On the left, a quadrupole 1.2 m long with a 5 cm aperture, capable of producing a gradient of 5000 gauss. On the right, a 1 m bending magnet with a 4 cm gap; its field is 20 000 gauss.

  20. NEUTRONIC REACTOR FUEL ELEMENT

    Science.gov (United States)

    Picklesimer, M.L.; Thurber, W.C.

    1961-01-01

    A chemically nonreactive fuel composition for incorporation in aluminum- clad, plate type fuel elements for neutronic reactors is described. The composition comprises a mixture of aluminum and uranium carbide particles, the uranium carbide particles containing at least 80 wt.% UC/sub 2/.

  1. Inside finite elements

    CERN Document Server

    Weiser, Martin

    2016-01-01

    All relevant implementation aspects of finite element methods are discussed in this book. The focus is on algorithms and data structures as well as on their concrete implementation. Theory is covered as far as it gives insight into the construction of algorithms. Throughout the exercises a complete FE-solver for scalar 2D problems will be implemented in Matlab/Octave.

  2. Elemental Chem Lab

    Science.gov (United States)

    Franco Mariscal, Antonio Joaquin

    2008-01-01

    This educative material uses the symbols of 45 elements to spell the names of 32 types of laboratory equipment usually found in chemical labs. This teaching material has been divided into three puzzles according to the type of the laboratory equipment: (i) glassware as reaction vessels or containers; (ii) glassware for measuring, addition or…

  3. Movies and Literary Elements.

    Science.gov (United States)

    Keller, Rodney D.

    1987-01-01

    Recommends using movie clips to stimulate students' interest in reading a novel as well as to teach elements of fiction such as plot, character, setting, symbol, irony, and theme. Describes each clip and provides study questions. Includes a listing of movies made from books. (NH)

  4. Thermoelectric heat exchange element

    Science.gov (United States)

    Callas, James J.; Taher, Mahmoud A.

    2007-08-14

    A thermoelectric heat exchange module includes a first substrate including a heat receptive side and a heat donative side and a series of undulatory pleats. The module may also include a thermoelectric material layer having a ZT value of 1.0 or more disposed on at least one of the heat receptive side and the heat donative side, and an electrical contact may be in electrical communication with the thermoelectric material layer.

  5. Trend prediction of chaotic time series

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Trend prediction of chaotic ti me series is anin-teresting probleminti me series analysis andti me se-ries data mining(TSDM)fields[1].TSDM-basedmethods can successfully characterize and predictcomplex,irregular,and chaotic ti me series.Somemethods have been proposed to predict the trend ofchaotic ti me series.In our knowledge,these meth-ods can be classified into t wo categories as follows.The first category is based on the embeddedspace[2-3],where rawti me series data is mapped to areconstructed phase spac...

  6. A Course in Time Series Analysis

    CERN Document Server

    Peña, Daniel; Tsay, Ruey S

    2011-01-01

    New statistical methods and future directions of research in time series A Course in Time Series Analysis demonstrates how to build time series models for univariate and multivariate time series data. It brings together material previously available only in the professional literature and presents a unified view of the most advanced procedures available for time series model building. The authors begin with basic concepts in univariate time series, providing an up-to-date presentation of ARIMA models, including the Kalman filter, outlier analysis, automatic methods for building ARIMA models, a

  7. Eisenstein series and automorphic representations

    CERN Document Server

    Fleig, Philipp; Kleinschmidt, Axel; Persson, Daniel

    2015-01-01

    We provide an introduction to the theory of Eisenstein series and automorphic forms on real simple Lie groups G, emphasising the role of representation theory. It is useful to take a slightly wider view and define all objects over the (rational) adeles A, thereby also paving the way for connections to number theory, representation theory and the Langlands program. Most of the results we present are already scattered throughout the mathematics literature but our exposition collects them together and is driven by examples. Many interesting aspects of these functions are hidden in their Fourier coefficients with respect to unipotent subgroups and a large part of our focus is to explain and derive general theorems on these Fourier expansions. Specifically, we give complete proofs of Langlands' constant term formula for Eisenstein series on adelic groups G(A) as well as the Casselman--Shalika formula for the p-adic spherical Whittaker vector associated to unramified automorphic representations of G(Q_p). Somewhat ...

  8. A study on the Translation of Cultural Elements in TV Subtitles-A Case Study of The Big Bang Theory

    Institute of Scientific and Technical Information of China (English)

    胡亚庆

    2014-01-01

    With the growing popularity of one country’s TV series in foreign countries, subtitle translation has attracted consider-able attention in recent years. The Big Bang Theory (TBBT) is a widespread American TV series whose subtitles have been trans-lated into many foreign languages, and it also boasts its richness in cultural elements, the most typical ones including science ele-ments and religious cultural elements.

  9. OPTIMALITY ISSUES IN A SERIES SYSTEM FROM MANUFACTURER’S PERSPECTIVE CONSIDERING BURN-IN AND WARRANTY PERIODS

    OpenAIRE

    MoghimiHadji, EHSAN

    2013-01-01

    Reliability engineers generally have to deal with systems that consist of some components in series and others in parallel. Reliability of a series system can be calculated by multiplying the reliability of individual elements in that system. Failure rate of many deteriorating systems shows a bathtub shape curve. The aim of this paper is to find the average total cost of a series system, from a manufacturer’s point of view, during the first two phases of its life; considering optimal...

  10. Performance Optimization of Two-Stage Exoreversible Thermoelectric Converter in Electrically Series and Parallel Configuration

    Science.gov (United States)

    Hans, Ranjana; Manikandan, S.; Kaushik, S. C.

    2015-10-01

    A two-stage exoreversible semiconductor thermoelectric converter (TEC) with internal heat transfer is proposed in two different configurations, i.e., electrically series and electrically parallel. The TEC performance assuming Newton's heat transfer law is evaluated through a combination of finite-time thermodynamics (FTT) and nonequilibrium thermodynamics. A formulation based on the power output versus working electrical current and efficiency versus working electrical current is applied in this study. For fixed total number of thermoelectric elements, the current-voltage ( I- V) characteristics of the series and parallel configurations have been obtained for different combinations of thermoelectric elements in the top and bottom stage. The number of thermoelectric elements in the top stage has been optimized to maximize the power output of the TEC in the electrically series and parallel modes. Thermodynamic models for a multistage TEC system considering internal irreversibilities have been developed in a matrix laboratory Simulink environment. The effect of load resistance on V opt, I opt, V oc, and I sc for different combinations of thermoelectric elements in the top and bottom stage has been analyzed. The I- V characteristics obtained for the two-stage series and parallel TEC configurations suggest a range of load resistance values to be chosen, in turn indicating the suitability of the parallel rather than series configuration when designing real multistage TECs. This analysis will be helpful in designing actual multistage TECs.

  11. A generic biokinetic model for predicting the behaviour of the lanthanide elements in the human body

    International Nuclear Information System (INIS)

    Information on the biokinetics of the 15 elements of the lanthanide series, 57La to 71Lu, is too sparse to permit individual development of meaningful biokinetic models to describe the behaviour of each of the elements in humans. The lanthanides show a regular gradation in chemical properties across the series, and animal studies indicate that this is reflected in regular differences in their deposition in tissues such as the liver and skeleton. These regular differences in chemical and biological behaviour have been utilised to construct a generic lanthanide biokinetic model and to define element-specific parameters for each element in the series. This report describes the use of the available biokinetic data for humans and animals to derive the parameters for each of the elements. (author)

  12. An Adaptive Finite Element Method Based on Optimal Error Estimates for Linear Elliptic Problems

    Institute of Scientific and Technical Information of China (English)

    汤雁

    2004-01-01

    The subject of the work is to propose a series of papers about adaptive finite element methods based on optimal error control estimate. This paper is the third part in a series of papers on adaptive finite element methods based on optimal error estimates for linear elliptic problems on the concave corner domains. In the preceding two papers (part 1:Adaptive finite element method based on optimal error estimate for linear elliptic problems on concave corner domain; part 2:Adaptive finite element method based on optimal error estimate for linear elliptic problems on nonconvex polygonal domains), we presented adaptive finite element methods based on the energy norm and the maximum norm. In this paper, an important result is presented and analyzed. The algorithm for error control in the energy norm and maximum norm in part 1 and part 2 in this series of papers is based on this result.

  13. Visits Service Launches New Seminar Series

    CERN Multimedia

    2001-01-01

    The CERN Visits Service is launching a new series of seminars for guides, and they are open to everyone. The series kicks off next week with a talk by Konrad Elsener on the CERN neutrinos to Gran Sasso, CNGS, project.

  14. Brand placements in fashion TV series

    NARCIS (Netherlands)

    M.S. Fakkert; H.A.M. Voorveld; E.A. van Reijmersdal

    2015-01-01

    Recently Fashion TV series have gained more and more popularity among young women worldwide (Dehnart 2008; Seidman 2010). Fashion TV series are an immensely popular TV genre portraying the world of fashion and the accompanying glamorous lifestyle.

  15. Investment Company Series and Class Information

    Data.gov (United States)

    Securities and Exchange Commission — The Series and Class Report provides basic identification information for all active registered investment company series and classes that have been issued IDs by...

  16. Summary compilation of shell element performance versus formulation.

    Energy Technology Data Exchange (ETDEWEB)

    Heinstein, Martin Wilhelm; Hales, Jason Dean (Idaho National Laboratory, Idaho Falls, ID); Breivik, Nicole L.; Key, Samuel W. (FMA Development, LLC, Great Falls, MT)

    2011-07-01

    This document compares the finite element shell formulations in the Sierra Solid Mechanics code. These are finite elements either currently in the Sierra simulation codes Presto and Adagio, or expected to be added to them in time. The list of elements are divided into traditional two-dimensional, plane stress shell finite elements, and three-dimensional solid finite elements that contain either modifications or additional terms designed to represent the bending stiffness expected to be found in shell formulations. These particular finite elements are formulated for finite deformation and inelastic material response, and, as such, are not based on some of the elegant formulations that can be found in an elastic, infinitesimal finite element setting. Each shell element is subjected to a series of 12 verification and validation test problems. The underlying purpose of the tests here is to identify the quality of both the spatially discrete finite element gradient operator and the spatially discrete finite element divergence operator. If the derivation of the finite element is proper, the discrete divergence operator is the transpose of the discrete gradient operator. An overall summary is provided from which one can rank, at least in an average sense, how well the individual formulations can be expected to perform in applications encountered year in and year out. A letter grade has been assigned albeit sometimes subjectively for each shell element and each test problem result. The number of A's, B's, C's, et cetera assigned have been totaled, and a grade point average (GPA) has been computed, based on a 4.0-system. These grades, combined with a comparison between the test problems and the application problem, can be used to guide an analyst to select the element with the best shell formulation.

  17. Quantitative constructional attributes selection in construction series of types

    Directory of Open Access Journals (Sweden)

    P. Gendarz

    2011-11-01

    Full Text Available Purpose: The main aim of research was to analyze the selection process of quantitative constructional attributes in construction series of types.Design/methodology/approach: The quantitative constructional attributes selection process is based on constructional similarity theory.Findings: The constructional similarity theory allows to select the quantitative constructional attributes.Research limitations/implications: The final construction similarity is not complete because of adjusting the dimension values to preferred numbers, catalogue and standardized elements dimensions etc.Practical implications: Presented method was applied to generate the constructions series of types with the use of quantitative constructional attributes selection process.Originality/value: Described analysis presents the process of selecting the quantitative constructional attributes with computer aid.

  18. Production of transuranium elements

    International Nuclear Information System (INIS)

    The Radiochemical Engineering Development Center (REDC) has the programmatic responsibility for the Department of Energy's Transuranium Element Program. Principle elements from the program are einsteinium, berkelium, and fermium. Targets containing curium oxide mixed with aluminum powder are fabricated by the REDC and irradiated in the Oak Ridge National Laboratory (ORNL) High Flux Isotope Reactor. Following an irradiation period of 6-12 months, targets are returned to the REDC for chemical processing. Processing operations consists of aluminum dejacketing in a caustic-nitrate solution, filtration, acid dissolution, solvent extraction, anion exchange, and finally a cation exchange to recover the actinides. The processing operations take place in heavily shielded hot cell facilities and all operations are carried out remotely. The chemistry for the separations has been well established over the 26-yr. operating life of the facility

  19. ELEMENTS OF MARKETING

    OpenAIRE

    Ramakrishna Mohan Rao Munaga

    2014-01-01

    The marketing thinking starts with customer’s needs. Today the customer is on the driver’s seat. It is also because of the change in the demand supply equation. Now the demand is less than supply just reverse to the past times situation. Today each marketer wants to retain and satisfy the customer because of the intense competition. The marketing elements are Needs, Wants, Demands, Products, Value, Exchange, Transaction and Relationship, Market, Marketers.

  20. Quantum theory elements

    CERN Document Server

    Bates, David Robert

    1962-01-01

    Quantum Theory: A Treatise in Three Volumes, I: Elements focuses on the principles, methodologies, and approaches involved in quantum theory, including quantum mechanics, linear combinations, collisions, and transitions. The selection first elaborates on the fundamental principles of quantum mechanics, exactly soluble bound state problems, and continuum. Discussions focus on delta function normalization, spherically symmetric potentials, rectangular potential wells, harmonic oscillators, spherically symmetrical potentials, Coulomb potential, axiomatic basis, consequences of first three postula

  1. Nuclear reactor fuel elements

    International Nuclear Information System (INIS)

    A nuclear reactor fuel element comprising a column of vibration compacted fuel which is retained in consolidated condition by a thimble shaped plug. The plug is wedged into gripping engagement with the wall of the sheath by a wedge. The wedge material has a lower coefficient of expansion than the sheath material so that at reactor operating temperature the retainer can relax sufficient to accommodate thermal expansion of the column of fuel. (author)

  2. Nuclear fuel element

    Science.gov (United States)

    Meadowcroft, Ronald Ross; Bain, Alastair Stewart

    1977-01-01

    A nuclear fuel element wherein a tubular cladding of zirconium or a zirconium alloy has a fission gas plenum chamber which is held against collapse by the loops of a spacer in the form of a tube which has been deformed inwardly at three equally spaced, circumferential positions to provide three loops. A heat resistant disc of, say, graphite separates nuclear fuel pellets within the cladding from the plenum chamber. The spacer is of zirconium or a zirconium alloy.

  3. A sealing element

    Energy Technology Data Exchange (ETDEWEB)

    Obi, F.; Takada, K.

    1983-09-22

    A sealing lining made of a mixture of polyethylene or polypropylene with an additive which prevents destruction of the lining is used in the element. The content of the additive in the mixture is 10 to 30 percent by mass. The additive basically consists of polyethylene. Carboxyl groups are introduced into the polymer as an anion and sodium, potassium and molybdenum are introduced as the cation.

  4. Seminar series on Safety matters

    CERN Multimedia

    HSE

    2010-01-01

    The HSE - Occupational Health & Safety and Environmental Protection - Unit is starting a seminar series on Safety matters. The aim is to invite colleagues from Universities, Industries or Government Agencies to share their experience. The seminars will take place in intervals of several months. Part of the Seminars will be held in the form of a Forum where participants can discuss and share views with persons who manage, teach or research Safety matters elsewhere. You are invited to the first Safety Seminar on 22nd September 2010 at 10h00 in building 40 S2 A1 "Salle Andersson" L’Ecole Polytechnique Fédérale de Lausanne (EPFL) will present the way safety is managed in their research institution. Some aspects of research in physics and chemical laboratories will also be presented. The seminar will be given by Dr Thierry Meyer, Head of OHS at FSB-EPFL and Dr Amela Groso, responsible for the safety of the physics institutes

  5. Familial Chiari malformation: case series.

    Science.gov (United States)

    Schanker, Benjamin D; Walcott, Brian P; Nahed, Brian V; Kahle, Kristopher T; Li, Yan Michael; Coumans, Jean-Valery C E

    2011-09-01

    Chiari malformations (Types I-IV) are abnormalities of the posterior fossa that affect the cerebellum, brainstem, and the spinal cord with prevalence rates of 0.1%-0.5%. Case reports of familial aggregation of Chiari malformation, twin studies, cosegregation of Chiari malformation with known genetic conditions, and recent gene and genome-wide association studies provide strong evidence of the genetic underpinnings of familial Chiari malformation. The authors report on a series of 3 family pairs with Chiari malformation Type I: 2 mother-daughter pairs and 1 father-daughter pair. The specific genetic causes of familial Chiari malformation have yet to be fully elucidated. The authors review the literature and discuss several candidate genes. Recent advances in the understanding of the genetic influences and pathogenesis of familial Chiari malformation are expected to improve management of affected patients and monitoring of at-risk family members.

  6. La scienza delle serie tv

    CERN Document Server

    Gentile, Andrea

    2016-01-01

    Un professore di chimica potrebbe davvero fabbricare droga come Walter White in "Breaking Bad"? Tra quanto avremo il teletrasporto di "Star Trek"? E qual è il modo migliore di reagire a un'epidemia zombie come quella di "The Walking Dead"? Si può parlare di scienza anche stando comodamente in poltrona di fronte alla televisione. Le serie tv sono diventate prodotti di culto, e le più celebri sono proprio quelle fantascientifiche, mediche o di investigazione, che al loro interno raccontano molta scienza. Cosa c'è di vero in ciò che mostrano? Dalla nascita del cosmo in "The Big Bang Theory", passando per le fantadiagnosi del "Dr. House", i complotti alieni di "X-Files" e la natura del tempo in "True Detective", Andrea Gentile svela il lato nascosto dei nostri show preferiti, con un linguaggio semplice e spiegazioni alla portata di tutti.

  7. The transuranium elements

    International Nuclear Information System (INIS)

    In this paper Seaborg's actinide hypothesis is traced from its beginnings to the present. The wealth of spectroscopic and magnetic data accumulated over the years leads to conclusions about the electronic structure of the actinides. These investigations include spectroscopic studies of gaseous atoms and ions, as well as of solutions and compounds, and magnetic susceptibility and electron spin resonance studies of metals, alloys, and compounds. Both experimental and theoretical studies have resulted in accurate values for spin-orbit coupling and crystal-field parameters for 5f electrons, for example, which can be compared with values characteristic of 4f electrons. For instance, the somewhat greater spatial extent of 5f versus 4f wave functions gives rise to 5f orbital participation in the bonding of actinide element organometallic compounds and leads to an extensive and intricate organometallic chemistry for this group of elements. The rich chemistry of Np and Pu provides new insights into electronic structure and the unique nature of 5f electrons yields exciting findings in the exploration of the chemistry of the actinide elements

  8. Helium the disappearing element

    CERN Document Server

    Sears, Wheeler M

    2015-01-01

    The subject of the book is helium, the element, and its use in myriad applications including MRI machines, particle accelerators, space telescopes, and of course balloons and blimps. It was at the birth of our Universe, or the Big Bang, where the majority of cosmic helium was created; and stellar helium production continues. Although helium is the second most abundant element in the Universe, it is actually quite rare here on Earth and only exists because of radioactive elements deep within the Earth. This book includes a detailed history of the discovery of helium, of the commercial industry built around it, how the helium we actually encounter is produced within the Earth, and the state of the helium industry today. The gas that most people associate with birthday party balloons is running out. “Who cares?” you might ask. Well, without helium, MRI machines could not function, rockets could not go into space, particle accelerators such as those used by CERN could not operate, fiber optic cables would not...

  9. Generating series for bilinear hybrid systems

    NARCIS (Netherlands)

    Petreczky, M.; Schuppen, J.H. van

    2010-01-01

    In this paper we introduce the novel concept of a hybrid generating series and show that continuous state and output trajectories of bilinear hybrid systems can be described in terms of these series. The results represent an extension of the Fliess-series expansion for bilinear systems to hybrid sys

  10. Reprint Series: Computation of Pi. RS-7.

    Science.gov (United States)

    Schaaf, William L., Ed.

    This is one in a series of SMSG supplementary and enrichment pamphlets for high school students. This series makes available expository articles which appeared in a variety of mathematical periodicals. Topics covered include: (1) the latest about pi; (2) a series useful in the computation of pi; (3) an ENIAC determination of pi and e to more than…

  11. Description of complex time series by multipoles

    DEFF Research Database (Denmark)

    Lewkowicz, M.; Levitan, J.; Puzanov, N.;

    2002-01-01

    We present a new method to describe time series with a highly complex time evolution. The time series is projected onto a two-dimensional phase-space plot which is quantified in terms of a multipole expansion where every data point is assigned a unit mass. The multipoles provide an efficient...... characterization of the original time series....

  12. Winter Video Series Coming in January | Poster

    Science.gov (United States)

    The Scientific Library’s annual Summer Video Series was so successful that it will be offering a new Winter Video Series beginning in January. For this inaugural event, the staff is showing the eight-part series from National Geographic titled “American Genius.” 

  13. DEFICIENT FUNCTIONS OF RANDOM DIRICHLET SERIES

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    In this article, the uniqueness theorem of Dirichlet series is proved. Then the random Dirichlet series in the right half plane is studied, and the result that the random Dirichlet series of finite order has almost surely(a.s.) no deficient functions is proved.

  14. Seri Dictionary: People and Kinship Terms.

    Science.gov (United States)

    Moser, Mary B.; Marlett, Stephen A.

    A subset of a Seri-English bilingual dictionary (in preparation) is presented that includes terms referring to people, kinship terms, and verbs closely related to them. This version includes an English-to-Seri dictionary with 61 basic terms and variants, and a Seri dictionary with both Spanish and English glosses. It uses a practical orthography…

  15. Determination of the coupling architecture and parameters of elements in ensembles of time-delay systems

    Science.gov (United States)

    Sysoev, I. V.; Ponomarenko, V. I.; Prokhorov, M. D.

    2016-01-01

    A method for the reconstruction of the architecture, strength of couplings, and parameters of elements in ensembles of coupled time-delay systems from their time series is proposed. The effectiveness of the method is demonstrated on chaotic time series of the ensemble of diffusively coupled nonidentical Ikeda equations in the presence of noise.

  16. The transuranium elements: From neptunium and plutonium to element 112

    Energy Technology Data Exchange (ETDEWEB)

    Hoffman, D.C. [California Univ., Berkeley, CA (United States)]|[Lawrence Livermore National Lab., CA (United States)

    1996-07-26

    Beginning in the 1930`s, both chemists and physicists became interested in synthesizing new artificial elements. The first transuranium element, Np, was synthesized in 1940. Over the past six decades, 20 transuranium elements have been produced. A review of the synthesis is given. The procedure of naming the heavy elements is also discussed. It appears feasible to produce elements 113 and 114. With the Berkeley Gas-filled Separator, it should be possible to reach the superheavy elements in the region of the spherical Z=114 shell, but with fewer neutrons than the N=184 spherical shell. 57 refs, 6 figs.

  17. Stochastic structural model of rock and soil aggregates by continuum-based discrete element method

    Institute of Scientific and Technical Information of China (English)

    WANG Yuannian; ZHAO Manhong; LI Shihai; J.G. Wang

    2005-01-01

    This paper first presents a stochastic structural model to describe the random geometrical features of rock and soil aggregates. The stochastic structural model uses mixture ratio, rock size and rock shape to construct the microstructures of aggregates,and introduces two types of structural elements (block element and jointed element) and three types of material elements (rock element, soil element, and weaker jointed element)for this microstructure. Then, continuum-based discrete element method is used to study the deformation and failure mechanism of rock and soil aggregate through a series of loading tests. It is found that the stress-strain curve of rock and soil aggregates is nonlinear, and the failure is usually initialized from weaker jointed elements. Finally, some factors such as mixture ratio, rock size and rock shape are studied in detail. The numerical results are in good agreement with in situ test. Therefore, current model is effective for simulating the mechanical behaviors of rock and soil aggregates.

  18. Series-Fed Microstrip Array Antenna with Circular Polarization

    Directory of Open Access Journals (Sweden)

    Tuan-Yung Han

    2012-01-01

    Full Text Available This study proposes a novel 2 × 2 array antenna design with broadband and circularly-polarized (CP operation. The proposed design uses a simple series-fed network to increase the CP bandwidth without requiring one-by-one adjustment of each array element or a complex feed network. Selecting the appropriate spacing between each array element allows the proposed array antenna to generate CP radiation with a low axial ratio. Experimental results based on a prototype show that this 2 × 2 microstrip array antenna achieves a wide 3 dB axial ratio bandwidth of more than 10%. Simulated data are also provided to confirm the measured results.

  19. Time Series Analysis and Forecasting by Example

    CERN Document Server

    Bisgaard, Soren

    2011-01-01

    An intuition-based approach enables you to master time series analysis with ease Time Series Analysis and Forecasting by Example provides the fundamental techniques in time series analysis using various examples. By introducing necessary theory through examples that showcase the discussed topics, the authors successfully help readers develop an intuitive understanding of seemingly complicated time series models and their implications. The book presents methodologies for time series analysis in a simplified, example-based approach. Using graphics, the authors discuss each presented example in

  20. Kolmogorov space in time series data

    Science.gov (United States)

    Kanjamapornkul, Kabin; Pinčák, Richard

    2016-10-01

    We provide the proof that the space of time series data is a Kolmogorov space with $T_{0}$-separation axiom using the loop space of time series data. In our approach we define a cyclic coordinate of intrinsic time scale of time series data after empirical mode decomposition. A spinor field of time series data comes from the rotation of data around price and time axis by defining a new extradimension to time series data. We show that there exist hidden eight dimensions in Kolmogorov space for time series data. Our concept is realized as the algorithm of empirical mode decomposition and intrinsic time scale decomposition and it is subsequently used for preliminary analysis on the real time series data.

  1. A review of subsequence time series clustering.

    Science.gov (United States)

    Zolhavarieh, Seyedjamal; Aghabozorgi, Saeed; Teh, Ying Wah

    2014-01-01

    Clustering of subsequence time series remains an open issue in time series clustering. Subsequence time series clustering is used in different fields, such as e-commerce, outlier detection, speech recognition, biological systems, DNA recognition, and text mining. One of the useful fields in the domain of subsequence time series clustering is pattern recognition. To improve this field, a sequence of time series data is used. This paper reviews some definitions and backgrounds related to subsequence time series clustering. The categorization of the literature reviews is divided into three groups: preproof, interproof, and postproof period. Moreover, various state-of-the-art approaches in performing subsequence time series clustering are discussed under each of the following categories. The strengths and weaknesses of the employed methods are evaluated as potential issues for future studies. PMID:25140332

  2. Method of securing filter elements

    Energy Technology Data Exchange (ETDEWEB)

    Brown, Erik P.; Haslam, Jeffery L.; Mitchell, Mark A.

    2016-10-04

    A filter securing system including a filter unit body housing; at least one tubular filter element positioned in the filter unit body housing, the tubular filter element having a closed top and an open bottom; a dimple in either the filter unit body housing or the top of the tubular filter element; and a socket in either the filter unit body housing or the top of the tubular filter element that receives the dimple in either the filter unit body housing or the top of the tubular filter element to secure the tubular filter element to the filter unit body housing.

  3. Elements of analytical dynamics

    CERN Document Server

    Kurth, Rudolph; Stark, M

    1976-01-01

    Elements of Analytical Dynamics deals with dynamics, which studies the relationship between motion of material bodies and the forces acting on them. This book is a compilation of lectures given by the author at the Georgia and Institute of Technology and formed a part of a course in Topological Dynamics. The book begins by discussing the notions of space and time and their basic properties. It then discusses the Hamilton-Jacobi theory and Hamilton's principle and first integrals. The text concludes with a discussion on Jacobi's geometric interpretation of conservative systems. This book will

  4. Analytical elements of mechanics

    CERN Document Server

    Kane, Thomas R

    2013-01-01

    Analytical Elements of Mechanics, Volume 1, is the first of two volumes intended for use in courses in classical mechanics. The books aim to provide students and teachers with a text consistent in content and format with the author's ideas regarding the subject matter and teaching of mechanics, and to disseminate these ideas. The book opens with a detailed exposition of vector algebra, and no prior knowledge of this subject is required. This is followed by a chapter on the topic of mass centers, which is presented as a logical extension of concepts introduced in connection with centroids. A

  5. Elements of probability theory

    CERN Document Server

    Rumshiskii, L Z

    1965-01-01

    Elements of Probability Theory presents the methods of the theory of probability. This book is divided into seven chapters that discuss the general rule for the multiplication of probabilities, the fundamental properties of the subject matter, and the classical definition of probability. The introductory chapters deal with the functions of random variables; continuous random variables; numerical characteristics of probability distributions; center of the probability distribution of a random variable; definition of the law of large numbers; stability of the sample mean and the method of moments

  6. [Healthcare marketing elements].

    Science.gov (United States)

    Ameri, Cinzia; Fiorini, Fulvio

    2014-01-01

    Marketing puts its foundation on a few key concepts: need-demand, product-service, satisfaction, exchange, market, or business structure manufacturing / supply. The combination of these elements allows you to build an effective marketing strategy. Crucial in this respect is to remember the Porter matrix, which shows that for a correct analysis of the relevant market is necessary to refer to the "five forces at play", ie: customers, competitors, new entrants and substitutes threat. Another key lever for proper marketing oriented approach is the continuous and constant monitoring of the application, anticipating their dissatisfactions.

  7. [Healthcare marketing elements].

    Science.gov (United States)

    Ameri, Cinzia; Fiorini, Fulvio

    2014-01-01

    Marketing puts its foundation on a few key concepts: need-demand, product-service, satisfaction, exchange, market, or business structure manufacturing / supply. The combination of these elements allows you to build an effective marketing strategy. Crucial in this respect is to remember the Porter matrix, which shows that for a correct analysis of the relevant market is necessary to refer to the "five forces at play", ie: customers, competitors, new entrants and substitutes threat. Another key lever for proper marketing oriented approach is the continuous and constant monitoring of the application, anticipating their dissatisfactions. PMID:24777920

  8. Elements of energy conversion

    CERN Document Server

    Russell, Charles R

    2013-01-01

    Elements of Energy Conversion brings together scattered information on the subject of energy conversion and presents it in terms of the fundamental thermodynamics that apply to energy conversion by any process. Emphasis is given to the development of the theory of heat engines because these are and will remain most important power sources. Descriptive material is then presented to provide elementary information on all important energy conversion devices. The book contains 10 chapters and opens with a discussion of forms of energy, energy sources and storage, and energy conversion. This is foll

  9. Extractability of risk elements and nutrition elements from ash

    OpenAIRE

    Hrma, Jiří

    2012-01-01

    The thesis „Extractability of risk elements and nutrition elements from ash“ studies the determination of physicochemical properties of ash and compares the mobility of heavy metals and nutrition elements in various samples. The aim of the study was to determine the extractability of heavy metals and nutrition elements from biomass ash and their chemical speciation using sequential extraction procedure based upon Tessier which was modified for given matrix. The results permit to classify m...

  10. Ring-laser gyroscope system using dispersive element(s)

    Science.gov (United States)

    Smith, David D. (Inventor)

    2010-01-01

    A ring-laser gyroscope system includes a ring-laser gyroscope (RLG) and at least one dispersive element optically coupled to the RLG's ring-shaped optical path. Each dispersive element has a resonant frequency that is approximately equal to the RLG's lasing frequency. A group index of refraction defined collectively by the dispersive element(s) has (i) a real portion that is greater than zero and less than one, and (ii) an imaginary portion that is less than zero.

  11. Pipe-anchor discontinuity analysis utilizing power series solutions, Bessel functions, and Fourier series

    International Nuclear Information System (INIS)

    One of the paradigmatic classes of problems that frequently arise in piping stress analysis discipline is the effect of local stresses created by supports and restraints attachments. Over the past 20 years, concerns have been identified by both regulatory agencies in the nuclear power industry and others in the process and chemicals industries concerning the effect of various stiff clamping arrangements on the expected life of the pipe and its various piping components. In many of the commonly utilized geometries and arrangements of pipe clamps, the elasticity problem becomes the axisymmetric stress and deformation determination in a hollow cylinder (pipe) subjected to the appropriate boundary conditions and respective loads per se. One of the geometries that serve as a pipe anchor is comprised of two pipe clamps that are bolted tightly to the pipe and affixed to a modified shoe-type arrangement. The shoe is employed for the purpose of providing an immovable base that can be easily attached either by bolting or welding to a structural steel pipe rack. Over the past 50 years, the computational tools available to the piping analyst have changed dramatically and thereby have caused the implementation of solutions to the basic problems of elasticity to change likewise. The need to obtain closed form elasticity solutions, however, has always been a driving force in engineering. The employment of symbolic calculus that is currently available through numerous software packages makes closed form solutions very economical. This paper briefly traces the solutions over the past 50 years to a variety of axisymmetric stress problems involving hollow circular cylinders employing a Fourier series representation. In the present example, a properly chosen Fourier series represent the mathematical simulation of the imposed axial displacements on the outside diametrical surface. A general solution technique is introduced for the axisymmetric discontinuity stresses resulting from an

  12. Miniaturized Multi-Band Antenna via Element Collocation

    Energy Technology Data Exchange (ETDEWEB)

    Martin, R. P.

    2012-04-19

    Although much research has been performed on a driven element parasitically loaded by another element shorted to ground for dual frequency operation, the novel concept of two or more coplanar-driven elements in close proximity designed for multiple frequency operation has not been represented in the literature. Since each higher frequency antenna is built into the lower frequency elements, the largest element controls the structure’s total size. Furthermore, by using the self-resonant frequency inherent in reactive elements due to device packaging, the aperture of each antenna, due to a low insertion loss path at the frequency of the larger element, will include that of all smaller radiators. This configuration provides a large standing wave ratio at the shorter wavelengths via several series capacitive-inductive connections. Therefore, each antenna element provides the required surface area for the frequency of operation while being isolated from the larger radiators. For this study, a dual 2.45/5.8 GHz microstrip patch encompasses a small surface area of 9 square inches and provides circularly polarized electromagnetic radiation in excess of 6 dBi. This concept can be extrapolated to include additional radiators or may be scaled to other frequencies of interest.

  13. The cryptic enhancer elements of the tCUP promoter.

    Science.gov (United States)

    Wu, Keqiang; Hu, Ming; Martin, Teresa; Wang, Changming; Li, Xiu-Qing; Tian, Lining; Brown, Dan; Miki, Brian

    2003-02-01

    Examination of the tCUP cryptic promoter from tobacco demonstrates that cryptic gene regulatory elements in the plant genome are functionally equivalent to elements responsible for the expression of plant genes. They are also organized in a similar fashion. Analysis of the expression pattern of the GUS reporter gene in transgenic Arabidopsis plants revealed that all of the information needed for strong constitutive expression was located in the truncated, -394tCUP promoter fragment. A series of 5' deletion and linker-scan mutagenesis constructs identified two separate enhancer elements. A long AT-rich region was identified between positions -350 and -161 bp relative to the transcription start site. 5' deletions that removed this A/T-rich fragment resulted in a significant decrease in promoter activity; whereas, oligomerization enhanced activity. A 21 bp sequence (TAGCCCCAATTTCAAATTCAA) spanning nucleotides -150 to -130 relative to transcription start site was also identified in a similar fashion and defined a novel cryptic constitutive enhancer element (Cce). Electrophoretic mobility-shift assays showed that tobacco nuclear proteins that interacted strongly with the tCUP promoter bound specifically to the 21-bp Cce element, suggesting that this sequence is probably a binding site(s) for transcription factors. The Cce element was dependent on the AT-rich element for activity indicating combinatorial control. The combined effects of the A/T rich and Cce elements appear to be responsible for the constitutive transcriptional activity of the tCUP promoter. PMID:12602866

  14. Oxidation and methylation of dissolved elemental mercury by anaerobic bacteria

    Energy Technology Data Exchange (ETDEWEB)

    Hu, Haiyan [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Chinese Academy of Sciences (CAS), Beijing (China); Lin, Hui [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Zheng, Wang [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Tomanicek, Stephen J [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Johs, Alexander [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Feng, Xinbin [Chinese Academy of Sciences (CAS), Beijing (China); Elias, Dwayne A [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Liang, Liyuan [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Gu, Baohua [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

    2013-08-04

    Methylmercury is a neurotoxin that poses significant health risks to humans. Some anaerobic sulphate- and iron-reducing bacteria can methylate oxidized forms of mercury, generating methylmercury1-4. One strain of sulphate-reducing bacteria (Desulfovibrio desulfuricans ND132) can also methylate elemental mercury5. The prevalence of this trait among different bacterial strains and species remains unclear, however. Here, we compare the ability of two strains of the sulphate-reducing bacterium Desulfovibrio and one strain of the iron-reducing bacterium Geobacter to oxidise and methylate elemental mercury in a series of laboratory incubations. Experiments were carried out under dark, anaerobic conditions, in the presence of environmentally-relevant concentrations of elemental mercury. We report differences in the ability of these organisms to oxidise and methylate elemental mercury. In line with recent findings5, we show that Desulfovibrio desulfuricans ND132 can both oxidise and methylate elemental mercury. However, the rate of methylation of elemental mercury is only about one third the rate of methylation of oxidized mercury. We also show that Desulfovibrio alaskensis G20 can oxidise, but not methylate, elemental mercury. Geobacter sulfurreducens PCA is able to oxidise and methylate elemental mercury in the presence of cysteine. We suggest that the activity of methylating and non-methylating bacteria may together enhance the formation of methylmercury in anaerobic environments.

  15. Fundamental Atomtronic Circuit Elements

    Science.gov (United States)

    Lee, Jeffrey; McIlvain, Brian; Lobb, Christopher; Hill, Wendell T., III

    2012-06-01

    Recent experiments with neutral superfluid gases have shown that it is possible to create atomtronic circuits analogous to existing superconducting circuits. The goals of these experiments are to create complex systems such as Josephson junctions. In addition, there are theoretical models for active atomtronic components analogous to diodes, transistors and oscillators. In order for any of these devices to function, an understanding of the more fundamental atomtronic elements is needed. Here we describe the first experimental realization of these more fundamental elements. We have created an atomtronic capacitor that is discharged through a resistance and inductance. We will discuss a theoretical description of the system that allows us to determine values for the capacitance, resistance and inductance. The resistance is shown to be analogous to the Sharvin resistance, and the inductance analogous to kinetic inductance in electronics. This atomtronic circuit is implemented with a thermal sample of laser cooled rubidium atoms. The atoms are confined using what we call free-space atom chips, a novel optical dipole trap produced using a generalized phase-contrast imaging technique. We will also discuss progress toward implementing this atomtronic system in a degenerate Bose gas.

  16. Elements of mathematics algebra

    CERN Document Server

    Bourbaki, Nicolas

    2003-01-01

    This is a softcover reprint of the English translation of 1990 of the revised and expanded version of Bourbaki's, Algèbre, Chapters 4 to 7 (1981). This completes Algebra, 1 to 3, by establishing the theories of commutative fields and modules over a principal ideal domain. Chapter 4 deals with polynomials, rational fractions and power series. A section on symmetric tensors and polynomial mappings between modules, and a final one on symmetric functions, have been added. Chapter 5 was entirely rewritten. After the basic theory of extensions (prime fields, algebraic, algebraically closed, radical extension), separable algebraic extensions are investigated, giving way to a section on Galois theory. Galois theory is in turn applied to finite fields and abelian extensions. The chapter then proceeds to the study of general non-algebraic extensions which cannot usually be found in textbooks: p-bases, transcendental extensions, separability criterions, regular extensions. Chapter 6 treats ordered groups and fields and...

  17. NIH Common Data Elements Repository

    Data.gov (United States)

    U.S. Department of Health & Human Services — The NIH Common Data Elements (CDE) Repository has been designed to provide access to structured human and machine-readable definitions of data elements that have...

  18. Variational formulation of high-performance finite elements - Parametrized variational principles

    Science.gov (United States)

    Felippa, C. A.; Militello, C.

    1990-01-01

    High-performance (HP) elements are simple finite elements constructed to deliver engineering accuracy with coarse arbitrary grids. This paper is part of a series on the variational basis of HP elements, with emphasis on those constructed with the free formulation (FF) and assumed natural strain (ANS) methods. The present paper studies parametrized variational principles that provide a foundation for the FF and ANS methods, as well as for a combustion of both methods.

  19. Report on intercomparison A-13 of the determination of trace elements in freeze dried animal blood

    International Nuclear Information System (INIS)

    This document deals with the comparative evaluation of the analytical data on the trace elements in beef blood obtained by 38 laboratories in 23 countries. The evaluations were based on 799 laboratory mean values of concentration of 41 elements. It was one of the series of IAEA intercomparisons on the determination of trace elements in animal materials. It was organized for the purpose of assisting the participating laboratories to check the accuracy of their work and to prepare a new reference material

  20. Modeling refractive metasurfaces in series as a single metasurface

    Science.gov (United States)

    Toor, Fatima; Guneratne, Ananda C.

    2016-03-01

    Metasurfaces are boundaries between two media that are engineered to induce an abrupt phase shift in propagating light over a distance comparable to the wavelength of the light. Metasurface applications exploit this rapid phase shift to allow for precise control of wavefronts. The phase gradient is used to compute the angle at which light is refracted using the generalized Snell's Law. [1] In practice, refractive metasurfaces are designed using a relatively small number of phaseshifting elements such that the phase gradient is discrete rather than continuous. Designing such a metasurface requires finding phase-shifting elements that cover a full range of phases (a phase range) from 0 to 360 degrees. We demonstrate an analytical technique to calculate the refraction angle due to multiple metasurfaces arranged in series without needing to account for the effect of each individual metasurface. The phase gradients of refractive metasurfaces in series may be summed to obtain the phase gradient of a single equivalent refractive metasurface. This result is relevant to any application that requires a system with multiple metasurfaces, such as biomedical imaging [2], wavefront correctors [3], and beam shaping [4].

  1. Trace element emissions from coal

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2012-09-15

    Trace elements are emitted during coal combustion. The quantity, in general, depends on the physical and chemical properties of the element itself, the concentration of the element in the coal, the combustion conditions and the type of particulate control device used, and its collection efficiency as a function of particle size. Some trace elements become concentrated in certain particle streams following combustion such as bottom ash, fly ash, and flue gas particulate matter, while others do not. Various classification schemes have been developed to describe this partitioning behaviour. These classification schemes generally distinguish between: Class 1: elements that are approximately equally concentrated in the fly ash and bottom ash, or show little or no fine particle enrichment, examples include Mn, Be, Co and Cr; Class 2: elements that are enriched in the fly ash relative to bottom ash, or show increasing enrichment with decreasing particle size, examples include As, Cd, Pb and Sb; Class 3: elements which are emitted in the gas phase (primarily Hg (not discussed in this review), and in some cases, Se). Control of class 1 trace elements is directly related to control of total particulate matter emissions, while control of the class 2 elements depends on collection of fine particulates. Due to the variability in particulate control device efficiencies, emission rates of these elements can vary substantially. The volatility of class 3 elements means that particulate controls have only a limited impact on the emissions of these elements.

  2. ServoSEA concept: Cheap, miniature series-elastic actuators for orthotic, prosthetic and robotic hands

    NARCIS (Netherlands)

    Ates, S.; Sluiter, V.I.; Lammertse, P.; Stienen, A.H.A.

    2014-01-01

    For interactive humanoids, rehabilitation robots, and orthotic and prosthetic devices, the human-robot interaction is an essential but challenging element. Compliant Series-Elastic Actuators (SEAs) are ideal to power such devices due to their low impedance and smoothness of generated forces. In this

  3. Mapping Maize Genes: A Series of Research-Based Laboratory Exercises

    Science.gov (United States)

    Makarevitch, Irina; Kralich, Elizabeth

    2011-01-01

    Open-ended, inquiry-based multiweek laboratory exercises are the key elements to increasing students' understanding and retention of the major biological concepts. Including original research into undergraduate teaching laboratories has also been shown to motivate students and improve their learning. Here, we present a series of original…

  4. Coupling between time series: a network view

    CERN Document Server

    Mehraban, Saeed; Zamani, Maryam; Jafari, Gholamreza

    2013-01-01

    Recently, the visibility graph has been introduced as a novel view for analyzing time series, which maps it to a complex network. In this paper, we introduce new algorithm of visibility, "cross-visibility", which reveals the conjugation of two coupled time series. The correspondence between the two time series is mapped to a network, "the cross-visibility graph", to demonstrate the correlation between them. We applied the algorithm to several correlated and uncorrelated time series, generated by the linear stationary ARFIMA process. The results demonstrate that the cross-visibility graph associated with correlated time series with power-law auto-correlation is scale-free. If the time series are uncorrelated, the degree distribution of their cross-visibility network deviates from power-law. For more clarifying the process, we applied the algorithm to real-world data from the financial trades of two companies, and observed significant small-scale coupling in their dynamics.

  5. International Work-Conference on Time Series

    CERN Document Server

    Pomares, Héctor

    2016-01-01

    This volume presents selected peer-reviewed contributions from The International Work-Conference on Time Series, ITISE 2015, held in Granada, Spain, July 1-3, 2015. It discusses topics in time series analysis and forecasting, advanced methods and online learning in time series, high-dimensional and complex/big data time series as well as forecasting in real problems. The International Work-Conferences on Time Series (ITISE) provide a forum for scientists, engineers, educators and students to discuss the latest ideas and implementations in the foundations, theory, models and applications in the field of time series analysis and forecasting. It focuses on interdisciplinary and multidisciplinary research encompassing the disciplines of computer science, mathematics, statistics and econometrics.

  6. RESEARCH OF THE FOUNDATION CONSOLIDATED BY DIFFERENT-SIZED HORIZONTAL ELEMENTS

    Directory of Open Access Journals (Sweden)

    Isakova Elena Aleksandrovna

    2016-05-01

    Full Text Available The article is dedicated to the problem of geotechnics. The problems of the weak soil base are topical. Also there sometimes happen severe accidents of soil mass. A great number of such emergencies is of a progressive character, when a local crash leads to the crash of the whole construction. Tarring the soil with epoxy can ensure geotechnical safety of the basis. That’s why the improvement of this method is needed in order to reduce yielding of the base, create ground water cutoff or create building hoisting. In the article new structural solutions for reduction of settlement are presented. The authors suggest using the manufactured plane elements containing epoxy. Such elements have different sizes and lie underneath the foundation. Similar structural scheme can be used to reduce soil settlement. The authors carried out two series of plate-bearing model tests with manufactured plane epoxy elements. In the first series of tests the biggest element was closer to the foundation, the smallest element was closer to the biggest element. In the second series of tests the smallest element was closer to the foundation, the biggest element was closer to the smallest element. After the end of plate-bearing model tests the authors received values of the base settlement and the dependency diagrams “base settlement-soil pressure”. The new structural solution for reducing soil settlement proved to be effective. Settlement of base decreased sevenfold.

  7. Accelerator vacuum system elements

    International Nuclear Information System (INIS)

    Some elements of vacuum systems are investigated. Considerable attention has been given to the investigation into peculiarities in pumping out of a ionoguide for transportation of an accelerated charged particles beam the spread of which often attains a considerable length. The number of pumps over the ionoguide length is experimentally determined. It is shown that as a result of ionoguide warm-up the pumping out time is considerably reduced maximum permissible pressure is decreased by two orders and lesser rate of pump pumping out is required. The investigations have shown that when operating the ionoguide there is no necessity in setting up seals between the ionoguide and magnetodischarged pump. The causes of the phenomenon in which the pressure near the pump is greater than in the end of the ionoguide, are impurities carried in by the pump into the ionoguide volume and the pumping out capacity of the pressure converter

  8. Finite element modelling

    International Nuclear Information System (INIS)

    The Finite Element Method (FEM) is a numerical technique for finding approximate solutions to boundary value problems. While FEM is commonly used to solve solid mechanics equations, it can be applied to a large range of BVPs from many different fields. FEM has been used for reactor fuels modelling for many years. It is most often used for fuel performance modelling at the pellet and pin scale, however, it has also been used to investigate properties of the fuel material, such as thermal conductivity and fission gas release. Recently, the United Stated Department Nuclear Energy Advanced Modelling and Simulation Program has begun using FEM as the basis of the MOOSE-BISON-MARMOT Project that is developing a multi-dimensional, multi-physics fuel performance capability that is massively parallel and will use multi-scale material models to provide a truly predictive modelling capability. (authors)

  9. Heavy-element research

    International Nuclear Information System (INIS)

    The status is reported of studies on the solid-state chemistry of the actinides and lanthanides, spectroscopy of actinide compounds, and dynamic chemical description of actinide elements in solution. Phase studies were done on Rb2UO4, K2UO4, Li2UO4, and Es2U2O7. The lithium neptunate (VI) system was investigated and the existence of Li2NpO4 was established. In oxidation-reduction studies it was shown that Am(III) can be electrolytically oxidized to Am(IV) in strong H3PO4, but Cf(III) and Pr(III) do not oxidize. The low-temperature absorption spectrum of thin films of NpBr3 was investigated. (U.S.)

  10. Nuclear reactor fuel element

    International Nuclear Information System (INIS)

    The grid-shaped spacer for PWR fuel elements consists of flat, upright metal bars at right angles to the fuel rods. In one corner of a grid mesh it has a spring with two end parts for the fuel rod. The cut-outs for the end parts start from an end edge of the metal bar parallel to the fuel rods. The transverse metal bar is one of four outer metal bars. Both end parts of the spring have an extension parallel to this outer metal arm, which grips a grid mesh adjacent to this grid mesh at the side in one corner of the spacer and forms an end part of a spring for the fuel rod there on the inside of the outer metal bar. (HP)

  11. The fantastic four.. elements

    Science.gov (United States)

    Marsili, Antonella; D'Addezio, Giuliana; Rubbia, Giuliana; Ramieri, Caterina; Todaro, Riccardo; Scipilliti, Francesca; Tosto, Eleonora

    2015-04-01

    With a "Sunday between territory and music to 'National Institute of Geophysics and Volcanology," October 12, 2014 the headquarters of INGV Roma kicked off the activities of the second edition of the Week of Planet Earth. The laboratory of scientific outreach and museum activities together with volunteers of the National Civil Service have organized the whole day dedicated to the dissemination of earth sciences, involving adults and children. Especially for primary school children a laboratory was made involving three amusing activities all aimed at inspiring respect for the Earth: a theatrical representation called "The Fantastic 4... elements", a behavioral game and a nursery rhyme reading. The theater as a means of communication of science is an innovative and creative way to introduce children to important scientific concepts. The use of this methodology and simple language favoring the emotional involvement of the child facilitating learning. The main character is a child, chosen to facilitate the identification of the spectators with the protagonist, that through a fantastic journey discovers the importance of the four elements of our planet: earth, fire, air and water. As a second step, volunteers involved children in reading a nursery rhyme "the ABC to become a Friend of the Earth" inviting them to protect and respect the environment and its resources. Finally, the behavioral game gave indications about behaviors to adopt to safeguard the planet. Volunteers introduced a billboard divided into two colors, green to indicate the right behaviors and red for the wrong ones. Each child, after reading a card with indication on the behavior to adopt, had to decide if they were correct or not with respect to the environment safeguard. After listening to the children's answer, the volunteer gave the correct explanation about the appropriate behavior to adopt. At the end of the activities, each child received a certificate as "a friend of Planet Earth".

  12. Introduction of the Mammography unit; SEPIO series

    Energy Technology Data Exchange (ETDEWEB)

    Nanbu, Yukiko; Sasaki, Osamu; Tsuji, Hisao [Shimadzu Corp., Medical Systems Division, Kyoto (Japan)

    2003-06-01

    Mammography unit SEPIO series are designed for the both screening and diagnosis of the breast cancer. SEPIO series have the following features; iso-centric C-arm rotation leads to high throughput, two phase compression method called Twincomp minimizes the blind are near chest wall and the bi-angular X-ray tube contributes to better image quality. Furthermore optional MaxVision system which has a function to pull the breast toward the film is introduced to SEPIO series. (author)

  13. Hurst Exponent Analysis of Financial Time Series

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Statistical properties of stock market time series and the implication of their Hurst exponents are discussed. Hurst exponents of DJ1A (Dow Jones Industrial Average) components are tested using re-scaled range analysis. In addition to the original stock return series, the linear prediction errors of the daily returns are also tested. Numerical results show that the Hurst exponent analysis can provide some information about the statistical properties of the financial time series.

  14. CYCLIC CODES OVER FORMAL POWER SERIES RINGS

    Institute of Scientific and Technical Information of China (English)

    Dougherty Steven T.; Liu Hongwei

    2011-01-01

    In this article, cyclic codes and negacyclic codes over formal power series rings are studied. The structure of cyclic codes over this class of rings is given, and the relationship between these codes and cyclic codes over finite chain rings is obtained. Using an isomorphism between cyclic and negacyclic codes over formal power series rings, the structure of negacyclic codes over the formal power series rings is obtained.

  15. Framing Biotechnology in Iranian TV Series

    OpenAIRE

    H. Khaniki; M. H. Panahi; M. A. Ghaneirad; Z. Zardar

    2014-01-01

    Media as public opinion formers have crucial role in supporting the growth and development of science and technology . They form media frames in various fields of science and Technology. This paper seeks to identify frames which Iranian television series depict biotechnology. The Biotechnology frames Identified through qualitative framing analysis. To achieve this goal, all TV series of Five main national channels for a five-year period (2008-2013) were considered and two TV series – “Balhaye...

  16. Novel high-performance element in the electromagnetic finite-element method--node-edge element

    Institute of Scientific and Technical Information of China (English)

    Sheng Xinqing; Peng Zhen

    2008-01-01

    It is known in the computational electromagnetics (CEM) that the node element has a relative well-conditioned matrix,but suffers from the spurious solution problem; whereas the edge element has no spurious solutions,but usually produces an ill-conditioned matrix.Particularly,when the mesh is over dense,the iterative solution of the matrix equation from edge element converges very slowly.Based on the node element and edge element,a node-edge element is presented,which has no spurious solutions and better-conditioned matrix.Numerical experiments demonstrate that the proposed node-edge element is more efficient than now-widely used edge element.

  17. An element by element spectral element method for elastic wave modeling

    Institute of Scientific and Technical Information of China (English)

    LIN Weijun; WANG Xiuming; ZHANG Hailan

    2006-01-01

    The spectral element method which combines the advantages of spectral method with those of finite element method,provides an efficient tool in simulating elastic wave equation in complex medium. Based on weak form of elastodynamic equations, mathematical formulations for Legendre spectral element method are presented. The wave field on an element is discretized using high-order Lagrange interpolation, and integration over the element is accomplished based upon the Gauss-Lobatto-Legendre integration rule. This results in a diagonal mass matrix which leads to a greatly simplified algorithm. In addition, the element by element technique is introduced in our method to reduce the memory sizes and improve the computation efficiency. Finally, some numerical examples are presented to demonstrate the spectral accuracy and the efficiency. Because of combinations of the finite element scheme and spectral algorithms, this method can be used for complex models, including free surface boundaries and strong heterogeneity.

  18. Satellite Image Time Series Decomposition Based on EEMD

    Directory of Open Access Journals (Sweden)

    Yun-long Kong

    2015-11-01

    Full Text Available Satellite Image Time Series (SITS have recently been of great interest due to the emerging remote sensing capabilities for Earth observation. Trend and seasonal components are two crucial elements of SITS. In this paper, a novel framework of SITS decomposition based on Ensemble Empirical Mode Decomposition (EEMD is proposed. EEMD is achieved by sifting an ensemble of adaptive orthogonal components called Intrinsic Mode Functions (IMFs. EEMD is noise-assisted and overcomes the drawback of mode mixing in conventional Empirical Mode Decomposition (EMD. Inspired by these advantages, the aim of this work is to employ EEMD to decompose SITS into IMFs and to choose relevant IMFs for the separation of seasonal and trend components. In a series of simulations, IMFs extracted by EEMD achieved a clear representation with physical meaning. The experimental results of 16-day compositions of Moderate Resolution Imaging Spectroradiometer (MODIS, Normalized Difference Vegetation Index (NDVI, and Global Environment Monitoring Index (GEMI time series with disturbance illustrated the effectiveness and stability of the proposed approach to monitoring tasks, such as applications for the detection of abrupt changes.

  19. Data mining in time series databases

    CERN Document Server

    Kandel, Abraham; Bunke, Horst

    2004-01-01

    Adding the time dimension to real-world databases produces Time SeriesDatabases (TSDB) and introduces new aspects and difficulties to datamining and knowledge discovery. This book covers the state-of-the-artmethodology for mining time series databases. The novel data miningmethods presented in the book include techniques for efficientsegmentation, indexing, and classification of noisy and dynamic timeseries. A graph-based method for anomaly detection in time series isdescribed and the book also studies the implications of a novel andpotentially useful representation of time series as strings. Theproblem of detecting changes in data mining models that are inducedfrom temporal databases is additionally discussed.

  20. On Walsh series with monotone coefficients

    International Nuclear Information System (INIS)

    We prove that if an↓0 and Σn=0∞an2=+∞ then the Walsh series Σn=0∞anWn(x) has the following property. For any measurable function f(x) which is finite almost everywhere, there are numbers δn=0, ±1 such that the series Σn=0∞δnanWn(x) converges to f(x) almost everywhere. This assertion complements and strengthens previously known results about universal Walsh series and Walsh null-series

  1. Outliers Mining in Time Series Data Sets

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    In this paper, we present a cluster-based algorithm for time series outlier mining.We use discrete Fourier transformation (DFT) to transform time series from time domain to frequency domain. Time series thus can be mapped as the points in k-dimensional space.For these points, a cluster-based algorithm is developed to mine the outliers from these points.The algorithm first partitions the input points into disjoint clusters and then prunes the clusters,through judgment that can not contain outliers.Our algorithm has been run in the electrical load time series of one steel enterprise and proved to be effective.

  2. Time series data correction for the Chang'E-1 gamma-ray spectrometer

    Institute of Scientific and Technical Information of China (English)

    Li-Yan Zhang; Yong-Liao Zou; Jian-Zhong Liu; Jian-Jun Liu; Ji Shen; Ling-Li Mu; Xin Ren; Wei-Bin Wen; Chun-Lai Li

    2011-01-01

    The main goal of the gamma-ray spectrometer (GRS) onboard Chang'E-l (CE-1) is to acquire global maps of elemental abundances and their distributions on the moon, since such maps will significantly improve our understanding of lunar formation and evolution. To derive the elemental maps and enable research on lunar formation and evolution, raw data that are received directly from the spacecraft must be converted into time series corrected gamma-ray spectra. The data correction procedures for the CE-1 GRS time series data are thoroughly described. The processing procedures to create the time series gamma-ray spectra described here include channel processing, optimal data selection, energy calibration, gain correction, dead time correction, geometric correction, orbit altitude normalization, eliminating unusable data and galactic cosmic ray correction. Finally, descriptions are also given on data measurement uncertainties, which will help the interested scientists to understand and estimate various uncertainties associated with the above data processing.

  3. Osseous genioplasty: A case series

    Directory of Open Access Journals (Sweden)

    Sanjeev N Deshpande

    2011-01-01

    Full Text Available Introduction: The chin (mentum is vital to the human facial morphology as it contributes to the facial aesthetics and harmony both on frontal and lateral views. Osseous genioplasty, the alteration of the chin through skeletal modification, can lead to significant enhancement of the overall facial profile. Aim and Study Design: A case series was designed to study the long-term results of osseous genioplasty in Indian patients with regard to patient satisfaction, complications, and long-term stability. Materials and Methods: All subjects who underwent osseous genioplasty either alone or as a component of orthognathic surgery between January 1992 and December 2010, with a minimum follow-up of 2 years, were included. The genioplasty was performed using standard protocols of assessment and execution. Post-operative evaluation included patient satisfaction, complications and radiological evidence of long-term stability. A comprehensive score was formulated for the purpose of the study. Results: Thirty-seven subjects underwent osseous genioplasty with at least 2 years of follow-up in the study period. This included 17 male and 20 female subjects, with a mean age of 22.8 years (15-52 years and a mean follow-up of 3 years 4 months (2 years to 4 years and 11 months. Nineteen subjects underwent isolated genioplasty while 18 underwent genioplasty as a part of orthognathic surgery. The procedures included advancement (22, pushback (9, side-to-side (4 and vertical reduction (2 genioplasty.Thirty-six subjects (97.3% were extremely pleased with the results with only one subject expressing reservations, without, however, demanding any further procedure. There were no significant complications. The osteotomised segment was well maintained in its new position with good bony union and minimal resorption. Overall, 35 (94.6% cases had excellent results and 2 (4.4% cases had good results, according to the comprehensive score. Conclusions: Osseous genioplasty is a safe

  4. Arctic Visiting Speakers Series (AVS)

    Science.gov (United States)

    Fox, S. E.; Griswold, J.

    2011-12-01

    The Arctic Visiting Speakers (AVS) Series funds researchers and other arctic experts to travel and share their knowledge in communities where they might not otherwise connect. Speakers cover a wide range of arctic research topics and can address a variety of audiences including K-12 students, graduate and undergraduate students, and the general public. Host applications are accepted on an on-going basis, depending on funding availability. Applications need to be submitted at least 1 month prior to the expected tour dates. Interested hosts can choose speakers from an online Speakers Bureau or invite a speaker of their choice. Preference is given to individuals and organizations to host speakers that reach a broad audience and the general public. AVS tours are encouraged to span several days, allowing ample time for interactions with faculty, students, local media, and community members. Applications for both domestic and international visits will be considered. Applications for international visits should involve participation of more than one host organization and must include either a US-based speaker or a US-based organization. This is a small but important program that educates the public about Arctic issues. There have been 27 tours since 2007 that have impacted communities across the globe including: Gatineau, Quebec Canada; St. Petersburg, Russia; Piscataway, New Jersey; Cordova, Alaska; Nuuk, Greenland; Elizabethtown, Pennsylvania; Oslo, Norway; Inari, Finland; Borgarnes, Iceland; San Francisco, California and Wolcott, Vermont to name a few. Tours have included lectures to K-12 schools, college and university students, tribal organizations, Boy Scout troops, science center and museum patrons, and the general public. There are approximately 300 attendees enjoying each AVS tour, roughly 4100 people have been reached since 2007. The expectations for each tour are extremely manageable. Hosts must submit a schedule of events and a tour summary to be posted online

  5. The application of hospitality elements in hospitals.

    Science.gov (United States)

    Wu, Ziqi; Robson, Stephani; Hollis, Brooke

    2013-01-01

    In the last decade, many hospital designs have taken inspiration from hotels, spurred by factors such as increased patient and family expectations and regulatory or financial incentives. Increasingly, research evidence suggests the value of enhancing the physical environment to foster healing and drive consumer decisions and perceptions of service quality. Although interest is increasing in the broader applicability of numerous hospitality concepts to the healthcare field, the focus of this article is design innovations, and the services that such innovations support, from the hospitality industry. To identify physical hotel design elements and associated operational features that have been used in the healthcare arena, a series of interviews with hospital and hotel design experts were conducted. Current examples and suggestions for future hospitality elements were also sought from the experts, academic journals, and news articles. Hospitality elements applied in existing hospitals that are addressed in this article include hotel-like rooms and decor; actual hotels incorporated into medical centers; hotel-quality food, room service, and dining facilities for families; welcoming lobbies and common spaces; hospitality-oriented customer service training; enhanced service offerings, including concierges; spas or therapy centers; hotel-style signage and way-finding tools; and entertainment features. Selected elements that have potential for future incorporation include executive lounges and/or communal lobbies with complimentary wireless Internet and refreshments, centralized controls for patients, and flexible furniture. Although the findings from this study underscore the need for more hospitality-like environments in hospitals, the investment decisions made by healthcare executives must be balanced with cost-effectiveness and the assurance that clinical excellence remains the top priority. PMID:23424818

  6. The application of hospitality elements in hospitals.

    Science.gov (United States)

    Wu, Ziqi; Robson, Stephani; Hollis, Brooke

    2013-01-01

    In the last decade, many hospital designs have taken inspiration from hotels, spurred by factors such as increased patient and family expectations and regulatory or financial incentives. Increasingly, research evidence suggests the value of enhancing the physical environment to foster healing and drive consumer decisions and perceptions of service quality. Although interest is increasing in the broader applicability of numerous hospitality concepts to the healthcare field, the focus of this article is design innovations, and the services that such innovations support, from the hospitality industry. To identify physical hotel design elements and associated operational features that have been used in the healthcare arena, a series of interviews with hospital and hotel design experts were conducted. Current examples and suggestions for future hospitality elements were also sought from the experts, academic journals, and news articles. Hospitality elements applied in existing hospitals that are addressed in this article include hotel-like rooms and decor; actual hotels incorporated into medical centers; hotel-quality food, room service, and dining facilities for families; welcoming lobbies and common spaces; hospitality-oriented customer service training; enhanced service offerings, including concierges; spas or therapy centers; hotel-style signage and way-finding tools; and entertainment features. Selected elements that have potential for future incorporation include executive lounges and/or communal lobbies with complimentary wireless Internet and refreshments, centralized controls for patients, and flexible furniture. Although the findings from this study underscore the need for more hospitality-like environments in hospitals, the investment decisions made by healthcare executives must be balanced with cost-effectiveness and the assurance that clinical excellence remains the top priority.

  7. The Chemistry of Superheavy Elements

    CERN Document Server

    Schädel, M

    2003-01-01

    The chemistry of transactinide or superheavy elements has reached element 108. Preparations are under way to leap to element 112 and beyond. The current status of this atom-at-a-time chemical research and its future perspectives are reviewed from an experimental point of view together with some of the interesting results from n -rich nuclides near and at the N=162 neutron shell. Experimental techniques and important results enlightening typical chemical properties of elements 104 through 108 are presented in an exemplary way. From the results of these experiments it is justified to place these elements in the Periodic Table of the Elements in to groups 4 through 8, respectively. However, mainly due to the influence of relativistic effects, it is no longer possible to deduce detailed chemical properties of these superheavy elements simply from this position.

  8. Finite element and finite difference methods in electromagnetic scattering

    CERN Document Server

    Morgan, MA

    2013-01-01

    This second volume in the Progress in Electromagnetic Research series examines recent advances in computational electromagnetics, with emphasis on scattering, as brought about by new formulations and algorithms which use finite element or finite difference techniques. Containing contributions by some of the world's leading experts, the papers thoroughly review and analyze this rapidly evolving area of computational electromagnetics. Covering topics ranging from the new finite-element based formulation for representing time-harmonic vector fields in 3-D inhomogeneous media using two coupled sca

  9. Trace element geochemistry of the South Atlantic Bight. Progress report

    International Nuclear Information System (INIS)

    This report summarizes research conducted during the past year under DOE Contract EY-76-S-09-0890. During this time, studies have been continued in the mid to outer continental shelf region. We have also initiated nearshore studies designed to elucidate processes influencing the fate of trace elements in estuaries and the coastal frontal zone. A smaller effort has been concerned with preliminary geochemical studies of uranium-thorium natural decay series radionuclides and with improvement, calibration, and expansion of our trace element laboratory procedures

  10. Elements of mathematics integration

    CERN Document Server

    Bourbaki, Nicolas

    2004-01-01

    Intégration is the sixth and last of the Books that form the core of the Bourbaki series; it draws abundantly on the preceding five Books, especially General Topology and Topological Vector Spaces, making it a culmination of the core six. The power of the tool thus fashioned is strikingly displayed in Chapter II of the author's Théories Spectrales, an exposition, in a mere 38 pages, of abstract harmonic analysis and the structure of locally compact abelian groups. The present volume comprises Chapters 1-6 in English translation (a second volume will contain the remaining Chapters 7-9). The individual fascicles of the original French edition have been extensively reviewed. Chapters 1-5 received very substantial revisions in a second edition, including changes to some fundamental definitions. Chapters 6-8 are based on the first editions of Chs. 1-5. The English edition has given the author the opportunity to correct misprints, update references, clarify the concordance of Chapter 6 with the second editions of...

  11. Health Psychology special series on health disparities

    NARCIS (Netherlands)

    A.E. Kazak; J. Bosch; E.A. Klonoff

    2012-01-01

    With the initiation of this new ongoing special series in Health Psychology on health disparities, we will publish articles that highlight ways in which health psychology can contribute to understanding and ameliorating these disparities. We welcome articles for this new special series and anticipat

  12. 1-Convergence of Complex Double Fourier Series

    Indian Academy of Sciences (India)

    Kulwinder Kaur; S S Bhatia; Babu Ram

    2003-11-01

    It is proved that the complex double Fourier series of an integrable function (, ) with coefficients {} satisfying certain conditions, will converge in 1-norm. The conditions used here are the combinations of Tauberian condition of Hardy–Karamata kind and its limiting case. This paper extends the result of Bray [1] to complex double Fourier series.

  13. Application of Power Series on Vibration Analyses

    Institute of Scientific and Technical Information of China (English)

    沈永刚

    2003-01-01

    Power series is extensively used for engineering studies. To raise the synthesis efficiency and computation accuracy of vibration mode synthesis (MS), the choosing of power series as the component mode-function is studied in this paper, and emphasis is laid on its effect upon the system computation accuracy when using the mode synthesis method for a high speed compound rotating elastic system.

  14. Euler Polynomials, Fourier Series and Zeta Numbers

    DEFF Research Database (Denmark)

    Scheufens, Ernst E

    2012-01-01

    Fourier series for Euler polynomials is used to obtain information about values of the Riemann zeta function for integer arguments greater than one. If the argument is even we recover the well-known exact values, if the argument is odd we find integral representations and rapidly convergent series....

  15. 4-H Science Inquiry Video Series

    Science.gov (United States)

    Green, Jeremy W.; Black, Lynette; Willis, Patrick

    2013-01-01

    Studies support science inquiry as a positive method and approach for 4-H professionals and volunteers to use for teaching science-based practices to youth. The development of a science inquiry video series has yielded positive results as it relates to youth development education and science. The video series highlights how to conduct science-rich…

  16. Measuring nonlinear behavior in time series data

    Science.gov (United States)

    Wai, Phoong Seuk; Ismail, Mohd Tahir

    2014-12-01

    Stationary Test is an important test in detect the time series behavior since financial and economic data series always have missing data, structural change as well as jumps or breaks in the data set. Moreover, stationary test is able to transform the nonlinear time series variable to become stationary by taking difference-stationary process or trend-stationary process. Two different types of hypothesis testing of stationary tests that are Augmented Dickey-Fuller (ADF) test and Kwiatkowski-Philips-Schmidt-Shin (KPSS) test are examine in this paper to describe the properties of the time series variables in financial model. Besides, Least Square method is used in Augmented Dickey-Fuller test to detect the changes of the series and Lagrange multiplier is used in Kwiatkowski-Philips-Schmidt-Shin test to examine the properties of oil price, gold price and Malaysia stock market. Moreover, Quandt-Andrews, Bai-Perron and Chow tests are also use to detect the existence of break in the data series. The monthly index data are ranging from December 1989 until May 2012. Result is shown that these three series exhibit nonlinear properties but are able to transform to stationary series after taking first difference process.

  17. DATA MINING IN CANADIAN LYNX TIME SERIES

    Directory of Open Access Journals (Sweden)

    R.Karnaboopathy

    2012-01-01

    Full Text Available This paper sums up the applications of Statistical model such as ARIMA family timeseries models in Canadian lynx data time series analysis and introduces the method of datamining combined with Statistical knowledge to analysis Canadian lynx data series.

  18. Goals and Indirect Objects in Seri.

    Science.gov (United States)

    Marlett, Stephen A.

    A number of Seri verbs display a sensitivity to whether a goal, which is a term used for recipients, adressees, etc., is singular or plural. The data presented in this paper are of typological interest. It is argued that Seri has indirect objects, but that there is no one-to-one mapping between the semantic role goal and either the syntactic…

  19. The transnational appeal of Danish TV series

    DEFF Research Database (Denmark)

    Jensen, Pia Majbritt

    with audio-visual content removed from their own (cultural) context as would be the case with international audiences engaging with Danish series – and instead emphasized the importance of geo-linguistic, national or ‘resident’ viewing. Even in cases when transnational viewing has been theorized...... findings on the transnational appeal and reception of the Danish series....

  20. THE GROWTH OF RANDOM DIRICHLET SERIES (I)

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    Under the conditions(without independence): (i) α>0, such that (X)0, such that (X) <+∞, the random series (X) and (X)series a.s. have the same abscissa of convergence, the (R) order, lower order and type.

  1. The Foundations of Modern Time Series Analysis

    CERN Document Server

    Mills, Professor Terence C

    2011-01-01

    This book develops the analysis of Time Series from its formal beginnings in the 1890s through to the publication of Box and Jenkins' watershed publication in 1970, showing how these methods laid the foundations for the modern techniques of Time Series analysis that are in use today.

  2. Some fascinating series and their sums

    CERN Document Server

    Azim, Md Enamul; Kaykobad, M

    2010-01-01

    In this paper we present some interesting results involving summation of series in particular trigonometric ones. We failed to locate these results in existing literature or in the web like MathWorld (http://mathworld.wolfram.com/) nor could we derive them using software for analytical computation like Maple. The identities are beautiful and involve finite series.

  3. Series Expansions for three-dimensional QED

    CERN Document Server

    Hamer, C J; Weihong, Z; Weihong, Zheng

    1998-01-01

    Strong-coupling series expansions are calculated for the Hamiltonian version of compact lattice electrodynamics in (2+1) dimensions, with 4-component fermions. Series are calculated for the ground-state energy per site, the chiral condensate, and the masses of `glueball' and positronium states. Comparisons are made with results obtained by other techniques.

  4. Chemistry of the superheavy elements.

    Science.gov (United States)

    Schädel, Matthias

    2015-03-13

    The quest for superheavy elements (SHEs) is driven by the desire to find and explore one of the extreme limits of existence of matter. These elements exist solely due to their nuclear shell stabilization. All 15 presently 'known' SHEs (11 are officially 'discovered' and named) up to element 118 are short-lived and are man-made atom-at-a-time in heavy ion induced nuclear reactions. They are identical to the transactinide elements located in the seventh period of the periodic table beginning with rutherfordium (element 104), dubnium (element 105) and seaborgium (element 106) in groups 4, 5 and 6, respectively. Their chemical properties are often surprising and unexpected from simple extrapolations. After hassium (element 108), chemistry has now reached copernicium (element 112) and flerovium (element 114). For the later ones, the focus is on questions of their metallic or possibly noble gas-like character originating from interplay of most pronounced relativistic effects and electron-shell effects. SHEs provide unique opportunities to get insights into the influence of strong relativistic effects on the atomic electrons and to probe 'relativistically' influenced chemical properties and the architecture of the periodic table at its farthest reach. In addition, they establish a test bench to challenge the validity and predictive power of modern fully relativistic quantum chemical models. PMID:25666065

  5. Detecting series periodicity with horizontal visibility graphs

    CERN Document Server

    Núñez, Angel M; Valero, Eusebio; Gómez, Jose Patricio; Luque, Bartolo

    2011-01-01

    The horizontal visibility algorithm has been recently introduced as a mapping between time series and networks. The challenge lies in characterizing the structure of time series (and the processes that generated those series) using the powerful tools of graph theory. Recent works have shown that the visibility graphs inherit several degrees of correlations from their associated series, and therefore such graph theoretical characterization is in principle possible. However, both the mathematical grounding of this promising theory and its applications are on its infancy. Following this line, here we address the question of detecting hidden periodicity in series polluted with a certain amount of noise. We first put forward some generic properties of horizontal visibility graphs which allow us to define a (graph theoretical) noise reduction filter. Accordingly, we evaluate its performance for the task of calculating the period of noisy periodic signals, and compare our results with standard time domain (autocorre...

  6. Statistical criteria for characterizing irradiance time series.

    Energy Technology Data Exchange (ETDEWEB)

    Stein, Joshua S.; Ellis, Abraham; Hansen, Clifford W.

    2010-10-01

    We propose and examine several statistical criteria for characterizing time series of solar irradiance. Time series of irradiance are used in analyses that seek to quantify the performance of photovoltaic (PV) power systems over time. Time series of irradiance are either measured or are simulated using models. Simulations of irradiance are often calibrated to or generated from statistics for observed irradiance and simulations are validated by comparing the simulation output to the observed irradiance. Criteria used in this comparison should derive from the context of the analyses in which the simulated irradiance is to be used. We examine three statistics that characterize time series and their use as criteria for comparing time series. We demonstrate these statistics using observed irradiance data recorded in August 2007 in Las Vegas, Nevada, and in June 2009 in Albuquerque, New Mexico.

  7. Transuranium organometallic elements

    International Nuclear Information System (INIS)

    This paper reports that neptunium and plutonium metal react cleanly with 1.5 equiv of I2 in aprotic ligating solvents, L, to give the triiodide complexes as tetrasolvates, AnI3L4 [An is Np, L is tetrahydrofuran (THF) (1); An is Pu, L is THF (2a), pyridine (Py) (2b), and dimethyl sulfoxide (DMSO) (2c)]. These complexes are convenient precursors to both new and existing transuranium compounds. Reaction of the triiodide complexes 1 and 2a in hexane with 3 equiv of sodium bis(trimethylsilyl)amide provides the volatile, solvate-free tris (silylamide) complexes, An[N(SiMe3)2]3 (An is Np, 3; An is Pu, 4). Hexan solutions of 3 and 4 react rapidly with 3 equiv of HO-2,6-(t-C4H9)2C6H3 to give the aryloxide complexes An[O-26-(t-C4H9)2C6H3]3 (An is Np 5; An is Pu, 6). Preliminary investigations indicate that complexes 5 and 6 react with lithium bis(trimethylsilyl)methanide, Li[CH(SiMe3)2], in hexane to give the alkyl complexes An[CH(SiME3)2]3 (An is Np, 7; An is PU, 8). Plutonium triiodide complex 2a readily reacts with LiC5H5 to give the known (n5-C5H5)3Pu(THF). The homoleptic silylamide, aryloxide, and alkyl complexes are the first reported examples for transuranium elements

  8. Matrix elements of unstable states

    CERN Document Server

    Bernard, V; Meißner, U -G; Rusetsky, A

    2012-01-01

    Using the language of non-relativistic effective Lagrangians, we formulate a systematic framework for the calculation of resonance matrix elements in lattice QCD. The generalization of the L\\"uscher-Lellouch formula for these matrix elements is derived. We further discuss in detail the procedure of the analytic continuation of the resonance matrix elements into the complex energy plane and investigate the infinite-volume limit.

  9. EDGE-ORIENTED HEXAGONAL ELEMENTS

    Institute of Scientific and Technical Information of China (English)

    Chao Yang; Jiachang Sun

    2007-01-01

    In this paper, two new nonconforming hexagonal elements are presented, which are based on the trilinear function space Q(3)1 and are edge-oriented, analogical to the case of the rotated Q1 quadrilateral element. A priori error estimates are given to show that the new elements achieve first-order accuracy in the energy norm and second-order accuracy in the L2 norm. This theoretical result is confirmed by the numerical tests.

  10. Evaluation of Harmonic Analysis of Time Series (HANTS): impact of gaps on time series reconstruction

    NARCIS (Netherlands)

    Zhou, J.Y.; Jia, L.; Hu, G.; Menenti, M.

    2012-01-01

    In recent decades, researchers have developed methods and models to reconstruct time series of irregularly spaced observations from satellite remote sensing, among which the widely used Harmonic Analysis of Time Series (HANTS) method. Many studies based on time series reconstructed with HANTS docume

  11. Forecasting Daily Time Series using Periodic Unobserved Components Time Series Models

    NARCIS (Netherlands)

    Koopman, Siem Jan; Ooms, Marius

    2004-01-01

    We explore a periodic analysis in the context of unobserved components time series models that decompose time series into components of interest such as trend and seasonal. Periodic time series models allow dynamic characteristics to depend on the period of the year, month, week or day. In the stand

  12. Photoshop Elements 10 For Dummies

    CERN Document Server

    Obermeier, Barbara

    2011-01-01

    Perfect your photos and images with this "focused" guide to the latest version of Photoshop Elements For most of us, the professional-level Photoshop is overkill for our needs. Amateur photographers and photo enthusiasts turn to Photoshop Elements for a powerful but simpler way to edit and retouch their snapshots. Photoshop Elements 10 For Dummies, fully updated and revised for the latest release of this software product, helps you navigate Elements to create, edit, fix, share, and organize the high-quality images you desire. Full color pages bring the techniques to life and make taking great

  13. Allan deviation analysis of financial return series

    Science.gov (United States)

    Hernández-Pérez, R.

    2012-05-01

    We perform a scaling analysis for the return series of different financial assets applying the Allan deviation (ADEV), which is used in the time and frequency metrology to characterize quantitatively the stability of frequency standards since it has demonstrated to be a robust quantity to analyze fluctuations of non-stationary time series for different observation intervals. The data used are opening price daily series for assets from different markets during a time span of around ten years. We found that the ADEV results for the return series at short scales resemble those expected for an uncorrelated series, consistent with the efficient market hypothesis. On the other hand, the ADEV results for absolute return series for short scales (first one or two decades) decrease following approximately a scaling relation up to a point that is different for almost each asset, after which the ADEV deviates from scaling, which suggests that the presence of clustering, long-range dependence and non-stationarity signatures in the series drive the results for large observation intervals.

  14. Impact of the FUTURES series. Executive summary

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    The purpose of this study was to evaluate the effectiveness of the FUTURES series in affecting junior high school students` attitudes towards math and careers. FUTURES is a series of 12 programs designed to encourage positive attitudes in students towards math and science. The series illustrates their relevance to a variety of careers. The programs are hosted by Jaime Escalante and targeted to seventh to 12th grade students, with a special focus on minority students. This study looked at the long-term effects of the FUTURES series under classroom conditions. This study was designed to measure the effectiveness of the series in: (1) increasing positive attitudes toward math and science in school; (2) motivating students to have more positive attitudes about their future careers; (3) widening the possible choices of careers that involve the use of math and science; and, (4) creating an understanding of the relevance of math and science to careers and daily life. In addition, this study examined the appeal of the series, the students` understanding of program content, and how the series was used in the classroom.

  15. Homogenising time series: beliefs, dogmas and facts

    Science.gov (United States)

    Domonkos, P.

    2011-06-01

    In the recent decades various homogenisation methods have been developed, but the real effects of their application on time series are still not known sufficiently. The ongoing COST action HOME (COST ES0601) is devoted to reveal the real impacts of homogenisation methods more detailed and with higher confidence than earlier. As a part of the COST activity, a benchmark dataset was built whose characteristics approach well the characteristics of real networks of observed time series. This dataset offers much better opportunity than ever before to test the wide variety of homogenisation methods, and analyse the real effects of selected theoretical recommendations. Empirical results show that real observed time series usually include several inhomogeneities of different sizes. Small inhomogeneities often have similar statistical characteristics than natural changes caused by climatic variability, thus the pure application of the classic theory that change-points of observed time series can be found and corrected one-by-one is impossible. However, after homogenisation the linear trends, seasonal changes and long-term fluctuations of time series are usually much closer to the reality than in raw time series. Some problems around detecting multiple structures of inhomogeneities, as well as that of time series comparisons within homogenisation procedures are discussed briefly in the study.

  16. Visibility Graph Based Time Series Analysis.

    Directory of Open Access Journals (Sweden)

    Mutua Stephen

    Full Text Available Network based time series analysis has made considerable achievements in the recent years. By mapping mono/multivariate time series into networks, one can investigate both it's microscopic and macroscopic behaviors. However, most proposed approaches lead to the construction of static networks consequently providing limited information on evolutionary behaviors. In the present paper we propose a method called visibility graph based time series analysis, in which series segments are mapped to visibility graphs as being descriptions of the corresponding states and the successively occurring states are linked. This procedure converts a time series to a temporal network and at the same time a network of networks. Findings from empirical records for stock markets in USA (S&P500 and Nasdaq and artificial series generated by means of fractional Gaussian motions show that the method can provide us rich information benefiting short-term and long-term predictions. Theoretically, we propose a method to investigate time series from the viewpoint of network of networks.

  17. Network structure of multivariate time series

    Science.gov (United States)

    Lacasa, Lucas; Nicosia, Vincenzo; Latora, Vito

    2015-10-01

    Our understanding of a variety of phenomena in physics, biology and economics crucially depends on the analysis of multivariate time series. While a wide range tools and techniques for time series analysis already exist, the increasing availability of massive data structures calls for new approaches for multidimensional signal processing. We present here a non-parametric method to analyse multivariate time series, based on the mapping of a multidimensional time series into a multilayer network, which allows to extract information on a high dimensional dynamical system through the analysis of the structure of the associated multiplex network. The method is simple to implement, general, scalable, does not require ad hoc phase space partitioning, and is thus suitable for the analysis of large, heterogeneous and non-stationary time series. We show that simple structural descriptors of the associated multiplex networks allow to extract and quantify nontrivial properties of coupled chaotic maps, including the transition between different dynamical phases and the onset of various types of synchronization. As a concrete example we then study financial time series, showing that a multiplex network analysis can efficiently discriminate crises from periods of financial stability, where standard methods based on time-series symbolization often fail.

  18. Element Abundances through the Cosmic Ages

    CERN Document Server

    Pettini, M

    2003-01-01

    The horizon for studies of element abundances has expanded dramatically in the last ten years. Once the domain of astronomers concerned chiefly with stars and nearby galaxies, this field has now become a key component of observational cosmology, as technological advances have made it possible to measure the abundances of several chemical elements in a variety of environments at redshifts up to z = 4, when the universe was in its infancy. In this series of lectures I summarise current knowledge on the chemical make-up of distant galaxies observed directly in their starlight, and of interstellar and intergalactic gas seen in absorption against the spectra of bright background sources. The picture which is emerging is one where the universe at z = 3 already included many of the constituents of today's galaxies-even at these early times we see evidence for Population I and II stars, while the `smoking gun' for Population III objects may be hidden in the chemical composition of the lowest density regions of the in...

  19. A Simple Fuzzy Time Series Forecasting Model

    DEFF Research Database (Denmark)

    Ortiz-Arroyo, Daniel

    2016-01-01

    In this paper we describe a new first order fuzzy time series forecasting model. We show that our automatic fuzzy partitioning method provides an accurate approximation to the time series that when combined with rule forecasting and an OWA operator improves forecasting accuracy. Our model does...... not attempt to provide the best results in comparison with other forecasting methods but to show how to improve first order models using simple techniques. However, we show that our first order model is still capable of outperforming some more complex higher order fuzzy time series models....

  20. Science and Society Series off the Press

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    @@ The CAS has published the 2002 Science & Society series. The series, which consists of reports on scientific development, high-tech development and sustainable development, aims to introduce the world's scientific and technological (S&T) progress and developmental trends in 2001, review the changes in the frontiers of science and technology, pinpoint the main problems in research and development (R&D), and recount S&T development in China. Through the series, it is hoped that China's decades-long efforts at capacity building of sustainability will be made clear to the world, including theoretical exploration, contents, identification,dynamic monitoring, parametric system and quantitative analysis.

  1. Synthesis of Dibenzylidene Sorbitol Series Compound

    Institute of Scientific and Technical Information of China (English)

    FENG Rongxiu; CHEN Ligong; HOU Zhongke; SONG Jian

    2007-01-01

    A series of alditol derivatives were designed and synthesized with relatively high yield. On the basis of reaction between sorbitol and a series of substituted benzaldehyde in the presence of an acid catalyst, a series of acetal derivatives were synthesized through free hydroxyl esterification. D-sorbitol acetal amido derivatives were prepared by reduction of nitryl and acylation of amino. Dsorbitol acetal carboxyl esterification derivatives were prepared through esterification and hydrolysis. By high performance liquid chromatography-mass spectra (HPLC-MS) and H nuclear magneticresonance spectra (1 H-NMR), 36 compounds prepared were identified. Among these derivatives prepared, 26 compounds have not been reported in the previous literatures.

  2. Time Series Analysis Forecasting and Control

    CERN Document Server

    Box, George E P; Reinsel, Gregory C

    2011-01-01

    A modernized new edition of one of the most trusted books on time series analysis. Since publication of the first edition in 1970, Time Series Analysis has served as one of the most influential and prominent works on the subject. This new edition maintains its balanced presentation of the tools for modeling and analyzing time series and also introduces the latest developments that have occurred n the field over the past decade through applications from areas such as business, finance, and engineering. The Fourth Edition provides a clearly written exploration of the key methods for building, cl

  3. Trace element emissions. Literature review

    International Nuclear Information System (INIS)

    Application of fossil fuels by various utilities results in the emission of trace elements to air, water and solid waste streams. Elements present in coal are released as particles or as vapours during coal combustion or gasification. Owing to the increased consumption of coal, especially for power generation, huge quantities of potentially hazardous trace elements are released into the atmosphere every year. It is necessary to evaluate the emissions of each trace element from coal-fired combustion or gasification systems, and their effects on the environment. Present research interests should be aimed at determining the sources, concentrations, and environmental impact of trace elements related with energy generation and relevant control technologies. Two of the emerging advanced coal gasification technologies, such as integrated gasification combined cycle (IGCC) and integrated gasification fuel cell (IGFC) are presently experiencing potential difficulties due to trace element emissions. In order to control the levels of these contaminants within regulatory limits and to ensure the efficient operation of fuel cells, it is necessary to determine the type and quantity of trace elements emitted from coal gasification-based systems as a function of system, operating conditions, and type of coal. The partitioning of the trace elements is influenced by the gasification conditions. In general, the following gasification conditions are expected to influence the distribution of trace elements between various product streams. (a) reducing and oxidizing environments (b) gas phase composition, pressure and temperature. The present report was aimed at finding and identifying gaps existing in the literature on the trace element transformations during gasification. Also included in the report is the modelling of relevant transformation mechanisms of the trace elements during gasification as a function of coal type and process conditions. 7 figs., 6 tabs., 69 refs

  4. A locking-free anisotropic nonconforming rectangular finite element approximation for the planar elasticity problem

    Institute of Scientific and Technical Information of China (English)

    SHI Dong-yang; WANG Cai-xia

    2008-01-01

    This paper deals with a new nonconforming anisotropic rectangular finite element approximation for the planar elasticity problem with pure displacement boundary condition. By use of the special properties of this element,and by introducing the complementary space and a series of novel techniques,the optimal error estimates of the energy norm and the L2-norm are obtained. The restrictions of regularity assumption and quasi-uniform assumption or the inverse assumption on the meshes required in the conventional finite element methods analysis are to be got rid of and the applicable scope of the nonconforming finite elements is extended.

  5. Repetitive elements in parasitic protozoa

    OpenAIRE

    Clayton Christine

    2010-01-01

    Abstract A recent paper published in BMC Genomics suggests that retrotransposition may be active in the human gut parasite Entamoeba histolytica. This adds to our knowledge of the various types of repetitive elements in parasitic protists and the potential influence of such elements on pathogenicity. See research article http://www.biomedcentral.com/1471-2164/11/321

  6. Clean Elements in Abelian Rings

    Indian Academy of Sciences (India)

    Angelina Y M Chin

    2009-04-01

    Let be a ring with identity. An element in is said to be clean if it is the sum of a unit and an idempotent. is said to be clean if all of its elements are clean. If every idempotent in is central, then is said to be abelian. In this paper we obtain some conditions equivalent to being clean in an abelian ring.

  7. Solution of Finite Element Equations

    DEFF Research Database (Denmark)

    Krenk, Steen

    An important step in solving any problem by the finite element method is the solution of the global equations. Numerical solution of linear equations is a subject covered in most courses in numerical analysis. However, the equations encountered in most finite element applications have some special...

  8. Fuel element for nuclear reactor

    International Nuclear Information System (INIS)

    In order to avoid a can box or an adjacent fuel element sitting on the spacer of a fuel element in the corner during assembly, the top and bottom edges of the outer bars of the spacers are provided with deflector bars, which have projections projecting beyond the outside of the outer bars. (orig.)

  9. Repetitive elements in parasitic protozoa

    Directory of Open Access Journals (Sweden)

    Clayton Christine

    2010-05-01

    Full Text Available Abstract A recent paper published in BMC Genomics suggests that retrotransposition may be active in the human gut parasite Entamoeba histolytica. This adds to our knowledge of the various types of repetitive elements in parasitic protists and the potential influence of such elements on pathogenicity. See research article http://www.biomedcentral.com/1471-2164/11/321

  10. Subsidence modelling with analytic elements.

    NARCIS (Netherlands)

    Fokker, P.A.; Orlic, B.

    2000-01-01

    The method of Analytic Elements has been extended to enable elasticity calculations, to evaluate subsidence at the surface as resulting from extraction of oil or gas. Validation has been achieved by comparison with more limited analytical methods and with a comprehensive finite-element simulator. Th

  11. Stabilized Finite Elements with Matlab

    OpenAIRE

    Asensio, M. I.; A. Russo

    2002-01-01

    The purpose of this note is to explain the MATLAB code developed to solve an advection diffusion-reaction problem, with different Finite Element Methods: Standard Galerkin [7], Streamline Upwind/ Petrov-Galerkin (SUPG) [6], Unsual Stabilized [8, 9] and Residual-Free Bubbles [3, 4, 5], for both linear (P1) (see [1]) and quadratic (P2) (see [2]) triangular finite elements.

  12. Self-adaptive one-dimensional nonlinear finite element method based on element energy projection method

    Institute of Scientific and Technical Information of China (English)

    Si YUAN; Yan DU; Qin-yan XING; Kang-sheng YE

    2014-01-01

    The element energy projection (EEP) method for computation of super-convergent resulting in a one-dimensional finite element method (FEM) is successfully used to self-adaptive FEM analysis of various linear problems, based on which this paper presents a substantial extension of the whole set of technology to nonlinear problems. The main idea behind the technology transfer from linear analysis to nonlinear analysis is to use Newton’s method to linearize nonlinear problems into a series of linear problems so that the EEP formulation and the corresponding adaptive strategy can be directly used without the need for specific super-convergence formulation for nonlinear FEM. As a re-sult, a unified and general self-adaptive algorithm for nonlinear FEM analysis is formed. The proposed algorithm is found to be able to produce satisfactory finite element results with accuracy satisfying the user-preset error tolerances by maximum norm anywhere on the mesh. Taking the nonlinear ordinary differential equation (ODE) of second-order as the model problem, this paper describes the related fundamental idea, the imple-mentation strategy, and the computational algorithm. Representative numerical exam-ples are given to show the efficiency, stability, versatility, and reliability of the proposed approach.

  13. Recent series capacitor applications in North America

    Energy Technology Data Exchange (ETDEWEB)

    Miske, S.A.; Lang, R.J.; Rowe, S.D. [Canadian General Electric Co. Ltd., Toronto, ON (Canada); Bilodeau, P.; Granger, M. [Hydro-Quebec, Montreal, PQ (Canada)

    1995-12-31

    Equipment used in three recent installations of series capacitors were reported on. Each set of equipment was designed to serve markedly different objectives. The first design discussed was that of the twelve series capacitor banks installed on the Hydro-Quebec 735 kV transmission system as part of a program to increase the system reliability of the power flow from James Bay to Montreal. The second was the unique series capacitors installed on the Hydro-Quebec 735 kV and 315 kV transmission systems solely for the purpose of blocking direct current. The third design discussed was the world`s first and only EHV three-phase multi-module thyristor-controlled series capacitor (TCSC) installed at the 500 kV Slatt Substation of the Bonneville Power Administration. This project has demonstrated the impressive power system swing and subsynchronous resonance damping capabilities of this technology. 3 refs., 15 figs.

  14. Complex network approach to fractional time series

    Science.gov (United States)

    Manshour, Pouya

    2015-10-01

    In order to extract correlation information inherited in stochastic time series, the visibility graph algorithm has been recently proposed, by which a time series can be mapped onto a complex network. We demonstrate that the visibility algorithm is not an appropriate one to study the correlation aspects of a time series. We then employ the horizontal visibility algorithm, as a much simpler one, to map fractional processes onto complex networks. The degree distributions are shown to have parabolic exponential forms with Hurst dependent fitting parameter. Further, we take into account other topological properties such as maximum eigenvalue of the adjacency matrix and the degree assortativity, and show that such topological quantities can also be used to predict the Hurst exponent, with an exception for anti-persistent fractional Gaussian noises. To solve this problem, we take into account the Spearman correlation coefficient between nodes' degrees and their corresponding data values in the original time series.

  15. Advanced spectral methods for climatic time series

    Science.gov (United States)

    Ghil, M.; Allen, M.R.; Dettinger, M.D.; Ide, K.; Kondrashov, D.; Mann, M.E.; Robertson, A.W.; Saunders, A.; Tian, Y.; Varadi, F.; Yiou, P.

    2002-01-01

    The analysis of univariate or multivariate time series provides crucial information to describe, understand, and predict climatic variability. The discovery and implementation of a number of novel methods for extracting useful information from time series has recently revitalized this classical field of study. Considerable progress has also been made in interpreting the information so obtained in terms of dynamical systems theory. In this review we describe the connections between time series analysis and nonlinear dynamics, discuss signal- to-noise enhancement, and present some of the novel methods for spectral analysis. The various steps, as well as the advantages and disadvantages of these methods, are illustrated by their application to an important climatic time series, the Southern Oscillation Index. This index captures major features of interannual climate variability and is used extensively in its prediction. Regional and global sea surface temperature data sets are used to illustrate multivariate spectral methods. Open questions and further prospects conclude the review.

  16. Applied time series analysis and innovative computing

    CERN Document Server

    Ao, Sio-Iong

    2010-01-01

    This text is a systematic, state-of-the-art introduction to the use of innovative computing paradigms as an investigative tool for applications in time series analysis. It includes frontier case studies based on recent research.

  17. Massively Parallel Finite Element Programming

    KAUST Repository

    Heister, Timo

    2010-01-01

    Today\\'s large finite element simulations require parallel algorithms to scale on clusters with thousands or tens of thousands of processor cores. We present data structures and algorithms to take advantage of the power of high performance computers in generic finite element codes. Existing generic finite element libraries often restrict the parallelization to parallel linear algebra routines. This is a limiting factor when solving on more than a few hundreds of cores. We describe routines for distributed storage of all major components coupled with efficient, scalable algorithms. We give an overview of our effort to enable the modern and generic finite element library deal.II to take advantage of the power of large clusters. In particular, we describe the construction of a distributed mesh and develop algorithms to fully parallelize the finite element calculation. Numerical results demonstrate good scalability. © 2010 Springer-Verlag.

  18. Chemical elements distribution in cells

    Science.gov (United States)

    Ortega, R.

    2005-04-01

    Analysing, imaging and understanding the cellular chemistry, from macromolecules to monoatomic elements, is probably a major challenge for the scientific community after the conclusion of the genome project. In order to probe the distribution of elements in cells, especially the so-called inorganic elements, it is necessary to apply microanalytical techniques with sub-micrometer resolution and high chemical sensitivity. This paper presents the current status of chemical element imaging inside cells, and a comparison of the different analytical techniques available: nuclear microprobe, electron microprobe and electron energy loss spectroscopy, synchrotron radiation microprobe, secondary ion mass spectrometry and fluorescence microscopy methods. Examples of intracellular chemical elements distributions relevant to cancer pharmacology, medical imaging, metal carcinogenesis and neuropathology studies obtained by nuclear microprobe and other microanalytical techniques are presented.

  19. Second order tensor finite element

    Science.gov (United States)

    Oden, J. Tinsley; Fly, J.; Berry, C.; Tworzydlo, W.; Vadaketh, S.; Bass, J.

    1990-01-01

    The results of a research and software development effort are presented for the finite element modeling of the static and dynamic behavior of anisotropic materials, with emphasis on single crystal alloys. Various versions of two dimensional and three dimensional hybrid finite elements were implemented and compared with displacement-based elements. Both static and dynamic cases are considered. The hybrid elements developed in the project were incorporated into the SPAR finite element code. In an extension of the first phase of the project, optimization of experimental tests for anisotropic materials was addressed. In particular, the problem of calculating material properties from tensile tests and of calculating stresses from strain measurements were considered. For both cases, numerical procedures and software for the optimization of strain gauge and material axes orientation were developed.

  20. Correlation filtering in financial time series (Invited Paper)

    Science.gov (United States)

    Aste, T.; Di Matteo, Tiziana; Tumminello, M.; Mantegna, R. N.

    2005-05-01

    We apply a method to filter relevant information from the correlation coefficient matrix by extracting a network of relevant interactions. This method succeeds to generate networks with the same hierarchical structure of the Minimum Spanning Tree but containing a larger amount of links resulting in a richer network topology allowing loops and cliques. In Tumminello et al.,1 we have shown that this method, applied to a financial portfolio of 100 stocks in the USA equity markets, is pretty efficient in filtering relevant information about the clustering of the system and its hierarchical structure both on the whole system and within each cluster. In particular, we have found that triangular loops and 4 element cliques have important and significant relations with the market structure and properties. Here we apply this filtering procedure to the analysis of correlation in two different kind of interest rate time series (16 Eurodollars and 34 US interest rates).

  1. Radioactive Elements in the Standard Atomic Weights Table.

    Energy Technology Data Exchange (ETDEWEB)

    Holden,N.E.

    2007-08-04

    In the 1949 Report of the Atomic Weights Commission, a series of new elements were added to the Atomic Weights Table. Since these elements had been produced in the laboratory and were not discovered in nature, the atomic weight value of these artificial products would depend upon the production method. Since atomic weight is a property of an element as it occurs in nature, it would be incorrect to assign an atomic weight value to that element. As a result of that discussion, the Commission decided to provide only the mass number of the most stable (or longest-lived) known isotope as the number to be associated with these entries in the Atomic Weights Table. As a function of time, the mass number associated with various elements has changed as longer-lived isotopes of a particular element has been found in nature, or as improved half-life values of an element's isotopes might cause a shift in the longest-lived isotope from one mass to another. In the 1957 Report of the Atomic Weights Commission, it was decided to discontinue the listing of the mass number in the Atomic Weights Table on the grounds that the kind of information supplied by the mass number is inconsistent with the primary purpose of the Table, i.e., to provide accurate values of 'these constants' for use in various chemical calculations. In addition to the Table of Atomic Weights, the Commission included an auxiliary Table of Radioactive Elements for the first time, where the entry would be the isotope of that element which was the most stable, i.e., the one with the longest known half-life. In their 1973 Report, the Commission noted that the users of the main Table of Atomic Weights were dissatisfied with the omission of values for some elements in that Table and it was decided to reintroduce the mass number for the radioactive elements into the main Table. In their 1983 Report, the Commission decided that radioactive elements were considered to lack a characteristic terrestrial

  2. Averages of Values of L-Series

    OpenAIRE

    Alkan, Emre; Ono, Ken

    2013-01-01

    We obtain an exact formula for the average of values of L-series over two independent odd characters. The average of any positive moment of values at s = 1 is then expressed in terms of finite cotangent sums subject to congruence conditions. As consequences, bounds on such cotangent sums, limit points for the average of first moment of L-series at s = 1 and the average size of positive moments of character sums related to the class number are deduced.

  3. Posn(R) and Eisenstein series

    CERN Document Server

    Jorgenson, Jay

    2005-01-01

    Posn(R) and Eisenstein Series provides an introduction, requiring minimal prerequisites, to the analysis on symmetric spaces of positive definite real matrices as well as quotients of this space by the unimodular group of integral matrices. The approach is presented in very classical terms and includes material on special functions, notably gamma and Bessel functions, and focuses on certain mathematical aspects of Eisenstein series.

  4. Nonlinear time series: semiparametric and nonparametric methods

    OpenAIRE

    Gao, Jiti

    2007-01-01

    Useful in the theoretical and empirical analysis of nonlinear time series data, semiparametric methods have received extensive attention in the economics and statistics communities over the past twenty years. Recent studies show that semiparametric methods and models may be applied to solve dimensionality reduction problems arising from using fully nonparametric models and methods. Answering the call for an up-to-date overview of the latest developments in the field, "Nonlinear Time Series: S...

  5. Harry Potter book series - trivial or not?

    OpenAIRE

    Orel, Brigita

    2015-01-01

    The article explores the extent to which the features of trivial literature appear in the Harry Potter series by J. K. Rowling. This is done in comparison with another popular children's series, The Famous Five by Enid Blyton, which was analysed by Igor Saksida. The main focus of the analysis is on the schematic representation of plot, characters and the exotic nature of the setting and time of the stories.

  6. Index to the Understanding the Atom Series

    Energy Technology Data Exchange (ETDEWEB)

    None

    1978-01-01

    The U. S. Atomic Energy Commission publishes the Understanding the Atom Series of educational booklets for high school science students and their teachers. This series explains many aspects of nuclear science including its history and applications. Because these 51 booklets cover such a variety of scientific fields, this index was prepared to help the reader find quickly those booklets that contain the information he needs.

  7. Combination prediction method of chaotic time series

    Institute of Scientific and Technical Information of China (English)

    ZHAO DongHua; RUAN Jiong; CAI ZhiJie

    2007-01-01

    In the present paper, we propose an approach of combination prediction of chaotic time series. The method is based on the adding-weight one-rank local-region method of chaotic time series. The method allows us to define an interval containing a future value with a given probability, which is obtained by studying the prediction error distribution. Its effectiveness is shown with data generated by Logistic map.

  8. Time Series Analysis Using Composite Multiscale Entropy

    OpenAIRE

    Kung-Yen Lee; Chun-Chieh Wang; Shiou-Gwo Lin; Chiu-Wen Wu; Shuen-De Wu

    2013-01-01

    Multiscale entropy (MSE) was recently developed to evaluate the complexity of time series over different time scales. Although the MSE algorithm has been successfully applied in a number of different fields, it encounters a problem in that the statistical reliability of the sample entropy (SampEn) of a coarse-grained series is reduced as a time scale factor is increased. Therefore, in this paper, the concept of a composite multiscale entropy (CMSE) is introduced to overcome this difficulty. S...

  9. Harry Potter book series - trivial or not?

    Directory of Open Access Journals (Sweden)

    Brigita Pavšič

    2006-12-01

    Full Text Available The article explores  the extcnt to which the features  of trivial literature appear in the Harry Potter series by J. K. Rowling.This is done in comparison with another popular children's series, The Famous Five by Enid Blyton, which was analysed  by Igor Saksida. The main focus of the analysis is on the schematic representation of plot, characters and the exotic nature of the setting and time of the stories.

  10. Bayes linear variance adjustment for time series

    CERN Document Server

    Wilkinson, Darren J

    2008-01-01

    This paper exhibits quadratic products of linear combinations of observables which identify the covariance structure underlying the univariate locally linear time series dynamic linear model. The first- and second-order moments for the joint distribution over these observables are given, allowing Bayes linear learning for the underlying covariance structure for the time series model. An example is given which illustrates the methodology and highlights the practical implications of the theory.

  11. Mayer and virial series at low temperature

    OpenAIRE

    Jansen, Sabine

    2011-01-01

    We analyze the Mayer pressure-activity and virial pressure-density series for a classical system of particles in continuous configuration space at low temperature. Particles interact via a finite range potential with an attractive tail. We propose physical interpretations of the Mayer and virial series' radius of convergence, valid independently of the question of phase transition: the Mayer radius corresponds to a fast increase from very small to finite density, and the virial radius corresp...

  12. FATS: Feature Analysis for Time Series

    CERN Document Server

    Nun, Isadora; Sim, Brandon; Zhu, Ming; Dave, Rahul; Castro, Nicolas; Pichara, Karim

    2015-01-01

    In this paper, we present the FATS (Feature Analysis for Time Series) library. FATS is a Python library which facilitates and standardizes feature extraction for time series data. In particular, we focus on one application: feature extraction for astronomical light curve data, although the library is generalizable for other uses. We detail the methods and features implemented for light curve analysis, and present examples for its usage.

  13. Good reduction of Puiseux series and applications

    OpenAIRE

    Poteaux, Adrien; Rybowicz, Marc

    2012-01-01

    International audience We have designed a new symbolic-numeric strategy for computing efficiently and accurately floating point Puiseux series defined by a bivariate polynomial over an algebraic number field. In essence, computations modulo a well-chosen prime number p are used to obtain the exact information needed to guide floating point computations. In this paper, we detail the symbolic part of our algorithm. First of all, we study modular reduction of Puiseux series and give a good re...

  14. Producing Popularity: The Success in France of the Comics Series "Astérix le Gaulois"

    OpenAIRE

    Dandridge, Eliza Bourque

    2008-01-01

    This study examines the rise in popularity of the French comics series "Astérix le Gaulois" through a production-of-culture lens in an effort to uncover how industry evolution and organization, protectionist legislation, marketing, advertising, branding, and consecration by the media worked interdependently to catapult Astérix, the series' protagonist, into stardom by the middle of the 1960s. In so doing, this study forcefully argues that elements external to the text itself greatly facilit...

  15. [Deficiency, disability, neurology and television series].

    Science.gov (United States)

    Collado-Vázquez, Susana; Martínez-Martínez, Ariadna; Cano-de-la-Cuerda, Roberto

    2015-06-01

    Introduccion. El enfoque de la deficiencia y la discapacidad neurologica en la television no ha sido algo univoco, sino que ha reflejado la postura de la sociedad ante estas cuestiones y como se tratan estas, desde la optica de las concepciones y valores dominantes en cada momento. Objetivos. Abordar la aparicion de la patologia neurologica en las series de television y reflexionar sobre su imagen en dicho contexto. Desarrollo. La deficiencia y la discapacidad de origen neurologico se han reflejado ampliamente en el medio televisivo en series, telefilmes y documentales, con un tratamiento desigual. Se aborda el enfoque que ha tenido en diferentes series televisivas la patologia neurologica, su diagnostico, su tratamiento, asi como la figura de los profesionales sanitarios y la adaptacion sociofamiliar, y se citan, a modo de ejemplo, series como House, Glee, American Horror Story, Homeland o Juego de tronos. Conclusiones. Las series de television son una herramienta util para dar a conocer algunas patologias neurologicas y para desmitificar otras, siempre que dichas patologias se aborden de manera realista, hecho que no siempre ocurre. Habria que cuidar el tratamiento que reciben los profesionales de la salud en las series de television, pues no siempre es correcto, y eso puede llevar a errores entre los telespectadores, que aceptan lo que ven en la pequeña pantalla como real.

  16. Drying results of K-Basin fuel element 0309M (Run 3)

    International Nuclear Information System (INIS)

    An N-Reactor outer fuel element that had been stored underwater in the Hanford 100 Area K-West Basin was subjected to a combination of low- and high-temperature vacuum drying treatments. These studies are part of a series of tests being conducted by Pacific Northwest National Laboratory on the drying behavior of spent nuclear fuel elements removed from both the K-West and K-East Basins. The drying test series was designed to test fuel elements that ranged from intact to severely damaged. The fuel element discussed in this report was removed from K-West canister 0309M during the second fuel selection campaign, conducted in 1996, and has remained in wet storage in the Postirradiation Testing Laboratory (PTL, 327 Building) since that time. The fuel element was broken in two pieces, with a relatively clean fracture, and the larger piece was tested. A gray/white coating was observed. This was the first test of a damaged fuel element in the furnace. K-West canisters can hold up to seven complete fuel assemblies, but, for purposes of this report, the element tested here is designated as Element 0309M. Element 0309M was subjected to drying processes based on those proposed under the Integrated Process Strategy, which included a hot drying step

  17. Subtitling Historical Drama TV Series: Constraints and Considerations

    Directory of Open Access Journals (Sweden)

    Şirin Okyayuz

    2016-03-01

    Full Text Available Although there are a large number of books and articles on subtitling concentrating on different aspects of the endeavour, less attention seems to be devoted to the subtitling constraints and the possible strategies to be used in film and television series genres. For example, the subtitling of historical drama TV series, which have become very popular and reach a wide audience across the world, is a rarely studied endeavour. The following article is an effort to present a framework for the subtitlers of historical drama in consideration of the constraints of subtitling, as well as the features of the genre itself. Following an introduction about historical distance in translation, the linguistic, cultural and discoursal elements used in the production of the genre, the constraints of subtitling are exemplified with a comparative analysis of a historical drama and its subtitles into English. Particular attention is devoted to the translation strategies used in rendering registers and temporal and geographical varieties of language and, the strategies used to convey military, imperial, religious culture and social stratification. In conclusion, the study hopes to suggest points of practical use for subtitlers, concerning the subtitling of, what is explained in the study as, pseudo historical distance in historical drama and formulating a subtitling metatext

  18. Cosmic Concepts: A Video Series for Scaffolded Learning

    Science.gov (United States)

    Eisenhamer, Bonnie; Summers, Frank; Maple, John

    2016-01-01

    Scaffolding is widely considered to be an essential element of effective teaching and is used to help bridge knowledge gaps for learners. Scaffolding is especially important for distance-learning programs and computer-based learning environments. Preliminary studies are showing that when students learn about complex topics within computer-based learning environments without scaffolding, they fail to gain a conceptual understanding of the topic. As a result, researchers have begun to emphasize the importance of scaffolding for web-based as well as in-person instruction.To support scaffolded teaching practices and techniques, while addressing the needs of life-long learners, we have created the Cosmic Concepts video series. The series consists of short, one-topic videos that address scientific concepts with a special emphasis on those that traditionally cause confusion or are layered with misconceptions. Each video focuses on one idea at a time and provides a clear explanation of phenomena that is succinct enough for on-demand reference usage by all types of learners. Likewise, the videos can be used by educators to scaffold the scientific concepts behind astronomical images, or can be sequenced together to create well-structured pathways for presenting deeper and more layered ideas. This approach is critical for communicating information about astronomical discoveries that are often dense with unfamiliar concepts, complex ideas, and highly technical details. Additionally, learning tools in video formats support multi-sensory presentation approaches that can make astronomy more accessible to a variety of learners.

  19. Time series analysis of gold production in Malaysia

    Science.gov (United States)

    Muda, Nora; Hoon, Lee Yuen

    2012-05-01

    Gold is a soft, malleable, bright yellow metallic element and unaffected by air or most reagents. It is highly valued as an asset or investment commodity and is extensively used in jewellery, industrial application, dentistry and medical applications. In Malaysia, gold mining is limited in several areas such as Pahang, Kelantan, Terengganu, Johor and Sarawak. The main purpose of this case study is to obtain a suitable model for the production of gold in Malaysia. The model can also be used to predict the data of Malaysia's gold production in the future. Box-Jenkins time series method was used to perform time series analysis with the following steps: identification, estimation, diagnostic checking and forecasting. In addition, the accuracy of prediction is tested using mean absolute percentage error (MAPE). From the analysis, the ARIMA (3,1,1) model was found to be the best fitted model with MAPE equals to 3.704%, indicating the prediction is very accurate. Hence, this model can be used for forecasting. This study is expected to help the private and public sectors to understand the gold production scenario and later plan the gold mining activities in Malaysia.

  20. Phase stability and swelling in the V-series alloys

    International Nuclear Information System (INIS)

    The response of the V-series alloys to irradiation to a fluence of 7 x 1022 n/cm2 at 5930C covers a range of behavior from a minimum swelling of 0.6% (V4) to a maximum of 8.1% (V5). The major phases identified in the V series alloys examined after irradiation to 7 x 1022 n/cm2 at 5930C are TiC and laves. Between the fluences of 2 x 1022 n/cm2 and 7 x 1022 n/cm2 the compositions of the precipitates identified do not vary significantly. Results of this investigation indicate that the minimum amount of titanium in solution should be approx. 0.16 wt %. Higher levels of titanium in solution will promote more efficient pinning of the dislocation structure and result in lower swelling. Silicon levels greater than 0.5 wt % promote severe phase instabilities which deplete the matrix of elements which suppress swelling. The irradiation performance of this type alloy depends upon the achievement of a uniform distribution of Ti and a balance of Ti, Si, and C in solution which will encourage precipitation of TiC during service

  1. Technological similarity in process of series of type technology creating

    Directory of Open Access Journals (Sweden)

    P. Chyra

    2008-08-01

    Full Text Available Purpose: Problems of research related to creating ordered series of type of technology is realized with the intention of replacement traditional methods of selection of technological features for processes of machining. This process is realized through replacement of repeatable stages with routined stages susceptible to computer aiding.Design/methodology/approach: This paper shows algorithmic understanding of getting input data in the process of creating ordered families of technology based on data of constructional. Basic tool of realization of data selection for the process of manufacture is the theory of technological similarity aided by computer programmes which is being elaborated.Findings: The basic result of the analyzed problem is the realization of relations between construction and technology for specified series of types of elements of machine engines. Apart from that, there has been also describe the theory of technological similarity with its essential constituents which determine input date of algorythmisation of processes of selection of technological features on bases of constructional features.Research limitations/implications: Described methods are closely related to the research on the process of construction and the theory of constructional similarity. Further analyses will be carried on in order to specify the theory of technological similarity in new forms of computer aiding (relational databases, theory of automatic classification.Practical implications: The represented methods are apply for series of type of units of servo-motors hydraulic practical in mining.Originality/value: Represented in article relations between construction and technology realized with use of theory of technological similarity they make up basic of the group technology. Method this is characterizes with possibility of shortening of times of preparation of manufacture and the enlargement of seriality of manufacture.

  2. quadratic spline finite element method

    Directory of Open Access Journals (Sweden)

    A. R. Bahadir

    2002-01-01

    Full Text Available The problem of heat transfer in a Positive Temperature Coefficient (PTC thermistor, which may form one element of an electric circuit, is solved numerically by a finite element method. The approach used is based on Galerkin finite element using quadratic splines as shape functions. The resulting system of ordinary differential equations is solved by the finite difference method. Comparison is made with numerical and analytical solutions and the accuracy of the computed solutions indicates that the method is well suited for the solution of the PTC thermistor problem.

  3. Increased burnup of fuel elements

    International Nuclear Information System (INIS)

    The specialists' group for fuel elements of the Kerntechnische Gesellschaft e.V. held a meeting on ''Increased Burnup of Fuel Elements'' on 9th and 10th of November 1982 at the GKSS Research Center Geesthacht. Most papers dealt with the problems of burnup increase of fuel elements for light water reactors with respect to fuel manufacturing, power plant operation and reprocessing. Review papers were given on the burnup limits for high temperature gas cooled reactors and sodium fast breeder reactors. The meeting ended with a presentation of the technical equipment of the hot laboratory of the GKSS and the programs which are in progress there. (orig.)

  4. Transposable elements: The enemies within.

    Science.gov (United States)

    Scarfò, Irene; Pellegrino, Elisa; Mereu, Elisabetta; Inghirami, Giorgio; Piva, Roberto

    2016-10-01

    Understanding transformation mechanisms other than genetic aberrations has recently captured the attention of cancer researchers. To date, the role of transposable elements (TEs) in tumor development remains largely undefined. However, an increasing number of studies have reported that loss of epigenetic control causes TE reactivation and consequent oncogenic transcription. Here, we discuss principal examples of TEs-driven oncogenesis. Available data suggest that long terminal repeats and long interspersed nuclear elements play a pivotal role as alternative promoters. These findings provide definitive experimental evidence that repetitive elements are a powerful underestimated force toward oncogenesis and open the possibility to new therapeutic treatments.

  5. Photoshop Elements 9 Digital Classroom

    CERN Document Server

    Team, AGI Creative

    2011-01-01

    Learn Photoshop Elements at your own pace with this unique book-and-DVD training packagePhotoshop Elements is the leading image-editing software, and this personal training course uses a full-color book plus video tutorials on the DVD to teach you how to use all its features. Each of the 13 lessons is presented with step-by-step instructions and includes lesson files and a video explanation of the concepts. You can learn from leading instructors, and do it at your own pace.Photoshop Elements provides professional quality image-editing tools at an affordable price; this book-and-DVD package off

  6. Spacer for a fuel element

    International Nuclear Information System (INIS)

    Spacers for fuel pins arranged to form congish fuel elements can be shaped as plates with openings in accordance with the fuel pin grid. Such a plate that covers the cross section of a fuel element consists according to the invention of at least two parts that are offset in the fuel element's longitudinal direction and joint hinge-like in at least one grid position. Thus, one has smaller parts that are easier to work on with due accuracy. The invention is designed in particular for breeder reactors and high-conversion reactors. (orig.)

  7. Major element, trace element, nutrient, and radionuclide mobility in a mining by-product-amended soil.

    Science.gov (United States)

    Douglas, G; Adeney, J; Johnston, K; Wendling, L; Coleman, S

    2012-01-01

    This study investigates the use of a mineral processing by-product, neutralized used acid (NUA), primarily composed of gypsum and Fe-oxyhydroxide, as a soil amendment. A 1489-d turf farm field trial assessed nutrient, trace element, and radionuclide mobility of a soil amended with ∼5% by mass to a depth of 15 cm of NUA. Average PO-P fluxes collected as subsoil leachates were 0.7 and 26.6 kg ha yr for NUA-amended and control sites, respectively, equating to a 97% reduction in PO-P loss after 434 kg P ha was applied. Total nitrogen fluxes in NUA-amended soil leachates were similarly reduced by 82%. Incorporation of NUA conferred major changes in leachate geochemistry with a diverse suite of trace elements depleted within NUA-amended leachates. Gypsum dissolution from NUA resulted in an increase from under- to oversaturation of the soil leachates for a range of Fe- and Ca-minerals including calcite and ferrihydrite, many of which have a well-documented ability to assimilate PO-P and trace elements. Isotopic analysis indicated little Pb addition from NUA. Both Sr and Nd isotope results revealed that NUA and added fertilizer became an important source of Ca to leachate and turf biomass. The NUA-amended soils retained a range of U-Th series radionuclides, with little evidence of transfer to soil leachate or turf biomass. Calculated radioactivity dose rates indicate only a small increment due to NUA amendment. With increased nutrient, trace element, and solute retention, and increased productivity, a range of potential agronomic benefits may be conferred by NUA amendment of soils, in addition to the potential to limit offsite nutrient loss and eutrophication. PMID:23128739

  8. OPTIMALITY ISSUES IN A SERIES SYSTEM FROM MANUFACTURER’S PERSPECTIVE CONSIDERING BURN-IN AND WARRANTY PERIODS

    Directory of Open Access Journals (Sweden)

    MoghimiHadji, EHSAN

    2013-01-01

    Full Text Available Reliability engineers generally have to deal with systems that consist of some components in series and others in parallel. Reliability of a series system can be calculated by multiplying the reliability of individual elements in that system. Failure rate of many deteriorating systems shows a bathtub shape curve. The aim of this paper is to find the average total cost of a series system, from a manufacturer’s point of view, during the first two phases of its life; considering optimality issues for burn-in and warranty periods. Numerical illustration is provided to show the applicability of the model.

  9. Trace Element Abundance Relationships in the Multi—stage Comagmatic Fractional Crystallization and Their Applications

    Institute of Scientific and Technical Information of China (English)

    汪云亮; 李巨初

    1993-01-01

    In this study a mathematical expression of trace element abundance relationship for the mul-ti-stage comagmatic fractional crystallization has been established ,based on geochemical studies of the Emeishan basalt-trachyte series and adjacent mafic-ultramafic layered intrusions, as well as on the avail-able data for basalt, andesite, dacite and rhyolite series in southern Andes,Chile ,which have been well documented.It is demonstrated that the abundance constant (R) for a given trace element at dif-ferent stages of fractional crystallization of a parental magma is highly variable,which can be used as a criterion to divide fractional crystallization stages.

  10. Homogenization results for various meteorological elements in the Czech Republic

    Science.gov (United States)

    Stepanek, P.; Zahradnicek, P.

    2012-04-01

    In many scientific disciplines it is needed to process long time series of meteorological elements. In recent years considerable attention has been devoted also to analysis of daily data. Prior to any analysis, the need to homogenize data and check their quality arises. Unfortunately, most of the time series of atmospheric data with a resolution of decades to centuries contains inhomogeneities caused by station relocations, exchange of observers, changes in the vicinity of stations (e.g. urbanization), changes of instruments, observing practices (like a new formula for calculating daily average, different observation times), etc. For the period 1961-2007, 1750 series of seven climatological characteristics were tested for homogeneity (on monthly, seasonal and annual scale) and inhomogeneities were found in 42% of them. This value is underestimated, due to the low number of detections in precipitation series, in which breaks were detected only in 15% of series. For all other characteristics, this number was above 50%. Before homogenization itself, quality control on the subdaily data (for individual observation hours 7,14,21) was performed and all suspicious values were removed from time series. In our approach, data quality control is carried out by combining several methods (Štěpánek et al 2009). Detection of inhomogeneities was performed using monthly, seasonal and annual means (or sums in the case of precipitation and sunshine duration). In the homogenization of the time series, the use of various statistical tests and types of reference series made it possible to increase considerably the number of homogeneity tests results for each series tested and thus to assess homogeneity more reliably. The relative homogeneity tests applied were: Standard Normal Homogeneity Test [SNHT], the Maronna and Yohai bivariate testand the Easterling and Peterson test. Data were corrected for found inhomogeneities on daily scale. We created our own correction method (called DAP

  11. Layered Ensemble Architecture for Time Series Forecasting.

    Science.gov (United States)

    Rahman, Md Mustafizur; Islam, Md Monirul; Murase, Kazuyuki; Yao, Xin

    2016-01-01

    Time series forecasting (TSF) has been widely used in many application areas such as science, engineering, and finance. The phenomena generating time series are usually unknown and information available for forecasting is only limited to the past values of the series. It is, therefore, necessary to use an appropriate number of past values, termed lag, for forecasting. This paper proposes a layered ensemble architecture (LEA) for TSF problems. Our LEA consists of two layers, each of which uses an ensemble of multilayer perceptron (MLP) networks. While the first ensemble layer tries to find an appropriate lag, the second ensemble layer employs the obtained lag for forecasting. Unlike most previous work on TSF, the proposed architecture considers both accuracy and diversity of the individual networks in constructing an ensemble. LEA trains different networks in the ensemble by using different training sets with an aim of maintaining diversity among the networks. However, it uses the appropriate lag and combines the best trained networks to construct the ensemble. This indicates LEAs emphasis on accuracy of the networks. The proposed architecture has been tested extensively on time series data of neural network (NN)3 and NN5 competitions. It has also been tested on several standard benchmark time series data. In terms of forecasting accuracy, our experimental results have revealed clearly that LEA is better than other ensemble and nonensemble methods. PMID:25751882

  12. Feature Matching in Time Series Modelling

    CERN Document Server

    Xia, Yingcun

    2011-01-01

    Using a time series model to mimic an observed time series has a long history. However, with regard to this objective, conventional estimation methods for discrete-time dynamical models are frequently found to be wanting. In the absence of a true model, we prefer an alternative approach to conventional model fitting that typically involves one-step-ahead prediction errors. Our primary aim is to match the joint probability distribution of the observable time series, including long-term features of the dynamics that underpin the data, such as cycles, long memory and others, rather than short-term prediction. For want of a better name, we call this specific aim {\\it feature matching}. The challenges of model mis-specification, measurement errors and the scarcity of data are forever present in real time series modelling. In this paper, by synthesizing earlier attempts into an extended-likelihood, we develop a systematic approach to empirical time series analysis to address these challenges and to aim at achieving...

  13. Essential Elements of Geologic Reports.

    Science.gov (United States)

    Webb, Elmer James

    1988-01-01

    Described is a report outline for geologic reports. Essential elements include title; abstract; introduction; stratigraphy; petrography; geochemistry; petrology; geophysics; structural geology; geologic history; modeling; economics; conclusions; and recommendations. (Author/CW)

  14. Finite element methods for engineers

    CERN Document Server

    Fenner, Roger T

    2013-01-01

    This book is intended as a textbook providing a deliberately simple introduction to finite element methods in a way that should be readily understandable to engineers, both students and practising professionals. Only the very simplest elements are considered, mainly two dimensional three-noded “constant strain triangles”, with simple linear variation of the relevant variables. Chapters of the book deal with structural problems (beams), classification of a broad range of engineering into harmonic and biharmonic types, finite element analysis of harmonic problems, and finite element analysis of biharmonic problems (plane stress and plane strain). Full Fortran programs are listed and explained in detail, and a range of practical problems solved in the text. Despite being somewhat unfashionable for general programming purposes, the Fortran language remains very widely used in engineering. The programs listed, which were originally developed for use on mainframe computers, have been thoroughly updated for use ...

  15. Environmental research on actinide elements

    International Nuclear Information System (INIS)

    The papers synthesize the results of research sponsored by DOE's Office of Health and Environmental Research on the behavior of transuranic and actinide elements in the environment. Separate abstracts have been prepared for the 21 individual papers

  16. In situ trace element microanalysis

    Science.gov (United States)

    Burnett, D. S.; Woolum, D. S.

    1983-01-01

    The use of particle-track-radiography and X-ray- fluorescence techniques in the in situ measurement of trace (less than 1000 ppm) elements in single mineral phases of polished sections is surveyed, and examples of their application to ordinary, carbonaceous and enstatite chondrites are provided. Radiographic methods surveyed include fission-track radiography (for U, Th, and Pu-244), alpha radiography using nuclear reactions (for Li and B), alpha autoradiography (for Bi and Pb), and beta autoradiography (for several elements in synthetic or biological samples). Two X-ray-fluorescence methods are compared: (1) photon-induced X-ray emission (PIXE), and (2) the potential use of synchrotron radiation. The latter is shown to allow much greater sensitivity than current PIXE technology and a much broader range of elements than particle-track radiography: the ppm analysis of 10-micron grains for all elements heavier than Na. These advantages are seen as balancing the high cost of accelerator use.

  17. Finding Sums for an Infinite Class of Alternating Series

    Science.gov (United States)

    Chen, Zhibo; Wei, Sheng; Xiao, Xuerong

    2012-01-01

    Calculus II students know that many alternating series are convergent by the Alternating Series Test. However, they know few alternating series (except geometric series and some trivial ones) for which they can find the sum. In this article, we present a method that enables the students to find sums for infinitely many alternating series in the…

  18. The Growth of Dirichlet Series and Random Dirichlet Series of Zero Order and Finite Order

    Institute of Scientific and Technical Information of China (English)

    YANG Qi; CAO Yue-bo; TIAN Hong-gen

    2013-01-01

    In this paper,we study the relations between the coefficients and the growthof zero order and finite order Dirichlet series and random Dirichlet series in the whole plane.And when the random variable sequence {Xn{w}} satisfies the certain condition,in the whole plane,the growth of the random entire function which is determined by the zero order and finite order random Dirichlet series is almost surely same with corresponding growth of random Dirichlet series on any horizontal straight line.

  19. Maria Goeppert Mayer's Theoretical Work on Rare-Earth and Transuranic Elements

    CERN Document Server

    Wang, Frank Y

    2008-01-01

    After the discovery of element 93 neptunium by Edwin McMillan and Philip H. Abelson in 1941, Maria Goeppert Mayer applied the Thomas-Fermi model to calculate the electronic configuration of heavy elements and predicted the occurrence of a second rare-earth series in the vicinity of elements 91 or 92 extending to the transuranic elements. Mayer was motivated by Enrico Fermi, who was at the time contemplating military uses of nuclear energy. Historical development of nuclear science research leading to Mayer's publication is outlined. Mayer's method is introduced with the aid of a computer, which enables students to visualize her description of eigenfunctions, particularly the sudden change of spatial distribution and eigenenergy at the beginning of the rare-earth series. The impact of Mayer's work on the periodic table is discussed.

  20. Naturalistic Elements in The Egg

    Institute of Scientific and Technical Information of China (English)

    惠菲菲

    2013-01-01

    The purpose of the study is to analyze the naturalistic elements in The Egg, which is taken from the collection of short stories, The Triumph of the Egg. The study states the ideology and technique of naturalism and then exams how naturalistic ele-ments are revealed in the fiction. Then it comes to the conclusion that the family is defeated by the egg and the life of human be-ings is under control of complicated forces from both inside and outside.

  1. Nuclear reactor fuel element splitter

    International Nuclear Information System (INIS)

    A method and apparatus are disclosed for removing nuclear fuel from a clad fuel element. The fuel element is power driven past laser beams which simultaneously cut the cladding lengthwise into at least two longitudinal pieces. The axially cut lengths of cladding are then separated, causing the nuclear fuel contained therein to drop into a receptacle for later disposition. The cut lengths of cladding comprise nuclear waste which is disposed of in a suitable manner. 6 claims, 10 drawing figures

  2. Elemental mercury exposure: peripheral neurotoxicity.

    OpenAIRE

    Levine, S P; Cavender, G D; Langolf, G D; Albers, J W

    1982-01-01

    Nerve conduction tests were performed on the right ulnar nerve of factory workers exposed to elemental mercury vapour. Time integrated urine mercury indices were used to measure the degree of exposure. Workers with prolonged distal latencies had significantly higher urine mercury concentrations when compared with those with normal latencies. Significant correlations between increasing urine mercury concentrations and prolonged motor and sensory distal latencies were established. Elemental mer...

  3. PROPOSAL OF NEW OPTICAL ELEMENTS

    Directory of Open Access Journals (Sweden)

    Goce Chadzitaskos

    2013-10-01

    Full Text Available A overview of our patented proposals of new optical elements is presented. The elements are suitable for laser pulse analysis, telescopy, X-ray microscopy and X-ray telescopy. They are based on the interference properties of light: a special grating for a double slit pattern, parabolic strip imaging for a telescope, and Bragg’s condition for X-ray scattering on a slice of a single crystal for X-raymicroscopy and X-ray telescopy.

  4. Developments from Programming the Partition Method for a Power Series Expansion

    CERN Document Server

    Kowalenko, Victor

    2012-01-01

    Recently, a novel method based on coding partitions [1]-[4] has been used to derive power series expansions to previously intractable problems. In this method the coefficients at $k$ are determined by summing the contributions made by each partition whose elements sum to $k$. These contributions are found by assigning values to each element and multiplying by an appropriate multinomial factor. This work presents a theoretical framework for the partition method for a power series expansion. To overcome the complexity due to the contributions, a programming methodology is created allowing more general problems to be studied than envisaged originally. The methodology uses the bi-variate recursive central partition (BRCP) algorithm, which is based on a tree-diagram approach to scanning partitions. Its main advantage is that partitions are generated in the multiplicity representation. During the development of the theoretical framework, scanning over partitions was seen as a discrete operation with an operator $L_...

  5. Developments in variational methods for high performance plate and shell elements

    Science.gov (United States)

    Felippa, Carlos A.; Militello, Carmelo

    1991-01-01

    High performance elements are simple finite elements constructed to deliver engineering accuracy with coarse arbitrary grids. This is part of a series on the variational foundations of high-performance elements, with emphasis on plate and shell elements constructed with the free formulation (FF) and assumed natural strain (ANS) methods. Parameterized variational principles are studied that provide a common foundation for the FF and ANS methods, as well as for a combination of both. From this unified formulation a variant of the ANS formulation, called the assumed natural deviatoric strain (ANDES) formulation, emerges as an important special case. The first ANDES element, a high-performance 9 degrees of freedom triangular Kirchhoff plate bending element, is briefly described to illustrate the use of the new formulation.

  6. Introduction to time series analysis and forecasting

    CERN Document Server

    Montgomery, Douglas C; Kulahci, Murat

    2008-01-01

    An accessible introduction to the most current thinking in and practicality of forecasting techniques in the context of time-oriented data. Analyzing time-oriented data and forecasting are among the most important problems that analysts face across many fields, ranging from finance and economics to production operations and the natural sciences. As a result, there is a widespread need for large groups of people in a variety of fields to understand the basic concepts of time series analysis and forecasting. Introduction to Time Series Analysis and Forecasting presents the time series analysis branch of applied statistics as the underlying methodology for developing practical forecasts, and it also bridges the gap between theory and practice by equipping readers with the tools needed to analyze time-oriented data and construct useful, short- to medium-term, statistically based forecasts.

  7. AMTEC vapor-vapor series connected cells

    Science.gov (United States)

    Underwood, Mark L.; Williams, Roger M.; Ryan, Margaret A.; Nakamura, Barbara J.; Oconnor, Dennis E.

    1995-08-01

    An alkali metal thermoelectric converter (AMTEC) having a plurality of cells structurally connected in series to form a septum dividing a plenum into two chambers, and electrically connected in series, is provided with porous metal anodes and porous metal cathodes in the cells. The cells may be planar or annular, and in either case a metal alkali vapor at a high temperature is provided to the plenum through one chamber on one side of the wall and returned to a vapor boiler after condensation at a chamber on the other side of the wall in the plenum. If the cells are annular, a heating core may be placed along the axis of the stacked cells. This arrangement of series-connected cells allows efficient generation of power at high voltage and low current.

  8. CALENDAR EFFECTS IN MONTHLY TIME SERIES MODELS

    Institute of Scientific and Technical Information of China (English)

    Gerhard THURY; Mi ZHOU

    2005-01-01

    It is not unusual for the level of a monthly economic time series, such as industrial production,retail and wholesale sales, monetary aggregates, telephone calls or road accidents, to be influenced by calendar effects. Such effects arise when changes occur in the level of activity resulting from differences in the composition of calendar between years. The two main sources of calendar effects are trading day variations and moving festivals. Ignoring such calendar effects will lead to substantial distortions in the identification stage of time series modeling. Therefore, it is mandatory to introduce calendar effects, when they are present in a time series, as the component of the model which one wants to estimate.

  9. Climate Time Series Analysis and Forecasting

    Science.gov (United States)

    Young, P. C.; Fildes, R.

    2009-04-01

    This paper will discuss various aspects of climate time series data analysis, modelling and forecasting being carried out at Lancaster. This will include state-dependent parameter, nonlinear, stochastic modelling of globally averaged atmospheric carbon dioxide; the computation of emission strategies based on modern control theory; and extrapolative time series benchmark forecasts of annual average temperature, both global and local. The key to the forecasting evaluation will be the iterative estimation of forecast error based on rolling origin comparisons, as recommended in the forecasting research literature. The presentation will conclude with with a comparison of the time series forecasts with forecasts produced from global circulation models and a discussion of the implications for climate modelling research.

  10. Uranium series dating of Allan Hills ice

    Science.gov (United States)

    Fireman, E. L.

    1986-03-01

    Uranium-238 decay series nuclides dissolved in Antarctic ice samples were measured in areas of both high and low concentrations of volcanic glass shards. Ice from the Allan Hills site (high shard content) had high Ra-226, Th-230 and U-234 activities but similarly low U-238 activities in comparison with Antarctic ice samples without shards. The Ra-226, Th-230 and U-234 excesses were found to be proportional to the shard content, while the U-238 decay series results were consistent with the assumption that alpha decay products recoiled into the ice from the shards. Through this method of uranium series dating, it was learned that the Allen Hills Cul de Sac ice is approximately 325,000 years old.

  11. Effective Feature Preprocessing for Time Series Forecasting

    DEFF Research Database (Denmark)

    Zhao, Junhua; Dong, Zhaoyang; Xu, Zhao

    2006-01-01

    Time series forecasting is an important area in data mining research. Feature preprocessing techniques have significant influence on forecasting accuracy, therefore are essential in a forecasting model. Although several feature preprocessing techniques have been applied in time series forecasting......, there is so far no systematic research to study and compare their performance. How to select effective techniques of feature preprocessing in a forecasting model remains a problem. In this paper, the authors conduct a comprehensive study of existing feature preprocessing techniques to evaluate their empirical...... performance in time series forecasting. It is demonstrated in our experiment that, effective feature preprocessing can significantly enhance forecasting accuracy. This research can be a useful guidance for researchers on effectively selecting feature preprocessing techniques and integrating them with time...

  12. Time Series Forecasting with Missing Values

    Directory of Open Access Journals (Sweden)

    Shin-Fu Wu

    2015-11-01

    Full Text Available Time series prediction has become more popular in various kinds of applications such as weather prediction, control engineering, financial analysis, industrial monitoring, etc. To deal with real-world problems, we are often faced with missing values in the data due to sensor malfunctions or human errors. Traditionally, the missing values are simply omitted or replaced by means of imputation methods. However, omitting those missing values may cause temporal discontinuity. Imputation methods, on the other hand, may alter the original time series. In this study, we propose a novel forecasting method based on least squares support vector machine (LSSVM. We employ the input patterns with the temporal information which is defined as local time index (LTI. Time series data as well as local time indexes are fed to LSSVM for doing forecasting without imputation. We compare the forecasting performance of our method with other imputation methods. Experimental results show that the proposed method is promising and is worth further investigations.

  13. TIME SERIES FORECASTING USING NEURAL NETWORKS

    Directory of Open Access Journals (Sweden)

    BOGDAN OANCEA

    2013-05-01

    Full Text Available Recent studies have shown the classification and prediction power of the Neural Networks. It has been demonstrated that a NN can approximate any continuous function. Neural networks have been successfully used for forecasting of financial data series. The classical methods used for time series prediction like Box-Jenkins or ARIMA assumes that there is a linear relationship between inputs and outputs. Neural Networks have the advantage that can approximate nonlinear functions. In this paper we compared the performances of different feed forward and recurrent neural networks and training algorithms for predicting the exchange rate EUR/RON and USD/RON. We used data series with daily exchange rates starting from 2005 until 2013.

  14. Uranium series dating of Allan Hills ice

    Science.gov (United States)

    Fireman, E. L.

    1986-01-01

    Uranium-238 decay series nuclides dissolved in Antarctic ice samples were measured in areas of both high and low concentrations of volcanic glass shards. Ice from the Allan Hills site (high shard content) had high Ra-226, Th-230 and U-234 activities but similarly low U-238 activities in comparison with Antarctic ice samples without shards. The Ra-226, Th-230 and U-234 excesses were found to be proportional to the shard content, while the U-238 decay series results were consistent with the assumption that alpha decay products recoiled into the ice from the shards. Through this method of uranium series dating, it was learned that the Allen Hills Cul de Sac ice is approximately 325,000 years old.

  15. Finite element modeling of electrically rectified piezoelectric energy harvesters

    Science.gov (United States)

    Wu, P. H.; Shu, Y. C.

    2015-09-01

    Finite element models are developed for designing electrically rectified piezoelectric energy harvesters. They account for the consideration of common interface circuits such as the standard and parallel-/series-SSHI (synchronized switch harvesting on inductor) circuits, as well as complicated structural configurations such as arrays of piezoelectric oscillators. The idea is to replace the energy harvesting circuit by the proposed equivalent load impedance together with the capacitance of negative value. As a result, the proposed framework is capable of being implemented into conventional finite element solvers for direct system-level design without resorting to circuit simulators. The validation based on COMSOL simulations carried out for various interface circuits by the comparison with the standard modal analysis model. The framework is then applied to the investigation on how harvested power is reduced due to fabrication deviations in geometric and material properties of oscillators in an array system. Remarkably, it is found that for a standard array system with strong electromechanical coupling, the drop in peak power turns out to be insignificant if the optimal load is carefully chosen. The second application is to design broadband energy harvesting by developing array systems with suitable interface circuits. The result shows that significant broadband is observed for the parallel (series) connection of oscillators endowed with the parallel-SSHI (series-SSHI) circuit technique.

  16. Evaluating the Representation of Cultural Elements in an In-use EFL Textbook

    OpenAIRE

    Nazli Bahrami

    2015-01-01

    The present study was an attempt to evaluate and specify teachers' perception of the cultural elements of Total English book series. Another objective was to study the techniques and strategies that teachers usually use in teaching these elements. To this end, a total of 50 male and female teachers working at Kish Language Institute in Esfahan participated in the study. A questionnaire adopted from Kilickaya (2004) was used for studying teachers' perception. It included 25 items about cultura...

  17. Model for the behavior of steel fibers reinforced concrete in plates elements

    OpenAIRE

    LOPEZ-GAYARRE, Fernando; LOPEZ-COLINA, Carlos; Lázaro Fernández, Carlos Manuel; Pelufo Carbonell, María José; Domingo Cabo, Alberto

    2009-01-01

    p. 2965-2981 This article presents and develops a model for the behavior of steel fibers reinforced concrete (SFRC) for its use in plates elements. In order to carry out the present investigation, a series of laboratory tests were made for the mechanical characterization of SFRC. Additionally, a set of plates elements were tested in the laboratory of Construction Engineering at the Technical University of Valencia, with different fiber contents and load conditions. These plates eleme...

  18. ELEMENTAL CONTENTS IN ORGANS AND TISSUES OF CHINESE ADULT MEN

    Institute of Scientific and Technical Information of China (English)

    Hong-da Zhu; Ya-qiong Liu; Qing Xie; Jing-yu Wang; Quan Wu; Nei-fen Wang; Ti-jiang Fan; Hu-sheng Liu; Qing-fen Liu; Xiao-yan Wang; Li Ou-yang

    2007-01-01

    Objective To provide basis of reference values for relevant parameters of Chinese Reference Man.Methods Eighteen kinds of major organ or tissue samples, including muscle, rib, liver, and so on, were obtained from 4 areas (Hebei, Shanxi, Jiangsu, and Sichuan provinces) with different dietary patterns in China in autopsy of 16 healthy adult men, who had just encountered sudden deaths. At the same time, whole blood samples were collected from 10 volunteers living in each of these areas. The concentrations of 56 elements in these samples were detected by using Inductively Coupled Plasma Mass Spectrometry (ICP-MS), Inductively Coupled Plasma Atomic Emission Spec-trometry (ICP-AES), and Graphite Furnace Atomic Absorption Spectrometry (GF-AAS) techniques. Based on obtained concentrations and reference values of these organ or tissue weights for Chinese Reference Man, the relative elemental burdens in these organs or tissues as well whole body were also estimated.Results The concentrations of 56 elements in 18 main organs or tissues were determined all together and their elemental organ or tissue and whole body burdens were estimated. Furthermore, the distributions of important elements for radiation protection in these organs or tissues were emphatically discussed.Conclusion By summing with past related results, the total results obtained from the series of research may provide more reliable and better representative basis of these reference values for Chinese Reference Man than before.

  19. Improving the prediction of chaotic time series

    Institute of Scientific and Technical Information of China (English)

    李克平; 高自友; 陈天仑

    2003-01-01

    One of the features of deterministic chaos is sensitive to initial conditions. This feature limits the prediction horizons of many chaotic systems. In this paper, we propose a new prediction technique for chaotic time series. In our method, some neighbouring points of the predicted point, for which the corresponding local Lyapunov exponent is particularly large, would be discarded during estimating the local dynamics, and thus the error accumulated by the prediction algorithm is reduced. The model is tested for the convection amplitude of Lorenz systems. The simulation results indicate that the prediction technique can improve the prediction of chaotic time series.

  20. Large Field Cutoffs Make Perturbative Series Converge

    CERN Document Server

    Meurice, Y

    2002-01-01

    For lambda phi^4 problems, convergent perturbative series can be obtained by cutting off the large field configurations. The modified series converge to values exponentially close to the exact ones. For lambda larger than some critical value, the method outperforms Pade approximants and Borel summations. We discuss some aspects of the semi-classical methods used to calculate the modified Feynman rules and estimate the error associated with the procedure. We provide a simple numerical example where the procedure works despite the fact that the Borel sum has singularities on the positive real axis.

  1. Large field cutoffs make perturbative series converge

    Science.gov (United States)

    Meurice, Yannick

    2002-03-01

    For λφ 4 problems, convergent perturbative series can be obtained by cutting off the large field configurations. The modified series converge to values exponentially close to the exact ones. For λ larger than some critical value, the method outperforms Padé approximants and Borel summations. We discuss some aspects of the semi-classical methods used to calculate the modified Feynman rules and estimate the error associated with the procedure. We provide a simple numerical example where the procedure works despite the fact that the Borel sum has singularities on the positive real axis.

  2. Fuzzy Information Granules in Time Series Data

    OpenAIRE

    HEIKO HOFER; ORTOLANI M; DAVID PATTERSON; FRANK HOEPPNER; ONDINE CALLAN; Berthold, Michael R

    2004-01-01

    Often, it is desirable to represent a set of time series through typical shapes in order to detect common patterns. The algorithm presented here compares pieces of a different time series in order to find such similar shapes. The use of a fuzzy clustering technique based on fuzzy c-means allows us to detect shapes that belong to a certain group of typical shapes with a degree of membership. Modifications to the original algorithm also allow this matching to be invariant with respect to a scal...

  3. Harry Potter book series - trivial or not?:

    OpenAIRE

    Orel, Brigita

    2006-01-01

    The article explores the extent to which the features of trivial literature appear in the Harry Potter series by J. K. Rowling. This is done in comparison with another popular children's series, The Famous Five by Enid Blyton, which was analysed by Igor Saksida. The main focus of the analysis is on the schematic representation of plot, characters and the exotic nature of the setting and time of the stories. Harry Potter J. K. Rowlingove je v središču pozornosti že vse od izdaje prve knjige...

  4. Lag space estimation in time series modelling

    DEFF Research Database (Denmark)

    Goutte, Cyril

    1997-01-01

    The purpose of this article is to investigate some techniques for finding the relevant lag-space, i.e. input information, for time series modelling. This is an important aspect of time series modelling, as it conditions the design of the model through the regressor vector a.k.a. the input layer i...... in a neural network. We give a rough description of the problem, insist on the concept of generalisation, and propose a generalisation-based method. We compare it to a non-parametric test, and carry out experiments, both on the well-known Henon map, and on a real data set...

  5. Dynamical networks reconstructed from time series

    CERN Document Server

    Levnajić, Zoran

    2012-01-01

    Novel method of reconstructing dynamical networks from empirically measured time series is proposed. By statistically examining the correlations between motions displayed by network nodes, we derive a simple equation that directly yields the adjacency matrix, assuming the intra-network interaction functions to be known. We illustrate the method's implementation on a simple example and discuss the dependence of the reconstruction precision on the properties of time series. Our method is applicable to any network, allowing for reconstruction precision to be maximized, and errors to be estimated.

  6. Introduction to time series analysis and forecasting

    CERN Document Server

    Montgomery, Douglas C; Kulahci, Murat

    2015-01-01

    Praise for the First Edition ""…[t]he book is great for readers who need to apply the methods and models presented but have little background in mathematics and statistics."" -MAA Reviews Thoroughly updated throughout, Introduction to Time Series Analysis and Forecasting, Second Edition presents the underlying theories of time series analysis that are needed to analyze time-oriented data and construct real-world short- to medium-term statistical forecasts.    Authored by highly-experienced academics and professionals in engineering statistics, the Second Edition features discussions on both

  7. Multiscale entropy analysis of electroseismic time series

    OpenAIRE

    L. Guzmán-Vargas; Ramírez-Rojas, A.; Angulo-Brown, F.

    2008-01-01

    In this work we use the multiscale entropy method to analyse the variability of geo-electric time series monitored in two sites located in Mexico. In our analysis we consider a period of time from January 1995 to December 1995. We systematically calculate the sample entropy of electroseismic time series. Important differences in the entropy profile for several time scales are observed in records from the same station. In particular, a complex behaviour is observed in the vicinity of a

  8. Random Series of Trace Class Operators

    CERN Document Server

    Pisier, Gilles

    2011-01-01

    In this lecture, we present some results on Gaussian (or Rademacher) random series of trace class operators, mainly due jointly with F. Lust-Piquard. We will emphasize the probabilistic reformulation of these results, as well as the open problems suggested by them. We start by a brief survey of what is known about the problem of characterizing a.s. convergent (Gaussian or Rademacher) series of random vectors in a Banach space. The main result presented here is that for certain pairs of Banach spaces $E,F$ that include Hilbert spaces (and type 2 spaces with the analytic UMD property), we have

  9. Patch testing with Indian standard series

    Directory of Open Access Journals (Sweden)

    Narendra G

    2002-01-01

    Full Text Available Hundred patients (61 males, 39 females suspected to have allergic contact dermatitis were patch tested with Indian standard series (ISS. Forty four showed one or more positive reactions. The frequent sensitizers observed were nickel sulphate-12 (15%, potassium dichromate-11 (13.75%, cobalt chloride and colophony-7 (8.75% each, fragrance mix and thiuram mix-6 (7.5% each. The ISS differs from the European Standard Series by inclusion of propylene glycol, nitrofurazone, gentamicin, chlorocresol, PEG-400 and ethylenediamine chloride where assesquiterpene lactone mix and primin allergens are excluded.

  10. Some Banach spaces of Dirichlet series

    OpenAIRE

    Bailleul, Maxime; Lefèvre, Pascal

    2013-01-01

    The Hardy spaces of Dirichlet series denoted by ${\\cal H}^p$ ($p\\ge1$) have been studied in [12] when p = 2 and in [3] for the general case. In this paper we study some Lp-generalizations of spaces of Dirichlet series, particularly two families of Bergman spaces denoted ${\\cal A}^p$ and ${\\cal B}^p$. We recover classical properties of spaces of analytic functions: boundedness of point evaluation, embeddings between these spaces and "Littlewood-Paley" formulas when p = 2. We also show that the...

  11. Ruptures of vulnerability: Linda Stein's Knight Series.

    Science.gov (United States)

    Bible, Ann Vollmann

    2010-01-01

    Drawing on the work of Monique Wittig, this article understands Linda Stein's Knight Series as a lacunary writing communicating both her challenges to come to representation and her creative registration of subjectivity. The argument is grounded in an exploration of the rich interplay of power and vulnerability across the series as against the discourse of escapist fashion. Specifically, Stein's critical contradictions of inside and outside, conflated temporality, disjunctions between decoration and abstraction, and fluidity of sex and gender are examined. The discussion is elaborated through consideration of the work of Julia Kristeva, Elizabeth Grosz, and Hayao Miyazaki.

  12. Derivation of Mayer Series from Canonical Ensemble

    Science.gov (United States)

    Wang, Xian-Zhi

    2016-02-01

    Mayer derived the Mayer series from both the canonical ensemble and the grand canonical ensemble by use of the cluster expansion method. In 2002, we conjectured a recursion formula of the canonical partition function of a fluid (X.Z. Wang, Phys. Rev. E 66 (2002) 056102). In this paper we give a proof for this formula by developing an appropriate expansion of the integrand of the canonical partition function. We further derive the Mayer series solely from the canonical ensemble by use of this recursion formula.

  13. On clustering fMRI time series

    DEFF Research Database (Denmark)

    Goutte, C; Toft, P; Rostrup, E;

    1999-01-01

    Analysis of fMRI time series is often performed by extracting one or more parameters for the individual voxels. Methods based, e.g., on various statistical tests are then used to yield parameters corresponding to probability of activation or activation strength. However, these methods do not indi......Analysis of fMRI time series is often performed by extracting one or more parameters for the individual voxels. Methods based, e.g., on various statistical tests are then used to yield parameters corresponding to probability of activation or activation strength. However, these methods do...

  14. Lecture notes for Advanced Time Series Analysis

    DEFF Research Database (Denmark)

    Madsen, Henrik; Holst, Jan

    1997-01-01

    A first version of this notes was used at the lectures in Grenoble, and they are now extended and improved (together with Jan Holst), and used in Ph.D. courses on Advanced Time Series Analysis at IMM and at the Department of Mathematical Statistics, University of Lund, 1994, 1997, ......A first version of this notes was used at the lectures in Grenoble, and they are now extended and improved (together with Jan Holst), and used in Ph.D. courses on Advanced Time Series Analysis at IMM and at the Department of Mathematical Statistics, University of Lund, 1994, 1997, ...

  15. High temperature fatigue experiments on welded stainless steel tubular elements

    International Nuclear Information System (INIS)

    One of the most important problems concerning the design of advanced type reactors regards the high temperature low-cycle fatigue behaviour of structural elements. Design Guides and Codes report reference data, mainly based on strain range versus failure cycles results, which have been determined by various researchers. The data have been obtained through different test techniques applied to different types of specimens. As a consequence such data are not easily correlated; moreover at present an exhaustive series of results about high temperature low-cycle fatigue behaviour of structures is not available. A test rig has been designed to perform high temperature fatigue experiments on AISI 304 stainless steel tubular elements of 500 mm length, 60.3 mm outer diameter and 2 mm thickness, they are composed of two butt welded tubular elements with welded end flanges. During the experiments it is possible to control the axial strain range, the strain rate and the hold time; the specimen temperature is obtained by an inner heating device, controlled by a series of measuring thermocouples; until now the imposed temperature is 6500C. The first results show a marked reduction of the number of cycles at failure, if compared with existing data about small size specimens; the measurement of residual plastic strains shows clearly non-uniform distribution of the plastic zones. (Auth.)

  16. Modeling and Application of Series Elastic Actuators for Force Control Multi Legged Robots

    CERN Document Server

    S, Arumugom; V, Ponselvan

    2009-01-01

    Series Elastic Actuators provide many benefits in force control of robots in unconstrained environments. These benefits include high force fidelity, extremely low impedance, low friction, and good force control bandwidth. Series Elastic Actuators employ a novel mechanical design architecture which goes against the common machine design principal of "stiffer is better". A compliant element is placed between the gear train and driven load to intentionally reduce the stiffness of the actuator. A position sensor measures the deflection, and the force output is accurately calculated using Hooke's Law (F=Kx). A control loop then servos the actuator to the desired output force. The resulting actuator has inherent shock tolerance, high force fidelity and extremely low impedance. These characteristics are desirable in many applications including legged robots, exoskeletons for human performance amplification, robotic arms, haptic interfaces, and adaptive suspensions. We describe several variations of Series Elastic Ac...

  17. What marketing scholars should know about time series analysis : time series applications in marketing

    NARCIS (Netherlands)

    Horváth, Csilla; Kornelis, Marcel; Leeflang, Peter S.H.

    2002-01-01

    In this review, we give a comprehensive summary of time series techniques in marketing, and discuss a variety of time series analysis (TSA) techniques and models. We classify them in the sets (i) univariate TSA, (ii) multivariate TSA, and (iii) multiple TSA. We provide relevant marketing application

  18. FECAP - FINITE ELEMENT COMPOSITE ANALYSIS PROGRAM FOR A MICROCOMPUTER

    Science.gov (United States)

    Bowles, D. E.

    1994-01-01

    Advanced composite materials have gained use in the aerospace industry over the last 20 years because of their high specific strength and stiffness, and low coefficient of thermal expansion. Design of composite structures requires the analysis of composite material behavior. The Finite Element Composite Analysis Program, FECAP, is a special purpose finite element analysis program for analyzing composite material behavior with a microcomputer. Composite materials, in regard to this program, are defined as the combination of at least two distinct materials to form one nonhomogeneous anisotropic material. FECAP assumes a state of generalized plane strain exists in a material consisting of two or more orthotropic phases, subjected to mechanical and/or thermal loading. The finite element formulation used in FECAP is displacement based and requires the minimization of the total potential energy for each element with respect to the unknown variables. This procedure leads to a set of linear simultaneous equations relating the unknown nodal displacements to the applied loads. The equations for each element are assembled into a global system, the boundary conditions are applied, and the system is solved for the nodal displacements. The analysis may be performed using either 4-mode linear or 8-mode quadratic isoparametric elements. Output includes the nodal displacements, and the element stresses and strains. FECAP was written for a Hewlett Packard HP9000 Series 200 Microcomputer with the HP Basic operating system. It was written in HP BASIC 3.0 and requires approximately 0.5 Mbytes of RAM in addition to what is required for the operating system. A math coprocessor card is highly recommended. FECAP was developed in 1988.

  19. Cosmetology Core. Teacher Workbook. Cosmetology Series.

    Science.gov (United States)

    Oklahoma State Dept. of Vocational and Technical Education, Stillwater. Curriculum and Instructional Materials Center.

    This teacher workbook, which is part of a series of publications designed to support instruction in Oklahoma vocational cosmetology programs, consists of 13 units of information and skills that are basic to all major instructional divisions of a cosmetology course of study. The unit topics are as follows: identifying cosmetology careers/displaying…

  20. Manicurist Speciality. Teacher Edition. Cosmetology Series.

    Science.gov (United States)

    Oklahoma State Dept. of Vocational and Technical Education, Stillwater. Curriculum and Instructional Materials Center.

    This publication is one of a series of curriculum guides designed to direct and support instruction in vocational cosmetology programs in the State of Oklahoma. It contains seven units for the manicurist specialty: performing silk wrap, performing sculptured nail application, performing nail tip application, performing gel nail sculpturing,…

  1. Cosmetology Reading Strategies. 1980 Vocational Reading Series.

    Science.gov (United States)

    Thornton, L. Jay; And Others

    Cosmetology Reading Strategies is one of five instructional guides in the Reading Strategies in Vocational Education Series. Developed to assist teachers working with students considered disadvantaged because of reading deficiency, the guide contains several strategies, suitable for adaptation, specifically related to cosmetology instruction. Each…

  2. The Audit Committee. AGB Effective Committee Series

    Science.gov (United States)

    Staisloff, Richard L.

    2011-01-01

    This publication is part of an Association of Governing Boards of Universities and Colleges (AGB) series devoted to strengthening the role of key standing committees of governing boards. While there is no optimum committee system for institutions of higher education, certain principles, practices, and procedures prevail. The best practices…

  3. The Investment Committee. AGB Effective Committee Series

    Science.gov (United States)

    Yoder, Jay A.

    2011-01-01

    This publication is part of an AGB series devoted to strengthening the role of key standing committees of governing boards. While there is no optimum committee system for institutions of higher education, certain principles, practices, and procedures prevail. The best practices included in this text support the objectives of board committees:…

  4. An interdisciplinary working paper series on multilingualism

    NARCIS (Netherlands)

    F. Gobbo; L. Máracz

    2014-01-01

    As a collaboration between two research centers based at the University of Amsterdam, ACLC (Amsterdam Center for Language and Communication) and ARTES (Amsterdam School for Regional, Transnational and European Studies), we are pleased to announce the launch of a new series of working papers A’dam Mu

  5. EPICUTICULAR WAXES OF SEDUM SERIES RUPESTRIA

    NARCIS (Netherlands)

    STEVENS, JF; HART, HT; POUW, AJA; BOLCK, A; ZWAVING, JH

    1994-01-01

    Epicuticular waxes from 55 plants of the seven species of Sedum series Rupestria and four artificial hybrids have been examined by GC and GC-MS. The taxa were S. amplexicaule, S. forsterianum, S. montanum ssp. montanum, S. montanum ssp. orientale, S. ochroleucum, S. pruinatum, S. rupestre ssp. erect

  6. Harmonic oscillator: an analysis via Fourier series

    CERN Document Server

    de Castro, A S

    2013-01-01

    The Fourier series method is used to solve the homogeneous equation governing the motion of the harmonic oscillator. It is shown that the general solution to the problem can be found in a surprisingly simple way for the case of the simple harmonic oscillator. It is also shown that the damped harmonic oscillator is susceptible to the analysis.

  7. Tourism. Leonardo da Vinci Series: Good Practices.

    Science.gov (United States)

    Commission of the European Communities, Brussels (Belgium). Directorate-General for Education and Culture.

    This brochure, part of a series about good practices in vocational training in the European Union, describes 10 projects that have promoted investment in human resources through training in the tourism sector to promote sustainable, or responsible, tourism. The projects and their countries of origin are as follows: (1) BEEFT, training of mobility…

  8. Atomic Energy Basics, Understanding the Atom Series.

    Science.gov (United States)

    Atomic Energy Commission, Oak Ridge, TN. Div. of Technical Information.

    This booklet is part of the "Understanding the Atom Series," though it is a later edition and not included in the original set of 51 booklets. A basic survey of the principles of nuclear energy and most important applications are provided. These major topics are examined: matter has molecules and atoms, the atom has electrons, the nucleus,…

  9. AAAI 1991 Fall Symposium Series Reports

    OpenAIRE

    AAAI,

    1992-01-01

    The Association for the Advancement of Artificial Intelligence held its 1991 Fall Symposium Series on November 15-17 at the Asilomar Conference Center, Pacific Grove, California. This article contains summaries of the four symposia: Discourse Structure in Natural Language Understanding and Generation, Knowledge and Action at Social and Organizational Levels, Principles of Hybrid Reasoning, Sensory Aspects of Robotic Intelligence.

  10. Modeling vector nonlinear time series using POLYMARS

    NARCIS (Netherlands)

    J.G. de Gooijer; B.K. Ray

    2003-01-01

    A modified multivariate adaptive regression splines method for modeling vector nonlinear time series is investigated. The method results in models that can capture certain types of vector self-exciting threshold autoregressive behavior, as well as provide good predictions for more general vector non

  11. Presidential Guideline Series, Vol. 1-6

    Science.gov (United States)

    Council for Higher Education Accreditation, 2007

    2007-01-01

    The Council for Higher Education Accreditation "Presidential Guidelines Series" was developed during 2006-2007 as means to further engage presidents in the work of accreditation and to offer tools for presidential leadership in this important area. Six individual Guidelines were issued, each addressing a vital dimension of the president…

  12. The First Reactor, Understanding the Atom Series.

    Science.gov (United States)

    Allardice, Corbin; And Others

    This booklet is one of the "Understanding the Atom" Series. Consisting of three sections, it is an account of the development of the first nuclear reactor by a team of scientists led by Enrico Farmi. The first section briefly reviews the early work on nuclear fission and neutron emission, the impact of Einstein's letter to President Roosevelt, the…

  13. The Nigeria Fadama National Development Series

    OpenAIRE

    Hima, Halimatou; Santibanez, Claudio; Roshan, Sabrina; Lomme, Roland

    2016-01-01

    Over the last 20 years, poor rural farmers in Nigeria have seen the benefits of community organization as a tool for local economic development under the National Fadama Development Project series. They have witnessed improvements in rural areas that have embraced a more inclusive and participatory model of local economic decision making. Many communities have come together under the umbre...

  14. Historical Heliophysical Series of the Ebro Observatory

    Science.gov (United States)

    Curto, J. J.; Solé, J. G.; Genescà, M.; Blanca, M. J.; Vaquero, J. M.

    2016-08-01

    We present the contents of the historical heliophysical series collected at the Ebro Observatory, as well as the actions carried out to restore and save these data and to conserve the physical media containing the data and the telescopes that helped to obtain them. We also discuss the results obtained with these measurements, describe how we disseminated them, and report on the investigations that we have carried out with this information. We show the evolution of the local solar indices such as the Ebro Sunspot Number (ESN), the Ebro Group Sunspot Number (EGSN), or the Ebro Sunspot Area (ESA), which are derived directly from our data. For verification purposes, these local solar indices have been compared to the international sunspot numbers published by SILSO. Our data are reliable and correlate well with the respective international series. Finally, as an example of the possibilities that the Ebro series offer, we explain the use of these data to elucidate one of the recent problems in solar physics: the discontinuity in international data known as the Waldmeier discontinuity and, in general, the ratio between sunspots and sunspot groups. In the Ebro Observatory series, no discontinuity such as this is detected. We instead observe a rather stable ratio in the spot or group rates. This result is in agreement with the hypothesis of Svalgaard (2010, ASP CS-428, 297) that the Waldmeier discontinuity is produced only on a procedural level, perhaps by a change in the criteria used in Zürich by Waldmeier or by changing external conditions.

  15. The Elusive Neutrino, Understanding the Atom Series.

    Science.gov (United States)

    Bernstein, Jeremy

    This booklet is one of the booklets in the "Understanding the Atom Series" published by the U. S. Atomic Energy Commission for high school science teachers and their students. The discovery of the neutrino and the research involving this important elementary particle of matter is discussed. The introductory section reviews topics basic to the…

  16. Nonlinear time-series analysis revisited

    Science.gov (United States)

    Bradley, Elizabeth; Kantz, Holger

    2015-09-01

    In 1980 and 1981, two pioneering papers laid the foundation for what became known as nonlinear time-series analysis: the analysis of observed data—typically univariate—via dynamical systems theory. Based on the concept of state-space reconstruction, this set of methods allows us to compute characteristic quantities such as Lyapunov exponents and fractal dimensions, to predict the future course of the time series, and even to reconstruct the equations of motion in some cases. In practice, however, there are a number of issues that restrict the power of this approach: whether the signal accurately and thoroughly samples the dynamics, for instance, and whether it contains noise. Moreover, the numerical algorithms that we use to instantiate these ideas are not perfect; they involve approximations, scale parameters, and finite-precision arithmetic, among other things. Even so, nonlinear time-series analysis has been used to great advantage on thousands of real and synthetic data sets from a wide variety of systems ranging from roulette wheels to lasers to the human heart. Even in cases where the data do not meet the mathematical or algorithmic requirements to assure full topological conjugacy, the results of nonlinear time-series analysis can be helpful in understanding, characterizing, and predicting dynamical systems.

  17. Bernoulli Polynomials, Fourier Series and Zeta Numbers

    DEFF Research Database (Denmark)

    Scheufens, Ernst E

    2013-01-01

    Fourier series for Bernoulli polynomials are used to obtain information about values of the Riemann zeta function for integer arguments greater than one. If the argument is even we recover the well-known exact values, if the argument is odd we find integral representations and rapidly convergent...

  18. Cuspidal discrete series for projective hyperbolic spaces

    DEFF Research Database (Denmark)

    Andersen, Nils Byrial; Flensted-Jensen, Mogens

    2013-01-01

    Abstract. We have in [1] proposed a definition of cusp forms on semisimple symmetric spaces G/H, involving the notion of a Radon transform and a related Abel transform. For the real non-Riemannian hyperbolic spaces, we showed that there exists an infinite number of cuspidal discrete series, and a...

  19. Facial Specialty. Teacher Edition. Cosmetology Series.

    Science.gov (United States)

    Oklahoma State Dept. of Vocational and Technical Education, Stillwater. Curriculum and Instructional Materials Center.

    This publication is one of a series of curriculum guides designed to direct and support instruction in vocational cosmetology programs in the State of Oklahoma. It contains seven units for the facial specialty: identifying enemies of the skin, using aromatherapy on the skin, giving facials without the aid of machines, giving facials with the aid…

  20. Prince Edward Island. Reference Series No. 33.

    Science.gov (United States)

    Department of External Affairs, Ottawa (Ontario).

    This booklet, one of a series featuring the Canadian provinces, presents a brief overview of Prince Edward Island and is suitable for teacher reference or student reading. Separate sections discuss geography, climate, history, early trade, development, agriculture, the potato industry, forests, fisheries, aquaculture, industry, tourism, energy,…

  1. Trade (Marketing): Occupational Cluster Series-6.

    Science.gov (United States)

    Miller, David H., Comp.; Moore, Allen B., Comp.

    This compilation of ERIC abstracts dealing with trade is the sixth in a series that identifies research and instructional materials in selected occupational clusters. Fifty-seven documents were identified by means of computer searches of "Research in Education" from 1967 to December 1972. Instructions on how to use ERIC reference products are…

  2. Nonlinear Time Series Analysis via Neural Networks

    Science.gov (United States)

    Volná, Eva; Janošek, Michal; Kocian, Václav; Kotyrba, Martin

    This article deals with a time series analysis based on neural networks in order to make an effective forex market [Moore and Roche, J. Int. Econ. 58, 387-411 (2002)] pattern recognition. Our goal is to find and recognize important patterns which repeatedly appear in the market history to adapt our trading system behaviour based on them.

  3. Nonlinear time-series analysis revisited.

    Science.gov (United States)

    Bradley, Elizabeth; Kantz, Holger

    2015-09-01

    In 1980 and 1981, two pioneering papers laid the foundation for what became known as nonlinear time-series analysis: the analysis of observed data-typically univariate-via dynamical systems theory. Based on the concept of state-space reconstruction, this set of methods allows us to compute characteristic quantities such as Lyapunov exponents and fractal dimensions, to predict the future course of the time series, and even to reconstruct the equations of motion in some cases. In practice, however, there are a number of issues that restrict the power of this approach: whether the signal accurately and thoroughly samples the dynamics, for instance, and whether it contains noise. Moreover, the numerical algorithms that we use to instantiate these ideas are not perfect; they involve approximations, scale parameters, and finite-precision arithmetic, among other things. Even so, nonlinear time-series analysis has been used to great advantage on thousands of real and synthetic data sets from a wide variety of systems ranging from roulette wheels to lasers to the human heart. Even in cases where the data do not meet the mathematical or algorithmic requirements to assure full topological conjugacy, the results of nonlinear time-series analysis can be helpful in understanding, characterizing, and predicting dynamical systems. PMID:26428563

  4. Hilbert's Grand Hotel with a series twist

    Science.gov (United States)

    Wijeratne, Chanakya; Mamolo, Ami; Zazkis, Rina

    2014-08-01

    This paper presents a new twist on a familiar paradox, linking seemingly disparate ideas under one roof. Hilbert's Grand Hotel, a paradox which addresses infinite set comparisons is adapted and extended to incorporate ideas from calculus - namely infinite series. We present and resolve several variations, and invite the reader to explore his or her own variations.

  5. Introduction to time series and forecasting

    CERN Document Server

    Brockwell, Peter J

    2016-01-01

    This book is aimed at the reader who wishes to gain a working knowledge of time series and forecasting methods as applied to economics, engineering and the natural and social sciences. It assumes knowledge only of basic calculus, matrix algebra and elementary statistics. This third edition contains detailed instructions for the use of the professional version of the Windows-based computer package ITSM2000, now available as a free download from the Springer Extras website. The logic and tools of time series model-building are developed in detail. Numerous exercises are included and the software can be used to analyze and forecast data sets of the user's own choosing. The book can also be used in conjunction with other time series packages such as those included in R. The programs in ITSM2000 however are menu-driven and can be used with minimal investment of time in the computational details. The core of the book covers stationary processes, ARMA and ARIMA processes, multivariate time series and state-space mod...

  6. Finance (Banking): Occupational Cluster Series-7.

    Science.gov (United States)

    Miller, David H., Comp.; Moore, Allen B., Comp.

    This compilation of ERIC abstracts dealing with banking is the seventh in a series that identifies research and instructional materials in selected occupational clusters. Ninety-three documents were identified by means of computer searches of "Research in Education" from 1967 to December 1972. Instructions on how to use ERIC reference products are…

  7. Fourier Series, the DFT and Shape Modelling

    DEFF Research Database (Denmark)

    Skoglund, Karl

    2004-01-01

    This report provides an introduction to Fourier series, the discrete Fourier transform, complex geometry and Fourier descriptors for shape analysis. The content is aimed at undergraduate and graduate students who wish to learn about Fourier analysis in general, as well as its application to shape...... modelling and analysis....

  8. Distributed series resistance effects in solar cells

    DEFF Research Database (Denmark)

    Nielsen, Lars Drud

    1982-01-01

    A mathematical treatment is presented of the effects of one-dimensional distributed series resistance in solar cells. A general perturbation theory is developed, including consistently the induced spatial variation of diode current density and leading to a first-order equivalent lumped resistance...... to cause an effective doubling of the "diode quality factor."...

  9. CAS issues its 2008 Science & Society Series

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    @@ CAS recently released its 2008 Science and Society Series consisting of three reports on scientific progress, high-tech advancement and sustainable development. Among them, the latter two were completed under the organization of the CAS Institute of Policy and Management.

  10. The Compensation Committee. AGB Effective Committee Series

    Science.gov (United States)

    Hyatt, Thomas K.

    2013-01-01

    This publication is part of an Association of Governing Boards of Universities and Colleges (AGB) series devoted to strengthening the role of key standing committees of governing boards. While there is no optimum committee system for institutions of higher education, certain principles, practices, and procedures prevail. The best practices…

  11. Equal Plate Charges on Series Capacitors?

    Science.gov (United States)

    Illman, B. L.; Carlson, G. T.

    1994-01-01

    Provides a line of reasoning in support of the contention that the equal charge proposition is at best an approximation. Shows how the assumption of equal plate charge on capacitors in series contradicts the conservative nature of the electric field. (ZWH)

  12. Fluorine geochemistry in volcanic rock series

    DEFF Research Database (Denmark)

    Stecher, Ole

    1998-01-01

    A new analytical procedure has been established in order to determine low fluorine concentrations (30–100 ppm F) in igneous rocks, and the method has also proven successful for higher concentrations (100–4000 ppm F). Fluorine has been measured in a series of olivine tholeiites from the Reykjanes ...

  13. Book series on sustainable development published

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    @@ An Outline of Sustainable Development in China·State Volume was published on 11 February in Beijing. Chief-edited by CAS President LU Yongxiang, the 20-volum book series was the brainchild of more than 180 senior Chinese experts and scholars from various fields after nearly three-year hard work.

  14. Crocodiles and Alligators. Young Discovery Library Series.

    Science.gov (United States)

    Farre, Marie

    This book is written for children ages 5 through 10. Part of a series designed to develop their curiosity, fascinate them and educate them, this volume describes the physical characteristics, behavior, and peculiar habits of crocodiles, including how to distinguish them from close relatives such as alligators, cayman, and gharials. (YP)

  15. Time series tapering for short data samples

    DEFF Research Database (Denmark)

    Kaimal, J.C.; Kristensen, L.

    1991-01-01

    We explore the effect of applying tapered windows on atmospheric data to eliminate overestimation inherent in spectra computed from short time series. Some windows are more effective than others in correcting this distortion. The Hamming window gave the best results with experimental data...

  16. Designer networks for time series processing

    DEFF Research Database (Denmark)

    Svarer, C; Hansen, Lars Kai; Larsen, Jan;

    1993-01-01

    The conventional tapped-delay neural net may be analyzed using statistical methods and the results of such analysis can be applied to model optimization. The authors review and extend efforts to demonstrate the power of this strategy within time series processing. They attempt to design compact...

  17. Energy coefficients for a propeller series

    DEFF Research Database (Denmark)

    Olsen, Anders Smærup

    2004-01-01

    of the potential theory with the propeller modelled as an actuator disk. The efficiency based on the energy coefficients is calculated for a propeller series. The results show a good agreement between the efficiency based on the energy coefficients and the efficiency obtained by a vortex-lattice method....

  18. Seri Landscape Classification and Spatial Reference

    Science.gov (United States)

    O'Meara, Carolyn

    2010-01-01

    This thesis contributes to the growing field of ethnophysiography, a new subfield of cognitive anthropology that aims to determine the universals and variation in the categorization of landscape objects across cultures. More specifically, this work looks at the case of the Seri people of Sonora, Mexico to investigate the way they categorize…

  19. Useful Pattern Mining on Time Series

    DEFF Research Database (Denmark)

    Goumatianos, Nikitas; Christou, Ioannis T; Lindgren, Peter

    2013-01-01

    calculations as complex but efficient distributed SQL queries on the relational databases that store the time-series. We present initial results from mining all frequent candlestick sequences with the characteristic property that when they occur then, with an average at least 60% probability, they signal a 2...

  20. Undersea Giants. Young Discovery Library Series.

    Science.gov (United States)

    Geistdoerfer, Patrick

    This book is written for children ages 5 through 10. Part of a series designed to develop their curiosity, fascinate them and educate them, this volume provides an introduction to whales and other sea mammals. Topics included are: (1) kinds of whales; (2) distribution of whales; (3) behavior of whales; (4) hunting whales; and (5) other sea…