WorldWideScience

Sample records for acid transporter slc10a5

  1. Major involvement of Na(+) -dependent multivitamin transporter (SLC5A6/SMVT) in uptake of biotin and pantothenic acid by human brain capillary endothelial cells.

    Science.gov (United States)

    Uchida, Yasuo; Ito, Katsuaki; Ohtsuki, Sumio; Kubo, Yoshiyuki; Suzuki, Takashi; Terasaki, Tetsuya

    2015-07-01

    The purpose of this study was to clarify the expression of Na(+) -dependent multivitamin transporter (SLC5A6/SMVT) and its contribution to the supply of biotin and pantothenic acid to the human brain via the blood-brain barrier. DNA microarray and immunohistochemical analyses confirmed that SLC5A6 is expressed in microvessels of human brain. The absolute expression levels of SLC5A6 protein in isolated human and monkey brain microvessels were 1.19 and 0.597 fmol/μg protein, respectively, as determined by a quantitative targeted absolute proteomics technique. Using an antibody-free method established by Kubo et al. (2015), we found that SLC5A6 was preferentially localized at the luminal membrane of brain capillary endothelium. Knock-down analysis using SLC5A6 siRNA showed that SLC5A6 accounts for 88.7% and 98.6% of total [(3) H]biotin and [(3) H]pantothenic acid uptakes, respectively, by human cerebral microvascular endothelial cell line hCMEC/D3. SLC5A6-mediated transport in hCMEC/D3 was markedly inhibited not only by biotin and pantothenic acid, but also by prostaglandin E2, lipoic acid, docosahexaenoic acid, indomethacin, ketoprofen, diclofenac, ibuprofen, phenylbutazone, and flurbiprofen. This study is the first to confirm expression of SLC5A6 in human brain microvessels and to provide evidence that SLC5A6 is a major contributor to luminal uptake of biotin and pantothenic acid at the human blood-brain barrier. In humans, it was unclear (not concluded) about what transport system at the blood-brain barrier (BBB) is responsible for the brain uptakes of two vitamins, biotin and pantothenic acid, which are necessary for brain proper function. This study clarified for the first time that the solute carrier 5A6/Na(+) -dependent multivitamin transporter SLC5A6/SMVT is responsible for the supplies of biotin and pantothenic acid into brain across the BBB in humans. DHA, docosahexaenoic acid; NSAID, non-steroidal anti-inflammatory drug; PGE2, prostaglandin E2. © 2015

  2. Na+-taurocholate cotransporting polypeptide (NTCP/SLC10A1) ortholog in the marine skate Leucoraja erinacea is not a physiological bile salt transporter.

    Science.gov (United States)

    Yu, Dongke; Zhang, Han; Lionarons, Daniel A; Boyer, James L; Cai, Shi-Ying

    2017-04-01

    The Na + -dependent taurocholate cotransporting polypeptide (NTCP/SLC10A1) is a hepatocyte-specific solute carrier, which plays an important role in maintaining bile salt homeostasis in mammals. The absence of a hepatic Na + -dependent bile salt transport system in marine skate and rainbow trout raises a question regarding the function of the Slc10a1 gene in these species. Here, we have characterized the Slc10a1 gene in the marine skate, Leucoraja erinacea The transcript of skate Slc10a1 (skSlc10a1) encodes 319 amino acids and shares 46% identity to human NTCP (hNTCP) with similar topology to mammalian NTCP. SkSlc10a1 mRNA was mostly confined to the brain and testes with minimal expression in the liver. An FXR-bile salt reporter assay indicated that skSlc10a1 transported taurocholic acid (TCA) and scymnol sulfate, but not as effectively as hNTCP. An [ 3 H]TCA uptake assay revealed that skSlc10a1 functioned as a Na + -dependent transporter, but with low affinity for TCA ( K m = 92.4 µM) and scymnol sulfate ( K i = 31 µM), compared with hNTCP (TCA, K m = 5.4 µM; Scymnol sulfate, K i = 3.5 µM). In contrast, the bile salt concentration in skate plasma was 2 µM, similar to levels seen in mammals. Interestingly, skSlc10a1 demonstrated transport activity for the neurosteroids dehydroepiandrosterone sulfate and estrone-3-sulfate at physiological concentration, similar to hNTCP. Together, our findings indicate that skSlc10a1 is not a physiological bile salt transporter, providing a molecular explanation for the absence of a hepatic Na + -dependent bile salt uptake system in skate. We speculate that Slc10a1 is a neurosteroid transporter in skate that gained its substrate specificity for bile salts later in vertebrate evolution. Copyright © 2017 the American Physiological Society.

  3. Inhibition of intestinal bile acid transporter Slc10a2 improves triglyceride metabolism and normalizes elevated plasma glucose levels in mice.

    Directory of Open Access Journals (Sweden)

    Thomas Lundåsen

    Full Text Available Interruption of the enterohepatic circulation of bile acids increases cholesterol catabolism, thereby stimulating hepatic cholesterol synthesis from acetate. We hypothesized that such treatment should lower the hepatic acetate pool which may alter triglyceride and glucose metabolism. We explored this using mice deficient of the ileal sodium-dependent BA transporter (Slc10a2 and ob/ob mice treated with a specific inhibitor of Slc10a2. Plasma TG levels were reduced in Slc10a2-deficient mice, and when challenged with a sucrose-rich diet, they displayed a reduced response in hepatic TG production as observed from the mRNA levels of several key enzymes in fatty acid synthesis. This effect was paralleled by a diminished induction of mature sterol regulatory element-binding protein 1c (Srebp1c. Unexpectedly, the SR-diet induced intestinal fibroblast growth factor (FGF 15 mRNA and normalized bile acid synthesis in Slc10a2-/- mice. Pharmacologic inhibition of Slc10a2 in diabetic ob/ob mice reduced serum glucose, insulin and TGs, as well as hepatic mRNA levels of Srebp1c and its target genes. These responses are contrary to those reported following treatment of mice with a bile acid binding resin. Moreover, when key metabolic signal transduction pathways in the liver were investigated, those of Mek1/2-Erk1/2 and Akt were blunted after treatment of ob/ob mice with the Slc10a2 inhibitor. It is concluded that abrogation of Slc10a2 reduces hepatic Srebp1c activity and serum TGs, and in the diabetic ob/ob model it also reduces glucose and insulin levels. Hence, targeting of Slc10a2 may be a promising strategy to treat hypertriglyceridemia and diabetes.

  4. Na(+) dependent acid-base transporters in the choroid plexus; insights from slc4 and slc9 gene deletion studies

    DEFF Research Database (Denmark)

    Christensen, Henriette L; Nguyen, An T; Pedersen, Fredrik D

    2013-01-01

    The choroid plexus epithelium (CPE) is located in the ventricular system of the brain, where it secretes the majority of the cerebrospinal fluid (CSF) that fills the ventricular system and surrounds the central nervous system. The CPE is a highly vascularized single layer of cuboidal cells....... Genetically modified mice targeting slc4a2, slc4a5, slc4a7, slc4a10, and slc9a1 have been generated. Deletion of slc4a5, 7 or 10, or slc9a1 has numerous impacts on CP function and structure in these mice. Removal of the transporters affects brain ventricle size (slc4a5 and slc4a10) and intracellular p...

  5. Sodium-coupled neutral amino acid (System N/A) transporters of the SLC38 gene family.

    Science.gov (United States)

    Mackenzie, Bryan; Erickson, Jeffrey D

    2004-02-01

    The sodium-coupled neutral amino acid transporters (SNAT) of the SLC38 gene family resemble the classically-described System A and System N transport activities in terms of their functional properties and patterns of regulation. Transport of small, aliphatic amino acids by System A subtypes (SNAT1, SNAT2, and SNAT4) is rheogenic and pH sensitive. The System N subtypes SNAT3 and SNAT5 also countertransport H(+), which may be key to their operation in reverse, and have narrower substrate profiles than do the System A subtypes. Glutamine emerges as a favored substrate throughout the family, except for SNAT4. The SLC38 transporters undoubtedly play many physiological roles including the transfer of glutamine from astrocyte to neuron in the CNS, ammonia detoxification and gluconeogenesis in the liver, and the renal response to acidosis. Probing their regulation has revealed additional roles, and recent work has considered SLC38 transporters as therapeutic targets in neoplasia.

  6. Plasma Membrane Na+-Coupled Citrate Transporter (SLC13A5 and Neonatal Epileptic Encephalopathy

    Directory of Open Access Journals (Sweden)

    Yangzom D. Bhutia

    2017-02-01

    Full Text Available SLC13A5 is a Na+-coupled transporter for citrate that is expressed in the plasma membrane of specific cell types in the liver, testis, and brain. It is an electrogenic transporter with a Na+:citrate3− stoichiometry of 4:1. In humans, the Michaelis constant for SLC13A5 to transport citrate is ~600 μM, which is physiologically relevant given that the normal concentration of citrate in plasma is in the range of 150–200 μM. Li+ stimulates the transport function of human SLC13A5 at concentrations that are in the therapeutic range in patients on lithium therapy. Human SLC13A5 differs from rodent Slc13a5 in two important aspects: the affinity of the human transporter for citrate is ~30-fold less than that of the rodent transporter, thus making human SLC13A5 a low-affinity/high-capacity transporter and the rodent Slc13a5 a high-affinity/low-capacity transporter. In the liver, SLC13A5 is expressed exclusively in the sinusoidal membrane of the hepatocytes, where it plays a role in the uptake of circulating citrate from the sinusoidal blood for metabolic use. In the testis, the transporter is expressed only in spermatozoa, which is also only in the mid piece where mitochondria are located; the likely function of the transporter in spermatozoa is to mediate the uptake of citrate present at high levels in the seminal fluid for subsequent metabolism in the sperm mitochondria to generate biological energy, thereby supporting sperm motility. In the brain, the transporter is expressed mostly in neurons. As astrocytes secrete citrate into extracellular medium, the potential function of SLC13A5 in neurons is to mediate the uptake of circulating citrate and astrocyte-released citrate for subsequent metabolism. Slc13a5-knockout mice have been generated; these mice do not have any overt phenotype but are resistant to experimentally induced metabolic syndrome. Recently however, loss-of-function mutations in human SLC13A5 have been found to cause severe epilepsy

  7. Amino acid derivatives are substrates or non-transported inhibitors of the amino acid transporter PAT2 (slc36a2).

    Science.gov (United States)

    Edwards, Noel; Anderson, Catriona M H; Gatfield, Kelly M; Jevons, Mark P; Ganapathy, Vadivel; Thwaites, David T

    2011-01-01

    The H(+)-coupled amino acid transporter PAT2 (SLC36A2) transports the amino acids proline, glycine, alanine and hydroxyproline. A physiological role played by PAT2 in amino acid reabsorption in the renal proximal tubule is demonstrated by mutations in SLC36A2 that lead to an iminoglycinuric phenotype (imino acid and glycine uria) in humans. A number of proline, GABA and tryptophan derivatives were examined to determine if they function either as transported substrates or non-transported inhibitors of PAT2. The compounds were investigated following heterologous expression of rat PAT2 in Xenopus laevis oocytes. PAT2 function was characterised by: radiotracer uptake and competition (cis-inhibition) studies; radiotracer efflux and trans-stimulation; and measurement of substrate-induced positive inward current by two-electrode voltage-clamp. In general, the proline derivatives appeared to be transported substrates and the relative ability to induce current flow was closely related to the inhibitory effects on PAT2-mediated l-[(3)H]proline uptake. In contrast, certain heterocyclic GABA derivatives (e.g. l-pipecolic acid) were translocated only slowly. Finally, the tryptophan derivatives inhibited PAT2 function but did not undergo transport. l-Proline uptake was inhibited by 5-hydroxy-l-tryptophan (IC(50) 1.6±0.4mM), α-methyl-d,l-tryptophan (3.5±1.5mM), l-tryptophan, 1-methyl-l-tryptophan and indole-3-propionic acid. Although neither 5-hydroxy-l-tryptophan nor α-methyl-d,l-tryptophan were able to elicit inward current in PAT2-expressing oocytes both reduced the current evoked by l-proline. 5-Hydroxy-l-tryptophan and α-methyl-d,l-tryptophan were unable to trans-stimulate l-proline efflux from PAT2-expressing oocytes, confirming that the two compounds act as non-transported blockers of PAT2. These two tryptophan derivatives should prove valuable experimental tools in future investigations of the physiological roles of PAT2. Copyright © 2010 Elsevier B.V. All rights

  8. Importance of uncharged polar residues and proline in the proximal two-thirds (Pro107–Ser128 of the highly conserved region of mouse ileal Na+-dependent bile acid transporter, Slc10a2, in transport activity and cellular expression

    Directory of Open Access Journals (Sweden)

    Saeki Tohru

    2013-02-01

    Full Text Available Abstract Background SLC10A2-mediated reabsorption of bile acids at the distal end of the ileum is the first step in enterohepatic circulation. Because bile acids act not only as detergents but also as signaling molecules in lipid metabolism and energy production, SLC10A2 is important as the key transporter for understanding the in vivo kinetics of bile acids. SLC10A family members and the homologous genes of various species share a highly conserved region corresponding to Gly104–Pro142 of SLC10A2. The functional importance of this region has not been fully elucidated. Results To elucidate the functional importance of this region, we previously performed mutational analysis of the uncharged polar residues and proline in the distal one-third (Thr130–Pro142 of the highly conserved region in mouse Slc10a2. In this study, proline and uncharged polar residues in the remaining two-thirds of this region in mouse Slc10a2 were subjected to mutational analysis, and taurocholic acid uptake and cell surface localization were examined. Cell surface localization of Slc10a2 is necessary for bile acid absorption. Mutants in which Asp or Leu were substituted for Pro107 (P107N or P107L were abundantly expressed, but their cell surface localization was impaired. The S126A mutant was completely impaired in cellular expression. The T110A and S128A mutants exhibited remarkably enhanced membrane expression. The S112A mutant was properly expressed at the cell surface but transport activity was completely lost. Replacement of Tyr117 with various amino acids resulted in reduced transport activity. The degree of reduction roughly depended on the van der Waals volume of the side chains. Conclusions The functional importance of proline and uncharged polar residues in the highly conserved region of mouse Slc10a2 was determined. This information will contribute to the design of bile acid-conjugated prodrugs for efficient drug delivery or SLC10A2 inhibitors for

  9. Identification of a large intronic transposal insertion in SLC17A5 causing sialic acid storage disease

    NARCIS (Netherlands)

    Tarailo-Graovac, M. (Maja); Drögemöller, B.I. (Britt I.); Wasserman, W.W. (Wyeth W.); C.J. Ross; A.M.W. van den Ouweland (Ans); N. Darin (Niklas); Kollberg, G. (Gittan); Van Karnebeek, C.D.M. (Clara D. M.); Blomqvist, M. (Maria)

    2017-01-01

    textabstractBackground: Sialic acid storage diseases are neurodegenerative disorders characterized by accumulation of sialic acid in the lysosome. These disorders are caused by mutations in SLC17A5, the gene encoding sialin, a sialic acid transporter located in the lysosomal membrane. The most

  10. The Human Gene SLC25A29, of Solute Carrier Family 25, Encodes a Mitochondrial Transporter of Basic Amino Acids*

    Science.gov (United States)

    Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando

    2014-01-01

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation. PMID:24652292

  11. The human gene SLC25A29, of solute carrier family 25, encodes a mitochondrial transporter of basic amino acids.

    Science.gov (United States)

    Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando

    2014-05-09

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation.

  12. ρ0 Cells Feature De-Ubiquitination of SLC Transporters and Increased Levels and Fluxes of Amino Acids

    Directory of Open Access Journals (Sweden)

    André Bordinassi Medina

    2017-04-01

    Full Text Available Solute carrier (SLC transporters are a diverse group of membrane transporter proteins that regulate the cellular flux and distribution of endogenous and xenobiotic compounds. Post-translational modifications (PTMs, such as ubiquitination, have recently emerged as one of the major regulatory mechanisms in protein function and localization. Previously, we showed that SLC amino acid transporters were on average 6-fold de-ubiquitinated and increased amino acid levels were detected in ρ0 cells (lacking mitochondrial DNA, mtDNA compared to parental cells. Here, we elucidated the altered functionality of SLC transporters and their dynamic ubiquitination status by measuring the uptake of several isotopically labeled amino acids in both human osteosarcoma 143B.TK- and ρ0 cells. Our pulse chase analysis indicated that de-ubiquitinated amino acid transporters in ρ0 cells were accompanied by an increased transport rate, which leads to higher levels of amino acids in the cell. Finding SLC transport enhancers is an aim of the pharmaceutical industry in order to compensate for loss of function mutations in these genes. Thus, the ubiquitination status of SLC transporters could be an indicator for their functionality, but evidence for a direct connection between de-ubiquitination and transporter activity has to be further elucidated.

  13. Impact of genetic polymorphisms of SLC2A2, SLC2A5, and KHK on metabolic phenotypes in hypertensive individuals.

    Directory of Open Access Journals (Sweden)

    MyPhuong T Le

    Full Text Available In the past few decades, consumption of added sugars has increased dramatically. Studies have linked high sugar intake with increased risk for a number of diseases. Importantly, fructose, a component of sugar, has been linked with the development of features of metabolic syndrome. This study determined if single nucleotide polymorphisms in genes involved in fructose transport (solute carrier family 2 facilitated glucose transporter, member 2 (SLC2A2 and solute carrier family 2 facilitated glucose/fructose transporter, member 5 (SLC2A5 and metabolism (ketohexokinase (KHK affect inter-individual variability in metabolic phenotypes, such as increased serum uric acid levels.The influence of SLC2A2, SLC2A5, and KHK SNPs on metabolic phenotypes was tested in 237 European Americans and 167 African Americans from the Pharmacogenomic Evaluation and Antihypertensive Responses (PEAR study. Using baseline untreated fasting data, associations were considered significant if p≤0.005. These SNPs were then evaluated for potential replication (p≤0.05 using data from the Genetic Epidemiology of Responses to Antihypertensives (GERA studies.SLC2A5 rs5438 was associated with an increase in serum uric acid in European American males. However, we were unable to replicate the association in GERA. The minor allele of SLC2A2 rs8192675 showed an association with lower high-density lipoproteins in European Americans (A/A: 51.0 mg/dL, A/G: 47.0 mg/dL, G/G: 41.5 mg/dL, p = 0.0034 in PEAR. The association between rs8192675 and lower high-density lipoproteins was replicated in the combined European American GERA study samples (A/A: 47.6 mg/dL, A/G: 48.6 mg/dL, G/G: 41.9 mg/dL, p = 0.0315.The association between SLC2A2 rs8192675 and high-density lipoproteins suggests the polymorphism may play a role in influencing high-density lipoproteins and thus metabolic risk of cardiovascular disease.

  14. Regulators of Slc4 bicarbonate transporter activity

    Directory of Open Access Journals (Sweden)

    Ian M. Thornell

    2015-06-01

    Full Text Available The Slc4 family of transporters is comprised of anion exchangers (AE1-4, Na-coupled bicarbonate transporters (NCBTs including electrogenic Na/bicarbonate cotransporters (NBCe1 and NBCe2, electroneutral Na/bicarbonate cotransporters (NBCn1 and NBCn2, and the electroneutral Na-driven Cl-bicarbonate exchanger (NDCBE, as well as a borate transporter (BTR1. These transporters regulate intracellular pH (pHi and contribute to steady-state pHi, but are also involved in other physiological processes including CO2 carriage by red blood cells and solute secretion/reabsorption across epithelia. Acid-base transporters function as either acid extruders or acid loaders, with the Slc4 proteins moving HCO3– either into or out of cells. According to results from both molecular and functional studies, multiple Slc4 proteins and/or associated splice variants with similar expected effects on pHi are often found in the same tissue or cell. Such apparent redundancy is likely to be physiologically important. In addition to regulating pHi, a HCO3– transporter contributes to a cell’s ability to fine tune the intracellular regulation of the cotransported/exchanged ion(s (e.g., Na+ or Cl–. In addition, functionally similar transporters or splice variants with different regulatory profiles will optimize pH physiology and solute transport under various conditions or within subcellular domains. Such optimization will depend on activated signaling pathways and transporter expression profiles. In this review, we will summarize and discuss both classical and more recently identified regulators of the Slc4 proteins. Some of these regulators include traditional second messengers, lipids, binding proteins, autoregulatory domains, and less conventional regulators. The material presented will provide insight into the diversity and physiological significance of multiple members within the Slc4 gene family.

  15. The renal urate transporter SLC17A1 locus: confirmation of association with gout.

    Science.gov (United States)

    Hollis-Moffatt, Jade E; Phipps-Green, Amanda J; Chapman, Brett; Jones, Gregory T; van Rij, Andre; Gow, Peter J; Harrison, Andrew A; Highton, John; Jones, Peter B; Montgomery, Grant W; Stamp, Lisa K; Dalbeth, Nicola; Merriman, Tony R

    2012-04-27

    Two major gout-causing genes have been identified, the urate transport genes SLC2A9 and ABCG2. Variation within the SLC17A1 locus, which encodes sodium-dependent phosphate transporter 1, a renal transporter of uric acid, has also been associated with serum urate concentration. However, evidence for association with gout is equivocal. We investigated the association of the SLC17A1 locus with gout in New Zealand sample sets. Five variants (rs1165196, rs1183201, rs9358890, rs3799344, rs12664474) were genotyped across a New Zealand sample set totaling 971 cases and 1,742 controls. Cases were ascertained according to American Rheumatism Association criteria. Two population groups were studied: Caucasian and Polynesian. At rs1183201 (SLC17A1), evidence for association with gout was observed in both the Caucasian (odds ratio (OR) = 0.67, P = 3.0 × 10-6) and Polynesian (OR = 0.74, P = 3.0 × 10-3) groups. Meta-analysis confirmed association of rs1183201 with gout at a genome-wide level of significance (OR = 0.70, P = 3.0 × 10-8). Haplotype analysis suggested the presence of a common protective haplotype. We confirm the SLC17A1 locus as the third associated with gout at a genome-wide level of significance.

  16. Genetic analysis of the GLUT10 glucose transporter (SLC2A10 polymorphisms in Caucasian American type 2 diabetes

    Directory of Open Access Journals (Sweden)

    Mychaleckyj Josyf C

    2005-12-01

    Full Text Available Abstract Background GLUT10 (gene symbol SLC2A10 is a facilitative glucose transporter within the type 2 diabetes (T2DM-linked region on chromosome 20q12-13.1. Therefore, we evaluated GLUT10 as a positional candidate gene for T2DM in Caucasian Americans. Methods Twenty SNPs including 4 coding, 10 intronic and 6 5' and 3' to the coding sequence were genotyped across a 100 kb region containing the SLC2A10 gene in DNAs from 300 T2DM cases and 310 controls using the Sequenom MassArray Genotyping System. Allelic association was evaluated, and linkage disequilibrium (LD and haplotype structure of SLC2A10 were also determined to assess whether any specific haplotypes were associated with T2DM. Results Of these variants, fifteen had heterozygosities greater than 0.80 and were analyzed further for association with T2DM. No evidence of significant association was observed for any variant with T2DM (all P ≥ 0.05, including Ala206Thr (rs2235491 which was previously reported to be associated with fasting insulin. Linkage disequilibrium analysis suggests that the SLC2A10 gene is contained in a single haplotype block of 14 kb. Haplotype association analysis with T2DM did not reveal any significant differences between haplotype frequencies in T2DM cases and controls. Conclusion From our findings, we can conclude that sequence variants in or near GLUT10 are unlikely to contribute significantly to T2DM in Caucasian Americans.

  17. SLC6 Neurotransmitter Transporters: Structure, Function, and Regulation

    DEFF Research Database (Denmark)

    Kristensen, Anders S; Andersen, Jacob; Jørgensen, Trine N

    2011-01-01

    The neurotransmitter transporters (NTTs) belonging to the solute carrier 6 (SLC6) gene family (also referred to as the neurotransmitter-sodium-symporter family or Na(+)/Cl(-)-dependent transporters) comprise a group of nine sodium- and chloride-dependent plasma membrane transporters...... for the monoamine neurotransmitters serotonin (5-hydroxytryptamine), dopamine, and norepinephrine, and the amino acid neurotransmitters GABA and glycine. The SLC6 NTTs are widely expressed in the mammalian brain and play an essential role in regulating neurotransmitter signaling and homeostasis by mediating uptake...... of released neurotransmitters from the extracellular space into neurons and glial cells. The transporters are targets for a wide range of therapeutic drugs used in treatment of psychiatric diseases, including major depression, anxiety disorders, attention deficit hyperactivity disorder and epilepsy...

  18. DNA methylation of amino acid transporter genes in the human placenta.

    Science.gov (United States)

    Simner, C; Novakovic, B; Lillycrop, K A; Bell, C G; Harvey, N C; Cooper, C; Saffery, R; Lewis, R M; Cleal, J K

    2017-12-01

    Placental transfer of amino acids via amino acid transporters is essential for fetal growth. Little is known about the epigenetic regulation of amino acid transporters in placenta. This study investigates the DNA methylation status of amino acid transporters and their expression across gestation in human placenta. BeWo cells were treated with 5-aza-2'-deoxycytidine to inhibit methylation and assess the effects on amino acid transporter gene expression. The DNA methylation levels of amino acid transporter genes in human placenta were determined across gestation using DNA methylation array data. Placental amino acid transporter gene expression across gestation was also analysed using data from publically available Gene Expression Omnibus data sets. The expression levels of these transporters at term were established using RNA sequencing data. Inhibition of DNA methylation in BeWo cells demonstrated that expression of specific amino acid transporters can be inversely associated with DNA methylation. Amino acid transporters expressed in term placenta generally showed low levels of promoter DNA methylation. Transporters with little or no expression in term placenta tended to be more highly methylated at gene promoter regions. The transporter genes SLC1A2, SLC1A3, SLC1A4, SLC7A5, SLC7A11 and SLC7A10 had significant changes in enhancer DNA methylation across gestation, as well as gene expression changes across gestation. This study implicates DNA methylation in the regulation of amino acid transporter gene expression. However, in human placenta, DNA methylation of these genes remains low across gestation and does not always play an obvious role in regulating gene expression, despite clear evidence for differential expression as gestation proceeds. Copyright © 2017. Published by Elsevier Ltd.

  19. Function and expression of the proton-coupled amino acid transporter Slc36a1 along the rat gastrointestinal tract

    DEFF Research Database (Denmark)

    Broberg, M. L.; Holm, Rasmus Koldborg; Tønsberg, H

    2012-01-01

    BACKGROUND AND PURPOSE: Intestinal absorption via membrane transporters may determine the pharmacokinetics of drug compounds. The hypothesis is that oral absorption of gaboxadol (4, 5, 6, 7-tetrahydroisoxazolo [5,4-c] pyridine-3-ol) in rats occurs via the proton-coupled amino acid transporter, r....... The intestinal expression of rSlc36a1 mRNA was measured by quantitative real-time PCR (q-RT-PCR). Furthermore, the hPAT1-/rPAT1-mediated transport of gaboxadol or L-proline was studied in hPAT1-expressing X. laevis oocytes, Caco-2 cell monolayers and excised segments of the rat intestine. KEY RESULTS......). The in vitro carrier-mediated uptake rate of L-proline in the excised intestinal segments was highest in the mid jejunum and low in the colon. The in vitro uptake and the in vivo absorption correlated with the expression of rSlc36a1 mRNA along the rat intestine. CONCLUSIONS AND IMPLICATIONS: The results...

  20. Expression of solute carrier 7A4 (SLC7A4) in the plasma membrane is not sufficient to mediate amino acid transport activity.

    OpenAIRE

    Wolf, Sabine; Janzen, Annette; Vékony, Nicole; Martiné, Ursula; Strand, Dennis; Closs, Ellen I

    2002-01-01

    Member 4 of human solute carrier family 7 (SLC7A4) exhibits significant sequence homology with the SLC7 subfamily of human cationic amino acid transporters (hCATs) [Sperandeo, Borsani, Incerti, Zollo, Rossi, Zuffardi, Castaldo, Taglialatela, Andria and Sebastio (1998) Genomics 49, 230-236]. It is therefore often referred to as hCAT-4 even though no convincing transport activity has been shown for this protein. We expressed SLC7A4 in Xenopus laevis oocytes, but could not detect any transport a...

  1. The Human SLC25A33 and SLC25A36 Genes of Solute Carrier Family 25 Encode Two Mitochondrial Pyrimidine Nucleotide Transporters*

    Science.gov (United States)

    Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando

    2014-01-01

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. PMID:25320081

  2. The human SLC25A33 and SLC25A36 genes of solute carrier family 25 encode two mitochondrial pyrimidine nucleotide transporters.

    Science.gov (United States)

    Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando

    2014-11-28

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. SLC2A9 is a high-capacity urate transporter in humans.

    Directory of Open Access Journals (Sweden)

    Mark J Caulfield

    2008-10-01

    Full Text Available Serum uric acid levels in humans are influenced by diet, cellular breakdown, and renal elimination, and correlate with blood pressure, metabolic syndrome, diabetes, gout, and cardiovascular disease. Recent genome-wide association scans have found common genetic variants of SLC2A9 to be associated with increased serum urate level and gout. The SLC2A9 gene encodes a facilitative glucose transporter, and it has two splice variants that are highly expressed in the proximal nephron, a key site for urate handling in the kidney. We investigated whether SLC2A9 is a functional urate transporter that contributes to the longstanding association between urate and blood pressure in man.We expressed both SLC2A9 splice variants in Xenopus laevis oocytes and found both isoforms mediate rapid urate fluxes at concentration ranges similar to physiological serum levels (200-500 microM. Because SLC2A9 is a known facilitative glucose transporter, we also tested whether glucose or fructose influenced urate transport. We found that urate is transported by SLC2A9 at rates 45- to 60-fold faster than glucose, and demonstrated that SLC2A9-mediated urate transport is facilitated by glucose and, to a lesser extent, fructose. In addition, transport is inhibited by the uricosuric benzbromarone in a dose-dependent manner (Ki = 27 microM. Furthermore, we found urate uptake was at least 2-fold greater in human embryonic kidney (HEK cells overexpressing SLC2A9 splice variants than nontransfected kidney cells. To confirm that our findings were due to SLC2A9, and not another urate transporter, we showed that urate transport was diminished by SLC2A9-targeted siRNA in a second mammalian cell line. In a cohort of men we showed that genetic variants of SLC2A9 are associated with reduced urinary urate clearance, which fits with common variation at SLC2A9 leading to increased serum urate. We found no evidence of association with hypertension (odds ratio 0.98, 95% confidence interval [CI

  4. Neurotransmitter Transporter-Like: a male germline-specific SLC6 transporter required for Drosophila spermiogenesis.

    Directory of Open Access Journals (Sweden)

    Nabanita Chatterjee

    2011-01-01

    Full Text Available The SLC6 class of membrane transporters, known primarily as neurotransmitter transporters, is increasingly appreciated for its roles in nutritional uptake of amino acids and other developmentally specific functions. A Drosophila SLC6 gene, Neurotransmitter transporter-like (Ntl, is expressed only in the male germline. Mobilization of a transposon inserted near the 3' end of the Ntl coding region yields male-sterile mutants defining a single complementation group. Germline transformation with Ntl cDNAs under control of male germline-specific control elements restores Ntl/Ntl homozygotes to normal fertility, indicating that Ntl is required only in the germ cells. In mutant males, sperm morphogenesis appears normal, with elongated, individualized and coiled spermiogenic cysts accumulating at the base of the testes. However, no sperm are transferred to the seminal vesicle. The level of polyglycylation of Ntl mutant sperm tubulin appears to be significantly lower than that of wild type controls. Glycine transporters are the most closely related SLC6 transporters to Ntl, suggesting that Ntl functions as a glycine transporter in developing sperm, where augmentation of the cytosolic pool of glycine may be required for the polyglycylation of the massive amounts of tubulin in the fly's giant sperm. The male-sterile phenotype of Ntl mutants may provide a powerful genetic system for studying the function of an SLC6 transporter family in a model organism.

  5. Transcript levels of members of the SLC2 and SLC5 families of glucose transport proteins in eel swimbladder tissue: the influence of silvering and the influence of a nematode infection.

    Science.gov (United States)

    Schneebauer, Gabriel; Mauracher, David; Fiechtner, Birgit; Pelster, Bernd

    2018-04-01

    The rate of glucose metabolism has been shown to be correlated to glucose uptake in swimbladder gas gland cells. Therefore, it is assumed that in the European eel silvering, i.e., the preparation of the eel for the spawning migration to the Sargasso Sea, coincides with an enhanced capacity for glucose uptake. To test this hypothesis expression of all known glucose transport proteins has been assessed at the transcript level in yellow and in silver eels, and we also included Anguillicola crassus infected swimbladders. Glucose uptake by rete mirabile endothelial cells could be crucial for the countercurrent exchange capacity of the rete. Therefore, this tissue was also included in our analysis. The results revealed expression of ten different members of the slc2 family of glucose transporters, of four slc5 family members, and of kiaa1919 in gas gland tissue. Glucose transporters of the slc2 family were expressed at very high level, and slc2a1b made up about 80% of all slc2 family members, irrespective of the developmental state or the infection status of the eel. Overall, the slc5 family contributed to only about 8% of all detected glucose transport transcripts in gas gland tissue, and the slc2 family to more than 85%. In rete capillaries, the contribution of sodium-dependent glucose transporters was significantly higher, leaving only 66% for the slc2 family of glucose transporters. Neither silvering nor the infection status had a significant effect on the expression of glucose transporters in swimbladder gas gland tissue, suggesting that glucose metabolism of eel gas gland cells may not be related to transcriptional changes of glucose transport proteins.

  6. Fructose Synthesis and Transport at the Uterine-Placental Interface of Pigs: Cell-Specific Localization of SLC2A5, SLC2A8, and Components of the Polyol Pathway.

    Science.gov (United States)

    Steinhauser, Chelsie B; Landers, McKinsey; Myatt, Louise; Burghardt, Robert C; Vallet, Jeffrey L; Bazer, Fuller W; Johnson, Greg A

    2016-11-01

    The fetal fluids and uterine flushings of pigs contain higher concentrations of fructose than glucose, but fructose is not detected in maternal blood. Fructose can be synthesized from glucose via enzymes of the polyol pathway, aldose reductase (AKR1B1) and sorbitol dehydrogenase (SORD), transported across cell membranes by solute carriers SLC2A5 and SLC2A8, and converted to fructose-1-phosphate by ketohexokinase (KHK). SLC2A8, SLC2A5, AKR1B1, SORD, and KHK mRNAs and proteins were analyzed using quantitative PCR and immunohistochemistry or in situ hybridization in endometria and placentae of cyclic and pregnant gilts, cyclic gilts injected with estrogen, and ovariectomized gilts injected with progesterone. Progesterone up-regulated SLC2A8 protein in uterine luminal (LE) and glandular epithelia during the peri-implantation period, and expression became exclusively placental, chorion and blood vessels, after Day 30. P4 up-regulated SLC2A5 mRNA in uterine LE and glandular epithelia after implantation, and the chorion expressed SLC2A5 between Days 30 and 85. AKR1B1 and SORD proteins localized to uterine LE during the peri-implantation period, but expression switched to chorion by Day 20 and was maintained through Day 85. Uterine expression of AKR1B1 mRNA was down-regulated by estrogen. KHK protein localized to trophectoderm/chorion throughout gestation. These results provide evidence that components for the conversion of glucose to fructose and for fructose transport are present at the uterine-placental interface of pigs. The shift in expression from LE to chorion during pregnancy suggests free-floating conceptuses are supported by fructose synthesized by the uterus, but after implantation, the chorion becomes self-sufficient for fructose synthesis and transport. © 2016 by the Society for the Study of Reproduction, Inc.

  7. Characterization of SLC transporters in human skin

    Directory of Open Access Journals (Sweden)

    Marion Alriquet

    2015-03-01

    Full Text Available Most identified drug transporters belong to the ATP-binding Cassette (ABC and Solute Carrier (SLC families. Recent research indicates that some of these transporters play an important role in the absorption, distribution and excretion of drugs, and are involved in clinically relevant drug-drug interactions for systemic drugs. However, very little is known about the role of drug transporters in human skin in the disposition of topically applied drugs and their involvement in drug-drug interactions. The aim of this work was to compare the expression in human skin (vs human hepatocytes and kidney of SLC transporters included in the EMA guidance as the most likely clinical sources of drug interactions. The expression of SLC transporters in human tissues was analyzed by quantitative RT-PCR. Modulation of SLC47A1 and SLC47A2 (MATE1 and MATE2 expression was analyzed after treatment of human skin in organ-culture with rifampicin and UV irradiation. The expression of SLCO2B1 (OATPB, SLCO3A1 (OATPD, SLCO4A1 (OATPE, SLC47A1 and SLC47A2 (MATE1 and MATE2 was detected in human skin, OATPE and MATE1 being the most expressed. OATPE is about 70 times more expressed in human skin than in human hepatocytes. Moreover, the expression of SLC47A1 and SLC47A2 was down-regulated after treatment with rifampicin or after exposure to UV light. The present findings demonstrate that SLCO4A1 (OATPE and SLC47A1 (MATE1 are highly expressed in human skin and suggest the involvement of SLC transporters in the disposition of topically applied drugs.

  8. Slc3a2 Mediates Branched-Chain Amino-Acid-Dependent Maintenance of Regulatory T Cells

    Directory of Open Access Journals (Sweden)

    Kayo Ikeda

    2017-11-01

    Full Text Available Summary: Foxp3+ regulatory T (Treg cells, which suppress immune responses, are highly proliferative in vivo. However, it remains unclear how the active replication of Treg cells is maintained in vivo. Here, we show that branched-chain amino acids (BCAAs, including isoleucine, are required for maintenance of the proliferative state of Treg cells via the amino acid transporter Slc3a2-dependent metabolic reprogramming. Mice fed BCAA-reduced diets showed decreased numbers of Foxp3+ Treg cells with defective in vivo proliferative capacity. Mice lacking Slc3a2 specifically in Foxp3+ Treg cells showed impaired in vivo replication and decreased numbers of Treg cells. Slc3a2-deficient Treg cells showed impaired isoleucine-induced activation of the mTORC1 pathway and an altered metabolic state. Slc3a2 mutant mice did not show an isoleucine-induced increase of Treg cells in vivo and exhibited multi-organ inflammation. Taken together, these findings demonstrate that BCAA controls Treg cell maintenance via Slc3a2-dependent metabolic regulation. : Treg cells regulate excess immune responses and are highly proliferative in vivo. Ikeda et al. find that branched-chain amino acids (BCAAs are essentially required to maintain expansion and the suppressive capacity of Treg cells via Slc3a2 and mTORC1. Keywords: Treg cells, amino acids, immunometabolism, immune regulation, transporter

  9. The orphan transporter v7-3 (slc6a15) is a Na+-dependent neutral amino acid transporter (B0AT2)

    DEFF Research Database (Denmark)

    Bröer, Angelika; Tietze, Nadine; Kowalczuk, Sonja

    2006-01-01

    . The transporter is functionally and sequence related to B(0)AT1 (slc6a19) and was hence named B(0)AT2. Leucine, isoleucine, valine, proline and methionine were recognized by the transporter, with values of K(0.5) (half-saturation constant) ranging from 40 to 200 microM. Alanine, glutamine and phenylalanine were...

  10. Global transcriptome profiling identifies KLF15 and SLC25A10 as modifiers of adipocytes insulin sensitivity in obese women.

    Directory of Open Access Journals (Sweden)

    Agné Kulyté

    Full Text Available Although the mechanisms linking obesity to insulin resistance (IR and type 2 diabetes (T2D are not entirely understood, it is likely that alterations of adipose tissue function are involved. The aim of this study was to identify new genes controlling insulin sensitivity in adipocytes from obese women with either insulin resistant (OIR or sensitive (OIS adipocytes. Insulin sensitivity was first determined by measuring lipogenesis in isolated adipocytes from abdominal subcutaneous white adipose tissue (WAT in a large observational study. Lipogenesis was measured under conditions where glucose transport was the rate limiting step and reflects in vivo insulin sensitivity. We then performed microarray-based transcriptome profiling on subcutaneous WAT specimen from a subgroup of 9 lean, 21 OIS and 18 obese OIR women. We could identify 432 genes that were differentially expressed between the OIR and OIS group (FDR ≤5%. These genes are enriched in pathways related to glucose and amino acid metabolism, cellular respiration, and insulin signaling, and include genes such as SLC2A4, AKT2, as well as genes coding for enzymes in the mitochondria respiratory chain. Two IR-associated genes, KLF15 encoding a transcription factor and SLC25A10 encoding a dicarboxylate carrier, were selected for functional evaluation in adipocytes differentiated in vitro. Knockdown of KLF15 and SLC25A10 using siRNA inhibited insulin-stimulated lipogenesis in adipocytes. Transcriptome profiling of siRNA-treated cells suggested that KLF15 might control insulin sensitivity by influencing expression of PPARG, PXMP2, AQP7, LPL and genes in the mitochondrial respiratory chain. Knockdown of SLC25A10 had only modest impact on the transcriptome, suggesting that it might directly influence insulin sensitivity in adipocytes independently of transcription due to its important role in fatty acid synthesis. In summary, this study identifies novel genes associated with insulin sensitivity in

  11. Hypotonic activation of the myo-inositol transporter SLC5A3 in HEK293 cells probed by cell volumetry, confocal and super-resolution microscopy.

    Directory of Open Access Journals (Sweden)

    Joseph Andronic

    Full Text Available Swelling-activated pathways for myo-inositol, one of the most abundant organic osmolytes in mammalian cells, have not yet been identified. The present study explores the SLC5A3 protein as a possible transporter of myo-inositol in hyponically swollen HEK293 cells. To address this issue, we examined the relationship between the hypotonicity-induced changes in plasma membrane permeability to myo-inositol P ino [m/s] and expression/localization of SLC5A3. P ino values were determined by cell volumetry over a wide tonicity range (100-275 mOsm in myo-inositol-substituted solutions. While being negligible under mild hypotonicity (200-275 mOsm, P ino grew rapidly at osmolalities below 200 mOsm to reach a maximum of ∼ 3 nm/s at 100-125 mOsm, as indicated by fast cell swelling due to myo-inositol influx. The increase in P ino resulted most likely from the hypotonicity-mediated incorporation of cytosolic SLC5A3 into the plasma membrane, as revealed by confocal fluorescence microscopy of cells expressing EGFP-tagged SLC5A3 and super-resolution imaging of immunostained SLC5A3 by direct stochastic optical reconstruction microscopy (dSTORM. dSTORM in hypotonic cells revealed a surface density of membrane-associated SLC5A3 proteins of 200-2000 localizations/μm2. Assuming SLC5A3 to be the major path for myo-inositol, a turnover rate of 80-800 myo-inositol molecules per second for a single transporter protein was estimated from combined volumetric and dSTORM data. Hypotonic stress also caused a significant upregulation of SLC5A3 gene expression as detected by semiquantitative RT-PCR and Western blot analysis. In summary, our data provide first evidence for swelling-mediated activation of SLC5A3 thus suggesting a functional role of this transporter in hypotonic volume regulation of mammalian cells.

  12. Mutations in the GABA Transporter SLC6A1 Cause Epilepsy with Myoclonic-Atonic Seizures

    DEFF Research Database (Denmark)

    Carvill, Gemma L; McMahon, Jacinta M; Schneider, Amy

    2015-01-01

    GAT-1, encoded by SLC6A1, is one of the major gamma-aminobutyric acid (GABA) transporters in the brain and is responsible for re-uptake of GABA from the synapse. In this study, targeted resequencing of 644 individuals with epileptic encephalopathies led to the identification of six SLC6A1 mutatio...

  13. mTORC1 Activator SLC38A9 Is Required to Efflux Essential Amino Acids from Lysosomes and Use Protein as a Nutrient.

    Science.gov (United States)

    Wyant, Gregory A; Abu-Remaileh, Monther; Wolfson, Rachel L; Chen, Walter W; Freinkman, Elizaveta; Danai, Laura V; Vander Heiden, Matthew G; Sabatini, David M

    2017-10-19

    The mTORC1 kinase is a master growth regulator that senses many environmental cues, including amino acids. Activation of mTORC1 by arginine requires SLC38A9, a poorly understood lysosomal membrane protein with homology to amino acid transporters. Here, we validate that SLC38A9 is an arginine sensor for the mTORC1 pathway, and we uncover an unexpectedly central role for SLC38A9 in amino acid homeostasis. SLC38A9 mediates the transport, in an arginine-regulated fashion, of many essential amino acids out of lysosomes, including leucine, which mTORC1 senses through the cytosolic Sestrin proteins. SLC38A9 is necessary for leucine generated via lysosomal proteolysis to exit lysosomes and activate mTORC1. Pancreatic cancer cells, which use macropinocytosed protein as a nutrient source, require SLC38A9 to form tumors. Thus, through SLC38A9, arginine serves as a lysosomal messenger that couples mTORC1 activation to the release from lysosomes of the essential amino acids needed to drive cell growth. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Defective enamel and bone development in sodium-dependent citrate transporter (NaCT Slc13a5 deficient mice.

    Directory of Open Access Journals (Sweden)

    Armando R Irizarry

    Full Text Available There has been growing recognition of the essential roles of citrate in biomechanical properties of mineralized tissues, including teeth and bone. However, the sources of citrate in these tissues have not been well defined, and the contribution of citrate to the regulation of odontogenesis and osteogenesis has not been examined. Here, tooth and bone phenotypes were examined in sodium-dependent citrate transporter (NaCT Slc13a5 deficient C57BL/6 mice at 13 and 32 weeks of age. Slc13a5 deficiency led to defective tooth development, characterized by absence of mature enamel, formation of aberrant enamel matrix, and dysplasia and hyperplasia of the enamel organ epithelium that progressed with age. These abnormalities were associated with fragile teeth with a possible predisposition to tooth abscesses. The lack of mature enamel was consistent with amelogenesis imperfecta. Furthermore, Slc13a5 deficiency led to decreased bone mineral density and impaired bone formation in 13-week-old mice but not in older mice. The findings revealed the potentially important role of citrate and Slc13a5 in the development and function of teeth and bone.

  15. Drosophila SLC5A11 Mediates Hunger by Regulating K(+) Channel Activity.

    Science.gov (United States)

    Park, Jin-Yong; Dus, Monica; Kim, Seonil; Abu, Farhan; Kanai, Makoto I; Rudy, Bernardo; Suh, Greg S B

    2016-08-08

    Hunger is a powerful drive that stimulates food intake. Yet, the mechanism that determines how the energy deficits that result in hunger are represented in the brain and promote feeding is not well understood. We previously described SLC5A11-a sodium/solute co-transporter-like-(or cupcake) in Drosophila melanogaster, which is required for the fly to select a nutritive sugar over a sweeter nonnutritive sugar after periods of food deprivation. SLC5A11 acts on approximately 12 pairs of ellipsoid body (EB) R4 neurons to trigger the selection of nutritive sugars, but the underlying mechanism is not understood. Here, we report that the excitability of SLC5A11-expressing EB R4 neurons increases dramatically during starvation and that this increase is abolished in the SLC5A11 mutation. Artificial activation of SLC5A11-expresssing neurons is sufficient to promote feeding and hunger-driven behaviors; silencing these neurons has the opposite effect. Notably, SLC5A11 transcript levels in the brain increase significantly when flies are starved and decrease shortly after starved flies are refed. Furthermore, expression of SLC5A11 is sufficient for promoting hunger-driven behaviors and enhancing the excitability of SLC5A11-expressing neurons. SLC5A11 inhibits the function of the Drosophila KCNQ potassium channel in a heterologous expression system. Accordingly, a knockdown of dKCNQ expression in SLC5A11-expressing neurons produces hunger-driven behaviors even in fed flies, mimicking the overexpression of SLC5A11. We propose that starvation increases SLC5A11 expression, which enhances the excitability of SLC5A11-expressing neurons by suppressing dKCNQ channels, thereby conferring the hunger state. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Upregulation of the Creatine Transporter Slc6A8 by Klotho

    Directory of Open Access Journals (Sweden)

    Ahmad Almilaji

    2014-11-01

    Full Text Available Background/Aims: The transmembrane Klotho protein contributes to inhibition of 1,25(OH2D3 formation. The extracellular domain of Klotho protein could function as an enzyme with e.g. β-glucuronidase activity, be cleaved off and be released into blood and cerebrospinal fluid. Klotho regulates several cellular transporters. Klotho protein deficiency accelerates the appearance of age related disorders including neurodegeneration and muscle wasting and eventually leads to premature death. The main site of Klotho protein expression is the kidney. Klotho protein is also appreciably expressed in other tissues including chorioid plexus. The present study explored the effect of Klotho protein on the creatine transporter CreaT (Slc6A8, which participates in the maintenance of neuronal function and survival. Methods: To this end cRNA encoding Slc6A8 was injected into Xenopus oocytes with and without additional injection of cRNA encoding Klotho protein. Creatine transporter CreaT (Slc6A8 activity was estimated from creatine induced current determined by two-electrode voltage-clamp. Results: Coexpression of Klotho protein significantly increased creatine-induced current in Slc6A8 expressing Xenopus oocytes. Coexpression of Klotho protein delayed the decline of creatine induced current following inhibition of carrier insertion into the cell membrane by brefeldin A (5 µM. The increase of creatine induced current by coexpression of Klotho protein in Slc6A8 expressing Xenopus oocytes was reversed by β-glucuronidase inhibitor (DSAL. Similarly, treatment of Slc6A8 expressing Xenopus oocytes with recombinant human alpha Klotho protein significantly increased creatine induced current. Conclusion: Klotho protein up-regulates the activity of creatine transporter CreaT (Slc6A8 by stabilizing the carrier protein in the cell membrane, an effect requiring β-glucuronidase activity of Klotho protein.

  17. Inhibition of SLC1A5 sensitizes colorectal cancer to cetuximab.

    Science.gov (United States)

    Ma, Huanrong; Wu, Zhenzhen; Peng, Jianjun; Li, Yang; Huang, Hongxiang; Liao, Yi; Zhou, Minyu; Sun, Li; Huang, Na; Shi, Min; Bin, Jianping; Liao, Yulin; Rao, Jinjun; Wang, Lin; Liao, Wangjun

    2018-06-15

    Cetuximab resistance is a key barrier in treating metastatic colorectal cancer (mCRC). Targeting of metabolic resources import could resensitize drug-resistant cancer cells to anticancer treatments. Here we showed that the expression of the glutamine transporter solute carrier 1 family member 5 (SLC1A5) in clinical CRC samples of patients resisted to cetuximab was significantly higher than in those of patients responded to cetuximab. Inhibition of SLC1A5 by shRNA-mediated gene silencing or pharmacological inhibitor significantly suppressed the growth of CRC. Moreover, inhibition of SLC1A5 significantly enhanced the inhibitory efficacy of cetuximab on CRC proliferation both in vitro and in vivo. Mechanistically, SLC1A5 inhibition facilitated EGFR degradation through the ubiquitin-proteasome pathway, and decreased the expression of nuclear EGFR, both of which might have contribution to the improved response to cetuximab. This study provides the metabolic molecule SLC1A5 as a potential therapeutic target to increase the efficacy of cetuximab on CRC. © 2018 UICC.

  18. Soy-dairy protein blend and whey protein ingestion after resistance exercise increases amino acid transport and transporter expression in human skeletal muscle

    Science.gov (United States)

    Reidy, P. T.; Walker, D. K.; Dickinson, J. M.; Gundermann, D. M.; Drummond, M. J.; Timmerman, K. L.; Cope, M. B.; Mukherjea, R.; Jennings, K.; Volpi, E.

    2014-01-01

    Increasing amino acid availability (via infusion or ingestion) at rest or postexercise enhances amino acid transport into human skeletal muscle. It is unknown whether alterations in amino acid availability, from ingesting different dietary proteins, can enhance amino acid transport rates and amino acid transporter (AAT) mRNA expression. We hypothesized that the prolonged hyperaminoacidemia from ingesting a blend of proteins with different digestion rates postexercise would enhance amino acid transport into muscle and AAT expression compared with the ingestion of a rapidly digested protein. In a double-blind, randomized clinical trial, we studied 16 young adults at rest and after acute resistance exercise coupled with postexercise (1 h) ingestion of either a (soy-dairy) protein blend or whey protein. Phenylalanine net balance and transport rate into skeletal muscle were measured using stable isotopic methods in combination with femoral arteriovenous blood sampling and muscle biopsies obtained at rest and 3 and 5 h postexercise. Phenylalanine transport into muscle and mRNA expression of select AATs [system L amino acid transporter 1/solute-linked carrier (SLC) 7A5, CD98/SLC3A2, system A amino acid transporter 2/SLC38A2, proton-assisted amino acid transporter 1/SLC36A1, cationic amino acid transporter 1/SLC7A1] increased to a similar extent in both groups (P protein blend resulted in a prolonged and positive net phenylalanine balance during postexercise recovery compared with whey protein (P protein synthesis increased similarly between groups. We conclude that, while both protein sources enhanced postexercise AAT expression, transport into muscle, and myofibrillar protein synthesis, postexercise ingestion of a protein blend results in a slightly prolonged net amino acid balance across the leg compared with whey protein. PMID:24699854

  19. Slc5a8, a Na+-coupled high-affinity transporter for short-chain fatty acids, is a conditional tumour suppressor in colon that protects against colitis and colon cancer under low-fibre dietary conditions.

    Science.gov (United States)

    Gurav, Ashish; Sivaprakasam, Sathish; Bhutia, Yangzom D; Boettger, Thomas; Singh, Nagendra; Ganapathy, Vadivel

    2015-07-15

    Mammalian colon harbours trillions of bacteria under physiological conditions; this symbiosis is made possible because of a tolerized response from the mucosal immune system. The mechanisms underlying this tolerogenic phenomenon remain poorly understood. In the present study we show that Slc5a8 (solute carrier gene family 5a, member 8), a Na(+)-coupled high-affinity transporter in colon for the bacterial fermentation product butyrate, plays a critical role in this process. Among various immune cells in colon, dendritic cells (DCs) are unique not only in their accessibility to luminal contents but also in their ability to induce tolerogenic phenotype in T-cells. We found that DCs exposed to butyrate express the immunosuppressive enzymes indoleamine 2,3-dioxygenase 1 (IDO1) and aldehyde dehydrogenase 1A2 (Aldh1A2), promote conversion of naive T-cells into immunosuppressive forkhead box P3(+) (FoxP3(+)) Tregs (regulatory T-cells) and suppress conversion of naive T-cells into pro-inflammatory interferon (IFN)-γ-producing cells. Slc5a8-null DCs do not induce IDO1 and Aldh1A2 and do not generate Tregs or suppress IFN-γ-producing T-cells in response to butyrate. We also provide in vivo evidence for an obligatory role for Slc5a8 in suppression of IFN-γ-producing T-cells. Furthermore, Slc5a8 protects against colitis and colon cancer under conditions of low-fibre intake but not when dietary fibre intake is optimal. This agrees with the high-affinity nature of the transporter to mediate butyrate entry into cells. We conclude that Slc5a8 is an obligatory link between dietary fibre and mucosal immune system via the bacterial metabolite butyrate and that this transporter is a conditional tumour suppressor in colon linked to dietary fibre content. © 2015 Authors; published by Portland Press Limited.

  20. Transport via SLC5A8 with Subsequent Inhibition of Histone Deacetylases HDAC1 and HDAC3 Underlies the Antitumor Activity of 3-Bromopyruvate

    Science.gov (United States)

    Thangaraju, Muthusamy; Karunakaran, Senthil K.; Itagaki, Shiro; Gopal, Elangovan; Elangovan, Selvakumar; Prasad, Puttur D.; Ganapathy, Vadivel

    2009-01-01

    Background 3-Bromopyruvate is an alkylating agent with antitumor activity. It is currently believed that blockade of ATP production from glycolysis and mitochondria is the primary mechanism responsible for this antitumor effect. The present studies have uncovered a new and novel mechanism for the antitumor activity of 3-bromopyruvate. Methods Transport of 3-bromopyruvate via SLC5A8, a tumor suppressor and a Na+-coupled electrogenic transporter for short-chain monocarboxylates, was studied using a mammalian cell expression and the Xenopus laevis oocyte expression systems. The effect of 3-bromopyruvate on histone deacetylases (HDACs) was monitored using the lysate of the human breast cancer cell line MCF7 and human recombinant HDAC isoforms as the enzyme sources. Cell viability was monitored by FACS analysis and colony formation assay. Acetylation status of histone H4 was evaluated by Western blot. Results 3-Bromopyruvate is a transportable substrate for SLC5A8, with the transport process being Na+-coupled and electrogenic. MCF7 cells do not express SLC5A8 and are not affected by 3-bromopyruvate. However, when transfected with SLC5A8 or treated with inhibitors of DNA methylation, these cells undergo apoptosis in the presence of 3-bromopyruvate. This cell death is associated with inhibition of HDAC1/HDAC3. Studies with different isoforms of human recombinant HDACs identify HDAC1 and HDAC3 as the targets for 3-bromopyruvate. Conclusions 3-Bromopyruvate is transported into cells actively via the tumor suppressor SLC5A8 and the process is energized by an electrochemical Na+ gradient. Ectopic expression of the transporter in MCF7 cells leads to apoptosis, and the mechanism involves inhibition of HDAC1/HDAC3. PMID:19637353

  1. Transport by SLC5A8 with subsequent inhibition of histone deacetylase 1 (HDAC1) and HDAC3 underlies the antitumor activity of 3-bromopyruvate.

    Science.gov (United States)

    Thangaraju, Muthusamy; Karunakaran, Senthil K; Itagaki, Shiro; Gopal, Elangovan; Elangovan, Selvakumar; Prasad, Puttur D; Ganapathy, Vadivel

    2009-10-15

    3-bromopyruvate is an alkylating agent with antitumor activity. It is currently believed that blockade of adenosine triphosphate production from glycolysis and mitochondria is the primary mechanism responsible for this antitumor effect. The current studies uncovered a new and novel mechanism for the antitumor activity of 3-bromopyruvate. The transport of 3-bromopyruvate by sodium-coupled monocarboxylate transporter SMCT1 (SLC5A8), a tumor suppressor and a sodium (Na+)-coupled, electrogenic transporter for short-chain monocarboxylates, was studied using a mammalian cell expression and the Xenopus laevis oocyte expression systems. The effect of 3-bromopyruvate on histone deacetylases (HDACs) was monitored using the lysate of the human breast cancer cell line MCF7 and human recombinant HDAC isoforms as the enzyme sources. Cell viability was monitored by fluorescence-activated cell-sorting analysis and colony-formation assay. The acetylation status of histone H4 was evaluated by Western blot analysis. 3-Bromopyruvate is a transportable substrate for SLC5A8, and that transport process is Na+-coupled and electrogenic. MCF7 cells did not express SLC5A8 and were not affected by 3-bromopyruvate. However, when transfected with SLC5A8 or treated with inhibitors of DNA methylation, these cells underwent apoptosis in the presence of 3-bromopyruvate. This cell death was associated with the inhibition of HDAC1/HDAC3. Studies with different isoforms of human recombinant HDACs identified HDAC1 and HDAC3 as the targets for 3-bromopyruvate. 3-Bromopyruvate was transported into cells actively through the tumor suppressor SLC5A8, and the process was energized by an electrochemical Na+ gradient. Ectopic expression of the transporter in MCF7 cells led to apoptosis, and the mechanism involved the inhibition of HDAC1/HDAC3. Copyright (c) 2009 American Cancer Society.

  2. SLC5A8 gene, a transporter of butyrate: a gut flora metabolite, is frequently methylated in African American colon adenomas.

    Directory of Open Access Journals (Sweden)

    Hassan Brim

    Full Text Available Colon cancer is one of the leading causes of cancer related deaths. Its impact on African Americans (AAs is higher than in the general population both in the incidence and mortality from the disease. Colon cancer aggressiveness in AAs as well as non-frequent check-ups and follow up in this population have been proposed as ways to explain the observed discrepancies. These facts made the detection of early carcinogenesis markers in this population a priority.Here, we analyzed 50 colon adenomas from AA patients for both microsatellite instability (MSI and the methylation status of SLC5A8 gene. This gene's product is involved in the transport of butyrate that has anti-proliferative properties through its effects on histone acetylation and gene expression. A proteomic analysis to check the expressed histones in adenoma and normal tissues was also performed.The analyzed samples displayed 82% (n = 41 methylation level of SLC5A8 gene in adenomas. The MSI-H (high adenoma were about 18% (n = 9 while the rest were mostly MSS (microsatellite stable with few MSI-L (Low. No association was found between SLC5A8 methylation and the MSI status. Also, there was no association between SLC5A8 methylation and the sex and age of the patients. However, there were more right sided adenomas with SLC5A8 methylation than the left sided ones. The proteomic analysis revealed distinct histone expression profiles between normal and adenoma tissues.SLC5A8 is highly methylated in AA colon adenomas which points to its potential use as a marker for early detection. The MSI rate is similar to that found in colon cancer tumors in AAs. These findings suggest that both processes stem from the same epigenetic and genetic events occurring at an early stage in colon carcinogenesis in AAs.

  3. Determination of Unbound Partition Coefficient and in Vitro-in Vivo Extrapolation for SLC13A Transporter-Mediated Uptake.

    Science.gov (United States)

    Riccardi, Keith; Li, Zhenhong; Brown, Janice A; Gorgoglione, Matthew F; Niosi, Mark; Gosset, James; Huard, Kim; Erion, Derek M; Di, Li

    2016-10-01

    Unbound partition coefficient (Kpuu) is important to an understanding of the asymmetric free drug distribution of a compound between cells and medium in vitro, as well as between tissue and plasma in vivo, especially for transporter-mediated processes. Kpuu was determined for a set of compounds from the SLC13A family that are inhibitors and substrates of transporters in hepatocytes and transporter-transfected cell lines. Enantioselectivity was observed, with (R)-enantiomers achieving much higher Kpuu (>4) than the (S)-enantiomers (<1) in human hepatocytes and SLC13A5-transfected human embryonic 293 cells. The intracellular free drug concentration correlated directly with in vitro pharmacological activity rather than the nominal concentration in the assay because of the high Kpuu mediated by SLC13A5 transporter uptake. Delivery of the diacid PF-06649298 directly or via hydrolysis of the ethyl ester prodrug PF-06757303 resulted in quite different Kpuu values in human hepatocytes (Kpuu of 3 for diacid versus 59 for prodrug), which was successfully modeled on the basis of passive diffusion, active uptake, and conversion rate from ester to diacid using a compartmental model. Kpuu values changed with drug concentrations; lower values were observed at higher concentrations possibly owing to a saturation of transporters. Michaelis-Menten constant (Km) of SLC13A5 was estimated to be 24 μM for PF-06649298 in human hepatocytes. In vitro Kpuu obtained from rat suspension hepatocytes supplemented with 4% fatty acid free bovine serum albumin showed good correlation with in vivo Kpuu of liver-to-plasma, illustrating the potential of this approach to predict in vivo Kpuu from in vitro systems. Copyright © 2016 by The American Society for Pharmacology and Experimental Therapeutics.

  4. Control of amino acid transport coordinates metabolic reprogramming in T-cell malignancy.

    Science.gov (United States)

    Grzes, K M; Swamy, M; Hukelmann, J L; Emslie, E; Sinclair, L V; Cantrell, D A

    2017-12-01

    This study explores the regulation and importance of System L amino acid transport in a murine model of T-cell acute lymphoblastic leukemia (T-ALL) caused by deletion of phosphatase and tensin homolog deleted on chromosome 10 (PTEN). There has been a strong focus on glucose transport in leukemias but the present data show that primary T-ALL cells have increased transport of multiple nutrients. Specifically, increased leucine transport in T-ALL fuels mammalian target of rapamycin complex 1 (mTORC1) activity which then sustains expression of hypoxia inducible factor-1α (HIF1α) and c-Myc; drivers of glucose metabolism in T cells. A key finding is that PTEN deletion and phosphatidylinositol (3,4,5)-trisphosphate (PtdIns(3,4,5)P 3 ) accumulation is insufficient to initiate leucine uptake, mTORC1 activity, HIF1α or c-Myc expression in T cells and hence cannot drive T-ALL metabolic reprogramming. Instead, a key regulator for leucine transport in T-ALL is identified as NOTCH. Mass spectrometry based proteomics identifies SLC7A5 as the predominant amino acid transporter in primary PTEN -/- T-ALL cells. Importantly, expression of SLC7A5 is critical for the malignant transformation induced by PTEN deletion. These data reveal the importance of regulated amino acid transport for T-cell malignancies, highlighting how a single amino acid transporter can have a key role.

  5. Analyses of SLC13A5-epilepsy patients reveal perturbations of TCA cycle.

    Science.gov (United States)

    Bainbridge, Matthew N; Cooney, Erin; Miller, Marcus; Kennedy, Adam D; Wulff, Jacob E; Donti, Taraka; Jhangiani, Shalini N; Gibbs, Richard A; Elsea, Sarah H; Porter, Brenda E; Graham, Brett H

    2017-08-01

    To interrogate the metabolic profile of five subjects from three families with rare, nonsense and missense mutations in SLC13A5 and Early Infantile Epileptic Encephalopathies (EIEE) characterized by severe, neonatal onset seizures, psychomotor retardation and global developmental delay. Mass spectrometry of plasma, CSF and urine was used to identify consistently dysregulated analytes in our subjects. Distinctive elevations of citrate and dysregulation of citric acid cycle intermediates, supporting the hypothesis that loss of SLC13A5 function alters tricarboxylic acid cycle (TCA) metabolism and may disrupt metabolic compartmentation in the brain. Our results indicate that analysis of plasma citrate and other TCA analytes in SLC13A5 deficient patients define a diagnostic metabolic signature that can aid in diagnosing children with this disease. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Serum uric acid concentrations and SLC2A9 genetic variation in Hispanic children: the Viva La Familia Study.

    Science.gov (United States)

    Voruganti, V Saroja; Laston, Sandra; Haack, Karin; Mehta, Nitesh R; Cole, Shelley A; Butte, Nancy F; Comuzzie, Anthony G

    2015-04-01

    Elevated concentrations of serum uric acid are associated with increased risk of gout and renal and cardiovascular diseases. Genetic studies in adults have consistently identified associations of solute carrier family 2, member 9 (SLC2A9), polymorphisms with variation in serum uric acid. However, it is not known whether the association of serum uric acid with SLC2A9 polymorphisms manifests in children. The aim was to investigate whether variation in serum uric acid is under genetic influence and whether the association with SLC2A9 polymorphisms generalizes to Hispanic children of the Viva La Familia Study. We conducted a genomewide association study with 1.1 million genetic markers in 815 children. We found serum uric acid to be significantly heritable [h(2) ± SD = 0.45 ± 0.08, P = 5.8 × 10(-11)] and associated with SLC2A9 variants (P values between 10(-16) and 10(-7)). Several of the significantly associated polymorphisms were previously identified in studies in adults. We also found positive genetic correlations between serum uric acid and BMI z score (ρG = 0.45, P = 0.002), percentage of body fat (ρG = 0.28, P = 0.04), fat mass (ρG = 0.34, P = 0.02), waist circumference (ρG = 0.42, P = 0.003), and waist-to-height ratio (ρG = 0.46, P = 0.001). Our results show that variation in serum uric acid in Hispanic children is under considerable genetic influence and is associated with obesity-related phenotypes. As in adults, genetic variation in SLC2A9 is associated with serum uric acid concentrations, an important biomarker of renal and cardiovascular disease risk, in Hispanic children. © 2015 American Society for Nutrition.

  7. SLC37A1 and SLC37A2 are phosphate-linked, glucose-6-phosphate antiporters.

    Directory of Open Access Journals (Sweden)

    Chi-Jiunn Pan

    Full Text Available Blood glucose homeostasis between meals depends upon production of glucose within the endoplasmic reticulum (ER of the liver and kidney by hydrolysis of glucose-6-phosphate (G6P into glucose and phosphate (P(i. This reaction depends on coupling the G6P transporter (G6PT with glucose-6-phosphatase-α (G6Pase-α. Only one G6PT, also known as SLC37A4, has been characterized, and it acts as a P(i-linked G6P antiporter. The other three SLC37 family members, predicted to be sugar-phosphate:P(i exchangers, have not been characterized functionally. Using reconstituted proteoliposomes, we examine the antiporter activity of the other SLC37 members along with their ability to couple with G6Pase-α. G6PT- and mock-proteoliposomes are used as positive and negative controls, respectively. We show that SLC37A1 and SLC37A2 are ER-associated, P(i-linked antiporters, that can transport G6P. Unlike G6PT, neither is sensitive to chlorogenic acid, a competitive inhibitor of physiological ER G6P transport, and neither couples to G6Pase-α. We conclude that three of the four SLC37 family members are functional sugar-phosphate antiporters. However, only G6PT/SLC37A4 matches the characteristics of the physiological ER G6P transporter, suggesting the other SLC37 proteins have roles independent of blood glucose homeostasis.

  8. Sialin (SLC17A5) functions as a nitrate transporter in the plasma membrane

    Science.gov (United States)

    Qin, Lizheng; Liu, Xibao; Sun, Qifei; Fan, Zhipeng; Xia, Dengsheng; Ding, Gang; Ong, Hwei Ling; Adams, David; Gahl, William A.; Zheng, Changyu; Qi, Senrong; Jin, Luyuan; Zhang, Chunmei; Gu, Liankun; He, Junqi; Deng, Dajun; Ambudkar, Indu S.; Wang, Songlin

    2012-01-01

    In vivo recycling of nitrate (NO3−) and nitrite (NO2−) is an important alternative pathway for the generation of nitric oxide (NO) and maintenance of systemic nitrate–nitrite–NO balance. More than 25% of the circulating NO3− is actively removed and secreted by salivary glands. Oral commensal bacteria convert salivary NO3− to NO2−, which enters circulation and leads to NO generation. The transporters for NO3− in salivary glands have not yet been identified. Here we report that sialin (SLC17A5), mutations in which cause Salla disease and infantile sialic acid storage disorder (ISSD), functions as an electrogenic 2NO3−/H+ cotransporter in the plasma membrane of salivary gland acinar cells. We have identified an extracellular pH-dependent anion current that is carried by NO3− or sialic acid (SA), but not by Br−, and is accompanied by intracellular acidification. Both responses were reduced by knockdown of sialin expression and increased by the plasma membrane-targeted sialin mutant (L22A-L23A). Fibroblasts from patients with ISSD displayed reduced SA- and NO3−-induced currents compared with healthy controls. Furthermore, expression of disease-associated sialin mutants in fibroblasts and salivary gland cells suppressed the H+-dependent NO3− conductance. Importantly, adenovirus-dependent expression of the sialinH183R mutant in vivo in pig salivary glands decreased NO3− secretion in saliva after intake of a NO3−-rich diet. Taken together, these data demonstrate that sialin mediates nitrate influx into salivary gland and other cell types. We suggest that the 2NO3−/H+ transport function of sialin in salivary glands can contribute significantly to clearance of serum nitrate, as well as nitrate recycling and physiological nitrite-NO homeostasis. PMID:22778404

  9. The histidine transporter SLC15A4 coordinates mTOR-dependent inflammatory responses and pathogenic antibody production.

    Science.gov (United States)

    Kobayashi, Toshihiko; Shimabukuro-Demoto, Shiho; Yoshida-Sugitani, Reiko; Furuyama-Tanaka, Kaori; Karyu, Hitomi; Sugiura, Yuki; Shimizu, Yukiko; Hosaka, Toshiaki; Goto, Motohito; Kato, Norihiro; Okamura, Tadashi; Suematsu, Makoto; Yokoyama, Shigeyuki; Toyama-Sorimachi, Noriko

    2014-09-18

    SLC15A4 is a lysosome-resident, proton-coupled amino-acid transporter that moves histidine and oligopeptides from inside the lysosome to the cytosol of eukaryotic cells. SLC15A4 is required for Toll-like receptor 7 (TLR7)- and TLR9-mediated type I interferon (IFN-I) productions in plasmacytoid dendritic cells (pDCs) and is involved in the pathogenesis of certain diseases including lupus-like autoimmunity. How SLC15A4 contributes to diseases is largely unknown. Here we have shown that B cell SLC15A4 was crucial for TLR7-triggered IFN-I and autoantibody productions in a mouse lupus model. SLC15A4 loss disturbed the endolysosomal pH regulation and probably the v-ATPase integrity, and these changes were associated with disruption of the mTOR pathway, leading to failure of the IFN regulatory factor 7 (IRF7)-IFN-I regulatory circuit. Importantly, SLC15A4's transporter activity was necessary for the TLR-triggered cytokine production. Our findings revealed that SLC15A4-mediated optimization of the endolysosomal state is integral to a TLR7-triggered, mTOR-dependent IRF7-IFN-I circuit that leads to autoantibody production. Copyright © 2014 Elsevier Inc. All rights reserved.

  10. Hereditary folate malabsorption: A positively charged amino acid at position 113 of the proton-coupled folate transporter (PCFT/SLC46A1) is required for folic acid binding

    International Nuclear Information System (INIS)

    Lasry, Inbal; Berman, Bluma; Glaser, Fabian; Jansen, Gerrit; Assaraf, Yehuda G.

    2009-01-01

    The proton-coupled folate transporter (PCFT/SLC46A1) mediates intestinal folate uptake at acidic pH. Some loss of folic acid (FA) transport mutations in PCFT from hereditary folate malabsorption (HFM) patients cluster in R113, thereby suggesting a functional role for this residue. Herein, unlike non-conservative substitutions, an R113H mutant displayed 80-fold increase in the FA transport Km while retaining parental Vmax, hence indicating a major fall in folate substrate affinity. Furthermore, consistent with the preservation of 9% of parental transport activity, R113H transfectants displayed a substantial decrease in the FA growth requirement relative to mock transfectants. Homology modeling based on the crystal structures of the Escherichia coli transporter homologues EmrD and glycerol-3-phosphate transporter revealed that the R113H rotamer properly protrudes into the cytoplasmic face of the minor cleft normally occupied by R113. These findings constitute the first demonstration that a basic amino acid at position 113 is required for folate substrate binding.

  11. SLC6A1 Mutation and Ketogenic Diet in Epilepsy With Myoclonic-Atonic Seizures.

    Science.gov (United States)

    Palmer, Samantha; Towne, Meghan C; Pearl, Phillip L; Pelletier, Renee C; Genetti, Casie A; Shi, Jiahai; Beggs, Alan H; Agrawal, Pankaj B; Brownstein, Catherine A

    2016-11-01

    Epilepsy with myoclonic-atonic seizures, also known as myoclonic-astatic epilepsy or Doose syndrome, has been recently linked to variants in the SLC6A1 gene. Epilepsy with myoclonic-atonic seizures is often refractory to antiepileptic drugs, and the ketogenic diet is known for treating medically intractable seizures, although the mechanism of action is largely unknown. We report a novel SLC6A1 variant in a patient with epilepsy with myoclonic-atonic seizures, analyze its effects, and suggest a mechanism of action for the ketogenic diet. We describe a ten-year-old girl with epilepsy with myoclonic-atonic seizures and a de novo SLC6A1 mutation who responded well to the ketogenic diet. She carried a c.491G>A mutation predicted to cause p.Cys164Tyr amino acid change, which was identified using whole exome sequencing and confirmed by Sanger sequencing. High-resolution structural modeling was used to analyze the likely effects of the mutation. The SLC6A1 gene encodes a transporter that removes gamma-aminobutyric acid from the synaptic cleft. Mutations in SLC6A1 are known to disrupt the gamma-aminobutyric acid transporter protein 1, affecting gamma-aminobutyric acid levels and causing seizures. The p.Cys164Tyr variant found in our study has not been previously reported, expanding on the variants linked to epilepsy with myoclonic-atonic seizures. A 10-year-old girl with a novel SLC6A1 mutation and epilepsy with myoclonic-atonic seizures had an excellent clinical response to the ketogenic diet. An effect of the diet on gamma-aminobutyric acid reuptake mediated by gamma-aminobutyric acid transporter protein 1 is suggested. A personalized approach to epilepsy with myoclonic-atonic seizures patients carrying SLC6A1 mutation and a relationship between epilepsy with myoclonic-atonic seizures due to SLC6A1 mutations, GABAergic drugs, and the ketogenic diet warrants further exploration. Copyright © 2016 Elsevier Inc. All rights reserved.

  12. Serum uric acid concentrations and SLC2A9 genetic variation in Hispanic children: the Viva La Familia Study1234

    Science.gov (United States)

    Voruganti, V Saroja; Laston, Sandra; Haack, Karin; Mehta, Nitesh R; Cole, Shelley A; Butte, Nancy F; Comuzzie, Anthony G

    2015-01-01

    Background: Elevated concentrations of serum uric acid are associated with increased risk of gout and renal and cardiovascular diseases. Genetic studies in adults have consistently identified associations of solute carrier family 2, member 9 (SLC2A9), polymorphisms with variation in serum uric acid. However, it is not known whether the association of serum uric acid with SLC2A9 polymorphisms manifests in children. Objective: The aim was to investigate whether variation in serum uric acid is under genetic influence and whether the association with SLC2A9 polymorphisms generalizes to Hispanic children of the Viva La Familia Study. Design: We conducted a genomewide association study with 1.1 million genetic markers in 815 children. Results: We found serum uric acid to be significantly heritable [h2 ± SD = 0.45 ± 0.08, P = 5.8 × 10−11] and associated with SLC2A9 variants (P values between 10−16 and 10−7). Several of the significantly associated polymorphisms were previously identified in studies in adults. We also found positive genetic correlations between serum uric acid and BMI z score (ρG = 0.45, P = 0.002), percentage of body fat (ρG = 0.28, P = 0.04), fat mass (ρG = 0.34, P = 0.02), waist circumference (ρG = 0.42, P = 0.003), and waist-to-height ratio (ρG = 0.46, P = 0.001). Conclusions: Our results show that variation in serum uric acid in Hispanic children is under considerable genetic influence and is associated with obesity-related phenotypes. As in adults, genetic variation in SLC2A9 is associated with serum uric acid concentrations, an important biomarker of renal and cardiovascular disease risk, in Hispanic children. PMID:25833971

  13. The dopamine transporter protein gene (SLC6A3): Primary linage mapping and linkage studies in Tourette syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Gelernter, J.; Kruger, S.D.; Pakstis, A.J. [Yale Univ., New Haven, CT (United States)]|[West Haven Veterans Affairs Medical Center, CT (United States)] [and others

    1995-12-10

    The dopamine transporter, the molecule responsible for presynaptic reuptake of dopamine and a major site of action of psychostimulant drugs, including cocaine, is encoded by locus SLC6A3 (alias DAT1). The protein`s actions and DAT`s specific localization to dopaminergic neurons make it a candidate gene for several psychiatric illnesses. SLC6A3 has been mapped to distal chromosome 5p, using physical methods. Genetic linkage methods were used to place SLC6A3 in the genetic linkage map. Four extended pedigrees (one of which overlaps with CEPH) were typed. Linkage with Tourette syndrome (TS) was also examined. SLC6A3 showed close linkage with several markers previously mapped to distal chromosome 5p, including D5S11 (Z{sub max} = 16.0, {theta}{sub M} = {theta}{sub F} = 0.03, results from four families) and D5S678 (Z{sub max} = 7.84, {theta}{sub M} = {theta}{sub F} = 0, results from two families). Observed crossovers established that SLC6A3 is a distal marker close to D5S10 and D5S678, but these three distal markers could not be ordered. Linkage between TS and SLC6A3 could be excluded independently in two branches of a large kindred segregating TS; the lod score in a third family was also negative, but not significant. Cumulative results show a lod score of -6.2 at {theta} = 0 and of -3.9 at {theta} = 0.05 (dominant model, narrow disease definition). SLC6A3 thus maps to distal chromosome 5p by linkage analysis, in agreement with previous physical mapping data. A mutation at SLC6A3 is not causative for TS in the two large families that generated significant negative lod scores (if the parameters of our analyses were correct) and is unlikely to be causative in the family that generated a negative lod score that did not reach significance. These results do not exclude a role for the dopamine transporter in influencing risk for TS in combination with other loci. 23 refs., 1 fig., 2 tabs.

  14. Effects of Sodium and Amino Acid Substrate Availability upon the Expression and Stability of the SNAT2 (SLC38A2 Amino Acid Transporter

    Directory of Open Access Journals (Sweden)

    Thorsten M. Hoffmann

    2018-02-01

    Full Text Available The SNAT2 (SLC38A2 System A amino acid transporter mediates Na+-coupled cellular uptake of small neutral α-amino acids (AAs and is extensively regulated in response to humoral and nutritional cues. Understanding the basis of such regulation is important given that AA uptake via SNAT2 has been linked to activation of mTORC1; a major controller of many important cellular processes including, for example, mRNA translation, lipid synthesis, and autophagy and whose dysregulation has been implicated in the development of cancer and conditions such as obesity and type 2 diabetes. Extracellular AA withdrawal induces an adaptive upregulation of SNAT2 gene transcription and SNAT2 protein stability but, as yet, the sensing mechanism(s that initiate this response remain poorly understood although interactions between SNAT2 and its substrates may play a vital role. Herein, we have explored how changes in substrate (AA and Na+ availability impact upon the adaptive regulation of SNAT2 in HeLa cells. We show that while AA deprivation induces SNAT2 gene expression, this induction was not apparent if extracellular Na+ was removed during the AA withdrawal period. Furthermore, we show that the increase in SNAT2 protein stability associated with AA withdrawal is selectively repressed by provision of SNAT2 AA substrates (N-methylaminoisobutyric acid and glutamine, but not non-substrates. This stabilization and substrate-induced repression were critically dependent upon the cytoplasmic N-terminal tail of SNAT2 (containing lysyl residues which are putative targets of the ubiquitin-proteasome system, because “grafting” this tail onto SNAT5, a related SLC38 family member that does not exhibit adaptive regulation, confers substrate-induced changes in stability of the SNAT2-5 chimeric transporter. In contrast, expression of SNAT2 in which the N-terminal lysyl residues were mutated to alanine rendered the transporter stable and insensitive to substrate-induced changes

  15. Complex analysis of urate transporters SLC2A9, SLC22A12 and functional characterization of non-synonymous allelic variants of GLUT9 in the Czech population: no evidence of effect on hyperuricemia and gout.

    Science.gov (United States)

    Hurba, Olha; Mancikova, Andrea; Krylov, Vladimir; Pavlikova, Marketa; Pavelka, Karel; Stibůrková, Blanka

    2014-01-01

    Using European descent Czech populations, we performed a study of SLC2A9 and SLC22A12 genes previously identified as being associated with serum uric acid concentrations and gout. This is the first study of the impact of non-synonymous allelic variants on the function of GLUT9 except for patients suffering from renal hypouricemia type 2. The cohort consisted of 250 individuals (150 controls, 54 nonspecific hyperuricemics and 46 primary gout and/or hyperuricemia subjects). We analyzed 13 exons of SLC2A9 (GLUT9 variant 1 and GLUT9 variant 2) and 10 exons of SLC22A12 by PCR amplification and sequenced directly. Allelic variants were prepared and their urate uptake and subcellular localization were studied by Xenopus oocytes expression system. The functional studies were analyzed using the non-parametric Wilcoxon and Kruskall-Wallis tests; the association study used the Fisher exact test and linear regression approach. We identified a total of 52 sequence variants (12 unpublished). Eight non-synonymous allelic variants were found only in SLC2A9: rs6820230, rs2276961, rs144196049, rs112404957, rs73225891, rs16890979, rs3733591 and rs2280205. None of these variants showed any significant difference in the expression of GLUT9 and in urate transport. In the association study, eight variants showed a possible association with hyperuricemia. However, seven of these were in introns and the one exon located variant, rs7932775, did not show a statistically significant association with serum uric acid concentration. Our results did not confirm any effect of SLC22A12 and SLC2A9 variants on serum uric acid concentration. Our complex approach using association analysis together with functional and immunohistochemical characterization of non-synonymous allelic variants did not show any influence on expression, subcellular localization and urate uptake of GLUT9.

  16. ASCT2 (SLC1A5-Deficient Mice Have Normal B-Cell Development, Proliferation, and Antibody Production

    Directory of Open Access Journals (Sweden)

    Etienne Masle-Farquhar

    2017-05-01

    Full Text Available SLC1A5 (solute carrier family 1, member 5 is a small neutral amino acid exchanger that is upregulated in rapidly proliferating lymphocytes but also in many primary human cancers. Furthermore, cancer cell lines have been shown to require SLC1A5 for their survival in vitro. One of SLC1A5’s primary substrates is the immunomodulatory amino acid glutamine, which plays an important role in multiple key processes, such as energy supply, macromolecular synthesis, nucleotide biosynthesis, redox homeostasis, and resistance against oxidative stress. These processes are also essential to immune cells, including neutrophils, macrophages, B and T lymphocytes. We show here that mice with a stop codon in Slc1a5 have reduced glutamine uptake in activated lymphocytes and primary fibroblasts. B and T cell populations and maturation in resting mice were not affected by absence of SLC1A5. Antibody production in resting and immunized mice and the germinal center response to immunization were also found to be normal. SLC1A5 has been recently described as a novel target for the treatment of a variety of cancers, and our results indicate that inhibition of SLC1A5 in cancer therapy may be tolerated well by the immune system of cancer patients.

  17. Impaired nutrient signaling and body weight control in a Na+ neutral amino acid cotransporter (Slc6a19)-deficient mouse.

    Science.gov (United States)

    Bröer, Angelika; Juelich, Torsten; Vanslambrouck, Jessica M; Tietze, Nadine; Solomon, Peter S; Holst, Jeff; Bailey, Charles G; Rasko, John E J; Bröer, Stefan

    2011-07-29

    Amino acid uptake in the intestine and kidney is mediated by a variety of amino acid transporters. To understand the role of epithelial neutral amino acid uptake in whole body homeostasis, we analyzed mice lacking the apical broad-spectrum neutral (0) amino acid transporter B(0)AT1 (Slc6a19). A general neutral aminoaciduria was observed similar to human Hartnup disorder which is caused by mutations in SLC6A19. Na(+)-dependent uptake of neutral amino acids into the intestine and renal brush-border membrane vesicles was abolished. No compensatory increase of peptide transport or other neutral amino acid transporters was detected. Mice lacking B(0)AT1 showed a reduced body weight. When adapted to a standard 20% protein diet, B(0)AT1-deficient mice lost body weight rapidly on diets containing 6 or 40% protein. Secretion of insulin in response to food ingestion after fasting was blunted. In the intestine, amino acid signaling to the mammalian target of rapamycin (mTOR) pathway was reduced, whereas the GCN2/ATF4 stress response pathway was activated, indicating amino acid deprivation in epithelial cells. The results demonstrate that epithelial amino acid uptake is essential for optimal growth and body weight regulation.

  18. Transport of the photodynamic therapy agent 5-aminolevulinic acid by distinct H+-coupled nutrient carriers coexpressed in the small intestine.

    Science.gov (United States)

    Anderson, Catriona M H; Jevons, Mark; Thangaraju, Muthusamy; Edwards, Noel; Conlon, Nichola J; Woods, Steven; Ganapathy, Vadivel; Thwaites, David T

    2010-01-01

    5-Aminolevulinic acid (ALA) is a prodrug used in photodynamic therapy, fluorescent diagnosis, and fluorescent-guided resection because it leads to accumulation of the photosensitizer protoporphyrin IX (PpIX) in tumor tissues. ALA has good oral bioavailability, but high oral doses are required to obtain selective PpIX accumulation in colonic tumors because accumulation is also observed in normal gut mucosa. Structural similarities between ALA and GABA led us to test the hypothesis that the H(+)-coupled amino acid transporter PAT1 (SLC36A1) will contribute to luminal ALA uptake. Radiolabel uptake and electrophysiological measurements identified PAT1-mediated H(+)-coupled ALA symport after heterologous expression in Xenopus oocytes. The selectivity of the nontransported inhibitors 5-hydroxytryptophan and 4-aminomethylbenzoic acid for, respectively, PAT1 and the H(+)-coupled di/tripeptide transporter PepT1 (SLC15A1) were examined. 5-Hydroxytryptophan selectively inhibited PAT1-mediated amino acid uptake across the brush-border membrane of the human intestinal (Caco-2) epithelium whereas 4-aminomethylbenzoic acid selectively inhibited PepT1-mediated dipeptide uptake. The inhibitory effects of 5-hydroxytryptophan and 4-aminomethylbenzoic acid were additive, demonstrating that both PAT1 and PepT1 contribute to intestinal transport of ALA. This is the first demonstration of overlap in substrate specificity between these distinct transporters for amino acids and dipeptides. PAT1 and PepT1 expression was monitored by reverse transcriptase-polymerase chain reaction using paired samples of normal and cancer tissue from human colon. mRNA for both transporters was detected. PepT1 mRNA was increased 2.3-fold in cancer tissues. Thus, increased PepT1 expression in colonic cancer could contribute to the increased PpIX accumulation observed. Selective inhibition of PAT1 could enhance PpIX loading in tumor tissue relative to that in normal tissue.

  19. Cystinuria Associated with Different SLC7A9 Gene Variants in the Cat.

    Directory of Open Access Journals (Sweden)

    Keijiro Mizukami

    Full Text Available Cystinuria is a classical inborn error of metabolism characterized by a selective proximal renal tubular defect affecting cystine, ornithine, lysine, and arginine (COLA reabsorption, which can lead to uroliths and urinary obstruction. In humans, dogs and mice, cystinuria is caused by variants in one of two genes, SLC3A1 and SLC7A9, which encode the rBAT and bo,+AT subunits of the bo,+ basic amino acid transporter system, respectively. In this study, exons and flanking regions of the SLC3A1 and SLC7A9 genes were sequenced from genomic DNA of cats (Felis catus with COLAuria and cystine calculi. Relative to the Felis catus-6.2 reference genome sequence, DNA sequences from these affected cats revealed 3 unique homozygous SLC7A9 missense variants: one in exon 5 (p.Asp236Asn from a non-purpose-bred medium-haired cat, one in exon 7 (p.Val294Glu in a Maine Coon and a Sphinx cat, and one in exon 10 (p.Thr392Met from a non-purpose-bred long-haired cat. A genotyping assay subsequently identified another cystinuric domestic medium-haired cat that was homozygous for the variant originally identified in the purebred cats. These missense variants result in deleterious amino acid substitutions of highly conserved residues in the bo,+AT protein. A limited population survey supported that the variants found were likely causative. The remaining 2 sequenced domestic short-haired cats had a heterozygous variant at a splice donor site in intron 10 and a homozygous single nucleotide variant at a branchpoint in intron 11 of SLC7A9, respectively. This study identifies the first SLC7A9 variants causing feline cystinuria and reveals that, as in humans and dogs, this disease is genetically heterogeneous in cats.

  20. Neurosteroid Transport in the Brain: Role of ABC and SLC Transporters

    Directory of Open Access Journals (Sweden)

    Markus Grube

    2018-04-01

    Full Text Available Neurosteroids, comprising pregnane, androstane, and sulfated steroids can alter neuronal excitability through interaction with ligand-gated ion channels and other receptors and have therefore a therapeutic potential in several brain disorders. They can be formed in brain cells or are synthesized by an endocrine gland and reach the brain by penetrating the blood–brain barrier (BBB. Especially sulfated steroids such as pregnenolone sulfate (PregS and dehydroepiandrosterone sulfate (DHEAS depend on transporter proteins to cross membranes. In this review, we discuss the involvement of ATP-binding cassette (ABC- and solute carrier (SLC-type membrane proteins in the transport of these compounds at the BBB and in the choroid plexus (CP, but also in the secretion from neurons and glial cells. Among the ABC transporters, especially BCRP (ABCG2 and several MRP/ABCC subfamily members (MRP1, MRP4, MRP8 are expressed in the brain and known to efflux conjugated steroids. Furthermore, several SLC transporters have been shown to mediate cellular uptake of steroid sulfates. These include members of the OATP/SLCO subfamily, namely OATP1A2 and OATP2B1, as well as OAT3 (SLC22A3, which have been reported to be expressed at the BBB, in the CP and in part in neurons. Furthermore, a role of the organic solute transporter OSTα-OSTβ (SLC51A/B in brain DHEAS/PregS homeostasis has been proposed. This transporter was reported to be localized especially in steroidogenic cells of the cerebellum and hippocampus. To date, the impact of transporters on neurosteroid homeostasis is still poorly understood. Further insights are desirable also with regard to the therapeutic potential of these compounds.

  1. Complex analysis of urate transporters SLC2A9, SLC22A12 and functional characterization of non-synonymous allelic variants of GLUT9 in the Czech population: no evidence of effect on hyperuricemia and gout.

    Directory of Open Access Journals (Sweden)

    Olha Hurba

    Full Text Available OBJECTIVE: Using European descent Czech populations, we performed a study of SLC2A9 and SLC22A12 genes previously identified as being associated with serum uric acid concentrations and gout. This is the first study of the impact of non-synonymous allelic variants on the function of GLUT9 except for patients suffering from renal hypouricemia type 2. METHODS: The cohort consisted of 250 individuals (150 controls, 54 nonspecific hyperuricemics and 46 primary gout and/or hyperuricemia subjects. We analyzed 13 exons of SLC2A9 (GLUT9 variant 1 and GLUT9 variant 2 and 10 exons of SLC22A12 by PCR amplification and sequenced directly. Allelic variants were prepared and their urate uptake and subcellular localization were studied by Xenopus oocytes expression system. The functional studies were analyzed using the non-parametric Wilcoxon and Kruskall-Wallis tests; the association study used the Fisher exact test and linear regression approach. RESULTS: We identified a total of 52 sequence variants (12 unpublished. Eight non-synonymous allelic variants were found only in SLC2A9: rs6820230, rs2276961, rs144196049, rs112404957, rs73225891, rs16890979, rs3733591 and rs2280205. None of these variants showed any significant difference in the expression of GLUT9 and in urate transport. In the association study, eight variants showed a possible association with hyperuricemia. However, seven of these were in introns and the one exon located variant, rs7932775, did not show a statistically significant association with serum uric acid concentration. CONCLUSION: Our results did not confirm any effect of SLC22A12 and SLC2A9 variants on serum uric acid concentration. Our complex approach using association analysis together with functional and immunohistochemical characterization of non-synonymous allelic variants did not show any influence on expression, subcellular localization and urate uptake of GLUT9.

  2. The blood-brain barrier fatty acid transport protein 1 (FATP1/SLC27A1) supplies docosahexaenoic acid to the brain, and insulin facilitates transport.

    Science.gov (United States)

    Ochiai, Yusuke; Uchida, Yasuo; Ohtsuki, Sumio; Tachikawa, Masanori; Aizawa, Sanshiro; Terasaki, Tetsuya

    2017-05-01

    We purposed to clarify the contribution of fatty acid transport protein 1 (FATP1/SLC 27A1) to the supply of docosahexaenoic acid (DHA) to the brain across the blood-brain barrier in this study. Transport experiments showed that the uptake rate of [ 14 C]-DHA in human FATP1-expressing HEK293 cells was significantly greater than that in empty vector-transfected (mock) HEK293 cells. The steady-state intracellular DHA concentration was nearly 2-fold smaller in FATP1-expressing than in mock cells, suggesting that FATP1 works as not only an influx, but also an efflux transporter for DHA. [ 14 C]-DHA uptake by a human cerebral microvascular endothelial cell line (hCMEC/D3) increased in a time-dependent manner, and was inhibited by unlabeled DHA and a known FATP1 substrate, oleic acid. Knock-down of FATP1 in hCMEC/D3 cells with specific siRNA showed that FATP1-mediated uptake accounts for 59.2-73.0% of total [ 14 C]-DHA uptake by the cells. Insulin treatment for 30 min induced translocation of FATP1 protein to the plasma membrane in hCMEC/D3 cells and enhanced [ 14 C]-DHA uptake. Immunohistochemical analysis of mouse brain sections showed that FATP1 protein is preferentially localized at the basal membrane of brain microvessel endothelial cells. We found that two neuroprotective substances, taurine and biotin, in addition to DHA, undergo FATP1-mediated efflux. Overall, our results suggest that FATP1 localized at the basal membrane of brain microvessels contributes to the transport of DHA, taurine and biotin into the brain, and insulin rapidly increases DHA supply to the brain by promoting translocation of FATP1 to the membrane. Read the Editorial Comment for this article on page 324. © 2016 International Society for Neurochemistry.

  3. Tubular urate transporter gene polymorphisms differentiate patients with gout who have normal and decreased urinary uric acid excretion.

    Science.gov (United States)

    Torres, Rosa J; de Miguel, Eugenio; Bailén, Rebeca; Banegas, José R; Puig, Juan G

    2014-09-01

    Primary gout has been associated with single-nucleotide polymorphisms (SNP) in several tubular urate transporter genes. No study has assessed the association of reabsorption and secretion urate transporter gene SNP with gout in a single cohort of documented primary patients with gout carefully subclassified as normoexcretors or underexcretors. Three reabsorption SNP (SLC22A12/URAT1, SLC2A9/GLUT9, and SLC22A11/OAT4) and 2 secretion transporter SNP (SLC17A1/NPT1 and ABCG2/BRCP) were studied in 104 patients with primary gout and in 300 control subjects. The patients were subclassified into normoexcretors and underexcretors according to their serum and 24-h urinary uric acid levels under strict conditions of dietary control. Compared with control subjects, patients with gout showed different allele distributions of the 5 SNP analyzed. However, the diagnosis of underexcretor was only positively associated with the presence of the T allele of URAT1 rs11231825, the G allele of GLUT9 rs16890979, and the A allele of ABCG2 rs2231142. The association of the A allele of ABCG2 rs2231142 in normoexcretors was 10 times higher than in underexcretors. The C allele of NPT1 rs1165196 was only significantly associated with gout in patients with normal uric acid excretion. Gout with uric acid underexcretion is associated with transporter gene SNP related mainly to tubular reabsorption, whereas uric acid normoexcretion is associated only with tubular secretion SNP. This finding supports the concept of distinctive mechanisms to account for hyperuricemia in patients with gout with reduced or normal uric acid excretion.

  4. Functional analysis of human aromatic amino acid transporter MCT10/TAT1 using the yeast Saccharomyces cerevisiae.

    Science.gov (United States)

    Uemura, Satoshi; Mochizuki, Takahiro; Kurosaka, Goyu; Hashimoto, Takanori; Masukawa, Yuki; Abe, Fumiyoshi

    2017-10-01

    Tryptophan is an essential amino acid in humans and an important serotonin and melatonin precursor. Monocarboxylate transporter MCT10 is a member of the SLC16A family proteins that mediates low-affinity tryptophan transport across basolateral membranes of kidney, small intestine, and liver epithelial cells, although the precise transport mechanism remains unclear. Here we developed a simple functional assay to analyze tryptophan transport by human MCT10 using a deletion mutant for the high-affinity tryptophan permease Tat2 in Saccharomyces cerevisiae. tat2Δtrp1 cells are defective in growth in YPD medium because tyrosine present in the medium competes for the low-affinity tryptophan permease Tat1 with tryptophan. MCT10 appeared to allow growth of tat2Δtrp1 cells in YPD medium, and accumulate in cells deficient for Rsp5 ubiquitin ligase. These results suggest that MCT10 is functional in yeast, and is subject to ubiquitin-dependent quality control. Whereas growth of Tat2-expressing cells was significantly impaired by neutral pH, that of MCT10-expressing cells was nearly unaffected. This property is consistent with the transport mechanism of MCT10 via facilitated diffusion without a need for pH gradient across the plasma membrane. Single-nucleotide polymorphisms (SNPs) are known to occur in the human MCT10 coding region. Among eight SNP amino acid changes in MCT10, the N81K mutation completely abrogated tryptophan import without any abnormalities in the expression or localization. In the MCT10 modeled structure, N81 appeared to protrude into the putative trajectory of tryptophan. Plasma membrane localization of MCT10 and the variant proteins was also verified in human embryonic kidney 293T cells. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Effect of 5-aminolevulinic acid on erythropoiesis: A preclinical in vitro characterization for the treatment of congenital sideroblastic anemia

    International Nuclear Information System (INIS)

    Fujiwara, Tohru; Okamoto, Koji; Niikuni, Ryoyu; Takahashi, Kiwamu; Okitsu, Yoko; Fukuhara, Noriko; Onishi, Yasushi; Ishizawa, Kenichi; Ichinohasama, Ryo; Nakamura, Yukio; Nakajima, Motowo; Tanaka, Tohru; Harigae, Hideo

    2014-01-01

    Highlights: • Treatment with ALA induces erythroid differentiation of K562 cells. • Transportation of ALA into erythroid cells occurs predominantly via SLC36A1. • ALA restores defects in ALAS2 in human iPS cell-derived erythroblasts. • ALA may represent a novel therapeutic option for CSA caused by ALAS2 mutations. - Abstract: Congenital sideroblastic anemia (CSA) is a hereditary disorder characterized by microcytic anemia and bone marrow sideroblasts. The most common form of CSA is attributed to mutations in the X-linked gene 5-aminolevulinic acid synthase 2 (ALAS2). ALAS2 is a mitochondrial enzyme, which utilizes glycine and succinyl-CoA to form 5-aminolevulinic acid (ALA), a crucial precursor in heme synthesis. Therefore, ALA supplementation could be an effective therapeutic strategy to restore heme synthesis in CSA caused by ALAS2 defects. In a preclinical study, we examined the effects of ALA in human erythroid cells, including K562 cells and human induced pluripotent stem cell-derived erythroid progenitor (HiDEP) cells. ALA treatment resulted in significant dose-dependent accumulation of heme in the K562 cell line. Concomitantly, the treatment substantially induced erythroid differentiation as assessed using benzidine staining. Quantitative reverse transcription polymerase chain reaction (RT-PCR) analysis confirmed significant upregulation of heme-regulated genes, such as the globin genes [hemoglobin alpha (HBA) and hemoglobin gamma (HBG)] and the heme oxygenase 1 (HMOX1) gene, in K562 cells. Next, to investigate the mechanism by which ALA is transported into erythroid cells, quantitative RT-PCR analysis was performed on previously identified ALA transporters, including solute carrier family 15 (oligopeptide transporter), member (SLC15A) 1, SLC15A2, solute carrier family 36 (proton/amino acid symporter), member (SLC36A1), and solute carrier family 6 (neurotransmitter transporter), member 13 (SLC6A13). Our analysis revealed that SLC36A1 was abundantly

  6. Effect of 5-aminolevulinic acid on erythropoiesis: A preclinical in vitro characterization for the treatment of congenital sideroblastic anemia

    Energy Technology Data Exchange (ETDEWEB)

    Fujiwara, Tohru [Department of Hematology and Rheumatology, Tohoku University Graduate School, Sendai (Japan); Department of Molecular Hematology/Oncology, Tohoku University Graduate School, Sendai (Japan); Okamoto, Koji; Niikuni, Ryoyu [Department of Hematology and Rheumatology, Tohoku University Graduate School, Sendai (Japan); Takahashi, Kiwamu [SBI Pharmaceuticals Co., Ltd., Tokyo (Japan); Okitsu, Yoko; Fukuhara, Noriko; Onishi, Yasushi [Department of Hematology and Rheumatology, Tohoku University Graduate School, Sendai (Japan); Ishizawa, Kenichi [Department of Hematology and Rheumatology, Tohoku University Graduate School, Sendai (Japan); Clinical Research, Innovation and Education Center, Tohoku University Hospital, Sendai (Japan); Ichinohasama, Ryo [Department of Hematopathology, Tohoku University Graduate School, Sendai (Japan); Nakamura, Yukio [Cell Engineering Division, RIKEN BioResource Center, Tsukuba, Ibaraki (Japan); Nakajima, Motowo; Tanaka, Tohru [SBI Pharmaceuticals Co., Ltd., Tokyo (Japan); Harigae, Hideo, E-mail: harigae@med.tohoku.ac.jp [Department of Hematology and Rheumatology, Tohoku University Graduate School, Sendai (Japan); Department of Molecular Hematology/Oncology, Tohoku University Graduate School, Sendai (Japan)

    2014-11-07

    Highlights: • Treatment with ALA induces erythroid differentiation of K562 cells. • Transportation of ALA into erythroid cells occurs predominantly via SLC36A1. • ALA restores defects in ALAS2 in human iPS cell-derived erythroblasts. • ALA may represent a novel therapeutic option for CSA caused by ALAS2 mutations. - Abstract: Congenital sideroblastic anemia (CSA) is a hereditary disorder characterized by microcytic anemia and bone marrow sideroblasts. The most common form of CSA is attributed to mutations in the X-linked gene 5-aminolevulinic acid synthase 2 (ALAS2). ALAS2 is a mitochondrial enzyme, which utilizes glycine and succinyl-CoA to form 5-aminolevulinic acid (ALA), a crucial precursor in heme synthesis. Therefore, ALA supplementation could be an effective therapeutic strategy to restore heme synthesis in CSA caused by ALAS2 defects. In a preclinical study, we examined the effects of ALA in human erythroid cells, including K562 cells and human induced pluripotent stem cell-derived erythroid progenitor (HiDEP) cells. ALA treatment resulted in significant dose-dependent accumulation of heme in the K562 cell line. Concomitantly, the treatment substantially induced erythroid differentiation as assessed using benzidine staining. Quantitative reverse transcription polymerase chain reaction (RT-PCR) analysis confirmed significant upregulation of heme-regulated genes, such as the globin genes [hemoglobin alpha (HBA) and hemoglobin gamma (HBG)] and the heme oxygenase 1 (HMOX1) gene, in K562 cells. Next, to investigate the mechanism by which ALA is transported into erythroid cells, quantitative RT-PCR analysis was performed on previously identified ALA transporters, including solute carrier family 15 (oligopeptide transporter), member (SLC15A) 1, SLC15A2, solute carrier family 36 (proton/amino acid symporter), member (SLC36A1), and solute carrier family 6 (neurotransmitter transporter), member 13 (SLC6A13). Our analysis revealed that SLC36A1 was abundantly

  7. Transport mechanism and regulatory properties of the human amino acid transporter ASCT2 (SLC1A5).

    Science.gov (United States)

    Scalise, Mariafrancesca; Pochini, Lorena; Panni, Simona; Pingitore, Piero; Hedfalk, Kristina; Indiveri, Cesare

    2014-11-01

    The kinetic mechanism of the transport catalyzed by the human glutamine/neutral amino acid transporter hASCT2 over-expressed in P. pastoris was determined in proteoliposomes by pseudo-bi-substrate kinetic analysis of the Na(+)-glutamineex/glutaminein transport reaction. A random simultaneous mechanism resulted from the experimental analysis. Purified functional hASCT2 was chemically cross-linked to a stable dimeric form. The oligomeric structure correlated well with the kinetic mechanism of transport. Half-saturation constants (Km) of the transporter for the other substrates Ala, Ser, Asn and Thr were measured both on the external and internal side. External Km were much lower than the internal ones confirming the asymmetry of the transporter. The electric nature of the transport reaction was determined imposing a negative inside membrane potential generated by K(+) gradients in the presence of valinomycin. The transport reaction resulted to be electrogenic and the electrogenicity originated from external Na(+). Internal Na(+) exerted a stimulatory effect on the transport activity which could be explained by a regulatory, not a counter-transport, effect. Native and deglycosylated hASCT2 extracted from HeLa showed the same transport features demonstrating that the glycosyl moiety has no role in transport function. Both in vitro and in vivo interactions of hASCT2 with the scaffold protein PDZK1 were revealed.

  8. The emerging physiological roles of the SLC14A family of urea transporters

    Science.gov (United States)

    Stewart, Gavin

    2011-01-01

    In mammals, urea is the main nitrogenous breakdown product of protein catabolism and is produced in the liver. In certain tissues, the movement of urea across cell membranes is specifically mediated by a group of proteins known as the SLC14A family of facilitative urea transporters. These proteins are derived from two distinct genes, UT-A (SLC14A2) and UT-B (SLC14A1). Facilitative urea transporters play an important role in two major physiological processes – urinary concentration and urea nitrogen salvaging. Although UT-A and UT-B transporters both have a similar basic structure and mediate the transport of urea in a facilitative manner, there are a number of significant differences between them. UT-A transporters are mainly found in the kidney, are highly specific for urea, have relatively lower transport rates and are highly regulated at both gene expression and cellular localization levels. In contrast, UT-B transporters are more widespread in their tissue location, transport both urea and water, have a relatively high transport rate, are inhibited by mercurial compounds and currently appear to be less acutely regulated. This review details the fundamental research that has so far been performed to investigate the function and physiological significance of these two types of urea transporters. PMID:21449978

  9. The cyanobacterial bicarbonate transporter BicA: its physiological role and the implications of structural similarities with human SLC26 transporters.

    Science.gov (United States)

    Price, G Dean; Howitt, Susan M

    2011-04-01

    The cyanobacterial Na+-dependent HCO3- transporter BicA is a member of the ubiquitous and important SulP/SLC26 family of anion transporters found in eukaryotes and prokaryotes. BicA is an important component of the cyanobacterial CO2 concentrating mechanism, an adaptation that contributes to cyanobacteria being able to achieve an estimated 25% of global primary productivity, largely in the oceans. The human SLC26 members are involved in a range of key cellular functions involving a diverse range of anion transport activities including Cl-/HCO3-, I-/HCO3-, and SO42-/HCO3- exchange; mutations in SLC26 members are known to be associated with debilitating diseases such as Pendred syndrome, chondrodysplasias, and congenital chloride diarrhoea. We have recently experimentally determined the membrane topology of BicA using the phoA-lacZ reporter system and here consider some of the extrapolated implications for topology of the human SLC26 family and the Sultr plant sulphate transporters.

  10. Differential expression of the Slc4 bicarbonate transporter family in murine corneal endothelium and cell culture.

    Science.gov (United States)

    Shei, William; Liu, Jun; Htoon, Hla M; Aung, Tin; Vithana, Eranga N

    2013-01-01

    To characterize the relative expression levels of all the solute carrier 4 (Slc4) transporter family members (Slc4a1-Slc4a11) in murine corneal endothelium using real-time quantitative (qPCR), to identify further important members besides Slc4a11 and Slc4a4, and to explore how close to the baseline levels the gene expressions remain after cells have been subjected to expansion and culture. Descemet's membrane-endothelial layers of 8-10-week-old C57BL6 mice were stripped from corneas and used for both primary cell culture and direct RNA extraction. Total RNA (from uncultured cells as well as cultured cells at passages 2 and 7) was reverse transcribed, and the cDNA was used for real time qPCR using specific primers for all the Slc4 family members. The geNorm method was applied to determine the most stable housekeeping genes and normalization factor, which was calculated from multiple housekeeping genes for more accurate and robust quantification. qPCR analyses revealed that all Slc4 bicarbonate transporter family members were expressed in mouse corneal endothelium. Slc4a11 showed the highest expression, which was approximately three times higher than that of Slc4a4 (3.4±0.3; p=0.004). All Slc4 genes were also expressed in cultured cells, and interestingly, the expression of Slc4a11 in cultured cells was significantly reduced by approximately 20-fold (0.05±0.001; p=0.000001) in early passage and by approximately sevenfold (0.14±0.002; p=0.000002) in late passage cells. Given the known involvement of SLC4A4 and SLC4A11 in corneal dystrophies, we speculate that the other two highly expressed genes in the uncultured corneal endothelium, SLC4A2 and SLC4A7, are worthy of being considered as potential candidate genes for corneal endothelial diseases. Moreover, as cell culture can affect expression levels of Slc4 genes, caution and careful design of experiments are necessary when undertaking studies of Slc4-mediated ion transport in cultured cells.

  11. Variants in SLC18A3, vesicular acetylcholine transporter, cause congenital myasthenic syndrome

    NARCIS (Netherlands)

    O'Grady, Gina L.; Verschuuren, Corien; Yuen, Michaela; Webster, Richard; Menezes, Manoj; Fock, Johanna M.; Pride, Natalie; Best, Heather A.; Damm, Tatiana Benavides; Turner, Christian; Lek, Monkol; Engel, Andrew G.; North, Kathryn N.; Clarke, Nigel F.; MacArthur, Daniel G.; Kamsteeg, Erik-Jan; Cooper, Sandra T.

    2016-01-01

    Objective: To describe the clinical and genetic characteristics of presynaptic congenital myasthenic syndrome secondary to biallelic variants in SLC18A3. Methods: Individuals from 2 families were identified with biallelic variants in SLC18A3, the gene encoding the vesicular acetylcholine transporter

  12. Genetic variation of the GLUT10 glucose transporter (SLC2A10) and relationships to type 2 diabetes and intermediary traits

    DEFF Research Database (Denmark)

    Andersen, Gitte; Rose, Christian Schack; Hamid, Yasmin Hassan

    2003-01-01

    The SLC2A10 gene encodes the GLUT10 facilitative glucose transporter, which is expressed in high amounts in liver and pancreas. The gene is mapped to chromosome 20q12-q13.1, a region that has been shown to be linked to type 2 diabetes. The gene was examined in 61 Danish type 2 diabetic patients......, and a total of six variants (-27C-->T, Ala206Thr, Ala272Ala, IVS2 + 10G-->A, IVS4 + 18T-->G, and IVS4 + 26G-->A) were identified and investigated in an association study, which included 503 type 2 diabetic patients and 510 glucose-tolerant control subjects. None of the variants were associated with type 2...... substantially to the pathogenesis of type 2 diabetes in the examined study population. However, the codon 206 polymorphism may be related to the interindividual variation in fasting and oral glucose-induced serum insulin levels....

  13. Riboflavin uptake transporter Slc52a2 (RFVT2) is upregulated in the mouse mammary gland during lactation.

    Science.gov (United States)

    Wu, Alex Man Lai; Dedina, Liana; Dalvi, Pooja; Yang, Mingdong; Leon-Cheon, John; Earl, Brian; Harper, Patricia A; Ito, Shinya

    2016-04-01

    While it is well recognized that riboflavin accumulates in breast milk as an essential vitamin for neonates, transport mechanisms for its milk excretion are not well characterized. The multidrug efflux transporter ABCG2 in the apical membrane of milk-producing mammary epithelial cells (MECs) is involved with riboflavin excretion. However, it is not clear whether MECs possess other riboflavin transport systems, which may facilitate its basolateral uptake into MECs. We report here that transcripts encoding the second (SLC52A2) and third (SLC52A3) member of the recently discovered family of SLC52A riboflavin uptake transporters are expressed in milk fat globules from human breast milk. Furthermore, Slc52a2 and Slc52a3 mRNA are upregulated in the mouse mammary gland during lactation. Importantly, the induction ofSlc52a2, which was the major Slc52a riboflavin transporter in the lactating mammary gland, was also observed at the protein level. Subcellular localization studies showed that green fluorescent protein-tagged mouse SLC52A2 mainly localized to the cell membrane, with no preferential distribution to the apical or basolateral membrane in polarized kidney MDCK cells. These results strongly implicate a potential role for SLC52A2 in riboflavin uptake by milk-producing MECs, a critical step in the transfer of riboflavin into breast milk. Copyright © 2016 the American Physiological Society.

  14. Mutations in the GABA Transporter SLC6A1 Cause Epilepsy with Myoclonic-Atonic Seizures

    Science.gov (United States)

    Carvill, Gemma L.; McMahon, Jacinta M.; Schneider, Amy; Zemel, Matthew; Myers, Candace T.; Saykally, Julia; Nguyen, John; Robbiano, Angela; Zara, Federico; Specchio, Nicola; Mecarelli, Oriano; Smith, Robert L.; Leventer, Richard J.; Møller, Rikke S.; Nikanorova, Marina; Dimova, Petia; Jordanova, Albena; Petrou, Steven; Helbig, Ingo; Striano, Pasquale; Weckhuysen, Sarah; Berkovic, Samuel F.; Scheffer, Ingrid E.; Mefford, Heather C.

    2015-01-01

    GAT-1, encoded by SLC6A1, is one of the major gamma-aminobutyric acid (GABA) transporters in the brain and is responsible for re-uptake of GABA from the synapse. In this study, targeted resequencing of 644 individuals with epileptic encephalopathies led to the identification of six SLC6A1 mutations in seven individuals, all of whom have epilepsy with myoclonic-atonic seizures (MAE). We describe two truncations and four missense alterations, all of which most likely lead to loss of function of GAT-1 and thus reduced GABA re-uptake from the synapse. These individuals share many of the electrophysiological properties of Gat1-deficient mice, including spontaneous spike-wave discharges. Overall, pathogenic mutations occurred in 6/160 individuals with MAE, accounting for ∼4% of unsolved MAE cases. PMID:25865495

  15. Association study of serotonin transporter SLC6A4 gene with Chinese Han irritable bowel syndrome.

    Directory of Open Access Journals (Sweden)

    Jing Yuan

    Full Text Available OBJECTIVE: Irritable bowel syndrome (IBS is a common clinical gastrointestinal dysfunction disorders. 5-sertonon (5-hydroxytryptamine, 5-HT is a very important neurotransmitter, which is involved in gastrointestinal motion and sensation. Solute carrier family 6 member 4 (SLC6A4 gene encode serotonin transporter (SERT which function is to rapidly reuptake the most of 5-HT. Therefore, it is needed to explore the association between SLC6A4 gene polymorphisms and IBS. METHODS: 119 patients and 238 healthy controls were administrated to detect the SLC6A4 gene polymorphisms including 5-HT-transporter-gene-linked polymorphic region (5-HTTLPR, variable number of tandem repeats (VNTRs and three selected tag Single Nucleotide Polymorphisms (SNPs rs1042173, rs3794808, rs2020936 by using polymerase chain reaction (PCR and TaqMan® SNP Genotyping. RESULTS: There were significant difference for 5-HTTLPR between IBS and control groups (X2 = 106.168, P<0.0001. In control group, genotypes were mainly L/L (58.4%, however, the genotypes in IBS were S/S (37.8%. The significant difference was shown in D-IBS subjects when compared to the controls (X(2 = 50.850, P<0.0001 for 5-HTTLPR. For STin2 VNTR, rs1042173, rs3794808, and rs2020936 polymorphisms, there were no any significant differences between IBS and control groups. There were no statistical significantly haplotypes for 5-HTTLPR, VNTRs and the three SNPs between IBS and controls. CONCLUSION: The S allele in 5-HTTLPR was a susceptible allele with Chinese Han IBS, but other associations of VNTRs, three selected Tag SNPs and positive haplotype with IBS were not found. It is indicated that much research are needed to study the relationship between other polymorphisms in SLC6A4 gene and IBS.

  16. Deletion of Slc26a1 and Slc26a7 Delays Enamel Mineralization in Mice

    Directory of Open Access Journals (Sweden)

    Kaifeng Yin

    2017-05-01

    Full Text Available Amelogenesis features two major developmental stages—secretory and maturation. During maturation stage, hydroxyapatite deposition and matrix turnover require delicate pH regulatory mechanisms mediated by multiple ion transporters. Several members of the Slc26 gene family (Slc26a1, Slc26a3, Slc26a4, Slc26a6, and Slc26a7, which exhibit bicarbonate transport activities, have been suggested by previous studies to be involved in maturation-stage amelogenesis, especially the key process of pH regulation. However, details regarding the functional role of these genes in enamel formation are yet to be clarified, as none of the separate mutant animal lines demonstrates any discernible enamel defects. Continuing with our previous investigation of Slc26a1−/− and Slc26a7−/− animal models, we generated a double-mutant animal line with the absence of both Slc26a1 and Slc26a7. We showed in the present study that the double-mutant enamel density was significantly lower in the regions that represent late maturation-, maturation- and secretory-stage enamel development in wild-type mandibular incisors. However, the “maturation” and “secretory” enamel microstructures in double-mutant animals resembled those observed in wild-type secretory and/or pre-secretory stages. Elemental composition analysis revealed a lack of mineral deposition and an accumulation of carbon and chloride in double-mutant enamel. Deletion of Slc26a1 and Slc26a7 did not affect the stage-specific morphology of the enamel organ. Finally, compensatory expression of pH regulator genes and ion transporters was detected in maturation-stage enamel organs of double-mutant animals when compared to wild-type. Combined with the findings from our previous study, these data indicate the involvement of SLC26A1and SLC26A7 as key ion transporters in the pH regulatory network during enamel maturation.

  17. Mutations in SLC12A5 in epilepsy of infancy with migrating focal seizures

    Science.gov (United States)

    Stödberg, Tommy; McTague, Amy; Ruiz, Arnaud J.; Hirata, Hiromi; Zhen, Juan; Long, Philip; Farabella, Irene; Meyer, Esther; Kawahara, Atsuo; Vassallo, Grace; Stivaros, Stavros M.; Bjursell, Magnus K.; Stranneheim, Henrik; Tigerschiöld, Stephanie; Persson, Bengt; Bangash, Iftikhar; Das, Krishna; Hughes, Deborah; Lesko, Nicole; Lundeberg, Joakim; Scott, Rod C.; Poduri, Annapurna; Scheffer, Ingrid E.; Smith, Holly; Gissen, Paul; Schorge, Stephanie; Reith, Maarten E. A.; Topf, Maya; Kullmann, Dimitri M.; Harvey, Robert J.; Wedell, Anna; Kurian, Manju A.

    2015-01-01

    The potassium-chloride co-transporter KCC2, encoded by SLC12A5, plays a fundamental role in fast synaptic inhibition by maintaining a hyperpolarizing gradient for chloride ions. KCC2 dysfunction has been implicated in human epilepsy, but to date, no monogenic KCC2-related epilepsy disorders have been described. Here we show recessive loss-of-function SLC12A5 mutations in patients with a severe infantile-onset pharmacoresistant epilepsy syndrome, epilepsy of infancy with migrating focal seizures (EIMFS). Decreased KCC2 surface expression, reduced protein glycosylation and impaired chloride extrusion contribute to loss of KCC2 activity, thereby impairing normal synaptic inhibition and promoting neuronal excitability in this early-onset epileptic encephalopathy. PMID:26333769

  18. The mammalian phosphate carrier SLC25A3 is a mitochondrial copper transporter required for cytochrome c oxidase biogenesis.

    Science.gov (United States)

    Boulet, Aren; Vest, Katherine E; Maynard, Margaret K; Gammon, Micah G; Russell, Antoinette C; Mathews, Alexander T; Cole, Shelbie E; Zhu, Xinyu; Phillips, Casey B; Kwong, Jennifer Q; Dodani, Sheel C; Leary, Scot C; Cobine, Paul A

    2018-02-09

    Copper is required for the activity of cytochrome c oxidase (COX), the terminal electron-accepting complex of the mitochondrial respiratory chain. The likely source of copper used for COX biogenesis is a labile pool found in the mitochondrial matrix. In mammals, the proteins that transport copper across the inner mitochondrial membrane remain unknown. We previously reported that the mitochondrial carrier family protein Pic2 in budding yeast is a copper importer. The closest Pic2 ortholog in mammalian cells is the mitochondrial phosphate carrier SLC25A3. Here, to investigate whether SLC25A3 also transports copper, we manipulated its expression in several murine and human cell lines. SLC25A3 knockdown or deletion consistently resulted in an isolated COX deficiency in these cells, and copper addition to the culture medium suppressed these biochemical defects. Consistent with a conserved role for SLC25A3 in copper transport, its heterologous expression in yeast complemented copper-specific defects observed upon deletion of PIC2 Additionally, assays in Lactococcus lactis and in reconstituted liposomes directly demonstrated that SLC25A3 functions as a copper transporter. Taken together, these data indicate that SLC25A3 can transport copper both in vitro and in vivo . © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  19. Functional assessment of allelic variants in the SLC26A4 gene involved in Pendred syndrome and nonsyndromic EVA

    Science.gov (United States)

    Pera, Alejandra; Dossena, Silvia; Rodighiero, Simona; Gandía, Marta; Bottà, Guido; Meyer, Giuliano; Moreno, Felipe; Nofziger, Charity; Hernández-Chico, Concepción; Paulmichl, Markus

    2008-01-01

    Pendred syndrome is an autosomal recessive disorder characterized by sensorineural hearing loss, with malformations of the inner ear, ranging from enlarged vestibular aqueduct (EVA) to Mondini malformation, and deficient iodide organification in the thyroid gland. Nonsyndromic EVA (ns-EVA) is a separate type of sensorineural hearing loss showing normal thyroid function. Both Pendred syndrome and ns-EVA seem to be linked to the malfunction of pendrin (SLC26A4), a membrane transporter able to exchange anions between the cytosol and extracellular fluid. In the past, the pathogenicity of SLC26A4 missense mutations were assumed if the mutations fulfilled two criteria: low incidence of the mutation in the control population and substitution of evolutionary conserved amino acids. Here we show that these criteria are insufficient to make meaningful predictions about the effect of these SLC26A4 variants on the pendrin-induced ion transport. Furthermore, we functionally characterized 10 missense mutations within the SLC26A4 ORF, and consistently found that on the protein level, an addition or omission of a proline or a charged amino acid in the SLC26A4 sequence is detrimental to its function. These types of changes may be adequate for predicting SLC26A4 functionality in the absence of direct functional tests. PMID:19017801

  20. Reduced Slc6a15 in Nucleus Accumbens D2-Neurons Underlies Stress Susceptibility.

    Science.gov (United States)

    Chandra, Ramesh; Francis, T Chase; Nam, Hyungwoo; Riggs, Lace M; Engeln, Michel; Rudzinskas, Sarah; Konkalmatt, Prasad; Russo, Scott J; Turecki, Gustavo; Iniguez, Sergio D; Lobo, Mary Kay

    2017-07-05

    Previous research demonstrates that Slc6a15, a neutral amino acid transporter, is associated with depression susceptibility. However, no study examined Slc6a15 in the ventral striatum [nucleus accumbens (NAc)] in depression. Given our previous characterization of Slc6a15 as a striatal dopamine receptor 2 (D2)-neuron-enriched gene, we examined the role of Slc6a15 in NAc D2-neurons in mediating susceptibility to stress in male mice. First, we showed that Slc6a15 mRNA was reduced in NAc of mice susceptible to chronic social defeat stress (CSDS), a paradigm that produces behavioral and molecular adaptations that resemble clinical depression. Consistent with our preclinical data, we observed Slc6a15 mRNA reduction in NAc of individuals with major depressive disorder (MDD). The Slc6a15 reduction in NAc occurred selectively in D2-neurons. Next, we used Cre-inducible viruses combined with D2-Cre mice to reduce or overexpress Slc6a15 in NAc D2-neurons. Slc6a15 reduction in D2-neurons caused enhanced susceptibility to a subthreshold social defeat stress (SSDS) as observed by reduced social interaction, while a reduction in social interaction following CSDS was not observed when Slc6a15 expression in D2-neurons was restored. Finally, since both D2-medium spiny neurons (MSNs) and D2-expressing choline acetyltransferase (ChAT) interneurons express Slc6a15, we examined Slc6a15 protein in these interneurons after CSDS. Slc6a15 protein was unaltered in ChAT interneurons. Consistent with this, reducing Slc5a15 selectively in NAc D2-MSNs, using A2A-Cre mice that express Cre selectively in D2-MSNs, caused enhanced susceptibility to SSDS. Collectively, our data demonstrate that reduced Slc6a15 in NAc occurs in MDD individuals and that Slc6a15 reduction in NAc D2-neurons underlies stress susceptibility. SIGNIFICANCE STATEMENT Our study demonstrates a role for reduced Slc6a15, a neutral amino acid transporter, in nucleus accumbens (NAc) in depression and stress susceptibility. The

  1. Human Sodium Phosphate Transporter 4 (hNPT4/SLC17A3) as a Common Renal Secretory Pathway for Drugs and Urate*

    Science.gov (United States)

    Jutabha, Promsuk; Anzai, Naohiko; Kitamura, Kenichiro; Taniguchi, Atsuo; Kaneko, Shuji; Yan, Kunimasa; Yamada, Hideomi; Shimada, Hidetaka; Kimura, Toru; Katada, Tomohisa; Fukutomi, Toshiyuki; Tomita, Kimio; Urano, Wako; Yamanaka, Hisashi; Seki, George; Fujita, Toshiro; Moriyama, Yoshinori; Yamada, Akira; Uchida, Shunya; Wempe, Michael F.; Endou, Hitoshi; Sakurai, Hiroyuki

    2010-01-01

    The evolutionary loss of hepatic urate oxidase (uricase) has resulted in humans with elevated serum uric acid (urate). Uricase loss may have been beneficial to early primate survival. However, an elevated serum urate has predisposed man to hyperuricemia, a metabolic disturbance leading to gout, hypertension, and various cardiovascular diseases. Human serum urate levels are largely determined by urate reabsorption and secretion in the kidney. Renal urate reabsorption is controlled via two proximal tubular urate transporters: apical URAT1 (SLC22A12) and basolateral URATv1/GLUT9 (SLC2A9). In contrast, the molecular mechanism(s) for renal urate secretion remain unknown. In this report, we demonstrate that an orphan transporter hNPT4 (human sodium phosphate transporter 4; SLC17A3) was a multispecific organic anion efflux transporter expressed in the kidneys and liver. hNPT4 was localized at the apical side of renal tubules and functioned as a voltage-driven urate transporter. Furthermore, loop diuretics, such as furosemide and bumetanide, substantially interacted with hNPT4. Thus, this protein is likely to act as a common secretion route for both drugs and may play an important role in diuretics-induced hyperuricemia. The in vivo role of hNPT4 was suggested by two hyperuricemia patients with missense mutations in SLC17A3. These mutated versions of hNPT4 exhibited reduced urate efflux when they were expressed in Xenopus oocytes. Our findings will complete a model of urate secretion in the renal tubular cell, where intracellular urate taken up via OAT1 and/or OAT3 from the blood exits from the cell into the lumen via hNPT4. PMID:20810651

  2. Characteristics of Mammalian Rh Glycoproteins (SLC42 transporters) and Their Role in Acid-Base Transport

    Science.gov (United States)

    Nakhoul, Nazih L.; Hamm, L. Lee

    2012-01-01

    The mammalian Rh glycoproteins belong to the solute transporter family SLC42 and include RhAG, present in red blood cells, and two non-erythroid members RhBG and RhCG that are expressed in various tissues, including kidney, liver, skin and the GI tract. The Rh proteins in the red blood cell form an “Rh complex” made up of one D-subunit, one CE-subunit and two RhAG subunits. The Rh complex has a well-known antigenic effect but also contributes to the stability of the red cell membrane. RhBG and RhCG are related to the NH4+ transporters of the yeast and bacteria but their exact function is yet to be determined. This review describes the expression and molecular properties of these membrane proteins and their potential role as NH3/NH4+ and CO2 transporters. The likelihood that these proteins transport gases such as CO2 or NH3 is novel and significant. The review also describes the physiological importance of these proteins and their relevance to human disease. PMID:23506896

  3. Impaired riboflavin transport due to missense mutations in SLC52A2 causes Brown-Vialetto-Van Laere syndrome.

    Science.gov (United States)

    Haack, Tobias B; Makowski, Christine; Yao, Yoshiaki; Graf, Elisabeth; Hempel, Maja; Wieland, Thomas; Tauer, Ulrike; Ahting, Uwe; Mayr, Johannes A; Freisinger, Peter; Yoshimatsu, Hiroki; Inui, Ken; Strom, Tim M; Meitinger, Thomas; Yonezawa, Atsushi; Prokisch, Holger

    2012-11-01

    Brown-Vialetto-Van Laere syndrome (BVVLS [MIM 211530]) is a rare neurological disorder characterized by infancy onset sensorineural deafness and ponto-bulbar palsy. Mutations in SLC52A3 (formerly C20orf54), coding for riboflavin transporter 2 (hRFT2), have been identified as the molecular genetic correlate in several individuals with BVVLS. Exome sequencing of just one single case revealed that compound heterozygosity for two pathogenic mutations in the SLC52A2 gene coding for riboflavin transporter 3 (hRFT3), another member of the riboflavin transporter family, is also associated with BVVLS. Overexpression studies confirmed that the gene products of both mutant alleles have reduced riboflavin transport activities. While mutations in SLC52A3 cause decreased plasma riboflavin levels, concordant with a role of SLC52A3 in riboflavin uptake from food, the SLC52A2-mutant individual had normal plasma riboflavin concentrations, a finding in line with a postulated function of SLC52A2 in riboflavin uptake from blood into target cells. Our results contribute to the understanding of human riboflavin metabolism and underscore its role in the pathogenesis of BVVLS, thereby providing a rational basis for a high-dose riboflavin treatment.

  4. Drug Clearance from Cerebrospinal Fluid Mediated by Organic Anion Transporters 1 (Slc22a6) and 3 (Slc22a8) at Arachnoid Membrane of Rats.

    Science.gov (United States)

    Zhang, Zhengyu; Tachikawa, Masanori; Uchida, Yasuo; Terasaki, Tetsuya

    2018-03-05

    Although arachnoid mater epithelial cells form the blood-arachnoid barrier (BAB), acting as a blood-CSF interface, it has been generally considered that the BAB is impermeable to water-soluble substances and plays a largely passive role. Here, we aimed to clarify the function of transporters at the BAB in regulating CSF clearance of water-soluble organic anion drugs based on quantitative targeted absolute proteomics (QTAP) and in vivo analyses. Protein expression levels of 61 molecules, including 19 ATP-binding-cassette (ABC) transporters and 32 solute-carrier (SLC) transporters, were measured in plasma membrane fraction of rat leptomeninges using QTAP. Thirty-three proteins were detected; others were under the quantification limits. Expression levels of multidrug resistance protein 1 (Mdr1a/P-gp/Abcb1a) and breast cancer resistance protein (Bcrp/Abcg2) were 16.6 and 3.27 fmol/μg protein (51.9- and 9.82-fold greater than in choroid plexus, respectively). Among those organic anion transporters detected only at leptomeninges, not choroid plexus, organic anion transporter 1 (oat1/Slc22a6) showed the greatest expression (2.73 fmol/μg protein). On the other hand, the protein expression level of oat3 at leptomeninges was 6.65 fmol/μg protein, and the difference from choroid plexus was within two-fold. To investigate oat1's role, we injected para-aminohippuric acid (PAH) with or without oat1 inhibitors into cisterna magna (to minimize the contribution of choroid plexus function) of rats. A bulk flow marker, FITC-inulin, was not taken up from CSF up to 15 min, whereas uptake clearance of PAH was 26.5 μL/min. PAH uptake was completely blocked by 3 mM cephalothin (inhibits both oat1 and oat3), while 17% of PAH uptake was inhibited by 0.2 mM cephalothin (selectively inhibits oat3). These results indicate that oat1 and oat3 at the BAB provide a distinct clearance pathway of organic anion drugs from CSF independently of choroid plexus.

  5. LAT1 acts as a crucial transporter of amino acids in human thymic carcinoma cells

    Directory of Open Access Journals (Sweden)

    Keitaro Hayashi

    2016-11-01

    Full Text Available L-type amino acid transporter 1 (LAT1, SLC7A5 incorporates essential amino acids into cells. Recent studies have shown that LAT1 is a predominant transporter in various human cancers. However, the function of LAT1 in thymic carcinoma remains unknown. Here we demonstrate that LAT1 is a critical transporter for human thymic carcinoma cells. LAT1 was strongly expressed in human thymic carcinoma tissues. LAT1-specific inhibitor significantly suppressed leucine uptake and growth of Ty82 human thymic carcinoma cell lines, suggesting that thymic carcinoma takes advantage of LAT1 as a quality transporter and that LAT1-specific inhibitor might be clinically beneficial in therapy for thymic carcinoma.

  6. Genome-wide association analysis confirms and extends the association of SLC2A9 with serum uric acid levels to Mexican Americans

    Directory of Open Access Journals (Sweden)

    Venkata Saroja eVoruganti

    2013-12-01

    Full Text Available Increased serum uric acid (SUA is a risk factor for gout and renal and cardiovascular disease. The purpose of this study was to identify genetic factors that affect the variation in SUA in 632 Mexican Americans participants of the San Antonio Family Heart Study (SAFHS. A genome-wide association analysis was performed using the Illumina Human Hap 550K single nucleotide polymorphism (SNP microarray. We used a linear regression-based association test under an additive model of allelic effect, while accounting for non-independence among family members via a kinship variance component. All analyses were performed in the software package SOLAR. SNPs rs6832439, rs13131257 and rs737267 in solute carrier protein 2 family, member 9 (SLC2A9 were associated with SUA at genome-wide significance (p <1.3×10-7. The minor alleles of these SNPs had frequencies of 36.2%, 36.2%, and 38.2 %, respectively, and were associated with decreasing SUA levels. All of these SNPs were located in introns 3-7 of SLC2A9, the location of the previously reported associations in European populations. When analyzed for association with cardiovascular-renal disease risk factors, conditional on SLC2A9 SNPs strongly associated with SUA, significant associations were found for SLC2A9 SNPs with BMI, body weight and waist circumference (p < 1.4 x 10-3 and suggestive associations with albumin-creatinine ratio and total antioxidant status. The SLC2A9 gene encodes an urate transporter that has considerable influence on variation in SUA. In addition to the primary association locus, suggestive evidence (p<1.9×10-6 for joint linkage/association was found at a previously-reported urate quantitative trait locus (Logarithm of odds score = 3.6 on 3p26.3. In summary, our GWAS extends and confirms the association of SLC2A9 with SUA for the first time in a Mexican American cohort and also shows for the first time its association with cardiovascular-renal disease risk factors.

  7. L-Theanine Administration Modulates the Absorption of Dietary Nutrients and Expression of Transporters and Receptors in the Intestinal Mucosa of Rats

    Directory of Open Access Journals (Sweden)

    Qiongxian Yan

    2017-01-01

    Full Text Available L-theanine has various advantageous functions for human health; whether or not it could mediate the nutrients absorption is unknown yet. The effects of L-theanine on intestinal nutrients absorption were investigated using rats ingesting L-theanine solution (0, 50, 200, and 400 mg/kg body weight per day for two weeks. The decline of insulin secretion and glucose concentration in the serum was observed by L-theanine. Urea and high-density lipoprotein were also reduced by 50 mg/kg L-theanine. Jejunal and ileac basic amino acids transporters SLC7a1 and SLC7a9, neutral SLC1a5 and SLC16a10, and acidic SLC1a1 expression were upregulated. The expression of intestinal SGLT3 and GLUT5 responsible for carbohydrates uptake and GPR120 and FABP2 associated with fatty acids transport were inhibited. These results indicated that L-theanine could inhibit the glucose uptake by downregulating the related gene expression in the small intestine of rats. Intestinal gene expression of transporters responding to amino acids absorption was stimulated by L-theanine administration.

  8. Role of the Intestinal Bile Acid Transporters in Bile Acid and Drug Disposition

    Science.gov (United States)

    Dawson, Paul A.

    2011-01-01

    Membrane transporters expressed by the hepatocyte and enterocyte play critical roles in maintaining the enterohepatic circulation of bile acids, an effective recycling and conservation mechanism that largely restricts these potentially cytotoxic detergents to the intestinal and hepatobiliary compartments. In doing so, the hepatic and enterocyte transport systems ensure a continuous supply of bile acids to be used repeatedly during the digestion of multiple meals throughout the day. Absorption of bile acids from the intestinal lumen and export into the portal circulation is mediated by a series of transporters expressed on the enterocyte apical and basolateral membranes. The ileal apical sodium-dependent bile acid cotransporter (abbreviated ASBT; gene symbol, SLC10A2) is responsible for the initial uptake of bile acids across the enterocyte brush border membrane. The bile acids are then efficiently shuttled across the cell and exported across the basolateral membrane by the heteromeric Organic Solute Transporter, OSTα-OSTβ. This chapter briefly reviews the tissue expression, physiology, genetics, pathophysiology, and transport properties of the ASBT and OSTα-OSTα. In addition, the chapter discusses the relationship between the intestinal bile acid transporters and drug metabolism, including development of ASBT inhibitors as novel hypocholesterolemic or hepatoprotective agents, prodrug targeting of the ASBT to increase oral bioavailability, and involvement of the intestinal bile acid transporters in drug absorption and drug-drug interactions. PMID:21103970

  9. Intracellular pH regulation by acid-base transporters in mammalian neurons

    Science.gov (United States)

    Ruffin, Vernon A.; Salameh, Ahlam I.; Boron, Walter F.; Parker, Mark D.

    2014-01-01

    Intracellular pH (pHi) regulation in the brain is important in both physiological and physiopathological conditions because changes in pHi generally result in altered neuronal excitability. In this review, we will cover 4 major areas: (1) The effect of pHi on cellular processes in the brain, including channel activity and neuronal excitability. (2) pHi homeostasis and how it is determined by the balance between rates of acid loading (JL) and extrusion (JE). The balance between JE and JL determine steady-state pHi, as well as the ability of the cell to defend pHi in the face of extracellular acid-base disturbances (e.g., metabolic acidosis). (3) The properties and importance of members of the SLC4 and SLC9 families of acid-base transporters expressed in the brain that contribute to JL (namely the Cl-HCO3 exchanger AE3) and JE (the Na-H exchangers NHE1, NHE3, and NHE5 as well as the Na+- coupled HCO3− transporters NBCe1, NBCn1, NDCBE, and NBCn2). (4) The effect of acid-base disturbances on neuronal function and the roles of acid-base transporters in defending neuronal pHi under physiopathologic conditions. PMID:24592239

  10. Genome-wide association analysis identifies a mutation in the thiamine transporter 2 (SLC19A3 gene associated with Alaskan Husky encephalopathy.

    Directory of Open Access Journals (Sweden)

    Karen M Vernau

    Full Text Available Alaskan Husky Encephalopathy (AHE has been previously proposed as a mitochondrial encephalopathy based on neuropathological similarities with human Leigh Syndrome (LS. We studied 11 Alaskan Husky dogs with AHE, but found no abnormalities in respiratory chain enzyme activities in muscle and liver, or mutations in mitochondrial or nuclear genes that cause LS in people. A genome wide association study was performed using eight of the affected dogs and 20 related but unaffected control AHs using the Illumina canine HD array. SLC19A3 was identified as a positional candidate gene. This gene controls the uptake of thiamine in the CNS via expression of the thiamine transporter protein THTR2. Dogs have two copies of this gene located within the candidate interval (SLC19A3.2 - 43.36-43.38 Mb and SLC19A3.1 - 43.411-43.419 Mb on chromosome 25. Expression analysis in a normal dog revealed that one of the paralogs, SLC19A3.1, was expressed in the brain and spinal cord while the other was not. Subsequent exon sequencing of SLC19A3.1 revealed a 4bp insertion and SNP in the second exon that is predicted to result in a functional protein truncation of 279 amino acids (c.624 insTTGC, c.625 C>A. All dogs with AHE were homozygous for this mutation, 15/41 healthy AH control dogs were heterozygous carriers while 26/41 normal healthy AH dogs were wild type. Furthermore, this mutation was not detected in another 187 dogs of different breeds. These results suggest that this mutation in SLC19A3.1, encoding a thiamine transporter protein, plays a critical role in the pathogenesis of AHE.

  11. Association between a genetic variant in the serotonin transporter gene (SLC6A4 and suicidal behavior in patients with schizophrenia

    Directory of Open Access Journals (Sweden)

    Lindholm Carlström Eva

    2012-05-01

    Full Text Available Abstract Background The serotonin (5-hydroxytryptamin; 5-HT system has a central role in the circuitry of cognition and emotions. Multiple lines of evidence suggest that genetic variation in the serotonin transporter gene (SLC6A4; 5-HTT is associated with schizophrenia and suicidal behavior. In this study, we wanted to elucidate whether SLC6A4 variations is involved in attempted suicide among patients with schizophrenia in a Scandinavian case–control sample. Methods Patients diagnosed with schizophrenia from three Scandinavian samples were assessed for presence or absence of suicide attempts, based on record reviews and interview data. Seven SLC6A4 single nucleotide polymorphisms (SNPs were genotyped in 837 schizophrenia patients and 1,473 control individuals. Association analyses and statistical evaluations were performed with the program UNPHASED (version 3.0.9. Results We observed an allele association between the SNP rs16965628, located in intron one of SLC6A4, and attempted suicide (adjusted p-value 0.01, among patients with schizophrenia. No association was found to a diagnosis of schizophrenia, when patients were compared to healthy control individuals. Conclusion The gene SLC6A4 appears to be involved in suicidal ideation among patients with schizophrenia. Independent replication is needed before more firm conclusions can be drawn.

  12. Association between a genetic variant in the serotonin transporter gene (SLC6A4) and suicidal behavior in patients with schizophrenia

    DEFF Research Database (Denmark)

    Lindholm Carlstrom, Eva; Saetre, Peter; Rosengren, Anders

    2012-01-01

    ABSTRACT: BACKGROUND: The serotonin (5-hydroxytryptamin; 5-HT) system has a central role in the circuitry of cognition and emotions. Multiple lines of evidence suggest that genetic variation in the serotonin transporter gene (SLC6A4; 5-HTT) is associated with schizophrenia and suicidal behavior. ...

  13. Epigenetic adaptation of the placental serotonin transporter gene (SLC6A4 to gestational diabetes mellitus.

    Directory of Open Access Journals (Sweden)

    Sofia Blazevic

    Full Text Available We tested the hypothesis that gestational diabetes mellitus (GDM alters the DNA methylation pattern of the fetal serotonin transporter gene (SLC6A4, and examined the functional relevance of DNA methylation for regulation of the SLC6A4 expression in the human placenta. The study included 50 mother-infant pairs. Eighteen mothers were diagnosed with GDM and 32 had normal glucose tolerance (NGT. All neonates were of normal birth weight and born at term by planned Cesarean section. DNA and RNA were isolated from samples of tissue collected from the fetal side of the placenta immediately after delivery. DNA methylation was quantified at 7 CpG sites within the SLC6A4 distal promoter region using PCR amplification of bisulfite treated DNA and subsequent DNA sequencing. SLC6A4 mRNA levels were measured by reverse transcription-quantitative PCR (RT-qPCR. Functional SLC6A4 polymorphisms (5HTTLPR, STin2, rs25531 were genotyped using standard PCR-based procedures. Average DNA methylation across the 7 analyzed loci was decreased in the GDM as compared to the NGT group (by 27.1%, p = 0.037 and negatively correlated, before and after adjustment for potential confounder/s, with maternal plasma glucose levels at the 24th to 28th week of gestation (p0.05. The results suggest that DNA methylation of the fetal SLC6A4 gene is sensitive to the maternal metabolic state in pregnancy. They also indicate a predominant role of epigenetic over genetic mechanisms in the regulation of SLC6A4 expression in the human placenta. Longitudinal studies in larger cohorts are needed to verify these results and determine to which degree placental SLC6A4 changes may contribute to long-term outcomes of infants exposed to GDM.

  14. SLC25 Family Member Genetic Interactions Identify a Role for HEM25 in Yeast Electron Transport Chain Stability.

    Science.gov (United States)

    Dufay, J Noelia; Fernández-Murray, J Pedro; McMaster, Christopher R

    2017-06-07

    The SLC25 family member SLC25A38 (Hem25 in yeast) was recently identified as a mitochondrial glycine transporter that provides substrate to initiate heme/hemoglobin synthesis. Mutations in the human SLC25A38 gene cause congenital sideroblastic anemia. The full extent to which SLC25 family members coregulate heme synthesis with other mitochondrial functions is not clear. In this study, we surveyed 29 nonessential SLC25 family members in Saccharomyces cerevisiae for their ability to support growth in the presence and absence of HEM25 Six SLC25 family members were identified that were required for growth or for heme synthesis in cells lacking Hem25 function. Importantly, we determined that loss of function of the SLC25 family member Flx1, which imports FAD into mitochondria, together with loss of function of Hem25, resulted in inability to grow on media that required yeast cells to supply energy using mitochondrial respiration. We report that specific components of complexes of the electron transport chain are decreased in the absence of Flx1 and Hem25 function. In addition, we show that mitochondria from flx1 Δ hem25 Δ cells contain uncharacterized Cox2-containing high molecular weight aggregates. The functions of Flx1 and Hem25 provide a facile explanation for the decrease in heme level, and in specific electron transport chain complex components. Copyright © 2017 Dufay et al.

  15. SLC25 Family Member Genetic Interactions Identify a Role for HEM25 in Yeast Electron Transport Chain Stability

    Directory of Open Access Journals (Sweden)

    J. Noelia Dufay

    2017-06-01

    Full Text Available The SLC25 family member SLC25A38 (Hem25 in yeast was recently identified as a mitochondrial glycine transporter that provides substrate to initiate heme/hemoglobin synthesis. Mutations in the human SLC25A38 gene cause congenital sideroblastic anemia. The full extent to which SLC25 family members coregulate heme synthesis with other mitochondrial functions is not clear. In this study, we surveyed 29 nonessential SLC25 family members in Saccharomyces cerevisiae for their ability to support growth in the presence and absence of HEM25. Six SLC25 family members were identified that were required for growth or for heme synthesis in cells lacking Hem25 function. Importantly, we determined that loss of function of the SLC25 family member Flx1, which imports FAD into mitochondria, together with loss of function of Hem25, resulted in inability to grow on media that required yeast cells to supply energy using mitochondrial respiration. We report that specific components of complexes of the electron transport chain are decreased in the absence of Flx1 and Hem25 function. In addition, we show that mitochondria from flx1Δ hem25Δ cells contain uncharacterized Cox2-containing high molecular weight aggregates. The functions of Flx1 and Hem25 provide a facile explanation for the decrease in heme level, and in specific electron transport chain complex components.

  16. Hypoxic Stress Upregulates the Expression of Slc38a1 in Brown Adipocytes via Hypoxia-Inducible Factor-1α.

    Science.gov (United States)

    Horie, Tetsuhiro; Fukasawa, Kazuya; Iezaki, Takashi; Park, Gyujin; Onishi, Yuki; Ozaki, Kakeru; Kanayama, Takashi; Hiraiwa, Manami; Kitaguchi, Yuka; Kaneda, Katsuyuki; Hinoi, Eiichi

    2018-01-01

    The availability of amino acid in the brown adipose tissue (BAT) has been shown to be altered under various conditions; however, little is known about the possible expression and pivotal role of amino acid transporters in BAT under physiological and pathological conditions. The present study comprehensively investigated whether amino acid transporters are regulated by obesogenic conditions in BAT in vivo. Moreover, we investigated the mechanism underlying the regulation of the expression of amino acid transporters by various stressors in brown adipocytes in vitro. The expression of solute carrier family 38 member 1 (Slc38a1; gene encoding sodium-coupled neutral amino acid transporter 1) was preferentially upregulated in the BAT of both genetic and acquired obesity mice in vivo. Moreover, the expression of Slc38a1 was induced by hypoxic stress through hypoxia-inducible factor-1α, which is a master transcription factor of the adaptive response to hypoxic stress, in brown adipocytes in vitro. These results indicate that Slc38a1 is an obesity-associated gene in BAT and a hypoxia-responsive gene in brown adipocytes. © 2017 S. Karger AG, Basel.

  17. Metformin Is a Substrate and Inhibitor of the Human Thiamine Transporter, THTR-2 (SLC19A3).

    Science.gov (United States)

    Liang, Xiaomin; Chien, Huan-Chieh; Yee, Sook Wah; Giacomini, Marilyn M; Chen, Eugene C; Piao, Meiling; Hao, Jia; Twelves, Jolyn; Lepist, Eve-Irene; Ray, Adrian S; Giacomini, Kathleen M

    2015-12-07

    The biguanide metformin is widely used as first-line therapy for the treatment of type 2 diabetes. Predominately a cation at physiological pH's, metformin is transported by membrane transporters, which play major roles in its absorption and disposition. Recently, our laboratory demonstrated that organic cation transporter 1, OCT1, the major hepatic uptake transporter for metformin, was also the primary hepatic uptake transporter for thiamine, vitamin B1. In this study, we tested the reverse, i.e., that metformin is a substrate of thiamine transporters (THTR-1, SLC19A2, and THTR-2, SLC19A3). Our study demonstrated that human THTR-2 (hTHTR-2), SLC19A3, which is highly expressed in the small intestine, but not hTHTR-1, transports metformin (Km = 1.15 ± 0.2 mM) and other cationic compounds (MPP(+) and famotidine). The uptake mechanism for hTHTR-2 was pH and electrochemical gradient sensitive. Furthermore, metformin as well as other drugs including phenformin, chloroquine, verapamil, famotidine, and amprolium inhibited hTHTR-2 mediated uptake of both thiamine and metformin. Species differences in the substrate specificity of THTR-2 between human and mouse orthologues were observed. Taken together, our data suggest that hTHTR-2 may play a role in the intestinal absorption and tissue distribution of metformin and other organic cations and that the transporter may be a target for drug-drug and drug-nutrient interactions.

  18. A Novel Missense Mutation in SLC5A5 Gene in a Sudanese Family with Congenital Hypothyroidism.

    Science.gov (United States)

    Watanabe, Yui; Ebrhim, Reham Shareef; Abdullah, Mohamed A; Weiss, Roy E

    2018-05-15

    Thyroid hormone synthesis requires the presence of iodide. The sodium iodide symporter (NIS) is a glycoprotein which mediates the active uptake of iodide from the blood stream into the thyroid grand. NIS defects due to SLC5A5 gene mutations are known to cause congenital hypothyroidism (CH). The proposita is a 28-year-old female whose origin is the North Sudan where neonatal screening for CH is not available. She presented with severe constipation and a goiter at the age of 40 days. Laboratory testing confirmed CH and she was started on levothyroxine (L-T4). Presumably due to the delayed treatment the patient developed mental retardation. Her younger sister presented with a goiter, tongue protrusion and umbilical hernia and the youngest brother was also diagnosed with CH based on the TSH >100 µIU/mL at the age of 22 days and 8 days, respectively. Two siblings were treated with L-T4 and had normal development. Their consanguineous parents had no history of thyroid disorders. We performed whole exome sequencing (WES) on the proposita. WES identified a novel homozygous missense mutation in the SLC5A5 gene: c.1042T>G, p.Tyr348Asp, which was subsequently confirmed by Sanger sequencing. All affected children were homozygous for the same mutation and their unaffected mother was heterozygous. The NIS protein is composed of 13 transmembrane segments (TMS), an extracellular amino-terminus and an intracellular carboxyl terminus. The mutation is located in the TMS IX which has the most β-OH group-containing amino acids (serine and threonine) which is implicated in Na+ binding and translocation. In conclusion, a novel homozygous missense mutation in the SLC5A5 gene was identified in the Sudanese family with CH. The mutation is located in the TMS IX of the NIS protein which is essential for NIS function. Low iodine intake in Sudan is considered to affect severity of hypothyroidism in the patients.

  19. SLC39A8 Deficiency: A Disorder of Manganese Transport and Glycosylation.

    Science.gov (United States)

    Park, Julien H; Hogrebe, Max; Grüneberg, Marianne; DuChesne, Ingrid; von der Heiden, Ava L; Reunert, Janine; Schlingmann, Karl P; Boycott, Kym M; Beaulieu, Chandree L; Mhanni, Aziz A; Innes, A Micheil; Hörtnagel, Konstanze; Biskup, Saskia; Gleixner, Eva M; Kurlemann, Gerhard; Fiedler, Barbara; Omran, Heymut; Rutsch, Frank; Wada, Yoshinao; Tsiakas, Konstantinos; Santer, René; Nebert, Daniel W; Rust, Stephan; Marquardt, Thorsten

    2015-12-03

    SLC39A8 is a membrane transporter responsible for manganese uptake into the cell. Via whole-exome sequencing, we studied a child that presented with cranial asymmetry, severe infantile spasms with hypsarrhythmia, and dysproportionate dwarfism. Analysis of transferrin glycosylation revealed severe dysglycosylation corresponding to a type II congenital disorder of glycosylation (CDG) and the blood manganese levels were below the detection limit. The variants c.112G>C (p.Gly38Arg) and c.1019T>A (p.Ile340Asn) were identified in SLC39A8. A second individual with the variants c.97G>A (p.Val33Met) and c.1004G>C (p.Ser335Thr) on the paternal allele and c.610G>T (p.Gly204Cys) on the maternal allele was identified among a group of unresolved case subjects with CDG. These data demonstrate that variants in SLC39A8 impair the function of manganese-dependent enzymes, most notably β-1,4-galactosyltransferase, a Golgi enzyme essential for biosynthesis of the carbohydrate part of glycoproteins. Impaired galactosylation leads to a severe disorder with deformed skull, severe seizures, short limbs, profound psychomotor retardation, and hearing loss. Oral galactose supplementation is a treatment option and results in complete normalization of glycosylation. SLC39A8 deficiency links a trace element deficiency with inherited glycosylation disorders. Copyright © 2015 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  20. Structure of Bor1 supports an elevator transport mechanism for SLC4 anion exchangers.

    Science.gov (United States)

    Thurtle-Schmidt, Bryan H; Stroud, Robert M

    2016-09-20

    Boron is essential for plant growth because of its incorporation into plant cell walls; however, in excess it is toxic to plants. Boron transport and homeostasis in plants is regulated in part by the borate efflux transporter Bor1, a member of the solute carrier (SLC) 4 transporter family with homology to the human bicarbonate transporter Band 3. Here, we present the 4.1-Å resolution crystal structure of Arabidopsis thaliana Bor1. The structure displays a dimeric architecture in which dimerization is mediated by centralized Gate domains. Comparisons with a structure of Band 3 in an outward-open state reveal that the Core domains of Bor1 have rotated inwards to achieve an occluded state. Further structural comparisons with UapA, a xanthine transporter from the nucleobase-ascorbate transporter family, show that the downward pivoting of the Core domains relative to the Gate domains may access an inward-open state. These results suggest that the SLC4, SLC26, and nucleobase-ascorbate transporter families all share an elevator transport mechanism in which alternating access is provided by Core domains that carry substrates across a membrane.

  1. Cation-Coupled Bicarbonate Transporters

    OpenAIRE

    Aalkjaer, Christian; Boedtkjer, Ebbe; Choi, Inyeong; Lee, Soojung

    2014-01-01

    Cation-coupled HCO3− transport was initially identified in the mid-1970s when pioneering studies showed that acid extrusion from cells is stimulated by CO2/HCO3− and associated with Na+ and Cl− movement. The first Na+-coupled bicarbonate transporter (NCBT) was expression-cloned in the late 1990s. There are currently five mammalian NCBTs in the SLC4-family: the electrogenic Na,HCO3-cotransporters NBCe1 and NBCe2 (SLC4A4 and SLC4A5 gene products); the electroneutral Na,HCO3-cotransporter NBCn1 ...

  2. Topology mapping to characterize cyanobacterial bicarbonate transporters: BicA (SulP/SLC26 family) and SbtA.

    Science.gov (United States)

    Price, G Dean; Howitt, Susan M

    2014-09-01

    This mini-review addresses advances in understanding the transmembrane topologies of two unrelated, single-subunit bicarbonate transporters from cyanobacteria, namely BicA and SbtA. BicA is a Na(+)-dependent bicarbonate transporter that belongs to the SulP/SLC26 family that is widespread in both eukaryotes and prokaryotes. Topology mapping of BicA via the phoA/lacZ fusion reporter method identified 12 transmembrane helices with an unresolved hydrophobic region just beyond helix 8. Re-interpreting this data in the light of a recent topology study on rat prestin leads to a consensus topology of 14 transmembrane domains with a 7+7 inverted repeat structure. SbtA is also a Na(+)-dependent bicarbonate transporter, but of considerably higher affinity (Km 2-5 μM versus >100 μM for BicA). Whilst SbtA is widespread in cyanobacteria and a few bacteria, it appears to be absent from eukaryotes. Topology mapping of SbtA via the phoA/lacZ fusion reporter method identified 10 transmembrane helices. The topology consists of a 5+5 inverted repeat, with the two repeats separated by a large intracellular loop. The unusual location of the N and C-termini outside the cell raises the possibility that SbtA forms a novel fold, not so far identified by structural and topological studies on transport proteins.

  3. Oncogenic MYC Activates a Feedforward Regulatory Loop Promoting Essential Amino Acid Metabolism and Tumorigenesis.

    Science.gov (United States)

    Yue, Ming; Jiang, Jue; Gao, Peng; Liu, Hudan; Qing, Guoliang

    2017-12-26

    Most tumor cells exhibit obligatory demands for essential amino acids (EAAs), but the regulatory mechanisms whereby tumor cells take up EAAs and EAAs promote malignant transformation remain to be determined. Here, we show that oncogenic MYC, solute carrier family (SLC) 7 member 5 (SLC7A5), and SLC43A1 constitute a feedforward activation loop to promote EAA transport and tumorigenesis. MYC selectively activates Slc7a5 and Slc43a1 transcription through direct binding to specific E box elements within both genes, enabling effective EAA import. Elevated EAAs, in turn, stimulate Myc mRNA translation, in part through attenuation of the GCN2-eIF2α-ATF4 amino acid stress response pathway, leading to MYC-dependent transcriptional amplification. SLC7A5/SLC43A1 depletion inhibits MYC expression, metabolic reprogramming, and tumor cell growth in vitro and in vivo. These findings thus reveal a MYC-SLC7A5/SLC43A1 signaling circuit that underlies EAA metabolism, MYC deregulation, and tumorigenesis. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  4. Loss-of-function mutations in SLC30A8 protect against type 2 diabetes.

    Science.gov (United States)

    Flannick, Jason; Thorleifsson, Gudmar; Beer, Nicola L; Jacobs, Suzanne B R; Grarup, Niels; Burtt, Noël P; Mahajan, Anubha; Fuchsberger, Christian; Atzmon, Gil; Benediktsson, Rafn; Blangero, John; Bowden, Don W; Brandslund, Ivan; Brosnan, Julia; Burslem, Frank; Chambers, John; Cho, Yoon Shin; Christensen, Cramer; Douglas, Desirée A; Duggirala, Ravindranath; Dymek, Zachary; Farjoun, Yossi; Fennell, Timothy; Fontanillas, Pierre; Forsén, Tom; Gabriel, Stacey; Glaser, Benjamin; Gudbjartsson, Daniel F; Hanis, Craig; Hansen, Torben; Hreidarsson, Astradur B; Hveem, Kristian; Ingelsson, Erik; Isomaa, Bo; Johansson, Stefan; Jørgensen, Torben; Jørgensen, Marit Eika; Kathiresan, Sekar; Kong, Augustine; Kooner, Jaspal; Kravic, Jasmina; Laakso, Markku; Lee, Jong-Young; Lind, Lars; Lindgren, Cecilia M; Linneberg, Allan; Masson, Gisli; Meitinger, Thomas; Mohlke, Karen L; Molven, Anders; Morris, Andrew P; Potluri, Shobha; Rauramaa, Rainer; Ribel-Madsen, Rasmus; Richard, Ann-Marie; Rolph, Tim; Salomaa, Veikko; Segrè, Ayellet V; Skärstrand, Hanna; Steinthorsdottir, Valgerdur; Stringham, Heather M; Sulem, Patrick; Tai, E Shyong; Teo, Yik Ying; Teslovich, Tanya; Thorsteinsdottir, Unnur; Trimmer, Jeff K; Tuomi, Tiinamaija; Tuomilehto, Jaakko; Vaziri-Sani, Fariba; Voight, Benjamin F; Wilson, James G; Boehnke, Michael; McCarthy, Mark I; Njølstad, Pål R; Pedersen, Oluf; Groop, Leif; Cox, David R; Stefansson, Kari; Altshuler, David

    2014-04-01

    Loss-of-function mutations protective against human disease provide in vivo validation of therapeutic targets, but none have yet been described for type 2 diabetes (T2D). Through sequencing or genotyping of ~150,000 individuals across 5 ancestry groups, we identified 12 rare protein-truncating variants in SLC30A8, which encodes an islet zinc transporter (ZnT8) and harbors a common variant (p.Trp325Arg) associated with T2D risk and glucose and proinsulin levels. Collectively, carriers of protein-truncating variants had 65% reduced T2D risk (P = 1.7 × 10(-6)), and non-diabetic Icelandic carriers of a frameshift variant (p.Lys34Serfs*50) demonstrated reduced glucose levels (-0.17 s.d., P = 4.6 × 10(-4)). The two most common protein-truncating variants (p.Arg138* and p.Lys34Serfs*50) individually associate with T2D protection and encode unstable ZnT8 proteins. Previous functional study of SLC30A8 suggested that reduced zinc transport increases T2D risk, and phenotypic heterogeneity was observed in mouse Slc30a8 knockouts. In contrast, loss-of-function mutations in humans provide strong evidence that SLC30A8 haploinsufficiency protects against T2D, suggesting ZnT8 inhibition as a therapeutic strategy in T2D prevention.

  5. OCD candidate gene SLC1A1/EAAT3 impacts basal ganglia-mediated activity and stereotypic behavior.

    Science.gov (United States)

    Zike, Isaac D; Chohan, Muhammad O; Kopelman, Jared M; Krasnow, Emily N; Flicker, Daniel; Nautiyal, Katherine M; Bubser, Michael; Kellendonk, Christoph; Jones, Carrie K; Stanwood, Gregg; Tanaka, Kenji Fransis; Moore, Holly; Ahmari, Susanne E; Veenstra-VanderWeele, Jeremy

    2017-05-30

    Obsessive-compulsive disorder (OCD) is a chronic, disabling condition with inadequate treatment options that leave most patients with substantial residual symptoms. Structural, neurochemical, and behavioral findings point to a significant role for basal ganglia circuits and for the glutamate system in OCD. Genetic linkage and association studies in OCD point to SLC1A1 , which encodes the neuronal glutamate/aspartate/cysteine transporter excitatory amino acid transporter 3 (EAAT3)/excitatory amino acid transporter 1 (EAAC1). However, no previous studies have investigated EAAT3 in basal ganglia circuits or in relation to OCD-related behavior. Here, we report a model of Slc1a1 loss based on an excisable STOP cassette that yields successful ablation of EAAT3 expression and function. Using amphetamine as a probe, we found that EAAT3 loss prevents expected increases in ( i ) locomotor activity, ( ii ) stereotypy, and ( iii ) immediate early gene induction in the dorsal striatum following amphetamine administration. Further, Slc1a1 -STOP mice showed diminished grooming in an SKF-38393 challenge experiment, a pharmacologic model of OCD-like grooming behavior. This reduced grooming is accompanied by reduced dopamine D 1 receptor binding in the dorsal striatum of Slc1a1 -STOP mice. Slc1a1 -STOP mice also exhibit reduced extracellular dopamine concentrations in the dorsal striatum both at baseline and following amphetamine challenge. Viral-mediated restoration of Slc1a1 /EAAT3 expression in the midbrain but not in the striatum results in partial rescue of amphetamine-induced locomotion and stereotypy in Slc1a1 -STOP mice, consistent with an impact of EAAT3 loss on presynaptic dopaminergic function. Collectively, these findings indicate that the most consistently associated OCD candidate gene impacts basal ganglia-dependent repetitive behaviors.

  6. Meta-analysis of 28,141 individuals identifies common variants within five new loci that influence uric acid concentrations.

    Directory of Open Access Journals (Sweden)

    Melanie Kolz

    2009-06-01

    Full Text Available Elevated serum uric acid levels cause gout and are a risk factor for cardiovascular disease and diabetes. To investigate the polygenetic basis of serum uric acid levels, we conducted a meta-analysis of genome-wide association scans from 14 studies totalling 28,141 participants of European descent, resulting in identification of 954 SNPs distributed across nine loci that exceeded the threshold of genome-wide significance, five of which are novel. Overall, the common variants associated with serum uric acid levels fall in the following nine regions: SLC2A9 (p = 5.2x10(-201, ABCG2 (p = 3.1x10(-26, SLC17A1 (p = 3.0x10(-14, SLC22A11 (p = 6.7x10(-14, SLC22A12 (p = 2.0x10(-9, SLC16A9 (p = 1.1x10(-8, GCKR (p = 1.4x10(-9, LRRC16A (p = 8.5x10(-9, and near PDZK1 (p = 2.7x10(-9. Identified variants were analyzed for gender differences. We found that the minor allele for rs734553 in SLC2A9 has greater influence in lowering uric acid levels in women and the minor allele of rs2231142 in ABCG2 elevates uric acid levels more strongly in men compared to women. To further characterize the identified variants, we analyzed their association with a panel of metabolites. rs12356193 within SLC16A9 was associated with DL-carnitine (p = 4.0x10(-26 and propionyl-L-carnitine (p = 5.0x10(-8 concentrations, which in turn were associated with serum UA levels (p = 1.4x10(-57 and p = 8.1x10(-54, respectively, forming a triangle between SNP, metabolites, and UA levels. Taken together, these associations highlight additional pathways that are important in the regulation of serum uric acid levels and point toward novel potential targets for pharmacological intervention to prevent or treat hyperuricemia. In addition, these findings strongly support the hypothesis that transport proteins are key in regulating serum uric acid levels.

  7. Downregulation of SLC7A7 Triggers an Inflammatory Phenotype in Human Macrophages and Airway Epithelial Cells

    Directory of Open Access Journals (Sweden)

    Bianca Maria Rotoli

    2018-03-01

    Full Text Available Lysinuric protein intolerance (LPI is a recessively inherited aminoaciduria caused by mutations of SLC7A7, the gene encoding y+LAT1 light chain of system y+L for cationic amino acid transport. The pathogenesis of LPI is still unknown. In this study, we have utilized a gene silencing approach in macrophages and airway epithelial cells to investigate whether complications affecting lung and immune system are directly ascribable to the lack of SLC7A7 or, rather, mediated by an abnormal accumulation of arginine in mutated cells. When SLC7A7/y+LAT1 was silenced in human THP-1 macrophages and A549 airway epithelial cells by means of short interference RNA (siRNA, a significant induction of the expression and release of the inflammatory mediators IL1β and TNFα was observed, no matter the intracellular arginine availability. This effect was mainly regulated at transcriptional level through the activation of NFκB signaling pathway. Moreover, since respiratory epithelial cells are the important sources of chemokines in response to pro-inflammatory stimuli, the effect of IL1β has been addressed on SLC7A7 silenced A549 cells. Results obtained indicated that the downregulation of SLC7A7/y+LAT1 markedly strengthened the stimulatory effect of the cytokine on CCL5/RANTES expression and release without affecting the levels of CXCL8/IL8. Consistently, also the conditioned medium of silenced THP-1 macrophages activated airway epithelial cells in terms of CCL5/RANTES expression due to the presence of elevated amount of proinflammatory cytokines. In conclusion, our results point to a novel thus far unknown function of SLC7A7/y+LAT1, that, under physiological conditions, besides transporting arginine, may act as a brake to restrain inflammation.

  8. The role of SLC2A1 in early onset and childhood absence epilepsies

    DEFF Research Database (Denmark)

    Muhle, Hiltrud; Helbig, Ingo; Frøslev, Tobias Guldberg

    2013-01-01

    Early Onset Absence Epilepsy constitutes an Idiopathic Generalized Epilepsy with absences starting before the age of four years. Mutations in SLC2A1, encoding the glucose transporter, account for approximately 10% of EOAE cases. The role of SLC2A1 mutations in absence epilepsies with a later onset...

  9. Activation of lysosomal P2X4 by ATP transported into lysosomes via VNUT/SLC17A9 using V‐ATPase generated voltage gradient as the driving force

    Science.gov (United States)

    Zhong, Xi Zoë; Cao, Qi; Sun, Xue

    2016-01-01

    Key points SLC17A9 proteins function as a lysosomal ATP transporter responsible for lysosomal ATP accumulation.P2X4 receptors act as lysosomal ion channels activated by luminal ATP.SLC17A9‐mediated ATP transport across the lysosomal membrane is suppressed by Bafilomycin A1, the V‐ATPase inhibitor.SLC17A9 mainly uses voltage gradient but not pH gradient generated by the V‐ATPase as the driving force to transport ATP into the lysosome to activate P2X4. Abstract The lysosome contains abundant ATP which plays important roles in lysosome functions and in cell signalling. Recently, solute carrier family 17 member 9 (SLC17A9, also known as VNUT for vesicular nucleotide transporter) proteins were suggested to function as a lysosomal ATP transporter responsible for lysosomal ATP accumulation, and P2X4 receptors were suggested to be lysosomal ion channels that are activated by luminal ATP. However, the molecular mechanism of SLC17A9 transporting ATP and the regulatory mechanism of lysosomal P2X4 are largely unknown. In this study, we report that SLC17A9‐mediated ATP transport across lysosomal membranes is suppressed by Bafilomycin A1, the V‐ATPase inhibitor. By measuring P2X4 activity, which is indicative of ATP transport across lysosomal membranes, we further demonstrated that SLC17A9 mainly uses voltage gradient but not pH gradient as the driving force to transport ATP into lysosomes. This study provides a molecular mechanism for lysosomal ATP transport mediated by SLC17A9. It also suggests a regulatory mechanism of lysosomal P2X4 by SLC17A9. PMID:27477609

  10. Alternative transcription of sodium/bicarbonate transporter SLC4A7 gene enhanced by single nucleotide polymorphisms.

    Science.gov (United States)

    Park, Hae Jeong; Lee, Soojung; Ju, Eunji; Jones, Jayre A; Choi, Inyeong

    2017-03-01

    Genome-wide association studies have identified the single nucleotide polymorphism (SNP) rs3278 in the human SLC4A7 gene as one of the marker loci for addiction vulnerability. This marker is located in an intron of the gene, and its genomic role has been unknown. In this study, we examined rs3278 and three adjacent SNPs prevalent in alcoholics for their effects on an alternative promoter that would lead to the production of the NH 2 -terminally truncated protein NBCn1ΔN450, missing the first 450 amino acids. Analysis of the transcription start site database and a promoter prediction algorithm identified a cluster of three promoters in intron 7 and two short CpG-rich sites in intron 6. The promoter closest to rs3278 showed strong transcription activity in luciferase reporter gene assays. Major-to-minor allele substitution at rs3278 resulted in increased transcription activity. Equivalent substitutions at adjacent rs3772723 (intron 7) and rs13077400 (exon 8) had negligible effect; however, the substitution at nonsynonymous rs3755652 (exon 8) increased the activity by more than twofold. The concomitant substitution at rs3278/rs3755652 produced an additive effect. The rs3755652 had more profound effects on the promoter than the upstream regulatory CpG sites. The amino acid change E326K caused by rs3755652 had negligible effect on transporter function. In HEK 293 cells, NBCn1ΔN450 was expressed in plasma membranes, but at significantly lower levels than the nontruncated NBCn1-E. The pH change mediated by NBCn1ΔN450 was also low. We conclude that rs3278 and rs3755652 stimulate an alternative transcription of the SLC4A7 gene, increasing the production of a defective transporter. Copyright © 2017 the American Physiological Society.

  11. Tissue-specific amino acid transporter partners ACE2 and collectrin differentially interact with hartnup mutations

    DEFF Research Database (Denmark)

    Camargo, Simone M R; Singer, Dustin; Makrides, Victoria

    2008-01-01

    BACKGROUND & AIMS: Hartnup amino acid transporter B(0)AT1 (SLC6A19) is the major luminal sodium-dependent neutral amino acid transporter of small intestine and kidney proximal tubule. The expression of B(0)AT1 in kidney was recently shown to depend on its association with collectrin (Tmem27...

  12. SLC52A2 [p.P141T] and SLC52A3 [p.N21S] causing Brown-Vialetto-Van Laere Syndrome in an Indian patient: First genetically proven case with mutations in two riboflavin transporters.

    Science.gov (United States)

    Udhayabanu, Tamilarasan; Subramanian, Veedamali S; Teafatiller, Trevor; Gowda, Vykuntaraju K; Raghavan, Varun S; Varalakshmi, Perumal; Said, Hamid M; Ashokkumar, Balasubramaniem

    2016-11-01

    Brown-Vialetto-Van Laere Syndrome (BVVLS), a rare neurological disorder characterized by bulbar palsies and sensorineural deafness, is mainly associated with defective riboflavin transporters encoded by the SLC52A2 and SLC52A3 genes. Here we present a 16-year-old BVVLS patient belonging to a five generation consanguineous family from Indian ethnicity with two homozygous missense mutations viz., c.421C>A [p.P141T] in SLC52A2 and c.62A>G [p.N21S] in SLC52A3. Functional characterization based on 3 H-riboflavin uptake assay and live-cell confocal imaging revealed that the effect of mutation c.421C>A [p.P141T] identified in SLC52A2 had a slight reduction in riboflavin uptake; on the other hand, the c.62A>G [p.N21S] identified in SLC52A3 showed a drastic reduction in riboflavin uptake, which appeared to be due to impaired trafficking and membrane targeting of the hRFVT-3 protein. This is the first report presenting mutations in both riboflavin transporters hRFVT-2 and hRFVT-3 in the same BVVLS patient. Also, c.62A>G [p.N21S] in SLC52A3 appears to contribute more to the disease phenotype in this patient than c.421C>A [p.P141T] in SLC52A2. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Exonal deletion of SLC24A4 causes hypomaturation amelogenesis imperfecta.

    Science.gov (United States)

    Seymen, F; Lee, K-E; Tran Le, C G; Yildirim, M; Gencay, K; Lee, Z H; Kim, J-W

    2014-04-01

    Amelogenesis imperfecta is a heterogeneous group of genetic conditions affecting enamel formation. Recently, mutations in solute carrier family 24 member 4 (SLC24A4) have been identified to cause autosomal recessive hypomaturation amelogenesis imperfecta. We recruited a consanguineous family with hypomaturation amelogenesis imperfecta with generalized brown discoloration. Sequencing of the candidate genes identified a 10-kb deletion, including exons 15, 16, and most of the last exon of the SLC24A4 gene. Interestingly, this deletion was caused by homologous recombination between two 354-bp-long homologous sequences located in intron 14 and the 3' UTR. This is the first report of exonal deletion in SLC24A4 providing confirmatory evidence that the function of SLC24A4 in calcium transport has a crucial role in the maturation stage of amelogenesis.

  14. Weekly intra-amniotic IGF-1 treatment increases growth of growth-restricted ovine fetuses and up-regulates placental amino acid transporters.

    Directory of Open Access Journals (Sweden)

    Jibran A Wali

    Full Text Available Frequent treatment of the growth-restricted (IUGR ovine fetus with intra-amniotic IGF-1 increases fetal growth. We aimed to determine whether increased growth was maintained with an extended dosing interval and to examine possible mechanisms. Pregnant ewes were allocated to three groups: Control, and two IUGR groups (induced by placental embolization treated with weekly intra-amniotic injections of either saline (IUGR or 360 µg IGF-1 (IGF1. IUGR fetuses were hypoxic, hyperuremic, hypoglycemic, and grew more slowly than controls. Placental glucose uptake and SLC2A1 (GLUT2 mRNA levels decreased in IUGR fetuses, but SLC2A3 (GLUT3 and SLC2A4 (GLUT4 levels were unaffected. IGF-1 treatment increased fetal growth rate, did not alter uterine blood flow or placental glucose uptake, and increased placental SLC2A1 and SLC2A4 (but not SLC2A3 mRNA levels compared with saline-treated IUGR animals. Following IGF-1 treatment, placental mRNA levels of isoforms of the system A, y(+, and L amino acid transporters increased 1.3 to 5.0 fold, while the ratio of phosphorylated-mTOR to total mTOR also tended to increase. Weekly intra-amniotic IGF-1 treatment provides a promising avenue for intra-uterine treatment of IUGR babies, and may act via increased fetal substrate supply, up-regulating placental transporters for neutral, cationic, and branched-chain amino acids, possibly via increased activation of the mTOR pathway.

  15. Additive composite ABCG2, SLC2A9 and SLC22A12 scores of high-risk alleles with alcohol use modulate gout risk.

    Science.gov (United States)

    Tu, Hung-Pin; Chung, Chia-Min; Min-Shan Ko, Albert; Lee, Su-Shin; Lai, Han-Ming; Lee, Chien-Hung; Huang, Chung-Ming; Liu, Chiu-Shong; Ko, Ying-Chin

    2016-09-01

    The aim of the present study was to evaluate the contribution of urate transporter genes and alcohol use to the risk of gout/tophi. Eight variants of ABCG2, SLC2A9, SLC22A12, SLC22A11 and SLC17A3 were genotyped in male individuals in a case-control study with 157 gout (33% tophi), 106 asymptomatic hyperuricaemia and 295 control subjects from Taiwan. The multilocus profiles of the genetic risk scores for urate gene variants were used to evaluate the risk of asymptomatic hyperuricaemia, gout and tophi. ABCG2 Q141K (T), SLC2A9 rs1014290 (A) and SLC22A12 rs475688 (C) under an additive model and alcohol use independently predicted the risk of gout (respective odds ratio for each factor=2.48, 2.03, 1.95 and 2.48). The additive composite Q141K, rs1014290 and rs475688 scores of high-risk alleles were associated with gout risk (Pgout and tophi risk (P for interaction=0.0452, 0.0033). The synergistic effect of genetic urate score 5-6 and alcohol use indicates that these combined factors correlate with gout and tophi occurrence.

  16. L-type amino-acid transporter 1 (LAT1): a therapeutic target supporting growth and survival of T-cell lymphoblastic lymphoma/T-cell acute lymphoblastic leukemia

    NARCIS (Netherlands)

    Rosilio, C.; Nebout, M.; Imbert, V.; Griessinger, E.; Neffati, Z.; Benadiba, J.; Hagenbeek, T.; Spits, H.; Reverso, J.; Ambrosetti, D.; Michiels, J.-F.; Bailly-Maitre, B.; Endou, H.; Wempe, M. F.; Peyron, J.-F.

    2015-01-01

    The altered metabolism of cancer cells is a treasure trove to discover new antitumoral strategies. The gene (SLC7A5) encoding system L amino-acid transporter 1 (LAT1) is overexpressed in murine lymphoma cells generated via T-cell deletion of the pten tumor suppressor, and also in human T-cell acute

  17. Molecular Properties of Drugs Interacting with SLC22 Transporters OAT1, OAT3, OCT1, and OCT2: A Machine-Learning Approach.

    Science.gov (United States)

    Liu, Henry C; Goldenberg, Anne; Chen, Yuchen; Lun, Christina; Wu, Wei; Bush, Kevin T; Balac, Natasha; Rodriguez, Paul; Abagyan, Ruben; Nigam, Sanjay K

    2016-10-01

    Statistical analysis was performed on physicochemical descriptors of ∼250 drugs known to interact with one or more SLC22 "drug" transporters (i.e., SLC22A6 or OAT1, SLC22A8 or OAT3, SLC22A1 or OCT1, and SLC22A2 or OCT2), followed by application of machine-learning methods and wet laboratory testing of novel predictions. In addition to molecular charge, organic anion transporters (OATs) were found to prefer interacting with planar structures, whereas organic cation transporters (OCTs) interact with more three-dimensional structures (i.e., greater SP3 character). Moreover, compared with OAT1 ligands, OAT3 ligands possess more acyclic tetravalent bonds and have a more zwitterionic/cationic character. In contrast, OCT1 and OCT2 ligands were not clearly distinquishable form one another by the methods employed. Multiple pharmacophore models were generated on the basis of the drugs and, consistent with the machine-learning analyses, one unique pharmacophore created from ligands of OAT3 possessed cationic properties similar to OCT ligands; this was confirmed by quantitative atomic property field analysis. Virtual screening with this pharmacophore, followed by transport assays, identified several cationic drugs that selectively interact with OAT3 but not OAT1. Although the present analysis may be somewhat limited by the need to rely largely on inhibition data for modeling, wet laboratory/in vitro transport studies, as well as analysis of drug/metabolite handling in Oat and Oct knockout animals, support the general validity of the approach-which can also be applied to other SLC and ATP binding cassette drug transporters. This may make it possible to predict the molecular properties of a drug or metabolite necessary for interaction with the transporter(s), thereby enabling better prediction of drug-drug interactions and drug-metabolite interactions. Furthermore, understanding the overlapping specificities of OATs and OCTs in the context of dynamic transporter tissue

  18. SLC1 and SLC4 encode partially redundant acyl-coenzyme A 1-acylglycerol-3-phosphate O-acyltransferases of budding yeast

    DEFF Research Database (Denmark)

    Benghezal, Mohammed; Roubaty, Carole; Veepuri, Vijayanath

    2007-01-01

    Phosphatidic acid is the intermediate, from which all glycerophospholipids are synthesized. In yeast, it is generated from lysophosphatidic acid, which is acylated by Slc1p, an sn-2-specific, acyl-coenzyme A-dependent 1-acylglycerol-3-phosphate O-acyltransferase. Deletion of SLC1 is not lethal...

  19. Association of serotonin transporter (SLC6A4 & receptor (5HTR1A, 5HTR2A polymorphisms with response to treatment with escitalopram in patients with major depressive disorder : A preliminary study

    Directory of Open Access Journals (Sweden)

    Aniruddha Basu

    2015-01-01

    Full Text Available Background & objectives: Genetic factors have potential of predicting response to antidepressants in patients with major depressive disorder (MDD. In this study, an attempt was made to find an association between response to escitalopram in patients with MDD, and serotonin transporter (SLC6A4 and receptor (5HTR1A, 5HTR2A polymorphisms. Methods: Fifty five patients diagnosed as suffering from MDD, were selected for the study. The patients were treated with escitalopram over a period of 6-8 wk. Severity of depression, response to treatment and side effects were assessed using standardised instruments. Genetic variations from HTR1A (rs6295, HTR2A (rs6311 and rs6313 and SLC6A4 (44 base-pair insertion/deletion at 5-HTTLPR were genotyped. The genetic data of the responders and non-responders were compared to assess the role of genetic variants in therapeutic outcome. Results: Thirty six (65.5% patients responded to treatment, and 19 (34.5% had complete remission. No association was observed for genotype and allelic frequencies of single nucleotide polymorphisms (SNPs among remitter/non-remitter and responder/non-responder groups, and six most common side-effects, except memory loss which was significantly associated with rs6311 ( p0 =0.03. Interpretation & conclusions: No significant association was found between the SNPs analysed and response to escitalopram in patients with MDD though a significant association was seen between the side effect of memory loss and rs6311. Studies with larger sample are required to find out genetic basis of antidepressant response in Indian patients.

  20. Contribution of SLC30A8 variants to the risk of type 2 diabetes in a multi-ethnic population: a case control study

    OpenAIRE

    Salem, Sameer D; Saif-Ali, Riyadh; Ismail, Ikram S; Al-Hamodi, Zaid; Muniandy, Sekaran

    2014-01-01

    Background Several studies have shown the association of solute carrier family 30 (zinc transporter) member 8 (SLC30A8) rs13266634 with type 2 diabetes (T2D). However, the association of alternative variants and haplotypes of SLC30A8 with T2D have not been studied in different populations. The aim of this study is to assess the association of the alternative SLC30A8 variants, rs7002176 and rs1995222 as well as the most common variant, rs13266634 and haplotypes with glutamic acid decarboxylase...

  1. Cotransporting Ion is a Trigger for Cellular Endocytosis of Transporter-Targeting Nanoparticles: A Case Study of High-Efficiency SLC22A5 (OCTN2)-Mediated Carnitine-Conjugated Nanoparticles for Oral Delivery of Therapeutic Drugs.

    Science.gov (United States)

    Kou, Longfa; Yao, Qing; Sun, Mengchi; Wu, Chunnuan; Wang, Jia; Luo, Qiuhua; Wang, Gang; Du, Yuqian; Fu, Qiang; Wang, Jian; He, Zhonggui; Ganapathy, Vadivel; Sun, Jin

    2017-09-01

    OCTN2 (SLC22A5) is a Na + -coupled absorption transporter for l-carnitine in small intestine. This study tests the potential of this transporter for oral delivery of therapeutic drugs encapsulated in l-carnitine-conjugated poly(lactic-co-glycolic acid) (PLGA) nanoparticles (LC-PLGA NPs) and discloses the molecular mechanism for cellular endocytosis of transporter-targeting nanoparticles. Conjugation of l-carnitine to a surface of PLGA-NPs enhances the cellular uptake and intestinal absorption of encapsulated drug. In both cases, the uptake process is dependent on cotransporting ion Na + . Computational OCTN2 docking analysis shows that the presence of Na + is important for the formation of the energetically stable intermediate complex of transporter-Na + -LC-PLGA NPs, which is also the first step in cellular endocytosis of nanoparticles. The transporter-mediated intestinal absorption of LC-PLGA NPs occurs via endocytosis/transcytosis rather than via the traditional transmembrane transport. The portal blood versus the lymphatic route is evaluated by the plasma appearance of the drug in the control and lymph duct-ligated rats. Absorption via the lymphatic system is the predominant route in the oral delivery of the NPs. In summary, LC-PLGA NPs can effectively target OCTN2 on the enterocytes for enhancing oral delivery of drugs and the critical role of cotransporting ions should be noticed in designing transporter-targeting nanoparticles. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Correction of the first order beam transport of the SLC Arcs

    International Nuclear Information System (INIS)

    Walker, N.; Barklow, T.; Emma, P.; Krejcik, P.

    1991-05-01

    Correction of the first order transport of the SLC Arcs has been made possible by a technique which allows the full 4x4 transport matrix across any section of Arc to be experimentally determined. By the introduction of small closed bumps into each achromat, it is possible to substantially correct first order optical errors, and notably the cross plane coupling at the exit of the Arcs. 4 refs., 3 figs

  3. The Effect of Turmeric (Curcuma longa Extract on the Functionality of the Solute Carrier Protein 22 A4 (SLC22A4 and Interleukin-10 (IL-10 Variants Associated with Inflammatory Bowel Disease

    Directory of Open Access Journals (Sweden)

    Mark J. McCann

    2014-10-01

    Full Text Available Inflammatory bowel disease (IBD is a chronic relapsing disease. Genetic predisposition to the disease reduces an individual’s capacity to respond appropriately to environmental challenges in the intestine leading to inappropriate inflammation. IBD patients often modify their diet to mitigate or reduce the severity of inflammation. Turmeric (Curcuma longa L., Zingiberaceae has historically been used in Chinese, Hindu, and Ayurvedic medicine over several centuries to treat inflammatory disorders. To understand how turmeric may influence the consequences of a genetic predisposition to inappropriate inflammation, we used HEK293 cells to examine the in vitro capacity of turmeric extract and fractions to affect the functionality of two gene variants, solute carrier protein 22 A4 (SLC22A4, rs1050152 and interleukin-10 (IL-10, rs1800896 associated with IBD. We found that a turmeric extract and several chromatographically separated fractions beneficially affected the variants of SLC22A4 and IL-10 associated with IBD, by reducing inappropriate epithelial cell transport (SLC22A4, 503F and increasing anti-inflammatory cytokine gene promoter activity (IL-10, −1082A. The effect of turmeric on the IL-10 variant was strongly associated with the curcumin content of the extract and its fractions.

  4. The effect of turmeric (Curcuma longa) extract on the functionality of the solute carrier protein 22 A4 (SLC22A4) and interleukin-10 (IL-10) variants associated with inflammatory bowel disease.

    Science.gov (United States)

    McCann, Mark J; Johnston, Sarah; Reilly, Kerri; Men, Xuejing; Burgess, Elaine J; Perry, Nigel B; Roy, Nicole C

    2014-10-13

    Inflammatory bowel disease (IBD) is a chronic relapsing disease. Genetic predisposition to the disease reduces an individual's capacity to respond appropriately to environmental challenges in the intestine leading to inappropriate inflammation. IBD patients often modify their diet to mitigate or reduce the severity of inflammation. Turmeric (Curcuma longa L., Zingiberaceae) has historically been used in Chinese, Hindu, and Ayurvedic medicine over several centuries to treat inflammatory disorders. To understand how turmeric may influence the consequences of a genetic predisposition to inappropriate inflammation, we used HEK293 cells to examine the in vitro capacity of turmeric extract and fractions to affect the functionality of two gene variants, solute carrier protein 22 A4 (SLC22A4, rs1050152) and interleukin-10 (IL-10, rs1800896) associated with IBD. We found that a turmeric extract and several chromatographically separated fractions beneficially affected the variants of SLC22A4 and IL-10 associated with IBD, by reducing inappropriate epithelial cell transport (SLC22A4, 503F) and increasing anti-inflammatory cytokine gene promoter activity (IL-10, -1082A). The effect of turmeric on the IL-10 variant was strongly associated with the curcumin content of the extract and its fractions.

  5. SLC injector simulation and tuning for high charge transport

    International Nuclear Information System (INIS)

    Yeremian, A.D.; Miller, R.H.; Clendenin, J.E.; Early, R.A.; Ross, M.C.; Turner, J.L.; Wang, J.W.

    1992-01-01

    We have simulated the SLC injector from the thermionic gun through the first accelerating section and used the resulting parameters to tune the injector for optimum performance and high charge transport. Simulations are conducted using PARMELA, a three-dimensional space-charge model. The magnetic field profile due to the existing magnetic optics is calculated using POISSON, while SUPERFISH is used to calculate the space harmonics of the various bunchers and the accelerator cavities. The initial beam conditions in the PARMELA code are derived from the EGUN model of the gun. The resulting injector parameters from the PARMELA simulation are used to prescribe experimental settings of the injector components. The experimental results are in agreement with the results of the integrated injector model. (Author) 5 figs., 7 refs

  6. The zinc transporter SLC39A13/ZIP13 is required for connective tissue development; its involvement in BMP/TGF-beta signaling pathways.

    Directory of Open Access Journals (Sweden)

    Toshiyuki Fukada

    Full Text Available BACKGROUND: Zinc (Zn is an essential trace element and it is abundant in connective tissues, however biological roles of Zn and its transporters in those tissues and cells remain unknown. METHODOLOGY/PRINCIPAL FINDINGS: Here we report that mice deficient in Zn transporter Slc39a13/Zip13 show changes in bone, teeth and connective tissue reminiscent of the clinical spectrum of human Ehlers-Danlos syndrome (EDS. The Slc39a13 knockout (Slc39a13-KO mice show defects in the maturation of osteoblasts, chondrocytes, odontoblasts, and fibroblasts. In the corresponding tissues and cells, impairment in bone morphogenic protein (BMP and TGF-beta signaling were observed. Homozygosity for a SLC39A13 loss of function mutation was detected in sibs affected by a unique variant of EDS that recapitulates the phenotype observed in Slc39a13-KO mice. CONCLUSIONS/SIGNIFICANCE: Hence, our results reveal a crucial role of SLC39A13/ZIP13 in connective tissue development at least in part due to its involvement in the BMP/TGF-beta signaling pathways. The Slc39a13-KO mouse represents a novel animal model linking zinc metabolism, BMP/TGF-beta signaling and connective tissue dysfunction.

  7. 10 CFR 960.5-2-7 - Transportation.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 4 2010-01-01 2010-01-01 false Transportation. 960.5-2-7 Section 960.5-2-7 Energy... REPOSITORY Preclosure Guidelines Environment, Socioeconomics, and Transportation § 960.5-2-7 Transportation... using reasonably available technology; (iii) will not require transportation system components to meet...

  8. Potential for food-drug interactions by dietary phenolic acids on human organic anion transporters 1 (SLC22A6), 3 (SLC22A8), and 4 (SLC22A11).

    Science.gov (United States)

    Wang, Li; Sweet, Douglas H

    2012-10-15

    Phenolic acids exert beneficial health effects such as anti-oxidant, anti-carcinogenic, and anti-inflammatory activities and show systemic exposure after consumption of common fruits, vegetables, and beverages. However, knowledge regarding which components convey therapeutic benefits and the mechanism(s) by which they cross cell membranes is extremely limited. Therefore, we determined the inhibitory effects of nine food-derived phenolic acids, p-coumaric acid, ferulic acid, gallic acid, gentisic acid, 4-hydroxybenzoic acid, protocatechuic acid, sinapinic acid, syringic acid, and vanillic acid, on human organic anion transporter 1 (hOAT1), hOAT3, and hOAT4. In the present study, inhibition of OAT-mediated transport of prototypical substrates (1 μM) by phenolic acids (100 μM) was examined in stably expressing cell lines. All compounds significantly inhibited hOAT3 transport, while just ferulic, gallic, protocatechuic, sinapinic, and vanillic acid significantly blocked hOAT1 activity. Only sinapinic acid inhibited hOAT4 (~35%). For compounds exhibiting inhibition > ~60%, known clinical plasma concentration levels and plasma protein binding in humans were examined to select compounds to evaluate further with dose-response curves (IC(50) values) and drug-drug interaction (DDI) index determinations. IC(50) values ranged from 1.24 to 18.08 μM for hOAT1 and from 7.35 to 87.36 μM for hOAT3. Maximum DDI indices for gallic and gentisic acid (≫0.1) indicated a very strong potential for DDIs on hOAT1 and/or hOAT3. This study indicates that gallic acid from foods or supplements, or gentisic acid from salicylate-based drug metabolism, may significantly alter the pharmacokinetics (efficacy and toxicity) of concomitant therapeutics that are hOAT1 and/or hOAT3 substrates. Copyright © 2012 Elsevier Inc. All rights reserved.

  9. MicroRNA-129-5p Regulates Glycolysis and Cell Proliferation by Targeting the Glucose Transporter SLC2A3 in Gastric Cancer Cells

    Directory of Open Access Journals (Sweden)

    Di Chen

    2018-05-01

    Full Text Available Tumor cells increase their glucose consumption through aerobic glycolysis to manufacture the necessary biomass required for proliferation, commonly known as the Warburg effect. Accumulating evidences suggest that microRNAs (miRNAs interact with their target genes and contribute to metabolic reprogramming in cancer cells. By integrating high-throughput screening data and the existing miRNA expression datasets, we explored the roles of candidate glycometabolism-regulating miRNAs in gastric cancer (GC. Subsequent investigation of the characterized miRNAs indicated that miR-129-5p inhibits glucose metabolism in GC cells. miRNA-129-5p directly targets the 3′-UTR of SLC2A3, thereby suppressing glucose consumption, lactate production, cellular ATP levels, and glucose uptake of GC cells. In addition, the PI3K-Akt and MAPK signaling pathways are involved in the effects of the miR-129-5p/SLC2A3 axis, regulating GC glucose metabolism and growth. These results reveal a novel role of the miR-129-5p/SLC2A3 axis in reprogramming the glycometabolism process in GC cells and indicate a potential therapeutic target for the treatment of this disease.

  10. In silico analysis of consequences of non-synonymous SNPs of Slc11a2 gene in Indian bovines

    Directory of Open Access Journals (Sweden)

    Shreya M. Patel

    2015-09-01

    Full Text Available The aim of our study was to analyze the consequences of non-synonymous SNPs in Slc11a2 gene using bioinformatic tools. There is a current need of efficient bioinformatic tools for in-depth analysis of data generated by the next generation sequencing technologies. SNPs are known to play an imperative role in understanding the genetic basis of many genetic diseases. Slc11a2 is one of the major metal transporter families in mammals and plays a critical role in host defenses. In this study, we performed a comprehensive analysis of the impact of all non-synonymous SNPs in this gene using multiple tools like SIFT, PROVEAN, I-Mutant and PANTHER. Among the total 124 SNPs obtained from amplicon sequencing of Slc11a2 gene by Ion Torrent PGM involving 10 individuals of Gir cattle and Murrah buffalo each, we found 22 non-synonymous. Comparing the prediction of these 4 methods, 5 nsSNPs (G369R, Y374C, A377V, Q385H and N492S were identified as deleterious. In addition, while tested out for polar interactions with other amino acids in the protein, from above 5, Y374C, Q385H and N492S showed a change in interaction pattern and further confirmed by an increase in total energy after energy minimizations in case of mutant protein compared to the native.

  11. Effect of common polymorphisms of the farnesoid X receptor and bile acid transporters on the pharmacokinetics of ursodeoxycholic acid.

    Science.gov (United States)

    Hu, Miao; Fok, Benny S P; Wo, Siu-Kwan; Lee, Vincent H L; Zuo, Zhong; Tomlinson, Brian

    2016-01-01

    Ursodeoxycholic acid (UDCA), a natural, dihydroxy bile acid, promotes gallstone dissolution and has been attributed with several other beneficial effects. The farnesoid X receptor (FXR) may influence the pharmacokinetics of UDCA by modulating the expression of bile acid transporters. This exploratory study examined whether common functional polymorphisms in FXR and in bile acid transporter genes affect the pharmacokinetics of exogenous UDCA. Polymorphisms in genes for transporters involved in bile acid transport, solute carrier organic anion 1B1 (SLCO1B1) 388A>G and 521T>C, solute carrier 10A1 (SLC10A1) 800 C>T and ATP-binding cassette B11 (ABCB11) 1331T>C, and the FXR -1G>T polymorphism were genotyped in 26 male Chinese subjects who ingested single oral 500-mg doses of UDCA. Plasma concentrations of UDCA and its major conjugate metabolite glycoursodeoxycholic acid (GUDCA) were determined. The mean systemic exposure of UDCA was higher in the five subjects with one copy of the FXR -1G>T variant allele than in those homozygous for the wild-type allele (n = 21) (AUC0-24 h : 38.5 ± 28.2 vs. 20.9 ± 8.0 μg h/mL, P = 0.021), but this difference appeared mainly due to one outlier with the -1GT genotype and elevated baseline and post-treatment UDCA concentrations. After excluding the outlier, body weight was the only factor associated with plasma concentrations of UDCA and there were no significant associations with the other polymorphisms examined. None of the polymorphisms affected the pharmacokinetics of GUDCA. This study showed that the common polymorphisms in bile acid transporters had no significant effect on the pharmacokinetics of exogenous UDCA but an effect of the FXR polymorphism cannot be excluded. © 2015 Wiley Publishing Asia Pty Ltd.

  12. Physiology of SLC12 transporters: lessons from inherited human genetic mutations and genetically engineered mouse knockouts.

    Science.gov (United States)

    Gagnon, Kenneth B; Delpire, Eric

    2013-04-15

    Among the over 300 members of the solute carrier (SLC) group of integral plasma membrane transport proteins are the nine electroneutral cation-chloride cotransporters belonging to the SLC12 gene family. Seven of these transporters have been functionally described as coupling the electrically silent movement of chloride with sodium and/or potassium. Although in silico analysis has identified two additional SLC12 family members, no physiological role has been ascribed to the proteins encoded by either the SLC12A8 or the SLC12A9 genes. Evolutionary conservation of this gene family from protists to humans confirms their importance. A wealth of physiological, immunohistochemical, and biochemical studies have revealed a great deal of information regarding the importance of this gene family to human health and disease. The sequencing of the human genome has provided investigators with the capability to link several human diseases with mutations in the genes encoding these plasma membrane proteins. The availability of bacterial artificial chromosomes, recombination engineering techniques, and the mouse genome sequence has simplified the creation of targeting constructs to manipulate the expression/function of these cation-chloride cotransporters in the mouse in an attempt to recapitulate some of these human pathologies. This review will summarize the three human disorders that have been linked to the mutation/dysfunction of the Na-Cl, Na-K-2Cl, and K-Cl cotransporters (i.e., Bartter's, Gitleman's, and Andermann's syndromes), examine some additional pathologies arising from genetically modified mouse models of these cotransporters including deafness, blood pressure, hyperexcitability, and epithelial transport deficit phenotypes.

  13. Effect of SLC34A2 gene mutation on extracellular phosphorus transport in PAM alveolar epithelial cells.

    Science.gov (United States)

    Ma, Tiangang; Qu, Danhua; Yan, Bingdi; Zhang, Qinghua; Ren, Jin; Hu, Yanbing

    2018-01-01

    A mutation in the IIb sodium phosphate transporter SLC34A2 gene has recently been described in pulmonary alveolar microlithiasis (PAM) patients. Experiments in this study were aimed at confirming the role of the gene product in PAM by comparing phosphorylated products in extracellular fluid of alveolar epithelial cells overexpressing the SLC34A2 gene or its mutated version. Eukaryotic expression vectors were constructed and transfected into A549 human alveolar epithelial cells. There were three groups of cells including those transfected with empty vector plasmid pcDNA3.1(+) (plasmid control group), those transfected with normal SLC34A2 gene expressed from pcDNA3.1 (normal control group), and those transfected with a version of the PAM SLC34A2 gene linked to the pcDNA3.1(+) (PAM group). Transfection efficiencies were detected by reverse transcription-polymerase chain reaction (RT-PCR). At 48 h after transfection, the concentration of inorganic phosphorus in the culture medium was detected using an automatic biochemical analyzer. Our results showed the concentration of inorganic phosphorus in the supernatant of the normal control group was significantly lower than that in the plasmid control and PAM groups (PPAM group was significantly lower than that in the plasmid control group (PPAM patients, given that the function of the phosphate transporter seems to be affected and it is conceivable that it would lead to extracellular fluid alterations in vivo .

  14. Partial deletion of the sulfate transporter SLC13A1 is associated with an osteochondrodysplasia in the Miniature Poodle breed.

    Directory of Open Access Journals (Sweden)

    Mark W Neff

    Full Text Available A crippling dwarfism was first described in the Miniature Poodle in Great Britain in 1956. Here, we resolve the genetic basis of this recessively inherited disorder. A case-control analysis (8:8 of genotype data from 173 k SNPs revealed a single associated locus on CFA14 (P(raw <10(-8. All affected dogs were homozygous for an ancestral haplotype consistent with a founder effect and an identical-by-descent mutation. Systematic failure of nine, nearly contiguous SNPs, was observed solely in affected dogs, suggesting a deletion was the causal mutation. A 130-kb deletion was confirmed both by fluorescence in situ hybridization (FISH analysis and by cloning the physical breakpoints. The mutation was perfectly associated in all cases and obligate heterozygotes. The deletion ablated all but the first exon of SLC13A1, a sodium/sulfate symporter responsible for regulating serum levels of inorganic sulfate. Our results corroborate earlier findings from an Slc13a1 mouse knockout, which resulted in hyposulfatemia and syndromic defects. Interestingly, the metabolic disorder in Miniature Poodles appears to share more clinical signs with a spectrum of human disorders caused by SLC26A2 than with the mouse Slc13a1 model. SLC26A2 is the primary sodium-independent sulfate transporter in cartilage and bone and is important for the sulfation of proteoglycans such as aggregan. We propose that disruption of SLC13A1 in the dog similarly causes undersulfation of proteoglycans in the extracellular matrix (ECM, which impacts the conversion of cartilage to bone. A co-dominant DNA test of the deletion was developed to enable breeders to avoid producing affected dogs and to selectively eliminate the mutation from the gene pool.

  15. SLC and SLD: Experimental experience with a linear collider

    International Nuclear Information System (INIS)

    Breidenbach, M.

    1993-08-01

    The SLAC Linear Collider (SLC) is the prototype e + e - linear collider. This talk will consist of an introduction to SLC, a description of the strategy for luminosity, a description of the systems for the transport and measurement of the polarized electrons, and a description of the present performance of the SLC and planned upgrades. The detector, SLD, and the status of the polarization asymmetry measurement A LR will be described

  16. Recent SLC developments

    International Nuclear Information System (INIS)

    Ross, M.

    1993-04-01

    The SLAC Linear Collider (SLC) is the forerunner of a new generation of high energy accelerators. As such, it incorporates many novel features that must be fully exploited to achieve optimum performance. In this paper we present an overview of the frontiers of collider performance at SLC. Recent developments have centered on polarization, intensity and emittance preservation issues. A polarized source and spin transport system were successfully commissioned in 1992 and operated with high reliability. Practical intensity limits associated with rapid growth ( S ) bunch length instabilities have been observed in the damping rings. Ring RF voltage manipulations are used to suppress the instabilities. Emittance preservation technique development has focused on controlling system-wide instabilities and improving feedback and tuning procedures. Control of instabilities of all time scales, pulse to pulse, fast and slow, is one of the most challenging aspects of the collider. The challenge is met with (1) very high level of control and automation required for general tuning and optimization, (2) real-time transport line optical correction and monitoring, (3) coupled, high level, trajectory and energy feedback, (4) high order multipole optical correction and monitoring, (5) feedback-based linac beam emittance preservation, and (6) interaction region luminosity optimization. The common thread beneath all of these is the SLC control system which must provide a level of control, diagnosis and feedback not required for simpler machines

  17. 10 CFR 71.5 - Transportation of licensed material.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 2 2010-01-01 2010-01-01 false Transportation of licensed material. 71.5 Section 71.5 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) PACKAGING AND TRANSPORTATION OF RADIOACTIVE MATERIAL General Provisions § 71.5 Transportation of licensed material. (a) Each licensee who transports licensed...

  18. Impaired riboflavin transport due to missense mutations in SLC52A2 causes Brown-Vialetto-Van Laere syndrome

    OpenAIRE

    Haack, Tobias B.; Makowski, Christine; Yao, Yoshiaki; Graf, Elisabeth; Hempel, Maja; Wieland, Thomas; Tauer, Ulrike; Ahting, Uwe; Mayr, Johannes A.; Freisinger, Peter; Yoshimatsu, Hiroki; Inui, Ken; Strom, Tim M.; Meitinger, Thomas; Yonezawa, Atsushi

    2012-01-01

    Brown-Vialetto-Van Laere syndrome (BVVLS [MIM 211530]) is a rare neurological disorder characterized by infancy onset sensorineural deafness and ponto-bulbar palsy. Mutations in SLC52A3 (formerly C20orf54), coding for riboflavin transporter 2 (hRFT2), have been identified as the molecular genetic correlate in several individuals with BVVLS. Exome sequencing of just one single case revealed that compound heterozygosity for two pathogenic mutations in the SLC52A2 gene coding for riboflavin tran...

  19. Truncating SLC5A7 mutations underlie a spectrum of dominant hereditary motor neuropathies.

    Science.gov (United States)

    Salter, Claire G; Beijer, Danique; Hardy, Holly; Barwick, Katy E S; Bower, Matthew; Mademan, Ines; De Jonghe, Peter; Deconinck, Tine; Russell, Mark A; McEntagart, Meriel M; Chioza, Barry A; Blakely, Randy D; Chilton, John K; De Bleecker, Jan; Baets, Jonathan; Baple, Emma L; Walk, David; Crosby, Andrew H

    2018-04-01

    To identify the genetic cause of disease in 2 previously unreported families with forms of distal hereditary motor neuropathies (dHMNs). The first family comprises individuals affected by dHMN type V, which lacks the cardinal clinical feature of vocal cord paralysis characteristic of dHMN-VII observed in the second family. Next-generation sequencing was performed on the proband of each family. Variants were annotated and filtered, initially focusing on genes associated with neuropathy. Candidate variants were further investigated and confirmed by dideoxy sequence analysis and cosegregation studies. Thorough patient phenotyping was completed, comprising clinical history, examination, and neurologic investigation. dHMNs are a heterogeneous group of peripheral motor neuron disorders characterized by length-dependent neuropathy and progressive distal limb muscle weakness and wasting. We previously reported a dominant-negative frameshift mutation located in the concluding exon of the SLC5A7 gene encoding the choline transporter (CHT), leading to protein truncation, as the likely cause of dominantly-inherited dHMN-VII in an extended UK family. In this study, our genetic studies identified distinct heterozygous frameshift mutations located in the last coding exon of SLC5A7 , predicted to result in the truncation of the CHT C-terminus, as the likely cause of the condition in each family. This study corroborates C-terminal CHT truncation as a cause of autosomal dominant dHMN, confirming upper limb predominating over lower limb involvement, and broadening the clinical spectrum arising from CHT malfunction.

  20. Association of polymorphisms in 5-HTT (SLC6A4) and MAOA genes with measures of obesity in young adults of Portuguese origin.

    Science.gov (United States)

    Dias, Helena; Muc, Magdalena; Padez, Cristina; Manco, Licínio

    2016-01-01

    To investigate the association of polymorphisms in SLC6A4 and MAOA genes with overweight (including obesity). Young adults (n = 535) of Portuguese origin were genotyped for the SLC6A4 polymorphisms 5-HTTLPR and STin2 and a MAOA VNTR. BMI and body fat percentage were measured and a questionnaire was used to assess individual's sport practicing habits. In whole study sample, haplotype-based analysis revealed significant association with overweight/obesity for the individual 5-HTTLPR/Stin2 haplotype L10 (p = 0.04). In men, the MAOA 3R genotype was nominally associated with body fat (p = 0.04). In inactive individuals, overweight/obesity was found significantly associated with 5-HTTLPR L-allele (p = 0.01) and nominally associated with STin2 10-allele (p = 0.03). A significant association was also found testing for all haplotype effects (χ(2 )= 8.7; p = 0.03). We found some evidences for the association of SLC6A4 and MAOA genes with measures of obesity. Our results suggest physical inactivity accentuates the influence of SLC6A4 polymorphisms on obesity risk.

  1. Study of the serotonin transporter (SLC6A4 and BDNF genes in French patients with non syndromic mental deficiency

    Directory of Open Access Journals (Sweden)

    Mignon Laurence

    2010-02-01

    Full Text Available Abstract Background Mental deficiency has been linked to abnormalities in cortical neuronal network connectivity and plasticity. These mechanisms are in part under the control of two interacting signalling pathways, the serotonergic and the brain-derived neurotrophic (BDNF pathways. The aim of the current paper is to determine whether particular alleles or genotypes of two crucial genes of these systems, the serotonin transporter gene (SLC6A4 and the brain-derived neurotrophic factor gene (BDNF, are associated with mental deficiency (MD. Methods We analyzed four functional polymorphisms (rs25531, 5-HTTLPR, VNTR, rs3813034 of the SLC6A4 gene and one functional polymorphism (Val66 Met of the BDNF gene in 98 patients with non-syndromic mental deficiency (NS-MD and in an ethnically matched control population of 251 individuals. Results We found no significant differences in allele and genotype frequencies in the five polymorphisms studied in the SLC6A4 and BDNF genes of NS-MD patients versus control patients. While the comparison of the patterns of linkage disequilibrium (D' in the control and NS-MD populations revealed a degree of variability it did not, however, reach significance. No significant differences in frequencies of haplotypes and genotypes for VNTR/rs3813034 and rs25531/5-HTTLPR were observed. Conclusion Altogether, results from the present study do not support a role for any of the five functional polymorphisms of SLC6A4 and BDNF genes in the aetiology of NS-RM. Moreover, they suggest no epistatic interaction in NS-MD between polymorphisms in BDNF and SLC6A4. However, we suggest that further studies on these two pathways in NS-MD remain necessary.

  2. Effects of fasting and refeeding on gene expression of slc15a1a, a gene encoding an oligopeptide transporter (PepT1), in the intestine of Mozambique tilapia.

    Science.gov (United States)

    Orozco, Zenith Gaye A; Soma, Satoshi; Kaneko, Toyoji; Watanabe, Soichi

    2017-01-01

    The tissue distribution of slc15a1a, a gene that encodes an oligopeptide transporter, PepT1, and its response to fasting and refeeding were investigated in the intestinal epithelium of Mozambique tilapia for a better understanding of its role on nutrient absorption. The slc15a1a was predominantly expressed in the absorptive epithelia of the anterior part of the intestine, suggesting that digested oligopeptides are primarily absorbed in the anterior intestine. The response of slc15a1a to fasting was evaluated at 1, 2, 4, 7 and 14days after the last feeding. Fasting revealed a biphasic effect, where short-term fasting significantly upregulated slc15a1a expression and long-term fasting resulted in downregulation. The expression level continued to decrease and fell below the pre-fasted level from day 4 to 14. Proximal (the hepatic loop, HL) and distal parts (the proximal major coil, PMC) of the anterior intestine showed different magnitudes of responses to fasting; slc15a1a expression in the PMC showed greater upregulation and downregulation than that in the HL. Refeeding significantly stimulated slc15a1a expression at day 3, although the expression did not exceed the pre-fasted level. Observed responses of slc15a1a to fasting and refeeding suggest that the expression level of this gene can serve as a sensitive indicator of the changes that may occur in altering nutritional conditions. These findings contribute to a better understanding of the role of PepT1 in nutrition and of the complex mechanisms underlying the absorption of oligopeptides and amino acids in the intestine, and may lead to development of possible means to manipulate the absorption processes for the improvement of growth and other metabolic and physiological conditions in fish. Copyright © 2016. Published by Elsevier Inc.

  3. Effects of Mutations and Ligands on the Thermostability of the l-Arginine/Agmatine Antiporter AdiC and Deduced Insights into Ligand-Binding of Human l-Type Amino Acid Transporters

    Directory of Open Access Journals (Sweden)

    Hüseyin Ilgü

    2018-03-01

    Full Text Available The l-arginine/agmatine transporter AdiC is a prokaryotic member of the SLC7 family, which enables pathogenic enterobacteria to survive the extremely acidic gastric environment. Wild-type AdiC from Escherichia coli, as well as its previously reported point mutants N22A and S26A, were overexpressed homologously and purified to homogeneity. A size-exclusion chromatography-based thermostability assay was used to determine the melting temperatures (Tms of the purified AdiC variants in the absence and presence of the selected ligands l-arginine (Arg, agmatine, l-arginine methyl ester, and l-arginine amide. The resulting Tms indicated stabilization of AdiC variants upon ligand binding, in which Tms and ligand binding affinities correlated positively. Considering results from this and previous studies, we revisited the role of AdiC residue S26 in Arg binding and proposed interactions of the α-carboxylate group of Arg exclusively with amide groups of the AdiC backbone. In the context of substrate binding in the human SLC7 family member l-type amino acid transporter-1 (LAT1; SLC7A5, an analogous role of S66 in LAT1 to S26 in AdiC is discussed based on homology modeling and amino acid sequence analysis. Finally, we propose a binding mechanism for l-amino acid substrates to LATs from the SLC7 family.

  4. Imaging the L-type amino acid transporter-1 (LAT1 with Zr-89 immunoPET.

    Directory of Open Access Journals (Sweden)

    Oluwatayo F Ikotun

    Full Text Available The L-type amino acid transporter-1 (LAT1, SLC7A5 is upregulated in a wide range of human cancers, positively correlated with the biological aggressiveness of tumors, and a promising target for both imaging and therapy. Radiolabeled amino acids such as O-(2-[(18F]fluoroethyl-L-tyrosine (FET that are transport substrates for system L amino acid transporters including LAT1 have met limited success for oncologic imaging outside of the brain, and thus new strategies are needed for imaging LAT1 in systemic cancers. Here, we describe the development and biological evaluation of a novel zirconium-89 labeled antibody, [(89Zr]DFO-Ab2, targeting the extracellular domain of LAT1 in a preclinical model of colorectal cancer. This tracer demonstrated specificity for LAT1 in vitro and in vivo with excellent tumor imaging properties in mice with xenograft tumors. PET imaging studies showed high tumor uptake, with optimal tumor-to-non target contrast achieved at 7 days post administration. Biodistribution studies demonstrated tumor uptake of 10.5 ± 1.8 percent injected dose per gram (%ID/g at 7 days with a tumor to muscle ratio of 13 to 1. In contrast, the peak tumor uptake of the radiolabeled amino acid [(18F]FET was 4.4 ± 0.5 %ID/g at 30 min after injection with a tumor to muscle ratio of 1.4 to 1. Blocking studies with unlabeled anti-LAT1 antibody demonstrated a 55% reduction of [(89Zr]DFO-Ab2 accumulation in the tumor at 7 days. These results are the first report of direct PET imaging of LAT1 and demonstrate the potential of immunoPET agents for imaging specific amino acid transporters.

  5. Association between norepinephrine transporter gene (SLC6A2) polymorphisms and suicide in patients with major depressive disorder.

    Science.gov (United States)

    Kim, Yong-Ku; Hwang, Jung-A; Lee, Heon-Jeong; Yoon, Ho-Kyoung; Ko, Young-Hoon; Lee, Bun-Hee; Jung, Han-Yong; Hahn, Sang-Woo; Na, Kyoung-Sae

    2014-04-01

    Although several studies have investigated possible associations between norepinephrine neurotransmitter transporter gene (SLC6A2) polymorphisms and depression, few studies have examined associations between SLC6A2 polymorphisms and suicide. Three single-nucleotide polymorphisms (rs2242446, rs28386840, and rs5569) were measured in 550 patients: 201 with major depressive disorder (MDD) and suicide attempt/s, 160 with MDD without suicide attempts, and 189 healthy controls. Analysis of single-nucleotide polymorphisms (SNPs) and haplotype was conducted for the three groups. Subsequently, multivariate logistic regression analysis adjusting for age and gender was conducted to identify independent influences of each SNP. A possible association between suicide lethality and SLC6A2 polymorphisms was also investigated. In the genotype and allele frequency analysis, there were significant differences in rs28386840 between suicidal MDD patients and healthy controls. In the haplotype analysis, TAA (rs2242446-rs28386840-rs5569, from left to right) was associated with suicide attempts in MDD, although the significance (p=0.043) disappeared after Bonferroni correction. There were no relationships between lethality scores and SLC6A2 polymorphisms in suicidal MDD. Modest sample size and a single type of neurotransmitter analyzed (norepinephrine) are the primary limitations. Our results suggest that SLC6A2 polymorphisms were associated with suicide risk in patients with MDD. Future studies are warranted to elucidate possible mechanisms by which SLC6A2 polymorphisms influence suicide risk. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Lack of Association between a 3'UTR VNTR Polymorphism of Dopamine Transporter Gene (SLC6A3) and ADHD in a Brazilian Sample of Adult Patients

    Science.gov (United States)

    Aperecida da Silva, Maria; Cordeiro, Quirino; Louza, Mario; Vallada, Homero

    2011-01-01

    Objective: To investigate a possible association between a 3'UTR VNTR polymorphism of the dopamine transporter gene (SLC6A3) and ADHD in a Brazilian sample of adult patients. Method: Study Case-control with 102 ADHD adult outpatients ("DSM-IV" criteria) and 479 healthy controls. The primers' sequence used were: 3'UTR-Forward: 5' TGT GGT…

  7. SLC30A9 mutation affecting intracellular zinc homeostasis causes a novel cerebro-renal syndrome.

    Science.gov (United States)

    Perez, Yonatan; Shorer, Zamir; Liani-Leibson, Keren; Chabosseau, Pauline; Kadir, Rotem; Volodarsky, Michael; Halperin, Daniel; Barber-Zucker, Shiran; Shalev, Hanna; Schreiber, Ruth; Gradstein, Libe; Gurevich, Evgenia; Zarivach, Raz; Rutter, Guy A; Landau, Daniel; Birk, Ohad S

    2017-04-01

    A novel autosomal recessive cerebro-renal syndrome was identified in consanguineous Bedouin kindred: neurological deterioration was evident as of early age, progressing into severe intellectual disability, profound ataxia, camptocormia and oculomotor apraxia. Brain MRI was normal. Four of the six affected individuals also had early-onset nephropathy with features of tubulo-interstitial nephritis, hypertension and tendency for hyperkalemia, though none had rapid deterioration of renal function. Genome wide linkage analysis identified an ∼18 Mb disease-associated locus on chromosome 4 (maximal logarithm of odds score 4.4 at D4S2971; θ = 0). Whole exome sequencing identified a single mutation in SLC30A9 within this locus, segregating as expected within the kindred and not found in a homozygous state in 300 Bedouin controls. We showed that SLC30A9 (solute carrier family 30 member 9; also known as ZnT-9) is ubiquitously expressed with high levels in cerebellum, skeletal muscle, thymus and kidney. Confocal analysis of SH-SY5Y cells overexpressing SLC30A9 fused to enhanced green fluorescent protein demonstrated vesicular cytosolic localization associated with the endoplasmic reticulum, not co-localizing with endosomal or Golgi markers. SLC30A9 encodes a putative zinc transporter (by similarity) previously associated with Wnt signalling. However, using dual-luciferase reporter assay in SH-SY5Y cells we showed that Wnt signalling was not affected by the mutation. Based on protein modelling, the identified mutation is expected to affect SLC30A9's highly conserved cation efflux domain, putatively disrupting its transmembrane helix structure. Cytosolic Zn2+ measurements in HEK293 cells overexpressing wild-type and mutant SLC30A9 showed lower zinc concentration within mutant rather than wild-type SLC30A9 cells. This suggests that SLC30A9 has zinc transport properties affecting intracellular zinc homeostasis, and that the molecular mechanism of the disease is through

  8. Intramolecular cross-linking in a bacterial homolog of mammalian SLC6 neurotransmitter transporters suggests an evolutionary conserved role of transmembrane segments 7 and 8

    DEFF Research Database (Denmark)

    Kniazeff, Julie; Loland, Claus Juul; Goldberg, Naomi

    2005-01-01

    The extracellular concentration of the neurotransmitters dopamine, serotonin, norepinephrine, GABA and glycine is tightly controlled by plasma membrane transporters belonging to the SLC6 gene family. A very large number of putative transport proteins with a remarkable homology to the SLC6...... proximity between TM 7 and 8 in the tertiary structure of TnaT as previously suggested for the mammalian counterparts. Furthermore, the inhibition of uptake upon cross-linking the two cysteines provides indirect support for a conserved conformational role of these transmembrane domains in the transport...

  9. Effects of Mutations and Ligands on the Thermostability of the l-Arginine/Agmatine Antiporter AdiC and Deduced Insights into Ligand-Binding of Human l-Type Amino Acid Transporters.

    Science.gov (United States)

    Ilgü, Hüseyin; Jeckelmann, Jean-Marc; Colas, Claire; Ucurum, Zöhre; Schlessinger, Avner; Fotiadis, Dimitrios

    2018-03-20

    The l-arginine/agmatine transporter AdiC is a prokaryotic member of the SLC7 family, which enables pathogenic enterobacteria to survive the extremely acidic gastric environment. Wild-type AdiC from Escherichia coli, as well as its previously reported point mutants N22A and S26A, were overexpressed homologously and purified to homogeneity. A size-exclusion chromatography-based thermostability assay was used to determine the melting temperatures ( T m s) of the purified AdiC variants in the absence and presence of the selected ligands l-arginine (Arg), agmatine, l-arginine methyl ester, and l-arginine amide. The resulting T m s indicated stabilization of AdiC variants upon ligand binding, in which T m s and ligand binding affinities correlated positively. Considering results from this and previous studies, we revisited the role of AdiC residue S26 in Arg binding and proposed interactions of the α-carboxylate group of Arg exclusively with amide groups of the AdiC backbone. In the context of substrate binding in the human SLC7 family member l-type amino acid transporter-1 (LAT1; SLC7A5), an analogous role of S66 in LAT1 to S26 in AdiC is discussed based on homology modeling and amino acid sequence analysis. Finally, we propose a binding mechanism for l-amino acid substrates to LATs from the SLC7 family.

  10. SL(C) 5 migration at CERN

    International Nuclear Information System (INIS)

    Schwickerath, Ulrich; Silva, Ricardo

    2010-01-01

    Most LCG sites are currently running on SL(C)4. However, this operating system is already rather old, and it is becoming difficult to get the required hardware drivers, to get the best out of recent hardware. A possible way out is the migration to SL(C)5 based systems where possible, in combination with virtualization methods. The former is typically possible for nodes where the software to run the services is available and tested, while the latter offers a possibility to make use of the new hardware platforms whilst maintaining operating system compatibility. Since autumn 2008, CERN has offered public interactive and batch worker nodes for evaluation to the experiments. For the Grid environment, access is granted by a dedicated CEs. The status of the evaluation, feedback received from the experiments and the status of the migration will be reviewed, and the status of virtualization of services at CERN will be reported. Beyond this, the migration to a new operating system also offers an excellent opportunity to upgrade the fabric infrastructure used to manage the servers.

  11. SLC5A8-Mediated Switching of STAT3 from a Pro-Oncogenic Signal into a Pro-Apoptotic Signal in Breast Cancer

    Science.gov (United States)

    2011-06-01

    provokes lung metastasis. (5) Both STAT3 and SLC5A8 knockout showed the similar phenotype, like mammary gland involution delay, mastitis and...100 ng/ml cholera toxin, 0.01mg/ml bovine insulin and 500 ng/ml hydrocortisone. HBL100 cells was grown in McCoy 5A with 10% FBS. MCF7 and BT20

  12. Flat beams in the SLC

    International Nuclear Information System (INIS)

    Adolphsen, C.; Barklow, T.; Burke, D.; Decker, F.J.; Emma, P.; Hildreth, M.; Himel, T.; Krejcik, P.; Limberg, T.; Minty, M.

    1993-01-01

    The Stanford Linear Collider was designed to operate with round beams; horizontal and vertical emittance made equal in the damping rings. The main motivation was to facilitate the optical matching through beam lines with strong coupling elements like the solenoid spin rotator magnets and the SLC arcs. Tests in 1992 showed that open-quote flat close-quote beams with a vertical to horizontal emittance ratio of around 1/10 can be successfully delivered to the end of the linac. Techniques developed to measure and control the coupling of the SLC arcs allow These beams to be transported to the Interaction Point (IP). Before flat beams could be used for collisions with polarized electrons, a new method of rotating the electron spin orientation with vertical arc orbit bumps had to be developed. Early in the 1993 run, the SLC was switched to open-quote flat close-quote beam operation. Within a short time the peak luminosity of the previous running cycle was reached and then surpassed. The average daily luminosity is now a factor of about two higher than the best achieved last year. In the following the authors present an overview of the problems encountered and their solutions for different parts of the SLC

  13. A haplotype of the norepinephrine transporter gene (SLC6A2) is associated with visual memory in attention-deficit/hyperactivity disorder.

    Science.gov (United States)

    Shang, Chi-Yung; Chiang, Huey-Ling; Gau, Susan Shur-Fen

    2015-04-03

    Attention-deficit/hyperactivity disorder (ADHD) is a common heritable childhood-onset psychiatric disorder with impaired visual memory. Based on the evidence from treatment effect of atomoxetine, which interacts directly with the norepinephrine transporter, on visual memory in children with ADHD, this study examined the linkage disequilibrium structure of the norepinephrine transporter gene (SLC6A2) and the association between SLC6A2 and ADHD and visual memory, a promising endophenotype for ADHD. This family-based association sample consisted of 382 probands with DSM-IV ADHD and their family members (n=1298 in total) of Han Chinese in Taiwan. Visual memory was assessed by the Pattern Recognition Memory (PRM) and Spatial Recognition Memory (SRM) tasks of the Cambridge Neuropsychological Test Automated Battery (CANTAB). We screened 21 polymorphisms across SLC6A2 and used the Family-Based Association Test (FBAT) to test the associations of SLC6A2 polymorphisms with ADHD and the PRM and SRM measures. In haplotype analyses, a haplotype rs36011 (T)/rs1566652 (G) was significantly associated with ADHD (minimal p=0.045) after adjustment for multiple testing. In quantitative analyses, this TG haplotype also demonstrated significant associations with visual memory measures, including mean latency of correct responses in PRM (minimal p=0.019), total correct responses in PRM (minimal p=0.018), and total correct responses in SRM (minimal p=0.015). Our novel finding of the haplotype rs36011 (T)/rs1566652 (G) as a novel genetic marker involved in both ADHD disease susceptibility and visual memory suggests that allelic variations in SLC6A2 could provide insight into the pathways leading from genotype to phenotype of ADHD. Copyright © 2014 Elsevier Inc. All rights reserved.

  14. Identification of placental nutrient transporters associated with intrauterine growth restriction and pre-eclampsia.

    Science.gov (United States)

    Huang, Xiao; Anderle, Pascale; Hostettler, Lu; Baumann, Marc U; Surbek, Daniel V; Ontsouka, Edgar C; Albrecht, Christiane

    2018-03-02

    Gestational disorders such as intrauterine growth restriction (IUGR) and pre-eclampsia (PE) are main causes of poor perinatal outcomes worldwide. Both diseases are related with impaired materno-fetal nutrient transfer, but the crucial transport mechanisms underlying IUGR and PE are not fully elucidated. In this study, we aimed to identify membrane transporters highly associated with transplacental nutrient deficiencies in IUGR/PE. In silico analyses on the identification of differentially expressed nutrient transporters were conducted using seven eligible microarray datasets (from Gene Expression Omnibus), encompassing control and IUGR/PE placental samples. Thereby 46 out of 434 genes were identified as potentially interesting targets. They are involved in the fetal provision with amino acids, carbohydrates, lipids, vitamins and microelements. Targets of interest were clustered into a substrate-specific interaction network by using Search Tool for the Retrieval of Interacting Genes. The subsequent wet-lab validation was performed using quantitative RT-PCR on placentas from clinically well-characterized IUGR/PE patients (IUGR, n = 8; PE, n = 5; PE+IUGR, n = 10) and controls (term, n = 13; preterm, n = 7), followed by 2D-hierarchical heatmap generation. Statistical evaluation using Kruskal-Wallis tests was then applied to detect significantly different expression patterns, while scatter plot analysis indicated which transporters were predominantly influenced by IUGR or PE, or equally affected by both diseases. Identified by both methods, three overlapping targets, SLC7A7, SLC38A5 (amino acid transporters), and ABCA1 (cholesterol transporter), were further investigated at the protein level by western blotting. Protein analyses in total placental tissue lysates and membrane fractions isolated from disease and control placentas indicated an altered functional activity of those three nutrient transporters in IUGR/PE. Combining bioinformatic analysis

  15. Pharmacotherapy in pregnancy; effect of ABC and SLC transporters on drug transport across the placenta and fetal drug exposure.

    Science.gov (United States)

    Staud, Frantisek; Cerveny, Lukas; Ceckova, Martina

    2012-11-01

    Pharmacotherapy during pregnancy is often inevitable for medical treatment of the mother, the fetus or both. The knowledge of drug transport across placenta is, therefore, an important topic to bear in mind when deciding treatment in pregnant women. Several drug transporters of the ABC and SLC families have been discovered in the placenta, such as P-glycoprotein, breast cancer resistance protein, or organic anion/cation transporters. It is thus evident that the passage of drugs across the placenta can no longer be predicted simply on the basis of their physical-chemical properties. Functional expression of placental drug transporters in the trophoblast and the possibility of drug-drug interactions must be considered to optimize pharmacotherapy during pregnancy. In this review we summarize current knowledge on the expression and function of ABC and SLC transporters in the trophoblast. Furthermore, we put this data into context with medical conditions that require maternal and/or fetal treatment during pregnancy, such as gestational diabetes, HIV infection, fetal arrhythmias and epilepsy. Proper understanding of the role of placental transporters should be of great interest not only to clinicians but also to pharmaceutical industry for future drug design and development to control the degree of fetal exposure.

  16. Screening of SLC26A4, FOXI1, KCNJ10, and GJB2 in bilateral deafness patients with inner ear malformation.

    Science.gov (United States)

    Chen, Kaitian; Wang, Xianren; Sun, Liang; Jiang, Hongyan

    2012-06-01

    Bilateral nonsyndromic sensorineural hearing loss associated with inner ear malformation is closely related to genetics. SLC26A4 is considered to be the major involved gene. Recently, FOXI1 and KCNJ10 mutations have been linked to enlarged vestibular aqueducts and GJB2 mutations linked to temporal bone malformation. The authors aimed to investigate the mutation spectrums of these genes in Chinese patients with bilateral hearing impairment associated with inner ear malformation. Cross-sectional study. Affiliated hospital of the university. The authors analyzed the GJB2, SLC26A4, FOXI1, and KCNJ10 gene sequences in 43 patients presenting with bilateral hearing impairment associated with inner ear malformation using pyrosequencing and direct DNA sequencing. In total, 74.4% (32/43) of patients carried at least 1 of 14 pathogenic SLC26A4 mutations, including 6 novel mutations and 4 polymorphisms. Patients with enlarged vestibular aqueducts had a higher rate of SLC26A4 mutation than Mondini dysplasia patients. No FOXI1 or KCNJ10 potential pathogenic mutation was present, and GJB2 biallelic pathogenic mutations were uncommon (2.3%; 1/43). No significant correlation was observed between the genotype and phenotype of SLC26A4 mutations. SLC26A4 accounts for 74.4% of inner ear malformations in our cohort, whereas FOXI1, KCNJ10, and GJB2 mutations are not common. Other possible genes or external factors may contribute to this multibranch abnormality.

  17. Disruption of Slc52a3 gene causes neonatal lethality with riboflavin deficiency in mice

    OpenAIRE

    Yoshimatsu, Hiroki; Yonezawa, Atsushi; Yamanishi, Kaori; Yao, Yoshiaki; Sugano, Kumiko; Nakagawa, Shunsaku; Imai, Satoshi; Omura, Tomohiro; Nakagawa, Takayuki; Yano, Ikuko; Masuda, Satohiro; Inui, Ken-ichi; Matsubara, Kazuo

    2016-01-01

    Homeostasis of riboflavin should be maintained by transporters. Previous in vitro studies have elucidated basic information about riboflavin transporter RFVT3 encoded by SLC52A3 gene. However, the contribution of RFVT3 to the maintenance of riboflavin homeostasis and the significance in vivo remain unclear. Here, we investigated the physiological role of RFVT3 using Slc52a3 knockout (Slc52a3−/−) mice. Most Slc52a3−/− mice died with hyperlipidemia and hypoglycemia within 48 hr after birth. The...

  18. Serum uric acid concentrations and SLC2A9 genetic variation in Hispanic children: The Viva La Familia Study

    Science.gov (United States)

    Elevated concentrations of serum uric acid are associated with increased risk of gout and renal and cardiovascular diseases. Genetic studies in adults have consistently identified associations of solute carrier family 2, member 9 (SLC2A9), polymorphisms with variation in serum uric acid. However, it...

  19. Molecular mechanisms of reduced glutathione transport: role of the MRP/CFTR/ABCC and OATP/SLC21A families of membrane proteins

    International Nuclear Information System (INIS)

    Ballatori, Nazzareno; Hammond, Christine L.; Cunningham, Jennifer B.; Krance, Suzanne M.; Marchan, Rosemarie

    2005-01-01

    The initial step in reduced glutathione (GSH) turnover in all mammalian cells is its transport across the plasma membrane into the extracellular space; however, the mechanisms of GSH transport are not clearly defined. GSH export is required for the delivery of its constituent amino acids to other tissues, detoxification of drugs, metals, and other reactive compounds of both endogenous and exogenous origin, protection against oxidant stress, and secretion of hepatic bile. Recent studies indicate that some members of the multidrug resistance-associated protein (MRP/CFTR or ABCC) family of ATP-binding cassette (ABC) proteins, as well as some members of the organic anion transporting polypeptide (OATP or SLC21A) family of transporters contribute to this process. In particular, five of the 12 members of the MRP/CFTR family appear to mediate GSH export from cells namely, MRP1, MRP2, MRP4, MRP5, and CFTR. Additionally, two members of the OATP family, rat Oatp1 and Oatp2, have been identified as GSH transporters. For the Oatp1 transporter, efflux of GSH may provide the driving force for the uptake of extracellular substrates. In humans, OATP-B and OATP8 do not appear to transport GSH; however, other members of this family have yet to be characterized in regards to GSH transport. In yeast, the ABC proteins Ycf1p and Bpt1p transport GSH from the cytosol into the vacuole, whereas Hgt1p mediates GSH uptake across the plasma membrane. Because transport is a key step in GSH homeostasis and is intimately linked to its biological functions, GSH export proteins are likely to modulate essential cellular functions

  20. 5'-azido-N-1-naphthylphthalamic acid, a photolabile analog of the auxin transport inhibitor, N-1-naphthylphthalamic acid: synthesis and binding properties

    International Nuclear Information System (INIS)

    Voet, J.G.; Howley, K.; Shumsky, J.S.

    1987-01-01

    The polar transport of the plant growth regulator, auxin (indole-3-acetic acid, IAAH), is thought to involve the participation of several proteins in the plasma membrane, including a specific, saturable, voltage independent H + /IAA - efflux carrier located preferentially at the basal end of each cell. Auxin transport is specifically inhibited by the herbicide, N-1-naphthylphthalamic acid (NPA), which binds specifically to a protein in the plasma membrane, thought to be either the IAA - efflux carrier or an allosteric effector protein. They have synthesized and characterized a photolabile analog of NPA, 5'-azido-N-1-naphthylphthalamic acid (Az-NPA). This potential photoaffinity label for the NPA binding protein competes with 3 H-NPA for binding sites on Curcurbita pepo L. (zucchini) stem cell membranes with K/sub j/ = 1.5 x 10 -7 M. The K/sub i/ for NPA under these conditions is 2 x 10 -8 M, indicating that the affinity of Az-NPA for the membranes is only 7.5 fold lower than NPA. While the binding of 4.6 x 10 -6 M Az-NPA to NPA binding sites is reversible in the dark, exposure to light results in a 30% loss in 3 H-NPA binding ability. Pretreatment with 10 -4 M NPA protects the membranes against photodestruction of 3 H-NPA binding sites by Az-NPA, supporting the conclusion that Az-NPA destroys these sites by specific covalent attachment

  1. Active Hydrophilic Components of the Medicinal Herb Salvia miltiorrhiza (Danshen Potently Inhibit Organic Anion Transporters 1 (Slc22a6 and 3 (Slc22a8

    Directory of Open Access Journals (Sweden)

    Li Wang

    2012-01-01

    Full Text Available Many active components of herbal products are small organic anions, and organic anion transporters were previously demonstrated to be a potential site of drug-drug interactions. In this study, we assessed the inhibitory effects of six hydrophilic components of the herbal medicine Danshen, lithospermic acid, protocatechuic acid, rosmarinic acid, salvianolic acid A, salvianolic acid B, and tanshinol, on the function of the murine organic anion transporters, mOat1 and mOat3. All of Danshen components significantly inhibited mOat1- and mOat3-mediated substrate uptake (<0.001 with lithospermic acid (LSA, protocatechuic acid, rosmarinic acid (RMA, and salvianolic acid A (SAA producing virtually complete inhibition under test conditions. Kinetic analysis demonstrated that LSA, RMA, and SAA were competitive inhibitors. As such, values were estimated as 14.9±4.9 μM for LSA, 5.5±2.2 μM for RMA, and 4.9±2.2 μM for SAA on mOat1-mediated transport, and as 31.1±7.0 μM for LSA, 4.3±0.2 μM for RMA, and 21.3±7.7 μM for SAA on mOat3-mediated transport. These data suggest that herb-drug interactions may occur in vivo on the human orthologs of these transporters in situations of polypharmacy involving Danshen and clinical therapeutics known to be organic anion transporter substrates.

  2. Association of a serotonin transporter gene (SLC6A4) 5-HTTLPR polymorphism with body mass index categories but not type 2 diabetes mellitus in Mexicans

    Science.gov (United States)

    Peralta-Leal, Valeria; Leal-Ugarte, Evelia; Meza-Espinoza, Juan P.; Dávalos-Rodríguez, Ingrid P.; Bocanegra-Alonso, Anabel; Acosta-González, Rosa I.; Gonzales, Enrique; Nair, Saraswathy; Durán-González, Jorge

    2012-01-01

    The serotonergic system has been hypothesized to contribute to the biological susceptibility to type 2 diabetes mellitus (T2DM) and body-mass index (BMI) categories. We investigate a possible association of 5-HTTLPR polymorphism (L and S alleles) in the promoter region of the serotonin transporter gene (SLC6A4) with the development of T2DM and/or higher BMI by analyzing a sample of 138 individuals diagnosed with T2DM and 172 unrelated controls from the Mexican general population. In the total sample genotypes were distributed according to Hardy-Weinberg equilibrium, and S allele frequency was 0.58. There was no statistical association between 5-HTTLPR polymorphism and the development of T2DM in this Mexican population sample (p = 0.12). Nevertheless, logistic regression analysis of the L allele and increased BMI disclosed an association, after adjusting for age, sex and T2DM (p = 0.02, OR 1.74, 95% CI: 1.079–2.808). PMID:23055796

  3. The glutamate transport inhibitor DL-Threo-β-Benzyloxyaspartic acid (DL-TBOA) differentially affects SN38- and oxaliplatin-induced death of drug-resistant colorectal cancer cells

    DEFF Research Database (Denmark)

    Cuesta, Elena Pedraz; Christensen, Sandra; Jensen, Anders A.

    2015-01-01

    affinity glutamate transporters Solute Carrier (SLC)-1A1 and -1A3 (EAAT3, EAAT1) is associated with the resistant phenotypes. Analyses included real-time quantitative PCR, immunoblotting and immunofluorescence analyses, radioactive tracer flux measurements, and biochemical analyses of cell viability...... was undetectable. The changes in SLC1A1 expression were accompanied by parallel changes in DL-Threo-β-Benzyloxyaspartic acid (TBOA)-sensitive, UCPH101-insensitive [(3)H]-D-Aspartate uptake, consistent with increased activity of SLC1A1 (or other family members), yet not of SLC1A3. DL-TBOA co-treatment concentration...... and glutamate transporter activity are altered in SN38-resistant CRC cells. Importantly, the non-selective glutamate transporter inhibitor DL-TBOA reduces chemotherapy-induced p53 induction and augments CRC cell death induced by SN38, while attenuating that induced by oxaliplatin. These findings may point...

  4. Three-dimensional structure of β-cell-specific zinc transporter, ZnT-8, predicted from the type 2 diabetes-associated gene variant SLC30A8 R325W

    Directory of Open Access Journals (Sweden)

    Weijers Rob NM

    2010-06-01

    Full Text Available Abstract Background We examined the effects of the R325W mutation on the three-dimensional (3D structure of the β-cell-specific Zn2+ (zinc transporter ZnT-8. Methods A model of the C-terminal domain of the human ZnT-8 protein was generated by homology modeling based on the known crystal structure of the Escherichia coli (E. coli zinc transporter YiiP at 3.8 Å resolution. Results The homodimer ZnT-8 protein structure exists as a Y-shaped architecture with Arg325 located at the ultimate bottom of this motif at approximately 13.5 Å from the transmembrane domain juncture. The C-terminal domain sequences of the human ZnT-8 protein and the E. coli zinc transporter YiiP share 12.3% identical and 39.5% homologous residues resulting in an overall homology of 51.8%. Validation statistics of the homology model showed a reasonable quality of the model. The C-terminal domain exhibited an αββαβ fold with Arg325 as the penultimate N-terminal residue of the α2-helix. The side chains of both Arg325 and Trp325 point away from the interface with the other monomer, whereas the ε-NH3+ group of Arg325 is predicted to form an ionic interaction with the β-COO- group of Asp326 as well as Asp295. An amino acid alignment of the β2-α2 C-terminal loop domain revealed a variety of neutral amino acids at position 325 of different ZnT-8 proteins. Conclusions Our validated homology models predict that both Arg325 and Trp325, amino acids with a helix-forming behavior, and penultimate N-terminal residues in the α2-helix of the C-terminal domain, are shielded by the planar surface of the three cytoplasmic β-strands and hence unable to affect the sensing capacity of the C-terminal domain. Moreover, the amino acid residue at position 325 is too far removed from the docking and transporter parts of ZnT-8 to affect their local protein conformations. These data indicate that the inherited R325W abnormality in SLC30A8 may be tolerated and results in adequate zinc transfer

  5. Mechanisms Regulating Acid-Base Transporter Expression in Breast- and Pancreatic Cancer

    DEFF Research Database (Denmark)

    Gorbatenko, Andrej

    , characteristics of which are a shift towards glycolytic metabolism and increased acid production. HER2 receptor overexpression in breast cancer leads to further increased glycolysis, invasion and metastasis, drug resistance and poor prognosis. Increased tumor glycolysis requires acquisition of mechanisms...... for dealing with excess acid production. In this light, evidence accumulates on the importance of pH regulatory proteins to cancer cell survival and motility. Our group previously demonstrated upregulation of the Na+/HCO3 - co-transporter NBCn1 (SLC4A7) by a constitutively active form of HER2 receptor (p95HER...

  6. 41 CFR 302-10.5 - May I transport a mobile home over water?

    Science.gov (United States)

    2010-07-01

    ... transport a mobile home over water? Yes, you may transport a mobile home over water when both the points of... 41 Public Contracts and Property Management 4 2010-07-01 2010-07-01 false May I transport a mobile home over water? 302-10.5 Section 302-10.5 Public Contracts and Property Management Federal Travel...

  7. Two Variants in SLC24A5 Are Associated with “Tiger-Eye” Iris Pigmentation in Puerto Rican Paso Fino Horses

    Directory of Open Access Journals (Sweden)

    Maura Mack

    2017-08-01

    Full Text Available A unique eye color, called tiger-eye, segregates in the Puerto Rican Paso Fino (PRPF horse breed and is characterized by a bright yellow, amber, or orange iris. Pedigree analysis identified a simple autosomal recessive mode of inheritance for this trait. A genome-wide association study (GWAS with 24 individuals identified a locus on ECA 1 reaching genome-wide significance (Pcorrected = 1.32 × 105. This ECA1 locus harbors the candidate gene, Solute Carrier Family 24 (Sodium/Potassium/Calcium Exchanger, Member 5 (SLC24A5, with known roles in pigmentation in humans, mice, and zebrafish. Humans with compound heterozygous mutations in SLC24A5 have oculocutaneous albinism (OCA type 6 (OCA6, which is characterized by dilute skin, hair, and eye pigmentation, as well as ocular anomalies. Twenty tiger-eye horses were homozygous for a nonsynonymous mutation in exon 2 (p.Phe91Tyr of SLC24A5 (called here Tiger-eye 1, which is predicted to be deleterious to protein function. Additionally, eight of the remaining 12 tiger-eye horses heterozygous for the p.Phe91Tyr variant were also heterozygous for a 628 bp deletion encompassing all of exon 7 of SLC24A5 (c.875-340_1081+82del, which we will call here the Tiger-eye 2 allele. None of the 122 brown-eyed horses were homozygous for either tiger-eye-associated allele or were compound heterozygotes. Further, neither variant was detected in 196 horses from four related breeds not known to have the tiger-eye phenotype. Here, we propose that two mutations in SLC24A5 affect iris pigmentation in tiger-eye PRPF horses. Further, unlike OCA6 in humans, the Tiger-eye 1 mutation in its homozygous state or as a compound heterozygote (Tiger-eye 1/Tiger-eye 2 does not appear to cause ocular anomalies or a change in coat color in the PRPF horse.

  8. Differential SLC1A2 Promoter Methylation in Bipolar Disorder With or Without Addiction

    Directory of Open Access Journals (Sweden)

    Yun-Fang Jia

    2017-07-01

    Full Text Available While downregulation of excitatory amino acid transporter 2 (EAAT2, the main transporter removing glutamate from the synapse, has been recognized in bipolar disorder (BD, the underlying mechanisms of downregulation have not been elucidated. BD is influenced by environmental factors, which may, via epigenetic modulation of gene expression, differentially affect illness presentation. This study thus focused on epigenetic DNA methylation regulation of SLC1A2, encoding for EAAT2, in BD with variable environmental influences of addiction. High resolution melting PCR (HRM-PCR and thymine–adenine (TA cloning with sequence analysis were conducted to examine methylation of the promoter region of the SLC1A2. DNA was isolated from blood samples drawn from BD patients (N = 150 with or without addiction to alcohol, nicotine, or food, defined as binge eating, and matched controls (N = 32. In comparison to controls, the SLC1A2 promoter region was hypermethylated in BD without addiction but was hypomethylated in BD with addiction. After adjusting for age and sex, the association of methylation levels with nicotine addiction (p = 0.0009 and binge eating (p = 0.0002 remained significant. Consistent with HRM-PCR, direct sequencing revealed increased methylation in CpG site 6 in BD, but decreased methylation in three CpG sites (6, 48, 156 in BD with alcohol and nicotine addictions. These results suggest that individual point methylation within the SLC1A2 promoter region may be modified by exogenous addiction and may have a potential for developing clinically valuable epigenetic biomarkers for BD diagnosis and monitoring.

  9. Variation in the SLC23A1 gene does not influence cardiometabolic outcomes to the extent expected given its association with l-ascorbic acid 1 2 3 4

    OpenAIRE

    Wade, Kaitlin H; Forouhi, Nita G; Cook, Derek G; Johnson, Paul; McConnachie, Alex; Morris, Richard W; Rodriguez, Santiago; Ye, Zheng; Ebrahim, Shah; Padmanabhan, Sandosh; Watt, Graham; Bruckdorfer, K Richard; Wareham, Nick J; Whincup, Peter H; Chanock, Stephen

    2014-01-01

    Background: Observational studies showed that circulating l-ascorbic acid (vitamin C) is inversely associated with cardiometabolic traits. However, these studies were susceptible to confounding and reverse causation.\\ud \\ud Objectives:We assessed the relation between l-ascorbic acid and 10 cardiometabolic traits by using a single nucleotide polymorphism in the solute carrier family 23 member 1 (SLC23A1) gene (rs33972313) associated with circulating l-ascorbic acid concentrations. The observed...

  10. Role of the urate transporter SLC2A9 gene in susceptibility to gout in New Zealand Māori, Pacific Island, and Caucasian case-control sample sets.

    Science.gov (United States)

    Hollis-Moffatt, Jade E; Xu, Xin; Dalbeth, Nicola; Merriman, Marilyn E; Topless, Ruth; Waddell, Chloe; Gow, Peter J; Harrison, Andrew A; Highton, John; Jones, Peter B B; Stamp, Lisa K; Merriman, Tony R

    2009-11-01

    To examine the role of genetic variation in the renal urate transporter SLC2A9 in gout in New Zealand sample sets of Māori, Pacific Island, and Caucasian ancestry and to determine if the Māori and Pacific Island samples could be useful for fine-mapping. Patients (n= 56 Māori, 69 Pacific Island, and 131 Caucasian) were recruited from rheumatology outpatient clinics and satisfied the American College of Rheumatology criteria for gout. The control samples comprised 125 Māori subjects, 41 Pacific Island subjects, and 568 Caucasian subjects without arthritis. SLC2A9 single-nucleotide polymorphisms rs16890979 (V253I), rs5028843, rs11942223, and rs12510549 were genotyped (possible etiologic variants in Caucasians). Association of the major allele of rs16890979, rs11942223, and rs5028843 with gout was observed in all sample sets (P = 3.7 x 10(-7), 1.6 x 10(-6), and 7.6 x 10(-5) for rs11942223 in the Māori, Pacific Island, and Caucasian samples, respectively). One 4-marker haplotype (1/1/2/1; more prevalent in the Māori and Pacific Island control samples) was not observed in a single gout case. Our data confirm a role of SLC2A9 in gout susceptibility in a New Zealand Caucasian sample set, with the effect on risk (odds ratio >2.0) greater than previous estimates. We also demonstrate association of SLC2A9 with gout in samples of Māori and Pacific Island ancestry and a consistent pattern of haplotype association. The presence of both alleles of rs16890979 on susceptibility and protective haplotypes in the Māori and Pacific Island sample is evidence against a role for this nonsynonymous variant as the sole etiologic agent. More extensive linkage disequilibrium in Māori and Pacific Island samples suggests that Caucasian samples may be more useful for fine-mapping.

  11. Enhanced Fructose Utilization Mediated by SLC2A5 Is a Unique Metabolic Feature of Acute Myeloid Leukemia with Therapeutic Potential.

    Science.gov (United States)

    Chen, Wen-Lian; Wang, Yue-Ying; Zhao, Aihua; Xia, Li; Xie, Guoxiang; Su, Mingming; Zhao, Linjing; Liu, Jiajian; Qu, Chun; Wei, Runmin; Rajani, Cynthia; Ni, Yan; Cheng, Zhen; Chen, Zhu; Chen, Sai-Juan; Jia, Wei

    2016-11-14

    Rapidly proliferating leukemic progenitor cells consume substantial glucose, which may lead to glucose insufficiency in bone marrow. We show that acute myeloid leukemia (AML) cells are prone to fructose utilization with an upregulated fructose transporter GLUT5, which compensates for glucose deficiency. Notably, AML patients with upregulated transcription of the GLUT5-encoding gene SLC2A5 or increased fructose utilization have poor outcomes. Pharmacological blockage of fructose uptake ameliorates leukemic phenotypes and potentiates the cytotoxicity of the antileukemic agent, Ara-C. In conclusion, this study highlights enhanced fructose utilization as a metabolic feature of AML and a potential therapeutic target. Copyright © 2016 Elsevier Inc. All rights reserved.

  12. Dicty_cDB: SLC411 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC411 (Link to dictyBase) - - - Contig-U16272-1 SLC411Z (Link... to Original site) - - SLC411Z 486 - - - - Show SLC411 Library SL (Link to library) Clone ID SLC411 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC411Q.Seq.d/ Representative seq. ID SLC41...1Z (Link to Original site) Representative DNA sequence >SLC411 (SLC411Q) /CSM/SL/SLC4-A/SLC411Q.Seq.d/ XXXXX...vacuolar 4.0 %: peroxisomal >> prediction for SLC411 is nuc 5' end seq. ID - 5' e

  13. Cloning and characterization of the promoter regions from the parent and paralogous creatine transporter genes.

    Science.gov (United States)

    Ndika, Joseph D T; Lusink, Vera; Beaubrun, Claudine; Kanhai, Warsha; Martinez-Munoz, Cristina; Jakobs, Cornelis; Salomons, Gajja S

    2014-01-10

    Interconversion between phosphocreatine and creatine, catalyzed by creatine kinase is crucial in the supply of ATP to tissues with high energy demand. Creatine's importance has been established by its use as an ergogenic aid in sport, as well as the development of intellectual disability in patients with congenital creatine deficiency. Creatine biosynthesis is complemented by dietary creatine uptake. Intracellular transport of creatine is carried out by a creatine transporter protein (CT1/CRT/CRTR) encoded by the SLC6A8 gene. Most tissues express this gene, with highest levels detected in skeletal muscle and kidney. There are lower levels of the gene detected in colon, brain, heart, testis and prostate. The mechanism(s) by which this regulation occurs is still poorly understood. A duplicated unprocessed pseudogene of SLC6A8-SLC6A10P has been mapped to chromosome 16p11.2 (contains the entire SLC6A8 gene, plus 2293 bp of 5'flanking sequence and its entire 3'UTR). Expression of SLC6A10P has so far only been shown in human testis and brain. It is still unclear as to what is the function of SLC6A10P. In a patient with autism, a chromosomal breakpoint that intersects the 5'flanking region of SLC6A10P was identified; suggesting that SLC6A10P is a non-coding RNA involved in autism. Our aim was to investigate the presence of cis-acting factor(s) that regulate expression of the creatine transporter, as well as to determine if these factors are functionally conserved upstream of the creatine transporter pseudogene. Via gene-specific PCR, cloning and functional luciferase assays we identified a 1104 bp sequence proximal to the mRNA start site of the SLC6A8 gene with promoter activity in five cell types. The corresponding 5'flanking sequence (1050 bp) on the pseudogene also had promoter activity in all 5 cell lines. Surprisingly the pseudogene promoter was stronger than that of its parent gene in 4 of the cell lines tested. To the best of our knowledge, this is the first

  14. Developmental expression of SLC26A4 (Pendrin) during amelogenesis in developing rodent teeth

    Science.gov (United States)

    Bronckers, Antonius LJJ; Guo, Jing; Zandieh-Doulabi, Behrouz; Bervoets, Theodore J; Lyaruu, Donacian M.; Li, Xiangming; Wangemann, Philine; DenBesten, Pamela

    2012-01-01

    Ameloblasts need to regulate pH during formation of enamel crystals, a process that generates protons. Solute carrier family 26A member 4 (SLC26A4, or pendrin) is an anion exchanger for chloride, bicarbonate, iodine and formate. It is expressed in apical membranes of ion-transporting epithelia in kidney, inner ear and thyroid where it regulates luminal pH and fluid transport. We hypothesized that maturation ameloblasts express SLC26A4 to neutralize acidification of enamel fluid in forming enamel. In rodents, secretory and maturation ameloblasts were immunopositive for SLC26A4. Staining was particularly strong in apical membranes of maturation ameloblasts facing forming enamel. RT-PCR confirmed the presence of mRNA transcripts for Slc26a4 in enamel organs. SLC26A4 immunostaining was also found in mineralizing connective tissues including odontoblasts, osteoblasts, osteocytes, osteoclasts, bone lining cells, cellular cementoblasts and cementocytes. However, Slc26a4-null mutant mice had no overt dental phenotype. The presence of SLC26A4 in apical plasma membranes of maturation ameloblasts is consistent with a potential function as pH regulator. SLC26A4 does not appear critical for ameloblast functioning and is likely compensated by other pH regulators. PMID:22243245

  15. [Polymorphism in the Serotonin Transporter Gene (SLC6A4) and Emotional Bipolar Disorder in Two Regional Mental Health Centers from the Eje Cafetero (Colombia)].

    Science.gov (United States)

    Ramos, Lucero Rengifo; Arias, Duverney Gaviria; Salazar, Liliana Salazar; Vélez, Juan Pablo; Pardo, Stella Lozano

    2012-03-01

    The indel polymorphisms in the promoting region and the 2(nd) intron polymorphisms in the serotonin transporter gene (SLC6A4) have been associated to bipolar disorder 1 (BD1) in several population studies. The objective was to analyze the genotypic and allelic frequencies in both gene regions in a study of cases and controls with individuals from Risaralda and Quindío (Colombia) so as to establish possible associations to BD1, and compare results with previous and similar studies. 133 patients and 120 controls were studied. L and S indel polymorphisms in the promoting region were analyzed by PCR, together with VNTR STin2.10 and STin 2.12 VNTRs polymorphisms in the 2(nd) intron of the SL-C6A4 gene Genotypic and allelic frequencies for the S and L polymorphisms were similar both in cases and controls. However, the LL genotype was significantly increased both in BD1 population (OR=1.89; CI95%=1.1-3.68), and when discriminated by gender. This particular genotype in general population is OR=2.22; IC95%=1.04-5.66 for women, and OR=1.62; IC 95%=0.71-4.39 for men. No significant genotypic and allelic differences were found for VNTR STin2.10 and STin 2.12. polymorphisms. No association was found between polymorphisms of 5-HTTLPR polymorphisms and the 2(nd) intron of the serotonin transporting gene in general patients with BD1, nor when compared by gender. Our results are similar to those reported for Caucasian populations and differ from those of Asian and Brazilian populations. Copyright © 2012 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.

  16. Dicty_cDB: SLC480 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC480 (Link to dictyBase) - - - Contig-U13538-1 SLC480Z (Link... to Original site) - - SLC480Z 455 - - - - Show SLC480 Library SL (Link to library) Clone ID SLC480 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC480Q.Seq.d/ Representative seq. ID SLC48...0Z (Link to Original site) Representative DNA sequence >SLC480 (SLC480Q) /CSM/SL/SLC4-D/SLC480Q.Seq.d/ XXXXX...ial 8.0 %: peroxisomal >> prediction for SLC480 is nuc 5' end seq. ID - 5' end seq. - Length of 5' end seq. - 3' end seq. ID SLC4

  17. The glutamate transport inhibitor DL-Threo-β-Benzyloxyaspartic acid (DL-TBOA) differentially affects SN38- and oxaliplatin-induced death of drug-resistant colorectal cancer cells

    International Nuclear Information System (INIS)

    Pedraz-Cuesta, Elena; Christensen, Sandra; Jensen, Anders A.; Jensen, Niels Frank; Bunch, Lennart; Romer, Maria Unni; Brünner, Nils; Stenvang, Jan; Pedersen, Stine Falsig

    2015-01-01

    Colorectal cancer (CRC) is a leading cause of cancer death globally and new biomarkers and treatments are severely needed. Here, we employed HCT116 and LoVo human CRC cells made resistant to either SN38 or oxaliplatin, to investigate whether altered expression of the high affinity glutamate transporters Solute Carrier (SLC)-1A1 and -1A3 (EAAT3, EAAT1) is associated with the resistant phenotypes. Analyses included real-time quantitative PCR, immunoblotting and immunofluorescence analyses, radioactive tracer flux measurements, and biochemical analyses of cell viability and glutathione content. Results were evaluated using one- and two-way ANOVA and Students two-tailed t-test, as relevant. In SN38-resistant HCT116 and LoVo cells, SLC1A1 expression was down-regulated ~60 % and up-regulated ~4-fold, respectively, at both mRNA and protein level, whereas SLC1A3 protein was undetectable. The changes in SLC1A1 expression were accompanied by parallel changes in DL-Threo-β-Benzyloxyaspartic acid (TBOA)-sensitive, UCPH101-insensitive [ 3 H]-D-Aspartate uptake, consistent with increased activity of SLC1A1 (or other family members), yet not of SLC1A3. DL-TBOA co-treatment concentration-dependently augmented loss of cell viability induced by SN38, while strongly counteracting that induced by oxaliplatin, in both HCT116 and LoVo cells. This reflected neither altered expression of the oxaliplatin transporter Cu 2+ -transporter-1 (CTR1), nor changes in cellular reduced glutathione (GSH), although HCT116 cell resistance per se correlated with increased cellular GSH. DL-TBOA did not significantly alter cellular levels of p21, cleaved PARP-1, or phospho-Retinoblastoma protein, yet altered SLC1A1 subcellular localization, and reduced chemotherapy-induced p53 induction. SLC1A1 expression and glutamate transporter activity are altered in SN38-resistant CRC cells. Importantly, the non-selective glutamate transporter inhibitor DL-TBOA reduces chemotherapy-induced p53 induction and augments

  18. gamma-Glutamyl amino acids. Transport and conversion to 5-oxoproline in the kidney

    International Nuclear Information System (INIS)

    Bridges, R.J.; Meister, A.

    1985-01-01

    Transport of gamma-glutamyl amino acids, a step in the proposed glutathione-gamma-glutamyl transpeptidase-mediated amino acid transport pathway, was examined in mouse kidney. The transport of gamma-glutamyl amino acids was demonstrated in vitro in studies on kidney slices. Transport was followed by measuring uptake of 35 S after incubation of the slices in media containing gamma-glutamyl methionine [ 35 S]sulfone. The experimental complication associated with extracellular conversion of the gamma-glutamyl amino acid to amino acid and uptake of the latter by slices was overcome by using 5-oxoproline formation (catalyzed by intracellular gamma-glutamyl-cyclotransferase) as an indicator of gamma-glutamyl amino acid transport. This method was also successfully applied to studies on transport of gamma-glutamyl amino acids in vivo. Transport of gamma-glutamyl amino acids in vitro and in vivo is inhibited by several inhibitors of gamma-glutamyl transpeptidase and also by high extracellular levels of glutathione. This seems to explain urinary excretion of gamma-glutamylcystine by humans with gamma-glutamyl transpeptidase deficiency and by mice treated with inhibitors of this enzyme. Mice depleted of glutathione by treatment with buthionine sulfoximine (which inhibits glutathione synthesis) or by treatment with 2,6-dimethyl-2,5-heptadiene-4-one (which effectively interacts with tissue glutathione) exhibited significantly less transport of gamma-glutamyl amino acids than did untreated controls. The findings suggest that intracellular glutathione functions in transport of gamma-glutamyl amino acids. Evidence was also obtained for transport of gamma-glutamyl gamma-glutamylphenylalanine into kidney slices

  19. Inhibitors of GLUT/SLC2A Enhance the Action of BCNU and Temozolomide against High-Grade Gliomas

    Directory of Open Access Journals (Sweden)

    Alberto Azzalin

    2017-04-01

    Full Text Available Glucose transport across glioblastoma membranes plays a crucial role in maintaining the enhanced glycolysis typical of high-grade gliomas and glioblastoma. We tested the ability of two inhibitors of the glucose transporters GLUT/SLC2A superfamily, indinavir (IDV and ritonavir (RTV, and of one inhibitor of the Na/glucose antiporter type 2 (SGLT2/SLC5A2 superfamily, phlorizin (PHZ, in decreasing glucose consumption and cell proliferation of human and murine glioblastoma cells. We found in vitro that RTV, active on at least three different GLUT/SLC2A transporters, was more effective than IDV, a specific inhibitor of GLUT4/SLC2A4, both in decreasing glucose consumption and lactate production and in inhibiting growth of U87MG and Hu197 human glioblastoma cell lines and primary cultures of human glioblastoma. PHZ was inactive on the same cells. Similar results were obtained when cells were grown in adherence or as 3D multicellular tumor spheroids. RTV treatment but not IDV treatment induced AMP-activated protein kinase (AMPKα phosphorylation that paralleled the decrease in glycolytic activity and cell growth. IDV, but not RTV, induced an increase in GLUT1/SLC2A1 whose activity could compensate for the inhibition of GLUT4/SLC2A4 by IDV. RTV and IDV pass poorly the blood brain barrier and are unlikely to reach sufficient liquoral concentrations in vivo to inhibit glioblastoma growth as single agents. Isobologram analysis of the association of RTV or IDV and 1,3-bis(2-chloroethyl-1-nitrosourea (BCNU or 4-methyl-5-oxo-2,3,4,6,8-pentazabicyclo[4.3.0]nona-2,7,9-triene-9-carboxamide (TMZ indicated synergy only with RTV on inhibition of glioblastoma cells. Finally, we tested in vivo the combination of RTV and BCNU on established GL261 tumors. This drug combination increased the overall survival and allowed a five-fold reduction in the dose of BCNU.

  20. The amino acid transporters of the glutamate/GABA-glutamine cycle and their impact on insulin and glucagon secretion

    Directory of Open Access Journals (Sweden)

    Monica eJenstad

    2013-12-01

    Full Text Available Intercellular communication is pivotal in optimising and synchronising cellular responses to keep internal homeostasis and to respond adequately to external stimuli. In the central nervous system (CNS, glutamatergic and GABAergic signals are postulated to be dependent on the glutamate/GABA-glutamine (GGG cycle for vesicular loading of neurotransmitters, for inactivating the signal and for the replenishment of the neurotransmitters. Islets of Langerhans release the hormones insulin and glucagon, but share similarities with CNS cells in for example transcriptional control of development and differentiation, and chromatin methylation. Interestingly, proteins involved in the CNS in secretion of the neurotransmitters and emitting their responses as well as the regulation of these processes, are also found in islet cells. Moreover, high levels of glutamate, GABA and glutamine and their respective vesicular and plasma membrane transporters have been shown in the islet cells and there is emerging support for these amino acids and their transporters playing important roles in the maturation and secretion of insulin and glucagon. In this review, we will discuss the feasibility of recent data in the field in relation to the biophysical properties of the transporters (Slc1, Slc17, Slc32 and Slc38 and physiology of hormone secretion in islets of Langerhans.

  1. Up-Regulation of Excitatory Amino Acid Transporters EAAT1 and EAAT2 by ß-Klotho

    Directory of Open Access Journals (Sweden)

    Jamshed Warsi

    2015-12-01

    Full Text Available Background/Aims: Klotho, a transmembrane protein expressed in chorioid plexus of the brain, kidney, and several other tissues, is required for inhibition of 1,25(OH2D3 formation by FGF23. The extracellular domain of Klotho protein could be cleaved off, thus being released into blood or cerebrospinal fluid. At least in part by exerting β-glucuronidase activity, soluble klotho regulates several ion channels and carriers. Klotho protein deficiency accelerates the appearance of age related disorders including neurodegeneration and muscle wasting and eventually leads to premature death. The present study explored the effect of Klotho protein on the excitatory glutamate transporters EAAT1 (SLC1A3 and EAAT2 (SLC1A2, Na+ coupled carriers clearing excitatory amino acids from the synaptic cleft and thus participating in the regulation of neuronal excitability. Methods: cRNA encoding EAAT1 or EAAT2 was injected into Xenopus laevis oocytes and glutamate (2 mM-induced inward current (IGlu taken as measure of glutamate transport. Measurements were made without or with prior 24 h treatment with soluble ß-Klotho protein (30 ng/ml in the absence and presence of β-glucuronidase inhibitor D-saccharic acid 1,4-lactone monohydrate (DSAL,10 µM. Results: IGlu was observed in EAAT1 and in EAAT2 expressing oocytes but not in water injected oocytes. In both, EAAT1 and EAAT2 expressing oocytes IGlu was significantly increased by treatment with soluble ß-Klotho protein, an effect reversed by DSAL. Treatment with ß-klotho protein increased significantly the maximal transport rate without significantly modifying the affinity of the carriers. Conclusion: ß-Klotho up-regulates the excitatory glutamate transporters EAAT1 and EAAT2 and thus participates in the regulation of neuronal excitation.

  2. Significance of downregulation of renal organic cation transporter (SLC47A1 in cisplatin-induced proximal tubular injury

    Directory of Open Access Journals (Sweden)

    Mizuno T

    2015-07-01

    Full Text Available Tomohiro Mizuno,1–3 Waichi Sato,2,3 Kazuhiro Ishikawa,4 Yuki Terao,1 Kazuo Takahashi,2 Yukihiro Noda,5 Yukio Yuzawa,2 Tadashi Nagamatsu1 1Department of Analytical Pharmacology, Meijo University Faculty of Pharmacy, Nagoya, 2Department of Nephrology, School of Medicine, Fujita Health University, Toyoake, 3Department of Nephrology, Nagoya University School of Medicine, Nagoya, 4Department of Neuropsychopharmacology and Hospital Pharmacy, Nagoya University Graduate School of Medicine, Nagoya, 5Division of Clinical Sciences and Neuropsychopharmacology, Meijo University Faculty of Pharmacy, Nagoya, Japan Background/aim: To elucidate the mechanism responsible for developing acute kidney injury in patients with diabetes mellitus, we also evaluated the issue of whether advanced glycation endproducts (AGEs influence the expressions of multi antimicrobial extrusion protein (MATE1/SLC47A1 in tubular cells. Materials and methods: To detect changing expression of MATE1/SLC47A1 in dose- and time-dependent manners, human proximal tubular epithelial cells were incubated with AGE-aggregated-human serum albumin. As a function assay for MATE1/SLC47A1, human proximal tubular epithelial cells were incubated with cisplatin or carboplatin. Results: On incubation with AGEs, the expressions of MATE1/SLC47A1 were decreased in tubular cells. In addition, the toxicities of cisplatin were increased in tubular cells that had been pretreated with AGEs. However, the toxicities of carboplatin were smaller than that of cisplatin in proximal tubular epithelial cells. Conclusion: The expression of the MATE1/SLC47A1 is decreased by AGEs, which increases the risk for proximal tubular injury. Keywords: advanced glycation endproducts, cisplatin, SLC47A1, diabetes mellitus, acute kidney injury

  3. Action Potential Shortening and Impairment of Cardiac Function by Ablation of Slc26a6.

    Science.gov (United States)

    Sirish, Padmini; Ledford, Hannah A; Timofeyev, Valeriy; Thai, Phung N; Ren, Lu; Kim, Hyo Jeong; Park, Seojin; Lee, Jeong Han; Dai, Gu; Moshref, Maryam; Sihn, Choong-Ryoul; Chen, Wei Chun; Timofeyeva, Maria Valeryevna; Jian, Zhong; Shimkunas, Rafael; Izu, Leighton T; Chiamvimonvat, Nipavan; Chen-Izu, Ye; Yamoah, Ebenezer N; Zhang, Xiao-Dong

    2017-10-01

    Intracellular pH (pH i ) is critical to cardiac excitation and contraction; uncompensated changes in pH i impair cardiac function and trigger arrhythmia. Several ion transporters participate in cardiac pH i regulation. Our previous studies identified several isoforms of a solute carrier Slc26a6 to be highly expressed in cardiomyocytes. We show that Slc26a6 mediates electrogenic Cl - /HCO 3 - exchange activities in cardiomyocytes, suggesting the potential role of Slc26a6 in regulation of not only pH i , but also cardiac excitability. To test the mechanistic role of Slc26a6 in the heart, we took advantage of Slc26a6 knockout ( Slc26a6 -/ - ) mice using both in vivo and in vitro analyses. Consistent with our prediction of its electrogenic activities, ablation of Slc26a6 results in action potential shortening. There are reduced Ca 2+ transient and sarcoplasmic reticulum Ca 2+ load, together with decreased sarcomere shortening in Slc26a6 -/ - cardiomyocytes. These abnormalities translate into reduced fractional shortening and cardiac contractility at the in vivo level. Additionally, pH i is elevated in Slc26a6 -/ - cardiomyocytes with slower recovery kinetics from intracellular alkalization, consistent with the Cl - /HCO 3 - exchange activities of Slc26a6. Moreover, Slc26a6 -/ - mice show evidence of sinus bradycardia and fragmented QRS complex, supporting the critical role of Slc26a6 in cardiac conduction system. Our study provides mechanistic insights into Slc26a6, a unique cardiac electrogenic Cl - /HCO 3 - transporter in ventricular myocytes, linking the critical roles of Slc26a6 in regulation of pH i , excitability, and contractility. pH i is a critical regulator of other membrane and contractile proteins. Future studies are needed to investigate possible changes in these proteins in Slc26a6 -/ - mice. © 2017 American Heart Association, Inc.

  4. Risk and protective genetic variants in suicidal behaviour: association with SLC1A2, SLC1A3, 5-HTR1B &NTRK2 polymorphisms.

    LENUS (Irish Health Repository)

    Murphy, Therese M

    2012-02-01

    BACKGROUND: Suicidal behaviour is known to aggregate in families. Patients with psychiatric disorders are at higher risk for suicide attempts (SA), however protective and risk genetic variants for suicide appear to be independent of underlying psychiatric disorders. Here we investigate genetic variants in genes important for neurobiological pathways linked to suicidal behaviour and\\/or associated endophenotypes, for association with SA among patients with co-existing psychiatric illness. Selected gene-gene and gene-environment interactions were also tested. METHODS: DNA was obtained from bloods of 159 patients (76 suicide attempters and 83 non-attempters), who were profiled for DSM-IV Axis I psychiatric diagnosis. Twenty-eight single nucleotide polymorphisms (SNPs) from 18 candidate genes (COMT, 5-HT2A, 5-HT1A, 5-HTR1B, TPH1, MAO-A, TPH2, DBH, CNR1, BDNF, ABCG1, GABRA5, GABRG2, GABRB2, SLC1A2, SLC1A3, NTRK2, CRHR1) were genotyped. Genotyping was performed by KBioscience. Tests of association between genetic variants and SA were conducted using Chi squared and Armitage Trend tests. Binary logistical regression analyses were performed to evaluate the contribution of individual genetic variants to the prediction of SA, and to examine SNPs for potential gene-gene and gene-environment interactions. RESULTS: Our analysis identified 4 SNPs (rs4755404, rs2269272, rs6296 and rs1659400), which showed evidence of association with SA compared to a non-attempter control group. We provide evidence of a 3-locus gene-gene interaction, and a putative gene-environment interaction, whereby genetic variation at the NTRK2 locus may moderate the risk associated with history of childhood abuse. CONCLUSION: Preliminary findings suggest that allelic variability in SLC1A2\\/3, 5-HTR1B and NTRK2 may be relevant to the underlying diathesis for suicidal acts.

  5. Diversity in the glucose transporter-4 gene (SLC2A4 in humans reflects the action of natural selection along the old-world primates evolution.

    Directory of Open Access Journals (Sweden)

    Eduardo Tarazona-Santos

    Full Text Available BACKGROUND: Glucose is an important source of energy for living organisms. In vertebrates it is ingested with the diet and transported into the cells by conserved mechanisms and molecules, such as the trans-membrane Glucose Transporters (GLUTs. Members of this family have tissue specific expression, biochemical properties and physiologic functions that together regulate glucose levels and distribution. GLUT4 -coded by SLC2A4 (17p13 is an insulin-sensitive transporter with a critical role in glucose homeostasis and diabetes pathogenesis, preferentially expressed in the adipose tissue, heart muscle and skeletal muscle. We tested the hypothesis that natural selection acted on SLC2A4. METHODOLOGY/PRINCIPAL FINDINGS: We re-sequenced SLC2A4 and genotyped 104 SNPs along a approximately 1 Mb region flanking this gene in 102 ethnically diverse individuals. Across the studied populations (African, European, Asian and Latin-American, all the eight common SNPs are concentrated in the N-terminal region upstream of exon 7 ( approximately 3700 bp, while the C-terminal region downstream of intron 6 ( approximately 2600 bp harbors only 6 singletons, a pattern that is not compatible with neutrality for this part of the gene. Tests of neutrality based on comparative genomics suggest that: (1 episodes of natural selection (likely a selective sweep predating the coalescent of human lineages, within the last 25 million years, account for the observed reduced diversity downstream of intron 6 and, (2 the target of natural selection may not be in the SLC2A4 coding sequence. CONCLUSIONS: We propose that the contrast in the pattern of genetic variation between the N-terminal and C-terminal regions are signatures of the action of natural selection and thus follow-up studies should investigate the functional importance of different regions of the SLC2A4 gene.

  6. Mask locations in the SLC final focus region

    International Nuclear Information System (INIS)

    Cence, R.J.

    1983-01-01

    The location of four sets of masks needed to shield against background in the final focus region of the SLC is shown. The main point of this note is to update the results of Miller and Sens taking into account the recent changes that have been made in the optics of the SLC beams. For the latest beam design we use the TRANSPORT output dated 5-13-83. This design assumes that the final bends will form an S about the interaction point and that the final quadrupoles will be superconducting and will be placed about 8 feet from the interaction point

  7. CryoEM structure of the human SLC4A4 sodium-coupled acid-base transporter NBCe1.

    Science.gov (United States)

    Huynh, Kevin W; Jiang, Jiansen; Abuladze, Natalia; Tsirulnikov, Kirill; Kao, Liyo; Shao, Xuesi; Newman, Debra; Azimov, Rustam; Pushkin, Alexander; Zhou, Z Hong; Kurtz, Ira

    2018-03-02

    Na + -coupled acid-base transporters play essential roles in human biology. Their dysfunction has been linked to cancer, heart, and brain disease. High-resolution structures of mammalian Na + -coupled acid-base transporters are not available. The sodium-bicarbonate cotransporter NBCe1 functions in multiple organs and its mutations cause blindness, abnormal growth and blood chemistry, migraines, and impaired cognitive function. Here, we have determined the structure of the membrane domain dimer of human NBCe1 at 3.9 Å resolution by cryo electron microscopy. Our atomic model and functional mutagenesis revealed the ion accessibility pathway and the ion coordination site, the latter containing residues involved in human disease-causing mutations. We identified a small number of residues within the ion coordination site whose modification transformed NBCe1 into an anion exchanger. Our data suggest that symporters and exchangers utilize comparable transport machinery and that subtle differences in their substrate-binding regions have very significant effects on their transport mode.

  8. Pathogenic substitution of IVS15 + 5G > A in SLC26A4 in patients of Okinawa Islands with enlarged vestibular aqueduct syndrome or Pendred syndrome.

    Science.gov (United States)

    Ganaha, Akira; Kaname, Tadashi; Yanagi, Kumiko; Naritomi, Kenji; Tono, Tetsuya; Usami, Shin-ichi; Suzuki, Mikio

    2013-05-24

    Pendred syndrome (PS) and nonsyndromic hearing loss associated with enlarged vestibular aqueduct (EVA) are caused by SLC26A4 mutations. The Okinawa Islands are the southwestern-most islands of the Japanese archipelago. And ancestral differences have been reported between people from Okinawa Island and those from the main islands of Japan. To confirm the ethnic variation of the spectrum of SLC26A4 mutations, we investigated the frequencies of SLC26A4 mutations and clinical manifestations of patients with EVA or PS living in the Okinawa Islands. We examined 22 patients with EVA or PS from 21 unrelated families in Okinawa Islands. The patient's clinical history, findings of physical and otoscopic examinations, hearing test, and computed tomography (CT) scan of the temporal bones were recorded. To detect mutations, all 21 exons and the exon-intron junctions of SLC26A4 were sequenced for all subjects. Quantitative reverse-transcription polymerase chain reaction (qRT-PCR) for SLC26A4 and calculations using the comparative CT (2(-ΔΔCT)) method were used to determine the pathogenicity associated with gene substitutions. SLC26A4 mutations were identified in 21 of the 22 patients. We found a compound heterozygous mutation for IVS15 + 5G > A/H723R in nine patients (41%), a homozygous substitution of IVS15 + 5G > A in six patients (27%), and homozygous mutation for H723R in five patients (23%). The most prevalent types of SLC26A4 alleles were IVS15 + 5G > A and H723R, which both accounted for 15/22 (68%) of the patients. There were no significant correlations between the types of SLC26A4 mutation and clinical manifestations. Based on qRT-PCR results, expression of SLC26A4 was not identified in patients with the homozygous substitution of IVS15 + 5G > A. The substitution of IVS15 + 5G > A in SLC26A4 was the most common mutation in uniquely found in patients with PS and EVA in Okinawa Islands. This suggested that the spectrum of SLC26A4 mutation differed

  9. Transport of phosphoric acid through supported liquid membrane

    International Nuclear Information System (INIS)

    Zayzafoon, G.; Yassine, T.; Baidoun, R.

    2003-01-01

    The transport of phosphhoric acid through liquid membranes of amylalkohol, 1-octanol and 2-octanol was studied. It was found that phosphoric acid is transfered from feed side to strip side and the transport increased with the concentration of phosphoric acid up to 5M. The permeability in each membrane was determined for 5M phosphoic acid. It was found that the permeability values are 1.45 x 10 1 0 m 2 s 1 for amylakohol and ∼ 1x10 1 0 m 2 s 1 for each of 1-octanol and 2-octanol

  10. Dicty_cDB: SLC415 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC415 (Link to dictyBase) - - - Contig-U16521-1 SLC415E (Link... to Original site) - - - - - - SLC415E 210 Show SLC415 Library SL (Link to library) Clone ID SLC415 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC415Q.Seq.d/ Representative seq. ID SLC41...5E (Link to Original site) Representative DNA sequence >SLC415 (SLC415Q) /CSM/SL/SLC4-A/SLC415Q.Seq.d/ CCAAC...lkprdpskfqakkllpsk *iilfsl*k Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC415 (SLC4

  11. Epigenetic regulation of the glucose transporter gene Slc2a1 by β-hydroxybutyrate underlies preferential glucose supply to the brain of fasted mice.

    Science.gov (United States)

    Tanegashima, Kosuke; Sato-Miyata, Yukiko; Funakoshi, Masabumi; Nishito, Yasumasa; Aigaki, Toshiro; Hara, Takahiko

    2017-01-01

    We carried out liquid chromatography-tandem mass spectrometry analysis of metabolites in mice. Those metabolome data showed that hepatic glucose content is reduced, but that brain glucose content is unaffected, during fasting, consistent with the priority given to brain glucose consumption during fasting. The molecular mechanisms for this preferential glucose supply to the brain are not fully understood. We also showed that the fasting-induced production of the ketone body β-hydroxybutyrate (β-OHB) enhances expression of the glucose transporter gene Slc2a1 (Glut1) via histone modification. Upon β-OHB treatment, Slc2a1 expression was up-regulated, with a concomitant increase in H3K9 acetylation at the critical cis-regulatory region of the Slc2a1 gene in brain microvascular endothelial cells and NB2a neuronal cells, shown by quantitative PCR analysis and chromatin immunoprecipitation assay. CRISPR/Cas9-mediated disruption of the Hdac2 gene increased Slc2a1 expression, suggesting that it is one of the responsible histone deacetylases (HDACs). These results confirm that β-OHB is a HDAC inhibitor and show that β-OHB plays an important role in fasting-induced epigenetic activation of a glucose transporter gene in the brain. © 2016 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.

  12. Dicty_cDB: SLC402 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC402 (Link to dictyBase) - - - Contig-U16327-1 SLC402E (Link to Original site) SLC4...02F 661 SLC402Z 395 SLC402P 1056 SLC402E 674 Show SLC402 Library SL (Link to library) Clone ID SLC4...inal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC402Q.Seq.d/ Representative seq. ID SLC4...02E (Link to Original site) Representative DNA sequence >SLC402 (SLC402Q) /CSM/SL/SLC4-A/SLC4...lignments: (bits) Value SSC554 (SSC554Q) /CSM/SS/SSC5-C/SSC554Q.Seq.d/ 1128 0.0 SLC402 (SLC4

  13. The solute carrier 6 family of transporters

    DEFF Research Database (Denmark)

    Bröer, Stefan; Gether, Ulrik

    2012-01-01

    of these transporters is associated with a variety of diseases. Pharmacological inhibition of the neurotransmitter transporters in this family is an important strategy in the management of neurological and psychiatric disorders. This review provides an overview of the biochemical and pharmacological properties......The solute carrier 6 (SLC6) family of the human genome comprises transporters for neurotransmitters, amino acids, osmolytes and energy metabolites. Members of this family play critical roles in neurotransmission, cellular and whole body homeostasis. Malfunction or altered expression...... of the SLC6 family transporters....

  14. Dicty_cDB: SLC435 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC435 (Link to dictyBase) - - - Contig-U16260-1 SLC435E (Link... to Original site) - - - - - - SLC435E 373 Show SLC435 Library SL (Link to library) Clone ID SLC435 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC435Q.Seq.d/ Representative seq. ID SLC43...5E (Link to Original site) Representative DNA sequence >SLC435 (SLC435Q) /CSM/SL/SLC4-B/SLC435Q.Seq.d/ GGAGA...I815Q) /CSM/SL/SLI8-A/SLI815Q.Seq.d/ 694 0.0 SLC435 (SLC435Q) /CSM/SL/SLC4-B/SLC4

  15. Deletions at SLC18A1 increased the risk of CRC and lower SLC18A1 expression associated with poor CRC outcome.

    Science.gov (United States)

    Zhang, Dandan; Li, Zhenli; Xu, Xiaohong; Zhou, Dan; Tang, Shunli; Yin, Xiaoyang; Xu, Fangying; Li, Hui; Zhou, Yuan; Zhu, Tao; Deng, Hong; Zhang, Shuai; Huang, Qiong; Wang, Jing; Yin, Wei; Zhu, Yimin; Lai, Maode

    2017-10-26

    Copy number variations (CNVs) contribute to the development of colorectal cancer (CRC). We conducted a two-stage association study to identify CNV risk loci for CRC. We performed a gene-based rare CNV study on 694 sporadic CRC and 1641 controls using Illumina Human-OmniExpress-12v1.0 BeadChips, and further replicated in 934 CRC cases and 2680 controls for risk CNVs by using TaqMan Copy Number Assay. Tumor buddings, cancer cells in the center of primary tumor and normal intestinal epithelial cells were captured using laser capture microdissection (LCM) and were assayed using AffymetrixGeneChip® Human Genome U133 Plus 2.0 Array. In addition, The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus data were assessed for the effects of risk CNVs. We found that germline deletions affecting the last six exons of SLC18A1 significantly associated with CRC with a combined P value of 6.4 × 10-5 by a two-stage analysis. Both in TCGA CRC RNA seq dataset and GDS4382, SLC18A1 was significantly down regulated in CRC tissues than in paired normal tissues (N = 32 and 17 pairs, P = 0.004 and 0.009, respectively). In LCM samples, similar observations were obtained that the expression levels of SLC18A1 in the tumor buddings, cancer cells in the center of primary tumor, and stroma of both tumor budding and cancer cells were lower than normal intestinal epithelial and stromal cells (fold change = 0.17-0.62, 0.12-0.57 and 0.37-0.68, respectively). In summary, the germline deletions at SLC18A1 contributed to the development of CRC. The role of SLC18A1 required further exploration. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  16. Genetic polymorphisms and haplotypes of the organic cation transporter 1 gene (SLC22A1 in the Xhosa population of South Africa

    Directory of Open Access Journals (Sweden)

    Clifford Jacobs

    2014-06-01

    Full Text Available Human organic cation transporter 1 is primarily expressed in hepatocytes and mediates the electrogenic transport of various endogenous and exogenous compounds, including clinically important drugs. Genetic polymorphisms in the gene coding for human organic cation transporter 1, SLC22A1, are increasingly being recognized as a possible mechanism explaining the variable response to clinical drugs, which are substrates for this transporter. The genotypic and allelic distributions of 19 nonsynonymous and one intronic SLC22A1 single nucleotide polymorphisms were determined in 148 healthy Xhosa participants from South Africa, using a SNAPshot® multiplex assay. In addition, haplotype structure for SLC22A1 was inferred from the genotypic data. The minor allele frequencies for S14F (rs34447885, P341L (rs2282143, V519F (rs78899680, and the intronic variant rs622342 were 1.7%, 8.4%, 3.0%, and 21.6%, respectively. None of the participants carried the variant allele for R61C (rs12208357, C88R (rs55918055, S189L (rs34104736, G220V (rs36103319, P283L (rs4646277, R287G (rs4646278, G401S (rs34130495, M440I (rs35956182, or G465R (rs34059508. In addition, no variant alleles were observed for A306T (COSM164365, A413V (rs144322387, M420V (rs142448543, I421F (rs139512541, C436F (rs139512541, V501E (rs143175763, or I542V (rs137928512 in the population. Eight haplotypes were inferred from the genotypic data. This study reports important genetic data that could be useful for future pharmacogenetic studies of drug transporters in the indigenous Sub-Saharan African populations.

  17. Solute carrier transporters: potential targets for digestive system neoplasms.

    Science.gov (United States)

    Xie, Jing; Zhu, Xiao Yan; Liu, Lu Ming; Meng, Zhi Qiang

    2018-01-01

    Digestive system neoplasms are the leading causes of cancer-related death all over the world. Solute carrier (SLC) superfamily is composed of a series of transporters that are ubiquitously expressed in organs and tissues of digestive systems and mediate specific uptake of small molecule substrates in facilitative manner. Given the important role of SLC proteins in maintaining normal functions of digestive system, dysregulation of these protein in digestive system neoplasms may deliver biological and clinical significance that deserves systemic studies. In this review, we critically summarized the recent advances in understanding the role of SLC proteins in digestive system neoplasms. We highlighted that several SLC subfamilies, including metal ion transporters, transporters of glucose and other sugars, transporters of urea, neurotransmitters and biogenic amines, ammonium and choline, inorganic cation/anion transporters, transporters of nucleotide, amino acid and oligopeptide organic anion transporters, transporters of vitamins and cofactors and mitochondrial carrier, may play important roles in mediating the initiation, progression, metastasis, and chemoresistance of digestive system neoplasms. Proteins in these SLC subfamilies may also have diagnostic and prognostic values to particular cancer types. Differential expression of SLC proteins in tumors of digestive system was analyzed by extracting data from human cancer database, which revealed that the roles of SLC proteins may either be dependent on the substrates they transport or be tissue specific. In addition, small molecule modulators that pharmacologically regulate the functions of SLC proteins were discussed for their possible application in the treatment of digestive system neoplasms. This review highlighted the potential of SLC family proteins as drug target for the treatment of digestive system neoplasms.

  18. The Physiopathological Role of the Exchangers Belonging to the SLC37 Family

    Directory of Open Access Journals (Sweden)

    Anna Rita Cappello

    2018-04-01

    Full Text Available The human SLC37 gene family includes four proteins SLC37A1-4, localized in the endoplasmic reticulum (ER membrane. They have been grouped into the SLC37 family due to their sequence homology to the bacterial organophosphate/phosphate (Pi antiporter. SLC37A1-3 are the less characterized isoforms. SLC37A1 and SLC37A2 are Pi-linked glucose-6-phosphate (G6P antiporters, catalyzing both homologous (Pi/Pi and heterologous (G6P/Pi exchanges, whereas SLC37A3 transport properties remain to be clarified. Furthermore, SLC37A1 is highly homologous to the bacterial glycerol 3-phosphate permeases, so it is supposed to transport also glycerol-3-phosphate. The physiological role of SLC37A1-3 is yet to be further investigated. SLC37A1 seems to be required for lipid biosynthesis in cancer cell lines, SLC37A2 has been proposed as a vitamin D and a phospho-progesterone receptor target gene, while mutations in the SLC37A3 gene appear to be associated with congenital hyperinsulinism of infancy. SLC37A4, also known as glucose-6-phosphate translocase (G6PT, transports G6P from the cytoplasm into the ER lumen, working in complex with either glucose-6-phosphatase-α (G6Pase-α or G6Pase-β to hydrolyze intraluminal G6P to Pi and glucose. G6PT and G6Pase-β are ubiquitously expressed, whereas G6Pase-α is specifically expressed in the liver, kidney and intestine. G6PT/G6Pase-α complex activity regulates fasting blood glucose levels, whereas G6PT/G6Pase-β is required for neutrophil functions. G6PT deficiency is responsible for glycogen storage disease type Ib (GSD-Ib, an autosomal recessive disorder associated with both defective metabolic and myeloid phenotypes. Several kinds of mutations have been identified in the SLC37A4 gene, affecting G6PT function. An increased autoimmunity risk for GSD-Ib patients has also been reported, moreover, SLC37A4 seems to be involved in autophagy.

  19. The Physiopathological Role of the Exchangers Belonging to the SLC37 Family

    Science.gov (United States)

    Cappello, Anna Rita; Curcio, Rosita; Lappano, Rosamaria; Maggiolini, Marcello; Dolce, Vincenza

    2018-04-01

    The human SLC37 gene family includes four proteins SLC37A1-4, localized in the endoplasmic reticulum (ER) membrane. They have been grouped into the SLC37 family due to their sequence homology to the bacterial organophosphate/phosphate (Pi) antiporter. SLC37A1-3 are the less characterized isoforms. SLC37A1 and SLC37A2 are Pi-linked glucose-6-phosphate (G6P) antiporters, catalyzing both homologous (Pi/Pi) and heterologous (G6P/Pi) exchanges, whereas SLC37A3 transport properties remain to be clarified. Furthermore, SLC37A1 is highly homologous to the bacterial glycerol 3-phosphate permeases, so it is supposed to transport also glycerol-3-phosphate. The physiological role of SLC37A1-3 is yet to be further investigated. SLC37A1 seems to be required for lipid biosynthesis in cancer cell lines, SLC37A2 has been proposed as a vitamin D and a phospho-progesterone receptor target gene, while mutations in the SLC37A3 gene appear to be associated with congenital hyperinsulinism of infancy. SLC37A4, also known as glucose-6-phosphate translocase (G6PT), transports G6P from the cytoplasm into the ER lumen, working in complex with either glucose-6-phosphatase-α (G6Pase-α) or G6Pase-β to hydrolyze intraluminal G6P to Pi and glucose. G6PT and G6Pase-β are ubiquitously expressed, whereas G6Pase-α is specifically expressed in the liver, kidney and intestine. G6PT/G6Pase-α complex activity regulates fasting blood glucose levels, whereas G6PT/G6Pase-β is required for neutrophil functions. G6PT deficiency is responsible for glycogen storage disease type Ib (GSD-Ib), an autosomal recessive disorder associated with both defective metabolic and myeloid phenotypes. Several kinds of mutations have been identified in the SLC37A4 gene, affecting G6PT function. An increased autoimmunity risk for GSD-Ib patients has also been reported, moreover, SLC37A4 seems to be involved in autophagy.

  20. Dicty_cDB: SLC409 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC409 (Link to dictyBase) - - - Contig-U14931-1 SLC409Z (Link... to Original site) - - SLC409Z 483 - - - - Show SLC409 Library SL (Link to library) Clone ID SLC409 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC409Q.Seq.d/ Representative seq. ID SLC40...9Z (Link to Original site) Representative DNA sequence >SLC409 (SLC409Q) /CSM/SL/SLC4-A/SLC409Q.Seq.d/ XXXXX... SLH501 (SLH501Q) /CSM/SL/SLH5-A/SLH501Q.Seq.d/ 858 0.0 SLF191 (SLF191Q) /CSM/SL/SLF1-D/SLF191Q.Seq.d/ 858 0.0 SLC409 (SLC4

  1. Dicty_cDB: SLC485 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC485 (Link to dictyBase) - - - Contig-U16358-1 SLC485Z (Link... to Original site) - - SLC485Z 452 - - - - Show SLC485 Library SL (Link to library) Clone ID SLC485 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC485Q.Seq.d/ Representative seq. ID SLC48...5Z (Link to Original site) Representative DNA sequence >SLC485 (SLC485Q) /CSM/SL/SLC4-D/SLC485Q.Seq.d/ XXXXX... 825 0.0 SLG820 (SLG820Q) /CSM/SL/SLG8-A/SLG820Q.Seq.d/ 825 0.0 SLC485 (SLC485Q) /CSM/SL/SLC4-D/SLC4

  2. Isochronous 180 degree turns for the SLC positron system

    International Nuclear Information System (INIS)

    Helm, R.H.; Clendenin, J.E.; Ecklund, S.D.; Kulikov, A.V.; Pitthan, R.

    1991-05-01

    The design of the compact, achromatic, second order isochronous 180 degrees turn for the SLC positron transport system will be described. Design criteria require an energy range of 200±20 MeV, energy acceptance of ±5%, transverse admittance of 25π mm-mr, and minimal lengthening of the 3 to 4 mm (rms) positron bunch. The devices had to fit within a maximum height or width of about 10 ft. Optics specifications and theoretical performance are presented and compared to experimental results based on streak camera measurements of bunch length immediately after the first isochronous turn (200 MeV) and positron beam energy spread after S-band acceleration to 1.15 GeV. 5 refs., 7 figs

  3. Functional identification of the promoter of SLC4A5, a gene associated with cardiovascular and metabolic phenotypes in the HERITAGE Family Study.

    Science.gov (United States)

    Stütz, Adrian M; Teran-Garcia, Margarita; Rao, D C; Rice, Treva; Bouchard, Claude; Rankinen, Tuomo

    2009-11-01

    The sodium bicarbonate cotransporter gene SLC4A5, associated earlier with cardiovascular phenotypes, was tested for associations in the HERITAGE Family Study, and possible mechanisms were investigated. Twelve tag-single nucleotide polymorphisms (SNPs) covering the SLC4A5 gene were analyzed in 276 Black and 503 White healthy, sedentary subjects. Associations were tested using a variance components-based (QTDT) method with data adjusted for age, sex and body size. In Whites, rs6731545 and rs7571842 were significantly associated with resting and submaximal exercise pulse pressure (PP) (0.0004 HERITAGE Family Study are likely due to neither variation in the promoter nor known coding SNPs of SLC4A5.

  4. Characterization of Organic Anion Transporter 2 (SLC22A7): A Highly Efficient Transporter for Creatinine and Species-Dependent Renal Tubular Expression.

    Science.gov (United States)

    Shen, Hong; Liu, Tongtong; Morse, Bridget L; Zhao, Yue; Zhang, Yueping; Qiu, Xi; Chen, Cliff; Lewin, Anne C; Wang, Xi-Tao; Liu, Guowen; Christopher, Lisa J; Marathe, Punit; Lai, Yurong

    2015-07-01

    The contribution of organic anion transporter OAT2 (SLC22A7) to the renal tubular secretion of creatinine and its exact localization in the kidney are reportedly controversial. In the present investigation, the transport of creatinine was assessed in human embryonic kidney (HEK) cells that stably expressed human OAT2 (OAT2-HEK) and isolated human renal proximal tubule cells (HRPTCs). The tubular localization of OAT2 in human, monkey, and rat kidney was characterized. The overexpression of OAT2 significantly enhanced the uptake of creatinine in OAT2-HEK cells. Under physiologic conditions (creatinine concentrations of 41.2 and 123.5 µM), the initial rate of OAT2-mediated creatinine transport was approximately 11-, 80-, and 80-fold higher than OCT2, multidrug and toxin extrusion protein (MATE)1, and MATE2K, respectively, resulting in approximately 37-, 1850-, and 80-fold increase of the intrinsic transport clearance when normalized to the transporter protein concentrations. Creatinine intracellular uptake and transcellular transport in HRPTCs were decreased in the presence of 50 µM bromosulfophthalein and 100 µM indomethacin, which inhibited OAT2 more potently than other known creatinine transporters, OCT2 and multidrug and toxin extrusion proteins MATE1 and MATE2K (IC50: 1.3 µM vs. > 100 µM and 2.1 µM vs. > 200 µM for bromosulfophthalein and indomethacin, respectively) Immunohistochemistry analysis showed that OAT2 protein was localized to both basolateral and apical membranes of human and cynomolgus monkey renal proximal tubules, but appeared only on the apical membrane of rat proximal tubules. Collectively, the findings revealed the important role of OAT2 in renal secretion and possible reabsorption of creatinine and suggested a molecular basis for potential species difference in the transporter handling of creatinine. Copyright © 2015 by The American Society for Pharmacology and Experimental Therapeutics.

  5. SLC injector simulation and tuning for high charge transport

    International Nuclear Information System (INIS)

    Yeremian, A.D.; Miller, R.H.; Clendenin, J.E.; Early, R.A.; Ross, M.C.; Turner, J.L.; Wang, J.W.

    1992-08-01

    We have simulated the SLC injector from the thermionic gun through the first accelerating section and used the resulting parameters to tune the injector for optimum performance and high charge transport. Simulations are conducted using PARMELA, a three-dimensional ray-trace code with a two-dimensional space-charge model. The magnetic field profile due to the existing magnetic optics is calculated using POISSON, while SUPERFISH is used to calculate the space harmonics of the various bunchers and the accelerator cavities. The initial beam conditions in the PARMELA code are derived from the EGUN model of the gun. The resulting injector parameters from the PARMELA simulation are used to prescribe experimental settings of the injector components. The experimental results are in agreement with the results of the integrated injector model

  6. Dicty_cDB: SLC425 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC425 (Link to dictyBase) - - - Contig-U16276-1 SLC425Z (Link... to Original site) - - SLC425Z 515 - - - - Show SLC425 Library SL (Link to library) Clone ID SLC425 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC425Q.Seq.d/ Representative seq. ID SLC42...5Z (Link to Original site) Representative DNA sequence >SLC425 (SLC425Q) /CSM/SL/SLC4-B/SLC425Q.Seq.d/ XXXXX...producing significant alignments: (bits) Value SLC425 (SLC425Q) /CSM/SL/SLC4-B/SLC4

  7. Membrane topology of rat sodium-coupled neutral amino acid transporter 2 (SNAT2).

    Science.gov (United States)

    Ge, Yudan; Gu, Yanting; Wang, Jiahong; Zhang, Zhou

    2018-07-01

    Sodium-coupled neutral amino acid transporter 2 (SNAT2) is a subtype of the amino acid transport system A that is widely expressed in mammalian tissues. It plays critical roles in glutamic acid-glutamine circulation, liver gluconeogenesis and other biological pathway. However, the topology of the SNAT2 amino acid transporter is unknown. Here we identified the topological structure of SNAT2 using bioinformatics analysis, Methoxy-polyethylene glycol maleimide (mPEG-Mal) chemical modification, protease cleavage assays, immunofluorescence and examination of glycosylation. Our results show that SNAT2 contains 11 transmembrane domains (TMDs) with an intracellular N terminus and an extracellular C terminus. Three N-glycosylation sites were verified at the largest extracellular loop. This model is consistent with the previous model of SNAT2 with the exception of a difference in number of glycosylation sites. This is the first time to confirm the SNAT2 membrane topology using experimental methods. Our study on SNAT2 topology provides valuable structural information of one of the solute carrier family 38 (SLC38) members. Copyright © 2018 Elsevier B.V. All rights reserved.

  8. Up-Regulation of the Excitatory Amino Acid Transporters EAAT1 and EAAT2 by Mammalian Target of Rapamycin

    Directory of Open Access Journals (Sweden)

    Abeer Abousaab

    2016-11-01

    Full Text Available Background: The excitatory amino-acid transporters EAAT1 and EAAT2 clear glutamate from the synaptic cleft and thus terminate neuronal excitation. The carriers are subject to regulation by various kinases. The EAAT3 isoform is regulated by mammalian target of rapamycin (mTOR. The present study thus explored whether mTOR influences transport by EAAT1 and/or EAAT2. Methods: cRNA encoding wild type EAAT1 (SLC1A3 or EAAT2 (SLC1A2 was injected into Xenopus oocytes without or with additional injection of cRNA encoding mTOR. Dual electrode voltage clamp was performed in order to determine electrogenic glutamate transport (IEAAT. EAAT2 protein abundance was determined utilizing chemiluminescence. Results: Appreciable IEAAT was observed in EAAT1 or EAAT2 expressing but not in water injected oocytes. IEAAT was significantly increased by coexpression of mTOR. Coexpression of mTOR increased significantly the maximal IEAAT in EAAT1 or EAAT2 expressing oocytes, without significantly modifying affinity of the carriers. Moreover, coexpression of mTOR increased significantly EAAT2 protein abundance in the cell membrane. Conclusions: The kinase mTOR up-regulates the excitatory amino acid transporters EAAT1 and EAAT2.

  9. Recessive mutations in SLC13A5 result in a loss of citrate transport and cause neonatal epilepsy, developmental delay and teeth hypoplasia

    DEFF Research Database (Denmark)

    Hardies, Katia; de Kovel, Carolien G F; Weckhuysen, Sarah

    2015-01-01

    The epileptic encephalopathies are a clinically and aetiologically heterogeneous subgroup of epilepsy syndromes. Most epileptic encephalopathies have a genetic cause and patients are often found to carry a heterozygous de novo mutation in one of the genes associated with the disease entity. Occas...... as a possible indicator for SLC13A5 screening. All three patients who tried the ketogenic diet responded well to this treatment, and future studies will allow us to ascertain whether this is a recurrent feature in this severe disorder....

  10. Dicty_cDB: SLC456 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC456 (Link to dictyBase) - - - Contig-U16272-1 SLC456Z (Link... to Original site) - - SLC456Z 483 - - - - Show SLC456 Library SL (Link to library) Clone ID SLC456 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC456Q.Seq.d/ Representative seq. ID SLC45...6Z (Link to Original site) Representative DNA sequence >SLC456 (SLC456Q) /CSM/SL/SLC4-C/SLC456Q.Seq.d/ XXXXX...0 %: vacuolar 4.0 %: peroxisomal >> prediction for SLC456 is nuc 5' end seq. ID -

  11. SLC4A11 Prevents Osmotic Imbalance Leading to Corneal Endothelial Dystrophy, Deafness, and Polyuria*

    Science.gov (United States)

    Gröger, Nicole; Fröhlich, Henning; Maier, Hannes; Olbrich, Andrea; Kostin, Sawa; Braun, Thomas; Boettger, Thomas

    2010-01-01

    Maintenance of ion concentration gradients is essential for the function of many organs, including the kidney, the cornea, and the inner ear. Ion concentrations and fluid content in the cornea are regulated by endothelial cells that separate the collagenous avascular corneal stroma from the anterior eye chamber. Failure to maintain correct ion concentrations leads to swelling and destruction of the cornea. In the inner ear, the stria vascularis is responsible for generating proper ion concentrations in the endolymph, which is essential for hearing. Mutations of SLC4A11 in humans lead to syndromes associated with corneal dystrophy and perceptive deafness. The molecular mechanisms underlying these symptoms are poorly understood, impeding therapeutic interventions. The ion transporter SLC4A11 mediates sodium-dependent transport of borate as well as flux of sodium and hydroxyl ions in vitro. Here, we show that SLC4A11 is expressed in the endothelial cells of the cornea where it prevents severe morphological changes of the cornea caused by increased sodium chloride concentrations in the stroma. In the inner ear, SLC4A11 is located in fibrocytes underlying the stria vascularis. Loss of SLC4A11 leads to morphological changes in the fibrocytes and deafness. We demonstrate that SLC4A11 is essential for the generation of the endocochlear potential but not for regulation of potassium concentrations in the endolymph. In the kidney, SLC4A11 is expressed in the thin descending limb of Henle loop. SLC4A11 is essential for urinary concentration, suggesting that SLC4A11 participates in the countercurrent multiplication that concentrates urine in the kidney medulla. PMID:20185830

  12. Dicty_cDB: SLC455 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC455 (Link to dictyBase) - - - Contig-U16584-1 SLC455Z (Link... to Original site) - - SLC455Z 379 - - - - Show SLC455 Library SL (Link to library) Clone ID SLC455 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC455Q.Seq.d/ Representative seq. ID SLC45...5Z (Link to Original site) Representative DNA sequence >SLC455 (SLC455Q) /CSM/SL/SLC4-C/SLC455Q.Seq.d/ XXXXX...57 ) Dictyostelium discoideum slug cDNA, clone SLC469. 468 e-177 3 ( AU034549 ) Dictyostelium discoideum slug cDNA, clone SLC4

  13. Review of lattice measurement techniques at the SLC

    International Nuclear Information System (INIS)

    Barklow, T.; Emma, P.; Krejcik, P.; Walker, N.

    1991-11-01

    A technique is described for reconstructing the first order transport matrix (R) for a given beam line. Emphasis is placed on the rigorous error analysis of the data, and the use of powerful statistical techniques to estimate unknown systematic errors. The application of the technique to the measurement and subsequent correction of the SLC Arcs is briefly described. 5 refs., 4 figs

  14. Dicty_cDB: SLC444 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC444 (Link to dictyBase) - - - Contig-U16368-1 SLC444Z (Link... to Original site) - - SLC444Z 462 - - - - Show SLC444 Library SL (Link to library) Clone ID SLC444 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC444Q.Seq.d/ Representative seq. ID SLC44...4Z (Link to Original site) Representative DNA sequence >SLC444 (SLC444Q) /CSM/SL/SLC4-B/SLC444Q.Seq.d/ XXXXX...tochondrial 8.0 %: nuclear 4.0 %: cytoskeletal 4.0 %: cytoplasmic >> prediction for SLC444 is mit 5' end seq

  15. Carnitine transport and fatty acid oxidation.

    Science.gov (United States)

    Longo, Nicola; Frigeni, Marta; Pasquali, Marzia

    2016-10-01

    Carnitine is essential for the transfer of long-chain fatty acids across the inner mitochondrial membrane for subsequent β-oxidation. It can be synthesized by the body or assumed with the diet from meat and dairy products. Defects in carnitine biosynthesis do not routinely result in low plasma carnitine levels. Carnitine is accumulated by the cells and retained by kidneys using OCTN2, a high affinity organic cation transporter specific for carnitine. Defects in the OCTN2 carnitine transporter results in autosomal recessive primary carnitine deficiency characterized by decreased intracellular carnitine accumulation, increased losses of carnitine in the urine, and low serum carnitine levels. Patients can present early in life with hypoketotic hypoglycemia and hepatic encephalopathy, or later in life with skeletal and cardiac myopathy or sudden death from cardiac arrhythmia, usually triggered by fasting or catabolic state. This disease responds to oral carnitine that, in pharmacological doses, enters cells using the amino acid transporter B(0,+). Primary carnitine deficiency can be suspected from the clinical presentation or identified by low levels of free carnitine (C0) in the newborn screening. Some adult patients have been diagnosed following the birth of an unaffected child with very low carnitine levels in the newborn screening. The diagnosis is confirmed by measuring low carnitine uptake in the patients' fibroblasts or by DNA sequencing of the SLC22A5 gene encoding the OCTN2 carnitine transporter. Some mutations are specific for certain ethnic backgrounds, but the majority are private and identified only in individual families. Although the genotype usually does not correlate with metabolic or cardiac involvement in primary carnitine deficiency, patients presenting as adults tend to have at least one missense mutation retaining residual activity. This article is part of a Special Issue entitled: Mitochondrial Channels edited by Pierre Sonveaux, Pierre Maechler

  16. SLC-2000: A luminosity upgrade for the SLC

    International Nuclear Information System (INIS)

    Breidenbach, M.; Decker, F.-J.; Helm, R.; Napoly, O.; Phinney, N.; Raimondi, P.; Raubenheimer, T.O.; Siemann, R.; Zimmermann, F.; Hertzbach, S.

    1996-01-01

    We discuss a possible upgrade to the Stanford Linear Collider (SLC), whose objective is to increase the SLC luminosity by at least a factor 7, to an average Z production rate of more than 35,000 per week. The centerpiece of the upgrade is the installation of a new superconducting final doublet with a field gradient of 240 T/m, which will be placed at a distance of only 70 cm from the interaction point. In addition, several bending magnets in each final focus will be lengthened and two octupole correctors are added. A complementary upgrade of damping rings and bunch compressors will allow optimum use of the modified final focus and can deliver, or exceed, the targeted luminosity. The proposed upgrade will place the SLC physics program in a very competitive position, and will also enable it to pursue its pioneering role as the first and only linear collider. (author)

  17. Status of the SLC

    International Nuclear Information System (INIS)

    Moffeit, K.C.

    1987-01-01

    The status and research possibilities of the Stanford Linear Collider (SLC) are reviewed. The physics program concentrates on production of Z 0 's and their decay. The SLC systems include a new injector and booster, two damping rings to provide the small beam emittance, a new positron source, the existing LINAC structure upgraded for higher energy and better beam control, beam transport arcs, a final focus section, and experimental halls are detectors. Energy spectrometers with an accuracy of ± 50 MeV/c 2 for pulse-to-pulse center of mass energy measurement are to be installed. Longitudinal polarized electrons are expected, and will allow more precise tests of the standard model

  18. NBCe1 (SLC4A4) a potential pH regulator in enamel organ cells during enamel development in the mouse

    NARCIS (Netherlands)

    Jalali, R.; Guo, J.; Zandieh-Doulabi, B.; Bervoets, T.J.M.; Paine, M.L.; Boron, W.F.; Parker, M.D.; Bijvelds, M.J.C.; Medina, J.F.; DenBesten, P.K.; Bronckers, A.L.J.J.

    2014-01-01

    During the formation of dental enamel, maturation-stage ameloblasts express ion-transporting transmembrane proteins. The SLC4 family of ion-transporters regulates intra- and extracellular pH in eukaryotic cells by cotransporting HCO3 − with Na+. Mutation in SLC4A4 (coding for the sodium-bicarbonate

  19. PCFT/SLC46A1 promoter methylation and restoration of gene expression in human leukemia cells

    International Nuclear Information System (INIS)

    Gonen, Nitzan; Bram, Eran E.; Assaraf, Yehuda G.

    2008-01-01

    The proton-coupled folate transporter (PCFT/SLC46A1) displays optimal and prominent folate and antifolate transport activity at acidic pH in human carcinoma cells but poor activity in leukemia cells. Consistently herein, human leukemia cell lines expressed poor PCFT transcript levels, whereas various carcinoma cell lines showed substantial PCFT gene expression. We identified a CpG island with high density at nucleotides -200 through +100 and explored its role in PCFT promoter silencing. Leukemia cells with barely detectable PCFT transcripts consistently harbored 85-100% methylation of this CpG island, whereas no methylation was found in carcinoma cells. Treatment with 5-Aza-2'-deoxycytidine which induced demethylation but not with the histone deacetylase inhibitor trichostatin A, restored 50-fold PCFT expression only in leukemia cells. These findings constitute the first demonstration of the dominant epigenetic silencing of the PCFT gene in leukemia cells. The potential translational implications of the restoration of PCFT expression in chemotherapy of leukemia are discussed

  20. A 40-bp VNTR polymorphism in the 3'-untranslated region of DAT1/SLC6A3 is associated with ADHD but not with alcoholism.

    Science.gov (United States)

    Šerý, Omar; Paclt, Ivo; Drtílková, Ivana; Theiner, Pavel; Kopečková, Marta; Zvolský, Petr; Balcar, Vladimir J

    2015-06-11

    ADHD and alcoholism are psychiatric diseases with pathophysiology related to dopamine system. DAT1 belongs to the SLC6 family of transporters and is involved in the regulation of extracellular dopamine levels. A 40 bp variable number tandem repeat (VNTR) polymorphism in the 3'-untranslated region of DAT1/SLC6A3 gene was previously reported to be associated with various phenotypes involving disturbed regulation of dopaminergic neurotransmission. A total of 1312 subjects were included and genotyped for 40 bp VNTR polymorphism of DAT1/SLC6A3 gene in this study (441 alcoholics, 400 non-alcoholic controls, 218 ADHD children and 253 non ADHD children). Using miRBase software, we have performed a computer analysis of VNTR part of DAT1 gene for presence of miRNA binding sites. We have found significant relationships between ADHD and the 40 bp VNTR polymorphisms of DAT1/SLC6A3 gene (P VNTR polymorphism of DAT1/SLC6A3 gene has been detected. We have found an association between 40 bp VNTR polymorphism of DAT1/SLC6A3 gene and ADHD in the Czech population; in a broad agreement with studies in other population samples. Furthermore, we detected rare genotypes 8/10, 7/10 and 10/11 present in ADHD boys only and identified miRNAs that should be looked at as potential novel targets in the research on ADHD.

  1. Chloride Anions Regulate Kinetics but Not Voltage-Sensor Qmax of the Solute Carrier SLC26a5.

    Science.gov (United States)

    Santos-Sacchi, Joseph; Song, Lei

    2016-06-07

    In general, SLC26 solute carriers serve to transport a variety of anions across biological membranes. However, prestin (SLC26a5) has evolved, now serving as a motor protein in outer hair cells (OHCs) of the mammalian inner ear and is required for cochlear amplification, a mechanical feedback mechanism to boost auditory performance. The mechanical activity of the OHC imparted by prestin is driven by voltage and controlled by anions, chiefly intracellular chloride. Current opinion is that chloride anions control the Boltzmann characteristics of the voltage sensor responsible for prestin activity, including Qmax, the total sensor charge moved within the membrane, and Vh, a measure of prestin's operating voltage range. Here, we show that standard narrow-band, high-frequency admittance measures of nonlinear capacitance (NLC), an alternate representation of the sensor's charge-voltage (Q-V) relationship, is inadequate for assessment of Qmax, an estimate of the sum of unitary charges contributed by all voltage sensors within the membrane. Prestin's slow transition rates and chloride-binding kinetics adversely influence these estimates, contributing to the prevalent concept that intracellular chloride level controls the quantity of sensor charge moved. By monitoring charge movement across frequency, using measures of multifrequency admittance, expanded displacement current integration, and OHC electromotility, we find that chloride influences prestin kinetics, thereby controlling charge magnitude at any particular frequency of interrogation. Importantly, however, this chloride dependence vanishes as frequency decreases, with Qmax asymptoting at a level irrespective of the chloride level. These data indicate that prestin activity is significantly low-pass in the frequency domain, with important implications for cochlear amplification. We also note that the occurrence of voltage-dependent charge movements in other SLC26 family members may be hidden by inadequate

  2. Organic solute carrier 22 (SLC22 family: Potential for interactions with food, herbal/dietary supplements, endogenous compounds, and drugs

    Directory of Open Access Journals (Sweden)

    Raymond E. Lai

    2018-04-01

    Full Text Available Many drugs, hormones, components of herbal medicines, environmental pesticides and toxins are Solute Carrier family 22 (SLC22 substrates. The last twenty years has seen great progress in determining SLC22 tissue expression profiles, membrane localization, energetics, substrate profiles and biopharmaceutical significance. However, much still remains to be answered in terms of SLC22 family member's roles in ‘normal’ physiology as compared to pathophysiological states, as well as in drug interactions that impact pharmacokinetics, efficacy and toxicity. This review begins with a brief synopsis of SLC22 family discovery, function and tissue expression. Subsequent sections provide examples establishing a role for SLC22 transporters in food-drug, herbal supplement-drug, endogenous substrate-drug and drug–drug interactions. Keywords: Hepatic transport, Nephrotoxicity, Organic anion transporter, Organic cation transporter, Renal transport

  3. Changes in oil content of transgenic soybeans expressing the yeast SLC1 gene.

    Science.gov (United States)

    Rao, Suryadevara S; Hildebrand, David

    2009-10-01

    The wild type (Wt) and mutant form of yeast (sphingolipid compensation) genes, SLC1 and SLC1-1, have been shown to have lysophosphatidic acid acyltransferase (LPAT) activities (Nageic et al. in J Biol Chem 269:22156-22163, 1993). Expression of these LPAT genes was reported to increase oil content in transgenic Arabidopsis and Brassica napus. It is of interest to determine if the TAG content increase would also be seen in soybeans. Therefore, the wild type SLC1 was expressed in soybean somatic embryos under the control of seed specific phaseolin promoter. Some transgenic somatic embryos and in both T2 and T3 transgenic seeds showed higher oil contents. Compared to controls, the average increase in triglyceride values went up by 1.5% in transgenic somatic embryos. A maximum of 3.2% increase in seed oil content was observed in a T3 line. Expression of the yeast Wt LPAT gene did not alter the fatty acid composition of the seed oil.

  4. Homozygous SLC6A17 Mutations Cause Autosomal-Recessive Intellectual Disability with Progressive Tremor, Speech Impairment, and Behavioral Problems

    Science.gov (United States)

    Iqbal, Zafar; Willemsen, Marjolein H.; Papon, Marie-Amélie; Musante, Luciana; Benevento, Marco; Hu, Hao; Venselaar, Hanka; Wissink-Lindhout, Willemijn M.; Vulto-van Silfhout, Anneke T.; Vissers, Lisenka E.L.M.; de Brouwer, Arjan P.M.; Marouillat, Sylviane; Wienker, Thomas F.; Ropers, Hans Hilger; Kahrizi, Kimia; Nadif Kasri, Nael; Najmabadi, Hossein; Laumonnier, Frédéric; Kleefstra, Tjitske; van Bokhoven, Hans

    2015-01-01

    We report on Dutch and Iranian families with affected individuals who present with moderate to severe intellectual disability and additional phenotypes including progressive tremor, speech impairment, and behavioral problems in certain individuals. A combination of exome sequencing and homozygosity mapping revealed homozygous mutations c.484G>A (p.Gly162Arg) and c.1898C>G (p.Pro633Arg) in SLC6A17. SLC6A17 is predominantly expressed in the brain, encodes a synaptic vesicular transporter of neutral amino acids and glutamate, and plays an important role in the regulation of glutamatergic synapses. Prediction programs and 3D modeling suggest that the identified mutations are deleterious to protein function. To directly test the functional consequences, we investigated the neuronal subcellular localization of overexpressed wild-type and mutant variants in mouse primary hippocampal neuronal cells. Wild-type protein was present in soma, axons, dendrites, and dendritic spines. p.Pro633Arg altered SLC6A17 was found in soma and proximal dendrites but did not reach spines. p.Gly162Arg altered SLC6A17 showed a normal subcellular distribution but was associated with an abnormal neuronal morphology mainly characterized by the loss of dendritic spines. In summary, our genetic findings implicate homozygous SLC6A17 mutations in autosomal-recessive intellectual disability, and their pathogenic role is strengthened by genetic evidence and in silico and in vitro functional analyses. PMID:25704603

  5. Developmental expression of solute carrier family 26A member 4 (SLC26A4/pendrin) during amelogenesis in developing rodent teeth.

    Science.gov (United States)

    Bronckers, Antonius L J J; Guo, Jing; Zandieh-Doulabi, Behrouz; Bervoets, Theodore J; Lyaruu, Donacian M; Li, Xiangming; Wangemann, Philine; DenBesten, Pamela

    2011-12-01

    Ameloblasts need to regulate pH during the formation of enamel crystals, a process that generates protons. Solute carrier family 26A member 4 (SLC26A4, or pendrin) is an anion exchanger for chloride, bicarbonate, iodine, and formate. It is expressed in apical membranes of ion-transporting epithelia in kidney, inner ear, and thyroid where it regulates luminal pH and fluid transport. We hypothesized that maturation ameloblasts express SLC26A4 to neutralize acidification of enamel fluid in forming enamel. In rodents, secretory and maturation ameloblasts were immunopositive for SLC26A4. Staining was particularly strong in apical membranes of maturation ameloblasts facing forming enamel. RT-PCR confirmed the presence of mRNA transcripts for Slc26a4 in enamel organs. SLC26A4 immunostaining was also found in mineralizing connective tissues, including odontoblasts, osteoblasts, osteocytes, osteoclasts, bone lining cells, cellular cementoblasts, and cementocytes. However, Slc26a4-null mutant mice had no overt dental phenotype. The presence of SLC26A4 in apical plasma membranes of maturation ameloblasts is consistent with a potential function as a pH regulator. SLC26A4 does not appear to be critical for ameloblast function and is probably compensated by other pH regulators. © 2011 Eur J Oral Sci.

  6. Sequence variation and linkage disequilibrium in the GABA transporter-1 gene (SLC6A1 in five populations: implications for pharmacogenetic research

    Directory of Open Access Journals (Sweden)

    Sughondhabirom Atapol

    2007-10-01

    Full Text Available Abstract Background GABA transporter-1 (GAT-1; genetic locus SLC6A1 is emerging as a novel target for treatment of neuropsychiatric disorders. To understand how population differences might influence strategies for pharmacogenetic studies, we identified patterns of genetic variation and linkage disequilibrium (LD in SLC6A1 in five populations representing three continental groups. Results We resequenced 12.4 kb of SLC6A1, including the promoters, exons and flanking intronic regions in African-American, Thai, Hmong, Finnish, and European-American subjects (total n = 40. LD in SLC6A1 was examined by genotyping 16 SNPs in larger samples. Sixty-three variants were identified through resequencing. Common population-specific variants were found in African-Americans, including a novel 21-bp promoter region variable number tandem repeat (VNTR, but no such variants were found in any of the other populations studied. Low levels of LD and the absence of major LD blocks were characteristic of all five populations. African-Americans had the highest genetic diversity. European-Americans and Finns did not differ in genetic diversity or LD patterns. Although the Hmong had the highest level of LD, our results suggest that a strategy based on the use of tag SNPs would not translate to a major improvement in genotyping efficiency. Conclusion Owing to the low level of LD and presence of recombination hotspots, SLC6A1 may be an example of a problematic gene for association and haplotype tagging-based genetic studies. The 21-bp promoter region VNTR polymorphism is a putatively functional candidate allele for studies focusing on variation in GAT-1 function in the African-American population.

  7. Quantifying the relative contributions of different solute carriers to aggregate substrate transport

    Science.gov (United States)

    Taslimifar, Mehdi; Oparija, Lalita; Verrey, Francois; Kurtcuoglu, Vartan; Olgac, Ufuk; Makrides, Victoria

    2017-01-01

    Determining the contributions of different transporter species to overall cellular transport is fundamental for understanding the physiological regulation of solutes. We calculated the relative activities of Solute Carrier (SLC) transporters using the Michaelis-Menten equation and global fitting to estimate the normalized maximum transport rate for each transporter (Vmax). Data input were the normalized measured uptake of the essential neutral amino acid (AA) L-leucine (Leu) from concentration-dependence assays performed using Xenopus laevis oocytes. Our methodology was verified by calculating Leu and L-phenylalanine (Phe) data in the presence of competitive substrates and/or inhibitors. Among 9 potentially expressed endogenous X. laevis oocyte Leu transporter species, activities of only the uniporters SLC43A2/LAT4 (and/or SLC43A1/LAT3) and the sodium symporter SLC6A19/B0AT1 were required to account for total uptake. Furthermore, Leu and Phe uptake by heterologously expressed human SLC6A14/ATB0,+ and SLC43A2/LAT4 was accurately calculated. This versatile systems biology approach is useful for analyses where the kinetics of each active protein species can be represented by the Hill equation. Furthermore, its applicable even in the absence of protein expression data. It could potentially be applied, for example, to quantify drug transporter activities in target cells to improve specificity. PMID:28091567

  8. Missense mutation in exon 2 of SLC36A1 responsible for champagne dilution in horses.

    Directory of Open Access Journals (Sweden)

    Deborah Cook

    2008-09-01

    Full Text Available Champagne coat color in horses is controlled by a single, autosomal-dominant gene (CH. The phenotype produced by this gene is valued by many horse breeders, but can be difficult to distinguish from the effect produced by the Cream coat color dilution gene (CR. Three sires and their families segregating for CH were tested by genome scanning with microsatellite markers. The CH gene was mapped within a 6 cM region on horse chromosome 14 (LOD = 11.74 for theta = 0.00. Four candidate genes were identified within the region, namely SPARC [Secreted protein, acidic, cysteine-rich (osteonectin], SLC36A1 (Solute Carrier 36 family A1, SLC36A2 (Solute Carrier 36 family A2, and SLC36A3 (Solute Carrier 36 family A3. SLC36A3 was not expressed in skin tissue and therefore not considered further. The other three genes were sequenced in homozygotes for CH and homozygotes for the absence of the dilution allele (ch. SLC36A1 had a nucleotide substitution in exon 2 for horses with the champagne phenotype, which resulted in a transition from a threonine amino acid to an arginine amino acid (T63R. The association of the single nucleotide polymorphism (SNP with the champagne dilution phenotype was complete, as determined by the presence of the nucleotide variant among all 85 horses with the champagne dilution phenotype and its absence among all 97 horses without the champagne phenotype. This is the first description of a phenotype associated with the SLC36A1 gene.

  9. Regulatory domain or CpG site variation in SLC12A5, encoding the chloride transporter KCC2, in human autism and schizophrenia

    Directory of Open Access Journals (Sweden)

    Nancy D Merner

    2015-10-01

    Full Text Available Many encoded gene products responsible for neurodevelopmental disorders (NDs like autism spectrum disorders (ASD, schizophrenia (SCZ, intellectual disability (ID, and idiopathic generalized epilepsy (IGE converge on networks controlling synaptic function. An increase in KCC2 (SLC12A5 Cl- transporter activity drives the developmental GABA excitatory-inhibitory sequence, but the role of KCC2 in human NDs is essentially unknown. Here, we report two rare, non-synonymous (NS, functionally-impairing variants in the KCC2 C-terminal regulatory domain (CTRD in human ASD (R952H and R1049C and SCZ (R952H previously linked with IGE and familial febrile seizures, and another novel NS KCC2 variant in ASD (R1048W with highly-predicted pathogenicity. Exome data from 2517 simplex families in the ASD Simon Simplex Collection revealed significantly more KCC2 CTRD variants in ASD cases than controls, and interestingly, these were more often synonymous and predicted to disrupt or introduce a CpG site. Furthermore, full gene analysis showed ASD cases are more likely to contain rare KCC2 variants affecting CpG sites than controls. These data suggest genetically-encoded dysregulation of KCC2-dependent GABA signaling may contribute to multiple human NDs.

  10. Insulin-increased L-arginine transport requires A(2A adenosine receptors activation in human umbilical vein endothelium.

    Directory of Open Access Journals (Sweden)

    Enrique Guzmán-Gutiérrez

    Full Text Available Adenosine causes vasodilation of human placenta vasculature by increasing the transport of arginine via cationic amino acid transporters 1 (hCAT-1. This process involves the activation of A(2A adenosine receptors (A(2AAR in human umbilical vein endothelial cells (HUVECs. Insulin increases hCAT-1 activity and expression in HUVECs, and A(2AAR stimulation increases insulin sensitivity in subjects with insulin resistance. However, whether A(2AAR plays a role in insulin-mediated increase in L-arginine transport in HUVECs is unknown. To determine this, we first assayed the kinetics of saturable L-arginine transport (1 minute, 37°C in the absence or presence of nitrobenzylthioinosine (NBTI, 10 µmol/L, adenosine transport inhibitor and/or adenosine receptors agonist/antagonists. We also determined hCAT-1 protein and mRNA expression levels (Western blots and quantitative PCR, and SLC7A1 (for hCAT-1 reporter promoter activity. Insulin and NBTI increased the extracellular adenosine concentration, the maximal velocity for L-arginine transport without altering the apparent K(m for L-arginine transport, hCAT-1 protein and mRNA expression levels, and SLC7A1 transcriptional activity. An A2AAR antagonist ZM-241385 blocked these effects. ZM241385 inhibited SLC7A1 reporter transcriptional activity to the same extent in cells transfected with pGL3-hCAT-1(-1606 or pGL3-hCAT-1(-650 constructs in the presence of NBTI + insulin. However, SLC7A1 reporter activity was increased by NBTI only in cells transfected with pGL3-hCAT-1(-1606, and the ZM-241385 sensitive fraction of the NBTI response was similar in the absence or in the presence of insulin. Thus, insulin modulation of hCAT-1 expression and activity requires functional A(2AAR in HUVECs, a mechanism that may be applicable to diseases associated with fetal insulin resistance, such as gestational diabetes.

  11. Distribution and expression of SLC45A2 in the skin of sheep with different coat colors.

    Science.gov (United States)

    Wang, Haidong; Xue, Linli; Li, Yanan; Zhao, Bingling; Chen, Tianzhi; Liu, Ying; Chang, Lucheng; Wang, Juan

    2016-01-01

    To investigate whether the membrane-associated transporter protein SLC45A2 is differentially expressed in the skin of sheep with different coat colors and to determine its correlation with coat color establishment in sheep. The expression of SLC45A2 in sheep skin samples with different coat colors was qualitatively and quantitatively analyzed by PCR amplification, RT-PCR, immunohistochemical staining and Western blotting. A 193-bp SLC45A2 CDS sequence was successfully amplified from sheep skin samples with diverse coat colors. RT-PCR analysis revealed that SLC45A2 mRNA was expressed in all sheep skin samples tested, with relative expression levels of 512.74 ± 121.51 in black skin, 143.38 ± 119.31 and 1.36 ± 0.09 in black dots and white dots of piebald skin, respectively, and 1.02 ± 0.23 in white skin (p coat colors. These patterns were quantified by optical density (OD) analysis, which yielded relative expression levels of 0.23 ± 0.11 in black skin, 0.19 ± 0.09 and 0.10 ± 0.03 in black dots and white dots of piebald skin, respectively, and 0.08 ± 0.01 in white skin (p coat colors, though at significantly different levels. SLC45A2 may participate in the establishment of coat color by regulating the synthesis and trafficking of melanin.

  12. Brain dopamine-serotonin vesicular transport disease presenting as a severe infantile hypotonic parkinsonian disorder.

    Science.gov (United States)

    Jacobsen, Jessie C; Wilson, Callum; Cunningham, Vicki; Glamuzina, Emma; Prosser, Debra O; Love, Donald R; Burgess, Trent; Taylor, Juliet; Swan, Brendan; Hill, Rosamund; Robertson, Stephen P; Snell, Russell G; Lehnert, Klaus

    2016-03-01

    Two male siblings from a consanguineous union presented in early infancy with marked truncal hypotonia, a general paucity of movement, extrapyramidal signs and cognitive delay. By mid-childhood they had made little developmental progress and remained severely hypotonic and bradykinetic. They developed epilepsy and had problems with autonomic dysfunction and oculogyric crises. They had a number of orthopaedic problems secondary to their hypotonia. Cerebrospinal fluid (CSF) neurotransmitters were initially normal, apart from mildly elevated 5-hydroxyindolacetic acid, and the children did not respond favourably to a trial of levodopa-carbidopa. The youngest died from respiratory complications at 10 years of age. Repeat CSF neurotransmitters in the older sibling at eight years of age showed slightly low homovanillic acid and 5-hydroxyindoleacetic acid levels. Whole-exome sequencing revealed a novel mutation homozygous in both children in the monoamine transporter gene SLC18A2 (p.Pro237His), resulting in brain dopamine-serotonin vesicular transport disease. This is the second family to be described with a mutation in this gene. Treatment with the dopamine agonist pramipexole in the surviving child resulted in mild improvements in alertness, communication, and eye movements. This case supports the identification of the causal mutation in the original case, expands the clinical phenotype of brain dopamine-serotonin vesicular transport disease and confirms that pramipexole treatment may lead to symptomatic improvement in affected individuals.

  13. Genetic polymorphism of serotonin transporter 5-HTTLPR ...

    Indian Academy of Sciences (India)

    society (Centers for Disease Control and Prevention 2008). More than 98% of ... smoking addiction (Li 2006). It is well ... neurotransmitter transporter (SLC6) family (Saier 1999). ..... gested that the effects of genotype and treatment may vary.

  14. The cataract and glucosuria associated monocarboxylate transporter MCT12 is a new creatine transporter

    Science.gov (United States)

    Abplanalp, Jeannette; Laczko, Endre; Philp, Nancy J.; Neidhardt, John; Zuercher, Jurian; Braun, Philipp; Schorderet, Daniel F.; Munier, Francis L.; Verrey, François; Berger, Wolfgang; Camargo, Simone M.R.; Kloeckener-Gruissem, Barbara

    2013-01-01

    Creatine transport has been assigned to creatine transporter 1 (CRT1), encoded by mental retardation associated SLC6A8. Here, we identified a second creatine transporter (CRT2) known as monocarboxylate transporter 12 (MCT12), encoded by the cataract and glucosuria associated gene SLC16A12. A non-synonymous alteration in MCT12 (p.G407S) found in a patient with age-related cataract (ARC) leads to a significant reduction of creatine transport. Furthermore, Slc16a12 knockout (KO) rats have elevated creatine levels in urine. Transport activity and expression characteristics of the two creatine transporters are distinct. CRT2 (MCT12)-mediated uptake of creatine was not sensitive to sodium and chloride ions or creatine biosynthesis precursors, breakdown product creatinine or creatine phosphate. Increasing pH correlated with increased creatine uptake. Michaelis–Menten kinetics yielded a Vmax of 838.8 pmol/h/oocyte and a Km of 567.4 µm. Relative expression in various human tissues supports the distinct mutation-associated phenotypes of the two transporters. SLC6A8 was predominantly found in brain, heart and muscle, while SLC16A12 was more abundant in kidney and retina. In the lens, the two transcripts were found at comparable levels. We discuss the distinct, but possibly synergistic functions of the two creatine transporters. Our findings infer potential preventive power of creatine supplementation against the most prominent age-related vision impaired condition. PMID:23578822

  15. Homozygous SLC6A17 mutations cause autosomal-recessive intellectual disability with progressive tremor, speech impairment, and behavioral problems.

    Science.gov (United States)

    Iqbal, Zafar; Willemsen, Marjolein H; Papon, Marie-Amélie; Musante, Luciana; Benevento, Marco; Hu, Hao; Venselaar, Hanka; Wissink-Lindhout, Willemijn M; Vulto-van Silfhout, Anneke T; Vissers, Lisenka E L M; de Brouwer, Arjan P M; Marouillat, Sylviane; Wienker, Thomas F; Ropers, Hans Hilger; Kahrizi, Kimia; Nadif Kasri, Nael; Najmabadi, Hossein; Laumonnier, Frédéric; Kleefstra, Tjitske; van Bokhoven, Hans

    2015-03-05

    We report on Dutch and Iranian families with affected individuals who present with moderate to severe intellectual disability and additional phenotypes including progressive tremor, speech impairment, and behavioral problems in certain individuals. A combination of exome sequencing and homozygosity mapping revealed homozygous mutations c.484G>A (p.Gly162Arg) and c.1898C>G (p.Pro633Arg) in SLC6A17. SLC6A17 is predominantly expressed in the brain, encodes a synaptic vesicular transporter of neutral amino acids and glutamate, and plays an important role in the regulation of glutamatergic synapses. Prediction programs and 3D modeling suggest that the identified mutations are deleterious to protein function. To directly test the functional consequences, we investigated the neuronal subcellular localization of overexpressed wild-type and mutant variants in mouse primary hippocampal neuronal cells. Wild-type protein was present in soma, axons, dendrites, and dendritic spines. p.Pro633Arg altered SLC6A17 was found in soma and proximal dendrites but did not reach spines. p.Gly162Arg altered SLC6A17 showed a normal subcellular distribution but was associated with an abnormal neuronal morphology mainly characterized by the loss of dendritic spines. In summary, our genetic findings implicate homozygous SLC6A17 mutations in autosomal-recessive intellectual disability, and their pathogenic role is strengthened by genetic evidence and in silico and in vitro functional analyses. Copyright © 2015 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  16. Bicarbonate Transport During Enamel Maturation.

    Science.gov (United States)

    Yin, Kaifeng; Paine, Michael L

    2017-11-01

    Amelogenesis (tooth enamel formation) is a biomineralization process consisting primarily of two stages (secretory stage and maturation stage) with unique features. During the secretory stage, the inner epithelium of the enamel organ (i.e., the ameloblast cells) synthesizes and secretes enamel matrix proteins (EMPs) into the enamel space. The protein-rich enamel matrix forms a highly organized architecture in a pH-neutral microenvironment. As amelogenesis transitions to maturation stage, EMPs are degraded and internalized by ameloblasts through endosomal-lysosomal pathways. Enamel crystallite formation is initiated early in the secretory stage, however, during maturation stage the more rapid deposition of calcium and phosphate into the enamel space results in a rapid expansion of crystallite length and mineral volume. During maturation-stage amelogenesis, the pH value of enamel varies considerably from slightly above neutral to acidic. Extracellular acid-base balance during enamel maturation is tightly controlled by ameloblast-mediated regulatory networks, which include significant synthesis and movement of bicarbonate ions from both the enamel papillary layer cells and ameloblasts. In this review we summarize the carbonic anhydrases and the carbonate transporters/exchangers involved in pH regulation in maturation-stage amelogenesis. Proteins that have been shown to be instrumental in this process include CA2, CA6, CFTR, AE2, NBCe1, SLC26A1/SAT1, SLC26A3/DRA, SLC26A4/PDS, SLC26A6/PAT1, and SLC26A7/SUT2. In addition, we discuss the association of miRNA regulation with bicarbonate transport in tooth enamel formation.

  17. Dicty_cDB: SLC832 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC832 (Link to dictyBase) - - - Contig-U13922-1 SLC832Z (Link... to Original site) - - SLC832Z 638 - - - - Show SLC832 Library SL (Link to library) Clone ID SLC832 (Link to dic..._1( EU565733 |pid:none) Uncultured soil bacterium clone gl... 35 2.4 CP000010_276....1 AP009385_2728( AP009385 |pid:none) Burkholderia multivorans ATCC 1... 33 5.3 A... 20.0 %: nuclear 16.0 %: vesicles of secretory system 12.0 %: mitochondrial 8.0 %: Golgi 8.0 %: endoplasmic reticul

  18. SGLT2 inhibitor lowers serum uric acid through alteration of uric acid transport activity in renal tubule by increased glycosuria

    Science.gov (United States)

    Chino, Yukihiro; Samukawa, Yoshishige; Sakai, Soichi; Nakai, Yasuhiro; Yamaguchi, Jun-ichi; Nakanishi, Takeo; Tamai, Ikumi

    2014-01-01

    Sodium glucose cotransporter 2 (SGLT2) inhibitors have been reported to lower the serum uric acid (SUA) level. To elucidate the mechanism responsible for this reduction, SUA and the urinary excretion rate of uric acid (UEUA) were analysed after the oral administration of luseogliflozin, a SGLT2 inhibitor, to healthy subjects. After dosing, SUA decreased, and a negative correlation was observed between the SUA level and the UEUA, suggesting that SUA decreased as a result of the increase in the UEUA. The increase in UEUA was correlated with an increase in urinary d-glucose excretion, but not with the plasma luseogliflozin concentration. Additionally, in vitro transport experiments showed that luseogliflozin had no direct effect on the transporters involved in renal UA reabsorption. To explain that the increase in UEUA is likely due to glycosuria, the study focused on the facilitative glucose transporter 9 isoform 2 (GLUT9ΔN, SLC2A9b), which is expressed at the apical membrane of the kidney tubular cells and transports both UA and d-glucose. It was observed that the efflux of [14C]UA in Xenopus oocytes expressing the GLUT9 isoform 2 was trans-stimulated by 10 mm d-glucose, a high concentration of glucose that existed under SGLT2 inhibition. On the other hand, the uptake of [14C]UA by oocytes was cis-inhibited by 100 mm d-glucose, a concentration assumed to exist in collecting ducts. In conclusion, it was demonstrated that the UEUA could potentially be increased by luseogliflozin-induced glycosuria, with alterations of UA transport activity because of urinary glucose. PMID:25044127

  19. Serotonin Transporter Gene ("SLC6A4") Methylation Associates with Neonatal Intensive Care Unit Stay and 3-month-old Temperament in Preterm Infants

    Science.gov (United States)

    Montirosso, Rosario; Provenzi, Livio; Fumagalli, Monica; Sirgiovanni, Ida; Giorda, Roberto; Pozzoli, Uberto; Beri, Silvana; Menozzi, Giorgia; Tronick, Ed; Morandi, Francesco; Mosca, Fabio; Borgatti, Renato

    2016-01-01

    Preterm birth and Neonatal Intensive Care Unit (NICU) stay are early adverse stressful experiences, which may result in an altered temperamental profile. The serotonin transporter gene ("SLC6A4"), which has been linked to infant temperament, is susceptible to epigenetic regulation associated with early stressful experience. This study…

  20. Positive selection in the SLC11A1 gene in the family Equidae.

    Science.gov (United States)

    Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan; Orlando, Ludovic; Horin, Petr

    2016-05-01

    Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence identity across the family. Single nucleotide polymorphisms (SNPs) were found in the coding and noncoding regions of the gene. Seven codon sites were identified to be under strong purifying selection. Codons located in three regions, including the glycosylated extracellular loop, were shown to be under diversifying selection. A 3-bp indel resulting in a deletion of the amino acid 321 in the predicted protein was observed in all horses, while it has been maintained in all other equid species. This codon comprised in an N-glycosylation site was found to be under positive selection. Interspecific variation in the presence of predicted N-glycosylation sites was observed.

  1. Disrupting Hypoxia-Induced Bicarbonate Transport Acidifies Tumor Cells and Suppresses Tumor Growth.

    Science.gov (United States)

    McIntyre, Alan; Hulikova, Alzbeta; Ledaki, Ioanna; Snell, Cameron; Singleton, Dean; Steers, Graham; Seden, Peter; Jones, Dylan; Bridges, Esther; Wigfield, Simon; Li, Ji-Liang; Russell, Angela; Swietach, Pawel; Harris, Adrian L

    2016-07-01

    Tumor hypoxia is associated clinically with therapeutic resistance and poor patient outcomes. One feature of tumor hypoxia is activated expression of carbonic anhydrase IX (CA9), a regulator of pH and tumor growth. In this study, we investigated the hypothesis that impeding the reuptake of bicarbonate produced extracellularly by CA9 could exacerbate the intracellular acidity produced by hypoxic conditions, perhaps compromising cell growth and viability as a result. In 8 of 10 cancer cell lines, we found that hypoxia induced the expression of at least one bicarbonate transporter. The most robust and frequent inductions were of the sodium-driven bicarbonate transporters SLC4A4 and SLC4A9, which rely upon both HIF1α and HIF2α activity for their expression. In cancer cell spheroids, SLC4A4 or SLC4A9 disruption by either genetic or pharmaceutical approaches acidified intracellular pH and reduced cell growth. Furthermore, treatment of spheroids with S0859, a small-molecule inhibitor of sodium-driven bicarbonate transporters, increased apoptosis in the cell lines tested. Finally, RNAi-mediated attenuation of SLC4A9 increased apoptosis in MDA-MB-231 breast cancer spheroids and dramatically reduced growth of MDA-MB-231 breast tumors or U87 gliomas in murine xenografts. Our findings suggest that disrupting pH homeostasis by blocking bicarbonate import might broadly relieve the common resistance of hypoxic tumors to anticancer therapy. Cancer Res; 76(13); 3744-55. ©2016 AACR. ©2016 American Association for Cancer Research.

  2. Interaction of GABA-mimetics with the taurine transporter (TauT, Slc6a6) in hyperosmotic treated caco-2, LLC-PK1 and rat renal SKPT cells

    DEFF Research Database (Denmark)

    Rasmussen, Rune Nørgaard; Lagunas, Candela; Plum, Jakob Munk

    2016-01-01

    The aim of the present study was to investigate if basic GABA-mimetics interact with the taurine transporter (TauT, Slc6a6), and to find a suitable cell based model that is robust towards extracellular changes in osmolality during uptake studies. Taurine uptake was measured in human Caco-2 cells....... Uptake of the GABA-mimetics gaboxadol and vigabatrin was investigated in SKPT cells, and quantified by liquid scintillation or HPLC-MS/MS analysis, respectively. The uptake rate of [(3)H]-taurine was Na(+) and Cl(-) and concentration dependent with taurine with an apparent Vmax of 6.3±1.6pmolcm(-2)min(-1......) and a Km of 24.9±15.0μM. β-alanine, nipecotic acid, gaboxadol, GABA, vigabatrin, δ-ALA and guvacine inhibited the taurine uptake rate in a concentration dependent manner. The order of affinity for TauT was β-alanine>GABA>nipecotic acid>guvacine>δ-ALA>vigabatrin>gaboxadol with IC50-values of 0.04, 1.07, 2...

  3. Polarized source performance in 1992 for SLC--SLD

    International Nuclear Information System (INIS)

    Schultz, D.; Alley, R.; Clendenin, J.; Frisch, J.; Garden, C.; Hoyt, E.; Klaisner, L.; Kulikov, A.; Prescott, C.; Saez, P.; Tang, H.; Turner, J.; Wicks, M.; Woods, M.; Yeremian, D.; Zolotorev, M.

    1993-02-01

    In its initial operation, the SLC Polarized Electron Source successfully met the SLC goals for 1992 for intensity and efficiency. However, the stability of the beam at the source was marginal, and the polarization was only ∼28%. The SLC goal to provide > 10,000 Z events for the SLD from polarized electrons was met

  4. Lack of SLC2A1 (glucose transporter 1) mutations in 30 Italian patients with alternating hemiplegia of childhood.

    Science.gov (United States)

    De Grandis, Elisa; Stagnaro, Michela; Biancheri, Roberta; Giannotta, Melania; Gobbi, Giuseppe; Traverso, Monica; Veneselli, Edvige; Zara, Federico

    2013-07-01

    Alternating hemiplegia of childhood is a rare, predominantly sporadic disorder. Diagnosis is clinical, and little is known about genetics. Glucose transporter 1 deficiency syndrome shares with alternating hemiplegia of childhood paroxysmal and nonparoxysmal symptoms. The aim of the study was to investigate glucose transporter 1 mutations in 30 Italian patients. Genetic material was analyzed by DNA amplification and glucose transporter 1 region sequencing. Mutational analysis findings of the SLC2A1 gene were negative in all patients. The pattern of movement disorders was reviewed. Interictal dystonia and multiple paroxysmal events were typical of alternating hemiplegia of childhood. In conclusion, alternating hemiplegia of childhood is a heterogeneous clinical condition, and although glucose transporter 1 deficiency can represent an undiagnosed cause of this disorder, mutational analysis is not routinely recommended. Alternatively, a careful clinical analysis and the 3-O-methyl-D-glucose uptake test can allow prompt identification of a subgroup of patients with alternating hemiplegia of childhood treatable with a ketogenic diet.

  5. Detecting Electron Transport of Amino Acids by Using Conductance Measurement

    Directory of Open Access Journals (Sweden)

    Wei-Qiong Li

    2017-04-01

    Full Text Available The single molecular conductance of amino acids was measured by a scanning tunneling microscope (STM break junction. Conductance measurement of alanine gives out two conductance values at 10−1.85 G0 (1095 nS and 10−3.7 G0 (15.5 nS, while similar conductance values are also observed for aspartic acid and glutamic acid, which have one more carboxylic acid group compared with alanine. This may show that the backbone of NH2–C–COOH is the primary means of electron transport in the molecular junction of aspartic acid and glutamic acid. However, NH2–C–COOH is not the primary means of electron transport in the methionine junction, which may be caused by the strong interaction of the Au–SMe (methyl sulfide bond for the methionine junction. The current work reveals the important role of the anchoring group in the electron transport in different amino acids junctions.

  6. Prevention of the disrupted enamel phenotype in Slc4a4-null mice using explant organ culture maintained in a living host kidney capsule.

    Directory of Open Access Journals (Sweden)

    Xin Wen

    Full Text Available Slc4a4-null mice are a model of proximal renal tubular acidosis (pRTA. Slc4a4 encodes the electrogenic sodium base transporter NBCe1 that is involved in transcellular base transport and pH regulation during amelogenesis. Patients with mutations in the SLC4A4 gene and Slc4a4-null mice present with dysplastic enamel, amongst other pathologies. Loss of NBCe1 function leads to local abnormalities in enamel matrix pH regulation. Loss of NBCe1 function also results in systemic acidemic blood pH. Whether local changes in enamel pH and/or a decrease in systemic pH are the cause of the abnormal enamel phenotype is currently unknown. In the present study we addressed this question by explanting fetal wild-type and Slc4a4-null mandibles into healthy host kidney capsules to study enamel formation in the absence of systemic acidemia. Mandibular E11.5 explants from NBCe1-/- mice, maintained in host kidney capsules for 70 days, resulted in teeth with enamel and dentin with morphological and mineralization properties similar to cultured NBCe1+/+ mandibles grown under identical conditions. Ameloblasts express a number of proteins involved in dynamic changes in H+/base transport during amelogenesis. Despite the capacity of ameloblasts to dynamically modulate the local pH of the enamel matrix, at least in the NBCe1-/- mice, the systemic pH also appears to contribute to the enamel phenotype. Extrapolating these data to humans, our findings suggest that in patients with NBCe1 mutations, correction of the systemic metabolic acidosis at a sufficiently early time point may lead to amelioration of enamel abnormalities.

  7. Physiological and pharmacological characterization of transmembrane acid extruders in cultured human umbilical artery smooth muscle cells

    Directory of Open Access Journals (Sweden)

    Gunng-Shinng Chen

    2015-01-01

    Full Text Available Background: Intracellular pH (pH i is a pivotal factor for cellular functions and homeostasis. Apart from passive intracellular buffering capacity, active transmembrane transporters responsible for kinetic changes of pH i impacts. Acid extrusion transporters such as Na + /H + exchanger (NHE and Na + /HCO3− cotransporter (NBC have been found to be activated when cells are in an acidic condition in different cell types. However, such far, the pH i regulators have not been characterized in human umbilical artery smooth muscle cells (HUASMCs. Materials and Methods: We, therefore, investigated the mechanism of pH i recovery from intracellular acidosis, induced by NH 4 Cl-prepulse, using pH-sensitive fluorescence dye: 2′,7′-bis(2-carboxethyl-5(6-carboxy-fluorescein in HUASMCs. Cultured HUASMCs were derived from the segments of the human umbilical artery that were obtained from women undergoing children delivery. Results: The resting pH i is 7.23 ± 0.03 when cells in HEPES (nominally HCO 3− -free buffered solution. The resting pH i is higher as 7.27 ± 0.03 when cells in CO 2 /HCO3− -buffered solution. In HEPES-buffered solution, a pH i recovery following induced intracellular acidosis could be inhibited completely by 30 μM HOE 694 (a specific NHE inhibitor or by removing [Na +]o . In 5% CO2/HCO3− -buffered solution, 30 μM HOE 694 slowed the pH i recovery from the induced intracellular acidosis only. On the contrary, HOE 694 adding together with 0.2 mM 4,4′-diisothiocyanatostilbene-2,2′-disulphonic acid (a specific NBC inhibitor or removal of [Na +]o entirely blocked the acid extrusion. By using Western blot technique, we demonstrated that four different isoforms of NBC, that is, SLC4A8 (NBCBE, SLC4A7 (NBCn1, SLC4A5 (NBCe2 and SLC4A4 (NBCe1, co-exist in the HUASMCs. Conclusions: We demonstrate, for the 1 st time, that apart from the housekeeping NHE1, another Na + couple HCO3− -transporter, that is, NBC, functionally coexists to

  8. Dispersive effects of transverse displacements of SLC Arc magnets

    International Nuclear Information System (INIS)

    Murray, J.J.; Fieguth, T.; Kheifets, S.

    1986-01-01

    The SLC Arc magnets are subject to random displacements and field errors resulting in unpredictable transverse displacement of the central trajectory from that of the design. The chosen method of correcting this perturbed trajectory in the SLC Arcs utilizes mechanical movement of the combined function magnets which compose the Arc transport lines. Here we present the results of a recent investigation substantiating the earlier results which led to the adoption of this method

  9. Autosomal-Recessive Intellectual Disability with Cerebellar Atrophy Syndrome Caused by Mutation of the Manganese and Zinc Transporter Gene SLC39A8

    Science.gov (United States)

    Boycott, Kym M.; Beaulieu, Chandree L.; Kernohan, Kristin D.; Gebril, Ola H.; Mhanni, Aziz; Chudley, Albert E.; Redl, David; Qin, Wen; Hampson, Sarah; Küry, Sébastien; Tetreault, Martine; Puffenberger, Erik G.; Scott, James N.; Bezieau, Stéphane; Reis, André; Uebe, Steffen; Schumacher, Johannes; Hegele, Robert A.; McLeod, D. Ross; Gálvez-Peralta, Marina; Majewski, Jacek; Ramaekers, Vincent T.; Nebert, Daniel W.; Innes, A. Micheil; Parboosingh, Jillian S.; Abou Jamra, Rami

    2015-01-01

    Manganese (Mn) and zinc (Zn) are essential divalent cations used by cells as protein cofactors; various human studies and animal models have demonstrated the importance of Mn and Zn for development. Here we describe an autosomal-recessive disorder in six individuals from the Hutterite community and in an unrelated Egyptian sibpair; the disorder is characterized by intellectual disability, developmental delay, hypotonia, strabismus, cerebellar atrophy, and variable short stature. Exome sequencing in one affected Hutterite individual and the Egyptian family identified the same homozygous variant, c.112G>C (p.Gly38Arg), affecting a conserved residue of SLC39A8. The affected Hutterite and Egyptian individuals did not share an extended common haplotype, suggesting that the mutation arose independently. SLC39A8 is a member of the solute carrier gene family known to import Mn, Zn, and other divalent cations across the plasma membrane. Evaluation of these two metal ions in the affected individuals revealed variably low levels of Mn and Zn in blood and elevated levels in urine, indicating renal wasting. Our findings identify a human Mn and Zn transporter deficiency syndrome linked to SLC39A8, providing insight into the roles of Mn and Zn homeostasis in human health and development. PMID:26637978

  10. Sodium/bicarbonate cotransporter NBCn1/slc4a7 increases cytotoxicity in magnesium depletion in primary cultures of hippocampal neurons

    Science.gov (United States)

    Cooper, Deborah S.; Yang, Han Soo; He, Peijian; Kim, Eunjin; Rajbhandari, Ira; Yun, Chris C.; Choi, Inyeong

    2009-01-01

    Growing evidence suggests that pharmacological inhibition of Na/H exchange and Na/HCO3 transport provides protection against damage or injury in cardiac ischemia. In this study, we examined the contribution of the sodium/bicarbonate cotransporter NBCn1 (slc4a7) to cytotoxicity in cultured hippocampal neurons of rats. In neurons exposed to extracellular pH (pHo) ranging from 6.2 to 8.3, NBCn1 protein expression increased by fivefold at pH < 6.5 compared to the expression at pHo 7.4. At pHo 6.5, the intracellular pH of neurons was ~1 unit lower than that at pH 7.4. Immunochemistry showed a marked increase in NBCn1 immunofluorescence in plasma membranes and cytosol of the soma as well as in dendrites, at pHo 6.5. NBCn1 expression also increased by 40% in a prolonged Mg2+-free incubation at normal pHo. Knockdown of NBCn1 in neurons had negligible effect on cell viability. The effect of NBCn1 knockdown on cytotoxicity was then determined by exposing neurons to 0.5 mM glutamate for 10 min and measuring lactate dehydrogenase (LDH) release from neurons. Compared to normal incubation (pHo 7.2 for 6 h) after glutamate exposure, acidic incubation (pHo 6.3 for 6 h) reduced cytotoxicity by 75% for control neurons and 78% for NBCn1-knockdown neurons. Thus, both controls and knockdown neurons showed acidic protection from cytotoxicity. However, in Mg2+-free incubation after glutamate exposure, NBCn1 knockdown progressively attenuated cytotoxicity. This attenuation was unaffected by acidic preincubation before glutamate exposure. We conclude that NBCn1 has a dynamic upregulation in low pHo and Mg2+ depletion. NBCn1 is not required for acidic protection, but increases cytotoxicity in Mg2+-free conditions. PMID:19170751

  11. Aryl hydrocarbon receptor-dependent up-regulation of the heterodimeric amino acid transporter LAT1 (SLC7A5)/CD98hc (SLC3A2) by diesel exhaust particle extract in human bronchial epithelial cells

    Energy Technology Data Exchange (ETDEWEB)

    Le Vee, Marc; Jouan, Elodie; Lecureur, Valérie [Institut de Recherches en Santé, Environnement et Travail (IRSET), UMR INSERM U1085, Faculté de Pharmacie, 2 Avenue du Pr Léon Bernard, 35043 Rennes (France); Fardel, Olivier, E-mail: olivier.fardel@univ-rennes1.fr [Institut de Recherches en Santé, Environnement et Travail (IRSET), UMR INSERM U1085, Faculté de Pharmacie, 2 Avenue du Pr Léon Bernard, 35043 Rennes (France); Pôle Biologie, Centre Hospitalier Universitaire, 2 rue Henri Le Guilloux, 35033 Rennes (France)

    2016-01-01

    The heterodimeric L-type amino acid transporter (LAT) 1/CD98hc is overexpressed in lung cancers with a poor prognosis factor. Factors that contribute to LAT1/CD98hc overexpression in lung cells remain however to be determined, but the implication of atmospheric pollution can be suspected. The present study was therefore designed to analyze the effects of diesel exhaust particle (DEP) extract (DEPe) on LAT1/CD98hc expression in bronchial epithelial BEAS-2B cells. Exposure to DEPe up-regulated LAT1 and CD98hc mRNA levels in a concentration-dependent manner, with DEPe EC{sub 50} values (around 0.2 μg/mL) relevant to environmental situations. DEPe concomitantly induced LAT1/CD98hc protein expression and LAT1-mediated leucine accumulation in BEAS-2B cells. Inhibition of the aryl hydrocarbon receptor (AhR) pathway through the use of a chemical AhR antagonist or the siRNA-mediated silencing of AhR expression was next found to prevent DEPe-mediated induction of LAT1/CD98hc, indicating that this regulation depends on AhR, known to be activated by major chemical DEP components like polycyclic aromatic hydrocarbons. DEPe exposure was finally shown to induce mRNA expression and activity of matrix metalloproteinase (MMP)-2 in BEAS-2B cells, in a CD98hc/focal adhesion kinase (FAK)/extracellular regulated kinase (ERK) manner, thus suggesting that DEPe-mediated induction of CD98hc triggers activation of the integrin/FAK/ERK signaling pathway known to be involved in MMP-2 regulation. Taken together, these data demonstrate that exposure to DEPe induces functional overexpression of the amino acid transporter LAT1/CD98hc in lung cells. Such a regulation may participate to pulmonary carcinogenic effects of DEPs, owing to the well-documented contribution of LAT1 and CD98hc to cancer development. - Highlights: • The amino acid transporter LAT1/CD98hc is up-regulated in DEPe-treated lung cells. • The aryl hydrocarbon receptor is involved in DEPe-triggered induction of LAT1/CD98hc.

  12. Variation in the SLC23A1 gene does not influence cardiometabolic outcomes to the extent expected given its association with L-ascorbic acid.

    Science.gov (United States)

    Wade, Kaitlin H; Forouhi, Nita G; Cook, Derek G; Johnson, Paul; McConnachie, Alex; Morris, Richard W; Rodriguez, Santiago; Ye, Zheng; Ebrahim, Shah; Padmanabhan, Sandosh; Watt, Graham; Bruckdorfer, K Richard; Wareham, Nick J; Whincup, Peter H; Chanock, Stephen; Sattar, Naveed; Lawlor, Debbie A; Davey Smith, George; Timpson, Nicholas J

    2015-01-01

    Observational studies showed that circulating L-ascorbic acid (vitamin C) is inversely associated with cardiometabolic traits. However, these studies were susceptible to confounding and reverse causation. We assessed the relation between L-ascorbic acid and 10 cardiometabolic traits by using a single nucleotide polymorphism in the solute carrier family 23 member 1 (SLC23A1) gene (rs33972313) associated with circulating L-ascorbic acid concentrations. The observed association between rs33972313 and cardiometabolic outcomes was compared with that expected given the rs33972313-L-ascorbic acid and L-ascorbic acid-outcome associations. A meta-analysis was performed in the following 5 independent studies: the British Women's Heart and Health Study (n = 1833), the MIDSPAN study (n = 1138), the Ten Towns study (n = 1324), the British Regional Heart Study (n = 2521), and the European Prospective Investigation into Cancer (n = 3737). With the use of a meta-analysis of observational estimates, inverse associations were shown between L-ascorbic acid and systolic blood pressure, triglycerides, and the waist-hip ratio [the strongest of which was the waist-hip ratio (-0.13-SD change; 95% CI: -0.20-, -0.07-SD change; P = 0.0001) per SD increase in L-ascorbic acid], and a positive association was shown with high-density lipoprotein (HDL) cholesterol. The variation at rs33972313 was associated with a 0.18-SD (95% CI: 0.10-, 0.25-SD; P = 3.34 × 10⁻⁶) increase in L-ascorbic acid per effect allele. There was no evidence of a relation between the variation at rs33972313 and any cardiometabolic outcome. Although observed estimates were not statistically different from expected associations between rs33972313 and cardiometabolic outcomes, estimates for low-density lipoprotein cholesterol, HDL cholesterol, triglycerides, glucose, and body mass index were in the opposite direction to those expected. The nature of the genetic association exploited in this study led to limited

  13. Effects of a series of acidic drugs on L-lactic acid transport by the monocarboxylate transporters MCT1 and MCT4.

    Science.gov (United States)

    Leung, Yat Hei; Belanger, Francois; Lu, Jennifer; Turgeon, Jacques; Michaud, Veronique

    2018-03-07

    Drug-induced myopathy is a serious side effect that often requires removal of a medication from a drug regimen. For most drugs, the underlying mechanism of drug-induced myopathy remains unclear. Monocarboxylate transporters (MCTs) mediate L-lactic acid transport, and inhibition of MCTs may potentially lead to perturbation of L-lactic acid accumulation and muscular disorders. Therefore, we hypothesized that L-lactic acid transport may be involved in the development of drug-induced myopathy. The aim of this study was to assess the inhibitory potential of 24 acidic drugs on L-lactic acid transport using breast cancer cell lines Hs578T and MDA-MB-231, which selectively express MCT1 and MCT4, respectively. The influx transport of L-lactic acid was minimally inhibited by all drugs tested. The efflux transport was next examined: loratadine (IC50: 10 and 61 µM) and atorvastatin (IC50: 78 and 41 µM) demonstrated the greatest potency for inhibition of L-lactic acid efflux by MCT1 and MCT4, respectively. Acidic drugs including fluvastatin, cerivastatin, simvastatin acid, lovastatin acid, irbesartan and losartan exhibited weak inhibitory potency on L-lactic acid efflux. Our results suggest that some acidic drugs, such as loratadine and atorvastatin, can inhibit the efflux transport of L-lactic acid. This inhibition may cause an accumulation of intracellular L-lactic acid leading to acidification and muscular disorders. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  14. The Role of Na:K:2Cl Cotransporter 1 (NKCC1/SLC12A2) in Dental Epithelium during Enamel Formation in Mice

    Science.gov (United States)

    Jalali, Rozita; Lodder, Johannes C.; Zandieh-Doulabi, Behrouz; Micha, Dimitra; Melvin, James E.; Catalan, Marcelo A.; Mansvelder, Huibert D.; DenBesten, Pamela; Bronckers, Antonius

    2017-01-01

    Na+:K+:2Cl− cotransporters (NKCCs) belong to the SLC12A family of cation-coupled Cl− transporters. We investigated whether enamel-producing mouse ameloblasts express NKCCs. Transcripts for Nkcc1 were identified in the mouse dental epithelium by RT-qPCR and NKCC1 protein was immunolocalized in outer enamel epithelium and in the papillary layer but not the ameloblast layer. In incisors of Nkcc1-null mice late maturation ameloblasts were disorganized, shorter and the mineral density of the enamel was reduced by 10% compared to wild-type controls. Protein levels of gap junction protein connexin 43, Na+-dependent bicarbonate cotransporter e1 (NBCe1), and the Cl−-dependent bicarbonate exchangers SLC26A3 and SLC26A6 were upregulated in Nkcc1-null enamel organs while the level of NCKX4/SLC24A4, the major K+, Na+ dependent Ca2+ transporter in maturation ameloblasts, was slightly downregulated. Whole-cell voltage clamp studies on rat ameloblast-like HAT-7 cells indicated that bumetanide increased ion-channel activity conducting outward currents. Bumetanide also reduced cell volume of HAT-7 cells. We concluded that non-ameloblast dental epithelium expresses NKCC1 to regulate cell volume in enamel organ and provide ameloblasts with Na+, K+ and Cl− ions required for the transport of mineral- and bicarbonate-ions into enamel. Absence of functional Nkcc1 likely is compensated by other types of ion channels and ion transporters. The increased amount of Cx43 in enamel organ cells in Nkcc1-null mice suggests that these cells display a higher number of gap junctions to increase intercellular communication. PMID:29209227

  15. Associations of serum uric acid and SLC2A9 variant with depressive and anxiety disorders: a population-based study.

    Directory of Open Access Journals (Sweden)

    Tanica Lyngdoh

    Full Text Available Limited information exists regarding the association between serum uric acid (SUA and psychiatric disorders. We explored the relationship between SUA and subtypes of major depressive disorder (MDD and specific anxiety disorders. Additionally, we examined the association of SLC2A9 rs6855911 variant with anxiety disorders.We conducted a cross-sectional analysis on 3,716 individuals aged 35-66 years previously selected for the population-based CoLaus survey and who agreed to undergo further psychiatric evaluation. SUA was measured using uricase-PAP method. The French translation of the semi-structured Diagnostic Interview for Genetic Studies was used to establish lifetime and current diagnoses of depression and anxiety disorders according to the DSM-IV criteria.Men reported significantly higher levels of SUA compared to women (357±74 µmol/L vs. 263±64 µmol/L. The prevalence of lifetime and current MDD was 44% and 18% respectively while the corresponding estimates for any anxiety disorders were 18% and 10% respectively. A quadratic hockey-stick shaped curve explained the relationship between SUA and social phobia better than a linear trend. However, with regards to the other specific anxiety disorders and other subtypes of MDD, there was no consistent pattern of association. Further analyses using SLC2A9 rs6855911 variant, known to be strongly associated with SUA, supported the quadratic relationship observed between SUA phenotype and social phobia.A quadratic relationship between SUA and social phobia was observed consistent with a protective effect of moderately elevated SUA on social phobia, which disappears at higher concentrations. Further studies are needed to confirm our observations.

  16. Hexose transporter mRNAs for GLUT4, GLUT5, and GLUT12 predominate in human muscle.

    Science.gov (United States)

    Stuart, Charles A; Yin, Deling; Howell, Mary E A; Dykes, Rhesa J; Laffan, John J; Ferrando, Arny A

    2006-11-01

    In the past few years, 8 additional members of the facilitative hexose transporter family have been identified, giving a total of 14 members of the SLC2A family of membrane-bound hexose transporters. To determine which of the new hexose transporters were expressed in muscle, mRNA concentrations of 11 glucose transporters (GLUTs) were quantified and compared. RNA from muscle from 10 normal volunteers was subjected to RT-PCR. Primers were designed that amplified 78- to 241-base fragments, and cDNA standards were cloned for GLUT1, GLUT2, GLUT3, GLUT4, GLUT5, GLUT6, GLUT8, GLUT9, GLUT10, GLUT11, GLUT12, and GAPDH. Seven of these eleven hexose transporters were detectable in normal human muscle. The rank order was GLUT4, GLUT5, GLUT12, GLUT8, GLUT11, GLUT3, and GLUT1, with corresponding concentrations of 404 +/- 49, 131 +/- 14, 33 +/- 4, 5.5 +/- 0.5, 4.1 +/- 0.4, 1.2 +/- .0.1, and 0.9 +/- 0.2 copies/ng RNA (means +/- SE), respectively, for the 10 subjects. Concentrations of mRNA for GLUT4, GLUT5, and GLUT12 were much higher than those for the remainder of the GLUTs and together accounted for 98% of the total GLUT isoform mRNA. Immunoblots of muscle homogenates verified that the respective proteins for GLUT4, GLUT5, and GLUT12 were present in normal human muscle. Immunofluorescent studies demonstrated that GLUT4 and GLUT12 were predominantly expressed in type I oxidative fibers; however, GLUT5 was expressed predominantly in type II (white) fibers.

  17. Treatment of intractable epilepsy in a female with SLC6A8 deficiency

    NARCIS (Netherlands)

    Mercimek-Mahmutoglu, S.; Connolly, M.B.; Poskitt, K.J.; Horvath, G.A.; Lowry, N.; Salomons, G.S.; Casey, B.; Sinclair, G.; Davis, C.; Jakobs, C.; Stockler-Ipsiroglu, S.

    2010-01-01

    A female heterozygous for a novel, disease causing, missense mutation in the X-linked cerebral creatine transporter (SLC6A8) gene (c.1067G > T, p.Gly356Val) presented with intractable epilepsy, mild intellectual disability and moderately reduced cerebral creatine levels. Treatment with creatine

  18. High frequency of the IVS2-2A>G DNA sequence variation in SLC26A5, encoding the cochlear motor protein prestin, precludes its involvement in hereditary hearing loss

    Directory of Open Access Journals (Sweden)

    Pereira Fred A

    2005-08-01

    Full Text Available Abstract Background Cochlear outer hair cells change their length in response to variations in membrane potential. This capability, called electromotility, is believed to enable the sensitivity and frequency selectivity of the mammalian cochlea. Prestin is a transmembrane protein required for electromotility. Homozygous prestin knockout mice are profoundly hearing impaired. In humans, a single nucleotide change in SLC26A5, encoding prestin, has been reported in association with hearing loss. This DNA sequence variation, IVS2-2A>G, occurs in the exon 3 splice acceptor site and is expected to abolish splicing of exon 3. Methods To further explore the relationship between hearing loss and the IVS2-2A>G transition, and assess allele frequency, genomic DNA from hearing impaired and control subjects was analyzed by DNA sequencing. SLC26A5 genomic DNA sequences from human, chimp, rat, mouse, zebrafish and fruit fly were aligned and compared for evolutionary conservation of the exon 3 splice acceptor site. Alternative splice acceptor sites within intron 2 of human SLC26A5 were sought using a splice site prediction program from the Berkeley Drosophila Genome Project. Results The IVS2-2A>G variant was found in a heterozygous state in 4 of 74 hearing impaired subjects of Hispanic, Caucasian or uncertain ethnicity and 4 of 150 Hispanic or Caucasian controls (p = 0.45. The IVS2-2A>G variant was not found in 106 subjects of Asian or African American descent. No homozygous subjects were identified (n = 330. Sequence alignment of SLC26A5 orthologs demonstrated that the A nucleotide at position IVS2-2 is invariant among several eukaryotic species. Sequence analysis also revealed five potential alternative splice acceptor sites in intron 2 of human SLC26A5. Conclusion These data suggest that the IVS2-2A>G variant may not occur more frequently in hearing impaired subjects than in controls. The identification of five potential alternative splice acceptor sites in

  19. Positive selection in the SLC11A1 gene in the family Equidae

    DEFF Research Database (Denmark)

    Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan

    2016-01-01

    Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes...... a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans...... and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence...

  20. Organic cation transporter 2 (SLC22A2), a low-affinity and high-capacity choline transporter, is preferentially enriched on synaptic vesicles in cholinergic neurons.

    Science.gov (United States)

    Nakata, T; Matsui, T; Kobayashi, K; Kobayashi, Y; Anzai, N

    2013-11-12

    Organic cation transporters (OCTs) are expressed mainly in the kidney and liver. OCTs transport intrinsic organic cations, including monoamine, dopamine, serotonine and choline, across the plasma membrane. Here, we demonstrate that OCT2 (SLC22A2) is expressed in cholinergic neurons, motoneurons in the anterior horn of the spinal cord, and is implicated in acetylcholine (Ach) recycling in presynaptic terminals. Application of rabbit anti-peptide antibody revealed that OCT2 was expressed in the anterior horn of the spinal cord. Double immunostaining of muscle sections with anti-OCT2 and alpha-bungarotoxin (BTX) revealed that OCT2 was localized in the neuromuscular junctions (NMJs). Immunoelectron microscopy revealed that OCT2 was localized both in synaptic vesicles (SVs) in presynaptic terminals around the motoneurons (C-terminals) and in SVs in nerve terminals in NMJs. The similarity in the distribution of OCT2 in cholinergic neurons and that of vesicular acetyl choline transporter (VAchT), and the fact that OCT2 can transport choline suggest that OCT2 could work as a low-affinity and high-capacity choline transporter at presynaptic terminals in cholinergic neurons in a firing-dependent manner. Copyright © 2013 IBRO. Published by Elsevier Ltd. All rights reserved.

  1. Transport characteristics of guanidino compounds at the blood-brain barrier and blood-cerebrospinal fluid barrier: relevance to neural disorders

    Directory of Open Access Journals (Sweden)

    Tachikawa Masanori

    2011-02-01

    Full Text Available Abstract Guanidino compounds (GCs, such as creatine, phosphocreatine, guanidinoacetic acid, creatinine, methylguanidine, guanidinosuccinic acid, γ-guanidinobutyric acid, β-guanidinopropionic acid, guanidinoethane sulfonic acid and α-guanidinoglutaric acid, are present in the mammalian brain. Although creatine and phosphocreatine play important roles in energy homeostasis in the brain, accumulation of GCs may induce epileptic discharges and convulsions. This review focuses on how physiologically important and/or neurotoxic GCs are distributed in the brain under physiological and pathological conditions. Transporters for GCs at the blood-brain barrier (BBB and the blood-cerebrospinal fluid (CSF barrier (BCSFB have emerged as substantial contributors to GCs distribution in the brain. Creatine transporter (CRT/solute carrier (SLC 6A8 expressed at the BBB regulates creatine concentration in the brain, and represents a major pathway for supply of creatine from the circulating blood to the brain. CRT may be a key factor facilitating blood-to-brain guanidinoacetate transport in patients deficient in S-adenosylmethionine:guanidinoacetate N-methyltransferase, the creatine biosynthetic enzyme, resulting in cerebral accumulation of guanidinoacetate. CRT, taurine transporter (TauT/SLC6A6 and organic cation transporter (OCT3/SLC22A3 expressed at the BCSFB are involved in guanidinoacetic acid or creatinine efflux transport from CSF. Interestingly, BBB efflux transport of GCs, including guanidinoacetate and creatinine, is negligible, though the BBB has a variety of efflux transport systems for synthetic precursors of GCs, such as amino acids and neurotransmitters. Instead, the BCSFB functions as a major cerebral clearance system for GCs. In conclusion, transport of GCs at the BBB and BCSFB appears to be the key determinant of the cerebral levels of GCs, and changes in the transport characteristics may cause the abnormal distribution of GCs in the brain seen

  2. S113R mutation in SLC33A1 leads to neurodegeneration and augmented BMP signaling in a mouse model

    Directory of Open Access Journals (Sweden)

    Pingting Liu

    2017-01-01

    Full Text Available The S113R mutation (c.339T>G (MIM #603690.0001 in SLC33A1 (MIM #603690, an ER membrane acetyl-CoA transporter, has been previously identified in individuals with hereditary spastic paraplegia type 42 (SPG42; MIM #612539. SLC33A1 has also been shown to inhibit the bone morphogenetic protein (BMP signaling pathway in zebrafish. To better understand the function of SLC33A1, we generated and characterized Slc33a1S113R knock-in mice. Homozygous Slc33a1S113R mutant mice were embryonic lethal, whereas heterozygous Slc33a1 mutant mice (Slc33a1wt/mut exhibited behavioral abnormalities and central neurodegeneration, which is consistent with hereditary spastic paraplegia (HSP phenotypes. Importantly, we found an upregulation of BMP signaling in the nervous system and mouse embryonic fibroblasts of Slc33a1wt/mut mice. Using a sciatic nerve crush injury model in vivo and dorsal root ganglion (DRG culture in vitro we showed that injury-induced axonal regeneration in Slc33a1wt/mut mice was accelerated and mediated by upregulated BMP signaling. Exogenous addition of BMP signaling antagonist, noggin, could efficiently alleviate the accelerated injury-induced axonal regrowth. These results indicate that SLC33A1 can negatively regulate BMP signaling in mice, further supporting the notion that upregulation of BMP signaling is a common mechanism of a subset of hereditary spastic paraplegias.

  3. Punctate white matter lesions in full-term infants with neonatal seizures associated with SLC13A5 mutations

    NARCIS (Netherlands)

    Weeke, Lauren C; Brilstra, Eva; Braun, Kees P; Zonneveld-Huijssoon, Evelien; Salomons, Gajja S; Koeleman, BPC; van Gassen, Koen L; van Straaten, Henrica L; Craiu, Dana; de Vries, Linda S

    INTRODUCTION: Early-onset epileptic encephalopathy caused by biallelic SLC13A5 mutations is characterized by seizure onset in the first days of life, refractory epilepsy and developmental delay. Little detailed information about the brain MRI features is available in these patients. METHODS:

  4. Urine screening for patients with developmental disabilities detected a patient with creatine transporter deficiency due to a novel missense mutation in SLC6A8.

    Science.gov (United States)

    Kato, Hidekazu; Miyake, Fuyu; Shimbo, Hiroko; Ohya, Makoto; Sugawara, Hidenori; Aida, Noriko; Anzai, Rie; Takagi, Mariko; Okuda, Mitsuko; Takano, Kyoko; Wada, Takahito; Iai, Mizue; Yamashita, Sumimasa; Osaka, Hitoshi

    2014-08-01

    Creatine transporter deficiency (CTD) is an example of X-linked intellectual disability syndromes, caused by mutations in SLC6A8 on Xq28. Although this is the second most frequent genetic cause of intellectual disabilities in Europe or America after Fragile X syndrome, information on the morbidity of this disease is limited in Japan. Using the HPLC screening method we have established recently, we examined samples of urine of 105 patients (73 males and 32 females) with developmental disabilities at our medical center. And we have found a family with three ID boys with a novel missense mutation in SLC6A8. This is the second report of a Japanese family case of CTD. A systematic diagnostic system of this syndrome should be established in Japan to enable us to estimate its frequency and treatment. Copyright © 2013 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

  5. Sodium dependent multivitamin transporter (SMVT): a potential target for drug delivery.

    Science.gov (United States)

    Vadlapudi, Aswani Dutt; Vadlapatla, Ramya Krishna; Mitra, Ashim K

    2012-06-01

    Sodium dependent multivitamin transporter (SMVT; product of the SLC5A6 gene) is an important transmembrane protein responsible for translocation of vitamins and other essential cofactors such as biotin, pantothenic acid and lipoic acid. Hydropathy plot (Kyte-Dolittle algorithm) revealed that human SMVT protein consists of 635 amino acids and 12 transmembrane domains with both amino and carboxyl termini oriented towards the cytoplasm. SMVT is expressed in various tissues such as placenta, intestine, brain, liver, lung, kidney, cornea, retina and heart. This transporter displays broad substrate specificity and excellent capacity for utilization in drug delivery. Drug absorption is often limited by the presence of physiological (epithelial tight junctions), biochemical (efflux transporters and enzymatic degradation) and chemical (size, lipophilicity, molecular weight, charge etc.) barriers. These barriers may cause many potential therapeutics to be dropped from the preliminary screening portfolio and subsequent entry into the market. Transporter targeted delivery has become a powerful approach to deliver drugs to target tissues because of the ability of the transporter to translocate the drug to intracellular organelles at a higher rate. This review highlights studies employing SMVT transporter as a target for drug delivery to improve bioavailability and investigate the feasibility of developing SMVT targeted drug delivery systems.

  6. Insights into the Structure, Function, and Ligand Discovery of the Large Neutral Amino Acid Transporter 1, LAT1

    Directory of Open Access Journals (Sweden)

    Natesh Singh

    2018-04-01

    Full Text Available The large neutral amino acid transporter 1 (LAT1, or SLC7A5 is a sodium- and pH-independent transporter, which supplies essential amino acids (e.g., leucine, phenylalanine to cells. It plays an important role at the Blood–Brain Barrier (BBB where it facilitates the transport of thyroid hormones, pharmaceuticals (e.g., l-DOPA, gabapentin, and metabolites into the brain. Moreover, its expression is highly upregulated in various types of human cancer that are characterized by an intense demand for amino acids for growth and proliferation. Therefore, LAT1 is believed to be an important drug target for cancer treatment. With the crystallization of the arginine/agmatine antiporter (AdiC from Escherichia Coli, numerous homology models of LAT1 have been built to elucidate the substrate binding site, ligand–transporter interaction, and structure–function relationship. The use of these models in combination with molecular docking and experimental testing has identified novel chemotypes of ligands of LAT1. Here, we highlight the structure, function, transport mechanism, and homology modeling of LAT1. Additionally, results from structure–function studies performed on LAT1 are addressed, which have enhanced our knowledge of the mechanism of substrate binding and translocation. This is followed by a discussion on ligand- and structure-based approaches, with an emphasis on elucidating the molecular basis of LAT1 inhibition. Finally, we provide an exhaustive summary of different LAT1 inhibitors that have been identified so far, including the recently discovered irreversible covalent inhibitors.

  7. Punctate white matter lesions in full-term infants with neonatal seizures associated with SLC13A5 mutations

    NARCIS (Netherlands)

    Weeke, Lauren C.; Brilstra, Eva; Braun, Kees P.; Zonneveld-Huijssoon, Evelien; Salomons, Gajja S.; Koeleman, Bobby P; van Gassen, Koen L. I.; van Straaten, Henrica L.; Craiu, Dana; de Vries, Linda S.

    Introduction: Early-onset epileptic encephalopathy caused by biallelic SLC13A5 mutations is characterized by seizure onset in the first days of life, refractory epilepsy and develop mental delay. Little detailed information about the brain MRI features is available in these patients. Methods:

  8. A mild form of SLC29A3 disorder: a frameshift deletion leads to the paradoxical translation of an otherwise noncoding mRNA splice variant.

    Directory of Open Access Journals (Sweden)

    Alexandre Bolze

    Full Text Available We investigated two siblings with granulomatous histiocytosis prominent in the nasal area, mimicking rhinoscleroma and Rosai-Dorfman syndrome. Genome-wide linkage analysis and whole-exome sequencing identified a homozygous frameshift deletion in SLC29A3, which encodes human equilibrative nucleoside transporter-3 (hENT3. Germline mutations in SLC29A3 have been reported in rare patients with a wide range of overlapping clinical features and inherited disorders including H syndrome, pigmented hypertrichosis with insulin-dependent diabetes, and Faisalabad histiocytosis. With the exception of insulin-dependent diabetes and mild finger and toe contractures in one sibling, the two patients with nasal granulomatous histiocytosis studied here displayed none of the many SLC29A3-associated phenotypes. This mild clinical phenotype probably results from a remarkable genetic mechanism. The SLC29A3 frameshift deletion prevents the expression of the normally coding transcripts. It instead leads to the translation, expression, and function of an otherwise noncoding, out-of-frame mRNA splice variant lacking exon 3 that is eliminated by nonsense-mediated mRNA decay (NMD in healthy individuals. The mutated isoform differs from the wild-type hENT3 by the modification of 20 residues in exon 2 and the removal of another 28 amino acids in exon 3, which include the second transmembrane domain. As a result, this new isoform displays some functional activity. This mechanism probably accounts for the narrow and mild clinical phenotype of the patients. This study highlights the 'rescue' role played by a normally noncoding mRNA splice variant of SLC29A3, uncovering a new mechanism by which frameshift mutations can be hypomorphic.

  9. Recessive mutations in SLC38A8 cause foveal hypoplasia and optic nerve misrouting without albinism.

    Science.gov (United States)

    Poulter, James A; Al-Araimi, Musallam; Conte, Ivan; van Genderen, Maria M; Sheridan, Eamonn; Carr, Ian M; Parry, David A; Shires, Mike; Carrella, Sabrina; Bradbury, John; Khan, Kamron; Lakeman, Phillis; Sergouniotis, Panagiotis I; Webster, Andrew R; Moore, Anthony T; Pal, Bishwanath; Mohamed, Moin D; Venkataramana, Anandula; Ramprasad, Vedam; Shetty, Rohit; Saktivel, Murugan; Kumaramanickavel, Govindasamy; Tan, Alex; Mackey, David A; Hewitt, Alex W; Banfi, Sandro; Ali, Manir; Inglehearn, Chris F; Toomes, Carmel

    2013-12-05

    Foveal hypoplasia and optic nerve misrouting are developmental defects of the visual pathway and only co-occur in connection with albinism; to date, they have only been associated with defects in the melanin-biosynthesis pathway. Here, we report that these defects can occur independently of albinism in people with recessive mutations in the putative glutamine transporter gene SLC38A8. Nine different mutations were identified in seven Asian and European families. Using morpholino-mediated ablation of Slc38a8 in medaka fish, we confirmed that pigmentation is unaffected by loss of SLC38A8. Furthermore, by undertaking an association study with SNPs at the SLC38A8 locus, we showed that common variants within this gene modestly affect foveal thickness in the general population. This study reveals a melanin-independent component underpinning the development of the visual pathway that requires a functional role for SLC38A8. Copyright © 2013 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  10. Genetic variations in the MCT1 (SLC16A1) gene in the Chinese population of Singapore.

    Science.gov (United States)

    Lean, Choo Bee; Lee, Edmund Jon Deoon

    2009-01-01

    MCT1(SLC16A1) is the first member of the monocarboxylate transporter (MCT) and its family is involved in the transportation of metabolically important monocarboxylates such as lactate, pyruvate, acetate and ketone bodies. This study identifies genetic variations in SLC16A1 in the ethnic Chinese group of the Singaporean population (n=95). The promoter, coding region and exon-intron junctions of the SLC16A1 gene encoding the MCT1 transporter were screened for genetic variation in the study population by DNA sequencing. Seven genetic variations of SLC16A1, including 4 novel ones, were found: 2 in the promoter region, 2 in the coding exons (both nonsynonymous variations), 2 in the 3' untranslated region (3'UTR) and 1 in the intron. Of the two mutations detected in the promoter region, the -363-855T>C is a novel mutation. The 1282G>A (Val(428)Ile) is a novel SNP and was found as heterozygotic in 4 subjects. The 1470T>A (Asp(490)Glu) was found to be a common polymorphism in this study. Lastly, IVS3-17A>C in intron 3 and 2258 (755)A>G in 3'UTR are novel mutations found to be common polymorphisms in the local Chinese population. To our knowledge, this is the first report of a comprehensive analysis on the MCT1 gene in any population.

  11. Placentome Nutrient Transporters and Mammalian Target of Rapamycin Signaling Proteins Are Altered by the Methionine Supply during Late Gestation in Dairy Cows and Are Associated with Newborn Birth Weight.

    Science.gov (United States)

    Batistel, Fernanda; Alharthi, Abdulrahman Sm; Wang, Ling; Parys, Claudia; Pan, Yuan-Xiang; Cardoso, Felipe C; Loor, Juan J

    2017-09-01

    Background: To our knowledge, most research demonstrating a link between maternal nutrition and both fetal growth and offspring development after birth has been performed with nonruminants. Whether such relationships exist in large ruminants is largely unknown. Objective: We aimed to investigate whether increasing the methionine supply during late pregnancy would alter uteroplacental tissue nutrient transporters and mammalian target of rapamycin (mTOR) and their relation with newborn body weight. Methods: Multiparous Holstein cows were used in a randomized complete block design experiment. During the last 28 d of pregnancy, cows were fed a control diet or the control diet plus ethylcellulose rumen-protected methionine (0.9 g/kg dry matter intake) (Mepron; Evonik Nutrition & Care GmbH) to achieve a 2.8:1 ratio of lysine to methionine in the metabolizable protein reaching the small intestine. We collected placentome samples at parturition and used them to assess mRNA and protein expression and the phosphorylation status of mTOR pathway proteins. Results: Newborn body weight was greater in the methionine group than in the control group (44.1 kg and 41.8 kg, respectively; P ≤ 0.05). Increasing the methionine supply also resulted in greater feed intake (15.8 kg/d and 14.6 kg/d), plasma methionine (11.9 μM and 15.3 μM), and plasma insulin (1.16 μg/L and 0.81 μg/L) in cows during late pregnancy. As a result, mRNA expression of genes involved in neutral amino acid transport [solute carrier (SLC) family members SLC3A2 , SLC7A5 , SLC38A1 , and SLC38A10 ], glucose transport [ SLC2A1 , SLC2A3 , and SLC2A4 ], and the mTOR pathway [mechanistic target of rapamycin and ribosomal protein S6 kinase B1] were upregulated ( P ≤ 0.07) in methionine-supplemented cows. Among 6 proteins in the mTOR pathway, increasing the methionine supply led to greater ( P ≤ 0.09) protein expression of α serine-threonine kinase (AKT), phosphorylated (p)-AKT, p-eukaryotic elongation factor 2

  12. A novel variant in the SLC12A1 gene in two families with antenatal Bartter syndrome.

    Science.gov (United States)

    Breinbjerg, Anders; Siggaard Rittig, Charlotte; Gregersen, Niels; Rittig, Søren; Hvarregaard Christensen, Jane

    2017-01-01

    Bartter syndrome is an autosomal-recessive inherited disease in which patients present with hypokalaemia and metabolic alkalosis. We present two apparently nonrelated cases with antenatal Bartter syndrome type I, due to a novel variant in the SLC12A1 gene encoding the bumetanide-sensitive sodium-(potassium)-chloride cotransporter 2 in the thick ascending limb of the loop of Henle. Blood samples were received from the two cases and 19 of their relatives, and deoxyribonucleic acid was extracted. The coding regions of the SLC12A1 gene were amplified using polymerase chain reaction, followed by bidirectional direct deoxyribonucleic acid sequencing. Each affected child in the two families was homozygous for a novel inherited variant in the SLC12A1gene, c.1614T>A. The variant predicts a change from a tyrosine codon to a stop codon (p.Tyr538Ter). The two cases presented antenatally and at six months of age, respectively. The two cases were homozygous for the same variant in the SLC12A1 gene, but presented clinically at different ages. This could eventually be explained by the presence of other gene variants or environmental factors modifying the phenotypes. The phenotypes of the patients were similar to other patients with antenatal Bartter syndrome. ©2016 Foundation Acta Paediatrica. Published by John Wiley & Sons Ltd.

  13. Prostaglandin transporter (OATP2A1/SLCO2A1) contributes to local disposition of eicosapentaenoic acid-derived PGE3.

    Science.gov (United States)

    Gose, Tomoka; Nakanishi, Takeo; Kamo, Shunsuke; Shimada, Hiroaki; Otake, Katsumasa; Tamai, Ikumi

    2016-01-01

    Eicosapentaenoic acid (EPA)-derived prostaglandin E3 (PGE3) possesses an anti-inflammatory effect; however, information for transporters that regulate its peri-cellular concentration is limited. The present study, therefore, aimed to clarify transporters involved in local disposition of PGE3. PGE3 uptake was assessed in HEK293 cells transfected with OATP2A1/SLCO2A1, OATP1B1/SLCO1B1, OATP2B1/SLCO2B1, OAT1/SLC22A6, OCT1/SLC22A1 or OCT2/SLC22A2 genes, compared with HEK293 cells transfected with plasmid vector alone (Mock). PGE3 uptake by OATP2A1-expressing HEK293 cells (HEK/2A1) was the highest and followed by HEK/1B1, while no significantly higher uptake of PGE3 than Mock cells was detected by other transporters. Saturation kinetics in PGE3 uptake by HEK/2A1 estimated the Km as 7.202 ± 0.595 μM, which was 22 times higher than that of PGE2 (Km=0.331 ± 0.131 μM). Furthermore, tissue disposition of PGE3 was examined in wild-type (WT) and Slco2a1-deficient (Slco2a1(-/-)) mice after oral administration of EPA ethyl ester (EPA-E) when they underwent intraperitoneal injection of endotoxin (e.g., lipopolysaccharide). PGE3 concentration was significantly higher in the lung, and tended to increase in the colon, stomach, and kidney of Slco2a1(-/-), compared to WT mice. Ratio of PGE2 metabolite 15-keto PGE2 over PGE2 concentration was significantly lower in the lung and colon of Slco2a1(-/-) than that of WT mice, suggesting that PGE3 metabolism is downregulated in Slco2a1(-/-) mice. In conclusion, PGE3 was found to be a substrate of OATP2A1, and local disposition of PGE3 could be regulated by OATP2A1 at least in the lung. Copyright © 2015 Elsevier Inc. All rights reserved.

  14. ZIP8 zinc transporter: indispensable role for both multiple-organ organogenesis and hematopoiesis in utero.

    Directory of Open Access Journals (Sweden)

    Marina Gálvez-Peralta

    Full Text Available Previously this laboratory characterized Slc39a8-encoded ZIP8 as a Zn(2+/(HCO(3(-(2 symporter; yet, the overall physiological importance of ZIP8 at the whole-organism level remains unclear. Herein we describe the phenotype of the hypomorphic Slc39a8(neo/neo mouse which has retained the neomycin-resistance gene in intron 3, hence causing significantly decreased ZIP8 mRNA and protein levels in embryo, fetus, placenta, yolk sac, and several tissues of neonates. The Slc39a8(neo allele is associated with diminished zinc and iron uptake in mouse fetal fibroblast and liver-derived cultures; consequently, Slc39a8(neo/neo newborns exhibit diminished zinc and iron levels in several tissues. Slc39a8(neo/neo homozygotes from gestational day(GD-11.5 onward are pale, growth-stunted, and die between GD18.5 and 48 h postnatally. Defects include: severely hypoplastic spleen; hypoplasia of liver, kidney, lung, and lower limbs. Histologically, Slc39a8(neo/neo neonates show decreased numbers of hematopoietic islands in yolk sac and liver. Low hemoglobin, hematocrit, red cell count, serum iron, and total iron-binding capacity confirmed severe anemia. Flow cytometry of fetal liver cells revealed the erythroid series strikingly affected in the hypomorph. Zinc-dependent 5-aminolevulinic acid dehydratase, required for heme synthesis, was not different between Slc39a8(+/+ and Slc39a8(neo/neo offspring. To demonstrate further that the mouse phenotype is due to ZIP8 deficiency, we bred Slc39a8(+/neo with BAC-transgenic BTZIP8-3 line (carrying three extra copies of the Slc39a8 allele; this cross generated viable Slc39a8(neo/neo_BTZIP8-3(+/+ pups showing none of the above-mentioned congenital defects-proving Slc39a8(neo/neo causes the described phenotype. Our study demonstrates that ZIP8-mediated zinc transport plays an unappreciated critical role during in utero and neonatal growth, organ morphogenesis, and hematopoiesis.

  15. SLC3A1 and SLC7A9 mutations in autosomal recessive or dominant canine cystinuria: a new classification system.

    Science.gov (United States)

    Brons, A-K; Henthorn, P S; Raj, K; Fitzgerald, C A; Liu, J; Sewell, A C; Giger, U

    2013-01-01

    Cystinuria, one of the first recognized inborn errors of metabolism, has been reported in many dog breeds. To determine urinary cystine concentrations, inheritance, and mutations in the SLC3A1 and SLC7A9 genes associated with cystinuria in 3 breeds. Mixed and purebred Labrador Retrievers (n = 6), Australian Cattle Dogs (6), Miniature Pinschers (4), and 1 mixed breed dog with cystine urolithiasis, relatives and control dogs. Urinary cystinuria and aminoaciduria was assessed and exons of the SLC3A1 and SLC7A9 genes were sequenced from genomic DNA. In each breed, male and female dogs, independent of neuter status, were found to form calculi. A frameshift mutation in SLC3A1 (c.350delG) resulting in a premature stop codon was identified in autosomal-recessive (AR) cystinuria in Labrador Retrievers and mixed breed dogs. A 6 bp deletion (c.1095_1100del) removing 2 threonines in SLC3A1 was found in autosomal-dominant (AD) cystinuria with a more severe phenotype in homozygous than in heterozygous Australian Cattle Dogs. A missense mutation in SLC7A9 (c.964G>A) was discovered in AD cystinuria in Miniature Pinschers with only heterozygous affected dogs observed to date. Breed-specific DNA tests were developed, but the prevalence of each mutation remains unknown. These studies describe the first AD inheritance and the first putative SLC7A9 mutation to cause cystinuria in dogs and expand our understanding of this phenotypically and genetically heterogeneous disease, leading to a new classification system for canine cystinuria and better therapeutic management and genetic control in these breeds. Copyright © 2013 by the American College of Veterinary Internal Medicine.

  16. Review of SLC performance

    International Nuclear Information System (INIS)

    Phinney, N.

    1992-08-01

    The SLAC Linear Collider (SLC) has begun a new era of operation with the SLD detector. During 1991 there was a first engineering run for the SLD in parallel with machine improvements to increase luminosity and reliability. For the 1992 run, a polarized electron source was added and more than 10,000 Zs with an average of 23% polarization have been logged by the SLD. This paper will discuss the performance of the SLC in 1991 and 1992 and the technical advances that have produced higher luminosity. Emphasis will be placed on issues relevant to future linear colliders such as producing and maintaining high-current, low-emittance beams and focusing the beams to the micron scale for collisions

  17. Dicty_cDB: SLC403 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC403 (Link to dictyBase) - - - Contig-U16252-1 SLC403Z (Link... to Original site) - - SLC403Z 492 - - - - Show SLC403 Library SL (Link to library) Clone ID SLC403 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC403Q.Seq.d/ Representative seq. ID SLC40...3Z (Link to Original site) Representative DNA sequence >SLC403 (SLC403Q) /CSM/SL/SLC4-A/SLC403Q.Seq.d/ XXXXX...-B/SLE731Q.Seq.d/ 902 0.0 SLC403 (SLC403Q) /CSM/SL/SLC4-A/SLC403Q.Seq.d/ 902 0.0 SLC241 (SLC241Q) /CSM/SL/SL

  18. Overexpression of monocarboxylate transporter-1 (Slc16a1) in mouse pancreatic ß-cells leads to relative hyperinsulinism during exercise

    DEFF Research Database (Denmark)

    Pullen, Timothy J; Sylow, Lykke; Sun, Gao

    2012-01-01

    Exercise-induced hyperinsulinism (EIHI) is an autosomal dominant disorder characterized by inappropriate insulin secretion in response to vigorous physical exercise or pyruvate injection. Activating mutations in the monocarboxylate transporter-1 (MCT1, SLC16A1) promoter have been linked to EIHI....... Expression of this pyruvate transporter is specifically repressed (disallowed) in pancreatic ß-cells, despite nearly universal expression across other tissues. It has been impossible to determine, however, whether EIHI mutations cause MCT1 expression in patient ß-cells. The hypothesis that MCT1 expression...... in ß-cells is sufficient to cause EIHI by allowing entry of pyruvate and triggering insulin secretion thus remains unproven. Therefore, we generated a transgenic mouse capable of doxycycline-induced, ß-cell-specific overexpression of MCT1 to test this model directly. MCT1 expression caused isolated...

  19. Dicty_cDB: SLC413 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC413 (Link to dictyBase) - - - Contig-U15735-1 SLC413P (Link to Original site) SLC4...13F 686 SLC413Z 466 SLC413P 1152 - - Show SLC413 Library SL (Link to library) Clone ID SLC4...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC413Q.Seq.d/ Representative seq. ID SLC4...13P (Link to Original site) Representative DNA sequence >SLC413 (SLC413Q) /CSM/SL/SLC4-A/SLC4...iknkikkknikqkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC413 (SLC413Q) /CSM/SL/SLC4

  20. Dicty_cDB: SLC404 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC404 (Link to dictyBase) - G22406 DDB0190371 Contig-U03918-1 SLC4...04E (Link to Original site) - - - - - - SLC404E 229 Show SLC404 Library SL (Link to library) Clone ID SLC4...riginal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC404Q.Seq.d/ ...Representative seq. ID SLC404E (Link to Original site) Representative DNA sequence >SLC404 (SLC404Q) /CSM/SL/SLC4-A/SLC4...y vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC404 (SLC404Q) /CSM/SL/SLC4-A/SLC4

  1. The gene expression of the neuronal protein, SLC38A9, changes in mouse brain after in vivo starvation and high-fat diet.

    Directory of Open Access Journals (Sweden)

    Sofie V Hellsten

    Full Text Available SLC38A9 is characterized as a lysosomal component of the amino acid sensing Ragulator-RAG GTPase complex, controlling the mechanistic target of rapamycin complex 1 (mTORC1. Here, immunohistochemistry was used to map SLC38A9 in mouse brain and staining was detected throughout the brain, in cortex, hypothalamus, thalamus, hippocampus, brainstem and cerebellum. More specifically, immunostaining was found in areas known to be involved in amino acid sensing and signaling pathways e.g. piriform cortex and hypothalamus. SLC38A9 immunoreactivity co-localized with both GABAergic and glutamatergic neurons, but not with astrocytes. SLC38A9 play a key role in the mTORC1 pathway, and therefore we performed in vivo starvation and high-fat diet studies, to measure gene expression alterations in specific brain tissues and in larger brain regions. Following starvation, Slc38a9 was upregulated in brainstem and cortex, and in anterior parts of the brain (Bregma 3.2 to -2.1mm. After high-fat diet, Slc38a9 was specifically upregulated in hypothalamus, while overall downregulation was noticed throughout the brain (Bregma 3.2 to -8.6mm.

  2. Dicty_cDB: SLC481 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC481 (Link to dictyBase) - - - Contig-U16358-1 SLC481Z (Link... to Original site) - - SLC481Z 393 - - - - Show SLC481 Library SL (Link to library) Clone ID SLC481 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC481Q.Seq.d/ Representative seq. ID SLC48...1Z (Link to Original site) Representative DNA sequence >SLC481 (SLC481Q) /CSM/SL/SLC4-D/SLC481Q.Seq.d/ XXXXX...SL/SLG8-A/SLG820Q.Seq.d/ 708 0.0 SLC481 (SLC481Q) /CSM/SL/SLC4-D/SLC481Q.Seq.d/ 708 0.0 SLC178 (SLC178Q) /CS

  3. Dicty_cDB: SLC407 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC407 (Link to dictyBase) - - - Contig-U16560-1 SLC407Z (Link... to Original site) - - SLC407Z 365 - - - - Show SLC407 Library SL (Link to library) Clone ID SLC407 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC407Q.Seq.d/ Representative seq. ID SLC40...7Z (Link to Original site) Representative DNA sequence >SLC407 (SLC407Q) /CSM/SL/SLC4-A/SLC407Q.Seq.d/ XXXXX...vvtkf*cqt e** Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC407 (SLC407Q) /CSM/SL/SLC4

  4. Dicty_cDB: SLC405 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC405 (Link to dictyBase) - - - Contig-U11279-1 | Contig-U16243-1 SLC4...05P (Link to Original site) SLC405F 536 SLC405Z 439 SLC405P 975 - - Show SLC405 Library SL (Link to library) Clone ID SLC4...79-1 | Contig-U16243-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...05Q.Seq.d/ Representative seq. ID SLC405P (Link to Original site) Representative DNA sequence >SLC405 (SLC4...05Q) /CSM/SL/SLC4-A/SLC405Q.Seq.d/ ATAACTAATAAAATGTCATTCAATTCAAGAATTGAAACTATTTCTCGCCACTTAAGCACT

  5. Dicty_cDB: SLC424 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC424 (Link to dictyBase) - G01086 DDB0231665 Contig-U08784-1 SLC4...24P (Link to Original site) SLC424F 169 SLC424Z 538 SLC424P 707 - - Show SLC424 Library SL (Link to library) Clone ID SLC4...ontig-U08784-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...24Q.Seq.d/ Representative seq. ID SLC424P (Link to Original site) Representative DNA sequence >SLC424 (SLC424Q) /CSM/SL/SLC4...-A/SLC424Q.Seq.d/ GGATATTATAATTTCAAATTAAGTTTTATAAATTTGAAATAATATTGAAAAAAAAAAAAA ATAAAAAA

  6. Dicty_cDB: SLC489 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC489 (Link to dictyBase) - - - Contig-U16255-1 SLC489P (Link to Original site) SLC4...89F 628 SLC489Z 172 SLC489P 800 - - Show SLC489 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC489Q.Seq.d/ Representative seq. ID SLC4...89P (Link to Original site) Representative DNA sequence >SLC489 (SLC489Q) /CSM/SL/SLC4-D/SLC4...SSD212Q.Seq.d/ 1001 0.0 SLE207 (SLE207Q) /CSM/SL/SLE2-A/SLE207Q.Seq.d/ 1001 0.0 SLC489 (SLC489Q) /CSM/SL/SLC4-D/SLC4

  7. Genetic variants in the regulatory region of SLC10A1 are not associated with the risk of hepatitis B virus infection and clearance.

    Science.gov (United States)

    Chen, Xueqin; Wang, Ying; Chen, Xiaohua; Cheng, Kailiang; Li, Jiaoyuan; Lou, Jiao; Ke, Juntao; Yang, Yang; Gong, Yajie; Zhu, Ying; Wang, Li; Zhong, Rong

    2016-10-01

    The Na/taurocholate cotransporter NTCP (encoded by SLC10A1) was identified as a cellular entry receptor for the human hepatitis B virus (HBV), advancing our understanding of the molecular mechanism of HBV infection. An alternative hypothesis was put forward that regulatory variants in SLC10A1 might play an important role in HBV susceptibility by potentially influencing expression levels of NTCP. The three regulatory SNPs (rs8011311, rs7154439, rs111409076) were genotyped in 1023 HBV-persistent carriers, 735 subjects with HBV natural clearance and 732 HBV marker-negative subjects in a Han Chinese population. Real-time reverse transcription PCR analysis and luciferase assays have been performed to dissect the potential functionality. In logistic regression analysis, when subjects with HBV natural clearance were compared with HBV marker-negative subjects, no significant associations with the risk of HBV infection were observed for any of the three SNPs after adjusting for age, sex, smoking status and alcohol consumption (P>0.05). Similar negative results were also found for the three SNPs when HBV-persistent carriers were compared with HBV marker-negative subjects. Likewise, no significant associations with the risk of HBV clearance were observed when HBV-persistent carriers were compared with subjects with HBV natural clearance (P>0.05). Quantitative RT/PCR showed no significant difference in NTCP expression levels in normal liver tissue amongst individuals with different rs111409076 genotypes (P=0.317 for the general linear model). Moreover, no evident effect of the SLC10A1 rs111409076 AACA/- polymorphism on transcriptional activity was found by luciferase assay in either HepG2 (P=0.161) or Hep3b (P=0.129) cell lines. The present study indicated that the common variants in the regulatory region of SLC10A1 may not influence the expression of NTCP at the level of transcriptional regulation, and ultimately may not be associated with HBV susceptibility in this Chinese

  8. High levels of the type III inorganic phosphate transporter PiT1 (SLC20A1) can confer faster cell adhesion

    OpenAIRE

    Kongsfelt, Iben Boutrup; Byskov, Kristina; Pedersen, Lasse Ebdrup; Pedersen, Lene

    2014-01-01

    The inorganic phosphate transporter PiT1 (SLC20A1) is ubiquitously expressed in mammalian cells. We recently showed that overexpression of human PiT1 was sufficient to increase proliferation of two strict density-inhibited cell lines, murine fibroblastic NIH3T3 and pre-osteoblastic MC3T3-E1 cells, and allowed the cultures to grow to higher cell densities. In addition, upon transformation NIH3T3 cells showed increased ability to form colonies in soft agar. The cellular regulation of PiT1 expre...

  9. Wire breakage in SLC wire profile monitors

    International Nuclear Information System (INIS)

    Field, C.; McCormick, D.; Raimondi, P.; Ross, M.

    1998-05-01

    Wire scanning beam profile monitors are used at the Stanford Linear Collider (SLC) for emittance preservation control and beam optics optimization. Twenty such scanners have proven most useful for this purpose and have performed a total of 1.5 million scans in the 4 to 6 years since their installation. Most of the essential scanners are equipped with 20 to 40 microm tungsten wires. SLC bunch intensities and sizes often exceed 2 x 10 7 particles/microm 2 (3C/m 2 ). The authors believe that this has caused a number of tungsten wire failures that appear at the ends of the wire, near the wire support points, after a few hundred scans are accumulated. Carbon fibers, also widely used at SLAC, have been substituted in several scanners and have performed well. In this paper, the authors present theories for the wire failure mechanism and techniques learned in reducing the failures

  10. Dicty_cDB: SLC420 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC420 (Link to dictyBase) - G01085 DDB0205634 Contig-U01169-1 | Contig-U15736-1 SLC4...20P (Link to Original site) SLC420F 333 SLC420Z 423 SLC420P 756 - - Show SLC420 Libra...ry SL (Link to library) Clone ID SLC420 (Link to dictyBase) Atlas ID - NBRP ID G01085 dictyBase ID DDB020563...cdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC420Q.Seq.d/ Representative seq. ID SLC420P (Link to Original site) R...epresentative DNA sequence >SLC420 (SLC420Q) /CSM/SL/SLC4-A/SLC420Q.Seq.d/ GCTAGCACACACATAAATAATACATACACACAT

  11. Dicty_cDB: SLC419 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC419 (Link to dictyBase) - - - Contig-U03801-1 SLC419Z (Link... to Original site) - - SLC419Z 335 - - - - Show SLC419 Library SL (Link to library) Clone ID SLC419 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC419Q.Seq.d/ Representative seq. ID SLC41...9Z (Link to Original site) Representative DNA sequence >SLC419 (SLC419Q) /CSM/SL/SLC4-A/SLC419Q.Seq.d/ XXXXX...I6-A/SSI602Q.Seq.d/ 490 e-138 SSD173 (SSD173Q) /CSM/SS/SSD1-D/SSD173Q.Seq.d/ 490 e-138 SLC419 (SLC4

  12. Sodium bicarbonate cotransporter NBCe2 gene variants increase sodium and bicarbonate transport in human renal proximal tubule cells.

    Science.gov (United States)

    Gildea, John J; Xu, Peng; Kemp, Brandon A; Carlson, Julia M; Tran, Hanh T; Bigler Wang, Dora; Langouët-Astrié, Christophe J; McGrath, Helen E; Carey, Robert M; Jose, Pedro A; Felder, Robin A

    2018-01-01

    Salt sensitivity of blood pressure affects >30% of the hypertensive and >15% of the normotensive population. Variants of the electrogenic sodium bicarbonate cotransporter NBCe2 gene, SLC4A5, are associated with increased blood pressure in several ethnic groups. SLC4A5 variants are also highly associated with salt sensitivity, independent of hypertension. However, little is known about how NBCe2 contributes to salt sensitivity, although NBCe2 regulates renal tubular sodium bicarbonate transport. We hypothesized that SLC4A5 rs10177833 and rs7571842 increase NBCe2 expression and human renal proximal tubule cell (hRPTC) sodium transport and may be a cause of salt sensitivity of blood pressure. To characterize the hRPTC ion transport of wild-type (WT) and homozygous variants (HV) of SLC4A5. The expressions of NBCe2 mRNA and protein were not different between hRPTCs carrying WT or HV SLC4A5 before or after dopaminergic or angiotensin (II and III) stimulation. However, luminal to basolateral sodium transport, NHE3 protein, and Cl-/HCO3- exchanger activity in hRPTCs were higher in HV than WT SLC4A5. Increasing intracellular sodium enhanced the apical location of NBCe2 in HV hRPTCs (4.24±0.35% to 11.06±1.72% (P<0.05, N = 3, 2-way ANOVA, Holm-Sidak test)) as determined by Total Internal Reflection Fluorescence Microscopy (TIRFM). In hRPTCs isolated from kidney tissue, increasing intracellular sodium enhanced bicarbonate-dependent pH recovery rate and increased NBCe2 mRNA and protein expressions to a greater extent in HV than WT SLC4A5 (+38.00±6.23% vs HV normal salt (P<0.01, N = 4, 2-way ANOVA, Holm-Sidak test)). In hRPTCs isolated from freshly voided urine, bicarbonate-dependent pH recovery was also faster in those from salt-sensitive and carriers of HV SLC4A5 than from salt-resistant and carriers of WT SLC4A5. The faster NBCe2-specific bicarbonate-dependent pH recovery rate in HV SCL4A5 was normalized by SLC4A5- but not SLC4A4-shRNA. The binding of purified hepatocyte

  13. Expression and Its Clinical Significance of SLC22A18 in Non-small Cell Lung Cancer

    Directory of Open Access Journals (Sweden)

    Ming LEI

    2012-01-01

    Full Text Available Background and objective It has been proven that multidrug resistance (MDR is the main cause of chemotherapy failure in lung cancer. Research on emergence mechanisms of MDR has great clinical significance in improving the curative efficiency of lung cancer chemotherapy. Proteins encoded by the SLC22A18 gene, which is similar to the transmembrane transporter, may influence the sensitivity of chemotherapeutics as well as the metabolism and growth of cells. In addition, these proteins probably have some effect on the development of lung cancer MDR. The aim of the present study is to investigate the expression of SLC22A18 protein in non-small cell lung cancer (NSCLC as well as in corresponding normal lung tissue. Furthermore, the relationship between SLC22A18 expression and pathological grade and TNM stage is analyzed. Methods The expression of SLC22A18 was detected by EnVinsion in 96 cases with NSCLC and in corresponding normal lung tissue. Statistical analysis was performed using SPSS 17.0 statistical software. Results SLC22A18 was mainly located in cell membrane and cytoplasm. The expression level of SLC22A18 in NSCLC was significantly higher than that in normal tissue (P<0.01. The positive rates in squamous cell lung cancer and lung adenocarcinoma were 68% and 78.2%, respectively (P<0.05. Moreover, the higher expression of SLC22A18 was associated with lower histological grade and later TNM stage (P<0.05. Conclusion SLC22A18 protein is overexpressed in NSCLC, and its expression is correlated with pathological grade and TNM stage. These findings provide the experimental basis for investigating the role of tumor and chemoresistance.

  14. Polymorphism Study on SLC30A8 and Its Association with Type 2 Diabetes

    Directory of Open Access Journals (Sweden)

    M. Vignesh

    2016-11-01

    Full Text Available Type 2 diabetes mellitus (T2DM is one of the threatening disorders in the world. It affects people of all ages. Type 2 diabetes mellitus is a condition in which the glucose level in the blood is elevated due to improper function of the secretion of insulin from beta cells of the pancreas. It is a multifactorial disease because it is caused by both environmental and hereditary factors. One of the genes which play an important role in type 2 diabetes mellitus is SLC30A8 which encodes for zinc transporter ZnT8. The common polymorphic site for SLC30A8 is rs13266634. This single-nucleotide polymorphism leads to type 2 diabetes mellitus by replacing the arginine residue with tryptophan residue. This review mainly focuses on the polymorphic studies in the gene SLC30A8 and its association with type 2 diabetes mellitus.

  15. Variation in the SLC23A1 gene does not influence cardiometabolic outcomes to the extent expected given its association with l-ascorbic acid1234

    Science.gov (United States)

    Wade, Kaitlin H; Forouhi, Nita G; Cook, Derek G; Johnson, Paul; McConnachie, Alex; Morris, Richard W; Rodriguez, Santiago; Ye, Zheng; Ebrahim, Shah; Padmanabhan, Sandosh; Watt, Graham; Bruckdorfer, K Richard; Wareham, Nick J; Whincup, Peter H; Chanock, Stephen; Sattar, Naveed; Lawlor, Debbie A; Davey Smith, George; Timpson, Nicholas J

    2015-01-01

    Background: Observational studies showed that circulating l-ascorbic acid (vitamin C) is inversely associated with cardiometabolic traits. However, these studies were susceptible to confounding and reverse causation. Objectives: We assessed the relation between l-ascorbic acid and 10 cardiometabolic traits by using a single nucleotide polymorphism in the solute carrier family 23 member 1 (SLC23A1) gene (rs33972313) associated with circulating l-ascorbic acid concentrations. The observed association between rs33972313 and cardiometabolic outcomes was compared with that expected given the rs33972313-l-ascorbic acid and l-ascorbic acid–outcome associations. Design: A meta-analysis was performed in the following 5 independent studies: the British Women's Heart and Health Study (n = 1833), the MIDSPAN study (n = 1138), the Ten Towns study (n = 1324), the British Regional Heart Study (n = 2521), and the European Prospective Investigation into Cancer (n = 3737). Results: With the use of a meta-analysis of observational estimates, inverse associations were shown between l-ascorbic acid and systolic blood pressure, triglycerides, and the waist-hip ratio [the strongest of which was the waist-hip ratio (−0.13-SD change; 95% CI: −0.20-, −0.07-SD change; P = 0.0001) per SD increase in l-ascorbic acid], and a positive association was shown with high-density lipoprotein (HDL) cholesterol. The variation at rs33972313 was associated with a 0.18-SD (95% CI: 0.10-, 0.25-SD; P = 3.34 × 10−6) increase in l-ascorbic acid per effect allele. There was no evidence of a relation between the variation at rs33972313 and any cardiometabolic outcome. Although observed estimates were not statistically different from expected associations between rs33972313 and cardiometabolic outcomes, estimates for low-density lipoprotein cholesterol, HDL cholesterol, triglycerides, glucose, and body mass index were in the opposite direction to those expected. Conclusions: The nature of the genetic

  16. 41 CFR 301-10.5 - What are the presumptions as to the most advantageous method of transportation?

    Science.gov (United States)

    2010-07-01

    ... presumptions as to the most advantageous method of transportation? 301-10.5 Section 301-10.5 Public Contracts... most advantageous method of transportation? (a) Common carrier. Travel by common carrier is presumed to be the most advantageous method of transportation and must be used when reasonably available. (b...

  17. Joint linkage and association analysis with exome sequence data implicates SLC25A40 in hypertriglyceridemia.

    Science.gov (United States)

    Rosenthal, Elisabeth A; Ranchalis, Jane; Crosslin, David R; Burt, Amber; Brunzell, John D; Motulsky, Arno G; Nickerson, Deborah A; Wijsman, Ellen M; Jarvik, Gail P

    2013-12-05

    Hypertriglyceridemia (HTG) is a heritable risk factor for cardiovascular disease. Investigating the genetics of HTG may identify new drug targets. There are ~35 known single-nucleotide variants (SNVs) that explain only ~10% of variation in triglyceride (TG) level. Because of the genetic heterogeneity of HTG, a family study design is optimal for identification of rare genetic variants with large effect size because the same mutation can be observed in many relatives and cosegregation with TG can be tested. We considered HTG in a five-generation family of European American descent (n = 121), ascertained for familial combined hyperlipidemia. By using Bayesian Markov chain Monte Carlo joint oligogenic linkage and association analysis, we detected linkage to chromosomes 7 and 17. Whole-exome sequence data revealed shared, highly conserved, private missense SNVs in both SLC25A40 on chr7 and PLD2 on chr17. Jointly, these SNVs explained 49% of the genetic variance in TG; however, only the SLC25A40 SNV was significantly associated with TG (p = 0.0001). This SNV, c.374A>G, causes a highly disruptive p.Tyr125Cys substitution just outside the second helical transmembrane region of the SLC25A40 inner mitochondrial membrane transport protein. Whole-gene testing in subjects from the Exome Sequencing Project confirmed the association between TG and SLC25A40 rare, highly conserved, coding variants (p = 0.03). These results suggest a previously undescribed pathway for HTG and illustrate the power of large pedigrees in the search for rare, causal variants. Copyright © 2013 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  18. In vitro evidence for the brain glutamate efflux hypothesis: brain endothelial cells cocultured with astrocytes display a polarized brain-to-blood transport of glutamate.

    Science.gov (United States)

    Helms, Hans Christian; Madelung, Rasmus; Waagepetersen, Helle Sønderby; Nielsen, Carsten Uhd; Brodin, Birger

    2012-05-01

    The concentration of the excitotoxic amino acid, L-glutamate, in brain interstitial fluid is tightly regulated by uptake transporters and metabolism in astrocytes and neurons. The aim of this study was to investigate the possible role of the blood-brain barrier endothelium in brain L-glutamate homeostasis. Transendothelial transport- and accumulation studies of (3) H-L-glutamate, (3) H-L-aspartate, and (3) H-D-aspartate in an electrically tight bovine endothelial/rat astrocyte blood-brain barrier coculture model were performed. After 6 days in culture, the endothelium displayed transendothelial resistance values of 1014 ± 70 Ω cm(2) , and (14) C-D-mannitol permeability values of 0.88 ± 0.13 × 10(-6) cm s(-1) . Unidirectional flux studies showed that L-aspartate and L-glutamate, but not D-aspartate, displayed polarized transport in the brain-to-blood direction, however, all three amino acids accumulated in the cocultures when applied from the abluminal side. The transcellular transport kinetics were characterized with a K(m) of 69 ± 15 μM and a J(max) of 44 ± 3.1 pmol min(-1) cm(-2) for L-aspartate and a K(m) of 138 ± 49 μM and J(max) of 28 ± 3.1 pmol min(-1) cm(-2) for L-glutamate. The EAAT inhibitor, DL-threo-ß-Benzyloxyaspartate, inhibited transendothelial brain-to-blood fluxes of L-glutamate and L-aspartate. Expression of EAAT-1 (Slc1a3), -2 (Slc1a2), and -3 (Slc1a1) mRNA in the endothelial cells was confirmed by conventional PCR and localization of EAAT-1 and -3 in endothelial cells was shown with immunofluorescence. Overall, the findings suggest that the blood-brain barrier itself may participate in regulating brain L-glutamate concentrations. Copyright © 2012 Wiley Periodicals, Inc.

  19. The sodium-bicarbonate cotransporter NBCe2 (slc4a5) expressed in human renal proximal tubules shows increased apical expression under high-salt conditions.

    Science.gov (United States)

    Gildea, John J; Xu, Peng; Carlson, Julia M; Gaglione, Robert T; Bigler Wang, Dora; Kemp, Brandon A; Reyes, Camellia M; McGrath, Helen E; Carey, Robert M; Jose, Pedro A; Felder, Robin A

    2015-12-01

    The electrogenic sodium bicarbonate cotransporter (NBCe2) is encoded by SLC4A5, variants of which have been associated with salt sensitivity of blood pressure, which affects 25% of the adult population. NBCe2 is thought to mediate sodium bicarbonate cotransport primarily in the renal collecting duct, but NBCe2 mRNA is also found in the rodent renal proximal tubule (RPT). The protein expression or function of NBCe2 has not been demonstrated in the human RPT. We validated an NBCe2 antibody by shRNA and Western blot analysis, as well as overexpression of an epitope-tagged NBCe2 construct in both RPT cells (RPTCs) and human embryonic kidney 293 (HEK293) cells. Using this validated NBCe2 antibody, we found NBCe2 protein expression in the RPT of fresh and frozen human kidney slices, RPTCs isolated from human urine, and isolated RPTC apical membrane. Under basal conditions, NBCe2 was primarily found in the Golgi, while NBCe1 was primarily found at the basolateral membrane. Following an acute short-term increase in intracellular sodium, NBCe2 expression was increased at the apical membrane in cultured slices of human kidney and polarized, immortalized RPTCs. Sodium bicarbonate transport was increased by monensin and overexpression of NBCe2, decreased by NBCe2 shRNA, but not by NBCe1 shRNA, and blocked by 2,2'-(1,2-ethenediyl)bis[5-isothiocyanato-benzenesulfonic acid]. NBCe2 could be important in apical sodium and bicarbonate cotransport under high-salt conditions; the implication of the ex vivo studies to the in vivo situation when salt intake is increased remains unclear. Therefore, future studies will examine the role of NBCe2 in mediating increased renal sodium transport in humans whose blood pressures are elevated by an increase in sodium intake. Copyright © 2015 the American Physiological Society.

  20. Functional Testing of SLC26A4 Variants—Clinical and Molecular Analysis of a Cohort with Enlarged Vestibular Aqueduct from Austria

    Science.gov (United States)

    Bernardinelli, Emanuele; Nofziger, Charity; Patsch, Wolfgang; Rasp, Gerd; Paulmichl, Markus; Dossena, Silvia

    2018-01-01

    The prevalence and spectrum of sequence alterations in the SLC26A4 gene, which codes for the anion exchanger pendrin, are population-specific and account for at least 50% of cases of non-syndromic hearing loss associated with an enlarged vestibular aqueduct. A cohort of nineteen patients from Austria with hearing loss and a radiological alteration of the vestibular aqueduct underwent Sanger sequencing of SLC26A4 and GJB2, coding for connexin 26. The pathogenicity of sequence alterations detected was assessed by determining ion transport and molecular features of the corresponding SLC26A4 protein variants. In this group, four uncharacterized sequence alterations within the SLC26A4 coding region were found. Three of these lead to protein variants with abnormal functional and molecular features, while one should be considered with no pathogenic potential. Pathogenic SLC26A4 sequence alterations were only found in 12% of patients. SLC26A4 sequence alterations commonly found in other Caucasian populations were not detected. This survey represents the first study on the prevalence and spectrum of SLC26A4 sequence alterations in an Austrian cohort and further suggests that genetic testing should always be integrated with functional characterization and determination of the molecular features of protein variants in order to unequivocally identify or exclude a causal link between genotype and phenotype. PMID:29320412

  1. The polarized electron gun for the SLC

    International Nuclear Information System (INIS)

    Schultz, D.C.; Clendenin, J.; Frisch, J.; Hoyt, E.; Klaisner, L.; Woods, M.; Wright, D.; Zolotorev, M.

    1992-03-01

    A new polarized electron gun for use on the SLC at SLAC has been built and tested. It is a diode gun with a laser driven GaAs photocathode. It is designed to provide short (2ns) pulses of 10 A at 160 kV at 120 Hz. The design features of the gun and results from a testing program on a new and dedicated beam line are presented. Early results from operation on the SLC will also be shown

  2. Dicty_cDB: SLC495 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC495 (Link to dictyBase) - - - Contig-U03919-1 SLC495E (Link to Original site) SLC4...95F 337 SLC495Z 295 SLC495P 632 SLC495E 337 Show SLC495 Library SL (Link to library) Clone ID SLC4...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC495Q.Seq.d/ Representative seq. ID SLC4...95E (Link to Original site) Representative DNA sequence >SLC495 (SLC495Q) /CSM/SL/SLC4-D/SLC4...ficant alignments: (bits) Value SLC495 (SLC495Q) /CSM/SL/SLC4-D/SLC495Q.Seq.d/ 446 e-124 VSF494 (VSF494Q) /C

  3. A single base deletion in the SLC45A2 gene in a Bullmastiff with oculocutaneous albinism.

    Science.gov (United States)

    Caduff, M; Bauer, A; Jagannathan, V; Leeb, T

    2017-10-01

    Oculocutaneous albinism type 4 (OCA4) in humans and similar phenotypes in many animal species are caused by variants in the SLC45A2 gene, encoding a putative sugar transporter. In dog, two independent SLC45A2 variants are known that cause oculocutaneous albinism in Doberman Pinschers and several small dog breeds respectively. For the present study, we investigated a Bullmastiff with oculocutaneous albinism. The affected dog was highly inbred and resulted from the mating of a sire to its own grandmother. We obtained whole genome sequence data from the affected dog and searched specifically for variants in candidate genes known to cause albinism. We detected a single base deletion in exon 6 of the SLC45A2 gene (NM_001037947.1:c.1287delC) that has not been reported thus far. This deletion is predicted to result in an early premature stop codon. It was confirmed by Sanger sequencing and perfectly co-segregated with the phenotype in the available family members. We genotyped 174 unrelated dogs from diverse breeds, all of which were homozygous wildtype. We therefore suggest that SLC45A2:c.1287delC causes the observed oculocutaneous albinism in the affected Bullmastiff. © 2017 Stichting International Foundation for Animal Genetics.

  4. Changes in the transcriptional profile of transporters in the intestine along the anterior-posterior and crypt-villus axes

    Directory of Open Access Journals (Sweden)

    Delorenzi Mauro

    2005-05-01

    Full Text Available Abstract Background The purpose of this work was to characterize the expression of drug and nutrient carriers along the anterior-posterior and crypt-villus axes of the intestinal epithelium and to study the validity of utilizing whole gut tissue rather than purified epithelial cells to examine regional variations in gene expression. Results We have characterized the mRNA expression profiles of 76 % of all currently known transporters along the anterior-posterior axis of the gut. This is the first study to describe the expression profiles of the majority of all known transporters in the intestine. The expression profiles of transporters, as defined according to the Gene Ontology consortium, were measured in whole tissue of the murine duodenum, jejunum, ileum and colon using high-density microarrays. For nine transporters (Abca1, Abcc1, Abcc3, Abcg8, Slc10a2, Slc28a2, Slc2a1, Slc34a2 and Slc5a8, the mRNA profiles were further measured by RT-PCR in laser micro-dissected crypt and villus epithelial cells corresponding to the aforementioned intestinal regions. With respect to differentially regulated transporters, the colon had a distinct expression profile from small intestinal segments. The majority (59 % for p cutoff ≤ 0.05 of transporter mRNA levels were constant across the intestinal sections studied. For the transporter subclass "carrier activity", which contains the majority of known carriers for biologically active compounds, a significant change (p ≤ 0.05 along the anterior-posterior axis was observed. Conclusion All nine transporters examined in laser-dissected material demonstrated good replication of the region-specific profiles revealed by microarray. Furthermore, we suggest that the distribution characteristics of Slc5a8 along the intestinal tract render it a suitable candidate carrier for monocarboxylate drugs in the posterior portion of the intestine. Our findings also predict that there is a significant difference in the

  5. Dicty_cDB: SLC443 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC443 (Link to dictyBase) - - - Contig-U16518-1 SLC443P (Link to Original site) SLC4...43F 466 SLC443Z 304 SLC443P 770 - - Show SLC443 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC443Q.Seq.d/ Representative seq. ID SLC4...43P (Link to Original site) Representative DNA sequence >SLC443 (SLC443Q) /CSM/SL/SLC4-B/SLC4...Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC443 (SLC443Q) /CSM/SL/SLC4-B/SLC4

  6. Dicty_cDB: SLC429 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC429 (Link to dictyBase) - - - Contig-U09691-1 SLC429Z (Link... to Original site) - - SLC429Z 419 - - - - Show SLC429 Library SL (Link to library) Clone ID SLC429 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC429Q.Seq.d/ Representative seq. ID SLC42...9Z (Link to Original site) Representative DNA sequence >SLC429 (SLC429Q) /CSM/SL/SLC4-B/SLC429Q.Seq.d/ XXXXX... significant alignments: (bits) Value SLC429 (SLC429Q) /CSM/SL/SLC4-B/SLC429Q.Seq.d/ 708 0.0 SLC392 (SLC392Q

  7. Dicty_cDB: SLC428 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC428 (Link to dictyBase) - - - Contig-U10963-1 SLC428P (Link to Original site) SLC4...28F 573 SLC428Z 307 SLC428P 880 - - Show SLC428 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC428Q.Seq.d/ Representative seq. ID SLC4...28P (Link to Original site) Representative DNA sequence >SLC428 (SLC428Q) /CSM/SL/SLC4-B/SLC4...nces producing significant alignments: (bits) Value SLC428 (SLC428Q) /CSM/SL/SLC4-B/SLC428Q.Seq.d/ 1526 0.0

  8. Dicty_cDB: SLC494 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC494 (Link to dictyBase) - - - Contig-U16260-1 SLC494Z (Link... to Original site) - - SLC494Z 451 - - - - Show SLC494 Library SL (Link to library) Clone ID SLC494 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC494Q.Seq.d/ Representative seq. ID SLC49...4Z (Link to Original site) Representative DNA sequence >SLC494 (SLC494Q) /CSM/SL/SLC4-D/SLC494Q.Seq.d/ XXXXX...a: 0.00 m3b: 0.00 m_ : 1.00 52.0 %: cytoplasmic 36.0 %: nuclear 8.0 %: cytoskeletal 4.0 %: mitochondrial >> prediction for SLC4

  9. Dicty_cDB: SLC418 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC418 (Link to dictyBase) - G01921 DDB0191271 Contig-U15820-1 SLC4...18E (Link to Original site) SLC418F 604 SLC418Z 554 SLC418P 1158 SLC418E 1076 Show SLC418 Library SL (L...ink to library) Clone ID SLC418 (Link to dictyBase) Atlas ID - NBRP ID G01921 dictyBase ID DDB0191271 Link t...o Contig Contig-U15820-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-A/SLC4...18Q.Seq.d/ Representative seq. ID SLC418E (Link to Original site) Representative DNA sequence >SLC418 (SLC4

  10. Filling Landsat ETM+ SLC-off gaps using a segmentation model approach

    Science.gov (United States)

    Maxwell, Susan

    2004-01-01

    The purpose of this article is to present a methodology for filling Landsat Scan Line Corrector (SLC)-off gaps with same-scene spectral data guided by a segmentation model. Failure of the SLC on the Landsat 7 Enhanced Thematic Mapper Plus (ETM+) instrument resulted in a loss of approximately 25 percent of the spectral data. The missing data span across most of the image with scan gaps varying in size from two pixels near the center of the image to 14 pixels along the east and west edges. Even with the scan gaps, the radiometric and geometric qualities of the remaining portions of the image still meet design specifications and therefore contain useful information (see http:// landsat7.usgs.gov for additional information). The U.S. Geological Survey EROS Data Center (EDC) is evaluating several techniques to fill the gaps in SLC-off data to enhance the usability of the imagery (Howard and Lacasse 2004) (PE&RS, August 2004). The method presented here uses a segmentation model approach that allows for same-scene spectral data to be used to fill the gaps. The segment model is generated from a complete satellite image with no missing spectral data (e.g., Landsat 5, Landsat 7 SLCon, SPOT). The model is overlaid on the Landsat SLC-off image, and the missing data within the gaps are then estimated using SLC-off spectral data that intersect the segment boundary. A major advantage of this approach is that the gaps are filled using spectral data derived from the same SLC-off satellite image.

  11. Dicty_cDB: SLC458 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC458 (Link to dictyBase) - - - Contig-U16279-1 SLC458Z (Link... to Original site) - - SLC458Z 508 - - - - Show SLC458 Library SL (Link to library) Clone ID SLC458 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC458Q.Seq.d/ Representative seq. ID SLC45...8Z (Link to Original site) Representative DNA sequence >SLC458 (SLC458Q) /CSM/SL/SLC4-C/SLC458Q.Seq.d/ XXXXX...icant alignments: (bits) Value SLC458 (SLC458Q) /CSM/SL/SLC4-C/SLC458Q.Seq.d/ 743

  12. Dicty_cDB: SLC451 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC451 (Link to dictyBase) - - - Contig-U16260-1 SLC451Z (Link... to Original site) - - SLC451Z 389 - - - - Show SLC451 Library SL (Link to library) Clone ID SLC451 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC451Q.Seq.d/ Representative seq. ID SLC45...1Z (Link to Original site) Representative DNA sequence >SLC451 (SLC451Q) /CSM/SL/SLC4-C/SLC451Q.Seq.d/ XXXXX... producing significant alignments: (bits) Value SLC451 (SLC451Q) /CSM/SL/SLC4-C/SLC4

  13. Dicty_cDB: SLC474 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC474 (Link to dictyBase) - - - Contig-U01121-1 SLC474Z (Link... to Original site) - - SLC474Z 431 - - - - Show SLC474 Library SL (Link to library) Clone ID SLC474 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC474Q.Seq.d/ Representative seq. ID SLC47...4Z (Link to Original site) Representative DNA sequence >SLC474 (SLC474Q) /CSM/SL/SLC4-D/SLC474Q.Seq.d/ XXXXX... Score E Sequences producing significant alignments: (bits) Value SLC474 (SLC474Q) /CSM/SL/SLC4-D/SLC474Q.Se

  14. Deletion of the γ-Aminobutyric Acid Transporter 2 (GAT2 and SLC6A13) Gene in Mice Leads to Changes in Liver and Brain Taurine Contents*

    Science.gov (United States)

    Zhou, Yun; Holmseth, Silvia; Guo, Caiying; Hassel, Bjørnar; Höfner, Georg; Huitfeldt, Henrik S.; Wanner, Klaus T.; Danbolt, Niels C.

    2012-01-01

    The GABA transporters (GAT1, GAT2, GAT3, and BGT1) have mostly been discussed in relation to their potential roles in controlling the action of transmitter GABA in the nervous system. We have generated the first mice lacking the GAT2 (slc6a13) gene. Deletion of GAT2 (both mRNA and protein) neither affected growth, fertility, nor life span under nonchallenging rearing conditions. Immunocytochemistry showed that the GAT2 protein was predominantly expressed in the plasma membranes of periportal hepatocytes and in the basolateral membranes of proximal tubules in the renal cortex. This was validated by processing tissue from wild-type and knockout mice in parallel. Deletion of GAT2 reduced liver taurine levels by 50%, without affecting the expression of the taurine transporter TAUT. These results suggest an important role for GAT2 in taurine uptake from portal blood into liver. In support of this notion, GAT2-transfected HEK293 cells transported [3H]taurine. Furthermore, most of the uptake of [3H]GABA by cultured rat hepatocytes was due to GAT2, and this uptake was inhibited by taurine. GAT2 was not detected in brain parenchyma proper, excluding a role in GABA inactivation. It was, however, expressed in the leptomeninges and in a subpopulation of brain blood vessels. Deletion of GAT2 increased brain taurine levels by 20%, suggesting a taurine-exporting role for GAT2 in the brain. PMID:22896705

  15. Dicty_cDB: SLC441 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC441 (Link to dictyBase) - - - Contig-U00414-1 SLC441P (Link to Original site) SLC4...41F 207 SLC441Z 473 SLC441P 680 - - Show SLC441 Library SL (Link to library) Clone ID SLC4... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC441Q.Seq.d/ Representative seq. ID SLC4...41P (Link to Original site) Representative DNA sequence >SLC441 (SLC441Q) /CSM/SL/SLC4-B/SLC4...Q) /CSM/SL/SLI1-C/SLI162Q.Seq.d/ 896 0.0 SLC441 (SLC441Q) /CSM/SL/SLC4-B/SLC441Q.Seq.d/ 896 0.0 AFK293 (AFK2

  16. Dicty_cDB: SLC436 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC436 (Link to dictyBase) - - - Contig-U16460-1 SLC436Z (Link... to Original site) - - SLC436Z 344 - - - - Show SLC436 Library SL (Link to library) Clone ID SLC436 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC436Q.Seq.d/ Representative seq. ID SLC43...6Z (Link to Original site) Representative DNA sequence >SLC436 (SLC436Q) /CSM/SL/SLC4-B/SLC436Q.Seq.d/ XXXXX.../CSM/SL/SLE2-C/SLE258Q.Seq.d/ 470 e-132 SLC773 (SLC773Q) /CSM/SL/SLC7-D/SLC773Q.Seq.d/ 470 e-132 SLC4

  17. Dicty_cDB: SLC483 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC483 (Link to dictyBase) - - - Contig-U16486-1 SLC483F (Link to Original site) SLC4...83F 718 - - - - - - Show SLC483 Library SL (Link to library) Clone ID SLC483 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC483Q.Seq.d/ Representative seq. ID SLC48...3F (Link to Original site) Representative DNA sequence >SLC483 (SLC483Q) /CSM/SL/SLC4-D/SLC483Q.Seq.d/ AAAAA...roducing significant alignments: (bits) Value SLC483 (SLC483Q) /CSM/SL/SLC4-D/SLC483Q.Seq.d/ 1423 0.0 SLE651

  18. Dicty_cDB: SLC434 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC434 (Link to dictyBase) - - - Contig-U15434-1 SLC434Z (Link... to Original site) - - SLC434Z 438 - - - - Show SLC434 Library SL (Link to library) Clone ID SLC434 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC434Q.Seq.d/ Representative seq. ID SLC43...4Z (Link to Original site) Representative DNA sequence >SLC434 (SLC434Q) /CSM/SL/SLC4-B/SLC434Q.Seq.d/ XXXXX...logy vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC434 (SLC434Q) /CSM/SL/SLC4-B/SLC4

  19. Dicty_cDB: SLC450 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC450 (Link to dictyBase) - - - Contig-U16382-1 SLC450Z (Link... to Original site) - - SLC450Z 416 - - - - Show SLC450 Library SL (Link to library) Clone ID SLC450 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC450Q.Seq.d/ Representative seq. ID SLC45...0Z (Link to Original site) Representative DNA sequence >SLC450 (SLC450Q) /CSM/SL/SLC4-C/SLC450Q.Seq.d/ XXXXX...cant alignments: (bits) Value SLC450 (SLC450Q) /CSM/SL/SLC4-C/SLC450Q.Seq.d/ 678 0.0 VFO858 (VFO858Q) /CSM/V

  20. Dicty_cDB: SLC469 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC469 (Link to dictyBase) - - - Contig-U16584-1 SLC469P (Link to Original site) SLC4...69F 676 SLC469Z 397 SLC469P 1073 - - Show SLC469 Library SL (Link to library) Clone ID SLC4...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC469Q.Seq.d/ Representative seq. ID SLC4...69P (Link to Original site) Representative DNA sequence >SLC469 (SLC469Q) /CSM/SL/SLC4-C/SLC4...sfflc sklvvik*ncynyp Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC469 (SLC4

  1. Dicty_cDB: SLC452 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC452 (Link to dictyBase) - - - Contig-U08358-1 SLC452E (Link to Original site) SLC4...52F 537 SLC452Z 347 SLC452P 884 SLC452E 537 Show SLC452 Library SL (Link to library) Clone ID SLC4...nal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC452Q.Seq.d/ Representative seq. ID SLC4...52E (Link to Original site) Representative DNA sequence >SLC452 (SLC452Q) /CSM/SL/SLC4-C/SLC4...slvtpplffq*skk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC4

  2. Dicty_cDB: SLC473 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC473 (Link to dictyBase) - - - Contig-U16054-1 SLC473F (Link to Original site) SLC4...73F 698 - - - - - - Show SLC473 Library SL (Link to library) Clone ID SLC473 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC473Q.Seq.d/ Representative seq. ID SLC47...3F (Link to Original site) Representative DNA sequence >SLC473 (SLC473Q) /CSM/SL/SLC4-D/SLC473Q.Seq.d/ AGAAA... CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC473 (SLC473Q) /CSM/SL/SLC4

  3. Expression and regulation of transmembrane transporters in healthy intestine and gastrointestinal diseases

    OpenAIRE

    Hruz, Petr

    2006-01-01

    Transmembrane transporters mediate energy dependent or independent translocation of drugs, potentially toxic compounds, and of various endogenous substrates such as bile acids and bilirubin across membranes. In this thesis the focus is on two classes of transporters, the ATPbinding cassette (ABC) transporters, which mediate ATP dependent transport and the solute carriers (SLC) which use electrochemical gradients for their transport. The transporters are expressed on membranes o...

  4. Dicty_cDB: SLC486 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC486 (Link to dictyBase) - - - Contig-U16480-1 SLC486E (Link... to Original site) - - - - - - SLC486E 451 Show SLC486 Library SL (Link to library) Clone ID SLC486 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC486Q.Seq.d/ Representative seq. ID SLC48...6E (Link to Original site) Representative DNA sequence >SLC486 (SLC486Q) /CSM/SL/SLC4-D/SLC486Q.Seq.d/ GTCAT...7Q.Seq.d/ 868 0.0 SLD427 (SLD427Q) /CSM/SL/SLD4-B/SLD427Q.Seq.d/ 868 0.0 SLC486 (SLC486Q) /CSM/SL/SLC4-D/SLC4

  5. Dicty_cDB: SLC470 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC470 (Link to dictyBase) - - - Contig-U15735-1 SLC470Z (Link... to Original site) - - SLC470Z 386 - - - - Show SLC470 Library SL (Link to library) Clone ID SLC470 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC470Q.Seq.d/ Representative seq. ID SLC47...0Z (Link to Original site) Representative DNA sequence >SLC470 (SLC470Q) /CSM/SL/SLC4-C/SLC470Q.Seq.d/ XXXXX...Seq.d/ 533 e-151 SLF229 (SLF229Q) /CSM/SL/SLF2-B/SLF229Q.Seq.d/ 533 e-151 SLC470 (SLC470Q) /CSM/SL/SLC4-C/SLC4

  6. Dicty_cDB: SLC487 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC487 (Link to dictyBase) - - - Contig-U12865-1 SLC487Z (Link... to Original site) - - SLC487Z 404 - - - - Show SLC487 Library SL (Link to library) Clone ID SLC487 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC487Q.Seq.d/ Representative seq. ID SLC48...7Z (Link to Original site) Representative DNA sequence >SLC487 (SLC487Q) /CSM/SL/SLC4-D/SLC487Q.Seq.d/ XXXXX...1 0.0 SSF377 (SSF377Q) /CSM/SS/SSF3-D/SSF377Q.Seq.d/ 801 0.0 SLC492 (SLC492Q) /CSM/SL/SLC4-D/SLC4

  7. Timing jitter measurements at the SLC electron source

    International Nuclear Information System (INIS)

    Sodja, J.; Browne, M.J.; Clendenin, J.E.

    1989-03-01

    The SLC thermionic gun and electron source produce a beam of up to 15 /times/ 10 10 /sub e//minus/ in a single S-band bunch. A 170 keV, 2 ns FWHM pulse out of the gun is compressed by means of two subharmonic buncher cavities followed by an S-band buncher and a standard SLAC accelerating section. Ceramic gaps in the beam pipe at the output of the gun allow a measure of the beam intensity and timing. A measurement at these gaps of the timing jitter, with a resolution of <10 ps, is described. 3 refs., 5 figs

  8. Dicty_cDB: SLC431 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC431 (Link to dictyBase) - - - Contig-U15865-1 SLC431Z (Link... to Original site) - - SLC431Z 405 - - - - Show SLC431 Library SL (Link to library) Clone ID SLC431 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC431Q.Seq.d/ Representative seq. ID SLC43...1Z (Link to Original site) Representative DNA sequence >SLC431 (SLC431Q) /CSM/SL/SLC4-B/SLC431Q.Seq.d/ XXXXX...omology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC431 (SLC4

  9. Dicty_cDB: SLC465 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC465 (Link to dictyBase) - G01923 DDB0190872 Contig-U14177-1 SLC4...65P (Link to Original site) SLC465F 725 SLC465Z 393 SLC465P 1118 - - Show SLC465 Library SL (Link to library) Clone ID SLC4...Contig-U14177-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...65Q.Seq.d/ Representative seq. ID SLC465P (Link to Original site) Representative DNA sequence >SLC465 (SLC465Q) /CSM/SL/SLC4...-C/SLC465Q.Seq.d/ CGTTAACAGATTTTAATATTACTAATATTGTAGAAAATGATTTTAAATAAAGTAGCAAAA TGTTATG

  10. Dicty_cDB: SLC426 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC426 (Link to dictyBase) - G01922 DDB0233225 Contig-U14991-1 SLC4...26E (Link to Original site) SLC426F 335 SLC426Z 320 SLC426P 655 SLC426E 335 Show SLC426 Library SL (Lin...Contig Contig-U14991-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC4...26Q.Seq.d/ Representative seq. ID SLC426E (Link to Original site) Representative DNA sequence >SLC426 (SLC4...26Q) /CSM/SL/SLC4-B/SLC426Q.Seq.d/ AAATAATAAATAGTAAATAATAAATAATAATAAATAATAATAATAATATTTNAAAATGGG

  11. Dicty_cDB: SLC464 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC464 (Link to dictyBase) - - - Contig-U00917-1 SLC464Z (Link... to Original site) - - SLC464Z 406 - - - - Show SLC464 Library SL (Link to library) Clone ID SLC464 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC464Q.Seq.d/ Representative seq. ID SLC46...4Z (Link to Original site) Representative DNA sequence >SLC464 (SLC464Q) /CSM/SL/SLC4-C/SLC464Q.Seq.d/ XXXXX... Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC464 (SLC4

  12. Dicty_cDB: SLC477 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC477 (Link to dictyBase) - - - Contig-U16260-1 SLC477Z (Link... to Original site) - - SLC477Z 326 - - - - Show SLC477 Library SL (Link to library) Clone ID SLC477 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC477Q.Seq.d/ Representative seq. ID SLC47...7Z (Link to Original site) Representative DNA sequence >SLC477 (SLC477Q) /CSM/SL/SLC4-D/SLC477Q.Seq.d/ XXXXX...hfefsnivikskkkkkkkkkkkkkk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value SLC477 (SLC4

  13. Dicty_cDB: SLC492 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC492 (Link to dictyBase) - - - Contig-U10734-1 | Contig-U12865-1 SLC4...92P (Link to Original site) SLC492F 645 SLC492Z 550 SLC492P 1195 - - Show SLC492 Library SL (Link to library) Clone ID SLC4...734-1 | Contig-U12865-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC4...92Q.Seq.d/ Representative seq. ID SLC492P (Link to Original site) Representative DNA sequence >SLC492 (SLC4...92Q) /CSM/SL/SLC4-D/SLC492Q.Seq.d/ AAAAAAAAAATATACAAATAATGAATAAATTTTTAGCTTTGTTATTTGTTTTAGCTTTGT

  14. Dicty_cDB: SLC432 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC432 (Link to dictyBase) - - - Contig-U09715-1 | Contig-U16382-1 SLC4...32P (Link to Original site) SLC432F 633 SLC432Z 188 SLC432P 821 - - Show SLC432 Library SL (Link to library) Clone ID SLC4...15-1 | Contig-U16382-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC4...32Q.Seq.d/ Representative seq. ID SLC432P (Link to Original site) Representative DNA sequence >SLC432 (SLC4...32Q) /CSM/SL/SLC4-B/SLC432Q.Seq.d/ ATTAAATTAAATAAAAAATAAAAATGGATGGTGAAGATGTTCAAGCTTTAGTTATTGATA

  15. Dicty_cDB: SLC442 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC442 (Link to dictyBase) - - - Contig-U16430-1 SLC442Z (Link... to Original site) - - SLC442Z 467 - - - - Show SLC442 Library SL (Link to library) Clone ID SLC442 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC442Q.Seq.d/ Representative seq. ID SLC44...2Z (Link to Original site) Representative DNA sequence >SLC442 (SLC442Q) /CSM/SL/SLC4-B/SLC442Q.Seq.d/ XXXXX... 4.0 %: extracellular, including cell wall 4.0 %: peroxisomal >> prediction for SLC4

  16. Dicty_cDB: SLC478 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC478 (Link to dictyBase) - - - Contig-U16419-1 SLC478Z (Link... to Original site) - - SLC478Z 400 - - - - Show SLC478 Library SL (Link to library) Clone ID SLC478 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC478Q.Seq.d/ Representative seq. ID SLC47...8Z (Link to Original site) Representative DNA sequence >SLC478 (SLC478Q) /CSM/SL/SLC4-D/SLC478Q.Seq.d/ XXXXX... %: cytoplasmic 28.0 %: nuclear 24.0 %: mitochondrial 12.0 %: cytoskeletal >> prediction for SLC4

  17. Dicty_cDB: SLC448 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC448 (Link to dictyBase) - - - Contig-U15118-1 SLC448E (Link... to Original site) - - - - - - SLC448E 245 Show SLC448 Library SL (Link to library) Clone ID SLC448 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC448Q.Seq.d/ Representative seq. ID SLC44...8E (Link to Original site) Representative DNA sequence >SLC448 (SLC448Q) /CSM/SL/SLC4-B/SLC448Q.Seq.d/ GGTAA... %: nuclear 12.0 %: mitochondrial 8.0 %: cytoskeletal 4.0 %: endoplasmic reticulum >> prediction for SLC4

  18. Dicty_cDB: SLC438 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC438 (Link to dictyBase) - - - Contig-U10771-1 SLC438Z (Link... to Original site) - - SLC438Z 549 - - - - Show SLC438 Library SL (Link to library) Clone ID SLC438 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC438Q.Seq.d/ Representative seq. ID SLC43...8Z (Link to Original site) Representative DNA sequence >SLC438 (SLC438Q) /CSM/SL/SLC4-B/SLC438Q.Seq.d/ XXXXX...es producing significant alignments: (bits) Value SSM825 (SSM825Q) /CSM/SS/SSM8-B/SSM825Q.Seq.d/ 948 0.0 SLC438 (SLC4

  19. Dicty_cDB: SLC440 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC440 (Link to dictyBase) - G22407 DDB0231506 Contig-U13322-1 | Contig-U16512-1 SLC4...40P (Link to Original site) SLC440F 491 SLC440Z 449 SLC440P 940 - - Show SLC440 Libra...ry SL (Link to library) Clone ID SLC440 (Link to dictyBase) Atlas ID - NBRP ID G22407 dictyBase ID DDB023150...cdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC440Q.Seq.d/ Representative seq. ID SLC440P (Link to Original site) R...epresentative DNA sequence >SLC440 (SLC440Q) /CSM/SL/SLC4-B/SLC440Q.Seq.d/ GGAGATTTCACCACCACCAACAGAACAACACCA

  20. Dicty_cDB: SLC466 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC466 (Link to dictyBase) - - - Contig-U16381-1 SLC466Z (Link... to Original site) - - SLC466Z 427 - - - - Show SLC466 Library SL (Link to library) Clone ID SLC466 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC466Q.Seq.d/ Representative seq. ID SLC46...6Z (Link to Original site) Representative DNA sequence >SLC466 (SLC466Q) /CSM/SL/SLC4-C/SLC466Q.Seq.d/ XXXXX... AU034556 ) Dictyostelium discoideum slug cDNA, clone SLC466. 176 2e-77 2 ( AU033496 ) Dictyostelium discoid

  1. Dicty_cDB: SLC461 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC461 (Link to dictyBase) - - - Contig-U16382-1 SLC461Z (Link... to Original site) - - SLC461Z 386 - - - - Show SLC461 Library SL (Link to library) Clone ID SLC461 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC461Q.Seq.d/ Representative seq. ID SLC46...1Z (Link to Original site) Representative DNA sequence >SLC461 (SLC461Q) /CSM/SL/SLC4-C/SLC461Q.Seq.d/ XXXXX...e-155 2 ( AU034553 ) Dictyostelium discoideum slug cDNA, clone SLC461. 531 e-155 2 ( AU052473 ) Dictyosteliu

  2. Dicty_cDB: SLC437 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC437 (Link to dictyBase) - - - Contig-U16397-1 SLC437Z (Link... to Original site) - - SLC437Z 622 - - - - Show SLC437 Library SL (Link to library) Clone ID SLC437 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC437Q.Seq.d/ Representative seq. ID SLC43...7Z (Link to Original site) Representative DNA sequence >SLC437 (SLC437Q) /CSM/SL/SLC4-B/SLC437Q.Seq.d/ XXXXX...scoideum slug cDNA, clone SLC437. 1158 0.0 1 ( AU033994 ) Dictyostelium discoideum slug cDNA, clone SLB708.

  3. Dicty_cDB: SLC490 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC490 (Link to dictyBase) - - - Contig-U16444-1 SLC490Z (Link... to Original site) - - SLC490Z 427 - - - - Show SLC490 Library SL (Link to library) Clone ID SLC490 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC490Q.Seq.d/ Representative seq. ID SLC49...0Z (Link to Original site) Representative DNA sequence >SLC490 (SLC490Q) /CSM/SL/SLC4-D/SLC490Q.Seq.d/ XXXXX...itochondrial 24.0 %: cytoplasmic 24.0 %: nuclear 4.0 %: cytoskeletal 4.0 %: plasma membrane 4.0 %: peroxisomal >> prediction for SLC4

  4. Dicty_cDB: SLC484 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC484 (Link to dictyBase) - - - Contig-U15497-1 SLC484Z (Link... to Original site) - - SLC484Z 462 - - - - Show SLC484 Library SL (Link to library) Clone ID SLC484 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC484Q.Seq.d/ Representative seq. ID SLC48...4Z (Link to Original site) Representative DNA sequence >SLC484 (SLC484Q) /CSM/SL/SLC4-D/SLC484Q.Seq.d/ XXXXX...mic 32.0 %: mitochondrial 16.0 %: nuclear 4.0 %: peroxisomal 4.0 %: endoplasmic reticulum >> prediction for SLC4

  5. Dicty_cDB: SLC433 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC433 (Link to dictyBase) - - - Contig-U16397-1 SLC433Z (Link... to Original site) - - SLC433Z 613 - - - - Show SLC433 Library SL (Link to library) Clone ID SLC433 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC433Q.Seq.d/ Representative seq. ID SLC43...3Z (Link to Original site) Representative DNA sequence >SLC433 (SLC433Q) /CSM/SL/SLC4-B/SLC433Q.Seq.d/ XXXXX...tyostelium discoideum slug cDNA, clone SLH872. 1134 0.0 1 ( AU034279 ) Dictyostelium discoideum slug cDNA, clone SLC4

  6. Congenital Chloride-Losing Diarrhea in a Mexican child with the novel homozygous SLC26A3 mutation G393W

    Directory of Open Access Journals (Sweden)

    Fabian R. Reimold

    2015-06-01

    Full Text Available Congenital chloride diarrhea is an autosomal recessive disease caused by mutations in the intestinal lumenal membrane Cl-/HCO3- exchanger, SLC26A3.We report here the novel SLC26A3 mutation G393W in a Mexican child, the first such report in a patient from Central America. SLC26A3 G393W expression in Xenopus oocytes exhibits a mild hypomorphic phenotype, with normal surface expression and moderately reduced anion transport function. However, expression of HA-SLC26A3 in HEK-293 cells reveals intracellular retention and greatly decreased steady-state levels of the mutant polypeptide, in contrast to peripheral membrane expression of the wildtype protein. Whereas wildtype HA-SLC26A3 is apically localized in polarized monolayers of filter-grown MDCK cells and Caco2 cells, mutant HA-SLC26A3 G393W exhibits decreased total polypeptide abundance, with reduced or absent surface expression and sparse punctate (or absent intracellular distribution. The WT protein is similarly localized in LLCPK1 cells, but the mutant fails to accumulate to detectable levels. We conclude that the chloride-losing diarrhea phenotype associated with homozygous expression of SLC26A3 G393W likely reflects lack of apical surface expression in enterocytes, secondary to combined abnormalities in polypeptide trafficking and stability. Future progress in development of general or target-specific folding chaperonins and correctors may hold promise for pharmacological rescue of this and similar genetic defects in membrane protein targeting.

  7. Hepatic uptake of conjugated bile acids is mediated by both sodium taurocholate cotransporting polypeptide and organic anion transporting polypeptides and modulated by intestinal sensing of plasma bile acid levels in mice.

    Science.gov (United States)

    Slijepcevic, Davor; Roscam Abbing, Reinout L P; Katafuchi, Takeshi; Blank, Antje; Donkers, Joanne M; van Hoppe, Stéphanie; de Waart, Dirk R; Tolenaars, Dagmar; van der Meer, Jonathan H M; Wildenberg, Manon; Beuers, Ulrich; Oude Elferink, Ronald P J; Schinkel, Alfred H; van de Graaf, Stan F J

    2017-11-01

    The Na + -taurocholate cotransporting polypeptide (NTCP/SLC10A1) is believed to be pivotal for hepatic uptake of conjugated bile acids. However, plasma bile acid levels are normal in a subset of NTCP knockout mice and in mice treated with myrcludex B, a specific NTCP inhibitor. Here, we elucidated which transport proteins mediate the hepatic uptake of conjugated bile acids and demonstrated intestinal sensing of elevated bile acid levels in plasma in mice. Mice or healthy volunteers were treated with myrcludex B. Hepatic bile acid uptake kinetics were determined in wild-type (WT), organic anion transporting polypeptide (OATP) knockout mice (lacking Slco1a/1b isoforms), and human OATP1B1-transgenic mice. Effects of fibroblast growth factor 19 (FGF19) on hepatic transporter mRNA levels were assessed in rat hepatoma cells and in mice by peptide injection or adeno-associated virus-mediated overexpression. NTCP inhibition using myrcludex B had only moderate effects on bile acid kinetics in WT mice, but completely inhibited active transport of conjugated bile acid species in OATP knockout mice. Cholesterol 7α-hydroxylase Cyp7a1 expression was strongly down-regulated upon prolonged inhibition of hepatic uptake of conjugated bile acids. Fgf15 (mouse counterpart of FGF19) expression was induced in hypercholanemic OATP and NTCP knockout mice, as well as in myrcludex B-treated cholestatic mice, whereas plasma FGF19 was not induced in humans treated with myrcludex B. Fgf15/FGF19 expression was induced in polarized human enterocyte-models and mouse organoids by basolateral incubation with a high concentration (1 mM) of conjugated bile acids. NTCP and OATPs contribute to hepatic uptake of conjugated bile acids in mice, whereas the predominant uptake in humans is NTCP mediated. Enterocytes sense highly elevated levels of (conjugated) bile acids in the systemic circulation to induce FGF15/19, which modulates hepatic bile acid synthesis and uptake. (Hepatology 2017;66:1631-1643).

  8. Dicty_cDB: SLC460 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC460 (Link to dictyBase) - - - - SLC460Z (Link to Original site) - - SLC4...60Z 333 - - - - Show SLC460 Library SL (Link to library) Clone ID SLC460 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...60Q.Seq.d/ Representative seq. ID SLC460Z (Link to Original site) R...epresentative DNA sequence >SLC460 (SLC460Q) /CSM/SL/SLC4-C/SLC460Q.Seq.d/ XXXXXXXXXXAATTATTATTGTGTAATTCCTGT

  9. Dicty_cDB: SLC496 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC496 (Link to dictyBase) - - - - SLC496E (Link to Original site) - - - - - - SLC4...96E 443 Show SLC496 Library SL (Link to library) Clone ID SLC496 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-D/SLC4...96Q.Seq.d/ Representative seq. ID SLC496E (Link to Original site) R...epresentative DNA sequence >SLC496 (SLC496Q) /CSM/SL/SLC4-D/SLC496Q.Seq.d/ AAGAAATTTGAATCACTCCAAATCATTATCCCA

  10. Dicty_cDB: SLC449 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC449 (Link to dictyBase) - - - - SLC449Z (Link to Original site) - - SLC4...49Z 384 - - - - Show SLC449 Library SL (Link to library) Clone ID SLC449 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-C/SLC4...49Q.Seq.d/ Representative seq. ID SLC449Z (Link to Original site) R...epresentative DNA sequence >SLC449 (SLC449Q) /CSM/SL/SLC4-C/SLC449Q.Seq.d/ XXXXXXXXXXGTAAAAAGGAACACCAAGCCACT

  11. Morphological study on dental caries induced in WBN/KobSlc rats (Rattus norvegicus) fed a standard laboratory diet.

    Science.gov (United States)

    Fukuzato, Yoko; Matsuura, Tetsuro; Ozaki, Kiyokazu; Matsuura, Masahiro; Sano, Tomoya; Nakahara, Yutaka; Kodama, Yasushi; Nakagawa, Akihito; Okamura, Sumie; Suido, Hirohisa; Torii, Kayo; Makino, Taketoshi; Narama, Isao

    2009-10-01

    In our previous studies, WBN/KobSlc was characterized as a rat strain in which only males began to develop pancreatitis, and then presented with diabetic symptoms. In the course of studying their pancreatic inflammation, we detected molar caries in prediabetic males feeding on a standard diet (CRF-1) widely used for experimental animals. The purpose of this study is to confirm whether the WBN/KobSlc strain is caries-susceptible to the diet reported to be non-cariogenic, and to examine the effect of a prediabetic condition on their dental caries. For a morphological study, 25 male WBN/KobSlc rats aged 3.2-7.8 months and 24 females of the same strain aged 3.3-6.6 months were used, along with 10 males and 10 females of 8.2-month-old F344 rats. Marked dental caries were detected in the mandibular molars of male and female WBN/KobSlc rats regardless of pancreatitis, although no similar changes were observed in any teeth of the F344 strain fed the same diet. Soft X-ray examination revealed that the caries began in the crown and progressed horizontally and vertically, and that a severe radiolucent lesion extensively expanded to the entire crown, corresponding to a macroscopically deleted molar. The caries had gradually developed mainly in the second mandibular molar from more than 3.5 months of age, while none were seen in any rats before that time. The WBN/KobSlc rats were caries-susceptible even to the standard laboratory diet, and pancreatitis was not directly associated with the onset of dental caries in this strain.

  12. Lack of Association between SLC30A8 Variants and Type 2 Diabetes in Mexican American Families

    Directory of Open Access Journals (Sweden)

    Hemant Kulkarni

    2016-01-01

    Full Text Available SLC30A8 encodes zinc transporter 8 which is involved in packaging and release of insulin. Evidence for the association of SLC30A8 variants with type 2 diabetes (T2D is inconclusive. We interrogated single nucleotide polymorphisms (SNPs around SLC30A8 for association with T2D in high-risk, pedigreed individuals from extended Mexican American families. This study of 118 SNPs within 50 kb of the SLC30A8 locus tested the association with eight T2D-related traits at four levels: (i each SNP using measured genotype approach (MGA; (ii interaction of SNPs with age and sex; (iii combinations of SNPs using Bayesian Quantitative Trait Nucleotide (BQTN analyses; and (iv entire gene locus using the gene burden test. Only one SNP (rs7817754 was significantly associated with incident T2D but a summary statistic based on all T2D-related traits identified 11 novel SNPs. Three SNPs and one SNP were weakly but interactively associated with age and sex, respectively. BQTN analyses could not demonstrate any informative combination of SNPs over MGA. Lastly, gene burden test results showed that at best the SLC30A8 locus could account for only 1-2% of the variability in T2D-related traits. Our results indicate a lack of association of the SLC30A8 SNPs with T2D in Mexican American families.

  13. Transcellular movement of hydroxyurea is mediated by specific solute carrier transporters

    Science.gov (United States)

    Walker, Aisha L.; Franke, Ryan M.; Sparreboom, Alex; Ware, Russell E.

    2015-01-01

    Objective Hydroxyurea has proven laboratory and clinical therapeutic benefits for sickle cell anemia (SCA) and other diseases, yet many questions remain regarding its in vivo pharmacokinetic and pharmacodynamic profiles. Previous reports suggest that hydroxyurea passively diffuses across cells, but its observed rapid absorption and distribution are more consistent with facilitated or active transport. We investigated the potential role of solute carrier (SLC) transporters in cellular uptake and accumulation of hydroxyurea. Materials and Methods Passive diffusion of hydroxyurea across cell membranes was determined using the parallel artificial membrane permeability assay. SLC transporter screens were conducted using in vitro intracellular drug accumulation and transcellular transport assays in cell lines and oocytes overexpressing SLC transporters. Gene expression of SLC transporters was measured by real-time PCR in human tissues and cell lines. Results Hydroxyurea had minimal diffusion across a lipid bilayer but was a substrate for 5 different SLC transporters belonging to the OCTN and OATP families of transporters and urea transporters A and B. Further characterization of hydroxyurea transport revealed that cellular uptake by OATP1B3 is time and temperature dependent and inhibited by known substrates of OATP1B3. Urea transporters A and B are expressed differentially in human tissues and erythroid cells, and transport hydroxyurea bidirectionally via facilitated diffusion. Conclusions These studies provide new insight into drug transport proteins that may be involved in the in vivo absorption, cellular distribution, and elimination of hydroxyurea. Elucidation of hydroxyurea transcellular movement should improve our understanding of its pharmacokinetics and pharmacodynamics, and may help explain some of the inter-patient drug variability observed in patients with SCA. PMID:21256917

  14. The small intestinal epithelia of beef steers differentially express sugar transporter messenger ribonucleic acid in response to abomasal versus ruminal infusion of starch hydrolysate.

    Science.gov (United States)

    Liao, S F; Harmon, D L; Vanzant, E S; McLeod, K R; Boling, J A; Matthews, J C

    2010-01-01

    In mammals, the absorption of monosaccharides from small intestinal lumen involves at least 3 sugar transporters (SugT): sodium-dependent glucose transporter 1 (SGLT1; gene SLC5A1) transports glucose and galactose, whereas glucose transporter (GLUT) 5 (GLUT5; gene SLC2A5) transports fructose, across the apical membrane of enterocytes. In contrast, GLUT2 (gene SLC2A2) transports all of these sugars across basolateral and apical membranes. To compare the distribution patterns and sensitivity with nutritional regulation of these 3 SugT mRNA in beef cattle small intestinal tissue, 18 ruminally and abomasally catheterized Angus steers (BW approximately 260 kg) were assigned to water (control), ruminal cornstarch (partially hydrolyzed by alpha-amylase; SH), or abomasal SH infusion treatments (n = 6) and fed an alfalfa-cube-based diet at 1.3 x NE(m) requirement. The SH infusions amounted to 20% of ME intake. After 14- or 16-d of infusion, steers were killed; duodenal, jejunal, and ileal epithelia harvested; and total RNA extracted. The relative amount of SugT mRNA in epithelia was determined using real-time reverse transcription-PCR quantification methods. Basal expression of GLUT2 and SGLT1 mRNA was greater (P content of GLUT5 mRNA was greater (P content of GLUT5 mRNA in small intestinal epithelia was not affected (P > or = 0.16) by either SH infusion treatment. In contrast, GLUT2 and SGLT1 mRNA content in the ileal epithelium was increased (P content also was increased (P = 0.07) by 64% after ruminal SH infusion. These results demonstrate that the ileum of beef cattle small intestine adapts to an increased luminal supply of glucose by increasing SGLT1 and GLUT2 mRNA content, whereas increased ruminal SH supply results in duodenal upregulation of SGLT1 mRNA content. These adaptive responses of GLUT2 and SGLT1 mRNA to abomasal or ruminal SH infusion suggest that beef cattle can adapt to increase their carbohydrate assimilation through small intestinal epithelia, assuming

  15. Molecular Determinants for Substrate Interactions with the Glycine Transporter GlyT2.

    Science.gov (United States)

    Carland, Jane E; Thomas, Michael; Mostyn, Shannon N; Subramanian, Nandhitha; O'Mara, Megan L; Ryan, Renae M; Vandenberg, Robert J

    2018-03-21

    Transporters in the SLC6 family play key roles in regulating neurotransmission and are the targets for a wide range of therapeutics. Important insights into the transport mechanisms and the specificity of drug interactions of SLC6 transporters have been obtained from the crystal structures of a bacterial homologue of the family, LeuT Aa , and more recently the Drosophila dopamine transporter and the human serotonin transporter. However, there is disputed evidence that the bacterial leucine transporter, LeuT Aa , contains two substrate binding sites that work cooperatively in the mechanism of transport, with the binding of a second substrate being required for the release of the substrate from the primary site. An alternate proposal is that there may be low affinity binding sites that serve to direct the flow of substrates to the primary site. We have used a combination of molecular dynamics simulations of substrate interactions with a homology model of GlyT2, together with radiolabeled amino acid uptake assays and electrophysiological analysis of wild-type and mutant transporters, to provide evidence that substrate selectivity of GlyT2 is determined entirely by the primary substrate binding site and, furthermore, if a secondary site exists then it is a low affinity nonselective amino acid binding site.

  16. Common Genetic Variation In Cellular Transport Genes and Epithelial Ovarian Cancer (EOC) Risk.

    Science.gov (United States)

    Chornokur, Ganna; Lin, Hui-Yi; Tyrer, Jonathan P; Lawrenson, Kate; Dennis, Joe; Amankwah, Ernest K; Qu, Xiaotao; Tsai, Ya-Yu; Jim, Heather S L; Chen, Zhihua; Chen, Ann Y; Permuth-Wey, Jennifer; Aben, Katja K H; Anton-Culver, Hoda; Antonenkova, Natalia; Bruinsma, Fiona; Bandera, Elisa V; Bean, Yukie T; Beckmann, Matthias W; Bisogna, Maria; Bjorge, Line; Bogdanova, Natalia; Brinton, Louise A; Brooks-Wilson, Angela; Bunker, Clareann H; Butzow, Ralf; Campbell, Ian G; Carty, Karen; Chang-Claude, Jenny; Cook, Linda S; Cramer, Daniel W; Cunningham, Julie M; Cybulski, Cezary; Dansonka-Mieszkowska, Agnieszka; du Bois, Andreas; Despierre, Evelyn; Dicks, Ed; Doherty, Jennifer A; Dörk, Thilo; Dürst, Matthias; Easton, Douglas F; Eccles, Diana M; Edwards, Robert P; Ekici, Arif B; Fasching, Peter A; Fridley, Brooke L; Gao, Yu-Tang; Gentry-Maharaj, Aleksandra; Giles, Graham G; Glasspool, Rosalind; Goodman, Marc T; Gronwald, Jacek; Harrington, Patricia; Harter, Philipp; Hein, Alexander; Heitz, Florian; Hildebrandt, Michelle A T; Hillemanns, Peter; Hogdall, Claus K; Hogdall, Estrid; Hosono, Satoyo; Jakubowska, Anna; Jensen, Allan; Ji, Bu-Tian; Karlan, Beth Y; Kelemen, Linda E; Kellar, Mellissa; Kiemeney, Lambertus A; Krakstad, Camilla; Kjaer, Susanne K; Kupryjanczyk, Jolanta; Lambrechts, Diether; Lambrechts, Sandrina; Le, Nhu D; Lee, Alice W; Lele, Shashi; Leminen, Arto; Lester, Jenny; Levine, Douglas A; Liang, Dong; Lim, Boon Kiong; Lissowska, Jolanta; Lu, Karen; Lubinski, Jan; Lundvall, Lene; Massuger, Leon F A G; Matsuo, Keitaro; McGuire, Valerie; McLaughlin, John R; McNeish, Iain; Menon, Usha; Milne, Roger L; Modugno, Francesmary; Moysich, Kirsten B; Ness, Roberta B; Nevanlinna, Heli; Eilber, Ursula; Odunsi, Kunle; Olson, Sara H; Orlow, Irene; Orsulic, Sandra; Weber, Rachel Palmieri; Paul, James; Pearce, Celeste L; Pejovic, Tanja; Pelttari, Liisa M; Pike, Malcolm C; Poole, Elizabeth M; Risch, Harvey A; Rosen, Barry; Rossing, Mary Anne; Rothstein, Joseph H; Rudolph, Anja; Runnebaum, Ingo B; Rzepecka, Iwona K; Salvesen, Helga B; Schernhammer, Eva; Schwaab, Ira; Shu, Xiao-Ou; Shvetsov, Yurii B; Siddiqui, Nadeem; Sieh, Weiva; Song, Honglin; Southey, Melissa C; Spiewankiewicz, Beata; Sucheston, Lara; Teo, Soo-Hwang; Terry, Kathryn L; Thompson, Pamela J; Thomsen, Lotte; Tangen, Ingvild L; Tworoger, Shelley S; van Altena, Anne M; Vierkant, Robert A; Vergote, Ignace; Walsh, Christine S; Wang-Gohrke, Shan; Wentzensen, Nicolas; Whittemore, Alice S; Wicklund, Kristine G; Wilkens, Lynne R; Wu, Anna H; Wu, Xifeng; Woo, Yin-Ling; Yang, Hannah; Zheng, Wei; Ziogas, Argyrios; Hasmad, Hanis N; Berchuck, Andrew; Iversen, Edwin S; Schildkraut, Joellen M; Ramus, Susan J; Goode, Ellen L; Monteiro, Alvaro N A; Gayther, Simon A; Narod, Steven A; Pharoah, Paul D P; Sellers, Thomas A; Phelan, Catherine M

    2015-01-01

    Defective cellular transport processes can lead to aberrant accumulation of trace elements, iron, small molecules and hormones in the cell, which in turn may promote the formation of reactive oxygen species, promoting DNA damage and aberrant expression of key regulatory cancer genes. As DNA damage and uncontrolled proliferation are hallmarks of cancer, including epithelial ovarian cancer (EOC), we hypothesized that inherited variation in the cellular transport genes contributes to EOC risk. In total, DNA samples were obtained from 14,525 case subjects with invasive EOC and from 23,447 controls from 43 sites in the Ovarian Cancer Association Consortium (OCAC). Two hundred seventy nine SNPs, representing 131 genes, were genotyped using an Illumina Infinium iSelect BeadChip as part of the Collaborative Oncological Gene-environment Study (COGS). SNP analyses were conducted using unconditional logistic regression under a log-additive model, and the FDR q<0.2 was applied to adjust for multiple comparisons. The most significant evidence of an association for all invasive cancers combined and for the serous subtype was observed for SNP rs17216603 in the iron transporter gene HEPH (invasive: OR = 0.85, P = 0.00026; serous: OR = 0.81, P = 0.00020); this SNP was also associated with the borderline/low malignant potential (LMP) tumors (P = 0.021). Other genes significantly associated with EOC histological subtypes (p<0.05) included the UGT1A (endometrioid), SLC25A45 (mucinous), SLC39A11 (low malignant potential), and SERPINA7 (clear cell carcinoma). In addition, 1785 SNPs in six genes (HEPH, MGST1, SERPINA, SLC25A45, SLC39A11 and UGT1A) were imputed from the 1000 Genomes Project and examined for association with INV EOC in white-European subjects. The most significant imputed SNP was rs117729793 in SLC39A11 (per allele, OR = 2.55, 95% CI = 1.5-4.35, p = 5.66x10-4). These results, generated on a large cohort of women, revealed associations between inherited cellular transport

  17. Homozygous SLC6A17 Mutations Cause Autosomal-Recessive Intellectual Disability with Progressive Tremor, Speech Impairment, and Behavioral Problems

    OpenAIRE

    Iqbal, Zafar; Willemsen, Marjolein H.; Papon, Marie-Amélie; Musante, Luciana; Benevento, Marco; Hu, Hao; Venselaar, Hanka; Wissink-Lindhout, Willemijn M.; Vulto-van Silfhout, Anneke T.; Vissers, Lisenka E.L.M.; de Brouwer, Arjan P.M.; Marouillat, Sylviane; Wienker, Thomas F.; Ropers, Hans Hilger; Kahrizi, Kimia

    2015-01-01

    We report on Dutch and Iranian families with affected individuals who present with moderate to severe intellectual disability and additional phenotypes including progressive tremor, speech impairment, and behavioral problems in certain individuals. A combination of exome sequencing and homozygosity mapping revealed homozygous mutations c.484G>A (p.Gly162Arg) and c.1898C>G (p.Pro633Arg) in SLC6A17. SLC6A17 is predominantly expressed in the brain, encodes a synaptic vesicular transporter of neu...

  18. Association between the SLC6A3 A1343G polymorphism and schizophrenia Associação entre o polimorfismo A1343G do SLC6A3 e esquizofrenia

    Directory of Open Access Journals (Sweden)

    Quirino Cordeiro

    2010-10-01

    Full Text Available Epidemiological studies have demonstrated that the genetic component is an important risk factor for the development of schizophrenia. The genes that codify the different compounds of the dopaminergic system have created interest for molecular investigations in patients with schizophrenia because the antipsychotic drugs, especially those of first generation, act on this cerebral system. Thus the aim of the present study was to investigate the possible association between a new single nucleotide polymorphism (rs6347 located in exon 9 of the protein transporter (SLC6A3 and schizophrenia. The distribution of the alleles and genotypes of the studied polymorphism was investigated in a sample of 235 patients and 834 controls matched by gender and age. There were statistical differences in the allelic (χ2=5.97, 1d.f. , p=0.01, OR=1.33-1.05Estudos epidemiológicos têm demonstrado que o componente genético é um importante fator de risco para a esquizofrenia. Os genes que codificam os diferentes componentes do sistema dopaminérgico passaram a despertar interesse para estudos moleculares em pacientes com esquizofrenia, pois os antipsicóticos, em especial os de primeira geração, exercem sua ação nesse sistema. Assim, o objetivo do presente estudo foi investigar a associação entre um novo polimorfismo de nucleotídeo único (rs6347 localizado no exon 9 do gene do transportador de dopamina (SLC6A3 e esquizofrenia. Um total de 235 pacientes e 834 controles pareados para sexo e idade foi selecionado para a investigação da distribuição dos alelos e genótipos do polimorfismo investigado entre os grupos de pacientes e controles. Houve diferenças estatisticamente significantes nas distribuições alélicas (χ2=5,97, 1d.f. , p=0,01, OR=1,33-1,05SLC6A3 A1343G mostrou associação com esquizofrenia na amostra estudada.

  19. Ascorbic acid transport and accumulation in human neutrophils

    International Nuclear Information System (INIS)

    Washko, P.; Rotrosen, D.; Levine, M.

    1989-01-01

    The transport, accumulation, and distribution of ascorbic acid were investigated in isolated human neutrophils utilizing a new ascorbic acid assay, which combined the techniques of high performance liquid chromatography and coulometric electrochemical detection. Freshly isolated human neutrophils contained 1.0-1.4 mM ascorbic acid, which was localized greater than or equal to 94% to the cytosol, was not protein bound, and was present only as ascorbic acid and not as dehydroascorbic acid. Upon addition of ascorbic acid to the extracellular medium in physiologic amounts, ascorbic acid was accumulated in neutrophils in millimolar concentrations. Accumulation was mediated by a high affinity and a low affinity transporter; both transporters were responsible for maintenance of concentration gradients as large as 50-fold. The high affinity transporter had an apparent Km of 2-5 microns by Lineweaver-Burk and Eadie-Hofstee analyses, and the low affinity transporter had an apparent Km of 6-7 mM by similar analyses. Each transporter was saturable and temperature dependent. In normal human blood the high affinity transporter should be saturated, whereas the low affinity transporter should be in its linear phase of uptake

  20. SLC polarized beam source electron optics design

    International Nuclear Information System (INIS)

    Eppley, K.R.; Lavine, T.L.; Early, R.A.; Herrmannsfeldt, W.B.; Miller, R.H.; Schultz, D.C.; Spencer, C.M.; Yeremian, A.D.

    1991-05-01

    This paper describes the design of the beam-line from the polarized electron gun to the linac injector in the Stanford Linear Collider (SLC). The polarized electron source is a GaAs photocathode, requiring 10 -11 -Torr-range pressure for adequate quantum efficiency and longevity. The photocathode is illuminated by 3-nsec-long laser pulses. The quality of the optics for the 160-kV beam is crucial since electron-stimulated gas desorption from beam loss in excess of 0.1% of the 20-nC pulses may poison the photocathode. Our design for the transport line consists of a differential pumping region isolated by a pair of valves. Focusing is provided by a pair of Helmholtz coils and by several iron-encased solenoidal lenses. Our optics design is based on beam transport simulations using 2 1/2-D particle-in-cell codes to model the gun and to solve the fully-relativistic time-dependent equations of motion in three dimensions for electrons in the presence of azimuthally symmetric electromagnetic fields. 6 refs., 6 figs

  1. Identification of two novel mutations in the SLC45A2 gene in a Hungarian pedigree affected by unusual OCA type 4.

    Science.gov (United States)

    Tóth, Lola; Fábos, Beáta; Farkas, Katalin; Sulák, Adrienn; Tripolszki, Kornélia; Széll, Márta; Nagy, Nikoletta

    2017-03-15

    Oculocutaneous albinism (OCA) is a clinically and genetically heterogenic group of pigmentation abnormalities. OCA type IV (OCA4, OMIM 606574) develops due to homozygous or compound heterozygous mutations in the solute carrier family 45, member 2 (SLC45A2) gene. This gene encodes a membrane-associated transport protein, which regulates tyrosinase activity and, thus, melanin content by changing melanosomal pH and disrupting the incorporation of copper into tyrosinase. Here we report two Hungarian siblings affected by an unusual OCA4 phenotype. After genomic DNA was isolated from peripheral blood of the patients, the coding regions of the SLC45A2 gene were sequenced. In silico tools were applied to identify the functional impact of the newly detected mutations. Direct sequencing of the SLC45A2 gene revealed two novel, heterozygous mutations, one missense (c.1226G > A, p.Gly409Asp) and one nonsense (c.1459C > T, p.Gln437*), which were present in both patients, suggesting the mutations were compound heterozygous. In silico tools suggest that these variations are disease causing mutations. The newly identified mutations may affect the transmembrane domains of the protein, and could impair transport function, resulting in decreases in both melanosomal pH and tyrosinase activity. Our study provides expands on the mutation spectrum of the SLC45A2 gene and the genetic background of OCA4.

  2. Interaction of GABA-mimetics with the taurine transporter (TauT, Slc6a6) in hyperosmotic treated Caco-2, LLC-PK1 and rat renal SKPT cells.

    Science.gov (United States)

    Rasmussen, Rune Nørgaard; Lagunas, Candela; Plum, Jakob; Holm, René; Nielsen, Carsten Uhd

    2016-01-20

    The aim of the present study was to investigate if basic GABA-mimetics interact with the taurine transporter (TauT, Slc6a6), and to find a suitable cell based model that is robust towards extracellular changes in osmolality during uptake studies. Taurine uptake was measured in human Caco-2 cells, porcine LLC-PK1 cells, and rat SKPT cells using radiolabelled taurine. Hyperosmotic conditions were obtained by incubation with raffinose (final osmolality of 500mOsm) for 24h prior to the uptake experiments. Expression of the taurine transporter, TauT, was investigated at the mRNA level by real-time PCR. Uptake of the GABA-mimetics gaboxadol and vigabatrin was investigated in SKPT cells, and quantified by liquid scintillation or HPLC-MS/MS analysis, respectively. The uptake rate of [(3)H]-taurine was Na(+) and Cl(-) and concentration dependent with taurine with an apparent Vmax of 6.3±1.6pmolcm(-2)min(-1) and a Km of 24.9±15.0μM. β-alanine, nipecotic acid, gaboxadol, GABA, vigabatrin, δ-ALA and guvacine inhibited the taurine uptake rate in a concentration dependent manner. The order of affinity for TauT was β-alanine>GABA>nipecotic acid>guvacine>δ-ALA>vigabatrin>gaboxadol with IC50-values of 0.04, 1.07, 2.02, 4.19, 4.94, 31.4 and 39.9mM, respectively. In conclusion, GABA mimetics inhibited taurine uptake in hyperosmotic rat renal SKPT cells. SKPT cells, which seem to be a useful model for investigating taurine transport in the short-term presence of high concentrations of osmolytes. Furthermore, analogues of β-alanine appear to have higher affinities for TauT than GABA-analogues. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Fatty acid transport protein-2 inhibitor Grassofermata/CB5 protects cells against lipid accumulation and toxicity

    Energy Technology Data Exchange (ETDEWEB)

    Saini, Nipun; Black, Paul N.; Montefusco, David; DiRusso, Concetta C., E-mail: cdirusso2@unl.edu

    2015-09-25

    The inhibition of the fatty acid uptake into non-adipose tissues provides an attractive target for prevention of lipotoxicity leading to obesity-associated non-alcoholic fatty liver disease and type 2 diabetes. Fatty acid transport proteins (FATPs) are bifunctional proteins involved in the uptake and activation of fatty acids by esterification with coenzyme A. Here we characterize Grassofermata/CB5, previously identified as a fatty acid uptake inhibitor directed against HsFATP2. The compound was effective in inhibiting the uptake of fatty acids in the low micro-molar range (IC{sub 50} 8–11 μM) and prevented palmitate-mediated lipid accumulation and cell death in cell lines that are models for intestines, liver, muscle and pancreas. In adipocytes, uptake inhibition was less effective (IC{sub 50} 58 μM). Inhibition was specific for long chain fatty acids and was ineffective toward medium chain fatty acids, which are transported by diffusion. Kinetic analysis of Grassofermata-dependent FA transport inhibition verified a non-competitive mechanism. By comparison with Grassofermata, several atypical antipsychotic drugs previously implicated as inhibitors of FA uptake were ineffectual. In mice Grassofermata decreased absorption of {sup 13}C-oleate demonstrating its potential as a therapeutic agent. - Highlights: • Grassofermata is a small compound inhibitor of FATP2. • Uptake inhibition is specific for long chain fatty acids. • Uptake kinetics shows low specificity for adipocytes compared to other cell types. • Inhibition is by a non-competitive mechanism. • Atypical antipsychotics do not inhibit FA uptake by comparison with Grassofermata.

  4. Fatty acid transport protein-2 inhibitor Grassofermata/CB5 protects cells against lipid accumulation and toxicity

    International Nuclear Information System (INIS)

    Saini, Nipun; Black, Paul N.; Montefusco, David; DiRusso, Concetta C.

    2015-01-01

    The inhibition of the fatty acid uptake into non-adipose tissues provides an attractive target for prevention of lipotoxicity leading to obesity-associated non-alcoholic fatty liver disease and type 2 diabetes. Fatty acid transport proteins (FATPs) are bifunctional proteins involved in the uptake and activation of fatty acids by esterification with coenzyme A. Here we characterize Grassofermata/CB5, previously identified as a fatty acid uptake inhibitor directed against HsFATP2. The compound was effective in inhibiting the uptake of fatty acids in the low micro-molar range (IC 50 8–11 μM) and prevented palmitate-mediated lipid accumulation and cell death in cell lines that are models for intestines, liver, muscle and pancreas. In adipocytes, uptake inhibition was less effective (IC 50 58 μM). Inhibition was specific for long chain fatty acids and was ineffective toward medium chain fatty acids, which are transported by diffusion. Kinetic analysis of Grassofermata-dependent FA transport inhibition verified a non-competitive mechanism. By comparison with Grassofermata, several atypical antipsychotic drugs previously implicated as inhibitors of FA uptake were ineffectual. In mice Grassofermata decreased absorption of 13 C-oleate demonstrating its potential as a therapeutic agent. - Highlights: • Grassofermata is a small compound inhibitor of FATP2. • Uptake inhibition is specific for long chain fatty acids. • Uptake kinetics shows low specificity for adipocytes compared to other cell types. • Inhibition is by a non-competitive mechanism. • Atypical antipsychotics do not inhibit FA uptake by comparison with Grassofermata

  5. The role of SLC2A1 mutations in myoclonic astatic epilepsy and absence epilepsy, and the estimated frequency of GLUT1 deficiency syndrome

    DEFF Research Database (Denmark)

    Larsen, Jan; Johannesen, Katrine Marie; Ek, Jakob

    2015-01-01

    The first mutations identified in SLC2A1, encoding the glucose transporter type 1 (GLUT1) protein of the blood-brain barrier, were associated with severe epileptic encephalopathy. Recently, dominant SLC2A1 mutations were found in rare autosomal dominant families with various forms of epilepsy inc...

  6. Orbit monitoring in the SLC

    International Nuclear Information System (INIS)

    Sanchez-Chopitea, L.; Emma, P.; Van Olst, D.

    1991-05-01

    Beam orbits in the SLC are monitored in real time and the data is stored for future trend and correlation analysis. A background process acquires Beam Position Monitor (BPM) and Toroid data on a periodic basis and saves the general quantities such as orbit RMS and beam intensity in addition to the individual readings. Some of this data is archived by the SLC History Buffer facility and the rest is saved in files for later analysis. This has permitted the tracing of interaction point instabilities to specific devices as far away as the damping rings. In addition, the data is displayed for the operators both in summary and in full form. The different displays can be configured from the control consoles. 2 refs., 5 figs

  7. Breed and species comparison of amino acid transport variation in equine erythrocytes.

    Science.gov (United States)

    Fincham, D A; Young, J D; Mason, D K; Collins, E A; Snow, D H

    1985-05-01

    The amino acid permeability of red blood cells from Equus caballus (thoroughbred, Arab, shire and pony), E przewalskii (Przewalski's horse), E asinus (donkey and mule) and E burchelli (common or plains zebra) was measured. Individual animals exhibited stable but widely differing rates of L-[U-14C]alanine uptake in the range 5 to 1554 mumol (litre cells)-1 h-1 (0.2 mM extracellular L-alanine, 37 degrees C). Of the thoroughbreds tested, 30 per cent had red blood cells which were essentially impermeable to L-alanine (5 to 10 mumol (litre cells)-1 h-1, giving transport rates similar to those found previously in amino acid transport-deficient sheep erythrocytes. In contrast, only 3 per cent of the ponies tested had red blood cells impermeable to L-alanine. No cases of erythrocyte amino acid transport deficiency were found in the other horse breeds and species tested.

  8. Prenatal serotonin reuptake inhibitor (SRI antidepressant exposure and serotonin transporter promoter genotype (SLC6A4 influence executive functions at 6 years of age

    Directory of Open Access Journals (Sweden)

    Whitney eWeikum

    2013-10-01

    Full Text Available Prenatal exposure to serotonin reuptake inhibitor (SRI antidepressants and maternal depression may affect prefrontal cognitive skills (executive functions; EFs including self-control, working memory and cognitive flexibility. We examined long-term effects of prenatal SRI exposure on EFs to determine whether effects are moderated by maternal mood and/or genetic variations in SLC6A4 (a gene that codes for the serotonin transporter [5-HTT] central to the regulation of synaptic serotonin levels and behavior. Children who were exposed to SRIs prenatally (SRI-exposed N=26 and non-exposed (N=38 were studied at age 6 years (M=6.3 SD=0.5 using the Hearts & Flowers task (H&F to assess EFs. Maternal mood was measured during pregnancy (3rd trimester and when the child was age 6 years (Hamilton Depression Scale. Parent reports of child behavior were also obtained (MacArthur Health & Behavior Questionnaire. Parents of prenatally SRI-exposed children reported fewer child externalizing and inattentive (ADHD behaviors. Generalized estimate equation modeling showed a significant 3-way interaction between prenatal SRI exposure, SLC6A4 variant, and maternal mood at the 6-year time-point on H&F accuracy. For prenatally SRI-exposed children, regardless of maternal mood, the H&F accuracy of children with reduced 5HTT expression (a short [S] allele remained stable. Even with increasing maternal depressive symptoms (though all below clinical threshold, EFs of children with at least one short allele were comparable to children with the same genotype whose mothers reported few if any depressive symptoms – in this sense they showed resilience. Children with two long (L alleles were more sensitive to context. When their mothers had few depressive symptoms, LL children showed extremely good EF performance – better than any other group. When their mothers reported more depressive symptoms, LL children’s EF performance was worse than that of any other group.

  9. Looking on the bright side of serotonin transporter gene variation.

    NARCIS (Netherlands)

    Homberg, J.R.; Lesch, K.P.

    2011-01-01

    Converging evidence indicates an association of the short (s), low-expressing variant of the repeat length polymorphism, serotonin transporter-linked polymorphic region (5-HTTLPR), in the human serotonin transporter gene (5-HTT, SERT, SLC6A4) with anxiety-related traits and increased risk for

  10. Effect of Known Inhibitors of Ion Transport on Pendrin (SLC26A4 Activity in a Human Kidney Cell Line

    Directory of Open Access Journals (Sweden)

    Emanuele Bernardinelli

    2016-05-01

    Full Text Available Background/Aims: Pendrin is a Cl-/I-/HCO3- exchanger playing a fundamental role in controlling blood pressure and airway function, therefore representing an attractive target for the treatment of hypertensive states and respiratory distresses. A review of the literature regarding the ability of some compounds (namely several known inhibitors of ion transport to block pendrin activity revealed discordant findings. These incongruous findings may be due, in part, to the concentration of compound and/or the nature of the model system used in the study. Methods: Pendrin activity was evaluated by measuring pendrin-dependent iodide influx following overexpression of the transporter in a human kidney cell line, in the presence of selected test compounds or the respective vehicles. Results: Pendrin activity was significantly hampered by 0.1 mM 5-nitro-2-[(3-phenylpropylamino]benzoic acid (NPPB, niflumic acid and tenidap, but was resistant to 0.1 mM 4, 4′-diisothiocyano-2, 2′-stilbene-disulfonic acid (DIDS, furosemide and probenecid. Conclusions: The results of the present study indicate that clinically effective non-steroidal anti-inflammatory drugs (niflumic acid and tenidap directly inhibit pendrin activity.

  11. Characterizing and evaluating the expression of the type IIb sodium-dependent phosphate cotransporter (slc34a2) gene and its potential influence on phosphorus utilization efficiency in yellow catfish (Pelteobagrus fulvidraco).

    Science.gov (United States)

    Chen, Pei; Tang, Qin; Wang, Chunfang

    2016-02-01

    A sodium-dependent phosphate cotransporter gene, NaPi-IIb (slc34a2), was isolated from yellow catfish (Pelteobagrus fulvidraco) intestine through homology cloning and the rapid amplification of cDNA ends. The full-length cDNA of slc34a2 consisted of 2326 bp with an open reading frame encoding 621 amino acids, a 160-bp 5' untranslated region, and a 300-bp 3' untranslated region. The deduced amino acid sequence showed 79.0 and 70.9% sequence identity to Astyanax mexicanus and Pundamilia nyererei, respectively. The membrane-spanning domains based on the hydrophilic and hydrophobic properties of the deduced amino acids were predicted, and results showed that the putative protein had eight transmembrane domains, with the intracellular NH2 and COOH termini. Two functional regions including first intracellular loop and third extracellular loop as well as the six N-glycosylation sites in second extracellular loop were found. The slc34a2 mRNA in the tested tissues was examined through semiquantitative reverse transcription polymerase chain reaction and quantitative real-time PCR, with the highest level found in the anterior intestine, followed by the posterior and middle intestines. The slc34a2 mRNA expression in the whole intestine under different dietary phosphorus (P) treatments was detected using qPCR. The results showed that the slc34a2 expression levels in the low-P groups (0.33 and 0.56%) were significantly higher (p < 0.05) than levels in the sufficient-P (0.81%) and high-P (1.15, 1.31, and 1.57%) groups. High expression of slc34a2 mRNA in low-P groups stimulated P utilization efficiency, indicating the close relationship between genotype and phenotype in yellow catfish. In contrast with conventional strategies (formula and feeding strategies), this study provided another possible approach by using molecular techniques to increase the P utilization in yellow catfish.

  12. Feedback systems in the SLC

    International Nuclear Information System (INIS)

    Thompson, K.A.; Jobe, R.K.; Johnson, R.; Phinney, N.

    1987-02-01

    Two classes of computer-controlled feedback have been implemented to stabilize parameters in subsystems of the SLC: (1) ''slow'' (time scales ∼ minutes) feedback, and (2) ''fast'', i.e., pulse-to-pulse, feedback. The slow loops run in a single FEEDBACK process in the SLC host VAX, which acquires signals and sets control parameters via communication with the database and the network of normal SLC microprocessors. Slow loops exist to stabilize beam energy and energy spread, beam position and angle, and timing of kicker magnets, and to compensate for changes in the phase length of the rf drive line. The fast loops run in dedicated microprocessors, and may sample and/or feedback on particular parameters as often as every pulse of the SLC beam. The first implementations of fast feedback are to control transverse beam blow-up and to stabilize the energy and energy spread of bunches going into the SLC arcs. The overall architecture of the feedback software and the operator interface for controlling loops are discussed

  13. Up-Regulation of Excitatory Amino Acid Transporters EAAT3 and EAAT4 by Lithium Sensitive Glycogen Synthase Kinase GSK3ß

    Directory of Open Access Journals (Sweden)

    Abeer Abousaab

    2016-12-01

    Full Text Available Background: Cellular uptake of glutamate by the excitatory amino-acid transporters (EAATs decreases excitation and thus participates in the regulation of neuroexcitability. Kinases impacting on neuronal function include Lithium-sensitive glycogen synthase kinase GSK3ß. The present study thus explored whether the activities of EAAT3 and/or EAAT4 isoforms are sensitive to GSK3ß. Methods: cRNA encoding wild type EAAT3 (SLC1A1 or EAAT4 (SLC1A6 was injected into Xenopus oocytes without or with additional injection of cRNA encoding wild type GSK3ß or the inactive mutant K85AGSK3ß. Dual electrode voltage clamp was performed in order to determine glutamate-induced current (IEAAT. Results: Appreciable IEAAT was observed in EAAT3 or EAAT4 expressing but not in water injected oocytes. IEAAT was significantly increased by coexpression of GSK3ß but not by coexpression of K85AGSK3ß. Coexpression of GSK3ß increased significantly the maximal IEAAT in EAAT3 or EAAT4 expressing oocytes, without significantly modifying apparent affinity of the carriers. Lithium (1 mM exposure for 24 hours decreased IEAAT in EAAT3 and GSK3ß expressing oocytes to values similar to IEAAT in oocytes expressing EAAT3 alone. Lithium did not significantly modify IEAAT in oocytes expressing EAAT3 without GSK3ß. Conclusions: Lithium-sensitive GSK3ß is a powerful regulator of excitatory amino acid transporters EAAT3 and EAAT4.

  14. De Novo Mutations in SLC25A24 Cause a Craniosynostosis Syndrome with Hypertrichosis, Progeroid Appearance, and Mitochondrial Dysfunction.

    Science.gov (United States)

    Ehmke, Nadja; Graul-Neumann, Luitgard; Smorag, Lukasz; Koenig, Rainer; Segebrecht, Lara; Magoulas, Pilar; Scaglia, Fernando; Kilic, Esra; Hennig, Anna F; Adolphs, Nicolai; Saha, Namrata; Fauler, Beatrix; Kalscheuer, Vera M; Hennig, Friederike; Altmüller, Janine; Netzer, Christian; Thiele, Holger; Nürnberg, Peter; Yigit, Gökhan; Jäger, Marten; Hecht, Jochen; Krüger, Ulrike; Mielke, Thorsten; Krawitz, Peter M; Horn, Denise; Schuelke, Markus; Mundlos, Stefan; Bacino, Carlos A; Bonnen, Penelope E; Wollnik, Bernd; Fischer-Zirnsak, Björn; Kornak, Uwe

    2017-11-02

    Gorlin-Chaudhry-Moss syndrome (GCMS) is a dysmorphic syndrome characterized by coronal craniosynostosis and severe midface hypoplasia, body and facial hypertrichosis, microphthalmia, short stature, and short distal phalanges. Variable lipoatrophy and cutis laxa are the basis for a progeroid appearance. Using exome and genome sequencing, we identified the recurrent de novo mutations c.650G>A (p.Arg217His) and c.649C>T (p.Arg217Cys) in SLC25A24 in five unrelated girls diagnosed with GCMS. Two of the girls had pronounced neonatal progeroid features and were initially diagnosed with Wiedemann-Rautenstrauch syndrome. SLC25A24 encodes a mitochondrial inner membrane ATP-Mg/P i carrier. In fibroblasts from affected individuals, the mutated SLC25A24 showed normal stability. In contrast to control cells, the probands' cells showed mitochondrial swelling, which was exacerbated upon treatment with hydrogen peroxide (H 2 O 2 ). The same effect was observed after overexpression of the mutant cDNA. Under normal culture conditions, the mitochondrial membrane potential of the probands' fibroblasts was intact, whereas ATP content in the mitochondrial matrix was lower than that in control cells. However, upon H 2 O 2 exposure, the membrane potential was significantly elevated in cells harboring the mutated SLC25A24. No reduction of mitochondrial DNA copy number was observed. These findings demonstrate that mitochondrial dysfunction with increased sensitivity to oxidative stress is due to the SLC25A24 mutations. Our results suggest that the SLC25A24 mutations induce a gain of pathological function and link mitochondrial ATP-Mg/P i transport to the development of skeletal and connective tissue. Copyright © 2017 American Society of Human Genetics. All rights reserved.

  15. The Creatine Transporter Gene Paralogous at 16p11.2 Is Expressed in Human Brain

    Directory of Open Access Journals (Sweden)

    Nadia Bayou

    2008-01-01

    We report on the clinical, cytogenetic, and molecular findings in a boy with autism carrying a de novo translocation t(7;16(p22.1;p11.2. The chromosome 16 breakpoint disrupts the paralogous SLC6A8 gene also called SLC6A10 or CT2. Predicted translation of exons and RT-PCR analysis reveal specific expression of the creatine transporter paralogous in testis and brain. Several studies reported on the role of X-linked creatine transporter mutations in individuals with mental retardation, with or without autism. The existence of disruption in SLC6A8 paralogous gene associated with idiopathic autism suggests that this gene may be involved in the autistic phenotype in our patient.

  16. SLC6A3 coding variant Ala559Val found in two autism probands alters dopamine transporter function and trafficking.

    Science.gov (United States)

    Bowton, E; Saunders, C; Reddy, I A; Campbell, N G; Hamilton, P J; Henry, L K; Coon, H; Sakrikar, D; Veenstra-VanderWeele, J M; Blakely, R D; Sutcliffe, J; Matthies, H J G; Erreger, K; Galli, A

    2014-10-14

    Emerging evidence associates dysfunction in the dopamine (DA) transporter (DAT) with the pathophysiology of autism spectrum disorder (ASD). The human DAT (hDAT; SLC6A3) rare variant with an Ala to Val substitution at amino acid 559 (hDAT A559V) was previously reported in individuals with bipolar disorder or attention-deficit hyperactivity disorder (ADHD). We have demonstrated that this variant is hyper-phosphorylated at the amino (N)-terminal serine (Ser) residues and promotes an anomalous DA efflux phenotype. Here, we report the novel identification of hDAT A559V in two unrelated ASD subjects and provide the first mechanistic description of its impaired trafficking phenotype. DAT surface expression is dynamically regulated by DAT substrates including the psychostimulant amphetamine (AMPH), which causes hDAT trafficking away from the plasma membrane. The integrity of DAT trafficking directly impacts DA transport capacity and therefore dopaminergic neurotransmission. Here, we show that hDAT A559V is resistant to AMPH-induced cell surface redistribution. This unique trafficking phenotype is conferred by altered protein kinase C β (PKCβ) activity. Cells expressing hDAT A559V exhibit constitutively elevated PKCβ activity, inhibition of which restores the AMPH-induced hDAT A559V membrane redistribution. Mechanistically, we link the inability of hDAT A559V to traffic in response to AMPH to the phosphorylation of the five most distal DAT N-terminal Ser. Mutation of these N-terminal Ser to Ala restores AMPH-induced trafficking. Furthermore, hDAT A559V has a diminished ability to transport AMPH, and therefore lacks AMPH-induced DA efflux. Pharmacological inhibition of PKCβ or Ser to Ala substitution in the hDAT A559V background restores AMPH-induced DA efflux while promoting intracellular AMPH accumulation. Although hDAT A559V is a rare variant, it has been found in multiple probands with neuropsychiatric disorders associated with imbalances in DA neurotransmission

  17. Elevated SLC26A4 gene promoter methylation is associated with the risk of presbycusis in men.

    Science.gov (United States)

    Xu, Jin; Zheng, Jiachen; Shen, Wanjing; Ma, Lili; Zhao, Ming; Wang, Xubo; Tang, Jiyuan; Yan, Jihong; Wu, Zhenhua; Zou, Zuquan; Bu, Shizhong; Xi, Yang

    2017-07-01

    Presbycusis affects approximately one-third of people over the age of 65 and is a worldwide health problem. In the current study, whether the methylation level of solute carrier family 26 member 4 (SLC26A4) predicted an increased risk of presbycusis was investigated. Peripheral blood samples from 102 patients with presbycusis and 104 controls were collected, and the methylation of the CpG sites of SLC26A4 was measured by applying pyrosequencing technology combined with sodium bisulfate DNA conversion chemistry. Within the SLC26A4 promoter region, one CpG site (CpG3) exhibited a significantly (Ppresbycusis (26.5±5.56%) compared with the controls (23.8±3.85%). Significantly different CpG3 methylation levels were observed between the patients with presbycusis and the controls among the male participants (P=0.0004). In addition, a significant decrease in the transcriptional level of SLC26A4 in peripheral blood was observed in the patients with presbycusis compared with the controls. Furthermore, analyses of the receiver operating characteristic (ROC) curves indicated that CpG3 methylation at the SLC26A4 promoter predicted the risk of presbycusis in the male participants (AUC=0.684, 95% CI=0.584‑0.784, P=0.001). The results demonstrated the significance of the CpG site methylation level of SLC26A4, and thus provides a potential marker for the diagnosis of presbycusis.

  18. Enteroendocrine-derived glucagon-like peptide-2 controls intestinal amino acid transport.

    Science.gov (United States)

    Lee, Jennifer; Koehler, Jacqueline; Yusta, Bernardo; Bahrami, Jasmine; Matthews, Dianne; Rafii, Mahroukh; Pencharz, Paul B; Drucker, Daniel J

    2017-03-01

    Glucagon-like peptide-2 (GLP-2) is co-secreted with GLP-1 from gut endocrine cells, and both peptides act as growth factors to expand the surface area of the mucosal epithelium. Notably, GLP-2 also enhances glucose and lipid transport in enterocytes; however, its actions on control of amino acid (AA) transport remain unclear. Here we examined the mechanisms linking gain and loss of GLP-2 receptor (GLP-2R) signaling to control of intestinal amino acid absorption in mice. Absorption, transport, and clearance of essential AAs, specifically lysine, were measured in vivo by Liquid Chromatography triple quadrupole Mass Spectrometry (LC-MS/MS) and ex vivo with Ussing chambers using intestinal preparations from Glp2 r +/+ and Glp2r - / - mice. Immunoblotting determined jejunal levels of protein components of signaling pathways (PI3K-AKT, and mTORC1-pS6-p4E-BP1) following administration of GLP-2, protein gavage, and rapamycin to fasted Glp2 r +/+ and Glp2r - / - mice. Expression of AA transporters from full thickness jejunum and 4F2hc from brush border membrane vesicles (BBMVs) was measured by real-time PCR and immunoblotting, respectively. Acute administration of GLP-2 increased basal AA absorption in vivo and augmented basal lysine transport ex vivo . GLP-2-stimulated lysine transport was attenuated by co-incubation with wortmannin, rapamycin, or tetrodotoxin ex vivo . Phosphorylation of mTORC1 effector proteins S6 and 4E-BP1 was significantly increased in wild-type mice in response to GLP-2 alone, or when co-administered with protein gavage, and abolished following oral gavage of rapamycin. In contrast, activation of GLP-1R signaling did not enhance S6 phosphorylation. Disruption of GLP-2 action in Glp2r -/- mice reduced lysine transport ex vivo and attenuated the phosphorylation of S6 and 4E-BP1 in response to oral protein. Moreover, the expression of cationic AA transporter slc7a9 in response to refeeding, and the abundance of 4F2hc in BBMVs following protein

  19. Common Genetic Variation In Cellular Transport Genes and Epithelial Ovarian Cancer (EOC Risk.

    Directory of Open Access Journals (Sweden)

    Ganna Chornokur

    Full Text Available Defective cellular transport processes can lead to aberrant accumulation of trace elements, iron, small molecules and hormones in the cell, which in turn may promote the formation of reactive oxygen species, promoting DNA damage and aberrant expression of key regulatory cancer genes. As DNA damage and uncontrolled proliferation are hallmarks of cancer, including epithelial ovarian cancer (EOC, we hypothesized that inherited variation in the cellular transport genes contributes to EOC risk.In total, DNA samples were obtained from 14,525 case subjects with invasive EOC and from 23,447 controls from 43 sites in the Ovarian Cancer Association Consortium (OCAC. Two hundred seventy nine SNPs, representing 131 genes, were genotyped using an Illumina Infinium iSelect BeadChip as part of the Collaborative Oncological Gene-environment Study (COGS. SNP analyses were conducted using unconditional logistic regression under a log-additive model, and the FDR q<0.2 was applied to adjust for multiple comparisons.The most significant evidence of an association for all invasive cancers combined and for the serous subtype was observed for SNP rs17216603 in the iron transporter gene HEPH (invasive: OR = 0.85, P = 0.00026; serous: OR = 0.81, P = 0.00020; this SNP was also associated with the borderline/low malignant potential (LMP tumors (P = 0.021. Other genes significantly associated with EOC histological subtypes (p<0.05 included the UGT1A (endometrioid, SLC25A45 (mucinous, SLC39A11 (low malignant potential, and SERPINA7 (clear cell carcinoma. In addition, 1785 SNPs in six genes (HEPH, MGST1, SERPINA, SLC25A45, SLC39A11 and UGT1A were imputed from the 1000 Genomes Project and examined for association with INV EOC in white-European subjects. The most significant imputed SNP was rs117729793 in SLC39A11 (per allele, OR = 2.55, 95% CI = 1.5-4.35, p = 5.66x10-4.These results, generated on a large cohort of women, revealed associations between inherited cellular

  20. Common Genetic Variation In Cellular Transport Genes and Epithelial Ovarian Cancer (EOC) Risk

    Science.gov (United States)

    Chornokur, Ganna; Lin, Hui-Yi; Tyrer, Jonathan P.; Lawrenson, Kate; Dennis, Joe; Amankwah, Ernest K.; Qu, Xiaotao; Tsai, Ya-Yu; Jim, Heather S. L.; Chen, Zhihua; Chen, Ann Y.; Permuth-Wey, Jennifer; Aben, Katja KH.; Anton-Culver, Hoda; Antonenkova, Natalia; Bruinsma, Fiona; Bandera, Elisa V.; Bean, Yukie T.; Beckmann, Matthias W.; Bisogna, Maria; Bjorge, Line; Bogdanova, Natalia; Brinton, Louise A.; Brooks-Wilson, Angela; Bunker, Clareann H.; Butzow, Ralf; Campbell, Ian G.; Carty, Karen; Chang-Claude, Jenny; Cook, Linda S.; Cramer, Daniel W.; Cunningham, Julie M.; Cybulski, Cezary; Dansonka-Mieszkowska, Agnieszka; du Bois, Andreas; Despierre, Evelyn; Dicks, Ed; Doherty, Jennifer A.; Dörk, Thilo; Dürst, Matthias; Easton, Douglas F.; Eccles, Diana M.; Edwards, Robert P.; Ekici, Arif B.; Fasching, Peter A.; Fridley, Brooke L.; Gao, Yu-Tang; Gentry-Maharaj, Aleksandra; Giles, Graham G.; Glasspool, Rosalind; Goodman, Marc T.; Gronwald, Jacek; Harrington, Patricia; Harter, Philipp; Hein, Alexander; Heitz, Florian; Hildebrandt, Michelle A. T.; Hillemanns, Peter; Hogdall, Claus K.; Hogdall, Estrid; Hosono, Satoyo; Jakubowska, Anna; Jensen, Allan; Ji, Bu-Tian; Karlan, Beth Y.; Kelemen, Linda E.; Kellar, Mellissa; Kiemeney, Lambertus A.; Krakstad, Camilla; Kjaer, Susanne K.; Kupryjanczyk, Jolanta; Lambrechts, Diether; Lambrechts, Sandrina; Le, Nhu D.; Lee, Alice W.; Lele, Shashi; Leminen, Arto; Lester, Jenny; Levine, Douglas A.; Liang, Dong; Lim, Boon Kiong; Lissowska, Jolanta; Lu, Karen; Lubinski, Jan; Lundvall, Lene; Massuger, Leon F. A. G.; Matsuo, Keitaro; McGuire, Valerie; McLaughlin, John R.; McNeish, Iain; Menon, Usha; Milne, Roger L.; Modugno, Francesmary; Moysich, Kirsten B.; Ness, Roberta B.; Nevanlinna, Heli; Eilber, Ursula; Odunsi, Kunle; Olson, Sara H.; Orlow, Irene; Orsulic, Sandra; Weber, Rachel Palmieri; Paul, James; Pearce, Celeste L.; Pejovic, Tanja; Pelttari, Liisa M.; Pike, Malcolm C.; Poole, Elizabeth M.; Risch, Harvey A.; Rosen, Barry; Rossing, Mary Anne; Rothstein, Joseph H.; Rudolph, Anja; Runnebaum, Ingo B.; Rzepecka, Iwona K.; Salvesen, Helga B.; Schernhammer, Eva; Schwaab, Ira; Shu, Xiao-Ou; Shvetsov, Yurii B.; Siddiqui, Nadeem; Sieh, Weiva; Song, Honglin; Southey, Melissa C.; Spiewankiewicz, Beata; Sucheston, Lara; Teo, Soo-Hwang; Terry, Kathryn L.; Thompson, Pamela J.; Thomsen, Lotte; Tangen, Ingvild L.; Tworoger, Shelley S.; van Altena, Anne M.; Vierkant, Robert A.; Vergote, Ignace; Walsh, Christine S.; Wang-Gohrke, Shan; Wentzensen, Nicolas; Whittemore, Alice S.; Wicklund, Kristine G.; Wilkens, Lynne R.; Wu, Anna H.; Wu, Xifeng; Woo, Yin-Ling; Yang, Hannah; Zheng, Wei; Ziogas, Argyrios; Hasmad, Hanis N.; Berchuck, Andrew; Iversen, Edwin S.; Schildkraut, Joellen M.; Ramus, Susan J.; Goode, Ellen L.; Monteiro, Alvaro N. A.; Gayther, Simon A.; Narod, Steven A.; Pharoah, Paul D. P.; Sellers, Thomas A.; Phelan, Catherine M.

    2015-01-01

    Background Defective cellular transport processes can lead to aberrant accumulation of trace elements, iron, small molecules and hormones in the cell, which in turn may promote the formation of reactive oxygen species, promoting DNA damage and aberrant expression of key regulatory cancer genes. As DNA damage and uncontrolled proliferation are hallmarks of cancer, including epithelial ovarian cancer (EOC), we hypothesized that inherited variation in the cellular transport genes contributes to EOC risk. Methods In total, DNA samples were obtained from 14,525 case subjects with invasive EOC and from 23,447 controls from 43 sites in the Ovarian Cancer Association Consortium (OCAC). Two hundred seventy nine SNPs, representing 131 genes, were genotyped using an Illumina Infinium iSelect BeadChip as part of the Collaborative Oncological Gene-environment Study (COGS). SNP analyses were conducted using unconditional logistic regression under a log-additive model, and the FDR q<0.2 was applied to adjust for multiple comparisons. Results The most significant evidence of an association for all invasive cancers combined and for the serous subtype was observed for SNP rs17216603 in the iron transporter gene HEPH (invasive: OR = 0.85, P = 0.00026; serous: OR = 0.81, P = 0.00020); this SNP was also associated with the borderline/low malignant potential (LMP) tumors (P = 0.021). Other genes significantly associated with EOC histological subtypes (p<0.05) included the UGT1A (endometrioid), SLC25A45 (mucinous), SLC39A11 (low malignant potential), and SERPINA7 (clear cell carcinoma). In addition, 1785 SNPs in six genes (HEPH, MGST1, SERPINA, SLC25A45, SLC39A11 and UGT1A) were imputed from the 1000 Genomes Project and examined for association with INV EOC in white-European subjects. The most significant imputed SNP was rs117729793 in SLC39A11 (per allele, OR = 2.55, 95% CI = 1.5-4.35, p = 5.66x10-4). Conclusion These results, generated on a large cohort of women, revealed associations

  1. Nutrient transport in the mammary gland: calcium, trace minerals and water soluble vitamins.

    Science.gov (United States)

    Montalbetti, Nicolas; Dalghi, Marianela G; Albrecht, Christiane; Hediger, Matthias A

    2014-03-01

    Milk nutrients are secreted by epithelial cells in the alveoli of the mammary gland by several complex and highly coordinated systems. Many of these nutrients are transported from the blood to the milk via transcellular pathways that involve the concerted activity of transport proteins on the apical and basolateral membranes of mammary epithelial cells. In this review, we focus on transport mechanisms that contribute to the secretion of calcium, trace minerals and water soluble vitamins into milk with particular focus on the role of transporters of the SLC series as well as calcium transport proteins (ion channels and pumps). Numerous members of the SLC family are involved in the regulation of essential nutrients in the milk, such as the divalent metal transporter-1 (SLC11A2), ferroportin-1 (SLC40A1) and the copper transporter CTR1 (SLC31A1). A deeper understanding of the physiology and pathophysiology of these transporters will be of great value for drug discovery and treatment of breast diseases.

  2. Meta-analysis of the association of the SLC6A3 3'-UTR VNTR with cognition.

    Science.gov (United States)

    Ettinger, Ulrich; Merten, Natascha; Kambeitz, Joseph

    2016-01-01

    The gene coding for the dopamine transporter (DAT), SLC6A3, contains a 40-base pair variable number of tandem repeats (VNTR) polymorphism (rs28363170) in its 3' untranslated region. This VNTR has been associated with attention deficit hyperactivity disorder (ADHD) and has been investigated in relation to cognition and brain function. Here, we report the results of a comprehensive meta-analysis with meta-regression examining the association of the VNTR with different domains of cognition in healthy adults. We extracted data from 28 independent studies and carried out meta-analyses for associations with working memory (k=10 samples, N=1193 subjects), inhibition (k=8 samples, N=829 subjects), executive functions including inhibition (k=10 samples, N=984 subjects), attention (k=6 samples, N=742 subjects) and declarative long-term memory (k=5 samples, N=251 subjects). None of the investigated dimensions showed significant associations with the VNTR (all p>0.26). Meta-regression including year of publication, gender, age, ethnicity and percentage of 10R-homozygotes similarly did not attain significance. We conclude that there is no evidence that rs28363170 may be a significant predictor of cognitive function in healthy adults. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. Development of imatinib and dasatinib resistance: dynamics of expression of drug transporters ABCB1, ABCC1, ABCG2, MVP, and SLC22A1.

    Science.gov (United States)

    Gromicho, Marta; Dinis, Joana; Magalhães, Marta; Fernandes, Alexandra R; Tavares, Purificação; Laires, António; Rueff, José; Rodrigues, António Sebastião

    2011-10-01

    About 20% of patients with chronic myeloid leukemia (CML) do not respond to treatment with imatinib either initially or because of acquired resistance. To study the development of CML drug resistance, an in vitro experimental system comprising cell lines with different resistance levels was established by exposing K562 cells to increasing concentrations of imatinib and dasatinib anticancer agents. The mRNA levels of BCR- ABL1 and of genes involved in drug transport or redistribution (ABCB1, ABCC1, ABCC3, ABCG2, MVP, and SLC22A1) were measured and the ABL1 kinase domain sequenced. Results excluded BCR- ABL1 overexpression and mutations as relevant resistance mechanisms. Most studied transporters were overexpressed in the majority of resistant cell lines. Their expression pattern was dynamic: varying with resistance level and chronic drug exposure. Studied efflux transporters may have an important role at the initial stages of resistance, but after prolonged exposure and for higher doses of drugs other mechanisms might take place.

  4. Vps35-deficiency impairs SLC4A11 trafficking and promotes corneal dystrophy.

    Directory of Open Access Journals (Sweden)

    Wei Liu

    Full Text Available Vps35 (vacuolar protein sorting 35 is a major component of retromer that selectively promotes endosome-to-Golgi retrieval of transmembrane proteins. Dysfunction of retromer is a risk factor for the pathogenesis of Parkinson's disease (PD and Alzheimer's disease (AD. However, Vps35/retromer's function in the eye or the contribution of Vps35-deficiency to eye degenerative disorders remains to be explored. Here we provide evidence for a critical role of Vps35 in mouse corneal dystrophy. Vps35 is expressed in mouse and human cornea. Mouse cornea from Vps35 heterozygotes (Vps35+/- show features of dystrophy, such as loss of both endothelial and epithelial cell densities, disorganizations of endothelial, stroma, and epithelial cells, excrescences in the Descemet membrane, and corneal edema. Additionally, corneal epithelial cell proliferation was reduced in Vps35-deficient mice. Intriguingly, cell surface targeting of SLC4A11, a membrane transport protein (OH- /H+ /NH3 /H2O of corneal endothelium, whose mutations have been identified in patients with corneal dystrophy, was impaired in Vps35-deficient cells and cornea. Taken together, these results suggest that SLC4A11 appears to be a Vps35/retromer cargo, and Vps35-regulation of SLC4A11 trafficking may underlie Vps35/retromer regulation of corneal dystrophy.

  5. Extremely discrepant mutation spectrum of SLC26A4 between Chinese patients with isolated Mondini deformity and enlarged vestibular aqueduct.

    Science.gov (United States)

    Huang, Shasha; Han, Dongyi; Yuan, Yongyi; Wang, Guojian; Kang, Dongyang; Zhang, Xin; Yan, Xiaofei; Meng, Xiaoxiao; Dong, Min; Dai, Pu

    2011-09-30

    Mutations in SLC26A4 cause Pendred syndrome (hearing loss with goiter) or DFNB4 (non-syndromic hearing loss with inner ear malformation, such as enlarged vestibular aqueduct or Mondini deformity). The relationship between mutations in SLC26A4 and Mondini deformity without enlarged vestibular aqueduct has not been studied in any Chinese deaf population. The purpose of this study was to assess whether mutations in the SLC26A4 gene cause Mondini deformity without an enlarged vestibular aqueduct (isolated Mondini deformity) in a Chinese population. In total, 144 patients with sensorineural hearing loss were included and subjected to high-resolution temporal bone CT. Among them, 28 patients with isolated Mondini dysplasia (MD group), 50 patients with enlarged vestibular aqueduct with Mondini dysplasia (EVA with MD group), 50 patients with enlarged vestibular aqueduct without Mondini dysplasia (EVA group), and 16 patients with other types of inner ear malformations (IEM group) were identified. The coding exons of SLC26A4 were analyzed in all subjects. DNA sequence analysis of SLC26A4 was performed in all 144 patients. In the different groups, the detection rate of the SLC26A4 mutation differed. In the isolated MD group, only one single allelic mutation in SLC26A4 was found in one patient (1/28, 3.6%). In the EVA with MD group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0%) and three patients (3/50, 6.0%), respectively. Also, in the EVA group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0%) and three patients (3/50, 6.0%), respectively. These percentages were identical to those in the EVA plus MD group. Only two patients carried monoallelic mutations of the SLC26A4 gene in the IEM group (2/16, 12.5%). There were significant differences in the frequency of SLC26A4 mutation among the groups (P0.5). Although mutations in the SLC26A4 gene were frequently found in Chinese EVA patients with and

  6. A Missense Mutation in SLC45A2 Is Associated with Albinism in Several Small Long Haired Dog Breeds.

    Science.gov (United States)

    Wijesena, Hiruni R; Schmutz, Sheila M

    2015-01-01

    Homozygosity for a large deletion in the solute carrier family 45, member 2 (SLC45A2) gene causes oculocutaneous albinism (OCA) in the Doberman Pinscher breed. An albino Lhasa Apso did not have this g.27141_31223del (CanFam2) deletion in her SLC45A2 sequence. Therefore, SLC45A2 was investigated in this female Lhasa Apso to search for other possible variants that caused her albinism. The albino Lhasa Apso was homozygous for a nonsynonymous substitution in the seventh exon, a c.1478G>A base change that resulted in a glycine to aspartic acid substitution (p.G493D). This mutation was not found in a wolf, a coyote, or any of the 15 other Lhasa Apso dogs or 32 other dogs of breeds related to the Lhasa Apso. However, an albino Pekingese, 2 albino Pomeranians, and an albino mixed breed dog that was small and long haired were also homozygous for the 493D allele. The colored puppies of the albino Lhasa Apso and the colored dam of the 2 albino Pomeranians were heterozygous for this allele. However, an albino Pug was homozygous for the 493G allele and therefore although we suggest the 493D allele causes albinism when homozygous in several small, long haired dog breeds, it does not explain all albinism in dogs. A variant effect prediction for the albino Lhasa Apso confirms that p.G493D is a deleterious substitution, and a topology prediction for SLC45A2 suggests that the 11th transmembrane domain where the 493rd amino acid was located, has an altered structure. © The American Genetic Association 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  7. KCNJ10 may not be a contributor to nonsyndromic enlargement of vestibular aqueduct (NSEVA in Chinese subjects.

    Directory of Open Access Journals (Sweden)

    Jiandong Zhao

    Full Text Available BACKGROUND: Nonsyndromic enlargement of vestibular aqueduct (NSEVA is an autosomal recessive hearing loss disorder that is associated with mutations in SLC26A4. However, not all patients with NSEVA carry biallelic mutations in SLC26A4. A recent study proposed that single mutations in both SLC26A4 and KCNJ10 lead to digenic NSEVA. We examined whether KCNJ10 excert a role in the pathogenesis of NSEVA in Chinese patients. METHODS: SLC26A4 was sequenced in 1056 Chinese patients with NSEVA. KCNJ10 was screened in 131 patients who lacked mutations in either one or both alleles of SLC26A4. Additionally, KCNJ10 was screened in 840 controls, including 563 patients diagnosed with NSEVA who carried biallelic SLC26A4 mutations, 48 patients with nonsyndromic hearing loss due to inner ear malformations that did not involve enlargement of the vestibular aqueduct (EVA, 96 patients with conductive hearing loss due to various causes, and 133 normal-hearing individuals with no family history of hereditary hearing loss. RESULTS: 925 NSEVA patients were found carrying two-allele pathogenic SLC26A4 mutations. The most frequently detected KCNJ10 mutation was c.812G>A (p.R271H. Compared with the normal-hearing control subjects, the occurrence rate of c.812G>A in NSEVA patients with lacking mutations in one or both alleles of SLC26A4 had no significant difference(1.53% vs. 5.30%, χ(2 = 2.798, p = 0.172, which suggested that it is probably a nonpathogenic benign variant. KCNJ10 c.1042C>T (p.R348C, the reported EVA-related mutation, was not found in patients with NSEVA who lacked mutations in either one or both alleles of SLC26A4. Furthermore, the normal-hearing parents of patients with NSEVA having two SLC26A4 mutations carried the KCNJ10 c.1042C>T or c.812G>A mutation and a SLC26A4 pathogenic mutation. CONCLUSION: SLC26A4 is the major genetic cause in Chinese NSEVA patients, accounting for 87.59%. KCNJ10 may not be a contributor to NSEVA in Chinese population. Other

  8. Intestinal drug transport via the proton-coupled amino acid transporter PAT1 (SLC36A1) is inhibited by Gly-X(aa) dipeptides

    DEFF Research Database (Denmark)

    Frølund, Sidsel; Langthaler, Louise; Kall, Morten A

    2012-01-01

    -Sar as substrates of the amino acid transporter PAT1. The aim of the present study is to investigate if other Gly-containing dipeptides interact with PAT1, and whether they can inhibit PAT1 mediated drug absorption, in vitro and in vivo. The in vitro methods included two-electrode voltage clamp measurements on h...... of different dipeptides. The in vivo part consisted of a pharmacokinetic study in rats following oral administration of gaboxadol and preadministration of 200 mg/kg dipeptide. The results showed that in hPAT1 expressing oocytes Gly-Tyr, Gly-Pro, and Gly-Phe inhibited currents induced by drug substances......, the present study identifies selected dipeptides as inhibitors of PAT1 mediated drug absorption in various in vitro models....

  9. Estimated carrier frequency of creatine transporter deficiency in females in the general population using functional characterization of novel missense variants in the SLC6A8 gene.

    Science.gov (United States)

    DesRoches, Caro-Lyne; Patel, Jaina; Wang, Peixiang; Minassian, Berge; Salomons, Gajja S; Marshall, Christian R; Mercimek-Mahmutoglu, Saadet

    2015-07-10

    Creatine transporter deficiency (CRTR-D) is an X-linked inherited disorder of creatine transport. All males and about 50% of females have intellectual disability or cognitive dysfunction. Creatine deficiency on brain proton magnetic resonance spectroscopy and elevated urinary creatine to creatinine ratio are important biomarkers. Mutations in the SLC6A8 gene occur de novo in 30% of males. Despite reports of high prevalence of CRTR-D in males with intellectual disability, there are no true prevalence studies in the general population. To determine carrier frequency of CRTR-D in the general population we studied the variants in the SLC6A8 gene reported in the Exome Variant Server database and performed functional characterization of missense variants. We also analyzed synonymous and intronic variants for their predicted pathogenicity using in silico analysis tools. Nine missense variants were functionally analyzed using transient transfection by site-directed mutagenesis with In-Fusion HD Cloning in HeLa cells. Creatine uptake was measured by liquid chromatography tandem mass spectrometry for creatine measurement. The c.1654G>T (p.Val552Leu) variant showed low residual creatine uptake activity of 35% of wild type transfected HeLa cells and was classified as pathogenic. Three variants (c.808G>A; p.Val270Met, c.942C>G; p.Phe314Leu and c.952G>A; p.Ala318Thr) were predicted to be pathogenic based on in silico analysis, but proved to be non-pathogenic by our functional analysis. The estimated carrier frequency of CRTR-D was 0.024% in females in the general population. We recommend functional studies for all novel missense variants by transient transfection followed by creatine uptake measurement by liquid chromatography tandem mass spectrometry as fast and cost effective method for the functional analysis of missense variants in the SLC6A8 gene. Crown Copyright © 2015. Published by Elsevier B.V. All rights reserved.

  10. Transport of perfluoroalkyl acids in a water-saturated sediment column investigated under near-natural conditions

    International Nuclear Information System (INIS)

    Vierke, Lena; Möller, Axel; Klitzke, Sondra

    2014-01-01

    The aim of this study was to gain an understanding of the transport of C 4–10 perfluoroalkyl carboxylic acids (PFCAs) and C 4,6,8 perfluoroalkyl sulfonic acids (PFSAs) in a water-saturated sediment column representing a riverbank filtration scenario under near-natural conditions. Short-chain PFCAs and PFSAs with up to six C-atoms showed complete tracer-like breakthrough. Longer chain ones were retarded due to sorption to the sediment or due to other processes in the aqueous phase. The study reports the first column derived sediment–water partition coefficients ranging from 0.01 cm 3 g −1 to 0.41 cm 3 g −1 for C 4,6 PFSAs and from 0.0 cm 3 g −1 to 6.5 cm 3 g −1 for C 4,5,6,8,9 PFCAs. The results clearly indicate that short-chain PFCAs and PFSAs may pose a problem if contaminated surface waters are used for drinking water production via riverbank filtration. Highlights: • Transport of per- and polyfluorinated compounds in a riverbank filtration scenario. • Investigations under near-natural conditions with a water-saturated sediment column. • Processes in water and sediment control the transport of analytes. • Short chain PFCAs and PFSAs are not retarded in the water-saturated sediment column. • First column derived sediment–water partition coefficients. -- Quantification of breakthrough of perfluoroalkyl carboxylic acids (PFCAs) and perfluoroalkyl sulfonic acids (PFSAs) under conditions simulating a riverbank filtration scenario

  11. Loss of function of Slc20a2 associated with familial idiopathic Basal Ganglia calcification in humans causes brain calcifications in mice

    DEFF Research Database (Denmark)

    Jensen, N.; Schroder, H. D.; Hejbol, E. K.

    2013-01-01

    Familial idiopathic basal ganglia calcification (FIBGC) is a neurodegenerative disorder with neuropsychiatric and motor symptoms. Deleterious mutations in SLC20A2, encoding the type III sodium-dependent phosphate transporter 2 (PiT2), were recently linked to FIBGC in almost 50% of the families...... reported worldwide. Here, we show that knockout of Slc20a2 in mice causes calcifications in the thalamus, basal ganglia, and cortex, demonstrating that reduced PiT2 expression alone can cause brain calcifications....

  12. Investigation of SLC6A4 gene expression in autism spectrum disorders

    Directory of Open Access Journals (Sweden)

    Elif Funda Şener

    2015-06-01

    Full Text Available Objective: Autism is defined as a complex neurodevelopmental disorder. Genetics plays a major role in the etiology of autism spectrum disorders (ASD. The role of the serotonin in the development of autism has been widely investigated. SLC6A4 gene (SERT or 5-HT has an important role reuptaking of serotonin. Because of this, our study examined the expression level of SLC6A4 gene in autism patients. Methods: Thirty-four patients (26 male, 8 female who diagnosed as autism firstly according to DSM-V criteria in the Department of child psychiatry, Erciyes University Medical Faculty and healthy 23 controls (16 male, 7 female were enrolled in this study. Total RNA was isolated from peripheral blood samples using TRIzol. Quantitative Real-time PCR (qRT-PCR was performed to detect SLC6A4 gene expression. Results: SLC6A4 gene expression was found statistically significant and low in autism group compared with controls (p=0,027. Conclusion: The low gene expression in the patient group implied that there is an abnormality of serotonin reuptake. According to our results, we suggest that much more studies may be planned with the expression and methylation profile of this gene combined with gene polymorphisms especially affecting the expression in larger sample sizes. J Clin Exp Invest 2015; 6 (2: 165-169

  13. Extremely discrepant mutation spectrum of SLC26A4 between Chinese patients with isolated Mondini deformity and enlarged vestibular aqueduct

    Directory of Open Access Journals (Sweden)

    Yan Xiaofei

    2011-09-01

    Full Text Available Abstract Background Mutations in SLC26A4 cause Pendred syndrome (hearing loss with goiter or DFNB4 (non-syndromic hearing loss with inner ear malformation, such as enlarged vestibular aqueduct or Mondini deformity. The relationship between mutations in SLC26A4 and Mondini deformity without enlarged vestibular aqueduct has not been studied in any Chinese deaf population. The purpose of this study was to assess whether mutations in the SLC26A4 gene cause Mondini deformity without an enlarged vestibular aqueduct (isolated Mondini deformity in a Chinese population. Methods In total, 144 patients with sensorineural hearing loss were included and subjected to high-resolution temporal bone CT. Among them, 28 patients with isolated Mondini dysplasia (MD group, 50 patients with enlarged vestibular aqueduct with Mondini dysplasia (EVA with MD group, 50 patients with enlarged vestibular aqueduct without Mondini dysplasia (EVA group, and 16 patients with other types of inner ear malformations (IEM group were identified. The coding exons of SLC26A4 were analyzed in all subjects. Results DNA sequence analysis of SLC26A4 was performed in all 144 patients. In the different groups, the detection rate of the SLC26A4 mutation differed. In the isolated MD group, only one single allelic mutation in SLC26A4 was found in one patient (1/28, 3.6%. In the EVA with MD group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0% and three patients (3/50, 6.0%, respectively. Also, in the EVA group, biallelic and monoallelic SLC26A4 mutations were identified in 46 patients (46/50, 92.0% and three patients (3/50, 6.0%, respectively. These percentages were identical to those in the EVA plus MD group. Only two patients carried monoallelic mutations of the SLC26A4 gene in the IEM group (2/16, 12.5%. There were significant differences in the frequency of SLC26A4 mutation among the groups (P SLC26A4 mutation in the isolated MD group was

  14. Generation and acceleration of high intensity beams in the SLC injector

    International Nuclear Information System (INIS)

    Ross, M.C.; Browne, M.J.; Clendenin, J.E.; Jobe, R.K.; Seeman, J.T.; Sheppard, J.C.; Stiening, R.F.

    1985-04-01

    A new gun pulser and substantially increased focusing have been added to the first 100 m of the SLAC linac in order to provide a pair of intense electron bunches to the SLC damping ring. Each bunch from this injector must have 5 x 10 10 electrons, an invariant emittance γepsilon less than or equal to 1.8 x 10 -3 m-rad and the pair must have an energy spread of less than 2%. Wakefield instabilities present in earlier versions of this injector have been controlled by reducing the transverse beam dimension by a factor of 3

  15. SLC energy spectrum monitor using synchrotron radiation

    International Nuclear Information System (INIS)

    Seeman, J.; Brunk, W.; Early, R.; Ross, M.; Tillmann, E.; Walz, D.

    1986-04-01

    The SLAC Linac is being upgraded for the use in the SLAC Linear Collider (SLC). The improved Linac must accelerate electron and positron bunches from 1.2 GeV to 50 GeV while producing output energy spectra of about 0.2%. The energy spectra must be maintained during operation to provide for good beam transmission and to minimize chromatic effects in the SLC ARCs and Final Focus. the energy spectra of these beams are determined by the bunch length and intensity, the RF phase and waveform and the intra-bunch longitudinal wakefields. A non-destructive energy spectrum monitor has been designed using a vertical wiggler magnet located downstream of the horizontal beam splitter at the end of the SLC Linac. It produces synchrotron radiation which is viewed in an off-axis x-ray position sensitive detector. The expected resolution is 0.08%. The design considerations of this monitor are presented in this paper. A pair of these monitors is under construction with an installation date set for late summer 1986. 5 refs., 6 figs

  16. Bicarbonate transporters in corals point towards a key step in the evolution of cnidarian calcification

    KAUST Repository

    Zoccola, Didier

    2015-06-04

    The bicarbonate ion (HCO3−) is involved in two major physiological processes in corals, biomineralization and photosynthesis, yet no molecular data on bicarbonate transporters are available. Here, we characterized plasma membrane-type HCO3− transporters in the scleractinian coral Stylophora pistillata. Eight solute carrier (SLC) genes were found in the genome: five homologs of mammalian-type SLC4 family members, and three of mammalian-type SLC26 family members. Using relative expression analysis and immunostaining, we analyzed the cellular distribution of these transporters and conducted phylogenetic analyses to determine the extent of conservation among cnidarian model organisms. Our data suggest that the SLC4γ isoform is specific to scleractinian corals and responsible for supplying HCO3− to the site of calcification. Taken together, SLC4γ appears to be one of the key genes for skeleton building in corals, which bears profound implications for our understanding of coral biomineralization and the evolution of scleractinian corals within cnidarians.

  17. Bicarbonate transporters in corals point towards a key step in the evolution of cnidarian calcification

    KAUST Repository

    Zoccola, Didier; Ganot, Philippe; Bertucci, Anthony; Caminiti-Segonds, Natacha; Techer, Nathalie; Voolstra, Christian R.; Aranda, Manuel; Tambutté , Eric; Allemand, Denis; Casey, Joseph R; Tambutté , Sylvie

    2015-01-01

    The bicarbonate ion (HCO3−) is involved in two major physiological processes in corals, biomineralization and photosynthesis, yet no molecular data on bicarbonate transporters are available. Here, we characterized plasma membrane-type HCO3− transporters in the scleractinian coral Stylophora pistillata. Eight solute carrier (SLC) genes were found in the genome: five homologs of mammalian-type SLC4 family members, and three of mammalian-type SLC26 family members. Using relative expression analysis and immunostaining, we analyzed the cellular distribution of these transporters and conducted phylogenetic analyses to determine the extent of conservation among cnidarian model organisms. Our data suggest that the SLC4γ isoform is specific to scleractinian corals and responsible for supplying HCO3− to the site of calcification. Taken together, SLC4γ appears to be one of the key genes for skeleton building in corals, which bears profound implications for our understanding of coral biomineralization and the evolution of scleractinian corals within cnidarians.

  18. Lack of association between VNTR polymorphism of dopamine transporter gene (SLC6A3 and schizophrenia in a Brazilian sample Ausência de associação entre o polimorfismo VNTR do gene do transportador de dopamina (SLC6A3 e esquizofrenia em uma população brasileira

    Directory of Open Access Journals (Sweden)

    Quirino Cordeiro

    2004-12-01

    Full Text Available A role of dopaminergic dysfunction has been postulated in the aetiology of schizophrenia. We hypothesized that variations in the dopamine transporter gene (SLC6A3 may be associated with schizophrenia. We conducted case-control and family based analysis on the polymorphic SLC6A3 variable number tandem repeat (VNTR in a sample of 220 schizophrenic patients, 226 gender and ethnic matched controls, and 49 additional case-parent trios. No differences were found in allelic or genotypic distributions between cases and controls and no significant transmission distortions from heterozygous parents to schizophrenic offspring were detected. Thus, our results do not support an association of the SLC6A3 VNTR with schizophrenia in our sample.Genes do sistema dopaminérgico são de escolha para a pesquisa de susceptibilidade para a esquizofrenia. Desse modo, possível contribuição do polimorfismo do gene do transportador de dopamina (SLC6A3 no aumento da vulnerabilidade para a esquizofrenia foi investigada no presente estudo. Analisou-se a distribuição do sítio polimórfico do gene do transportador de dopamina (VNTR em uma população de 220 pacientes com esquizofrenia (critério diagnóstico: DSM-IV e comparou-se com a distribuição em uma população controle de 226 indivíduos pareados para sexo e etnia. Nenhuma diferença foi observada na distribuição dos alelos entre casos e controles. O mesmo polimorfismo também foi investigado em uma segunda amostra composta por 49 trios (pais e probando. O resultado também foi negativo. Tais dados não dão suporte para a participação do polimorfismo do gene do transportador de dopamina no aumento de susceptibilidade para esquizofrenia na amostra estudada.

  19. Glucose transporter-1 deficiency syndrome : the expanding clinical and genetic spectrum of a treatable disorder

    NARCIS (Netherlands)

    Leen, Wilhelmina G.; Klepper, Joerg; Verbeek, Marcel M.; Leferink, Maike; Hofste, Tom; van Engelen, Baziel G.; Wevers, Ron A.; Arthur, Todd; Bahi-Buisson, Nadia; Ballhausen, Diana; Bekhof, Jolita; van Bogaert, Patrick; Carrilho, Ines; Chabrol, Brigitte; Champion, Michael P.; Coldwell, James; Clayton, Peter; Donner, Elizabeth; Evangeliou, Athanasios; Ebinger, Friedrich; Farrell, Kevin; Forsyth, Rob J.; de Goede, Christian G. E. L.; Gross, Stephanie; Grunewald, Stephanie; Holthausen, Hans; Jayawant, Sandeep; Lachlan, Katherine; Laugel, Vincent; Leppig, Kathy; Lim, Ming J.; Mancini, Grazia; Della Marina, Adela; Martorell, Loreto; McMenamin, Joe; Meuwissen, Marije E. C.; Mundy, Helen; Nilsson, Nils O.; Panzer, Axel; Poll-The, Bwee T.; Rauscher, Christian; Rouselle, Christophe M. R.; Sandvig, Inger; Scheffner, Thomas; Sheridan, Eamonn; Simpson, Neil; Sykora, Parol; Tomlinson, Richard; Trounce, John; Webb, David; Weschke, Bernhard; Scheffer, Hans; Willemsen, Michel A.

    Glucose transporter-1 deficiency syndrome is caused by mutations in the SLC2A1 gene in the majority of patients and results in impaired glucose transport into the brain. From 2004-2008, 132 requests for mutational analysis of the SLC2A1 gene were studied by automated Sanger sequencing and multiplex

  20. Glucose transporter-1 deficiency syndrome: The expanding clinical and genetic spectrum of a treatable disorder

    NARCIS (Netherlands)

    W.G. Leen (Wilhelmina); J. Klepper (Joerg); M.M. Verbeek (Marcel); M. Leferink (Maike); T. Hofste (Tom); B.G.M. van Engelen (Baziel); R.A. Wevers (Ron); T. Arthur (Todd); N. Bahi-Buisson (Nadia); D. Ballhausen (Diana); J. Bekhof (Jolita); P. van Bogaert (Patrick); I. Carrilho (Inês); B. Chabrol (Brigitte); M.P. Champion (Michael); J. Coldwell (James); P. Clayton (Peter); E. Donner (Elizabeth); A. Evangeliou (Athanasios); F. Ebinger (Friedrich); K. Farrell (Kevin); R.J. Forsyth (Rob); C.G.E.L. de Goede (Christian); S. Gross (Stephanie); S. Grünewald (Sonja); H. Holthausen (Hans); S. Jayawant (Sandeep); K. Lachlan (Katherine); V. Laugel (Vincent); K. Leppig (Kathy); M.J. Lim (Ming); G.M.S. Mancini (Grazia); A.D. Marina; L. Martorell (Loreto); J. McMenamin (Joe); M.E.C. Meuwissen (Marije); H. Mundy (Helen); N.O. Nilsson (Nils); A. Panzer (Axel); B.T. Poll-The; C. Rauscher (Christian); C.M.R. Rouselle (Christophe); I. Sandvig (Inger); T. Scheffner (Thomas); E. Sheridan (Eamonn); N. Simpson (Neil); P. Sykora (Parol); R. Tomlinson (Richard); J. Trounce (John); D.W.M. Webb (David); B. Weschke (Bernhard); H. Scheffer (Hans); M.A. Willemsen (Michél)

    2010-01-01

    textabstractGlucose transporter-1 deficiency syndrome is caused by mutations in the SLC2A1 gene in the majority of patients and results in impaired glucose transport into the brain. From 2004-2008, 132 requests for mutational analysis of the SLC2A1 gene were studied by automated Sanger sequencing

  1. Glucose transporter-1 deficiency syndrome: the expanding clinical and genetic spectrum of a treatable disorder

    NARCIS (Netherlands)

    Leen, Wilhelmina G.; Klepper, Joerg; Verbeek, Marcel M.; Leferink, Maike; Hofste, Tom; van Engelen, Baziel G.; Wevers, Ron A.; Arthur, Todd; Bahi-Buisson, Nadia; Ballhausen, Diana; Bekhof, Jolita; van Bogaert, Patrick; Carrilho, Inês; Chabrol, Brigitte; Champion, Michael P.; Coldwell, James; Clayton, Peter; Donner, Elizabeth; Evangeliou, Athanasios; Ebinger, Friedrich; Farrell, Kevin; Forsyth, Rob J.; de Goede, Christian G. E. L.; Gross, Stephanie; Grunewald, Stephanie; Holthausen, Hans; Jayawant, Sandeep; Lachlan, Katherine; Laugel, Vincent; Leppig, Kathy; Lim, Ming J.; Mancini, Grazia; Marina, Adela Della; Martorell, Loreto; McMenamin, Joe; Meuwissen, Marije E. C.; Mundy, Helen; Nilsson, Nils O.; Panzer, Axel; Poll-The, Bwee T.; Rauscher, Christian; Rouselle, Christophe M. R.; Sandvig, Inger; Scheffner, Thomas; Sheridan, Eamonn; Simpson, Neil; Sykora, Parol; Tomlinson, Richard; Trounce, John; Webb, David; Weschke, Bernhard; Scheffer, Hans; Willemsen, Michél A.

    2010-01-01

    Glucose transporter-1 deficiency syndrome is caused by mutations in the SLC2A1 gene in the majority of patients and results in impaired glucose transport into the brain. From 2004-2008, 132 requests for mutational analysis of the SLC2A1 gene were studied by automated Sanger sequencing and multiplex

  2. Glucose transporter-1 deficiency syndrome: the expanding clinical and genetic spectrum of a treatable disorder.

    NARCIS (Netherlands)

    Leen, W.G.; Klepper, J.; Verbeek, M.M.; Leferink, M.; Hofste, T.; Engelen, B.G.M. van; Wevers, R.A.; Arthur, T.; Bahi-Buisson, N.; Ballhausen, D.; Bekhof, J.; Bogaert, P. van; Carrilho, I.; Chabrol, B.; Champion, M.P.; Coldwell, J.; Clayton, P.; Donner, E.; Evangeliou, A.; Ebinger, F.; Farrell, K.; Forsyth, R.J.; Goede, C.G. de; Gross, S.; Grunewald, S.; Holthausen, H.; Jayawant, S.; Lachlan, K.; Laugel, V.; Leppig, K.; Lim, M.J.; Mancini, G.; Marina, A.D.; Martorell, L.; McMenamin, J.; Meuwissen, M.E.; Mundy, H.; Nilsson, N.O.; Panzer, A.; Poll-The, B.T.; Rauscher, C.; Rouselle, C.M.; Sandvig, I.; Scheffner, T.; Sheridan, E.; Simpson, N.; Sykora, P.; Tomlinson, R.; Trounce, J.; Webb, D.; Weschke, B.; Scheffer, H.; Willemsen, M.A.A.P.

    2010-01-01

    Glucose transporter-1 deficiency syndrome is caused by mutations in the SLC2A1 gene in the majority of patients and results in impaired glucose transport into the brain. From 2004-2008, 132 requests for mutational analysis of the SLC2A1 gene were studied by automated Sanger sequencing and multiplex

  3. Verification of the SLC wake potentials

    International Nuclear Information System (INIS)

    Bane, K.; Weiland, T.

    1983-01-01

    The accurate knowledge of the monopole, dipole, and quadrupole wake potentials is essential for SLC. These wake potentials were previously computed by the modal method. The time domain code TBCI allows independent verification of these results. This comparison shows that the two methods agree to within 10% for bunch lengths down to 1 mm. TBCI results also indicate that rounding the irises gives at least a 10% reduction in the wake potentials

  4. Regulation and roles of bicarbonate transport in cancer

    Directory of Open Access Journals (Sweden)

    Andrej eGorbatenko

    2014-04-01

    Full Text Available A unifying feature of solid tumors is a markedly altered pH profile compared to normal tissues. This reflects that solid tumors, despite completely different origins, often share several phenotypic properties with implications for intra- and extracellular pH. These include: a metabolic shift in most cancer cells towards more acid-producing pathways, reflecting both oncogenic signaling and the development of hypoxia in poorly perfused regions of the tumors; the poorly perfused and often highly dense tumor microenvironment, reducing the diffusive flux of acid equivalents compared to that in normal tissues; and the markedly altered regulation of the expression and activity of pH-regulatory transport proteins in the cancer cells. While some of these properties of tumors have been well described in recent years, the great majority of the research in this clinically important area has focused on proton transport, in particular via the Na+/H+-exchanger 1 (SLC9A1, NHE1 and various H+ ATPases. We have, however, recently demonstrated that at least under some conditions, including in vitro models of HER2 positive breast cancer, and measurements obtained directly in freshly dissected human mammary tumors, bicarbonate transporters such as the electroneutral Na+,HCO3--cotransporter (SLC4A7, NBCn1, are upregulated and play central roles in pH regulation. In this review, we summarize and discuss the current knowledge regarding the regulation and roles of bicarbonate transport in cancer.

  5. The copper transporter (SLC31A1/CTR1) is expressed in bovine spermatozoa and oocytes: Copper in IVF medium improves sperm quality.

    Science.gov (United States)

    Anchordoquy, J P; Anchordoquy, J M; Pascua, A M; Nikoloff, N; Peral-García, P; Furnus, C C

    2017-07-15

    Adequate dietary intake of copper (Cu) is required for normal reproductive performance in cattle. The objective of this study was to investigate the pregnancy rates from cattle with deficient, marginal and adequate Cu plasma concentration at the beginning of artificial insemination protocol. Moreover, we determined Cu concentrations present in bovine oviductal fluid (OF), and the effects of Cu on fertilizing ability of bovine spermatozoa. Also, the presence of Cu transporter, SLC31A1 (also known as CTR1), in spermatozoa and in vitro matured oocyte were investigated. We found no differences in pregnancy rates among animals with adequate, marginal, and deficient Cu concentrations measured in plasma at the beginning of fixed-time artificial insemination (FTAI) protocol. Copper concentrations in OF were 38.3 ± 2.17 μg/dL (mean ± SEM) regardless of cupremia levels. The addition of 40 μg/dL Cu to IVF medium enhanced total and progressive motility, sperm viability, functional sperm membrane integrity (HOST), sperm-zona binding, and pronuclear formation. On the other hand, the presence of Cu in IVF medium did not modify acrosome integrity and cleavage rates after IVF, but impaired blastocyst rates. Cu transporter SLC31A1 was detected in bovine spermatozoa in the apical segment of acrosome, and in the oocyte matured in vitro. In conclusion, the results obtained in the present study determined that cupremia levels at the beginning of FTAI protocol did not influence the pregnancy rates at 60 d after insemination. The presence of CTR1 in bovine mature oocyte and spermatozoa, as well as the beneficial effect of Cu on sperm quality would suggest an important role of this mineral during the fertilization process. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Adding PCs to SLC Control System

    International Nuclear Information System (INIS)

    Lahey, T.; Levitt, S.; MacKenzie, R.; Spencer, N.; Underwood, K.

    1993-05-01

    The SLAC Controls Department has interfaced IBM-Compatible PCs to the SLC Control System, for use by the Final Focus Test Beam (FFTB) experimenters, who are building new accelerator equipment and developing and testing it at their home institutions. They will bring the equipment to SLAC and integrate it into the control system using a new software package. The machine physicists and operators will use the existing SLC control system applications and database device types to control and monitor the equipment. The PCs support a limited control environment: they run DOS and exchange messages with the existing control system via TCP/IP over ethernet, using the new SLC Area Message Service. This mechanism will also allow SLC to implement other commercial device controllers that can communicate over ethernet and run the same software interface code

  7. Multicenter cohort association study of SLC2A1 single nucleotide polymorphisms and age-related macular degeneration

    Science.gov (United States)

    Baas, Dominique C.; Ho, Lintje; Tanck, Michael W.T.; Fritsche, Lars G.; Merriam, Joanna E.; van het Slot, Ruben; Koeleman, Bobby P.C.; Gorgels, Theo G.M.F.; van Duijn, Cornelia M.; Uitterlinden, André G.; de Jong, Paulus T.V.M.; Hofman, Albert; ten Brink, Jacoline B.; Vingerling, Johannes R.; Klaver, Caroline C.W.; Dean, Michael; Weber, Bernhard H. F.; Allikmets, Rando; Hageman, Gregory S.

    2012-01-01

    Purpose Age-related macular degeneration (AMD) is a major cause of blindness in older adults and has a genetically complex background. This study examines the potential association between single nucleotide polymorphisms (SNPs) in the glucose transporter 1 (SLC2A1) gene and AMD. SLC2A1 regulates the bioavailability of glucose in the retinal pigment epithelium (RPE), which might influence oxidative stress–mediated AMD pathology. Methods Twenty-two SNPs spanning the SLC2A1 gene were genotyped in 375 cases and 199 controls from an initial discovery cohort (the Amsterdam-Rotterdam-Netherlands study). Replication testing was performed in The Rotterdam Study (the Netherlands) and study populations from Würzburg (Germany), the Age Related Eye Disease Study (AREDS; United States), Columbia University (United States), and Iowa University (United States). Subsequently, a meta-analysis of SNP association was performed. Results In the discovery cohort, significant genotypic association between three SNPs (rs3754219, rs4660687, and rs841853) and AMD was found. Replication in five large independent (Caucasian) cohorts (4,860 cases and 4,004 controls) did not yield consistent association results. The genotype frequencies for these SNPs were significantly different for the controls and/or cases among the six individual populations. Meta-analysis revealed significant heterogeneity of effect between the studies. Conclusions No overall association between SLC2A1 SNPs and AMD was demonstrated. Since the genotype frequencies for the three SLC2A1 SNPs were significantly different for the controls and/or cases between the six cohorts, this study corroborates previous evidence that population dependent genetic risk heterogeneity in AMD exists. PMID:22509097

  8. Synopsis of the 48 annual meeting of the Lake Cumberland Biological Transport Group and the second biannual meeting of the Pendrin Consortium.

    Science.gov (United States)

    Dossena, Silvia; Nofziger, Charity; Morabito, Rossana; Adragna, Norma C; Paulmichl, Markus

    2013-01-01

    Ion transporters are the molecular basis for ion homeostasis of the cell and the whole organism. The anion exchanger pendrin is only one of a number of examples where a complete or partial loss of function and/or deregulation of expression of ion transporters may lead or contribute to pathological conditions in humans. A complete understanding of the function of ion transporters in health and disease may pave the way for the identification of new and focused therapeutic approaches. Exchange of knowledge and connectivity between the experts in the feld of transport physiology is essential in facing these challenging tasks. The Lake Cumberland Biological Transport Group and the Pendrin Consortium are examples of scientific forums where investigators combine their efforts towards a better understanding of molecular pathophysiology of ion transport. This issue discusses the versatility of ion transporters involved in the regulation of cellular volume and other functions, such as the solute carrier (SLC) 12A gene family members SLC12A4-7, encoding the Na(+)-independent cation-chloride cotransporters commonly known as the K(+)-Cl(-) cotransporters KCC1-4, and the betaine/γ-aminobutyric acid transport system (BGT1, SLC6A12), just to name a few. The issue further addresses the pathophysiology of intestinal and respiratory epithelia and related therapeutic tools and techniques to investigate interactions between proteins and proteins and small compounds. Finally, the current knowledge and new findings on the expression, regulation and function of pendrin (SLC26A4) in the inner ear, kidney, airways and blood platelets are presented. © 2014 S. Karger AG, Basel.

  9. SLC22A1-ABCB1 haplotype profiles predict imatinib pharmacokinetics in Asian patients with chronic myeloid leukemia.

    Directory of Open Access Journals (Sweden)

    Onkar Singh

    Full Text Available OBJECTIVE: This study aimed to explore the influence of SLC22A1, PXR, ABCG2, ABCB1 and CYP3A5 3 genetic polymorphisms on imatinib mesylate (IM pharmacokinetics in Asian patients with chronic myeloid leukemia (CML. PATIENTS AND METHODS: Healthy subjects belonging to three Asian populations (Chinese, Malay, Indian; n = 70 each and CML patients (n = 38 were enrolled in a prospective pharmacogenetics study. Imatinib trough (C(0h and clearance (CL were determined in the patients at steady state. Haplowalk method was applied to infer the haplotypes and generalized linear model (GLM to estimate haplotypic effects on IM pharmacokinetics. Association of haplotype copy numbers with IM pharmacokinetics was defined by Mann-Whitney U test. RESULTS: Global haplotype score statistics revealed a SLC22A1 sub-haplotypic region encompassing three polymorphisms (rs3798168, rs628031 and IVS7+850C>T, to be significantly associated with IM clearance (p = 0.013. Haplotype-specific GLM estimated that the haplotypes AGT and CGC were both associated with 22% decrease in clearance compared to CAC [CL (10(-2 L/hr/mg: CAC vs AGT: 4.03 vs 3.16, p = 0.017; CAC vs CGC: 4.03 vs 3.15, p = 0.017]. Patients harboring 2 copies of AGT or CGC haplotypes had 33.4% lower clearance and 50% higher C(0h than patients carrying 0 or 1 copy [CL (10(-2 L/hr/mg: 2.19 vs 3.29, p = 0.026; C(0h (10(-6 1/ml: 4.76 vs 3.17, p = 0.013, respectively]. Further subgroup analysis revealed SLC22A1 and ABCB1 haplotypic combinations to be significantly associated with clearance and C(0h (p = 0.002 and 0.009, respectively. CONCLUSION: This exploratory study suggests that SLC22A1-ABCB1 haplotypes may influence IM pharmacokinetics in Asian CML patients.

  10. Impedance calculations for the improved SLC damping rings

    International Nuclear Information System (INIS)

    Bane, K.L.F.; Ng, C.K.

    1993-04-01

    A longitudinal, single bunch instability is observed in the damping rings of the Stanford Linear Collider (SLC). Beyond a threshold bunch population of 3 x 10 10 particles the bunch energy spread increases and a ''saw-tooth'' variation in bunch length and synchronous phase as functions of time is observed. Although the relative amplitude of the saw-tooth variation is small-only on the order of 10% -- the resulting unpredictability of the beam properties in the rest of the SLC accelerator makes it difficult, if not impossible, to operate the machine above the threshold current. An additional problem at higher currents is that the bunch length is greatly increased. When the bunch is very long in the ring it becomes difficult or impossible to properly compress it after extraction. We want to solve both of these problems so that the SLC can run at higher currents to increase the luminosity. In order to solve these problems the vacuum chambers of both damping rings are being rebuilt with the aim of reducing their impedance. According to previous calculations the impedance the SLC damping rings is dominated by the many small discontinuities that are located in the so-called QD and QF vacuum chamber segments -- elements such as transitions, masks, bellows-that are inductive to the beam, Since these earlier calculations were performed the bellows of the QD segments have been sleeved, yielding a factor of 2 increase in the instability threshold. In this paper we begin by discussing the gains that might be achieved if we can reduce the impedance of the rings even further. Then we estimate the effect on the total impedance of the actual design changes that are being proposed. Three important elements -- the bend-to-quad transitions, the distributed ion pump slots, and the beam position monitor (BPM) electrodes are fully 3-dimensional and will be studied using T3 of the MAFIA computer programs

  11. SLC polarized beam source ultra-high-vacuum design

    International Nuclear Information System (INIS)

    Lavine, T.L.; Clendenin, J.E.; Garwin, E.L.; Hoyt, E.W.; Hoyt, M.W.; Miller, R.H.; Nuttall, J.A.; Schultz, D.C.; Wright, D.

    1991-05-01

    This paper describes the design of the ultra-high vacuum system for the beam-line from the 160-kV polarized electron gun to the linac injector in the Stanford Linear Collider (SLC). The polarized electron source is a GaAs photocathode, requiring 10 -11 -Torr-range pressure for adequate quantum efficiency and longevity. The photo-cathode is illuminated by 3-nsec-long laser pulses. Photo-cathode maintenance and improvements require occasional substitution of guns with rapid restoration of UHV conditions. Differential pumping is crucial since the pressure in the injector is more than 10 times greater than the photocathode can tolerate, and since electron-stimulated gas desorption from beam loss in excess of 0.1% of the 20-nC pulses may poison the photocathode. Our design for the transport line contains a differential pumping region isolated by a pair of valves. Exchange of guns requires venting only this isolated region which can be restored to UHV rapidly by baking. The differential pumping is performed by non-evaporable getters (NEGs) and an ion pump. 3 refs., 3 figs

  12. Synopsis of the 48th Annual Meeting of the Lake Cumberland Biological Transport Group and the Second Biannual Meeting of the Pendrin Consortium

    Directory of Open Access Journals (Sweden)

    Silvia Dossena

    2013-12-01

    Full Text Available Ion transporters are the molecular basis for ion homeostasis of the cell and the whole organism. The anion exchanger pendrin is only one of a number of examples where a complete or partial loss of function and/or deregulation of expression of ion transporters may lead or contribute to pathological conditions in humans. A complete understanding of the function of ion transporters in health and disease may pave the way for the identification of new and focused therapeutic approaches. Exchange of knowledge and connectivity between the experts in the feld of transport physiology is essential in facing these challenging tasks. The Lake Cumberland Biological Transport Group and the Pendrin Consortium are examples of scientific forums where investigators combine their efforts towards a better understanding of molecular pathophysiology of ion transport. This issue discusses the versatility of ion transporters involved in the regulation of cellular volume and other functions, such as the solute carrier (SLC 12A gene family members SLC12A4-7, encoding the Na+-independent cation-chloride cotransporters commonly known as the K+-Cl- cotransporters KCC1-4, and the betaine/γ-aminobutyric acid transport system (BGT1, SLC6A12, just to name a few. The issue further addresses the pathophysiology of intestinal and respiratory epithelia and related therapeutic tools and techniques to investigate interactions between proteins and proteins and small compounds. Finally, the current knowledge and new findings on the expression, regulation and function of pendrin (SLC26A4 in the inner ear, kidney, airways and blood platelets are presented.

  13. A laser-based beam profile monitor for the SLC/SLD interaction region

    International Nuclear Information System (INIS)

    Alley, R.; Arnett, D.; Bong, E.; Colocho, W.; Frisch, J.; Horton-Smith, S.; Inman, W.; Jobe, K.; Kotseroglou, T.; McCormick, D.; Nelson, J.; Scheeff, M.; Wagner, S.; Ross, M.C.

    1996-01-01

    Beam size estimates made using beam-beam deflections are used for optimization of the Stanford linear collider (SLC) electron-positron beam sizes. Typical beam sizes and intensities expected for 1996 operations are 2.1 x 0.6 μm (x, y) at 4.0.10 10 particles per pulse. Conventional profile monitors, such as scanning wires, fail at charge densities well below this. The laser-based profile monitor uses a finely-focused 350-nm wavelength tripled YLF laser pulse that traverses the particle beam path about 29 cm away from the e + /e - IP. Compton scattered photons and degraded e + /e - are detected as the beam is steered across the laser pulse. The laser pulse has a transverse size of 380 nm and a Rayleigh range of about 5 μm. (orig.)

  14. Evolutionary relationships and functional diversity of plant sulfate transporters

    Directory of Open Access Journals (Sweden)

    Hideki eTakahashi

    2012-01-01

    Full Text Available Sulfate is an essential nutrient cycled in nature. Ion transporters that specifically facilitate the transport of sulfate across the membranes are found ubiquitously in living organisms. The phylogenetic analysis of known sulfate transporters and their homologous proteins from eukaryotic organisms indicate two evolutionarily distinct groups of sulfate transport systems. One major group named Tribe 1 represents yeast and fungal SUL, plant SULTR and animal SLC26 families. The evolutionary origin of SULTR family members in land plants and green algae is suggested to be common with yeast and fungal sulfate transporters (SUL and animal anion exchangers (SLC26. The lineage of plant SULTR family is expanded into four subfamilies (SULTR1 to SULTR4 in land plant species. By contrast, the putative SULTR homologues from Chlorophyte green algae are in two separate lineages; one with the subfamily of plant tonoplast-localized sulfate transporters (SULTR4, and the other diverged before the appearance of lineages for SUL, SULTR and SLC26. There also was a group of yet undefined members of putative sulfate transporters in yeast and fungi divergent from these major lineages in Tribe 1. The other distinct group is Tribe 2, primarily composed of animal sodium-dependent sulfate/carboxylate transporters (SLC13 and plant tonoplast-localized dicarboxylate transporters (TDT. The putative sulfur-sensing protein (SAC1 and SAC1-like transporters (SLT of Chlorophyte green algae, bryophyte and lycophyte show low degrees of sequence similarities with SLC13 and TDT. However, the phylogenetic relationship between SAC1/SLT and the other two families, SLC13 and TDT in Tribe 2, is not clearly supported. In addition, the SAC1/SLT family is completely absent in the angiosperm species analyzed. The present study suggests distinct evolutionary trajectories of sulfate transport systems for land plants and green algae.

  15. Mitochondrial oxodicarboxylate carrier deficiency is associated with mitochondrial DNA depletion and spinal muscular atrophy-like disease.

    Science.gov (United States)

    Boczonadi, Veronika; King, Martin S; Smith, Anthony C; Olahova, Monika; Bansagi, Boglarka; Roos, Andreas; Eyassu, Filmon; Borchers, Christoph; Ramesh, Venkateswaran; Lochmüller, Hanns; Polvikoski, Tuomo; Whittaker, Roger G; Pyle, Angela; Griffin, Helen; Taylor, Robert W; Chinnery, Patrick F; Robinson, Alan J; Kunji, Edmund R S; Horvath, Rita

    2018-03-08

    PurposeTo understand the role of the mitochondrial oxodicarboxylate carrier (SLC25A21) in the development of spinal muscular atrophy-like disease.MethodsWe identified a novel pathogenic variant in a patient by whole-exome sequencing. The pathogenicity of the mutation was studied by transport assays, computer modeling, followed by targeted metabolic testing and in vitro studies in human fibroblasts and neurons.ResultsThe patient carries a homozygous pathogenic variant c.695A>G; p.(Lys232Arg) in the SLC25A21 gene, encoding the mitochondrial oxodicarboxylate carrier, and developed spinal muscular atrophy and mitochondrial myopathy. Transport assays show that the mutation renders SLC25A21 dysfunctional and 2-oxoadipate cannot be imported into the mitochondrial matrix. Computer models of central metabolism predicted that impaired transport of oxodicarboxylate disrupts the pathways of lysine and tryptophan degradation, and causes accumulation of 2-oxoadipate, pipecolic acid, and quinolinic acid, which was confirmed in the patient's urine by targeted metabolomics. Exposure to 2-oxoadipate and quinolinic acid decreased the level of mitochondrial complexes in neuronal cells (SH-SY5Y) and induced apoptosis.ConclusionMitochondrial oxodicarboxylate carrier deficiency leads to mitochondrial dysfunction and the accumulation of oxoadipate and quinolinic acid, which in turn cause toxicity in spinal motor neurons leading to spinal muscular atrophy-like disease.GENETICS in MEDICINE advance online publication, 8 March 2018; doi:10.1038/gim.2017.251.

  16. The mitochondrial citrate carrier, SLC25A1, drives stemness and therapy resistance in non-small cell lung cancer.

    Science.gov (United States)

    Fernandez, Harvey R; Gadre, Shreyas M; Tan, Mingjun; Graham, Garrett T; Mosaoa, Rami; Ongkeko, Martin S; Kim, Kyu Ah; Riggins, Rebecca B; Parasido, Erika; Petrini, Iacopo; Pacini, Simone; Cheema, Amrita; Varghese, Rency; Ressom, Habtom W; Zhang, Yuwen; Albanese, Christopher; Üren, Aykut; Paige, Mikell; Giaccone, Giuseppe; Avantaggiati, Maria Laura

    2018-04-12

    Therapy resistance represents a clinical challenge for advanced non-small cell lung cancer (NSCLC), which still remains an incurable disease. There is growing evidence that cancer-initiating or cancer stem cells (CSCs) provide a reservoir of slow-growing dormant populations of cells with tumor-initiating and unlimited self-renewal ability that are left behind by conventional therapies reigniting post-therapy relapse and metastatic dissemination. The metabolic pathways required for the expansion of CSCs are incompletely defined, but their understanding will likely open new therapeutic opportunities. We show here that lung CSCs rely upon oxidative phosphorylation for energy production and survival through the activity of the mitochondrial citrate transporter, SLC25A1. We demonstrate that SLC25A1 plays a key role in maintaining the mitochondrial pool of citrate and redox balance in CSCs, whereas its inhibition leads to reactive oxygen species build-up thereby inhibiting the self-renewal capability of CSCs. Moreover, in different patient-derived tumors, resistance to cisplatin or to epidermal growth factor receptor (EGFR) inhibitor treatment is acquired through SLC25A1-mediated implementation of mitochondrial activity and induction of a stemness phenotype. Hence, a newly identified specific SLC25A1 inhibitor is synthetic lethal with cisplatin or with EGFR inhibitor co-treatment and restores antitumor responses to these agents in vitro and in animal models. These data have potential clinical implications in that they unravel a metabolic vulnerability of drug-resistant lung CSCs, identify a novel SLC25A1 inhibitor and, lastly, provide the first line of evidence that drugs, which block SLC25A1 activity, when employed in combination with selected conventional antitumor agents, lead to a therapeutic benefit.

  17. Bunch-length and beam-timing monitors in the SLC final focus

    International Nuclear Information System (INIS)

    Zimmermann, F.; Yocky, G.; Whittum, D.H.; Seidel, M.; Ng, C.K.; McCormick, D.; Bane, K.L.F.

    1998-07-01

    During the 1997/98 luminosity run of the Stanford Linear Collider (SLC), two novel RF-based detectors were brought into operation, in order to monitor the interaction-point (IP) bunch lengths and fluctuations in the relative arrival time of the two colliding beams. Both bunch length and timing can strongly affect the SLC luminosity and had not been monitored in previous years. The two new detectors utilize a broad-band microwave signal, which is excited by the beam through a ceramic gap in the final-focus beam pipe and transported outside of the beam line vault by a 160-ft long X-Band waveguide. The authors describe the estimated luminosity reduction due to bunch-length drift and IP timing fluctuation, the monitor layout, the expected responses and signal levels, calibration measurements, and beam observations

  18. Evolutionary relationships and functional diversity of plant sulfate transporters.

    Science.gov (United States)

    Takahashi, Hideki; Buchner, Peter; Yoshimoto, Naoko; Hawkesford, Malcolm J; Shiu, Shin-Han

    2011-01-01

    Sulfate is an essential nutrient cycled in nature. Ion transporters that specifically facilitate the transport of sulfate across the membranes are found ubiquitously in living organisms. The phylogenetic analysis of known sulfate transporters and their homologous proteins from eukaryotic organisms indicate two evolutionarily distinct groups of sulfate transport systems. One major group named Tribe 1 represents yeast and fungal SUL, plant SULTR, and animal SLC26 families. The evolutionary origin of SULTR family members in land plants and green algae is suggested to be common with yeast and fungal SUL and animal anion exchangers (SLC26). The lineage of plant SULTR family is expanded into four subfamilies (SULTR1-SULTR4) in land plant species. By contrast, the putative SULTR homologs from Chlorophyte green algae are in two separate lineages; one with the subfamily of plant tonoplast-localized sulfate transporters (SULTR4), and the other diverged before the appearance of lineages for SUL, SULTR, and SLC26. There also was a group of yet undefined members of putative sulfate transporters in yeast and fungi divergent from these major lineages in Tribe 1. The other distinct group is Tribe 2, primarily composed of animal sodium-dependent sulfate/carboxylate transporters (SLC13) and plant tonoplast-localized dicarboxylate transporters (TDT). The putative sulfur-sensing protein (SAC1) and SAC1-like transporters (SLT) of Chlorophyte green algae, bryophyte, and lycophyte show low degrees of sequence similarities with SLC13 and TDT. However, the phylogenetic relationship between SAC1/SLT and the other two families, SLC13 and TDT in Tribe 2, is not clearly supported. In addition, the SAC1/SLT family is absent in the angiosperm species analyzed. The present study suggests distinct evolutionary trajectories of sulfate transport systems for land plants and green algae.

  19. SLC26A4 Variations Among Graves’ Hyper-Functioning Thyroid Gland

    Directory of Open Access Journals (Sweden)

    Hassen Hadj-Kacem

    2010-01-01

    Full Text Available Deleterious mutations of SLC26A4 cause Pendred syndrome (PS, an autosomal recessive disorder comprising goitre and deafness with enlarged vestibular aqueducts (EVA, and nonsyndromic hearing loss (NSHL. However, the SLC26A4 hyperactivity was recently associated with the emergence of autoimmune thyroid diseases (AITD and asthma among human and mouse model. Here, by direct sequencing, we investigate the sequences of the 20 coding exons (2 to 21 of SLC26A4 and their flanking intron-exon junctions among patients affected with Graves' disease (GD hyperthyroidism. Ten mono-allelic variants were identified, seven of which are intronic and previously unreported. Two, c.898A>C (p.I300L and c.1061T>C (p.F354S, of the three exonic variants are non synonymous. The p.F354S variant is already described to be involved in PS or NSHL inheritances. The exploration by PCR-RFLP of p.I300L and p.F354S variants among 132 GD patients, 105 Hashimoto thyroiditis (HT, 206 Healthy subjects and 102 families with NSHL have shown the presence of both variants. The p.F354S variation was identified both among patients (1~HT and 3 GD and healthy subjects (n=5. Whereas, the p.I300L variant was identified only in GD patients (n=3. Our studies provide evidence of the importance of systematic analysis of SLC26A4 gene sequences on models other than deafness. This approach allows the identification of new variants and the review of the pathogenic effects of certain mono-allelic variants reported responsible for PS and NSHL development.

  20. Variations in CCR5, but not HFE, ELMO1, or SLC12A3, are associated with susceptibility to kidney disease in north Indian individuals with type 2 diabetes.

    Science.gov (United States)

    Yadav, Ashok K; Kumar, Vinod; Dutta, Pinaki; Bhansali, Anil; Jha, Vivekanand

    2014-11-01

    Diabetic nephropathy (DN), the leading cause of end-stage renal disease worldwide, may have a genetic component. In the present study, we investigated variations in a set of genes with susceptibility to DN in a north Indian population. Four genes (HFE, ELMO1, SLC12A3, and CCR5) were selected on the basis of reported association with type 2 diabetes and nephropathy. In all, 417 diabetic subjects (215 without kidney disease [DM] and 202 with DN) and 197 healthy controls (HC) were evaluated for variations in HFE (845 G>A and 187G>C), SLC12A3 (g.34372G>A), CCR5 (59029A>G), and ELMO1 (+9170 G>A). Polymorphism analysis was performed by polymerase chain reaction-restriction fragment length polymorphism and Taqman allele discrimination assays. Significant differences were found in genotype and allelic frequency in SLC12A3 (g.34372G>A) between diabetic subjects and HC (P A (AA+GA) genotype between diabetic subjects with and without nephropathy. However, the CCR5 59029AA genotype and A allele were significantly more frequent in diabetics compared with the HC (P = 0.01 and 0.03, respectively) and subjects with DN versus DM (P = 0.002 and 0.01, respectively). For ELMO1 (+9170 G>A), the GG genotype frequency was higher in the diabetic versus HC group. There were no differences in the frequency of HFE-845 G>A and HFE-187G>C among the groups. This study shows that the CCR5 AA genotype is over-represented in subjects with kidney disease due to type 2 diabetes. The CCR5 59029G>A and ELMO1 (+9170 G>A) loci are more frequent, and the SLC12A3 34372 AA genotype is associated with a reduced risk of diabetes. © 2014 Ruijin Hospital, Shanghai Jiaotong University School of Medicine and Wiley Publishing Asia Pty Ltd.

  1. The effects and mechanisms of SLC34A2 on maintaining stem cell-like phenotypes in CD147+ breast cancer stem cells.

    Science.gov (United States)

    Lv, Yonggang; Wang, Ting; Fan, Jing; Zhang, Zhenzhen; Zhang, Juliang; Xu, Cheng; Li, Yongping; Zhao, Ge; He, Chenyang; Meng, Huimin; Yang, Hua; Wang, Zhen; Liu, Jiayun; Chen, Jianghao; Wang, Ling

    2017-04-01

    The cancer stem cell (CSC) hypothesis has gained significant recognition in describing tumorigenesis. Identification of the factors critical to development of breast cancer stem cells (BCSCs) may provide insight into the improvement of effective therapies against breast cancer. In this study, we aim to investigate the biological function of SLC34A2 in affecting the stem cell-like phenotypes in BCSCs and its underlying mechanisms. We demonstrated that CD147 + cells from breast cancer tissue samples and cell lines possessed BCSC-like features, including the ability of self-renewal in vitro, differentiation, and tumorigenic potential in vivo. Flow cytometry analysis showed the presence of a variable fraction of CD147 + cells in 9 of 10 tumor samples. Significantly, SLC34A2 expression in CD147 + BCSCs was enhanced compared with that in differentiated adherent progeny of CD147 + BCSCs and adherently cultured cell line cells. In breast cancer patient cohorts, SLC34A2 expression was found increased in 9 of 10 tumor samples. By using lentiviral-based approach, si-SLC34A2-transduced CD147 + BCSCs showed decreased ability of sphere formation, cell viability in vitro, and tumorigenicity in vivo, which suggested the essential role of SLC34A2 in CD147 + BCSCs. Furthermore, PI3K/AKT pathway and SOX2 were found necessary to maintain the stemness of CD147 + BCSCs by using LY294002 or lentiviral-si-SOX2. Finally, we indicated that SLC34A2 could regulate SOX2 to maintain the stem cell-like features in CD147 + BCSCs through PI3K/AKT pathway. Therefore, our report identifies a novel role of SLC34A2 in BCSCs' state regulation and establishes a rationale for targeting the SLC34A2/PI3K/AKT/SOX2 signaling pathway for breast cancer therapy.

  2. Language disorder with mild intellectual disability in a child affected by a novel mutation of SLC6A8 gene.

    Science.gov (United States)

    Battini, R; Chilosi, A M; Casarano, M; Moro, F; Comparini, A; Alessandrì, M G; Leuzzi, V; Tosetti, M; Cioni, G

    2011-02-01

    We describe the clinical and molecular features of a child harboring a novel mutation in SLC6A8 gene in association with a milder phenotype than other creatine transporter (CT1) deficient patients (OMIM 300352) [1-7]. The mutation c.757 G>C p.G253R in exon 4 of SLC6A8 was hemizygous in the child, aged 6 years and 6 months, who showed mild intellectual disability with severe speech and language delay. His carrier mother had borderline intellectual functioning. Although the neurochemical and biochemical parameters were fully consistent with those reported in the literature for subjects with CT1 deficit, in our patient within a general cognitive disability, a discrepancy between nonverbal and verbal skills was observed, confirming the peculiar vulnerability of language development under brain Cr depletion. Copyright © 2010 Elsevier Inc. All rights reserved.

  3. Beam determination of quadrupole misalignments and beam position monitor biases in the SLC linac

    International Nuclear Information System (INIS)

    Lavine, T.L.; Seeman, J.T.; Atwood, W.B.; Himel, T.M.; Petersen, A.; Adolphsen, C.E.

    1988-09-01

    Misalignments of magnetic quadrupoles and biases in beam position monitors (BPMs) in the Stanford Linear Collider (SLC) linac can lead to a situation in which the beam is off-center in the disk-loaded waveguide accelerator structure. The off-center beam produces wakefields which can limit SLC performance by causing unacceptably large emittance growth. We present a general method for determining quadrupole misalignments and BPM biases in the SLC linac by using beam trajectory measurements. The method utilizes both electron and positron beams on opposite rf cycles in the same linac lattice to determine simultaneously magnetic quadrupole misalignments and BPM biases. The two-beam trajectory data may be acquired without interrupting SLC colliding beam operations. 2 refs., 5 figs

  4. SLC kicker magnet limitations

    International Nuclear Information System (INIS)

    Cassel, R.; Donaldson, A.; Mattison, T.; Bowden, G.; Weaver, J.; Bulos, F.; Fiander, D.

    1991-01-01

    The SLC Damping Ring kicker magnets requires a fast magnetic field rise time of 58 nsec, a peak field of 800 gauss, a pulse amplitude stability of 0.01%, and a reasonable operational lifetime. The original kicker magnets designed by SLAC and at Fermi were not able to fulfill the SLC kicker requirements. Extensive studies were conducted to determine the limitation in the magnets, response of the ferrite in kicker magnet, and the modifications needed to improve the kicker magnet performance. The paper details the SLAC and Fermi kicker magnets limitation of performance

  5. Folic acid induces cell type-specific changes in the transcriptome of breast cancer cell lines: a proof-of-concept study.

    Science.gov (United States)

    Price, R Jordan; Lillycrop, Karen A; Burdge, Graham C

    2016-01-01

    The effect of folic acid (FA) on breast cancer (BC) risk is uncertain. We hypothesised that this uncertainty may be due, in part, to differential effects of FA between BC cells with different phenotypes. To test this we investigated the effect of treatment with FA concentrations within the range of unmetabolised FA reported in humans on the expression of the transcriptome of non-transformed (MCF10A) and cancerous (MCF7 and Hs578T) BC cells. The total number of transcripts altered was: MCF10A, seventy-five (seventy up-regulated); MCF7, twenty-four (fourteen up-regulated); and Hs578T, 328 (156 up-regulated). Only the cancer-associated gene TAGLN was altered by FA in all three cell lines. In MCF10A and Hs578T cells, FA treatment decreased pathways associated with apoptosis, cell death and senescence, but increased those associated with cell proliferation. The folate transporters SLC19A1, SLC46A1 and FOLR1 were differentially expressed between cell lines tested. However, the level of expression was not altered by FA treatment. These findings suggest that physiological concentrations of FA can induce cell type-specific changes in gene regulation in a manner that is consistent with proliferative phenotype. This has implications for understanding the role of FA in BC risk. In addition, these findings support the suggestion that differences in gene expression induced by FA may involve differential activities of folate transporters. Together these findings indicate the need for further studies of the effect of FA on BC.

  6. Recent advances on uric acid transporters

    Science.gov (United States)

    Xu, Liuqing; Shi, Yingfeng; Zhuang, Shougang; Liu, Na

    2017-01-01

    Uric acid is the product of purine metabolism and its increased levels result in hyperuricemia. A number of epidemiological reports link hyperuricemia with multiple disorders, such as kidney diseases, cardiovascular diseases and diabetes. Recent studies also showed that expression and functional changes of urate transporters are associated with hyperuricemia. Uric acid transporters are divided into two categories: urate reabsorption transporters, including urate anion transporter 1 (URAT1), organic anion transporter 4 (OAT4) and glucose transporter 9 (GLUT9), and urate excretion transporetrs, including OAT1, OAT3, urate transporter (UAT), multidrug resistance protein 4 (MRP4/ABCC4), ABCG-2 and sodium-dependent phosphate transport protein. In the kidney, uric acid transporters decrease the reabsorption of urate and increase its secretion. These transporters’ dysfunction would lead to hyperuricemia. As the function of urate transporters is important to control the level of serum uric acid, studies on the functional role of uric acid transporter may provide a new strategy to treat hyperuricemia associated diseases, such as gout, chronic kidney disease, hyperlipidemia, hypertension, coronary heart disease, diabetes and other disorders. This review article summarizes the physiology of urate reabsorption and excretion transporters and highlights the recent advances on their roles in hyperuricemia and various diseases. PMID:29246027

  7. Precise system stabilization at SLC using dither techniques

    International Nuclear Information System (INIS)

    Ross, M.C.; Hendrickson, L.; Himel, T.; Miller, E.

    1993-01-01

    A data acquisition method has been developed at the SLAC Linear Collider (SLC) that provides accurate beam parameter information using sub-tolerance excitation and synchronized detection. This is being applied to several SLC sub-systems to provide high speed feedback on beam parameters such as linac output energy spread. The method has significantly improved control of the linac energy spread. The linac average phase offset (θ), used to compensate the effects of longitudinal wakefields, is adjusted ±l control bit (about 0.18 degree S-band or 20% of tolerance), in a continuous fashion. Properly coordinated beam energy measurements provide a measure of the derivative of the accelerating voltage (dE/dθ). The position of the beam on the RF wave can thus be determined to ± 0.3 degree in about 5 seconds. The dithering does not contribute significantly to the energy jitter of the SLC and therefore does not adversely affect routine operation. Future applications include control of the interaction region beam size and orientation

  8. Organic anion and cation SLC22 "drug" transporter (Oat1, Oat3, and Oct1 regulation during development and maturation of the kidney proximal tubule.

    Directory of Open Access Journals (Sweden)

    Thomas F Gallegos

    Full Text Available Proper physiological function in the pre- and post-natal proximal tubule of the kidney depends upon the acquisition of selective permeability, apical-basolateral epithelial polarity and the expression of key transporters, including those involved in metabolite, toxin and drug handling. Particularly important are the SLC22 family of transporters, including the organic anion transporters Oat1 (originally identified as NKT and Oat3 as well as the organic cation transporter Oct1. In ex vivo cultures of metanephric mesenchyme (MM; the embryonic progenitor tissue of the nephron Oat function was evident before completion of nephron segmentation and corresponded with the maturation of tight junctions as measured biochemically by detergent extractability of the tight junction protein, ZO-1. Examination of available time series microarray data sets in the context of development and differentiation of the proximal tubule (derived from both in vivo and in vitro/ex vivo developing nephrons allowed for correlation of gene expression data to biochemically and functionally defined states of development. This bioinformatic analysis yielded a network of genes with connectivity biased toward Hnf4α (but including Hnf1α, hyaluronic acid-CD44, and notch pathways. Intriguingly, the Oat1 and Oat3 genes were found to have strong temporal co-expression with Hnf4α in the cultured MM supporting the notion of some connection between the transporters and this transcription factor. Taken together with the ChIP-qPCR finding that Hnf4α occupies Oat1, Oat3, and Oct1 proximal promoters in the in vivo differentiating rat kidney, the data suggest a network of genes with Hnf4α at its center plays a role in regulating the terminal differentiation and capacity for drug and toxin handling by the nascent proximal tubule of the kidney.

  9. Renal transport and metabolism of nicotinic acid

    International Nuclear Information System (INIS)

    Schuette, S.; Rose, R.C.

    1986-01-01

    Renal metabolism and brush-border transport of nicotinic acid were studied in renal cortical slices and brush-border membrane vesicles exposed to a physiological concentration of vitamin (2.2-3.5 microM). Vesicle transport of [ 3 H]nicotinic acid was found to be Na+ dependent and concentrative. The presence of a Na+ gradient resulted in a fivefold increase in the rate of nicotinic acid uptake over that observed with mannitol and caused a transient nicotinic acid accumulation two- to fourfold above the equilibrium value. The effects of membrane potential, pH, and elimination of Na+-H+ exchange were also studied. Cortical slices and isolated tubules exposed to 2.2 microM [ 14 C]nicotinic acid took up vitamin and rapidly metabolized most of it to intermediates in the Preiss-Handler pathway for NAD biosynthesis; little free nicotinic acid was detectable intracellularly. The replacement of Na+ with Li+ in the bathing medium reduced total accumulation of 14 C label primarily as a result of reduced nicotinic acid uptake. Cortical tissue concentrated free nicotinic acid only when the involved metabolic pathways were saturated by levels of nicotinic acid far in excess of what occurs in vivo

  10. Hypothesis: SLC12A3 Polymorphism modifies thiazide hypersensitivity of antenatal Bartter syndrome to thiazide resistance.

    Science.gov (United States)

    Mammen, Cherry; Rupps, Rosemarie; Trnka, Peter; Boerkoel, Cornelius F

    2012-02-01

    We report a 5-year-old boy with thiazide-resistant Bartter syndrome. This is highly unusual since thiazide hypersensitivity is a common diagnostic finding in Bartter syndrome patients. Subsequent molecular testing identified compound heterozygosity for two novel mutations in KCNJ1, (c.556A > G and c.683G > A) which is associated with Bartter syndrome, and a paternally inherited polymorphism in SLC12A3 (c.791G > C). Mutations in SLC12A3 cause the thiazide-resistant tubulopathy Gitelman syndrome. Based on published studies of this polymorphism in SLC12A3 and the features of the proband's father, we postulate that this polymorphism modifies the phenotype of Bartter syndrome in the proband to thiazide resistance. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

  11. Recent luminosity improvements at the SLC

    International Nuclear Information System (INIS)

    Raimondi, P.; Usher, T.; Akre, R.

    1998-07-01

    The luminosity of the SLAC Linear Collider (SLC) has been increased by more than a factor of three during the 1997--98 run. Improved alignment and emittance tuning techniques throughout the accelerator resulted in minimal emittance growth from the damping rings to the final focus. In particular, a revised strategy for wakefield cancellation using precision beam size measurements at the entrance of the final focus proved effective for optimizing emittance. The final focus lattice was modified to provide stronger demagnification near the interaction point and to remove residual higher-order aberrations. Beam sizes as small as 1.5 by 0.65 microns were achieved at full beam intensity of 4 10 10 particles per pulse. With these parameters, the mutual focusing of the beams in collision becomes significant, resulting in a further increase in the luminosity. Recorded SLD event rates confirmed the theoretical calculations of the disruption enhancement which was typically 50 to 100%

  12. Functional expression of a human GDP-L-fucose transporter in Escherichia coli.

    Science.gov (United States)

    Förster-Fromme, Karin; Schneider, Sarah; Sprenger, Georg A; Albermann, Christoph

    2017-02-01

    To investigate the translocation of nucleotide-activated sugars from the cytosol across a membrane into the endoplasmatic reticulum or the Golgi apparatus which is an important step in the synthesis of glycoproteins and glycolipids in eukaryotes. The heterologous expression of the recombinant and codon-adapted human GDP-L-fucose antiporter gene SLC35C1 (encoding an N-terminal OmpA-signal sequence) led to a functional transporter protein located in the cytoplasmic membrane of Escherichia coli. The in vitro transport was investigated using inverted membrane vesicles. SLC35C1 is an antiporter specific for GDP-L-fucose and depending on the concomitant reverse transport of GMP. The recombinant transporter FucT1 exhibited an activity for the transport of 3 H-GDP-L-fucose with a V max of 8 pmol/min mg with a K m of 4 µM. The functional expression of SLC35C1 in GDP-L-fucose overproducing E. coli led to the export of GDP-L-fucose to the culture supernatant. The export of GDP-L-fucose by E. coli provides the opportunity for the engineering of a periplasmatic fucosylation reaction in recombinant bacterial cells.

  13. Kicker for the SLC electron damping ring

    International Nuclear Information System (INIS)

    Bartelson, L.; Crawford, C.; Dinkel, J.; Kerns, Q.; Howell, J.; Snowdon, S.; Walton, J.

    1987-01-01

    The SLC electron damping ring requires two kickers each providing a 5 mr kick at 1.2 GEV to pairs of electron bunches spaced 61.63 nsec apart. The exact shape of the kick is unimportant, but the specification applies to the field the bunches see

  14. Mutations in SLC33A1 cause a lethal autosomal-recessive disorder with congenital cataracts, hearing loss, and low serum copper and ceruloplasmin

    DEFF Research Database (Denmark)

    Huppke, Peter; Brendel, Cornelia; Kalscheuer, Vera

    2012-01-01

    or compound heterozygous mutations for all affected subjects in SLC33A1 encoding a highly conserved acetylCoA transporter (AT-1) required for acetylation of multiple gangliosides and glycoproteins. The mutations were found to cause reduced or absent AT-1 expression and abnormal intracellular localization...

  15. Molecular Mechanisms of Urea Transport in Health and Disease

    Science.gov (United States)

    Klein, Janet D.; Blount, Mitsi A.; Sands, Jeff M.

    2012-01-01

    In the late 1980s, urea permeability measurements produced values that could not be explained by paracellular transport or lipid phase diffusion. The existence of urea transport proteins were thus proposed and less than a decade later, the first urea transporter was cloned. The SLC14A family of urea transporters has two major subgroups, designated SLC14A1 (or UT-B) and Slc14A2 (or UT-A). UT-B and UT-A gene products are glycoproteins located in various extra-renal tissues however, a majority of the resulting isoforms are found in the kidney. The UT-B (Slc14A1) urea transporter was originally isolated from erythrocytes and two isoforms have been reported. In kidney, UT-B is located primarily in the descending vasa recta. The UT-A (Slc14A2) urea transporter yields 6 distinct isoforms, of which 3 are found chiefly in the kidney medulla. UT-A1 and UT-A3 are found in the inner medullary collecting duct (IMCD), while UT-A2 is located in the thin descending limb. These transporters are crucial to the kidney’s ability to concentrate urine. The regulation of urea transporter activity in the IMCD involves acute modification through phosphorylation and subsequent movement to the plasma membrane. UT-A1 and UT-A3 accumulate in the plasma membrane in response to stimulation by vasopressin or hypertonicity. Long term regulation of the urea transporters in the IMCD involves altering protein abundance in response to changes in hydration status, low protein diets, or adrenal steroids. Urea transporters have been studied using animal models of disease including diabetes mellitus, lithium intoxication, hypertension, and nephrotoxic drug responses. Exciting new genetically engineered mouse models are being developed to study these transporters. PMID:23007461

  16. SLC26A4 mutations are associated with a specific inner ear malformation.

    Science.gov (United States)

    Fitoz, Suat; Sennaroğlu, Levent; Incesulu, Armağan; Cengiz, Filiz Başak; Koç, Yasemin; Tekin, Mustafa

    2007-03-01

    Inner ear anomalies have been reported in approximately 30% of children with early onset deafness. Identification of causative genetic factors in a large proportion of these patients was not successful. Mutations in the SLC26A4 gene have been detected in individuals with enlarged vestibular aqueduct (EVA) or Mondini dysplasia. We aimed to characterize the inner ear anomalies associated with SLC26A4 mutations. The SLC26A4 gene has been screened for mutations in 16 subjects from 14 unrelated Turkish families with a variety of inner ear anomalies ranging from Michel aplasia to incomplete partition-II and EVA. None of the patients was diagnosed to have a recognizable genetic syndrome. Additional four patients with Pendred syndrome from three families were included. Only one patient with EVA was found to have a heterozygous mutation (c.1586delT) in SLC26A4. All patients with Pendred syndrome had homozygous mutations and were noted to have either EVA or EVA associated with incomplete partition-II on the computed tomography of the temporal bone. SLC26A4 mutations are not associated with a large spectrum of inner ear anomalies. They, instead, result in a specific morphological appearance consistent with EVA or incomplete partition-II.

  17. Measurement of 12(S)-hydroxy-5Z,8E,10E-heptadecatrienoic acid and its metabolite 12-oxo-5Z,8E,10E-heptadecatrienoic acid in human plasma by gas chromatography/negative ion chemical ionization mass spectrometry

    International Nuclear Information System (INIS)

    Hofmann, U.; Seefried, S.; Meese, C.O.; Mettang, T.; Huebel, E.K.; Kuhlmann, U.

    1990-01-01

    Thromboxane A2, the predominant product of arachidonic acid metabolism in the blood platelet, is a potent vasoconstrictor and platelet agonist. During its biosynthesis from cyclic endoperoxide, 12(S)-hydroxy-5Z,8E,10E-heptadecatrienoic acid (HHT) is formed in equal amounts. The further metabolism of HHT, catalyzed by 15-hydroxyprostaglandin dehydrogenase, leads to 12-oxo-5Z,8E,10E-heptadecatrienoic acid (Oxo-HT). Sample workup procedures are described which allow for the sensitive and reproducible determination of these two arachidonic acid metabolites in human plasma by gas chromatography-mass spectrometry in the presence of deuterated analogues as internal standards. HHT is derivatized to the pentafluorobenzyl ester tert-butyldimethylsilyl ether. In order to enable quantification of low concentrations of about 10 pg/ml in nonstimulated human plasma, the samples have to be purified by HPLC. Oxo-HT is derivatized to the pentafluorobenzyl ester, which is purified by HPLC, and then derivatized to the trimethylsilyloxime. The method allows quantification of Oxo-HT in concentrations down to 10 pg/ml plasma. The reported methods have been used to measure HHT and Oxo-HT in stimulated platelet rich plasma and to quantify HHT in nonstimulated plasma. Determination of endogenous levels of these two arachidonic acid metabolites may give new insights into the overall biosynthesis of thromboxane A2 in man

  18. SLC beam line error analysis using a model-based expert system

    International Nuclear Information System (INIS)

    Lee, M.; Kleban, S.

    1988-02-01

    Commissioning particle beam line is usually a very time-consuming and labor-intensive task for accelerator physicists. To aid in commissioning, we developed a model-based expert system that identifies error-free regions, as well as localizing beam line errors. This paper will give examples of the use of our system for the SLC commissioning. 8 refs., 5 figs

  19. Treatable childhood neuronopathy caused by mutations in riboflavin transporter RFVT2

    Science.gov (United States)

    Foley, A. Reghan; Menezes, Manoj P.; Pandraud, Amelie; Gonzalez, Michael A.; Al-Odaib, Ahmad; Abrams, Alexander J.; Sugano, Kumiko; Yonezawa, Atsushi; Manzur, Adnan Y.; Burns, Joshua; Hughes, Imelda; McCullagh, B. Gary; Jungbluth, Heinz; Lim, Ming J.; Lin, Jean-Pierre; Megarbane, Andre; Urtizberea, J. Andoni; Shah, Ayaz H.; Antony, Jayne; Webster, Richard; Broomfield, Alexander; Ng, Joanne; Mathew, Ann A.; O’Byrne, James J.; Forman, Eva; Scoto, Mariacristina; Prasad, Manish; O’Brien, Katherine; Olpin, Simon; Oppenheim, Marcus; Hargreaves, Iain; Land, John M.; Wang, Min X.; Carpenter, Kevin; Horvath, Rita; Straub, Volker; Lek, Monkol; Gold, Wendy; Farrell, Michael O.; Brandner, Sebastian; Phadke, Rahul; Matsubara, Kazuo; McGarvey, Michael L.; Scherer, Steven S.; Baxter, Peter S.; King, Mary D.; Clayton, Peter; Rahman, Shamima; Reilly, Mary M.; Ouvrier, Robert A.; Christodoulou, John; Züchner, Stephan; Muntoni, Francesco

    2014-01-01

    Childhood onset motor neuron diseases or neuronopathies are a clinically heterogeneous group of disorders. A particularly severe subgroup first described in 1894, and subsequently called Brown-Vialetto-Van Laere syndrome, is characterized by progressive pontobulbar palsy, sensorineural hearing loss and respiratory insufficiency. There has been no treatment for this progressive neurodegenerative disorder, which leads to respiratory failure and usually death during childhood. We recently reported the identification of SLC52A2, encoding riboflavin transporter RFVT2, as a new causative gene for Brown-Vialetto-Van Laere syndrome. We used both exome and Sanger sequencing to identify SLC52A2 mutations in patients presenting with cranial neuropathies and sensorimotor neuropathy with or without respiratory insufficiency. We undertook clinical, neurophysiological and biochemical characterization of patients with mutations in SLC52A2, functionally analysed the most prevalent mutations and initiated a regimen of high-dose oral riboflavin. We identified 18 patients from 13 families with compound heterozygous or homozygous mutations in SLC52A2. Affected individuals share a core phenotype of rapidly progressive axonal sensorimotor neuropathy (manifesting with sensory ataxia, severe weakness of the upper limbs and axial muscles with distinctly preserved strength of the lower limbs), hearing loss, optic atrophy and respiratory insufficiency. We demonstrate that SLC52A2 mutations cause reduced riboflavin uptake and reduced riboflavin transporter protein expression, and we report the response to high-dose oral riboflavin therapy in patients with SLC52A2 mutations, including significant and sustained clinical and biochemical improvements in two patients and preliminary clinical response data in 13 patients with associated biochemical improvements in 10 patients. The clinical and biochemical responses of this SLC52A2-specific cohort suggest that riboflavin supplementation can

  20. [Role of Serotonin Transporter Gene in Eating Disorders].

    Science.gov (United States)

    Hernández-Muñoz, Sandra; Camarena-Medellin, Beatriz

    2014-01-01

    The serotoninergic system has been implicated in mood and appetite regulation, and the serotonin transporter gene (SLC6A4) is a commonly studied candidate gene for eating disorders. However, most studies have focused on a single polymorphism (5-HTTLPR) in SLC6A4. We present the studies published on the association between eating disorders (ED) and 5-HTTLPR polymorphism in anorexia nervosa (AN), bulimia nervosa (BN), and eating disorders not otherwise specified (EDNOS). Search of databases: MEDLINE, ISI, and PubMed for SLC6A4 and ED. From a review of 37 original articles, it was suggested that carriers of S allele is a risk factor for eating disorders, especially for AN. However, BN did not show any association. Also, BMI, impulsivity, anxiety, depression, and age of onset have been associated with S allele in ED patients. Copyright © 2013 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.

  1. Peripheral SLC6A4 DNA methylation is associated with in vivo measures of human brain serotonin synthesis and childhood physical aggression.

    Directory of Open Access Journals (Sweden)

    Dongsha Wang

    Full Text Available The main challenge in addressing the role of DNA methylation in human behaviour is the fact that the brain is inaccessible to epigenetic analysis in living humans. Using positron emission tomography (PET measures of brain serotonin (5-HT synthesis, we found in a longitudinal sample that adult males with high childhood-limited aggression (C-LHPA had lower in vivo 5-HT synthesis in the orbitofrontal cortex (OBFC. Here we hypothesized that 5-HT alterations associated with childhood aggression were linked to differential DNA methylation of critical genes in the 5-HT pathway and these changes were also detectable in peripheral white blood cells. Using pyrosequencing, we determined the state of DNA methylation of SLC6A4 promoter in T cells and monocytes isolated from blood of cohort members (N = 25 who underwent a PET scan, and we examined whether methylation status in the blood is associated with in vivo brain 5-HT synthesis. Higher levels of methylation were observed in both T cells and monocytes at specific CpG sites in the C-LHPA group. DNA methylation of SLC6A4 in monocytes appears to be associated more reliably with group membership than T cells. In both cell types the methylation state of these CpGs was associated with lower in vivo measures of brain 5-HT synthesis in the left and right lateral OBFC (N = 20 where lower 5-HT synthesis in C-LHPA group was observed. Furthermore, in vitro methylation of the SLC6A4 promoter in a luciferase reporter construct suppresses its transcriptional activity supporting a functional role of DNA methylation in SLC6A4 promoter regulation. These findings indicate that state of SLC6A4 promoter methylation is altered in peripheral white blood cells of individuals with physical aggression during childhood. This supports the relevance of peripheral DNA methylation for brain function and suggests that peripheral SLC6A4 DNA methylation could be a marker of central 5-HT function.

  2. SLC Final Performance and Lessons

    International Nuclear Information System (INIS)

    Phinney, Nan

    2000-01-01

    The Stanford Linear Collider (SLC) was the first prototype of a new type of accelerator, the electron-positron linear collider. Many years of dedicated effort were required to understand the physics of this new technology and to develop the techniques for maximizing performance. Key issues were emittance dilution, stability, final beam optimization and background control. Precision, non-invasive diagnostics were required to measure and monitor the beams throughout the machine. Beam-based feedback systems were needed to stabilize energy, trajectory, intensity and the final beam size at the interaction point. variety of new tuning techniques were developed to correct for residual optical or alignment errors. The final focus system underwent a series of refinements in order to deliver sub-micron size beams. It also took many iterations to understand the sources of backgrounds and develop the methods to control them. The benefit from this accumulated experience was seen in the performance of the SLC during its final run in 1997-98. The luminosity increased by a factor of three to 3*10 30 and the 350,000 Z data sample delivered was nearly double that from all previous runs combined

  3. Physics at the SLC [SLAC Linear Collider

    International Nuclear Information System (INIS)

    Swartz, M.L.

    1990-11-01

    The SLAC Linear Collider (SLC) was constructed in the years 1983--1987 for two principal reasons: to develop the accelerator physics and technology that are necessary for the construction of future linear electron-positron colliders; and to produce electron-positron collisions at the Z 0 pole and to study the physics of the weak neutral current. To date, the SLC program has been quite successful at achieving the first goal. The machine has produced and collided high energy electron and positron beams of three-micron transverse size. The problems of operating an open geometry detector in an environment that is more akin to those found in fixed-target experiments than in storage rings have largely been solved. As a physics producing venture, the SLC has been less successful than was originally hoped but more successful than is commonly believed. Some of the results that have been produced by the Mark II experiment with a very modest data sample are competitive with those that have been produced with much larger samples by the four LEP collaborations. At the current, time, SLAC is engaged in an ambitious program to upgrade the SLC luminosity and to exploit one of its unique features, a spin polarized electron beam. These lectures are therefore organized into three sections: a brief description of the SLC; a review of the physics results that have been achieved with the Mark II detector; a description of the SLC's future: the realization and use of a polarized electron beam

  4. Solute carrier protein family 11 member 1 (Slc11a1) activation efficiently inhibits Leishmania donovani survival in host macrophages.

    Science.gov (United States)

    Singh, Nisha; Gedda, Mallikarjuna Rao; Tiwari, Neeraj; Singh, Suya P; Bajpai, Surabhi; Singh, Rakesh K

    2017-09-01

    Visceral leishmaniasis (kala-azar), a life threatening disease caused by L. donovani , is a latent threat to more than 147 million people living in disease endemic South East Asia region of the Indian subcontinent. The therapeutic option to control leishmanial infections are very limited, and at present comprise only two drugs, an antifungal amphotericin B and an antitumor miltefosine, which are also highly vulnerable for parasitic resistance. Therefore, identification and development of alternate control measures is an exigent requirement to control leishmanial infections. In this study, we report that functionally induced expression of solute carrier protein family 11 member 1 ( Slc11a1), a transmembrane divalent cationic transporter recruited on the surface of phagolysosomes after phagocytosis of parasites, effectively inhibits Leishmania donovani growth in host macrophages. Further, the increased Slc11a1 functionality also resulted in increased production of NOx, TNF-α and IL-12 by activated macrophages. The findings of this study signify the importance of interplay between Slc11a1 expression and macrophages activation that can be effectively used to control of Leishmania growth and survival.

  5. Characterization of a novel sialic acid transporter of the sodium solute symporter (SSS) family and in vivo comparison with known bacterial sialic acid transporters.

    Science.gov (United States)

    Severi, Emmanuele; Hosie, Arthur H F; Hawkhead, Judith A; Thomas, Gavin H

    2010-03-01

    The function of sialic acids in the biology of bacterial pathogens is reflected by the diverse range of solute transporters that can recognize these sugar acids. Here, we use an Escherichia coliDeltananT strain to characterize the function of known and proposed bacterial sialic acid transporters. We discover that the STM1128 gene from Salmonella enterica serovar Typhimurium, which encodes a member of the sodium solute symporter family, is able to restore growth on sialic acid to the DeltananT strain and is able to transport [(14)C]-sialic acid. Using the DeltananT genetic background, we performed a direct in vivo comparison of the transport properties of the STM1128 protein with those of sialic acid transporters of the major facilitator superfamily and tripartite ATP-independent periplasmic families, E. coli NanT and Haemophilus influenzae SiaPQM, respectively. This revealed that both STM1128 and SiaPQM are sodium-dependent and, unlike SiaPQM, both STM1128 and NanT are reversible secondary carriers, demonstrating qualitative functional differences in the properties of sialic acid transporters used by bacteria that colonize humans.

  6. SLC2A3 single-nucleotide polymorphism and duplication influence cognitive processing and population-specific risk for attention-deficit/hyperactivity disorder.

    Science.gov (United States)

    Merker, Sören; Reif, Andreas; Ziegler, Georg C; Weber, Heike; Mayer, Ute; Ehlis, Ann-Christine; Conzelmann, Annette; Johansson, Stefan; Müller-Reible, Clemens; Nanda, Indrajit; Haaf, Thomas; Ullmann, Reinhard; Romanos, Marcel; Fallgatter, Andreas J; Pauli, Paul; Strekalova, Tatyana; Jansch, Charline; Vasquez, Alejandro Arias; Haavik, Jan; Ribasés, Marta; Ramos-Quiroga, Josep Antoni; Buitelaar, Jan K; Franke, Barbara; Lesch, Klaus-Peter

    2017-07-01

    Attention-deficit/hyperactivity disorder (ADHD) is a common, highly heritable neurodevelopmental disorder with profound cognitive, behavioral, and psychosocial impairments with persistence across the life cycle. Our initial genome-wide screening approach for copy number variants (CNVs) in ADHD implicated a duplication of SLC2A3, encoding glucose transporter-3 (GLUT3). GLUT3 plays a critical role in cerebral glucose metabolism, providing energy for the activity of neurons, which, in turn, moderates the excitatory-inhibitory balance impacting both brain development and activity-dependent neural plasticity. We therefore aimed to provide additional genetic and functional evidence for GLUT3 dysfunction in ADHD. Case-control association analyses of SLC2A3 single-nucleotide polymorphisms (SNPs) and CNVs were conducted in several European cohorts of patients with childhood and adult ADHD (SNP, n = 1,886 vs. 1,988; CNV, n = 1,692 vs. 1,721). These studies were complemented by SLC2A3 expression analyses in peripheral cells, functional EEG recordings during neurocognitive tasks, and ratings of food energy content. Meta-analysis of all cohorts detected an association of SNP rs12842 with ADHD. While CNV analysis detected a population-specific enrichment of SLC2A3 duplications only in German ADHD patients, the CNV + rs12842 haplotype influenced ADHD risk in both the German and Spanish cohorts. Duplication carriers displayed elevated SLC2A3 mRNA expression in peripheral blood cells and altered event-related potentials reflecting deficits in working memory and cognitive response control, both endophenotypic traits of ADHD, and an underestimation of energy units of high-caloric food. Taken together, our results indicate that both common and rare SLC2A3 variation impacting regulation of neuronal glucose utilization and energy homeostasis may result in neurocognitive deficits known to contribute to ADHD risk. © 2017 Association for Child and Adolescent Mental Health.

  7. Transport mechanisms of hepatic uptake and bile excretion in clinical hepatobiliary scintigraphy with 99mTc-N-pyridoxyl-5-methyltryptophan

    International Nuclear Information System (INIS)

    Kobayashi, Masato; Nakanishi, Takeo; Nishi, Kodai; Higaki, Yusuke; Okudaira, Hiroyuki; Ono, Masahiro; Tsujiuchi, Takafumi; Mizutani, Asuka; Nishii, Ryuichi; Tamai, Ikumi; Arano, Yasushi; Kawai, Keiichi

    2014-01-01

    Introduction: In clinical hepatobiliary scintigraphy, 99m Tc-N-pyridoxyl-5-methyltryptophan ( 99m Tc-PMT) is an effective radiotracer among the 99m Tc-pyridoxylaminates. However, the mechanisms of human hepatic uptake and bile excretion transport of 99m Tc-PMT have not been determined. We thus investigated the transport mechanisms of human hepatic uptake and bile excretion in hepatobiliary scintigraphy with 99m Tc-PMT. Methods: Four solute carrier (SLC) transporters involved in hepatic uptake were evaluated using human embryonic kidney (HEK) and HeLa cells with high expression of SLC transporters (organic anion transporting polypeptide (OATP)1B1, OATP1B3, OATP2B1, organic anion transporters (OAT)2 and organic cation transporters (OCT)1) after 5 min of 99m Tc-PMT incubation. Metabolic analysis of 99m Tc-PMT was performed using pooled human liver S9. Adenosine triphosphate (ATP)-binding cassette (ABC) transporters for bile excretion were examined using hepatic ABC transporter vesicles human expressing multiple drug resistance 1 (MDR1), multidrug resistance-associated protein 2 (MRP2), breast cancer resistance protein or bile salt export pump. 99m Tc-PMT was incubated for 1, 3 and 5 min with ATP or adenosine monophosphate and these vesicles. SPECT scans were performed in normal and Eisai hyperbilirubinemic (EHBR) model rats, deficient in Mrp2 transporters, without and with verapamil (rat Mdr1 and human MDR1 inhibitor) after intravenous injection of 99m Tc-PMT. Results: Uptake of 99m Tc-PMT in HEK293/OATP1B1 and HeLa/OATP1B3 was significantly higher than that in HEK293- and HeLa-mock cells. 99m Tc-PMT was not metabolized in the human liver S9. In vesicles with high expression of ABC transporters, uptake of MDR1 or MRP2 was significantly higher at all incubation times. Bile excretion of 99m Tc-PMT was also identified by comparison between normal and EHBR rats with and without verapamil on in-vivo imaging. Conclusions: Human hepatic uptake of 99m Tc-PMT was transferred

  8. Characterization of simvastatin acid uptake by organic anion transporting polypeptide 3A1 (OATP3A1) and influence of drug-drug interaction.

    Science.gov (United States)

    Atilano-Roque, Amandla; Joy, Melanie S

    2017-12-01

    Human organic anion transporting polypeptide 3A1 (OATP3A1) is predominately expressed in the heart. The ability of OATP3A1 to transport statins into cardiomyocytes is unknown, although other OATPs are known to mediate the uptake of statin drugs in liver. The pleiotropic effects and uptake of simvastatin acid were analyzed in primary human cardiomyocytes and HEK293 cells transfected with the OATP3A1 gene. Treatment with simvastatin acid reduced indoxyl sulfate-mediated reactive oxygen species and modulated OATP3A1 expression in cardiomyocytes and HEK293 cells transfected with the OATP3A1 gene. We observed a pH-dependent effect on OATP3A1 uptake, with more efficient simvastatin acid uptake at pH5.5 in HEK293 cells transfected with the OATP3A1 gene. The Michaelis-Menten constant (K m ) for simvastatin acid uptake by OATP3A1 was 0.017±0.002μM and the V max was 0.995±0.027fmol/min/10 5 cells. Uptake of simvastatin acid was significantly increased by known (benzylpenicillin and estrone-3-sulfate) and potential (indoxyl sulfate and cyclosporine) substrates of OATP3A1. In conclusion, the presence of OATP3A1 in cardiomyocytes suggests that this transporter may modulate the exposure of cardiac tissue to simvastatin acid due to its enrichment in cardiomyocytes. Increases in uptake of simvastatin acid by OATP3A1 when combined with OATP substrates suggest the potential for drug-drug interactions that could influence clinical outcomes. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Luminosity Optimization Feedback in the SLC

    International Nuclear Information System (INIS)

    1999-01-01

    The luminosity optimization at the SLC has been limited by the precision with which one can measure the micron size beams at the Interaction Point. Ten independent tuning parameters must be adjusted. An automated application has been used to scan each parameter over a significant range and set the minimum beam size as measured with a beam-beam deflection scan. Measurement errors limited the accuracy of this procedure and degraded the resulting luminosity. A new luminosity optimization feedback system has been developed using novel dithering techniques to maximize the luminosity with respect to the 10 parameters, which are adjusted one at a time. Control devices are perturbed around nominal setpoints, while the averaged readout of a digitized luminosity monitor measurement is accumulated for each setting. Results are averaged over many pulses to achieve high precision and then fitted to determine the optimal setting. The dithering itself causes a small loss in luminosity, but the improved optimization is expected to significantly enhance the performance of the SLC. Commissioning results are reported

  10. Inorganic phosphorus (Pi) in CSF is a biomarker for SLC20A2-associated idiopathic basal ganglia calcification (IBGC1).

    Science.gov (United States)

    Hozumi, Isao; Kurita, Hisaka; Ozawa, Kazuhiro; Furuta, Nobuyuki; Inden, Masatoshi; Sekine, Shin-Ichiro; Yamada, Megumi; Hayashi, Yuichi; Kimura, Akio; Inuzuka, Takashi; Seishima, Mitsuru

    2018-05-15

    Idiopathic basal ganglia calcification (IBGC), also called Fahr's disease or recently primary familial brain calcification (PFBC), is characterized by abnormal deposits of minerals including calcium mainly and phosphate in the brain. Mutations in SLC20A2 (IBGC1 (merged with former IBGC2 and IBGC3)), which encodes PiT-2, a phosphate transporter, is the major cause of IBGC. Recently, Slc20a2-KO mice have been showed to have elevated levels of inorganic phosphorus (Pi) in cerebrospinal fluid (CSF); however, CSF Pi levels in patients with IBGC have not been fully examined. We investigated the cases of 29 patients with IBGC including six patients with SLC20A2 mutation and three patients with PDGFB mutation, and 13 controls. The levels of sodium (Na), potassium (K), chloride (Cl), calcium (Ca), and Pi in sera and CSF were determined by potentiometry and colorimetry. Moreover, clinical manifestations were investigated in the IBGC patients with high Pi levels in CSF. The study revealed that the average level of Pi in the CSF of the total group of patients with IBGC is significantly higher than that of the control group, and the levels of Pi in CSF of the IBGC patients with SLC20A2 mutations are significantly higher than those of the IBGC patients with PDGFB mutations, the other IBGC patients and controls. Results of this study suggest that the levels of CSF Pi will be a good biomarker for IBGC1. Copyright © 2018 Elsevier B.V. All rights reserved.

  11. Modulation of sodium-bicarbonate co-transporter (SLC4A4/NBCe1) protein and mRNA expression in rat's uteri by sex-steroids and at different phases of the oestrous cycle.

    Science.gov (United States)

    Gholami, Khadijeh; Muniandy, Sekaran; Salleh, Naguib

    2014-02-01

    Oestrogen-induced uterine fluid sodium (Na(+)) and bicarbonate (HCO3(-)) secretion may involve SLC4A4. We hypothesized that uterine SLC4A4 expression changes under different sex-steroid influence, therefore may account for the fluctuation in uterine fluid Na(+) and HCO3(-) content throughout the oestrous cycle. The aim of this study is to investigate the differential effects of sex-steroids and oestrous cycle phases on uterine SLC4A4 expression. Adult female WKY rats were ovariectomised and treated with different doses of 17β-oestradiol (E2) (0.2, 2, 20 and 50 μg/ml/day) or progesterone (P4) (4 mg/ml/day) for three consecutive days and 3 days treatment with 0.2 μg/ml/day E2 followed by another 3 days with P4 to mimic the hormonal changes in early pregnancy. Oestrous cycle phases in intact, non-ovariectomised rats were determined by vaginal smear. The animals were then sacrificed and uteri were removed for protein and mRNA expression analyses by Western blotting and Real Time PCR, respectively. SLC4A4 distribution was observed by immunohistochemistry. Treatment with increasing E2 doses resulted in a dose-dependent increase in SLC4A4 protein expression. High SLC4A4 protein and mRNA expression can be seen at estrus. SLC4A4 is distributed mainly at the apical as well as basolateral membranes of the luminal and glandular epithelia following E2 treatment and at Es. Meanwhile, SLC4A4 expression was reduced following P4 treatment and was low at diestrus. High SLC4A4 expression under estrogen dominance may contribute to the increase in uterine fluid Na(+) and HCO3(-) content, while its low expression under P4 dominance may result in vice versa. Copyright © 2013 Elsevier Ltd. All rights reserved.

  12. 10 CFR 960.5-2-5 - Environmental quality.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 4 2010-01-01 2010-01-01 false Environmental quality. 960.5-2-5 Section 960.5-2-5 Energy... REPOSITORY Preclosure Guidelines Environment, Socioeconomics, and Transportation § 960.5-2-5 Environmental... repository siting, construction, operation, closure, and decommissioning, and projected environmental impacts...

  13. High levels of the type III inorganic phosphate transporter PiT1 (SLC20A1) can confer faster cell adhesion

    DEFF Research Database (Denmark)

    Kongsfelt, Iben Boutrup; Byskov, Kristina; Pedersen, Lasse Ebdrup

    2014-01-01

    overexpression led to faster cell spreading. The final total numbers of attached cells did, however, not differ between cultures of PiT1 overexpressing cells and control cells of neither cell type. We suggest that the PiT1-mediated fast adhesion potentials allow the cells to go faster out of G0/G1 and thereby......The inorganic phosphate transporter PiT1 (SLC20A1) is ubiquitously expressed in mammalian cells. We recently showed that overexpression of human PiT1 was sufficient to increase proliferation of two strict density-inhibited cell lines, murine fibroblastic NIH3T3 and pre-osteoblastic MC3T3-E1 cells......, and allowed the cultures to grow to higher cell densities. In addition, upon transformation NIH3T3 cells showed increased ability to form colonies in soft agar. The cellular regulation of PiT1 expression supports that cells utilize the PiT1 levels to control proliferation, with non-proliferating cells showing...

  14. Importance of high order momentum terms in SLC optics

    International Nuclear Information System (INIS)

    Kozanecki, W.

    1985-01-01

    The evaluation of background levels at the SLC relies, in several cases, on the proper representation of how low momentum electrons propagate through the Arcs and the Final Focus System (FFS). For example, beam - gas bremsstrahlung in the arcs causes electrons of up to 6% energy loss to be transported through to the IP; secondary showers on edges of masks and collimators yield debris with a very wide momentum spectrum. This note is a naive attempt at checking the validity of TRANSPORT and TURTLE calculations, by evaluating the contributions of the momentum terms to increasingly higher order, and checking the mutual consistency of the results produced by the two methods on a beam of wide momentum spread. 8 refs., 4 figs., 1 tab

  15. Loss of Slc4a1b chloride/bicarbonate exchanger function protects mechanosensory hair cells from aminoglycoside damage in the zebrafish mutant persephone.

    Directory of Open Access Journals (Sweden)

    Dale W Hailey

    Full Text Available Mechanosensory hair cell death is a leading cause of hearing and balance disorders in the human population. Hair cells are remarkably sensitive to environmental insults such as excessive noise and exposure to some otherwise therapeutic drugs. However, individual responses to damaging agents can vary, in part due to genetic differences. We previously carried out a forward genetic screen using the zebrafish lateral line system to identify mutations that alter the response of larval hair cells to the antibiotic neomycin, one of a class of aminoglycoside compounds that cause hair cell death in humans. The persephone mutation confers resistance to aminoglycosides. 5 dpf homozygous persephone mutants are indistinguishable from wild-type siblings, but differ in their retention of lateral line hair cells upon exposure to neomycin. The mutation in persephone maps to the chloride/bicarbonate exchanger slc4a1b and introduces a single Ser-to-Phe substitution in zSlc4a1b. This mutation prevents delivery of the exchanger to the cell surface and abolishes the ability of the protein to import chloride across the plasma membrane. Loss of function of zSlc4a1b reduces hair cell death caused by exposure to the aminoglycosides neomycin, kanamycin, and gentamicin, and the chemotherapeutic drug cisplatin. Pharmacological block of anion transport with the disulfonic stilbene derivatives DIDS and SITS, or exposure to exogenous bicarbonate, also protects hair cells against damage. Both persephone mutant and DIDS-treated wild-type larvae show reduced uptake of labeled aminoglycosides. persephone mutants also show reduced FM1-43 uptake, indicating a potential impact on mechanotransduction-coupled activity in the mutant. We propose that tight regulation of the ionic environment of sensory hair cells, mediated by zSlc4a1b activity, is critical for their sensitivity to aminoglycoside antibiotics.

  16. Kicker thyratron experience from SLC

    International Nuclear Information System (INIS)

    Donaldson, A.R.; Cassel, R.L.; Mattison, T.S.; Reginato, L.L.

    1991-05-01

    The SLAC Linear Collider has five fast kickers for the damping ring injectors, extractors, and the electron extractor for the positron target that use multi-gap Deuterium-filled thyratrons. The thyratrons operate with 30 to 70 kV anode voltages and 1 to 5 kA currents, to deliver pulses to kicker magnets with ∼ 30 ns rise times, up to ∼ 150 ns pulse widths, at 120 Hz. Operating and lifetime experience with several types of thyratrons and support electronics are discussed. Floating driver and power supply electronics were replaced by a ferrite choke isolator to allow grounding of the cathode support electronics with a commensurate increase in operating reliability. The construction of a 100 ns Blumlein enabled detailed measurements of the switching times for all SLC thyratrons under similar conditions. In the final focus area, the kickers dump the SLC beams after the e + e - collisions. These thyratrons function with 15 kV anode voltages and up to 2 kA currents to produce 1/2 sine pulses with ∼ 300 ns rise times, ∼ 550 ns FWHM, at 120 Hz. Operating experience with these thyratrons will also be presented. 7 refs., 1 fig., 3 tabs

  17. Transport of amino acids and GABA analogues via the human proton-coupled amino acid transporter, hPAT1

    DEFF Research Database (Denmark)

    Larsen, Mie; Larsen, Birger Brodin; Frølund, Bente

    2008-01-01

    The objective of this study was to investigate transepithelial amino acid transport as a function of Caco-2 cell culture time. Furthermore, the objective was to investigate apical uptake characteristics of hPAT1-mediated transport under various experimental conditions. Apical amino acid uptake......, which has been shown to function as a carboxylic acid bioisostere for substrates of the GABA receptor and transport systems....

  18. Lessons learned from the SLC

    Energy Technology Data Exchange (ETDEWEB)

    Phinney, N. [Stanford Univ., CA (United States). Stanford Linear Accelerator Center

    1998-07-01

    The SLAC Linear Collider (SLC) is the first example of an entirely new type of lepton collider. Many years of effort were required to develop the understanding and techniques needed to approach design luminosity. This paper discusses some of the key issues and problems encountered in producing a working linear collider. These include the polarized source, techniques for emittance preservation, extensive feedback systems, and refinements in beam optimization in the final focus. The SLC experience has been invaluable for testing concepts and developing designs for a future linear collider.

  19. Lessons learned from the SLC

    International Nuclear Information System (INIS)

    Phinney, N.

    1998-01-01

    The SLAC Linear Collider (SLC) is the first example of an entirely new type of lepton collider. Many years of effort were required to develop the understanding and techniques needed to approach design luminosity. This paper discusses some of the key issues and problems encountered in producing a working linear collider. These include the polarized source, techniques for emittance preservation, extensive feedback systems, and refinements in beam optimization in the final focus. The SLC experience has been invaluable for testing concepts and developing designs for a future linear collider

  20. Genetic variants of the human H+/dipeptide transporter PEPT2

    DEFF Research Database (Denmark)

    Pinsonneault, Julia; Nielsen, Carsten Uhd; Sadée, Wolfgang

    2004-01-01

    . We have conducted a haplotype analysis of 27 single nucleotide polymorphisms located in or near exons of the human gene encoding hPEPT2 (SLC15A2), using genotyping data from 247 genomic DNA samples from the Coriell collection. Our analysis reveals that hPEPT2 has a >6-kilobase sequence block......PEPT2 is a high-affinity H+/dipeptide transporter expressed in kidney, brain, lung, and mammary gland. The physiological role of PEPT2 in kidney is to reabsorb small peptides generated by luminal peptidases. PEPT2 is also a transporter for peptide-like drugs such as penicillins and cephalosporins...... with at least 10 abundant polymorphisms in almost complete linkage disequilibrium. As a result, only two main hPEPT2 variants exist (hPEPT2*1 and *2) with several phased amino acid substitutions, present in substantial frequencies in all ethnic groups tested. When expressed in Chinese hamster ovary cells, h...

  1. Importance of Terminal Amino Acid Residues to the Transport of Oligopeptides across the Caco-2 Cell Monolayer.

    Science.gov (United States)

    Ding, Long; Wang, Liying; Yu, Zhipeng; Ma, Sitong; Du, Zhiyang; Zhang, Ting; Liu, Jingbo

    2017-09-06

    The objective of this paper was to investigate the effects of terminal amino acids on the transport of oligopeptides across the Caco-2 cell monolayer. Ala-based tetra- and pentapeptides were designed, and the N- or C-terminal amino acid residues were replaced by different amino acids. The results showed that the oligopeptides had a wide range of transport permeability across the Caco-2 cell monolayer and could be divided into four categories: non-/poor permeability, low permeability, intermediate permeability, and good permeability. Tetrapeptides with N-terminal Leu, Pro, Ile, Cys, Met, and Val or C-terminal Val showed the highest permeability, with apparent permeability coefficient (P app ) values over 10 × 10 -6 cm/s (p transport of tetrapeptides. Pentapeptides with N- or C-terminal Tyr also showed high permeability levels, with P app values of about 10 × 10 -6 cm/s. The amino acids Glu, Asn, and Thr at the N terminus or Lys, Asp, and Arg at the C terminus were also beneficial for the transport of tetra- and pentapeptides, with P app values ranging from 1 × 10 -6 to 10 × 10 -6 cm/s. In addition, peptides with amino acids replaced at the N terminus generally showed higher permeability than those with amino acids replaced at the C terminus (p transport of oligopeptides across the Caco-2 cell monolayer.

  2. Linking chronic infection and autoimmune diseases: Mycobacterium avium subspecies paratuberculosis, SLC11A1 polymorphisms and type-1 diabetes mellitus.

    Directory of Open Access Journals (Sweden)

    Daniela Paccagnini

    2009-09-01

    Full Text Available The etiology of type 1 diabetes mellitus (T1DM is still unknown; numerous studies are performed to unravel the environmental factors involved in triggering the disease. SLC11A1 is a membrane transporter that is expressed in late endosomes of antigen presenting cells involved in the immunopathogenic events leading to T1DM. Mycobacterium avium subsp. paratuberculosis (MAP has been reported to be a possible trigger in the development of T1DM.Fifty nine T1DM patients and 79 healthy controls were genotyped for 9 polymorphisms of SLC11A1 gene, and screened for the presence of MAP by PCR. Differences in genotype frequency were evaluated for both T1DM patients and controls. We found a polymorphism in the SLC11A1 gene (274C/T associated to type 1 diabetic patients and not to controls. The presence of MAP DNA was also significantly associated with T1DM patients and not with controls.The 274C/T SCL11A1 polymorphism was found to be associated with T1DM as well as the presence of MAP DNA in blood. Since MAP persists within macrophages and it is also processed by dendritic cells, further studies are necessary to evaluate if mutant forms of SLC11A1 alter the processing or presentation of MAP antigens triggering thereby an autoimmune response in T1DM patients.

  3. STANFORD: Highly polarized SLC electron beams

    International Nuclear Information System (INIS)

    Anon.

    1993-01-01

    Full text: Using specialized photocathodes made with 'strained' gallium arsenide, physicists at the Stanford Linear Accelerator Center (SLAC) have generated electron beams with polarizations in excess of 60 percent a year ahead of schedule. Together with recent luminosity increases, this breakthrough will have a major impact on the physics output of the Stanford Linear Collider (SLC). Beam polarization was almost tripled using photocathodes in which a gallium arsenide layer was grown epitaxially over a substrate of gallium arsenide phosphide. The mismatch between these two layers deforms the crystal structure and removes a degeneracy in the valence band structure, permitting selective optical pumping of one unique spin state. Whereas conventional gallium arsenide photocathodes are limited to 50 percent polarization because of this degeneracy (and realistic cathodes fall substantially below this theoretical limit), such strained crystal lattices have the potential to yield polarizations close to 100 percent. Polarization enhancement with strained lattices was first demonstrated in 1991 by a SLAC/Wisconsin/ Berkeley group (May 1991, page 6) with a 71 percent polarization in a laboratory experiment. More recently this group has achieved polarization in excess of 90 percent, reported last November at the Nagoya Spin Symposium. (In a complementary development, a Japanese KEK/ Nagoya/KEK obtains polarized beams using a 'superlattice' - May 1991, page 4.) The 1993 SLC run, the strained gallium arsenide photocathode technique's debut in an operating particle accelerator, has proved to be a resounding, unqualified success - as have physics experiments on the Z particles produced by the highly polarized beam. A conservative approach was called for, due to concerns about possible charge saturation effects. A relatively thick (0.3 micron) gallium arsenide layer was used for the photocathode in the SLC polarized electron source. With a titanium

  4. Accumulation, selection and covariation of amino acids in sieve tube sap of tansy (Tanacetum vulgare) and castor bean (Ricinus communis): evidence for the function of a basic amino acid transporter and the absence of a γ-amino butyric acid transporter.

    Science.gov (United States)

    Bauer, Susanne N; Nowak, Heike; Keller, Frank; Kallarackal, Jose; Hajirezaei, Mohamad-Reza; Komor, Ewald

    2014-09-01

    Sieve tube sap was obtained from Tanacetum by aphid stylectomy and from Ricinus after apical bud decapitation. The amino acids in sieve tube sap were analyzed and compared with those from leaves. Arginine and lysine accumulated in the sieve tube sap of Tanacetum more than 10-fold compared to the leaf extracts and they were, together with asparagine and serine, preferably selected into the sieve tube sap, whereas glycine, methionine/tryptophan and γ-amino butyric acid were partially or completely excluded. The two basic amino acids also showed a close covariation in sieve tube sap. The acidic amino acids also grouped together, but antagonistic to the other amino acids. The accumulation ratios between sieve tube sap and leaf extracts were smaller in Ricinus than in Tanacetum. Arginine, histidine, lysine and glutamine were enriched and preferentially loaded into the phloem, together with isoleucine and valine. In contrast, glycine and methionine/tryptophan were partially and γ-amino butyric acid almost completely excluded from sieve tube sap. The covariation analysis grouped arginine together with several neutral amino acids. The acidic amino acids were loaded under competition with neutral amino acids. It is concluded from comparison with the substrate specificities of already characterized plant amino acid transporters, that an AtCAT1-like transporter functions in phloem loading of basic amino acids, whereas a transporter like AtGAT1 is absent in phloem. Although Tanacetum and Ricinus have different minor vein architecture, their phloem loading specificities for amino acids are relatively similar. © 2014 Scandinavian Plant Physiology Society.

  5. "Facilitated" amino acid transport is upregulated in brain tumors.

    Science.gov (United States)

    Miyagawa, T; Oku, T; Uehara, H; Desai, R; Beattie, B; Tjuvajev, J; Blasberg, R

    1998-05-01

    The goal of this study was to determine the magnitude of "facilitated" amino acid transport across tumor and brain capillaries and to evaluate whether amino acid transporter expression is "upregulated" in tumor vessels compared to capillaries in contralateral brain tissue. Aminocyclopentane carboxylic acid (ACPC), a non-metabolized [14C]-labeled amino acid, and a reference molecule for passive vascular permeability, [67Ga]-gallium-diethylenetriaminepentaacetic acid (Ga-DTPA), were used in these studies. Two experimental rat gliomas were studied (C6 and RG2). Brain tissue was rapidly processed for double label quantitative autoradiography 10 minutes after intravenous injection of ACPC and Ga-DTPA. Parametric images of blood-to-brain transport (K1ACPC and K1Ga-DTPA, microL/min/g) produced from the autoradiograms and the histology were obtained from the same tissue section. These three images were registered in an image array processor; regions of interest in tumor and contralateral brain were defined on morphologic criteria (histology) and were transferred to the autoradiographic images to obtain mean values. The facilitated component of ACPC transport (deltaK1ACPC) was calculated from the K1ACPC and K1Ga-DTPA data, and paired comparisons between tumor and contralateral brain were performed. ACPC flux, K1ACPC, across normal brain capillaries (22.6 +/- 8.1 microL/g/min) was >200-fold greater than that of Ga-DTPA (0.09 +/- 0.04 microL/g/min), and this difference was largely (approximately 90%) due to facilitated ACPC transport. Substantially higher K1ACPC values compared to corresponding K1DTPA values were also measured in C6 and RG2 gliomas. The deltaK1ACPC values for C6 glioma were more than twice that of contralateral brain cortex. K1ACPC and deltaK1ACPC values for RG2 gliomas was not significantly higher than that of contralateral cortex, although a approximately 2-fold difference in facilitated transport is obtained after normalization for differences in capillary

  6. Increased Bile Acid Synthesis and Impaired Bile Acid Transport in Human Obesity

    OpenAIRE

    Haeusler, Rebecca A.; Camastra, Stefania; Nannipieri, Monica; Astiarraga, Brenno; Castro-Perez, Jose; Xie, Dan; Wang, Liangsu; Chakravarthy, Manu; Ferrannini, Ele

    2015-01-01

    We measured plasma bile acids, markers of bile acid synthesis, and expression of bile acid transporters in obese and nonobese subjects. We found that obesity was associated with increased bile acid synthesis and 12-hydroxylation, blunted response of plasma bile acids to insulin infusion or a mixed meal, and decreased expression of liver bile acid transporters.

  7. First results from SLD with polarized electron beam at SLC

    International Nuclear Information System (INIS)

    Fero, M.J.

    1992-12-01

    The SLAC Linear Collider (SLC) has been modified to collide a longitudinally polarized electron beam with the unpolarized positron beam. We review the beginning of polarized beam running at the SLC, and report on the measurement of the left-right cross section asymmetry (A LR ) made with a sample of 10,224 Z decays collected over the course of the 1992 run. The average beam polarization for this set of Z decays was 22.4 ± 0.6%(syst.). A LR was measured to be 0.100 ± 0.044(stat.) ± 0.004(syst.). From this measurement, the weak mixing angle defined at the Z boson pole is determined to be sin 2 θ eff W = 0.2378 ± 0.0056 ± 0.0005

  8. Genetic polymorphisms associated to folate transport as predictors of increased risk for acute lymphoblastic leukemia in Mexican children

    Directory of Open Access Journals (Sweden)

    Fausto Zaruma-Torres

    2016-08-01

    Full Text Available Acute lymphoblastic leukemia (ALL is a frequent neoplasia occurring in children. The most commonly used drug for the treatment of ALL is methotrexate (MTX, an anti-folate agent. Previous studies suggest that folate transporters play a role in ALL prognosis and that genetic polymorphism of genes encoding folate transporters may increase the risk of ALL. Therefore, the main goal of this study was to determine the associations among six genetic polymorphisms in four genes related with the folate transporter pathway to determine a relationship with the occurrence of ALL in Mexican children.A case-control study was performed in 73 ALL children and 133 healthy children from Northern and Northwestern Mexico. COL18A1 (rs2274808, SLC19A1 (rs2838956, ABCB1 (rs1045642 and rs1128503 and ABCC5 (rs9838667 and rs3792585. polymorphisms were assayed through qPCR.Our results showed an increased ALL risk in children carrying CT genotype (OR=2.55, CI 95% 1.11-5.83, p=0.0001 and TT genotype (OR=21.05, CI 95% 5.62-78.87, p<0.0001 of COL18A1 rs2274808; in SLC19A1 rs2838956 AG carriers (OR=44.69, CI 95% 10.42-191.63, p=0.0001; in ABCB1 rs1045642 TT carriers (OR=13.76, CI 95% 5.94-31.88, p=0.0001; in ABCC5 rs9838667 AC carriers (OR=2.61, CI 95% 1.05-6.48, p<0.05; and in ABCC5 rs3792585 CC carriers (OR=9.99, CI 95% 3.19-31.28, p=0.004. Moreover, several combinations of genetic polymorphisms were found to be significantly associated with a risk for ALL. Finally, two combinations of ABCC5 polymorphisms resulted in protection from this neoplasia.In conclusion, certain genetic polymorphisms related to the folate transport pathway, particularly COL18A1 rs2274808, SLC19A1 rs2838956, ABCB1 rs1045642 and ABCC5 rs3792585, were associated with an increased risk for ALL in Mexican children.

  9. Characterization of a novel organic solute transporter homologue from Clonorchis sinensis.

    Directory of Open Access Journals (Sweden)

    Yanyan Lu

    2018-04-01

    Full Text Available Clonorchis sinensis is a liver fluke that can dwell in the bile ducts of mammals. Bile acid transporters function to maintain the homeostasis of bile acids in C. sinensis, as they induce physiological changes or have harmful effects on C. sinensis survival. The organic solute transporter (OST transports mainly bile acid and belongs to the SLC51 subfamily of solute carrier transporters. OST plays a critical role in the recirculation of bile acids in higher animals. In this study, we cloned full-length cDNA of the 480-amino acid OST from C. sinensis (CsOST. Genomic analysis revealed 11 exons and nine introns. The CsOST protein had a 'Solute_trans_a' domain with 67% homology to Schistosoma japonicum OST. For further analysis, the CsOST protein sequence was split into the ordered domain (CsOST-N at the N-terminus and disordered domain (CsOST-C at the C-terminus. The tertiary structure of each domain was built using a threading-based method and determined by manual comparison. In a phylogenetic tree, the CsOST-N domain belonged to the OSTα and CsOST-C to the OSTβ clade. These two domains were more highly conserved with the OST α- and β-subunits at the structure level than at sequence level. These findings suggested that CsOST comprised the OST α- and β-subunits. CsOST was localized in the oral and ventral suckers and in the mesenchymal tissues abundant around the intestine, vitelline glands, uterus, and testes. This study provides fundamental data for the further understanding of homologues in other flukes.

  10. Interaction between serotonin transporter gene variants and life events predicts response to antidepressants in the GENDEP project

    DEFF Research Database (Denmark)

    Keers, R.; Uher, R.; Huezo-Diaz, P.

    2011-01-01

    , and several polymorphisms in the serotonin transporter gene (SLC6A4) have been genotyped including the serotonin transporter-linked polymorphic region (5-HTTLPR). Stressful life events were shown to predict a significantly better response to escitalopram but had no effect on response to nortriptyline...

  11. Transport of acidic amino acids by human jejunal brush-border membrane vesicles

    International Nuclear Information System (INIS)

    Rajendran, V.M.; Harig, J.M.; Adams, M.B.; Ramaswamy, K.

    1987-01-01

    This study characterizes the transport of radiolabeled acidic amino acids into brush-border membrane vesicles prepared from human jejunum. The uptakes of L-glutamic, L-aspartic, and D-aspartic acids were stimulated by a Na + gradient. Concentrative uptake (resulting in an overshoot phenomenon) of these dicarboxylic amino acids occurred when there was an outward K + gradient. In addition, increasing K + gradients resulted in enhanced uptake of L-glutamic acid. This K + requirement is somewhat specific as Rb + and Cs + could enhance uptake to a limited extent, whereas Li + and choline + showed no enhancement. The presence of a K + gradient did not affect the affinity of the carrier system for L-glutamic acid but it did increase the V/sub max/. The presence of extravesicular anions having differing membrane permeabilities did not altar L-glutamic acid uptake indicating an absence of an effect of membrane potential on the transport process. Finally, the human transport system for L-glutamic acid appears to be specific for acidic amino acids as demonstrated by inhibition studies. The studies demonstrate a transport system in human jejunum specific for acidic amino acids that is energized by an inward Na + gradient and an outward K + gradient

  12. Stanford: SLC back in action

    Energy Technology Data Exchange (ETDEWEB)

    Anon.

    1990-05-15

    During January, Stanford's SLC Linear Collider began producing Z particles again after the major disruptions in October due to the Loma Prieta earthquake. What's more, the pulse repetition rate climbed smoothly from 60 to 120 Hz as part of the ongoing collider improvement programme. Although the SLC luminosity has not quite returned to its best pre-quake levels, the collider managed to produce enough Z particles to permit Mark II physicists to test their newly installed Vertex Detection System (VDS)

  13. Energy spread in SLC linac with Landau damping

    International Nuclear Information System (INIS)

    Seeman, J.

    1984-01-01

    The possibility of using Landau damping to reduce the growth of the beam size due to transverse wake fields has been known for some time. Recently K. Bane has calculated the effects of Landau damping for the SLC. The energy spread is then slowly removed so that at the end of the linac it has returned to the SLC specification of less than +0.5%. The purpose of the energy spread is to reduce the resonant driving of the tail of the bunch by the head. In this note the expected energy spreads within the beam are tabulated at various positions along the linac for use by those people designing momentum dependent equipment and for those interested in Landau damping

  14. Characterization of a novel organic solute transporter homologue from Clonorchis sinensis

    Science.gov (United States)

    Dai, Fuhong; Lee, Ji-Yun; Pak, Jhang Ho; Sohn, Woon-Mok

    2018-01-01

    Clonorchis sinensis is a liver fluke that can dwell in the bile ducts of mammals. Bile acid transporters function to maintain the homeostasis of bile acids in C. sinensis, as they induce physiological changes or have harmful effects on C. sinensis survival. The organic solute transporter (OST) transports mainly bile acid and belongs to the SLC51 subfamily of solute carrier transporters. OST plays a critical role in the recirculation of bile acids in higher animals. In this study, we cloned full-length cDNA of the 480-amino acid OST from C. sinensis (CsOST). Genomic analysis revealed 11 exons and nine introns. The CsOST protein had a ‘Solute_trans_a’ domain with 67% homology to Schistosoma japonicum OST. For further analysis, the CsOST protein sequence was split into the ordered domain (CsOST-N) at the N-terminus and disordered domain (CsOST-C) at the C-terminus. The tertiary structure of each domain was built using a threading-based method and determined by manual comparison. In a phylogenetic tree, the CsOST-N domain belonged to the OSTα and CsOST-C to the OSTβ clade. These two domains were more highly conserved with the OST α- and β-subunits at the structure level than at sequence level. These findings suggested that CsOST comprised the OST α- and β-subunits. CsOST was localized in the oral and ventral suckers and in the mesenchymal tissues abundant around the intestine, vitelline glands, uterus, and testes. This study provides fundamental data for the further understanding of homologues in other flukes. PMID:29702646

  15. Common variants related to serum uric acid concentrations are associated with glucose metabolism and insulin secretion in a Chinese population.

    Directory of Open Access Journals (Sweden)

    Xue Sun

    Full Text Available Elevated serum uric acid concentration is an independent risk factor and predictor of type 2 diabetes (T2D. Whether the uric acid-associated genes have an impact on T2D remains unclear. We aimed to investigate the effects of the uric acid-associated genes on the risk of T2D as well as glucose metabolism and insulin secretion.We recruited 2,199 normal glucose tolerance subjects from the Shanghai Diabetes Study I and II and 2,999 T2D patients from the inpatient database of Shanghai Diabetes Institute. Fifteen single nucleotide polymorphisms (SNPs mapped in or near 11 loci (PDZK1, GCKR, LRP2, SLC2A9, ABCG2, LRRC16A, SLC17A1, SLC17A3, SLC22A11, SLC22A12 and SF1 were genotyped and serum biochemical parameters related to uric acid and T2D were determined.SF1 rs606458 showed strong association to T2D in both males and females (p = 0.034 and 0.0008. In the males, LRRC16A was associated with 2-h insulin and insulin secretion (p = 0.009 and 0.009. SLC22A11 was correlated with HOMA-B and insulin secretion (p = 0.048 and 0.029. SLC2A9 rs3775948 was associated with 2-h glucose (p = 0.043. In the females, LRP2 rs2544390 and rs1333049 showed correlations with fasting insulin, HOMA-IR and insulin secretion (p = 0.028, 0.033 and 0.052 and p = 0.034, 0.047 and 0.038, respectively. SLC2A9 rs11722228 was correlated with 2-h glucose, 2-h insulin and insulin secretion (p = 0.024, 0.049 and 0.049, respectively.Our results indicated that the uric acid-associated genes have an impact on the risk of T2D, glucose metabolism and insulin secretion in a Chinese population.

  16. Resistance to diet-induced obesity and associated metabolic perturbations in haploinsufficient monocarboxylate transporter 1 mice.

    OpenAIRE

    Lengacher Sylvain; Nehiri-Sitayeb Touria; Steiner Nadia; Carneiro Lionel; Favrod Céline; Preitner Frédéric; Thorens Bernard; Stehle Jean-Christophe; Dix Laure; Pralong François; Magistretti Pierre J; Pellerin Luc

    2013-01-01

    The monocarboxylate transporter 1 (MCT1 or SLC16A1) is a carrier of short-chain fatty acids, ketone bodies, and lactate in several tissues. Genetically modified C57BL/6J mice were produced by targeted disruption of the mct1 gene in order to understand the role of this transporter in energy homeostasis. Null mutation was embryonically lethal, but MCT1(+/-) mice developed normally. However, when fed high fat diet (HFD), MCT1(+/-) mice displayed resistance to development of diet-induced obesity ...

  17. Enhanced absorption and growth inhibition with amino acid monoester prodrugs of floxuridine by targeting hPEPT1 transporters.

    Science.gov (United States)

    Tsume, Yasuhiro; Vig, Balvinder S; Sun, Jing; Landowski, Christopher P; Hilfinger, John M; Ramachandran, Chandrasekharan; Amidon, Gordon L

    2008-06-28

    A series of amino acid monoester prodrugs of floxuridine was synthesized and evaluated for the improvement of oral bioavailability and the feasibility of target drug delivery via oligopeptide transporters. All floxuridine 5'-amino acid monoester prodrugs exhibited PEPT1 affinity, with inhibition coefficients of Gly-Sar uptake (IC50) ranging from 0.7 - 2.3 mM in Caco-2 and 2.0 - 4.8 mM in AsPC-1 cells, while that of floxuridine was 7.3 mM and 6.3 mM, respectively. Caco-2 membrane permeabilities of floxuridine prodrugs (1.01 - 5.31 x 10(-6 )cm/sec) and floxuridine (0.48 x 10(-6 )cm/sec) were much higher than that of 5-FU (0.038 x 10(-6) cm/sec). MDCK cells stably transfected with the human oligopeptide transporter PEPT1 (MDCK/hPEPT1) exhibited enhanced cell growth inhibition in the presence of the prodrugs. This prodrug strategy offers great potential, not only for increased drug absorption but also for improved tumor selectivity and drug efficacy.

  18. Comprehensive phenotype/genotype analyses of the norepinephrine transporter gene (SLC6A2 in ADHD: relation to maternal smoking during pregnancy.

    Directory of Open Access Journals (Sweden)

    Geeta A Thakur

    Full Text Available Despite strong pharmacological evidence implicating the norepinephrine transporter in ADHD, genetic studies have yielded largely insignificant results. We tested the association between 30 tag SNPs within the SLC6A2 gene and ADHD, with stratification based on maternal smoking during pregnancy, an environmental factor strongly associated with ADHD.Children (6-12 years old diagnosed with ADHD according to DSM-IV criteria were comprehensively evaluated with regard to several behavioral and cognitive dimensions of ADHD as well as response to a fixed dose of methylphenidate (MPH using a double-blind placebo controlled crossover trial. Family-based association tests (FBAT, including categorical and quantitative trait analyses, were conducted in 377 nuclear families.A highly significant association was observed with rs36021 (and linked SNPs in the group where mothers smoked during pregnancy. Association was noted with categorical DSM-IV ADHD diagnosis (Z=3.74, P=0.0002, behavioral assessments by parents (CBCL, P=0.00008, as well as restless-impulsive subscale scores on Conners'-teachers (P=0.006 and parents (P=0.006. In this subgroup, significant association was also observed with cognitive deficits, more specifically sustained attention, spatial working memory, planning, and response inhibition. The risk allele was associated with significant improvement of behavior as measured by research staff (Z=3.28, P=0.001, parents (Z=2.62, P=0.009, as well as evaluation in the simulated academic environment (Z=3.58, P=0.0003.By using maternal smoking during pregnancy to index a putatively more homogeneous group of ADHD, highly significant associations were observed between tag SNPs within SLC6A2 and ADHD diagnosis, behavioral and cognitive measures relevant to ADHD and response to MPH. This comprehensive phenotype/genotype analysis may help to further understand this complex disorder and improve its treatment. Clinical trial registration information - Clinical

  19. Functional characterization of folic acid transport in the intestine of the laying hen using the everted intestinal sac model.

    Science.gov (United States)

    Tactacan, G B; Rodriguez-Lecompte, J C; Karmin, O; House, J D

    2011-01-01

    Absorption at the level of the intestine is likely a primary regulatory mechanism for the deposition of dietary supplemented folic acid into the chicken egg. Therefore, factors affecting the intestinal transport of folic acid in the laying hen may influence the level of egg folate concentrations. To this end, a series of experiments using intestinal everted sacs were conducted to characterize intestinal folic acid absorption processes in laying hens. Effects of naturally occurring folate derivatives (5-methyl and 10-formyltetrahydrofolate) as well as heme on folic acid absorption were also investigated. Folic acid absorption was measured based on the rate of uptake of (3)H-labeled folic acid in the everted sac from various segments of the small and large intestines. Folic acid concentration, incubation length, and pH condition were optimized before the performance of uptake experiments. The distribution profile of folic acid transport along the intestine was highest in the upper half of the small intestine. Maximum uptake rate (nmol·100 g tissue(-1)·min(-1)) was observed in the duodenum (20.6 ± 1.9) and jejunum (22.3 ± 2.0) and decreased significantly in the ileum (15.3 ± 1.1) and cecum (9.3 ± 0.9). Transport increased proportionately (P methyl and 10-formyltetrahydrofolate as well as heme impeded folic acid uptake, reducing intestinal folic acid absorption when added at concentrations ranging from 0 to 100 µM. Overall, these data indicated the presence of a folic acid transport system in the entire intestine of the laying hen. Uptake of folic acid in the cecum raises the likelihood of absorption of bacterial-derived folate.

  20. X-Linked Creatine Transporter Deficiency Presenting as a Mitochondrial Disorder

    NARCIS (Netherlands)

    Hathaway, S.C.; Friez, M.; Limbo, K.; Parker, C.; Salomons, G.S.; Vockley, J.; Wood, T.; Abdul-Rahman, O.A.

    2010-01-01

    X-linked creatine transporter defect is caused by mutations in SLC6A8 at Xq28, which encodes the sodium-dependent creatine transporter. Reduction in creatine uptake results in elevated urine creatine and CSF creatine deficiency, which can be detected on magnetic resonance spectroscopy. We report a

  1. The Putative SLC Transporters Mfsd5 and Mfsd11 Are Abundantly Expressed in the Mouse Brain and Have a Potential Role in Energy Homeostasis.

    Directory of Open Access Journals (Sweden)

    Emelie Perland

    Full Text Available Solute carriers (SLCs are membrane bound transporters responsible for the movement of soluble molecules such as amino acids, ions, nucleotides, neurotransmitters and oligopeptides over cellular membranes. At present, there are 395 SLCs identified in humans, where about 40% are still uncharacterized with unknown expression and/or function(s. Here we have studied two uncharacterized atypical SLCs that belong to the Major Facilitator Superfamily Pfam clan, Major facilitator superfamily domain 5 (MFSD5 and Major facilitator superfamily domain 11 (MFSD11. We provide fundamental information about the histology in mice as well as data supporting their disposition to regulate expression levels to keep the energy homeostasis.In mice subjected to starvation or high-fat diet, the mRNA expression of Mfsd5 was significantly down-regulated (P<0.001 in food regulatory brain areas whereas Mfsd11 was significantly up-regulated in mice subjected to either starvation (P<0.01 or high-fat diet (P<0.001. qRT-PCR analysis on wild type tissues demonstrated that both Mfsd5 and Mfsd11 have a wide central and peripheral mRNA distribution, and immunohistochemistry was utilized to display the abundant protein expression in the mouse embryo and the adult mouse brain. Both proteins are expressed in excitatory and inhibitory neurons, but not in astrocytes.Mfsd5 and Mfsd11 are both affected by altered energy homeostasis, suggesting plausible involvement in the energy regulation. Moreover, the first histological mapping of MFSD5 and MFSD11 shows ubiquitous expression in the periphery and the central nervous system of mice, where the proteins are expressed in excitatory and inhibitory mouse brain neurons.

  2. Clinical presentation and outcome of riboflavin transporter deficiency: mini review after five years of experience

    NARCIS (Netherlands)

    Jaeger, Bregje; Bosch, Annet M.

    2016-01-01

    Riboflavin (vitamin B2) is absorbed in the small intestine by the human riboflavin transporters RFVT1 and RFVT3. A third riboflavin transporter (RFVT2) is expressed in the brain. In 2010 it was demonstrated that mutations in the riboflavin transporter genes SLC52A2 (coding for RFVT2) and SLC52A3

  3. Hearing loss associated with enlarged vestibular aqueduct and zero or one mutant allele of SLC26A4.

    Science.gov (United States)

    Rose, Jane; Muskett, Julie A; King, Kelly A; Zalewski, Christopher K; Chattaraj, Parna; Butman, John A; Kenna, Margaret A; Chien, Wade W; Brewer, Carmen C; Griffith, Andrew J

    2017-07-01

    To characterize the severity and natural history of hearing loss, and the prevalence of having a cochlear implant in a maturing cohort of individuals with enlarged vestibular aqueduct (EVA) and zero or one mutant allele of SLC26A4. Prospective cohort study of subjects ascertained between 1998 and 2015 at the National Institutes of Health Clinical Center. Study subjects were 127 individuals (median age, 8 years; range, 0-59 years) with EVA in at least one ear. Ears with EVA and zero or one mutant allele of SLC26A4 had mean 0.5/1/2/4-kHz pure-tone averages of 62.6 and 52.9 dB HL, respectively, in contrast to EVA ears with two mutant alleles of SLC26A4 (88.1 dB HL; P zero, one, and two mutant alleles, respectively (P = .00833). This association was not independent (P = .534) but reflected underlying correlations with age at time of first audiogram (P = .003) or severity of hearing loss (P = .000). Ears with EVA and zero or one mutant allele of SLC26A4 have less severe hearing loss, no difference in prevalence of fluctuation, and a lower prevalence of cochlear implantation in comparison to ears with two mutant alleles of SLC26A4. NA Laryngoscope, 127:E238-E243, 2017. © 2016 The American Laryngological, Rhinological and Otological Society, Inc.

  4. Stanford: SLC back in action

    International Nuclear Information System (INIS)

    Anon.

    1990-01-01

    During January, Stanford's SLC Linear Collider began producing Z particles again after the major disruptions in October due to the Loma Prieta earthquake. What's more, the pulse repetition rate climbed smoothly from 60 to 120 Hz as part of the ongoing collider improvement programme. Although the SLC luminosity has not quite returned to its best pre-quake levels, the collider managed to produce enough Z particles to permit Mark II physicists to test their newly installed Vertex Detection System (VDS)

  5. Performance of the SLC polarized electron source with high polarization

    International Nuclear Information System (INIS)

    Clendenin, J.E.; Alley, R.K.; Aoyagi, H.

    1993-04-01

    For the 1992 operating cycle of the SLAC Linear Collider (SLC), the polarized electron source (PES) during its maiden run successfully met the pulse intensity and overall efficiency requirements of the SLC. However, the polarization of the bulk GaAs cathode was low (∼27%) and the pulse-to-pulse stability was marginal. We have shown that adequate charge for the SLC can be extracted from a strained layer cathode having P e ∼80% even though the quantum efficiency (QE) is - beam stability. The performance of the PES during the 1993 SLC operating cycle with these and other improvements is discussed

  6. Biodistribution of [11C] methylaminoisobutyric acid, a tracer for PET studies on system A amino acid transport in vivo

    International Nuclear Information System (INIS)

    Sutinen, E.; Jyrkkioe, S.; Groenroos, T.; Haaparanta, M.; Lehikoinen, P.; Naagren, K.

    2001-01-01

    [N-methyl- 11 C]α-Methylaminoisobutyric acid ( 11 C-MeAIB) is a potentially useful tracer for positron emission tomography (PET) studies on hormonally regulated system A amino acid transport. 11 C-MeAIB is a metabolically stable amino acid analogue specific for system A amino acid transport. We evaluated the biodistribution of 11 C-MeAIB in rats and humans to estimate the usefulness of the tracer for in vivo human PET studies, for example, on regulation of system A amino acid transport and on tumour imaging. Healthy Sprague-Dawley rats (n=14) were killed 5, 20, 40 or 60 min after the injection of 11 C-MeAIB, and the tissue samples were weighed and counted for 11 C radioactivity. Ten lymphoma patients with relatively limited tumour burden underwent whole-body (WB) PET imaging with 11 C-MeAIB. In addition, three other patients had dynamic PET scanning of the head and neck area, and the tracer uptake was quantitated by calculating the kinetic influx constants (K i values) for the tracer. In animal studies, the highest activity was detected in the kidney, pancreas, adrenal gland and intestines. In humans, the highest activity was found in the salivary glands, and after that in the kidney and pancreas, similar to the results in animal studies. Rapid uptake was also detected in the skeletal muscle. In the graphical analysis, linear plots were obtained, and the mean fractional tracer uptake values (K i ) of the parotid glands (n=3) and cervical muscles (n=3) were 0.039±0.008 min -1 and 0.013±0.006 min -1 , respectively. The K i value of the tumour (n=1) was 0.064 min -1 . Higher uptake of 11 C-MeAIB into the tumour tissue was encountered. These results encourage further 11 C-MeAIB PET studies in humans on the physiology and pathology of system A amino acid transport and on tumour detection. (orig.)

  7. Chromatic correction in the SLC bunch length compressors

    International Nuclear Information System (INIS)

    Adolphsen, C.E.; Emma, P.J.; Fieguth, T.H.; Spence, W.L.

    1991-06-01

    The SLC Ring to Linac (RTL) transport lines employ intense bending and strong transverse focusing to produce the momentum compaction needed for bunch length compression prior to S-band acceleration. In the presence of the large rf induced energy spread needed for compression the consequent chromatic effects -- viz. the variation with energy of residual output dispersion and of the RTL transfer matrix, threaten to destroy the small emittances produced by the damping rings. We report on the tuning methods that have been developed and used to implement the sextupole based chromatic correction scheme. 6 refs., 4 figs

  8. Measurement of electron beam polarization at the SLC

    International Nuclear Information System (INIS)

    Steiner, H.; California Univ., Berkeley

    1988-01-01

    One of the unique features of the SLC is its capability to accelerate longitudinally polarized electrons. The SLC polarization group has been performed to implement the polarization program at the SLC. Technically the polarization project consists of three main parts: (1) a polarized source, (2) spin-rotating superconducting solenoid magnets to be used to manipulate the direction of the electron spin, and (3) the polarimeters needed to monitor and measure the electron beam polarization. It is this last topic that will concern us here. Two types of polarimeters will be used - Compton and Moeller. (orig./HSI)

  9. The two Na+ sites in the human serotonin transporter play distinct roles in the ion coupling and electrogenicity of transport.

    Science.gov (United States)

    Felts, Bruce; Pramod, Akula Bala; Sandtner, Walter; Burbach, Nathan; Bulling, Simon; Sitte, Harald H; Henry, L Keith

    2014-01-17

    Neurotransmitter transporters of the SLC6 family of proteins, including the human serotonin transporter (hSERT), utilize Na(+), Cl(-), and K(+) gradients to induce conformational changes necessary for substrate translocation. Dysregulation of ion movement through monoamine transporters has been shown to impact neuronal firing potentials and could play a role in pathophysiologies, such as depression and anxiety. Despite multiple crystal structures of prokaryotic and eukaryotic SLC transporters indicating the location of both (or one) conserved Na(+)-binding sites (termed Na1 and Na2), much remains uncertain in regard to the movements and contributions of these cation-binding sites in the transport process. In this study, we utilize the unique properties of a mutation of hSERT at a single, highly conserved asparagine on TM1 (Asn-101) to provide several lines of evidence demonstrating mechanistically distinct roles for Na1 and Na2. Mutations at Asn-101 alter the cation dependence of the transporter, allowing Ca(2+) (but not other cations) to functionally replace Na(+) for driving transport and promoting 5-hydroxytryptamine (5-HT)-dependent conformational changes. Furthermore, in two-electrode voltage clamp studies in Xenopus oocytes, both Ca(2+) and Na(+) illicit 5-HT-induced currents in the Asn-101 mutants and reveal that, although Ca(2+) promotes substrate-induced current, it does not appear to be the charge carrier during 5-HT transport. These findings, in addition to functional evaluation of Na1 and Na2 site mutants, reveal separate roles for Na1 and Na2 and provide insight into initiation of the translocation process as well as a mechanism whereby the reported SERT stoichiometry can be obtained despite the presence of two putative Na(+)-binding sites.

  10. The Two Na+ Sites in the Human Serotonin Transporter Play Distinct Roles in the Ion Coupling and Electrogenicity of Transport*

    Science.gov (United States)

    Felts, Bruce; Pramod, Akula Bala; Sandtner, Walter; Burbach, Nathan; Bulling, Simon; Sitte, Harald H.; Henry, L. Keith

    2014-01-01

    Neurotransmitter transporters of the SLC6 family of proteins, including the human serotonin transporter (hSERT), utilize Na+, Cl−, and K+ gradients to induce conformational changes necessary for substrate translocation. Dysregulation of ion movement through monoamine transporters has been shown to impact neuronal firing potentials and could play a role in pathophysiologies, such as depression and anxiety. Despite multiple crystal structures of prokaryotic and eukaryotic SLC transporters indicating the location of both (or one) conserved Na+-binding sites (termed Na1 and Na2), much remains uncertain in regard to the movements and contributions of these cation-binding sites in the transport process. In this study, we utilize the unique properties of a mutation of hSERT at a single, highly conserved asparagine on TM1 (Asn-101) to provide several lines of evidence demonstrating mechanistically distinct roles for Na1 and Na2. Mutations at Asn-101 alter the cation dependence of the transporter, allowing Ca2+ (but not other cations) to functionally replace Na+ for driving transport and promoting 5-hydroxytryptamine (5-HT)-dependent conformational changes. Furthermore, in two-electrode voltage clamp studies in Xenopus oocytes, both Ca2+ and Na+ illicit 5-HT-induced currents in the Asn-101 mutants and reveal that, although Ca2+ promotes substrate-induced current, it does not appear to be the charge carrier during 5-HT transport. These findings, in addition to functional evaluation of Na1 and Na2 site mutants, reveal separate roles for Na1 and Na2 and provide insight into initiation of the translocation process as well as a mechanism whereby the reported SERT stoichiometry can be obtained despite the presence of two putative Na+-binding sites. PMID:24293367

  11. SLAC-Linac-Collider (SLC) Project

    International Nuclear Information System (INIS)

    Wiedemann, H.

    1981-02-01

    The proposed SLAC Linear Collider Project (SLC) and its features are described in this paper. In times of ever increasing costs for energy the electron storage ring principle is about to reach its practical limit. A new class of colliding beam beam facilities, the Linear Colliders, are getting more and more attractive and affordable at very high center-of-mass energies. The SLC is designed to be a poineer of this new class of colliding beam facilities and at the same time will serve as a valuable tool to explore the high energy physics at the level of 100 GeV in the center-of-mass system

  12. The rise and fall of novel renal magnesium transporters.

    Science.gov (United States)

    Schäffers, Olivier J M; Hoenderop, Joost G J; Bindels, René J M; de Baaij, Jeroen H F

    2018-06-01

    Body Mg 2+ balance is finely regulated in the distal convoluted tubule (DCT), where a tight interplay among transcellular reabsorption, mitochondrial exchange, and basolateral extrusion takes place. In the last decades, several research groups have aimed to identify the molecular players in these processes. A multitude of proteins have been proposed to function as Mg 2+ transporter in eukaryotes based on phylogenetic analysis, differential gene expression, and overexpression studies. However, functional evidence for many of these proteins is lacking. The aim of this review is, therefore, to critically reconsider all putative Mg 2+ transporters and put their presumed function in context of the renal handling of Mg 2+ . Sufficient experimental evidence exists to acknowledge transient receptor potential melastatin (TRPM) 6 and TRPM7, solute carrier family 41 (SLC41) A1 and SLC41A3, and mitochondrial RNA splicing 2 (MRS2) as Mg 2+ transporters. TRPM6/7 facilitate Mg 2+ influx, SLC41A1 mediates Mg 2+ extrusion, and MRS2 and SLC41A3 are implicated in mitochondrial Mg 2+ homeostasis. These proteins are highly expressed in the DCT. The function of cyclin M (CNNM) proteins is still under debate. For the other proposed Mg 2+ transporters including Mg 2+ transporter subtype 1 (MagT1), nonimprinted in Prader-Willi/Angelman syndrome (NIPA), membrane Mg 2+ transport (MMgT), Huntingtin-interacting protein 14 (HIP14), and ATP13A4, functional evidence is limited, or functions alternative to Mg 2+ transport have been suggested. Additional characterization of their Mg 2+ transport proficiency should be provided before further claims about their role as Mg 2+ transporter can be made.

  13. Cardiomyocyte Triglyceride Accumulation and Reduced Ventricular Function in Mice with Obesity Reflect Increased Long Chain Fatty Acid Uptake and De Novo Fatty Acid Synthesis

    Directory of Open Access Journals (Sweden)

    Fengxia Ge

    2012-01-01

    Full Text Available A nonarteriosclerotic cardiomyopathy is increasingly seen in obese patients. Seeking a rodent model, we studied cardiac histology, function, cardiomyocyte fatty acid uptake, and transporter gene expression in male C57BL/6J control mice and three obesity groups: similar mice fed a high-fat diet (HFD and db/db and ob/ob mice. At sacrifice, all obesity groups had increased body and heart weights and fatty livers. By echocardiography, ejection fraction (EF and fractional shortening (FS of left ventricular diameter during systole were significantly reduced. The Vmax for saturable fatty acid uptake was increased and significantly correlated with cardiac triglycerides and insulin concentrations. Vmax also correlated with expression of genes for the cardiac fatty acid transporters Cd36 and Slc27a1. Genes for de novo fatty acid synthesis (Fasn, Scd1 were also upregulated. Ten oxidative phosphorylation pathway genes were downregulated, suggesting that a decrease in cardiomyocyte ATP synthesis might explain the decreased contractile function in obese hearts.

  14. Drift chamber vertex detectors for SLC/LEP

    Energy Technology Data Exchange (ETDEWEB)

    Hayes, K G

    1988-03-01

    Factors influencing the design of drift chamber vertex detectors for SLC and LEP are discussed including global strategy, chamber gas, cell design, and signal processing. The designs of the vertex chambers for the L3 and OPAL experiments at LEP and the Mark II experiment at the SLC are described.

  15. Zinc-Associated Variant in SLC30A8 Gene Interacts With Gestational Weight Gain on Postpartum Glycemic Changes: A Longitudinal Study in Women With Prior Gestational Diabetes Mellitus.

    Science.gov (United States)

    Wang, Tiange; Liu, Huikun; Wang, Leishen; Huang, Tao; Li, Weiqin; Zheng, Yan; Heianza, Yoriko; Sun, Dianjianyi; Leng, Junhong; Zhang, Shuang; Li, Nan; Hu, Gang; Qi, Lu

    2016-12-01

    Zinc transporter 8 genetic variant SLC30A8 has been associated with postpartum risk of type 2 diabetes among women with gestational diabetes mellitus (GDM). Gestational weight gain is one of the strongest risk factors for postpartum hyperglycemia. We assessed the interaction between type 2 diabetes-associated SLC30A8 rs13266634 and gestational weight gain on 1-5 years of postpartum glycemic changes in 1,071 women with prior GDM in a longitudinal study. Compared with gestation of 26-30 weeks, postpartum levels of fasting glucose, oral glucose tolerance test 2-h glucose, and hemoglobin A 1c (HbA 1c ) increased across rs13266634 TT, CT, and CC genotypes in women with excessive gestational weight gain, whereas opposite genetic associations were found in women with inadequate or adequate gestational weight gain. Postpartum changes in fasting glucose per additional copy of the C allele were -0.18, -0.04, and 0.12 mmol/L in women with inadequate, adequate, and excessive gestational weight gain, respectively (P for interaction = 0.002). We also found similar interactions for changes in 2-h glucose and HbA 1c (P for interaction = 0.003 and 0.005, respectively). Our data indicate that gestational weight gain may modify SLC30A8 variant on long-term glycemic changes, highlighting the importance of gestational weight control in the prevention of postpartum hyperglycemia in women with GDM. © 2016 by the American Diabetes Association.

  16. Neuropathological characteristics of the brain in two patients with SLC19A3 mutations related to the biotin-thiamine-responsive basal ganglia disease

    Directory of Open Access Journals (Sweden)

    Maciej Pronicki

    2017-06-01

    Full Text Available Biotin-thiamine-responsive basal ganglia disease is a severe form of a rare neurogenetic disorder caused by pathogenic molecular variants in the thiamine transporter gene. Nowadays, a potentially effective treatment is known, therefore the early diagnosis is mandatory. The aim of the paper was to assess the contribution of neuropathological and magnetic resonance imaging (MRI studies to a proper diagnosis. We present the brain study of two Polish patients with SLC19A3 mutations, including (1 an infant with an intriguing “walnut” appearance of the brain autopsied many years before the discovery of the SLC19A3 defect, and (2 a one-year-old patient with clinical features of Leigh syndrome. In patient 2, biotin/thiamine responsiveness was not tested at the time of diagnosis and causal treatment started with one-year delay. The central nervous system lesions found in the patients displayed almost clearly a specific pattern for SLC19A3 defect, as previously proposed in diagnostic criteria. Our study presents a detailed description of neuropathological and MRI findings of both patients. We confirm that the autopsy and/or MRI of the brain is sufficient to qualify a patient with an unknown neuropathological disorder directly for SLC19A3 mutations testing and a prompt trial of specific treatment.

  17. Characterization of substrate preference for Slc1p and Cst26p in Saccharomyces cerevisiae using lipidomic approaches and an LPAAT activity assay.

    Directory of Open Access Journals (Sweden)

    Guanghou Shui

    Full Text Available BACKGROUND: Phosphatidic acid (PA is a key regulated intermediate and precursor for de novo biosynthesis of all glycerophospholipids. PA can be synthesized through the acylation of lysophosphatidic acid (LPA by 1-acyl-3-phosphate acyltransferase (also called lysophosphatidic acid acyltransferase, LPAAT. Recent findings have substantiated the essential roles of acyltransferases in various biological functions. METHODOLOGIES/PRINCIPAL FINDINGS: We used a flow-injection-based lipidomic approach with approximately 200 multiple reaction monitoring (MRM transitions to pre-screen fatty acyl composition of phospholipids in the yeast Saccharomyces cerevisiae mutants. Dramatic changes were observed in fatty acyl composition in some yeast mutants including Slc1p, a well-characterized LPAAT, and Cst26p, a recently characterized phosphatidylinositol stearoyl incorporating 1 protein and putative LPAAT in S. cerevisiae. A comprehensive high-performance liquid chromatography-based multi-stage MRM approach (more than 500 MRM transitions was developed and further applied to quantify individual phospholipids in both strains to confirm these changes. Our data suggest potential fatty acyl substrates as well as fatty acyls that compensate for defects in both Cst26p and Slc1p mutants. These results were consistent with those from a non-radioactive LPAAT enzymatic assay using C17-LPA and acyl-CoA donors as substrates. CONCLUSIONS: We found that Slc1p utilized fatty acid (FA 18:1 and FA 14:0 as substrates to synthesize corresponding PAs; moreover, it was probably the only acyltransferase responsible for acylation of saturated short-chain fatty acyls (12:0 and 10:0 in S. cerevisiae. We also identified FA 18:0, FA 16:0, FA 14:0 and exogenous FA 17:0 as preferred substrates for Cst26p because transformation with a GFP-tagged CST26 restored the phospholipid profile of a CST26 mutant. Our current findings expand the enzymes and existing scope of acyl-CoA donors for

  18. Superconducting quadrupoles for the SLC final focus

    International Nuclear Information System (INIS)

    Erickson, R.; Fieguth, T.; Murray, J.J.

    1987-01-01

    The final focus system of the SLC will be upgraded by replacing the final quadrupoles with higher gradient superconducting magnets positioned closer to the interaction point. The parameters of the new system have been chosen to be compatible with the experimental detectors with a minimum of changes to other final focus components. These parameter choices are discussed along with the expected improvement in SLC performance

  19. Making electron beams for the SLC linac

    International Nuclear Information System (INIS)

    Clendenin, J.E.; Ecklund, S.D.; James, M.B.; Miller, R.H.; Sheppard, J.C.; Sodja, J.; Truher, J.B.; Minten, A.

    1984-01-01

    A source of high-intensity, single-bunch electron beams has been developed at SLAC for the SLC. The properties of these beams have been studied extensively utilizing the first 100-m of the SLAC linac and the computer-based control system being developed for the SLC. The source is described and the properties of the beams are summarized. 9 references, 2 figures, 1 table

  20. Superconducting quadrupoles for the SLC final focus

    International Nuclear Information System (INIS)

    Erickson, R.; Fieguth, T.; Murray, J.J.

    1987-01-01

    The final focus system of the SLC will be upgraded by replacing the final quadrupoles with higher gradient supperconducting magnets positioned closer to the interaction point. The parameters of the new system have been chosen to be compatible with the experimental detectors with a minimum of changes to other final focus components. These parameter choices are discussed along with the expected improvement in SLC performance