Cloning and sequence analysis of putative type II fatty acid synthase ...
Indian Academy of Sciences (India)
Prakash
Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L. ... acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, β-ketoacyl-ACP .... Helix II plays a dominant role in the interaction ... main distinguishing features of plant ACPs in plastids and ..... synthase component; J. Biol.
DEFF Research Database (Denmark)
Christensen, Caspar Elo; Kragelund, Birthe B; von Wettstein-Knowles, Penny
2007-01-01
Two distinct ways of organizing fatty acid biosynthesis exist: the multifunctional type I fatty acid synthase (FAS) of mammals, fungi, and lower eukaryotes with activities residing on one or two polypeptides; and the dissociated type II FAS of prokaryotes, plastids, and mitochondria with individual...... activities encoded by discrete genes. The beta-ketoacyl [ACP] synthase (KAS) moiety of the mitochondrial FAS (mtKAS) is targeted by the antibiotic cerulenin and possibly by the other antibiotics inhibiting prokaryotic KASes: thiolactomycin, platensimycin, and the alpha-methylene butyrolactone, C75. The high...... degree of structural similarity between mitochondrial and prokaryotic KASes complicates development of novel antibiotics targeting prokaryotic KAS without affecting KAS domains of cytoplasmic FAS. KASes catalyze the C(2) fatty acid elongation reaction using either a Cys-His-His or Cys-His-Asn catalytic...
Use of octaketide synthases to produce kermesic acid and flavokermesic acid
DEFF Research Database (Denmark)
2017-01-01
A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide...... in vivo within the recombinant host cell and (II): converting in vivo the non-reduced octaketide of step (I) into a C14-C34 aromatic compound of interest (e.g. carminic acid)....
Use of octaketide synthases to produce kermesic acid and flavokermesic acid
DEFF Research Database (Denmark)
2016-01-01
A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide...... in vivo within the recombinant host cell and (II): converting in vivo the non-reduced octaketide of step (I) into a C14-C34 aromatic compound of interest (e.g. carminic acid)....
Slama, Nawel; Leiba, Jade; Eynard, Nathalie; Daffé, Mamadou; Kremer, Laurent; Quémard, Annaïk; Molle, Virginie
2011-09-02
The type II fatty acid synthase system of mycobacteria is involved in the biosynthesis of major and essential lipids, mycolic acids, key-factors of Mycobacterium tuberculosis pathogenicity. One reason of the remarkable survival ability of M. tuberculosis in infected hosts is partly related to the presence of cell wall-associated mycolic acids. Despite their importance, the mechanisms that modulate synthesis of these lipids in response to environmental changes are unknown. We demonstrate here that HadAB and HadBC dehydratases of this system are phosphorylated by Ser/Thr protein kinases, which negatively affects their enzymatic activity. The phosphorylation of HadAB/BC is growth phase-dependent, suggesting that it represents a mechanism by which mycobacteria might tightly control mycolic acid biosynthesis under non-replicating condition. Copyright © 2011 Elsevier Inc. All rights reserved.
Effects and mechanism of acid rain on plant chloroplast ATP synthase.
Sun, Jingwen; Hu, Huiqing; Li, Yueli; Wang, Lihong; Zhou, Qing; Huang, Xiaohua
2016-09-01
Acid rain can directly or indirectly affect plant physiological functions, especially photosynthesis. The enzyme ATP synthase is the key in photosynthetic energy conversion, and thus, it affects plant photosynthesis. To clarify the mechanism by which acid rain affects photosynthesis, we studied the effects of acid rain on plant growth, photosynthesis, chloroplast ATP synthase activity and gene expression, chloroplast ultrastructure, intracellular H(+) level, and water content of rice seedlings. Acid rain at pH 4.5 remained the chloroplast structure unchanged but increased the expression of six chloroplast ATP synthase subunits, promoted chloroplast ATP synthase activity, and increased photosynthesis and plant growth. Acid rain at pH 4.0 or less decreased leaf water content, destroyed chloroplast structure, inhibited the expression of six chloroplast ATP synthase subunits, decreased chloroplast ATP synthase activity, and reduced photosynthesis and plant growth. In conclusion, acid rain affected the chloroplast ultrastructure, chloroplast ATPase transcription and activity, and P n by changing the acidity in the cells, and thus influencing the plant growth and development. Finally, the effects of simulated acid rain on the test indices were found to be dose-dependent.
Inhibitors of Fatty Acid Synthase for Prostate Cancer
2012-05-01
compounds. For example, numerous classes of acetyl- cholinesterase inhibitors have been developed, m any with fe mtomolar binding affinities (7). This...AD_________________ Award Number: W81XWH-09-1-0204 TITLE: Inhibitors of Fatty Acid Synthase for...CONTRACT NUMBER Inhibitors of Fatty Acid Synthase for Prostate Cancer 5b. GRANT NUMBER W81XWH-09-1-0204 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR
Inhibitors of Fatty Acid Synthase for Prostate Cancer. Revision
2013-05-01
acetyl- cholinesterase inhibitors have been developed, many with femtomolar binding affinities (7). This body of literature also confirms that the...AD_________________ Award Number: W81XWH-09-1-0204 TITLE: Inhibitors of Fatty Acid Synthase for...May 2013 2. REPORT TYPE Revised Final 3. DATES COVERED 01 May 2009-30 Apr 2013 4. TITLE AND SUBTITLE Inhibitors of Fatty Acid Synthase for
Crystallization and X-ray diffraction studies of a complete bacterial fatty-acid synthase type I
International Nuclear Information System (INIS)
Enderle, Mathias; McCarthy, Andrew; Paithankar, Karthik Shivaji; Grininger, Martin
2015-01-01
Bacterial and fungal type I fatty-acid synthases (FAS I) are evolutionarily connected, as bacterial FAS I is considered to be the ancestor of fungal FAS I. In this work, the production, crystallization and X-ray diffraction data analysis of a bacterial FAS I are reported. While a deep understanding of the fungal and mammalian multi-enzyme type I fatty-acid synthases (FAS I) has been achieved in recent years, the bacterial FAS I family, which is narrowly distributed within the Actinomycetales genera Mycobacterium, Corynebacterium and Nocardia, is still poorly understood. This is of particular relevance for two reasons: (i) although homologous to fungal FAS I, cryo-electron microscopic studies have shown that bacterial FAS I has unique structural and functional properties, and (ii) M. tuberculosis FAS I is a drug target for the therapeutic treatment of tuberculosis (TB) and therefore is of extraordinary importance as a drug target. Crystals of FAS I from C. efficiens, a homologue of M. tuberculosis FAS I, were produced and diffracted X-rays to about 4.5 Å resolution
Crystallization and X-ray diffraction studies of a complete bacterial fatty-acid synthase type I
Energy Technology Data Exchange (ETDEWEB)
Enderle, Mathias [Goethe University Frankfurt, Max-von-Laue-Strasse 15, 60438 Frankfurt am Main (Germany); Max-Planck-Institute of Biochemistry, Am Klopferspitz 18, 82152 Martinsried (Germany); McCarthy, Andrew [EMBL Grenoble, 71 Avenue des Martyrs, 38042 Grenoble CEDEX 9 (France); Paithankar, Karthik Shivaji, E-mail: paithankar@em.uni-frankfurt.de [Goethe University Frankfurt, Max-von-Laue-Strasse 15, 60438 Frankfurt am Main (Germany); Grininger, Martin, E-mail: paithankar@em.uni-frankfurt.de [Goethe University Frankfurt, Max-von-Laue-Strasse 15, 60438 Frankfurt am Main (Germany); Max-Planck-Institute of Biochemistry, Am Klopferspitz 18, 82152 Martinsried (Germany)
2015-10-23
Bacterial and fungal type I fatty-acid synthases (FAS I) are evolutionarily connected, as bacterial FAS I is considered to be the ancestor of fungal FAS I. In this work, the production, crystallization and X-ray diffraction data analysis of a bacterial FAS I are reported. While a deep understanding of the fungal and mammalian multi-enzyme type I fatty-acid synthases (FAS I) has been achieved in recent years, the bacterial FAS I family, which is narrowly distributed within the Actinomycetales genera Mycobacterium, Corynebacterium and Nocardia, is still poorly understood. This is of particular relevance for two reasons: (i) although homologous to fungal FAS I, cryo-electron microscopic studies have shown that bacterial FAS I has unique structural and functional properties, and (ii) M. tuberculosis FAS I is a drug target for the therapeutic treatment of tuberculosis (TB) and therefore is of extraordinary importance as a drug target. Crystals of FAS I from C. efficiens, a homologue of M. tuberculosis FAS I, were produced and diffracted X-rays to about 4.5 Å resolution.
Crystallization of Δ1-tetrahydrocannabinolic acid (THCA) synthase from Cannabis sativa
International Nuclear Information System (INIS)
Shoyama, Yoshinari; Takeuchi, Ayako; Taura, Futoshi; Tamada, Taro; Adachi, Motoyasu; Kuroki, Ryota; Shoyama, Yukihiro; Morimoto, Satoshi
2005-01-01
Δ 1 -Tetrahydrocannabinolic acid (THCA) synthase from C. sativa was crystallized. The crystal diffracted to 2.7 Å resolution with sufficient quality for further structure determination. Δ 1 -Tetrahydrocannabinolic acid (THCA) synthase is a novel oxidoreductase that catalyzes the biosynthesis of the psychoactive compound THCA in Cannabis sativa (Mexican strain). In order to investigate the structure–function relationship of THCA synthase, this enzyme was overproduced in insect cells, purified and finally crystallized in 0.1 M HEPES buffer pH 7.5 containing 1.4 M sodium citrate. A single crystal suitable for X-ray diffraction measurement was obtained in 0.09 M HEPES buffer pH 7.5 containing 1.26 M sodium citrate. The crystal diffracted to 2.7 Å resolution at beamline BL41XU, SPring-8. The crystal belonged to the primitive cubic space group P432, with unit-cell parameters a = b = c = 178.2 Å. The calculated Matthews coefficient was approximately 4.1 or 2.0 Å 3 Da −1 assuming the presence of one or two molecules of THCA synthase in the asymmetric unit, respectively
Rudolf, Jeffrey D; Dong, Liao-Bin; Cao, Hongnan; Hatzos-Skintges, Catherine; Osipiuk, Jerzy; Endres, Michael; Chang, Chin-Yuan; Ma, Ming; Babnigg, Gyorgy; Joachimiak, Andrzej; Phillips, George N; Shen, Ben
2016-08-31
Terpenoids are the largest and most structurally diverse family of natural products found in nature, yet their presence in bacteria is underappreciated. The carbon skeletons of terpenoids are generated through carbocation-dependent cyclization cascades catalyzed by terpene synthases (TSs). Type I and type II TSs initiate cyclization via diphosphate ionization and protonation, respectively, and protein structures of both types are known. Most plant diterpene synthases (DTSs) possess three α-helical domains (αβγ), which are thought to have arisen from the fusion of discrete, ancestral bacterial type I TSs (α) and type II TSs (βγ). Type II DTSs of bacterial origin, of which there are no structurally characterized members, are a missing piece in the structural evolution of TSs. Here, we report the first crystal structure of a type II DTS from bacteria. PtmT2 from Streptomyces platensis CB00739 was verified as an ent-copalyl diphosphate synthase involved in the biosynthesis of platensimycin and platencin. The crystal structure of PtmT2 was solved at a resolution of 1.80 Å, and docking studies suggest the catalytically active conformation of geranylgeranyl diphosphate (GGPP). Site-directed mutagenesis confirmed residues involved in binding the diphosphate moiety of GGPP and identified DxxxxE as a potential Mg(2+)-binding motif for type II DTSs of bacterial origin. Finally, both the shape and physicochemical properties of the active sites are responsible for determining specific catalytic outcomes of TSs. The structure of PtmT2 fundamentally advances the knowledge of bacterial TSs, their mechanisms, and their role in the evolution of TSs.
Hall, Dawn E; Zerbe, Philipp; Jancsik, Sharon; Quesada, Alfonso Lara; Dullat, Harpreet; Madilao, Lina L; Yuen, Macaire; Bohlmann, Jörg
2013-02-01
Diterpene resin acids (DRAs) are major components of pine (Pinus spp.) oleoresin. They play critical roles in conifer defense against insects and pathogens and as a renewable resource for industrial bioproducts. The core structures of DRAs are formed in secondary (i.e. specialized) metabolism via cycloisomerization of geranylgeranyl diphosphate (GGPP) by diterpene synthases (diTPSs). Previously described gymnosperm diTPSs of DRA biosynthesis are bifunctional enzymes that catalyze the initial bicyclization of GGPP followed by rearrangement of a (+)-copalyl diphosphate intermediate at two discrete class II and class I active sites. In contrast, similar diterpenes of gibberellin primary (i.e. general) metabolism are produced by the consecutive activity of two monofunctional class II and class I diTPSs. Using high-throughput transcriptome sequencing, we discovered 11 diTPS from jack pine (Pinus banksiana) and lodgepole pine (Pinus contorta). Three of these were orthologous to known conifer bifunctional levopimaradiene/abietadiene synthases. Surprisingly, two sets of orthologous PbdiTPSs and PcdiTPSs were monofunctional class I enzymes that lacked functional class II active sites and converted (+)-copalyl diphosphate, but not GGPP, into isopimaradiene and pimaradiene as major products. Diterpene profiles and transcriptome sequences of lodgepole pine and jack pine are consistent with roles for these diTPSs in DRA biosynthesis. The monofunctional class I diTPSs of DRA biosynthesis form a new clade within the gymnosperm-specific TPS-d3 subfamily that evolved from bifunctional diTPS rather than monofunctional enzymes (TPS-c and TPS-e) of gibberellin metabolism. Homology modeling suggested alterations in the class I active site that may have contributed to their functional specialization relative to other conifer diTPSs.
Citric acid production and citrate synthase genes in distinct strains of ...
African Journals Online (AJOL)
SAM
2014-05-28
May 28, 2014 ... synthase in lactic acid production by A. niger and with the ... A number of microorganisms, including both bacteria and fungi, possess the capacity ..... citric acid production by solid-state fermentation from cassava bagasse and ...
Mechanistic studies of 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase
International Nuclear Information System (INIS)
Dotson, G.D.; Woodard, R.W.
1994-01-01
The enzyme 3-deOXY-D-manno-octulosonic acid 8-phosphate synthase (KDO 8-P synthase) catalyses the condensation of arabinose 5-phosphate (A 5-P) with phosphoenolpyruvate (PEP) to give the unique eight-carbon acidic sugar 3-deoxy-D-nianno-octulosonic acid 8-phosphate (KDO 8-P) found only in gram-negative bacteria and required for lipid A maturation and cellular growth. The E. coli gene kdsA that encodes KDO 8-P synthase has been amplified by standard PCR methodologies. The synthetic gene, subcloned into the expression vector pT7-7 was used to infect E. coli BL 21 (DE 3). Purification of crude supernatant from this transformant on Q Sepharose yields >200 mg of near-homogeneous KDO 8-P synthase per liter of cell culture. To explore the mechanism of KDO 8-P synthase, we prepared (E)- and (Z)-(3 2 H)PEP, (2- 13 C)PEP, and (2- 13 C, 18 O)PEP chemically from the appropriately labeled 3-bromopyruvates by reaction with trimethylphosphite under Perkow reaction conditions. Our 1 H-NMR analysis of the stereochemistry at C3 of the KDO 8-Ps, obtained by separate incubation of (E)- and (Z)-(3- 2 H)PEP with A 5-P in the presence of KDO 8-P synthase, demonstrated that the reaction is stereospecific with respect to both the C3 of PEP and the C1 carbonyl of A 5-P. (Z)-(3- 2 H)PEP gave predominantly (3S)-(3 2 H)KDO 8-P and (E)-(3- 2 H)PEP gave predominantly (3R)-(3 2 H)KDO-8P, which indicates condensation of the si face of PEP upon the re face of A 5-P-an orientation analogous to that seen with the similar aldehyde Iyase DAH 7-P synthase. The fate of the enolic oxygen of (2- 13 C, 18 O)PEP, during the course of the KDO 8-P synthase-catalyzed reaction as monitored by both 13 C- and 31 P-NMR spectroscopy demonstrated that the inorganic phosphate (Pi) and not the KDO 8-P contained the 18 O
Mechanistic studies of 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase
Energy Technology Data Exchange (ETDEWEB)
Dotson, G.D.; Woodard, R.W. [Univ. of Michigan, Ann Arbor, MI (United States)
1994-12-01
The enzyme 3-deOXY-D-manno-octulosonic acid 8-phosphate synthase (KDO 8-P synthase) catalyses the condensation of arabinose 5-phosphate (A 5-P) with phosphoenolpyruvate (PEP) to give the unique eight-carbon acidic sugar 3-deoxy-D-nianno-octulosonic acid 8-phosphate (KDO 8-P) found only in gram-negative bacteria and required for lipid A maturation and cellular growth. The E. coli gene kdsA that encodes KDO 8-P synthase has been amplified by standard PCR methodologies. The synthetic gene, subcloned into the expression vector pT7-7 was used to infect E. coli BL 21 (DE 3). Purification of crude supernatant from this transformant on Q Sepharose yields >200 mg of near-homogeneous KDO 8-P synthase per liter of cell culture. To explore the mechanism of KDO 8-P synthase, we prepared (E)- and (Z)-(3{sup 2}H)PEP, (2-{sup 13}C)PEP, and (2-{sup 13}C,{sup 18}O)PEP chemically from the appropriately labeled 3-bromopyruvates by reaction with trimethylphosphite under Perkow reaction conditions. Our {sup 1}H-NMR analysis of the stereochemistry at C3 of the KDO 8-Ps, obtained by separate incubation of (E)- and (Z)-(3-{sup 2}H)PEP with A 5-P in the presence of KDO 8-P synthase, demonstrated that the reaction is stereospecific with respect to both the C3 of PEP and the C1 carbonyl of A 5-P. (Z)-(3-{sup 2}H)PEP gave predominantly (3S)-(3{sup 2}H)KDO 8-P and (E)-(3-{sup 2}H)PEP gave predominantly (3R)-(3{sup 2}H)KDO-8P, which indicates condensation of the si face of PEP upon the re face of A 5-P-an orientation analogous to that seen with the similar aldehyde Iyase DAH 7-P synthase. The fate of the enolic oxygen of (2-{sup 13}C, {sup 18}O)PEP, during the course of the KDO 8-P synthase-catalyzed reaction as monitored by both {sup 13}C- and {sup 31}P-NMR spectroscopy demonstrated that the inorganic phosphate (Pi) and not the KDO 8-P contained the {sup 18}O.
Erratum Aldosterone synthase C-344T, angiotensin II type 1 receptor ...
Indian Academy of Sciences (India)
Aldosterone synthase C-344T, angiotensin II type 1 receptor A1166C and 11-β hydroxysteroid dehydrogenase G534A gene polymorphisms and essential hypertension in the population of Odisha, India. Manisha Patnaik, Pallabi Pati, Surendra N. Swain, Manoj K. Mohapatra, Bhagirathi Dwibedi, Shantanu K. Kar.
Crystallization of Δ{sup 1}-tetrahydrocannabinolic acid (THCA) synthase from Cannabis sativa
Energy Technology Data Exchange (ETDEWEB)
Shoyama, Yoshinari; Takeuchi, Ayako; Taura, Futoshi [Faculty of Pharmaceutical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan); Tamada, Taro; Adachi, Motoyasu; Kuroki, Ryota [Neutron Science Research Center, Japan Atomic Energy Research Institute, 2-4 Shirakata-Shirane, Tokai, Ibaraki 319-1195 (Japan); Shoyama, Yukihiro; Morimoto, Satoshi [Faculty of Pharmaceutical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan)
2005-08-01
Δ{sup 1}-Tetrahydrocannabinolic acid (THCA) synthase from C. sativa was crystallized. The crystal diffracted to 2.7 Å resolution with sufficient quality for further structure determination. Δ{sup 1}-Tetrahydrocannabinolic acid (THCA) synthase is a novel oxidoreductase that catalyzes the biosynthesis of the psychoactive compound THCA in Cannabis sativa (Mexican strain). In order to investigate the structure–function relationship of THCA synthase, this enzyme was overproduced in insect cells, purified and finally crystallized in 0.1 M HEPES buffer pH 7.5 containing 1.4 M sodium citrate. A single crystal suitable for X-ray diffraction measurement was obtained in 0.09 M HEPES buffer pH 7.5 containing 1.26 M sodium citrate. The crystal diffracted to 2.7 Å resolution at beamline BL41XU, SPring-8. The crystal belonged to the primitive cubic space group P432, with unit-cell parameters a = b = c = 178.2 Å. The calculated Matthews coefficient was approximately 4.1 or 2.0 Å{sup 3} Da{sup −1} assuming the presence of one or two molecules of THCA synthase in the asymmetric unit, respectively.
Hall, Dawn E.; Zerbe, Philipp; Jancsik, Sharon; Quesada, Alfonso Lara; Dullat, Harpreet; Madilao, Lina L.; Yuen, Macaire; Bohlmann, Jörg
2013-01-01
Diterpene resin acids (DRAs) are major components of pine (Pinus spp.) oleoresin. They play critical roles in conifer defense against insects and pathogens and as a renewable resource for industrial bioproducts. The core structures of DRAs are formed in secondary (i.e. specialized) metabolism via cycloisomerization of geranylgeranyl diphosphate (GGPP) by diterpene synthases (diTPSs). Previously described gymnosperm diTPSs of DRA biosynthesis are bifunctional enzymes that catalyze the initial bicyclization of GGPP followed by rearrangement of a (+)-copalyl diphosphate intermediate at two discrete class II and class I active sites. In contrast, similar diterpenes of gibberellin primary (i.e. general) metabolism are produced by the consecutive activity of two monofunctional class II and class I diTPSs. Using high-throughput transcriptome sequencing, we discovered 11 diTPS from jack pine (Pinus banksiana) and lodgepole pine (Pinus contorta). Three of these were orthologous to known conifer bifunctional levopimaradiene/abietadiene synthases. Surprisingly, two sets of orthologous PbdiTPSs and PcdiTPSs were monofunctional class I enzymes that lacked functional class II active sites and converted (+)-copalyl diphosphate, but not GGPP, into isopimaradiene and pimaradiene as major products. Diterpene profiles and transcriptome sequences of lodgepole pine and jack pine are consistent with roles for these diTPSs in DRA biosynthesis. The monofunctional class I diTPSs of DRA biosynthesis form a new clade within the gymnosperm-specific TPS-d3 subfamily that evolved from bifunctional diTPS rather than monofunctional enzymes (TPS-c and TPS-e) of gibberellin metabolism. Homology modeling suggested alterations in the class I active site that may have contributed to their functional specialization relative to other conifer diTPSs. PMID:23370714
Thupari, J N; Pinn, M L; Kuhajda, F P
2001-07-13
Inhibition of fatty acid synthase (FAS) induces apoptosis in human breast cancer cells in vitro and in vivo without toxicity to proliferating normal cells. We have previously shown that FAS inhibition causes a rapid increase in malonyl-CoA levels identifying malonyl-CoA as a potential trigger of apoptosis. In this study we further investigated the role of malonyl-CoA during FAS inhibition. We have found that: [i] inhibition of FAS with cerulenin causes carnitine palmitoyltransferase-1 (CPT-1) inhibition and fatty acid oxidation inhibition in MCF-7 human breast cancer cells likely mediated by elevation of malonyl-CoA; [ii] cerulenin cytotoxicity is due to the nonphysiological state of increased malonyl-CoA, decreased fatty acid oxidation, and decreased fatty acid synthesis; and [iii] the cytotoxic effect of cerulenin can be mimicked by simultaneous inhibition of CPT-1, with etomoxir, and fatty acid synthesis with TOFA, an acetyl-CoA carboxylase (ACC) inhibitor. This study identifies CPT-1 and ACC as two new potential targets for cancer chemotherapy. Copyright 2001 Academic Press.
Energy Technology Data Exchange (ETDEWEB)
Rudolf, Jeffrey D.; Dong, Liao-Bin; Cao, Hongnan; Hatzos-Skintges, Catherine; Osipiuk, Jerzy; Endres, Michael; Chang, Chin-Yuan; Ma, Ming; Babnigg, Gyorgy; Joachimiak, Andrzej; Phillips, George N.; Shen, Ben
2016-08-31
Terpenoids are the largest and most structurally diverse family of natural products found in nature, yet their presence in bacteria is underappreciated. The carbon skeletons of terpenoids are generated through carbocation-dependent cyclization cascades catalyzed by terpene synthases (TSs). Type I and type II TSs initiate cyclization via diphosphate ionization and protonation, respectively, and protein structures of both types are known. Most plant diterpene synthases (DTSs) possess three alpha-helical domains (alpha beta gamma), which are thought to have arisen from the fusion of discrete, ancestral bacterial type I TSs (alpha) and type II TSs (beta gamma). Type II DTSs of bacterial origin, of which there are no structurally characterized members, are a missing piece in the structural evolution of TSs. Here, we report the first crystal structure of a type II DTS from bacteria. PtnaT2 from Streptomyces platensis CB00739 was verified as an ent-copalyl diphosphate synthase involved in the biosynthesis of platensimycin and platencin. The crystal structure of PtmT2 was solved at a resolution of 1.80 angstrom, and docking studies suggest the catalytically active conformation of geranylgeranyl diphosphate (GGPP). Site-directed mutagenesis confirmed residues involved in binding the diphosphate moiety of GGPP and identified DxxxxE as a potential Mg2+-binding motif for type II DTSs of bacterial origin. Finally, both the shape and physicochemical properties of the active sites are responsible for determining specific catalytic outcomes of TSs. The structure of PtmT2 fundamentally advances the knowledge of bacterial TSs, their mechanisms, and their role in the evolution of TSs.
Expanding the product portfolio of fungal type I fatty acid synthases
DEFF Research Database (Denmark)
Zhu, Zhiwei; Zhou, Yongjin J.; Krivoruchko, Anastasia
2017-01-01
Fungal type I fatty acid synthases (FASs) are mega-enzymes with two separated, identical compartments, in which the acyl carrier protein (ACP) domains shuttle substrates to catalytically active sites embedded in the chamber wall. We devised synthetic FASs by integrating heterologous enzymes into ...
Fatty acid synthase inhibitors isolated from Punica granatum L
International Nuclear Information System (INIS)
Jiang, He-Zhong; Ma, Qing-Yun; Liang, Wen-Juan; Huang, Sheng-Zhuo; Dai, Hao-Fu; Wang, Peng-Cheng; Zhao, You-Xing; Fan, Hui-Jin; Ma, Xiao-Feng
2012-01-01
The aim of this work is the isolation of fatty acid synthase (FAS) inhibitors from the ethyl acetate extracts of fruit peels of Punica granatum L. Bioassay-guided chemical investigation of the fruit peels resulted in the isolation of seventeen compounds mainly including triterpenoids and phenolic compounds, from which one new oleanane-type triterpene (punicaone) along with fourteen known compounds were isolated for the first time from this plant. Seven isolates were evaluated for inhibitory activities of FAS and two compounds showed to be active. Particularly, flavogallonic acid exhibited strong FAS inhibitory activity with IC 50 value of 10.3 μmol L -1 . (author)
Fatty acid synthase inhibitors isolated from Punica granatum L
Energy Technology Data Exchange (ETDEWEB)
Jiang, He-Zhong [School of Life Science and Engineering, Southwest Jiaotong University, Chengdu, (China); Ma, Qing-Yun; Liang, Wen-Juan; Huang, Sheng-Zhuo; Dai, Hao-Fu; Wang, Peng-Cheng; Zhao, You-Xing, E-mail: zhaoyx1011@163.com [Institute of Tropical Bioscience and Biotechnology, Chinese Academy of Tropical Agricultural Sciences, Haikou (China); Fan, Hui-Jin; Ma, Xiao-Feng, E-mail: maxiaofeng@gucas.ac.cn [College of Life Sciences, Graduate University of Chinese Academy of Sciences, Beijing (China)
2012-05-15
The aim of this work is the isolation of fatty acid synthase (FAS) inhibitors from the ethyl acetate extracts of fruit peels of Punica granatum L. Bioassay-guided chemical investigation of the fruit peels resulted in the isolation of seventeen compounds mainly including triterpenoids and phenolic compounds, from which one new oleanane-type triterpene (punicaone) along with fourteen known compounds were isolated for the first time from this plant. Seven isolates were evaluated for inhibitory activities of FAS and two compounds showed to be active. Particularly, flavogallonic acid exhibited strong FAS inhibitory activity with IC{sub 50} value of 10.3 {mu}mol L{sup -1}. (author)
Angiotensin II stimulates superoxide production by nitric oxide synthase in thick ascending limbs.
Gonzalez-Vicente, Agustin; Saikumar, Jagannath H; Massey, Katherine J; Hong, Nancy J; Dominici, Fernando P; Carretero, Oscar A; Garvin, Jeffrey L
2016-02-01
Angiotensin II (Ang II) causes nitric oxide synthase (NOS) to become a source of superoxide (O2 (-)) via a protein kinase C (PKC)-dependent process in endothelial cells. Ang II stimulates both NO and O2 (-) production in thick ascending limbs. We hypothesized that Ang II causes O2 (-) production by NOS in thick ascending limbs via a PKC-dependent mechanism. NO production was measured in isolated rat thick ascending limbs using DAF-FM, whereas O2 (-) was measured in thick ascending limb suspensions using the lucigenin assay. Consistent stimulation of NO was observed with 1 nmol/L Ang II (P thick ascending limbs via a PKC- and NADPH oxidase-dependent process; and (2) the effect of Ang II is not due to limited substrate. © 2016 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.
DEFF Research Database (Denmark)
Hove-Jensen, Bjarne; McGuire, James N
2004-01-01
The amino acid sequence of 5-phospho-alpha-D-ribosyl 1-diphosphate synthase from the thermophile Bacillus caldolyticus is 81% identical to the amino acid sequence of 5-phospho-alpha-D-ribosyl 1-diphosphate synthase from the mesophile Bacillus subtilis. Nevertheless the enzyme from the two organisms...... possesses very different thermal properties. The B. caldolyticus enzyme has optimal activity at 60-65 degrees C and a half-life of 26 min at 65 degrees C, compared to values of 46 degrees C and 60 s at 65 degrees C, respectively, for the B. subtilis enzyme. Chemical cross-linking shows that both enzymes...... are hexamers. Vmax is determined as 440 micromol.min(-1).mg protein(-1) and Km values for ATP and ribose 5-phosphate are determined as 310 and 530 microM, respectively, for the B. caldolyticus enzyme. The enzyme requires 50 mM Pi as well as free Mg2+ for maximal activity. Manganese ion substitutes for Mg2...
Rigouin, Coraline; Gueroult, Marc; Croux, Christian; Dubois, Gwendoline; Borsenberger, Vinciane; Barbe, Sophie; Marty, Alain; Daboussi, Fayza; André, Isabelle; Bordes, Florence
2017-10-20
Yarrowia lipolytica is a promising organism for the production of lipids of biotechnological interest and particularly for biofuel. In this study, we engineered the key enzyme involved in lipid biosynthesis, the giant multifunctional fatty acid synthase (FAS), to shorten chain length of the synthesized fatty acids. Taking as starting point that the ketoacyl synthase (KS) domain of Yarrowia lipolytica FAS is directly involved in chain length specificity, we used molecular modeling to investigate molecular recognition of palmitic acid (C16 fatty acid) by the KS. This enabled to point out the key role of an isoleucine residue, I1220, from the fatty acid binding site, which could be targeted by mutagenesis. To address this challenge, TALEN (transcription activator-like effector nucleases)-based genome editing technology was applied for the first time to Yarrowia lipolytica and proved to be very efficient for inducing targeted genome modifications. Among the generated FAS mutants, those having a bulky aromatic amino acid residue in place of the native isoleucine at position 1220 led to a significant increase of myristic acid (C14) production compared to parental wild-type KS. Particularly, the best performing mutant, I1220W, accumulates C14 at a level of 11.6% total fatty acids. Overall, this work illustrates how a combination of molecular modeling and genome-editing technology can offer novel opportunities to rationally engineer complex systems for synthetic biology.
González-Thuillier, Irene; Venegas-Calerón, Mónica; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique
2015-01-01
Enoyl-[acyl carrier protein]-reductases from sunflower. A major factor contributing to the amount of fatty acids in plant oils are the first steps of their synthesis. The intraplastidic fatty acid biosynthetic pathway in plants is catalysed by type II fatty acid synthase (FAS). The last step in each elongation cycle is carried out by the enoyl-[ACP]-reductase, which reduces the dehydrated product of β-hydroxyacyl-[ACP] dehydrase using NADPH or NADH. To determine the mechanisms involved in the biosynthesis of fatty acids in sunflower (Helianthus annuus) seeds, two enoyl-[ACP]-reductase genes have been identified and cloned from developing seeds with 75 % identity: HaENR1 (GenBank HM021137) and HaENR2 (HM021138). The two genes belong to the ENRA and ENRB families in dicotyledons, respectively. The genetic duplication most likely originated after the separation of di- and monocotyledons. RT-qPCR revealed distinct tissue-specific expression patterns. Highest expression of HaENR1 was in roots, stems and developing cotyledons whereas that of H a ENR2 was in leaves and early stages of seed development. Genomic DNA gel blot analyses suggest that both are single-copy genes. In vivo activity of the ENR enzymes was tested by complementation experiments with the JP1111 fabI(ts) E. coli strain. Both enzymes were functional demonstrating that they interacted with the bacterial FAS components. That different fatty acid profiles resulted infers that the two Helianthus proteins have different structures, substrate specificities and/or reaction rates. The latter possibility was confirmed by in vitro analysis with affinity-purified heterologous-expressed enzymes that reduced the crotonyl-CoA substrate using NADH with different V max.
2011-07-01
controls, Menendez et al demonstrated that addition of omega-3 fatty acids (-3 FA), docosahexanoic acid ( DHA ), alpha- linolenic acid , and -6 FA, γ...AD_________________ Award Number: W81XWH-04-1-0296 TITLE: Fish Oil Supplementation and Fatty Acid ...COVERED 1 March 2010 – 30 June 2011 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER Fish Oil Supplementation and Fatty Acid Synthase Expression in the
Deletion of a Chitin Synthase Gene in a Citric Acid Producing Strain of Aspergillus niger
Energy Technology Data Exchange (ETDEWEB)
Rinker, Torri E.; Baker, Scott E.
2007-01-29
Citric acid production by the filamentous fungus Aspergillus niger is carried out in a process that causes the organism to drastically alter its morphology. This altered morphology includes hyphal swelling and highly limited polar growth resulting in clumps of swollen cells that eventually aggregate into pellets of approximately 100 microns in diameter. In this pelleted form, A. niger has increased citric acid production as compared to growth in filamentous form. Chitin is a crucial component of the cell wall of filamentous fungi. Alterations in the deposition or production of chitin may have profound effects on the morphology of the organism. In order to study the role of chitin synthesis in pellet formation we have deleted a chitin synthase gene (csmA) in Aspergillus niger strain ATCC 11414 using a PCR based deletion construct. This class of chitin synthases is only found in filamentous fungi and is not present in yeasts. The csmA genes contain a myosin motor domain at the N-terminus and a chitin synthesis domain at the C-terminus. They are believed to contribute to the specialized polar growth observed in filamentous fungi that is lacking in yeasts. The csmA deletion strain (csmAΔ) was subjected to minimal media with and without osmotic stabilizers as well as tested in citric acid production media. Without osmotic stabilizers, the mutant germlings were abnormally swollen, primarily in the subapical regions, and contained large vacuoles. However, this swelling is ultimately not inhibitory to growth as the germlings are able to recover and undergo polar growth. Colony formation was largely unaffected in the absence of osmotic stabilizers. In citric acid production media csmAΔ was observed to have a 2.5 fold increase in citric acid production. The controlled expression of this class of chitin synthases may be useful for improving production of organic acids in filamentous fungi.
Strategies in megasynthase engineering – fatty acid synthases (FAS as model proteins
Directory of Open Access Journals (Sweden)
Manuel Fischer
2017-06-01
Full Text Available Megasynthases are large multienzyme proteins that produce a plethora of important natural compounds by catalyzing the successive condensation and modification of precursor units. Within the class of megasynthases, polyketide synthases (PKS are responsible for the production of a large spectrum of bioactive polyketides (PK, which have frequently found their way into therapeutic applications. Rational engineering approaches have been performed during the last 25 years that seek to employ the “assembly-line synthetic concept” of megasynthases in order to deliver new bioactive compounds. Here, we highlight PKS engineering strategies in the light of the newly emerging structural information on megasynthases, and argue that fatty acid synthases (FAS are and will be valuable objects for further developing this field.
Jin, Li; Piao, Zhe Hao; Liu, Chun Ping; Sun, Simei; Liu, Bin; Kim, Gwi Ran; Choi, Sin Young; Ryu, Yuhee; Kee, Hae Jin; Jeong, Myung Ho
2018-03-01
Hypertension causes cardiac hypertrophy and leads to heart failure. Apoptotic cells are common in hypertensive hearts. Ca 2+ /calmodulin-dependent protein kinase II (CaMKII) is associated with apoptosis. We recently demonstrated that gallic acid reduces nitric oxide synthase inhibition-induced hypertension. Gallic acid is a trihydroxybenzoic acid and has been shown to have beneficial effects, such as anti-cancer, anti-calcification and anti-oxidant activity. The purpose of this study was to determine whether gallic acid regulates cardiac hypertrophy and apoptosis in essential hypertension. Gallic acid significantly lowered systolic and diastolic blood pressure in spontaneously hypertensive rats (SHRs). Wheat germ agglutinin (WGA) and H&E staining revealed that gallic acid reduced cardiac enlargement in SHRs. Gallic acid treatment decreased cardiac hypertrophy marker genes, including atrial natriuretic peptide (ANP) and brain natriuretic peptide (BNP), in SHRs. The four isoforms, α, β, δ and γ, of CaMKII were increased in SHRs and were significantly reduced by gallic acid administration. Gallic acid reduced cleaved caspase-3 protein as well as bax, p53 and p300 mRNA levels in SHRs. CaMKII δ overexpression induced bax and p53 expression, which was attenuated by gallic acid treatment in H9c2 cells. Gallic acid treatment reduced DNA fragmentation and the TUNEL positive cells induced by angiotensin II. Taken together, gallic acid could be a novel therapeutic for the treatment of hypertension through suppression of CaMKII δ-induced apoptosis. © 2017 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.
Threonine phosphorylation of rat liver glycogen synthase
International Nuclear Information System (INIS)
Arino, J.; Arro, M.; Guinovart, J.J.
1985-01-01
32 P-labeled glycogen synthase specifically immunoprecipitated from 32 P-phosphate incubated rat hepatocytes contains, in addition to [ 32 P] phosphoserine, significant levels of [ 32 P] phosphothreonine. When the 32 P-immunoprecipitate was cleaved with CNBr, the [ 32 P] phosphothreonine was recovered in the large CNBr fragment (CB-2, Mapp 28 Kd). Homogeneous rat liver glycogen synthase was phosphorylated by all the protein kinases able to phosphorylate CB-2 in vitro. After analysis of the immunoprecipitated enzyme for phosphoaminoacids, it was observed that only casein kinase II was able to phosphorylate on threonine and 32 P-phosphate was only found in CB-2. These results demonstrate that rat liver glycogen synthase is phosphorylated at threonine site(s) contained in CB-2 and strongly indicate that casein kinase II may play a role in the ''in vivo'' phosphorylation of liver glycogen synthase. This is the first protein kinase reported to phosphorylate threonine residues in liver glycogen synthase
Class II recombinant phosphoribosyl diphosphate synthase from spinach
DEFF Research Database (Denmark)
Krath, B N; Hove-Jensen, B
2001-01-01
to other PRPP synthases the activity of spinach PRPP synthase isozyme 3 is independent of P(i), and the enzyme is inhibited by ribonucleoside diphosphates in a purely competitive manner, which indicates a lack of allosteric inhibition by these compounds. In addition spinach PRPP synthase isozyme 3 shows...... an unusual low specificity toward diphosphoryl donors by accepting dATP, GTP, CTP, and UTP in addition to ATP. The kinetic mechanism of the enzyme is an ordered steady state Bi Bi mechanism with K(ATP) and K(Rib-5-P) values of 170 and 110 micrometer, respectively, and a V(max) value of 13.1 micromol (min x...... mg of protein)(-1). The enzyme has an absolute requirement for magnesium ions, and maximal activity is obtained at 40 degrees C at pH 7.6....
Taguchi, Yoshimitsu; Kondo, Tadakazu; Watanabe, Mitsumasa; Miyaji, Michihiko; Umehara, Hisanori; Kozutsumi, Yasunori; Okazaki, Toshiro
2004-11-15
Interleukin 2 (IL-2) rescued human natural killer (NK) KHYG-1 cells from apoptosis along with a reduction of ceramide. Conversely, an increase of ceramide inhibited IL-2-rescued survival. IL-2 deprivation-induced activation of acid sphingomyelinase (SMase) and inhibition of glucosylceramide synthase (GCS) and sphingomyelin synthase (SMS) were normalized by IL-2 supplementation. A phosphatidyl inositol-3 (PI-3) kinase inhibitor, LY294002, inhibited IL-2-rescued survival, but a mitogen-activated protein kinase inhibitor, PD98059, and an inhibitor of Janus tyrosine kinase/signal transducer and activator of transcription pathway, AG490, did not. LY294002 inhibited IL-2-induced reduction of ceramide through activation of acid SMase and inhibition of GCS and SMS, suggesting the positive involvement of PI-3 kinase in ceramide reduction through enzymatic regulation. Indeed, a constitutively active PI-3 kinase enhanced growth rate and ceramide reduction through inhibition of acid SMase and activation of GCS and SMS. Further, LY294002 inhibited IL-2-induced changes of transcriptional level as well as mRNA and protein levels in acid SMase and GCS but did not affect the stability of the mRNAs. These results suggest that PI-3 kinase-dependent reduction of ceramide through regulation of acid SMase, GCS, and SMS plays a role in IL-2-rescued survival of NK cells.
Henritzi, Sandra; Fischer, Manuel; Grininger, Martin; Oreb, Mislav; Boles, Eckhard
2018-01-01
The ideal biofuel should not only be a regenerative fuel from renewable feedstocks, but should also be compatible with the existing fuel distribution infrastructure and with normal car engines. As the so-called drop-in biofuel, the fatty alcohol 1-octanol has been described as a valuable substitute for diesel and jet fuels and has already been produced fermentatively from sugars in small amounts with engineered bacteria via reduction of thioesterase-mediated premature release of octanoic acid from fatty acid synthase or via a reversal of the β-oxidation pathway. The previously engineered short-chain acyl-CoA producing yeast Fas1 R1834K /Fas2 fatty acid synthase variant was expressed together with carboxylic acid reductase from Mycobacterium marinum and phosphopantetheinyl transferase Sfp from Bacillus subtilis in a Saccharomyces cerevisiae Δfas1 Δfas2 Δfaa2 mutant strain. With the involvement of endogenous thioesterases, alcohol dehydrogenases, and aldehyde reductases, the synthesized octanoyl-CoA was converted to 1-octanol up to a titer of 26.0 mg L -1 in a 72-h fermentation. The additional accumulation of 90 mg L -1 octanoic acid in the medium indicated a bottleneck in 1-octanol production. When octanoic acid was supplied externally to the yeast cells, it could be efficiently converted to 1-octanol indicating that re-uptake of octanoic acid across the plasma membrane is not limiting. Additional overexpression of aldehyde reductase Ahr from Escherichia coli nearly completely prevented accumulation of octanoic acid and increased 1-octanol titers up to 49.5 mg L -1 . However, in growth tests concentrations even lower than 50.0 mg L -1 turned out to be inhibitory to yeast growth. In situ extraction in a two-phase fermentation with dodecane as second phase did not improve growth, indicating that 1-octanol acts inhibitive before secretion. Furthermore, 1-octanol production was even reduced, which results from extraction of the intermediate octanoic acid to
Fatty Acid Synthase Activity as a Target for c-Met Driven Prostate Cancer
2013-07-01
cancer potentially due to increased fecal fat excretion. In addition, several families of plant-derived flavonoid compounds including...Apoptosis by Flavonoids Is Associated with Their Ability to Inhibit Fatty Acid Synthase Activity. J. Biol. Chem., 2005. 280(7): p. 5636-5645. 156... flavonoids , represent a source of relatively nontoxic, orally available and affordable compounds that are known to affect a number of different
Rehman, Ajijur; Akhtar, Salman; Siddiqui, Mohd Haris; Sayeed, Usman; Ahmad, Syed Sayeed; Arif, Jamal M.; Khan, M. Kalim A.
2016-01-01
4-hydroxy-tetrahydrodipicolinate synthase (DHDPS) is an important enzyme needed for the biosynthesis of lysine and many more key metabolites in Mycobacterium tuberculosis (Mtb). Inhibition of DHDPS is supposed to a promising therapeutic target due to its specific role in sporulation, cross-linking of the peptidiglycan polymers and biosynthesis of amino acids. In this work, a known inhibitor-based similarity search was carried out against a natural products database (Super Natural II) towards ...
7.5-Å cryo-em structure of the mycobacterial fatty acid synthase.
Boehringer, Daniel; Ban, Nenad; Leibundgut, Marc
2013-03-11
The mycobacterial fatty acid synthase (FAS) complex is a giant 2.0-MDa α(6) homohexameric multifunctional enzyme that catalyzes synthesis of fatty acid precursors of mycolic acids, which are major components of the cell wall in Mycobacteria and play an important role in pathogenicity. Here, we present a three-dimensional reconstruction of the Mycobacterium smegmatis FAS complex at 7.5Å, highly homologous to the Mycobacterium tuberculosis multienzyme, by cryo-electron microscopy. Based on the obtained structural data, which allowed us to identify secondary-structure elements, and sequence homology with the fungal FAS, we generated an accurate architectural model of the complex. The FAS system from Mycobacteria resembles a minimized version of the fungal FAS with much larger openings in the reaction chambers. These architectural features of the mycobacterial FAS may be important for the interaction with mycolic acid processing and condensing enzymes that further modify the precursors produced by FAS and for autoactivation of the FAS complex. Copyright © 2012 Elsevier Ltd. All rights reserved.
Mutational, Phylogeny and Evolution Analyses of Salvia Copalyl Diphosphate Synthase
International Nuclear Information System (INIS)
Hao, D. C.; Thimmappa, R. B.; Xiao, P. G.
2016-01-01
The cyclization of geranylgeranyl diphosphate (GGPP) is catalyzed by copalyl diphosphate synthase (CPS), a class II diterpene synthase (diTPS), to form copalyl diphosphate (CPP), which is an essential substrate of a variety of diterpenes in secondary metabolism of angiosperm including Salvia medicinal plants. The protein environment of the N-terminal class II active site stabilizes the carbocation intermediates and maintains the catalytic activity of angiosperm class II diTPS. The virtual modeling and mutagenesis of the class II diTPS of Salvia miltiorrhiza (SmCPS) were accomplished to illuminate the catalytic activity of SmCPS. Terminal truncations and point mutations established the role of the Beta-Gamma domain and Alpha domain, i.e., they facilitate the flexible conformational change of the class II active site after substrate binding. E203 and K238 in the N-ter Gamma domain of SmCPS1 are functional in the substrate binding and conformational transition and might be essential in catalysis. Similar to other CPSs, the ensuing protonation of the GGPP substrate and coordination of the diphosphate group are governed by highly conserved residues in the DxDD motif of SmCPS, e.g., D372 of CPS1. Moreover, F256 and Y505 stabilize the carbocation and control the enzymatic activity during CPP formation. The amino acids of the predicted active sites, despite under purifying selection, vary greatly, corresponding to the functional flexibility of angiosperm CPSs. Molecular phylogeny and evolution analyses suggest early and ongoing evolution of labdane-related diterpenoid metabolism in angiosperm. (author)
Czech Academy of Sciences Publication Activity Database
Kyselková, Martina; Janata, Jiří; Ságová-Marečková, M.; Kopecký, J.
2010-01-01
Roč. 192, č. 3 (2010), s. 195-200 ISSN 0302-8933 R&D Projects: GA MŠk 2B08064 Institutional research plan: CEZ:AV0Z50200510 Keywords : Streptomyces cinnamonensis * Acetohydroxy acid synthase * Subunit-subunit interaction Subject RIV: EE - Microbiology, Virology Impact factor: 1.754, year: 2010
González-Thuillier, Irene; Venegas-Calerón, Mónica; Sánchez, Rosario; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique
2016-02-01
Two sunflower hydroxyacyl-[acyl carrier protein] dehydratases evolved into two different isoenzymes showing distinctive expression levels and kinetics' efficiencies. β-Hydroxyacyl-[acyl carrier protein (ACP)]-dehydratase (HAD) is a component of the type II fatty acid synthase complex involved in 'de novo' fatty acid biosynthesis in plants. This complex, formed by four intraplastidial proteins, is responsible for the sequential condensation of two-carbon units, leading to 16- and 18-C acyl-ACP. HAD dehydrates 3-hydroxyacyl-ACP generating trans-2-enoyl-ACP. With the aim of a further understanding of fatty acid biosynthesis in sunflower (Helianthus annuus) seeds, two β-hydroxyacyl-[ACP] dehydratase genes have been cloned from developing seeds, HaHAD1 (GenBank HM044767) and HaHAD2 (GenBank GU595454). Genomic DNA gel blot analyses suggest that both are single copy genes. Differences in their expression patterns across plant tissues were detected. Higher levels of HaHAD2 in the initial stages of seed development inferred its key role in seed storage fatty acid synthesis. That HaHAD1 expression levels remained constant across most tissues suggest a housekeeping function. Heterologous expression of these genes in E. coli confirmed both proteins were functional and able to interact with the bacterial complex 'in vivo'. The large increase of saturated fatty acids in cells expressing HaHAD1 and HaHAD2 supports the idea that these HAD genes are closely related to the E. coli FabZ gene. The proposed three-dimensional models of HaHAD1 and HaHAD2 revealed differences at the entrance to the catalytic tunnel attributable to Phe166/Val1159, respectively. HaHAD1 F166V was generated to study the function of this residue. The 'in vitro' enzymatic characterization of the three HAD proteins demonstrated all were active, with the mutant having intermediate K m and V max values to the wild-type proteins.
International Nuclear Information System (INIS)
Bacha, N.; Dao, H.P.; Mathieu, F.; Liboz, T.; Lebrihi, A.; Atoui, A.; O'Callaghan, J.; Dobson, A.D.W.; Puel, O.
2008-01-01
Aspergillus westerdijkiae is the main producer of several biologically active polyketide metabolites including isoasperlactone and asperlactone. A 5298 bp polyketide synthase gene ''aomsas'' has been cloned in Aspergillus westerdijkiae by using gene walking approach and RACE-PCR. The predicted amino acid sequence of aomsas shows an identity of 40-56% with different methylsalicylic acid synthase genes found in Byssochlamys nivea, P. patulum, A. terreus and Streptomyces viridochromogenes. Based on the reverse transcription PCR and kinetic secondary metabolites production studies, aomsas expression was found to be associated with the biosynthesis of isoasperlactone and asperlactone. Moreover an aomsas knockout mutant ''aomsas'' of A. westerdijkiae, not only lost the capacity to produce isoasperlactone and asperlactone, but also 6-methylsalicylic acid. The genetically complemented mutant aomsas restored the biosynthesis of all the missing metabolites. Chemical complementation through the addition of 6-methylsalicylic acid, aspyrone and diepoxide to growing culture of aomsas mutant revealed that these compounds play intermediate roles in the biosynthesis of asperlactone and isoasperlactone. (author)
Monoterpene synthases from common sage (Salvia officinalis)
Energy Technology Data Exchange (ETDEWEB)
Croteau, Rodney Bruce (Pullman, WA); Wise, Mitchell Lynn (Pullman, WA); Katahira, Eva Joy (Pullman, WA); Savage, Thomas Jonathan (Christchurch 5, NZ)
1999-01-01
cDNAs encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase from common sage (Salvia officinalis) have been isolated and sequenced, and the corresponding amino acid sequences has been determined. Accordingly, isolated DNA sequences (SEQ ID No:1; SEQ ID No:3 and SEQ ID No:5) are provided which code for the expression of (+)-bornyl diphosphate synthase (SEQ ID No:2), 1,8-cineole synthase (SEQ ID No:4) and (+)-sabinene synthase SEQ ID No:6), respectively, from sage (Salvia officinalis). In other aspects, replicable recombinant cloning vehicles are provided which code for (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase, or for a base sequence sufficiently complementary to at least a portion of (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant monoterpene synthases that may be used to facilitate their production, isolation and purification in significant amounts. Recombinant (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase may be used to obtain expression or enhanced expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase in plants in order to enhance the production of monoterpenoids, or may be otherwise employed for the regulation or expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase, or the production of their products.
Inhibition of fatty acid synthase prevents preadipocyte differentiation
International Nuclear Information System (INIS)
Schmid, Bernhard; Rippmann, Joerg F.; Tadayyon, Moh; Hamilton, Bradford S.
2005-01-01
Inhibition of fatty acid synthase (FAS) reduces food intake in rodents. As adipose tissue expresses FAS, we sought to investigate the effect of reduced FAS activity on adipocyte differentiation. FAS activity was suppressed either pharmacologically or by siRNA during differentiation of 3T3-L1 cells. Cerulenin (10 μM), triclosan (50 μM), and C75 (50 μM) reduced dramatically visible lipid droplet accumulation, while incorporation of [1- 14 C]acetate into lipids was reduced by 75%, 70%, and 90%, respectively. Additionally, the substances reduced FAS, CEBPα, and PPARγ mRNA by up to 85% compared to that of control differentiated cells. Transient transfection with FAS siRNA suppressed FAS mRNA and FAS activity, and this was accompanied by reduction of CEBPα and PPARγ mRNA levels, and complete prevention of lipid accumulation. CD36, a late marker of differentiation, was also reduced. Together, these results suggest that FAS generated signals may be essential to support preadipocyte differentiation
Genome-wide identification, functional and evolutionary analysis of terpene synthases in pineapple.
Chen, Xiaoe; Yang, Wei; Zhang, Liqin; Wu, Xianmiao; Cheng, Tian; Li, Guanglin
2017-10-01
Terpene synthases (TPSs) are vital for the biosynthesis of active terpenoids, which have important physiological, ecological and medicinal value. Although terpenoids have been reported in pineapple (Ananas comosus), genome-wide investigations of the TPS genes responsible for pineapple terpenoid synthesis are still lacking. By integrating pineapple genome and proteome data, twenty-one putative terpene synthase genes were found in pineapple and divided into five subfamilies. Tandem duplication is the cause of TPS gene family duplication. Furthermore, functional differentiation between each TPS subfamily may have occurred for several reasons. Sixty-two key amino acid sites were identified as being type-II functionally divergence between TPS-a and TPS-c subfamily. Finally, coevolution analysis indicated that multiple amino acid residues are involved in coevolutionary processes. In addition, the enzyme activity of two TPSs were tested. This genome-wide identification, functional and evolutionary analysis of pineapple TPS genes provide a new insight into understanding the roles of TPS family and lay the basis for further characterizing the function and evolution of TPS gene family. Copyright © 2017 Elsevier Ltd. All rights reserved.
Oslob, Johan D; Johnson, Russell J; Cai, Haiying; Feng, Shirley Q; Hu, Lily; Kosaka, Yuko; Lai, Julie; Sivaraja, Mohanram; Tep, Samnang; Yang, Hanbiao; Zaharia, Cristiana A; Evanchik, Marc J; McDowell, Robert S
2013-01-10
Potent imidazopyridine-based inhibitors of fatty acid synthase (FASN) are described. The compounds are shown to have antiviral (HCV replicon) activities that track with their biochemical activities. The most potent analogue (compound 19) also inhibits rat FASN and inhibits de novo palmitate synthesis in vitro (cell-based) as well as in vivo.
Salicylic acid (SA), an essential regulator of plant defense, is derived from chorismate via either the phenylalanine ammonia lyase (PAL), or the isochorishmate synthase (ICS) catalyzed steps. The ICS pathway is thought to be the primary contributor of defense-related SA, at least in Arabidopsis. We...
E, Guangqi; Drujon, Thierry; Correia, Isabelle; Ploux, Olivier; Guianvarc'h, Dominique
2013-12-01
We have produced and purified an active site mutant of the Escherichia coli cyclopropane fatty acid synthase (CFAS) by replacing the strictly conserved G236 within cyclopropane synthases, by a glutamate residue, which corresponds to E146 of the homologous mycolic acid methyltransferase, Hma, producing hydroxymethyl mycolic acids. The G236E CFAS mutant had less than 1% of the in vitro activity of the wild type enzyme. We expressed the G236E CFAS mutant in an E. coli (DE3) strain in which the chromosomal cfa gene had been deleted. After extraction of phospholipids and conversion into the corresponding fatty acid methyl esters (FAMEs), we observed the formation of cyclopropanated FAMEs suggesting that the mutant retained some of the normal activity in vivo. However, we also observed the formation of new C17 methyl-branched unsaturated FAMEs whose structures were determined using GC/MS and NMR analyses. The double bond was located at different positions 8, 9 or 10, and the methyl group at position 10 or 9. Thus, this new FAMEs are likely arising from a 16:1 acyl chain of a phospholipid that had been transformed by the G236E CFAS mutant in vivo. The reaction catalyzed by this G236E CFAS mutant thus starts by the methylation of the unsaturated acyl chain at position 10 or 9 yielding a carbocation at position 9 or 10 respectively. It follows then two competing steps, a normal cyclopropanation or hydride shift/elimination events giving different combinations of alkenes. This study not only provides further evidence that cyclopropane synthases (CSs) form a carbocationic intermediate but also opens the way to CSs engineering for the synthesis of non-natural fatty acids. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
DEFF Research Database (Denmark)
Krath, B N; Hove-Jensen, B
2001-01-01
Spinach 5-phospho-D-ribosyl alpha-1-diphosphate (PRPP) synthase isozyme 4 was synthesized in Escherichia coli and purified to near homogeneity. The activity of the enzyme is independent of P(i); it is inhibited by ADP in a competitive manner, indicating a lack of an allosteric site; and it accepts...... is consistent with a homotrimer. Secondary structure prediction shows that spinach PRPP synthase isozyme 4 has a general folding similar to that of Bacillus subtilis class I PRPP synthase, for which the three-dimensional structure has been solved, as the position and extent of helices and beta-sheets of the two...... in the spinach enzyme. In contrast, residues of the active site of B. subtilis PRPP synthase show extensive conservation in spinach PRPP synthase isozyme 4....
Directory of Open Access Journals (Sweden)
S. Suresh
2016-01-01
Full Text Available The molecular structure of the three compounds Aceclofenac (I, Salicylic Acid (II, and Piroxicam (III has been determined using Gaussian 03W program with B3LYP method using 6-311++G (d,p basis set calculations. The molecular structures were fully optimized with atomic numbering scheme adopted in the study. To understand the mode of binding and molecular interaction, the docking studies of compounds Aceclofenac (I, Salicylic Acid (II, and Piroxicam (III have been carried out with prostaglandin H2 synthase-1 (1PGE as target using induced fit docking. The molecular docking results show that the interactions and energy for Aceclofenac, Salicylic Acid, and Piroxicam show the best results when docked with prostaglandin H2 synthase-1 (1PGE. The hydrogen bonding interactions of compound I (Aceclofenac are prominent with Arginine moiety, those of compound II (Salicylic Acid are prominent with Tyrosine and Serine moieties, and compound III (Piroxicam shows such interaction with Tyrosine and Arginine moieties. These interactions of prostaglandin H2 synthase-1 (1PGE with substrates are responsible for governing COX-1 inhibitor potency which in turn is a direct measure of the potency of the drug.
Energy Technology Data Exchange (ETDEWEB)
Hopperton, Kathryn E., E-mail: kathryn.hopperton@mail.utoronto.ca [Department of Nutritional Sciences, Faculty of Medicine, University of Toronto, Toronto, ON, Canada M5S 3E2 (Canada); Duncan, Robin E., E-mail: robin.duncan@uwaterloo.ca [Department of Nutritional Sciences, Faculty of Medicine, University of Toronto, Toronto, ON, Canada M5S 3E2 (Canada); Bazinet, Richard P., E-mail: richard.bazinet@utoronto.ca [Department of Nutritional Sciences, Faculty of Medicine, University of Toronto, Toronto, ON, Canada M5S 3E2 (Canada); Archer, Michael C., E-mail: m.archer@utoronto.ca [Department of Nutritional Sciences, Faculty of Medicine, University of Toronto, Toronto, ON, Canada M5S 3E2 (Canada); Department of Medical Biophysics, Faculty of Medicine, University of Toronto, Toronto, ON, Canada M5S 3E2 (Canada)
2014-01-15
Fatty acid synthase is over-expressed in many cancers and its activity is required for cancer cell survival, but the role of endogenously synthesized fatty acids in cancer is unknown. It has been suggested that endogenous fatty acid synthesis is either needed to support the growth of rapidly dividing cells, or to maintain elevated glycolysis (the Warburg effect) that is characteristic of cancer cells. Here, we investigate both hypotheses. First, we compared utilization of fatty acids synthesized endogenously from {sup 14}C-labeled acetate to those supplied exogenously as {sup 14}C-labeled palmitate in the culture medium in human breast cancer (MCF-7 and MDA-MB-231) and untransformed breast epithelial cells (MCF-10A). We found that cancer cells do not produce fatty acids that are different from those derived from exogenous palmitate, that these fatty acids are esterified to the same lipid and phospholipid classes in the same proportions, and that their distribution within neutral lipids is not different from untransformed cells. These results suggest that endogenously synthesized fatty acids do not fulfill a specific function in cancer cells. Furthermore, we observed that cancer cells excrete endogenously synthesized fatty acids, suggesting that they are produced in excess of requirements. We next investigated whether lipogenic activity is involved in the maintenance of high glycolytic activity by culturing both cancer and non-transformed cells under anoxic conditions. Although anoxia increased glycolysis 2–3 fold, we observed no concomitant increase in lipogenesis. Our results indicate that breast cancer cells do not have a specific qualitative or quantitative requirement for endogenously synthesized fatty acids and that increased de novo lipogenesis is not required to sustain elevations in glycolytic activity induced by anoxia in these cells. - Highlights: • Fatty acid synthase (FASN) is over-expressed in cancer but its function is unknown. • We compare
International Nuclear Information System (INIS)
Hopperton, Kathryn E.; Duncan, Robin E.; Bazinet, Richard P.; Archer, Michael C.
2014-01-01
Fatty acid synthase is over-expressed in many cancers and its activity is required for cancer cell survival, but the role of endogenously synthesized fatty acids in cancer is unknown. It has been suggested that endogenous fatty acid synthesis is either needed to support the growth of rapidly dividing cells, or to maintain elevated glycolysis (the Warburg effect) that is characteristic of cancer cells. Here, we investigate both hypotheses. First, we compared utilization of fatty acids synthesized endogenously from 14 C-labeled acetate to those supplied exogenously as 14 C-labeled palmitate in the culture medium in human breast cancer (MCF-7 and MDA-MB-231) and untransformed breast epithelial cells (MCF-10A). We found that cancer cells do not produce fatty acids that are different from those derived from exogenous palmitate, that these fatty acids are esterified to the same lipid and phospholipid classes in the same proportions, and that their distribution within neutral lipids is not different from untransformed cells. These results suggest that endogenously synthesized fatty acids do not fulfill a specific function in cancer cells. Furthermore, we observed that cancer cells excrete endogenously synthesized fatty acids, suggesting that they are produced in excess of requirements. We next investigated whether lipogenic activity is involved in the maintenance of high glycolytic activity by culturing both cancer and non-transformed cells under anoxic conditions. Although anoxia increased glycolysis 2–3 fold, we observed no concomitant increase in lipogenesis. Our results indicate that breast cancer cells do not have a specific qualitative or quantitative requirement for endogenously synthesized fatty acids and that increased de novo lipogenesis is not required to sustain elevations in glycolytic activity induced by anoxia in these cells. - Highlights: • Fatty acid synthase (FASN) is over-expressed in cancer but its function is unknown. • We compare utilization of
International Nuclear Information System (INIS)
Chang, Soo-Ik; Hammes, G.G.
1989-01-01
Homology analyses of the protein sequences of chicken liver and rat mammary gland fatty acid synthases were carried out. The amino acid sequences of the chicken and rat enzymes are 67% identical. If conservative substitutions are allowed, 78% of the amino acids are matched. A region of low homologies exists between the functional domains, in particular around amino acid residues 1059-1264 of the chicken enzyme. Homologies between the active sites of chicken and rat and of chicken and yeast enzymes have been analyzed by an alignment method. A high degree of homology exists between the active sites of the chicken and rat enzymes. However, the chicken and yeast enzymes show a lower degree of homology. The DADPH-binding dinucleotide folds of the β-ketoacyl reductase and the enoyl reductase sites were identified by comparison with a known consensus sequence for the DADP- and FAD-binding dinucleotide folds. The active sites of all of the enzymes are primarily in hydrophobic regions of the protein. This study suggests that the genes for the functional domains of fatty acid synthase were originally separated, and these genes were connected to each other by using different connecting nucleotide sequences in different species. An alternative explanation for the differences in rat and chicken is a common ancestry and mutations in the joining regions during evolution
Directory of Open Access Journals (Sweden)
T. Angeline
2011-01-01
Full Text Available The objective of the study is to find out whether the endothelial nitric oxide synthase (eNOS G894T single-nucleotide polymorphism is associated with type 2 diabetes mellitus in South Indian (Tamil population. A total number of 260 subjects comprising 100 type 2 diabetic mellitus patients and 160 healthy individuals with no documented history of diabetes were included for the study. DNA was isolated, and eNOS G894T genotyping was performed using the polymerase chain reaction followed by restriction enzyme analysis using Ban II. The genotype distribution in patients and controls were compatible with the Hardy-Weinberg expectations (P>0.05. Odds ratio indicates that the occurrence of mutant genotype (GT/TT was 7.2 times (95% CI = 4.09–12.71 more frequent in the cases than in controls. Thus, the present study demonstrates that there is an association of endothelial nitric oxide synthase gene (G894T polymorphism with diabetes mellitus among South Indians.
Producing biofuels using polyketide synthases
Katz, Leonard; Fortman, Jeffrey L; Keasling, Jay D
2013-04-16
The present invention provides for a non-naturally occurring polyketide synthase (PKS) capable of synthesizing a carboxylic acid or a lactone, and a composition such that a carboxylic acid or lactone is included. The carboxylic acid or lactone, or derivative thereof, is useful as a biofuel. The present invention also provides for a recombinant nucleic acid or vector that encodes such a PKS, and host cells which also have such a recombinant nucleic acid or vector. The present invention also provides for a method of producing such carboxylic acids or lactones using such a PKS.
Coordination compounds of cobalt(II), nickel(II), copper(II), and zinc(II) with pantothenic acid
Energy Technology Data Exchange (ETDEWEB)
Shabilalov, A.A.; Yunuskhodzhaev, A.N.; Khodzhaev, O.F.; Azizov, M.A.
1986-11-01
The compounds Ni(PANA - H)/sub 2/ x 4H/sub 2/O (PANA stands for pantothenic acid, and - H indicates a deprotonated ligand), Cu(PANA - H)/sub 2/ x 2H/sub 2/O, Zn(PANA - H)/sub 2/ x H/sub 2/O, Co(PANA - H)Cl x H/sub 2/O, and Ni(PANA - H)Cl x 3H/sub 2/O have been synthesized on the basis of pantothenic acid and Co(II), Ni(II), Cu(II), and Zn(II) salts in aqueous media. The compounds have been identified by elemental and x-ray diffraction analysis. Some physicochemical properties (solubility, melting point, molar conductivity) of the compounds obtained have been studied. The structure of the compounds isolated has been established on the basis of an analysis of their IR, ESR, and electronic spectra, as well as derivatograms.
Stan-Lotter, Helga; Hochstein, Lawrence I.
1989-01-01
A purified ATPase associated with membranes from Halobacterium saccharovorum was compared with the F sub 1 moiety from the Escherichia coli ATP Synthase. The halobacterial enzyme was composed of two major (I and II) and two minor subunits (III and IV), whose molecular masses were 87 kDa, 60 kDa, 29 kDa, and 20 kDa, respectively. The isoelectric points of these subunits ranged from 4.1 to 4.8, which in the case of the subunits I and II was consistent with the presence of an excess of acidic amino acids (20 to 22 Mol percent). Peptide mapping of sodium dodecylsulfate-denatured subunits I and II showed no relationship between the primary structures of the individual halobacterial subunits or similarities to the subunits of the F sub 1 ATPase (EC 3.6.1.34) from E. coli. Trypsin inactivation of the halobacterial ATPase was accompanied by the partial degradation of the major subunits. This observation, taken in conjunction with molecular masses of the subunits and the native enzyme, was consistent with the previously proposed stoichiometry of 2:2:1:1. These results suggest that H. saccharovorum, and possibly, Halobacteria in general, possess an ATPase which is unlike the ubiquitous F sub o F sub 1 - ATP Synthase.
A human fatty acid synthase inhibitor binds β-ketoacyl reductase in the keto-substrate site.
Hardwicke, Mary Ann; Rendina, Alan R; Williams, Shawn P; Moore, Michael L; Wang, Liping; Krueger, Julie A; Plant, Ramona N; Totoritis, Rachel D; Zhang, Guofeng; Briand, Jacques; Burkhart, William A; Brown, Kristin K; Parrish, Cynthia A
2014-09-01
Human fatty acid synthase (hFAS) is a complex, multifunctional enzyme that is solely responsible for the de novo synthesis of long chain fatty acids. hFAS is highly expressed in a number of cancers, with low expression observed in most normal tissues. Although normal tissues tend to obtain fatty acids from the diet, tumor tissues rely on de novo fatty acid synthesis, making hFAS an attractive metabolic target for the treatment of cancer. We describe here the identification of GSK2194069, a potent and specific inhibitor of the β-ketoacyl reductase (KR) activity of hFAS; the characterization of its enzymatic and cellular mechanism of action; and its inhibition of human tumor cell growth. We also present the design of a new protein construct suitable for crystallography, which resulted in what is to our knowledge the first co-crystal structure of the human KR domain and includes a bound inhibitor.
Heme A synthase in bacteria depends on one pair of cysteinyls for activity.
Lewin, Anna; Hederstedt, Lars
2016-02-01
Heme A is a prosthetic group unique for cytochrome a-type respiratory oxidases in mammals, plants and many microorganisms. The poorly understood integral membrane protein heme A synthase catalyzes the synthesis of heme A from heme O. In bacteria, but not in mitochondria, this enzyme contains one or two pairs of cysteine residues that are present in predicted hydrophilic polypeptide loops on the extracytoplasmic side of the membrane. We used heme A synthase from the eubacterium Bacillus subtilis and the hyperthermophilic archeon Aeropyrum pernix to investigate the functional role of these cysteine residues. Results with B. subtilis amino acid substituted proteins indicated the pair of cysteine residues in the loop connecting transmembrane segments I and II as being essential for catalysis but not required for binding of the enzyme substrate, heme O. Experiments with isolated A. pernix and B. subtilis heme A synthase demonstrated that a disulfide bond can form between the cysteine residues in the same loop and also between loops showing close proximity of the two loops in the folded enzyme protein. Based on the findings, we propose a classification scheme for the four discrete types of heme A synthase found so far in different organisms and propose that essential cysteinyls mediate transfer of reducing equivalents required for the oxygen-dependent catalysis of heme A synthesis from heme O. Copyright © 2015 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Kabra, Kavita; Chaudhary, Rubina; Sawhney, R.L.
2008-01-01
The present study is targeted on solar photocatalytic removal of metal ions from wastewater. Photoreductive deposition and dark adsorption of metal ions Cu(II), Ni(II), Pb(II) and Zn(II), using solar energy irradiated TiO 2 , has been investigated. Citric acid has been used as a hole scavenger. Modeling of metal species has been performed and speciation is used as a tool for discussing the photodeposition trends. Ninety-seven percent reductive deposition was obtained for copper. The deposition values of other metals were significantly low [nickel (36.4%), zinc (22.2%) and lead (41.4%)], indicating that the photocatalytic treatment process, using solar energy, was more suitable for wastewater containing Cu(II) ions. In absence of citric acid, the decreasing order deposition was Cu(II) > Ni(II) > Pb(II) > Zn(II), which proves the theoretical thermodynamic predictions about the metals
International Nuclear Information System (INIS)
Hegazy, M.G.; Reimann, E.M.; Thysseril, T.J.; Schlender, K.K.
1986-01-01
Rat skeletal muscle contains a glycogen synthase kinase (GSK-M) which is not stimulated by Ca 2+ or cAMP. This kinase has an apparent Mr of 62,000 and uses ATP but not GTP as a phosphoryl donor. GSK-M phosphorylated glycogen synthase at sites 2 and 3. It phosphorylated ATP-citrate lyase and activated MgATP-dependent phosphatase in the presence of ATP but not GTP. As expected, the kinase also phosphorylated phosphatase inhibitor 2 (I-2). Phosphatase incorporation reached approximately 0.3 mol/mol of I-2. Phosphopeptide maps were obtained by digesting 32 P-labeled I-2 with trypsin and separating the peptides by reversed phase HPLC. Two partially separated 32 P-labeled peaks were obtained when I-2 was phosphorylated with either GSK-M or glycogen synthase kinase 3 (GSK-3) and these peptides were different from those obtained when I-2 was phosphorylated with the catalytic subunit of cAMP-dependent protein kinase (CSU) or casein kinase II (CK-II). When I-2 was phosphorylated with GSK-M or GSK-3 and cleaved by CNBr, a single radioactive peak was obtained. Phosphoamino acid analysis showed that I-2 was phosphorylated by GSK-M or GSK-3 predominately in Thr whereas CSU and CK-II phosphorylated I-2 exclusively in Ser. These results indicate that GSK-M is similar to GSK-3 and to ATP-citrate lyase kinase. However, it appears to differ in Mr from ATP-citrate lyase kinase and it differs from GSK-3 in that it phosphorylates glycogen synthase at site 2 and it does not use GTP as a phosphoryl donor
Directory of Open Access Journals (Sweden)
Kawamukai Makoto
2004-11-01
Full Text Available Abstract Background Isopentenyl diphosphate (IPP, a common biosynthetic precursor to the labdane diterpene forskolin, has been biosynthesised via a non-mevalonate pathway. Geranylgeranyl diphosphate (GGPP synthase is an important branch point enzyme in terpenoid biosynthesis. Therefore, GGPP synthase is thought to be a key enzyme in biosynthesis of forskolin. Herein we report the first confirmation of the GGPP synthase gene in Coleus forskohlii Briq. Results The open reading frame for full-length GGPP synthase encodes a protein of 359 amino acids, in which 1,077 nucleotides long with calculated molecular mass of 39.3 kDa. Alignments of C. forskohlii GGPP synthase amino acid sequences revealed high homologies with other plant GGPP synthases. Several highly conserved regions, including two aspartate-rich motifs were identified. Transient expression of the N-terminal region of C. forskohlii GGPP synthase-GFP fusion protein in tobacco cells demonstrated subcellular localization in the chloroplast. Carotenoid production was observed in Escherichia coli harboring pACCAR25ΔcrtE from Erwinia uredovora and plasmid carrying C. forskohlii GGPP synthase. These results suggested that cDNA encoded functional GGPP synthase. Furthermore, C. forskohlii GGPP synthase expression was strong in leaves, decreased in stems and very little expression was observed in roots. Conclusion This investigation proposed that forskolin was synthesised via a non-mevalonate pathway. GGPP synthase is thought to be involved in the biosynthesis of forskolin, which is primarily synthesised in the leaves and subsequently accumulates in the stems and roots.
Competition from Cu(II), Zn(II) and Cd(II) in Pb(II) binding to Suwannee River Fulvic Acid
Chakraborty, P.; Chakrabarti, C.L.
2008-01-01
This is a study of trace metal competition in the complexation of Pb(II) by well-characterized humic substances, namely Suwannee River Fulvic Acid (SRFA) in model solutions. It was found that Cu(II) seems to compete with Pb(II) for strong binding sites of SRFA when present at the same concentration
Glycogen synthase activation by sugars in isolated hepatocytes.
Ciudad, C J; Carabaza, A; Bosch, F; Gòmez I Foix, A M; Guinovart, J J
1988-07-01
We have investigated the activation by sugars of glycogen synthase in relation to (i) phosphorylase a activity and (ii) changes in the intracellular concentration of glucose 6-phosphate and adenine nucleotides. All the sugars tested in this work present the common denominator of activating glycogen synthase. On the other hand, phosphorylase a activity is decreased by mannose and glucose, unchanged by galactose and xylitol, and increased by tagatose, glyceraldehyde, and fructose. Dihydroxyacetone exerts a biphasic effect on phosphorylase. These findings provide additional evidence proving that glycogen synthase can be activated regardless of the levels of phosphorylase a, clearly establishing that a nonsequential mechanism for the activation of glycogen synthase occurs in liver cells. The glycogen synthase activation state is related to the concentrations of glucose 6-phosphate and adenine nucleotides. In this respect, tagatose, glyceraldehyde, and fructose deplete ATP and increase AMP contents, whereas glucose, mannose, galactose, xylitol, and dihydroxyacetone do not alter the concentration of these nucleotides. In addition, all these sugars, except glyceraldehyde, increase the intracellular content of glucose 6-phosphate. The activation of glycogen synthase by sugars is reflected in decreases on both kinetic constants of the enzyme, M0.5 (for glucose 6-phosphate) and S0.5 (for UDP-glucose). We propose that hepatocyte glycogen synthase is activated by monosaccharides by a mechanism triggered by changes in glucose 6-phosphate and adenine nucleotide concentrations which have been described to modify glycogen synthase phosphatase activity. This mechanism represents a metabolite control of the sugar-induced activation of hepatocyte glycogen synthase.
Directory of Open Access Journals (Sweden)
Emilia Wilmowicz
2016-03-01
Full Text Available Allene oxide synthase (AOS encodes the first enzyme in the lipoxygenase pathway, which is responsible for jasmonic acid (JA formation. In this study we report the molecular cloning and characterization of InAOS from Ipomoea nil. The full-length gene is composed of 1662 bp and encodes for 519 amino acids. The predicted InAOS contains PLN02648 motif, which is evolutionarily conserved and characteristic for functional enzymatic proteins. We have shown that wounding led to a strong stimulation of the examined gene activity in cotyledons and an increase in JA level, which suggest that this compound may be a modulator of stress responses in I. nil.
Directory of Open Access Journals (Sweden)
Amro Abd al fattah Amara
2012-04-01
Full Text Available ABSTRACT: A question addressed in this study is: why similar enzymes are classified into different subclasses? As an example, PhaC synthases are classified according to four different classes (I, II, III and IV. To answer this question we proposed that besides the catalytic residues, the overall amino acids (AAs present are responsible for the differences observed. The AAs’ composition affects the structure/function/substrate specificity (SFS of these enzymes. The differences between the classes in various PhaC synthases and proteases were analysed to support our argument. Homology and phylogenic tree of some selected PhaC synthases of different strains (representing the four classes were demonstrated. The properties of a specific class of enzyme could not be changed into those of another by changing the catalytic residues. Moreover, these differences could not be detected from the proteins’ 3D structures, despite clear differences at the AAs level. Another question was also addressed: could we benefit from the various existing protein databases in the field of biotechnology? To answer this, we introduced a model for an Experimental Design based on the information in the protein database (for strains available in our lab regarding their ability to degrade castor oil. Two enzymes in the phenol degradation pathway, phenol 2-monooxygenase and catechol 1,2-dioxygenase, and a lipase enzyme were analysed. These enzymes were screened and analysed according to the BLAST-protein database and BRENDA. The comprehensive enzyme information system compared six strains against each other, including: Pseudomonas aeruginosa, Bacillus subtilis, Bacillus pumilus, Bacillus thuringiensis, Bacillus licheniformis, and Geobacillus stearothermophilus. Only P. aeruginosa proved to have the three required enzymes and was suitable for the production of lipases from castor oil (crude castor oil is usually contaminated with phenol as indicated by the databases. In
Phytochelatin synthase activity as a marker of metal pollution
Energy Technology Data Exchange (ETDEWEB)
Zitka, Ondrej; Krystofova, Olga; Sobrova, Pavlina [Department of Chemistry and Biochemistry, Faculty of Agronomy, Mendel University in Brno, Zemedelska 1, CZ-613 00 Brno (Czech Republic); Adam, Vojtech [Department of Chemistry and Biochemistry, Faculty of Agronomy, Mendel University in Brno, Zemedelska 1, CZ-613 00 Brno (Czech Republic); Central European Institute of Technology, Brno University of Technology, Technicka 3058/10, CZ-616 00 Brno (Czech Republic); Zehnalek, Josef; Beklova, Miroslava [Department of Chemistry and Biochemistry, Faculty of Agronomy, Mendel University in Brno, Zemedelska 1, CZ-613 00 Brno (Czech Republic); Kizek, Rene, E-mail: kizek@sci.muni.cz [Department of Chemistry and Biochemistry, Faculty of Agronomy, Mendel University in Brno, Zemedelska 1, CZ-613 00 Brno (Czech Republic); Central European Institute of Technology, Brno University of Technology, Technicka 3058/10, CZ-616 00 Brno (Czech Republic)
2011-08-30
Highlights: {yields} New tool for determination of phytochelatin synthase activity. {yields} The optimization of experimental condition for determination of the enzyme activity. {yields} First evaluation of K{sub m} for the enzyme. {yields} The effects of cadmium (II) not only on the activity of the enzyme but also on K{sub m}. -- Abstract: The synthesis of phytochelatins is catalyzed by {gamma}-Glu-Cys dipeptidyl transpeptidase called phytochelatin synthase (PCS). Aim of this study was to suggest a new tool for determination of phytochelatin synthase activity in the tobacco BY-2 cells treated with different concentrations of the Cd(II). After the optimization steps, an experiment on BY-2 cells exposed to different concentrations of Cd(NO{sub 3}){sub 2} for 3 days was performed. At the end of the experiment, cells were harvested and homogenized. Reduced glutathione and cadmium (II) ions were added to the cell suspension supernatant. These mixtures were incubated at 35 {sup o}C for 30 min and analysed using high performance liquid chromatography coupled with electrochemical detector (HPLC-ED). The results revealed that PCS activity rises markedly with increasing concentration of cadmium (II) ions. The lowest concentration of the toxic metal ions caused almost three fold increase in PCS activity as compared to control samples. The activity of PCS (270 fkat) in treated cells was more than seven times higher in comparison to control ones. K{sub m} for PCS was estimated as 2.3 mM.
Phytochelatin synthase activity as a marker of metal pollution
International Nuclear Information System (INIS)
Zitka, Ondrej; Krystofova, Olga; Sobrova, Pavlina; Adam, Vojtech; Zehnalek, Josef; Beklova, Miroslava; Kizek, Rene
2011-01-01
Highlights: → New tool for determination of phytochelatin synthase activity. → The optimization of experimental condition for determination of the enzyme activity. → First evaluation of K m for the enzyme. → The effects of cadmium (II) not only on the activity of the enzyme but also on K m . -- Abstract: The synthesis of phytochelatins is catalyzed by γ-Glu-Cys dipeptidyl transpeptidase called phytochelatin synthase (PCS). Aim of this study was to suggest a new tool for determination of phytochelatin synthase activity in the tobacco BY-2 cells treated with different concentrations of the Cd(II). After the optimization steps, an experiment on BY-2 cells exposed to different concentrations of Cd(NO 3 ) 2 for 3 days was performed. At the end of the experiment, cells were harvested and homogenized. Reduced glutathione and cadmium (II) ions were added to the cell suspension supernatant. These mixtures were incubated at 35 o C for 30 min and analysed using high performance liquid chromatography coupled with electrochemical detector (HPLC-ED). The results revealed that PCS activity rises markedly with increasing concentration of cadmium (II) ions. The lowest concentration of the toxic metal ions caused almost three fold increase in PCS activity as compared to control samples. The activity of PCS (270 fkat) in treated cells was more than seven times higher in comparison to control ones. K m for PCS was estimated as 2.3 mM.
Zhang, De-Huai; Li, Na; Yu, Xuya; Zhao, Peng; Li, Tao; Xu, Jun-Wei
2017-02-01
Ganoderic acids (GAs) in Ganoderma lingzhi exhibit anticancer and antimetastatic activities. GA yields can be potentially improved by manipulating G. lingzhi through genetic engineering. In this study, a putative lanosterol synthase (LS) gene was cloned and overexpressed in G. lingzhi. Results showed that its overexpression (OE) increased the ganoderic acid (GA) content and the accumulation of lanosterol and ergosterol in a submerged G. lingzhi culture. The maximum contents of GA-O, GA-Mk, GA-T, GA-S, GA-Mf, and GA-Me in transgenic strains were 46.6 ± 4.8, 24.3 ± 3.5, 69.8 ± 8.2, 28.9 ± 1.4, 15.4 ± 1.2, and 26.7 ± 3.1 μg/100 mg dry weight, respectively, these values being 6.1-, 2.2-, 3.2-, 4.8-, 2.0-, and 1.9-times higher than those in wild-type strains. In addition, accumulated amounts of lanosterol and ergosterol in transgenic strains were 2.3 and 1.4-fold higher than those in the control strains, respectively. The transcription level of LS was also increased by more than five times in the presence of the G. lingzhi glyceraldehyde-3-phosphate dehydrogenase gene promoter, whereas transcription levels of 3-hydroxy-3-methylglutaryl coenzyme A enzyme and squalene synthase did not change significantly in transgenic strains. This study demonstrated that OE of the homologous LS gene can enhance lanosterol accumulation. A large precursor supply promotes GA biosynthesis. Copyright © 2016 Elsevier Ltd. All rights reserved.
Zerbe, Philipp; Chiang, Angela; Yuen, Macaire; Hamberger, Björn; Hamberger, Britta; Draper, Jason A.; Britton, Robert; Bohlmann, Jörg
2012-01-01
The labdanoid diterpene alcohol cis-abienol is a major component of the aromatic oleoresin of balsam fir (Abies balsamea) and serves as a valuable bioproduct material for the fragrance industry. Using high-throughput 454 transcriptome sequencing and metabolite profiling of balsam fir bark tissue, we identified candidate diterpene synthase sequences for full-length cDNA cloning and functional characterization. We discovered a bifunctional class I/II cis-abienol synthase (AbCAS), along with the paralogous levopimaradiene/abietadiene synthase and isopimaradiene synthase, all of which are members of the gymnosperm-specific TPS-d subfamily. The AbCAS-catalyzed formation of cis-abienol proceeds via cyclization and hydroxylation at carbon C-8 of a postulated carbocation intermediate in the class II active site, followed by cleavage of the diphosphate group and termination of the reaction sequence without further cyclization in the class I active site. This reaction mechanism is distinct from that of synthases of the isopimaradiene- or levopimaradiene/abietadiene synthase type, which employ deprotonation reactions in the class II active site and secondary cyclizations in the class I active site, leading to tricyclic diterpenes. Comparative homology modeling suggested the active site residues Asp-348, Leu-617, Phe-696, and Gly-723 as potentially important for the specificity of AbCAS. As a class I/II bifunctional enzyme, AbCAS is a promising target for metabolic engineering of cis-abienol production. PMID:22337889
Contribution of granule bound starch synthase in kernel modification ...
African Journals Online (AJOL)
The role of gbssI and gbssII genes, encoding granule bound starch synthase enzyme I and II, respectively, in quality protein maize (QPM) were studied at different days after pollination (DAP). Total RNA was used for first strand cDNA synthesis using the ImpromIISriptTM reverse transcriptase. No detectable levels of gbssI ...
Energy Technology Data Exchange (ETDEWEB)
Fortman, Jeffrey L.; Hagen, Andrew; Katz, Leonard; Keasling, Jay D.; Poust, Sean; Zhang, Jingwei; Zotchev, Sergey
2016-05-10
The present invention provides for a polyketide synthase (PKS) capable of synthesizing an even-chain or odd-chain diacid or lactam or diamine. The present invention also provides for a host cell comprising the PKS and when cultured produces the even-chain diacid, odd-chain diacid, or KAPA. The present invention also provides for a host cell comprising the PKS capable of synthesizing a pimelic acid or KAPA, and when cultured produces biotin.
Ikeda, Masato; Nagashima, Takashi; Nakamura, Eri; Kato, Ryosuke; Ohshita, Masakazu; Hayashi, Mikiro; Takeno, Seiki
2017-10-01
For fatty acid biosynthesis, Corynebacterium glutamicum uses two type I fatty acid synthases (FAS-I), FasA and FasB, in addition to acetyl-coenzyme A (CoA) carboxylase (ACC) consisting of AccBC, AccD1, and AccE. The in vivo roles of the enzymes in supplying precursors for biotin and α-lipoic acid remain unclear. Here, we report genetic evidence demonstrating that the biosynthesis of these cofactors is linked to fatty acid biosynthesis through the FAS-I pathway. For this study, we used wild-type C. glutamicum and its derived biotin vitamer producer BFI-5, which was engineered to express Escherichia coli bioBF and Bacillus subtilis bioI Disruption of either fasA or fasB in strain BFI-5 led to decreased production of biotin vitamers, whereas its amplification contributed to increased production, with a larger impact of fasA in both cases. Double disruptions of fasA and fasB resulted in no biotin vitamer production. The acc genes showed a positive effect on production when amplified simultaneously. Augmented fatty acid biosynthesis was also reflected in pimelic acid production when carbon flow was blocked at the BioF reaction. These results indicate that carbon flow down the FAS-I pathway is destined for channeling into the biotin biosynthesis pathway, and that FasA in particular has a significant impact on precursor supply. In contrast, fasB disruption resulted in auxotrophy for lipoic acid or its precursor octanoic acid in both wild-type and BFI-5 strains. The phenotypes were fully complemented by plasmid-mediated expression of fasB but not fasA These results reveal that FasB plays a specific physiological role in lipoic acid biosynthesis in C. glutamicum IMPORTANCE For the de novo biosynthesis of fatty acids, C. glutamicum exceptionally uses a eukaryotic multifunctional type I fatty acid synthase (FAS-I) system comprising FasA and FasB, in contrast to most bacteria, such as E. coli and B. subtilis , which use an individual nonaggregating type II fatty acid synthase
Directory of Open Access Journals (Sweden)
Patrick C Y Woo
Full Text Available BACKGROUND: The genome of P. marneffei, the most important thermal dimorphic fungus causing respiratory, skin and systemic mycosis in China and Southeast Asia, possesses 23 polyketide synthase (PKS genes and 2 polyketide synthase nonribosomal peptide synthase hybrid (PKS-NRPS genes, which is of high diversity compared to other thermal dimorphic pathogenic fungi. We hypothesized that the yellow pigment in the mold form of P. marneffei could also be synthesized by one or more PKS genes. METHODOLOGY/PRINCIPAL FINDINGS: All 23 PKS and 2 PKS-NRPS genes of P. marneffei were systematically knocked down. A loss of the yellow pigment was observed in the mold form of the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants. Sequence analysis showed that PKS11 and PKS12 are fungal non-reducing PKSs. Ultra high performance liquid chromatography-photodiode array detector/electrospray ionization-quadruple time of flight-mass spectrometry (MS and MS/MS analysis of the culture filtrates of wild type P. marneffei and the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants showed that the yellow pigment is composed of mitorubrinic acid and mitorubrinol. The survival of mice challenged with the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants was significantly better than those challenged with wild type P. marneffei (P<0.05. There was also statistically significant decrease in survival of pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants compared to wild type P. marneffei in both J774 and THP1 macrophages (P<0.05. CONCLUSIONS/SIGNIFICANCE: The yellow pigment of the mold form of P. marneffei is composed of mitorubrinol and mitorubrinic acid. This represents the first discovery of PKS genes responsible for mitorubrinol and mitorubrinic acid biosynthesis. pks12 and pks11 are probably responsible for sequential use in the biosynthesis of mitorubrinol and mitorubrinic acid
Kalaitzis, John A; Cheng, Qian; Meluzzi, Dario; Xiang, Longkuan; Izumikawa, Miho; Dorrestein, Pieter C; Moore, Bradley S
2011-11-15
Enterocin is an atypical type II polyketide synthase (PKS) product from the marine actinomycete 'Streptomyces maritimus'. The enterocin biosynthesis gene cluster (enc) codes for proteins involved in the assembly and attachment of the rare benzoate primer that initiates polyketide assembly with the addition of seven malonate molecules and culminates in a Favorskii-like rearrangement of the linear poly-β-ketone to give its distinctive non-aromatic, caged core structure. Fundamental to enterocin biosynthesis, which utilizes a single acyl carrier protein (ACP), EncC, for both priming with benzoate and elongating with malonate, involves maintaining the correct balance of acyl-EncC substrates for efficient polyketide assembly. Here, we report the characterization of EncL as a type II thioesterase that functions to edit starter unit (mis)priming of EncC. We performed a series of in vivo mutational studies, heterologous expression experiments, in vitro reconstitution studies, and Fourier-transform mass spectrometry-monitored competitive enzyme assays that together support the proposed selective hydrolase activity of EncL toward misprimed acetyl-ACP over benzoyl-ACP to facilitate benzoyl priming of the enterocin PKS complex. While this system resembles the R1128 PKS that also utilizes an editing thioesterase (ZhuC) to purge acetate molecules from its initiation module ACP in favor of alkylacyl groups, the enterocin system is distinct in its usage of a single ACP for both priming and elongating reactions with different substrates. Copyright © 2011 Elsevier Ltd. All rights reserved.
Ramseyer, Vanesa D; Gonzalez-Vicente, Agustin; Carretero, Oscar A; Garvin, Jeffrey L
2015-01-15
Thick ascending limbs reabsorb 30% of the filtered NaCl load. Nitric oxide (NO) produced by NO synthase 3 (NOS3) inhibits NaCl transport by this segment. In contrast, chronic angiotensin II (ANG II) infusion increases net thick ascending limb transport. NOS3 activity is regulated by changes in expression and phosphorylation at threonine 495 (T495) and serine 1177 (S1177), inhibitory and stimulatory sites, respectively. We hypothesized that NO production by thick ascending limbs is impaired by chronic ANG II infusion, due to reduced NOS3 expression, increased phosphorylation of T495, and decreased phosphorylation of S1177. Rats were infused with 200 ng·kg(-1)·min(-1) ANG II or vehicle for 1 and 5 days. ANG II infusion for 5 days decreased NOS3 expression by 40 ± 12% (P thick ascending limbs from ANG II-infused animals [ANG II -0.01 ± 0.06 arbitrary fluorescence units (AFU)/min vs. 0.17 ± 0.02 AFU/min in controls; P thick ascending limbs is impaired due to decreased NOS3 expression and altered phosphorylation. Copyright © 2015 the American Physiological Society.
Directory of Open Access Journals (Sweden)
Aditya Dev
2013-06-01
Full Text Available The Shikimate pathway is an attractive target for herbicides and antimicrobial agents because it is essential in microbes and plants but absent in animals. The 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase (DAHPS is the first enzyme of this pathway, which is involved in the condensation of phosphoenolpyruvate (PEP and D-erythrose 4-phosphate (E4P to produce 3-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP. DAHPS enzymes have been divided into two types, class I and class II, based on their primary amino acid sequence and three dimensional structures. The plant DAHPS belongs to class II and is regulated differently than DAHPS from microorganisms. To understand the structural basis of such differences in DAHPS from plants and its catalytic mechanism, we have used sequence analysis, homology modeling and docking approach to generate the three dimensional models of DAHP synthase from Brachypodium distachyon (Bd-DAHPS complexed with substrate PEP for the first time. The three dimensional models of Bd-DAHPS provides a detailed knowledge of the active site and the important secondary structural regions that play significant roles in the regulatory mechanism and further may be helpful for design of specific inhibitors towards herbicide development.
Senan, Ahmed M; Zhang, Sicheng; Zeng, Miao; Chen, Zhuqi; Yin, Guochuan
2017-08-16
Utilization of renewable biomass to partly replace the fossil resources in industrial applications has attracted attention due to the limited fossil feedstock with the increased environmental concerns. This work introduced a modified Wacker-type oxidation for transformation of unsaturated fatty acids/esters to the corresponding keto fatty acids/esters, in which Cu 2+ cation was replaced with common nonredox metal ions, that is, a novel Pd(II)/Lewis acid (LA) catalyst. It was found that adding nonredox metal ions can effectively promote Pd(II)-catalyzed oxidation of unsaturated fatty acids/esters to the corresponding keto fatty acids/esters, even much better than Cu 2+ , and the promotional effect is highly dependent on the Lewis acidity of added nonredox metal ions. The improved catalytic efficiency is attributed to the formation of heterobimetallic Pd(II)/LA species, and the oxidation mechanism of this Pd(II)/LA catalyst is also briefly discussed.
Cloning and expression of pineapple sucrose- phosphate synthase ...
African Journals Online (AJOL)
hope&shola
2010-12-06
Dec 6, 2010 ... phosphate; EDTA, ethylene diamine tetraacetic acid; Ivr, invertase; SS .... phenolics, tannins and artifacts due to differences of tissue composition ..... Banana sucrose-phosphate synthase gene expression during fruit ripening.
Trujillo, Uldaeliz
2013-02-28
The polyunsaturated fatty acid (PUFA) synthases from deep-sea bacteria invariably contain multiple acyl carrier protein (ACP) domains in tandem. This conserved tandem arrangement has been implicated in both amplification of fatty acid production (additive effect) and in structural stabilization of the multidomain protein (synergistic effect). While the more accepted model is one in which domains act independently, recent reports suggest that ACP domains may form higher oligomers. Elucidating the three-dimensional structure of tandem arrangements may therefore give important insights into the functional relevance of these structures, and hence guide bioengineering strategies. In an effort to elucidate the three-dimensional structure of tandem repeats from deep-sea anaerobic bacteria, we have expressed and purified a fragment consisting of five tandem ACP domains from the PUFA synthase from Photobacterium profundum. Analysis of the tandem ACP fragment by analytical gel filtration chromatography showed a retention time suggestive of a multimeric protein. However, small angle X-ray scattering (SAXS) revealed that the multi-ACP fragment is an elongated monomer which does not form a globular unit. Stokes radii calculated from atomic monomeric SAXS models were comparable to those measured by analytical gel filtration chromatography, showing that in the gel filtration experiment, the molecular weight was overestimated due to the elongated protein shape. Thermal denaturation monitored by circular dichroism showed that unfolding of the tandem construct was not cooperative, and that the tandem arrangement did not stabilize the protein. Taken together, these data are consistent with an elongated beads-on-a-string arrangement of the tandem ACP domains in PUFA synthases, and speak against synergistic biocatalytic effects promoted by quaternary structuring. Thus, it is possible to envision bioengineering strategies which simply involve the artificial linking of multiple ACP
Directory of Open Access Journals (Sweden)
Uldaeliz Trujillo
Full Text Available The polyunsaturated fatty acid (PUFA synthases from deep-sea bacteria invariably contain multiple acyl carrier protein (ACP domains in tandem. This conserved tandem arrangement has been implicated in both amplification of fatty acid production (additive effect and in structural stabilization of the multidomain protein (synergistic effect. While the more accepted model is one in which domains act independently, recent reports suggest that ACP domains may form higher oligomers. Elucidating the three-dimensional structure of tandem arrangements may therefore give important insights into the functional relevance of these structures, and hence guide bioengineering strategies. In an effort to elucidate the three-dimensional structure of tandem repeats from deep-sea anaerobic bacteria, we have expressed and purified a fragment consisting of five tandem ACP domains from the PUFA synthase from Photobacterium profundum. Analysis of the tandem ACP fragment by analytical gel filtration chromatography showed a retention time suggestive of a multimeric protein. However, small angle X-ray scattering (SAXS revealed that the multi-ACP fragment is an elongated monomer which does not form a globular unit. Stokes radii calculated from atomic monomeric SAXS models were comparable to those measured by analytical gel filtration chromatography, showing that in the gel filtration experiment, the molecular weight was overestimated due to the elongated protein shape. Thermal denaturation monitored by circular dichroism showed that unfolding of the tandem construct was not cooperative, and that the tandem arrangement did not stabilize the protein. Taken together, these data are consistent with an elongated beads-on-a-string arrangement of the tandem ACP domains in PUFA synthases, and speak against synergistic biocatalytic effects promoted by quaternary structuring. Thus, it is possible to envision bioengineering strategies which simply involve the artificial linking of
Trujillo, Uldaeliz; Vá zquez-Rosa, Edwin; Oyola-Robles, Delise; Stagg, Loren J.; Vassallo, David A.; Vega, Irving E.; Arold, Stefan T.; Baerga-Ortiz, Abel
2013-01-01
The polyunsaturated fatty acid (PUFA) synthases from deep-sea bacteria invariably contain multiple acyl carrier protein (ACP) domains in tandem. This conserved tandem arrangement has been implicated in both amplification of fatty acid production (additive effect) and in structural stabilization of the multidomain protein (synergistic effect). While the more accepted model is one in which domains act independently, recent reports suggest that ACP domains may form higher oligomers. Elucidating the three-dimensional structure of tandem arrangements may therefore give important insights into the functional relevance of these structures, and hence guide bioengineering strategies. In an effort to elucidate the three-dimensional structure of tandem repeats from deep-sea anaerobic bacteria, we have expressed and purified a fragment consisting of five tandem ACP domains from the PUFA synthase from Photobacterium profundum. Analysis of the tandem ACP fragment by analytical gel filtration chromatography showed a retention time suggestive of a multimeric protein. However, small angle X-ray scattering (SAXS) revealed that the multi-ACP fragment is an elongated monomer which does not form a globular unit. Stokes radii calculated from atomic monomeric SAXS models were comparable to those measured by analytical gel filtration chromatography, showing that in the gel filtration experiment, the molecular weight was overestimated due to the elongated protein shape. Thermal denaturation monitored by circular dichroism showed that unfolding of the tandem construct was not cooperative, and that the tandem arrangement did not stabilize the protein. Taken together, these data are consistent with an elongated beads-on-a-string arrangement of the tandem ACP domains in PUFA synthases, and speak against synergistic biocatalytic effects promoted by quaternary structuring. Thus, it is possible to envision bioengineering strategies which simply involve the artificial linking of multiple ACP
Creation of a high-amylose durum wheat through mutagenesis of starch synthase II (SSIIa)
In cereal seeds mutations in one or more starch synthases lead to decreased amylopectin and increased amylose content. Here, the impact of starch synthase IIa (SSIIa or SGP-1) mutations upon durum starch was investigated. A screen of durum accessions identified two lines lacking SGP-A1, the A geno...
Planchais, Julien; Boutant, Marie; Fauveau, Véronique; Qing, Lou Dan; Sabra-Makke, Lina; Bossard, Pascale; Vasseur-Cognet, Mireille; Pégorier, Jean-Paul
2015-05-15
Chicken ovalbumin upstream promoter transcription factor II (COUP-TFII) is an orphan nuclear receptor involved in the control of numerous functions in various organs (organogenesis, differentiation, metabolic homeostasis, etc.). The aim of the present work was to characterize the regulation and contribution of COUP-TFII in the control of hepatic fatty acid and glucose metabolisms in newborn mice. Our data show that postnatal increase in COUP-TFII mRNA levels is enhanced by glucagon (via cAMP) and PPARα. To characterize COUP-TFII function in the liver of suckling mice, we used a functional (dominant negative form; COUP-TFII-DN) and a genetic (shRNA) approach. Adenoviral COUP-TFII-DN injection induces a profound hypoglycemia due to the inhibition of gluconeogenesis and fatty acid oxidation secondarily to reduced PEPCK, Gl-6-Pase, CPT I, and mHMG-CoA synthase gene expression. Using the crossover plot technique, we show that gluconeogenesis is inhibited at two different levels: 1) pyruvate carboxylation and 2) trioses phosphate synthesis. This could result from a decreased availability in fatty acid oxidation arising cofactors such as acetyl-CoA and reduced equivalents. Similar results are observed using the shRNA approach. Indeed, when fatty acid oxidation is rescued in response to Wy-14643-induced PPARα target genes (CPT I and mHMG-CoA synthase), blood glucose is normalized in COUP-TFII-DN mice. In conclusion, this work demonstrates that postnatal increase in hepatic COUP-TFII gene expression is involved in the regulation of liver fatty acid oxidation, which in turn sustains an active hepatic gluconeogenesis that is essential to maintain an appropriate blood glucose level required for newborn mice survival. Copyright © 2015 the American Physiological Society.
Zirpel, Bastian; Stehle, Felix; Kayser, Oliver
2015-09-01
The Δ9-tetrahydrocannabinolic acid synthase (THCAS) from Cannabis sativa was expressed intracellularly in different organisms to investigate the potential of a biotechnological production of Δ9-tetrahydrocannabinolic acid (THCA) using whole cells. Functional expression of THCAS was obtained in Saccharomyces cerevisiae and Pichia (Komagataella) pastoris using a signal peptide from the vacuolar protease, proteinase A. No functional expression was achieved in Escherichia coli. The highest volumetric activities obtained were 98 pkat ml(-1) (intracellular) and 44 pkat ml(-1) (extracellular) after 192 h of cultivation at 15 °C using P. pastoris cells. Low solubility of CBGA prevents the THCAS application in aqueous cell-free systems, thus whole cells were used for a bioconversion of cannabigerolic acid (CBGA) to THCA. Finally, 1 mM (0.36 g THCA l(-1)) THCA could be produced by 10.5 gCDW l(-1) before enzyme activity was lost. Whole cells of P. pastoris offer the capability of synthesizing pharmaceutical THCA production.
Micellar effect on metal-ligand complexes of Co(II, Ni(II, Cu(II and Zn(II with citric acid
Directory of Open Access Journals (Sweden)
Nageswara Rao Gollapalli
2009-12-01
Full Text Available Chemical speciation of citric acid complexes of Co(II, Ni(II, Cu(II and Zn(II was investigated pH-metrically in 0.0-2.5% anionic, cationic and neutral micellar media. The primary alkalimetric data were pruned with SCPHD program. The existence of different binary species was established from modeling studies using the computer program MINIQUAD75. Alkalimetric titrations were carried out in different relative concentrations (M:L:X = 1:2:5, 1:3:5, 1:5:3 of metal (M to citric acid. The selection of best chemical models was based on statistical parameters and residual analysis. The species detected were MLH, ML2, ML2H and ML2H2. The trend in variation of stability constants with change in mole fraction of the medium is explained on the basis of electrostatic and non-electrostatic forces. Distributions of the species with pH at different compositions of micellar media are also presented.
Jullien, Frédéric; Moja, Sandrine; Bony, Aurélie; Legrand, Sylvain; Petit, Cécile; Benabdelkader, Tarek; Poirot, Kévin; Fiorucci, Sébastien; Guitton, Yann; Nicolè, Florence; Baudino, Sylvie; Magnard, Jean-Louis
2014-01-01
In this paper we characterize three sTPSs: a germacrene D (LaGERDS), a (E)-β-caryophyllene (LaCARS) and a τ-cadinol synthase (LaCADS). τ-cadinol synthase is reported here for the first time and its activity was studied in several biological models including transiently or stably transformed tobacco species. Three dimensional structure models of LaCADS and Ocimum basilicum γ-cadinene synthase were built by homology modeling using the template structure of Gossypium arboreum δ-cadinene synthase. The depiction of their active site organization provides evidence of the global influence of the enzymes on the formation of τ-cadinol: instead of a unique amino-acid, the electrostatic properties and solvent accessibility of the whole active site in LaCADS may explain the stabilization of the cadinyl cation intermediate. Quantitative PCR performed from leaves and inflorescences showed two patterns of expression. LaGERDS and LaCARS were mainly expressed during early stages of flower development and, at these stages, transcript levels paralleled the accumulation of the corresponding terpene products (germacrene D and (E)-β-caryophyllene). By contrast, the expression level of LaCADS was constant in leaves and flowers. Phylogenetic analysis provided informative results on potential duplication process leading to sTPS diversification in lavender.
Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase
DEFF Research Database (Denmark)
Krath, Britta N.; Hove-Jensen, Bjarne
1996-01-01
The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...
Directory of Open Access Journals (Sweden)
MAHESWARA RAO VEGI
2008-12-01
Full Text Available Chemical speciation of Pb(II, Cd(II, Hg(II, Co(II, Ni(II, Cu(II and Zn(II complexes of L-glutamic acid was studied at 303 K in 0–60 vol. % 1,2-propanediol–water mixtures, whereby the ionic strength was maintained at 0.16 mol dm-3. The active forms of the ligand are LH3+, LH2 and LH–. The predominant detected species were ML, ML2, MLH, ML2H and ML2H2. The trend of the variation in the stability constants with changing dielectric constant of the medium is explained based on the cation stabilizing nature of the co-solvents, specific solvent–water interactions, charge dispersion and specific interactions of the co-solvent with the solute. The effect of systematic errors in the concentrations of the substances on the stability constants is in the order alkali > > acid > ligand > metal. The bioavailability and transportation of metals are explained based on distribution diagrams and stability constants.
Fan, Yuan-Jie; Ye, Yan-Bin; Gao, Wen; Zhang, Feng; Zhang, Ying-Xia
2010-11-01
To study the dynamic variations of the contents of total polyphenols, flvonoids and chlorogenic acid from Acer truncatum leaves in different months, and their inhibitory activities on fatty acid synthase. Spectrophotometry was used to determine the contents of total polyphenols, flavonoids and chlorogenic acid in extracts and the extracts' inhibitory effects were also investigated. All Leaves picked from May to November have inhibitory effect. But the contents of polyphenols in leaves of July appeared to be higher than other months', and consequently exhibited stronger inhibition against FAS. A positive correlation between the content of polyphenols in leaves extract and the inhibitory efficacy on FAS could be established.
Cascini, Fidelia; Passerotti, Stella; Martello, Simona
2012-04-10
In this study, we wanted to investigate whether or not the tetrahydrocannabinolic acid (THCA) synthase gene, which codes for the enzyme involved in the biosynthesis of THCA, influences the production and storage of tetrahydrocannabinol (THC) in a dose-dependent manner. THCA is actually decarboxylated to produce THC, the main psychoactive component in the Cannabis plant. Assuming as the research hypothesis a correlation between the gene copy number and the production of THC, gene quantification could be useful in forensics in order to complement or replace chemical analysis for the identification and classification of seized Cannabis samples, thus distinguishing the drug-type from the fibre-type varieties. A real-time PCR assay for the relative quantification of the THCA synthase gene was then validated on Cannabis samples; some were seized from the illegal drug market and others were derived from experimental cultivation. In order to determine the gene copy number to compare high vs. low potency plants, we chose the ΔΔCt method for TaqMan reactions. The assay enabled single plants with zero, one, and two copies of the gene to be distinguished. As a result of this first part of the research on the THCA synthase gene (the second part will cover a study of gene expression), we found no correlation between THCA synthase gene copy number and the content of THC in the herbal Cannabis samples tested. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.
p63 promotes cell survival through fatty acid synthase.
Directory of Open Access Journals (Sweden)
Venkata Sabbisetti
2009-06-01
Full Text Available There is increasing evidence that p63, and specifically DeltaNp63, plays a central role in both development and tumorigenesis by promoting epithelial cell survival. However, few studies have addressed the molecular mechanisms through which such important function is exerted. Fatty acid synthase (FASN, a key enzyme that synthesizes long-chain fatty acids and is involved in both embryogenesis and cancer, has been recently proposed as a direct target of p53 family members, including p63 and p73. Here we show that knockdown of either total or DeltaN-specific p63 isoforms in squamous cell carcinoma (SCC9 or immortalized prostate epithelial (iPrEC cells caused a decrease in cell viability by inducing apoptosis without affecting the cell cycle. p63 silencing significantly reduced both the expression and the activity of FASN. Importantly, stable overexpression of either FASN or myristoylated AKT (myr-AKT was able to partially rescue cells from cell death induced by p63 silencing. FASN induced AKT phosphorylation and a significant reduction in cell viability was observed when FASN-overexpressing SCC9 cells were treated with an AKT inhibitor after p63 knockdown, indicating that AKT plays a major role in FASN-mediated survival. Activated AKT did not cause any alteration in the FASN protein levels but induced its activity, suggesting that the rescue from apoptosis documented in the p63-silenced cells expressing myr-AKT cells may be partially mediated by FASN. Finally, we demonstrated that p63 and FASN expression are positively associated in clinical squamous cell carcinoma samples as well as in the developing prostate. Taken together, our findings demonstrate that FASN is a functionally relevant target of p63 and is required for mediating its pro-survival effects.
Kohli, Gurjeet S; Campbell, Katrina; John, Uwe; Smith, Kirsty F; Fraga, Santiago; Rhodes, Lesley L; Murray, Shauna A
2017-09-01
Gambierdiscus, a benthic dinoflagellate, produces ciguatoxins that cause the human illness Ciguatera. Ciguatoxins are polyether ladder compounds that have a polyketide origin, indicating that polyketide synthases (PKS) are involved in their production. We sequenced transcriptomes of Gambierdiscus excentricus and Gambierdiscus polynesiensis and found 264 contigs encoding single domain ketoacyl synthases (KS; G. excentricus: 106, G. polynesiensis: 143) and ketoreductases (KR; G. excentricus: 7, G. polynesiensis: 8) with sequence similarity to type I PKSs, as reported in other dinoflagellates. In addition, 24 contigs (G. excentricus: 3, G. polynesiensis: 21) encoding multiple PKS domains (forming typical type I PKSs modules) were found. The proposed structure produced by one of these megasynthases resembles a partial carbon backbone of a polyether ladder compound. Seventeen contigs encoding single domain KS, KR, s-malonyltransacylase, dehydratase and enoyl reductase with sequence similarity to type II fatty acid synthases (FAS) in plants were found. Type I PKS and type II FAS genes were distinguished based on the arrangement of domains on the contigs and their sequence similarity and phylogenetic clustering with known PKS/FAS genes in other organisms. This differentiation of PKS and FAS pathways in Gambierdiscus is important, as it will facilitate approaches to investigating toxin biosynthesis pathways in dinoflagellates. © 2017 The Author(s) Journal of Eukaryotic Microbiology © 2017 International Society of Protistologists.
Modulation of hyaluronan synthase activity in cellular membrane fractions
Vigetti, Davide; Genasetti, A; Karousou, Evgenia; Viola, Manuela; Clerici, M; Bartolini, B; Moretto, Paola; DE LUCA, Giancarlo; Hascall, Vc; Passi, Alberto
2009-01-01
Hyaluronan (HA), the only non-sulfated glycosaminoglycan, is involved in morphogenesis, wound healing, inflammation, angiogenesis, and cancer. In mammals, HA is synthesized by three homologous HA synthases, HAS1, HAS2, and HAS3, that polymerize the HA chain using UDP-glucuronic acid and UDP-N-acetylglucosamine as precursors. Since the amount of HA is critical in several pathophysiological conditions, we developed a non-radioactive assay for measuring the activity of HA synthases (HASs) in euk...
Studies on the Active Site of Deacetoxycephalosporin C Synthase
Lloyd, Matthew D.; Lee, Hwei-Jen; Harlos, Karl; Zhang, Zhi-Hong; Baldwin, Jack E.; Schofield, Christopher J.; Charnock, John M.; Garner, C. David; Hara, Takane; Terwisscha van Scheltinga, Anke C.; Valegård, Karin; Viklund, Jenny A.C.; Hajdu, Janos; Andersson, Inger; Danielsson, Åke; Bhikhabhai, Rama
1999-01-01
The Fe(II) and 2-oxoglutarate-dependent dioxygenase deacetoxycephalosporin C synthase (DAOCS) from Streptomyces clavuligerus was expressed at ca 25% of total soluble protein in Escherichia coli and purified by an efficient large-scale procedure. Purified protein catalysed the conversions of
Directory of Open Access Journals (Sweden)
Rawat Richa
2011-05-01
Full Text Available Abstract Background Cyclopropane fatty acids (CPA have been found in certain gymnosperms, Malvales, Litchi and other Sapindales. The presence of their unique strained ring structures confers physical and chemical properties characteristic of unsaturated fatty acids with the oxidative stability displayed by saturated fatty acids making them of considerable industrial interest. While cyclopropenoid fatty acids (CPE are well-known inhibitors of fatty acid desaturation in animals, CPE can also inhibit the stearoyl-CoA desaturase and interfere with the maturation and reproduction of some insect species suggesting that in addition to their traditional role as storage lipids, CPE can contribute to the protection of plants from herbivory. Results Three genes encoding cyclopropane synthase homologues GhCPS1, GhCPS2 and GhCPS3 were identified in cotton. Determination of gene transcript abundance revealed differences among the expression of GhCPS1, 2 and 3 showing high, intermediate and low levels, respectively, of transcripts in roots and stems; whereas GhCPS1 and 2 are both expressed at low levels in seeds. Analyses of fatty acid composition in different tissues indicate that the expression patterns of GhCPS1 and 2 correlate with cyclic fatty acid (CFA distribution. Deletion of the N-terminal oxidase domain lowered GhCPS's ability to produce cyclopropane fatty acid by approximately 70%. GhCPS1 and 2, but not 3 resulted in the production of cyclopropane fatty acids upon heterologous expression in yeast, tobacco BY2 cell and Arabidopsis seed. Conclusions In cotton GhCPS1 and 2 gene expression correlates with the total CFA content in roots, stems and seeds. That GhCPS1 and 2 are expressed at a similar level in seed suggests both of them can be considered potential targets for gene silencing to reduce undesirable seed CPE accumulation. Because GhCPS1 is more active in yeast than the published Sterculia CPS and shows similar activity when expressed in model
Monoterpene and sesquiterpene synthases and the origin of terpene skeletal diversity in plants.
Degenhardt, Jörg; Köllner, Tobias G; Gershenzon, Jonathan
2009-01-01
The multitude of terpene carbon skeletons in plants is formed by enzymes known as terpene synthases. This review covers the monoterpene and sesquiterpene synthases presenting an up-to-date list of enzymes reported and evidence for their ability to form multiple products. The reaction mechanisms of these enzyme classes are described, and information on how terpene synthase proteins mediate catalysis is summarized. Correlations between specific amino acid motifs and terpene synthase function are described, including an analysis of the relationships between active site sequence and cyclization type and a discussion of whether specific protein features might facilitate multiple product formation.
Directory of Open Access Journals (Sweden)
Gaetano Castaldo
2005-01-01
Full Text Available Interactions between proteins that form the ’minimal’ type II polyketide synthase in the doxorubicin producing biosynthetic pathway from Streptomyces peucetius were investigated using a yeast two-hybrid system (Y2H. Proteins that function as the so called ’chain length factor’ (DpsB and putative transacylase (DpsD were found to interact with the ketosynthase subunit (DpsA, which can also interact with itself. On the basis of these results we propose a head-to-tail homodimeric structure, which is consistent with previously published in vivo mutagenesis studies. No interactions were found between the acyl-carrier protein (DpsG and any of the other constituents of the complex, however, transient interactions, not detectable using the Y2H system, cannot be discounted and warrant further investigation.
Isolation and expression of the Pneumocystis carinii thymidylate synthase gene
DEFF Research Database (Denmark)
Edman, U; Edman, J C; Lundgren, B
1989-01-01
The thymidylate synthase (TS) gene from Pneumocystis carinii has been isolated from complementary and genomic DNA libraries and expressed in Escherichia coli. The coding sequence of TS is 891 nucleotides, encoding a 297-amino acid protein of Mr 34,269. The deduced amino acid sequence is similar...
Structure of the Mitochondrial Aminolevulinic Acid Synthase, a Key Heme Biosynthetic Enzyme.
Brown, Breann L; Kardon, Julia R; Sauer, Robert T; Baker, Tania A
2018-04-03
5-Aminolevulinic acid synthase (ALAS) catalyzes the first step in heme biosynthesis. We present the crystal structure of a eukaryotic ALAS from Saccharomyces cerevisiae. In this homodimeric structure, one ALAS subunit contains covalently bound cofactor, pyridoxal 5'-phosphate (PLP), whereas the second is PLP free. Comparison between the subunits reveals PLP-coupled reordering of the active site and of additional regions to achieve the active conformation of the enzyme. The eukaryotic C-terminal extension, a region altered in multiple human disease alleles, wraps around the dimer and contacts active-site-proximal residues. Mutational analysis demonstrates that this C-terminal region that engages the active site is important for ALAS activity. Our discovery of structural elements that change conformation upon PLP binding and of direct contact between the C-terminal extension and the active site thus provides a structural basis for investigation of disruptions in the first step of heme biosynthesis and resulting human disorders. Copyright © 2018 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Müller, Christian; Hjort, C.M.; Hansen, K.
2002-01-01
In Aspergillus oryzae, one full-length chitin synthase (chsB) and fragments of two other chitin synthases (csmA and chsC) were identified. The deduced amino acid sequence of chsB was similar (87% identity) to chsB from Aspergillus nidulans, which encodes a class III chitin synthase. The sequence...
International Nuclear Information System (INIS)
Aqeel Ashraf, M.; Jamil Maah, M.; Yusuf, I.
2012-01-01
Cr(III), Co(II), Ni(II), Cu(II) and Zn(II) salts of 2-(4-nitro phenylaminocarbonyl)benzoic acid were characterized by physical, analytical and spectroscopic studies and checked for their in-vitro antimicrobial activity against three bacterial strains, Mycobacterium smegmatis (Gram +ve), Escherichia coli (Gram -ve), Pseudomonas aeuroginosa (Gram -ve) and three fungal strains, Nigrospora oryzae, Aspergillus niger and Candida albicans. The antimicrobial activities of the metal complexes - were found to be greater than those of 2-(4-nitro phenylaminocarbonyl)benzoic acid alone.
Radtke, O.A.; Kiderlen, A.F.; Kayser, Oliver; Kolodziej, H
2004-01-01
The effects of gallic acid on the gene expressions of inducible nitric oxide synthase (iNOS) and the cytokines interleukin (IL)-1, IL-10, IL-12, IL-18, TNF-alpha, and interferon (IFN)-gamma were investigated by reverse-transcription polymerase chain reaction (RT-PCR). The experiments were performed
Jones, Sara E; Whitehead, Kristi; Saulnier, Delphine; Thomas, Carissa M; Versalovic, James; Britton, Robert A
2011-01-01
Although commensal microbes have been shown to modulate host immune responses, many of the bacterial factors that mediate immune regulation remain unidentified. Select strains of human-derived Lactobacillus reuteri synthesize immunomodulins that potently inhibit production of the inflammatory cytokine TNF. In this study, genetic and genomic approaches were used to identify and investigate L. reuteri genes required or human TNF immunomodulatory activity. Analysis of membrane fatty acids from multiple L. reuteri strains cultured in MRS medium showed that only TNF inhibitory strains produced the cyclopropane fatty acid (CFA) lactobacillic acid. The enzyme cyclopropane fatty acid synthase is required for synthesis of CFAs such as lactobacillic acid, therefore the cfa gene was inactivated and supernatants from the cfa mutant strain were assayed for TNF inhibitory activity. We found that supernatants from the wild-type strain, but not the cfa mutant, suppressed TNF production by activated THP-1 human monocytoid cells Although this suggested a direct role for lactobacillic acid in immunomodulation, purified lactobacillic acid did not suppress TNF at physiologically relevant concentrations. We further analyzed TNF inhibitory and TNF non-inhibitory strains under different growth conditions and found that lactobacillic acid production did not correlate with TNF inhibition. These results indicate that cfa indirectly contributed to L. reuter immunomodulatory activity and suggest that other mechanisms, such as decreased membrane fluidity or altered expression of immunomodulins, result in the loss of TNF inhibitory activity. By increasing our understanding of immunomodulation by probiotic species, beneficial microbes can be rationally selected to alleviate intestinal inflammation.
Broadbent, J R; Oberg, T S; Hughes, J E; Ward, R E; Brighton, C; Welker, D L; Steele, J L
2014-03-01
Lactic acid is an important industrial chemical commonly produced through microbial fermentation. The efficiency of acid extraction is increased at or below the acid's pKa (pH 3.86), so there is interest in factors that allow for a reduced fermentation pH. We explored the role of cyclopropane synthase (Cfa) and polysorbate (Tween) 80 on acid production and membrane lipid composition in Lactobacillus casei ATCC 334 at low pH. Cells from wild-type and an ATCC 334 cfa knockout mutant were incubated in APT broth medium containing 3 % glucose plus 0.02 or 0.2 % Tween 80. The cultures were allowed to acidify the medium until it reached a target pH (4.5, 4.0, or 3.8), and then the pH was maintained by automatic addition of NH₄OH. Cells were collected at the midpoint of the fermentation for membrane lipid analysis, and media samples were analyzed for lactic and acetic acids when acid production had ceased. There were no significant differences in the quantity of lactic acid produced at different pH values by wild-type or mutant cells grown in APT, but the rate of acid production was reduced as pH declined. APT supplementation with 0.2 % Tween 80 significantly increased the amount of lactic acid produced by wild-type cells at pH 3.8, and the rate of acid production was modestly improved. This effect was not observed with the cfa mutant, which indicated Cfa activity and Tween 80 supplementation were each involved in the significant increase in lactic acid yield observed with wild-type L. casei at pH 3.8.
Engineering a Polyketide Synthase for In Vitro Production of Adipic Acid
Energy Technology Data Exchange (ETDEWEB)
Hagen, A; Poust, S; De Rond, T; Fortman, JL; Katz, L; Petzold, CJ; Keasling, JD
2015-10-26
Polyketides have enormous structural diversity, yet polyketide synthases (PKSs) have thus far been engineered to produce only drug candidates or derivatives thereof. Thousands of other molecules, including commodity and specialty chemicals, could be synthesized using PKSs if composing hybrid PKSs from well-characterized parts derived from natural PKSs was more efficient. Here, using modern mass spectrometry techniques as an essential part of the design–build–test cycle, we engineered a chimeric PKS to enable production one of the most widely used commodity chemicals, adipic acid. To accomplish this, we introduced heterologous reductive domains from various PKS clusters into the borrelidin PKS’ first extension module, which we previously showed produces a 3-hydroxy-adipoyl intermediate when coincubated with the loading module and a succinyl-CoA starter unit. Acyl-ACP intermediate analysis revealed an unexpected bottleneck at the dehydration step, which was overcome by introduction of a carboxyacyl-processing dehydratase domain. Appending a thioesterase to the hybrid PKS enabled the production of free adipic acid. Using acyl-intermediate based techniques to “debug” PKSs as described here, it should one day be possible to engineer chimeric PKSs to produce a variety of existing commodity and specialty chemicals, as well as thousands of chemicals that are difficult to produce from petroleum feedstocks using traditional synthetic chemistry.
Directory of Open Access Journals (Sweden)
Nabila Bensacia
2015-01-01
Full Text Available Potentiometric titration of poly(acrylic acid and hydroquinone-functionalized poly(acrylic acid was conducted in the presence of copper (II. The effects of hydroquinone functionalizing and copper (II complexing on the potentiometric titration of poly(acrylic acid were studied in an ionic environment and in its absence. Henderson-Hasselbalch equation was applied to assess its validity for this titration. Coordination number and the stability constants of the copper- (II-complexed polymers were determined, and results showed the formation of mostly monodentate and bidentate copper- (II-polymer complexes.
Use of linalool synthase in genetic engineering of scent production
Pichersky, Eran
1998-01-01
A purified S-linalool synthase polypeptide from Clarkia breweri is disclosed as is the recombinant polypeptide and nucleic acid sequences encoding the polypeptide. Also disclosed are antibodies immunoreactive with the purified peptide and with recombinant versions of the polypeptide. Methods of using the nucleic acid sequences, as well as methods of enhancing the smell and the flavor of plants expressing the nucleic acid sequences are also disclosed.
Directory of Open Access Journals (Sweden)
La Harimu
2010-06-01
Full Text Available Fe (III, Cr(III, Cu(II, Ni(II, Co(II, and Pb(II metal ions had been separated using poly(eugenyl oxyacetic acid as an ion carrier by bulk liquid membrane transport method. The effect of pH, polyeugenyl oxyacetic acid ion carrier concentration, nitric acid concentration in the stripping solution, transport time, and metal concentration were optimized. The result showed that the optimum condition for transport of metal ions was at pH 4 for ion Fe(III and at pH 5 for Cr(III, Cu(II, Ni(II, Co(II, and Pb(II ions. The carrier volumes were optimum with concentration of 1 x 10-3 M at 7.5 mL for Cr(III, Cu (II, Ni(II, Co(II ions and at 8.5 mL for Fe(III and Pb(II ions. The concentration of HNO3 in stripping phase was optimum at 2 M for Fe(III and Cu(II ions, 1 M for Cr(III, Ni(II and Co(II ions, and 0.5 M for Pb(II ion. The optimum transport times were 36 h for Fe(III and Co(II ions, and 48 h for Cr(III, Cu (II, Ni(II, and Pb(II ions. The concentration of metal ions accurately transported were 2.5 x 10-4 M for Fe(III and Cr(III ions, and 1 M for Cu (II, Ni(II, Co(II, and Pb(II ions. Compared to other metal ions the transport of Fe(III was the highest with selectivity order of Fe(III > Cr(III > Pb(II > Cu(II > Ni(II > Co(II. At optimum condition, Fe(III ion was transported through the membrane at 46.46%. Keywords: poly(eugenyl oxyacetic acid, transport, liquid membrane, Fe (III, Cr(III, Cu(II, Ni(II, Co(II, and Pb(II ions
Prostaglandin H synthase-mediated bioactivation of the amino acid pyrolysate product Trp P-2
Energy Technology Data Exchange (ETDEWEB)
Petry, T.W.; Krauss, R.S.; Eling, T.E.
1986-08-01
We report evidence that the mutagen and carcinogen 3-amino-1-methyl-5H pyrido(4,3b)indole (Trp P-2) is a substrate for co-oxidation by prostaglandin H synthase (PHS) in ram seminal vesicle (RSV) microsomes. Trp P-2 serves as a reducing cofactor for the hydroperoxidase activity of PHS as shown by the concentration-dependent inhibition of the hydroperoxidase catalyzed incorporation of molecular oxygen into phenylbutazone. Spectral data suggest that this metabolism results in disruption of the double bond conjugation within the nucleus of the molecule. A single metabolite peak which was dependent upon arachidonic acid and substrate concentration was separated from the parent compound by h.p.l.c. following incubation with RSV microsomes. Co-oxidation of Trp P-2 produced reactive intermediates which bound covalently to microsomal protein (9 nmol/mg) and to calf thymus DNA (475 pmol/mg). Binding was inhibited by indomethacin, and supported by substitution of hydrogen peroxide for arachidonic acid. These data suggest a possible role for PHS in the in situ activation of Trp P-2 to its ultimate carcinogenic form in tissues which contain PHS.
Al-Bahlani, Shadia; Al-Lawati, Hanaa; Al-Adawi, Moza; Al-Abri, Nadia; Al-Dhahli, Buthaina; Al-Adawi, Kawther
2017-06-01
Fatty acid synthase (FASN) is a key enzyme in fat biosynthesis that is over-expressed in advanced breast cancer stages. Cisplatin (CDDP) is a platinum-based drug used in the treatment of certain types of this disease. Although it was shown that FASN inhibition induced apoptosis by enhancing the cytotoxicity of certain drugs in breast cancer, its role in regulating the chemosensitivity of different types of breast cancer cells to CDDP-induced apoptosis is not established yet. Therefore, two different breast cancer cell lines; triple negative breast cancer (TNBC; MDA-MB-231) and triple positive breast cancer (TPBC; BT-474) cells were used to examine such role. We show that TNBC cells had naturally less fat content than TPBC cells. Subsequently, the fat content increased in both cells when treated with Palmitate rather than Oleate, whereas both fatty acids produced apoptotic ultra-structural effects and attenuated FASN expression. However, Oleate increased FASN expression in TPBC cells. CDDP decreased FASN expression and increased apoptosis in TNBC cells. These effects were further enhanced by combining CDDP with fatty acids. We also illustrate that the inhibition of FASN by either siRNA or exogenous inhibitor decreased CDDP-induced apoptosis in TPBC cells suggesting its role as an apoptotic factor, while an opposite finding was observed in TNBC cells when siRNA and fatty acids were used, suggesting its role as a survival factor. To our knowledge, we are the first to demonstrate a dual role of FASN in CDDP-induced apoptosis in breast cancer cells and how it can modulate their chemosensitivity.
Cloning and expression of pineapple sucrosephosphate synthase ...
African Journals Online (AJOL)
A 1132-base pairs (bp) polymerase-chain-reaction product of sucrose-phosphate synthase (SPS) (EC 2.3.1.14) from pineapple (Ananas comosus cv. Comte de paris) fruit was cloned and nominated as Ac- SPS1. The sequence encodes a putative 377 amino acids protein containing two serine conserved features that had ...
Lassner, M W; Lardizabal, K; Metz, J G
1996-02-01
beta-Ketoacyl-coenzyme A (CoA) synthase (KCS) catalyzes the condensation of malonyl-CoA with long-chain acyl-CoA. This reaction is the initial step of the microsomal fatty acyl-CoA elongation pathway responsible for formation of very long chain fatty acids (VLCFAs, or fatty acids with chain lengths > 18 carbons). Manipulation of this pathway is significant for agriculture, because it is the basis of conversion of high erucic acid rapeseed into canola. High erucic acid rapeseed oil, used as an industrial feedstock, is rich in VLCFAs, whereas the edible oil extracted from canola is essentially devoid of VLCFAs. Here, we report the cloning of a cDNA from developing jojoba embryos involved in microsomal fatty acid elongation. The jojoba cDNA is homologous to the recently cloned Arabidopsis FATTY ACID ELONGATION1 (FAE1) gene that has been suggested to encode KCS. We characterize the jojoba enzyme and present biochemical data indicating that the jojoba cDNA does indeed encode KCS. Transformation of low erucic acid rapeseed with the jojoba cDNA restored KCS activity to developing embryos and altered the transgenic seed oil composition to contain high levels of VLCFAs. The data reveal the key role KCS plays in determining the chain lengths of fatty acids found in seed oils.
Potent Inhibitory Effect of Chinese Dietary Spices on Fatty Acid Synthase.
Jiang, Bing; Liang, Yan; Sun, Xuebing; Liu, Xiaoxin; Tian, Weixi; Ma, Xiaofeng
2015-09-01
Dietary spices have been adopted in cooking since ancient times to enhance flavor and also as food preservatives and disease remedies. In China, the use of spices and other aromatic plants as food flavoring is an integral part of dietary behavior, but relatively little is known about their functions. Fatty acid synthase (FAS) has been recognized as a remedy target, and its inhibitors might be applied in disease treatment. The present work was designed to assess the inhibitory activities on FAS of spices extracts in Chinese menu. The in vitro inhibitory activities on FAS of 22 extracts of spices were assessed by spectrophotometrically monitoring oxidation of NADPH at 340 nm. Results showed that 20 spices extracts (90.9 %) exhibited inhibitory activities on FAS, with half inhibition concentration (IC(50)) values ranging from 1.72 to 810.7 μg/ml. Among them, seven spices showed strong inhibitory effect with IC(50) values lower than 10 μg/ml. These findings suggest that a large proportion of the dietary spices studied possess promising inhibitory activities on FAS, and subsequently might be applied in the treatment of obesity and obesity-related human diseases.
Hopperton, Kathryn E; Duncan, Robin E; Bazinet, Richard P; Archer, Michael C
2014-01-15
Fatty acid synthase is over-expressed in many cancers and its activity is required for cancer cell survival, but the role of endogenously synthesized fatty acids in cancer is unknown. It has been suggested that endogenous fatty acid synthesis is either needed to support the growth of rapidly dividing cells, or to maintain elevated glycolysis (the Warburg effect) that is characteristic of cancer cells. Here, we investigate both hypotheses. First, we compared utilization of fatty acids synthesized endogenously from (14)C-labeled acetate to those supplied exogenously as (14)C-labeled palmitate in the culture medium in human breast cancer (MCF-7 and MDA-MB-231) and untransformed breast epithelial cells (MCF-10A). We found that cancer cells do not produce fatty acids that are different from those derived from exogenous palmitate, that these fatty acids are esterified to the same lipid and phospholipid classes in the same proportions, and that their distribution within neutral lipids is not different from untransformed cells. These results suggest that endogenously synthesized fatty acids do not fulfill a specific function in cancer cells. Furthermore, we observed that cancer cells excrete endogenously synthesized fatty acids, suggesting that they are produced in excess of requirements. We next investigated whether lipogenic activity is involved in the maintenance of high glycolytic activity by culturing both cancer and non-transformed cells under anoxic conditions. Although anoxia increased glycolysis 2-3 fold, we observed no concomitant increase in lipogenesis. Our results indicate that breast cancer cells do not have a specific qualitative or quantitative requirement for endogenously synthesized fatty acids and that increased de novo lipogenesis is not required to sustain elevations in glycolytic activity induced by anoxia in these cells. © 2013 The Authors. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Max Hirte
2018-04-01
Full Text Available Diterpene synthases catalyze complex, multi-step C-C coupling reactions thereby converting the universal, aliphatic precursor geranylgeranyl diphosphate into diverse olefinic macrocylces that form the basis for the structural diversity of the diterpene natural product family. Since catalytically relevant crystal structures of diterpene synthases are scarce, homology based biomolecular modeling techniques offer an alternative route to study the enzyme's reaction mechanism. However, precise identification of catalytically relevant amino acids is challenging since these models require careful preparation and refinement techniques prior to substrate docking studies. Targeted amino acid substitutions in this protein class can initiate premature quenching of the carbocation centered reaction cascade. The structural characterization of those alternative cyclization products allows for elucidation of the cyclization reaction cascade and provides a new source for complex macrocyclic synthons. In this study, new insights into structure and function of the fungal, bifunctional Aphidicolan-16-ß-ol synthase were achieved using a simplified biomolecular modeling strategy. The applied refinement methodologies could rapidly generate a reliable protein-ligand complex, which provides for an accurate in silico identification of catalytically relevant amino acids. Guided by our modeling data, ACS mutations lead to the identification of the catalytically relevant ACS amino acid network I626, T657, Y658, A786, F789, and Y923. Moreover, the ACS amino acid substitutions Y658L and D661A resulted in a premature termination of the cyclization reaction cascade en-route from syn-copalyl diphosphate to Aphidicolan-16-ß-ol. Both ACS mutants generated the diterpene macrocycle syn-copalol and a minor, non-hydroxylated labdane related diterpene, respectively. Our biomolecular modeling and mutational studies suggest that the ACS substrate cyclization occurs in a spatially
Hirte, Max; Meese, Nicolas; Mertz, Michael; Fuchs, Monika; Brück, Thomas B
2018-01-01
Diterpene synthases catalyze complex, multi-step C-C coupling reactions thereby converting the universal, aliphatic precursor geranylgeranyl diphosphate into diverse olefinic macrocylces that form the basis for the structural diversity of the diterpene natural product family. Since catalytically relevant crystal structures of diterpene synthases are scarce, homology based biomolecular modeling techniques offer an alternative route to study the enzyme's reaction mechanism. However, precise identification of catalytically relevant amino acids is challenging since these models require careful preparation and refinement techniques prior to substrate docking studies. Targeted amino acid substitutions in this protein class can initiate premature quenching of the carbocation centered reaction cascade. The structural characterization of those alternative cyclization products allows for elucidation of the cyclization reaction cascade and provides a new source for complex macrocyclic synthons. In this study, new insights into structure and function of the fungal, bifunctional Aphidicolan-16-ß-ol synthase were achieved using a simplified biomolecular modeling strategy. The applied refinement methodologies could rapidly generate a reliable protein-ligand complex, which provides for an accurate in silico identification of catalytically relevant amino acids. Guided by our modeling data, ACS mutations lead to the identification of the catalytically relevant ACS amino acid network I626, T657, Y658, A786, F789, and Y923. Moreover, the ACS amino acid substitutions Y658L and D661A resulted in a premature termination of the cyclization reaction cascade en-route from syn-copalyl diphosphate to Aphidicolan-16-ß-ol. Both ACS mutants generated the diterpene macrocycle syn-copalol and a minor, non-hydroxylated labdane related diterpene, respectively. Our biomolecular modeling and mutational studies suggest that the ACS substrate cyclization occurs in a spatially restricted location of
Hirte, Max; Meese, Nicolas; Mertz, Michael; Fuchs, Monika; Brück, Thomas B.
2018-04-01
Diterpene synthases catalyze complex, multi-step C-C coupling reactions thereby converting the universal, aliphatic precursor geranylgeranyl diphosphate into diverse olefinic macrocylces that form the basis for the structural diversity of the diterpene natural product family. Since catalytically relevant crystal structures of diterpene synthases are scarce, homology based biomolecular modelling techniques offer an alternative route to study the enzyme’s reaction mechanism. However, precise identification of catalytically relevant amino acids is challenging since these models require careful preparation and refinement techniques prior to substrate docking studies. Targeted amino acid substitutions in this protein class can initiate premature quenching of the carbocation centered reaction cascade. The structural characterization of those alternative cyclization products allows for elucidation of the cyclization reaction cascade and provides a new source for complex macrocyclic synthons. In this study, new insights into structure and function of the fungal, bifunctional Aphidicolan-16-ß-ol synthase were achieved using a simplified biomolecular modelling strategy. The applied refinement methodologies could rapidly generate a reliable protein-ligand complex, which provides for an accurate in silico identification of catalytically relevant amino acids. Guided by our modelling data, ACS mutations lead to the identification of the catalytically relevant ACS amino acid network I626, T657, Y658, A786, F789 and Y923. Moreover, the ACS amino acid substitutions Y658L and D661A resulted in a premature termination of the cyclization reaction cascade en-route from syn-copalyl diphosphate to Aphidicolan-16-ß-ol. Both ACS mutants generated the diterpene macrocycle syn-copalol and a minor, non-hydroxylated labdane related diterpene, respectively. Our biomolecular modelling and mutational studies suggest that the ACS substrate cyclization occurs in a spatially restricted location
Ivontsin, L. A.; Mashkovtseva, E. V.; Nartsissov, Ya R.
2017-11-01
Implications of quantum-mechanical approach to the description of proton transport in biological systems are a tempting subject for an overlapping of fundamental physics and biology. The model of proton transport through the integrated membrane enzyme FoF1-ATP synthase responsible for ATP synthesis was developed. The estimation of the mathematical expectation of the proton transfer time through the half-channel was performed. Observed set of proton pathways through the inlet half-channel showed the nanosecond timescale highly dependable of some amino acid residues. There were proposed two types of crucial amino acids: critically localized (His245) and being a part of energy conserving system (Asp119).
Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants
Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE
2007-07-10
Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.
Energy Technology Data Exchange (ETDEWEB)
Halavaty, Andrei S. [Center for Structural Genomics of Infectious Diseases, (United States); Northwestern University, Chicago, IL 60611 (United States); Kim, Youngchang [Center for Structural Genomics of Infectious Diseases, (United States); Argonne National Laboratory, Argonne, IL 60439 (United States); University of Chicago, Chicago, IL 60637 (United States); Minasov, George; Shuvalova, Ludmilla; Dubrovska, Ievgeniia; Winsor, James [Center for Structural Genomics of Infectious Diseases, (United States); Northwestern University, Chicago, IL 60611 (United States); Zhou, Min [Center for Structural Genomics of Infectious Diseases, (United States); Argonne National Laboratory, Argonne, IL 60439 (United States); University of Chicago, Chicago, IL 60637 (United States); Onopriyenko, Olena; Skarina, Tatiana [Center for Structural Genomics of Infectious Diseases, (United States); University of Toronto, Toronto, Ontario M5G 1L6 (Canada); Papazisi, Leka; Kwon, Keehwan; Peterson, Scott N. [Center for Structural Genomics of Infectious Diseases, (United States); J. Craig Venter Institute, Rockville, MD 20850 (United States); Joachimiak, Andrzej [Center for Structural Genomics of Infectious Diseases, (United States); Argonne National Laboratory, Argonne, IL 60439 (United States); University of Chicago, Chicago, IL 60637 (United States); Savchenko, Alexei [Center for Structural Genomics of Infectious Diseases, (United States); University of Toronto, Toronto, Ontario M5G 1L6 (Canada); Anderson, Wayne F., E-mail: wf-anderson@northwestern.edu [Center for Structural Genomics of Infectious Diseases, (United States); Northwestern University, Chicago, IL 60611 (United States)
2012-10-01
The structural characterization of acyl-carrier-protein synthase (AcpS) from three different pathogenic microorganisms is reported. One interesting finding of the present work is a crystal artifact related to the activity of the enzyme, which fortuitously represents an opportunity for a strategy to design a potential inhibitor of a pathogenic AcpS. Some bacterial type II fatty-acid synthesis (FAS II) enzymes have been shown to be important candidates for drug discovery. The scientific and medical quest for new FAS II protein targets continues to stimulate research in this field. One of the possible additional candidates is the acyl-carrier-protein synthase (AcpS) enzyme. Its holo form post-translationally modifies the apo form of an acyl carrier protein (ACP), which assures the constant delivery of thioester intermediates to the discrete enzymes of FAS II. At the Center for Structural Genomics of Infectious Diseases (CSGID), AcpSs from Staphylococcus aureus (AcpS{sub SA}), Vibrio cholerae (AcpS{sub VC}) and Bacillus anthracis (AcpS{sub BA}) have been structurally characterized in their apo, holo and product-bound forms, respectively. The structure of AcpS{sub BA} is emphasized because of the two 3′, 5′-adenosine diphosphate (3′, 5′-ADP) product molecules that are found in each of the three coenzyme A (CoA) binding sites of the trimeric protein. One 3′, 5′-ADP is bound as the 3′, 5′-ADP part of CoA in the known structures of the CoA–AcpS and 3′, 5′-ADP–AcpS binary complexes. The position of the second 3′, 5′-ADP has never been described before. It is in close proximity to the first 3′, 5′-ADP and the ACP-binding site. The coordination of two ADPs in AcpS{sub BA} may possibly be exploited for the design of AcpS inhibitors that can block binding of both CoA and ACP.
International Nuclear Information System (INIS)
Halavaty, Andrei S.; Kim, Youngchang; Minasov, George; Shuvalova, Ludmilla; Dubrovska, Ievgeniia; Winsor, James; Zhou, Min; Onopriyenko, Olena; Skarina, Tatiana; Papazisi, Leka; Kwon, Keehwan; Peterson, Scott N.; Joachimiak, Andrzej; Savchenko, Alexei; Anderson, Wayne F.
2012-01-01
The structural characterization of acyl-carrier-protein synthase (AcpS) from three different pathogenic microorganisms is reported. One interesting finding of the present work is a crystal artifact related to the activity of the enzyme, which fortuitously represents an opportunity for a strategy to design a potential inhibitor of a pathogenic AcpS. Some bacterial type II fatty-acid synthesis (FAS II) enzymes have been shown to be important candidates for drug discovery. The scientific and medical quest for new FAS II protein targets continues to stimulate research in this field. One of the possible additional candidates is the acyl-carrier-protein synthase (AcpS) enzyme. Its holo form post-translationally modifies the apo form of an acyl carrier protein (ACP), which assures the constant delivery of thioester intermediates to the discrete enzymes of FAS II. At the Center for Structural Genomics of Infectious Diseases (CSGID), AcpSs from Staphylococcus aureus (AcpS SA ), Vibrio cholerae (AcpS VC ) and Bacillus anthracis (AcpS BA ) have been structurally characterized in their apo, holo and product-bound forms, respectively. The structure of AcpS BA is emphasized because of the two 3′, 5′-adenosine diphosphate (3′, 5′-ADP) product molecules that are found in each of the three coenzyme A (CoA) binding sites of the trimeric protein. One 3′, 5′-ADP is bound as the 3′, 5′-ADP part of CoA in the known structures of the CoA–AcpS and 3′, 5′-ADP–AcpS binary complexes. The position of the second 3′, 5′-ADP has never been described before. It is in close proximity to the first 3′, 5′-ADP and the ACP-binding site. The coordination of two ADPs in AcpS BA may possibly be exploited for the design of AcpS inhibitors that can block binding of both CoA and ACP
α-Lipoic acid prevents lipotoxic cardiomyopathy in acyl CoA-synthase transgenic mice
International Nuclear Information System (INIS)
Lee, Young; Naseem, R. Haris; Park, Byung-Hyun; Garry, Daniel J.; Richardson, James A.; Schaffer, Jean E.; Unger, Roger H.
2006-01-01
α-Lipoic acid (α-LA) mimics the hypothalamic actions of leptin on food intake, energy expenditure, and activation of AMP-activated protein kinase (AMPK). To determine if, like leptin, α-LA protects against cardiac lipotoxicity, α-LA was fed to transgenic mice with cardiomyocyte-specific overexpression of the acyl CoA synthase (ACS) gene. Untreated ACS-transgenic mice died prematurely with increased triacylglycerol content and dilated cardiomyopathy, impaired systolic function and myofiber disorganization, apoptosis, and interstitial fibrosis on microscopy. In α-LA-treated ACS-transgenic mice heart size, echocardiogram and TG content were normal. Plasma TG fell 50%, hepatic-activated phospho-AMPK rose 6-fold, sterol regulatory element-binding protein-1c declined 50%, and peroxisome proliferator-activated receptor-γ cofactor-1α mRNA rose 4-fold. Since food restriction did not prevent lipotoxicity, we conclude that α-LA treatment, like hyperleptinemia, protects the heart of ACS-transgenic mice from lipotoxicity
Fatty acid synthase inhibition triggers apoptosis during S phase in human cancer cells.
Zhou, Weibo; Simpson, P Jeanette; McFadden, Jill M; Townsend, Craig A; Medghalchi, Susan M; Vadlamudi, Aravinda; Pinn, Michael L; Ronnett, Gabriele V; Kuhajda, Francis P
2003-11-01
C75, an inhibitor of fatty acid synthase (FAS), induces apoptosis in cultured human cancer cells. Its proposed mechanism of action linked high levels of malonyl-CoA after FAS inhibition to potential downstream effects including inhibition of carnitine palmitoyltransferase-1 (CPT-1) with resultant inhibition of fatty acid oxidation. Recent data has shown that C75 directly stimulates CPT-1 increasing fatty acid oxidation in MCF-7 human breast cancer cells despite inhibitory concentrations of malonyl-CoA. In light of these findings, we have studied fatty acid metabolism in MCF7 human breast cancer cells to elucidate the mechanism of action of C75. We now report that: (a) in the setting of increased fatty acid oxidation, C75 inhibits fatty acid synthesis; (b) C273, a reduced form of C75, is unable to inhibit fatty acid synthesis and is nontoxic to MCF7 cells; (c) C75 and 5-(tetradecyloxy)-2-furoic acid (TOFA), an inhibitor of acetyl-CoA carboxylase, both cause a significant reduction of fatty acid incorporation into phosphatidylcholine, the major membrane phospholipid, within 2 h; (d) pulse chase studies with [(14)C]acetate labeling of membrane lipids show that both C75 and TOFA accelerate the decay of (14)C-labeled lipid from membranes within 2 h; (e) C75 also promotes a 2-3-fold increase in oxidation of membrane lipids within 2 h; and (f) because interference with phospholipid synthesis during S phase is known to trigger apoptosis in cycling cells, we performed double-labeled terminal deoxynucleotidyltransferase-mediated nick end labeling and BrdUrd analysis with both TOFA and C75. C75 triggered apoptosis during S phase, whereas TOFA did not. Moreover, application of TOFA 2 h before C75 blocked the C75 induced apoptosis, whereas etomoxir did not. Taken together these data indicate that FAS inhibition and its downstream inhibition of phospholipid production is a necessary part of the mechanism of action of C75. CPT-1 stimulation does not likely play a role in the
Karuppiah, Vijaykumar; Ranaghan, Kara E.; Leferink, Nicole G. H.; Johannissen, Linus O.; Shanmugam, Muralidharan; Ní Cheallaigh, Aisling; Bennett, Nathan J.; Kearsey, Lewis J.; Takano, Eriko; Gardiner, John M.; van der Kamp, Marc W.; Hay, Sam; Mulholland, Adrian J.; Leys, David; Scrutton, Nigel S.
2017-01-01
Terpenoids form the largest and stereochemically most diverse class of natural products, and there is considerable interest in producing these by biocatalysis with whole cells or purified enzymes, and by metabolic engineering. The monoterpenes are an important class of terpenes and are industrially important as flavors and fragrances. We report here structures for the recently discovered Streptomyces clavuligerus monoterpene synthases linalool synthase (bLinS) and 1,8-cineole synthase (bCinS)...
Niazi, Zahid Rasul; Silva, Grazielle C; Ribeiro, Thais Porto; León-González, Antonio J; Kassem, Mohamad; Mirajkar, Abdur; Alvi, Azhar; Abbas, Malak; Zgheel, Faraj; Schini-Kerth, Valérie B; Auger, Cyril
2017-12-01
Eicosapentaenoic acid:docosahexaenoic acid (EPA:DHA) 6:1, an omega-3 polyunsaturated fatty acid formulation, has been shown to induce a sustained formation of endothelial nitric oxide (NO) synthase-derived NO, a major vasoprotective factor. This study examined whether chronic intake of EPA:DHA 6:1 prevents hypertension and endothelial dysfunction induced by angiotensin II (Ang II) in rats. Male Wister rats received orally corn oil or EPA:DHA 6:1 (500 mg kg -1 per day) before chronic infusion of Ang II (0.4 mg kg -1 per day). Systolic blood pressure was determined by tail cuff sphingomanometry, vascular reactivity using a myograph, oxidative stress using dihydroethidium and protein expression by immunofluorescence and western blot analysis. Ang II-induced hypertension was associated with reduced acetylcholine-induced relaxations of secondary branch mesenteric artery rings affecting the endothelium-dependent hyperpolarization (EDH)- and the NO-mediated relaxations, both of which were improved by the NADPH oxidase inhibitor VAS-2870. The Ang II treatment induced also endothelium-dependent contractile responses (EDCFs), which were abolished by the cyclooxygenase (COX) inhibitor indomethacin. An increased level of vascular oxidative stress and expression of NADPH oxidase subunits (p47 phox and p22 phox ), COX-1 and COX-2, endothelial NO synthase and Ang II type 1 receptors were observed in the Ang II group, whereas SK Ca and connexin 37 were downregulated. Intake of EPA:DHA 6:1 prevented the Ang II-induced hypertension and endothelial dysfunction by improving both the NO- and EDH-mediated relaxations, and by reducing EDCFs and the expression of target proteins. The present findings indicate that chronic intake of EPA:DHA 6:1 prevented the Ang II-induced hypertension and endothelial dysfunction in rats, most likely by preventing NADPH oxidase- and COX-derived oxidative stress.
Demissie, Zerihun A; Erland, Lauren A E; Rheault, Mark R; Mahmoud, Soheil S
2013-03-01
Lavender essential oils are constituted predominantly of regular monoterpenes, for example linalool, 1,8-cineole, and camphor. However, they also contain irregular monoterpenes including lavandulol and lavandulyl acetate. Although the majority of genes responsible for the production of regular monoterpenes in lavenders are now known, enzymes (including lavandulyl diphosphate synthase (LPPS)) catalyzing the biosynthesis of irregular monoterpenes in these plants have not been described. Here, we report the isolation and functional characterization of a novel cis-prenyl diphosphate synthase cDNA, termed Lavandula x intermedia lavandulyl diphosphate synthase (LiLPPS), through a homology-based cloning strategy. The LiLPPS ORF, encoding for a 305-amino acid long protein, was expressed in Escherichia coli, and the recombinant protein was purified by nickel-nitrilotriacetic acid affinity chromatography. The approximately 34.5-kDa bacterially produced protein specifically catalyzed the head-to-middle condensation of two dimethylallyl diphosphate units to LPP in vitro with apparent Km and kcat values of 208 ± 12 μm and 0.1 s(-1), respectively. LiLPPS is a homodimeric enzyme with a sigmoidal saturation curve and Hill coefficient of 2.7, suggesting a positive co-operative interaction among its catalytic sites. LiLPPS could be used to modulate the production of lavandulol and its derivatives in plants through metabolic engineering.
An Arabidopsis callose synthase
DEFF Research Database (Denmark)
Ostergaard, Lars; Petersen, Morten; Mattsson, Ole
2002-01-01
in the Arabidopsis mpk4 mutant which exhibits systemic acquired resistance (SAR), elevated beta-1,3-glucan synthase activity, and increased callose levels. In addition, AtGsl5 is a likely target of salicylic acid (SA)-dependent SAR, since AtGsl5 mRNA accumulation is induced by SA in wild-type plants, while...... expression of the nahG salicylate hydroxylase reduces AtGsl5 mRNA levels in the mpk4 mutant. These results indicate that AtGsl5 is likely involved in callose synthesis in flowering tissues and in the mpk4 mutant....
HAEM SYNTHASE AND COBALT PORPHYRIN SYNTHASE IN VARIOUS MICRO-ORGANISMS.
PORRA, R J; ROSS, B D
1965-03-01
1. The preparation of a crude extract of Clostridium tetanomorphum containing cobalt porphyrin synthase but little haem-synthase activity is described. 2. The properties of cobalt porphyrin synthase in the clostridial extracts is compared with the properties of a haem synthase present in crude extracts of the yeast Torulopsis utilis. 3. Cobalt porphyrin synthase in extracts of C. tetanomorphum inserts Co(2+) ions into the following dicarboxylic porphyrins in descending order of rate of insertion: meso-, deutero- and proto-porphyrins. Esterification renders meso- and deutero-porphyrins inactive as substrates. Neither the tetracarboxylic (coproporphyrin III) nor the octacarboxylic (uroporphyrin III) compounds are converted into cobalt porphyrins by the extract, but the non-enzymic incorporation of Co(2+) ions into these two porphyrins is rapid. These extracts are unable to insert Mn(2+), Zn(2+), Mg(2+) or Cu(2+) ions into mesoporphyrin. 4. Crude extracts of T. utilis readily insert both Co(2+) and Fe(2+) ions into deutero-, meso, and proto-porphyrins. Unlike the extracts of C. tetanomorphum, these preparations catalyse the insertion of Co(2+) ions into deuteroporphyrin more rapidly than into mesoporphyrin. This parallels the formation of haems by the T. utilis extract. 5. Cobalt porphyrin synthase is present in the particulate fraction of the extracts of C. tetanomorphum but requires a heat-stable factor present in the soluble fraction. This soluble factor can be replaced by GSH. 6. Cobalt porphyrin synthase in the clostridial extract is inhibited by iodoacetamide and to a smaller extent by p-chloromercuribenzoate and N-ethylmaleimide. The haem synthases of T. utilis and Micrococcus denitrificans are also inhibited by various thiol reagents.
Marini, A; Grether-Beck, S; Jaenicke, T; Weber, M; Burki, C; Formann, P; Brenden, H; Schönlau, F; Krutmann, J
2012-01-01
In recent years there has been an increasing interest in the use of nutritional supplements to benefit human skin. Molecular evidence substantiating such effects, however, is scarce. In the present study we investigated whether nutritional supplementation of women with the standardized pine bark extract Pycnogenol® will improve their cosmetic appearance and relate these effects to expression of corresponding molecular markers of their skin. For this purpose 20 healthy postmenopausal women were supplemented with Pycnogenol for 12 weeks. Before, during and after supplementation, their skin condition was assessed (i) by employing non-invasive, biophysical methods including corneometry, cutometry, visioscan and ultrasound analyses and (ii) by taking biopsies and subsequent PCR for gene expression analyses related to extracellular matrix homeostasis. Pycnogenol supplementation was well tolerated in all volunteers. Pycnogenol significantly improved hydration and elasticity of skin. These effects were most pronounced in women presenting with dry skin conditions prior to the start of supplementation. The skin-physiological improvement was accompanied by a significant increase in the mRNA expression of hyaluronic acid synthase-1 (HAS-1), an enzyme critically involved in the synthesis of hyaluronic acid, and a noticeable increase in gene expression involved in collagen de novo synthesis. This study provides skin-physiological and for the first time molecular evidence that Pycnogenol supplementation benefits human skin by increasing skin hydration and skin elasticity. These effects are most likely due to an increased synthesis of extracellular matrix molecules such as hyaluronic acid and possibly collagen. Pycnogenol supplementation may thus be useful to counteract the clinical signs of skin aging. Copyright © 2012 S. Karger AG, Basel.
Gonzalez, Veronica; Touchet, Sabrina; Grundy, Daniel J; Faraldos, Juan A; Allemann, Rudolf K
2014-10-15
Germacrene A synthase (GAS) from Solidago canadensis catalyzes the conversion of farnesyl diphosphate (FDP) to the plant sesquiterpene (+)-germacrene A. After diphosphate expulsion, farnesyl cation reacts with the distal 10,11-double bond to afford germacrene A (>96%) and <2% α-humulene, which arises from 1,11-cyclization of FDP. The origin of the 1,11-activity of GAS was investigated by amino acid sequence alignments of 1,10- and 1,11-synthases and comparisons of X-ray crystal structures with the homology model of GAS; a triad [Thr 401-Gly 402-Gly 403] that might be responsible for the predominant 1,10-cyclization activity of GAS was identified. Replacement of Gly 402 with residues of increasing size led to a progressive increase of 1,11-cyclization. The catalytic robustness of these 1,10- /1,11-GAS variants point to Gly 402 as a functional switch of evolutionary significance and suggests that enzymes with strict functionalities have evolved from less specific ancestors through a small number of substitutions. Similar results were obtained with germacrene D synthase (GDS) upon replacement of the homologous active-site residue Gly 404: GDS-G404V generated approximately 20% bicyclogermacrene, a hydrocarbon with a cyclopropane ring that underlines the dual 1,10-/1,11-cyclization activity of this mutant. This suggests that the reaction pathways to germacrenes and humulenes might be connected through a bridged 1,10,11-carbocation intermediate or transition state that resembles bicyclogermacrene. Mechanistic studies using [1-(3)H1]-10-fluorofarnesyl diphosphate and deuterium-labeling experiments with [12,13-(2)H6]-FDP support a germacrene-humulene rearrangement linking 1,10- and 1,11-pathways. These results support the bioinformatics proposal that modern 1,10-synthases could have evolved from promiscuous 1,11-sesquiterpene synthases.
Molecular cloning and characterization of strictosidine synthase, a ...
African Journals Online (AJOL)
Mitragynine is one of the most dominant indole alkaloids present in the leaves of Mitragyna speciosa, a species of Rubiaceae. This alkaloid is believed to be synthesized via condensation of the amino acid derivative, tryptamine and secologanine by the action of strictosidine synthase (STR). The cDNA clone encoding STR ...
The c-Ring of the F1FO-ATP Synthase: Facts and Perspectives.
Nesci, Salvatore; Trombetti, Fabiana; Ventrella, Vittoria; Pagliarani, Alessandra
2016-04-01
The F1FO-ATP synthase is the only enzyme in nature endowed with bi-functional catalytic mechanism of synthesis and hydrolysis of ATP. The enzyme functions, not only confined to energy transduction, are tied to three intrinsic features of the annular arrangement of c subunits which constitutes the so-called c-ring, the core of the membrane-embedded FO domain: (i) the c-ring constitution is linked to the number of ions (H(+) or Na(+)) channeled across the membrane during the dissipation of the transmembrane electrochemical gradient, which in turn determines the species-specific bioenergetic cost of ATP, the "molecular currency unit" of energy transfer in all living beings; (ii) the c-ring is increasingly involved in the mitochondrial permeability transition, an event linked to cell death and to most mitochondrial dysfunctions; (iii) the c subunit species-specific amino acid sequence and susceptibility to post-translational modifications can address antibacterial drug design according to the model of enzyme inhibitors which target the c subunits. Therefore, the simple c-ring structure not only allows the F1FO-ATP synthase to perform the two opposite tasks of molecular machine of cell life and death, but it also amplifies the enzyme's potential role as a drug target.
Esakova, Olga A; Silakov, Alexey; Grove, Tyler L; Saunders, Allison H; McLaughlin, Martin I; Yennawar, Neela H; Booker, Squire J
2016-06-15
Quinolinic acid (QA) is a common intermediate in the biosynthesis of nicotinamide adenine dinucleotide (NAD(+)) and its derivatives in all organisms that synthesize the molecule de novo. In most prokaryotes, it is formed from the condensation of dihydroxyacetone phosphate (DHAP) and aspartate-enamine by the action of quinolinate synthase (NadA). NadA contains a [4Fe-4S] cluster cofactor with a unique, non-cysteinyl-ligated, iron ion (Fea), which is proposed to bind the hydroxyl group of a postulated intermediate in the last step of the reaction to facilitate a dehydration. However, direct evidence for this role in catalysis has yet to be provided. Herein, we present the structure of NadA in the presence of the product of its reaction, QA. We find that N1 and the C7 carboxylate group of QA ligate to Fea in a bidentate fashion, which is confirmed by Hyperfine Sublevel Correlation (HYSCORE) spectroscopy. This binding mode would place the C5 hydroxyl group of the postulated final intermediate distal to Fea and virtually incapable of coordinating to it. The structure shows that three strictly conserved amino acids, Glu198, Tyr109, and Tyr23, are in close proximity to the bound product. Substitution of these amino acids with Gln, Phe, and Phe, respectively, leads to complete loss of activity.
Seo, Min-Ju; Kang, Woo-Ri; Shin, Kyung-Chul; Oh, Deok-Kun
2016-11-16
The reaction conditions for the production of 7S,8S-dihydroxy-9,12(Z,Z)-octadecadienoic acid from linoleic acid by recombinant Escherichia coli expressing 7,8-linoleate diol synthase from Glomerella cingulata were optimized using response surface methodology. The optimal reaction conditions were pH 7.0, 18.6 °C, 10.8% (v/v) dimethyl sulfoxide, 44.9 g/L cells, and 14.3 g/L linoleic acid, with agitation at 256 rpm. Under these conditions, recombinant cells produced 7,8-dihydroxy unsaturated fatty acids in the range of 7.0-9.8 g/L from 14.3 g/L linoleic acid, 14.3 g/L oleic acid, and plant oil hydrolysates such as waste oil and olive oil containing 14.3 g/L linoleic acid or oleic acid. To the best of the authors' knowledge, this is the first report on the biotechnological production of 7,8-dihydroxy unsaturated fatty acids.
Photoreactions of ruthenium(II) and osmium(II) complexes with deoxyribonucleic acid (DNA).
Moucheron, C; Kirsch-De Mesmaeker, A; Kelly, J M
1997-09-01
The design of Ru(II) and Os(II) complexes which are photoreactive with deoxyribonucleic acid (DNA) represents one of the main targets for the development of novel molecular tools for the study of DNA and, in the future, for the production of new, metal-based, anti-tumor drugs. In this review, we explain how it is possible to make a complex photoreactive with nucleobases and nucleic acids. According to the photophysical behaviour of the Ru(II) compounds, two types of photochemistry are expected: (1) photosubstitution of a ligand by a nucleobase and another monodentate ligand, which takes place from the triplet, metal-centred (3MC) state; this state is populated thermally from the lowest lying triplet metal to ligand charge transfer (3MLCT) state; (2) photoreaction from the 3MLCT state, corresponding to photoredox processes with DNA bases. The two photoreactivities are in competition. By modulating appropriately the redox properties of the 3MLCT state, an electron transfer process from the base to the excited complex takes place, and is directly correlated with DNA cleavage or the formation of an adduct of the complex to DNA. In this adduct, guanine is linked by N2 to the alpha-position of a non-chelating nitrogen of the polyazaaromatic ligand without destruction of the complex. Different strategies are explained which increase the affinity of the complexes for DNA and direct the complex photoreactivity to sites of special DNA topology or targeted sequences of bases. Moreover, the replacement of the Ru(II) ion by the Os(II) ion in the photoreactive complexes leads to an increased specificity of photoreaction. Indeed, only one type of photoreactivity (from the 3MLCT state) is present for the Os(II) complexes because the 3MC state is too high in energy to be populated at room temperature.
Directory of Open Access Journals (Sweden)
Abir U Igamberdiev
2015-01-01
Full Text Available The bulk of ATP synthesis in plants is performed by ATP synthase, the main bioenergetics engine of cells, operating both in mitochondria and in chloroplasts. The reaction mechanism of ATP synthase has been studied in detail for over half a century; however, its optimal performance depends also on the steady delivery of ATP synthase substrates and the removal of its products. For mitochondrial ATP synthase, we analyze here the provision of stable conditions for (i the supply of ADP and Mg2+, supported by adenylate kinase (AK equilibrium in the intermembrane space, (ii the supply of phosphate via membrane transporter in symport with H+, and (iii the conditions of outflow of ATP by adenylate transporter carrying out the exchange of free adenylates. We also show that, in chloroplasts, AK equilibrates adenylates and governs Mg2+ contents in the stroma, optimizing ATP synthase and Calvin cycle operation, and affecting the import of inorganic phosphate in exchange with triose phosphates. It is argued that chemiosmosis is not the sole component of ATP synthase performance, which also depends on AK-mediated equilibrium of adenylates and Mg2+, adenylate transport and phosphate release and supply.
Cheng, Jiujun; Charles, Trevor C
2016-09-01
Bacterially produced biodegradable polyhydroxyalkanoates (PHAs) with versatile properties can be achieved using different PHA synthases (PhaCs). This work aims to expand the diversity of known PhaCs via functional metagenomics and demonstrates the use of these novel enzymes in PHA production. Complementation of a PHA synthesis-deficient Pseudomonas putida strain with a soil metagenomic cosmid library retrieved 27 clones expressing either class I, class II, or unclassified PHA synthases, and many did not have close sequence matches to known PhaCs. The composition of PHA produced by these clones was dependent on both the supplied growth substrates and the nature of the PHA synthase, with various combinations of short-chain-length (SCL) and medium-chain-length (MCL) PHA. These data demonstrate the ability to isolate diverse genes for PHA synthesis by functional metagenomics and their use for the production of a variety of PHA polymer and copolymer mixtures.
Li, J N; Mahmoud, M A; Han, W F; Ripple, M; Pizer, E S
2000-11-25
Endogenous fatty acid synthesis has been observed in certain rapidly proliferating normal and neoplastic tissues. Sterol regulatory element-binding proteins (SREBPs) are transcription factors that regulate the expression of lipogenic genes including fatty acid synthase (FAS), the major biosynthetic enzyme for fatty acid synthesis. We have previously shown that SREBP-1, FAS, and Ki-67, a proliferation marker, colocalized in the crypts of the fetal gastrointestinal tract epithelium. This study sought to determine whether SREBP-1 participates in the regulation of proliferation-associated fatty acid synthesis in colorectal neoplasia. An immunohistochemical analysis of SREBP-1, FAS, and Ki-67 expression in 25 primary human colorectal carcinoma specimens showed colocalization in 22 of these. To elucidate a functional linkage between SREBP-1 activation and proliferation-associated FA synthesis, SREBP-1 and FAS content were assayed during the adaptive response of cultured HCT116 colon carcinoma cells to pharmacological inhibition of FA synthesis. Cerulenin and TOFA each inhibited the endogenous synthesis of fatty acids in a dose-dependent manner and each induced increases in both precursor and mature forms of SREBP-1. Subsequently, both the transcriptional activity of the FAS promoter in a luciferase reporter gene construct and the FAS expression increased. These results demonstrate that tumor cells recognize and respond to a deficiency in endogenous fatty acid synthesis by upregulating both SREBP-1 and FAS expression and support the model that SREBP-1 participates in the transcriptional regulation of lipogenic genes in colorectal neoplasia. Copyright 2000 Academic Press.
International Nuclear Information System (INIS)
Anstrom, David M.; Colip, Leslie; Moshofsky, Brian; Hatcher, Eric; Remington, S. James
2005-01-01
Alanine and glutamine mutations were made to the same 15 lysine positions on the surface of E. coli malate synthase G and the impact on crystallization observed. The results support lysine replacement for improvement of crystallization and provide insight into site selection and type of amino-acid replacement. Two proposals recommend substitution of surface lysine residues as a means to improve the quality of protein crystals. In proposal I, substitution of lysine by alanine has been suggested to improve crystallization by reducing the entropic cost of ordering flexible side chains at crystal contacts. In proposal II, substitution of lysine by residues more commonly found in crystal contacts, such as glutamine, has been proposed to improve crystallization. 15 lysine residues on the surface of Escherichia coli malate synthase G, distributed over a variety of secondary structures, were individually mutated to both alanine and glutamine. For 28 variants, detailed studies of the effect on enzymatic activity and crystallization were conducted. This has permitted direct comparison of the relative effects of the two types of mutations. While none of the variants produced crystals suitable for X-ray structural determination, small crystals were obtained in a wide variety of conditions, in support of the general approach. Glutamine substitutions were found to be more effective than alanine in producing crystals, in support of proposal II. Secondary structure at the site of mutation does not appear to play a major role in determining the rate of success
Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants
Energy Technology Data Exchange (ETDEWEB)
Somerville, Chris R.; Scieble, Wolf
2000-10-11
Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.
Regulation of basal gastric acid secretion by the glycogen synthase kinase GSK3.
Rotte, Anand; Pasham, Venkanna; Eichenmüller, Melanie; Yang, Wenting; Qadri, Syed M; Bhandaru, Madhuri; Lang, Florian
2010-10-01
According to previous observations, basal gastric acid secretion is downregulated by phosphoinositol-3-(PI3)-kinase, phosphoinositide-dependent kinase (PDK1), and protein kinase B (PKBβ/Akt2) signaling. PKB/Akt phosphorylates glycogen synthase kinase GSK3. The present study explored whether PKB/Akt-dependent GSK3-phosphorylation modifies gastric acid secretion. Utilizing 2',7'-bis-(carboxyethyl)-5(6')-carboxyfluorescein (BCECF)-fluorescence, basal gastric acid secretion was determined from Na(+)-independent pH recovery (∆pH/min) following an ammonium pulse, which reflects H(+)/K(+)-ATPase activity. Experiments were performed in gastric glands from gene-targeted mice (gsk3 ( KI )) with PKB/serum and glucocorticoid-inducible kinase (SGK)-insensitive GSKα,β, in which the serines within the PKB/SGK phosphorylation site were replaced by alanine (GSK3α(21A/21A), GSK3β(9A/9A)). The cytosolic pH in isolated gastric glands was similar in gsk3 ( KI ) and their wild-type littermates (gsk3 ( WT )). However, ∆pH/min was significantly larger in gsk3 ( KI ) than in gsk3 ( WT ) mice and ∆pH/min was virtually abolished by the H(+)/K(+)-ATPase inhibitor omeprazole (100 μM) in gastric glands from both gsk3 ( KI ) and gsk3 ( WT ). Plasma gastrin levels were lower in gsk3 ( KI ) than in gsk3 ( WT ). Both, an increase of extracellular K(+) concentration to 35 mM [replacing Na(+)/N-methyl-D: -glucamine (NMDG)] and treatment with forskolin (5 μM), significantly increased ∆pH/min to virtually the same value in both genotypes. The protein kinase A (PKA) inhibitor H89 (150 nM) and the H(2)-receptor antagonist ranitidine (100 μM) decreased ∆pH/min in gsk3 ( KI ) but not gsk3 ( WT ) and again abrogated the differences between the genotypes. The protein abundance of phosphorylated but not of total PKA was significantly larger in gsk3 ( KI ) than in gsk3 ( WT ). Basal gastric acid secretion is enhanced by the disruption of PKB/SGK-dependent phosphorylation and the
Functional Characterization of Sesquiterpene Synthase from Polygonum minus
Directory of Open Access Journals (Sweden)
Su-Fang Ee
2014-01-01
Full Text Available Polygonum minus is an aromatic plant, which contains high abundance of terpenoids, especially the sesquiterpenes C15H24. Sesquiterpenes were believed to contribute to the many useful biological properties in plants. This study aimed to functionally characterize a full length sesquiterpene synthase gene from P. minus. P. minus sesquiterpene synthase (PmSTS has a complete open reading frame (ORF of 1689 base pairs encoding a 562 amino acid protein. Similar to other sesquiterpene synthases, PmSTS has two large domains: the N-terminal domain and the C-terminal metal-binding domain. It also consists of three conserved motifs: the DDXXD, NSE/DTE, and RXR. A three-dimensional protein model for PmSTS built clearly distinguished the two main domains, where conserved motifs were highlighted. We also constructed a phylogenetic tree, which showed that PmSTS belongs to the angiosperm sesquiterpene synthase subfamily Tps-a. To examine the function of PmSTS, we expressed this gene in Arabidopsis thaliana. Two transgenic lines, designated as OE3 and OE7, were further characterized, both molecularly and functionally. The transgenic plants demonstrated smaller basal rosette leaves, shorter and fewer flowering stems, and fewer seeds compared to wild type plants. Gas chromatography-mass spectrometry analysis of the transgenic plants showed that PmSTS was responsible for the production of β-sesquiphellandrene.
Liu, Rui; Yang, Zhenyu; Ni, Yuxin; Song, Kaixuan; Shen, Kai; Lin, Shaohui; Pan, Qinmin
2017-08-04
Pd(II)/bipyridine-catalyzed conjugate addition of arylboronic acids to α,β-unsaturated carboxylic acids (including β,β-disubstituted acrylic acids) was developed and optimized, which provided a mild and convenient method for the highly challenging synthesis of β-quaternary carbons substituted carboxylic acids.
Viroj Wiwanitkit
2008-01-01
Renal cell carcinoma is a rare but serious malignancy. Since a reduction in the level of retinoic acid receptor beta 2 (RARbeta2) expression in cancer cells due in part to histone hypoacetylation which is controlled by histone deacetylase (HD), the study on the interaction between cellular retinoic acid-binding proteins II (CRABP II), which is proposed to have its potential influence on retinoic acid (RA) response, and HD can be useful. Comparing to CARBP II and HD, the CARBP II-HD poses the ...
Directory of Open Access Journals (Sweden)
Aarón Barraza
2016-11-01
Full Text Available Legumes form symbioses with rhizobia, producing nitrogen-fixing nodules on the roots of the plant host. The network of plant signaling pathways affecting carbon metabolism may determine the final number of nodules. The trehalose biosynthetic pathway regulates carbon metabolism and plays a fundamental role in plant growth and development, as well as in plant-microbe interactions. The expression of genes for trehalose synthesis during nodule development suggests that this metabolite may play a role in legume-rhizobia symbiosis. In this work, PvTPS9, which encodes a Class II trehalose-6-phosphate synthase (TPS of common bean (Phaseolus vulgaris, was silenced by RNA interference in transgenic nodules. The silencing of PvTPS9 in root nodules resulted in a reduction of 85% (± 1% of its transcript, which correlated with a 30% decrease in trehalose contents of transgenic nodules and in untransformed leaves. Composite transgenic plants with PvTPS9 silenced in the roots showed no changes in nodule number and nitrogen fixation, but a severe reduction in plant biomass and altered transcript profiles of all Class II TPS genes. Our data suggest that PvTPS9 plays a key role in modulating trehalose metabolism in the symbiotic nodule and, therefore, in the whole plant.
Pd(II)-Catalyzed Enantioselective C-H Olefination of Diphenylacetic Acids
Shi, Bing-Feng; Zhang, Yang-Hui; Lam, Jonathan K.; Wang, Dong-Hui; Yu, Jin-Quan
2009-01-01
Pd(II)-catalyzed enantioselective C-H olefination of diphenylacetic acid substrates has been achieved through the use of mono-protected chiral amino acid ligands. The absolute configuration of the resulting olefinated products is consistent with that of a proposed C-H insertion intermediate. PMID:20017549
Vāvere, Amy L; Kridel, Steven J; Wheeler, Frances B; Lewis, Jason S
2008-02-01
Although it is accepted that the metabolic fate of 1-(11)C-acetate is different in tumors than in myocardial tissue because of different clearance patterns, the exact pathway has not been fully elucidated. For decades, fatty acid synthesis has been quantified in vitro by the incubation of cells with (14)C-acetate. Fatty acid synthase (FAS) has been found to be overexpressed in prostate carcinomas, as well as other cancers, and it is possible that imaging with 1-(11)C-acetate could be a marker for its expression. In vitro and in vivo uptake experiments in prostate tumor models with 1-(11)C-acetate were performed both with and without blocking of fatty acid synthesis with either C75, an inhibitor of FAS, or 5-(tetradecyloxy)-2-furoic acid (TOFA), an inhibitor of acetyl-CoA carboxylase (ACC). FAS levels were measured by Western blot and immunohistochemical techniques for comparison. In vitro studies in 3 different prostate tumor models (PC-3, LNCaP, and 22Rv1) demonstrated blocking of 1-(11)C-acetate accumulation after treatment with both C75 and TOFA. This was further shown in vivo in PC-3 and LNCaP tumor-bearing mice after a single treatment with C75. A positive correlation between 1-(11)C-acetate uptake into the solid tumors and FAS expression levels was found. Extensive involvement of the fatty acid synthesis pathway in 1-(11)C-acetate uptake in prostate tumors was confirmed, leading to a possible marker for FAS expression in vivo by noninvasive PET.
Directory of Open Access Journals (Sweden)
Mirian Perez Maluf
2009-01-01
Full Text Available In this work, we studied the biosynthesis of caffeine by examining the expression of genes involved in this biosynthetic pathway in coffee fruits containing normal or low levels of this substance. The amplification of gene-specific transcripts during fruit development revealed that low-caffeine fruits had a lower expression of the theobromine synthase and caffeine synthase genes and also contained an extra transcript of the caffeine synthase gene. This extra transcript contained only part of exon 1 and all of exon 3. The sequence of the mutant caffeine synthase gene revealed the substitution of isoleucine for valine in the enzyme active site that probably interfered with enzymatic activity. These findings indicate that the absence of caffeine in these mutants probably resulted from a combination of transcriptional regulation and the presence of mutations in the caffeine synthase amino acid sequence.
DEFF Research Database (Denmark)
Krath, Britta N.; Eriksen, Tina A.; Poulsen, Tim S.
1999-01-01
cDNAs specifying four active phosphoribosyl diphosphate synthase isozymes were isolated from an Arabidopsis thaliana cDNA library. In contrast to other phosphoribosyl diphosphate synthases the activity of two of the A. thaliana isozymes are independent of Pi. Amino acid sequence comparison and ph...
Fatty acid synthase - Modern tumor cell biology insights into a classical oncology target.
Buckley, Douglas; Duke, Gregory; Heuer, Timothy S; O'Farrell, Marie; Wagman, Allan S; McCulloch, William; Kemble, George
2017-09-01
Decades of preclinical and natural history studies have highlighted the potential of fatty acid synthase (FASN) as a bona fide drug target for oncology. This review will highlight the foundational concepts upon which this perspective is built. Published studies have shown that high levels of FASN in patient tumor tissues are present at later stages of disease and this overexpression predicts poor prognosis. Preclinical studies have shown that experimental overexpression of FASN in previously normal cells leads to changes that are critical for establishing a tumor phenotype. Once the tumor phenotype is established, FASN elicits several changes to the tumor cell and becomes intertwined with its survival. The product of FASN, palmitate, changes the biophysical nature of the tumor cell membrane; membrane microdomains enable the efficient assembly of signaling complexes required for continued tumor cell proliferation and survival. Membranes densely packed with phospholipids containing saturated fatty acids become resistant to the action of other chemotherapeutic agents. Inhibiting FASN leads to tumor cell death while sparing normal cells, which do not have the dependence of this enzyme for normal functions, and restores membrane architecture to more normal properties thereby resensitizing tumors to killing by chemotherapies. One compound has recently reached clinical studies in solid tumor patients and highlights the need for continued evaluation of the role of FASN in tumor cell biology. Significant advances have been made and much remains to be done to optimally apply this class of pharmacological agents for the treatment of specific cancers. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Tung tree (Vernicia fordii) is an important woody oil tree. Tung tree seeds contain 50-60% oil with approximately 80 mole a-eleostearic acid (9cis, 11trans, 13trans octadecatrienoic acid). Fatty acid synthesis is catalyzed by the concerted action of acetyl-CoA carboxylase and fatty acid synthase, a ...
Molecular characterization of two alkylresorcylic acid synthases from Sordariomycetes fungi
DEFF Research Database (Denmark)
Ramakrishnan, Dhivya; Tiwari, Manish Kumar; Manoharan, Gomathi
2018-01-01
Two putative type III polyketide synthase genes (PKS) were identified from Sordariomycetes fungi. These two type III PKS genes from Sordaria macrospora (SmPKS) and Chaetomium thermophilum (CtPKS), shared 59.8% sequence identity. Both, full-length and truncated versions of type III PKSs were...
Human METTL12 is a mitochondrial methyltransferase that modifies citrate synthase.
Rhein, Virginie F; Carroll, Joe; Ding, Shujing; Fearnley, Ian M; Walker, John E
2017-06-01
The protein methylome in mammalian mitochondria has been little studied until recently. Here, we describe that lysine-368 of human citrate synthase is methylated and that the modifying enzyme, localized in the mitochondrial matrix, is methyltransferase-like protein 12 (METTL12), a member of the family of 7β-strand methyltransferases. Lysine-368 is near the active site of citrate synthase, but removal of methylation has no effect on its activity. In mitochondria, it is possible that some or all of the enzymes of the citric acid cycle, including citrate synthase, are organized in metabolons to facilitate the channelling of substrates between participating enzymes. Thus, possible roles for the methylation of Lys-368 are in controlling substrate channelling itself, or in influencing protein-protein interactions in the metabolon. © 2017 The Authors FEBS Letters published by John Wiley & Sons Ltd on behalf of Federation of European Biochemical Societies.
Song, Laizhou; Zhao, Xiaodan; Fu, Jie; Wang, Xiuli; Sheng, Yiping; Liu, Xiaowei
2012-01-15
Melamine-diethylenetriaminepentaacetic acid/polyvinylidene fluoride (MA-DTPA/PVDF) chelating membrane bearing polyaminecarboxylate groups was used to remove Ni(II) from nickel plating effluents. Adsorption experiments were conducted to study the adsorption of the membrane towards Ni(II) in Ni(II)-Ca(II), Ni(II)-NH(4)(+), Ni(II)-Fe(III) binary systems, and Ni(II)-lactic acid, Ni(II)-succinic acid and Ni(II)-citric acid complex systems. For the ternary nickel plating processes, the effects of 3d transition metals including Fe(II), Co(II), Cu(II) and Zn(II) on Ni(II) adsorption were evaluated. The influences of the aforementioned coexistent cations and organic acids were elucidated by the continuum solvation model (COSMO)-corrected density functional theory (DFT) method. Geometries and complexation energies were analyzed for metal-MA-DTPA and Ni(II)-organic acid complexes. DFT results accord with the experimental data, indicating that DFT is helpful to evaluate the complexation between the membrane and metal cations. The coexistent Ca(II) tends to form more stable complex with MA-DTPA ligand than NH(4)(+) and Fe(III), and can interfere with the formation of Ni(II)-MA-DTPA complex. The complexing sequence of 3d metals with MA-DTPA ligand is Zn(II)
Czech Academy of Sciences Publication Activity Database
Kopel, P.; Trávníček, Zdeněk; Kvítek, L.; Černošek, Z.; Wrzeszcz, G.; Marek, J.
2003-01-01
Roč. 56, č. 1 (2003), s. 1-11 ISSN 0095-8972 R&D Projects: GA ČR GA203/00/0152; GA AV ČR IBS5038351 Institutional research plan: CEZ:AV0Z5038910 Keywords : Copper(II) * cobalt(II) and nickel(II) complexes * Trithiocyanuric acid Subject RIV: CE - Biochemistry Impact factor: 0.841, year: 2003
Removal of Cu(II) from acidic electroplating effluent by biochars generated from crop straws.
Tong, Xuejiao; Xu, Renkou
2013-04-01
The removal efficiency of copper (Cu(II)) from an actual acidic electroplating effluent by biochars generated from canola, rice, soybean and peanut straws was investigated. The biochars simultaneously removed Cu(II) from the effluent, mainly through the mechanisms of adsorption and precipitation, and neutralized its acidity. The removal efficiency of Cu(II) by the biochars followed the order: peanut straw char > soybean straw char > canola straw char > rice straw char > a commercial activated carbonaceous material, which is consistent with the alkalinity of the biochars. The pH of the effluent was a key factor determining the removal efficiency of Cu(II) by biochars. Raising the initial pH of the effluent enhanced the removal of Cu(II) from it. The optimum pyrolysis temperature was 400 degrees C for producing biochar from crop straws for acidic wastewater treatment, and the optimum reaction time was 8 hr.
Jin, Zhehao; Kim, Jin-Hee; Park, Sang Un; Kim, Soo-Un
2016-12-01
Two cDNAs for indole-3-glycerol phosphate lyase homolog were cloned from Polygonum tinctorium. One encoded cytosolic indole synthase possibly in indigoid synthesis, whereas the other encoded a putative tryptophan synthase α-subunit. Indigo is an old natural blue dye produced by plants such as Polygonum tinctorium. Key step in plant indigoid biosynthesis is production of indole by indole-3-glycerol phosphate lyase (IGL). Two tryptophan synthase α-subunit (TSA) homologs, PtIGL-short and -long, were isolated by RACE PCR from P. tinctorium. The genome of the plant contained two genes coding for IGL. The short and the long forms, respectively, encoded 273 and 316 amino acid residue-long proteins. The short form complemented E. coli ΔtnaA ΔtrpA mutant on tryptophan-depleted agar plate signifying production of free indole, and thus was named indole synthase gene (PtINS). The long form, either intact or without the transit peptide sequence, did not complement the mutant and was tentatively named PtTSA. PtTSA was delivered into chloroplast as predicted by 42-residue-long targeting sequence, whereas PtINS was localized in cytosol. Genomic structure analysis suggested that a TSA duplicate acquired splicing sites during the course of evolution toward PtINS so that the targeting sequence-containing pre-mRNA segment was deleted as an intron. PtINS had about two to fivefolds higher transcript level than that of PtTSA, and treatment of 2,1,3-benzothiadiazole caused the relative transcript level of PtINS over PtTSA was significantly enhanced in the plant. The results indicate participation of PtINS in indigoid production.
Directory of Open Access Journals (Sweden)
Häberle J
2011-08-01
Full Text Available Johannes HäberleKinderspital Zürich, Abteilung Stoffwechsel, Zürich, SwitzerlandAbstract: N-acetylglutamate synthase (NAGS deficiency is a rare inborn error of metabolism affecting ammonia detoxification in the urea cycle. The product of NAGS is N-acetylglutamate which is the absolutely required allosteric activator of the first urea cycle enzyme carbamoylphosphate synthetase 1. In defects of NAGS, the urea cycle function can be severely affected resulting in fatal hyperammonemia in neonatal patients or at any later stage in life. NAGS deficiency can be treated with a structural analog of N-acetylglutamate, N-carbamyl-L-glutamate, which is available for enteral use as a licensed drug. Since NAGS deficiency is an extremely rare disorder, reports on the use of N-carbamyl-L-glutamate are mainly based on single patients. According to these, the drug is very effective in treating acute hyperammonemia by avoiding the need for detoxification during the acute metabolic decompensation. Also during long-term treatment, N-carbamyl-L-glutamate is effective in maintaining normal plasma ammonia levels and avoiding the need for additional drug therapy or protein-restricted diet. Open questions remain which concern the optimal dosage in acute and long-term use of N-carbamyl-L-glutamate and potential additional disorders in which the drug might also be effective in treating acute hyperammonemia. This review focuses on the role of N-carbamyl-L-glutamate for the treatment of acute hyperammonemia due to primary NAGS deficiency but will briefly discuss the current knowledge on the role of N-carbamyl-L-glutamate for treatment of secondary NAGS deficiencies.Keywords: carglumic acid, carbamylglutamate, N-carbamyl-L-glutamate, N-acetylglutamate synthase deficiency, NAGS deficiency, hyperammonemia
International Nuclear Information System (INIS)
Parsons, James F.; Shi, Katherine; Calabrese, Kelly; Ladner, Jane E.
2006-01-01
Salicylate synthase, which catalyzes the first step in the synthesis of the siderophore yersiniabactin, has been crystallized. Diffraction data have been collected to 2.5 Å. Bacteria have evolved elaborate schemes that help them thrive in environments where free iron is severely limited. Siderophores such as yersiniabactin are small iron-scavenging molecules that are deployed by bacteria during iron starvation. Several studies have linked siderophore production and virulence. Yersiniabactin, produced by several Enterobacteriaceae, is derived from the key metabolic intermediate chorismic acid via its conversion to salicylate by salicylate synthase. Crystals of salicylate synthase from the uropathogen Escherichia coli CFT073 have been grown by vapour diffusion using polyethylene glycol as the precipitant. The monoclinic (P2 1 ) crystals diffract to 2.5 Å. The unit-cell parameters are a = 57.27, b = 164.07, c = 59.04 Å, β = 108.8°. The solvent content of the crystals is 54% and there are two molecules of the 434-amino-acid protein in the asymmetric unit. It is anticipated that the structure will reveal key details about the reaction mechanism and the evolution of salicylate synthase
Energy Technology Data Exchange (ETDEWEB)
Parsons, James F., E-mail: parsonsj@umbi.umd.edu; Shi, Katherine; Calabrese, Kelly [Center for Advanced Research in Biotechnology, The University of Maryland Biotechnology Institute, 9600 Gudelsky Drive, Rockville, MD 20850 (United States); Ladner, Jane E. [Center for Advanced Research in Biotechnology, The University of Maryland Biotechnology Institute, 9600 Gudelsky Drive, Rockville, MD 20850 (United States); National Institute of Standards and Technology (United States)
2006-03-01
Salicylate synthase, which catalyzes the first step in the synthesis of the siderophore yersiniabactin, has been crystallized. Diffraction data have been collected to 2.5 Å. Bacteria have evolved elaborate schemes that help them thrive in environments where free iron is severely limited. Siderophores such as yersiniabactin are small iron-scavenging molecules that are deployed by bacteria during iron starvation. Several studies have linked siderophore production and virulence. Yersiniabactin, produced by several Enterobacteriaceae, is derived from the key metabolic intermediate chorismic acid via its conversion to salicylate by salicylate synthase. Crystals of salicylate synthase from the uropathogen Escherichia coli CFT073 have been grown by vapour diffusion using polyethylene glycol as the precipitant. The monoclinic (P2{sub 1}) crystals diffract to 2.5 Å. The unit-cell parameters are a = 57.27, b = 164.07, c = 59.04 Å, β = 108.8°. The solvent content of the crystals is 54% and there are two molecules of the 434-amino-acid protein in the asymmetric unit. It is anticipated that the structure will reveal key details about the reaction mechanism and the evolution of salicylate synthase.
International Nuclear Information System (INIS)
Cheng, Xia; Lu, Guangwen; Qi, Jianxun; Cheng, Hao; Gao, Feng; Wang, Jundong; Yan, Jinghua
2010-01-01
Crystals of SAICAR synthase from S. suis serotype 2 were obtained in the presence of 40 mM aspartic acid substrate; they belonged to space group P2 and diffracted to 2.8 Å resolution. Phosphoribosylaminoimidazole-succinocarboxamide synthase (SAICAR synthase) plays an essential role in the de novo biosynthesis of purine nucleotides. In this study, the SAICAR synthase from Streptococcus suis was cloned and overexpressed in Escherichia coli. The subsequent product was purified and crystallized using the hanging-drop vapour-diffusion method. The crystals diffracted to 2.8 Å resolution and belonged to space group P2, with unit-cell parameters a = 70.2, b = 52.2, c = 153.9 Å, β = 102.8°
Cleven, R.F.M.J.
1984-01-01
Polyelectrolyte effects in the interaction of heavy metal ions with model polycarboxylic acids have been described, in order to establish the relevance of these effects in the interaction of heavy metal ions with naturally occurring humic and fulvic acids. The model systems consisted of Cd(II),
Formentini, Laura; Pereira, Marta P; Sánchez-Cenizo, Laura; Santacatterina, Fulvio; Lucas, José J; Navarro, Carmen; Martínez-Serrano, Alberto; Cuezva, José M
2014-04-01
A key transducer in energy conservation and signaling cell death is the mitochondrial H(+)-ATP synthase. The expression of the ATPase inhibitory factor 1 (IF1) is a strategy used by cancer cells to inhibit the activity of the H(+)-ATP synthase to generate a ROS signal that switches on cellular programs of survival. We have generated a mouse model expressing a mutant of human IF1 in brain neurons to assess the role of the H(+)-ATP synthase in cell death in vivo. The expression of hIF1 inhibits the activity of oxidative phosphorylation and mediates the shift of neurons to an enhanced aerobic glycolysis. Metabolic reprogramming induces brain preconditioning affording protection against quinolinic acid-induced excitotoxicity. Mechanistically, preconditioning involves the activation of the Akt/p70S6K and PARP repair pathways and Bcl-xL protection from cell death. Overall, our findings provide the first in vivo evidence highlighting the H(+)-ATP synthase as a target to prevent neuronal cell death.
Wang, Qiang; Du, Xia; Zhou, Bingjie; Li, Jing; Lu, Wenlong; Chen, Qiuyun; Gao, Jing
2017-12-01
Targeting cellular metabolism is becoming a hallmark to overcome drug resistance in breast cancer treatment. Activation of fatty acid synthase (FASN) has been shown to promote breast cancer cell growth. However, there is no concrete report underlying the mechanism associated with mitochondrial dysfunction in relation to fatty acid synthase inhibition-induced apoptosis in breast cancer cells. The current study is aimed at exploring the effect of the novel manganese (Mn) complex, labeled as PdpaMn, on lipid metabolism and mitochondrial function in breast cancer cells. Herein, we observed that PdpaMn displayed strong cytotoxicity on breast cancer cell lines and selectively targeted the tumor without affecting the normal organs or cells in vivo. We also observed that PdpaMn could bind to TE domain of FASN and decrease the activity and the level of expression of FASN, which is an indication that FASN could serve as a target of PdpaMn. In addition, we demonstrated that PdpaMn increased intrinsic apoptosis in breast cancer cells relayed by a suppressed the level of expression of FASN, followed by the release of mitochondrial cytochrome c and the activation of caspases-9. Instigated by the above observations, we hypothesized that PdpaMn-induced apoptosis events are dependent on mitochondrial dysfunction. Indeed, we found that mitochondrial membrane potential (MMP) collapse, mitochondrial oxygen consumption reduction and adenosine triphosphate (ATP) release were deeply repressed. Furthermore, our results showed that PdpaMn significantly increased the reactive oxygen species (ROS) production, and the protection conferred by the free radical scavenger N-acetyl-cysteine (NAC) indicates that PdpaMn-induced apoptosis through an oxidative stress-associated mechanism. More so, the above results have demonstrated that mitochondrial dysfunction participated in FASN inhibition-induce apoptosis in breast cancer cells by PdpaMn. Therefore, PdpaMn may be considered as a good candidate
DEFF Research Database (Denmark)
Hansen, Nikolaj Lervad; Nissen, Jakob N.; Hamberger, Björn Robert
2017-01-01
residue gave mixed product profiles. Two mutants, TwTPS14:Y265H and TwTPS21:A325V, also produced ent-copalyl diphosphate, highlighting the evolutionary potential of enzymes of this family to drive rapid diversification of plant diterpene biosynthesis through neo-functionalization. Our study contributes......The medicinal plant Tripterygium wilfordii (Celastraceae) contains a pair of class II diterpene synthases (diTPS) of specialized labdane-type metabolism that, despite remarkably close homology, form strikingly different products. TwTPS21 catalyzes bicyclization of the linear C20 precursor......-directed mutagenesis, we generated a panel of six variants, where one, or both positions were exchanged between the enzymes. In coupled heterologous assays with a corresponding class I diTPS, TwTPS2, complete product interchange was observed in variants with both reciprocal mutations, while substitutions of either...
DEFF Research Database (Denmark)
González-Mellado, Damián; von Wettstein, Penny; Garcés, Rafael
2010-01-01
The ß-ketoacyl-acyl carrier protein synthase III (KAS III; EC 2.3.1.180) is a condensing enzyme catalyzing the initial step of fatty acid biosynthesis using acetyl-CoA as primer. To determine the mechanisms involved in the biosynthesis of fatty acids in sunflower (Helianthus annuus L.) developing...... seeds, a cDNA coding for HaKAS III (EF514400) was isolated, cloned and sequenced. Its protein sequence is as much as 72% identical to other KAS III-like ones such as those from Perilla frutescens, Jatropha curcas, Ricinus communis or Cuphea hookeriana. Phylogenetic study of the HaKAS III homologous...... proteins infers its origin from cyanobacterial ancestors. A genomic DNA gel blot analysis revealed that HaKAS III is a single copy gene. Expression levels of this gene, examined by Q-PCR, revealed higher levels in developing seeds storing oil than in leaves, stems, roots or seedling cotyledons...
Aschenbrenner, Anna-Katharina; Kwon, Moonhyuk; Conrad, Jürgen; Ro, Dae-Kyun; Spring, Otmar
2016-04-01
Sunflower is known to produce a variety of bisabolene-type sesquiterpenes and accumulates these substances in trichomes of leaves, stems and flowering parts. A bioinformatics approach was used to identify the enzyme responsible for the initial step in the biosynthesis of these compounds from its precursor farnesyl pyrophosphate. Based on sequence similarity with a known bisabolene synthases from Arabidopsis thaliana AtTPS12, candidate genes of Helianthus were searched in EST-database and used to design specific primers. PCR experiments identified two candidates in the RNA pool of linear glandular trichomes of sunflower. Their sequences contained the typical motifs of sesquiterpene synthases and their expression in yeast functionally characterized them as bisabolene synthases. Spectroscopic analysis identified the stereochemistry of the product of both enzymes as (Z)-γ-bisabolene. The origin of the two sunflower bisabolene synthase genes from the transcripts of linear trichomes indicates that they may be involved in the synthesis of sesquiterpenes produced in these trichomes. Comparison of the amino acid sequences of the sunflower bisabolene synthases showed high similarity with sesquiterpene synthases from other Asteracean species and indicated putative evolutionary origin from a β-farnesene synthase. Copyright © 2016 Elsevier Ltd. All rights reserved.
Phosphatase activity of Poa pratensis seeds. l. Preliminary studies on acid phosphatase II
Energy Technology Data Exchange (ETDEWEB)
Lorenc-Kubis, I.; Morawiecka, B.
1973-01-01
Acid phosphatase (EC 3.1.3.2) was extracted from 0.1 M sodium acetate buffer, pH 5.1 from Poa pratensis seeds, and separated into three fractions by chromatography on DEAE cellulose. The highest activity was found in fraction II-b (acid phosphatase II). The activity of the enzyme was optimal at pH 4.9. It hydrolyzed p-nitrophenyl phosphate most readily among the various phosphomonoesters examined. Acid phosphatase II showed also a high activity toward ..beta..-naphtyl phosphate and phenyl phosphate, very low activity towards ..beta..-glycero phosphate, 5'-GMP and no activity with glucose-1 phosphate. The enzyme was inhibited by Ca/sup 2 +/ and fluoride, but activated by Mg/sup 2 +/. EDTA had no influence on the activity of the enzyme. 12 references, 3 figures, 4 tables.
International Nuclear Information System (INIS)
Tsai, Shihfeng; Bishop, D.F.; Desnick, R.J.
1988-01-01
Uroporphyrinogen III synthase, the fourth enzyme in the heme biosynthetic pathway, is responsible for conversion of the linear tetrapyrrole, hydroxymethylbilane, to the cyclic tetrapyrrole, uroporphyrinogen III. The deficient activity of URO-synthase is the enzymatic defect in the autosomal recessive disorder congenital erythropoietic porphyria. To facilitate the isolation of a full-length cDNA for human URO-synthase, the human erythrocyte enzyme was purified to homogeneity and 81 nonoverlapping amino acids were determined by microsequencing the N terminus and four tryptic peptides. Two synthetic oligonucleotide mixtures were used to screen 1.2 x 10 6 recombinants from a human adult liver cDNA library. Eight clones were positive with both oligonucleotide mixtures. Of these, dideoxy sequencing of the 1.3 kilobase insert from clone pUROS-2 revealed 5' and 3' untranslated sequences of 196 and 284 base pairs, respectively, and an open reading frame of 798 base pairs encoding a protein of 265 amino acids with a predicted molecular mass of 28,607 Da. The isolation and expression of this full-length cDNA for human URO-synthase should facilitate studies of the structure, organization, and chromosomal localization of this heme biosynthetic gene as well as the characterization of the molecular lesions causing congenital erythropoietic porphyria
Isolation and Characterization of Three New Monoterpene Synthases from Artemisia annua
Ruan, Ju-Xin; Li, Jian-Xu; Fang, Xin; Wang, Ling-Jian; Hu, Wen-Li; Chen, Xiao-Ya; Yang, Chang-Qing
2016-01-01
Artemisia annua, an annual herb used in traditional Chinese medicine, produces a wealth of monoterpenes and sesquiterpenes, including the well-known sesquiterpene lactone artemisinin, an active ingredient in the treatment for malaria. Here we report three new monoterpene synthases of A. annua. From a glandular trichome cDNA library, monoterpene synthases of AaTPS2, AaTPS5, and AaTPS6, were isolated and characterized. The recombinant proteins of AaTPS5 and AaTPS6 produced multiple products with camphene and 1,8-cineole as major products, respectively, and AaTPS2 produced a single product, β-myrcene. Although both Mg2+ and Mn2+ were able to support their catalytic activities, altered product spectrum was observed in the presence of Mn2+ for AaTPS2 and AaTPS5. Analysis of extracts of aerial tissues and root of A. annua with gas chromatography–mass spectrometry detected more than 20 monoterpenes, of which the three enzymes constituted more than 1/3 of the total. Mechanical wounding induced the expression of all three monoterpene synthase genes, and transcript levels of AaTPS5 and AaTPS6 were also elevated after treatments with phytohormones of methyl jasmonate, salicylic acid, and gibberellin, suggesting a role of these monoterpene synthases in plant–environment interactions. The three new monoterpene synthases reported here further our understanding of molecular basis of monoterpene biosynthesis and regulation in plant. PMID:27242840
Isolation and characterization of three new monoterpene synthases from Artemisia annua
Directory of Open Access Journals (Sweden)
Ju-Xin eRuan
2016-05-01
Full Text Available Artemisia annua, an annual herb used in traditional Chinese medicine, produces a wealth of monoterpenes and sesquiterpenes, including the well-known sesquiterpene lactone artemisinin, an active ingredient in the treatment for malaria. Here we report three new monoterpene synthases of A. annua. From a glandular trichome cDNA library, monoterpene synthases of AaTPS2, AaTPS5 and AaTPS6, were isolated and characterized. The recombinant proteins of AaTPS5 and AaTPS6 produced multiple products with camphene and 1,8-cineole as major products, respectively, and AaTPS2 produced a single product, β-myrcene. Although both Mg2+ and Mn2+ were able to support their catalytic activities, altered product spectrum was observed in the presence of Mn2+ for AaTPS2 and AaTPS5. Analysis of extracts of aerial tissues and root of A. annua with gas chromatography-mass spectrometry (GC-MS detected more than 20 monoterpenes, of which the three enzymes constituted more than 1/3 of the total. Mechanical wounding induced the expression of all three monoterpene synthase genes, and transcript levels of AaTPS5 and AaTPS6 were also elevated after treatments with phytohormones of methyl jasmonate (MeJA, salicylic acid (SA and gibberellin (GA, suggesting a role of these monoterpene synthases in plant-environment interactions. The three new monoterpene synthases reported here further our understanding of molecular basis of monoterpene biosynthesis and regulation in plant.
Energy Technology Data Exchange (ETDEWEB)
Elkhatali, Samya; El-Sherbeni, Ahmed A.; Elshenawy, Osama H. [Faculty of Pharmacy and Pharmaceutical Sciences, University of Alberta, Edmonton, Alberta T6G 2E1 (Canada); Abdelhamid, Ghada [Faculty of Pharmacy and Pharmaceutical Sciences, University of Alberta, Edmonton, Alberta T6G 2E1 (Canada); Department of Pharmacology and Toxicology, Faculty of Pharmacy, Helwan University, Helwan (Egypt); El-Kadi, Ayman O.S., E-mail: aelkadi@ualberta.ca [Faculty of Pharmacy and Pharmaceutical Sciences, University of Alberta, Edmonton, Alberta T6G 2E1 (Canada)
2015-12-15
We have recently demonstrated that 19-hydroxyeicosatetraenoic acid (19-HETE) is the major subterminal-HETE formed in the heart tissue, and its formation was decreased during cardiac hypertrophy. In the current study, we examined whether 19-HETE confers cardioprotection against angiotensin II (Ang II)-induced cardiac hypertrophy. The effect of Ang II, with and without 19-HETE (20 μM), on the development of cellular hypertrophy in cardiomyocyte RL-14 cells was assessed by real-time PCR. Also, cardiac hypertrophy was induced in Sprague–Dawley rats by Ang II, and the effect of increasing 19-HETE by isoniazid (INH; 200 mg/kg/day) was assessed by heart weight and echocardiography. Also, alterations in cardiac cytochrome P450 (CYP) and their associated arachidonic acid (AA) metabolites were determined by real-time PCR, Western blotting and liquid-chromatography–mass-spectrometry. Our results demonstrated that 19-HETE conferred a cardioprotective effect against Ang II-induced cellular hypertrophy in vitro, as indicated by the significant reduction in β/α-myosin heavy chain ratio. In vivo, INH improved heart dimensions, and reversed the increase in heart weight to tibia length ratio caused by Ang II. We found a significant increase in cardiac 19-HETE, as well as a significant reduction in AA and its metabolite, 20-HETE. In conclusion, 19-HETE, incubated with cardiomyocytes in vitro or induced in the heart by INH in vivo, provides cardioprotection against Ang II-induced hypertrophy. This further confirms the role of CYP, and their associated AA metabolites in the development of cardiac hypertrophy. - Highlights: • We found 19-hydroxy arachidonic acid to protect cardiomyocytes from hypertrophy. • We validated the use of isoniazid as a cardiac 19-hydroxy arachidonic acid inducer. • We found isoniazid to increase protective and inhibit toxic eicosanoides. • We found isoniazid to protect against angiotensin-induced cardiac hypertrophy. • This will help to
Allene oxide synthase, allene oxide cyclase and jasmonic acid levels in Lotus japonicus nodules.
Directory of Open Access Journals (Sweden)
Anna Zdyb
Full Text Available Jasmonic acid (JA, its derivatives and its precursor cis-12-oxo phytodienoic acid (OPDA form a group of phytohormones, the jasmonates, representing signal molecules involved in plant stress responses, in the defense against pathogens as well as in development. Elevated levels of JA have been shown to play a role in arbuscular mycorrhiza and in the induction of nitrogen-fixing root nodules. In this study, the gene families of two committed enzymes of the JA biosynthetic pathway, allene oxide synthase (AOS and allene oxide cyclase (AOC, were characterized in the determinate nodule-forming model legume Lotus japonicus JA levels were to be analysed in the course of nodulation. Since in all L. japonicus organs examined, JA levels increased upon mechanical disturbance and wounding, an aeroponic culture system was established to allow for a quick harvest, followed by the analysis of JA levels in whole root and shoot systems. Nodulated plants were compared with non-nodulated plants grown on nitrate or ammonium as N source, respectively, over a five week-period. JA levels turned out to be more or less stable independently of the growth conditions. However, L. japonicus nodules formed on aeroponically grown plants often showed patches of cells with reduced bacteroid density, presumably a stress symptom. Immunolocalization using a heterologous antibody showed that the vascular systems of these nodules also seemed to contain less AOC protein than those of nodules of plants grown in perlite/vermiculite. Hence, aeroponically grown L. japonicus plants are likely to be habituated to stress which could have affected JA levels.
Directory of Open Access Journals (Sweden)
Ikuro eAbe
2012-03-01
Full Text Available Benzalacetone synthase, from the medicinal plant Rheum palmatum (Polygonaceae (RpBAS, is a plant-specific chalcone synthase (CHS superfamily of type III polyketide synthase (PKS. RpBAS catalyzes the one-step, decarboxylative condensation of 4-coumaroyl-CoA with malonyl-CoA to produce the C6-C4 benzalacetone scaffold. The X-ray crystal structures of RpBAS confirmed that the diketide-forming activity is attributable to the characteristic substitution of the conserved active-site "gatekeeper" Phe with Leu. Furthermore, the crystal structures suggested that RpBAS employs novel catalytic machinery for the thioester bond cleavage of the enzyme-bound diketide intermediate and the final decarboxylation reaction to produce benzalacetone. Finally, by exploiting the remarkable substrate tolerance and catalytic versatility of RpBAS, precursor-directed biosynthesis efficiently generated chemically and structurally divergent, unnatural novel polyketide scaffolds. These findings provided a structural basis for the functional diversity of the type III PKS enzymes.
Gonzalez, D.
2017-12-01
Inhalation of fine particulate matter (PM2.5) has long been associated with adverse health outcomes. However, the causative agents and underlying mechanisms for these health effects have yet to be identified. One hypothesis is that PM2.5 deposited in the alveoli produce an excess of highly reactive radicals, leading to oxidative stress. The OH radical may be the most physiologically damaging, capable of oxidizing of lipids, proteins and DNA. Due to the variability and uncertainty in PM2.5 composition, the components that contribute to OH formation are not well understood. Soluble Fe is a component of PM2.5that produces OH under physiological conditions. Humic-like substances are water soluble organics found in biomass burning and tobacco smoke. Humic-like substances are capable of binding to Fe and enhancing OH formation, but this chemistry is not well understood. In this work, we use soil derived fulvic acid as a surrogate for Humic-like substances and investigate its effect on OH formation from Fe(II) under conditions relevant to the lungs. We use a fluorescent OH trapping probe, chemical kinetics and thermodynamic modeling to investigate OH formation from fulvic acid and Fe(II) dissolved in simulated and human lung fluids. In simulated lung fluid, we find that fulvic acid binds to Fe(II) and enhances the rate of key reactions that form OH. When fulvic acid is added to human lung fluids containing Fe(II), an enhancement of OH formation is observed. In human lung fluid, fulvic acid and metal binding proteins compete for Fe binding. These metal binding proteins are typically not found in simulated lung fluids. Results show that fulvic acid strongly binds Fe(II) and catalyzes key reactions that form OH in both simulated and human lung fluids. These results may help explain the role of Humic-like substances and Fe in oxidative stress and adverse health outcomes. Furthermore, we suggest that future studies employ simulated lung fluids containing metal binding proteins
Directory of Open Access Journals (Sweden)
Nataliya E Chorna
Full Text Available Voluntary running is a robust inducer of adult hippocampal neurogenesis. Given that fatty acid synthase (FASN, the key enzyme for de novo fatty acid biosynthesis, is critically involved in proliferation of embryonic and adult neural stem cells, we hypothesized that FASN could mediate both exercise-induced cell proliferation in the subgranular zone (SGZ of the dentate gyrus (DG and enhancement of spatial learning and memory. In 20 week-old male mice, voluntary running-induced hippocampal-specific upregulation of FASN was accompanied also by hippocampal-specific accumulation of palmitate and stearate saturated fatty acids. In experiments addressing the functional role of FASN in our experimental model, chronic intracerebroventricular (i.c.v. microinfusions of C75, an irreversible FASN inhibitor, and significantly impaired exercise-mediated improvements in spatial learning and memory in the Barnes maze. Unlike the vehicle-injected mice, the C75 group adopted a non-spatial serial escape strategy and displayed delayed escape latencies during acquisition and memory tests. Furthermore, pharmacologic blockade of FASN function with C75 resulted in a significant reduction, compared to vehicle treated controls, of the number of proliferative cells in the DG of running mice as measured by immunoreactive to Ki-67 in the SGZ. Taken together, our data suggest that FASN plays an important role in exercise-mediated cognitive enhancement, which might be associated to its role in modulating exercise-induced stimulation of neurogenesis.
Dey, Sanghamitra; Lane, James M; Lee, Richard E; Rubin, Eric J; Sacchettini, James C
2010-08-10
Mycobacterium tuberculosis (Mtb) depends on biotin synthesis for survival during infection. In the absence of biotin, disruption of the biotin biosynthesis pathway results in cell death rather than growth arrest, an unusual phenotype for an Mtb auxotroph. Humans lack the enzymes for biotin production, making the proteins of this essential Mtb pathway promising drug targets. To this end, we have determined the crystal structures of the second and third enzymes of the Mtb biotin biosynthetic pathway, 7,8-diaminopelargonic acid synthase (DAPAS) and dethiobiotin synthetase (DTBS), at respective resolutions of 2.2 and 1.85 A. Superimposition of the DAPAS structures bound either to the SAM analogue sinefungin or to 7-keto-8-aminopelargonic acid (KAPA) allowed us to map the putative binding site for the substrates and to propose a mechanism by which the enzyme accommodates their disparate structures. Comparison of the DTBS structures bound to the substrate 7,8-diaminopelargonic acid (DAPA) or to ADP and the product dethiobiotin (DTB) permitted derivation of an enzyme mechanism. There are significant differences between the Mtb enzymes and those of other organisms; the Bacillus subtilis DAPAS, presented here at a high resolution of 2.2 A, has active site variations and the Escherichia coli and Helicobacter pylori DTBS have alterations in their overall folds. We have begun to exploit the unique characteristics of the Mtb structures to design specific inhibitors against the biotin biosynthesis pathway in Mtb.
Li, Lai-Fu; Lu, Yan-Yu; Xiong, Wei; Liu, Juan-Ying; Chen, Qiang
2008-10-24
The central or systemic administration of 3-carboxy-4-octyl-2-methylenebutyrolactone (C75), a synthetic inhibitor of fatty acid synthase (FAS), causes anorexia and profound weight loss in rodents. The amount of food intake and gastrointestinal mobility are closely related. In this study, an attempt has been made to investigate the effects and mechanisms of C75 on gastric emptying and gastrointestinal transit after intracerebroventricular (i.c.v.) injection in mice. Our data showed that C75 (1, 5, 10 microg/mouse) dose-dependently delayed gastric emptying and gastrointestinal transit in fasted mice. 10 microg C75 delayed gastric emptying by about 21.4% and reduced gastrointestinal transit by about 31.0% compared with vehicle control group. Administration (i.c.v.) of 5-(tetradecyloxy)-2-furoic acid (TOFA, an acetyl-CoA carboxylase (ACC) inhibitor) or ghrelin attenuated the delayed gastrointestinal mobility effect induced by 10 microg C75. Taken together, C75 is able to decrease gastrointestinal mobility and it seems possible that malonyl-CoA and ghrelin might play an intermediary role in these processes.
Prosser, Ian; Altug, Iris G; Phillips, Andy L; König, Wilfried A; Bouwmeester, Harro J; Beale, Michael H
2004-12-15
The naturally occurring, volatile sesquiterpene hydrocarbon germacrene D has strong effects on insect behaviour and genes encoding enzymes that produce this compound are of interest in the study of plant-insect interactions and in a number of biotechnological approaches to pest control. Goldenrod, Solidago canadensis, is unusual in that it produces both enantiomers of germacrene D. Two new sesquiterpene synthase cDNAs, designated Sc11 and Sc19, have been isolated from goldenrod and functional expression in Escherichia coli identified Sc11 as (+)-germacrene D synthase and Sc19 as (-)-germacrene D synthase. Thus, the enantiomers of germacrene D are the products of separate, but closely related (85% amino-acid identity), enzymes. Unlike other sesquiterpene synthases and the related monoterpene synthases and prenyl transferases, which contain the characteristic amino-acid motif DDXX(D,E), Sc11 is unusual in that this motif occurs as (303)NDTYD. Mutagenesis of this motif to (303)DDTYD gave rise to an enzyme that fully retained (+)-germacrene D synthase activity. The converse mutation in Sc19 (D303N) resulted in a less efficient but functional enzyme. Mutagenesis of position 303 to glutamate in both enzymes resulted in loss of activity. These results indicate that the magnesium ion-binding role of the first aspartate in the DDXXD motif may not be as critical as previously thought. Further amino-acid sequence comparisons and molecular modelling of the enzyme structures revealed that very subtle changes to the active site of this family of enzymes are required to alter the reaction pathway to form, in this case, different enantiomers from the same enzyme-bound carbocationic intermediate.
International Nuclear Information System (INIS)
Budi Setiawan
2007-01-01
To estimate the safety assessment around the disposal facility, the interaction behavior of radionuclides/metal ions into organic material (such as humic acids) exist in natural water becomes an important study. To avoid the effect of heterogeneous composition of humic acid, polyacrylic acids (abbrev. APA) was used as are representative of homogeneous polymeric weak acid. The experiments have been carried out by solvent extraction and ion exchange methods to find out the suitable method for the study of complex formation of Fe(II) with humic acid(AH) and APA. The solvent extraction experiment has been done by using diphenylthiocarbazone (dithizone) in CCl 4 and C Fe(II) were 10 -8 M to 10 -5 M, pH around 5 and I=0.1M NaCI. In ionic exchange experiment, C Fe(II) were 10 -8 to 10 -4 M, pH from 4.8 to 5.5 in I=0.1M NaCl. The apparent complex formation constant is defined as β α = [ML]/([M][R]), where [M] and [ML] are concentration of free and bound of Fe(II) and [R] is the concentration of dissociated carboxylic group in macromolecules of PAA. The results shown that, for solvent extraction experiments, variable concentration of Fe(II) had no appreciable influence on the distribution ratio of Fe(II)-polyacrylate at the tracer concentration with the log D to be 1.32 ± 0.03 (pcH 5.25). At macro concentration, the distribution ratio of Fe(II) becomes smaller due to oxidation and obtained log D value to be 1.04 ± 0.07 (pcH 5.34). An interest kind was observed at higher PAA concentration, the distribution ratio curve becomes higher presumably due to the problem on redox sensitive characteristic of Fe(II) and/or coagulation of Fe(II)-polyacrylate at the interface of aqueous-organic phases. In case of ionic exchange method, the plot of I/Kd versus [R] gives a straight line result indicating this method is appropriate and more superior compare than solvent extraction method to determine the complex formation constant. (author)
Krishnamoorthy, Ezhilarasi; Hassan, Sameer; Hanna, Luke Elizabeth; Padmalayam, Indira; Rajaram, Rama; Viswanathan, Vijay
2017-05-07
Lipoic acid synthase (LIAS) is an iron-sulfur cluster mitochondrial enzyme which catalyzes the final step in the de novo pathway for the biosynthesis of lipoic acid, a potent antioxidant. Recently there has been significant interest in its role in metabolic diseases and its deficiency in LIAS expression has been linked to conditions such as diabetes, atherosclerosis and neonatal-onset epilepsy, suggesting a strong inverse correlation between LIAS reduction and disease status. In this study we use a bioinformatics approach to predict its structure, which would be helpful to understanding its role. A homology model for LIAS protein was generated using X-ray crystallographic structure of Thermosynechococcus elongatus BP-1 (PDB ID: 4U0P). The predicted structure has 93% of the residues in the most favour region of Ramachandran plot. The active site of LIAS protein was mapped and docked with S-Adenosyl Methionine (SAM) using GOLD software. The LIAS-SAM complex was further refined using molecular dynamics simulation within the subsite 1 and subsite 3 of the active site. To the best of our knowledge, this is the first study to report a reliable homology model of LIAS protein. This study will facilitate a better understanding mode of action of the enzyme-substrate complex for future studies in designing drugs that can target LIAS protein. Copyright © 2017 Elsevier Ltd. All rights reserved.
Fatty acid synthase cooperates with glyoxalase 1 to protect against sugar toxicity.
Directory of Open Access Journals (Sweden)
Damien Garrido
2015-02-01
Full Text Available Fatty acid (FA metabolism is deregulated in several human diseases including metabolic syndrome, type 2 diabetes and cancers. Therefore, FA-metabolic enzymes are potential targets for drug therapy, although the consequence of these treatments must be precisely evaluated at the organismal and cellular levels. In healthy organism, synthesis of triacylglycerols (TAGs-composed of three FA units esterified to a glycerol backbone-is increased in response to dietary sugar. Saturation in the storage and synthesis capacity of TAGs is associated with type 2 diabetes progression. Sugar toxicity likely depends on advanced-glycation-end-products (AGEs that form through covalent bounding between amine groups and carbonyl groups of sugar or their derivatives α-oxoaldehydes. Methylglyoxal (MG is a highly reactive α-oxoaldehyde that is derived from glycolysis through a non-enzymatic reaction. Glyoxalase 1 (Glo1 works to neutralize MG, reducing its deleterious effects. Here, we have used the power of Drosophila genetics to generate Fatty acid synthase (FASN mutants, allowing us to investigate the consequence of this deficiency upon sugar-supplemented diets. We found that FASN mutants are lethal but can be rescued by an appropriate lipid diet. Rescued animals do not exhibit insulin resistance, are dramatically sensitive to dietary sugar and accumulate AGEs. We show that FASN and Glo1 cooperate at systemic and cell-autonomous levels to protect against sugar toxicity. We observed that the size of FASN mutant cells decreases as dietary sucrose increases. Genetic interactions at the cell-autonomous level, where glycolytic enzymes or Glo1 were manipulated in FASN mutant cells, revealed that this sugar-dependent size reduction is a direct consequence of MG-derived-AGE accumulation. In summary, our findings indicate that FASN is dispensable for cell growth if extracellular lipids are available. In contrast, FA-synthesis appears to be required to limit a cell
International Nuclear Information System (INIS)
Bang, P.; Eriksson, U.; Wivall, I.-L.; Hall, K.; Sara, V.
1991-01-01
Insulin-like growth factor binding proteins interfere in the IGF-I and -II radioimmunoassays. In an attempt to overcome this problem, we have compared the use of truncated IGF-I, with reduced IGFBP affinity, and IGF-I as radioligands for IGF-I RIA measurements in serum separated by acid gel filtration or acid ethanol extraction followed by cryo-precipitation. With truncated IGF-I as radioligand the IGF-I measurements in acid gel filtrates and acid ethanol extracts were significantly correlated in healthy subjects (N=42, r=0.91, p<0.001) and in patients with acromegaly (N=10, r=0.85, p<0.01), GH deficiency (N=10, r=0.88, p<0.001) or Type I diabetes mellitus (N=10, r=0.90, p<0.001). In contrast, the IGF-I concentrations in acid ethanol extracts determined with IGF-I as radioligand did not correlate with those in acid gel filtrates using truncated IGF-I radioligand in patients with acromegaly (r=0.61, NS) or GH deficiency (r=0.46, NS). In the latter group the mean IGF-I concentrations measured in acid ethanol extracts were erroneously elevated by 112%. Low-affinity antibodies used for IGF-II RIA determinations failed to give reliable results in acid ethanol extracts from patients with Type I diabetes mellitus or GH deficiency. In conclusion, erroneously high IGF-I concentrations owing to binding of the radioligand to IGFBPs not completely removed by acid ethanol extraction can be avoided by the use of truncated IGF-I as radioligand. (author)
Zhu, Yueming; Zhang, Jun; Wei, Dongsheng; Wang, Yufan; Chen, Xiaoyun; Xing, Laijun; Li, Mingchun
2008-08-01
A slightly thermophilic strain, CBS-01, producing trehalose synthase (TreS), was isolated from geothermal water in this study. According to the phenotypic characteristics and phylogenetic analysis of the 16s rRNA gene sequence, it was identified as Meiothermus ruber. The trehalose synthase gene of Meiothermus ruber CBS-01 was cloned by polymerase chain reaction and sequenced. The TreS gene consisted of 2,895 nucleotides, which specified a 964-amino-acid protein. This novel TreS catalyzed reversible interconversion of maltose and trehalose.
Directory of Open Access Journals (Sweden)
Viroj Wiwanitkit
2008-04-01
Full Text Available Renal cell carcinoma is a rare but serious malignancy. Since a reduction in the level of retinoic acid receptor beta 2 (RARbeta2 expression in cancer cells due in part to histone hypoacetylation which is controlled by histone deacetylase (HD, the study on the interaction between cellular retinoic acid-binding proteins II (CRABP II, which is proposed to have its potential influence on retinoic acid (RA response, and HD can be useful. Comparing to CARBP II and HD, the CARBP II-HD poses the same function and biological process as HD. This can confirm that HD has a significant suppressive effect on the expression of CARBP II. Therefore, reduction in the level of RARbeta2 expression in cancer cells can be expected and this can lead to failure in treatment of renal cell carcinoma with RA. The author hereby purpose that additional HD inhibitor should be added into the regiment of RA to increase the effectiveness of treatment.
Maniscalco, W M; Finkelstein, J N; Parkhurst, A B
1989-05-01
De novo fatty acid synthesis may be an important source of saturated fatty acids for fetal lung disaturated phosphatidylcholine (DSPC) production. To investigate the roles of de novo fatty acid synthesis and exogenous fatty acids, we incubated dispersed fetal lung cells and freshly isolated adult type II cells with exogenous palmitate and oleate and measured DSPC synthesis. Unlike adult type II cells, fetal lung cells did not increase DSPC synthesis when exogenous palmitate was available; adult type II cells increased DSPC synthesis by 70% in the presence of palmitate. Exogenous oleate decreased DSPC synthesis by 48% in fetal cells but not in adult type II cells. Incubation of fetal lung cells with TOFA [2-furancarboxylate, 5-(tetradecyloxy)-sodium], a metabolic inhibitor of fatty acid synthesis, decreased fatty acid synthesis by 65%. There was a simultaneous 56% inhibition of DSPC production, but no effect on protein, DNA, or glyceride-glycerol production, measured by precursor incorporation. The inhibition of DSPC synthesis associated with TOFA was partially prevented by exogenous palmitate but not oleate. Fetal cells prepared from explants that had been cultured in dexamethasone also had TOFA-associated inhibition of DSPC synthesis that was similar to non-dexamethasone-exposed cells. These studies suggest that under baseline conditions of low fatty acid availability, such as in the fetus, de novo fatty acid synthesis in fetal cells, but not in adult type II cells, provides sufficient saturated fatty acids to support maximal DSPC production. Inhibition of de novo fatty acid synthesis resulting in decreased DSPC production in fetal lung cells in conditions of low fatty acid availability suggests that fatty acid synthesis may be central to maintain DSPC synthesis in the fetus.
International Nuclear Information System (INIS)
Imran, M; Nazir, S.; Latif, S.; Mahmood, Z.
2010-01-01
Cr(III), Co(II), Ni(II), Cu(II) and Zn(II) complexes of 2-(4-Nitrophenyl aminocarbonyl)benzoic acid were synthesized and characterized on the basis of physical, analytical and spectroscopic data. The ligands, as well as its metal complexes were checked for their in-vitro antimicrobial activity against three bacterial strains, Mycobacterium smegmatis, Escherichia coli, Pseudomonas aeuroginosa, and three fungal strains, Nigrospora oryzae, Aspergillus niger and Candida albicans. Disc diffusion method and Tube diffusion test were used for antibacterial and antifungal activities, respectively. The synthesized complexes only show significant antifungal activity but inactive for antibacterial, however, in general, the metal complexes were found to be more active against antimicrobial activities as compared to their un complexed ligand. (author)
Directory of Open Access Journals (Sweden)
M. A. Slugina
2016-01-01
Full Text Available The potato is one of the main strategic crops in the Russian Federation, Belarus and Kazakhstan. Currently, we have achieved significant advances in the understanding of metabolic mechanism of carbohydrate and interconversion «sucrose – starch» in potato tubers. Sucrose synthase (Sus is a key enzyme in the breakdown of sucrose. Sucrose synthase (Sus is catalyzing a reversible reaction of conversion sucrose and UDP into fructose and UDP-glucose. The identification and subsequent characterization of the genes encoding plant sucrose synthase is the first step towards understanding their physiological roles and metabolic mechanism involved in carbohydrate accumulation in potato tubers. In the present work the nucleotide and amino acid polymorphism of the Sus4 gene fragments containing sequences of the sucrose synthase domain were analyzed. Sus4 gene fragments (intron III – exon VI in 9 potato cultivars of Russian, Kazakh and Belarusian breeding were analyzed. The polymorphism of the Sus4 sucrose synthase domain sequences was first examined. The length of analyzed fragment varied from 977 b.p. (cultivars Favorit, Karasaiskii, Miras to 1013 b.p. (cultivars Zorochka, Manifest, Elisaveta, Bashkirskii. It was demonstrated that the examined sequences contained point mutations, as well as insertions and deletions. The common polymorphism level was 5.82%. It was shown that the examined sequences contained 58 SNPs and 4 indels. The most variable were introns IV (12.4% and V (9.18%. The most variable was exon IV. 7 allelic variants were detected. 6 different amino acid sequences specific to different varieties were also identified.
Electron transfer reactions of ruthenium(II) complexes with polyphenolic acids in micelles
Energy Technology Data Exchange (ETDEWEB)
Rajeswari, Angusamy [School of Chemistry, Madurai Kamaraj University, Madurai 625 021 (India); Department of Chemistry, Fatima College, Madurai 625 018 (India); Ramdass, Arumugam [School of Chemistry, Madurai Kamaraj University, Madurai 625 021 (India); Research Department of Chemistry, Aditanar College of Arts and Science, Tiruchendur 628 216 (India); Muthu Mareeswaran, Paulpandian [School of Chemistry, Madurai Kamaraj University, Madurai 625 021 (India); Department of Industrial Chemistry, Alagappa University, Karaikudi 630 003 (India); Rajagopal, Seenivasan, E-mail: rajagopalseenivasan@yahoo.com [School of Chemistry, Madurai Kamaraj University, Madurai 625 021 (India)
2016-02-15
The electron transfer in a microhetrogeneous system is a perfect mimic of biological electron transfer. The electron transfer between biologically important phenolic acids and ruthenium (II) complexes is systematically studied in the presence of anionic and cationic micelles. The photophysical properties of these ruthenium (II) complexes with anionic and cationic micelles and their binding abilities with these two type of micelles are also studies using absorption, emission and excited state lifetime spectral techniques. Pseudophase Ion Exchange (PIE) Model is applied to derive mechanism of electron transfer in two types of micelles. - Highlights: • Effect of microhetrogeneous system is studied using ruthenium (II) complexes and gallic acid is studied. • Pseudophase Ion exchange model is applied to derive the mechanism. • Binding constants are in the range of 10{sup 2}–10{sup 4} M{sup −1}.
Virtual Screening of Novel Glucosamine-6-Phosphate Synthase Inhibitors.
Lather, Amit; Sharma, Sunil; Khatkar, Anurag
2018-01-01
affinities and interaction between the inhibitors and the target proteins (G-6-P synthase) by using Glide software (Schrodinger Inc. U.S.A.-Maestro version 10.2). Grid-based Ligand Docking with Energetic (Glide) is one of the most accurate docking softwares available for ligand-protein, protein-protein binding studies. A library of hundreds of available ligands was docked against targeted proteins G-6-P synthase having PDB ID 1moq. Results of docking are shown in Table 1 and Table 2. Results of G-6-P synthase docking showed that some compounds were found to have comparable docking score and binding energy (kj/mol) as compared to standard antibiotics. Many of the ligands showed hydrogen bond interaction, hydrophobic interactions, electrostatic interactions, ionic interactions and π- π stacking with the various amino acid residues in the binding pockets of G-6-P synthase. The docking study estimated free energy of binding, binding pose andglide score and all these parameters provide a promising tool for the discovery of new potent natural inhibitors of G-6-P synthase. These G-6-P synthase inhibitors could further be used as antimicrobials. Here, a detailed binding analysis and new insights of inhibitors from various classes of molecules were docked in binding cavity of G-6-P synthase. ADME and toxicity prediction of these compounds will further accentuate us to study these compounds in vivo. This information will possibly present further expansion of effective antimicrobials against several microbial infections. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Prosser, Ian; Phillips, Andy L; Gittings, Simon; Lewis, Mervyn J; Hooper, Antony M; Pickett, John A; Beale, Michael H
2002-08-01
Profiling of sesquiterpene hydrocarbons in extracts of goldenrod, Solidago canadensis, by GC-MS revealed the presence of both enantiomers of germacrene D and lesser amounts of germacrene A, alpha-humulene, and beta-caryophyllene. A similarity-based cloning strategy using degenerate oligonucleotide primers, based on conserved amino acid sequences in known plant sesquiterpene synthases and RT-PCR, resulted in the isolation of a full length sesquiterpene synthase cDNA. Functional expression of the cDNA in E. coli, as an N-terminal thioredoxin fusion protein using the pET32b vector yielded an enzyme that was readily purified by nickel-chelate affinity chromatography. Chiral GC-MS analysis of products from of (3)H- and (2)H-labelled farnesyl diphosphate identified the enzyme as (+)-(10R)-germacrene A synthase. Sequence analysis and molecular modelling was used to compare this enzyme with the mechanistically related epi-aristolochene synthase from tobacco.
Ghosh, Subhabrata; Mandi, Swati Sen
2015-07-25
Zingiber officinale, medicinally the most important species within Zingiber genus, contains 6-gingerol as the active principle. This compound obtained from rhizomes of Z.officinale, has immense medicinal importance and is used in various herbal drug formulations. Our record of variation in content of this active principle, viz. 6-gingerol, in land races of this drug plant collected from different locations correlated with our Gene expression studies exhibiting high Chalcone Synthase gene (Chalcone Synthase is the rate limiting enzyme of 6-gingerol biosynthesis pathway) expression in high 6-gingerol containing landraces than in the low 6-gingerol containing landraces. Sequencing of Chalcone Synthase cDNA and subsequent multiple sequence alignment revealed seven SNPs between these contrasting genotypes. Converting this nucleotide sequence to amino acid sequence, alteration of two amino acids becomes evident; one amino acid change (asparagine to serine at position 336) is associated with base change (A→G) and another change (serine to leucine at position 142) is associated with the base change (C→T). Since asparagine at position 336 is one of the critical amino acids of the catalytic triad of Chalcone Synthase enzyme, responsible for substrate binding, our study suggests that landraces with a specific amino acid change viz. Asparagine (found in high 6-gingerol containing landraces) to serine causes low 6-gingerol content. This is probably due to a weak enzyme substrate association caused by the absence of asparagine in the catalytic triad. Detailed study of this finding could also help to understand molecular mechanism associated with variation in 6-gingerol content in Z.officinale genotypes and thereby strategies for developing elite genotypes containing high 6-gingerol content. Copyright © 2015 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Hove-Jensen, Bjarne; Bentsen, Ann-Kristin K; Harlow, Kenneth W
2005-01-01
Eleven of the codons specifying the amino acids of the flexible catalytic loop [KRRPRPNVAEVM(197-208)] of Bacillus subtilis phosphoribosyl diphosphate synthase have been changed individually to specify alanine. The resulting variant enzyme forms, as well as the wildtype enzyme, were produced...... in an Escherichia coli strain lacking endogenous phosphoribosyl diphosphate synthase activity and purified to near homogeneity. The B. subtilis phosphoribosyl diphosphate synthase mutant variants K197A and R199A were studied in detail. The physical properties of the two enzymes were similar to those of the wildtype...
Azuma, Yusuke; Zschoche, Reinhard; Hilvert, Donald
2017-06-23
Encapsulation of specific enzymes in self-assembling protein cages is a hallmark of bacterial compartments that function as counterparts to eukaryotic organelles. The cage-forming enzyme lumazine synthase (LS) from Bacillus subtilis (BsLS), for example, encapsulates riboflavin synthase (BsRS), enabling channeling of lumazine from the site of its generation to the site of its conversion to vitamin B 2 Elucidating the molecular mechanisms underlying the assembly of these supramolecular complexes could help inform new approaches for metabolic engineering, nanotechnology, and drug delivery. To that end, we investigated a thermostable LS from Aquifex aeolicus (AaLS) and found that it also forms cage complexes with the cognate riboflavin synthase (AaRS) when both proteins are co-produced in the cytosol of Escherichia coli A 12-amino acid-long peptide at the C terminus of AaRS serves as a specific localization sequence responsible for targeting the guest to the protein compartment. Sequence comparisons suggested that analogous peptide segments likely direct RS complexation by LS cages in other bacterial species. Covalent fusion of this peptide tag to heterologous guest molecules led to their internalization into AaLS assemblies both in vivo and in vitro , providing a firm foundation for creating tailored biomimetic nanocompartments for medical and biotechnological applications. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Souza-Moreira, Tatiana M.; Alves, Thaís B.; Pinheiro, Karina A.; Felippe, Lidiane G.; de Lima, Gustavo M. A.; Watanabe, Tatiana F.; Barbosa, Cristina C.; Santos, Vânia A. F. F. M.; Lopes, Norberto P.; Valentini, Sandro R.; Guido, Rafael V. C.; Furlan, Maysa; Zanelli, Cleslei F.
2016-11-01
Among the biologically active triterpenes, friedelin has the most-rearranged structure produced by the oxidosqualene cyclases and is the only one containing a cetonic group. In this study, we cloned and functionally characterized friedelin synthase and one cycloartenol synthase from Maytenus ilicifolia (Celastraceae). The complete coding sequences of these 2 genes were cloned from leaf mRNA, and their functions were characterized by heterologous expression in yeast. The cycloartenol synthase sequence is very similar to other known OSCs of this type (approximately 80% identity), although the M. ilicifolia friedelin synthase amino acid sequence is more related to β-amyrin synthases (65-74% identity), which is similar to the friedelin synthase cloned from Kalanchoe daigremontiana. Multiple sequence alignments demonstrated the presence of a leucine residue two positions upstream of the friedelin synthase Asp-Cys-Thr-Ala-Glu (DCTAE) active site motif, while the vast majority of OSCs identified so far have a valine or isoleucine residue at the same position. The substitution of the leucine residue with valine, threonine or isoleucine in M. ilicifolia friedelin synthase interfered with substrate recognition and lead to the production of different pentacyclic triterpenes. Hence, our data indicate a key role for the leucine residue in the structure and function of this oxidosqualene cyclase.
Kojima, N; Sitthithaworn, W; Viroonchatapan, E; Suh, D Y; Iwanami, N; Hayashi, T; Sankaw, U
2000-07-01
cDNAs encoding geranylgeranyl diphosphate synthase (GGPPS) of two diterpene producing plants, Scoparia dulcis and Croton sublyratus, were isolated using the homology-based polymerase chain reaction method. Both cloned genes showed high amino acid sequence homology (60-70%) to other plant GGPPSs and contained highly conserved aspartate-rich motifs. The obtained clones were functionally expressed in Escherichia coli and showed sufficient GGPPS activity to catalyze the condensation of farnesyl diphosphate (FPP) and isopentenyl diphosphate to form geranylgeranyl diphosphate. To investigate the factor determining the product chain length of plant GGPPSs, S. dulcis GGPPS mutants in which either the small amino acids at the fourth and fifth positions before the first aspartate-rich motif (FARM) were replaced with aromatic amino acids or in which two additional amino acids in FARM were deleted were constructed. Both mutants behaved like FPPS-like enzymes and almost exclusively produced FPP when dimethylallyl diphosphate was used as a primer substrate, and failed to accept FPP as a primer substrate. These results indicate that both small amino acids at the fourth and fifth positions before FARM and the amino acid insertion in FARM play essential roles in product length determination in plant GGPPSs.
Endler, Anne; Schneider, Rene; Kesten, Christopher; Lampugnani, Edwin R.; Persson, Staffan
2016-01-01
Cellulose is a cell wall constituent that is essential for plant growth and development, and an important raw material for a range of industrial applications. Cellulose is synthesized at the plasma membrane by massive cellulose synthase (CesA) complexes that track along cortical microtubules in elongating cells of Arabidopsis through the activity of the protein CELLULOSE SYNTHASE INTERACTING1 (CSI1). In a recent study we identified another family of proteins that also are associated with the ...
Pizer, E S; Thupari, J; Han, W F; Pinn, M L; Chrest, F J; Frehywot, G L; Townsend, C A; Kuhajda, F P
2000-01-15
A biologically aggressive subset of human breast cancers and other malignancies is characterized by elevated fatty-acid synthase (FAS) enzyme expression, elevated fatty acid (FA) synthesis, and selective sensitivity to pharmacological inhibition of FAS activity by cerulenin or the novel compound C75. In this study, inhibition of FA synthesis at the physiologically regulated step of carboxylation of acetyl-CoA to malonyl-CoA by 5-(tetradecyloxy)-2-furoic acid (TOFA) was not cytotoxic to breast cancer cells in clonogenic assays. FAS inhibitors induced a rapid increase in intracellular malonyl-CoA to several fold above control levels, whereas TOFA reduced intracellular malonyl-CoA by 60%. Simultaneous exposure of breast cancer cells to TOFA and an FAS inhibitor resulted in significantly reduced cytotoxicity and apoptosis. Subcutaneous xenografts of MCF7 breast cancer cells in nude mice treated with C75 showed FA synthesis inhibition, apoptosis, and inhibition of tumor growth to less than 1/8 of control volumes, without comparable toxicity in normal tissues. The data suggest that differences in intermediary metabolism render tumor cells susceptible to toxic fluxes in malonyl-CoA, both in vitro and in vivo.
Basyuni, M.; Sulistiyono, N.; Wati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.
2018-03-01
Cloning of Kandelia obovata KcCAS gene (previously known as Kandelia candel) and Rhizophora stylosa RsCAS have already have been reported and encoded cycloartenol synthases. In this study, the predicted KcCAS and RsCAS protein were analyzed using online software of Phyre2 and Swiss-model. The protein modelling for KcCAS and RsCAS cycloartenol synthases was determined using Pyre2 had similar results with slightly different in sequence identity. By contrast, the Swiss-model for KcCAS slightly had higher sequence identity (47.31%) and Qmean (0.70) compared to RsCAS. No difference of ligands binding site which is considered as modulators for both cycloartenol synthases. The range of predicted protein derived from 91-757 amino acid residues with coverage sequence similarities 0.86, respectively from template model of lanosterol synthase from the human. Homology modelling revealed that 706 residues (93% of the amino acid sequence) had been modelled with 100.0% confidence by the single highest scoring template for both KcCAS and RsCAS using Phyre2. This coverage was more elevated than swiss-model predicted (86%). The present study suggested that both genes are responsible for the genesis of cycloartenol in these mangrove plants.
Huang, Jing; Liao, NanQing; Li, HaoMing
2018-04-01
Monacolin K, an inhibitor of HMG-CoA reductase, is a secondary metabolite synthesized by polyketide synthases (PKS) from Monascus ruber. The mokH gene encoding Zn(II)2Cys6 binding protein and mokA gene encoding polyketide synthase are presumed to activate monacolin K production. In this study, linoleic acid could be a quorum sensing signaling molecule to increase monacolin K production in the cyclic AMP(cAMP)-protein kinase A(PKA) signaling pathway. Analysis of the PKA activity and the cAMP concentration shows that linoleic acid could increase cAMP concentration and activate PKA. Analysis of the RT-qPCR products demonstrates that 256μM and 512μM linoleic acid can up-regulate mokH and mokA gene transcript levels. Especially with 512μM linoleic acid addition, linoleic acid increase 1.35 folds of monacolin K production, but 64μM linoleic acid increase 1.94 folds of red pigment production in Monascus ruber. These results show the cAMP-PkA pathway activity can up-regulate mokA and mokH gene, which enhance the yield of Monacolin K. Copyright © 2017 Elsevier B.V. All rights reserved.
Protein modelling of triterpene synthase genes from mangrove plants using Phyre2 and Swiss-model
Basyuni, M.; Wati, R.; Sulistiyono, N.; Hayati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.
2018-03-01
Molecular cloning of five oxidosqualene cyclases (OSC) genes from Bruguiera gymnorrhiza, Kandelia candel, and Rhizophora stylosa had previously been cloned, characterized, and encoded mono and -multi triterpene synthases. The present study analyzed protein modelling of triterpene synthase genes from mangrove using Phyre2 and Swiss-model. The diversity was noted within protein modelling of triterpene synthases using Phyre2 from sequence identity (38-43%) and residue (696-703). RsM2 was distinguishable from others for template structure; it used lanosterol synthase as a template (PDB ID: w6j.1.A). By contrast, other genes used human lanosterol synthase (1w6k.1.A). The predicted bind sites were correlated with the product of triterpene synthase, the product of BgbAS was β-amyrin, while RsM1 contained a significant amount of β-amyrin. Similarly BgLUS and KcMS, both main products was lupeol, on the other hand, RsM2 with the outcome of taraxerol. Homology modelling revealed that 696 residues of BgbAS, BgLUS, RsM1, and RsM2 (91-92% of the amino acid sequence) had been modelled with 100% confidence by the single highest scoring template using Phyre2. This coverage was higher than Swiss-model (85-90%). The present study suggested that molecular cloning of triterpene genes provides useful tools for studying the protein modelling related regulation of isoprenoids biosynthesis in mangrove forests.
DEFF Research Database (Denmark)
Harthill, Jean E; Meek, Sarah E M; Morrice, Nick
2006-01-01
Trehalose-6-phosphate is a 'sugar signal' that regulates plant metabolism and development. The Arabidopsis genome encodes trehalose-6-phosphate synthase (TPS) and trehalose-6-phosphatase (TPP) enzymes. It also encodes class II proteins (TPS isoforms 5-11) that contain both TPS-like and TPP...
Directory of Open Access Journals (Sweden)
Chun-Hsien eHung
2016-01-01
Full Text Available Phosphatidylglycerol (PG and cardiolipin (CL are two essential classes of phospholipid in plants and algae. Phosphatidylglycerophosphate synthase (PGPS and cardiolipin synthase (CLS involved in the biosynthesis of PG and CL belong to CDP-alcohol phosphotransferase and share overall amino acid sequence homology. However, it remains elusive whether PGPS and CLS are functionally distinct in vivo. Here, we report identification of a gene encoding CLS in Chlamydomonas reinhardtii, CrCLS1, and its functional compatibility. Whereas CrCLS1 did not complement the growth phenotype of a PGPS mutant of Synechocystis sp. PCC 6803, it rescued the temperature-sensitive growth phenotype, growth profile with different carbon sources, phospholipid composition and enzyme activity of ∆crd1, a CLS mutant of Saccharomyces cerevisiae. These results suggest that CrCLS1 encodes a functional CLS of C. reinhardtii as the first identified algal CLS, whose enzyme function is distinct from that of PGPSs from C. reinhardtii. Comparison of CDP-alcohol phosphotransferase motif between PGPS and CLS among different species revealed a possible additional motif that might define the substrate specificity of these closely related enzymes.
Morcx, Serena; Kunz, Caroline; Choquer, Mathias; Assie, Sébastien; Blondet, Eddy; Simond-Côte, Elisabeth; Gajek, Karina; Chapeland-Leclerc, Florence; Expert, Dominique; Soulie, Marie-Christine
2013-03-01
Chitin synthases play critical roles in hyphal development and fungal pathogenicity. Previous studies on Botrytis cinerea, a model organism for necrotrophic pathogens, have shown that disruption of Bcchs1 and more particularly Bcchs3a genes have a drastic impact on virulence (Soulié et al., 2003, 2006). In this work, we investigate the role of other CHS including BcCHS4, BcCHS6 and BcCHS7 during the life cycle of B. cinerea. Single deletions of corresponding genes were carried out. Phenotypic analysis indicates that: (i) BcCHS4 enzyme is not essential for development and pathogenicity of the fungus; (ii) BcCHS7 is required for pathogenicity in a host dependant manner. For Bcchs6 gene disruption, we obtained only heterokaryotic strains. Indeed, sexual or asexual purification assays were unsuccessful. We concluded that class VI chitin synthase could be essential for B. cinerea and therefore BcCHS6 represents a valuable antifungal target. Copyright © 2012 Elsevier Inc. All rights reserved.
Li, Ying; Chen, Cheng; Zhang, Jing; Lan, Yeqing
2015-05-01
The catalytic role of Cu(II) in the reduction of Cr(VI) by citric acid with simulated solar light was investigated. The results demonstrated that Cu(II) could significantly accelerate Cr(VI) reduction and the reaction obeyed to pseudo zero-order kinetics with respect to Cr(VI). The removal of Cr(VI) was related to the initial concentrations of Cu(II), citric acid, and the types of organic acids. The optimal removal of Cr(VI) was achieved at pH 4, and the rates of Cu(II) photocatalytic reduction of Cr(VI) by organic acids were in the order: tartaric acid (two α-OH groups, two -COOH groups)>citric acid (one α-OH group, three -COOH groups)>malic acid (one α-OH group, two -COOH groups)>lactic acid (one α-OH group, one -COOH group)≫succinic acid (two -COOH groups), suggesting that the number of α-OH was the key factor for the reaction, followed by the number of -COOH. The formation of Cu(II)-citric acid complex could generate Cu(I) and radicals through a pathway of metal-ligand-electron transfer, promoting the reduction of Cr(VI). This study is helpful to fully understanding the conversion of Cr(VI) in the existence of both organic acids and Cu(II) with solar light in aquatic environments. Copyright © 2015 Elsevier Ltd. All rights reserved.
Phosphatase activity of Poa pratensis seeds. I. Preliminary studies on acid phosphatase II
Directory of Open Access Journals (Sweden)
I. Lorenc-Kubis
2015-01-01
Full Text Available Acid phosphatase (EC 3.1.3.2 was extracted with 0.1 M sodium acetate buffer pH 5.1 from Poa pratensis seeds, and separated into three fractions by chromatography on DEAE cellulose. The highest activity was found in fraction Il-b (acid phosphatase II. The activity of the enzyme was optimal at pH 4.9. It hydrolyzed p-nitrophenyl phosphate most readily among the various phosphomonoesters examined. Acid phosphatase II showed also a high activity toward β-naphtyl phosphate and phenyl phosphate, very low activity towards β-glycero phosphate, 5'-GMP and no activity with glucose-1 phosphate. The enzyme was inhibited by Ca2+ and fluoride, but activated by Mg2+. EDTA had no influence on the activity of the enzyme.
Xu, Jinkun; Ai, Ying; Wang, Jianhui; Xu, Jingwei; Zhang, Yongkang; Yang, Dong
2017-05-01
S-limonene synthase is a model monoterpene synthase that cyclizes geranyl pyrophosphate (GPP) to form S-limonene. It is a relatively specific enzyme as the majority of its products are composed of limonene. In this study, we converted it to pinene or phellandrene synthases after introducing N345A/L423A/S454A or N345I mutations. Further studies on N345 suggest the polarity of this residue plays a critical role in limonene production by stabilizing the terpinyl cation intermediate. If it is mutated to a non-polar residue, further cyclization or hydride shifts occurs so the carbocation migrates towards the pyrophosphate, leading to the production of pinene or phellandrene. On the other hand, mutant enzymes that still possess a polar residue at this position produce limonene as the major product. N345 is not the only polar residue that may stabilize the terpinyl cation because it is not strictly conserved among limonene synthases across species and there are also several other polar residues in this area. These residues could form a "polar pocket" that may collectively play this stabilizing role. Our study provides important insights into the catalytic mechanism of limonene synthases. Furthermore, it also has wider implications on the evolution of terpene synthases. Copyright © 2017 Elsevier Ltd. All rights reserved.
EPOXYEICOSATRIENOIC ACID ANALOG ATTENUATES ANGIOTENSIN II HYPERTENSION AND KIDNEY INJURY
Directory of Open Access Journals (Sweden)
Md. Abdul Hye Khan
2014-09-01
Full Text Available Epoxyeicosatrienoic acids (EETs contribute to blood pressure regulation leading to the concept that EETs can be therapeutically targeted for hypertension and the associated end-organ damage. In the present study, we investigated anti-hypertensive and kidney protective actions of an EET analog, EET-B in angiotensin II (ANG II-induced hypertension. EET-B was administered in drinking water for 14 days (10mg/kg/d and resulted in a decreased blood pressure elevation in ANG II hypertension. At the end of the two-week period, blood pressure was 30 mmHg lower in EET analog-treated ANG II hypertensive rats. The vasodilation of mesenteric resistance arteries to acetylcholine was impaired in ANG II hypertension; however, it was improved with EET-B treatment. Further, EET-B protected the kidney in ANG II hypertension as evidenced by a marked 90% decrease in albuminuria and 54% decrease in nephrinuria. Kidney histology demonstrated a decrease in renal tubular cast formation in EET analog-treated hypertensive rats. In ANG II hypertension, EET-B treatment markedly lowered renal inflammation. Urinary monocyte chemoattractant protein-1 excretion was decreased by 55% and kidney macrophage infiltration was reduced by 52% with EET-B treatment. Overall, our results demonstrate that EET-B has anti-hypertensive properties, improves vascular function, and decreases renal inflammation and injury in ANG II hypertension.
Enzymatic Properties and Mutational Studies of Chalcone Synthase from Physcomitrella patens
Directory of Open Access Journals (Sweden)
Mahiran Basri
2012-08-01
Full Text Available PpCHS is a member of the type III polyketide synthase family and catalyses the synthesis of the flavonoid precursor naringenin chalcone from p-coumaroyl-CoA. Recent research reports the production of pyrone derivatives using either hexanoyl-CoA or butyryl-CoA as starter molecule. The Cys-His-Asn catalytic triad found in other plant chalcone synthase predicted polypeptides is conserved in PpCHS. Site directed mutagenesis involving these amino acids residing in the active-site cavity revealed that the cavity volume of the active-site plays a significant role in the selection of starter molecules as well as product formation. Substitutions of Cys 170 with Arg and Ser amino acids decreased the ability of the PpCHS to utilize hexanoyl-CoA as a starter molecule, which directly effected the production of pyrone derivatives (products. These substitutions are believed to have a restricted number of elongations of the growing polypeptide chain due to the smaller cavity volume of the mutant’s active site.
Directory of Open Access Journals (Sweden)
Mónica Hernández-Rodríguez
2017-01-01
Full Text Available In the research the effect of modification of coconut shell activated carbon with diluted solutions of nitric acid, in its chemical characteristics and removal capacity of the nickel (II ions present in modeling solutions of sulfates with similar characteristics to the acid liquor waste of the nickel industry, was studied. The characterization of the adsorbent material evidenced that the modification process increases the superficial acids groups according with the increase of acid nitric concentration employee in the treatment. The adsorption equilibrium tests, carried out with metallic species solutions at concentrations between 0,5 and 3,5 g/L evidenced that the process is described by Freundlich model. The effect of chemical modification of the adsorbent material in adsorption capacity of nickel (II ions was evaluated using a traditional experimental design at pH of 1,2 and 6,9 units, obtaining that the increase of acid groups in the carbon surface causes an increase of adsorption capacity and removal percentages of nickel (II, due to specific interactions of these groups with the metal cations.
Tuan, Pham Anh; Kim, Jae Kwang; Lee, Sanghyun; Chae, Soo Cheon; Park, Sang Un
2012-12-05
Riboflavin (vitamin B2) is the universal precursor of the coenzymes flavin mononucleotide and flavin adenine dinucleotide--cofactors that are essential for the activity of a wide variety of metabolic enzymes in animals, plants, and microbes. Using the RACE PCR approach, cDNAs encoding lumazine synthase (McLS) and riboflavin synthase (McRS), which catalyze the last two steps in the riboflavin biosynthetic pathway, were cloned from bitter melon (Momordica charantia), a popular vegetable crop in Asia. Amino acid sequence alignments indicated that McLS and McRS share high sequence identity with other orthologous genes and carry an N-terminal extension, which is reported to be a plastid-targeting sequence. Organ expression analysis using quantitative real-time RT PCR showed that McLS and McRS were constitutively expressed in M. charantia, with the strongest expression levels observed during the last stage of fruit ripening (stage 6). This correlated with the highest level of riboflavin content, which was detected during ripening stage 6 by HPLC analysis. McLS and McRS were highly expressed in the young leaves and flowers, whereas roots exhibited the highest accumulation of riboflavin. The cloning and characterization of McLS and McRS from M. charantia may aid the metabolic engineering of vitamin B2 in crops.
Landree, Leslie E; Hanlon, Andrea L; Strong, David W; Rumbaugh, Gavin; Miller, Ian M; Thupari, Jagan N; Connolly, Erin C; Huganir, Richard L; Richardson, Christine; Witters, Lee A; Kuhajda, Francis P; Ronnett, Gabriele V
2004-01-30
C75, a synthetic inhibitor of fatty acid synthase (FAS), is hypothesized to alter the metabolism of neurons in the hypothalamus that regulate feeding behavior to contribute to the decreased food intake and profound weight loss seen with C75 treatment. In the present study, we characterize the suitability of primary cultures of cortical neurons for studies designed to investigate the consequences of C75 treatment and the alteration of fatty acid metabolism in neurons. We demonstrate that in primary cortical neurons, C75 inhibits FAS activity and stimulates carnitine palmitoyltransferase-1 (CPT-1), consistent with its effects in peripheral tissues. C75 alters neuronal ATP levels and AMP-activated protein kinase (AMPK) activity. Neuronal ATP levels are affected in a biphasic manner with C75 treatment, decreasing initially, followed by a prolonged increase above control levels. Cerulenin, a FAS inhibitor, causes a similar biphasic change in ATP levels, although levels do not exceed control. C75 and cerulenin modulate AMPK phosphorylation and activity. TOFA, an inhibitor of acetyl-CoA carboxylase, increases ATP levels, but does not affect AMPK activity. Several downstream pathways are affected by C75 treatment, including glucose metabolism and acetyl-CoA carboxylase (ACC) phosphorylation. These data demonstrate that C75 modulates the levels of energy intermediates, thus, affecting the energy sensor AMPK. Similar effects in hypothalamic neurons could form the basis for the effects of C75 on feeding behavior.
Boris, K V; Kochieva, E Z; Kudryavtsev, A M
2014-12-01
The sequences that encode the main functional glucosyltransferase domain of sucrose synthase genes have been identified for the first time in 14 species of the genus Malus and related species of the family Rosaceae, and their polymorphism was investigated. Single nucleotide substitutions leading to amino acid substitutions in the protein sequence, including the conservative transmembrane motif sequence common to all sucrose synthase genes of higher plants, were detected in the studied sequences.
Directory of Open Access Journals (Sweden)
Xiang Zhou
2014-07-01
Full Text Available A set of bisphosphonate ethers has been prepared through sequential phosphonylation and alkylation of monophosphonate ethers. After formation of the corresponding phosphonic acid salts, these compounds were tested for their ability to inhibit the enzyme geranylgeranyl diphosphate synthase (GGDPS. Five of the new compounds show IC50 values of less than 1 μM against GGDPS with little to no activity against the related enzyme farnesyl diphosphate synthase (FDPS. The most active compound displayed an IC50 value of 82 nM when assayed with GGDPS, and no activity against FDPS even at a 10 μM concentration.
Gay, Darren C; Wagner, Drew T; Meinke, Jessica L; Zogzas, Charles E; Gay, Glen R; Keatinge-Clay, Adrian T
2016-03-01
Polyketides such as the clinically-valuable antibacterial agent mupirocin are constructed by architecturally-sophisticated assembly lines known as trans-acyltransferase polyketide synthases. Organelle-sized megacomplexes composed of several copies of trans-acyltransferase polyketide synthase assembly lines have been observed by others through transmission electron microscopy to be located at the Bacillus subtilis plasma membrane, where the synthesis and export of the antibacterial polyketide bacillaene takes place. In this work we analyze ten crystal structures of trans-acyltransferase polyketide synthases ketosynthase domains, seven of which are reported here for the first time, to characterize a motif capable of zippering assembly lines into a megacomplex. While each of the three-helix LINKS (Laterally-INteracting Ketosynthase Sequence) motifs is observed to similarly dock with a spatially-reversed copy of itself through hydrophobic and ionic interactions, the amino acid sequences of this motif are not conserved. Such a code is appropriate for mediating homotypic contacts between assembly lines to ensure the ordered self-assembly of a noncovalent, yet tightly-knit, enzymatic network. LINKS-mediated lateral interactions would also have the effect of bolstering the vertical association of the polypeptides that comprise a polyketide synthase assembly line. Copyright © 2015 Elsevier Inc. All rights reserved.
Xu, Lisheng; Wang, Zhiyuan; Mao, Pingting; Liu, Junzhong; Zhang, Hongjuan; Liu, Qian; Jiao, Qing-Cai
2013-04-01
An economical method for production of S-phenyl-L-cysteine from keratin acid hydrolysis wastewater (KHW) containing L-serine was developed by recombinant tryptophan synthase. This study provides us with an alternative KHW utilization strategy to synthesize S-phenyl-L-cysteine. Tryptophan synthase could efficiently convert L-serine contained in KHW to S-phenyl-L-cysteine at pH 9.0, 40°C and Trion X-100 of 0.02%. In a scale up study, L-serine conversion rate reach 97.1% with a final S-phenyl-L-cysteine concentration of 38.6 g l(-1). Copyright © 2013 Elsevier Ltd. All rights reserved.
Differentiation of Cannabis subspecies by THCA synthase gene analysis using RFLP.
Cirovic, Natasa; Kecmanovic, Miljana; Keckarevic, Dusan; Keckarevic Markovic, Milica
2017-10-01
Cannabis sativa subspecies, known as industrial hemp (C. sativa sativa) and marijuana (C. sativa indica) show no evident morphological distinctions, but they contain different levels of psychoactive Δ-9-tetrahidrocanabinol (THC), with considerably higher concentration in marijuana than in hemp. C. sativa subspecies differ in sequence of tetrahydrocannabinolic acid (THCA) synthase gene, responsible for THC production, and only one active copy of the gene, distinctive for marijuana, is capable of producing THC in concentration more then 0,3% in dried plants, usually punishable by the law. Twenty different samples of marijuana that contain THC in concentration more then 0,3% and three varieties of industrial hemp were analyzed for presence of an active copy of THCA synthase gene using in-house developed restriction fragment length polymorphism (RFLP) method All twenty samples of marijuana were positive for the active copy of THCA synthase gene, 16 of them heterozygous. All three varieties of industrial hemp were homozygous for inactive copy. An algorithm for the fast and accurate forensic analysis of samples suspected to be marijuana was constructed, answering the question if an analyzed sample is capable of producing THC in concentrations higher than 0.3%. Copyright © 2017 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.
Polarographic study of mixed-ligand complexes of cadmium(II) with L-amino acid and vitamin B5
International Nuclear Information System (INIS)
Jain, Alok K.; Khan, Farid
1998-01-01
A survey of literature shows that ternary complexes of Cd II with L-amino acids and vitamin B 5 have not been studied so far. The present communication reports the formation of mixed-ligand complexes of Cd II with L-amino acids as primary ligands and vitamin B 5 as secondary ligand, studied by polarographic technique. (author)
Jin, Mei Lan; Lee, Dae Young; Um, Yurry; Lee, Jeong Hoon; Park, Chun Geun; Jetter, Reinhard; Kim, Ok Tae
2014-03-01
Expression of PtBS (Polygala tenuifolia β-amyrin synthase) led to the production of β-amyrin as sole product. Polygala tenuifolia Willdenow is a rich source of triterpene saponins, onjisaponins and polygalasaponins, used as herbal medicine to treat phlegms and for detumescence in traditional Asian healing. The Polygala saponins share the oleanane backbone structure and are, therefore, likely synthesized via β-amyrin as a common precursor. We hypothesized that, in analogy to diverse other plant species, this central intermediate should be formed by a β-amyrin synthase catalyzing the complex cyclization of oxidosqualene. This member of the oxidosqualene cyclase (OSC) family of enzymes is thus defining an important branch point between primary and secondary metabolisms, and playing a crucial role in the control of oleanane-type triterpene saponin biosynthesis. From P. tenuifolia roots, we isolated an OSC cDNA containing a reading frame of 2,289 bp nucleotides. The predicted protein of 763 amino acids (molecular weight 87.353 kDa) showed particularly high amino acid sequence identities to known β-amyrin synthases (85-87 %) and was, therefore, named PtBS. Expression of PtBS in the triterpenoid synthase-deficient yeast mutant GIL77 led to the production of β-amyrin as sole product. qRT-PCR analysis of various P. tenuifolia organs showed that PtBS transcript levels were highest in the roots, consistent with onjisaponin accumulation patterns. Therefore, we conclude that PtBS is the β-amyrin synthase enzyme catalyzing the first committed step in the biosynthesis of onjisaponins and polygalasaponins in P. tenuifolia.
Pyreu, D. F.; Gridchin, S. N.
2018-05-01
The formation of mixed-ligand complexes in the M(II)-Nta, Ida-L (M = Cu(II), Ni, Zn, Co(II), L = Ser, Thr, Asp, Arg, Asn) systems, where Ida and Nta are the residues of iminodiacetic and nitrilotriacetic acids, respectively, is studied using pH measurements, calorimetry and spectrophotometry. The thermodynamic parameters (log K, Δr G 0, Δr H, Δr S) of their formation at 298.15 K and ionic strength I = 0.5 (KNO3) are determined. The most likely scenario of amino acid residue coordination in the composition of mixed complexes is discussed.
Directory of Open Access Journals (Sweden)
Nevzat Selim Gokay
2016-01-01
Full Text Available The objective of this study was to investigate the effects of selective inducible nitric oxide synthase and neuronal nitric oxide synthase inhibitors on cartilage regeneration. The study involved 27 Wistar rats that were divided into five groups. On Day 1, both knees of 3 rats were resected and placed in a formalin solution as a control group. The remaining 24 rats were separated into 4 groups, and their right knees were surgically damaged. Depending on the groups, the rats were injected with intra-articular normal saline solution, neuronal nitric oxide synthase inhibitor 7-nitroindazole (50 mg/kg, inducible nitric oxide synthase inhibitor amino-guanidine (30 mg/kg, or nitric oxide precursor L-arginine (200 mg/kg. After 21 days, the right and left knees of the rats were resected and placed in formalin solution. The samples were histopathologically examined by a blinded evaluator and scored on 8 parameters. Although selective neuronal nitric oxide synthase inhibition exhibited significant (P=0.044 positive effects on cartilage regeneration following cartilage damage, it was determined that inducible nitric oxide synthase inhibition had no statistically significant effect on cartilage regeneration. It was observed that the nitric oxide synthase activation triggered advanced arthrosis symptoms, such as osteophyte formation. The fact that selective neuronal nitric oxide synthase inhibitors were observed to have mitigating effects on the severity of the damage may, in the future, influence the development of new agents to be used in the treatment of cartilage disorders.
Stability of binary complexes of Pb(II, Cd(II and Hg(II with maleic acid in TX100-water mixtures
Directory of Open Access Journals (Sweden)
M. Ramanaiah
2014-09-01
Full Text Available Binary complexes of maleic acid with toxic metal ions such as Pb(II, Cd(II and Hg(II have been studied in 0.0-2.5% v/v tritonX-100 (TX100 - water media at 303 K at an ionic strength of 0.16 M. The active forms of the ligand are LH2, LH- and L2-. The derived ‘best fit’ chemical speciation models are based on crystallographic R-factors, χ2 and Skewness and Kurtosis factors. The predominant species formed are of the type ML2, ML2H and ML3. The trend in variation of complex stability constants with change in the mole fraction of the medium is explained on the basis of prevailing electrostatic and non-electrostatic forces. The species distribution as a function of pH at different compositions of TX100-water mixtures and plausible speciation equilibria are presented and discussed. DOI: http://dx.doi.org/10.4314/bcse.v28i3.7
Oberding, Lisa K; Gieg, Lisa M
2018-01-01
Paraffinic n -alkanes (>C 17 ) that are solid at ambient temperature comprise a large fraction of many crude oils. The comparatively low water solubility and reactivity of these long-chain alkanes can lead to their persistence in the environment following fuel spills and pose serious problems for crude oil recovery operations by clogging oil production wells. However, the degradation of waxy paraffins under the anoxic conditions characterizing contaminated groundwater environments and deep subsurface energy reservoirs is poorly understood. Here, we assessed the ability of a methanogenic culture enriched from freshwater fuel-contaminated aquifer sediments to biodegrade the model paraffin n -octacosane (C 28 H 58 ). Compared with that in controls, the consumption of n -octacosane was coupled to methane production, demonstrating its biodegradation under these conditions. Smithella was postulated to be an important C 28 H 58 degrader in the culture on the basis of its high relative abundance as determined by 16S rRNA gene sequencing. An identified assA gene (known to encode the α subunit of alkylsuccinate synthase) aligned most closely with those from other Smithella organisms. Quantitative PCR (qPCR) and reverse transcription qPCR assays for assA demonstrated significant increases in the abundance and expression of this gene in C 28 H 58 -degrading cultures compared with that in controls, suggesting n -octacosane activation by fumarate addition. A metabolite analysis revealed the presence of several long-chain α,ω-dicarboxylic acids only in the C 28 H 58 -degrading cultures, a novel observation providing clues as to how methanogenic consortia access waxy hydrocarbons. The results of this study broaden our understanding of how waxy paraffins can be biodegraded in anoxic environments with an application toward bioremediation and improved oil recovery. IMPORTANCE Understanding the methanogenic biodegradation of different classes of hydrocarbons has important
Glycogen synthase kinase 3: more than a namesake.
Rayasam, Geetha Vani; Tulasi, Vamshi Krishna; Sodhi, Reena; Davis, Joseph Alex; Ray, Abhijit
2009-03-01
Glycogen synthase kinase 3 (GSK3), a constitutively acting multi-functional serine threonine kinase is involved in diverse physiological pathways ranging from metabolism, cell cycle, gene expression, development and oncogenesis to neuroprotection. These diverse multiple functions attributed to GSK3 can be explained by variety of substrates like glycogen synthase, tau protein and beta catenin that are phosphorylated leading to their inactivation. GSK3 has been implicated in various diseases such as diabetes, inflammation, cancer, Alzheimer's and bipolar disorder. GSK3 negatively regulates insulin-mediated glycogen synthesis and glucose homeostasis, and increased expression and activity of GSK3 has been reported in type II diabetics and obese animal models. Consequently, inhibitors of GSK3 have been demonstrated to have anti-diabetic effects in vitro and in animal models. However, inhibition of GSK3 poses a challenge as achieving selectivity of an over achieving kinase involved in various pathways with multiple substrates may lead to side effects and toxicity. The primary concern is developing inhibitors of GSK3 that are anti-diabetic but do not lead to up-regulation of oncogenes. The focus of this review is the recent advances and the challenges surrounding GSK3 as an anti-diabetic therapeutic target.
Resveratrol suppresses growth of cancer stem-like cells by inhibiting fatty acid synthase.
Pandey, Puspa R; Okuda, Hiroshi; Watabe, Misako; Pai, Sudha K; Liu, Wen; Kobayashi, Aya; Xing, Fei; Fukuda, Koji; Hirota, Shigeru; Sugai, Tamotsu; Wakabayashi, Go; Koeda, Keisuke; Kashiwaba, Masahiro; Suzuki, Kazuyuki; Chiba, Toshimi; Endo, Masaki; Fujioka, Tomoaki; Tanji, Susumu; Mo, Yin-Yuan; Cao, Deliang; Wilber, Andrew C; Watabe, Kounosuke
2011-11-01
Resveratrol is a natural polyphenolic compound and has been shown to exhibit cardio-protective as well as anti-neoplastic effects on various types of cancers. However, the exact mechanism of its anti-tumor effect is not clearly defined. Resveratrol has been shown to have strong hypolipidemic effect on normal adipocytes and as hyper-lipogenesis is a hallmark of cancer cell physiology, the effect of resveratrol on lipid synthesis in cancer stem-like cells (CD24(-)/CD44(+)/ESA(+)) that were isolated from both ER+ and ER- breast cancer cell lines was examined. The authors found that resveratrol significantly reduced the cell viability and mammosphere formation followed by inducing apoptosis in cancer stem-like cells. This inhibitory effect of resveratrol is accompanied by a significant reduction in lipid synthesis which is caused by the down-regulation of the fatty acid synthase (FAS) gene followed by up-regulation of pro-apoptotic genes, DAPK2 and BNIP3. The activation of apoptotic pathway in the cancer stem-like cells was suppressed by TOFA and by Fumonisin B1, suggesting that resveratrol-induced apoptosis is indeed through the modulation of FAS-mediated cell survival signaling. Importantly, resveratrol was able to significantly suppress the growth of cancer stem-like cells in an animal model of xenograft without showing apparental toxicity. Taken together, the results of this study indicate that resveratrol is capable of inducing apoptosis in the cancer stem-like cells through suppression of lipogenesis by modulating FAS expression, which highlights a novel mechanism of anti-tumor effect of resveratrol.
Zhang, Xiu-Mei; Wang, Wei; Du, Li-Qing; Xie, Jiang-Hui; Yao, Yan-Li; Sun, Guang-Ming
2012-01-01
Differences in carbohydrate contents and metabolizing-enzyme activities were monitored in apical, medial, basal and core sections of pineapple (Ananas comosus cv. Comte de paris) during fruit development and ripening. Fructose and glucose of various sections in nearly equal amounts were the predominant sugars in the fruitlets, and had obvious differences until the fruit matured. The large rise of sucrose/hexose was accompanied by dramatic changes in sucrose phosphate synthase (SPS) and sucrose synthase (SuSy) activities. By contrast, neutral invertase (NI) activity may provide a mechanism to increase fruit sink strength by increasing hexose concentrations. Furthermore, two cDNAs of Ac-sps (accession no. GQ996582) and Ac-ni (accession no. GQ996581) were first isolated from pineapple fruits utilizing conserved amino-acid sequences. Homology alignment reveals that the amino acid sequences contain some conserved function domains. Transcription expression analysis of Ac-sps, Ac-susy and Ac-ni also indicated distinct patterns related to sugar accumulation and composition of pineapple fruits. It suggests that differential expressions of multiple gene families are necessary for sugar metabolism in various parts and developmental stages of pineapple fruit. A cycle of sucrose breakdown in the cytosol of sink tissues could be mediated through both Ac-SuSy and Ac-NI, and Ac-NI could be involved in regulating crucial steps by generating sugar signals to the cells in a temporally and spatially restricted fashion. PMID:22949808
Characterization and sequencing of the active site of 1-aminocyclopropane-1-carboxylate synthase
International Nuclear Information System (INIS)
Yip, Wing-Kin; Dong, Jian-Guo; Yang, S.F.; Kenny, J.W.; Thompson, G.A.
1990-01-01
The pyridoxal phosphate (PLP)-dependent 1-aminocyclopropane-1-carboxylic acid (ACC) synthase the key enzyme in ethylene biosynthesis, is inactivated by its substrate S-adenosylmethionine (AdoMet). Apple ACC synthase was purified with an immunoaffinity gel, and its active site was probed with NaB 3 H 4 or Ado[ 14 C]Met. Peptide sequencing of both 3 H- and 14 C-labeled peptides revealed a common dodecapeptide of Ser-Leu-Ser-Xaa-Asp-Leu-Gly-Leu-Pro-Gly-Phe-Arg, where Xaa was the modified, radioactive residue in each case. Acid hydrolysis of the 3 H-labeled enzyme released radioactive N-pyridoxyllysine, indicating that the active-site peptide contained lysine at position 4. Mass spectrometry of the 14 C-labeled peptide indicated a protonated molecular ion at m/z 1390.6, from which the mass of Xaa was calculated to be 229, a number that is equivalent to the mass of a lysine residue alkylated by the 2-aminobutyrate portion of AdoMet, as we previously proposed. These results indicate that the same active-site lysine binds the PLP and convalently links to the 2-aminobutyrate portion of AdoMet during inactivation. The active site of tomato ACC synthase was probed in the same manner with Ado [ 14 C]Met. Sequencing of the tomato active-site peptide revealed two highly conserved dodecapeptides; the minor peptide possessed a sequence identical to that of the apple enzyme, whereas the major peptide differed from the minor peptide in that methionine replaced leucine at position 6
Elimination par électrodialyse des ions Fe(II) d'une solution d'acide ...
African Journals Online (AJOL)
Administrateur
concentration de l'acide (H2SO4) et la température sur l'efficacité d'élimination de Fe(II) a été étudiée. Les .... C. Negro et al. [20] ont étudié la possibilité de récupérer l'acide sulfurique à partir de solution d'acide sulfurique contenant du sulfate de cuivre. L. Cifuentes et al. ..... removal from rinsing water after metal etching,.
Azevedo, Marisa F; Camsari, Cagri; Sá, Carla M; Lima, Cristovao F; Fernandes-Ferreira, Manuel; Pereira-Wilson, Cristina
2010-06-01
In the present study, two phytochemicals - ursolic acid (UA) and luteolin-7-glucoside (L7G) - were assessed in vivo in healthy rats regarding effects on plasma glucose and lipid profile (total cholesterol, HDL and LDL), as well as liver glycogen content, in view of their importance in the aetiology of diabetes and associated complications. Both UA and L7G significantly decreased plasma glucose concentration. UA also significantly increased liver glycogen levels accompanied by phosphorylation of glycogen synthase kinase-3 (GSK3). The increase in glycogen deposition induced by UA (mediated by GSK3) could have contributed to the lower plasma glucose levels observed. Both compounds significantly lowered total plasma cholesterol and low-density lipoprotein levels, and, in addition, UA increased plasma high-density lipoprotein levels. Our results show that UA particularly may be useful in preventable strategies for people at risk of developing diabetes and associated cardiovascular complications by improving plasma glucose levels and lipid profile, as well as by promoting liver glycogen deposition.
CTP synthase forms cytoophidia in the cytoplasm and nucleus
International Nuclear Information System (INIS)
Gou, Ke-Mian; Chang, Chia-Chun; Shen, Qing-Ji; Sung, Li-Ying; Liu, Ji-Long
2014-01-01
CTP synthase is an essential metabolic enzyme responsible for the de novo synthesis of CTP. Multiple studies have recently showed that CTP synthase protein molecules form filamentous structures termed cytoophidia or CTP synthase filaments in the cytoplasm of eukaryotic cells, as well as in bacteria. Here we report that CTP synthase can form cytoophidia not only in the cytoplasm, but also in the nucleus of eukaryotic cells. Both glutamine deprivation and glutamine analog treatment promote formation of cytoplasmic cytoophidia (C-cytoophidia) and nuclear cytoophidia (N-cytoophidia). N-cytoophidia are generally shorter and thinner than their cytoplasmic counterparts. In mammalian cells, both CTP synthase 1 and CTP synthase 2 can form cytoophidia. Using live imaging, we have observed that both C-cytoophidia and N-cytoophidia undergo multiple rounds of fusion upon glutamine analog treatment. Our study reveals the coexistence of cytoophidia in the cytoplasm and nucleus, therefore providing a good opportunity to investigate the intracellular compartmentation of CTP synthase. - Highlights: • CTP synthase forms cytoophidia not only in the cytoplasm but also in the nucleus. • Glutamine deprivation and Glutamine analogs promotes cytoophidium formation. • N-cytoophidia exhibit distinct morphology when compared to C-cytoophidia. • Both CTP synthase 1 and CTP synthase 2 form cytoophidia in mammalian cells. • Fusions of cytoophidia occur in the cytoplasm and nucleus
CTP synthase forms cytoophidia in the cytoplasm and nucleus
Energy Technology Data Exchange (ETDEWEB)
Gou, Ke-Mian [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom); State Key Laboratory for Agrobiotechnology, College of Biological Sciences, China Agricultural University, Beijing 100193 (China); Chang, Chia-Chun [Institute of Biotechnology, National Taiwan University, Taipei, Taiwan, ROC (China); Shen, Qing-Ji [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom); Sung, Li-Ying, E-mail: liyingsung@ntu.edu.tw [Institute of Biotechnology, National Taiwan University, Taipei, Taiwan, ROC (China); Agricultural Biotechnology Research Center, Academia Sinica, Taipei 115, Taiwan, ROC (China); Liu, Ji-Long, E-mail: jilong.liu@dpag.ox.ac.uk [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom)
2014-04-15
CTP synthase is an essential metabolic enzyme responsible for the de novo synthesis of CTP. Multiple studies have recently showed that CTP synthase protein molecules form filamentous structures termed cytoophidia or CTP synthase filaments in the cytoplasm of eukaryotic cells, as well as in bacteria. Here we report that CTP synthase can form cytoophidia not only in the cytoplasm, but also in the nucleus of eukaryotic cells. Both glutamine deprivation and glutamine analog treatment promote formation of cytoplasmic cytoophidia (C-cytoophidia) and nuclear cytoophidia (N-cytoophidia). N-cytoophidia are generally shorter and thinner than their cytoplasmic counterparts. In mammalian cells, both CTP synthase 1 and CTP synthase 2 can form cytoophidia. Using live imaging, we have observed that both C-cytoophidia and N-cytoophidia undergo multiple rounds of fusion upon glutamine analog treatment. Our study reveals the coexistence of cytoophidia in the cytoplasm and nucleus, therefore providing a good opportunity to investigate the intracellular compartmentation of CTP synthase. - Highlights: • CTP synthase forms cytoophidia not only in the cytoplasm but also in the nucleus. • Glutamine deprivation and Glutamine analogs promotes cytoophidium formation. • N-cytoophidia exhibit distinct morphology when compared to C-cytoophidia. • Both CTP synthase 1 and CTP synthase 2 form cytoophidia in mammalian cells. • Fusions of cytoophidia occur in the cytoplasm and nucleus.
Jeangkhwoa, Pattraporn; Bandhaya, Achirapa; Umpunjun, Puangpaka; Chuenboonngarm, Ngarmnij; Panvisavas, Nathinee
2017-03-01
This study reports a successful application of fluorescence in situ hybridization (FISH) technique in the identification of Cannabis sativa L. cells recovered from fresh and dried powdered plant materials. Two biotin-16-dUTP-labeled FISH probes were designed from the Cannabis-specific tetrahydrocannabinolic acid synthase (THCAS) gene and the ITS region of the 45S rRNA gene. Specificity of probe-target hybridization was tested against the target and 4 non-target plant species, i.e., Humulus lupulus, Mitragyna speciosa, Papaver sp., and Nicotiana tabacum. The 1-kb THCA synthase hybridization probe gave Cannabis-specific hybridization signals, unlike the 700-bp Cannabis-ITS hybridization probe. Probe-target hybridization was also confirmed against 20 individual Cannabis plant samples. The 1-kb THCA synthase and 700-bp Cannabis-ITS hybridization probes clearly showed 2 hybridization signals per cell with reproducibility. The 1-kb THCA synthase probe did not give any FISH signal when tested against H. lupulus, its closely related member of the Canabaceae family. It was also showed that 1-kb THCA synthase FISH probe can be applied to identify small amount of dried powdered Cannabis material with an addition of rehydration step prior to the experimental process. This study provided an alternative identification method for Cannabis trace. Copyright © 2016. Published by Elsevier B.V.
Bioassay studies of metal(II complexes of 2,2'-(ethane-1,2-diyldiiminodiacetic acid
Directory of Open Access Journals (Sweden)
Saeed-ur-Rehman
2011-08-01
Full Text Available Ni(II, Cu(II and Zn(II coordination compounds with modified diammine 2,2'-(ethane-1,2-diyldiiminodiacetic acid (EDDA were prepared and characterized. Coordination complexes of the EDDA were characterized by physical measurements including elemental analysis, IR, UV-Visible, magnetic susceptibilities and conductance measurements. The complexes were screened against four pathogenic bacteria like Escherichia coli, Pseudomonas aeruginosa, Klebsiella pneumoniae and Staphylococcus aureus and their concentrations for maximum inhibition zones were obtained.
Carglumic acid: a second look. Confirmed progress in a rare urea cycle disorder.
2008-04-01
(1) N-acetylglutamate synthase deficiency is a rare congenital disorder that causes hyperammonaemic comas, resulting in severe neurological morbidity and usually leading to death during childhood. (2) Carglumic acid is the first drug to be used for replacement therapy. Data available in 2003 showed beneficial effects on growth and psychomotor development. (3) In 2007, about 20 patients treated with carglumic acid for N-acetyglutamate synthase deficiency, for at least 5 years in half of cases, were all still alive. Their development was normal when treatment was initiated before complications occurred. (4) No serious adverse effects have been observed. (5) In practice, although this treatment has to continue for life, carglumic acid represents a major advance for patients with N-acetylglutamate synthase deficiency.
Fattorini, L; Veloccia, A; Della Rovere, F; D'Angeli, S; Falasca, G; Altamura, M M
2017-07-11
Indole-3-acetic acid (IAA), and its precursor indole-3-butyric acid (IBA), control adventitious root (AR) formation in planta. Adventitious roots are also crucial for propagation via cuttings. However, IBA role(s) is/are still far to be elucidated. In Arabidopsis thaliana stem cuttings, 10 μM IBA is more AR-inductive than 10 μM IAA, and, in thin cell layers (TCLs), IBA induces ARs when combined with 0.1 μM kinetin (Kin). It is unknown whether arabidopsis TCLs produce ARs under IBA alone (10 μM) or IAA alone (10 μM), and whether they contain endogenous IAA/IBA at culture onset, possibly interfering with the exogenous IBA/IAA input. Moreover, it is unknown whether an IBA-to-IAA conversion is active in TCLs, and positively affects AR formation, possibly through the activity of the nitric oxide (NO) deriving from the conversion process. Revealed undetectable levels of both auxins at culture onset, showing that arabidopsis TCLs were optimal for investigating AR-formation under the total control of exogenous auxins. The AR-response of TCLs from various ecotypes, transgenic lines and knockout mutants was analyzed under different treatments. It was shown that ARs are better induced by IBA than IAA and IBA + Kin. IBA induced IAA-efflux (PIN1) and IAA-influx (AUX1/LAX3) genes, IAA-influx carriers activities, and expression of ANTHRANILATE SYNTHASE -alpha1 (ASA1), a gene involved in IAA-biosynthesis. ASA1 and ANTHRANILATE SYNTHASE -beta1 (ASB1), the other subunit of the same enzyme, positively affected AR-formation in the presence of exogenous IBA, because the AR-response in the TCLs of their mutant wei2wei7 was highly reduced. The AR-response of IBA-treated TCLs from ech2ibr10 mutant, blocked into IBA-to-IAA-conversion, was also strongly reduced. Nitric oxide, an IAA downstream signal and a by-product of IBA-to-IAA conversion, was early detected in IAA- and IBA-treated TCLs, but at higher levels in the latter explants. Altogether, results showed that IBA induced
Degradation of gas-liquid gliding arc discharge on Acid Orange II
International Nuclear Information System (INIS)
Yan, J.H.; Liu, Y.N.; Bo, Zh.; Li, X.D.; Cen, K.F.
2008-01-01
The effects of pH value, initial concentration of dye solution and temperature on the degradation efficiency of Acid Orange II (AO7) using gas-liquid gliding arc discharge were investigated. The influences of pH value and temperature on degradation efficiency were not apparent. Increasing initial solution concentration caused the decrease of degradation rate and the increase of absolute degradation quantity. Considering energy efficiency and absolute degradation quantity, the gas-liquid gliding arc discharge is fit for treating high concentration organic wastewater. A possible mineralization pathway was proposed through the analysis of intermediate products detected by gas chromatograph coupled with mass spectrophotometer (GC-MS) and ion chromatograph (IC). Hydroxyl radicals reacted with the azo linkage-bearing carbon of a hydroxy-substituted ring, leading to the cleavage of -C-N- and degradation of AO7. The solution biodegradability was significantly improved (BOD 5 /COD from 0.02 to 0.43). The toxicity of intermediate products was lower than that of the initial Acid Orange II
Wei, Wei; Cui, Jing; Wei, Zhenggui
2014-06-01
Understanding the effects of low molecular weight organic acids (LMWOAs) on the transformation of Pb(II) to geochemically stable pyromorphite (PY) by apatite materials (AMs), has considerable benefits for risk assessment and remediation strategies for contaminated water and soil. In this study, we systematically investigated the immobilization of Pb(II) from aqueous solution by natural phosphate rock (PR) and different crystallized hydroxyapatite (HAp) in the absence and presence of LMWOAs (oxalic, malic and citric acids). The results indicated that the effectiveness of PR and HAp in immobilizing Pb(II) followed in descending order by HAp2 (the poorly crystallized HAp), HAp1 (the well crystallized HAp) and PR, regardlessof the presence of LMWOAs. The presence of malic and citric acids significantly decreased the immobilizationefficiency of Pb(II) by HAp1 and PR, clarifying the lower adsorption affinities of Pb(II)-organic acid complexes on HAp1 and PR rather than Pb(II) ion. On thecontrary, oxalic acid could markedly enhance the removal of Pb(II) from aqueous solution by HAp1 and PR through the formation of lead oxalate, which was confirmed by FT-IR and XRDanalysis. Results also showed that LMWOAs had little promoting or inhibiting effect on the immobilization of Pb(II) by HAp2. This study suggested that the ubiquity of LMWOAs in natural environments could retard the transformation efficiency of Pb(II) to PY by AMs, especiallyin thepresenceof oxalic acid, and the poorly crystallized HAp2 had great potential to remediate Pb(II)-contaminated water and soil due to its insusceptibility to LMWOAs. Copyright © 2013 Elsevier Ltd. All rights reserved.
Regulska, E; Kalinowska, M; Wojtulewski, S; Korczak, A; Sienkiewicz-Gromiuk, J; Rzączyńska, Z; Swisłocka, R; Lewandowski, W
2014-11-11
The DFT calculations (B3LYP method with 6-311++G(d,p) mixed with LanL2DZ for transition metals basis sets) for different conformers of 2,5-dihydroxybenzoic acid (gentisic acid), sodium 2,5-dihydroxybenzoate (gentisate) and copper(II) and cadmium(II) gentisates were done. The proposed hydrated structures of transition metal complexes were based on the results of experimental findings. The theoretical geometrical parameters and atomic charge distribution were discussed. Moreover Na, Cu(II) and Cd(II) gentisates were synthesized and the composition of obtained compounds was revealed by means of elemental and thermogravimetric analyses. The FT-IR and FT-Raman spectra of gentisic acid and gentisates were registered and the effect of metals on the electronic charge distribution of ligand was discussed. Copyright © 2014 Elsevier B.V. All rights reserved.
Inducible nitric oxide synthase (iNOS) in tumor biology: the two sides of the same coin
Lechner, Matthias; Lirk, Philipp; Rieder, Josef
2005-01-01
Inducible nitric oxide synthase (iNOS) is one of three key enzymes generating nitric oxide (NO) from the amino acid l-arginine. iNOS-derived NO plays an important role in numerous physiological (e.g. blood pressure regulation, wound repair and host defence mechanisms) and pathophysiological
McCue, Kent F.; Conn, Eric E.
1990-01-01
Light treatment of suspension cultured cells of parsley (Petroselinum crispum) was shown to increase the activity of the shikimic acid pathway enzyme, 3-deoxy-d-arabino-heptulosonic acid-7-phosphate (DAHP) synthase (EC 4.1.2.15). DAHP synthase activity was assayed for two isoforms, DS-Mn and DS-Co (RJ Ganson, TA d'Amato, RA Jensen [1986] Plant Physiol 82: 203-210). Light increased the enzymatic activity of the plastidic isoform DS-Mn as much as 2-fold, averaging 1.6-fold with >95% confidence. The cytosolic isoform DS-Co was unaffected. Cycloheximide and actinomycin D, translational and transcriptional inhibitors, respectively, both reversed induction of DS-Mn by light suggesting transcriptional regulation of the gene. Chorismate mutase activity was assayed for the two isoforms CM I and CM II (BK Singh, JA Connelly, EE Conn [1985] Arch Biochem Biophys 243: 374-384). Treatment by light did not significantly affect either chorismate mutase isoform. The ratio of the two chorismate mutase isoforms changed during the growth cycle, with an increase in the ratio of plastidic to cytosolic isoforms occurring towards the end of logarithmic growth. PMID:16667741
International Nuclear Information System (INIS)
Oyenarte, Iker; Majtan, Tomas; Ereño, June; Corral-Rodríguez, María Angeles; Kraus, Jan P.; Martínez-Cruz, Luis Alfonso
2012-01-01
This article describes the crystallization and preliminary crystallographic analysis of a protein construct (hCBS 516–525 ) that contains the full-length cystathionine β-synthase from Homo sapiens (hCBS) and just lacks amino-acid residues 516–525. Human cystathionine β-synthase (CBS) is a pyridoxal-5′-phosphate-dependent hemeprotein, whose catalytic activity is regulated by S-adenosylmethionine. CBS catalyzes the β-replacement reaction of homocysteine (Hcy) with serine to yield cystathionine. CBS is a key regulator of plasma levels of the thrombogenic Hcy and deficiency in CBS is the single most common cause of homocystinuria, an inherited metabolic disorder of sulfur amino acids. The properties of CBS enzymes, such as domain organization, oligomerization degree or regulatory mechanisms, are not conserved across the eukaryotes. The current body of knowledge is insufficient to understand these differences and their impact on CBS function and physiology. To overcome this deficiency, we have addressed the crystallization and preliminary crystallographic analysis of a protein construct (hCBS 516–525 ) that contains the full-length CBS from Homo sapiens (hCBS) and just lacks amino-acid residues 516–525, which are located in a disordered loop. The human enzyme yielded crystals belonging to space group I222, with unit-cell parameters a = 124.98, b = 136.33, c = 169.83 Å and diffracting X-rays to a resolution of 3.0 Å. The crystal structure appears to contain two molecules in the asymmetric unit which presumably correspond to a dimeric form of the enzyme
Directory of Open Access Journals (Sweden)
Ardala Breda
Full Text Available The 5-phospho-α-D-ribose 1-diphosphate (PRPP metabolite plays essential roles in several biosynthetic pathways, including histidine, tryptophan, nucleotides, and, in mycobacteria, cell wall precursors. PRPP is synthesized from α-D-ribose 5-phosphate (R5P and ATP by the Mycobacterium tuberculosis prsA gene product, phosphoribosylpyrophosphate synthase (MtPRS. Here, we report amplification, cloning, expression and purification of wild-type MtPRS. Glutaraldehyde cross-linking results suggest that MtPRS predominates as a hexamer, presenting varied oligomeric states due to distinct ligand binding. MtPRS activity measurements were carried out by a novel coupled continuous spectrophotometric assay. MtPRS enzyme activity could be detected in the absence of P(i. ADP, GDP and UMP inhibit MtPRS activity. Steady-state kinetics results indicate that MtPRS has broad substrate specificity, being able to accept ATP, GTP, CTP, and UTP as diphosphoryl group donors. Fluorescence spectroscopy data suggest that the enzyme mechanism for purine diphosphoryl donors follows a random order of substrate addition, and for pyrimidine diphosphoryl donors follows an ordered mechanism of substrate addition in which R5P binds first to free enzyme. An ordered mechanism for product dissociation is followed by MtPRS, in which PRPP is the first product to be released followed by the nucleoside monophosphate products to yield free enzyme for the next round of catalysis. The broad specificity for diphosphoryl group donors and detection of enzyme activity in the absence of P(i would suggest that MtPRS belongs to Class II PRS proteins. On the other hand, the hexameric quaternary structure and allosteric ADP inhibition would place MtPRS in Class I PRSs. Further data are needed to classify MtPRS as belonging to a particular family of PRS proteins. The data here presented should help augment our understanding of MtPRS mode of action. Current efforts are toward experimental structure
Breda, Ardala; Martinelli, Leonardo K. B.; Bizarro, Cristiano V.; Rosado, Leonardo A.; Borges, Caroline B.; Santos, Diógenes S.; Basso, Luiz A.
2012-01-01
The 5-phospho-α-D-ribose 1-diphosphate (PRPP) metabolite plays essential roles in several biosynthetic pathways, including histidine, tryptophan, nucleotides, and, in mycobacteria, cell wall precursors. PRPP is synthesized from α-D-ribose 5-phosphate (R5P) and ATP by the Mycobacterium tuberculosis prsA gene product, phosphoribosylpyrophosphate synthase (MtPRS). Here, we report amplification, cloning, expression and purification of wild-type MtPRS. Glutaraldehyde cross-linking results suggest that MtPRS predominates as a hexamer, presenting varied oligomeric states due to distinct ligand binding. MtPRS activity measurements were carried out by a novel coupled continuous spectrophotometric assay. MtPRS enzyme activity could be detected in the absence of Pi. ADP, GDP and UMP inhibit MtPRS activity. Steady-state kinetics results indicate that MtPRS has broad substrate specificity, being able to accept ATP, GTP, CTP, and UTP as diphosphoryl group donors. Fluorescence spectroscopy data suggest that the enzyme mechanism for purine diphosphoryl donors follows a random order of substrate addition, and for pyrimidine diphosphoryl donors follows an ordered mechanism of substrate addition in which R5P binds first to free enzyme. An ordered mechanism for product dissociation is followed by MtPRS, in which PRPP is the first product to be released followed by the nucleoside monophosphate products to yield free enzyme for the next round of catalysis. The broad specificity for diphosphoryl group donors and detection of enzyme activity in the absence of Pi would suggest that MtPRS belongs to Class II PRS proteins. On the other hand, the hexameric quaternary structure and allosteric ADP inhibition would place MtPRS in Class I PRSs. Further data are needed to classify MtPRS as belonging to a particular family of PRS proteins. The data here presented should help augment our understanding of MtPRS mode of action. Current efforts are toward experimental structure determination of Mt
Ji, Yingbin; Liu, Jian; Xing, Da
2016-09-01
In plants, extensive efforts have been devoted to understanding the crosstalk between salicylic acid (SA) and jasmonic acid (JA) signaling in pathogen defenses, but this crosstalk has scarcely been addressed during senescence. In this study, the effect of SA application on methyl jasmonate (MeJA)-induced leaf senescence was assessed. We found that low concentrations of SA (1-50 μM) played a delayed role against the senescence promoted by MeJA. Furthermore, low concentrations of SA enhanced plant antioxidant defenses and restricted reactive oxygen species (ROS) accumulation in MeJA-treated leaves. When applied simultaneously with MeJA, low concentrations of SA triggered a nitric oxide (NO) burst, and the elevated NO levels were linked to the nitric oxide associated 1 (NOA1)-dependent pathway via nitric oxide synthase (NOS) activity. The ability of SA to up-regulate plant antioxidant defenses, reduce ROS accumulation, and suppress leaf senescence was lost in NO-deficient Atnoa1 plants. In a converse manner, exogenous addition of NO donors increased the plant antioxidant capacity and lowered the ROS levels in MeJA-treated leaves. Taken together, the results indicate that SA at low concentrations counteracts MeJA-induced leaf senescence through NOA1-dependent NO signaling and strengthening of the antioxidant defense. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Purification and H-1 NMR spectroscopic characterization of phase II metabolites of tolfenamic acid
DEFF Research Database (Denmark)
Sidelmann, U. G.; Christiansen, E.; Krogh, L.
1997-01-01
samples obtained on days 7 to 10 from a human volunteer after oral administration of 200 mg of the drug three times per day (steady-state plasma concentration). The metabolites of tolfenamic acid were initially concentrated by preparative solid phase extraction (PSPE) chromatography, thereby removing...... the endogenous polar compounds that are present in the urine. The individual metabolites were purified by preparative high performance liquid chromatography (HPLC) and then identified using H-1 NMR, Both one- and two-dimensional NMR experiments were performed to identify the phase II metabolites of tolfenamic......), and N-(2-methyl-4-hydroxyphenyl)-anthranilic acid (11) were identified. The phase II metabolites (5-11) had not previously been identified in urine from humans administered tolfenamic acid. The phase I metabolites of the glucuronides 7, 8, 10, and 11 were identified here for the first time. An HPLC...
Directory of Open Access Journals (Sweden)
Tao Zhou
2015-01-01
Full Text Available The incorporation pattern of biosynthetic precursors into two structurally unique polyketides, akaeolide and lorneic acid A, was elucidated by feeding experiments with 13C-labeled precursors. In addition, the draft genome sequence of the producer, Streptomyces sp. NPS554, was performed and the biosynthetic gene clusters for these polyketides were identified. The putative gene clusters contain all the polyketide synthase (PKS domains necessary for assembly of the carbon skeletons. Combined with the 13C-labeling results, gene function prediction enabled us to propose biosynthetic pathways involving unusual carbon-carbon bond formation reactions. Genome analysis also indicated the presence of at least ten orphan type I PKS gene clusters that might be responsible for the production of new polyketides.
ORF Alignment: NC_004463 [GENIUS II[Archive
Lifescience Database Archive (English)
Full Text Available NC_004463 gi|27377726 >1k4iA 2 216 3 205 5e-67 ... ref|NP_769255.1| 3,4-dihydroxy-2-butanone-4-phosha...0.1| ... 3,4-dihydroxy-2-butanone-4-phoshate synthase/GTP ... cyclohydrolase II [Bradyrhizobiu
Sitthithaworn, W; Kojima, N; Viroonchatapan, E; Suh, D Y; Iwanami, N; Hayashi, T; Noji, M; Saito, K; Niwa, Y; Sankawa, U
2001-02-01
cDNAs encoding geranylgeranyl diphosphate synthase (GGPPS) of two diterpene-producing plants, Scoparia dulcis and Croton sublyratus, have been isolated using the homology-based polymerase chain reaction (PCR) method. Both clones contained highly conserved aspartate-rich motifs (DDXX(XX)D) and their N-terminal residues exhibited the characteristics of chloroplast targeting sequence. When expressed in Escherichia coli, both the full-length and truncated proteins in which the putative targeting sequence was deleted catalyzed the condensation of farnesyl diphosphate and isopentenyl diphosphate to produce geranylgeranyl diphosphate (GGPP). The structural factors determining the product length in plant GGPPSs were investigated by constructing S. dulcis GGPPS mutants on the basis of sequence comparison with the first aspartate-rich motif (FARM) of plant farnesyl diphosphate synthase. The result indicated that in plant GGPPSs small amino acids, Met and Ser, at the fourth and fifth positions before FARM and Pro and Cys insertion in FARM play essential roles in determination of product length. Further, when a chimeric gene comprised of the putative transit peptide of the S. dulcis GGPPS gene and a green fluorescent protein was introduced into Arabidopsis leaves by particle gun bombardment, the chimeric protein was localized in chloroplasts, indicating that the cloned S. dulcis GGPPS is a chloroplast protein.
Energy Technology Data Exchange (ETDEWEB)
Nicholas C Carpita
2009-04-20
Five specific objectives of this project are to develop strategies to identify the genes that encode the catalytic components of "mixed-linkage" (1→3),(1→4)-beta-D-glucans in grasses, to determine the protein components of the synthase complex, and determine the biochemical mechanism of synthesis. We have used proteomic approaches to define intrinsic and extrinsic polypeptides of Golgi membranes that are associated with polysaccharide synthesis and trafficking. We were successful in producing recombinant catalytic domains of cellulose synthase genes and discovered that they dimerize upon concentration, indicating that two CesA proteins form the catalytic unit. We characterized a brittle stalk2 mutant as a defect in a COBRA-like protein that results in compromised lignin-cellulose interactions that decrease tissue flexibility. We used virus-induced gene silencing of barley cell wall polysaccharide synthesis by BSMV in an attempt to silence specific members of the cellulose synthase-like gene family. However, we unexpectedly found that regardless of the specificity of the target gene, whole gene interaction networks were silenced. We discovered the cause to be an antisense transcript of the cellulose synthase gene initiated small interfering RNAs that spread silencing to related genes.
Energy Technology Data Exchange (ETDEWEB)
Lin, Shuo [School of Environmental Science and Engineering, Huazhong University of Science and Technology, Wuhan 430074 (China); Wei, Wei [School of Chemical Engineering, Chonbuk National University, Jeonbuk 561-756 (Korea, Republic of); Wu, Xiaohui; Zhou, Tao [School of Environmental Science and Engineering, Huazhong University of Science and Technology, Wuhan 430074 (China); Mao, Juan, E-mail: monicamao45@hust.edu.cn [School of Environmental Science and Engineering, Huazhong University of Science and Technology, Wuhan 430074 (China); Yun, Yeoung-Sang, E-mail: ysyun@jbnu.ac.kr [School of Chemical Engineering, Chonbuk National University, Jeonbuk 561-756 (Korea, Republic of)
2015-12-15
Highlights: • An acid-resisting chitosan fiber was prepared by ion-imprinting technique. • Pd(II) and ECH were as template and two-step crosslinking agent, respectively. • IIF showed a good adsorption and selectivity performance on Pd(II) solutions. • Selectivity was due to the electrostatic attraction between −NH{sub 3}{sup +} and [PdCl{sub 4}]{sup 2−}. • Stable sorption/desorption performance shows a potential in further application. - Abstract: A novel, selective and acid-resisting chitosan fiber adsorbent was prepared by the ion-imprinting technique using Pd(II) and epichlorohydrin as the template and two-step crosslinking agent, respectively. The resulting ion-imprinted chitosan fibers (IIF) were used to selectively adsorb Pd(II) under extremely acidic synthetic metal solutions. The adsorption and selectivity performances of IIF including kinetics, isotherms, pH effects, and regeneration were investigated. Pd(II) rapidly adsorbed on the IIF within 100 min, achieving the adsorption equilibrium. The isotherm results showed that the maximum Pd(II) uptake on the IIF was maintained as 324.6–326.4 mg g{sup −1} in solutions containing single and multiple metals, whereas the Pd(II) uptake on non-imprinted fibers (NIF) decreased from 313.7 to 235.3 mg g{sup −1} in solution containing multiple metals. Higher selectivity coefficients values were obtained from the adsorption on the IIF, indicating a better Pd(II) selectivity. The amine group, supposedly the predominant adsorption site for Pd(II), was confirmed by Fourier transform infrared spectroscopy and X-ray photoelectron spectroscopy. The pH value played a significant role on the mechanism of the selective adsorption in the extremely acidic conditions. Furthermore, the stabilized performance for three cycles of sorption/desorption shows a potential for further large-scale applications.
International Nuclear Information System (INIS)
Lin, Shuo; Wei, Wei; Wu, Xiaohui; Zhou, Tao; Mao, Juan; Yun, Yeoung-Sang
2015-01-01
Highlights: • An acid-resisting chitosan fiber was prepared by ion-imprinting technique. • Pd(II) and ECH were as template and two-step crosslinking agent, respectively. • IIF showed a good adsorption and selectivity performance on Pd(II) solutions. • Selectivity was due to the electrostatic attraction between −NH_3"+ and [PdCl_4]"2"−. • Stable sorption/desorption performance shows a potential in further application. - Abstract: A novel, selective and acid-resisting chitosan fiber adsorbent was prepared by the ion-imprinting technique using Pd(II) and epichlorohydrin as the template and two-step crosslinking agent, respectively. The resulting ion-imprinted chitosan fibers (IIF) were used to selectively adsorb Pd(II) under extremely acidic synthetic metal solutions. The adsorption and selectivity performances of IIF including kinetics, isotherms, pH effects, and regeneration were investigated. Pd(II) rapidly adsorbed on the IIF within 100 min, achieving the adsorption equilibrium. The isotherm results showed that the maximum Pd(II) uptake on the IIF was maintained as 324.6–326.4 mg g"−"1 in solutions containing single and multiple metals, whereas the Pd(II) uptake on non-imprinted fibers (NIF) decreased from 313.7 to 235.3 mg g"−"1 in solution containing multiple metals. Higher selectivity coefficients values were obtained from the adsorption on the IIF, indicating a better Pd(II) selectivity. The amine group, supposedly the predominant adsorption site for Pd(II), was confirmed by Fourier transform infrared spectroscopy and X-ray photoelectron spectroscopy. The pH value played a significant role on the mechanism of the selective adsorption in the extremely acidic conditions. Furthermore, the stabilized performance for three cycles of sorption/desorption shows a potential for further large-scale applications.
Directory of Open Access Journals (Sweden)
Bua-In Saowaluck
2014-01-01
Full Text Available Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr. is a native Thai herb with a high content and large variety of terpenoids in its essential oil. Improving the essential oil content and quality of cassumunar ginger is difficult for a breeder due to its clonally propagated nature. In this research, we describe the isolation and expression level of the monoterpene synthase gene that controls the key step of essential oil synthesis in this plant and evaluate the mechanical wounding that may influence the transcription level of the monoterpene synthase gene. To isolate the gene, the selected clones from DNA derived from young leaves were sequenced and analyzed and the monoterpene synthase gene from cassumunar ginger (ZMM1 was identified. The ZMM1 CDS containing 1 773 bp (KF500399 is predicted to encode a protein of 590 amino acids. The deduced amino acid sequence is 40-74% identical with known sequences of other angiosperm monoterpene synthases belonging to the isoprenoid biosynthesis C1 superfamily. A transcript of ZMM1 was detected almost exclusively in the leaves and was related to leaf wounding. The results of this research offer insight into the control of monoterpene synthesis in this plant. This finding can be applied to breeding programs or crop management of cassumunar ginger for better yield and quality of essential oil.
Liang, Jing; Han, Qian; Ding, Haizhen; Li, Jianyong
2017-12-01
In available insect genomes, there are several L-3,4-dihydroxyphenylalanine (L-dopa) decarboxylase (DDC)-like or aromatic amino acid decarboxylase (AAAD) sequences. This contrasts to those of mammals whose genomes contain only one DDC. Our previous experiments established that two DDC-like proteins from Drosophila actually mediate a complicated decarboxylation-oxidative deamination process of dopa in the presence of oxygen, leading to the formation of 3,4-dihydroxyphenylacetaldehyde (DHPA), CO 2 , NH 3, and H 2 O 2 . This contrasts to the typical DDC-catalyzed reaction, which produces CO 2 and dopamine. These DDC-like proteins were arbitrarily named DHPA synthases based on their critical role in insect soft cuticle formation. Establishment of reactions catalyzed by these AAAD-like proteins solved a puzzle that perplexed researchers for years, but to tell a true DHPA synthase from a DDC in the insect AAAD family remains problematic due to high sequence similarity. In this study, we performed extensive structural and biochemical comparisons between DHPA synthase and DDC. These comparisons identified several target residues potentially dictating DDC-catalyzed and DHPA synthase-catalyzed reactions, respectively. Comparison of DHPA synthase homology models with crystal structures of typical DDC proteins, particularly residues in the active sites, provided further insights for the roles these identified target residues play. Subsequent site-directed mutagenesis of the tentative target residues and activity evaluations of their corresponding mutants determined that active site His192 and Asn192 are essential signature residues for DDC- and DHPA synthase-catalyzed reactions, respectively. Oxygen is required in DHPA synthase-mediated process and this oxidizing agent is reduced to H 2 O 2 in the process. Biochemical assessment established that H 2 O 2 , formed in DHPA synthase-mediated process, can be reused as oxidizing agent and this active oxygen species is reduced to H 2
Directory of Open Access Journals (Sweden)
Ligia De Carli
2006-03-01
Full Text Available A técnica de titulação potenciométrica foi utilizada para verificar as propriedades ácida-base do ácido fítico [1,2,3,4,5,6-hexaquis(dihidrogenofosfato-mio-inositol] e do complexo ácido fítico e Ni(II, em solução aquosa, em temperatura e força iônica constantes. Para avaliar o comportamento térmico e a complexação do ácido fítico com o íon Ni(II foram realizadas análises de Termogravimetria (TG, Termogravimetria Derivada (DTG, Calorimetria Exploratória Diferencial (DSC e estudos de Espectrofotometria de Infravermelho. Foram obtidas oito constantes de protonação da amostra de ácido fítico na forma de sal de dipotássio e sete constantes de estabilidade do complexo ácido fítico e Ni(II. As reações de protonação e de formação ocorrem na faixa de pH de 2,0 a 11,0. Os dados obtidos mostram que o ácido fítico encontra-se totalmente deprotonado em pH 12,0 no qual a espécie ML (um ligante para um íon metálico encontra-se totalmente formada no mesmo valor de pH. Os resultados obtidos por TG e DSC revelaram tanto para o ácido fítico como para o complexo boa estabilidade até a temperatura próxima a 200ºC. Por TG, DTG e DSC conclui-se também que a estequiometria do complexo estudado foi de um mol de ligante para um mol de íon metálico. A Espectrofotometria de Infravermelho comprovou a estabilidade do ácido fítico e a sua interação com o íon Ni(II.The technique of potenciometric titration was used to verify the acid-basic properties of the phytic acid, [1,2,3,4,5,6-hexakis(dihydrogen phosphate-myo-inositol] and the Phytic Acid-Ni(II complex, in aqueous solution, in constant temperature and ionic strength. To evaluate the thermal behavior end complexation of the isolated phytic acid with the Ni(II were performed analyses of thermogravimetry (TG, calorimetric scanning differential (DSC and studies Spectroscopy Infrared (IR. Eight protonation constants of the phytic acid sample as dipotassium salt were
Michel, J B; Feron, O; Sase, K; Prabhakar, P; Michel, T
1997-10-10
Nitric oxide is synthesized in diverse mammalian tissues by a family of calmodulin-dependent nitric oxide synthases. The endothelial isoform of nitric oxide synthase (eNOS) is targeted to the specialized signal-transducing membrane domains termed plasmalemmal caveolae. Caveolin, the principal structural protein in caveolae, interacts with eNOS and leads to enzyme inhibition in a reversible process modulated by Ca2+-calmodulin (Michel, J. B., Feron, O., Sacks, D., and Michel, T. (1997) J. Biol. Chem. 272, 15583-15586). Caveolin also interacts with other structurally distinct signaling proteins via a specific region identified within the caveolin sequence (amino acids 82-101) that appears to subserve the role of a "scaffolding domain." We now report that the co-immunoprecipitation of eNOS with caveolin is completely and specifically blocked by an oligopeptide corresponding to the caveolin scaffolding domain. Peptides corresponding to this domain markedly inhibit nitric oxide synthase activity in endothelial membranes and interact directly with the enzyme to inhibit activity of purified recombinant eNOS expressed in Escherichia coli. The inhibition of purified eNOS by the caveolin scaffolding domain peptide is competitive and completely reversed by Ca2+-calmodulin. These studies establish that caveolin, via its scaffolding domain, directly forms an inhibitory complex with eNOS and suggest that caveolin inhibits eNOS by abrogating the enzyme's activation by calmodulin.
Flynn, Christopher M; Schmidt-Dannert, Claudia
2018-06-01
The wood-rotting mushroom Stereum hirsutum is a known producer of a large number of namesake hirsutenoids, many with important bioactivities. Hirsutenoids form a structurally diverse and distinct class of sesquiterpenoids. No genes involved in hirsutenoid biosynthesis have yet been identified or their enzymes characterized. Here, we describe the cloning and functional characterization of a hirsutene synthase as an unexpected fusion protein of a sesquiterpene synthase (STS) with a C-terminal 3-hydroxy-3-methylglutaryl-coenzyme A (3-hydroxy-3-methylglutaryl-CoA) synthase (HMGS) domain. Both the full-length fusion protein and truncated STS domain are highly product-specific 1,11-cyclizing STS enzymes with kinetic properties typical of STSs. Complementation studies in Saccharomyces cerevisiae confirmed that the HMGS domain is also functional in vivo Phylogenetic analysis shows that the hirsutene synthase domain does not form a clade with other previously characterized sesquiterpene synthases from Basidiomycota. Comparative gene structure analysis of this hirsutene synthase with characterized fungal enzymes reveals a significantly higher intron density, suggesting that this enzyme may be acquired by horizontal gene transfer. In contrast, the HMGS domain is clearly related to other fungal homologs. This STS-HMGS fusion protein is part of a biosynthetic gene cluster that includes P450s and oxidases that are expressed and could be cloned from cDNA. Finally, this unusual fusion of a terpene synthase to an HMGS domain, which is not generally recognized as a key regulatory enzyme of the mevalonate isoprenoid precursor pathway, led to the identification of additional HMGS duplications in many fungal genomes, including the localization of HMGSs in other predicted sesquiterpenoid biosynthetic gene clusters. IMPORTANCE Hirsutenoids represent a structurally diverse class of bioactive sesquiterpenoids isolated from fungi. Identification of their biosynthetic pathways will provide
Energy Technology Data Exchange (ETDEWEB)
Ibanez, J. P.; Ipinza, J.; Cifuentes, L.
2007-07-01
The separation of copper and arsenic from acidic electrolytes by electrodialysis was investigated at room temperature. the effect of current density and pH was studied in a batch cell during 3 hours. The kinetic parameters showed that Cu(II) transport rate was 0.75 mol/m''2/h and the As(V) transport rate was 0.002 mol/m''2/h. An efficient separation between Cu(II) and As(V) was achieved; Generating a concentrated solution of copper with no arsenic, which was obtained independently of the electrolyte acidity and current density used. The effect of the arsenic speciation with pH is discussed as well. (Author) 23 refs.
Directory of Open Access Journals (Sweden)
Nuryono Nuryono
2010-06-01
Full Text Available In this research, treatment of diatomaceous earth, Sangiran, Central Java using hydrogen chloride (HCl and sulfuric acid (H2SO4 on kinetics of Cd(II adsorption in aqueous solution has been carried out. The work was conducted by mixing an amount of grounded diatomaceous earth (200 mesh in size with HCl or H2SO4 solution in various concentrations for two hours at temperature range of 100 - 150oC. The mixture was then filtered and washed with water until the filtrate pH is approximately 7 and then the residue was dried for four hours at a temperature of 70oC. The product was used as an adsorbent to adsorb Cd(II in aqueous solution with various concentrations. The Cd(II adsorbed was determined by analyzing the rest of Cd(II in the solution using atomic absorption spectrophotometry. The effect of treatment was evaluated from kinetic parameter of adsorption rate constant calculated based on the simple kinetic model. Results showed that before equilibrium condition reached, adsorpstion of Cd(II occurred through two steps, i.e. a step tends to follow a reaction of irreversible first order (step I followed by reaction of reversible first order (step II. Treatment with acids, either hydrogen chloride or sulfuric acid, decreased adsorption rate constant for the step I from 15.2/min to a range of 6.4 - 9.4/min. However, increasing concentration of acid (in a range of concentration investigated did not give significant and constant change of adsorption rate constant. For step II process, adsorption involved physical interaction with the sufficient low adsorption energy (in a range of 311.3 - 1001 J/mol. Keywords: adsorption, cdmium, diatomaceous earth, kinetics.
Santoso, D; Thornburg, R
2000-08-01
We have selected 143 independent Nicotiana plumbaginifolia cell lines that survive in the presence of 5-fluoroorotic acid. These lines show several diverse phenotypes. The majority of these cell lines showed reduced levels of UMP synthase. However, one particular phenotype, which represents 14% of the total independent lines (20 cell lines), showed an unexpected, high level of UMP synthase and was therefore analyzed in detail. The selected cell lines showed no differences with wild-type cells with respect to uptake of orotic acid, affinity of UMP synthase for its substrates, or UMP synthase gene-copy number. Alternative detoxification mechanisms were also excluded. The elevated enzyme activity was correlated with elevated UMP synthase protein levels as well as elevated UMP synthase mRNA levels. In contrast to wild-type cell lines, the fluoroorotic acid-selected cell lines did not respond to thymine or to other biochemicals that affect thymine levels. In addition, there was also a concomitant up-regulation of aspartate transcarbamoylase, however, dihydroorotase and dihydroorotate dehydrogenase are not up-regulated in these cell lines.
Schimpl, Flávia Camila; Kiyota, Eduardo; Mayer, Juliana Lischka Sampaio; Gonçalves, José Francisco de Carvalho; da Silva, José Ferreira; Mazzafera, Paulo
2014-09-01
Guarana seeds have the highest caffeine concentration among plants accumulating purine alkaloids, but in contrast with coffee and tea, practically nothing is known about caffeine metabolism in this Amazonian plant. In this study, the levels of purine alkaloids in tissues of five guarana cultivars were determined. Theobromine was the main alkaloid that accumulated in leaves, stems, inflorescences and pericarps of fruit, while caffeine accumulated in the seeds and reached levels from 3.3% to 5.8%. In all tissues analysed, the alkaloid concentration, whether theobromine or caffeine, was higher in young/immature tissues, then decreasing with plant development/maturation. Caffeine synthase activity was highest in seeds of immature fruit. A nucleotide sequence (PcCS) was assembled with sequences retrieved from the EST database REALGENE using sequences of caffeine synthase from coffee and tea, whose expression was also highest in seeds from immature fruit. The PcCS has 1083bp and the protein sequence has greater similarity and identity with the caffeine synthase from cocoa (BTS1) and tea (TCS1). A recombinant PcCS allowed functional characterization of the enzyme as a bifunctional CS, able to catalyse the methylation of 7-methylxanthine to theobromine (3,7-dimethylxanthine), and theobromine to caffeine (1,3,7-trimethylxanthine), respectively. Among several substrates tested, PcCS showed higher affinity for theobromine, differing from all other caffeine synthases described so far, which have higher affinity for paraxanthine. When compared to previous knowledge on the protein structure of coffee caffeine synthase, the unique substrate affinity of PcCS is probably explained by the amino acid residues found in the active site of the predicted protein. Copyright © 2014 Elsevier Ltd. All rights reserved.
Clinical significance of Phosphatidyl Inositol Synthase overexpression in oral cancer
International Nuclear Information System (INIS)
Kaur, Jatinder; Sawhney, Meenakshi; DattaGupta, Siddartha; Shukla, Nootan K; Srivastava, Anurag; Ralhan, Ranju
2010-01-01
We reported increased levels of Phosphatidyl Inositol synthase (PI synthase), (enzyme that catalyses phosphatidyl inositol (PI) synthesis-implicated in intracellular signaling and regulation of cell growth) in smokeless tobacco (ST) exposed oral cell cultures by differential display. This study determined the clinical significance of PI synthase overexpression in oral squamous cell carcinoma (OSCC) and premalignant lesions (leukoplakia), and identified the downstream signaling proteins in PI synthase pathway that are perturbed by smokeless tobacco (ST) exposure. Tissue microarray (TMA) Immunohistochemistry, Western blotting, Confocal laser scan microscopy, RT-PCR were performed to define the expression of PI synthase in clinical samples and in oral cell culture systems. Significant increase in PI synthase immunoreactivity was observed in premalignant lesions and OSCCs as compared to oral normal tissues (p = 0.000). Further, PI synthase expression was significantly associated with de-differentiation of OSCCs, (p = 0.005) and tobacco consumption (p = 0.03, OR = 9.0). Exposure of oral cell systems to smokeless tobacco (ST) in vitro confirmed increase in PI synthase, Phosphatidylinositol 3-kinase (PI3K) and cyclin D1 levels. Collectively, increased PI synthase expression was found to be an early event in oral cancer and a target for smokeless tobacco
Sorochinsky, Alexander E; Aceña, José Luis; Moriwaki, Hiroki; Sato, Tatsunori; Soloshonok, Vadim A
2013-10-01
Alkylations of chiral or achiral Ni(II) complexes of glycine Schiff bases constitute a landmark in the development of practical methodology for asymmetric synthesis of α-amino acids. Straightforward, easy preparation as well as high reactivity of these Ni(II) complexes render them ready available and inexpensive glycine equivalents for preparing a wide variety of α-amino acids, in particular on a relatively large scale. In the case of Ni(II) complexes containing benzylproline moiety as a chiral auxiliary, their alkylation proceeds with high thermodynamically controlled diastereoselectivity. Similar type of Ni(II) complexes derived from alanine can also be used for alkylation providing convenient access to quaternary, α,α-disubstituted α-amino acids. Achiral type of Ni(II) complexes can be prepared from picolinic acid or via recently developed modular approach using simple secondary or primary amines. These Ni(II) complexes can be easily mono/bis-alkylated under homogeneous or phase-transfer catalysis conditions. Origin of diastereo-/enantioselectivity in the alkylations reactions, aspects of practicality, generality and limitations of this methodology is critically discussed.
The crystal structure of human GDP-L-fucose synthase.
Zhou, Huan; Sun, Lihua; Li, Jian; Xu, Chunyan; Yu, Feng; Liu, Yahui; Ji, Chaoneng; He, Jianhua
2013-09-01
Human GDP-l-fucose synthase, also known as FX protein, synthesizes GDP-l-fucose from its substrate GDP-4-keto-6-deoxy-d-mannose. The reaction involves epimerization at both C-3 and C-5 followed by an NADPH-dependent reduction of the carbonyl at C-4. In this paper, the first crystal structure of human FX protein was determined at 2.37 Å resolution. The asymmetric unit of the crystal structure contains four molecules which form two homodimers. Each molecule consists of two domains, a Rossmann-fold NADPH-binding motif and a carboxyl terminal domain. Compared with the Escherichia coli GDP-l-fucose synthase, the overall structures of these two enzymes have four major differences. There are four loops in the structure of human FX protein corresponding to two α-helices and two β-sheets in that of the E. coli enzyme. Besides, there are seven different amino acid residues binding with NAPDH comparing human FX protein with that from E. coli. The structure of human FX reveals the key catalytic residues and could be useful for the design of drugs for the treatment of inflammation, auto-immune diseases, and possibly certain types of cancer.
Liu, Jiayan; Seibold, Steve A; Rieke, Caroline J; Song, Inseok; Cukier, Robert I; Smith, William L
2007-06-22
The cyclooxygenase (COX) activity of prostaglandin endoperoxide H synthases (PGHSs) converts arachidonic acid and O2 to prostaglandin G2 (PGG2). PGHS peroxidase (POX) activity reduces PGG2 to PGH2. The first step in POX catalysis is formation of an oxyferryl heme radical cation (Compound I), which undergoes intramolecular electron transfer forming Intermediate II having an oxyferryl heme and a Tyr-385 radical required for COX catalysis. PGHS POX catalyzes heterolytic cleavage of primary and secondary hydroperoxides much more readily than H2O2, but the basis for this specificity has been unresolved. Several large amino acids form a hydrophobic "dome" over part of the heme, but when these residues were mutated to alanines there was little effect on Compound I formation from H2O2 or 15-hydroperoxyeicosatetraenoic acid, a surrogate substrate for PGG2. Ab initio calculations of heterolytic bond dissociation energies of the peroxyl groups of small peroxides indicated that they are almost the same. Molecular Dynamics simulations suggest that PGG2 binds the POX site through a peroxyl-iron bond, a hydrogen bond with His-207 and van der Waals interactions involving methylene groups adjoining the carbon bearing the peroxyl group and the protoporphyrin IX. We speculate that these latter interactions, which are not possible with H2O2, are major contributors to PGHS POX specificity. The distal Gln-203 four residues removed from His-207 have been thought to be essential for Compound I formation. However, Q203V PGHS-1 and PGHS-2 mutants catalyzed heterolytic cleavage of peroxides and exhibited native COX activity. PGHSs are homodimers with each monomer having a POX site and COX site. Cross-talk occurs between the COX sites of adjoining monomers. However, no cross-talk between the POX and COX sites of monomers was detected in a PGHS-2 heterodimer comprised of a Q203R monomer having an inactive POX site and a G533A monomer with an inactive COX site.
Norcoclaurine Synthase: Mechanism of an Enantioselective Pictet-Spengler Catalyzing Enzyme
Directory of Open Access Journals (Sweden)
Alberto Macone
2010-03-01
Full Text Available The use of bifunctional catalysts in organic synthesis finds inspiration in the selectivity of enzymatic catalysis which arises from the specific interactions between basic and acidic amino acid residues and the substrate itself in order to stabilize developing charges in the transition state. Many enzymes act as bifunctional catalysts using amino acid residues at the active site as Lewis acids and Lewis bases to modify the substrate as required for the given transformation. They bear a clear advantage over non-biological methods for their ability to tackle problems related to the synthesis of enantiopure compounds as chiral building blocks for drugs and agrochemicals. Moreover, enzymatic synthesis may offer the advantage of a clean and green synthetic process in the absence of organic solvents and metal catalysts. In this work the reaction mechanism of norcoclaurine synthase is described. This enzyme catalyzes the Pictet-Spengler condensation of dopamine with 4-hydroxyphenylacetaldehyde (4-HPAA to yield the benzylisoquinoline alkaloids central precursor, (S-norcoclaurine. Kinetic and crystallographic data suggest that the reaction mechanism occurs according to a typical bifunctional catalytic process.
Directory of Open Access Journals (Sweden)
XI-SHI TAI
2015-10-01
Full Text Available A new Ca(II coordination polymer has been obtained by reaction of Ca(ClO42·H2O with 3-amino-2-pyrazinecarboxylic acid in CH3CH2OH/H2O. It was characterized by IR, 1HNMR, thermal analysis and X-ray single crystal diffraction analysis. X-ray analysis reveals that each Ca(II center is seven-coordination with a N2O5 distorted pentagonal bipyramidal coordination environment. The Ca(II ions are linked through the O atoms of 3-amino-2-pyrazinecarboxylic acid ligands to form 1D chain structure. And then a 3D network structure is constructed by hydrogen bonds and π-π stacking. The antitumor activity of 3-amino-2-pyrazinecarboxylic acid ligand and its Ca(II coordination polymer against human intestinal adenocarcinoma HCT-8 cells, lung adenocarcinoma HCT-116 cells and human lung adenocarcinoma A549 cells line have been investigated.
Sphingomyelin Synthase 1 Is Essential for Male Fertility in Mice.
Directory of Open Access Journals (Sweden)
Anke Wittmann
Full Text Available Sphingolipids and the derived gangliosides have critical functions in spermatogenesis, thus mutations in genes involved in sphingolipid biogenesis are often associated with male infertility. We have generated a transgenic mouse line carrying an insertion in the sphingomyelin synthase gene Sms1, the enzyme which generates sphingomyelin species in the Golgi apparatus. We describe the spermatogenesis defect of Sms1-/- mice, which is characterized by sloughing of spermatocytes and spermatids, causing progressive infertility of male homozygotes. Lipid profiling revealed a reduction in several long chain unsaturated phosphatidylcholins, lysophosphatidylcholins and sphingolipids in the testes of mutants. Multi-Spectral Optoacoustic Tomography indicated blood-testis barrier dysfunction. A supplementary diet of the essential omega-3 docosahexaenoic acid and eicosapentaenoic acid diminished germ cell sloughing from the seminiferous epithelium and restored spermatogenesis and fertility in 50% of previously infertile mutants. Our findings indicate that SMS1 has a wider than anticipated role in testis polyunsaturated fatty acid homeostasis and for male fertility.
Santoso, Djoko; Thornburg, Robert
2000-01-01
We have selected 143 independent Nicotiana plumbaginifolia cell lines that survive in the presence of 5-fluoroorotic acid. These lines show several diverse phenotypes. The majority of these cell lines showed reduced levels of UMP synthase. However, one particular phenotype, which represents 14% of the total independent lines (20 cell lines), showed an unexpected, high level of UMP synthase and was therefore analyzed in detail. The selected cell lines showed no differences with wild-type cells with respect to uptake of orotic acid, affinity of UMP synthase for its substrates, or UMP synthase gene-copy number. Alternative detoxification mechanisms were also excluded. The elevated enzyme activity was correlated with elevated UMP synthase protein levels as well as elevated UMP synthase mRNA levels. In contrast to wild-type cell lines, the fluoroorotic acid-selected cell lines did not respond to thymine or to other biochemicals that affect thymine levels. In addition, there was also a concomitant up-regulation of aspartate transcarbamoylase, however, dihydroorotase and dihydroorotate dehydrogenase are not up-regulated in these cell lines. PMID:10938367
Despinasse, Yolande; Fiorucci, Sébastien; Antonczak, Serge; Moja, Sandrine; Bony, Aurélie; Nicolè, Florence; Baudino, Sylvie; Magnard, Jean-Louis; Jullien, Frédéric
2017-05-01
Lavender essential oils (EOs) of higher quality are produced by a few Lavandula angustifolia cultivars and mainly used in the perfume industry. Undesirable compounds such as camphor and borneol are also synthesized by lavender leading to a depreciated EO. Here, we report the cloning of bornyl diphosphate synthase of lavender (LaBPPS), an enzyme that catalyzes the production of bornyl diphosphate (BPP) and then by-products such as borneol or camphor, from an EST library. Compared to the BPPS of Salvia officinalis, the functional characterization of LaBPPS showed several differences in amino acid sequence, and the distribution of catalyzed products. Molecular modeling of the enzyme's active site suggests that the carbocation intermediates are more stable in LaBPPS than in SoBPPS leading probably to a lower efficiency of LaBPPS to convert GPP into BPP. Quantitative RT-PCR performed from leaves and flowers at different development stages of L. angustifolia samples show a clear correlation between transcript level of LaBPPS and accumulation of borneol/camphor, suggesting that LaBPPS is mainly responsible of in vivo biosynthesis of borneol/camphor in fine lavender. A phylogenetic analysis of terpene synthases (TPS) pointed out the basal position of LaBPPS in the TPSb clade, suggesting that LaBPPS could be an ancestor of others lavender TPSb. Finally, borneol could be one of the first monoterpenes to be synthesized in the Lavandula subgenus. Knowledge gained from these experiments will facilitate future studies to improve the lavender oils through metabolic engineering or plant breeding. Accession numbers: LaBPPS: KM015221. Copyright © 2017. Published by Elsevier Ltd.
Tasdemir, Deniz; Sanabria, David; Lauinger, Ina L; Tarun, Alice; Herman, Rob; Perozzo, Remo; Zloh, Mire; Kappe, Stefan H; Brun, Reto; Carballeira, Néstor M
2010-11-01
Acetylenic fatty acids are known to display several biological activities, but their antimalarial activity has remained unexplored. In this study, we synthesized the 2-, 5-, 6-, and 9-hexadecynoic acids (HDAs) and evaluated their in vitro activity against erythrocytic (blood) stages of Plasmodium falciparum and liver stages of Plasmodium yoelii infections. Since the type II fatty acid biosynthesis pathway (PfFAS-II) has recently been shown to be indispensable for liver stage malaria parasites, the inhibitory potential of the HDAs against multiple P. falciparum FAS-II (PfFAS-II) elongation enzymes was also evaluated. The highest antiplasmodial activity against blood stages of P. falciparum was displayed by 5-HDA (IC(50) value 6.6 μg/ml), whereas the 2-HDA was the only acid arresting the growth of liver stage P. yoelii infection, in both flow cytometric assay (IC(50) value 2-HDA 15.3 μg/ml, control drug atovaquone 2.5 ng/ml) and immunofluorescence analysis (IC(50) 2-HDA 4.88 μg/ml, control drug atovaquone 0.37 ng/ml). 2-HDA showed the best inhibitory activity against the PfFAS-II enzymes PfFabI and PfFabZ with IC(50) values of 0.38 and 0.58 μg/ml (IC(50) control drugs 14 and 30 ng/ml), respectively. Enzyme kinetics and molecular modeling studies revealed valuable insights into the binding mechanism of 2-HDA on the target enzymes. All HDAs showed in vitro activity against Trypanosoma brucei rhodesiense (IC(50) values 3.7-31.7 μg/ml), Trypanosoma cruzi (only 2-HDA, IC(50) 20.2 μg/ml), and Leishmania donovani (IC(50) values 4.1-13.4 μg/ml) with generally low or no significant toxicity on mammalian cells. This is the first study to indicate therapeutic potential of HDAs against various parasitic protozoa. It also points out that the malarial liver stage growth inhibitory effect of the 2-HDA may be promoted via PfFAS-II enzymes. The lack of cytotoxicity, lipophilic nature, and calculated pharmacokinetic properties suggests that 2-HDA could be a useful compound to
Tasdemir, Deniz; Sanabria, David; Lauinger, Ina L.; Tarun, Alice; Herman, Rob; Perozzo, Remo; Zloh, Mire; Kappe, Stefan H.; Brun, Reto; Carballeira, Néstor M.
2010-01-01
Acetylenic fatty acids are known to display several biological activities, but their antimalarial activity has remained unexplored. In this study, we synthesized the 2-, 5-, 6-, and 9-hexadecynoic acids (HDAs) and evaluated their in vitro activity against erythrocytic (blood) stages of Plasmodium falciparum and liver stages of P. yoelii infections. Since the type II fatty acid biosynthesis pathway (PfFAS-II) has recently been shown to be indispensable for liver stage malaria parasites, the inhibitory potential of the HDAs against multiple P. falciparum FAS-II (PfFAS-II) elongation enzymes was also evaluated. The highest antiplasmodial activity against blood stages of P. falciparum was displayed by 5-HDA (IC50 value 6.6. μg/ml), whereas the 2-HDA was the only acid arresting the growth of liver stage P. yoelii infection, in both flow cytometric assay (IC50 value 2-HDA 15.3 μg/ml, control drug atovaquone 2.5 ng/ml) and immunofluorescense analysis (IC50 2-HDA 4.88 μg/ml, control drug atovaquone 0.37 ng/ml). 2-HDA showed the best inhibitory against the PfFAS-II enzymes PfFabI and PfFabZ with IC50 values of 0.38 and 0.58 μg/ml (IC50 control drugs 14 and 30 ng/ml) respectively. Enzyme kinetics and molecular modeling studies revealed valuable insights into the binding mechanism of 2-HDA on the target enzymes. All HDAs showed in vitro activity against Trypanosoma brucei rhodesiense (IC50 values 3.7–31.7 μg/ml), Trypanosoma cruzi (only 2-HDA, IC50 20.2 μg/ml), and Leishmania donovani (IC50 values 4.1–13.4 μg/ml) with generally low or no significant toxicity on mammalian cells. This is the first study to indicate therapeutic potential of HDAs against various parasitic protozoa. It also points out that the malarial liver stage growth inhibitory effect of the 2-HDA may be promoted via PfFAS-II enzymes. The lack of cytotoxicity, lipophilic nature and calculated pharmacokinetic properties suggest that 2-HDA could be a useful compound to study the interaction of fatty
Recent Advances in the Development of Mammalian Geranylgeranyl Diphosphate Synthase Inhibitors
Directory of Open Access Journals (Sweden)
Staci L. Haney
2017-05-01
Full Text Available The enzyme geranylgeranyl diphosphate synthase (GGDPS catalyzes the synthesis of the 20-carbon isoprenoid geranylgeranyl diphosphate (GGPP. GGPP is the isoprenoid donor for protein geranylgeranylation reactions catalyzed by the enzymes geranylgeranyl transferase (GGTase I and II. Inhibitors of GGDPS result in diminution of protein geranylgeranylation through depletion of cellular GGPP levels, and there has been interest in GGDPS inhibitors as potential anti-cancer agents. Here we discuss recent advances in the development of GGDPS inhibitors, including insights gained by structure-function relationships, and review the preclinical data that support the continued development of this novel class of drugs.
Das, Satarupa; Mattson, David L.
2014-01-01
SUMMARY Administration of exogenous L-Arginine (L-Arg) attenuates Angiotensin II (AngII)-mediated hypertension and kidney disease in rats. The present study assessed renal hemodynamics and pressure-diuresis-natriuresis in anesthetized rats infused with vehicle, AngII (20 ng/kg/min, iv) or AngII + L-Arg (300 µg/kg/min, iv). Increasing renal perfusion pressure (RPP) from approximately 100 to 140 mmHg resulted in a 9–10 fold increase in urine flow and sodium excretion rate in control animals. In comparison, AngII infusion significantly reduced renal blood flow (RBF) and glomerular filtration rate (GFR) by 40–42% and blunted the pressure-dependent increase in urine flow and sodium excretion rate by 54–58% at elevated RPP. Supplementation of L-Arg reversed the vasoconstrictor effects of AngII and restored pressure-dependent diuresis to levels not significantly different from control rats. Experiments in isolated aortic rings were performed to assess L-Arg effects on the vasculature. Dose-dependent contraction to AngII (10−10M to 10−7M) was observed with a maximal force equal to 27±3% of the response to 10−5M phenylephrine. Contraction to 10−7M AngII was blunted by 75±3% with 10−4M L-Arg. The influence of L-Arg to blunt AngII mediated contraction was eliminated by endothelial denudation or incubation with nitric oxide synthase inhibitors. Moreover, the addition of 10−3M cationic or neutral amino acids, which compete with L-Arg for cellular uptake, blocked the effect of L-Arg. Anionic amino acids did not influence the effects of L-Arg on AngII-mediated contraction. These studies indicate that L-Arg blunts AngII-mediated vascular contraction by an endothelial- and NOS-dependent mechanism involving cellular uptake of L-Arg. PMID:24472006
Maruri-López, Israel; Rodríguez-Kessler, Margarita; Rodríguez-Hernández, Aída Araceli; Becerra-Flora, Alicia; Olivares-Grajales, Juan Elías; Jiménez-Bremont, Juan Francisco
2014-05-01
Polyamines are low molecular weight aliphatic compounds involved in various biochemical, cellular and physiological processes in all organisms. In plants, genes involved in polyamine biosynthesis and catabolism are regulated at transcriptional, translational, and posttranslational level. In this research, we focused on the characterization of a PEST sequence (rich in proline, glutamic acid, serine, and threonine) of the maize spermine synthase 1 (ZmSPMS1). To this aim, 123 bp encoding 40 amino acids of the C-terminal region of the ZmSPMS1 enzyme containing the PEST sequence were fused to the GUS reporter gene. This fusion was evaluated in Arabidopsis thaliana transgenic lines and onion monolayers transient expression system. The ZmSPMS1 PEST sequence leads to specific degradation of the GUS reporter protein. It is suggested that the 26S proteasome may be involved in GUS::PEST fusion degradation in both onion and Arabidopsis. The PEST sequences appear to be present in plant spermine synthases, mainly in monocots. Copyright © 2014 Elsevier Masson SAS. All rights reserved.
Ling, Wei Chih; Liu, Jian; Lau, Chi Wai; Murugan, Dharmani Devi; Mustafa, Mohd Rais; Huang, Yu
2017-07-15
Salvianolic acid B (Sal B) is one of the most abundant phenolic acids derived from the root of Danshen with potent anti-oxidative properties. The present study examined the vasoprotective effect of Sal B in hypertensive mice induced by angiotensin II (Ang II). Sal B (25mg/kg/day) was administered via oral gavage for 11days to Ang II (1.2mg/kg/day)-infused C57BL/6J mice (8-10weeks old). The vascular reactivity (both endothelium-dependent relaxations and contractions) in mouse arteries was examined by wire myography. The production of reactive oxygen species (ROS), protein level and localization of angiotensin AT 1 receptors and the proteins involved in ROS formation were evaluated using dihydroethidium (DHE) fluorescence, lucigenin-enhanced chemiluminescence, immunohistochemistry and Western blotting, respectively. The changes of ROS generating proteins were also assessed in vitro in human umbilical vein endothelial cells (HUVECs) exposed to Ang II with and without co-treatment with Sal B (0.1-10nM). Oral administration of Sal B reversed the Ang II-induced elevation of arterial systolic blood pressure in mice, augmented the impaired endothelium-dependent relaxations and attenuated the exaggerated endothelium-dependent contractions in both aortas and renal arteries of Ang II-infused mice. In addition, Sal B treatment normalized the elevated levels of AT 1 receptors, NADPH oxidase subunits (NOx-2 and NOx-4) and nitrotyrosine in arteries of Ang II-infused mice or in Ang II-treated HUVECs. In summary, the present study provided additional evidence demonstrating that Sal B treatment for 11days reverses the impaired endothelial function and with a marked inhibition of AT 1 receptor-dependent vascular oxidative stress. This vasoprotective and anti-oxidative action of Sal B most likely contributes to the anti-hypertensive action of the plant-derived compound. Copyright © 2017 Elsevier Inc. All rights reserved.
Xiang, Lin; Zhao, Kaige; Chen, Longqing
2010-01-01
Farnesyl pyrophosphate (FPP) synthase catalyzes the biosynthesis of FPP, which is the precursors of sesquiterpenoids such as floral scent volatiles, from isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP). cDNA encoding wintersweet (Chimonanthus praecox L.) FPP synthase was isolated by the RT-PCR and RACE methods. The deduced amino acid sequence showed a high identity to plant FPP synthases. Expression of the gene in Escherichia coli yielded FPPS activity that catalyzed the synthesis of FPP as a main product. Tissue-specific and developmental analyses of the mRNA levels of CpFPPS and volatile sesquiterpenoids levels in C. praecox flowers revealed that the FPPS may play a regulatory role in floral volatile sesquiterpenoids of wintersweet. Copyright © 2010 Elsevier Masson SAS. All rights reserved.
Directory of Open Access Journals (Sweden)
John Butar Butar
2013-12-01
Full Text Available BACKGROUND: This study was carried out to investigate the association of Cross Linked C-Telopeptide Type I & II Collagen (CTX-I and II and hyaluronic acid (HA with knee osteoarthritis (OA severity. METHODS: Sixty menopause women with primary knee OA were enrolled in this study during their visits to the Outpatient Department. Patients with knee pain during weight bearing, active or passive range of motion, or tenderness with Kellgren-Lawrence (KL grade of more than I were included. Patients with injury, inflammatory and metabolic diseases were excluded. Patients were put in a 10-hour fasting prior to withdrawal of morning blood samples for examinations of HA, CTX-I, interleukin 1 beta (IL-1β, and high sensitivity C reactive protein (hs-CRP level. Second void morning urine specimens were taken for CTXII assessment. HA, CTX-I and II levels were measured by enzyme-linked immunosorbent assay. RESULTS: Sixty menopausal female patients were included in this study, 35 with KL grade II, 17 grade III, and 8 grade IV. Means of CTX-II were significantly different between subjects KL grade IV and III (p=0.021. Correlation of KL grade was significant with CTX-II (p=0.001, r=0.412 and HA (p=0.0411, r=0.269. KL grades were not significantly associated with CTX-I (p=0.8364, r=-0.0272; IL-1β (p=0.5773, r=0.0853 and hs-CRP (p=0.2625, r=0.1470. CONCLUSIONS: CTX-II and HA were associated with severity of knee OA, suggesting that CTX-II and HA can be used as marker for knee OA severity. KEYWORDS: CTX-II, hyaluronic acid, otestoarthritis, knee.
Energy Technology Data Exchange (ETDEWEB)
Bian, Yong, E-mail: drbiany@126.com [Department of Science and Technology, Nanjing University of Chinese Medicine, 210023 (China); Yu, Yun [College of Pharmacy, Nanjing University of Chinese Medicine, 210023 (China); Wang, Shanshan; Li, Lin [Department of Science and Technology, Nanjing University of Chinese Medicine, 210023 (China)
2015-08-07
Lipid metabolism is dysregulated in many human diseases including atherosclerosis, type 2 diabetes and cancers. Fatty acid synthase (FASN), a key lipogenic enzyme involved in de novo lipid biosynthesis, is significantly upregulated in multiple types of human cancers and associates with tumor progression. However, limited data is available to understand underlying biological functions and clinical significance of overexpressed FASN in pancreatic ductal adenocarcinoma (PDAC). Here, upregulated FASN was more frequently observed in PDAC tissues compared with normal pancreas in a tissue microarray. Kaplan–Meier survival analysis revealed that high expression level of FASN resulted in a significantly poor prognosis of PDAC patients. Knockdown or inhibition of endogenous FASN decreased cell proliferation and increased cell apoptosis in HPAC and AsPC-1 cells. Furthermore, we demonstrated that EGFR/ERK signaling accounts for elevated FASN expression in PDAC as ascertained by performing siRNA assays and using specific pharmacological inhibitors. Collectively, our results indicate that FASN exhibits important roles in tumor growth and EGFR/ERK pathway is responsible for upregulated expression of FASN in PDAC. - Highlights: • Increased expression of FASN indicates a poor prognosis in PDAC. • Elevated FASN favors tumor growth in PDAC in vitro. • Activation of EGFR signaling contributes to elevated FASN expression.
International Nuclear Information System (INIS)
Bian, Yong; Yu, Yun; Wang, Shanshan; Li, Lin
2015-01-01
Lipid metabolism is dysregulated in many human diseases including atherosclerosis, type 2 diabetes and cancers. Fatty acid synthase (FASN), a key lipogenic enzyme involved in de novo lipid biosynthesis, is significantly upregulated in multiple types of human cancers and associates with tumor progression. However, limited data is available to understand underlying biological functions and clinical significance of overexpressed FASN in pancreatic ductal adenocarcinoma (PDAC). Here, upregulated FASN was more frequently observed in PDAC tissues compared with normal pancreas in a tissue microarray. Kaplan–Meier survival analysis revealed that high expression level of FASN resulted in a significantly poor prognosis of PDAC patients. Knockdown or inhibition of endogenous FASN decreased cell proliferation and increased cell apoptosis in HPAC and AsPC-1 cells. Furthermore, we demonstrated that EGFR/ERK signaling accounts for elevated FASN expression in PDAC as ascertained by performing siRNA assays and using specific pharmacological inhibitors. Collectively, our results indicate that FASN exhibits important roles in tumor growth and EGFR/ERK pathway is responsible for upregulated expression of FASN in PDAC. - Highlights: • Increased expression of FASN indicates a poor prognosis in PDAC. • Elevated FASN favors tumor growth in PDAC in vitro. • Activation of EGFR signaling contributes to elevated FASN expression
Zhu, J J; Luo, J; Sun, Y T; Shi, H B; Li, J; Wu, M; Yu, K; Haile, A B; Loor, J J
2015-05-01
The role of fatty acid synthase (FASN) on de novo fatty acid synthesis has been well established. In monogastrics, unlike acetyl-coenzyme A carboxylase, FASN is primarily controlled at the transcriptional level. However, no data exist on ruminant mammary cells evaluating effects of FASN knockdown on mRNA expression of lipogenic genes. Inhibition of FASN in mammary cells by C75-mediated interference, a synthetic inhibitor of FASN activity, and short hairpin RNA-mediated interference markedly reduced cellular triglyceride content at least in part by decreasing the expression of genes related to triglyceride synthesis (GPAT, AGPAT6, and DGAT2) and enhancing the expression of lipolysis-related genes (ATGL and HSL). Consistent with the markedly lower expression of genes related to lipid droplet formation and secretion (TIP47, ADFP, BTN1A1, and XDH), cellular lipid droplets also were reduced sharply after incubation with C75 or adenovirus-short-hairpin-RNA. The results underscored the essential role of FASN in the overall process of milk-fat formation in goat mammary epithelial cells. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Kudo, T; Tsuchihashi, N; Ogata, T
1987-07-30
Paramagnetic /sup 99/Tc complex formed by the reduction of ammonium pertechnetate by ascorbic acid with excess sodium nitrite in concentrated hydrochloric acid was investigated by ESR technique. This complex had total electron spin S=1/2 and the obtained ESR parameters are 2.032, 2.043; and 264, 108 gauss, respectively. It was concluded that the formed species was low spin /sup 99/Tc(II) complex. (author) 13 refs.
Heterooligomeric phosphoribosyl diphosphate synthase of Saccharomyces cerevisiae
DEFF Research Database (Denmark)
Hove-Jensen, Bjarne
2004-01-01
The yeast Saccharomyces cerevisiae contains five phosphoribosyl diphosphate (PRPP) synthase-homologous genes (PRS1-5), which specify PRPP synthase subunits 1-5. Expression of the five S. cerevisiae PRS genes individually in an Escherichia coli PRPP-less strain (Deltaprs) showed that a single PRS...
Directory of Open Access Journals (Sweden)
Vatrál Jaroslav
2014-12-01
Full Text Available The electrochemical behavior of an Fe(II/Fe(III redox couple in the presence of various selected amino acids has been studied using ferrocene-modified carbon paste electrode at pH = 7.4. Because of Fe(II/Fe(III solubility issues at physiological pH, ferrocene was used as a source of iron. Anodic oxidation of iron (pH = 7.2 occurred at 0.356 V and cathodic oxidation at 0.231 V, both vs Ag|AgCl. Treatment of the voltammetric data showed that it was a purely diffusion-controlled reaction with the involvement of one electron. After addition of amino acids, potential shifts and current changes can be observed on the voltammograms. Cyclic voltammetry experiments revealed the capability of amino acids to change the electrochemical behavior of the Fe(II/Fe(III redox couple.
Solving nucleic acid structures by molecular replacement: examples from group II intron studies
International Nuclear Information System (INIS)
Marcia, Marco; Humphris-Narayanan, Elisabeth; Keating, Kevin S.; Somarowthu, Srinivas; Rajashankar, Kanagalaghatta; Pyle, Anna Marie
2013-01-01
Strategies for phasing nucleic acid structures by molecular replacement, using both experimental and de novo designed models, are discussed. Structured RNA molecules are key players in ensuring cellular viability. It is now emerging that, like proteins, the functions of many nucleic acids are dictated by their tertiary folds. At the same time, the number of known crystal structures of nucleic acids is also increasing rapidly. In this context, molecular replacement will become an increasingly useful technique for phasing nucleic acid crystallographic data in the near future. Here, strategies to select, create and refine molecular-replacement search models for nucleic acids are discussed. Using examples taken primarily from research on group II introns, it is shown that nucleic acids are amenable to different and potentially more flexible and sophisticated molecular-replacement searches than proteins. These observations specifically aim to encourage future crystallographic studies on the newly discovered repertoire of noncoding transcripts
Xia, Yongzhen; Wübbeler, Jan Hendrik; Qi, Qingsheng
2012-01-01
Advenella mimigardefordensis strain DPN7T was genetically modified to produce poly(3-mercaptopropionic acid) (PMP) homopolymer by exploiting the recently unraveled process of 3,3′-dithiodipropionic acid (DTDP) catabolism. Production was achieved by systematically engineering the metabolism of this strain as follows: (i) deletion of its inherent 3MP dioxygenase-encoding gene (mdo), (ii) introduction of the buk-ptb operon (genes encoding the butyrate kinase, Buk, and the phosphotransbutyrylase, Ptb, from Clostridium acetobutylicum), and (iii) overexpression of its own polyhydroxyalkanoate synthase (phaCAm). These measures yielded the potent PMP production strain A. mimigardefordensis strain SHX22. The deletion of mdo was required for adequate synthesis of PMP due to the resulting accumulation of 3MP during utilization of DTDP. Overexpression of the plasmid-borne buk-ptb operon caused a severe growth repression. This effect was overcome by inserting this operon into the genome. Polyhydroxyalkanoate (PHA) synthases from different origins were compared. The native PHA synthase of A. mimigardefordensis (phaCAm) was obviously the best choice to establish homopolythioester production in this strain. In addition, the cultivation conditions, including an appropriate provision of the carbon source, were further optimized to enhance PMP production. The engineered strain accumulated PMP up to approximately 25% (wt/wt) of the cell dry weight when cultivated in mineral salts medium containing glycerol as the carbon source in addition to DTDP as the sulfur-providing precursor. According to our knowledge, this is the first report of PMP homopolymer production by a metabolically engineered bacterium using DTDP, which is nontoxic, as the precursor substrate. PMID:22344658
Koeberle, Andreas; Werz, Oliver
2015-11-01
Prostaglandin (PG)E2 encompasses crucial roles in pain, fever, inflammation and diseases with inflammatory component, such as cancer, but is also essential for gastric, renal, cardiovascular and immune homeostasis. Cyclooxygenases (COX) convert arachidonic acid to the intermediate PGH2 which is isomerized to PGE2 by at least three different PGE2 synthases. Inhibitors of COX - non-steroidal anti-inflammatory drugs (NSAIDs) - are currently the only available therapeutics that target PGE2 biosynthesis. Due to adverse effects of COX inhibitors on the cardiovascular system (COX-2-selective), stomach and kidney (COX-1/2-unselective), novel pharmacological strategies are in demand. The inducible microsomal PGE2 synthase (mPGES)-1 is considered mainly responsible for the excessive PGE2 synthesis during inflammation and was suggested as promising drug target for suppressing PGE2 biosynthesis. However, 15 years after intensive research on the biology and pharmacology of mPGES-1, the therapeutic value of mPGES-1 as drug target is still vague and mPGES-1 inhibitors did not enter the market so far. This commentary will first shed light on the structure, mechanism and regulation of mPGES-1 and will then discuss its biological function and the consequence of its inhibition for the dynamic network of eicosanoids. Moreover, we (i) present current strategies for interfering with mPGES-1-mediated PGE2 synthesis, (ii) summarize bioanalytical approaches for mPGES-1 drug discovery and (iii) describe preclinical test systems for the characterization of mPGES-1 inhibitors. The pharmacological potential of selective mPGES-1 inhibitor classes as well as dual mPGES-1/5-lipoxygenase inhibitors is reviewed and pitfalls in their development, including species discrepancies and loss of in vivo activity, are discussed. Copyright © 2015 Elsevier Inc. All rights reserved.
Glutamic acid as anticancer agent: An overview
Dutta, Satyajit; Ray, Supratim; Nagarajan, K.
2013-01-01
The objective of the article is to highlight various roles of glutamic acid like endogenic anticancer agent, conjugates to anticancer agents, and derivatives of glutamic acid as possible anticancer agents. Besides these emphases are given especially for two endogenous derivatives of glutamic acid such as glutamine and glutamate. Glutamine is a derivative of glutamic acid and is formed in the body from glutamic acid and ammonia in an energy requiring reaction catalyzed by glutamine synthase. I...
Antibacterial activity of Pd(II) complexes with salicylaldehyde-amino acids Schiff bases ligands.
Rîmbu, Cristina; Danac, Ramona; Pui, Aurel
2014-01-01
Palladium(II) complexes with Schiff bases ligands derived from salicylaldehyde and amino acids (Ala, Gly, Met, Ser, Val) have been synthesized and characterized by Fourier transform (FT)-IR, UV-Vis and (1)H-NMR spectroscopy. The electrospray mass spectrometry (ES-MS) spectrometry confirms the formation of palladium(II) complexes in 1/2 (M/L) molar ratio. All the Pd(II) complexes 1, [Pd(SalAla)2]Cl2; 2, [Pd(SalGly)2]Cl2; 3, [Pd(SalMet)2]Cl2; 4, [Pd(SalSer)2]Cl2; 5, [Pd(SalVal)2]Cl2; have shown antibacterial activity against Gram-positive bacteria Staphylococcus aureus and Gram-negative bacteria Escherichia coli.
Inoue, H; Hirobe, M
1987-05-29
The interchange reaction of disulfides was caused by the copper(II)/ascorbic acid/O2 system. The incubation of two symmetric disulfides, L-cystinyl-bis-L-phenylalanine (PP) and L-cystinyl-bis-L-tyrosine (TT), with L-ascorbic acid and CuSO4 in potassium phosphate buffer (pH 7.2, 50 mM) resulted in the formation of an asymmetric disulfide, L-cystinyl-L-phenylalanine-L-tyrosine (PT), and the final ratio of PP:PT:TT was 1:2:1. As the reaction was inhibited by catalase and DMSO only at the initial time, hydroxyl radical generated by the copper(II)/ascorbic acid/O2 system seemed to be responsible for the initiation of the reaction. Oxytocin and insulin were denatured by this system, and catalase and DMSO similarly inhibited these denaturations. As the composition of amino acids was unchanged after the reaction, hydroxyl radical was thought to cause the cleavage and/or interchange reaction of disulfides to denature the peptides.
Ozonation of azo dyes (Orange II and Acid Red 27) in saline media
International Nuclear Information System (INIS)
Silva, Alessandra C.; Pic, Jean Stephane; Sant'Anna, Geraldo L.; Dezotti, Marcia
2009-01-01
Ozonation of two azo dyes was investigated in a monitored bench scale bubble column reactor (8.5-L), varying liquid media salt content (0, 1, 40 and 100 g L -1 , NaCl). In experiments with Orange II pH was varied (5, 7.5 and 9) but ozonation of Acid Red 27 was performed at pH 7.5. Ozone self-decomposition rate-constant increased with salt concentration. Color removal was very effective and fast achieved under all experimental conditions. For the two azo dyes tested, more than 98% of color intensity was removed in 30-min ozonation assays. However, only partial mineralization of azo dyes (45%-Orange II; 20%-Acid Red 27) was attained in such experiments. The degree of mineralization (TOC removal) was negatively affected by salt concentration. Biodegradation assays conducted by respirometry revealed the inhibitory effect of dye degradation products formed during ozonation.
Krill, Christian; Barrow, Russell A.; Chen, Shasha; Trengove, Robert; Oliver, Richard P.; Solomon, Peter S.
2014-01-01
Parastagonospora nodorum is a pathogen of wheat that affects yields globally. Previous transcriptional analysis identified a partially reducing polyketide synthase (PR-PKS) gene, SNOG_00477 (SN477), in P. nodorum that is highly upregulated during infection of wheat leaves. Disruption of the corresponding SN477 gene resulted in the loss of production of two compounds, which we identified as (R)-mellein and (R)-O-methylmellein. Using a Saccharomyces cerevisiae yeast heterologous expression system, we successfully demonstrated that SN477 is the only enzyme required for the production of (R)-mellein. This is the first identification of a fungal PKS that is responsible for the synthesis of (R)-mellein. The P. nodorum ΔSN477 mutant did not show any significant difference from the wild-type strain in its virulence against wheat. However, (R)-mellein at 200 μg/ml inhibited the germination of wheat (Triticum aestivum) and barrel medic (Medicago truncatula) seeds. Comparative sequence analysis identified the presence of mellein synthase (MLNS) homologues in several Dothideomycetes and two sodariomycete genera. Phylogenetic analysis suggests that the MLNSs in fungi and bacteria evolved convergently from fungal and bacterial 6-methylsalicylic acid synthases. PMID:25326302
African Journals Online (AJOL)
user
Depending on the way goethite was pretreated with oxalic acid, affinity for Cd(II) varied ...... Effects and mechanisms of oxalate on Cd(II) adsorption on goethite at different ... precipitation, surfactant mediation, hydrothermal and micro-emulsion.
Anti-inflammatory drugs interacting with Zn(II), Cd(II) and Pt(II) metal ions.
Dendrinou-Samara, C; Tsotsou, G; Ekateriniadou, L V; Kortsaris, A H; Raptopoulou, C P; Terzis, A; Kyriakidis, D A; Kessissoglou, D P
1998-09-01
Complexes of Zn(II), Cd(II) and Pt(II) metal ions with the anti-inflammatory drugs, 1-methyl-5-(p-toluoyl)-1H-pyrrole-2-acetic acid (Tolmetin), alpha-methyl-4-(2-methylpropyl)benzeneacetic acid (Ibuprofen), 6-methoxy-alpha-methylnaphthalene-2-acetic acid (Naproxen) and 1-(4-chlorobenzoyl)-5-methoxy-2-methyl-1H-indole-3-acetic acid (indomethacin) have been synthesized and characterized. In the structurally characterized Cd(naproxen)2 complex the anti-inflammatory drugs acts as bidentate chelate ligand coordinatively bound to metal ions through the deprotonated carboxylate group. Crystal data for 1: [C32H26O8Cd], orthorhombic, space group P22(1)2(1), a = 5.693(2) (A), b = 8.760(3) (A), c = 30.74(1) (A), V = 1533(1) A3, Z = 2. Antibacterial and growth inhibitory activity is higher than that of the parent ligands or the platinum(II) diamine compounds.
gamma-Aminobutyric acid stimulates ethylene biosynthesis in sunflower
International Nuclear Information System (INIS)
Kathiresan, A.; Tung, P.; Chinnappa, C.C.; Reid, D.M.
1997-01-01
gamma-Aminobutyric acid (GABA), a nonprotein amino acid, is often accumulated in plants following environmental stimuli that can also cause ethylene production. We have investigated the relationship between GABA and ethylene production in excised sunflower (Helianthus annuus L.) tissues. Exogenous GABA causes up to a 14-fold increase in the ethylene production rate after about 12 h. Cotyledons fed with [14C]GABA did not release substantial amounts of radioactive ethylene despite its chemical similarity to 1-aminocyclopropane-1-carboxylic acid (ACC), indicating that GABA is not likely to be an alternative precursor for ethylene. GABA causes increases in ACC synthase mRNA accumulation, ACC levels, ACC oxidase mRNA levels, and in vitro ACC oxidase activity. In the presence of aminoethoxyvinylglycine or alpha-aminoisobutyric acid, GABA did not stimulate ethylene production. We therefore conclude that GABA stimulates ethylene biosynthesis mainly by promoting ACC synthase transcript abundance. Possible roles of GABA as a signal transducer are suggested
Energy Technology Data Exchange (ETDEWEB)
Boone, Christopher D. [University of Florida, PO Box 100267, Gainesville, FL 32610 (United States); Tu, Chingkuang [University of Florida, PO Box 100245, Gainesville, FL 32610 (United States); McKenna, Robert, E-mail: rmckenna@ufl.edu [University of Florida, PO Box 100267, Gainesville, FL 32610 (United States)
2014-06-01
The structure of human carbonic anhydrase II in complex with cholate has been determined to 1.54 Å resolution. Elucidation of the novel inhibition mechanism of cholate will aid in the development of a nonsulfur-containing, isoform-specific therapeutic agent. The carbonic anhydrases (CAs) are a family of mostly zinc metalloenzymes that catalyze the reversible hydration/dehydration of CO{sub 2} into bicarbonate and a proton. Human isoform CA II (HCA II) is abundant in the surface epithelial cells of the gastric mucosa, where it serves an important role in cytoprotection through bicarbonate secretion. Physiological inhibition of HCA II via the bile acids contributes to mucosal injury in ulcerogenic conditions. This study details the weak biophysical interactions associated with the binding of a primary bile acid, cholate, to HCA II. The X-ray crystallographic structure determined to 1.54 Å resolution revealed that cholate does not make any direct hydrogen-bond interactions with HCA II, but instead reconfigures the well ordered water network within the active site to promote indirect binding to the enzyme. Structural knowledge of the binding interactions of this nonsulfur-containing inhibitor with HCA II could provide the template design for high-affinity, isoform-specific therapeutic agents for a variety of diseases/pathological states, including cancer, glaucoma, epilepsy and osteoporosis.
Mechanistic insight into chromium(VI) reduction by oxalic acid in the presence of manganese(II)
Energy Technology Data Exchange (ETDEWEB)
Wrobel, Katarzyna; Corrales Escobosa, Alma Rosa; Gonzalez Ibarra, Alan Alexander; Mendez Garcia, Manuel; Yanez Barrientos, Eunice; Wrobel, Kazimierz, E-mail: kazimier@ugto.mx
2015-12-30
Over the past few decades, reduction of hexavalent chromium (Cr(VI)) has been studied in many physicochemical contexts. In this research, we reveal the mechanism underlying the favorable effect of Mn(II) observed during Cr(VI) reduction by oxalic acid using liquid chromatography with spectrophotometric diode array detector (HPLC–DAD), nitrogen microwave plasma atomic emission spectrometry (HPLC–MP-AES), and high resolution mass spectrometry (ESI–QTOFMS). Both reaction mixtures contained potassium dichromate (0.67 mM Cr(VI)) and oxalic acid (13.3 mM), pH 3, one reaction mixture contained manganese sulfate (0.33 mM Mn(II)). In the absence of Mn(II) only trace amounts of reaction intermediates were generated, most likely in the following pathways: (1) Cr(VI) → Cr(IV) and (2) Cr(VI) + Cr(IV) → 2Cr(V). In the presence of Mn(II), the active reducing species appeared to be Mn(II) bis-oxalato complex (J); the proposed reaction mechanism involves a one-electron transfer from J to any chromium compound containing Cr=O bond, which is reduced to Cr−OH, and the generation of Mn(III) bis-oxalato complex (K). Conversion of K to J was observed, confirming the catalytic role of Mn(II). Since no additional acidification was required, the results obtained in this study may be helpful in designing a new, environmentally friendly strategy for the remediation of environments contaminated with Cr(VI).
Schmiderer, Corinna; Grausgruber-Gröger, Sabine; Grassi, Paolo; Steinborn, Ralf; Novak, Johannes
2010-07-01
Common sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants, with antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, composed mainly of the monoterpenes 1,8-cineole, alpha-thujone, beta-thujone and camphor, is responsible for some of these effects. Gibberellins regulate diverse physiological processes in plants, such as seed germination, shoot elongation and cell division. In this study, we analyzed the effect of exogenously applied plant growth regulators, namely gibberellic acid (GA(3)) and daminozide, on leaf morphology and essential oil formation of two leaf stages during the period of leaf expansion. Essential oil content increased with increasing levels of gibberellins and decreased when gibberellin biosynthesis was blocked with daminozide. With increasing levels of gibberellins, 1,8-cineole and camphor contents increased. Daminozide blocked the accumulation of alpha- and beta-thujone. GA(3) at the highest level applied also led to a significant decrease of alpha- and beta-thujone. Monoterpene synthases are a class of enzymes responsible for the first step in monoterpene biosynthesis, competing for the same substrate geranylpyrophosphate. The levels of gene expression of the three most important monoterpene synthases in sage were investigated, 1,8-cineole synthase leading directly to 1,8-cineole, (+)-sabinene synthase responsible for the first step in the formation of alpha- and beta-thujone, and (+)-bornyl diphosphate synthase, the first step in camphor biosynthesis. The foliar application of GA(3) increased, while daminozide significantly decreased gene expression of the monoterpene synthases. The amounts of two of the end products, 1,8-cineole and camphor, were directly correlated with the levels of gene expression of the respective monoterpene synthases, indicating transcriptional control, while the formation of alpha- and beta
Biogenic glutamic acid-based resin: Its synthesis and application in the removal of cobalt(II)
International Nuclear Information System (INIS)
Jamiu, Zakariyah A.; Saleh, Tawfik A.; Ali, Shaikh A.
2017-01-01
Highlights: • A novel resin embedded with metal chelating glutamic acid was synthesized. • The biogenic amino acid residues imparted remarkable efficacy to remove Co(II). • The resin showed excellent ability to remove various metals from wastewater. - Abstract: Inexpensive biogenic glutamic acid has been utilized to synthesize a cross-linked dianionic polyelectrolyte (CDAP) containing metal chelating ligands. Cycloterpolymerization, using azoisobutyronitrile as an initiator, of N,N-diallylglutamic acid hydrochloride, sulfur dioxide and a cross-linker afforded a pH-responsive cross-linked polyzwitterionic acid (CPZA) which upon basification with NaOH was converted into CDAP. The new resin, characterized by a multitude of spectroscopic techniques as well as Scanning Electron Microscopy (SEM) and Brunauer–Emmett–Teller (BET) analyses, was evaluated for the removal of Co(II) as a model case under different conditions. The adsorption capacity of 137 mg g"−"1 does indeed make the resin as one of the most effective sorbents in recent times. The resin leverages its cheap natural source and ease of regeneration in combination with its high and fast uptake capacities to offer a great promise for wastewater treatment. The resin has demonstrated remarkable efficiency in removing toxic metal ions including arsenic from a wastewater sample.
Biogenic glutamic acid-based resin: Its synthesis and application in the removal of cobalt(II)
Energy Technology Data Exchange (ETDEWEB)
Jamiu, Zakariyah A.; Saleh, Tawfik A.; Ali, Shaikh A., E-mail: shaikh@kfupm.edu.sa
2017-04-05
Highlights: • A novel resin embedded with metal chelating glutamic acid was synthesized. • The biogenic amino acid residues imparted remarkable efficacy to remove Co(II). • The resin showed excellent ability to remove various metals from wastewater. - Abstract: Inexpensive biogenic glutamic acid has been utilized to synthesize a cross-linked dianionic polyelectrolyte (CDAP) containing metal chelating ligands. Cycloterpolymerization, using azoisobutyronitrile as an initiator, of N,N-diallylglutamic acid hydrochloride, sulfur dioxide and a cross-linker afforded a pH-responsive cross-linked polyzwitterionic acid (CPZA) which upon basification with NaOH was converted into CDAP. The new resin, characterized by a multitude of spectroscopic techniques as well as Scanning Electron Microscopy (SEM) and Brunauer–Emmett–Teller (BET) analyses, was evaluated for the removal of Co(II) as a model case under different conditions. The adsorption capacity of 137 mg g{sup −1} does indeed make the resin as one of the most effective sorbents in recent times. The resin leverages its cheap natural source and ease of regeneration in combination with its high and fast uptake capacities to offer a great promise for wastewater treatment. The resin has demonstrated remarkable efficiency in removing toxic metal ions including arsenic from a wastewater sample.
Energy Technology Data Exchange (ETDEWEB)
Amer, Hany; Moustafa, Wafaa M. [Nuclar Fuel Cycle Department, Nuclear and Radiological Regulatory Authority (NRRA), Naser City, Cairo (Egypt); Farghali, Ahmed A.; El Rouby, Waleed M.A. [Materials Science and Nanotechnology Department, Faculty of Postgraduate Studies for Advanced Sciences (PASA), Beni-Suef University (Egypt); Khalil, Waleed F. [Nuclar Fuel Cycle Department, Nuclear and Radiological Regulatory Authority (NRRA), Naser City, Cairo (Egypt); Materials Science and Nanotechnology Department, Faculty of Postgraduate Studies for Advanced Sciences (PASA), Beni-Suef University (Egypt)
2017-12-04
Graphene oxide (GO) with high specific surface area was prepared and functionalized with ethylene diamine tetra-acetic acid (EDTA). The as-prepared GO and the functionalized one (GO-EDTA) were characterized using high resolution transmission electron microscopy (HRTEM), Fourier transform infrared spectroscopy (FT-IR), X-ray diffraction (XRD), and Raman spectroscopy. The as-prepared and EDTA functionalized GO were applied as adsorbent to remove strontium(II) and cobalt(II) from water. The results indicated that the prepared materials are efficient adsorbents for strontium(II) and cobalt(II) removal. The adsorption of Co{sup II} and Sr{sup II} under effects of contact time, temperature, and pH was investigated It is concluded that the maximum adsorption capacities of GO for Co{sup II} and Sr{sup II} were about 168 and 140 mg.g{sup -1}, whereas of GO-EDTA the values were about 197 and 158 mg.g{sup -1}, respectively. It is indicated that pH 6 and temperature 40 C are the best condition for Co{sup II} and Sr{sup II} removal from water. The application of Langmuir and Freundlich isotherms indicated that Langmuir isotherm is best fit for Co{sup II} and Sr{sup II} equilibrium adsorption. Adsorption kinetics were studied by applying pseudo first-order, pseudo second-order, and intraparticle diffusion models on the experimental data. The results proved that pseudo second-order model is the best represented adsorption kinetics. Appling the intraparticle diffusion regressions on the experimental data indicated that intraparticle diffusion involved in adsorption process, which was not the only rate-controlling step. (copyright 2017 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)
Cai, Jie; Zhang, Qiu-Yun; Wei, Fang-Fang; Huang, Jin-Shu; Feng, Yun-Mei; Ma, Hai-Tao; Zhang, Yutao-
2018-04-01
Copper (II) containing phosphomolybdic acid (PMA) catalysts were synthesized by ion exchange method and characterization using various physico-chemical techniques such as X-ray diffraction (XRD), fourier transform infrared spectroscopy (FT-IR), thermogravimetric (TG) and scanning electron microscopy (SEM). The characterization results showed that the Keggin ions were retained in the catalysts and possessed well thermal stability. The catalytic esterification of lauric acid with methanol could be easily achieved about 78.7% conversion under optimum condition, the catalyst also contributed to the stability of the catalyst in which it can be reused for a certain time. This study demonstrated an alternative approach to biodiesel production with high efficiency by Cu (II) ion exchanged phosphomolybdic acid catalyst in the esterification catalytic.
Directory of Open Access Journals (Sweden)
Anne K. Braczynski
2015-01-01
Full Text Available TMEM70 is involved in the biogenesis of mitochondrial ATP synthase and mutations in the TMEM70 gene impair oxidative phosphorylation. Herein, we report on pathology and treatment of ATP synthase deficiency in four siblings. A consanguineous family of Roma (Gipsy ethnic origin gave birth to 6 children of which 4 were affected presenting with dysmorphic features, failure to thrive, cardiomyopathy, metabolic crises, and 3-methylglutaconic aciduria as clinical symptoms. Genetic testing revealed a homozygous mutation (c.317-2A>G in the TMEM70 gene. While light microscopy was unremarkable, ultrastructural investigation of muscle tissue revealed accumulation of swollen degenerated mitochondria with lipid crystalloid inclusions, cristae aggregation, and exocytosis of mitochondrial material. Biochemical analysis of mitochondrial complexes showed an almost complete ATP synthase deficiency. Despite harbouring the same mutation, the clinical outcome in the four siblings was different. Two children died within 60 h after birth; the other two had recurrent life-threatening metabolic crises but were successfully managed with supplementation of anaplerotic amino acids, lipids, and symptomatic treatment during metabolic crisis. In summary, TMEM70 mutations can cause distinct ultrastructural mitochondrial degeneration and almost complete deficiency of ATP synthase but are still amenable to treatment.
Galea, E; Regunathan, S; Eliopoulos, V; Feinstein, D L; Reis, D J
1996-01-01
Agmatine, decarboxylated arginine, is a metabolic product of mammalian cells. Considering the close structural similarity between L-arginine and agmatine, we investigated the interaction of agmatine and nitric oxide synthases (NOSs), which use L-arginine to generate nitric oxide (NO) and citrulline. Brain, macrophages and endothelial cells were respectively used as sources for NOS isoforms I, II and III. Enzyme activity was measured by the production of nitrites or L-citrulline. Agmatine was ...
Pająk, Marek; Woźniczka, Magdalena; Vogt, Andrzej; Kufelnicki, Aleksander
2017-09-19
The paper examines Co(II)-amino acid-imidazole systems (where amino acid = L-α-amino acid: alanine, asparagine, histidine) which, when in aqueous solutions, activate and reversibly take up dioxygen, while maintaining the structural scheme of the heme group (imidazole as axial ligand and O 2 uptake at the sixth, trans position) thus imitating natural respiratory pigments such as myoglobin and hemoglobin. The oxygenated reaction shows higher reversibility than for Co(II)-amac systems with analogous amino acids without imidazole. Unlike previous investigations of the heteroligand Co(II)-amino acid-imidazole systems, the present study accurately calculates all equilibrium forms present in solution and determines the [Formula: see text]equilibrium constants without using any simplified approximations. The equilibrium concentrations of Co(II), amino acid, imidazole and the formed complex species were calculated using constant data obtained for analogous systems under oxygen-free conditions. Pehametric and volumetric (oxygenation) studies allowed the stoichiometry of O 2 uptake reaction and coordination mode of the central ion in the forming oxygen adduct to be determined. The values of dioxygen uptake equilibrium constants [Formula: see text] were evaluated by applying the full mass balance equations. Investigations of oxygenation of the Co(II)-amino acid-imidazole systems indicated that dioxygen uptake proceeds along with a rise in pH to 9-10. The percentage of reversibility noted after acidification of the solution to the initial pH ranged within ca 30-60% for alanine, 40-70% for asparagine and 50-90% for histidine, with a rising tendency along with the increasing share of amino acid in the Co(II): amino acid: imidazole ratio. Calculations of the share of the free Co(II) ion as well as of the particular complex species existing in solution beside the oxygen adduct (regarding dioxygen bound both reversibly and irreversibly) indicated quite significant values for the
A method for the determination of ascorbic acid using the iron(II)-pyridine-dimethylglyoxime complex
International Nuclear Information System (INIS)
Arya, S. P.; Mahajan, M.
1998-01-01
A simple and rapid spectrophotometric method for the determination of ascorbic acid is proposed. Ascorbic acid reduces iron (III) to iron (II) which forms a red colored complex with dimethylglyoxime in the presence of pyridine. The absorbance of the resulting solution is measured at 514 nm and a linear relationship between absorbance and concentration of ascorbic acid is observed up to 14 μg ml -1 . Studies on the interference of substances usually associated with ascorbic acid have been carried out and the applicability of the method has been tested by analysing pharmaceutical preparations of vitamin C [it
Directory of Open Access Journals (Sweden)
Berta Alquézar
2017-08-01
Full Text Available Citrus aroma and flavor, chief traits of fruit quality, are derived from their high content in essential oils of most plant tissues, including leaves, stems, flowers, and fruits. Accumulated in secretory cavities, most components of these oils are volatile terpenes. They contribute to defense against herbivores and pathogens, and perhaps also protect tissues against abiotic stress. In spite of their importance, our understanding of the physiological, biochemical, and genetic regulation of citrus terpene volatiles is still limited. The availability of the sweet orange (Citrus sinensis L. Osbeck genome sequence allowed us to characterize for the first time the terpene synthase (TPS family in a citrus type. CsTPS is one of the largest angiosperm TPS families characterized so far, formed by 95 loci from which just 55 encode for putative functional TPSs. All TPS angiosperm families, TPS-a, TPS-b, TPS-c, TPS-e/f, and TPS-g were represented in the sweet orange genome, with 28, 18, 2, 2, and 5 putative full length genes each. Additionally, sweet orange β-farnesene synthase, (Z-β-cubebene/α-copaene synthase, two β-caryophyllene synthases, and three multiproduct enzymes yielding β-cadinene/α-copaene, β-elemene, and β-cadinene/ledene/allo-aromandendrene as major products were identified, and functionally characterized via in vivo recombinant Escherichia coli assays.
SULPHUR-CONTAINING AMINO ACIDS METABOLISM IN EXPERIMENTAL HYPER- AND HYPOTHYROIDISM IN RATS.
Nechiporuk, V; Zaichko, N; Korda, М; Melnyk, A; Koloshko, O
2017-10-01
Hyper- and hypothyroidism are some of the most common endocrinopathies that cause many metabolic disorders including amino acids metabolism. However, a specific molecular mechanism of thyroid hormones influence on sulphur-containing amino acids metabolism has not been established. The aim of our research was to investigate experimentally the influence of thyroid gland functional state on the main enzymatic systems of sulphur-containing amino acids metabolism in liver and kidneys, the content of homocysteine, cysteine and H2S in blood. The rats were administered with L-thyroxine and mercazolil to simulate the states of hyper- and hypothyroidism, which were confirmed by the content of fT3, fT4 and TSH in the blood. In liver and kidneys of the animals with hypothyroidism we observed the decrease in the activity of enzymes of remethylation cycle of S-adenosylmethioninsyntase, S-adenosylhomocysteinhyhdrolase, betaine-homocysteine methyltransferase. Suppression of transsulfuration transformation of homocysteine to cysteine in hypothyroidism was mainly due to the inhibition of cystathionine synthase activity of cystathionine-β-synthase, wherein cystathionase activity of cystathionine-γ-lyase was not changed. In animals with hypothyroidism we also noticed the inhibition of cysteine desulfunation reactions: the activity of enzymes of cystathionine-β-synthase, cystathionine-γ-lyase and cysteine aminotransferase significantly decreased in liver and kidneys. Experimental hyperthyroidism was accompanied by increase in activity of remethylation cycle enzymes, increase in cystationine synthase activity of cystathionine-β-synthase in liver and activity of these enzymes in kidneys. The simulation of hyperthyroidism led to the decrease of homocysteine concentration, and of hypothyroidism - to the increase of homocysteine and cysteine concentrations and reduced H2S content in blood of the animals. Thus, the significant risk factors for the development of atherosclerosis
Gao, Lei; Zhao, Shengjie; Lu, Xuqiang; He, Nan; Zhu, Hongju; Dou, Junling
2018-01-01
Soluble sugars and organic acids are important components of fruit flavor and have a strong impact on the overall organoleptic quality of watermelon (Citrullus lanatus) fruit. Several studies have analyzed the expression levels of the genes related to soluble sugar accumulation and the dynamic changes in their content during watermelon fruit development and ripening. Nevertheless, to date, there have been no reports on the organic acid content in watermelon or the genes regulating their synthesis. In this study, the soluble sugars and organic acids in watermelon were measured and a comparative transcriptome analysis was performed to identify the key genes involved in the accumulation of these substances during fruit development and ripening. The watermelon cultivar ‘203Z’ and its near-isogenic line (NIL) ‘SW’ (in the ‘203Z’ background) were used as experimental materials. The results suggested that soluble sugar consist of fructose, glucose and sucrose while malic-, citric-, and oxalic acids are the primary organic acids in watermelon fruit. Several differentially expressed genes (DEGs) related to soluble sugar- and organic acid accumulation and metabolism were identified. These include the DEGs encoding raffinose synthase, sucrose synthase (SuSy), sucrose-phosphate synthase (SPSs), insoluble acid invertases (IAI), NAD-dependent malate dehydrogenase (NAD-cyt MDH), aluminum-activated malate transporter (ALMT), and citrate synthase (CS). This is the first report addressing comparative transcriptome analysis via NILs materials in watermelon fruit. These findings provide an important basis for understanding the molecular mechanism that leads to soluble sugar and organic acid accumulation and metabolism during watermelon fruit development and ripening. PMID:29324867
Directory of Open Access Journals (Sweden)
Lei Gao
Full Text Available Soluble sugars and organic acids are important components of fruit flavor and have a strong impact on the overall organoleptic quality of watermelon (Citrullus lanatus fruit. Several studies have analyzed the expression levels of the genes related to soluble sugar accumulation and the dynamic changes in their content during watermelon fruit development and ripening. Nevertheless, to date, there have been no reports on the organic acid content in watermelon or the genes regulating their synthesis. In this study, the soluble sugars and organic acids in watermelon were measured and a comparative transcriptome analysis was performed to identify the key genes involved in the accumulation of these substances during fruit development and ripening. The watermelon cultivar '203Z' and its near-isogenic line (NIL 'SW' (in the '203Z' background were used as experimental materials. The results suggested that soluble sugar consist of fructose, glucose and sucrose while malic-, citric-, and oxalic acids are the primary organic acids in watermelon fruit. Several differentially expressed genes (DEGs related to soluble sugar- and organic acid accumulation and metabolism were identified. These include the DEGs encoding raffinose synthase, sucrose synthase (SuSy, sucrose-phosphate synthase (SPSs, insoluble acid invertases (IAI, NAD-dependent malate dehydrogenase (NAD-cyt MDH, aluminum-activated malate transporter (ALMT, and citrate synthase (CS. This is the first report addressing comparative transcriptome analysis via NILs materials in watermelon fruit. These findings provide an important basis for understanding the molecular mechanism that leads to soluble sugar and organic acid accumulation and metabolism during watermelon fruit development and ripening.
Gao, Lei; Zhao, Shengjie; Lu, Xuqiang; He, Nan; Zhu, Hongju; Dou, Junling; Liu, Wenge
2018-01-01
Soluble sugars and organic acids are important components of fruit flavor and have a strong impact on the overall organoleptic quality of watermelon (Citrullus lanatus) fruit. Several studies have analyzed the expression levels of the genes related to soluble sugar accumulation and the dynamic changes in their content during watermelon fruit development and ripening. Nevertheless, to date, there have been no reports on the organic acid content in watermelon or the genes regulating their synthesis. In this study, the soluble sugars and organic acids in watermelon were measured and a comparative transcriptome analysis was performed to identify the key genes involved in the accumulation of these substances during fruit development and ripening. The watermelon cultivar '203Z' and its near-isogenic line (NIL) 'SW' (in the '203Z' background) were used as experimental materials. The results suggested that soluble sugar consist of fructose, glucose and sucrose while malic-, citric-, and oxalic acids are the primary organic acids in watermelon fruit. Several differentially expressed genes (DEGs) related to soluble sugar- and organic acid accumulation and metabolism were identified. These include the DEGs encoding raffinose synthase, sucrose synthase (SuSy), sucrose-phosphate synthase (SPSs), insoluble acid invertases (IAI), NAD-dependent malate dehydrogenase (NAD-cyt MDH), aluminum-activated malate transporter (ALMT), and citrate synthase (CS). This is the first report addressing comparative transcriptome analysis via NILs materials in watermelon fruit. These findings provide an important basis for understanding the molecular mechanism that leads to soluble sugar and organic acid accumulation and metabolism during watermelon fruit development and ripening.
Best, Daniel; Burns, David J; Lam, Hon Wai
2015-01-01
A commercially available rhodium(II) complex catalyzes the direct arylation of 5-diazobarbituric acids with arenes, allowing straightforward access to 5-aryl barbituric acids. Free N—H groups are tolerated on the barbituric acid, with no complications arising from N—H insertion processes. This method was applied to the concise synthesis of a potent matrix metalloproteinase (MMP) inhibitor. PMID:25959544
A method for the determination of ascorbic acid using the iron(II)-pyridine-dimethylglyoxime complex
Energy Technology Data Exchange (ETDEWEB)
Arya, S. P.; Mahajan, M. [Haryana, Kurukshetra Univ. (India). Dept. of Chemistry
1998-05-01
A simple and rapid spectrophotometric method for the determination of ascorbic acid is proposed. Ascorbic acid reduces iron (III) to iron (II) which forms a red colored complex with dimethylglyoxime in the presence of pyridine. The absorbance of the resulting solution is measured at 514 nm and a linear relationship between absorbance and concentration of ascorbic acid is observed up to 14 {mu}g ml{sup -1}. Studies on the interference of substances usually associated with ascorbic acid have been carried out and the applicability of the method has been tested by analysing pharmaceutical preparations of vitamin C. [Italiano] Si propone un rapido e semplice metodo spettrofotometrico per la determinazione dell`acido ascorbico. L`acido ascorbico riduce il ferro(III) a ferro(II) che forma con la dimetilgliossima, in presenza di piridina, un complesso colorato in rosso. L`assorbanza della soluzione risultante e` misurata a 514 nm e si ottiene una relazione lineare tra assorbanza e concentrazione dell`acido ascorbico fino a 14 {mu}g ml{sup -1}. Si sono condotti studi sugli interferenti usualmente associati all`acido ascorbico ed e` stata valutata l`applicabilita` del metodo all`analisi di preparati farmaceutici di vitamina C.
Jiao, Yuntong; Xu, Weirong; Duan, Dong; Wang, Yuejin; Nick, Peter
2016-10-01
Stilbenes are central phytoalexins in Vitis, and induction of the key enzyme stilbene synthase (STS) is pivotal for disease resistance. Here, we address the potential for breeding resistance using an STS allele isolated from Chinese wild grapevine Vitis pseudoreticulata (VpSTS) by comparison with its homologue from Vitis vinifera cv. 'Carigane' (VvSTS). Although the coding regions of both alleles are very similar (>99% identity on the amino acid level), the promoter regions are significantly different. By expression in Arabidopsis as a heterologous system, we show that the allele from the wild Chinese grapevine can confer accumulation of stilbenes and resistance against the powdery mildew Golovinomyces cichoracearum, whereas the allele from the vinifera cultivar cannot. To dissect the upstream signalling driving the activation of this promoter, we used a dual-luciferase reporter system in a grapevine cell culture. We show elevated responsiveness of the promoter from the wild grape to salicylic acid (SA) and to the pathogen-associated molecular pattern (PAMP) flg22, equal induction of both alleles by jasmonic acid (JA), and a lack of response to the cell death-inducing elicitor Harpin. This elevated SA response of the VpSTS promoter depends on calcium influx, oxidative burst by RboH, mitogen-activated protein kinase (MAPK) signalling, and JA synthesis. We integrate the data in the context of a model where the resistance of V. pseudoreticulata is linked to a more efficient recruitment of SA signalling for phytoalexin synthesis. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.
International Nuclear Information System (INIS)
Nemani Murty, K.; Yedluri Rao, P.; Geddada Chalam, K.
1982-01-01
Sn(II), Ti(III), Cu(I),Fe(II), V(III) and V(II) can be titrated potentiometrically with cacotheline in 1-4 M hydrochloric acid, 0.5-2 M hydrochloric acid, 0.5-1.5 M sulphuric acid in presence of 4 ml of 10% EDTA solution in a total volume of 50 ml, 9-10 M phosphoric acid, 4-8 M acetic acid and 3-8 M acetic acid respectively. Cacotheline can be used for the assay of tin plate and solder. The cacotheline undergoes a 2-electron reduction reaction. A cacotheline solution (0.005 M) in 0.02 M hydrochloric acid is fairly stable for several months. The conditional redox potentials of cacotheline have been determined in sulphuric, phosphoric and acetic acid medium. (Author)
International Nuclear Information System (INIS)
Taguchi, Chiho; Taura, Futoshi; Tamada, Taro; Shoyama, Yoshinari; Shoyama, Yukihiro; Tanaka, Hiroyuki; Kuroki, Ryota; Morimoto, Satoshi
2008-01-01
Polyketide synthase-1 from C. sativa has been crystallized. The crystal diffracted to 1.55 Å resolution with sufficient quality for further structure determination. Polyketide synthase-1 (PKS-1) is a novel type III polyketide synthase that catalyzes the biosynthesis of hexanoyl triacetic acid lactone in Cannabis sativa (Mexican strain). PKS-1 was overproduced in Escherichia coli, purified and finally crystallized in two different space groups. The crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M calcium acetate and 20%(w/v) polyethylene glycol 3350 diffracted to 1.65 Å resolution and belonged to space group P1, with unit-cell parameters a = 54.3, b = 59.3, c = 62.6 Å, α = 69, β = 81, γ = 80°. Another crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M sodium chloride and 20%(w/v) polyethylene glycol 3350 diffracted to 1.55 Å resolution and belonged to space group P2 1 2 1 2 1 , with unit-cell parameters a = 54.3, b = 110, c = 130 Å. These data will enable us to determine the crystal structure of PKS-1
Energy Technology Data Exchange (ETDEWEB)
Taguchi, Chiho [Faculty of Pharmaceutical Sciences, Kyushu University (Japan); Quantum Beam Science Directorate, Japan Atomic Energy Agency (Japan); Taura, Futoshi [Faculty of Pharmaceutical Sciences, Kyushu University (Japan); Tamada, Taro; Shoyama, Yoshinari [Quantum Beam Science Directorate, Japan Atomic Energy Agency (Japan); Shoyama, Yukihiro; Tanaka, Hiroyuki [Faculty of Pharmaceutical Sciences, Kyushu University (Japan); Kuroki, Ryota [Quantum Beam Science Directorate, Japan Atomic Energy Agency (Japan); Morimoto, Satoshi [Faculty of Pharmaceutical Sciences, Kyushu University (Japan)
2008-03-01
Polyketide synthase-1 from C. sativa has been crystallized. The crystal diffracted to 1.55 Å resolution with sufficient quality for further structure determination. Polyketide synthase-1 (PKS-1) is a novel type III polyketide synthase that catalyzes the biosynthesis of hexanoyl triacetic acid lactone in Cannabis sativa (Mexican strain). PKS-1 was overproduced in Escherichia coli, purified and finally crystallized in two different space groups. The crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M calcium acetate and 20%(w/v) polyethylene glycol 3350 diffracted to 1.65 Å resolution and belonged to space group P1, with unit-cell parameters a = 54.3, b = 59.3, c = 62.6 Å, α = 69, β = 81, γ = 80°. Another crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M sodium chloride and 20%(w/v) polyethylene glycol 3350 diffracted to 1.55 Å resolution and belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 54.3, b = 110, c = 130 Å. These data will enable us to determine the crystal structure of PKS-1.
Nanson, Jeffrey D; Forwood, Jade K
2015-01-01
Ketoacyl-acyl carrier protein reductases (FabG) are ubiquitously expressed enzymes that catalyse the reduction of acyl carrier protein (ACP) linked thioesters within the bacterial type II fatty acid synthesis (FASII) pathway. The products of these enzymes, saturated and unsaturated fatty acids, are essential components of the bacterial cell envelope. The FASII reductase enoyl-ACP reductase (FabI) has been the focus of numerous drug discovery efforts, some of which have led to clinical trials, yet few studies have focused on FabG. Like FabI, FabG appears to be essential for survival in many bacteria, similarly indicating the potential of this enzyme as a drug target. FabG enzymes are members of the short-chain alcohol dehydrogenase/reductase (SDR) family, and like other SDRs, exhibit highly conserved secondary and tertiary structures, and contain a number of conserved sequence motifs. Here we describe the crystal structures of FabG from Yersinia pestis (YpFabG), the causative agent of bubonic, pneumonic, and septicaemic plague, and three human pandemics. Y. pestis remains endemic in many parts of North America, South America, Southeast Asia, and Africa, and a threat to human health. YpFabG shares a high degree of structural similarity with bacterial homologues, and the ketoreductase domain of the mammalian fatty acid synthase from both Homo sapiens and Sus scrofa. Structural characterisation of YpFabG, and comparison with other bacterial FabGs and the mammalian fatty acid synthase, provides a strong platform for virtual screening of potential inhibitors, rational drug design, and the development of new antimicrobial agents to combat Y. pestis infections.
Directory of Open Access Journals (Sweden)
Jeffrey D Nanson
Full Text Available Ketoacyl-acyl carrier protein reductases (FabG are ubiquitously expressed enzymes that catalyse the reduction of acyl carrier protein (ACP linked thioesters within the bacterial type II fatty acid synthesis (FASII pathway. The products of these enzymes, saturated and unsaturated fatty acids, are essential components of the bacterial cell envelope. The FASII reductase enoyl-ACP reductase (FabI has been the focus of numerous drug discovery efforts, some of which have led to clinical trials, yet few studies have focused on FabG. Like FabI, FabG appears to be essential for survival in many bacteria, similarly indicating the potential of this enzyme as a drug target. FabG enzymes are members of the short-chain alcohol dehydrogenase/reductase (SDR family, and like other SDRs, exhibit highly conserved secondary and tertiary structures, and contain a number of conserved sequence motifs. Here we describe the crystal structures of FabG from Yersinia pestis (YpFabG, the causative agent of bubonic, pneumonic, and septicaemic plague, and three human pandemics. Y. pestis remains endemic in many parts of North America, South America, Southeast Asia, and Africa, and a threat to human health. YpFabG shares a high degree of structural similarity with bacterial homologues, and the ketoreductase domain of the mammalian fatty acid synthase from both Homo sapiens and Sus scrofa. Structural characterisation of YpFabG, and comparison with other bacterial FabGs and the mammalian fatty acid synthase, provides a strong platform for virtual screening of potential inhibitors, rational drug design, and the development of new antimicrobial agents to combat Y. pestis infections.
Onofri, Chiara; de Meijer, Etienne P M; Mandolino, Giuseppe
2015-08-01
Sequence variants of THCA- and CBDA-synthases were isolated from different Cannabis sativa L. strains expressing various wild-type and mutant chemical phenotypes (chemotypes). Expressed and complete sequences were obtained from mature inflorescences. Each strain was shown to have a different specificity and/or ability to convert the precursor CBGA into CBDA and/or THCA type products. The comparison of the expressed sequences led to the identification of different mutations, all of them due to SNPs. These SNPs were found to relate to the cannabinoid composition of the inflorescence at maturity and are therefore proposed to have a functional significance. The amount of variation was found to be higher within the CBDAS sequence family than in the THCAS family, suggesting a more recent evolution of THCA-forming enzymes from the CBDAS group. We therefore consider CBDAS as the ancestral type of these synthases. Copyright © 2015 Elsevier Ltd. All rights reserved.
Nitrite reductase activity and inhibition of H₂S biogenesis by human cystathionine ß-synthase.
Directory of Open Access Journals (Sweden)
Carmen Gherasim
Full Text Available Nitrite was recognized as a potent vasodilator >130 years and has more recently emerged as an endogenous signaling molecule and modulator of gene expression. Understanding the molecular mechanisms that regulate nitrite metabolism is essential for its use as a potential diagnostic marker as well as therapeutic agent for cardiovascular diseases. In this study, we have identified human cystathionine ß-synthase (CBS as a new player in nitrite reduction with implications for the nitrite-dependent control of H₂S production. This novel activity of CBS exploits the catalytic property of its unusual heme cofactor to reduce nitrite and generate NO. Evidence for the possible physiological relevance of this reaction is provided by the formation of ferrous-nitrosyl (Fe(II-NO CBS in the presence of NADPH, the human diflavin methionine synthase reductase (MSR and nitrite. Formation of Fe(II-NO CBS via its nitrite reductase activity inhibits CBS, providing an avenue for regulating biogenesis of H₂S and cysteine, the limiting reagent for synthesis of glutathione, a major antioxidant. Our results also suggest a possible role for CBS in intracellular NO biogenesis particularly under hypoxic conditions. The participation of a regulatory heme cofactor in CBS in nitrite reduction is unexpected and expands the repertoire of proteins that can liberate NO from the intracellular nitrite pool. Our results reveal a potential molecular mechanism for cross-talk between nitrite, NO and H₂S biology.
The Tomato Terpene Synthase Gene Family1[W][OA
Falara, Vasiliki; Akhtar, Tariq A.; Nguyen, Thuong T.H.; Spyropoulou, Eleni A.; Bleeker, Petra M.; Schauvinhold, Ines; Matsuba, Yuki; Bonini, Megan E.; Schilmiller, Anthony L.; Last, Robert L.; Schuurink, Robert C.; Pichersky, Eran
2011-01-01
Compounds of the terpenoid class play numerous roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of cultivated tomato (Solanum lycopersicum) contains 44 terpene synthase (TPS) genes, including 29 that are functional or potentially functional. Of these 29 TPS genes, 26 were expressed in at least some organs or tissues of the plant. The enzymatic functions of eight of the TPS proteins were previously reported, and here we report the specific in vitro catalytic activity of 10 additional tomato terpene synthases. Many of the tomato TPS genes are found in clusters, notably on chromosomes 1, 2, 6, 8, and 10. All TPS family clades previously identified in angiosperms are also present in tomato. The largest clade of functional TPS genes found in tomato, with 12 members, is the TPS-a clade, and it appears to encode only sesquiterpene synthases, one of which is localized to the mitochondria, while the rest are likely cytosolic. A few additional sesquiterpene synthases are encoded by TPS-b clade genes. Some of the tomato sesquiterpene synthases use z,z-farnesyl diphosphate in vitro as well, or more efficiently than, the e,e-farnesyl diphosphate substrate. Genes encoding monoterpene synthases are also prevalent, and they fall into three clades: TPS-b, TPS-g, and TPS-e/f. With the exception of two enzymes involved in the synthesis of ent-kaurene, the precursor of gibberellins, no other tomato TPS genes could be demonstrated to encode diterpene synthases so far. PMID:21813655
Beld, Joris; Abbriano, Raffaela; Finzel, Kara; Hildebrand, Mark; Burkart, Michael D
2016-04-01
In both eukaryotes and prokaryotes, fatty acid synthases are responsible for the biosynthesis of fatty acids in an iterative process, extending the fatty acid by two carbon units every cycle. Thus, odd numbered fatty acids are rarely found in nature. We tested whether representatives of diverse microbial phyla have the ability to incorporate odd-chain fatty acids as substrates for their fatty acid synthases and their downstream enzymes. We fed various odd and short chain fatty acids to the bacterium Escherichia coli, cyanobacterium Synechocystis sp. PCC 6803, green microalga Chlamydomonas reinhardtii and diatom Thalassiosira pseudonana. Major differences were observed, specifically in the ability among species to incorporate and elongate short chain fatty acids. We demonstrate that E. coli, C. reinhardtii, and T. pseudonana can produce longer fatty acid products from short chain precursors (C3 and C5), while Synechocystis sp. PCC 6803 lacks this ability. However, Synechocystis can incorporate and elongate longer chain fatty acids due to acyl-acyl carrier protein synthetase (AasS) activity, and knockout of this protein eliminates the ability to incorporate these fatty acids. In addition, expression of a characterized AasS from Vibrio harveyii confers a similar capability to E. coli. The ability to desaturate exogenously added fatty acids was only observed in Synechocystis and C. reinhardtii. We further probed fatty acid metabolism of these organisms by feeding desaturase inhibitors to test the specificity of long-chain fatty acid desaturases. In particular, supplementation with thia fatty acids can alter fatty acid profiles based on the location of the sulfur in the chain. We show that coupling sensitive gas chromatography mass spectrometry to supplementation of unnatural fatty acids can reveal major differences between fatty acid metabolism in various organisms. Often unnatural fatty acids have antibacterial or even therapeutic properties. Feeding of short
Isolation and functional effects of monoclonal antibodies binding to thymidylate synthase.
Jastreboff, M M; Todd, M B; Malech, H L; Bertino, J R
1985-01-29
Monoclonal antibodies against electrophoretically pure thymidylate synthase from HeLa cells have been produced. Antibodies (M-TS-4 and M-TS-9) from hybridoma clones were shown by enzyme-linked immunoassay to recognize thymidylate synthase from a variety of human cell lines, but they did not bind to thymidylate synthase from mouse cell lines. The strongest binding of antibodies was observed to enzyme from HeLa cells. These two monoclonal antibodies bind simultaneously to different antigenic sites on thymidylate synthase purified from HeLa cells, as reflected by a high additivity index and results of cross-linked radioimmunoassay. Both monoclonal antibodies inhibit the activity of thymidylate synthase from human cell lines. The strongest inhibition was observed with thymidylate synthase from HeLa cells. Monoclonal antibody M-TS-9 (IgM subclass) decreased the rate of binding of [3H]FdUMP to thymidylate synthase in the presence of 5,10-methylenetetrahydrofolate while M-TS-4 (IgG1) did not change the rate of ternary complex formation. These data indicate that the antibodies recognize different epitopes on the enzyme molecule.
Structure and mechanism of the diterpene cyclase ent-copalyl diphosphate synthase
Energy Technology Data Exchange (ETDEWEB)
Köksal, Mustafa; Hu, Huayou; Coates, Robert M.; Peters, Reuben J.; Christianson, David W. (UIUC); (Iowa State); (Penn)
2011-09-20
The structure of ent-copalyl diphosphate synthase reveals three {alpha}-helical domains ({alpha}, {beta} and {gamma}), as also observed in the related diterpene cyclase taxadiene synthase. However, active sites are located at the interface of the {beta}{gamma} domains in ent-copalyl diphosphate synthase but exclusively in the {alpha} domain of taxadiene synthase. Modular domain architecture in plant diterpene cyclases enables the evolution of alternative active sites and chemical strategies for catalyzing isoprenoid cyclization reactions.
Generation and Functional Evaluation of Designer Monoterpene Synthases.
Srividya, N; Lange, I; Lange, B M
2016-01-01
Monoterpene synthases are highly versatile enzymes that catalyze the first committed step in the pathways toward terpenoids, the structurally most diverse class of plant natural products. Recent advancements in our understanding of the reaction mechanism have enabled engineering approaches to develop mutant monoterpene synthases that produce specific monoterpenes. In this chapter, we are describing protocols to introduce targeted mutations, express mutant enzyme catalysts in heterologous hosts, and assess their catalytic properties. Mutant monoterpene synthases have the potential to contribute significantly to synthetic biology efforts aimed at producing larger amounts of commercially attractive monoterpenes. © 2016 Elsevier Inc. All rights reserved.
Pfeiffer, Daniel; Jendrossek, Dieter
2014-01-01
Poly(3-hydroxybutyrate) (PHB) synthase (PhaC1) is the key enzyme of PHB synthesis in Ralstonia eutropha and other PHB-accumulating bacteria and catalyzes the polymerization of 3-hydroxybutyryl-CoA to PHB. Activity assays of R. eutropha PHB synthase are characterized by the presence of lag phases and by low specific activity. It is assumed that the lag phase is caused by the time necessary to convert the inactive PhaC1 monomer into the active dimeric form by an unknown priming process. The lag phase can be reduced by addition of nonionic detergents such as hecameg [6-O-(N-heptyl-carbamoyl)-methyl-α-D-glucopyranoside], which apparently accelerates the formation of PhaC1 dimers. We identified the PHB granule-associated protein (PGAP) PhaM as the natural primer (activator) of PHB synthase activity. PhaM was recently discovered as a novel type of PGAP with multiple functions in PHB metabolism. Addition of PhaM to PHB synthase assays resulted in immediate polymerization of 3HB coenzyme A with high specific activity and without a significant lag phase. The effect of PhaM on (i) PhaC1 activity, (ii) oligomerization of PhaC1, (iii) complex formation with PhaC1, and (iv) PHB granule formation in vitro and in vivo was shown by cross-linking experiments of purified proteins (PhaM, PhaC1) with glutardialdehyde, by size exclusion chromatography, and by fluorescence microscopic detection of de novo-synthesized PHB granules.
International Nuclear Information System (INIS)
Ahmed, M.; El Dessouky, S.I.; El-Nadi, Y.A.; Daoud, J.A.; Saad, E.A.
2008-01-01
The paper aims to study the extraction and separation of Cd(II), Co(II) and Ni(II) from their mixtures in hydrochloric acid medium with CYANEX 923 in kerosene. Preliminary investigations showed that only Cd(II) is extracted with CYANEX 923 while Co(II) and Ni(II) are not extracted. Different parameters affecting the extraction of Cd(II) with CYANEX 923 such as hydrochloric acid, hydrogen ion, extractant and metal concentrations, temperature investigations were also investigated. The stoichiometry of the extracted metal species investigated was found to be HCdCl 3 . 2 CYANEX 923. The stripping of the extracted Cd(II) species is obtained with 0.1 M HCl solution. Co(II) was found to be extracted with CYANEX 272 at ph 5.8 leaving Ni(II) in the solution. A developed process for the sequential of Cd(II), Co(II) and Ni(II) from their mixture in hydrochloric acid medium is proposed
Directory of Open Access Journals (Sweden)
T. L. Rakitskaya
2015-02-01
Full Text Available The maximum activity of Pd(II-Cu(II catalyst anchored to acid modified clinoptilolite in the reaction of low-temperature carbon monoxide oxidation with air oxygen has been found at the water content in the range from 3.3 to 4.2 mmol/g.
DEFF Research Database (Denmark)
Gaster, Michael; Brusgaard, Klaus; Handberg, Aa.
2004-01-01
The mechanism responsible for the diminished activation of glycogen synthase (GS) in diabetic myotubes remains unclear, but may involve increased activity and/or expression of glycogen synthase kinase-3 (GSK-3). In myotubes established from type 2 diabetic and healthy control subjects we determined...
Insight into Biochemical Characterization of Plant Sesquiterpene Synthases
DEFF Research Database (Denmark)
Manczak, Tom; Simonsen, Henrik Toft
2016-01-01
A fast and reproducible protocol was established for enzymatic characterization of plant sesquiterpene synthases that can incorporate radioactivity in their products. The method utilizes the 96-well format in conjunction with cluster tubes and enables processing of >200 samples a day. Along...... with reduced reagent usage, it allows further reduction in the use of radioactive isotopes and flammable organic solvents. The sesquiterpene synthases previously characterized were expressed in yeast, and the plant-derived Thapsia garganica kunzeaol synthase TgTPS2 was tested in this method. KM for TgTPS2...... was found to be 0.55 μM; the turnover number, kcat, was found to be 0.29 s-1, kcat for TgTPS2 is in agreement with that of terpene synthases of other plants, and kcat/KM was found to be 0.53 s-1 μM-1 for TgTPS2. The kinetic parameters were in agreement with previously published data....
Directory of Open Access Journals (Sweden)
Hyun Jo Koo
Full Text Available The essential oils of ginger (Zingiber officinale and turmeric (Curcuma longa contain a large variety of terpenoids, some of which possess anticancer, antiulcer, and antioxidant properties. Despite their importance, only four terpene synthases have been identified from the Zingiberaceae family: (+-germacrene D synthase and (S-β-bisabolene synthase from ginger rhizome, and α-humulene synthase and β-eudesmol synthase from shampoo ginger (Zingiber zerumbet rhizome. We report the identification of 25 mono- and 18 sesquiterpene synthases from ginger and turmeric, with 13 and 11, respectively, being functionally characterized. Novel terpene synthases, (--caryolan-1-ol synthase and α-zingiberene/β-sesquiphellandrene synthase, which is responsible for formation of the major sesquiterpenoids in ginger and turmeric rhizomes, were also discovered. These suites of enzymes are responsible for formation of the majority of the terpenoids present in these two plants. Structures of several were modeled, and a comparison of sets of paralogs suggests how the terpene synthases in ginger and turmeric evolved. The most abundant and most important sesquiterpenoids in turmeric rhizomes, (+-α-turmerone and (+-β-turmerone, are produced from (--α-zingiberene and (--β-sesquiphellandrene, respectively, via α-zingiberene/β-sesquiphellandrene oxidase and a still unidentified dehydrogenase.
Suites of Terpene Synthases Explain Differential Terpenoid Production in Ginger and Turmeric Tissues
Koo, Hyun Jo; Gang, David R.
2012-01-01
The essential oils of ginger (Zingiber officinale) and turmeric (Curcuma longa) contain a large variety of terpenoids, some of which possess anticancer, antiulcer, and antioxidant properties. Despite their importance, only four terpene synthases have been identified from the Zingiberaceae family: (+)-germacrene D synthase and (S)-β-bisabolene synthase from ginger rhizome, and α-humulene synthase and β-eudesmol synthase from shampoo ginger (Zingiber zerumbet) rhizome. We report the identification of 25 mono- and 18 sesquiterpene synthases from ginger and turmeric, with 13 and 11, respectively, being functionally characterized. Novel terpene synthases, (−)-caryolan-1-ol synthase and α-zingiberene/β-sesquiphellandrene synthase, which is responsible for formation of the major sesquiterpenoids in ginger and turmeric rhizomes, were also discovered. These suites of enzymes are responsible for formation of the majority of the terpenoids present in these two plants. Structures of several were modeled, and a comparison of sets of paralogs suggests how the terpene synthases in ginger and turmeric evolved. The most abundant and most important sesquiterpenoids in turmeric rhizomes, (+)-α-turmerone and (+)-β-turmerone, are produced from (−)-α-zingiberene and (−)-β-sesquiphellandrene, respectively, via α-zingiberene/β-sesquiphellandrene oxidase and a still unidentified dehydrogenase. PMID:23272109
İlkimen, Halil; Yenikaya, Cengiz
2018-01-01
In thisstudy, mixed ligand transitionmetal complexes of Cu(II)have been prepared between salicylic acid derivatives [salicylic acid (H2sal) or acetylsalicylic acid (Hasal)] and 2-aminobenzothiazole derivatives[2-aminobenzothiazole (abt) or 2-amino-6-chlorobenzothiazole (Clabt) or2-amino-6-methylbenzothiazole (Meabt)]. The structures of amorphous metalcomplexes have been proposed by evaluating the data obtained from elementalanalysis, ICP-OES, FT-IR, UV-Vis, thermal analysis, magnetic suscepti...
Misra, Rajesh Chandra; Garg, Anchal; Roy, Sudeep; Chanotiya, Chandan Singh; Vasudev, Prema G; Ghosh, Sumit
2015-11-01
Ent-labdane-related diterpene (ent-LRD) specialized (i.e. secondary) metabolites of the medicinal plant kalmegh (Andrographis paniculata) have long been known for several pharmacological activities. However, our understanding of the ent-LRD biosynthetic pathway has remained largely incomplete. Since ent-LRDs accumulate in leaves, we carried out a comparative transcriptional analysis using leaf and root tissues, and identified 389 differentially expressed transcripts, including 223 transcripts that were preferentially expressed in leaf tissue. Analysis of the transcripts revealed various specialized metabolic pathways, including transcripts of the ent-LRD biosynthetic pathway. Two class II diterpene synthases (ApCPS1 and ApCPS2) along with one (ApCPS1') and two (ApCPS2' and ApCPS2″) transcriptional variants that were the outcomes of alternative splicing of the precursor mRNA and alternative transcriptional termination, respectively, were identified. ApCPS1 and ApCPS2 encode for 832- and 817-amino acids proteins, respectively, and are phylogenetically related to the dicotyledons ent-copalyl diphosphate synthases (ent-CPSs). The spatio-temporal patterns of ent-LRD metabolites accumulation and gene expression suggested a likely role for ApCPS1 in general (i.e. primary) metabolism, perhaps by providing precursor for the biosynthesis of phytohormone gibberellin (GA). However, ApCPS2 is potentially involved in tissue-specific accumulation of ent-LRD specialized metabolites. Bacterially expressed recombinant ApCPS2 catalyzed the conversion of (E,E,E)-geranylgeranyl diphosphate (GGPP), the general precursor of diterpenes to ent-copalyl diphosphate (ent-CPP), the precursor of ent-LRDs. Taken together, these results advance our understanding of the tissue-specific accumulation of specialized ent-LRDs of medicinal importance. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Glycosyltransferase glycosylating flavokermesic acid and/or kermesic acid
DEFF Research Database (Denmark)
2016-01-01
An isolated glycosyltransferase (GT) polypeptide capable of: (I) : conjugating glucose to flavokermesic acid (FK); and/or (II) : conjugating glucose to kermesic acid (KA) and use of this GT to e.g. make Carminic acid.......An isolated glycosyltransferase (GT) polypeptide capable of: (I) : conjugating glucose to flavokermesic acid (FK); and/or (II) : conjugating glucose to kermesic acid (KA) and use of this GT to e.g. make Carminic acid....
GLYCOSYLTRANSFERASE GLYCOSYLATING FLAVOKERMESIC ACID AND/OR KERMESIC ACID
DEFF Research Database (Denmark)
2015-01-01
An isolated glycosyltransferase (GT) polypeptide capable of: (I): conjugating glucose to flavokermesic acid (FK); and/or (II): conjugating glucose to kermesic acid (KA) and use of this GT to e.g. make Carminic acid.......An isolated glycosyltransferase (GT) polypeptide capable of: (I): conjugating glucose to flavokermesic acid (FK); and/or (II): conjugating glucose to kermesic acid (KA) and use of this GT to e.g. make Carminic acid....
International Nuclear Information System (INIS)
Sheng Guodong; Li Jiaxing; Shao Dadong; Hu Jun; Chen Changlun; Chen Yixue; Wang Xiangke
2010-01-01
The adsorption of Cu(II) on multiwalled carbon nanotubes (MWCNTs) as a function of pH and ionic strength in the absence and presence of humic acid (HA) or fulvic acid (FA) was studied using batch technique. The results indicated that the adsorption is strongly dependent on pH but independent of ionic strength. A positive effect of HA/FA on Cu(II) adsorption was found at pH 7.5. The adsorption isotherms can be described better by the Freundlich model than by the Langmuir model in the absence and presence of HA/FA. Adsorption isotherms of Cu(II) at higher initial HA/FA concentrations are higher than those of Cu(II) at lower FA/HA concentrations. The thermodynamic data calculated from temperature-dependent adsorption isotherms suggested that the adsorption was spontaneous and enhanced at higher temperature. Results of this work suggest that MWCNTs may be a promising candidate for the removal of heavy metal ions from aqueous solutions.
Energy Technology Data Exchange (ETDEWEB)
Yamamoto, Kohji, E-mail: yamamok@agr.kyushu-u.ac.jp [Faculty of Agriculture, Kyushu University Graduate School, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Suzuki, Mamoru; Higashiura, Akifumi [Institute for Protein Research, Osaka University, Suita 565-0871 (Japan); Aritake, Kosuke; Urade, Yoshihiro; Uodome, Nobuko [Department of Molecular Behavioral Biology, Osaka Bioscience Institute, 6-2-4 Furuedai, Suita, Osaka 565-0874 (Japan); Hossain, MD. Tofazzal [Faculty of Agriculture, Kyushu University Graduate School, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Nakagawa, Atsushi [Institute for Protein Research, Osaka University, Suita 565-0871 (Japan)
2013-11-01
Highlights: •Structure of Bombyx mori prostaglandin E synthase is determined. •Bound glutathione sulfonic acid is located at the glutathione-binding site. •Electron-sharing network is present in this protein. •This network includes Asn95, Asp96, and Arg98. •Site-directed mutagenesis reveals that the residues contribute to the catalytic activity. -- Abstract: Prostaglandin E synthase (PGES) catalyzes the isomerization of PGH{sub 2} to PGE{sub 2}. We previously reported the identification and structural characterization of Bombyx mori PGES (bmPGES), which belongs to Sigma-class glutathione transferase. Here, we extend these studies by determining the structure of bmPGES in complex with glutathione sulfonic acid (GTS) at a resolution of 1.37 Å using X-ray crystallography. GTS localized to the glutathione-binding site. We found that electron-sharing network of bmPGES includes Asn95, Asp96, and Arg98. Site-directed mutagenesis of these residues to create mutant forms of bmPGES mutants indicate that they contribute to catalytic activity. These results are, to our knowledge, the first to reveal the presence of an electron-sharing network in bmPGES.
Directory of Open Access Journals (Sweden)
Wojnicki M.
2017-06-01
Full Text Available The kinetics studies of redox reaction between palladium(II chloride complex ions and potassium formate in acidic aqueous solutions was investigated. It was shown, that the reduction reaction of Pd(II is selective in respect to Pd(II complex structure. The kinetic of the process was monitored spectrophotometrically. The influence of chloride ions concentration, Pd(II initial concentration, reductant concentration, ionic strength as well as the temperature were investigated in respect to the process dynamics. Arrhenius equation parameters were determined and are equal to 65.8 kJ/mol, and A = 1.12×1011 s−1.
Yu, Jianxiu; Deng, Rong; Zhu, Helen H; Zhang, Sharon S; Zhu, Changhong; Montminy, Marc; Davis, Roger; Feng, Gen-Sheng
2013-02-08
The Src-homology 2 (SH2) domain-containing tyrosine phosphatase Shp2 has been known to regulate various signaling pathways triggered by receptor and cytoplasmic tyrosine kinases. Here we describe a novel function of Shp2 in control of lipid metabolism by mediating degradation of fatty acid synthase (FASN). p38-phosphorylated COP1 accumulates in the cytoplasm and subsequently binds FASN through Shp2 here as an adapter, leading to FASN-Shp2-COP1 complex formation and FASN degradation mediated by ubiquitination pathway. By fasting p38 is activated and stimulates FASN protein degradation in mice. Consistently, the FASN protein levels are dramatically elevated in mouse liver and pancreas in which Shp2/Ptpn11 is selectively deleted. Thus, this study identifies a new activity for Shp2 in lipid metabolism.
Highly divergent mitochondrial ATP synthase complexes in Tetrahymena thermophila.
Directory of Open Access Journals (Sweden)
Praveen Balabaskaran Nina
2010-07-01
Full Text Available The F-type ATP synthase complex is a rotary nano-motor driven by proton motive force to synthesize ATP. Its F(1 sector catalyzes ATP synthesis, whereas the F(o sector conducts the protons and provides a stator for the rotary action of the complex. Components of both F(1 and F(o sectors are highly conserved across prokaryotes and eukaryotes. Therefore, it was a surprise that genes encoding the a and b subunits as well as other components of the F(o sector were undetectable in the sequenced genomes of a variety of apicomplexan parasites. While the parasitic existence of these organisms could explain the apparent incomplete nature of ATP synthase in Apicomplexa, genes for these essential components were absent even in Tetrahymena thermophila, a free-living ciliate belonging to a sister clade of Apicomplexa, which demonstrates robust oxidative phosphorylation. This observation raises the possibility that the entire clade of Alveolata may have invented novel means to operate ATP synthase complexes. To assess this remarkable possibility, we have carried out an investigation of the ATP synthase from T. thermophila. Blue native polyacrylamide gel electrophoresis (BN-PAGE revealed the ATP synthase to be present as a large complex. Structural study based on single particle electron microscopy analysis suggested the complex to be a dimer with several unique structures including an unusually large domain on the intermembrane side of the ATP synthase and novel domains flanking the c subunit rings. The two monomers were in a parallel configuration rather than the angled configuration previously observed in other organisms. Proteomic analyses of well-resolved ATP synthase complexes from 2-D BN/BN-PAGE identified orthologs of seven canonical ATP synthase subunits, and at least 13 novel proteins that constitute subunits apparently limited to the ciliate lineage. A mitochondrially encoded protein, Ymf66, with predicted eight transmembrane domains could be a
Fang, Lu; Shen, Bin; Irwin, David M; Zhang, Shuyi
2014-10-01
Glycogen synthase, which catalyzes the synthesis of glycogen, is especially important for Old World (Pteropodidae) and New World (Phyllostomidae) fruit bats that ingest high-carbohydrate diets. Glycogen synthase 1, encoded by the Gys1 gene, is the glycogen synthase isozyme that functions in muscles. To determine whether Gys1 has undergone adaptive evolution in bats with carbohydrate-rich diets, in comparison to insect-eating sister bat taxa, we sequenced the coding region of the Gys1 gene from 10 species of bats, including two Old World fruit bats (Pteropodidae) and a New World fruit bat (Phyllostomidae). Our results show no evidence for positive selection in the Gys1 coding sequence on the ancestral Old World and the New World Artibeus lituratus branches. Tests for convergent evolution indicated convergence of the sequences and one parallel amino acid substitution (T395A) was detected on these branches, which was likely driven by natural selection.
Energy Technology Data Exchange (ETDEWEB)
Kamnev, Alexander A.; Tugarova, Anna V. [Institute of Biochemistry and Physiology of Plants and Microorganisms, Russian Academy of Sciences (Russian Federation); Kovacs, Krisztina; Homonnay, Zoltan, E-mail: homonnay@ludens.elte.hu; Kuzmann, Erno; Vertes, Attila [Eoetvoes Lorand University, Institute of Chemistry (Hungary)
2012-03-15
Emission ({sup 57}Co) Moessbauer spectra of the aspartic acid-{sup 57}CoCl{sub 2} system were measured at T = 80 K in frozen aqueous solution and in the form of a dried residue of this solution. The Moessbauer spectra, besides a weak contribution from after-effects, showed two Fe{sup 2 + }/Co{sup 2 + } components which were ascribed to octahedrally and tetrahedrally coordinated {sup 57}Co{sup II} microenvironments in the Asp-cobalt(II) complex. This dual coordination mode may be due to the involvement of the second terminal carboxylic group of aspartic acid in the coordination sphere of Co.
Chen, Xujun; Chen, Hao; Yuan, Joshua S; Köllner, Tobias G; Chen, Yuying; Guo, Yufen; Zhuang, Xiaofeng; Chen, Xinlu; Zhang, Yong-Jun; Fu, Jianyu; Nebenführ, Andreas; Guo, Zejian; Chen, Feng
2018-03-06
Rice blast disease, caused by the fungus Magnaporthe oryzae, is the most devastating disease of rice. In our ongoing characterization of the defence mechanisms of rice plants against M. oryzae, a terpene synthase gene OsTPS19 was identified as a candidate defence gene. Here, we report the functional characterization of OsTPS19, which is up-regulated by M. oryzae infection. Overexpression of OsTPS19 in rice plants enhanced resistance against M. oryzae, while OsTPS19 RNAi lines were more susceptible to the pathogen. Metabolic analysis revealed that the production of a monoterpene (S)-limonene was increased and decreased in OsTPS19 overexpression and RNAi lines, respectively, suggesting that OsTPS19 functions as a limonene synthase in planta. This notion was further supported by in vitro enzyme assays with recombinant OsTPS19, in which OsTPS19 had both sesquiterpene activity and monoterpene synthase activity, with limonene as a major product. Furthermore, in a subcellular localization experiment, OsTPS19 was localized in plastids. OsTPS19 has a highly homologous paralog, OsTPS20, which likely resulted from a recent gene duplication event. We found that the variation in OsTPS19 and OsTPS20 enzyme activities was determined by a single amino acid in the active site cavity. The expression of OsTPS20 was not affected by M. oryzae infection. This indicates functional divergence of OsTPS19 and OsTPS20. Lastly, (S)-limonene inhibited the germination of M. oryzae spores in vitro. OsTPS19 was determined to function as an (S)-limonene synthase in rice and plays a role in defence against M. oryzae, at least partly, by inhibiting spore germination. © 2018 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Cloning and functional characterization of β-phellandrene synthase from Lavandula angustifolia.
Demissie, Zerihun A; Sarker, Lukman S; Mahmoud, Soheil S
2011-04-01
En route to building genomics resources for Lavandula, we have obtained over 14,000 ESTs for leaves and flowers of L. angustifolia, a major essential oil crop, and identified a number of previously uncharacterized terpene synthase (TPS) genes. Here we report the cloning, expression in E. coli, and functional characterization of β-phellandrene synthase, LaβPHLS. The ORF--excluding the transit peptide--for this gene encoded a 62.3 kDa protein that contained all conserved motifs present in plant TPSs. Expression in bacteria resulted in the production of a soluble protein that was purified by Ni-NTA agarose affinity chromatography. While the recombinant LaβPHLS did not utilize FPP as a substrate, it converted GPP (the preferred substrate) and NPP into β-phellandrene as the major product, with K (m) and k (cat) of 6.55 μM and 1.75 × 10(-2) s(-1), respectively, for GPP. The LaβPHLS transcripts were highly abundant in young leaves where β-phellandrene is produced, but were barely detectable in flowers and older leaves, where β-phellandrene is not synthesized in significant quantities. This data indicate that β-phellandrene biosynthesis is transcriptionally and developmentally regulated. We also cloned and expressed in E. coli a second TPS-like protein, LaTPS-I, that lacks an internal stretch of 73 amino acids, including the signature DDxxD divalent metal binding motif, compared to other plant TPSs. The recombinant LaTPS-I did not produce detectable products in vitro when assayed with GPP, NPP or FPP as substrates. The lack of activity is most likely due to the absence of catalytically important amino acid residues within the missing region.
Beta-Glucan Synthase Gene Expression in Pleurotus sp
International Nuclear Information System (INIS)
Azhar Mohamad; Nie, H.J.
2016-01-01
Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)
Crous-Masó, Joan; Palomeras, Sònia; Relat, Joana; Camó, Cristina; Martínez-Garza, Úrsula; Planas, Marta; Feliu, Lidia; Puig, Teresa
2018-05-11
(-)-Epigallocatechin 3-gallate (EGCG) is a natural polyphenol from green tea with reported anticancer activity and capacity to inhibit the lipogenic enzyme fatty acid synthase (FASN), which is overexpressed in several human carcinomas. To improve the pharmacological profile of EGCG, we previously developed a family of EGCG derivatives and the lead compounds G28, G37 and G56 were characterized in HER2-positive breast cancer cells overexpressing FASN. Here, diesters G28, G37 and G56 and two G28 derivatives, monoesters M1 and M2, were synthesized and assessed in vitro for their cytotoxic, FASN inhibition and apoptotic activities in MDA-MB-231 triple-negative breast cancer (TNBC) cells. All compounds displayed moderate to high cytotoxicity and significantly blocked FASN activity, monoesters M1 and M2 being more potent inhibitors than diesters. Interestingly, G28, M1, and M2 also diminished FASN protein expression levels, but only monoesters M1 and M2 induced apoptosis. Our results indicate that FASN inhibition by such polyphenolic compounds could be a new strategy in TNBC treatment, and highlight the potential anticancer activities of monoesters. Thus, G28, G37, G56, and most importantly M1 and M2, are anticancer candidates (alone or in combination) to be further characterized in vitro and in vivo.
Energy Technology Data Exchange (ETDEWEB)
Bang, P; Eriksson, U; Wivall, I -L; Hall, K [Department of Endocrinology, Karolinska Institute, Stockholm (Sweden); Sara, V [Department of Pathology, Karolinska Institute, Stockholm (Sweden)
1991-01-01
Insulin-like growth factor binding proteins interfere in the IGF-I and -II radioimmunoassays. In an attempt to overcome this problem, we have compared the use of truncated IGF-I, with reduced IGFBP affinity, and IGF-I as radioligands for IGF-I RIA measurements in serum separated by acid gel filtration or acid ethanol extraction followed by cryo-precipitation. With truncated IGF-I as radioligand the IGF-I measurements in acid gel filtrates and acid ethanol extracts were significantly correlated in healthy subjects (N=42, r=0.91, p<0.001) and in patients with acromegaly (N=10, r=0.85, p<0.01), GH deficiency (N=10, r=0.88, p<0.001) or Type I diabetes mellitus (N=10, r=0.90, p<0.001). In contrast, the IGF-I concentrations in acid ethanol extracts determined with IGF-I as radioligand did not correlate with those in acid gel filtrates using truncated IGF-I radioligand in patients with acromegaly (r=0.61, NS) or GH deficiency (r=0.46, NS). In the latter group the mean IGF-I concentrations measured in acid ethanol extracts were erroneously elevated by 112%. Low-affinity antibodies used for IGF-II RIA determinations failed to give reliable results in acid ethanol extracts from patients with Type I diabetes mellitus or GH deficiency. In conclusion, erroneously high IGF-I concentrations owing to binding of the radioligand to IGFBPs not completely removed by acid ethanol extraction can be avoided by the use of truncated IGF-I as radioligand. (author).
African Journals Online (AJOL)
CLEMENT O BEWAJI
Valine (2 - amino - 3 – methylbutanoic acid), is a chemical compound containing .... Stability constant (Kf). Gibb's free energy. ) (. 1. −. ∆. Mol. JG. [CuL2(H2O)2] ... synthesis and characterization of Co(ii), Ni(ii), Cu (II), and Zn(ii) complexes with ...
Sequence analysis of cereal sucrose synthase genes and isolation ...
African Journals Online (AJOL)
SERVER
2007-10-18
Oct 18, 2007 ... sequencing of sucrose synthase gene fragment from sor- ghum using primers designed at their conserved exons. MATERIALS AND METHODS. Multiple sequence alignment. Sucrose synthase gene sequences of various cereals like rice, maize, and barley were accessed from NCBI Genbank database.
Fe(II) oxidation during acid mine drainage neutralization in a pilot-scale sequencing batch reactor
CSIR Research Space (South Africa)
Zvimba, JN
2013-10-01
Full Text Available crystallization for metal content using ICP-OES (Varian: Vista Pro CCD Simultaneous ICP- OES). The pH, acidity and alkalinity of the AMD were determined using a Mettler Toledo Auto-titrator following filtration. Fe(II) was determined by standard permanganate...
Localization of nitric oxide synthase in human skeletal muscle
DEFF Research Database (Denmark)
Frandsen, Ulrik; Lopez-Figueroa, M.; Hellsten, Ylva
1996-01-01
The present study investigated the cellular localization of the neuronal type I and endothelial type III nitric oxide synthase in human skeletal muscle. Type I NO synthase immunoreactivity was found in the sarcolemma and the cytoplasm of all muscle fibres. Stronger immunoreactivity was expressed...
Sucrose Phosphate Synthase and Sucrose Accumulation at Low Temperature 1
Guy, Charles L.; Huber, Joan L. A.; Huber, Steven C.
1992-01-01
The influence of growth temperature on the free sugar and sucrose phosphate synthase content and activity of spinach (Spinacia oleracea) leaf tissue was studied. When plants were grown at 25°C for 3 weeks and then transferred to a constant 5°C, sucrose, glucose, and fructose accumulated to high levels during a 14-d period. Predawn sugar levels increased from 14- to 20-fold over the levels present at the outset of the low-temperature treatment. Sucrose was the most abundant free sugar before, during, and after exposure to 5°C. Leaf sucrose phosphate synthase activity was significantly increased by the low-temperature treatment, whereas sucrose synthase and invertases were not. Synthesis of the sucrose phosphate synthase subunit was increased during and after low-temperature exposure and paralleled an increase in the steady-state level of the subunit. The increases in sucrose and its primary biosynthetic enzyme, sucrose phosphate synthase, are discussed in relation to adjustment of metabolism to low nonfreezing temperature and freezing stress tolerance. Images Figure 1 Figure 2 Figure 3 PMID:16652990
Chee, Marcus Jenn Yang; Lycett, Grantley W.; Khoo, Teng-Jin; Chin, Chiew Foan
2016-01-01
Production of vanillin by bioengineering has gained popularity due to consumer demand towards vanillin produced by biological systems. Natural vanillin from vanilla beans is very expensive to produce compared to its synthetic counterpart. Current bioengineering works mainly involve microbial biotechnology. Therefore, alternative means to the current approaches are constantly being explored. This work describes the use of vanillin synthase (VpVAN), to bioconvert ferulic acid to vanillin in a p...
Directory of Open Access Journals (Sweden)
I MADE ARTIKA
2010-09-01
Full Text Available The yeast mitochondrial F1F0-ATP synthase is a multisubunit complex that contains at least 17 different subunits. Subunit 8 of yeast mitochondrial ATP synthase is a hydrophobic protein of 48 amino acids encoded by the mitochondrial ATP8 gene. Subunit 8 has three distinct domains; an N-terminal domain, a central hydrophobic domain and a C-terminal domain. FLAG tag addition to subunit 8 protein potentially facilitate elucidation of its topology, structure, and function. It has been shown that following incorporation of FLAG tag to its C-terminus, subunit 8 still assemble into functional ATP synthase complex. In order to analyze bioenergetic consequences of the FLAG tag addition, a yeast strain expressing FLAG tagged-subunit 8 was subjected to cellular respiration assays. Results obtained showed that addition of FLAG tag to the C-terminus of subunit 8 does not impair its proper functioning. The FLAG tag system, therefore, can be employed to study subunit 8′s detailed structure, topology, and function.
Modulation of hyaluronan synthase activity in cellular membrane fractions.
Vigetti, Davide; Genasetti, Anna; Karousou, Evgenia; Viola, Manuela; Clerici, Moira; Bartolini, Barbara; Moretto, Paola; De Luca, Giancarlo; Hascall, Vincent C; Passi, Alberto
2009-10-30
Hyaluronan (HA), the only non-sulfated glycosaminoglycan, is involved in morphogenesis, wound healing, inflammation, angiogenesis, and cancer. In mammals, HA is synthesized by three homologous HA synthases, HAS1, HAS2, and HAS3, that polymerize the HA chain using UDP-glucuronic acid and UDP-N-acetylglucosamine as precursors. Since the amount of HA is critical in several pathophysiological conditions, we developed a non-radioactive assay for measuring the activity of HA synthases (HASs) in eukaryotic cells and addressed the question of HAS activity during intracellular protein trafficking. We prepared three cellular fractions: plasma membrane, cytosol (containing membrane proteins mainly from the endoplasmic reticulum and Golgi), and nuclei. After incubation with UDP-sugar precursors, newly synthesized HA was quantified by polyacrylamide gel electrophoresis of fluorophore-labeled saccharides and high performance liquid chromatography. This new method measured HAS activity not only in the plasma membrane fraction but also in the cytosolic membranes. This new technique was used to evaluate the effects of 4-methylumbeliferone, phorbol 12-myristate 13-acetate, interleukin 1beta, platelet-derived growth factor BB, and tunicamycin on HAS activities. We found that HAS activity can be modulated by post-translational modification, such as phosphorylation and N-glycosylation. Interestingly, we detected a significant increase in HAS activity in the cytosolic membrane fraction after tunicamycin treatment. Since this compound is known to induce HA cable structures, this result links HAS activity alteration with the capability of the cell to promote HA cable formation.
Directory of Open Access Journals (Sweden)
Abeer Abousaab
2016-12-01
Full Text Available Background: Cellular uptake of glutamate by the excitatory amino-acid transporters (EAATs decreases excitation and thus participates in the regulation of neuroexcitability. Kinases impacting on neuronal function include Lithium-sensitive glycogen synthase kinase GSK3ß. The present study thus explored whether the activities of EAAT3 and/or EAAT4 isoforms are sensitive to GSK3ß. Methods: cRNA encoding wild type EAAT3 (SLC1A1 or EAAT4 (SLC1A6 was injected into Xenopus oocytes without or with additional injection of cRNA encoding wild type GSK3ß or the inactive mutant K85AGSK3ß. Dual electrode voltage clamp was performed in order to determine glutamate-induced current (IEAAT. Results: Appreciable IEAAT was observed in EAAT3 or EAAT4 expressing but not in water injected oocytes. IEAAT was significantly increased by coexpression of GSK3ß but not by coexpression of K85AGSK3ß. Coexpression of GSK3ß increased significantly the maximal IEAAT in EAAT3 or EAAT4 expressing oocytes, without significantly modifying apparent affinity of the carriers. Lithium (1 mM exposure for 24 hours decreased IEAAT in EAAT3 and GSK3ß expressing oocytes to values similar to IEAAT in oocytes expressing EAAT3 alone. Lithium did not significantly modify IEAAT in oocytes expressing EAAT3 without GSK3ß. Conclusions: Lithium-sensitive GSK3ß is a powerful regulator of excitatory amino acid transporters EAAT3 and EAAT4.
Pydiura, N A; Bayer, G Ya; Galinousky, D V; Yemets, A I; Pirko, Ya V; Podvitski, T A; Anisimova, N V; Khotyleva, L V; Kilchevsky, A V; Blume, Ya B
2015-01-01
A bioinformatic search of sequences encoding cellulose synthase genes in the flax genome, and their comparison to dicots orthologs was carried out. The analysis revealed 32 cellulose synthase gene candidates, 16 of which are highly likely to encode cellulose synthases, and the remaining 16--cellulose synthase-like proteins (Csl). Phylogenetic analysis of gene products of cellulose synthase genes allowed distinguishing 6 groups of cellulose synthase genes of different classes: CesA1/10, CesA3, CesA4, CesA5/6/2/9, CesA7 and CesA8. Paralogous sequences within classes CesA1/10 and CesA5/6/2/9 which are associated with the primary cell wall formation are characterized by a greater similarity within these classes than orthologous sequences. Whereas the genes controlling the biosynthesis of secondary cell wall cellulose form distinct clades: CesA4, CesA7, and CesA8. The analysis of 16 identified flax cellulose synthase gene candidates shows the presence of at least 12 different cellulose synthase gene variants in flax genome which are represented in all six clades of cellulose synthase genes. Thus, at this point genes of all ten known cellulose synthase classes are identify in flax genome, but their correct classification requires additional research.
A study on complex formation of cadmium(II) ions, 8
International Nuclear Information System (INIS)
Matsui, Haruo; Hirabayashi, Yoshihiro
1984-01-01
In the potentiometric titration of the solution containing a cadmium(II) ion and an amino acid, white precipitates often appear in the test solution, and they disturb the emf measurements. Such precipitates were formes in the solutions, pH ranging 7.5--8.5, during the course of titrations of the test solutions containing cadmium(II) ion and amino acid such as glycine, α-alanine. 2-aminobutanoic acid, 3-aminobutanoic acid, 4-aminobutanoic acid, 2-aminopentanoic acid, 5-aminopentanoic acid, 2-aminohexanoic acid, 6-aminohexanoic acid, aspartic acid, glutamic acid, asparagine, or glutamine. The identification of the precipitates obtained from the solutions containing cadmium(II) ion and L-aspartic acid, 4-aminobutanoic acid, or 6-aminohexanoic acid were carried out by both of elemental analysis and the infrared spectroscopy. These results indicated that the precipitate obtained from the solution containing cadmium(II) ion and L-aspartic acid was 1:1 cadmium(II)-L-aspartic acid complex and did not contain any cadmium(II) hydroxide, and other two precipitates were mostly cadmium(II) hydroxide and contained a little cadmium(II)-amino acid complexes. (author)
Rehman, Ajijur; Akhtar, Salman; Siddiqui, Mohd Haris; Sayeed, Usman; Ahmad, Syed Sayeed; Arif, Jamal M.; Khan, M. Kalim A.
2016-01-01
4-hydroxy-tetrahydrodipicolinate synthase (DHDPS) is an important enzyme needed for the biosynthesis of lysine and many more key metabolites in Mycobacterium tuberculosis (Mtb). Inhibition of DHDPS is supposed to a promising therapeutic target due to its specific role in sporulation, cross-linking of the peptidiglycan polymers and biosynthesis of amino acids. In this work, a known inhibitor-based similarity search was carried out against a natural products database (Super Natural II) towards identification of more potent phyto-inhibitors. Molecular interaction studies were accomplished using three different tools to understand and establish the participation of active site residues as the key players in stabilizing the binding mode of ligands and target protein. The best phyto-compound deduced on the basis of binding affinity was further used as a template to make similarity scan across the PubChem Compound database (score > = 80 %) to get more divesred leads. In this search 5098 hits were obtained that further reduced to 262 after drug-likeness filtration. These phytochemicallike compounds were docked at the active site of DHDPS.Then, those hits selected from docking analysis that showing stronger binding and forming maximum H-bonds with the active site residues (Thr54, Thr55, Tyr143, Arg148 and Lys171). Finally, we predicted one phytochemical compound (SN00003544), two PubChem-compounds (CID41032023, CID54025334) akin to phytochemical molecule showing better interactions in comaprison of known inhibitors of target protein.These findings might be further useful to gain the structural insight into the designing of novel leads against DapA family. PMID:28293071
International Nuclear Information System (INIS)
Lamas, Maria J.; Duran, Goretti; Gomez, Antonio; Balboa, Emilia; Anido, Urbano; Bernardez, Beatriz; Rana-Diez, Pablo; Lopez, Rafael; Carracedo, Angel; Barros, Francisco
2012-01-01
Purpose: 5-Fluorouracil–based chemoradiotherapy before total mesorectal excision is currently the standard treatment of Stage II and III rectal cancer patients. We used known predictive pharmacogenetic biomarkers to identify the responders to preoperative chemoradiotherapy in our series. Methods and Materials: A total of 93 Stage II-III rectal cancer patients were genotyped using peripheral blood samples. The genes analyzed were X-ray cross-complementing group 1 (XRCC1), ERCC1, MTHFR, EGFR, DPYD, and TYMS. The patients were treated with 225 mg/m 2 /d continuous infusion of 5-fluorouracil concomitantly with radiotherapy (50.4 Gy) followed by total mesorectal excision. The outcomes were measured by tumor regression grade (TRG) as a major response (TRG 1 and TRG 2) or as a poor response (TRG3, TRG4, and TRG5). Results: The major histopathologic response rate was 47.3%. XRCC1 G/G carriers had a greater probability of response than G/A carriers (odds ratio, 4.18; 95% confidence interval, 1.62–10.74, p = .003) Patients with polymorphisms associated with high expression of thymidylate synthase (2R/3G, 3C/3G, and 3G/3G) showed a greater pathologic response rate compared with carriers of low expression (odds ratio, 2.65; 95% confidence interval, 1.10–6.39, p = .02) No significant differences were seen in the response according to EGFR, ERCC1, MTHFR C 677 and MTHFR A 1298 expression. Conclusions: XRCC1 G/G and thymidylate synthase (2R/3G, 3C/3G, and 3G/3G) are independent factors of a major response. Germline thymidylate synthase and XRCC1 polymorphisms might be useful as predictive markers of rectal tumor response to neoadjuvant chemoradiotherapy with 5-fluorouracil.
Energy Technology Data Exchange (ETDEWEB)
Lamas, Maria J., E-mail: mlamasd@yahoo.es [Oncology Pharmacy Unit, Complejo Hospitalario Universitario of Santiago (CHUS), Choupana S/N, Santiago de Compostela (Spain); Duran, Goretti [Oncology Pharmacy Unit, Complejo Hospitalario Universitario of Santiago (CHUS), Choupana S/N, Santiago de Compostela (Spain); Gomez, Antonio [Department of Oncology Radiotherapy, Complejo Hospitalario Universitario of Santiago (CHUS), Choupana S/N, Santiago de Compostela (Spain); Balboa, Emilia [Molecular Medicine Unit, Fundacion Publica Galega de Medicina Xenomica, Choupana S/N, Santiago de Compostela (Spain); Anido, Urbano [Department of Medical Oncology, Complejo Hospitalario Universitario of Santiago (CHUS), Choupana S/N, Santiago de Compostela (Spain); Bernardez, Beatriz [Oncology Pharmacy Unit, Complejo Hospitalario Universitario of Santiago (CHUS), Choupana S/N, Santiago de Compostela (Spain); Rana-Diez, Pablo [Molecular Medicine Unit, Fundacion Publica Galega de Medicina Xenomica, Choupana S/N, Santiago de Compostela (Spain); Lopez, Rafael [Department of Medical Oncology, Complejo Hospitalario Universitario of Santiago (CHUS), Choupana S/N, Santiago de Compostela (Spain); Carracedo, Angel; Barros, Francisco [Fundacion Publica Galega de Medicina Xenomica and Genomic Medicine Group-CIBERER, University of Santiago de Compostela, Calle San Fransisco S/N, Santiago de Compostela (Spain)
2012-01-01
Purpose: 5-Fluorouracil-based chemoradiotherapy before total mesorectal excision is currently the standard treatment of Stage II and III rectal cancer patients. We used known predictive pharmacogenetic biomarkers to identify the responders to preoperative chemoradiotherapy in our series. Methods and Materials: A total of 93 Stage II-III rectal cancer patients were genotyped using peripheral blood samples. The genes analyzed were X-ray cross-complementing group 1 (XRCC1), ERCC1, MTHFR, EGFR, DPYD, and TYMS. The patients were treated with 225 mg/m{sup 2}/d continuous infusion of 5-fluorouracil concomitantly with radiotherapy (50.4 Gy) followed by total mesorectal excision. The outcomes were measured by tumor regression grade (TRG) as a major response (TRG 1 and TRG 2) or as a poor response (TRG3, TRG4, and TRG5). Results: The major histopathologic response rate was 47.3%. XRCC1 G/G carriers had a greater probability of response than G/A carriers (odds ratio, 4.18; 95% confidence interval, 1.62-10.74, p = .003) Patients with polymorphisms associated with high expression of thymidylate synthase (2R/3G, 3C/3G, and 3G/3G) showed a greater pathologic response rate compared with carriers of low expression (odds ratio, 2.65; 95% confidence interval, 1.10-6.39, p = .02) No significant differences were seen in the response according to EGFR, ERCC1, MTHFR{sub C}677 and MTHFR{sub A}1298 expression. Conclusions: XRCC1 G/G and thymidylate synthase (2R/3G, 3C/3G, and 3G/3G) are independent factors of a major response. Germline thymidylate synthase and XRCC1 polymorphisms might be useful as predictive markers of rectal tumor response to neoadjuvant chemoradiotherapy with 5-fluorouracil.
Shaw, Jeffrey J.; Berbasova, Tetyana; Sasaki, Tomoaki; Jefferson-George, Kyra; Spakowicz, Daniel J.; Dunican, Brian F.; Portero, Carolina E.; Narváez-Trujillo, Alexandra; Strobel, Scott A.
2015-01-01
Terpenes are an important and diverse class of secondary metabolites widely produced by fungi. Volatile compound screening of a fungal endophyte collection revealed a number of isolates in the family Xylariaceae, producing a series of terpene molecules, including 1,8-cineole. This compound is a commercially important component of eucalyptus oil used in pharmaceutical applications and has been explored as a potential biofuel additive. The genes that produce terpene molecules, such as 1,8-cineole, have been little explored in fungi, providing an opportunity to explore the biosynthetic origin of these compounds. Through genome sequencing of cineole-producing isolate E7406B, we were able to identify 11 new terpene synthase genes. Expressing a subset of these genes in Escherichia coli allowed identification of the hyp3 gene, responsible for 1,8-cineole biosynthesis, the first monoterpene synthase discovered in fungi. In a striking example of convergent evolution, mutational analysis of this terpene synthase revealed an active site asparagine critical for water capture and specificity during cineole synthesis, the same mechanism used in an unrelated plant homologue. These studies have provided insight into the evolutionary relationship of fungal terpene synthases to those in plants and bacteria and further established fungi as a relatively untapped source of this important and diverse class of compounds. PMID:25648891
Oh, Joonseok; Liu, Haining; Park, Hyun Bong; Ferreira, Daneel; Jeong, Gil-Saeng; Hamann, Mark T; Doerksen, Robert J; Na, MinKyun
2017-01-01
Inhibition of fatty acid synthase (FAS) is regarded as a sensible therapeutic strategy for the development of optimal anti-cancer agents. Flavonoids exhibit potent anti-neoplastic properties. The MeOH extract of Sophora flavescens was subjected to chromatographic analyses such as VLC and HPLC for the purification of active flavonoids. The DP4 chemical-shift analysis protocol was employed to investigate the elusive chirality of the lavandulyl moiety of the purified polyphenols. Induced Fit docking protocols and per-residue analyses were utilized to scrutinize structural prerequisites for hampering FAS activity. The FAS-inhibitory activity of the purified flavonoids was assessed via the incorporation of [ 3 H] acetyl-CoA into palmitate. Six flavonoids, including lavandulyl flavanones, were purified and evaluated for FAS inhibition. The lavandulyl flavanone sophoraflavanone G (2) exhibited the highest potency (IC 50 of 6.7±0.2μM), which was more potent than the positive controls. Extensive molecular docking studies revealed the structural requirements for blocking FAS. Per-residue interaction analysis demonstrated that the lavandulyl functional group in the active flavonoids (1-3 and 5) significantly contributed to increasing their binding affinity towards the target enzyme. This research suggests a basis for the in silico design of a lavandulyl flavonoid-based architecture showing anti-cancer effects via enhancement of the binding potential to FAS. FAS inhibition by flavonoids and their derivatives may offer significant potential as an approach to lower the risk of various cancer diseases and related fatalities. In silico technologies with available FAS crystal structures may be of significant use in optimizing preliminary leads. Copyright © 2016 Elsevier B.V. All rights reserved.
Zhaksyntay Kairbekov; Dina Akbayeva; Zh. Eshova
2012-01-01
It was established that in mild conditions (50-70 oC, РО2= 1 atm) white phosphorus effectively is oxidized by oxygen in water-toluene solutions of copper(II) chloride modified by humic (fulvo-) acid to give mainly phosphoric acid. Humic (fulvo-) acid was extracted from brown coal of domestic deposit Kiyakty. For determination of optimum parameters of fulvo-acid extraction the laboratory experiments were carried out using the method of experiment planning. The kinetics, intermediate and final ...
International Nuclear Information System (INIS)
Shukla, J.P.
1996-01-01
Carrier-facilitated co-transport of Pd (II) from dilute acidic nitrate solutions was examined across a polymer-immobilized liquid membrane (PILM) deploying S 6 -pentano-36 (S 6 -P-36), bis-(2-ethylhexyl) sulfoxide (BESO) and bis (2, 4, 4 trimethyl pentyl) monothio phosphinic acid (Cyanex 302) as the novel receptors. The study carried out to distinguish the driving force between H + and NO 3 - ion for the cation transport across PILM, indicated that NO 3 - ion not the H + ion seems to be the driving force for Pd (II) transport under the present conditions for both BESO-PILM and S 6 -P-36-PILM systems. Recovery of palladium from acidic process effluents generated in Purex reprocessing of spent fuels was successfully achieved. 39 refs., 8 figs., 7 tabs
Energy Technology Data Exchange (ETDEWEB)
Jalilehvand, F.; Laffin, L.J.
2009-05-18
Careful analysis of Pt L{sub 3}-edge extended X-ray absorption fine structure (EXAFS) spectra shows that the hydrated platinum(II) ion in acidic (HClO{sub 4}) aqueous solution binds four water molecules with the Pt-O bond distance 2.01(2) {angstrom} and one (or two) in the axial position at 2.39(2) {angstrom}. The weak axial water coordination is in accordance with the unexpectedly small activation volume previously reported for water exchange in an interchange mechanism with associative character. The hydrated cis-diammineplatinum(II) complex has a similar coordination environment with two ammine and two aqua ligands strongly bound with Pt-O/N bond distances of 2.01(2) {angstrom} and, in addition, one (or two) axial water molecule at 2.37(2) {angstrom}. This result provides a new basis for theoretical computational studies aiming to connect the function of the anticancer drug cis-platin to its ligand exchange reactions, where usually four-coordinated square planar platinum(II) species are considered as the reactant and product. {sup 195}Pt NMR spectroscopy has been used to characterize the Pt(II) complexes.
Directory of Open Access Journals (Sweden)
Ahmad Khairudin Nurul
2006-11-01
Full Text Available Abstract Background Polyhydroxyalkanoates (PHA, are biodegradable polyesters derived from many microorganisms such as the pseudomonads. These polyesters are in great demand especially in the packaging industries, the medical line as well as the paint industries. The enzyme responsible in catalyzing the formation of PHA is PHA synthase. Due to the limited structural information, its functional properties including catalysis are lacking. Therefore, this study seeks to investigate the structural properties as well as its catalytic mechanism by predicting the three-dimensional (3D model of the Type II Pseudomonas sp. USM 4–55 PHA synthase 1 (PhaC1P.sp USM 4–55. Results Sequence analysis demonstrated that PhaC1P.sp USM 4–55 lacked similarity with all known structures in databases. PSI-BLAST and HMM Superfamily analyses demonstrated that this enzyme belongs to the alpha/beta hydrolase fold family. Threading approach revealed that the most suitable template to use was the human gastric lipase (PDB ID: 1HLG. The superimposition of the predicted PhaC1P.sp USM 4–55 model with 1HLG covering 86.2% of the backbone atoms showed an RMSD of 1.15 Å. The catalytic residues comprising of Cys296, Asp451 and His479 were found to be conserved and located adjacent to each other. In addition to this, an extension to the catalytic mechanism was also proposed whereby two tetrahedral intermediates were believed to form during the PHA biosynthesis. These transition state intermediates were further postulated to be stabilized by the formation of oxyanion holes. Based on the sequence analysis and the deduced model, Ser297 was postulated to contribute to the formation of the oxyanion hole. Conclusion The 3D model of the core region of PhaC1P.sp USM 4–55 from residue 267 to residue 484 was developed using computational techniques and the locations of the catalytic residues were identified. Results from this study for the first time highlighted Ser297 potentially
Huang, Ji; Rajapakse, Angana; Xiong, Yuyan; Montani, Jean-Pierre; Verrey, François; Ming, Xiu-Fen; Yang, Zhihong
2016-01-01
Obesity is associated with development and progression of chronic kidney disease (CKD). Recent evidence demonstrates that enhanced levels of the L-arginine:ureahydrolase, including the two isoenzymes arginase-I (Arg-I) and arginase-II (Arg-II) in vascular endothelial cells promote uncoupling of endothelial nitric oxide synthase (eNOS), leading to increased superoxide radical anion and decreased NO production thereby endothelial dysfunction. Arg-II but not Arg-I is abundantly expressed in kidney and the role of Arg-II in CKD is uncertain and controversial. We aimed to investigate the role of Arg-II in renal damage associated with diet-induced obesity mouse model. Wild type (WT) C57BL/6 mice and mice deficient in Arg-II gene (Arg-II -/- ) were fed with either a normal chow (NC) or a high-fat-diet (HFD) for 14 weeks (starting at the age of 7 weeks) to induce obesity. In WT mice, HFD feeding caused frequent renal lipid accumulation, enhancement of renal reactive oxygen species (ROS) levels which could be attenuated by a NOS inhibitor, suggesting uncoupling of NOS in kidney. HFD feeding also significantly augmented renal Arg-II expression and activity. All the alterations in the kidney under HFD feeding were reduced in Arg-II -/- mice. Moreover, mesangial expansion as analyzed by Periodic Acid Schiff (PAS) staining and renal expression of vascular adhesion molecule-1 (VCAM-1) and intercellular adhesion molecule-1 (ICAM-1) in HFD-fed WT mouse assessed by immunoblotting were reduced in the HFD-fed Arg-II -/- mice, although there was no significant difference in body weight and renal weight/body weight ratio between the WT and Arg-II -/- mice. Thus, Arg-II expression/activity is enhanced in kidney of diet-induced obesity mice. Genetic targeting of Arg-II prevents renal damage associated with obesity, suggesting an important role of Arg-II in obesity-associated renal disease development.
Directory of Open Access Journals (Sweden)
Ji Huang
2016-11-01
Full Text Available Obesity is associated with development and progression of chronic kidney disease (CKD. Recent evidence demonstrates that enhanced levels of the L-arginine:ureahydrolase, including the two isoenzymes arginase-I (Arg-I and arginase-II (Arg-II in vascular endothelial cells promote uncoupling of endothelial nitric oxide synthase (eNOS, leading to increased superoxide radical anion and decreased NO production thereby endothelial dysfunction. Arg-II but not Arg-I is abundantly expressed in kidney and the role of Arg-II in CKD is uncertain and controversial. We aimed to investigate the role of Arg-II in renal damage associated with diet-induced obesity mouse model. Wild type (WT C57BL/6 mice and mice deficient in Arg-II gene (Arg-II-/- were fed with either a normal chow (NC or a high-fat-diet (HFD for 14 weeks (starting at the age of 7 weeks to induce obesity. In WT mice, HFD feeding caused frequent renal lipid accumulation, enhancement of renal ROS levels which could be attenuated by a NOS inhibitor, suggesting uncoupling of NOS in kidney. HFD feeding also significantly augmented renal Arg-II expression and activity. All the alterations in the kidney under HFD feeding were reduced in Arg-II-/- mice. Moreover, mesangial expansion as analysed by Periodic Acid Schiff (PAS staining and renal expression of vascular adhesion molecule-1 (VCAM-1 and intercellular adhesion molecule-1 (ICAM-1 in HFD-fed WT mouse assessed by immunoblotting were reduced in the HFD-fed Arg-II-/- mice, although there was no significant difference in body weight and renal weight/body weight ratio between the WT and Arg-II-/- mice. Thus, Arg-II expression/activity is enhanced in kidney of diet-induced obesity mice. Genetic targeting of Arg-II prevents renal damage associated with obesity, suggesting an important role of Arg-II in obesity-associated renal disease development.
Energy Technology Data Exchange (ETDEWEB)
Lee, G.L.; Astrin, K.H.; Desnick, R.J. [Mount Sinai School of Medicine, New York, NY (United States)
1995-08-28
Acute intermittent porphyria (AIP) is an autosomal-dominant inborn error of metabolism that results from the half-normal activity of the third enzyme in the heme biosynthetic pathway, hydroxymethylbilane synthase (HMB-synthase). AIP is an ecogenetic condition, since the life-threatening acute attacks are precipitated by various factors, including drugs, alcohol, fasting, and certain hormones. Biochemical diagnosis is problematic, and the identification of mutations in the HMB-synthase gene provides accurate detection of presymptomatic heterozygotes, permitting avoidance of the acute precipitating factors. By direct solid-phase sequencing, two mutations causing AIP were identified, an adenine deletion at position 629 in exon 11(629delA), which alters the reading frame and predicts premature truncation of the enzyme protein after amino acid 255, and a nonsense mutation in exon 12 (R225X). These mutations were confirmed by either restriction enzyme analysis or family studies of symptomatic patients, permitting accurate presymptomatic diagnosis of affected relatives. 29 refs., 2 figs.
Characterization of the human gene (TBXAS1) encoding thromboxane synthase.
Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T
1994-09-01
The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.
DEFF Research Database (Denmark)
Vionnet, Christine; Roubaty, Carole; Ejsing, Christer S.
2010-01-01
In yeast, the inositolphosphorylceramides mostly contain C26:0 fatty acids. Inositolphosphorylceramides were considered to be important for viability, since the inositolphosphorylceramide synthase AUR1 is essential. Yet, lcb1 cells, unable to make sphingoid bases and inositolphosphorylceramides......, are viable if they harbor SLC1-1, a gain of function mutation in the 1-acyl-glycerol-3-phosphate acyltransferase SLC1. SLC1-1 allows to incorporate C26:0 fatty acids into phosphatidylinositol (PI), thus generating PIii, an abnormal, C26-containing PI, presumably acting as surrogate...
Complete amino acid sequence of a Lolium perenne (perennial rye grass) pollen allergen, Lol p II.
Ansari, A A; Shenbagamurthi, P; Marsh, D G
1989-07-05
The complete amino acid sequence of a Lolium perenne (rye grass) pollen allergen, Lol p II was determined by automated Edman degradation of the protein and selected fragments. Cleavage of the protein by enzymatic and chemical techniques established an unambiguous sequence for the protein. Lol p II contains 97 amino acid residues, with a calculated molecular weight of 10,882. The protein lacks cysteine and glutamine and shows no evidence of glycosylation. Theoretical predictions by Fraga's (Fraga, S. (1982) Can. J. Chem. 60, 2606-2610) and Hopp and Woods' (Hopp, T. P., and Woods, K. R. (1981) Proc. Natl. Acad. Sci. U.S.A. 78, 3824-3828) methods indicate the presence of four hydrophilic regions, which may contribute to sequential or parts of conformational B-cell epitopes. Analysis of amphipathic regions by Berzofsky's method indicates the presence of a highly amphipathic region, which may contain, or contribute to, an Ia/T-cell epitope. This latter segment of Lol p II was found to be highly homologous with an antibody-binding segment of the major rye allergen Lol p I and may explain why immune responsiveness to both the allergens is associated with HLA-DR3.
Tsume, Yasuhiro; Langguth, Peter; Garcia-Arieta, Alfredo; Amidon, Gordon L
2012-10-01
The FDA Biopharmaceutical Classification System guidance allows waivers for in vivo bioavailability and bioequivalence studies for immediate-release solid oral dosage forms only for BCS class I. Extensions of the in vivo biowaiver for a number of drugs in BCS class III and BCS class II have been proposed, in particular, BCS class II weak acids. However, a discrepancy between the in vivo BE results and in vitro dissolution results for BCS class II acids was recently observed. The objectives of this study were to determine the oral absorption of BCS class II weak acids via simulation software and to determine if the in vitro dissolution test with various dissolution media could be sufficient for in vitro bioequivalence studies of ibuprofen and ketoprofen as models of carboxylic acid drugs. The oral absorption of these BCS class II acids from the gastrointestinal tract was predicted by GastroPlus™. Ibuprofen did not satisfy the bioequivalence criteria at lower settings of intestinal pH of 6.0. Further the experimental dissolution of ibuprofen tablets in a low concentration phosphate buffer at pH 6.0 (the average buffer capacity 2.2 mmol l (-1) /pH) was dramatically reduced compared with the dissolution in SIF (the average buffer capacity 12.6 mmol l (-1) /pH). Thus these predictions for the oral absorption of BCS class II acids indicate that the absorption patterns depend largely on the intestinal pH and buffer strength and must be considered carefully for a bioequivalence test. Simulation software may be a very useful tool to aid the selection of dissolution media that may be useful in setting an in vitro bioequivalence dissolution standard. Copyright © 2012 John Wiley & Sons, Ltd.
International Nuclear Information System (INIS)
Du, J.Z.; Zhou, C.Y.; Dong, W.M.; Tao, Z.Y.
1999-01-01
The stability constants for tracer concentrations of Co(II) complexes with both the red earth humic and fulvic acids were determined at pH 5.9 and ionic strength 0.010 mol/l by using the ARDAKANI-STEVENSON cation exchange equilibrium method and the radiotracer 60 Co. It was found that the 1:1 complexes of Co(II) with the red earth humic and fulvic acids were formed and that the average values of logβ (stability constant) of humic and fulvic acid complexes were 5.76±0.19 and 4.42±0.03, respectively. (author)
Geranylfarnesyl diphosphate synthase from Methanosarcina mazei: Different role, different evolution
International Nuclear Information System (INIS)
Ogawa, Takuya; Yoshimura, Tohru; Hemmi, Hisashi
2010-01-01
The gene of (all-E) geranylfarnesyl diphosphate synthase that is responsible for the biosynthesis of methanophenazine, an electron carrier utilized for methanogenesis, was cloned from a methanogenic archaeon Methanosarcina mazei Goe1. The properties of the recombinant enzyme and the results of phylogenetic analysis suggest that the enzyme is closely related to (all-E) prenyl diphosphate synthases that are responsible for the biosynthesis of respiratory quinones, rather than to the enzymes involved in the biosynthesis of archaeal membrane lipids, including (all-E) geranylfarnesyl diphosphate synthase from a thermophilic archaeon.
The Mycobacterium tuberculosis Rv2540c DNA sequence encodes a bifunctional chorismate synthase
Directory of Open Access Journals (Sweden)
Santos Diógenes S
2008-04-01
Full Text Available Abstract Background The emergence of multi- and extensively-drug resistant Mycobacterium tuberculosis strains has created an urgent need for new agents to treat tuberculosis (TB. The enzymes of shikimate pathway are attractive targets to the development of antitubercular agents because it is essential for M. tuberculosis and is absent from humans. Chorismate synthase (CS is the seventh enzyme of this route and catalyzes the NADH- and FMN-dependent synthesis of chorismate, a precursor of aromatic amino acids, naphthoquinones, menaquinones, and mycobactins. Although the M. tuberculosis Rv2540c (aroF sequence has been annotated to encode a chorismate synthase, there has been no report on its correct assignment and functional characterization of its protein product. Results In the present work, we describe DNA amplification of aroF-encoded CS from M. tuberculosis (MtCS, molecular cloning, protein expression, and purification to homogeneity. N-terminal amino acid sequencing, mass spectrometry and gel filtration chromatography were employed to determine identity, subunit molecular weight and oligomeric state in solution of homogeneous recombinant MtCS. The bifunctionality of MtCS was determined by measurements of both chorismate synthase and NADH:FMN oxidoreductase activities. The flavin reductase activity was characterized, showing the existence of a complex between FMNox and MtCS. FMNox and NADH equilibrium binding was measured. Primary deuterium, solvent and multiple kinetic isotope effects are described and suggest distinct steps for hydride and proton transfers, with the former being more rate-limiting. Conclusion This is the first report showing that a bacterial CS is bifunctional. Primary deuterium kinetic isotope effects show that C4-proS hydrogen is being transferred during the reduction of FMNox by NADH and that hydride transfer contributes significantly to the rate-limiting step of FMN reduction reaction. Solvent kinetic isotope effects and
International Nuclear Information System (INIS)
Páez, David; Salazar, Juliana; Paré, Laia; Pertriz, Lourdes; Targarona, Eduardo; Rio, Elisabeth del; Barnadas, Agusti; Marcuello, Eugenio; Baiget, Montserrat
2011-01-01
Purpose: Several studies have been performed to evaluate the usefulness of neoadjuvant treatment using oxaliplatin and fluoropyrimidines for locally advanced rectal cancer. However, preoperative biomarkers of outcome are lacking. We studied the polymorphisms in thymidylate synthase, epidermal growth factor receptor, glutathione S-transferase pi 1 (GSTP1), and several DNA repair genes to evaluate their usefulness as pharmacogenetic markers in a cohort of 128 rectal cancer patients treated with preoperative chemoradiotherapy. Methods and Materials: Blood samples were obtained from 128 patients with Stage II-III rectal cancer. DNA was extracted from the peripheral blood nucleated cells, and the genotypes were analyzed by polymerase chain reaction amplification and automated sequencing techniques or using a 48.48 dynamic array on the BioMark system. The germline polymorphisms studied were thymidylate synthase, (VNTR/5′UTR, 2R G>C single nucleotide polymorphism [SNP], 3R G>C SNP), epidermal growth factor receptor (Arg497Lys), GSTP1 (Ile105val), excision repair cross-complementing 1 (Asn118Asn, 8092C>A, 19716G>C), X-ray repair cross-complementing group 1 (XRCC1) (Arg194Trp, Arg280His, Arg399Gln), and xeroderma pigmentosum group D (Lys751Gln). The pathologic response, pathologic regression, progression-free survival, and overall survival were evaluated according to each genotype. Results: The ∗3/∗3 thymidylate synthase genotype was associated with a greater response rate (pathologic complete remission and microfoci residual tumor, 59% in ∗3/∗3 vs. 35% in ∗2/∗2 and ∗2/∗3; p = .013). For the thymidylate synthase genotype, the median progression-free survival was 103 months for the ∗3/∗3 patients and 84 months for the ∗2/∗2 and ∗2/∗3 patients (p = .039). For XRCC1 Arg399Gln SNP, the median progression-free survival was 101 months for the G/G, 78 months for the G/A, and 31 months for the A/A patients (p = .048). Conclusions: The thymidylate
Energy Technology Data Exchange (ETDEWEB)
Paez, David, E-mail: dpaez@santpau.cat [Department of Medical Oncology, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Salazar, Juliana; Pare, Laia [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Pertriz, Lourdes [Department of Radiotherapy, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Targarona, Eduardo [Department of Surgery, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Rio, Elisabeth del [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Barnadas, Agusti; Marcuello, Eugenio [Department of Medical Oncology, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Baiget, Montserrat [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain)
2011-12-01
Purpose: Several studies have been performed to evaluate the usefulness of neoadjuvant treatment using oxaliplatin and fluoropyrimidines for locally advanced rectal cancer. However, preoperative biomarkers of outcome are lacking. We studied the polymorphisms in thymidylate synthase, epidermal growth factor receptor, glutathione S-transferase pi 1 (GSTP1), and several DNA repair genes to evaluate their usefulness as pharmacogenetic markers in a cohort of 128 rectal cancer patients treated with preoperative chemoradiotherapy. Methods and Materials: Blood samples were obtained from 128 patients with Stage II-III rectal cancer. DNA was extracted from the peripheral blood nucleated cells, and the genotypes were analyzed by polymerase chain reaction amplification and automated sequencing techniques or using a 48.48 dynamic array on the BioMark system. The germline polymorphisms studied were thymidylate synthase, (VNTR/5 Prime UTR, 2R G>C single nucleotide polymorphism [SNP], 3R G>C SNP), epidermal growth factor receptor (Arg497Lys), GSTP1 (Ile105val), excision repair cross-complementing 1 (Asn118Asn, 8092C>A, 19716G>C), X-ray repair cross-complementing group 1 (XRCC1) (Arg194Trp, Arg280His, Arg399Gln), and xeroderma pigmentosum group D (Lys751Gln). The pathologic response, pathologic regression, progression-free survival, and overall survival were evaluated according to each genotype. Results: The Asterisk-Operator 3/ Asterisk-Operator 3 thymidylate synthase genotype was associated with a greater response rate (pathologic complete remission and microfoci residual tumor, 59% in Asterisk-Operator 3/ Asterisk-Operator 3 vs. 35% in Asterisk-Operator 2/ Asterisk-Operator 2 and Asterisk-Operator 2/ Asterisk-Operator 3; p = .013). For the thymidylate synthase genotype, the median progression-free survival was 103 months for the Asterisk-Operator 3/ Asterisk-Operator 3 patients and 84 months for the Asterisk-Operator 2/ Asterisk-Operator 2 and Asterisk-Operator 2/ Asterisk
Directory of Open Access Journals (Sweden)
Joan Crous-Masó
2018-05-01
Full Text Available (−-Epigallocatechin 3-gallate (EGCG is a natural polyphenol from green tea with reported anticancer activity and capacity to inhibit the lipogenic enzyme fatty acid synthase (FASN, which is overexpressed in several human carcinomas. To improve the pharmacological profile of EGCG, we previously developed a family of EGCG derivatives and the lead compounds G28, G37 and G56 were characterized in HER2-positive breast cancer cells overexpressing FASN. Here, diesters G28, G37 and G56 and two G28 derivatives, monoesters M1 and M2, were synthesized and assessed in vitro for their cytotoxic, FASN inhibition and apoptotic activities in MDA-MB-231 triple-negative breast cancer (TNBC cells. All compounds displayed moderate to high cytotoxicity and significantly blocked FASN activity, monoesters M1 and M2 being more potent inhibitors than diesters. Interestingly, G28, M1, and M2 also diminished FASN protein expression levels, but only monoesters M1 and M2 induced apoptosis. Our results indicate that FASN inhibition by such polyphenolic compounds could be a new strategy in TNBC treatment, and highlight the potential anticancer activities of monoesters. Thus, G28, G37, G56, and most importantly M1 and M2, are anticancer candidates (alone or in combination to be further characterized in vitro and in vivo.
International Nuclear Information System (INIS)
Van Dyk, D.E.; Schloss, J.V.
1987-01-01
Bromopyruvate is an affinity label for acetolactate synthase isozyme II from Salmonella typhimurium (ALSII). The concentration of bromopyruvate giving half-maximal inactivation is 0.1 mM, and the maximal rate of inactivation is 0.56 hr -1 . Inactivation with [ 14 C]bromopyruvate is associated with the incorporation of 4 molecules of reagent per active site lost. Two cysteinyl residues are modified extremely rapidly, with no loss of enzymatic activity, as judged by quenching the reaction with thiol after its initial phase. Inactivation is a consequence of the additional two moles of reagent incorporated per mole of protomer. The additional incorporation is divided between one major and two minor sites of modification. Substantial protection against inactivation is afforded by FAD, with virtually complete protection provided by a mixture of FAD and thiamine pyrophosphate (TPP). The major site of modification, protected by FAD, is cysteinyl residue number67, based upon amino acid sequence analysis of the purified tryptic peptide that encompasses this site. The remaining site of modification, protected by TPP, is associated with cysteinyl residue number44. Both sites of modification are afforded protection by the sulfonylurea herbicide sulfometuron methyl (SM). Although inactivation by bromopyruvate exhibits rate saturation, indicating binding as a prerequisite to inactivation, neither pyruvate nor α-ketobutyrate prevent modification of the enzyme by bromopyruvate. Thus, it would appear that the bromopyruvate binding site is not the site normally occupied by substrate
Characterization of a 1,4-. beta. -D-glucan synthase from Dictyostelium discoideum
Energy Technology Data Exchange (ETDEWEB)
Blanton, R.L.
1992-01-15
Various aspects of research concerning Dictyostelium discoideum are presented. The initial focus of this project was upon: the characterization of potential probes for the cellulose synthase (antibody and nucleic acid), the determination of the cultural induction conditions of cellulose synthesis, the solubilization of the enzyme activity, the development of a non-inhibitory disruption buffer, the generation and isolation of mutant strains deficient in cellulose synthesis, and the development of the capability to determine the degree of polymerization of the in vitro product. I have briefly summarized our most significant findings with only selected data sets being shown in this report in the interest of brevity.
Zhou, Fei; Wang, Cheng-Yuan; Gutensohn, Michael; Jiang, Ling; Zhang, Peng; Zhang, Dabing; Dudareva, Natalia; Lu, Shan
2017-06-27
In plants, geranylgeranyl diphosphate (GGPP) is produced by plastidic GGPP synthase (GGPPS) and serves as a precursor for vital metabolic branches, including chlorophyll, carotenoid, and gibberellin biosynthesis. However, molecular mechanisms regulating GGPP allocation among these biosynthetic pathways localized in the same subcellular compartment are largely unknown. We found that rice contains only one functionally active GGPPS, OsGGPPS1, in chloroplasts. A functionally active homodimeric enzyme composed of two OsGGPPS1 subunits is located in the stroma. In thylakoid membranes, however, the GGPPS activity resides in a heterodimeric enzyme composed of one OsGGPPS1 subunit and GGPPS recruiting protein (OsGRP). OsGRP is structurally most similar to members of the geranyl diphosphate synthase small subunit type II subfamily. In contrast to members of this subfamily, OsGRP enhances OsGGPPS1 catalytic efficiency and specificity of GGPP production on interaction with OsGGPPS1. Structural biology and protein interaction analyses demonstrate that affinity between OsGRP and OsGGPPS1 is stronger than between two OsGGPPS1 molecules in homodimers. OsGRP determines OsGGPPS1 suborganellar localization and directs it to a large protein complex in thylakoid membranes, consisting of geranylgeranyl reductase (OsGGR), light-harvesting-like protein 3 (OsLIL3), protochlorophyllide oxidoreductase (OsPORB), and chlorophyll synthase (OsCHLG). Taken together, genetic and biochemical analyses suggest OsGRP functions in recruiting OsGGPPS1 from the stroma toward thylakoid membranes, thus providing a mechanism to control GGPP flux toward chlorophyll biosynthesis.
Substrate specificity of Arabidopsis 3-ketoacyl-CoA synthases
International Nuclear Information System (INIS)
Blacklock, Brenda J.; Jaworski, Jan G.
2006-01-01
The very long chain fatty acids (VLCFA) incorporated into plant lipids are derived from the iterative addition of C2 units provided by malonyl-CoA to an acyl-CoA by the 3-ketoacyl-CoA synthase (KCS) component of a fatty acid elongase (FAE) complex. Mining of the Arabidopsis genome sequence database revealed 20 genes with homology to seed-specific FAE1 KCS. Eight of the 20 putative KCSs were cloned, expressed in yeast, and isolated as (His) 6 fusion proteins. Five of the eight (At1g71160, At1g19440, At1g07720, At5g04530, and At4g34250) had little or no activity with C16 to C20 substrates while three demonstrated activity with C16, C18, and C20 saturated acyl-CoA substrates. At1g01120 KCS (KCS1) and At2g26640 KCS had broad substrate specificities when assayed with saturated and mono-unsaturated C16 to C24 acyl-CoAs while At4g34510 KCS was specific for saturated fatty acyl-CoA substrates
Enzymatic properties of Staphylococcus aureus adenosine synthase (AdsA)
2011-01-01
Background Staphylococcus aureus is a human pathogen that produces extracellular adenosine to evade clearance by the host immune system, an activity attributed to the 5'-nucleotidase activity of adenosine synthase (AdsA). In mammals, conversion of adenosine triphosphate to adenosine is catalyzed in a two-step process: ecto-nucleoside triphosphate diphosphohydrolases (ecto-NTDPases) hydrolyze ATP and ADP to AMP, whereas 5'-nucleotidases hydrolyze AMP to adenosine. NTPDases harbor apyrase conserved regions (ACRs) that are critical for activity. Results NTPDase ACR motifs are absent in AdsA, yet we report here that recombinant AdsA hydrolyzes ADP and ATP in addition to AMP. Competition assays suggest that hydrolysis occurs following binding of all three substrates at a unique site. Alanine substitution of two amino acids, aspartic acid 127 and histidine 196 within the 5'-nucleotidase signature sequence, leads to reduced AMP or ADP hydrolysis but does not affect the binding of these substrates. Conclusion Collectively, these results provide insight into the unique ability of AdsA to produce adenosine through the consecutive hydrolysis of ATP, ADP and AMP, thereby endowing S. aureus with the ability to modulate host immune responses. PMID:22035583
Tsume, Yasuhiro; Langguth, Peter; Garcia-Arieta, Alfredo; Amidon, Gordon L.
2012-01-01
The FDA Biopharmaceutical Classification System guidance allows waivers for in vivo bioavailability and bioequivalence studies for immediate-release solid oral dosage forms only for BCS class I. Extensions of the in vivo biowaiver for a number of drugs in BCS Class III and BCS class II have been proposed, particularly, BCS class II weak acids. However, a discrepancy between the in vivo- BE results and in vitro- dissolution results for a BCS class II acids was recently observed. The objectives of this study were to determine the oral absorption of BCS class II weak acids via simulation software and to determine if the in vitro dissolution test with various dissolution media could be sufficient for in vitro bioequivalence studies of ibuprofen and ketoprofen as models of carboxylic acid drugs. The oral absorption of these BCS class II acids from the gastrointestinal tract was predicted by GastroPlus™. Ibuprofen did not satisfy the bioequivalence criteria at lower settings of intestinal pH=6.0. Further the experimental dissolution of ibuprofen tablets in the low concentration phosphate buffer at pH 6.0 (the average buffer capacity 2.2 mmol L-1/pH) was dramatically reduced compared to the dissolution in SIF (the average buffer capacity 12.6 mmol L -1/pH). Thus these predictions for oral absorption of BCS class II acids indicate that the absorption patterns largely depend on the intestinal pH and buffer strength and must be carefully considered for a bioequivalence test. Simulation software may be very useful tool to aid the selection of dissolution media that may be useful in setting an in vitro bioequivalence dissolution standard. PMID:22815122
L. D. Varbanets; О. V. Matselyukh; N. А. Nidyalkova; Е. V. Аvdiyuk; А. V. Gudzenko; I. I. Seifullina; G. N. Маsаnоvets; N. V. Khitrich
2013-01-01
Chloride, bromide and isothiocyanate complexes of cobalt(II) with N-substituted thiocarbamoyl-N?-pentamethylenesulfenamides (1)–(12), and also complexes of cobalt(II, Ш) with derivatives of morpholine-4-carbodithioic acid (13)–(18) have been used as modificators of enzymes of hydrolytic action — Bacillus thurin-giensis ІМВ В-7324 peptidases, Bacillus subtilis 147 and Aspergillus flavus var. oryzae 80428 amylases, Eupenicillium erubescens 248 and Cryptococcus albidus 1001 rhamnosidases. It was...
African Journals Online (AJOL)
activities of Schiff base tin (II) complexes. Neelofar1 ... Conclusion: All synthesized Schiff bases and their Tin (II) complexes showed high antimicrobial and ...... Singh HL. Synthesis and characterization of tin (II) complexes of fluorinated Schiff bases derived from amino acids. Spectrochim Acta Part A: Molec Biomolec.
Isolation and Characterization of D-Myo-Inositol-3-Phosphate Synthase Gene Family Members in Soybean
Good, Laura Lee
2001-01-01
The objective of this research was to isolate genes encoding isoforms of the enzyme D-myo-inositol 3-phosphate synthase (MIPS, E.C. 5.5.1.4) from soybean and to characterize their expression, especially with respect to their involvement in phytic acid biosynthesis. A MIPS-homologous cDNA, designated GmMIPS1, was isolated via PCR using total RNA from developing seeds. Southern blot analysis and examination of MIPS-homologous soybean EST sequences suggested that GmMIPS1 is part of a multigene...
DEFF Research Database (Denmark)
Yang, Ting; Gao, Liping; Hu, Hao
2014-01-01
Chrysanthemyl diphosphate synthase (CDS) is the first path-way-specific enzyme in the biosynthesis of pyrethrins, the most widely used plant-derived pesticide. CDS catalyzes c1′-2-3 cyclopropanation reactions of two molecules of dimethylallyl diphosphate (DMAPP) to yield chrysanthemyl diphosphate...
Sydor, Tobias; von Bargen, Kristine; Hsu, Fong-Fu; Huth, Gitta; Holst, Otto; Wohlmann, Jens; Becken, Ulrike; Dykstra, Tobias; Söhl, Kristina; Lindner, Buko; Prescott, John F; Schaible, Ulrich E; Utermöhlen, Olaf; Haas, Albert
2013-03-01
Rhodococcus equi is a close relative of Mycobacterium spp. and a facultative intracellular pathogen which arrests phagosome maturation in macrophages before the late endocytic stage. We have screened a transposon mutant library of R. equi for mutants with decreased capability to prevent phagolysosome formation. This screen yielded a mutant in the gene for β-ketoacyl-(acyl carrier protein)-synthase A (KasA), a key enzyme of the long-chain mycolic acid synthesizing FAS-II system. The longest kasA mutant mycolic acid chains were 10 carbon units shorter than those of wild-type bacteria. Coating of non-pathogenic E. coli with purified wild-type trehalose dimycolate reduced phagolysosome formation substantially which was not the case with shorter kasA mutant-derived trehalose dimycolate. The mutant was moderately attenuated in macrophages and in a mouse infection model, but was fully cytotoxic.Whereas loss of KasA is lethal in mycobacteria, R. equi kasA mutant multiplication in broth was normal proving that long-chain mycolic acid compounds are not necessarily required for cellular integrity and viability of the bacteria that typically produce them. This study demonstrates a central role of mycolic acid chain length in diversion of trafficking by R. equi. © 2012 Blackwell Publishing Ltd.
Wang, Huicong; Ma, Fangfang; Cheng, Lailiang
2010-07-01
Metabolite profiles and activities of key enzymes in the metabolism of organic acids, nitrogen and amino acids were compared between chlorotic leaves and normal leaves of 'Honeycrisp' apple to understand how accumulation of non-structural carbohydrates affects the metabolism of organic acids, nitrogen and amino acids. Excessive accumulation of non-structural carbohydrates and much lower CO(2) assimilation were found in chlorotic leaves than in normal leaves, confirming feedback inhibition of photosynthesis in chlorotic leaves. Dark respiration and activities of several key enzymes in glycolysis and tricarboxylic acid (TCA) cycle, ATP-phosphofructokinase, pyruvate kinase, citrate synthase, aconitase and isocitrate dehydrogenase were significantly higher in chlorotic leaves than in normal leaves. However, concentrations of most organic acids including phosphoenolpyruvate (PEP), pyruvate, oxaloacetate, 2-oxoglutarate, malate and fumarate, and activities of key enzymes involved in the anapleurotic pathway including PEP carboxylase, NAD-malate dehydrogenase and NAD-malic enzyme were significantly lower in chlorotic leaves than in normal leaves. Concentrations of soluble proteins and most free amino acids were significantly lower in chlorotic leaves than in normal leaves. Activities of key enzymes in nitrogen assimilation and amino acid synthesis, including nitrate reductase, glutamine synthetase, ferredoxin and NADH-dependent glutamate synthase, and glutamate pyruvate transaminase were significantly lower in chlorotic leaves than in normal leaves. It was concluded that, in response to excessive accumulation of non-structural carbohydrates, glycolysis and TCA cycle were up-regulated to "consume" the excess carbon available, whereas the anapleurotic pathway, nitrogen assimilation and amino acid synthesis were down-regulated to reduce the overall rate of amino acid and protein synthesis.
Sorochinsky, Alexander E; Aceña, José Luis; Moriwaki, Hiroki; Sato, Tatsunori; Soloshonok, Vadim
2013-11-01
This review provides a comprehensive treatment of literature data dealing with asymmetric synthesis of α-amino-β-hydroxy and α,β-diamino acids via homologation of chiral Ni(II) complexes of glycine Schiff bases using aldol and Mannich-type reactions. These reactions proceed with synthetically useful chemical yields and thermodynamically controlled stereoselectivity and allow direct introduction of two stereogenic centers in a single operation with predictable stereochemical outcome. Furthermore, new application of Ni(II) complexes of α-amino acids Schiff bases for deracemization of racemic α-amino acids and (S) to (R) interconversion providing additional synthetic opportunities for preparation of enantiomerically pure α-amino acids, is also reviewed. Origin of observed diastereo-/enantioselectivity in the aldol, Mannich-type and deracemization reactions, generality and limitations of these methodologies are critically discussed.
Enzymatic regulation of organic acid metabolism in an alkali-tolerant ...
African Journals Online (AJOL)
Tuoyo Aghomotsegin
2016-10-05
Oct 5, 2016 ... seedlings of C. virgata were treated with varying salt and alkali stress. First, the composition and .... mechanisms of organic acid accumulation in C. virgata ..... dehydrogenase and ferredoxin-dependent glutamate synthase in.
Directory of Open Access Journals (Sweden)
L. D. Varbanets
2013-02-01
Full Text Available Chloride, bromide and isothiocyanate complexes of cobalt(II with N-substituted thiocarbamoyl-N?-pentamethylenesulfenamides (1–(12, and also complexes of cobalt(II, Ш with derivatives of morpholine-4-carbodithioic acid (13–(18 have been used as modificators of enzymes of hydrolytic action — Bacillus thurin-giensis ІМВ В-7324 peptidases, Bacillus subtilis 147 and Aspergillus flavus var. oryzae 80428 amylases, Eupenicillium erubescens 248 and Cryptococcus albidus 1001 rhamnosidases. It was shown that cobalt (II, Ш compounds influence differently on the activity of enzymes tested, exerted both inhibitory and stimulatory action. It gives a possibility to expect that manifestation of activity by complex molecule depends on ligand and anion presence — Cl–, Br– or NCS–. The high activating action of cobalt(II complexes with N-substituted thiocarbamoyl-N?-pentamethylenesulphenamides (1–(12 on elastase and fibrinolytic activity of peptidases compared to tris(4-morpholinecarbodithioatocobalt(ІІІ (14 and products of its interaction with halogens (15–(17, causes inhibitory effect that is probably due to presence of a weekly S–N link, which is easy subjected to homolytic breaking. The studies of influences of cobalt(II complexes on activity of C. аlbidus and E. еrubescens ?-Lrhamnosidases showed, that majority of compounds inhibits of its activity, at that the most inhibitory effect exerts to C. аlbidus enzyme.To sum up, it is possible to state that character of influence of cobalt(II complexes with N-substituted thiocarbamoyl-N?-pentamethylenesulphenamides, and also cobalt(II, Ш complexes with derivatives of morpholine-4-carbodithioic acid varies depending on both strain producer and enzyme tested. The difference in complex effects on enzymes tested are due to peculiarities of building and functional groups of their active centers, which are also responsible for binding with modificators.
Evaluation of Fe(II) oxidation at an acid mine drainage site using laboratory-scale reactors
Brown, Juliana; Burgos, William
2010-05-01
Acid mine drainage (AMD) is a severe environmental threat to the Appalachian region of the Eastern United States. The Susquehanna and Potomac River basins of Pennsylvania drain to the Chesapeake Bay, which is heavily polluted by acidity and metals from AMD. This study attempted to unravel the complex relationships between AMD geochemistry, microbial communities, hydrodynamic conditions, and the mineral precipitates for low-pH Fe mounds formed downstream of deep mine discharges, such as Lower Red Eyes in Somerset County, PA, USA. This site is contaminated with high concentrations of Fe (550 mg/L), Mn (115 mg/L), and other trace metals. At the site 95% of dissolved Fe(II) and 56% of total dissolved Fe is removed without treatment, across the mound, but there is no change in the concentration of trace metals. Fe(III) oxides were collected across the Red Eyes Fe mound and precipitates were analyzed by X-ray diffraction, electron microscopy and elemental analysis. Schwertmannite was the dominant mineral phase with traces of goethite. The precipitates also contained minor amounts of Al2O3, MgO,and P2O5. Laboratory flow-through reactors were constructed to quantify Fe(II) oxidation and Fe removal over time at terrace and pool depositional facies. Conditions such as residence time, number of reactors in sequence and water column height were varied to determine optimal conditions for Fe removal. Reactors with sediments collected from an upstream terrace oxidized more than 50% of dissolved Fe(II) at a ten hour residence time, while upstream pool sediments only oxidized 40% of dissolved Fe(II). Downstream terrace and pool sediments were only capable of oxidizing 25% and 20% of Fe(II), respectively. Fe(II) oxidation rates measured in the reactors were determined to be between 3.99 x 10-8and 1.94 x 10-7mol L-1s-1. The sediments were not as efficient for total dissolved Fe removal and only 25% was removed under optimal conditions. The removal efficiency for all sediments
Sooman, Linda; Wennman, Anneli; Hamberg, Mats; Hoffmann, Inga; Oliw, Ernst H
2016-02-01
The genome of Aspergillus niger codes for a fusion protein (EHA25900), which can be aligned with ~50% sequence identity to 9S-dioxygenase (DOX)-allene oxide synthase (AOS) of Fusarium oxysporum, homologues of the Fusarium and Colletotrichum complexes and with over 62% sequence identity to homologues of Aspergilli, including (DOX)-9R-AOS of Aspergillus terreus. The aims were to characterize the enzymatic activities of EHA25900 and to identify crucial amino acids for the stereospecificity. Recombinant EHA25900 oxidized 18:2n-6 sequentially to 9R-hydroperoxy-10(E),12(Z)-octadecadienoic acid (9R-HPODE) and to a 9R(10)-allene oxide. 9S- and 9R-DOX-AOS catalyze abstraction of the pro-R hydrogen at C-11, but the direction of oxygen insertion differs. A comparison between twelve 9-DOX domains of 9S- and 9R-DOX-AOS revealed conserved amino acid differences, which could contribute to the chirality of products. The Gly616Ile replacement of 9R-DOX-AOS (A. niger) increased the biosynthesis of 9S-HPODE and the 9S(10)-allene oxide, whereas the Phe627Leu replacement led to biosynthesis of 9S-HPODE and the 9S(10)-allene oxide as main products. The double mutant (Gly616Ile, Phe627Leu) formed over 90% of the 9S stereoisomer of HPODE. 9S-HPODE was formed by antarafacial hydrogen abstraction and oxygen insertion, i.e., the original H-abstraction was retained but the product chirality was altered. We conclude that 9R-DOX-AOS can be altered to 9S-DOX-AOS by replacement of two amino acids (Gly616Ile, Phe627Leu) in the DOX domain. Copyright © 2015 Elsevier B.V. All rights reserved.
Glutamic acid as anticancer agent: An overview.
Dutta, Satyajit; Ray, Supratim; Nagarajan, K
2013-10-01
The objective of the article is to highlight various roles of glutamic acid like endogenic anticancer agent, conjugates to anticancer agents, and derivatives of glutamic acid as possible anticancer agents. Besides these emphases are given especially for two endogenous derivatives of glutamic acid such as glutamine and glutamate. Glutamine is a derivative of glutamic acid and is formed in the body from glutamic acid and ammonia in an energy requiring reaction catalyzed by glutamine synthase. It also possesses anticancer activity. So the transportation and metabolism of glutamine are also discussed for better understanding the role of glutamic acid. Glutamates are the carboxylate anions and salts of glutamic acid. Here the roles of various enzymes required for the metabolism of glutamates are also discussed.
Eady, Colin C; Kamoi, Takahiro; Kato, Masahiro; Porter, Noel G; Davis, Sheree; Shaw, Martin; Kamoi, Akiko; Imai, Shinsuke
2008-08-01
Through a single genetic transformation in onion (Allium cepa), a crop recalcitrant to genetic transformation, we suppressed the lachrymatory factor synthase gene using RNA interference silencing in six plants. This reduced lachrymatory synthase activity by up to 1,544-fold, so that when wounded the onions produced significantly reduced levels of tear-inducing lachrymatory factor. We then confirmed, through a novel colorimetric assay, that this silencing had shifted the trans-S-1-propenyl-l-cysteine sulfoxide breakdown pathway so that more 1-propenyl sulfenic acid was converted into di-1-propenyl thiosulfinate. A consequence of this raised thiosulfinate level was a marked increase in the downstream production of a nonenzymatically produced zwiebelane isomer and other volatile sulfur compounds, di-1-propenyl disulfide and 2-mercapto-3,4-dimethyl-2,3-dihydrothiophene, which had previously been reported in trace amounts or had not been detected in onion. The consequences of this dramatic simultaneous down- and up-regulation of secondary sulfur products on the health and flavor attributes of the onion are discussed.
International Nuclear Information System (INIS)
Oladeji, O.
2016-01-01
Ascorbic acid is very important to man and the consumption has been linked to the prevention of degenerative diseases such as scurvy and serves as an antioxidants. There have been different approaches in the determination of ascorbic acid in fruits and vegetable. In recent times, new methods were introduced by scientists. Therefore, in order to prove the authenticity of these methods, the concentrations obtained were compared with the conventional methods. The results show that orange has maximum ascorbic acid content when compared to cashew and in vegetables Vermonia baldwinii has maximum and Solanium incanum has low ascorbic acid content. The amount of ascorbic acid determined by 2, 6-dichlorophenol-indophenol and copper (II) complex (2-bromo-bis-1, 10 phenanthroline-copper (II) bromide) are comparable.Therefore, 2-bromo-bis-1, 10-phenanthroline-copper (II) bromide can serve as a titrant in titrimetric determination of ascorbic acid in pure form, fruits and vegetables. (author)
Triacetic acid lactone production from Saccharomyces cerevisiae
Triacetic acid lactone (TAL) is a potential platform chemical produced from acetyl-CoA and malonyl-CoA by the Gerbera hybrida 2-pyrone synthase (2PS) gene. Studies are ongoing to optimize production, purification, and chemical modification of TAL, which can be used to create the commercial chemicals...
2015-01-01
A Pd(II)/bis-sulfoxide/Brønsted acid catalyzed allylic C–H oxidation reaction for the synthesis of oxazolidinones from simple N-Boc amines is reported. A range of oxazolidinones are furnished in good yields (avg 63%) and excellent diastereoselectivities (avg 15:1) to furnish products regioisomeric from those previously obtained using allylic C–H amination reactions. Mechanistic studies suggest the role of the phosphoric acid is to furnish a Pd(II)bis-sulfoxide phosphate catalyst that promotes allylic C–H cleavage and π-allylPd functionalization with a weak, aprotic oxygen nucleophile and to assist in catalyst regeneration. PMID:24999765
Osberger, Thomas J; White, M Christina
2014-08-06
A Pd(II)/bis-sulfoxide/Brønsted acid catalyzed allylic C-H oxidation reaction for the synthesis of oxazolidinones from simple N-Boc amines is reported. A range of oxazolidinones are furnished in good yields (avg 63%) and excellent diastereoselectivities (avg 15:1) to furnish products regioisomeric from those previously obtained using allylic C-H amination reactions. Mechanistic studies suggest the role of the phosphoric acid is to furnish a Pd(II)bis-sulfoxide phosphate catalyst that promotes allylic C-H cleavage and π-allylPd functionalization with a weak, aprotic oxygen nucleophile and to assist in catalyst regeneration.
Nitric oxide production from macrophages is regulated by arachidonic acid metabolites.
Imai, Y; Kolb, H; Burkart, V
1993-11-30
In activated macrophages the inducible form of the enzyme nitric oxide (NO) synthase generates high amounts of the toxic mediator NO. After 20 h of treatment with LPS rat peritoneal macrophages release 12-16 nmol NO2-/10(5) cells which is detectable in the culture supernatant by the Griess reaction as a measure of NO formation. The addition of aminoguanidine (1 mM), a preferential inhibitor of the inducible NO-synthase, completely abolished NO2-accumulation. Incubation with indomethacin or acetyl-salicylic acid, preferential inhibitors of the cyclooxygenase pathway of the arachidonic acid metabolism, did not influence NO2- levels. Nordihydro-guaiaretic acid (50 microM), a preferential inhibitor of the lipoxygenase pathway, caused strong reduction of NO2- accumulation to 1.9 +/- 0.3 nmol/200 microliter. Simultaneous inhibition of cyclo- and lipoxygenase by BW755c resulted in an intermediate effect (7.3 +/- 1.1 nmol/200 microliter NO2-). These results show that the induction of NO production in activated macrophages is regulated by products of the lipoxygenase-pathway of the arachidonic acid metabolism.
Directory of Open Access Journals (Sweden)
Ehsan Karimi
2012-11-01
Full Text Available The effect of foliar application of salicylic acid (SA at different concentrations (10−3 M and 10−5 M was investigated on the production of secondary metabolites (flavonoids, chalcone synthase (CHS activity, antioxidant activity and anticancer activity (against breast cancer cell lines MCF-7 and MDA-MB-231 in two varieties of Malaysian ginger, namely Halia Bentong and Halia Bara. The results of high performance liquid chromatography (HPLC analysis showed that application of SA induced the synthesis of anthocyanin and fisetin in both varieties. Anthocyanin and fisetin were not detected in the control plants. Accordingly, the concentrations of some flavonoids (rutin and apigenin decreased significantly in plants treated with different concentrations of SA. The present study showed that SA enhanced the chalcone synthase (CHS enzyme activity (involving flavonoid synthesis and recorded the highest activity value of 5.77 nkat /mg protein in Halia Bara with the 10−5 M SA treatment. As the SA concentration was decreased from 10−3 M to 10−5 M, the free radical scavenging power (FRAP increased about 23% in Halia Bentong and 10.6% in Halia Bara. At a concentration of 350 μg mL−1, the DPPH antioxidant activity recorded the highest value of 58.30%–72.90% with the 10−5 M SA treatment followed by the 10−3 M SA (52.14%–63.66% treatment. The lowest value was recorded in the untreated control plants (42.5%–46.7%. These results indicate that SA can act not only as an inducer but also as an inhibitor of secondary metabolites. Meanwhile, the highest anticancer activity against MCF-7 and MDA-MB-231 cell lines was observed for H. Bara extracts treated with 10−5 M SA with values of 61.53 and 59.88%, respectively. The results suggest that the high anticancer activity in these varieties may be related to the high concentration of potent anticancer components including fisetin and anthocyanin. The results thus indicate that the synthesis of
Chromosomal localization of the human and mouse hyaluronan synthase genes
Energy Technology Data Exchange (ETDEWEB)
Spicer, A.P.; McDonald, J.A. [Mayo Clinic Scottsdale, AZ (United States); Seldin, M.F. [Univ. of California Davis, CA (United States)] [and others
1997-05-01
We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.
Investigation of irradiated rats DNA in the presence of Cu(II) chelates of amino acids Schiff bases.
Karapetyan, N H; Torosyan, A L; Malakyan, M; Bajinyan, S A; Haroutiunian, S G
2016-01-01
The new synthesized Cu(II) chelates of amino acids Schiff bases were studied as a potential radioprotectors. Male albino rats of Wistar strain were exposed to X-ray whole-body irradiation at 4.8 Gy. This dose caused 30% mortality of the animals (LD30). The survival of animals exposed to radiation after preliminary administration of 10 mg/kg Cu(II)(Nicotinyl-L-Tyrosinate)2 or Cu(II)(Nicotinyl-L-Tryptophanate)2 prior to irradiation was registered about 80 and 100% correspondingly. Using spectrophotometric melting and agarose gel electrophoresis methods, the differences between the DNA isolated from irradiated rats and rats pretreated with Cu(II) chelates were studied. The fragments of DNA with different breaks were revealed in DNA samples isolated from irradiated animals. While, the repair of the DNA structure was observed for animals pretreated with the Cu(II) chelates. The results suggested that pretreatment of the irradiated rats with Cu(II)(Nicotinyl-L-Tyrosinate)2 and Cu(II)(Nicotinyl-L-Tryptophanate)2 compounds improves the liver DNA characteristics.
Prostaglandin H synthase immunoreactivity in human gut. An immunohistochemical study
DEFF Research Database (Denmark)
Mikkelsen, H B; Rumessen, J J; Qvortrup, Klaus
1991-01-01
Prostaglandins exhibit a variety of actions on intestinal smooth muscle depending upon the type, dose and muscle layer studied. As the cellular origin of prostaglandin H (PGH) synthase has not been established with certainty in the human gut wall, we studied the localization of PGH synthase...
Best, Daniel; Burns, David J; Lam, Hon Wai
2015-06-15
A commercially available rhodium(II) complex catalyzes the direct arylation of 5-diazobarbituric acids with arenes, allowing straightforward access to 5-aryl barbituric acids. Free N-H groups are tolerated on the barbituric acid, with no complications arising from N-H insertion processes. This method was applied to the concise synthesis of a potent matrix metalloproteinase (MMP) inhibitor. © 2015 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA. This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.
Yao, Shuheng; Zhang, Jiajun; Shen, Dekui; Xiao, Rui; Gu, Sai; Zhao, Ming; Liang, Junyu
2016-02-01
The rice husk based activated carbon (RH-AC) was treated by nitric acid under microwave heating, in order to improve its capability for the removal of heavy metal ions from water. The optimal conditions for the modification of RH-AC (M-RH-AC) were determined by means of orthogonal array experimental design, giving those as the concentration of nitric acid of 8mol/L, modification time of 15min, modification temperature of 130°C and microwave power of 800W. The characteristics of the M-RH-AC and RH-AC were examined by BET, XRD, Raman spectrum, pH titration, zeta potential, Boehm titration and FTIR analysis. The M-RH-AC has lower pore surface area, smaller crystallite, lower pHIEP and more oxygen-containing functional groups than the RH-AC. Removal capacity of Pb(II) ions by the M-RH-AC and RH-AC from water solution was estimated concerning the influence of contact time, pH value, and initial concentration. The equilibrium time of Pb(II) removal was found to be around 90min after modification process. Two kinetic models are adopted to describe the possible Pb(II) adsorption mechanism, finding that the adsorption rate of Pb(II) ions by the M-RH-AC is larger than that of RH-AC. Copyright © 2015 Elsevier Inc. All rights reserved.
Sorption behavior of Sn(II) onto Haro river sand from aqueous acidic solutions
International Nuclear Information System (INIS)
Hasany, S.M.; Khurshid, S.J.
1999-01-01
The sorption behavior of Sn(II) onto Haro river sand has been examined with respect to nature of electrolyte, agitation time, dosage of sorbent and concentration of sorbate. Maximum sorption (95.5%) has been achieved from 0.034M hydrochloric acid solution after equilibrating sorbate (2 x 10 -5 M) and sorbent (50 mg) for 120 minutes at a V/W ratio of 90 cm 3 x g -1 . The kinetic data have been subjected to Morris-Weber and Lagergren equations. The kinetics of sorption proceeds a two stage process consisting of a relatively slow initial uptake followed by a much rapid increase in the sorption. The rate constant of intraparticle transport, K d , comes out to be 8.75 x 10 -8 mol x g -1 x min -1/2 and the first order rate constant for sorption is 0.0416 min -1 . The sorption data of Sn(II) onto Haro river sand followed Langmuir, Freundlich and Dubinin-Radushkevich (D-R) type isotherms. The Langmuir constant, Q, related to sorption capacity and, b, related to sorption energy are computed to be 10.6±1.1 μmol x g -1 and 1123±137 dm 3 x mol -1 , respectively. The D-R isotherm yields the values of C m = 348±151 μmol x g -1 and β = -0.01044±0.0008 mol 2 x kJ -2 and of E = 6.9±0.3 kJ x mol -1 . In all three isotherms correlation factor (γ) is ≥ 0.99. The influence of common anions and cations on the sorption has been investigated. Zn(II), Mg(II), oxalate, Pb(II), Mn(II) and tartrate reduce the sorption significantly whereas Fe(II) causes substantial increase in the sorption. (author)
Energy Technology Data Exchange (ETDEWEB)
Li, X.Y. [Shanghai Institute of Optics and Fine Mechanics, Chinese Academy of Sciences, Shanghai 201800 (China)], E-mail: xyli@siom.ac.cn; Wu, Y.Q. [Shanghai Institute of Optics and Fine Mechanics, Chinese Academy of Sciences, Shanghai 201800 (China); Key Lab of Functional Inorganic Material Chemistry (Heilongjiang University), Ministry of Education, Haerbin 150080 (China)], E-mail: yqwu@siom.ac.cn; Gu, D.D.; Gan, F.X. [Shanghai Institute of Optics and Fine Mechanics, Chinese Academy of Sciences, Shanghai 201800 (China)
2009-02-25
Smooth thin films of nickel(II), cobalt(II) and zinc(II) complexes with azo barbituric acid were prepared by the spin-coating method. Absorption spectra of the thin films on K9 glass substrates in 300-700 nm wavelength region were measured. Optical constants (complex refractive index N = n + ik) of the thin films prepared on single-crystal silicon substrates in 275-695 nm wavelength region were investigated on rotating analyzer-polarizer type of scanning ellipsometer, and dielectric constant {epsilon} ({epsilon} = {epsilon}{sub 1} + i{epsilon}{sub 2}) as well as absorption coefficient {alpha} of thin films were calculated at 405 nm. In addition, static optical recording properties of the cobalt(II) complex thin film with an Ag reflective layer was carried out using a 406.7 nm blue-violet laser and a high numerical aperture (NA) of 0.90. Clear recording marks with high reflectivity contrast (>60%) at proper laser power and pulse width were obtained, and the size of recording mark was as small as 250 nm. The results indicate that these metal(II) complexes are promising organic recording medium for the blu-ray optical storage system.
International Nuclear Information System (INIS)
Miziorko, H.M.; Behnke, C.E.
1985-01-01
3-Chloropropionyl coenzyme A (3-chloropropionyl-CoA) irreversibly inhibits avian liver 3-hydroxy-3-methylglutaryl-CoA synthase (HMG-CoA synthase). Enzyme inactivation follows pseudo-first-order kinetics and is retarded in the presence of substrates, suggesting that covalent labeling occurs at the active site. A typical rate saturation effect is observed when inactivation kinetics are measured as a function of 3-chloropropionyl-CoA concentration. These data indicate a Ki = 15 microM for the inhibitor and a limiting kinact = 0.31 min-1. [1- 14 C]-3-Chloropropionyl-CoA binds covalently to the enzyme with a stoichiometry (0.7 per site) similar to that measured for acetylation of the enzyme by acetyl-CoA. While the acetylated enzyme formed upon incubation of HMG-CoA synthase with acetyl-CoA is labile to performic acid oxidation, the adduct formed upon 3-chloropropionyl-CoA inactivation is stable to such treatment. Therefore, such an adduct cannot solely involve a thio ester linkage. Exhaustive Pronase digestion of [ 14 C]-3-chloropropionyl-CoA-labeled enzyme produces a radioactive compound which cochromatographs with authentic carboxyethylcysteine using reverse-phase/ion-pairing high-pressure liquid chromatography and both silica and cellulose thin-layer chromatography systems. This suggests that enzyme inactivation is due to alkylation of an active-site cysteine residue
Directory of Open Access Journals (Sweden)
Broglie Karen E
2008-09-01
Full Text Available Abstract Background Starch is of great importance to humans as a food and biomaterial, and the amount and structure of starch made in plants is determined in part by starch synthase (SS activity. Five SS isoforms, SSI, II, III, IV and Granule Bound SSI, have been identified, each with a unique catalytic role in starch synthesis. The basic mode of action of SSs is known; however our knowledge of several aspects of SS enzymology at the structural and mechanistic level is incomplete. To gain a better understanding of the differences in SS sequences that underscore their specificity, the previously uncharacterised SSIVb from wheat was cloned and extensive bioinformatics analyses of this and other SSs sequences were done. Results The wheat SSIV cDNA is most similar to rice SSIVb with which it shows synteny and shares a similar exon-intron arrangement. The wheat SSIVb gene was preferentially expressed in leaf and was not regulated by a circadian clock. Phylogenetic analysis showed that in plants, SSIV is closely related to SSIII, while SSI, SSII and Granule Bound SSI clustered together and distinctions between the two groups can be made at the genetic level and included chromosomal location and intron conservation. Further, identified differences at the amino acid level in their glycosyltransferase domains, predicted secondary structures, global conformations and conserved residues might be indicative of intragroup functional associations. Conclusion Based on bioinformatics analysis of the catalytic region of 36 SSs and 3 glycogen synthases (GSs, it is suggested that the valine residue in the highly conserved K-X-G-G-L motif in SSIII and SSIV may be a determining feature of primer specificity of these SSs as compared to GBSSI, SSI and SSII. In GBSSI, the Ile485 residue may partially explain that enzyme's unique catalytic features. The flexible 380s Loop in the starch catalytic domain may be important in defining the specificity of action for each
Podstolski, Andrzej; Havkin-Frenkel, Daphna; Malinowski, Jacek; Blount, Jack W; Kourteva, Galina; Dixon, Richard A
2002-11-01
Tissue cultures of the vanilla orchid, Vanilla planifolia, produce the flavor compound vanillin (4-hydroxy-3-methoxybenzaldehyde) and vanillin precursors such as 4-hydroxybenzaldehyde. A constitutively expressed enzyme activity catalyzing chain shortening of a hydroxycinnamic acid, believed to be the first reaction specific for formation of vanilla flavor compounds, was identified in these cultures. The enzyme converts 4-coumaric acid non-oxidatively to 4-hydroxybenzaldehyde in the presence of a thiol reagent but with no co-factor requirement. Several forms of this 4-hydroxybenzaldehyde synthase (4HBS) were resolved and partially purified by a combination of hydrophobic interaction, ion exchange and gel filtration chromatography. These forms appear to be interconvertible. The unusual properties of the 4HBS, and its appearance in different protein fractions, raise questions as to its physiological role in vanillin biosynthesis in vivo.
Ma, Ming; Kwong, Thomas; Lim, Si-Kyu; Ju, Jianhua; Lohman, Jeremy R.; Shen, Ben
2013-01-01
The iso-migrastatin (iso-MGS) biosynthetic gene cluster from Streptomyces platensis NRRL 18993 consists of 11 genes, featuring an acyltransferase (AT)-less type I polyketide synthase (PKS) and three tailoring enzymes MgsIJK. Systematic inactivation of mgsIJK in S. platensis enabled us to (i) identify two nascent products (10 and 13) of the iso-MGS AT-less type I PKS, establishing an unprecedented novel feature for AT-less type I PKSs, and (ii) account for the formation of all known post-PKS biosynthetic intermediates (10-17) generated by the three tailoring enzymes MgsIJK, which possessed significant substrate promiscuities. PMID:23394593
Energy Technology Data Exchange (ETDEWEB)
Sasaki, I.; Gaudemer, A.; Chiaroni, A.; Riche, C.
1986-02-17
Schiff bases have been prepared from 5-formylbarbituric acid and 5-formyl-1,3-dimethyl-barbituric acid and various di- or tri-amines. The structure of the corresponding copper(II) complexes have been established by elemental analysis and spectroscopic methods. The molecular structure of one of the complexes, Cu(DiMeBardpt), was determined by X-ray diffraction. Electrochemical study shows that these complexes are reduced at slightly more negative potentials than the corresponding complexes obtained from uracil, which suggests that these new ligands are better electron-donors.
Directory of Open Access Journals (Sweden)
Nacer Ferrah
2013-01-01
Full Text Available A new chelating polymeric sorbent has been developed using polystyrene resin grafted with phosphonic acid. After characterization by FTIR and elementary analysis, the new resin has been investigated in liquid-solid extraction of cadmium(II. The results indicated that phosphonic resin could adsorb Cd(II ion effectively from aqueous solution. The adsorption was strongly dependent on the pH of the medium and the optimum pH value level for better sorption was between 3.2 and 5.2. The influence of other analytical parameters including contact time, amount of resin, metal ion concentration, and the presence of some electrolytes was investigated. The maximum uptake capacity of Cd(II ions was 37,9 mg·g−1 grafted resin at ambient temperature, at an initial pH value of 5.0. The overall adsorption process was best described by pseudo second-order kinetic. When Freundlich and Langmuir isotherms were tested, the latter had a better fit with the experimental data. Furthermore, more than 92% of Cd(II could be eluted by using 1.0 mol·L−1 HCl in one cycle.
Seasonal influence on gene expression of monoterpene synthases in Salvia officinalis (Lamiaceae).
Grausgruber-Gröger, Sabine; Schmiderer, Corinna; Steinborn, Ralf; Novak, Johannes
2012-03-01
Garden sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants and possesses antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, formed mainly in very young leaves, is in part responsible for these activities. It is mainly composed of the monoterpenes 1,8-cineole, α- and β-thujone and camphor synthesized by the 1,8-cineole synthase, the (+)-sabinene synthase and the (+)-bornyl diphosphate synthase, respectively, and is produced and stored in epidermal glands. In this study, the seasonal influence on the formation of the main monoterpenes in young, still expanding leaves of field-grown sage plants was studied in two cultivars at the level of mRNA expression, analyzed by qRT-PCR, and at the level of end-products, analyzed by gas chromatography. All monoterpene synthases and monoterpenes were significantly influenced by cultivar and season. 1,8-Cineole synthase and its end product 1,8-cineole remained constant until August and then decreased slightly. The thujones increased steadily during the vegetative period. The transcript level of their corresponding terpene synthase, however, showed its maximum in the middle of the vegetative period and declined afterwards. Camphor remained constant until August and then declined, exactly correlated with the mRNA level of the corresponding terpene synthase. In summary, terpene synthase mRNA expression and respective end product levels were concordant in the case of 1,8-cineole (r=0.51 and 0.67 for the two cultivars, respectively; p<0.05) and camphor (r=0.75 and 0.82; p<0.05) indicating basically transcriptional control, but discordant for α-/β-thujone (r=-0.05 and 0.42; p=0.87 and 0.13, respectively). Copyright © 2011 Elsevier GmbH. All rights reserved.
Journal of Biosciences | Indian Academy of Sciences
Indian Academy of Sciences (India)
The cultivated peanut is a valuable source of dietary oil and ranks fifth among the world oil crops. Plant fatty acid biosynthesis is catalysed by type II fatty acid synthase (FAS) in plastids and mitochondria. By constructing a full-length cDNA library derived from immature peanut seeds and homology-based cloning, candidate ...
Mohamed, Gehad G.; Nour El-Dien, F. A.; El-Nahas, R. G.
2011-10-01
The dopamine derivatives participate in the regulation of wide variety of physiological functions in the human body and in medication life. Increase and/or decrease in the concentration of dopamine in human body reflect an indication for diseases such as Schizophrenia and/or Parkinson diseases. The Cu(II) chelates with coupled products of dopamine hydrochloride (DO.HCl) and vanillymandelic acid (VMA) with 4-aminoantipyrine (4-AAP) are prepared and characterized. Different physico-chemical techniques namely IR, magnetic and UV-vis spectra are used to investigate the structure of these chelates. Cu(II) forms 1:1 (Cu:DO) and 1:2 (Cu:VMA) chelates. DO behave as a uninegative tridentate ligand in binding to the Cu(II) ion while VMA behaves as a uninegative bidentate ligand. IR spectra show that the DO is coordinated to the Cu(II) ion in a tridentate manner with ONO donor sites of the phenolic- OH, -NH and carbonyl- O, while VMA is coordinated with OO donor sites of the phenolic- OH and -NH. Magnetic moment measurements reveal the presence of Cu(II) chelates in octahedral and square planar geometries with DO and VMA, respectively. The thermal decomposition of Cu(II) complexes is studied using thermogravimetric (TG) and differential thermal analysis (DTA) techniques. The activation thermodynamic parameters, such as, energy of activation, enthalpy, entropy and free energy change of the complexes are evaluated and the relative thermal stability of the complexes are discussed.
Pd(II)-Catalyzed Hydroxyl-Directed C–H Olefination Enabled by Mono-Protected Amino Acid Ligands
Lu, Yi; Wang, Dong-Hui; Engle, Keary M.
2010-01-01
A novel Pd(II)-catalyzed ortho-C–H olefination protocol has been developed using spatially remote, unprotected tertiary, secondary, and primary alcohols as the directing groups. Mono-N-protected amino acid ligands were found to promote the reaction, and an array of olefin coupling partners could be used. When electron-deficient alkenes were used, the resulting olefinated intermediates underwent subsequent Pd(II)-catalyzed oxidative intramolecular cyclization to give the corresponding pyran products, which could be converted into ortho-alkylated alcohols under hydrogenolysis conditions. The mechanistic details of the oxidative cyclization step are discussed and situated in the context of the overall catalytic cycle. PMID:20359184
Dana, Suman; Mandal, Anup; Sahoo, Harekrishna; Mallik, Sumitava; Grandhi, Gowri Sankar; Baidya, Mahiuddin
2018-02-02
A straightforward synthesis of 2-styrylbenzoic acids from aryl carboxylic acids is disclosed through a carboxylate-assisted coupling under Ru(II) catalysis. This protocol is simple and exhibits broad scope with high tolerance of common organic functional groups, providing good to excellent yields of diverse olefinated products. The efficacy of this protocol has been showcased through sequential syntheses of isochromanone, isocoumarin, and formal synthesis of anacardic acid derivative in good yields.
Directory of Open Access Journals (Sweden)
José Javier Otero
2011-01-01
Full Text Available G2 → M transition is a strategic target for glioma chemotherapy. Key players in G2 → M transition include CDC2 and glycogen synthase kinase 3β (GSK3β, which are highly regulated by posttranslational phosphorylation. This report is a morphological analysis of CDC2 and GSK3β phosphorylation using immunohistochemistry in gliomas with different biological properties. GBM showed a 2.8-fold and 5.6-fold increase in number of cells positive for pThr161CDC2 and a 4.2- and 6.9-fold increase in number of cells positive for pTyr15CDC2 relative to oligodendroglioma and ependymoma, respectively. Elevated labeling for inhibited phospho-CDC2 (pTyr15CDC correlates with elevated levels of phosphorylated glycogen synthase kinase 3β (GSK3β. 71% of the GBM cases showed intermediate to high intensity staining for pSer9SGK3β 53% of oligodendroglioma, and 73% of ependymoma showed low intensity staining. CDC2 gene amplification correlates with increased survival in glioblastoma multiforme (GBM and astrocytoma WHO grades II-III, but not in oligodendroglioma WHO grades II-III.
International Nuclear Information System (INIS)
Wu, K.K.; Sanduja, R.; Tsai, A.L.; Ferhanoglu, B.; Loose-Mitchell, D.S.
1991-01-01
Prostaglandin H (PGH) synthase is a key enzyme in the biosynthesis of prostaglandins, thromboxane, and prostacyclin. In cultured human umbilical vein endothelial cells, interleukin 1 (IL-1) is known to induce the synthesis of this enzyme, thereby raising the level of PGH synthase protein severalfold over the basal level. Pretreatment with aspirin at low concentrations inhibited more than 60% of the enzyme mass and also the cyclooxygenase activity in IL-1-induced cells with only minimal effects on the basal level of the synthase enzyme in cells without IL-1. Sodium salicylate exhibited a similar inhibitory action whereas indomethacin had no apparent effect. Similarly low levels of aspirin inhibited the increased L-[ 35 S]methionine incorporation into PGH synthase that was induced by IL0-1 and also suppressed expression of the 2.7-kilobase PGH synthase mRNA. These results suggest that in cultured endothelial cells a potent inhibition of eicosanoid biosynthetic capacity can be effected by aspirin or salicylate at the level of PGH synthase gene expression. The aspirin effect may well be due to degradation of salicylate
Ober, Dietrich; Hartmann, Thomas
1999-01-01
Pyrrolizidine alkaloids are preformed plant defense compounds with sporadic phylogenetic distribution. They are thought to have evolved in response to the selective pressure of herbivory. The first pathway-specific intermediate of these alkaloids is the rare polyamine homospermidine, which is synthesized by homospermidine synthase (HSS). The HSS gene from Senecio vernalis was cloned and shown to be derived from the deoxyhypusine synthase (DHS) gene, which is highly conserved among all eukaryotes and archaebacteria. DHS catalyzes the first step in the activation of translation initiation factor 5A (eIF5A), which is essential for eukaryotic cell proliferation and which acts as a cofactor of the HIV-1 Rev regulatory protein. Sequence comparison provides direct evidence for the evolutionary recruitment of an essential gene of primary metabolism (DHS) for the origin of the committing step (HSS) in the biosynthesis of pyrrolizidine alkaloids. PMID:10611289
Kurhaliuk, N M; Ikkert, O V; Vovkanych, L S; Horyn', O V; Hal'kiv, M O; Hordiĭ, S K
2001-01-01
The effect of L-arginine and blockator of nitric oxide synthase L-NNA on processes of calcium mitochondrial capacity in liver with different resistance to hypoxia in the experiments with Wistar rats has been studied using the followrng substrates of energy support: succinic, alpha-ketoglutaric acids, alpha-ketolutarate and inhibitor succinatedehydrogenase malonate. As well we used substrates mixtures combination providing for activation of aminotransferase mechanism: glutamate and piruvate, glutamate and malate. It has been shown that L-arginine injection increases calcium mitochondrial capacity of low resistant rats using as substrates the succinate and alpha-ketoglutarate to control meanings of high resistance rats. Effects of donors nitric oxide on this processes limit NO-synthase inhibitor L-NNA.
Structure of the dimeric form of CTP synthase from Sulfolobus solfataricus
DEFF Research Database (Denmark)
Lauritsen, Iben; Willemoës, Martin; Jensen, Kaj Frank
2011-01-01
CTP synthase catalyzes the last committed step in de novo pyrimidine-nucleotide biosynthesis. Active CTP synthase is a tetrameric enzyme composed of a dimer of dimers. The tetramer is favoured in the presence of the substrate nucleotides ATP and UTP; when saturated with nucleotide, the tetramer...... completely dominates the oligomeric state of the enzyme. Furthermore, phosphorylation has been shown to regulate the oligomeric states of the enzymes from yeast and human. The crystal structure of a dimeric form of CTP synthase from Sulfolobus solfataricus has been determined at 2.5 Å resolution...
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
Belokon, Yuri N.; Bespalova, Natalia B.; Churkina, Tatiana D.; Císařová, Ivana; Ezernitskaya, Marina G.; Harutyunyan, Syuzanna R.; Hrdina, Radim; Kagan, Henri B.; Kočovský, Pavel; Kochetkov, Konstantin A.; Larionov, Oleg V.; Lyssenko, Konstantin A.; North, Michael; Polášek, Miroslav; Peregudov, Alexander S.; Prisyazhnyuk, Vladimir V.; Vyskočil, Štěpán
2003-01-01
Achiral, diamagnetic Ni(II) complexes 1 and 3 have been synthesized from Ni(II) salts and the Schiff bases, generated from glycine and PBP and PBA, respectively, in MeONa/MeOH solutions. The requisite carbonyl-derivatizing agents pyridine-2-carboxylic acid(2-benzoyl-phenyl)-amide (PBP) and
Citric acid production and citrate synthase genes in distinct strains of ...
African Journals Online (AJOL)
Citric acid is an important organic acid, multifunctional with a wide array of uses. The objectives of this study were the isolation and selection strains of the genus Aspergillus, investigating the solubilization of phosphate of these isolates, verifying the expression rate of genes involved in the identification of isolates, and ...
International Nuclear Information System (INIS)
Ökvist, Mats; Sasso, Severin; Roderer, Kathrin; Kast, Peter; Krengel, Ute
2009-01-01
Two shikimate-pathway enzymes from M. tuberculosis, the intracellular chorismate mutase (MtCM) and DAHP synthase (MtDS), were produced recombinantly and purified. MtCM was crystallized alone and in complex with MtDS and analyzed by X-ray diffraction. Chorismate mutase catalyzes a key step in the shikimate-biosynthetic pathway and hence is an essential enzyme in bacteria, plants and fungi. Mycobacterium tuberculosis contains two chorismate mutases, a secreted and an intracellular one, the latter of which (MtCM; Rv0948c; 90 amino-acid residues; 10 kDa) is the subject of this work. Here are reported the gene expression, purification and crystallization of MtCM alone and of its complex with another shikimate-pathway enzyme, DAHP synthase (MtDS; Rv2178c; 472 amino-acid residues; 52 kDa), which has been shown to enhance the catalytic efficiency of MtCM. The MtCM–MtDS complex represents the first noncovalent enzyme complex from the common shikimate pathway to be structurally characterized. Soaking experiments with a transition-state analogue are also reported. The crystals of MtCM and the MtCM–MtDS complex diffracted to 1.6 and 2.1 Å resolution, respectively
International Nuclear Information System (INIS)
Ballesta-Claver, J.; Rodríguez-Gómez, R.; Capitán-Vallvey, L.F.
2013-01-01
Highlights: ► Cathodic ECL offers conventional and non-aggressive analysis conditions. ► The ECL hydrogen peroxide/ruthenium complex system for uric acid determination is novel. ► The ruthenium complex is electrochemically immobilized on graphite screen-printed electrodes. ► The quantification of the uric acid is based on a Stern–Volmer type equation. ► The use of the cathodic ECL working methodology reduces interferences during analysis. -- Abstract: A new method for uric acid (UA) determination based on the quenching of the cathodic ECL of the tris(2,2-bipyridine)ruthenium(II)–uricase system is described. The biosensor is based on a double-layer design containing first tris(2,2-bipyridine)ruthenium(II) (Ru(bpy) 3 2+ ) electrochemically immobilized on graphite screen-printed cells and uricase in chitosan as a second layer. The uric acid biosensing is based on the ECL quenching produced by uric acid over the cathodic ECL caused by immobilized Ru(bpy) 3 2+ in the presence of uricase. The use of a −1.1 V pulse for 1 s with a dwelling time of 10 s makes it possible to estimate the initial enzymatic rate, which is used as the analytical signal. The Stern–Volmer type calibration function shows a dynamic range from 1.0 × 10 −5 to 1.0 × 10 −3 M with a limit of detection of 3.1 × 10 −6 M and an accuracy of 13.6% (1.0 × 10 −4 M, n = 5) as relative standard deviation. Satisfactory results were obtained for urine samples, creating an affordable alternative for uric acid determination
Schröder, J; Raiber, S; Berger, T; Schmidt, A; Schmidt, J; Soares-Sello, A M; Bardshiri, E; Strack, D; Simpson, T J; Veit, M; Schröder, G
1998-06-09
Heterologous screening of a cDNA library from Pinusstrobus seedlings identified clones for two chalcone synthase (CHS) related proteins (PStrCHS1 and PStrCHS2, 87.6% identity). Heterologous expression in Escherichia coli showed that PStrCHS1 performed the typical CHS reaction, that it used starter CoA-esters from the phenylpropanoid pathway, and that it performed three condensation reactions with malonyl-CoA, followed by the ring closure to the chalcone. PstrCHS2 was completely inactive with these starters and also with linear CoA-esters. Activity was detected only with a diketide derivative (N-acetylcysteamine thioester of 3-oxo-5-phenylpent-4-enoic acid) that corresponded to the CHS reaction intermediate postulated after the first condensation reaction. PstrCHS2 performed only one condensation, with 6-styryl-4-hydroxy-2-pyrone derivatives as release products. The enzyme preferred methylmalonyl-CoA against malonyl-CoA, if only methylmalonyl-CoA was available. These properties and a comparison with the CHS from Pinus sylvestris suggested for PstrCHS2 a special function in the biosynthesis of secondary products. In contrast to P. sylvestris, P. strobus contains C-methylated chalcone derivatives, and the methyl group is at the position predicted from a chain extension with methylmalonyl-CoA in the second condensation of the biosynthetic reaction sequence. We propose that PstrCHS2 specifically contributes the condensing reaction with methylmalonyl-CoA to yield a methylated triketide intermediate. We discuss a model that the biosynthesis of C-methylated chalcones represents the simplest example of a modular polyketide synthase.
Substrate promiscuity of a rosmarinic acid synthase from lavender (Lavandula angustifolia L.).
Landmann, Christian; Hücherig, Stefanie; Fink, Barbara; Hoffmann, Thomas; Dittlein, Daniela; Coiner, Heather A; Schwab, Wilfried
2011-08-01
One of the most common types of modification of secondary metabolites is the acylation of oxygen- and nitrogen-containing substrates to produce esters and amides, respectively. Among the known acyltransferases, the members of the plant BAHD family are capable of acylating a wide variety of substrates. Two full-length acyltransferase cDNAs (LaAT1 and 2) were isolated from lavender flowers (Lavandula angustifolia L.) by reverse transcriptase-PCR using degenerate primers based on BAHD sequences. Recombinant LaAT1 exhibited a broad substrate tolerance accepting (hydroxy)cinnamoyl-CoAs as acyl donors and not only tyramine, tryptamine, phenylethylamine and anthranilic acid but also shikimic acid and 4-hydroxyphenyllactic acid as acceptors. Thus, LaLT1 forms esters and amides like its phylogenetic neighbors. In planta LaAT1 might be involved in the biosynthesis of rosmarinic acid, the ester of caffeic acid and 3,4-dihydroxyphenyllactic acid, a major constituent of lavender flowers. LaAT2 is one of three members of clade VI with unknown function.
International Nuclear Information System (INIS)
Saba, A.; Maqsood, Z.T.; Wasim, A.A.; Basha, F.Z.
2017-01-01
In this study novel complexes of substituted bipyridine (4-(4-bromophenyl)-[2,2'-bipyridine]-6-carboxylic acid) with Fe/sup +2/ and Co/sup +2/ were synthesized and characterized by different physical, analytical and spectral techniques which includes /sup 1/ H-NMR, MALDI-MS, FTIR, UV-VIS Spectrophotometry, CHN analysis and conductometry. Mole ratio method revealed that both complexes satisfied ML2 stoichiometry. Other characterization studies showed that substituted bipyridine acted as a tridentate ligand, with two pyridine N and one carboxylic O atom as binding sites per ligand molecule. The complexes were found octahedral, neutral and possessed fairly high molar absorptivities in visible region. Electrochromic studies revealed that Fe (II) complex had relatively good electrochromic properties with a reversible color change from blue to pale yellow. Co (II) complex, however, did not show significant electrochromic properties in the visible region. (author)
Reduced ceramide synthase 2 activity causes progressive myoclonic epilepsy
DEFF Research Database (Denmark)
Mosbech, Mai-Britt; Olsen, Anne S B; Neess, Ditte
2014-01-01
between genes involved in SL metabolism and epilepsy. METHODS: We used quantitative real-time PCR, Western blotting, and enzymatic assays to determine the mRNA, protein, and activity levels of ceramide synthase 2 (CERS2) in fiibroblasts isolated from parental control subjects and from a patient diagnosed...... with progressive myoclonic epilepsy (PME). Mass spectrometry and fluorescence microscopy were used to examine the effects of reduced CERS2 activity on cellular lipid composition and plasma membrane functions. RESULTS: We identify a novel 27 kb heterozygous deletion including the CERS2 gene in a proband diagnosed...... with PME. Compared to parental controls, levels of CERS2 mRNA, protein, and activity were reduced by ˜50% in fibroblasts isolated from this proband, resulting in significantly reduced levels of ceramides and sphingomyelins containing the very long-chain fatty acids C24:0 and C26:0. The change in SL...
Directory of Open Access Journals (Sweden)
Piotr Szymczyk
2016-09-01
Full Text Available The promoter, 5' UTR, and 34-nt 5' fragments of protein encoding region of the Salvia miltiorrhiza copalyl diphosphate synthase gene were cloned and characterized. No tandem repeats, miRNA binding sites, or CpNpG islands were observed in the promoter, 5' UTR, or protein encoding fragments. The entire isolated promoter and 5' UTR is 2235 bp long and contains repetitions of many cis-active elements, recognized by homologous transcription factors, found in Arabidopsis thaliana and other plant species. A pyrimidine-rich fragment with only 6 non-pyrimidine bases was localized in the 33-nt stretch from nt 2185 to 2217 in the 5' UTR. The observed cis-active sequences are potential binding sites for trans-factors that could regulate spatio-temporal CPS gene expression in response to biotic and abiotic stress conditions. Obtained results are initially verified by in silico and co-expression studies based on A. thaliana microarray data. The quantitative RT-PCR analysis confirmed that the entire 2269-bp copalyl diphosphate synthase gene fragment has the promoter activity. Quantitative RT-PCR analysis was used to study changes in CPS promoter activity occurring in response to the application of four selected biotic and abiotic regulatory factors; auxin, gibberellin, salicylic acid, and high-salt concentration.
Lee, Yong Joo; Hoe, Kwang Lae; Maeng, Pil Jae
2007-01-01
In Saccharomyces cerevisiae, the initial reaction of the tricarboxylic acid cycle is catalyzed by the mitochondrial citrate synthase Cit1. The function of Cit1 has previously been studied mainly in terms of acetate utilization and metabolon construction. Here, we report the relationship between the function of Cit1 and apoptosis. Yeast cells with cit1 deletion showed a temperature-sensitive growth phenotype, and they displayed a rapid loss in viability associated with typical apoptotic hallma...
Activation of cyclic GMP-AMP synthase by self-DNA causes autoimmune diseases.
Gao, Daxing; Li, Tuo; Li, Xiao-Dong; Chen, Xiang; Li, Quan-Zhen; Wight-Carter, Mary; Chen, Zhijian J
2015-10-20
TREX1 is an exonuclease that digests DNA in the cytoplasm. Loss-of-function mutations of TREX1 are linked to Aicardi-Goutieres Syndrome (AGS) and systemic lupus erythematosus (SLE) in humans. Trex1(-/-) mice exhibit autoimmune and inflammatory phenotypes that are associated with elevated expression of interferon (IFN)-induced genes (ISGs). Cyclic GMP-AMP (cGAMP) synthase (cGAS) is a cytosolic DNA sensor that activates the IFN pathway. Upon binding to DNA, cGAS is activated to catalyze the synthesis of cGAMP, which functions as a second messenger that binds and activates the adaptor protein STING to induce IFNs and other cytokines. Here we show that genetic ablation of cGas in Trex1(-/-) mice eliminated all detectable pathological and molecular phenotypes, including ISG induction, autoantibody production, aberrant T-cell activation, and lethality. Even deletion of just one allele of cGas largely rescued the phenotypes of Trex1(-/-) mice. Similarly, deletion of cGas in mice lacking DNaseII, a lysosomal enzyme that digests DNA, rescued the lethal autoimmune phenotypes of the DNaseII(-/-) mice. Through quantitative mass spectrometry, we found that cGAMP accumulated in mouse tissues deficient in Trex1 or DNaseII and that this accumulation was dependent on cGAS. These results demonstrate that cGAS activation causes the autoimmune diseases in Trex1(-/-) and DNaseII(-/-) mice and suggest that inhibition of cGAS may lead to prevention and treatment of some human autoimmune diseases caused by self-DNA.
Energy Technology Data Exchange (ETDEWEB)
Myers, G.; Korber, B. [eds.] [Los Alamos National Lab., NM (United States); Wain-Hobson, S. [ed.] [Laboratory of Molecular Retrovirology, Pasteur Inst.; Smith, R.F. [ed.] [Baylor Coll. of Medicine, Houston, TX (United States). Dept. of Pharmacology; Pavlakis, G.N. [ed.] [National Cancer Inst., Frederick, MD (United States). Cancer Research Facility
1993-12-31
This compendium and the accompanying floppy diskettes are the result of an effort to compile and rapidly publish all relevant molecular data concerning the human immunodeficiency viruses (HIV) and related retroviruses. The scope of the compendium and database is best summarized by the five parts that it comprises: (I) HIV and SIV Nucleotide Sequences; (II) Amino Acid Sequences; (III) Analyses; (IV) Related Sequences; and (V) Database Communications. Information within all the parts is updated at least twice in each year, which accounts for the modes of binding and pagination in the compendium.
Sasmal, Dinabandhu; Maity, Jayanta; Kolya, Haradhan; Tripathy, Tridib
2017-04-01
Amylopectin-g-poly (acrylamide-co-acrylic acid) [AP-g-poly (AM-co-AA)] was synthesised in water medium by using potassium perdisulphate as an initiator. The graft copolymer was characterized by molecular weight determination by size exclusion chromatography (SEC), fourier transform infrared spectroscopy (FTIR) and nuclear magnetic resonance (NMR) spectroscopy, scanning electron microscope (SEM) studies, thermal analysis, measurement of neutralisation equivalent and biodegradation studies. The graft copolymer was used for Pb (II) ion removal from aqueous solution. The Pb (II) ion removal capacity of the graft copolymer was also compared with another laboratory developed graft copolymer Amylopectin-g-poly (acrylamide) (AP-g-PAM). Both the graft copolymers were also used for the competitive metal ions removal with Pb (II)/Cd (II), Pb (II)/Zn (II), Pb (II)/Ni (II), Pb (II)/Cu (II) pairs separately under similar conditions. AP-g-poly (AM-co-AA) showed better Pb (II) ion adsorbing power over AP-g-PAM and also much selective towards Pb (II) ions. The adsorption follows a second order rate equation and Langmuir isotherm model. Copyright © 2017 Elsevier B.V. All rights reserved.
Su, Kuo-Hui; Tsai, Jin-Yi; Kou, Yu Ru; Chiang, An-Na; Hsiao, Sheng-Huang; Wu, Yuh-Lin; Hou, Hsin-Han; Pan, Ching-Chian; Shyue, Song-Kun; Lee, Tzong-Shyuan
2009-06-01
Valsartan, a selective angiotensin II type 1 receptor (AT1R) blocker, has beneficial effects in the cardiovascular system in part by its increase of nitric oxide (NO) bioavailability, yet the mechanisms are unclear. We investigated the molecular mechanisms underlying this effect in endothelial cells (ECs). NO production was examined by Griess reagent assay, DAF-2 DA fluorescence staining and cGMP ELISA kits. Protein interaction was determined by western blotting and immunoprecipitation. Treating bovine or human aortic ECs with valsartan increased NO production, as evidenced by elevated level of stable NO metabolites and intracellular cGMP. Valsartan increased the phosphorylation but not the protein level of endothelial NO synthase (eNOS). Inhibition of phosphoinositide-3 kinase (PI3K)/Akt and Src pathways by specific inhibitors suppressed valsartan-induced NO release. In addition, valsartan increased the tyrosine residue phosphorylation of AT1R, which was attenuated by inhibition of Src but not PI3K activities. Valsartan also suppressed the interaction of eNOS and AT1R, which was blocked by Src or PI3K inhibition. Valsartan-induced NO production in ECs is mediated through Src/PI3K/Akt-dependent phosphorylation of eNOS. Valsartan-induced AT1R phosphorylation depends on Src but not PI3K, whereas valsartan-induced suppression of AT1R-eNOS interaction depends on Src/PI3K/Akt signalling. These results indicate a novel vasoprotective mechanism of valsartan in upregulating NO production in ECs.
Analytical application of aminohydroxamic acids
International Nuclear Information System (INIS)
Fadl Elmoula, Abd ELfatah Abdella
2000-11-01
Anthranilic hydroxamic acid was prepared by coupling of methylanthranilate (prepared by esterification of anthranilic acid with methyl alcohol using the fisher-speir method) with freshly prepared hydroxylamine. The lignad was characterized by the usual reaction of hydroxamic acid with acidic V(V) and Fe(III) solutions that gives blood-red colour in amyl alcohol and deep-violet colour in aqueous solution, respectively. The absorbance of Fe(III)-hydroxamic acids complexes increases with increase of pH. In this study, the effect of pH on the absorbance of Fe(III)-anthranilic hydroxamic acid was in accordance with this trend. The maximum absorbance was obtained at pH 5.0 at maximum wavelength of 482 nm. For Cu(II)-anthranilic hydroxamic acid complex, the use of acidic basic pH lead to precipitation of Cu(II)-ligand complex. But when using buffer pH (acetic acid/sodium acetate) a clear green colour of Cu(II)-ligand complex was obtained. The maximum wavelength of 390 nm. V(V)-anthranilic hydroxamic acid complex was extracted in acidic medium in amyl alcohol at pH 2.0 because in aqueous solution V(V)-anthranilic hydroxamic acid complex has not clear colour. It was observed the the maximum extraction in acidic medium decrease sharply with the increasing of pH value. The maximum wavelength for maximum absorbance was recorded at 472 nm. V(V) interfered with determination of Fe(III)) above concentration of 2 ppm, whereas Cu(II) interferes slightly with the determination of Fe(III) ions even at a high concentration of the Cu(II) ions. Both Cu(II) and Ni(II) do not interfere with the determination of V(V) ions even at high concentrations, Fe(III) ion produced slight interference, while Mo(VI) ions have a pronounced interference. Both V(V) and Fe(III) ions interfered markedly with the determination of Cu(II) ions, and made impractical under conditions. However, the calibration curves for the three metal ions produced a practical linear dynamic range.(Author)
Nakamura, Yusuke; Taruno, Yoko; Sugimoto, Masashi; Kitamura, Yusuke; Seng, Hoi Ling; Kong, Siew Ming; Ng, Chew Hee; Chikira, Makoto
2013-03-14
The binding site specificity of the ternary complexes, [M(II)(phen)(edda)] (M(II) = Pt(2+) and Zn(2+); phen = 1,10-phenanthroline; edda = N,N'-ethylenediaminediacetic acid), for the self-complementary oligonucleotides (ODNs), ds(C(1)G(2)C(3)G(4)A(5)A(6)T(7)T(8)C(9)G(10)C(11)G(12))(2) (ODN1) and ds(C(1)G(2)C(3)G(4)T(5)A(6)T(7)A(8)C(9)G(10)C(11)G(12))(2) (ODN2), was studied by NMR measurements. The results indicated that [Pt(ii)(phen)(edda)] was partially intercalated between C(3)/G(10) and G(4)/C(9) base pairs of ODN1 and ODN2 in the major grooves, whereas [Zn(II)(phen)(edda)] was bound specifically to the TATA region of ODN2 in the minor groove and to the terminal G(2)/C(11) base pair of ODN1 in the major groove. The preference for the TATA sequence over the AATT sequence in the binding of [Zn(phen)(edda)] was attributed to the wider minor groove width of the TATA sequence. The bindings of the complexes to ct-DNA were also studied by UV, CD, and fluorescence spectroscopy. Additionally, the antiproliferative property of [Pt(II)(phen)(edda)] towards MCF7 breast cancer cells and normal MCF10-A cells was compared with that of [Zn(II)(phen)(edda)].
Santos, Rodrigo L S R; van Eldik, Rudi; de Oliveira Silva, Denise
2012-06-18
The known paddlewheel, tetrakis(acetato)chloridodiruthenium(II,III), offers a versatile synthetic route to a novel class of antitumor diruthenium(II,III) metallo drugs, where the equatorial ligands are nonsteroidal anti-inflammatory carboxylates. This complex was studied here as a soluble starting prototype model for antitumor analogues to elucidate the reactivity of the [Ru(2)(CH(3)COO)(4)](+) framework. Thermodynamic studies on equilibration reactions for axial substitution of water by chloride and kinetic studies on reactions of the diaqua complexes with the amino acids glycine, cysteine, histidine, and tryptophan were performed. The standard thermodynamic reaction parameters ΔH°, ΔS°, and ΔV° were determined and showed that both of the sequential axial substitution reactions are enthalpy driven. Kinetic rate laws and rate constants were determined for the axial substitution reactions of coordinated water by the amino acids that gave the corresponding aqua(amino acid)-Ru(2) substituted species. The results revealed that the [Ru(2)(CH(3)COO)(4)](+) paddlewheel framework remained stable during the axial ligand substitution reactions and was also mostly preserved in the presence of the amino acids.
Keeling, Christopher I.; Dullat, Harpreet K.; Yuen, Mack; Ralph, Steven G.; Jancsik, Sharon; Bohlmann, Jörg
2010-01-01
The biosynthesis of the tetracyclic diterpene ent-kaurene is a critical step in the general (primary) metabolism of gibberellin hormones. ent-Kaurene is formed by a two-step cyclization of geranylgeranyl diphosphate via the intermediate ent-copalyl diphosphate. In a lower land plant, the moss Physcomitrella patens, a single bifunctional diterpene synthase (diTPS) catalyzes both steps. In contrast, in angiosperms, the two consecutive cyclizations are catalyzed by two distinct monofunctional enzymes, ent-copalyl diphosphate synthase (CPS) and ent-kaurene synthase (KS). The enzyme, or enzymes, responsible for ent-kaurene biosynthesis in gymnosperms has been elusive. However, several bifunctional diTPS of specialized (secondary) metabolism have previously been characterized in gymnosperms, and all known diTPSs for resin acid biosynthesis in conifers are bifunctional. To further understand the evolution of ent-kaurene biosynthesis as well as the evolution of general and specialized diterpenoid metabolisms in gymnosperms, we set out to determine whether conifers use a single bifunctional diTPS or two monofunctional diTPSs in the ent-kaurene pathway. Using a combination of expressed sequence tag, full-length cDNA, genomic DNA, and targeted bacterial artificial chromosome sequencing, we identified two candidate CPS and KS genes from white spruce (Picea glauca) and their orthologs in Sitka spruce (Picea sitchensis). Functional characterization of the recombinant enzymes established that ent-kaurene biosynthesis in white spruce is catalyzed by two monofunctional diTPSs, PgCPS and PgKS. Comparative analysis of gene structures and enzyme functions highlights the molecular evolution of these diTPSs as conserved between gymnosperms and angiosperms. In contrast, diTPSs for specialized metabolism have evolved differently in angiosperms and gymnosperms. PMID:20044448
Molecular size estimation of plasma membrane β-glucan synthase from red beet root
International Nuclear Information System (INIS)
Sloan, M.E.; Eiberger, L.L.; Wasserman, B.P.
1986-01-01
Cellulose and cell wall β-D-glucans in higher plants are thought to be synthesized by the plasma membrane enzyme, β-glucan synthase. This enzyme has never been purified to homogeneity, hence its subunit composition is unknown. Partial purification of red beet root glucan synthase by glycerol density gradient centrifugation followed by SDS-PAGE yielded a highly enriched subunit of 68 kDa. Radiation inactivation of plasma membranes gave a molecular size the 450 kDa for the holoenzyme complex. This suggests that glucan synthase consists of 6 to 7 subunits and confirms electron microscope studies showing that glucan synthases exist as multi-subunit complexes embedded within the membrane
Energy Technology Data Exchange (ETDEWEB)
Godino-Salido, M. Luz, E-mail: mlgodino@ujaen.es [Departamento de Química Inorgánica y Orgánica, Facultad de Ciencias Experimentales, Universidad de Jaén, 23071, Jaén (Spain); Santiago-Medina, Antonio; López-Garzón, Rafael; Gutiérrez-Valero, María D.; Arranz-Mascarós, Paloma; López de la Torre, M. Dolores [Departamento de Química Inorgánica y Orgánica, Facultad de Ciencias Experimentales, Universidad de Jaén, 23071, Jaén (Spain); Domingo-García, María; López-Garzón, F. Javier [Departamento de Química Inorgánica, Facultad de Ciencias, Universidad de Granada, 18071, Granada (Spain)
2016-11-30
Highlights: • Hybrid materials made by irreversible adsorption of a deferoxamine derivative on ACs. • The surface trihydroxamate groups are the active functions of the hybrid materials. • Great adsorption capacity for Cu(II) of novel trihydroxamic acid functionalized ACs. • Desorption of Cu(II) from the loaded hybrid materials regenerates the parent hybrids. - Abstract: The main objective of this study is to prepare and characterize two functionalizated carbon materials with enhanced adsorptive properties for Cu(II). Thus, two novel hybrid materials have been prepared by a non-covalent functionalization method based on the adsorption of a pyrimidine-desferrioxamine-B conjugate compound (H{sub 4}L) on two activated carbons, ACs (labelled Merck and F). The adsorption of H{sub 4}L on the ACs is pH-dependent and highly irreversible. This is due to strong π-π interactions between the arene centers of the ACs and the pyrimidine moiety of H{sub 4}L. The textural characterization of the AC/H{sub 4}L hybrids shows large decreases of their surface areas. Thus the values of Merck and F are 1031 and 1426 m{sup 2}/g respectively, while these of Merck/H{sub 4}L and F/H{sub 4}L hybrids are 200 and 322 m{sup 2}/g. An important decrease in the micropore volumes is also found, due to the blockage of narrow porosity produced by the adsorption of H{sub 4}L molecules. The ACs/H{sub 4}L hybrids show larger adsorption capacities for Cu(II) (0.105(4) and 0.13(2) mmol/g, at pH 2.0, and 0.20(3) and 0.242(9) mmol/g, at pH 5.5, for Merck/H{sub 4}L and F/H{sub 4}L, respectively) than those of the ACs (0.024(6) and 0.096(9) mmol/g, at pH 2.0, and 0.10(2) and 0.177(8) mmol/g, at pH 5.5, for Merck and F respectively), which is explained on the basis of the complexing ability of the trihydroxamic acid functions. The desorption of Cu(II) from the ACs/H{sub 4}L/Cu(II) materials in acid solution allows the regeneration of most active sites (78.5% in the case of Merck/H{sub 4}L/Cu(II) and 83
A.G.A. Bijvoet (Agnes); A.J.J. Reuser (Arnold); H. van Hirtum (Hans); M.A. Kroos (Marian); E.H. van de Kamp; O. Schoneveld; P. Visser (Pim); J.P. Brakenhoff (Just); M. Weggeman (Miranda); E.J.J.M. van Corven (Emiel); A.T. van der Ploeg (Ans)
1999-01-01
textabstractPompe's disease or glycogen storage disease type II (GSDII) belongs to the family of inherited lysosomal storage diseases. The underlying deficiency of acid alpha-glucosidase leads in different degrees of severity to glycogen storage in heart, skeletal
Directory of Open Access Journals (Sweden)
Vinita Khot
2014-01-01
Full Text Available We have reported that folic acid, vitamin B12, and omega-3 fatty acids are interlinked in the one carbon cycle and have implications for fetal programming. Our earlier studies demonstrate that an imbalance in maternal micronutrients influence long chain polyunsaturated fatty acid metabolism and global methylation in rat placenta. We hypothesize that these changes are mediated through micronutrient dependent regulation of enzymes in one carbon cycle. Pregnant dams were assigned to six dietary groups with varying folic acid and vitamin B12 levels. Vitamin B12 deficient groups were supplemented with omega-3 fatty acid. Placental mRNA levels of enzymes, levels of phospholipids, and glutathione were determined. Results suggest that maternal micronutrient imbalance (excess folic acid with vitamin B12 deficiency leads to lower mRNA levels of methylene tetrahydrofolate reductase (MTHFR and methionine synthase , but higher cystathionine b-synthase (CBS and Phosphatidylethanolamine-N-methyltransferase (PEMT as compared to control. Omega-3 supplementation normalized CBS and MTHFR mRNA levels. Increased placental phosphatidylethanolamine (PE, phosphatidylcholine (PC, in the same group was also observed. Our data suggests that adverse effects of a maternal micronutrient imbalanced diet may be due to differential regulation of key genes encoding enzymes in one carbon cycle and omega-3 supplementation may ameliorate most of these changes.
Mutation and biochemical analysis in carnitine palmitoyltransferase type II (CPT II) deficiency
DEFF Research Database (Denmark)
Olpin, S E; Afifi, A; Clark, S
2003-01-01
Carnitine palmitoyltransferase type II (CPT II) deficiency has three basic phenotypes, late-onset muscular (mild), infantile/juvenile hepatic (intermediate) and severe neonatal. We have measured fatty acid oxidation and CPT II activity and performed mutation studies in 24 symptomatic patients...
Król, P; Igielski, R; Pollmann, S; Kępczyńska, E
2015-05-01
Methyl jasmonate (MeJA) was tested by seed treatment for its ability to protect tomato seedlings against fusarium wilt caused by the soil-borne fungal pathogen Fusarium oxysporum f.sp. lycopersici. Isolated from Solanum lycopersicon L. seeds, cv. Beta fungus was identified as F. oxysporum f.sp. lycopersici Race 3 fungus by using phytopathological and molecular methods. MeJA applied at 0.01, 0.1 and 1 mM reduced spore germination and mycelial growth in vitro. Soaking of tomato seeds in MeJA solution at 0.1 mM for 1 h significantly enhanced the resistance level against the tested fungus in tomato seedlings 4 weeks after inoculation. The extracts from leaves of 15-day-old seedlings obtained from previously MeJA soaked seeds had the ability to inhibit in vitro spore germination of tested fungus. In these seedlings a significant increase in the levels phenolic compounds such as salicylic acid (SA), kaempferol and quercetin was observed. Up-regulation of phenylalanine ammonia-lyase (PAL5) and benzoic acid/salicylic acid carboxyl methyltransferase (BSMT) genes and down-regulation of the isochorysmate synthase (ICS) gene in response to exogenous MeJA application indicate that the phenylalanine ammonia-lyase (PAL), not the isochorismate (IC) pathway, is the primary route for SA production in tomato. Moreover, the increased accumulation of the flavonols quercetin and kaempferol appears closely related to the increase of PAL5, chalcone synthase (CHS) and flavonol synthase/flavanone 3-hydroxylase-like (FLS) genes. Elevated levels of salicylic acid in seedlings raised from MeJA-soaked seeds were simultaneously accompanied by a decrease of jasmonic acid, the precursor of MeJA, and an increase of 12-oxo-phytodienoic acid (OPDA), the precursor of jasmonic acid. The present results indicate that the priming of tomato seeds with 0.1mM MeJA before sowing enables the seedlings grown from these seeds to reduce the attack of the soil-borne fungal pathogen F. oxysporum f.sp. lycopersici
Directory of Open Access Journals (Sweden)
DURDI QUJEQ
1999-10-01
Full Text Available A deficiency of the phenylalanine hydroxylase activity or its cofactor tetrahydrobiopterin may"nlead to hyperphenylalamnemia and as a result, loss of IQ, poor school performance, and"nbehavior problems occurs. Deficiency in 6-pyruvoyl-tetrahydropterin synthase activity is the"nmajor cause of tetrahydrobiopterin deficient phenylketonuria. In this study, blood specimens"nfrom 165 healthy volunteers and 127 children with phenylketonuria were used to determine"nthe 6-pyruvoyl-tetrahydropterin synthase activity. It was found that the activity of 6-"npyruvoyl- tetrahydropterin synthase was decreased in comparison with control [23.46 +/-"n2.94, (mean +/- SD, mmol/ ml/h, n=I27 vs. 127.63 +/- 4.52, n=165, p<0.05]. Results of"nthis study indicate that examination of 6-pyruvoyl-tetrahydropterin synthase activity is helpful"nand may lead to the diagnosis cause of hyperphenylalaninemia.
International Nuclear Information System (INIS)
Elkhadir, A. Y. F.
2001-05-01
Two aliphatic hydroxamic acids were prepared; N-phenyl-n-butyro hydroxamic acid and N-p-tolyl-n-butyro hydroxamic acid, by the reaction of β-phenylhydroxylamine and p-tolyl hydroxylamine with n-butyryl chloride. The acids were identified by: their melting points, characteristic reactions with acidic solutions of vanadium (V) and iron (III), infrared spectroscopy, nitrogen content and molecular weight determination. The extractability of these acids towards Cr (VI), Cu (II), Fe (III) and U (VI) were investigated at different pH values and molar acid concentrations. N-phenyl-n- butyro hydroxamic acid has a maximum extraction (98.80%) for Cr (VI) at 4 M H 2 SO 4 , (83.25%) for Cu (II) at pH 6, (99.17%) for Fe (III) at pH 5 and (99.76%) at 4 M HNO 3 for U (VI) respectively. N-p-tolyl-n-butyro hydroxamic acid has a maximum extraction (98.40%) for Cr (VI)at 4 M H 2 SO 4 , (81.30%) for Cu (II) at pH 6, (92.80%) for Fe (III) at pH 5 and (99.64%) for U (VI) at 4 M HNO 3 , respectively. The ratios of the metal to ligands were determined by job method (continuous variation method) and were found to be 1:2 for Cr (VI) and U (VI). (Author)
Energy Technology Data Exchange (ETDEWEB)
Elkhadir, A Y. F. [Department of Chemistry, Faculty of Science, University of Khartoum, Khartoum (Sudan)
2001-05-01
Two aliphatic hydroxamic acids were prepared; N-phenyl-n-butyro hydroxamic acid and N-p-tolyl-n-butyro hydroxamic acid, by the reaction of {beta}-phenylhydroxylamine and p-tolyl hydroxylamine with n-butyryl chloride. The acids were identified by: their melting points, characteristic reactions with acidic solutions of vanadium (V) and iron (III), infrared spectroscopy, nitrogen content and molecular weight determination. The extractability of these acids towards Cr (VI), Cu (II), Fe (III) and U (VI) were investigated at different pH values and molar acid concentrations. N-phenyl-n- butyro hydroxamic acid has a maximum extraction (98.80%) for Cr (VI) at 4 M H{sub 2}SO{sub 4}, (83.25%) for Cu (II) at pH 6, (99.17%) for Fe (III) at pH 5 and (99.76%) at 4 M HNO{sub 3} for U (VI) respectively. N-p-tolyl-n-butyro hydroxamic acid has a maximum extraction (98.40%) for Cr (VI)at 4 M H{sub 2} SO{sub 4}, (81.30%) for Cu (II) at pH 6, (92.80%) for Fe (III) at pH 5 and (99.64%) for U (VI) at 4 M HNO{sub 3}, respectively. The ratios of the metal to ligands were determined by job method (continuous variation method) and were found to be 1:2 for Cr (VI) and U (VI). (Author)
Impaired glycogen synthase activity and mitochondrial dysfunction in skeletal muscle
DEFF Research Database (Denmark)
Højlund, Kurt; Beck-Nielsen, Henning
2006-01-01
Insulin resistance in skeletal muscle is a major hallmark of type 2 diabetes and an early detectable abnormality in the development of this disease. The cellular mechanisms of insulin resistance include impaired insulin-mediated muscle glycogen synthesis and increased intramyocellular lipid content......, whereas impaired insulin activation of muscle glycogen synthase represents a consistent, molecular defect found in both type 2 diabetic and high-risk individuals. Despite several studies of the insulin signaling pathway believed to mediate dephosphorylation and hence activation of glycogen synthase......, the molecular mechanisms responsible for this defect remain unknown. Recently, the use of phospho-specific antibodies in human diabetic muscle has revealed hyperphosphorylation of glycogen synthase at sites not regulated by the classical insulin signaling pathway. In addition, novel approaches such as gene...
Yamaguchi, S; Saito, T; Abe, H; Yamane, H; Murofushi, N; Kamiya, Y
1996-08-01
The first committed step in the formation of diterpenoids leading to gibberellin (GA) biosynthesis is the conversion of geranylgeranyl diphosphate (GGDP) to ent-kaurene. ent-Kaurene synthase A (KSA) catalyzes the conversion of GGDP to copalyl diphosphate (CDP), which is subsequently converted to ent-kaurene by ent-kaurene synthase B (KSB). A full-length KSB cDNA was isolated from developing cotyledons in immature seeds of pumpkin (Cucurbita maxima L.). Degenerate oligonucleotide primers were designed from the amino acid sequences obtained from the purified protein to amplify a cDNA fragment, which was used for library screening. The isolated full-length cDNA was expressed in Escherichia coli as a fusion protein, which demonstrated the KSB activity to cyclize [3H]CDP to [3H]ent-kaurene. The KSB transcript was most abundant in growing tissues, but was detected in every organ in pumpkin seedlings. The deduced amino acid sequence shares significant homology with other terpene cyclases, including the conserved DDXXD motif, a putative divalent metal ion-diphosphate complex binding site. A putative transit peptide sequence that may target the translated product into the plastids is present in the N-terminal region.
Aceña, José Luis; Sorochinsky, Alexander E; Soloshonok, Vadim
2014-09-01
The major goal of this review is a critical discussion of the literature data on asymmetric synthesis of α-amino acids via Michael addition reactions involving Ni(II)-complexes of amino acids. The material covered is divided into two conceptually different groups dealing with applications of: (a) Ni(II)-complexes of glycine as C-nucleophiles and (b) Ni(II)-complexes of dehydroalanine as Michael acceptors. The first group is significantly larger and consequently subdivided into four chapters based on the source of stereocontrolling element. Thus, a chiral auxiliary can be used as a part of nucleophilic glycine Ni(II) complex, Michael acceptor or both, leading to the conditions of matching vs. mismatching stereochemical preferences. The particular focus of the review is made on the practical aspects of the methodology under discussion and mechanistic considerations.
Energy Technology Data Exchange (ETDEWEB)
Ballesta-Claver, J.; Rodríguez-Gómez, R. [ECsens, Department of Analytical Chemistry, Campus Fuentenueva, Faculty of Sciences, University of Granada, E-18071 Granada (Spain); Capitán-Vallvey, L.F., E-mail: lcapitan@ugr.es [ECsens, Department of Analytical Chemistry, Campus Fuentenueva, Faculty of Sciences, University of Granada, E-18071 Granada (Spain)
2013-04-03
Highlights: ► Cathodic ECL offers conventional and non-aggressive analysis conditions. ► The ECL hydrogen peroxide/ruthenium complex system for uric acid determination is novel. ► The ruthenium complex is electrochemically immobilized on graphite screen-printed electrodes. ► The quantification of the uric acid is based on a Stern–Volmer type equation. ► The use of the cathodic ECL working methodology reduces interferences during analysis. -- Abstract: A new method for uric acid (UA) determination based on the quenching of the cathodic ECL of the tris(2,2-bipyridine)ruthenium(II)–uricase system is described. The biosensor is based on a double-layer design containing first tris(2,2-bipyridine)ruthenium(II) (Ru(bpy){sub 3}{sup 2+}) electrochemically immobilized on graphite screen-printed cells and uricase in chitosan as a second layer. The uric acid biosensing is based on the ECL quenching produced by uric acid over the cathodic ECL caused by immobilized Ru(bpy){sub 3}{sup 2+} in the presence of uricase. The use of a −1.1 V pulse for 1 s with a dwelling time of 10 s makes it possible to estimate the initial enzymatic rate, which is used as the analytical signal. The Stern–Volmer type calibration function shows a dynamic range from 1.0 × 10{sup −5} to 1.0 × 10{sup −3} M with a limit of detection of 3.1 × 10{sup −6} M and an accuracy of 13.6% (1.0 × 10{sup −4} M, n = 5) as relative standard deviation. Satisfactory results were obtained for urine samples, creating an affordable alternative for uric acid determination.
Directory of Open Access Journals (Sweden)
BHAVNA A. SHAH
2011-06-01
Full Text Available Chelating ion-exchange resins were synthesized by polycondensation of ortho/para hydroxybenzoic acid with resorcinol/catechol employing formaldehyde as cross-linking agent at 80±5 °C in DMF. The resins were characterized by FTIR and XRD. The uptake behaviour of synthesized resins for Cd(II and Pb(II ions have been studied depending on contact time, pH, metal ion concentration and temperature. The sorption data obtained at optimized conditions were analyzed by the Langmuir and Freundlich isotherms. Experimental data of all metal–resin system were best represented by the Freundlich isotherm. The maximum obtained sorption capacity for cadmium was 69.53 mg g-1 and 169.32 mg g-1 for Lead. The adsorption process follows first order kinetics and the specific rate constant Kr was obtained by the application of the Lagergan equation. Thermodynamic parameters ∆Gads, ∆Sads and ∆Hads were calculated for the metal–resin systems. The external diffusion rate constant (KS and the intra-particle diffusion rate constant (Kid were calculated by the Spahn–Schlunder and Weber–Morris models, respectively. The sorption process was found to follow an intra-particle diffusion phenomenon.
A new type of Na(+-driven ATP synthase membrane rotor with a two-carboxylate ion-coupling motif.
Directory of Open Access Journals (Sweden)
Sarah Schulz
Full Text Available The anaerobic bacterium Fusobacterium nucleatum uses glutamate decarboxylation to generate a transmembrane gradient of Na⁺. Here, we demonstrate that this ion-motive force is directly coupled to ATP synthesis, via an F₁F₀-ATP synthase with a novel Na⁺ recognition motif, shared by other human pathogens. Molecular modeling and free-energy simulations of the rotary element of the enzyme, the c-ring, indicate Na⁺ specificity in physiological settings. Consistently, activity measurements showed Na⁺ stimulation of the enzyme, either membrane-embedded or isolated, and ATP synthesis was sensitive to the Na⁺ ionophore monensin. Furthermore, Na⁺ has a protective effect against inhibitors targeting the ion-binding sites, both in the complete ATP synthase and the isolated c-ring. Definitive evidence of Na⁺ coupling is provided by two identical crystal structures of the c₁₁ ring, solved by X-ray crystallography at 2.2 and 2.6 Å resolution, at pH 5.3 and 8.7, respectively. Na⁺ ions occupy all binding sites, each coordinated by four amino acids and a water molecule. Intriguingly, two carboxylates instead of one mediate ion binding. Simulations and experiments demonstrate that this motif implies that a proton is concurrently bound to all sites, although Na⁺ alone drives the rotary mechanism. The structure thus reveals a new mode of ion coupling in ATP synthases and provides a basis for drug-design efforts against this opportunistic pathogen.
Directory of Open Access Journals (Sweden)
Sheo B Singh
Full Text Available Platensimycin (PTM is a natural antibiotic produced by Streptomyces platensis that selectively inhibits bacterial and mammalian fatty acid synthase (FAS without affecting synthesis of other lipids. Recently, we reported that oral administration of PTM in mouse models (db/db and db/+ with high de novo lipogenesis (DNL tone inhibited DNL and enhanced glucose oxidation, which in turn led to net reduction of liver triglycerides (TG, reduced ambient glucose, and improved insulin sensitivity. The present study was conducted to explore translatability and the therapeutic potential of FAS inhibition for the treatment of diabetes in humans.We tested PTM in animal models with different DNL tones, i.e. intrinsic synthesis rates, which vary among species and are regulated by nutritional and disease states, and confirmed glucose-lowering efficacy of PTM in lean NHPs with quantitation of liver lipid by MRS imaging. To understand the direct effect of PTM on liver metabolism, we performed ex vivo liver perfusion study to compare FAS inhibitor and carnitine palmitoyltransferase 1 (CPT1 inhibitor.The efficacy of PTM is generally reproduced in preclinical models with DNL tones comparable to humans, including lean and established diet-induced obese (eDIO mice as well as non-human primates (NHPs. Similar effects of PTM on DNL reduction were observed in lean and type 2 diabetic rhesus and lean cynomolgus monkeys after acute and chronic treatment of PTM. Mechanistically, PTM lowers plasma glucose in part by enhancing hepatic glucose uptake and glycolysis. Teglicar, a CPT1 inhibitor, has similar effects on glucose uptake and glycolysis. In sharp contrast, Teglicar but not PTM significantly increased hepatic TG production, thus caused liver steatosis in eDIO mice.These findings demonstrate unique properties of PTM and provide proof-of-concept of FAS inhibition having potential utility for the treatment of diabetes and related metabolic disorders.
Spectroscopic evidence for ternary surface complexes in the lead(II)-malonic acid-hematite system
Lenhart, J.J.; Bargar, J.R.; Davis, J.A.
2001-01-01
Using extended X-ray absorption fine structure (EXAFS) and attenuated total reflectance Fourier-transform infrared (ATR-FTIR) measurements, we examined the sorption of Pb(II) to hematite in the presence of malonic acid. Pb LIII-edge EXAFS measurements performed in the presence of malonate indicate the presence of both Fe and C neighbors, suggesting that a major fraction of surface-bound malonate is bonded to adsorbed Pb(II). In the absence of Pb(II), ATR-FTIR measurements of sorbed malonate suggest the formation of more than one malonate surface complex. The dissimilarity of the IR spectrum of malonate sorbed on hematite to those for aqueous malonate suggest at least one of the sorbed malonate species is directly coordinated to surface Fe atoms in an inner-sphere mode. In the presence of Pb, little change is seen in the IR spectrum for sorbed malonate, indicating that geometry of malonate as it coordinates to sorbed Pb(II) adions is similar to the geometry of malonate as it coordinates to Fe in the hematite surface. Fits of the raw EXAFS spectra collected from pH 4 to pH 8 result in average Pb-C distances of 2.98 to 3.14 A??, suggesting the presence of both four- and six-membered Pb-malonate rings. The IR results are consistent with this interpretation. Thus, our results suggest that malonate binds to sorbed Pb(II) adions, forming ternary metal-bridging surface complexes. ?? 2001 Academic Press.
Directory of Open Access Journals (Sweden)
Maiko Furubayashi
Full Text Available Terpene synthases catalyze the formation of a variety of terpene chemical structures. Systematic mutagenesis studies have been effective in providing insights into the characteristic and complex mechanisms of C-C bond formations and in exploring the enzymatic potential for inventing new chemical structures. In addition, there is growing demand to increase terpene synthase activity in heterologous hosts, given the maturation of metabolic engineering and host breeding for terpenoid synthesis. We have developed a simple screening method for the cellular activities of terpene synthases by scoring their substrate consumption based on the color loss of the cell harboring carotenoid pathways. We demonstrate that this method can be used to detect activities of various terpene synthase or prenyltransferase genes in a high-throughput manner, irrespective of the product type, enabling the mutation analysis and directed evolution of terpene synthases. We also report the possibility for substrate-specific screening system of terpene synthases by taking advantage of the substrate-size specificity of C30 and C40 carotenoid pathways.
International Nuclear Information System (INIS)
Baum, Bernhard; Lecker, Laura S. M.; Zoltner, Martin; Jaenicke, Elmar; Schnell, Robert; Hunter, William N.; Brenk, Ruth
2015-01-01
Three crystal structures of recombinant P. aeruginosa FabF are reported: the apoenzyme, an active-site mutant and a complex with a fragment of a natural product inhibitor. The characterization provides reagents and new information to support antibacterial drug discovery. Bacterial infections remain a serious health concern, in particular causing life-threatening infections of hospitalized and immunocompromised patients. The situation is exacerbated by the rise in antibacterial drug resistance, and new treatments are urgently sought. In this endeavour, accurate structures of molecular targets can support early-stage drug discovery. Here, crystal structures, in three distinct forms, of recombinant Pseudomonas aeruginosa β-ketoacyl-(acyl-carrier-protein) synthase II (FabF) are presented. This enzyme, which is involved in fatty-acid biosynthesis, has been validated by genetic and chemical means as an antibiotic target in Gram-positive bacteria and represents a potential target in Gram-negative bacteria. The structures of apo FabF, of a C164Q mutant in which the binding site is altered to resemble the substrate-bound state and of a complex with 3-(benzoylamino)-2-hydroxybenzoic acid are reported. This compound mimics aspects of a known natural product inhibitor, platensimycin, and surprisingly was observed binding outside the active site, interacting with a symmetry-related molecule. An unusual feature is a completely buried potassium-binding site that was identified in all three structures. Comparisons suggest that this may represent a conserved structural feature of FabF relevant to fold stability. The new structures provide templates for structure-based ligand design and, together with the protocols and reagents, may underpin a target-based drug-discovery project for urgently needed antibacterials
Energy Technology Data Exchange (ETDEWEB)
Baum, Bernhard [Johannes Gutenberg-Universität, Staudinger Weg 5, 55128 Mainz (Germany); Lecker, Laura S. M.; Zoltner, Martin [University of Dundee, Dundee DD1 4EH, Scotland (United Kingdom); Jaenicke, Elmar [Johannes Gutenberg-Universität, Jakob Welder Weg 26, 55128 Mainz (Germany); Schnell, Robert [Karolinska Institutet, 17 177 Stockholm (Sweden); Hunter, William N., E-mail: w.n.hunter@dundee.ac.uk [University of Dundee, Dundee DD1 4EH, Scotland (United Kingdom); Brenk, Ruth, E-mail: w.n.hunter@dundee.ac.uk [Johannes Gutenberg-Universität, Staudinger Weg 5, 55128 Mainz (Germany)
2015-07-28
Three crystal structures of recombinant P. aeruginosa FabF are reported: the apoenzyme, an active-site mutant and a complex with a fragment of a natural product inhibitor. The characterization provides reagents and new information to support antibacterial drug discovery. Bacterial infections remain a serious health concern, in particular causing life-threatening infections of hospitalized and immunocompromised patients. The situation is exacerbated by the rise in antibacterial drug resistance, and new treatments are urgently sought. In this endeavour, accurate structures of molecular targets can support early-stage drug discovery. Here, crystal structures, in three distinct forms, of recombinant Pseudomonas aeruginosa β-ketoacyl-(acyl-carrier-protein) synthase II (FabF) are presented. This enzyme, which is involved in fatty-acid biosynthesis, has been validated by genetic and chemical means as an antibiotic target in Gram-positive bacteria and represents a potential target in Gram-negative bacteria. The structures of apo FabF, of a C164Q mutant in which the binding site is altered to resemble the substrate-bound state and of a complex with 3-(benzoylamino)-2-hydroxybenzoic acid are reported. This compound mimics aspects of a known natural product inhibitor, platensimycin, and surprisingly was observed binding outside the active site, interacting with a symmetry-related molecule. An unusual feature is a completely buried potassium-binding site that was identified in all three structures. Comparisons suggest that this may represent a conserved structural feature of FabF relevant to fold stability. The new structures provide templates for structure-based ligand design and, together with the protocols and reagents, may underpin a target-based drug-discovery project for urgently needed antibacterials.
Metabolically engineered cells for the production of polyunsaturated fatty acids
DEFF Research Database (Denmark)
2005-01-01
The present invention relates to the construction and engineering of cells, more particularly microorganisms for producing PUFAs with four or more double bonds from non-fatty acid substrates through heterologous expression of an oxygen requiring pathway. The invention especially involves...... improvement of the PUFA content in the host organism through fermentation optimization, e.g. decreasing the temperature and/or designing an optimal medium, or through improving the flux towards fatty acids by metabolic engineering, e.g. through over-expression of fatty acid synthases, over-expression of other...
Sex differences in angiotensin II- induced hypertension
Directory of Open Access Journals (Sweden)
B. Xue
2007-05-01
Full Text Available Sex differences in the development of hypertension and cardiovascular disease have been described in humans and in animal models. In this paper we will review some of our studies which have as their emphasis the examination of the role of sex differences and sex steroids in modulating the central actions of angiotensin II (ANG II via interactions with free radicals and nitric oxide, generating pathways within brain circumventricular organs and in central sympathomodulatory systems. Our studies indicate that low-dose infusions of ANG II result in hypertension in wild-type male mice but not in intact wild-type females. Furthermore, we have demonstrated that ANG II-induced hypertension in males is blocked by central infusions of the androgen receptor antagonist, flutamide, and by central infusions of the superoxide dismutase mimetic, tempol. We have also found that, in comparison to females, males show greater levels of intracellular reactive oxygen species in circumventricular organ neurons following long-term ANG II infusions. In female mice, ovariectomy, central blockade of estrogen receptors or total knockout of estrogen a receptors augments the pressor effects of ANG II. Finally, in females but not in males, central blockade of nitric oxide synthase increases the pressor effects of ANG II. Taken together, these results suggest that sex differences and estrogen and testosterone play important roles in the development of ANG II-induced hypertension.
Landmann, Christian; Fink, Barbara; Festner, Maria; Dregus, Márta; Engel, Karl-Heinz; Schwab, Wilfried
2007-09-15
The essential oil of lavender (Lavandula angustifolia) is mainly composed of mono- and sesquiterpenes. Using a homology-based PCR strategy, two monoterpene synthases (LaLIMS and LaLINS) and one sesquiterpene synthase (LaBERS) were cloned from lavender leaves and flowers. LaLIMS catalyzed the formation of (R)-(+)-limonene, terpinolene, (1R,5S)-(+)-camphene, (1R,5R)-(+)-alpha-pinene, beta-myrcene and traces of alpha-phellandrene. The proportions of these products changed significantly when Mn(2+) was supplied as the cofactor instead of Mg(2+). The second enzyme LaLINS produced exclusively (R)-(-)-linalool, the main component of lavender essential oil. LaBERS transformed farnesyl diphosphate and represents the first reported trans-alpha-bergamotene synthase. It accepted geranyl diphosphate with higher affinity than farnesyl diphosphate and also produced monoterpenes, albeit at low rates. LaBERS is probably derived from a parental monoterpene synthase by the loss of the plastidial signal peptide and by broadening its substrate acceptance spectrum. The identification and description of the first terpene synthases from L. angustifolia forms the basis for the biotechnological modification of essential oil composition in lavender.
Cd(II) removal from aqueous solution by adsorption on α-ketoglutaric acid-modified magnetic chitosan
International Nuclear Information System (INIS)
Yang, Guide; Tang, Lin; Lei, Xiaoxia; Zeng, Guangming; Cai, Ye; Wei, Xue; Zhou, Yaoyu; Li, Sisi; Fang, Yan; Zhang, Yi
2014-01-01
The present study developed an α-ketoglutaric acid-modified magnetic chitosan (α-KA-Fe 3 O 4 /CS) for highly efficient adsorption of Cd(II) from aqueous solution. Several techniques, including transmission electron microscopy (TEM), Fourier transform infrared (FTIR) and vibrating sample magnetometer (VSM), were applied to characterize the adsorbent. Batch tests were conducted to investigate the Cd(II) adsorption performance of α-KA-Fe 3 O 4 /CS. The maximum adsorption efficiency of Cd(II) appeared at pH 6.0 with the value of 93%. The adsorption amount was large and even reached 201.2 mg/g with the initial Cd(II) concentration of 1000 mg/L. The adsorption equilibrium was reached within 30 min and commendably described by pseudo-second-order model, and Langmuir model fitted the adsorption isotherm better. Furthermore, thermodynamic parameters, free energy (ΔG), enthalpy (ΔH) and entropy (ΔS) of Cd(II) adsorption were also calculated and showed that the overall adsorption process was endothermic and spontaneous in nature because of positive ΔH values and negative ΔG values, respectively. Moreover, the Cd(II)-loaded α-KA-Fe 3 O 4 /CS could be regenerated by 0.02 mol/L NaOH solution, and the cadmium removal capacity could still be kept around 89% in the sixth cycle. All the results indicated that α-KA-Fe 3 O 4 /CS was a promising adsorbent in environment pollution cleanup.
Triacetic acid lactone production in industrial Saccharomyces yeast strains
Triacetic acid lactone (TAL) is a potential platform chemical that can be produced in yeast. To evaluate the potential for industrial yeast strains to produce TAL, the g2ps1 gene encoding 2-pyrone synthase was transformed into thirteen industrial yeast strains of varied genetic background. TAL produ...
International Nuclear Information System (INIS)
Lim, Yong-Whan; Yoon, Seung-Yong; Choi, Jung-Eun; Kim, Sang-Min; Lee, Hui-Sun; Choe, Han; Lee, Seung-Chul; Kim, Dong-Hou
2010-01-01
Glycogen synthase kinase-3β (GSK3β) is recognized as one of major kinases to phosphorylate tau in Alzheimer's disease (AD), thus lots of AD drug discoveries target GSK3β. However, the inactive form of GSK3β which is phosphorylated at serine-9 is increased in AD brains. This is also inconsistent with phosphorylation status of other GSK3β substrates, such as β-catenin and collapsin response mediator protein-2 (CRMP2) since their phosphorylation is all increased in AD brains. Thus, we addressed this paradoxical condition of AD in rat neurons treated with okadaic