Nasarabadi, Shanavaz [Livermore, CA
2011-01-11
A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reaction chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.
Energy Technology Data Exchange (ETDEWEB)
Koh, Chung-Yan; Light, Yooli Kim; Piccini, Matthew Ernest; Singh, Anup K.
2017-10-31
Embodiments of the present invention are directed toward devices, systems, and methods for purifying nucleic acids to conduct polymerase chain reaction (PCR) assays. In one example, a method includes generating complexes of silica beads and nucleic acids in a lysis buffer, transporting the complexes through an immiscible fluid to remove interfering compounds from the complexes, further transporting the complexes into a density medium containing components required for PCR where the nucleic acids disassociate from the silica beads, and thermocycling the contents of the density medium to achieve PCR. Signal may be detected from labeling agents in the components required for PCR.
Reverse transcriptase-quantitative polymerase chain reaction (RT ...
African Journals Online (AJOL)
The reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) is a highly specific polymerase chain reaction (PCR) method that allows one to detect very low transcription levels of functional gene(s) in soil. RT-qPCR helps us to know the active members of the microbial community, and their activities can be ...
Interaction of gold nanoparticles with Pfu DNA polymerase and effect on polymerase chain reaction.
Sun, L-P; Wang, S; Zhang, Z-W; Ma, Y-Y; Lai, Y-Q; Weng, J; Zhang, Q-Q
2011-03-01
The interaction of gold nanoparticles with Pfu DNA polymerase has been investigated by a number of biological, optical and electronic spectroscopic techniques. Polymerase chain reaction was performed to show gold nanoparticles' biological effect. Ultraviolet-visible and circular dichroism spectra analysis were applied to character the structure of Pfu DNA polymerase after conjugation with gold nanoparticles. X-ray photoelectron spectroscopy was used to investigate the bond properties of the polymerase-gold nanoparticles complex. The authors demonstrate that gold nanoparticles do not affect the amplification efficiency of polymerase chain reaction using Pfu DNA polymerase, and Pfu DNA polymerase displays no significant changes of the secondary structure upon interaction with gold nanoparticles. The adsorption of Pfu DNA polymerase to gold nanoparticles is mainly through Au-NH(2) bond and electrostatic interaction. These findings may have important implications regarding the safety issue as gold nanoparticles are widely used in biomedical applications.
False-negative HIV-1 polymerase chain reaction in a 15-month-old ...
African Journals Online (AJOL)
Corresponding author: S Korsman (stephen.korsman@nhls.ac.za). Polymerase chain reaction (PCR) testing is the gold standard for determining the HIV status in children <18 months of age. ... mismatches relative to the consensus are shown as coloured blocks. Nucleic acid numbering relative to consensus C gag p24 is ...
Kaur, Jasmine; Sharma, Anshul; Lee, Sulhee; Park, Young-Seo
2018-06-01
Lactobacillus brevis is a part of a large family of lactic acid bacteria that are present in cheese, sauerkraut, sourdough, silage, cow manure, feces, and the intestinal tract of humans and rats. It finds its use in food fermentation, and so is considered a "generally regarded as safe" organism. L. brevis strains are extensively used as probiotics and hence, there is a need for identifying and characterizing these strains. For identification and discrimination of the bacterial species at the subspecific level, repetitive element-polymerase chain reaction method is a reliable genomic fingerprinting tool. The objective of the present study was to characterize 13 strains of L. brevis isolated from various fermented foods using repetitive element-polymerase chain reaction. Repetitive element-polymerase chain reaction was performed using three primer sets, REP, Enterobacterial Repetitive Intergenic Consensus (ERIC), and (GTG) 5 , which produced different fingerprinting patterns that enable us to distinguish between the closely related strains. Fingerprinting patterns generated band range in between 150 and 5000 bp with REP, 200-7500 bp with ERIC, and 250-2000 bp with (GTG) 5 primers, respectively. The Jaccard's dissimilarity matrices were used to obtain dendrograms by the unweighted neighbor-joining method using genetic dissimilarities based on repetitive element-polymerase chain reaction fingerprinting data. Repetitive element-polymerase chain reaction proved to be a rapid and easy method that can produce reliable results in L. brevis species.
Detection of adenovirus hexon sequence in a cat by polymerase chain reaction(short communication)
Horzinek, M.C.; Lakatos, B.; Farkas, J.; Egberink, H.F.; Vennema, H.; Benko, M.
1999-01-01
Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in pharyngeal and rectal swab samples of a cat seropositive for adenovirus and suffering from transient hepatic failure. The samples were taken at a one-year interval, and both faecal samples as well as the second pharyngeal
Polymerase chain reaction to search for Herpes viruses in uveitic ...
African Journals Online (AJOL)
Objective: To analyse aqueous polymerase chain reaction (PCR) results in patients diagnosed with undifferentiated uveitis ... Cite as: Laaks D, Smit DP, Harvey J. Polymerase chain reaction to search for Herpes viruses in uveitic and healthy eyes: a South African ... may be mild and patients do not seek medical attention.
Directory of Open Access Journals (Sweden)
Olivier Martínez
Full Text Available (S(C5', R(P α,β-D- Constrained Nucleic Acids (CNA are dinucleotide building blocks that can feature either B-type torsional angle values or non-canonical values, depending on their 5'C and P absolute stereochemistry. These CNA are modified neither on the nucleobase nor on the sugar structure and therefore represent a new class of nucleotide with specific chemical and structural characteristics. They promote marked bending in a single stranded DNA so as to preorganize it into a loop-like structure, and they have been shown to induce rigidity within oligonucleotides. Following their synthesis, studies performed on CNA have only focused on the constraints that this family of nucleotides introduced into DNA. On the assumption that bending in a DNA template may produce a terminator structure, we investigated whether CNA could be used as a new strong terminator of polymerization in PCR. We therefore assessed the efficiency of CNA as a terminator in PCR, using triethylene glycol phosphate units as a control. Analyses were performed by denaturing gel electrophoresis and several PCR products were further analysed by sequencing. The results showed that the incorporation of only one CNA was always skipped by the polymerases tested. On the other hand, two CNA units always stopped proofreading polymerases, such as Pfu DNA polymerase, as expected for a strong replication terminator. Non-proofreading enzymes, e.g. Taq DNA polymerase, did not recognize this modification as a strong terminator although it was predominantly stopped by this structure. In conclusion, this first functional use of CNA units shows that these modified nucleotides can be used as novel polymerization terminators of proofreading polymerases. Furthermore, our results lead us to propose that CNA and their derivatives could be useful tools for investigating the behaviour of different classes of polymerases.
A Double Polymerase Chain Reaction Method for Detecting African ...
African Journals Online (AJOL)
Keywords: African swine fever, Swine vesicular disease, Polymerase chain reaction, Recombinant plasmids ... included 5 μL of 10×Pfu DNA polymerase buffer,. 1 μL of Pfu DNA .... Garcia-Barreno B, Sanz A, Nogal ML, Vinuela E,. Enjuanes L.
Reverse transcriptase-quantitative polymerase chain reaction (RT ...
African Journals Online (AJOL)
zino
2014-02-05
Feb 5, 2014 ... ecological studies - A review ... The objective of this review is to assess the importance of RT-qPCR in soil related ... phenol extraction step with heat inactivation of the added .... Real time polymerase chain reaction (PCR).
Polymerase chain reaction versus enzyme-linked immunosorbent ...
African Journals Online (AJOL)
Polymerase chain reaction versus enzyme-linked immunosorbent assay in detection of Chlamydia trachomatis infection among gynaecological patients in southwestern Nigeria. ... Socio-demographic bio-data and gynaecological history were obtained with questionnaire; data was analyzed using SPSS version 20.0.
Polymerase chain reaction for the detection of Mycobacterium leprae
Hartskeerl, R. A.; de Wit, M. Y.; Klatser, P. R.
1989-01-01
A polymerase chain reaction (PCR) using heat-stable Taq polymerase is described for the specific detection of Mycobacterium leprae, the causative agent of leprosy. A set of primers was selected on the basis of the nucleotide sequence of a gene encoding the 36 kDa antigen of M. leprae. With this set
Peeters, M; Huang, C L; Vonk, L A; Lu, Z F; Bank, R A; Helder, M N; Doulabi, B Zandieh
2016-11-01
Studies which consider the molecular mechanisms of degeneration and regeneration of cartilaginous tissues are seriously hampered by problematic ribonucleic acid (RNA) isolations due to low cell density and the dense, proteoglycan-rich extracellular matrix of cartilage. Proteoglycans tend to co-purify with RNA, they can absorb the full spectrum of UV light and they are potent inhibitors of polymerase chain reaction (PCR). Therefore, the objective of the present study is to compare and optimise different homogenisation methods and RNA isolation kits for an array of cartilaginous tissues. Tissue samples such as the nucleus pulposus (NP), annulus fibrosus (AF), articular cartilage (AC) and meniscus, were collected from goats and homogenised by either the MagNA Lyser or Freezer Mill. RNA of duplicate samples was subsequently isolated by either TRIzol (benchmark), or the RNeasy Lipid Tissue, RNeasy Fibrous Tissue, or Aurum Total RNA Fatty and Fibrous Tissue kits. RNA yield, purity, and integrity were determined and gene expression levels of type II collagen and aggrecan were measured by real-time PCR. No differences between the two homogenisation methods were found. RNA isolation using the RNeasy Fibrous and Lipid kits resulted in the purest RNA (A260/A280 ratio), whereas TRIzol isolations resulted in RNA that is not as pure, and show a larger difference in gene expression of duplicate samples compared with both RNeasy kits. The Aurum kit showed low reproducibility. For the extraction of high-quality RNA from cartilaginous structures, we suggest homogenisation of the samples by the MagNA Lyser. For AC, NP and AF we recommend the RNeasy Fibrous kit, whereas for the meniscus the RNeasy Lipid kit is advised.Cite this article: M. Peeters, C. L. Huang, L. A. Vonk, Z. F. Lu, R. A. Bank, M. N. Helder, B. Zandieh Doulabi. Optimisation of high-quality total ribonucleic acid isolation from cartilaginous tissues for real-time polymerase chain reaction analysis. Bone Joint Res 2016
The application of polymerase chain reaction-denaturing gradient ...
African Journals Online (AJOL)
Jane
2011-05-23
May 23, 2011 ... dominance in microbial ecology if the corresponding environment samples had been provided. This ... yeast peptone dextrose; PCR, polymerase chain reaction. method, DGGE method ..... Two nuclear mutations that block.
Directory of Open Access Journals (Sweden)
Tuti Susanti Legiastuti
2013-04-01
Full Text Available Yellow leaf curl disease, caused by a member of Begomovirus (Geminiviridae, is one of important diseases of chilli pepper in Indonesia. Exploration of endophytic fungi was initiated in order to find biological control agents for an alternative control strategies of this disease. Isolates of endophytic fungi were collected from chilli pepper growing area in Sleman, Yogyakarta and further identification using molecular technique involving polymerase chain reaction (PCR and DNA sequencing was performed. DNA fragments of ±500 bp were successfully amplified from 10 fungal isolates by PCR using primer pair ITS1/ITS4, but only 8 DNA sequences was obtained for further genetic analysis. Based on BLASTN analysis the endophytic fungi were identified as having the highest similarity with Pleosporaceae sp. (98% for H1 isolate, Cercospora nicotianae (100% for H5 isolate, ercospora piaropi (98% for H11 isolate, Guignardia mangiferae (99% for H16 isolate, Geomyces pannorum 95% for H17 isolate, Diaporthe phaseoloru (99% for H18 isolate, Dothideomycete sp. (100% for K3 isolate, and Alternaria longissima (99% for K10 isolate. Key words: Begomovirus, chillipepper, DNA sequencing, polymerase chain reaction
Rapid establishment of polymerase chain reaction-restriction ...
African Journals Online (AJOL)
2012-03-30
Mar 30, 2012 ... genome using polymerase chain reaction (PCR) has made it possible to explore organelle DNA diversity for taxonomic and phylogenetic purposes. Because of its uniparental mode of inheritance and its low mutation rate related to the nuclear genome, chloroplast DNA (cpDNA) is considered to be an ideal ...
Determining Annealing Temperatures for Polymerase Chain Reaction
Porta, Angela R.; Enners, Edward
2012-01-01
The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…
Lalam, N.; Jacob, C.
2007-01-01
The aim of Quantitative Polymerase Chain Reaction is to determine the initial amount X0 of specific nucleic acids from an observed trajectory of the amplification process, the amplification being achieved through successive replication cycles. This process depends on the efficiency fpngn of
Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics
Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David
2014-02-01
Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas.
Alessandro, Pancrazzi; Paola, Guglielmelli; Vanessa, Ponziani; Gaetano, Bergamaschi; Alberto, Bosi; Giovanni, Barosi; Alessandro M, Vannucchi
2008-01-01
Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves we...
[Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].
Harano, K; Harano, T; Kushida, Y; Ueda, S
1991-08-01
Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.
Estimation of the reaction efficiency in polymerase chain reaction
Lalam, N.
2006-01-01
Polymerase chain reaction (PCR) is largely used in molecular biology for increasing the copy number of a specific DNA fragment. The succession of 20 replication cycles makes it possible to multiply the quantity of the fragment of interest by a factor of 1 million. The PCR technique has
Electrochemiluminescence polymerase chain reaction detection of genetically modified organisms
International Nuclear Information System (INIS)
Liu Jinfeng; Xing Da; Shen Xingyan; Zhu Debin
2005-01-01
With the development of biotechnology, more and more genetically modified organisms (GMOs) have entered commercial market. Because of the safety concerns, detection and characterization of GMOs have attracted much attention recently. Electrochemiluminescence (ECL) method is a chemiluminescent (CL) reaction of species generated electrochemically on an electrode surface. It is a highly efficient and accurate detection method. In this paper, ECL polymerase chain reaction (PCR) combined with two types of nucleic acid probes hybridization was applied to detect GMOs for the first time. Whether the organisms contain GM components was discriminated by detecting the cauliflower mosaic virus 35S (CaMV35S) promoter and nopaline synthase (NOS) terminator. The experiment results show that the detection limit is 100 fmol of PCR products. The promoter and the terminator can be clearly detected in GMOs. The method may provide a new means for the detection of GMOs due to its simplicity and high efficiency
Sidstedt, Maja; Romsos, Erica L; Hedell, Ronny; Ansell, Ricky; Steffen, Carolyn R; Vallone, Peter M; Rådström, Peter; Hedman, Johannes
2017-02-07
Digital PCR (dPCR) enables absolute quantification of nucleic acids by partitioning of the sample into hundreds or thousands of minute reactions. By assuming a Poisson distribution for the number of DNA fragments present in each chamber, the DNA concentration is determined without the need for a standard curve. However, when analyzing nucleic acids from complex matrixes such as soil and blood, the dPCR quantification can be biased due to the presence of inhibitory compounds. In this study, we evaluated the impact of varying the DNA polymerase in chamber-based dPCR for both pure and impure samples using the common PCR inhibitor humic acid (HA) as a model. We compared the TaqMan Universal PCR Master Mix with two alternative DNA polymerases: ExTaq HS and Immolase. By using Bayesian modeling, we show that there is no difference among the tested DNA polymerases in terms of accuracy of absolute quantification for pure template samples, i.e., without HA present. For samples containing HA, there were great differences in performance: the TaqMan Universal PCR Master Mix failed to correctly quantify DNA with more than 13 pg/nL HA, whereas Immolase (1 U) could handle up to 375 pg/nL HA. Furthermore, we found that BSA had a moderate positive effect for the TaqMan Universal PCR Master Mix, enabling accurate quantification for 25 pg/nL HA. Increasing the amount of DNA polymerase from 1 to 5 U had a strong effect for ExTaq HS, elevating HA-tolerance four times. We also show that the average Cq values of positive reactions may be used as a measure of inhibition effects, e.g., to determine whether or not a dPCR quantification result is reliable. The statistical models developed to objectively analyze the data may also be applied in quality control. We conclude that the choice of DNA polymerase in dPCR is crucial for the accuracy of quantification when analyzing challenging samples.
Bruisten, S. M.; Koppelman, M. H.; Roos, M. T.; Loeliger, A. E.; Reiss, P.; Boucher, C. A.; Huisman, H. G.
1993-01-01
OBJECTIVE: To develop a competitive polymerase chain reaction technique with which to evaluate the usefulness of HIV-1 level as a marker of response to antiviral treatment. DESIGN: HIV-1 sequences were assessed by competitive polymerase chain reaction in four subjects participating in a double-blind
DEFF Research Database (Denmark)
Deutch, Susanna; Dahlberg, Daniel; Hedegaard, Jesper
2007-01-01
OBJECTIVE: To compare a broad-range real-time polymerase chain reaction (PCR) diagnostic strategy with culture to evaluate additional effects on the etiological diagnosis and the quantification of the bacterial load during the course of ventricular drainage-related bacterial meningitis (VR......-BM). METHODS: We applied a PCR that targeted conserved regions of the 16S ribosomal ribonucleic acid gene to cerebrospinal fluid (CSF) samples from patients with external ventricular drainage or a ventriculoperitoneal shunt during the course of VR-BM. We compared the PCR results with CSF cultures. A total...... of 350 routine CSF samples were consecutively collected from 86 patients. The CSF deoxyribonucleic acid was automatically purified and subjected to PCR. Amplicons from the PCR samples that were positive for VR-BM were subsequently deoxyribonucleic acid sequenced for final identification. Clinical data...
Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M
2008-09-01
Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy.
Polymerase Chain Reaction/Rapid Methods Are Gaining a Foothold in Developing Countries.
Ragheb, Suzan Mohammed; Jimenez, Luis
Detection of microbial contamination in pharmaceutical raw materials and finished products is a critical factor to guarantee their safety, stability, and potency. Rapid microbiological methods-such as polymerase chain reaction-have been widely applied to clinical and food quality control analysis. However, polymerase chain reaction applications to pharmaceutical quality control have been rather slow and sporadic. Successful implementation of these methods in pharmaceutical companies in developing countries requires important considerations to provide sensitive and robust assays that will comply with good manufacturing practices. In recent years several publications have encouraged the application of molecular techniques in the microbiological assessment of pharmaceuticals. One of these techniques is polymerase chain reaction (PCR). The successful application of PCR in the pharmaceutical industry in developing countries is governed by considerable factors and requirements. These factors include the setting up of a PCR laboratory and the choice of appropriate equipment and reagents. In addition, the presence of well-trained analysts and establishment of quality control and quality assurance programs are important requirements. The pharmaceutical firms should take into account these factors to allow better chances for regulatory acceptance and wide application of this technique. © PDA, Inc. 2014.
Use of polymerase chain reaction for detection of Chlamydia trachomatis
DEFF Research Database (Denmark)
Østergaard, Lars; Birkelund, Svend; Christiansen, Gunna
1990-01-01
A polymerase chain reaction (PCR) assay was developed for detection of Chlamydia trachomatis DNA. From the published sequence of the common C. trachomatis plasmid, two primer sets were selected. Detection of amplified sequences was done by agarose gel electrophoresis of cleaved or uncleaved...
Comparison of polymerase chain reaction (PCR) and loop-mediated ...
African Journals Online (AJOL)
Comparison of polymerase chain reaction (PCR) and loop-mediated isothermal amplification (LAMP) for diagnosis of Fusarium solani in human immunodeficiency virus (HIV) positive patients. ... The test was carried out in 1 h reaction at 65°C in a heater block. The specificity of the test was 100% and its sensitivity was a ...
The use of real-time polymerase chain reaction for rapid diagnosis of skeletal tuberculosis.
Kobayashi, Naomi; Fraser, Thomas G; Bauer, Thomas W; Joyce, Michael J; Hall, Gerri S; Tuohy, Marion J; Procop, Gary W
2006-07-01
We identified Mycobacterium tuberculosis DNA using real-time polymerase chain reaction on a specimen from an osteolytic lesion of a femoral condyle, in which the frozen section demonstrated granulomas. The process was much more rapid than is possible with culture. The rapid detection of M tuberculosis and the concomitant exclusion of granulomatous disease caused by nontuberculous mycobacteria or systemic fungi are necessary to appropriately treat skeletal tuberculosis. The detection and identification of M tuberculosis by culture may require several weeks using traditional methods. The real-time polymerase chain reaction method used has been shown to be rapid and reliable, and is able to detect and differentiate both tuberculous and nontuberculous mycobacteria. Real-time polymerase chain reaction may become a diagnostic standard for the evaluation of clinical specimens for the presence of mycobacteria; this case demonstrates the potential utility of this assay for the rapid diagnosis of skeletal tuberculosis.
Role of Polymerase Chain Reaction (PCR) in the detection of ...
African Journals Online (AJOL)
Background: Staphylococcus aureus is mainly acquired from hospital infections and demonstrated the ability of developing resistance to many antibiotics. Polymerase Chain Reaction (PCR) was used to identify antibiotic-resistant isolates. This study was conducted in Al-Mujtahed, Al-Mouwasat and the Children Hospitals in ...
Jiang, Sha-Yi; Yang, Jing-Wei; Shao, Jing-Bo; Liao, Xue-Lian; Lu, Zheng-Hua; Jiang, Hui
2016-05-01
In this meta-analysis, we evaluated the diagnostic role of Epstein-Barr virus deoxyribonucleic acid detection and quantitation in the serum of pediatric and young adult patients with infectious mononucleosis. The primary outcome of this meta-analysis was the sensitivity and specificity of Epstein-Barr virus (EBV) deoxyribonucleic acid (DNA) detection and quantitation using polymerase chain reaction (PCR). A systematic review and meta-analysis was performed by searching for articles that were published through September 24, 2014 in the following databases: Medline, Cochrane, EMBASE, and Google Scholar. The following keywords were used for the search: "Epstein-Barr virus," "infectious mononucleosis," "children/young adults/infant/pediatric," and "polymerase chain reaction or PCR." Three were included in this analysis. We found that for detection by PCR, the pooled sensitivity for detecting EBV DNA was 77% (95%CI, 66-86%) and the pooled specificity for was 98% (95%CI, 93-100%). Our findings indicate that this PCR-based assay has high specificity and good sensitivity for detecting of EBV DNA, indicating it may useful for identifying patients with infectious mononucleosis. This assay may also be helpful to identify young athletic patients or highly physically active pediatric patients who are at risk for a splenic rupture due to acute infectious mononucleosis. © 2015 Wiley Periodicals, Inc.
Polymerase Chain Reaction (PCR) provides a superior tool for the ...
African Journals Online (AJOL)
Polymerase Chain Reaction (PCR) provides a superior tool for the diagnosis of Pneumococcal Infection in Burkina Faso. Y Chaibou, M Congo/Ouedraogo, I Sanou, H Somlare, K Ouattara, CM Kienou, H Belem, E Sampo, SA Traore, R Traore/Ouedraogo, C Hatcher, L Mayer, X Wang, L Sangare ...
Evaluation of a new HTLV-I/II polymerase chain reaction
Vrielink, H.; Zaaijer, H. L.; Cuypers, H. T.; van der Poel, C. L.; Woerdeman, M.; Lelie, P. N.; Winkel, C.; Reesink, H. W.
1997-01-01
AIM: Evaluation of a qualitative HTLV-I/II DNA polymerase chain reaction (PCR) test for the detection of HTLV-I/II DNA (Roche Diagnostic Systems, Branchburg, N.J., USA) in various panels. METHODS: The panels consisted of fresh EDTA blood samples from blood donors who were anti-HTLV-I/II ELISA
Bordetella pertussis diagnosed by polymerase chain reaction
DEFF Research Database (Denmark)
Birkebaek, N H; Heron, I; Skjødt, K
1994-01-01
The object of this work was to test the polymerase chain reaction (PCR) for demonstration of Bordetella pertussis (BP) in nasopharyngeal secretions. The method was applied to patients with recently diagnosed pertussis, as verified by BP culture. In order to test the sensitivity and specificity...... in 25 patients in whose nasopharyngeal secretions BP had been demonstrated after 4-7 days of culture. The detection limit of PCR in aqueous solution was 1-2 BP bacteria per reaction tube. PCR was 100% specific for BP, showing no response with other Bordetella species or other bacteria known to colonize...
UVB DNA dosimeters analyzed by polymerase chain reactors
International Nuclear Information System (INIS)
Yoshida, Hiroko; Regan, J.D.; Florida Inst. of Tech., Melbourne, FL
1997-01-01
Purified bacteriophage λ DNA was dried on a UV-transparent polymer film and served as a UVB dosimeter for personal and ecological applications. Bacteriophage λ DNA was chosen because it is commercially available and inexpensive, and its entire sequence is known. Each dosimeter contained two sets of DNA sandwiched between UV-transparent polymer films, one exposed to solar radiation (experimental) and another protected from UV radiation by black paper (control). The DNA dosimeter was then analyzed by a polymerase chain reaction (PCR) that amplifies a 500 base pair specific region of λ DNA. Photoinduced damage in DNA blocks polymerase from synthesizing a new strand; therefore, the amount of amplified product in UV-exposed DNA was reduced from that found in control DNA. The dried λ DNA dosimeter is compact, robust, safe and transportable, stable over long storage times and provides the total UVB dose integrated over the exposure time. (author)
Felice, A. E.; Alshinawi, C.
1996-01-01
The product of the Polymerase Chain Reaction (PCR) may be generically suitable for four types of investigations: Discovery PCR, Analytical PCR, Modification by PCR, and Synthetic PCR. Despite the potential problem of contamination with extraneous DNA, PCR is relatively simple and inexpensive, and
International Nuclear Information System (INIS)
Billen, D.; Hellermann, G.R.
1976-01-01
Toluene-treated Escherichia coli mutants have been used to study the roles of deoxyribonucleic acid (DNA) polymerases I, II, and III, and of DNA ligase in repair synthesis and strand rejoining following X-irradiation. In cells possessing all three DNA polymerases, both a greater amount of repair synthesis (''exaggerated'' repair synthesis) and failure of ligation are observed when DNA ligase activity is inhibited. In a mutant lacking the polymerizing activity of DNA polymerase I, exaggerated repair synthesis is not observed, and strand rejoining does not occur even if DNA ligase is fully activated. In a mutant possessing the polymerizing activity of DNA polymerase I but lacking its 5' → 3' exonuclease activity, exaggerated repair synthesis is minimal. After irradiation, DNA polymerases II and III are capable of carrying out an adenosine 5'-triphosphate-dependent repair synthesis, but rejoining of strand breaks does not occur and exaggerated synthesis is not seen whether DNA ligase is active or not. These results suggest that DNA polymerase I and DNA ligase act together to limit repair synthesis after X irradiation and that both are necessary in toluene-treated cells for strand rejoining. DNA polymerases II and III apparently cannot complete chain elongation and gap filling, and therefore repair carried out by these enzymes does not respond to ligase action
Chain-modified radioiodinated fatty acids
International Nuclear Information System (INIS)
Otto, C.A.
1987-01-01
Several carbon chain manipulations have been studied in terms of their effects on myocardial activity levels and residence time. The manipulations examined included: chain length, chain branching, chain unsaturation, and carbon-iodine bond stabilization. It was found that chain length affects myocardial activity levels for both straight-chain alkyl acids and branched chain alkyl and aryl acids. Similar results have been reported for the straight-chain aryl acids. Generally, the longer chain lengths correlated with higher myocardial activity levels and longer residence times. This behavior is attributed to storage as triglycerides. Branched chain acids are designed to be anti-metabolites but only the aryl β-methyl acids possessed the expected time course of constant or very slowly decreasing activity levels. The alkyl β-methyl acids underwent rapid deiodination - a process apparently independent of β-oxidation. Inhibition of β-oxidation by incorporation of carbon-carbon double and triple bonds was studied. Deiodination of ω-iodo alkyl fatty acids prevented an assessment of suicide inhibition using an unsaturated alkynoic acid. Stabilization of the carbon-iodine bond by attachment of iodine to a vinylic or aryl carbon was studied. The low myocardial values and high blood values observed for an eleven carbon ω-iodo vinylic fatty acid were not encouraging but ω-iodo aryl fatty acids appear to avoid the problems of rapid deiodination. (Auth.)
Angers, M; Cloutier, J F; Castonguay, A; Drouin, R
2001-08-15
Ligation-Mediated Polymerase Chain Reaction (LMPCR) is the most sensitive sequencing technique available to map single-stranded DNA breaks at the nucleotide level of resolution using genomic DNA. LMPCR has been adapted to map DNA damage and reveal DNA-protein interactions inside living cells. However, the sequence context (GC content), the global break frequency and the current combination of DNA polymerases used in LMPCR affect the quality of the results. In this study, we developed and optimized an LMPCR protocol adapted for Pyrococcus furiosus exo(-) DNA polymerase (Pfu exo(-)). The relative efficiency of Pfu exo(-) was compared to T7-modified DNA polymerase (Sequenase 2.0) at the primer extension step and to Thermus aquaticus DNA polymerase (Taq) at the PCR amplification step of LMPCR. At all break frequencies tested, Pfu exo(-) proved to be more efficient than Sequenase 2.0. During both primer extension and PCR amplification steps, the ratio of DNA molecules per unit of DNA polymerase was the main determinant of the efficiency of Pfu exo(-), while the efficiency of Taq was less affected by this ratio. Substitution of NaCl for KCl in the PCR reaction buffer of Taq strikingly improved the efficiency of the DNA polymerase. Pfu exo(-) was clearly more efficient than Taq to specifically amplify extremely GC-rich genomic DNA sequences. Our results show that a combination of Pfu exo(-) at the primer extension step and Taq at the PCR amplification step is ideal for in vivo DNA analysis and DNA damage mapping using LMPCR.
DEFF Research Database (Denmark)
Østergaard, Lars; Traulsen, J; Birkelund, Svend
1991-01-01
the two test systems were compared, the overall sensitivity of the polymerase chain reaction was 96% and the specificity 94% when compared to the cell culture technique. By use of a closed system for DNA extraction and sample transfer for the polymerase chain reaction, contamination of the samples......Two hundred and fifty-four specimens from males and females consulting a clinic for sexually transmitted diseases were analyzed for genital Chlamydia trachomatis infection. Each clinical sample was tested by the cell culture technique and the polymerase chain reaction using a closed system. When...... not detect Chlamydia trachomatis after sufficient antibiotic treatment of the chlamydial infections....
DEFF Research Database (Denmark)
Østergaard, Lars; Traulsen, J; Birkelund, Svend
1993-01-01
the two test systems were compared, the overall sensitivity of the polymerase chain reaction was 96% and the specificity 94% when compared to the cell culture technique. By use of a closed system for DNA extraction and sample transfer for the polymerase chain reaction, contamination of the samples......Two hundred and fifty-four specimens from males and females consulting a clinic for sexually transmitted diseases were analyzed for genital Chlamydia trachomatis infection. Each clinical sample was tested by the cell culture technique and the polymerase chain reaction using a closed system. When...... not detect Chlamydia trachomatis after sufficient antibiotic treatment of the chlamydial infections....
DEFF Research Database (Denmark)
Kalia, A.; Jalava, T.; Nieminen, P.
1992-01-01
Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test......Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test...
Real-time TaqMan polymerase chain reaction to quantify the effects ...
African Journals Online (AJOL)
TaqMan polymerase chain reaction was developed to quantify the number of Bifidobacterium. We used this assay to detect genomic DNA of Bifidobacterium in the intestinal tract digesta of piglets, including duodenum, jejunum, ileum, cecum and colon. Our results indicated that, developed new real-time quantitative PCR ...
Effects of Superparamagnetic Nanoparticle Clusters on the Polymerase Chain Reaction
Directory of Open Access Journals (Sweden)
Toshiaki Higashi
2012-04-01
Full Text Available The polymerase chain reaction (PCR method is widely used for the reproduction and amplification of specific DNA segments, and a novel PCR method using nanomaterials such as gold nanoparticles has recently been reported. This paper reports on the effects of superparamagnetic nanoparticles on PCR amplification without an external magnetic field, and clarifies the mechanism behind the effects of superparamagnetic particle clusters on PCR efficiency by estimating the structures of such clusters in PCR. It was found that superparamagnetic nanoparticles tend to inhibit PCR amplification depending on the structure of the magnetic nanoparticle clusters. The paper also clarifies that Taq polymerase is captured in the spaces formed among magnetic nanoparticle clusters, and that it is captured more efficiently as a result of their motion from heat treatment in PCR thermal cycles. Consequently, Taq polymerase that should be used in PCR is reduced in the PCR solution. These outcomes will be applied to novel PCR techniques using magnetic particles in an external magnetic field.
Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory
Elkins, Kelly M.
2011-01-01
The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…
Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction
Energy Technology Data Exchange (ETDEWEB)
Sharma, Vinay, E-mail: winn201@gmail.com; Rajaura, Rajveer; Sharma, Preetam Kumar; Srivastava, Rishabh Ronin [Centre for Converging Technologies, University of Rajasthan, Jaipur 302004 (India); Sharma, Shyam Sundar [Govt. women Engineering College, Ajmer (India); Agrawal, Kailash [Centre for Converging Technologies, University of Rajasthan, Jaipur 302004 (India); Department of Botany, University of Rajasthan, Jaipur 302004 (India)
2016-05-06
An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO composite for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.
Tabachnick, W J; MacLachlan, N J; Thompson, L H; Hunt, G J; Patton, J F
1996-05-01
Cattle bloods containing only polymerase chain reaction (PCR)--detectable bluetongue-10 viral nucleic acid, but as determined by virus isolation techniques, not bluetongue-10 virus, were incapable of infecting intrathoracically inoculated Culicoides variipennis sonorensis. These insects also failed to transmit bluetongue-10 virus when fed on sheep. Cattle whose blood contain only PCR-detectable bluetongue viral nucleic acid, but no infectious virus, are unlikely to play a role in the epidemiology of bluetongue. The biological significance of PCR-based detection assays and their effect on animal health regulations on the international trade of livestock and livestock germplasm is discussed. Bluetongue virus infection provides a very useful model with which to study arthropod-transmitted RNA virus infections of humans and other animals.
Case Report:False-negative HIV-1 polymerase chain reaction in a ...
African Journals Online (AJOL)
Polymerase chain reaction (PCR) testing is the gold standard for determining the HIV status in children <18 months of age. However, when clinical manifestations are not consistent with laboratory results, additional investigation is required. We report a 15-month-old HIV-exposed boy referred to our hospital after he had ...
Giesendorf, B A; Goossens, H; Niesters, H G; Van Belkum, A; Koeken, A; Endtz, H P; Stegeman, H; Quint, W G
The applicability of polymerase chain reaction (PCR)-mediated DNA typing, with primers complementary to dispersed repetitive DNA sequences and arbitrarily chosen DNA motifs, to study the epidemiology of campylobacter infection was evaluated. With a single PCR reaction and simple gel electrophoresis,
Polymerase chain reaction for detection of Mycobacterium leprae in nasal swab specimens
de Wit, M. Y.; Douglas, J. T.; McFadden, J.; Klatser, P. R.
1993-01-01
The polymerase chain reaction based on the selective amplification of a 531-bp fragment of the gene encoding the proline-rich antigen of Mycobacterium leprae was applied to nasal swab specimens from leprosy patients, occupational contacts, and endemic and nonendemic controls. To prevent
DEFF Research Database (Denmark)
Feng, Xiaotong; Ashley, Jon; Zhou, Tongchang
2018-01-01
Molecularly imprinted nanoparticles (nanoMIPs) are synthesized via a solid-phase approach using RNase as the template. The feasibility of employing the nanoMIPs as RNase inhibitor is successfully demonstrated in reverse transcriptase polymerase chain reaction (RT-PCR) assays, suggesting the tailor...
Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data
Ramakers, Christian; Ruijter, Jan M.; Deprez, Ronald H. Lekanne; Moorman, Antoon F. M.
2003-01-01
Quantification of mRNAs using real-time polymerase chain reaction (PCR) by monitoring the product formation with the fluorescent dye SYBR Green I is being extensively used in neurosciences, developmental biology, and medical diagnostics. Most PCR data analysis procedures assume that the PCR
Polymerase chain reaction assay for detection of Staphylococcus aureus in buffalo milk
Directory of Open Access Journals (Sweden)
V.K. Jain
2010-02-01
Full Text Available In India, Haryana has the world’s best dairy type buffalo, the Murrah capable of milk yields as high as 35 kg a day. Clinical and Sub clinical mastitis exerts a negative impact on milk quality, quantity and animal health and profits. In India, Staphylococci are the main causative agents responsible for mastitis of economic importance. Therefore, a suitable and specific test is required for the rapid diagnosis of Staphylococcus aureus. For definitive diagnosis of Staphylococcus aureus in mastitic milk, a polymerase chain reaction assay was developed using target sequence of 16S to 23S rRNA spacer region. This test can be performed within hours and avoids cumbersome and lengthy steps involved in microbiological culture of milk and biochemical tests. Polymerase chain reaction assay can be used as a screening test for a large herd to detect Staphylococcus aureus in milk.
Polymerase chain reaction in unilateral cases of presumed viral anterior uveitis.
Shoughy, Samir S; Alkatan, Hind M; Al-Abdullah, Abdulelah A; El-Khani, Albarah; de Groot-Mijnes, Jolanda Df; Tabbara, Khalid F
2015-01-01
Anterior uveitis is the most common form of intraocular inflammation. The main aim of this study was to determine the viral etiology in patients with unilateral cases of anterior uveitis. A total of 12 consecutive patients with the diagnosis of idiopathic unilateral anterior uveitis were included prospectively. Aqueous specimens were obtained from each patient by anterior chamber paracentesis and subjected to the detection of viral DNA/RNA genome by polymerase chain reaction assay for herpes simplex virus, varicella zoster virus, cytomegalovirus, Epstein-Barr virus, and rubella virus. There were six male and six female patients. The mean age was 43 years, with an age range of 11-82 years. All 12 cases presented with unilateral anterior uveitis. In four (33%) patients, polymerase chain reaction was positive for viral genome. Two patients were positive for herpes simplex virus type 1, one patient was positive for cytomegalovirus and one for Epstein-Barr virus. Recent molecular diagnostic assays would help in the identification of the causative agent in patients with unilateral anterior uveitis.
Pathogen detection by the polymerase chain reaction
Energy Technology Data Exchange (ETDEWEB)
Chitpatima, S T; Settachan, D; Pornsilpatip, J; Visawapoka, U [Pramongkutklao College of Medicine, Bangkok (Thailand). Molecular Biology Lab.; Dvorak, D R [Amersham International Ltd., Singapore (Singapore)
1994-05-01
In recent years, significant advances in the knowledge of DNA and its make up have led to the development of a powerful technique called polymerase chain reaction (PCR). Since the advent of PCR, laboratories around the globe have been exploiting this technology to bridge limitations or to overcome common problems encountered in molecular biology techniques. In addition, this technology has been employed successfully in diagnostic and basic scientific research and development. The true potentials of this technology is realized in early detection of pathogens and genetic abnormalities. In this paper two PCR protocols are described. The first is for detection of HIV-1 DNA in blood, the other for detection of rabies virus RNA in brain cells. 6 refs, 3 figs, 1 tab.
Use of polymerase chain reaction in the diagnosis of toxocariasis: an experimental study.
Rai, S K; Uga, S; Wu, Z; Takahashi, Y; Matsumura, T
1997-09-01
In this paper we report the usefulness of polymerase chain reaction technique in the diagnosis of visceral larva migrans in a mouse model. Liver samples obtained from two set of experimentally infected mice (10, 100, 1,000 and 10,000 embryonated Toxocara canis eggs per mouse) along with the eggs of T. canis, T. cati and Ascaris suum were included in this study. Polymerase chain reaction (PCR) was performed using Toxocara primers (SB12). The first PCR product electrophoresis revealed very thin positive bands or no bands in liver samples. However, on second PCR a clear-cut bands were observed. No positive band was shown by A. suum eggs. Our findings thus indicate the usefulness of PCR technic in the diagnosis of visceral larva migrans (VLM) in liver biopsy materials specifically by means of double PCR using the primer SB12.
Polymerase chain reaction: Theory, practice and application: A review
Directory of Open Access Journals (Sweden)
S E Atawodi
2010-01-01
Full Text Available Polymerase Chain Reaction (PCR is a rapid procedure for in vitro enzymatic amplification of specific DNA sequences using two oligonucleotide primers that hybridize to opposite strands and flank the region of interest in the target DNA. Repetitive cycles involving template denaturation, primer annealing and the extension of the annealed primers by DNA polymerase, result in the exponential accumulation of a specific fragment whose termini are defined by 5′ end of the primers. The primer extension products synthesized in one cycle can serve as a template in the next. Hence the number of target DNA copies approximately doubles at every cycle. Since its inception, PCR has had an enormous impact in both basic and diagnostic aspects of molecular biology. Like the PCR itself, the number of applications has been accumulating exponentially. It is therefore recommended that relevant scientists and laboratories in developing countries like Nigeria should acquire this simple and relatively inexpensive, but rather robust technology.
Building block synthesis using the polymerase chain assembly method.
Marchand, Julie A; Peccoud, Jean
2012-01-01
De novo gene synthesis allows the creation of custom DNA molecules without the typical constraints of traditional cloning assembly: scars, restriction site incompatibility, and the quest to find all the desired parts to name a few. Moreover, with the help of computer-assisted design, the perfect DNA molecule can be created along with its matching sequence ready to download. The challenge is to build the physical DNA molecules that have been designed with the software. Although there are several DNA assembly methods, this section presents and describes a method using the polymerase chain assembly (PCA).
National Research Council Canada - National Science Library
McAvin, James C; Escamilla, Elizabeth M; Blow, James A; Turell, Micahel J; Quintana, Miguel; Bowles, David E; Swaby, James A; Barnes, William J; Huff, William B; Lahman, Kenton L
2005-01-01
...) reverse transcription-polymerase chain reaction assays were developed for screening and seroype identification of infected mosquito vectors and human sera using a field-deployable, fluorometric thermocycler...
Boujnan, Mohamed; Duits, Ashley J; Koppelman, Marco H G M
2018-03-01
Several countries have implemented safety strategies to reduce the risk of Zika virus (ZIKV) transmission through blood transfusion. These strategies have included nucleic acid amplification testing (NAT) of blood donations. In this study, a new real-time polymerase chain reaction (PCR) assay including internal control for the detection of ZIKV on the cobas omni Utility Channel (UC) on the cobas 6800 system is presented. PCR conditions and primer/probe concentrations were optimized on the LightCycler 480 instrument. Optimized conditions were transferred to the cobas omni UC on the cobas 6800 system. Subsequently, the limit of detection (LOD) in plasma and urine, genotype inclusivity, specificity, cross-reactivity, and clinical sensitivity were determined. The 95% LOD of the ZIKV PCR assay on the cobas 6800 system was 23.0 IU/mL (95% confidence interval [CI], 16.5-37.5) in plasma and 24.5 IU/mL (95% CI, 13.4-92.9) in urine. The assay detected African and Asian lineages of ZIKV. The specificity was 100%. The clinical concordance between the newly developed ZIKV PCR assay and the investigational Roche cobas Zika NAT test was 83% (24/29). We developed a sensitive ZIKV PCR assay on the cobas omni UC on the cobas 6800 system. The assay can be used for large-scale screening of blood donations for ZIKV or for testing of blood donors returning from areas with ZIKV to avoid temporal deferral. This study also demonstrates that the cobas omni UC on the cobas 6800 system can be used for in-house-developed PCR assays. © 2018 AABB.
Pérez Urquiza, M.; Acatzi Silva, A. I.
2014-02-01
Three certified reference materials produced from powdered seeds to measure the copy number ratio sequences of p35S/hmgA in maize containing MON 810 event, p35S/Le1 in soybeans containing GTS 40-3-2 event and DREB1A/acc1 in wheat were produced according to the ISO Guides 34 and 35. In this paper, we report digital polymerase chain reaction (dPCR) protocols, performance parameters and results of copy number ratio content of genetically modified organisms (GMOs) in these materials using two new dPCR systems to detect and quantify molecular deoxyribonucleic acid: the BioMark® (Fluidigm) and the OpenArray® (Life Technologies) systems. These technologies were implemented at the National Institute of Metrology in Mexico (CENAM) and in the Reference Center for GMO Detection from the Ministry of Agriculture (CNRDOGM), respectively. The main advantage of this technique against the more-used quantitative polymerase chain reaction (qPCR) is that it generates an absolute number of target molecules in the sample, without reference to standards or an endogenous control, which is very useful when not much information is available for new developments or there are no standard reference materials in the market as in the wheat case presented, or when it was not possible to test the purity of seeds as in the maize case presented here. Both systems reported enhanced productivity, increased reliability and reduced instrument footprint. In this paper, the performance parameters and uncertainty of measurement obtained with both systems are presented and compared.
DEFF Research Database (Denmark)
Beck, Hans Christian
2005-01-01
Fatty acid biosynthesis by a mutant strain of Staphylococcus carnosus deficient in branched-chain amino acid aminotransferase (IlvE) activity was analysed. This mutant was unable to produce the appropriate branched-chain alpha-ketoacid precursors for branched-chain fatty acid biosynthesis from...... in rich medium and growth in defined medium supplemented with 2-methylpropanoic acid lead to extensive alteration of the fatty acid composition in the cell membrane. In rich medium, a change from 51.7% to 17.1% anteiso-C15:0, and from 3.6% to 33.9% iso-C14:0 fatty acids as compared to the wild-type strain...... for 2-methylpropanoic acid production, revealing that the IlvE protein plays an important, but not essential role in the biosynthesis of branched-chain fatty acids and secondary metabolites in S. carnosus....
Peano, C; Lesignoli, F; Gulli, M; Corradini, R; Samson, M C; Marchelli, R; Marmiroli, N
2005-09-15
In the present study a peptide nucleic acid (PNA)-mediated polymerase chain reaction (PCR) clamping method was developed and applied to the detection of genetically modified organisms (GMO), to test PCR products for band identity and to obtain a semiquantitative evaluation of GMO content. The minimal concentration of PNA necessary to block the PCR was determined by comparing PCRs containing a constant amount of DNA in the presence of increasing concentration of target-specific PNA. The lowest PNA concentration at which specific inhibition took place, by the inhibition of primer extension and/or steric hindrance, was the most efficient condition. Optimization of PCR clamping by PNA was observed by testing five different PNAs with a minimum of 13 bp to a maximum of 15 bp, designed on the target sequence of Roundup Ready soybean. The results obtained on the DNA extracted from Roundup Ready soybean standard flour were verified also on DNA extracted from standard flours of maize GA21, Bt176, Bt11, and MON810. A correlation between the PNA concentration necessary for inducing PCR clamping and the percentage of the GMO target sequence in the sample was found.
Identification of Meat Species by Polymerase Chain Reaction (PCR) Technique
İLHAK, O. İrfan; ARSLAN, Ali
2014-01-01
The origin of horse, dog, cat, bovine, sheep, porcine, and goat meat was determined by the polymerase chain reaction (PCR) technique, using species-specific primers. Test mixtures of meat were prepared by adding 5%, 2.5%, 1%, 0.5%, and 0.1% levels of pork, horse, cat, or dog meat to beef, sheep, and goat meat. Samples taken from those combinations were analyzed by PCR for species determination. Mitochondrial DNA (mt DNA) fragments of 439, 322, 274, 271, 225, 212, and 157 bp for horse, dog, ca...
Reverse transcription and polymerase chain reaction: principles and applications in dentistry.
Santos, Carlos Ferreira Dos; Sakai, Vivien Thiemy; Machado, Maria Aparecida de Andrade Moreira; Schippers, Daniela Nicole; Greene, Andrew Seth
2004-03-01
Various molecular biology techniques have become available in the last few years. One of the most revolutionary of these techniques regarding nucleic acid analysis is the polymerase chain reaction (PCR), which was first described in 1985. This method relies on the exponential amplification of specific DNA fragments, resulting in millions of copies that can serve as templates for different kinds of analyses. PCR can be preceded by a reverse transcription (RT) reaction in order to produce cDNA from RNA (RT-PCR). RT-PCR provides the possibility to assess gene transcription in cells or tissues. PCR and RT-PCR techniques have been instrumental in dental research, and show potential to be used for diagnosis as well as for treatment and prevention of many diseases (dental caries, periodontal disease, endodontic infections and oral cancer). Compared to other traditional methodologies, PCR and RT-PCR show many advantages including high specificity, sensitivity, and speed. Since PCR and RT-PCR are relatively new techniques and are not available to most students and professionals involved with dentistry, the aim of this work is to present the details of these techniques as well as dental literature reports in which they were used.
Early detection of typhoid by polymerase chain reaction
International Nuclear Information System (INIS)
Haque, A.; Qureshi, Javed A.; Ahmed, J.
1999-01-01
Typhoid is a common problem in developing countries. Cultivation ofbacteria and serology (especially Widal test) gives unacceptable levels offalse-negative and false-positive results respectively. In this study, arecently introduced polymerase chain reaction based technique (which has 100%specificity for Salmonella typhi) was compared with blood culture and Widaltest during the first week of illness of 82 suspected cases of typhoid. Therespective figures of positivity for PCR, blood culture and Widal test were71.95%, 34.1% and 36.5%. A control group of 20 healthy persons gave figuresof 0%, 0% and 33.3%, respectively. We conclude that this PCR-based techniqueis not only absolutely specific, but also very sensitive and therefore muchsuperior to blood culture and, Widal test for the early diagnosis of typhoid.(author)
International Nuclear Information System (INIS)
Sawyers, C.L.; Timson, L.; Clark, S.S.; Witte, O.N.; Champlin, R.; Kawasaki, E.S.
1990-01-01
Relapse of chronic myelogenous leukemia after bone marrow transplantation can be detected by using clinical, cytogenetic, or molecular tools. A modification of the polymerase chain reaction can be used in patients to detect low levels of the BCR-ABL-encoded mRNA transcript, a specific marker for chronic myelogenous leukemia. Early detection of relapse after bone marrow transplantation could potentially alter treatment decisions. The authors prospectively evaluated 19 patients for evidence of molecular relapse, cytogenetic relapse, and clinical relapse after bone marrow transplantation. They used the polymerase chain reaction to detect residual BCR-ABL mRNA in patients followed up to 45 months after treatment and found 4 patients with BCR-ABL mRNA expression following bone marrow transplantation. Fifteen patients did not express detectable BCR-ABL mRNA. All 19 patients remain in clinical remission. In this prospective study of chronic myelogenous leukemia patients treated with bone marrow transplantation, molecular relapse preceded cytogenetic relapse in those patients who persistently express BCR-ABL mRNA. They recommend using standard clinical and cytogenetic testing to make patient care decisions until further follow-up determines the clinical outcome of those patients with residual BCR-ABL mRNA transcripts detected by polymerase chain reaction
Polymerase chain reaction methods (PCR in agrobiotechnology
Directory of Open Access Journals (Sweden)
Taški-Ajduković Ksenija
2006-01-01
Full Text Available The agricultural biotechnology applies polymerase chain reaction (PCR technology at numerous steps throughout product development. The major uses of PCR technology during product development include gene discovery and cloning, vector construction, transformant identification, screening and characterization as well as seed quality control. Commodity and food companies as well as testing laboratories rely on PCR technology to verify the presence or absence of genetically modification (GM in a product or to quantify the amount of GM material present in the product. This article describes the fundamental elements of PCR analysis and its application to the testing of grains and highlights some of areas to which attention must be paid in order to produce reliable test results. The article also discuses issues related to the analysis of different matrixes and the effect they may have on the accuracy of the PCR analytical results.
International Nuclear Information System (INIS)
Rudnicka, L.; Diaz, A.; Varga, J.; Jimenez, S.A.; Christiano, A.; Uitto, J.
1995-01-01
Quantification of gene expression is of increasing interest in many medical sciences. Methods based on reverse transcription-polymerase chain reactions (RT-PCRs) are timesaving and require only very small amounts of RNA. A limiting factor, however, is the significant fluctuation in the efficacy of reverse transcription as well in the polymerase chain reactions. Various external and internal standards have been suggested for correcting these fluctuations. We describe a novel way of creating an internal standard for assessing the expression of type VII collagen in human cells. The total RNA of a patient with hereditary 'epidermilysis bulosa dystrophica' associated with a homozygous T to A point mutation in type VII collagen gene was reverse transcribed and a 382bp fragment of type VII collagen cDNA containing the mutation was amplified. The mutated cDNA, unlike normal type VII collagen cDNA could be cleaved by 'Ear I' endonuclease into 244bp and 138bp fragments. Semiquantitative PCR was performed with the mutated cDNA as internal standard and the studied cDNA sample in the same tube in the presence of α 32 P-labelled dCTP. The reaction was followed by 'Ear I' digestion, electrophoresis on a polyacrylamide gel and exposure to a X-ray film. In conclusion, we describe a timesaving method for creating internal standards for semiquantitative RT-PCR. (author). 12 refs, 3 figs
Polymerase chain reaction for detection of invasive Shigella flexneri in food.
Lampel, K A; Jagow, J A; Trucksess, M; Hill, W E
1990-01-01
The polymerase chain reaction (PCR) was used to amplify a 760-base-pair (bp) fragment with the 220-kbp invasive plasmids of enteroinvasive Escherichia coli, Shigella flexneri, Shigella dysenteriae, Shigella boydii, and Shigella sonnei as templates. This PCR product was easily detected by agarose gel electrophoresis. A 210-bp AccI-PstI fragment lying within the amplified region was used as a probe in Southern hybridization blots and showed that the PCR-generated product was derived from the in...
Directory of Open Access Journals (Sweden)
Carlos Alberto Scrideli
2001-09-01
Full Text Available CONTEXT: The CDR-3 region of heavy-chain immunoglobulin has been used as a clonal marker in the study of minimal residual disease in children with acute lymphoblastic leukemia. Southern blot and polymerase chain reaction studies have demonstrated the occurrence of bi/oligoclonality in a variable number of cases of B-lineage acute lymphoblastic leukemia, a fact that may strongly interfere with the detection of minimal residual disease. Oligoclonality has also been associated with a poorer prognosis and a higher chance of relapse. OBJECTIVES: To correlate bi/oligoclonality, detected by polymerase chain reaction in Brazilian children with B-lineage acute lymphoblastic leukemia with a chance of relapse, with immunophenotype, risk group, and disease-free survival. DESIGN: Prospective study of patients’ outcome. SETTING: Pediatric Oncology Unit of the University Hospital, Faculty of Medicine of Ribeirão Preto, University of São Paulo. PARTICIPANTS: 47 children with acute lymphoblastic leukemia DIAGNOSTIC TEST: Polymerase chain reaction using consensus primers for the CDR-3 region of heavy chain immunoglobulin (FR3A, LJH and VLJH for the detection of clonality. RESULTS: Bi/oligoclonality was detected in 15 patients (31.9%. There was no significant difference between the groups with monoclonality and biclonality in terms of the occurrence of a relapse (28.1% versus 26.1%, presence of CALLA+ (81.2% versus 80% or risk group (62.5% versus 60%. Disease-free survival was similar in both groups, with no significant difference (p: 0.7695. CONCLUSIONS: We conclude that bi/oligoclonality was not associated with the factors investigated in the present study and that its detection in 31.9% of the patients may be important for the study and monitoring of minimal residual disease.
Thermally multiplexed polymerase chain reaction.
Phaneuf, Christopher R; Pak, Nikita; Saunders, D Curtis; Holst, Gregory L; Birjiniuk, Joav; Nagpal, Nikita; Culpepper, Stephen; Popler, Emily; Shane, Andi L; Jerris, Robert; Forest, Craig R
2015-07-01
Amplification of multiple unique genetic targets using the polymerase chain reaction (PCR) is commonly required in molecular biology laboratories. Such reactions are typically performed either serially or by multiplex PCR. Serial reactions are time consuming, and multiplex PCR, while powerful and widely used, can be prone to amplification bias, PCR drift, and primer-primer interactions. We present a new thermocycling method, termed thermal multiplexing, in which a single heat source is uniformly distributed and selectively modulated for independent temperature control of an array of PCR reactions. Thermal multiplexing allows amplification of multiple targets simultaneously-each reaction segregated and performed at optimal conditions. We demonstrate the method using a microfluidic system consisting of an infrared laser thermocycler, a polymer microchip featuring 1 μl, oil-encapsulated reactions, and closed-loop pulse-width modulation control. Heat transfer modeling is used to characterize thermal performance limitations of the system. We validate the model and perform two reactions simultaneously with widely varying annealing temperatures (48 °C and 68 °C), demonstrating excellent amplification. In addition, to demonstrate microfluidic infrared PCR using clinical specimens, we successfully amplified and detected both influenza A and B from human nasopharyngeal swabs. Thermal multiplexing is scalable and applicable to challenges such as pathogen detection where patients presenting non-specific symptoms need to be efficiently screened across a viral or bacterial panel.
Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...
Urine Nested Polymerase Chain Reaction in Neonatal Septicemia.
Das, B K; Suri, Shipra; Nath, Gopal; Prasad, Rajniti
2015-08-01
This cross-sectional study was done to evaluate diagnostic efficacy of urine nested polymerase chain reaction (PCR) using broad-range 16SrDNA PCR-based amplification, followed by restriction analysis and sequencing in neonatal septicemia. The study included 50 babies; 48% had vaginal delivery, 46% were preterm, 20% had a history of prolonged rupture of membranes and 56% were low birth weight (≤2500 g). Clinical presentations were lethargy (96%), respiratory distress (80%) and bleeding diathesis (16%). Absolute neutrophil count value, negative predictive value and accuracy of nested PCR were 100, 60, 78.9, 100 and 84%, respectively, compared with blood culture. Nested PCR can detect most bacteria in single assay and identify unusual and unexpected causal agents. © The Author [2015]. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Sefrita Tri Utami
2014-01-01
Full Text Available ABSTRACTLeptospirosis is a zoonotic disease, which is caused by leptospira. Leptospirosis cases often show no specificclinical symptoms and is difficult to diagnose without testing samples in the laboratory. Testing using PCR(Polymerase Chain Reaction is considered more accurate than the other methods. Components required in theexamination Leptospira bacteria in human blood samples using PCR method is DNA template, DNA polymeraseenzyme, forward primer (PU1 and SU1 and reverse primer (Lep R1, nuclease free water, Mg 2 +, and dNTPs.Examination of Leptospira bacteria in human blood samples include sampling, DNA isolation, examination byPCR, and electrophoresis running.Key words: leptospirosis, Leptospira, PCR methodsABSTRAKLeptospirosis adalah penyakit zoonosis yang disebabkan oleh bakteri Leptospira. Kasus leptospirosis seringtidak menunjukkan gejala klinis yang spesifik dan sulit didiagnosis tanpa pengujian sampel di laboratorium.Pengujian dengan menggunakan metode PCR (Polymerase Chain Reaction dinilai lebih akurat dibandingkandengan metode yang lain. Komponen-komponen yang dibutuhkan dalam pemeriksaan bakteri Leptospira padasampel darah manusia menggunakan metode PCR adalah DNA template, enzim polymerase, Primer PU 1 danPrimer SU 1, Primer Lep R1, air, Mg2+ , dan dNTP. Pemeriksaan bakteri Leptospira pada sampel darah manusiameliputi pengambilan sampel, isolasi DNA, pemeriksaan dengan metode PCR, dan running elektroforesis.Kata kunci: leptospirosis, Leptospira, metode PCR
Kelly, Kathleen M; Wack, Allison N; Bradway, Dan; Simons, Brian W; Bronson, Ellen; Osterhout, Gerard; Parrish, Nicole M; Montali, Richard J
2015-06-01
A 25-yr-old Diana monkey (Cercopithecus diana) with a 1.5-yr history of chronic colitis and diarrhea was found to have disseminated granulomatous disease with intralesional acid fast bacilli. Bacilli were identified as Mycobacterium genavense by polymerase chain reaction, sequencing of the 16S-23S ribosomal RNA intergenic spacer (ITS) gene, and mycolic acid analysis by high-performance liquid chromatography. Mycobacterium genavense is a common cause of mycobacteriosis in free-ranging and captive birds. In addition, recognition of opportunistic infection in human immunodeficiency virus-positive patients is increasing. Disease manifestations of M. genavense are similar to Mycobacterium avium complex (MAC) and include fever, wasting, and diarrhea with disseminated disease. Similar clinical signs and lesions were observed in this monkey. Mycobacterium genavense should be considered as a differential for disseminated mycobacterial disease in nonhuman primates as this agent can mimic MAC and related mycobacteria.
Phutikanit, Nawapen; Suwimonteerabutr, Junpen; Harrison, Dion; D'Occhio, Michael; Carroll, Bernie; Techakumphu, Mongkol
2010-01-01
Abstract Background The purpose of this study was to apply an arbitrarily primed methylation sensitive polymerase chain reaction (PCR) assay called Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR) to investigate the methylation profiles of somatic and germ cells obtained from Holstein bulls. Methods Genomic DNA was extracted from sperm, leukocytes and fibroblasts obtained from three bulls and digested with a methylation sensitive endonuclease (HpaII). The native genomic ...
Detection of Salmonella typhi by nested polymerase chain reaction in blood, urine, and stool samples
Hatta, Mochammad; Smits, Henk L.
2007-01-01
A nested polymerase chain reaction (PCR) specific for Salmonella enterica serovar Typhi was used for the detection of the pathogen in blood, urine, and stool samples from 131 patients with clinical suspicion of typhoid fever. The sensitivity of blood culture, the PCRs with blood, urine, and feces,
Zhong, Yong; Huang, Lihong; Zhang, Zhisen; Xiong, Yunjing; Sun, Liping; Weng, Jian
2016-01-01
Graphene oxides (GOs) with different surface characteristics, such as size, reduction degree and charge, are prepared, and their effects on the specificity of polymerase chain reaction (PCR) are investigated. In this study, we demonstrate that GO with a large size and high reduction degree is superior to small and nonreduced GO in enhancing the specificity of PCR. Negatively charged polyacrylic acid (PAA), positively charged polyacrylamide (PAM), neutral polyethylene glycol (PEG) and zwitterionic polymer poly(sulfobetaine) (pSB) are used to modify GO. The PCR specificity-enhancing ability increases in the following order: GO-PAA Pfu DNA polymerase. Our data demonstrate that the size, reduction degree and surface charge of GO affect the specificity of PCR. Based on our results, zwitterionic polymer-modified GO may be used as an efficient additive for enhancing the specificity of PCR. PMID:27956830
STUDY OF UROGENITAL TRACT MICROFLORA OF DNEPROPETROVSK FEMALES BY POLYMERASE CHAIN REACTION
Directory of Open Access Journals (Sweden)
Honcharova S.Y.
2015-08-01
Full Text Available We isolated and identified the pathogens from the urogenital tract in 100 women of 26-55 years in Diagnostic Center of Dnepropetrovsk Medical Academy by polymerase chain reaction. It was found that all investigated microflora was represented by HPV of high and low cancer risk - HSV type 1+2, Ureaplasma urealyticum, Chlamydia trachomatis, Trichomonas vaginalis, Mycoplasma hominis, and Candida yeast species. The most abundant pathogens from the urogenital tract were HPV, Ureaplasma urealyticum, and Chlamydia trachomatis.
Fan, Hongxin; Robetorye, Ryan S
2013-01-01
Although well-established diagnostic criteria exist for mature B-cell neoplasms, a definitive diagnosis of a B-cell lymphoproliferative disorder cannot always be obtained using more conventional techniques such as flow cytometric immunophenotyping, conventional cytogenetics, fluorescence in situ hybridization, or immunohistochemistry. However, because B-cell malignancies contain identically rearranged immunoglobulin heavy chain genes, the polymerase chain reaction (PCR) can be a fast, convenient, and dependable option to identify clonal B-cell processes. This chapter describes the use of PCR and capillary electrophoresis to identify clonal immunoglobulin heavy chain (IGH) variable and joining region (VH-JH) gene rearrangements (IGH VH-JH PCR) using a commercially available method employing multiple multiplex PCR tubes that was originally developed as the result of a large European BIOMED-2 collaborative study (Invivoscribe Technologies). The core protocol involves the use of three separate master mix tubes that target the conserved framework (FR1, FR2, and FR3) and joining (J) regions of the IGH gene. Analysis of these three framework regions can detect approximately 88% of clonal IGH gene rearrangements.
Optimizing polymerase chain reaction testing for the diagnosis of pertussis: current perspectives
Directory of Open Access Journals (Sweden)
Arbefeville S
2015-09-01
Full Text Available Sophie Arbefeville, Patricia Ferrieri Department of Laboratory Medicine and Pathology, University of Minnesota Medical School, Minneapolis, MN, USA Abstract: Nucleic acid testing has revolutionized the diagnosis of pertussis in the clinical microbiology laboratory and has become the main avenue of testing for pertussis infection. Real-time polymerase chain reaction (RT-PCR is an important tool for timely diagnosis of pertussis and is more sensitive than culture. The most commonly amplified targets are the insertion-sequence (IS genes, which are found in multiple copies in the genome of Bordetella species. Some strains of Bordetella pertussis have more than 200 copies of IS481 in their genome. This high number of repeats allows RT-PCR assays to be very sensitive and makes nucleic acid testing two to three times more sensitive than culture. Despite these advantages, RT-PCR can give inaccurate results due to contamination or lack of specificity. Contamination can easily happen during specimen collection, DNA extraction, or nucleic acid amplification steps. To avoid contamination, laboratories need to have quality controls and good workflows in place. The poor specificity of the nucleic acid assays amplifying the IS genes is because they are found in various Bordetella species and, thus, not unique to a specific species. Bordetella holmesii, a more recently described Bordetella species found to be responsible for respiratory symptoms similar to pertussis in adolescents and adults, can be misidentified as B. pertussis in RT-PCR assays that amplify only the IS481 target. Use of multiple targets may improve specificity of RT-PCR assays for pertussis. In the past few years, the US Food and Drug Administration has cleared three commercial assays for the detection of B. pertussis in respiratory specimens. Several commercial assays and analyte-specific reagents, which are not US Food and Drug Administration cleared, are available for the detection of one
Susan Maphilindawati Noor; Pratiwi Pujilestari Sudarmono; Asmarani Kusumawati; Anis Karuniawati
2014-01-01
Brucella abortus Strain Specific-Polymerase Chain Reaction (BaSS-PCR) is a single multiplex PCRtechnique which able to identify and differentiate between Brucella abortus field strains (biovar 1, 2, and4), B. abortus vaccine strains, Brucella species, and non-Brucella species. In this study, BaSS-PCR wasapplied to identify local isolates of B. abortus in order to investigate the B. abortus strains that infectedcattle in Indonesia. Fifty local strains of B.abortus isolated from infected cattle...
Campbell, J; Lowe, J; Walz, S; Ezzell, J
1993-01-01
We developed a 4-h nested polymerase chain reaction assay that detected a region of the plasminogen activator gene of Yersinia pestis in 100% of 43 Y. pestis strains isolated from humans, rats, and fleas yet was unreactive with the closely related species Yersinia enterocolitica and Yersinia pseudotuberculosis.
A targeted metabolomic protocol for short-chain fatty acids and branched-chain amino acids
Zheng, Xiaojiao; Qiu, Yunping; Zhong, Wei; Baxter, Sarah; Su, Mingming; Li, Qiong; Xie, Guoxiang; Ore, Brandon M.; Qiao, Shanlei; Spencer, Melanie D.; Zeisel, Steven H.; Zhou, Zhanxiang; Zhao, Aihua; Jia, Wei
2013-01-01
Research in obesity and metabolic disorders that involve intestinal microbiota demands reliable methods for the precise measurement of the short-chain fatty acids (SCFAs) and branched-chain amino acids (BCAAs) concentration. Here, we report a rapid method of simultaneously determining SCFAs and BCAAs in biological samples using propyl chloroformate (PCF) derivatization followed by gas chromatography mass spectrometry (GC-MS) analysis. A one-step derivatization using 100 µL of PCF in a reactio...
Theory and applications of the polymerase chain reaction.
Remick, D G; Kunkel, S L; Holbrook, E A; Hanson, C A
1990-04-01
The polymerase chain reaction (PCR) is a newly developed molecular biology technique that can significantly amplify DNA or RNA. The process consists of repetitive cycles of specific DNA synthesis, defined by short stretches of preselected DNA. With each cycle, there is a doubling of the final, desired DNA product such that a million-fold amplification is possible. This powerful method has numerous applications in diagnostic pathology, especially in the fields of microbiology, forensic science, and hematology. The PCR may be used to directly detect viral DNA, which may facilitate the diagnosis of acquired immune deficiency syndrome (AIDS) or other viral diseases. PCR amplification of DNA allows detection of specific sequences from extremely small samples, such as with forensic material. In hematology, PCR may help in the diagnosis of hemoglobinopathies or of neoplastic disorders by documenting chromosomal translocations. The new PCR opens exciting new avenues for diagnostic pathology using this new technology.
DEFF Research Database (Denmark)
Abdulmawjood, A.; Bulte, M.; Roth, S.
2004-01-01
A diagnostic polymerase chain reaction assay was developed for the detection of E. coli O157 as the first part of a multicenter validation and standardization project. The assay is based on amplification of sequences of the rfbE O157 gene and includes an internal amplification control. The select...
Elshawadfy, Ashraf M; Keith, Brian J; Ee Ooi, H'Ng; Kinsman, Thomas; Heslop, Pauline; Connolly, Bernard A
2014-01-01
The polymerase chain reaction (PCR) is widely applied across the biosciences, with archaeal Family-B DNA polymerases being preferred, due to their high thermostability and fidelity. The enzyme from Pyrococcus furiosus (Pfu-Pol) is more frequently used than the similar protein from Thermococcus kodakarensis (Tkod-Pol), despite the latter having better PCR performance. Here the two polymerases have been comprehensively compared, confirming that Tkod-Pol: (1) extends primer-templates more rapidly; (2) has higher processivity; (3) demonstrates superior performance in normal and real time PCR. However, Tkod-Pol is less thermostable than Pfu-Pol and both enzymes have equal fidelities. To understand the favorable properties of Tkod-Pol, hybrid proteins have been prepared. Single, double and triple mutations were used to site arginines, present at the "forked-point" (the junction of the exonuclease and polymerase channels) of Tkod-Pol, at the corresponding locations in Pfu-Pol, slightly improving PCR performance. The Pfu-Pol thumb domain, responsible for double-stranded DNA binding, has been entirely replaced with that from Tkod-Pol, again giving better PCR properties. Combining the "forked-point" and thumb swap mutations resulted in a marked increase in PCR capability, maintenance of high fidelity and retention of the superior thermostability associated with Pfu-Pol. However, even the arginine/thumb swap mutant falls short of Tkod-Pol in PCR, suggesting further improvement within the Pfu-Pol framework is attainable. The significance of this work is the observation that improvements in PCR performance are easily attainable by blending elements from closely related archaeal polymerases, an approach that may, in future, be extended by using more polymerases from these organisms.
Application of the arbitrarily primed polymerase chain reaction for the detection of DNA damage
International Nuclear Information System (INIS)
Atienzar, F.; Evenden, A.; Jha, A.; Depledge, M.; Savva, D.; Walker, C.
1998-01-01
The technique of arbitrarily primed polymerase chain reaction (AP-PCR) shows potential as a selective and sensitive assay for the detection of xenobiotic-induced DNA damage. Problems, however, may occur in AP-PCR, diminishing its discriminative abilities. These problems include the presence of spurious amplification products in non-template-containing negative control reactions, and a lack of reproducibility amongst amplification patterns. Experiments designed to remove contaminated nucleic acids by ultraviolet (UV) treatment indicated that spurious bands are the result of aberrant primer-induced polymerisation, an event shown to be influenced by the concentration of deoxynucleotide triphosphates (dNTP) present in the reaction mixtures. Optimisation of dNTP concentration from 0.22 to 0.33 MM resulted in clear negative controls and highly reproducible amplification patterns with all DNA templates. As an example of the application of the method, in the present study, the macroalga Palmaria palmata (Rhodophyta) was exposed to UV A and B radiations. The study shows that the AP-PCR method can detect DNA damage and may be useful in detecting such damage following exposure of cells to xenobiotics. (author)
Application of the arbitrarily primed polymerase chain reaction for the detection of DNA damage
Energy Technology Data Exchange (ETDEWEB)
Atienzar, F.; Evenden, A.; Jha, A.; Depledge, M. [University of Plymouth (United Kingdom). Environmental Research Centre; Child, P. [ADAS Boxworth (United Kingdom); Savva, D.; Walker, C. [University of Reading (United Kingdom). School of Animal and Microbial Sciences
1998-07-01
The technique of arbitrarily primed polymerase chain reaction (AP-PCR) shows potential as a selective and sensitive assay for the detection of xenobiotic-induced DNA damage. Problems, however, may occur in AP-PCR, diminishing its discriminative abilities. These problems include the presence of spurious amplification products in non-template-containing negative control reactions, and a lack of reproducibility amongst amplification patterns. Experiments designed to remove contaminated nucleic acids by ultraviolet (UV) treatment indicated that spurious bands are the result of aberrant primer-induced polymerisation, an event shown to be influenced by the concentration of deoxynucleotide triphosphates (dNTP) present in the reaction mixtures. Optimisation of dNTP concentration from 0.22 to 0.33 MM resulted in clear negative controls and highly reproducible amplification patterns with all DNA templates. As an example of the application of the method, in the present study, the macroalga Palmaria palmata (Rhodophyta) was exposed to UV A and B radiations. The study shows that the AP-PCR method can detect DNA damage and may be useful in detecting such damage following exposure of cells to xenobiotics. (author)
Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.
Wu, Z; Nagano, I; Xu, D; Takahashi, Y
1997-03-01
Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.
Goorhuis, A.; van der Kooi, T.; Vaessen, N.; Dekker, F. W.; van den Berg, R.; Harmanus, C.; van den Hof, S.; Notermans, D. W.; Kuijper, E. J.
2007-01-01
After reports of emerging outbreaks in Canada and the United States, Clostridium difficile-associated disease (CDAD) due to polymerase chain reaction ribotype 027 was detected in 2 medium-to-large hospitals in The Netherlands in 2005. National surveillance was initiated to investigate the spread and
Polymerase chain reaction as a tool for developing stress protein probes
Energy Technology Data Exchange (ETDEWEB)
Cochrane, B.J.; Mattley, Y.D. (Univ. of South Florida, Tampa, FL (United States). Dept. of Biology); Snell, T.W. (Georgia Inst. of Tech., Atlanta, GA (United States). Div. of Biology)
1994-08-01
Because of the high degree of evolutionary conservation of stress proteins, potential exists for the development of nucleic acid probes from particular species that could be used to monitor stress-related changes in mRNA abundance. The polymerase chain reaction (PCR) is a powerful tool that can be applied to the generation of these probes, provided that primer sequences can be identified that specifically amplify sequences of interest from a wide variety of organisms. The authors identified such sequences from multiple alignments of published chaperonin and stress-70 sequences, and tested their ability to amplify appropriately sized fragments from genomic DNA from a variety of vertebrates and invertebrates. Although no primer pair could be used successfully with all species, the authors were able to derive specific products from most species by testing different pairs. One primer pair for chaperonin proved particularly useful. Products were obtained from all tested species, and with a single exception (human), these primers appeared to amplify a single copy sequence. The authors determined the nucleotide sequence of the product obtained from the rotifer Brachionus plicatilis and determined by phylogenetic analysis of the inferred protein product that the product obtained is most likely derived from a rotifer DNA template. Finally, the authors show that this product can be used to detect changes in abundance of homologous mRNA in heat-stressed rotifers.
Tsukuda, Masahiko; Wiederkehr, Rodrigo Sergio; Cai, Qing; Majeed, Bivragh; Fiorini, Paolo; Stakenborg, Tim; Matsuno, Toshinobu
2016-04-01
A silicon microfluidic chip was developed for microRNA (miRNA) quantitative analysis. It performs sequentially reverse transcription and polymerase chain reaction in a digital droplet format. Individual processes take place on different cavities, and reagent and sample mixing is carried out on a chip, prior to entering each compartment. The droplets are generated on a T-junction channel before the polymerase chain reaction step. Also, a miniaturized fluorescence detector was developed, based on an optical pick-up head of digital versatile disc (DVD) and a micro-photomultiplier tube. The chip integrated in the detection system was tested using synthetic miRNA with known concentrations, ranging from 300 to 3,000 templates/µL. Results proved the functionality of the system.
Harmey, Judith H.; Harmey, Matthew A.
1993-01-01
We have evaluated the potential of DNA-based methods to identify and differentiate Bursaphelenchus spp. and isolates. The isolation of a DNA probe, designated X14, and development of a DNA fingerprinting method for the identification and differentiation of Bursaphelenchus species and strains is described. Polymerase chain reaction (PCR) amplification of DNA isolated from Bursaphelenchus species using two primers derived from the sequence of the cloned repetitive DNA fragment X14 resulted in m...
Mohammadi, Samira; Esfahani, Bahram Nasr; Moghim, Sharareh; Mirhendi, Hossein; Zaniani, Fatemeh Riyahi; Safaei, Hajieh Ghasemian; Fazeli, Hossein; Salehi, Mahshid
2017-01-01
Nontuberculous mycobacteria (NTM) are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA ® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR) amplification of the heat-shock protein 65 gene with serially diluted DNA samples. The CTAB method showed more positive results at 1:10-1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor.
Directory of Open Access Journals (Sweden)
Samira Mohammadi
2017-01-01
Full Text Available Background: Nontuberculous mycobacteria (NTM are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. Materials and Methods: The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR amplification of the heat-shock protein 65 gene with serially diluted DNA samples. Results: The CTAB method showed more positive results at 1:10–1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. Conclusions: According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor.
DEFF Research Database (Denmark)
Pedersen, Ken Steen; Stege, Helle; Jensen, Tim Kåre
2013-01-01
Quantitative polymerase chain reaction (qPCR) tests for detection and quantification of Lawsonia intracellularis in feces from pigs have been developed. The objective of the current study was to evaluate the diagnostic performance of a fecal qPCR test for detection of nursery pigs with L. intrace......Quantitative polymerase chain reaction (qPCR) tests for detection and quantification of Lawsonia intracellularis in feces from pigs have been developed. The objective of the current study was to evaluate the diagnostic performance of a fecal qPCR test for detection of nursery pigs with L...
Goorhuis, Abraham; Bakker, Dennis; Corver, Jeroen; Debast, Sylvia B.; Harmanus, Celine; Notermans, Daan W.; Bergwerff, Aldert A.; Dekker, Frido W.; Kuijper, Ed J.
2008-01-01
Since 2005, an increase in the prevalence of Clostridium difficile infection (CDI) due to polymerase chain reaction ribotype 078 has been noticed in The Netherlands. This strain has also been identified as the predominant strain in pigs and calves. CDI caused by type 078 was studied in relation to
Branched-chain amino acids for hepatic encephalopathy
DEFF Research Database (Denmark)
Als-Nielsen, B; Koretz, R L; Kjaergard, L L
2003-01-01
Hepatic encephalopathy may be caused by a decreased plasma ratio of branched-chain amino acids (BCAA) to aromatic amino acids. Treatment with BCAA may therefore have a beneficial effect on patients with hepatic encephalopathy.......Hepatic encephalopathy may be caused by a decreased plasma ratio of branched-chain amino acids (BCAA) to aromatic amino acids. Treatment with BCAA may therefore have a beneficial effect on patients with hepatic encephalopathy....
Directory of Open Access Journals (Sweden)
Mohammad Rubayet Hasan
2014-01-01
Full Text Available BACKGROUND: Bordetella pertussis infections continue to be a major public health challenge in Canada. Polymerase chain reaction (PCR assays to detect B pertussis are typically based on the multicopy insertion sequence IS481, which offers high sensitivity but lacks species specificity.
Rapid quantification of semen hepatitis B virus DNA by real-time polymerase chain reaction
Qian, Wei-Ping; Tan, Yue-Qiu; Chen, Ying; Peng, Ying; Li, Zhi; Lu, Guang-Xiu; Lin, Marie C.; Kung, Hsiang-Fu; He, Ming-Ling; Shing, Li-Ka
2005-01-01
AIM: To examine the sensitivity and accuracy of real-time polymerase chain reaction (PCR) for the quantification of hepatitis B virus (HBV) DNA in semen. METHODS: Hepatitis B viral DNA was isolated from HBV carriers’ semen and sera using phenol extraction method and QIAamp DNA blood mini kit (Qiagen, Germany). HBV DNA was detected by conventional PCR and quantified by TaqMan technology-based real-time PCR (quantitative polymerase chain reaction (qPCR)). The detection threshold was 200 copies of HBV DNA for conventional PCR and 10 copies of HBV DNA for real time PCR per reaction. RESULTS: Both methods of phenol extraction and QIAamp DNA blood mini kit were suitable for isolating HBV DNA from semen. The value of the detection thresholds was 500 copies of HBV DNA per mL in the semen. The viral loads were 7.5 × 107 and 1.67 × 107 copies of HBV DNA per mL in two HBV infected patients’ sera, while 2.14 × 105 and 3.02 × 105 copies of HBV DNA per mL in the semen. CONCLUSION: Real-time PCR is a more sensitive and accurate method to detect and quantify HBV DNA in the semen. PMID:16149152
Directory of Open Access Journals (Sweden)
Wen-Pin Chou
2017-02-01
Full Text Available Polymerase chain reaction (PCR has been one of the principal techniques of molecular biology and diagnosis for decades. Conventional PCR platforms, which work by rapidly heating and cooling the whole vessel, need complicated hardware designs, and cause energy waste and high cost. On the other hand, partial heating on the various locations of vessels to induce convective solution flows by buoyancy have been used for DNA amplification in recent years. In this research, we develop a new convective PCR platform, capillary loop convective polymerase chain reaction (clcPCR, which can generate one direction flow and make the PCR reaction more stable. The U-shaped loop capillaries with 1.6 mm inner diameter are designed as PCR reagent containers. The clcPCR platform utilizes one isothermal heater for heating the bottom of the loop capillary and a CCD device for detecting real-time amplifying fluorescence signals. The stable flow was generated in the U-shaped container and the amplification process could be finished in 25 min. Our experiments with different initial concentrations of DNA templates demonstrate that clcPCR can be applied for precise quantification. Multiple sample testing and real-time quantification will be achieved in future studies.
Polymerase chain reaction: A molecular diagnostic tool in periodontology
Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam
2016-01-01
This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease. PMID:27143822
Real-Time Polymerase Chain Reaction: Applications in Diagnostic Microbiology
Directory of Open Access Journals (Sweden)
Kordo B. A. Saeed
2013-11-01
Full Text Available The polymerase chain reaction (PCR has revolutionized the detection of DNA and RNA. Real-Time PCR (RT-PCR is becoming the gold standard test for accurate, sensitive and fast diagnosis for a large range of infectious agents. Benefits of this procedure over conventional methods for measuring RNA include its sensitivity, high throughout and quantification. RT-PCR assays have advanced the diagnostic abilities of clinical laboratories particularly microbiology and infectious diseases. In this review we would like to briefly discuss RT-PCR in diagnostic microbiology laboratory, beginning with a general introduction to RT-PCR and its principles, setting up an RT PCR, including multiplex systems and the avoidance and remediation of contamination issues. A segment of the review would be devoted to the application of RT-PCR in clinical practice concentrating on its role in the diagnosis and treatment of infectious diseases.
DEFF Research Database (Denmark)
Blair, D.; Waycott, M.; Byrne, L.
2006-01-01
This work was prompted by the need to be able to identify the invasive mussel species, Perna viridis, in tropical Australian seas using techniques that do not rely solely on morphology. DNA-based molecular methods utilizing a polymerase chain reaction (PCR) approach were developed to distinguish...
Miller, Kennon; Harrington, Susan M; Procop, Gary W
2015-08-01
New molecular diagnostic tests are attractive because of the potential they hold for improving diagnostics in microbiology. The value of these tests, which is often assumed, should be investigated to determine the best use of these potentially powerful tools. To investigate the usefulness of broad-range polymerase chain reaction (PCR), followed by sequencing, in mycobacterial infections. We reviewed the test performance of acid-fast bacilli (AFB) PCR and traditional diagnostic methods (histopathology, AFB smear, and culture). We assessed the diagnostic effect and cost of the unrestricted ordering of broad-range PCR for the detection and identification of mycobacteria in clinical specimens. The AFB PCR was less sensitive than culture and histopathology and was less specific than culture, AFB smear, and histopathology. During 18 months, $93 063 was spent on 183 patient specimens for broad-range PCR and DNA sequencing for mycobacteria to confirm one culture-proven Mycobacterium tuberculosis infection that was also known to be positive by AFB smear and histopathology. In this cohort, there was a false-negative AFB PCR for M tuberculosis and a false-positive AFB PCR for Mycobacterium lentiflavum . Testing of AFB smear-negative specimens from patients without an inflammatory response supportive of a mycobacterial infection is costly and has not been proven to improve patient care. Traditional diagnostics (histopathology, AFB smear, and culture) should remain the primary methods for the detection of mycobacteria in clinical specimens.
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Laboratory procedure recommended for... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... tracheal swabs in PBS or 1 mL of broth culture by a non-phenolic procedure. Centrifuge samples at 14,000 x...
Directory of Open Access Journals (Sweden)
Людмила Мар’янівна Іщенко
2016-11-01
Full Text Available Approbation of diagnostic tests for species identification of beef, pork and chicken by real time polymerase chain reaction method was done. Meat food, including heat treated and animal feed, was used for research. The fact of inconsistencies was revealed for product composition of some meat products that is marked by manufacturer
International Nuclear Information System (INIS)
Tang Yabing; Xing Da; Zhu Debin; Liu Jinfeng
2007-01-01
Recently, we have reported an electrochemiluminescence polymerase chain reaction (ECL-PCR) method for detection of genetically modified organisms. The ECL-PCR method was further improved in the current study by introducing a multi-purpose nucleic acid sequence that was specific to the tris(bipyridine) ruthenium (TBR) labeled probe, into the 5' terminal of the primers. The method was applied to detect plant viruses. Conserved sequence of the plant viruses was amplified by PCR. The product was hybridized with a biotin labeled probe and a TBR labeled probe. The hybridization product was separated by streptavidin-coated magnetic beads, and detected by measuring the ECL signals of the TBR labeled. Under the optimized conditions, the experiment results show that the detection limit is 50 fmol of PCR products, and the signal-to-noise ratio is in excess of 14.6. The method was used to detect banana streak virus, banana bunchy top virus, and papaya leaf curl virus. The experiment results show that this method could reliably identity viruses infected plant samples. The improved ECL-PCR approach has higher sensitivity and lower cost than previous approach. It can effectively detect the plant viruses with simplicity, stability, and high sensitivity
DNA extraction from coral reef sediment bacteria for the polymerase chain reaction.
Guthrie, J N; Moriarty, D J; Blackall, L L
2000-12-15
A rapid and effective method for the direct extraction of high molecular weight amplifiable DNA from two coral reef sediments was developed. DNA was amplified by the polymerase chain reaction (PCR) using 16S rDNA specific primers. The amplicons were digested with HaeIII, HinP1I and MspI and separated using polyacrylamide gel electrophoresis and silver staining. The resulting amplified ribosomal DNA restriction analysis (ARDRA) patterns were used as a fingerprint to discern differences between the coral reef sediment samples. Results indicated that ARDRA is an effective method for determining differences within the bacterial community amongst different environmental samples.
Polymerase chain reaction in unilateral cases of presumed viral anterior uveitis
Directory of Open Access Journals (Sweden)
Shoughy SS
2015-12-01
Full Text Available Samir S Shoughy,1 Hind M Alkatan,2,4 Abdulelah A Al-Abdullah,2 Albarah El-Khani,2 Jolanda DF de Groot-Mijnes,3 Khalid F Tabbara1,4,5 1Department of Ophthalmology, The Eye Center and The Eye Foundation for Research in Ophthalmology, 2Department of Pathology & Laboratory Medicine and Uveitis Division, King Khaled Eye Specialist Hospital, Riyadh, Saudi Arabia; 3Department of Virology and Ophthalmology, University Medical Center Utrecht, Utrecht, the Netherlands; 4Department of Ophthalmology, College of Medicine, King Saud University, Riyadh, Saudi Arabia; 5The Wilmer Ophthalmological Institute of The Johns Hopkins University School of Medicine, Baltimore, MD, USA Background and objectives: Anterior uveitis is the most common form of intraocular inflammation. The main aim of this study was to determine the viral etiology in patients with unilateral cases of anterior uveitis.Patients and methods: A total of 12 consecutive patients with the diagnosis of idiopathic unilateral anterior uveitis were included prospectively. Aqueous specimens were obtained from each patient by anterior chamber paracentesis and subjected to the detection of viral DNA/RNA genome by polymerase chain reaction assay for herpes simplex virus, varicella zoster virus, cytomegalovirus, Epstein–Barr virus, and rubella virus.Results: There were six male and six female patients. The mean age was 43 years, with an age range of 11–82 years. All 12 cases presented with unilateral anterior uveitis. In four (33% patients, polymerase chain reaction was positive for viral genome. Two patients were positive for herpes simplex virus type 1, one patient was positive for cytomegalovirus and one for Epstein–Barr virus.Conclusion: Recent molecular diagnostic assays would help in the identification of the causative agent in patients with unilateral anterior uveitis. Keywords: viral anterior uveitis, PCR, herpes simplex virus, cytomegalovirus, diffuse keratic precipitates, anterior chamber
Polymerase chain reaction-based discrimination of viable from non-viable Mycoplasma gallisepticum
Directory of Open Access Journals (Sweden)
Ching Giap Tan
2014-09-01
Full Text Available The present study was based on the reverse transcription polymerase chain reaction (RT-PCR of the 16S ribosomal nucleic acid (rRNA of Mycoplasma for detection of viable Mycoplasma gallisepticum. To determine the stability of M. gallisepticum 16S rRNA in vitro, three inactivation methods were used and the suspensions were stored at different temperatures. The 16S rRNA of M. gallisepticum was detected up to approximately 20–25 h at 37 °C, 22–25 h at 16 °C, and 23–27 h at 4 °C. The test, therefore, could detect viable or recently dead M. gallisepticum (< 20 h. The RT-PCR method was applied during an in vivo study of drug efficacy under experimental conditions, where commercial broiler-breeder eggs were inoculated with M. gallisepticum into the yolk. Hatched chicks that had been inoculated in ovo were treated with Macrolide 1. The method was then applied in a flock of day 0 chicks with naturally acquired vertical transmission of M. gallisepticum, treated with Macrolide 2. Swabs of the respiratory tract were obtained for PCR and RT-PCR evaluations to determine the viability of M. gallisepticum. This study proved that the combination of both PCR and RT-PCR enables detection and differentiation of viable from non-viable M. gallisepticum.
LENUS (Irish Health Repository)
Drew, Richard J
2012-03-01
Laboratory methods of diagnosis were examined for 266 children with invasive meningococcal disease. Seventy-five (36%) of 207 cases with bloodstream infection had both positive blood culture and blood meningococcal polymerase chain reaction (PCR), 130 (63%) negative blood culture and positive blood PCR, and 2 (1%) had positive blood culture and negative blood PCR. Sixty-three percent of cases were diagnosed by PCR alone.
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Laboratory procedures recommended for... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...
Tang, Min; Zhao, Xiao-Gang; Gu, Y. John; Chen, Chang-Zhi
The accurate temperature control of a polymerase chain reaction (PCR) thermocycler was exploited in developing an in vitro model to study neutrophil activation during cardiopulmonary bypass. Neutrophils from 12 volunteers underwent temperature changes in a PCR thermocycler (37 degrees C for 30
Giesendorf, B A; van Belkum, A; Koeken, A; Stegeman, H; Henkens, M H; van der Plas, J; Goossens, H; Niesters, H G; Quint, W G
The application of polymerase chain reaction (PCR) fingerprinting assays enables discrimination between species and strains of microorganisms. PCR primers aiming at arbitrary sequences in combination with primers directed against the repetitive extragenic palindrome (REP) or enterobacterial
A polymerase chain reaction-based methodology to detect gene doping.
Carter, Adam; Flueck, Martin
2012-04-01
The non-therapeutic use of genes to enhance athletic performance (gene doping) is a novel threat to the world of sports. Skeletal muscle is a prime target of gene therapy and we asked whether we can develop a test system to produce and detect gene doping. Towards this end, we introduced a plasmid (pCMV-FAK, 3.8 kb, 50 μg) for constitutive expression of the chicken homologue for the regulator of muscle growth, focal adhesion kinase (FAK), via gene electro transfer in the anti-gravitational muscle, m. soleus, or gastrocnemius medialis of rats. Activation of hypertrophy signalling was monitored by assessing the ribosomal kinase p70S6K and muscle fibre cross section. Detectability of the introduced plasmid was monitored with polymerase chain reaction in deoxyribonucleic acids (DNA) from transfected muscle and serum. Muscle transfection with pCMV-FAK elevated FAK expression 7- and 73-fold, respectively, and increased mean cross section by 52 and 16% in targeted muscle fibres of soleus and gastrocnemius muscle 7 days after gene electro transfer. Concomitantly p70S6K content was increased in transfected soleus muscle (+110%). Detection of the exogenous plasmid sequence was possible in DNA and cDNA of muscle until 7 days after transfection, but not in serum except close to the site of plasmid deposition, 1 h after injection and surgery. The findings suggest that the reliable detection of gene doping in the immoral athlete is not possible unless a change in the current practice of tissue sampling is applied involving the collection of muscle biopsy close to the site of gene injection.
Improved zeolite regeneration processes for preparing saturated branched-chain fatty acids
Ferrierite zeolite solid is an excellent catalyst for the skeletal isomerization of unsaturated linear-chain fatty acids (i.e., oleic acid) to unsaturated branched-chain fatty acids (i.e., iso-oleic acid) follow by hydrogenation to give saturated branched-chain fatty acids (i.e., isostearic acid). ...
DEFF Research Database (Denmark)
Randrianasolo, Bodo Sahondra; Jourdan, Peter Mark; Ravoniarimbinina, Pascaline
2015-01-01
BACKGROUND: The pathophysiology of female genital schistosomiasis (FGS) is only partially understood. This study aims to describe the histopathological findings, polymerase chain reaction (PCR) results, and gynecological manifestations of FGS in women with different intensities of Schistosoma hae...
Development of the polymerase chain reaction for diagnosis of chancroid.
Chui, L; Albritton, W; Paster, B; Maclean, I; Marusyk, R
1993-01-01
The published nucleotide sequences of the 16S rRNA gene of Haemophilus ducreyi were used to develop primer sets and probes for the diagnosis of chancroid by polymerase chain reaction (PCR) DNA amplification. One set of broad specificity primers yielded a 303-bp PCR product from all bacteria tested. Two 16-base probes internal to this sequence were species specific for H. ducreyi when tested with 12 species of the families Pasteurellaceae and Enterobacteriaceae. The two probes in combination with the broad specificity primers were 100% sensitive with 51 strains of H. ducreyi isolated from six continents over a 15-year period. The direct detection of H. ducreyi from 100 clinical specimens by PCR showed a sensitivity of 83 to 98% and a specificity of 51 to 67%, depending on the number of amplification cycles. Images PMID:8458959
Directory of Open Access Journals (Sweden)
Scott B Crown
Full Text Available The branched chain amino acids (BCAA valine, leucine and isoleucine have been implicated in a number of diseases including obesity, insulin resistance, and type 2 diabetes mellitus, although the mechanisms are still poorly understood. Adipose tissue plays an important role in BCAA homeostasis by actively metabolizing circulating BCAA. In this work, we have investigated the link between BCAA catabolism and fatty acid synthesis in 3T3-L1 adipocytes using parallel 13C-labeling experiments, mass spectrometry and model-based isotopomer data analysis. Specifically, we performed parallel labeling experiments with four fully 13C-labeled tracers, [U-13C]valine, [U-13C]leucine, [U-13C]isoleucine and [U-13C]glutamine. We measured mass isotopomer distributions of fatty acids and intracellular metabolites by GC-MS and analyzed the data using the isotopomer spectral analysis (ISA framework. We demonstrate that 3T3-L1 adipocytes accumulate significant amounts of even chain length (C14:0, C16:0 and C18:0 and odd chain length (C15:0 and C17:0 fatty acids under standard cell culture conditions. Using a novel GC-MS method, we demonstrate that propionyl-CoA acts as the primer on fatty acid synthase for the production of odd chain fatty acids. BCAA contributed significantly to the production of all fatty acids. Leucine and isoleucine contributed at least 25% to lipogenic acetyl-CoA pool, and valine and isoleucine contributed 100% to lipogenic propionyl-CoA pool. Our results further suggest that low activity of methylmalonyl-CoA mutase and mass action kinetics of propionyl-CoA on fatty acid synthase result in high rates of odd chain fatty acid synthesis in 3T3-L1 cells. Overall, this work provides important new insights into the connection between BCAA catabolism and fatty acid synthesis in adipocytes and underscores the high capacity of adipocytes for metabolizing BCAA.
A polymerase chain reaction strategy for the diagnosis of camelpox.
Balamurugan, Vinayagamurthy; Bhanuprakash, Veerakyathappa; Hosamani, Madhusudhan; Jayappa, Kallesh Danappa; Venkatesan, Gnanavel; Chauhan, Bina; Singh, Raj Kumar
2009-03-01
Camelpox is a contagious viral skin disease that is mostly seen in young camels. The disease is caused by the Camelpox virus (CMLV). In the present study, a polymerase chain reaction (PCR) assay based on the C18L gene (encoding ankyrin repeat protein) and a duplex PCR based on the C18L and DNA polymerase (DNA pol) genes were developed. The former assay yields a specific amplicon of 243 bp of the C18L gene, whereas the duplex PCR yields 243- and 96-bp products of the C18L and DNA pol genes, respectively, in CMLV, and only a 96-bp product of the DNA pol gene in other orthopoxviruses. The limit of detection was as low as 0.4 ng of viral DNA. Both PCR assays were employed successfully for the direct detection and differentiation of CMLV from other orthopoxviruses, capripoxviruses, and parapoxviruses in both cell culture samples and clinical material. Furthermore, a highly sensitive SYBR Green dye-based, real-time PCR was optimized for quantitation of CMLV DNA. In the standard curve of the quantitative assay, the melting temperature of the specific amplicon at 77.6 degrees C with peak measured fluorescence in dissociation plot was observed with an efficiency of 102%. To the authors' knowledge, this is the first report to describe a C18L gene-based PCR for specific diagnosis of camelpox infection.
Cabada, Miguel M.; Malaga, Jose L.; Castellanos-Gonzalez, Alejandro; Bagwell, Kelli A.; Naeger, Patrick A.; Rogers, Hayley K.; Maharsi, Safa; Mbaka, Maryann; White, A. Clinton
2017-01-01
Fasciola hepatica is the most widely distributed trematode infection in the world. Control efforts may be hindered by the lack of diagnostic capacity especially in remote endemic areas. Polymerase chain reaction (PCR)–based methods offer high sensitivity and specificity but require expensive technology. However, the recombinase polymerase amplification (RPA) is an efficient isothermal method that eliminates the need for a thermal cycler and has a high deployment potential to resource-limited settings. We report on the characterization of RPA and PCR tests to detect Fasciola infection in clinical stool samples with low egg burdens. The sensitivity of the RPA and PCR were 87% and 66%, respectively. Both tests were 100% specific showing no cross-reactivity with trematode, cestode, or nematode parasites. In addition, RPA and PCR were able to detect 47% and 26% of infections not detected by microscopy, respectively. The RPA adapted to a lateral flow platform was more sensitive than gel-based detection of the reaction products. In conclusion, the Fasciola RPA is a highly sensitive and specific test to diagnose chronic infection using stool samples. The Fasciola RPA lateral flow has the potential for deployment to endemic areas after further characterization. PMID:27821691
Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies.
Lorenz, Todd C
2012-05-22
In the biological sciences there have been technological advances that catapult the discipline into golden ages of discovery. For example, the field of microbiology was transformed with the advent of Anton van Leeuwenhoek's microscope, which allowed scientists to visualize prokaryotes for the first time. The development of the polymerase chain reaction (PCR) is one of those innovations that changed the course of molecular science with its impact spanning countless subdisciplines in biology. The theoretical process was outlined by Keppe and coworkers in 1971; however, it was another 14 years until the complete PCR procedure was described and experimentally applied by Kary Mullis while at Cetus Corporation in 1985. Automation and refinement of this technique progressed with the introduction of a thermal stable DNA polymerase from the bacterium Thermus aquaticus, consequently the name Taq DNA polymerase. PCR is a powerful amplification technique that can generate an ample supply of a specific segment of DNA (i.e., an amplicon) from only a small amount of starting material (i.e., DNA template or target sequence). While straightforward and generally trouble-free, there are pitfalls that complicate the reaction producing spurious results. When PCR fails it can lead to many non-specific DNA products of varying sizes that appear as a ladder or smear of bands on agarose gels. Sometimes no products form at all. Another potential problem occurs when mutations are unintentionally introduced in the amplicons, resulting in a heterogeneous population of PCR products. PCR failures can become frustrating unless patience and careful troubleshooting are employed to sort out and solve the problem(s). This protocol outlines the basic principles of PCR, provides a methodology that will result in amplification of most target sequences, and presents strategies for optimizing a reaction. By following this PCR guide, students should be able to: • Set up reactions and thermal cycling
PCR performance of a thermostable heterodimeric archaeal DNA polymerase
Killelea, Tom; Ralec, Céline; Bossé, Audrey; Henneke, Ghislaine
2014-01-01
DNA polymerases are versatile tools used in numerous important molecular biological core technologies like the ubiquitous polymerase chain reaction (PCR), cDNA cloning, genome sequencing, and nucleic acid based diagnostics. Taking into account the multiple DNA amplification techniques in use, different DNA polymerases must be optimized for each type of application. One of the current tendencies is to reengineer or to discover new DNA polymerases with increased performance and broadened substrate spectra. At present, there is a great demand for such enzymes in applications, e.g., forensics or paleogenomics. Current major limitations hinge on the inability of conventional PCR enzymes, such as Taq, to amplify degraded or low amounts of template DNA. Besides, a wide range of PCR inhibitors can also impede reactions of nucleic acid amplification. Here we looked at the PCR performances of the proof-reading D-type DNA polymerase from P. abyssi, Pab-polD. Fragments, 3 kilobases in length, were specifically PCR-amplified in its optimized reaction buffer. Pab-polD showed not only a greater resistance to high denaturation temperatures than Taq during cycling, but also a superior tolerance to the presence of potential inhibitors. Proficient proof-reading Pab-polD enzyme could also extend a primer containing up to two mismatches at the 3' primer termini. Overall, we found valuable biochemical properties in Pab-polD compared to the conventional Taq, which makes the enzyme ideally suited for cutting-edge PCR-applications. PMID:24847315
PCR performance of a thermostable heterodimeric archaeal DNA polymerase
Directory of Open Access Journals (Sweden)
Tom eKillelea
2014-05-01
Full Text Available DNA polymerases are versatile tools used in numerous important molecular biological core technologies like the ubiquitous polymerase chain reaction (PCR, cDNA cloning, genome sequencing and nucleic acid based diagnostics. Taking into account the multiple DNA amplification techniques in use, different DNA polymerases must be optimized for each type of application. One of the current tendencies is to reengineer or to discover new DNA polymerases with increased performance and broadened substrate spectra. At present, there is a great demand for such enzymes in applications, e.g., forensics or paleogenomics. Current major limitations hinge on the inability of conventional PCR enzymes, such as Taq, to amplify degraded or low amounts of template DNA. Besides, a wide range of PCR inhibitors can also impede reactions of nucleic acid amplification. Here we looked at the PCR performances of the proof-reading D-type DNA polymerase from P. abyssi, Pab-polD. Fragments, 3 kilobases in length, were specifically PCR-amplified in its optimized reaction buffer. Pab-polD showed not only a greater resistance to high denaturation temperatures than Taq during cycling, but also a superior tolerance to the presence of potential inhibitors. Proficient proof-reading Pab-polD enzyme could also extend a primer containing up to two mismatches at the 3’ primer termini. Overall, we found valuable biochemical properties in Pab-polD compared to the conventional Taq, which makes the enzyme ideally suited for cutting-edge PCR-applications.
Accuracy of real-time polymerase chain reaction for Toxoplasma gondii in amniotic fluid.
Wallon, Martine; Franck, Jacqueline; Thulliez, Philippe; Huissoud, Cyril; Peyron, François; Garcia-Meric, Patricia; Kieffer, François
2010-04-01
To provide clinicians with information about the accuracy of real-time polymerase chain reaction (PCR) analysis of amniotic fluid for the prenatal diagnosis of congenital Toxoplasma infection. This was a prospective cohort study of women with Toxoplasma infection identified by prenatal screening in three centers routinely carrying out real-time PCR for the detection of Toxoplasma gondii in amniotic fluid. The data available were gestational age at maternal infection, types and dates of maternal treatment, results of amniocentesis and neonatal work-up and definitive infectious status of the child. We estimated sensitivity, specificity and positive and negative predictive values both overall and per trimester of pregnancy at the time of maternal infection. Polymerase chain reaction analysis was carried out on amniotic fluid for 261 of the 377 patients included (69%). It was accurate with the exception of four negative results in children who were infected. Overall sensitivity and negative predictive value were 92.2% (95% confidence interval [CI] 81-98%) and 98.1% (95% CI 95-99.5%), respectively. There was no significant association with the trimester of pregnancy during which maternal infection occurred. Specificity and positive predictive values of 100% were obtained for all trimesters. Real-time PCR analysis significantly improves the detection of T. gondii on amniotic fluid. It provides an accurate tool to predict fetal infection and to decide on appropriate treatment and surveillance. However, postnatal follow-up remains necessary in the first year of life to fully exclude infection in children for whom PCR results were negative. III.
Hammond, R W; Crosslin, J M; Pasini, R; Howell, W E; Mink, G I
1999-07-01
Prunus necrotic ringspot ilarvirus (PNRSV) exists as a number of biologically distinct variants which differ in host specificity, serology, and pathology. Previous nucleotide sequence alignment and phylogenetic analysis of cloned reverse transcription-polymerase chain reaction (RT-PCR) products of several biologically distinct sweet cherry isolates revealed correlations between symptom type and the nucleotide and amino acid sequences of the 3a (putative movement protein) and 3b (coat protein) open reading frames. Based upon this analysis, RT-PCR assays have been developed that can identify isolates displaying different symptoms and serotypes. The incorporation of primers in a multiplex PCR protocol permits rapid detection and discrimination among the strains. The results of PCR amplification using type-specific primers that amplify a portion of the coat protein gene demonstrate that the primer-selection procedure developed for PNRSV constitutes a reliable method of viral strain discrimination in cherry for disease control and will also be useful for examining biological diversity within the PNRSV virus group.
Chacón, Jorge Luis; Brandão, Paulo E; Buim, Marcos; Villarreal, Laura; Ferreira, Antonio J Piantino
2007-10-01
Subtype B avian metapneumovirus (aMPV) was isolated and detected by reverse transcriptase-polymerase chain reaction (RT-PCR) in Brazilian commercial laying chicken flocks with no history of vaccination against aMPV and presenting respiratory signs and decreased egg production. RT-PCR results from samples from three affected flocks revealed that the three isolates were subtype B. Partial sequence analysis of the G glycoprotein gene confirmed that the samples belonged to subtype B and were not of the vaccine type. Comparison of nucleotide and amino acid sequences of the G gene of the three Brazilian aMPV samples with subtype B isolates from other countries revealed 95.1% to 96.1% identity. Nucleotide sequences showed 100% identity among the Brazilian subtype B samples and 95.6% identity with the subtype B vaccine strain used in Brazil. This work describes the circulation of subtype B aMPV in Brazil and discusses its importance in terms of disease epidemiology.
James, Ameh; Macdonald, Joanne
2015-01-01
Isothermal molecular diagnostics are bridging the technology gap between traditional diagnostics and polymerase chain reaction-based methods. These new techniques enable timely and accurate testing, especially in settings where there is a lack of infrastructure to support polymerase chain reaction facilities. Despite this, there is a significant lack of uptake of these technologies in developing countries where they are highly needed. Among these novel isothermal technologies, recombinase polymerase amplification (RPA) holds particular potential for use in developing countries. This rapid nucleic acid amplification approach is fast, highly sensitive and specific, and amenable to countries with a high burden of infectious diseases. Implementation of RPA technology in developing countries is critically required to assess limitations and potentials of the diagnosis of infectious disease, and may help identify impediments that prevent adoption of new molecular technologies in low resource- and low skill settings. This review focuses on approaching diagnosis of infectious disease with RPA.
Bondarenko, N P; Lakatosh, V P; Lakatosh, P V; Malanchuk, O B; Poladich, I V
2015-01-01
The combined method of diagnosis parvovirus infection during pregnancy by maternal serum enzyme immunoassay and deoxyribonucleic acid isolation parvovirus B19 polymerase chain reaction in amnniotic fluid and fetal cord blood newborns, can diagnose vertical transmission and anticipate a negative effect on the fetus parvovirus. Lack of maternal IgM antibodies in serum due to parvovirus seroconversion during pregnancy does not exclude the persistence of the virus in the fetus. To analyze the diagnostic value of the method for determining the LHP parvovirus B19 DNA in the amniotic fluid, umbilical cord blood of newborns to determine vertical transmission of parvovirus infection when infected mothers B19 during pregnancy.
Side Chain Cyclized Aromatic Amino Acids
DEFF Research Database (Denmark)
Van der Poorten, Olivier; Knuhtsen, Astrid; Sejer Pedersen, Daniel
2016-01-01
Constraining the conformation of flexible peptides is a proven strategy to increase potency, selectivity, and metabolic stability. The focus has mostly been on constraining the backbone dihedral angles; however, the correct orientation of the amino acid side chains (χ-space) that constitute...... the peptide pharmacophore is equally important. Control of χ-space utilizes conformationally constrained amino acids that favor, disfavor, or exclude the gauche (-), the gauche (+), or the trans conformation. In this review we focus on cyclic aromatic amino acids in which the side chain is connected...... to the peptide backbone to provide control of χ(1)- and χ(2)-space. The manifold applications for cyclized analogues of the aromatic amino acids Phe, Tyr, Trp, and His within peptide medicinal chemistry are showcased herein with examples of enzyme inhibitors and ligands for G protein-coupled receptors....
Cancilla, M R; Powell, I B; Hillier, A J; Davidson, B E
1992-01-01
Arbitrarily primed polymerase chain reaction, with incorporation of either radioactive or fluorescent labels, was used as a rapid and sensitive method for obtaining genomic fingerprints of strains of Lactococcus lactis. Closely related strains produced almost identical fingerprints. Fingerprints of other strains showed only some similarities.
Directory of Open Access Journals (Sweden)
Shyamal G
2005-01-01
Full Text Available Purpose: To standardize and apply a polymerase chain reaction (PCR on the glycoprotein D gene to differentiate Herpes simplex virus (HSV 1 & 2 serotypes in culture negative intraocular specimens. Methods: Twenty-one intraocular fluids collected from 19 patients were subjected to cultures for HSV and uniplex PCR (uPCR for DNA polymerase gene. To differentiate HSV serotypes, as 1 & 2, a seminested PCR (snPCR targeting the glycoprotein D gene was standardised and applied onto 21 intraocular fluids. The specificity of the snPCR was verified by application onto ATCC strains of HSV 1 and 2, clinical isolates and DNA sequencing of the amplified products. All specimens were also tested for the presence of cytomegalovirus (CMV and varicella zoster virus (VZV by nucleic acid amplification methods. Results: Four of the 21 intraocular fluids were positive for HSV by uPCR. snPCR detected HSV in three additional specimens (total of seven specimens, and identified three as HSV 1 and four as HSV 2. DNA sequencing of PCR products showed 100% homology with the standard strains of HSV 1 and 2 respectively. None of the samples were positive in culture. Among the other patients, CMV DNA was detected in two and VZV DNA in five others. Conclusions: The standardized snPCR can be applied directly onto the culture negative specimens for rapid differentiation of HSV serotypes.
Importance of medium chain fatty acids in animal nutrition
Baltić, B.; Starčević, M.; Đorđević, J.; Mrdović, B.; Marković, R.
2017-09-01
Fats in animal and human nutrition are a common subject of research. These studies most often pay attention to particular fat groups (saturated, unsaturated, polyunsaturated fats or fats grouped by the length of their fatty acid chains into short, medium or long chain fatty acids). Medium chain fatty acids (MCFAs) have two main sources: milk and coconut oil. To date, research has shown these acids have positive effects on health, production, feed digestibility and lower body and muscle fats in broilers and swine. MCFAs possess antibacterial, anticoccidial and antiviral effects. Also, it has been proven that these acids act synergistically if they are used together with organic acids, essential oils, or probiotics. Nowadays, commercial MCFA products are available for use in animal nutrition as feed additives.
Directory of Open Access Journals (Sweden)
Jennifer A. Scoble
2013-10-01
Full Text Available A late preterm neonate born by cesarean section with intact membranes presented at 9 days of life with shock and liver failure. Surface cultures were negative but whole blood polymerase chain reaction was positive for herpes simplex virus type 2, underscoring the value of this test in early diagnosis of perinatally acquired disseminated herpes simplex virus infection without skin lesions.
Figueroa, J V; Alvarez, J A; Ramos, J A; Vega, C A; Buening, G M
1993-01-01
A study was conducted to test the applicability of a Polymerase Chain Reaction (PCR)-based approach for the simultaneous detection of the bovine hemoparasites Babesia bigemina, B. bovis and Anaplasma marginale. Bovine blood samples from cattle ranches of a previously determined enzootic zone in the Yucatan Peninsula of Mexico, were collected from peripheral blood and processed for PCR analysis. Blood samples were subjected to DNA amplification by placing an aliquot in a reaction tube containing oligonucleotide primers specific for DNA of each hemoparasite species. The PCR products were detected by Dot-Blot nucleic acid hybridization utilizing nonradioactive, species-specific, digoxigenin PCR-labeled DNA probes. Four hundred twenty one field samples analyzed by the multiplex PCR-DNA probe assay showed 66.7%, 60.1% and 59.6% prevalence rates for B. bigemina, B. bovis and A. marginale, respectively. The multiplex PCR analysis showed that animals with single, double or triple infection could be detected with the parasite specific DNA probes. The procedure is proposed as a valuable tool for the epidemiological analysis in regions where the hemoparasite species are concurrently infecting cattle.
DEFF Research Database (Denmark)
Wittig, Rainer; Salowsky, Rüdiger; Blaich, Stephanie
2005-01-01
Combining multiplex reverse transcription-polymerase chain reaction (mRT-PCR) with microfluidic amplicon analysis, we developed an assay for the rapid and reliable semiquantitative expression screening of 11 candidate genes for drug resistance in human malignant melanoma. The functionality of thi...
Su, Guoming; Fu, Zhuqing; Hu, Liren; Wang, Yueying; Zhao, Zuguo; Yang, Weiqing
2015-01-01
We aim to evaluate the accuracy of the 16S ribosomal ribonucleic acid (rRNA) gene polymerase chain reaction (PCR) test in the diagnosis of bloodstream infections through a systematic review and meta-analysis. A computerized literature search was conducted to identify studies that assessed the diagnostic value of 16S rRNA gene PCR test for bloodstream infections. Study quality was assessed using the revised Quality Assessment of Diagnostic Accuracy Studies (QUADAS-2) tool. We calculated the sensitivity, specificity, positive likelihood ratio (PLR), negative likelihood ratio (NLR), diagnostic odds ratio (DOR) and their 95% confidence intervals (95% CI) for each study. Summary receiver operating characteristic (SROC) curve was used to summarize overall test performance. Statistical analysis was performed in Meta-DiSc 1.4 and Stata/SE 12.0 software. Twenty-eight studies were included in our meta-analysis. Using random-effect model analysis, the pooled sensitivity, specificity, PLR, NLR, and DOR were 0.87 (95% CI, 0.85-0.89), 0.94 (95% CI, 0.93-0.95), 12.65 (95% CI, 8.04-19.90), 0.14 (95% CI, 0.08-0.24), and 116.76 (95% CI, 52.02-262.05), respectively. The SROC curve indicated that the area under the curve (AUC) was 0.9690 and the maximum joint sensitivity and specificity (Q*) was 0.9183. In addition, heterogeneity was statistically significant but was not caused by the threshold effect. Existing data suggest that 16S rRNA gene PCR test is a practical tool for the rapid screening of sepsis. Further prospective studies are needed to assess the diagnostic value of PCR amplification and DNA microarray hybridization of 16S rRNA gene in the future.
Enhancing the efficiency of polymerase chain reaction using graphene nanoflakes.
Abdul Khaliq, R; Kafafy, Raed; Salleh, Hamzah Mohd; Faris, Waleed Fekry
2012-11-16
The effect of the recently developed graphene nanoflakes (GNFs) on the polymerase chain reaction (PCR) has been investigated in this paper. The rationale behind the use of GNFs is their unique physical and thermal properties. Experiments show that GNFs can enhance the thermal conductivity of base fluids and results also revealed that GNFs are a potential enhancer of PCR efficiency; moreover, the PCR enhancements are strongly dependent on GNF concentration. It was found that GNFs yield DNA product equivalent to positive control with up to 65% reduction in the PCR cycles. It was also observed that the PCR yield is dependent on the GNF size, wherein the surface area increases and augments thermal conductivity. Computational fluid dynamics (CFD) simulations were performed to analyze the heat transfer through the PCR tube model in the presence and absence of GNFs. The results suggest that the superior thermal conductivity effect of GNFs may be the main cause of the PCR enhancement.
Evidence of simian retrovirus type D by polymerase chain reaction.
Hwa, Christian Z R; Tsai, Sheung Pun; Yee, JoAnn L; Van Rompay, Koen K; Roberts, Jeffrey A
2017-06-01
Over the past few years, there have been reports of finding Simian retrovirus type D (SRV) in macaque colonies where some animals were characterized as antibody positive but virus negative raising questions about how SRV was transmitted or whether there is a variant strain detected by antibody but not polymerase chain reaction (PCR) in current use. We developed a three-round nested PCR assay using degenerate primers targeting the pol gene to detect for SRV serotypes 1-5 and applied this newly validated PCR assay to test macaque DNA samples collected in China from 2010 to 2015. Using the nested PCR assay validated in this study, we found 0.15% of the samples archived on FTA ® cards were positive. The source of SRV infection identified within domestic colonies might have originated from imported macaques. The multiplex nested PCR assay developed here may supplement the current assays for SRV. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Li, Weina; Li, Xuesong; Zhu, Wei; Li, Changxu; Xu, Dan; Ju, Yong; Li, Guangtao
2011-07-21
Based on a topochemical approach, a strategy for efficiently producing main-chain poly(bile acid)s in the solid state was developed. This strategy allows for facile and scalable synthesis of main-chain poly(bile acid)s not only with high molecular weights, but also with quantitative conversions and yields.
Diagnostic value of polymerase chain reaction analysis of skin biopsies in purpura fulminans.
Beau, Caroline; Vlassova, Natalia; Sarlangue, Jean; Brissaud, Olivier; Léauté-Labrèze, Christine; Boralevi, Franck
2013-01-01
Even though prompt diagnosis and treatment of purpura fulminans (PF) is essential to reduce mortality, early administration of antibiotics may preclude identification of the causative agent by standard bacterial cultures and thus render definitive diagnosis impossible. Here we present a case of an infant with PF and negative bacterial cultures for whom polymerase chain reaction (PCR) analysis of a cutaneous biopsy specimen obtained 4 days after initiation of antibiotics identified the genomic sequence of Neisseria meningitidis genogroup C. When bacterial cultures fail to provide useful information, PCR of skin biopsy specimens can be a valuable diagnostic tool in PF. © 2013 Wiley Periodicals, Inc.
Mirsadraee, Majid; Shafahie, Ahmad; Reza Khakzad, Mohammad; Sankian, Mojtaba
2014-04-01
Anthracofibrosis is the black discoloration of the bronchial mucosa with deformity and obstruction. Association of this disease with tuberculosis (TB) was approved. The objective of this study was to find the additional benefit of assessment of TB by the polymerase chain reaction (PCR) method. Bronchoscopy was performed on 103 subjects (54 anthracofibrosis and 49 control subjects) who required bronchoscopy for their pulmonary problems. According to bronchoscopic findings, participants were classified to anthracofibrosis and nonanthracotic groups. They were examined for TB with traditional methods such as direct smear (Ziehl-Neelsen staining), Löwenstein-Jensen culture, and histopathology and the new method "PCR" for Mycobacterium tuberculosis genome (IS6110). Age, sex, smoking, and clinical findings were not significantly different in the TB and the non-TB groups. Acid-fast bacilli could be detected by a direct smear in 12 (25%) of the anthracofibrosis subjects, and adding the results of culture and histopathology traditional tests indicated TB in 27 (31%) of the cases. Mycobacterium tuberculosis was diagnosed by PCR in 18 (33%) patients, but the difference was not significant. Detection of acid-fast bacilli in control nonanthracosis subjects was significantly lower (3, 6%), but PCR (20, 40%) and accumulation of results from all traditional methods (22, 44%) showed a nonsignificant difference. The PCR method showed a result equal to traditional methods including accumulation of smear, culture, and histopathology.
Zambenedetti, Miriam Ribas; Pavoni, Daniela Parada; Dallabona, Andreia Cristine; Dominguez, Alejandro Correa; Poersch, Celina de Oliveira; Fragoso, Stenio Perdigão; Krieger, Marco Aurélio
2017-05-01
Real-time reverse transcription polymerase chain reaction (RT-PCR) is routinely used to detect viral infections. In Brazil, it is mandatory the use of nucleic acid tests to detect hepatitis C virus (HCV), hepatitis B virus and human immunodeficiency virus in blood banks because of the immunological window. The use of an internal control (IC) is necessary to differentiate the true negative results from those consequent from a failure in some step of the nucleic acid test. The aim of this study was the construction of virus-modified particles, based on MS2 bacteriophage, to be used as IC for the diagnosis of RNA viruses. The MS2 genome was cloned into the pET47b(+) plasmid, generating pET47b(+)-MS2. MS2-like particles were produced through the synthesis of MS2 RNA genome by T7 RNA polymerase. These particles were used as non-competitive IC in assays for RNA virus diagnostics. In addition, a competitive control for HCV diagnosis was developed by cloning a mutated HCV sequence into the MS2 replicase gene of pET47b(+)-MS2, which produces a non-propagating MS2 particle. The utility of MS2-like particles as IC was evaluated in a one-step format multiplex real-time RT-PCR for HCV detection. We demonstrated that both competitive and non-competitive IC could be successfully used to monitor the HCV amplification performance, including the extraction, reverse transcription, amplification and detection steps, without compromising the detection of samples with low target concentrations. In conclusion, MS2-like particles generated by this strategy proved to be useful IC for RNA virus diagnosis, with advantage that they are produced by a low cost protocol. An attractive feature of this system is that it allows the construction of a multicontrol by the insertion of sequences from more than one pathogen, increasing its applicability for diagnosing different RNA viruses.
Directory of Open Access Journals (Sweden)
Miriam Ribas Zambenedetti
Full Text Available BACKGROUND Real-time reverse transcription polymerase chain reaction (RT-PCR is routinely used to detect viral infections. In Brazil, it is mandatory the use of nucleic acid tests to detect hepatitis C virus (HCV, hepatitis B virus and human immunodeficiency virus in blood banks because of the immunological window. The use of an internal control (IC is necessary to differentiate the true negative results from those consequent from a failure in some step of the nucleic acid test. OBJECTIVES The aim of this study was the construction of virus-modified particles, based on MS2 bacteriophage, to be used as IC for the diagnosis of RNA viruses. METHODS The MS2 genome was cloned into the pET47b(+ plasmid, generating pET47b(+-MS2. MS2-like particles were produced through the synthesis of MS2 RNA genome by T7 RNA polymerase. These particles were used as non-competitive IC in assays for RNA virus diagnostics. In addition, a competitive control for HCV diagnosis was developed by cloning a mutated HCV sequence into the MS2 replicase gene of pET47b(+-MS2, which produces a non-propagating MS2 particle. The utility of MS2-like particles as IC was evaluated in a one-step format multiplex real-time RT-PCR for HCV detection. FINDINGS We demonstrated that both competitive and non-competitive IC could be successfully used to monitor the HCV amplification performance, including the extraction, reverse transcription, amplification and detection steps, without compromising the detection of samples with low target concentrations. In conclusion, MS2-like particles generated by this strategy proved to be useful IC for RNA virus diagnosis, with advantage that they are produced by a low cost protocol. An attractive feature of this system is that it allows the construction of a multicontrol by the insertion of sequences from more than one pathogen, increasing its applicability for diagnosing different RNA viruses.
DEFF Research Database (Denmark)
Krog, Grethe Risum; Clausen, Frederik Banch; Dziegiel, Morten Hanefeld
2007-01-01
Determination of RHD zygosity of the spouse is crucial in preconception counseling of families with history of hemolytic disease of the fetus and newborn caused by anti-D. RHD zygosity can be determined by quantitative real-time polymerase chain reaction (PCR) basically by determining RHD dosage,......, and this feature is relevant in investigating RHD mosaicism and chimerism....
Directory of Open Access Journals (Sweden)
Trioso Purnawarman
2014-04-01
Full Text Available Sensitivity and specificity of nested polymerase chain reaction (nested PCR to detect Coxiella burnetii(C. burnetii DNA were studied. The primer system which consists of external primers (OMP1 and OMP2and internal primers (OMP3 and OMP4, was designed from the nucleotide sequence of the com I geneencoding for 27 kDa outer membrane protein and used to specifically amplify a 501 bp and 438 bp fragment.This nested PCR assay was 50 fold more sensitive than that of using PCR external primer only. TheNested PCR has a detection limit as low as 300 pg/?l. Specificity studies showed that nested PCR onlydetected C. burnetii DNA and did not happened Brucella abortus, Escherichia coli, Pseudomonas aeruginosaand Campylobacter Jejuni DNA. Nested PCR has high senstively and specificaly diagnostic method of C.burnetii as agent of Q fever disease.
Catabolism of leucine to branched-chain fatty acids in Staphylococcus xylosus
DEFF Research Database (Denmark)
Beck, Hans Christian; Hansen, A M; Lauritsen, F R
2004-01-01
Staphylococcus xylosus is an important starter culture in the production of flavours from the branched-chain amino acids leucine, valine and isoleucine in fermented meat products. The sensorially most important flavour compounds are the branched-chain aldehydes and acids derived from the correspo......Staphylococcus xylosus is an important starter culture in the production of flavours from the branched-chain amino acids leucine, valine and isoleucine in fermented meat products. The sensorially most important flavour compounds are the branched-chain aldehydes and acids derived from...
Comparison of isoelectric focusing and polymerase chain reaction for the detection of β-lactamases
Directory of Open Access Journals (Sweden)
Sharma J
2010-01-01
Full Text Available Extended spectrum β-lactamases (ESBLs have been observed in virtually all the species of family Enterobacteriaceae. Threat posed by antibiotic resistance because of ESBLs is more serious as a number of technical problems are associated with the detection of these enzymes. Although a number of detection methods have been designed for ESBLs, every method has its own benefits and shortcomings as well. In earlier days, isoelectric focusing (IEF was used as the gold standard for ESBL detection. This study was undertaken to compare IEF with polymerase chain reaction, a method which has been extensively used for ESBL detection these days.
Sumi, Ryosuke; Miyake, Ariko; Endo, Taiji; Ohsato, Yoshiharu; Ngo, Minh Ha; Nishigaki, Kazuo
2018-04-01
Feline lymphomas are associated with the transduction and activation of cellular proto-oncogenes, such as c-myc, by feline leukemia virus (FeLV). We describe a polymerase chain reaction assay for detection of myc transduction usable in clinical diagnosis. The assay targets c-myc exons 2 and 3, which together result in a FeLV-specific fusion gene following c-myc transduction. When this assay was conducted on FeLV-infected feline tissues submitted for clinical diagnosis of tumors, myc transduction was detected in 14% of T-cell lymphoma/leukemias. This newly established system could become a useful diagnostic tool in veterinary medicine.
Siqueira, José F; Rôças, Isabela N
2003-08-01
Propionibacterium propionicus and the recently described species Actinomyces radicidentis have been isolated from infections of endodontic origin; nevertheless, the possibility exists that their actual prevalence may have been underestimated by culture. The purpose of our study was to assess the occurrence of these 2 species in different types of endodontic infections by using the sensitive 16S rDNA-based nested polymerase chain reaction approach. To detect these 2 species, nested polymerase chain reaction was performed directly in samples taken from primary endodontic infections associated with asymptomatic periradicular lesions, acute apical periodontitis, or acute periradicular abscesses and in samples from patients in whom endodontic therapy had failed. DNA was extracted from the samples and initially amplified by using universal 16S rDNA primers. In the second round of amplification, the first polymerase chain reaction products were used to detect a specific 16S rDNA fragment of either P propionicus or A radicidentis. P propionicus was detected in 6/21 (29%) root canal samples from teeth with chronic periradicular lesions, in 5/10 (50%) cases diagnosed as acute apical periodontitis, and in 7/19 (37%) pus samples aspirated from acute periradicular abscesses. Overall, this species was found in 18/50 (36%) samples taken from primary endodontic infections. Of the root canal samples obtained from root-filled teeth with chronic periradicular lesions, P propionicus was detected in 7/12 (58%) cases. A radicidentis was detected in 1/21 (5%) root canal samples from teeth with chronic periradicular lesions and in 1/10 (10%) cases of acute apical periodontitis. No pus sample yielded this species. In general, A radicidentis was detected in 2/50 (4%) samples taken from primary endodontic infections and in 1/12 (8%) root canal samples taken from patients in whom endodontic treatment had failed. P propionicus was found in a relatively large number of patients with primary and
Maas, M.I.M.; Hopman, W.P.M.; Katan, M.B.; Jansen, J.B.M.J.
1996-01-01
Long-chain triglycerides inhibit gastric acid secretion, but the effect of medium-chain triglycerides in humans is unknown. We compared the effects of intraduodenally perfused saline, medium-chain and long-chain triglycerides on gastrin-stimulated gastric acid secretion and cholecystokinin release.
Identifying of meat species using polymerase chain reaction (PCR)
International Nuclear Information System (INIS)
Foong, Chow Ming; Sani, Norrakiah Abdullah
2013-01-01
Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing
Identifying of meat species using polymerase chain reaction (PCR)
Energy Technology Data Exchange (ETDEWEB)
Foong, Chow Ming; Sani, Norrakiah Abdullah [School of Chemical Sciences and Food Technology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600, Bangi, Selangor (Malaysia)
2013-11-27
Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.
A primer on on-demand polymerase chain reaction technology.
Spencer, Maureen; Barnes, Sue; Parada, Jorge; Brown, Scott; Perri, Luci; Uettwiller-Geiger, Denise; Johnson, Helen Boehm; Graham, Denise
2015-10-01
Efforts to reduce health care-associated infections (HAIs) have grown in both scale and sophistication over the past few decades; however, the increasing threat of antimicrobial resistance and the impact of new legislation regarding HAIs on health care economics make the fight against them all the more urgent. On-demand polymerase chain reaction (PCR) technology has proven to be a highly effective weapon in this fight, offering the ability to accurately and efficiently identify disease-causing pathogens such that targeted and directed therapy can be initiated at the point of care. As a result, on-demand PCR technology has far-reaching influences on HAI rates, health care outcomes, hospital length of stay, isolation days, patient satisfaction, antibiotic stewardship, and health care economics. The basics of on-demand PCR technology and its potential to impact health care have not been widely incorporated into health care education and enrichment programs for many of those involved in infection control and prevention, however. This article serves as a primer on on-demand PCR technology and its ramifications. Copyright © 2015 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.
Surger, Maximilian J; Angelov, Angel; Stier, Philipp; Übelacker, Maria; Liebl, Wolfgang
2018-01-01
Micrococcus luteus naturally produces alkenes, unsaturated aliphatic hydrocarbons, and represents a promising host to produce hydrocarbons as constituents of biofuels and lubricants. In this work, we identify the genes for key enzymes of the branched-chain amino acid catabolism in M. luteus , whose first metabolic steps lead also to the formation of primer molecules for branched-chain fatty acid and olefin biosynthesis, and demonstrate how these genes can be used to manipulate the production of specific olefins in this organism. We constructed mutants of several gene candidates involved in the branched-chain amino acid metabolism or its regulation and investigated the resulting changes in the cellular fatty acid and olefin profiles by GC/MS. The gene cluster encoding the components of the branched-chain α-keto acid dehydrogenase (BCKD) complex was identified by deletion and promoter exchange mutagenesis. Overexpression of the BCKD gene cluster resulted in about threefold increased olefin production whereas deletion of the cluster led to a drastic reduction in branched-chain fatty acid content and a complete loss of olefin production. The specificities of the acyl-CoA dehydrogenases of the branched amino acid degradation pathways were deduced from the fatty acid and olefin profiles of the respective deletion mutant strains. In addition, growth experiments with branched amino acids as the only nitrogen source were carried out with the mutants in order to confirm our annotations. Both the deletion mutant of the BCKD complex, responsible for the further degradation of all three branched-chain amino acids, as well as the deletion mutant of the proposed isovaleryl-CoA dehydrogenase (specific for leucine degradation) were not able to grow on leucine in contrast to the parental strain. In conclusion, our experiments allow the unambigous assignment of specific functions to the genes for key enzymes of the branched-chain amino acid metabolism of M. luteus . We also show how
Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats.
Lorch, Jeffrey M; Gargas, Andrea; Meteyer, Carol Uphoff; Berlowski-Zier, Brenda M; Green, D Earl; Shearn-Bochsler, Valerie; Thomas, Nancy J; Blehert, David S
2010-03-01
A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.
Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats
Lorch, J.M.; Gargas, A.; Meteyer, C.U.; Berlowski-Zier, B. M.; Green, D.E.; Shearn-Bochsler, V.; Thomas, N.J.; Blehert, D.S.
2010-01-01
A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.
Inhibition of telomerase by linear-chain fatty acids: a structural analysis.
Oda, Masako; Ueno, Takamasa; Kasai, Nobuyuki; Takahashi, Hirotada; Yoshida, Hiromi; Sugawara, Fumio; Sakaguchi, Kengo; Hayashi, Hideya; Mizushina, Yoshiyuki
2002-01-01
In the present study, we have found that mono-unsaturated linear-chain fatty acids in the cis configuration with C(18) hydrocarbon chains (i.e. oleic acid) strongly inhibited the activity of human telomerase in a cell-free enzymic assay, with an IC(50) value of 8.6 microM. Interestingly, fatty acids with hydrocarbon chain lengths below 16 or above 20 carbons substantially decreased the potency of inhibition of telomerase. Moreover, the cis-mono-unsaturated C(18) linear-chain fatty acid oleic acid was the strongest inhibitor of all the fatty acids tested. A kinetic study revealed that oleic acid competitively inhibited the activity of telomerase ( K (i)=3.06 microM) with respect to the telomerase substrate primer. The energy-minimized three-dimensional structure of the linear-chain fatty acid was calculated and modelled. A molecule width of 11.53-14.26 A (where 1 A=0.1 nm) in the C(16) to C(20) fatty acid structure was suggested to be important for telomerase inhibition. The three-dimensional structure of the telomerase active site (i.e. the substrate primer-binding site) appears to have a pocket that could bind oleic acid, with the pocket being 8.50 A long and 12.80 A wide. PMID:12121150
Espinoza-Herrera, Shirly J; Gaur, Vineet; Suo, Zucai; Carey, Paul R
2013-07-23
Y-Family DNA polymerases are known to bypass DNA lesions in vitro and in vivo. Sulfolobus solfataricus DNA polymerase (Dpo4) was chosen as a model Y-family enzyme for investigating the mechanism of DNA synthesis in single crystals. Crystals of Dpo4 in complexes with DNA (the binary complex) in the presence or absence of an incoming nucleotide were analyzed by Raman microscopy. (13)C- and (15)N-labeled d*CTP, or unlabeled dCTP, were soaked into the binary crystals with G as the templating base. In the presence of the catalytic metal ions, Mg(2+) and Mn(2+), nucleotide incorporation was detected by the disappearance of the triphosphate band of dCTP and the retention of *C modes in the crystal following soaking out of noncovalently bound C(or *C)TP. The addition of the second coded base, thymine, was observed by adding cognate dTTP to the crystal following a single d*CTP addition. Adding these two bases caused visible damage to the crystal that was possibly caused by protein and/or DNA conformational change within the crystal. When d*CTP is soaked into the Dpo4 crystal in the absence of Mn(2+) or Mg(2+), the primer extension reaction did not occur; instead, a ternary protein·template·d*CTP complex was formed. In the Raman difference spectra of both binary and ternary complexes, in addition to the modes of d(*C)CTP, features caused by ring modes from the template/primer bases being perturbed and from the DNA backbone appear, as well as features from perturbed peptide and amino acid side chain modes. These effects are more pronounced in the ternary complex than in the binary complex. Using standardized Raman intensities followed as a function of time, the C(*C)TP population in the crystal was maximal at ∼20 min. These remained unchanged in the ternary complex but declined in the binary complexes as chain incorporation occurred.
Lee, Hyun-A; Hong, Sunhwa; Chung, Yungho; Kim, Okjin
2011-09-01
Eimeria tenella and Eimeria maxima are important pathogens causing intracellular protozoa infections in laboratory avian animals and are known to affect experimental results obtained from contaminated animals. This study aimed to find a fast, sensitive, and efficient protocol for the molecular identification of E. tenella and E. maxima in experimental samples using chickens as laboratory avian animals. DNA was extracted from fecal samples collected from chickens and polymerase chain reaction (PCR) analysis was employed to detect E. tenella and E. maxima from the extracted DNA. The target nucleic acid fragments were specifically amplified by PCR. Feces secreting E. tenella and E. maxima were detected by a positive PCR reaction. In this study, we were able to successfully detect E. tenella and E. maxima using the molecular diagnostic method of PCR. As such, we recommended PCR for monitoring E. tenella and E. maxima in laboratory avian facilities.
Wilkes, Rebecca P; Tsai, Yun-Long; Lee, Pei-Yu; Lee, Fu-Chun; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas
2014-09-09
Canine distemper virus (CDV) has been associated with outbreaks of canine infectious respiratory disease in shelters and boarding kennel environments. POCKITTM Nucleic Acid Analyzer is a field-deployable device capable of generating automatically interpreted insulated isothermal polymerase chain reaction (iiPCR) results from extracted nucleic acid within one hour. In this study, reverse transcription iiPCR (RT-iiPCR) was developed to facilitate point-of-need diagnosis of CDV infection. Analytical sensitivity (limit of detection 95%) of the established CDV RT-iiPCR was about 11 copies of in vitro transcribed RNA per reaction. CDV RT-iiPCR generated positive signals from CDV, but not Bordetella bronchiseptica, canine parvovirus, canine herpesvirus, canine adenovirus 2, canine influenza virus (subtype H3N8), canine parainfluenza virus, and canine respiratory coronavirus. To evaluate accuracy of the established reaction in canine distemper clinical diagnosis, 110 specimens from dogs, raccoons, and foxes suspected with CDV infection were tested simultaneously by CDV RT-iiPCR and real-time RT-PCR. CDV RT-iiPCR demonstrated excellent sensitivity (100%) and specificity (100%), compared to real-time RT-PCR. The results indicated an excellent correlation between RT-iiPCR and a reference real time RT-PCR method. Working in a lyophilized format, the established method has great potential to be used for point-of-care diagnosis of canine distemper in animals, especially in resource-limited facilities.
Role of multiplex polymerase chain reaction in diagnosing tubercular meningitis
Directory of Open Access Journals (Sweden)
Anupam Berwal
2017-01-01
Full Text Available Tuberculous meningitis (TBM is one of the most serious manifestations of extrapulmonary tuberculosis. Timely and accurate diagnosis provides a favorable prognosis in patients with TBM. The study evaluated the use of multiplex polymerase chain reaction (PCR in the diagnosis of TBM. A study was conducted on 74 patients clinically suspected with TBM. The cerebrospinal fluid (CSF specimens were processed for smear microscopy, middle brook 7H9 culture, and multiplex PCR using primers directed against IS6110 gene and 38 kD protein for detection of Mycobacterium tuberculosis. The results were analyzed to assess the role of multiplex PCR in the diagnosis of TBM. A total of 26 (35.1% patients were diagnosed with TBM. Microscopy was negative in all while culture was positive in two cases only. Comparing with clinical diagnosis and CSF adenosine deaminase levels of ≥10 U/L, multiplex PCR showed sensitivity, specificity, positive predictive value, and negative predictive value of 71.4%, 89.6%, 83.3%, and 81.2%, respectively, in the diagnosis of TBM.
Electron transport chains of lactic acid bacteria
Brooijmans, R.J.W.
2008-01-01
Lactic acid bacteria are generally considered facultative anaerobic obligate fermentative bacteria. They are unable to synthesize heme. Some lactic acid bacteria are unable to form menaquinone as well. Both these components are cofactors of respiratory (electron transport) chains of prokaryotic
Shawar, R M; el-Zaatari, F A; Nataraj, A; Clarridge, J E
1993-01-01
Detection of Mycobacterium tuberculosis in clinical specimens by the polymerase chain reaction (PCR) was compared with detection by culture. A 317-bp segment within the M. tuberculosis-specific insertion sequence IS6110 was amplified. The detection limit of the PCR assay for cultured mycobacteria was 50 cells per reaction by ethidium bromide-stained agarose gel electrophoresis and 5 cells per reaction by hybridization with an oligonucleotide probe conjugated with either digoxigenin or alkalin...
Calogero, A; Timmer-Bosscha, H; Tiebosch, ATMG; Mulder, NH; Hospers, GAP; Schraffordt Koops, H.
The specificity and sensitivity of the nested reverse transcriptase polymerase chain reaction (RT-PCR) on tyrosinase was studied, for the detection of micrometastases of malignant melanoma. The specificity was assessed in the blood of six healthy donors, four patients with non-melanoma cancers of
International Nuclear Information System (INIS)
Sudrajat, Dadang; R, Maria Lina; Suhadi, F.
2000-01-01
A polymerase Chain Reaction (PCR) assay for detect presence of enterohemmoragic Eschericha coli O157:H7 was carried out. DNA was extracted from bacterial cells with CTBA-phenol-chloroform and precipitated with isopropanol. To test sensitivity of PCR amplifies reaction, serial dilutions of E. coli DNA solution were prepared bwtween 1 mu g-1 ng/mu l. A single pair oligonucleotide primer SLTI-F and SLTI-R derived from shiga-like-toxin genes was used in amplification method. The results shows that 1 ng/mu l of E. coli DNA could be detected using the primers SLTI-F and SLTI-R with the position of 140 bp DNA fragment
Medium-chain fatty acids undergo elongation before β-oxidation in fibroblasts
International Nuclear Information System (INIS)
Jones, Patricia M.; Butt, Yasmeen; Messmer, Bette; Boriak, Richard; Bennett, Michael J.
2006-01-01
Although mitochondrial fatty acid β-oxidation (FAO) is considered to be well understood, further elucidation of the pathway continues through evaluation of patients with FAO defects. The FAO pathway can be examined by measuring the 3-hydroxy-fatty acid (3-OHFA) intermediates. We present a unique finding in the study of this pathway: the addition of medium-chain fatty acids to the culture media of fibroblasts results in generation of 3-OHFAs which are two carbons longer than the precursor substrate. Cultured skin fibroblasts from normal and LCHAD-deficient individuals were grown in media supplemented with various chain-length fatty acids. The cell-free medium was analyzed for 3-OHFAs by stable-isotope dilution gas-chromatography/mass-spectrometry. Our finding suggests that a novel carbon chain-length elongation process precedes the oxidation of medium-chain fatty acids. This previously undescribed metabolic step may have important implications for the metabolism of medium-chain triglycerides, components in the dietary treatment of a number of disorders
Directory of Open Access Journals (Sweden)
Matteo Ghiringhelli
2015-07-01
Full Text Available Our study is focused on evaluation and use of the most effective and correct nutrients. In particular, our attention is directed to the role of certain amino acids in cachectic patients. During parenteral nutrition in humans, physician already associates in the PN-bags different formulations including amino acids, lipids and glucose solutions or essential amino acids solution alone or exclusively branched-chain amino acids (BCAA. Studies investigated the effects of dietary BCAA ingestion on different diseases and conditions such as obesity and metabolic disorders, liver disease, muscle atrophy, cancer, impaired immunity or injuries (surgery, trauma, burns, and sepsis. BCAAs have been shown to affect gene expression, protein metabolism, apoptosis and regeneration of hepatocytes, and insulin resistance. They have also been shown to inhibit the proliferation of liver cancer cells in vitro, and are essential for lymphocyte proliferation and dendritic cell maturation. Oral or parenteral administration of these three amino acids will allow us to evaluate the real efficacy of these compounds during a therapy to treat malnutrition in subjects unable to feed themselves.
Culture-Negative Endocarditis Diagnosed Using 16S DNA Polymerase Chain Reaction
Directory of Open Access Journals (Sweden)
Stephen Duffett
2012-01-01
Full Text Available 16S DNA polymerase chain reaction (PCR is a molecular amplification technique that can be used to identify bacterial pathogens in culture-negative endocarditis. Bacterial DNA can be isolated from surgically excised valve tissue or from blood collected in EDTA vials. Use of this technique is particularly helpful in identifying the bacterial pathogen in cases of culture-negative endocarditis. A case involving a 48-year-old man who presented with severe aortic regurgitation and a four-month prodrome of low-grade fever is reported. Blood and valve tissue cultures following valve replacement were negative. A valve tissue sample was sent for investigation with 16S DNA PCR, which successfully identified Streptococcus salivarius and was interpreted as the true diagnosis. A review of the literature suggests that 16S DNA PCR from valve tissue is a more sensitive diagnostic test than culture. It is also extremely specific, based on a sequence match of at least 500 base pairs.
The polymerase chain reaction and its application to clinical plastic surgery.
LENUS (Irish Health Repository)
Rea, S
2012-02-03
Molecular biology has become an essential component in many fields of modern medical research, including plastic surgery. Research into the molecular mechanisms underlying many disease processes offer increased understanding of the pathogenesis of disease and provide exciting therapeutic possibilities. Yet for many clinicians, the presentation of much research into molecular biological processes is couched in confusing terminology and based on scientific techniques, the basis of which are frequently difficult for the clinician to understand. The purpose of this review is to present an introduction to some of the molecular biological techniques currently in use, namely the polymerase chain reaction (PCR) and explore its applications to different aspects of plastic surgery. This review explores the role PCR now plays in all aspects of modern plastic surgery practise, with particular emphasis on normal and abnormal wound healing, the diagnosis of craniofacial anomalies, the diagnosis and treatment of cancer including melanoma and squamous cell carcinoma of the head and neck, and burns.
Monitoring Acidophilic Microbes with Real-Time Polymerase Chain Reaction (PCR) Assays
Energy Technology Data Exchange (ETDEWEB)
Frank F. Roberto
2008-08-01
Many techniques that are used to characterize and monitor microbial populations associated with sulfide mineral bioleaching require the cultivation of the organisms on solid or liquid media. Chemolithotrophic species, such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans, or thermophilic chemolithotrophs, such as Acidianus brierleyi and Sulfolobus solfataricus can grow quite slowly, requiring weeks to complete efforts to identify and quantify these microbes associated with bioleach samples. Real-time PCR (polymerase chain reaction) assays in which DNA targets are amplified in the presence of fluorescent oligonucleotide primers, allowing the monitoring and quantification of the amplification reactions as they progress, provide a means of rapidly detecting the presence of microbial species of interest, and their relative abundance in a sample. This presentation will describe the design and use of such assays to monitor acidophilic microbes in the environment and in bioleaching operations. These assays provide results within 2-3 hours, and can detect less than 100 individual microbial cells.
Colorimetric Detection of Specific DNA Segments Amplified by Polymerase Chain Reactions
Kemp, David J.; Smith, Donald B.; Foote, Simon J.; Samaras, N.; Peterson, M. Gregory
1989-04-01
The polymerase chain reaction (PCR) procedure has many potential applications in mass screening. We describe here a general assay for colorimetric detection of amplified DNA. The target DNA is first amplified by PCR, and then a second set of oligonucleotides, nested between the first two, is incorporated by three or more PCR cycles. These oligonucleotides bear ligands: for example, one can be biotinylated and the other can contain a site for a double-stranded DNA-binding protein. After linkage to an immobilized affinity reagent (such as a cloned DNA-binding protein, which we describe here) and labeling with a second affinity reagent (for example, avidin) linked to horseradish peroxidase, reaction with a chromogenic substrate allows detection of the amplified DNA. This amplified DNA assay (ADA) is rapid, is readily applicable to mass screening, and uses routine equipment. We show here that it can be used to detect human immunodeficiency virus sequences specifically against a background of human DNA.
Hsia, Ho-Pan; Yang, Yin-Hua; Szeto, Wun-Chung; Nilsson, Benjamin E; Lo, Chun-Yeung; Ng, Andy Ka-Leung; Fodor, Ervin; Shaw, Pang-Chui
2018-01-01
The influenza virus RNA genome is transcribed and replicated in the context of the viral ribonucleoprotein (vRNP) complex by the viral RNA polymerase. The nucleoprotein (NP) is the structural component of the vRNP providing a scaffold for the viral RNA. In the vRNP as well as during transcription and replication the viral polymerase interacts with NP but it is unclear which parts of the polymerase and NP mediate these interactions. Previously the C-terminal '627' domain (amino acids 538-693) of PB2 was shown to interact with NP. Here we report that a fragment encompassing amino acids 146-185 of NP is sufficient to mediate this interaction. Using NMR chemical shift perturbation assays we show that amino acid region 601 to 607 of the PB2 '627' domain interacts with this fragment of NP. Substitutions of these PB2 amino acids resulted in diminished RNP activity and surface plasmon resonance assays showed that amino acids D605 was essential for the interaction with NP and V606 may also play a partial role in the interaction. Collectively these results reveal a possible interaction surface between NP and the PB2 subunit of the RNA polymerase complex.
DEFF Research Database (Denmark)
Efunshile, Michael A; Ngwu, Bethrand A F; Kurtzhals, Jørgen A L
2015-01-01
Diarrhea remains the second largest killer of children worldwide, and Nigeria ranks number two on the list of global deaths attributable to diarrhea. Meanwhile, prevalence studies on potentially diarrheagenic protozoa in asymptomatic carriers using molecular detection methods remain scarce in sub......-Saharan countries. To overcome sensitivity issues related to microscopic detection and identification of cysts in stool concentrates, real-time polymerase chain reaction (PCR) was used to analyze genomic DNAs extracted from stool samples from 199 healthy school children for Entamoeba histolytica, E. dispar, Giardia...
Czech Academy of Sciences Publication Activity Database
Trachtová, S.; Španová, A.; Horák, Daniel; Kozáková, Hana; Rittich, B.
2016-01-01
Roč. 22, č. 5 (2016), s. 639-646 ISSN 1381-6128 R&D Projects: GA ČR GA15-07268S Institutional support: RVO:61389013 ; RVO:61388971 Keywords : magnetic microspheres * inhibitory effect * real-time polymerase chain Subject RIV: CD - Macromolecular Chemistry; CD - Macromolecular Chemistry (MBU-M) Impact factor: 2.611, year: 2016
Cornelissen, M. T.; van den Tweel, J. G.; Struyk, A. P.; Jebbink, M. F.; Briët, M.; van der Noordaa, J.; ter Schegget, J. T.
1989-01-01
The localization of human papillomavirus type 16 (HPV-16) DNA throughout the cervix uteri of women with cervical intraepithelial neoplasia (CIN) was studied by utilizing the polymerase chain reaction technique directly on histologically defined sections of paraffin-embedded cervical tissue obtained
Rapid Detection of Salmonella in Food and Beverage Samples by Polymerase Chain Reaction
Directory of Open Access Journals (Sweden)
Radji, M.
2010-01-01
Full Text Available Polymerase chain reaction (PCR assay had been used to detect Salmonella in food and beverage samples using suitable primers which are based on specific invA gene of Salmonella. Twenty nine samples were collected from street food counters and some canteens in Margonda Street, Depok, West Java, Indonesia. It was found that five of twenty nine samples were detected to contain Salmonella and showed the presence of the amplified product of the size 244 bp. The method of PCR demonstrated the specificity of invA primers for detection of Salmonella as confirmed by biochemical and serological assay. The results of this study revealed that PCR was a rapid and useful tool for detection of Salmonella in food and beverage samples.
Does Polymerase Chain Reaction of Tissue Specimens Aid in the Diagnosis of Tuberculosis?
Directory of Open Access Journals (Sweden)
Yoo Jin Lee
2016-11-01
Full Text Available Background Mycobacterial culture is the gold standard test for diagnosing tuberculosis (TB, but it is time-consuming. Polymerase chain reaction (PCR is a highly sensitive and specific method that can reduce the time required for diagnosis. The diagnostic efficacy of PCR differs, so this study determined the actual sensitivity of TB-PCR in tissue specimens. Methods We retrospectively reviewed 574 cases. The results of the nested PCR of the IS6110 gene, mycobacterial culture, TB-specific antigen-induced interferon-γ release assay (IGRA, acid-fast bacilli (AFB staining, and histological findings were evaluated. Results The positivity rates were 17.6% for PCR, 3.3% for the AFB stain, 22.2% for mycobacterial culture, and 55.4% for IGRA. PCR had a low sensitivity (51.1% and a high specificity (86.3% based on the culture results of other studies. The sensitivity was higher (65.5% in cases with necrotizing granuloma but showed the highest sensitivity (66.7% in those with necrosis only. The concordance rate between the methods indicated that PCR was the best method compared to mycobacterial culture, and the concordance rate increased for the methods using positive result for PCR or histologic features. Conclusions PCR of tissue specimens is a good alternative to detect tuberculosis, but it may not be as sensitive as previously suggested. Its reliability may also be influenced by some histological features. Our data showed a higher sensitivity when specimens contained necrosis, which indicated that only specimens with necrosis should be used for PCR to detect tuberculosis.
Tucci, Sara; Behringer, Sidney; Spiekerkoetter, Ute
2015-11-01
An even medium-chain triglyceride (MCT)-based diet is the mainstay of treatment in very long-chain acyl-CoA dehydrogenase (VLCAD) deficiency (VLCADD). Previous studies with magnetic resonance spectroscopy have shown an impact of MCT on the average fatty acid chain length in abdominal fat. We therefore assume that medium-chain fatty acids (MCFAs) are elongated and accumulate in tissue as long-chain fatty acids. In this study, we explored the hepatic effects of long-term supplementation with MCT or triheptanoin, an odd-chain C7-based triglyceride, in wild-type and VLCAD-deficient (VLCAD(-/-) ) mice after 1 year of supplementation as compared with a control diet. The de novo biosynthesis and elongation of fatty acids, and peroxisomal β-oxidation, were quantified by RT-PCR. This was followed by a comprehensive analysis of hepatic and cardiac fatty acid profiles by GC-MS. Long-term application of even and odd MCFAs strongly induced de novo biosynthesis and elongation of fatty acids in both wild-type and VLCAD(-/-) mice, leading to an alteration of the hepatic fatty acid profiles. We detected de novo-synthesized and elongated fatty acids, such as heptadecenoic acid (C17:1n9), eicosanoic acid (C20:1n9), erucic acid (C22:1n9), and mead acid (C20:3n9), that were otherwise completely absent in mice under control conditions. In parallel, the content of monounsaturated fatty acids was massively increased. Furthermore, we observed strong upregulation of peroxisomal β-oxidation in VLCAD(-/-) mice, especially when they were fed an MCT diet. Our data raise the question of whether long-term MCFA supplementation represents the most efficient treatment in the long term. Studies on the hepatic toxicity of triheptanoin are still ongoing. © 2015 FEBS.
International Nuclear Information System (INIS)
Shen Cenchao; Yang Wenjuan; Ji Qiaoli; Zhang Zhizhou; Maki, Hisaji; Dong Anjie
2009-01-01
Nanoparticle-assisted PCR (polymerase chain reaction) technology is getting more and more attention recently. It is believed that some of the DNA recombinant technologies will be upgraded by nanotechnology in the near future, among which DNA replication is one of the core manipulation techniques. So whether or not the DNA replication fidelity is compromised in nanoparticle-assisted PCR is a question. In this study, a total of 16 different metallic and non-metallic nanoparticles (NPs) were tested for their effects on DNA replication fidelity in vitro and in vivo. Sixteen types of nanomaterials were distinctly different in enhancing the PCR efficiency, and their relative capacity to retain DNA replication fidelity was largely different from each other based on rpsL gene mutation assay. Generally speaking, metallic nanoparticles induced larger error rates in DNA replication fidelity than non-metallic nanoparticles, and non-metallic nanomaterials such as carbon nanopowder or nanotubes were still safe as PCR enhancers because they did not compromise the DNA replication fidelity in the Taq DNA polymerase-based PCR system.
Directory of Open Access Journals (Sweden)
Andriani .
2013-08-01
Full Text Available Campylobacter sp. is the most commonly reported as agent of foodborne zoonosis causing acutegastroenteritis in humans. Poultry meat is considered as a major source of C. jejuni infection in human.The conventional methods for detecting foodborne bacteria is time-consuming which rely on the of thebacteria in culture media, followed by biochemical identification. In this study polymerase chain reaction(PCR technique was used for rapid identification of the pathogenic Campylobacter sp. The samples usedwere 298 chicken carcass with sold in supermarkets and traditional markets, and were carried out inaccordance the isolation protocol ISO/ DIS 10272-1994. Identification was performed using biochemicalAPI Campy. The direct PCR (DPCR assay with two sets of primers was employed for isolation andidentification of C. jejuni and C. coli. The result of the isolation and identification both by conventional orPCR methods showed that chicken carcasses both from supermarket and traditional market werecontaminated with C. jejuni and or C. coli. Prevalence of Campylobacter sp. contamination in chicken meatwas higher by DPCR (62.6% than by conventional (19.8%, indicating that DPCR technique was moresensitive than conventional method with detection limit for C. jejuni was103 cfu/ml.
DEFF Research Database (Denmark)
Krøjgaard, Louise H.; Krogfelt, Karen A.; Albrechtsen, Hans-Jorgen
2011-01-01
Background: Culture and quantitative polymerase chain reaction (qPCR) assays for the detection of Legionella were compared on samples from a residential area before and after two interventions. A total of 84 samples were collected from shower hoses and taps as first flush samples and at constant...... temperature. Samples were grouped according to the origin of the sample, a) circulation water b) water from empty apartments c) water from shower hoses. The aims were to investigate the usefulness of qPCR compared to culture for monitoring remedial actions for elimination of Legionella bacteria and as a tool...
Detecting beef meatball contamination with polymerase chain reaction
Directory of Open Access Journals (Sweden)
Hoda A.
2017-10-01
Full Text Available The objective of the study was to describe how much rat and swine primer developed from cytochrome b could detect rat and pork in processed beef products sold in North Maluku. The settings of the study were the traditional markets and supermarkets in several cities in North Maluku such as Ternate, Tidore Kepulauan, West Halmahera, North Halmahera, Central Halmahera, South Halmahera, East Halmahera, Sula Island and Morotai Island. The data collection lasted between May and June, 2015. The samples were analyzed in the Biotechnology Lab of Unkhair in July, 2015. To detect rat and swine DNA, the researchers used the PCR (Polymerase Chain Reaction method with Top Taq master mix Kit kit (250 (Catalog no. 200403 Swine Primer: Forward: 5'CTA CAT AAG ATAT ATC CAC CAC A 3 'Reverse: 5' ACA TTG TGG GAT CTT CTA GGT 3 'Product size: 290 bp. Rat Primer: forward SIM (5'-GACCTCCCAGCTCCATCAAACATCTCATCTTGATGAAA-3'. Reverse (5'GAATGGGATTTT GTTGGAGTTT-3 '. Out of 41 samples, sample 3, 4 and 5 taken in Jailolo contained rat DNA (positive; the samples were amplified with 499 base pair length (bp. In addition, sample 2, 7, 8 and 10 from Ternate as well as sample 4 from Morotai Island was also found positive (containing rat DNA. In terms of swine DNA, all of the samples came back negative. The amplification showed that none of the meatball samples contained pork. No pig DNA was amplified in the gel.
Quantum dots for a high-throughput Pfu polymerase based multi-round polymerase chain reaction (PCR).
Sang, Fuming; Zhang, Zhizhou; Yuan, Lin; Liu, Deli
2018-02-26
Multi-round PCR is an important technique for obtaining enough target DNA from rare DNA resources, and is commonly used in many fields including forensic science, ancient DNA analysis and cancer research. However, multi-round PCR is often aborted, largely due to the accumulation of non-specific amplification during repeated amplifications. Here, we developed a Pfu polymerase based multi-round PCR technique assisted by quantum dots (QDs). Different PCR assays, DNA polymerases (Pfu and Taq), DNA sizes and GC amounts were compared in this study. In the presence of QDs, PCR specificity could be retained even in the ninth-round amplification. Moreover, the longer and more complex the targets were, the earlier the abortion happened in multi-round PCR. However, no obvious enhancement of specificity was found in multi-round PCR using Taq DNA polymerase. Significantly, the fidelity of Pfu polymerase based multi-round PCR was not sacrificed in the presence of QDs. Besides, pre-incubation at 50 °C for an hour had no impact on multi-round PCR performance, which further authenticated the hot start effect of QDs modulated in multi-round PCR. The findings of this study demonstrated that a cost-effective and promising multi-round PCR technique for large-scale and high-throughput sample analysis could be established with high specificity, sensibility and accuracy.
Isaacman, D J; Zhang, Y; Rydquist-White, J; Wadowsky, R M; Post, J C; Ehrlich, G D
1995-06-01
A polymerase chain reaction (PCR) assay based on the penicillin-binding protein gene PBP2B identified the presence of DNA specific for Streptococcus pneumoniae in the serum and CSF of a patient with culture-proven bacteremia and meningitis. Positive signals were seen to dilutions of 1:125 and 1:390,625 for the blood and CSF specimens, respectively. Potential advantages of PCR over conventional culture include exquisite sensitivity, faster results and the ability to identify the organisms by the presence of species-specific DNA even in patients pretreated with antibiotics.
Zeolites relieves inhibitory stress from high concentrations of long chain fatty acids.
Nordell, Erik; Hansson, Anna B; Karlsson, Martin
2013-12-01
Protein and fat rich slaughterhouse waste is a very attractive waste stream for the production of biogas because of the high biochemical methane potential of the substrate. The material has however some drawbacks as the sole material for biogas production due to the production of several process disturbing metabolites such as ammonia, sulfides and long chain fatty acids. We can in this work present results that show that zeolites have the potential to relieve inhibitory stress from the presence of long chain fatty acids. Moreover, the results strongly indicate that it is mainly acetic acid consumers that are most negatively affected by long chain fatty acids and that the mechanism of stress relief is an adsorption of long chain fatty acids to the zeolites. In addition to this, it is shown that the effect is immediate and that only a small amount of zeolites is necessary to cancel the inhibitory effect of long chain fatty acids. Copyright © 2013 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Dastur P
2004-01-01
Full Text Available The diagnosis of Duchenna Muscular Dystrophy (DMD and Becker Muscular Dystorphy (BMD is mainly based on clinical profile, serum CPK values, muscle biopsy and immunostaining for dystrophin. This was done in 100 unrelated patients using 19 exons including the promoter region in two sets of multiplex polymerase chain reaction (PCR. These primers amplify most of the exons in the deletion prone ′hot spot′ regions allowing determinations of deletion end points. Intragenic deletions were detected in 74 patients indicating that the use of PCR- based assays will allow deletion detection help in prenatal diagnosis for most of the DMD/BMD patients. The frequency of deletions observed in the present study was 74%.
DEFF Research Database (Denmark)
Andresen, K; Gasim, S; Elhassan, A M
1997-01-01
We have evaluated the sensitivity of the polymerase chain reaction (PCR) as a diagnostic tool for Leishmania donovani using blood, bone marrow and lymph node samples from Sudanese patients with a confirmed infection. Forty patients were diagnosed by microscopic examination of bone marrow or lymph...
Ieven, M; Ursi, D; Van Bever, H; Quint, W; Niesters, H G; Goossens, H
Mycoplasma pneumoniae and viruses in acute respiratory tract infections in children were studied during the winter of 1992-1993 in Antwerp, Belgium. M. pneumoniae was diagnosed in nasopharyngeal aspirates by culture and polymerase chain reaction (PCR). For this, amplification of a fragment of the PI
ÖZKUL, Aykut
2002-01-01
In this study, the detection of canine parvovirus (CPV) in a fecal sample from a dog with enteritis was performed for the first time using the polymerase chain reaction (PCR) in Turkey. The final PCR product was analyzed using the restriction fragment length polymorphysm (RFLP) technique. RFLP analysis using Apa LI and Eco RV restriction endonucleases revealed homology in the nucleotide sequence in at least the VP2 coding region of the virus DNAs detected in the fecal specimen and prepared fr...
Directory of Open Access Journals (Sweden)
Kosuke Nakamura
2016-06-01
Real-time polymerase chain reaction (PCR detection method for unauthorized genetically modified (GM papaya (Carica papaya L. line PRSV-YK (PRSV-YK detection method was developed using whole genome sequence data (DDBJ Sequenced Read Archive under accession No. PRJDB3976. Interlaboratory validation datasets for PRSV-YK detection method were provided. Data indicating homogeneity of samples prepared for interlaboratory validation were included. Specificity and sensitivity test data for PRSV-YK detection method were also provided.
Evolution of the biosynthesis of the branched-chain amino acids
Keefe, Anthony D.; Lazcano, Antonio; Miller, Stanley L.
1995-01-01
The origins of the biosynthetic pathways for the branched-chain amino acids cannot be understood in terms of the backwards development of the present acetolactate pathway because it contains unstable intermediates. We propose that the first biosynthesis of the branched-chain amino acids was by the reductive carboxylation of short branched chain fatty acids giving keto acids which were then transaminated. Similar reaction sequences mediated by nonspecific enzymes would produce serine and threomine from the abundant prebiotic compounds glycolic and lactic acids. The aromatic amino acids may also have first been synthesized in this way, e.g. tryptophan from indole acetic acid. The next step would have been the biosynthesis of leucine from alpha-ketoisovalerc acid. The acetolactate pathway developed subsequently. The first version of the Krebs cycle, which was used for amino acid biosynthesis, would have been assembled by making use fo the reductive carboxylation and leucine biosynthesis enzymes, and completed with the development of a single new enzyme, succinate dehydrogenase. This evolutionary scheme suggests that there may be limitations to inferring the origins of metabolism by a simple back extrapolation of current pathways.
DEFF Research Database (Denmark)
Fløe, Andreas; Hilberg, Ole; Thomsen, Vibeke Østergaard
2015-01-01
Background. Isolation of patients suspected for pulmonary tuberculosis is guided by serial sputum smears. This can result in isolation for days for patients with noncontagious tuberculosis. To determine whether a single sample negative for Mycobacterium tuberculosis complex at polymerase chain...... reaction (PCR) can guide isolation. Methods. We retrospectively evaluated sputum samples analyzed for M. tuberculosis complex at the International Reference Laboratory of Mycobacteriology, Copenhagen, Denmark in 2002–2011. We selected culture-confirmed tuberculosis cases with ≥3 samples within 14 days...... before or after the initial culture-positive sample. We repeated the process for those with ≥2 samples within 28 days. The primary outcome was PCR-negative, smear-positive patients. Results. We included 53 533 sputum samples from 20 928 individuals; 1636 had culture-confirmed tuberculosis. Of these, 856...
David E. Schreiber; Karen J. Garner; James M. Slavicek
1997-01-01
Gypsy moths originating in Asia have recently been introduced into North America, making it necessary to develop markers for distinguishing the Asian strain from the established North American population. We have identified 3 randomly amplified polymorphic DNA-polymerase chain reaction generated (RAPD-PCR) markers which are specific for either Asian or North American...
DEFF Research Database (Denmark)
Skøt, J; Lerche, A G; Kolmos, H J
1995-01-01
To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe......, but sensitivity dropped markedly with this system. A further 33 patients had both induced sputum and bronchoalveolar lavage performed and the induced sputum was analysed using PCR and routine microbiological methods. The PCR sensitivity on induced sputum was equal to that of routine methods. At present...... the evaluated PCR cannot replace routine microbiological methods for detection of Pneumocystis carinii, on either BAL fluid or induced sputum....
[REAL TIME POLYMERASE CHAIN REACTION IN TULAREMIA LABORATORY DIAGNOSTICS].
Kormilitsyna, M I; Mescheryakova, I S; Mikhailova, T V; Dobrovolsky, A A
2015-01-01
Enhancement of tularemia laboratory diagnostics by F. tularensis DNA determination in blood sera of patients using real time polymerase chain reaction (RT-PCR). 39 blood sera of patients obtained during transmissive epidemic outbreak of tularemia in Khanty-Mansiysk in 2013 were studied in agglutination reaction, passive hemagglutination, RT-PCR. Specific primers and fluorescent probes were used: ISFTu2F/R+ISFTu2P, Tu14GF/R+tul4-PR2. Advantages of using RT-PCR for early diagnostics of tularemia, when specific antibodies are not detected using traditional immunologic methods, were established. Use of a combination of primers and ISFTu2F/R+ISFTu2P probe allowed to detect F. tularensis DNA in 100% of sera, whereas Tul4G F/R+tul4-PR2 combination--92% of sera. The data were obtained when DNA was isolated from sera using "Proba Rapid" express method. Clinical-epidemiologic diagnosis oftularemia was confirmed by both immune-serologic and RT-PCR methods when sera were studied 3-4 weeks after the onset of the disease. RT-PCR with ISFTu2F/R primers and fluorescent probe ISFTu2P, having high sensitivity and specificity, allows to determine F. tularensis DNA in blood sera of patients at both the early stage and 3-4 weeks after the onset of the disease.
International Nuclear Information System (INIS)
Noonan, K.E.; Beck, C.; Holzmayer, T.A.; Chin, J.E.; Roninson, I.B.; Wunder, J.S.; Andrulis, I.L.; Gazdar, A.F.; Willman, C.L.; Griffith, B.; Von Hoff, D.D.
1990-01-01
The resistance of tumor cells ot chemotheraprutic drugs is a major obstacle to successful cancer chemotherapy. In human cells, expression of the MDR1 gene, encoding a transmembrane efflux pump (P-glycoprotein), leads to decreased intracellular accumulation and resistance to a variety of lipophilic drugs (multidrug resistance; MDR). The levels of MDR in cell lines selected in bitro have been shown to correlate with the steady-state levels of MDR1 mRNA and P-glycoprotein. In cells with a severalfold increase in cellular drug resistance, MDR1 expression levels are close to the limits of detection by conventional assays. MDR1 expression has been frequently observed in human tumors after chemotherapy and in some but not all types of clinically refactory tumors untreated with chemotherapeutic drugs. The authors have devised a highly sensitive, specific, and quantitative protocol for measuring the levels of MDR1 mRNA in clincal samples, based on the polymerase chain reaction. They have used this assay to measure MDR1 gene expression in MDR cell lines and >300 normal tissues, tumor-derived cell lines, and clinical specimens of untreated tumors of the types in which MDR1 expression was rarely observed by standard assays. Low levels of MDR1 expression were found by polymerase chain reaction in most solid tumors and leukemias tested. The frequency of samples without detectable MDR1 expression varied among different types of tumors; MDR1-negative samples were ost common among tumor types known to be relatively responsive to chemotherapy
Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom
2015-01-01
This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR. PMID:26350449
DEFF Research Database (Denmark)
Mulberg, Mads Westergaard; Taskova, Maria; Thomsen, Rasmus P.
2017-01-01
For decades, the detection of nucleic acids and their interactions at low abundances has been a challenging task. Present nucleic acid diagnostics are primarily based on enzymatic reactions including sequencing, polymerase-chain reaction and microarrays. However, the use of enzymatic amplificatio...
Sen, Suranjana; Sirobhushanam, Sirisha; Johnson, Seth R; Song, Yang; Tefft, Ryan; Gatto, Craig; Wilkinson, Brian J
2016-01-01
The fatty acid composition of membrane glycerolipids is a major determinant of Staphylococcus aureus membrane biophysical properties that impacts key factors in cell physiology including susceptibility to membrane active antimicrobials, pathogenesis, and response to environmental stress. The fatty acids of S. aureus are considered to be a mixture of branched-chain fatty acids (BCFAs), which increase membrane fluidity, and straight-chain fatty acids (SCFAs) that decrease it. The balance of BCFAs and SCFAs in USA300 strain JE2 and strain SH1000 was affected considerably by differences in the conventional laboratory medium in which the strains were grown with media such as Mueller-Hinton broth and Luria broth resulting in high BCFAs and low SCFAs, whereas growth in Tryptic Soy Broth and Brain-Heart Infusion broth led to reduction in BCFAs and an increase in SCFAs. Straight-chain unsaturated fatty acids (SCUFAs) were not detected. However, when S. aureus was grown ex vivo in serum, the fatty acid composition was radically different with SCUFAs, which increase membrane fluidity, making up a substantial proportion of the total (37%) and BCFAs (>36%) making up the rest. Staphyloxanthin, an additional major membrane lipid component unique to S. aureus, tended to be greater in content in cells with high BCFAs or SCUFAs. Cells with high staphyloxanthin content had a lower membrane fluidity that was attributed to increased production of staphyloxanthin. S. aureus saves energy and carbon by utilizing host fatty acids for part of its total fatty acids when growing in serum, which may impact biophysical properties and pathogenesis given the role of SCUFAs in virulence. The nutritional environment in which S. aureus is grown in vitro or in vivo in an infection is likely to be a major determinant of membrane fatty acid composition.
Alarcón, Gonzalo; Barraza, Gabriela; Vera, Andrea; Wozniak, Aniela; García, Patricia
2016-02-01
Trichomonas vaginalis, Mycoplasma hominis and Ureaplasma spp. are microorganisms responsible for genitourinary and pregnancy pathologies. Nucleic acid amplification methods have shown several advantages, but have not been widely studied for the detection of these microorganisms. To implement a conventional polymerase chain reaction (PCR) for the detection of the microorganisms and to compare its results versus the methods currently used at our laboratory. 91 available samples were processed by PCR, culture (M. hominis y Ureaplasma spp.) and wet mount (T vaginalis). Results were compared and statistically analyzed by kappa agreement test. 85, 80 and 87 samples resulted in agreement for the detection of M. hominis, Ureaplasma spp. y T. vaginalis, respectively. For M. hominis and Ureaplasma spp., agreement was substantial, whereas for T. vaginalis it was moderate, however, for the latter, PCR detected more cases than wet mount. We recommend the implementation of PCR for detection of T. vaginalis whereas culture kit is still a useful method for the other microorganisms.
Shipitsyna, E; Zolotoverkhaya, E; Hjelmevoll, S O; Maximova, A; Savicheva, A; Sokolovsky, E; Skogen, V; Domeika, M; Unemo, M
2009-11-01
In Russia, laboratory diagnosis of gonorrhoea has been mainly based on microscopy only and, in some settings, relatively rare suboptimal culturing. In recent years, Russian developed and manufactured nucleic acid amplification tests (NAAT) have been implemented for routine diagnosis of Neisseria gonorrhoeae. However, these NAATs have never been validated to any international well-recognized diagnostic NAAT. This study aims to evaluate the performance characteristics of six Russian NAATs for N. gonorrhoeae diagnostics. In total, 496 symptomatic patients were included. Five polymerase chain reaction (PCR) assays and one real-time nucleic acid sequence based amplification (NASBA) assay, developed by three Russian companies, were evaluated on urogenital samples, i.e. cervical and first voided urine (FVU) samples from females (n = 319), urethral and FVU samples from males (n = 127), and extragenital samples, i.e. rectal and pharyngeal samples, from 50 additional female patients with suspicion of gonorrhoea. As reference method, an international strictly validated real-time porA pseudogene PCR was applied. The prevalence of N. gonorrhoeae was 2.7% and 16% among the patients providing urogenital and extragenital samples, respectively. The Russian NAATs and the reference method displayed high level of concordance (99.4-100%). The sensitivities, specificities, positive predictive values and negative predictive values of the Russian tests in different specimens were 66.7-100%, 100%, 100%, and 99.4-100%, respectively. Russian N. gonorrhoeae diagnostic NAATs comprise relatively good performance characteristics. However, larger studies are crucial and, beneficially, the Russian assays should also be evaluated to other international highly sensitive and specific, and ideally Food and Drug Administration approved, NAATs such as Aptima Combo 2 (Gen-Probe).
Nuchprayoon, Surang; Saksirisampant, Wilai; Jaijakul, Siraya; Nuchprayoon, Issarang
2007-01-01
We evaluated the diagnostic value of Flinders Technology Associates (FTA) filter paper together with polymerase chain reaction (PCR) for detection of Pneumocystis jirovecii (carinii) from induced sputum (IS) and bronchoalveolar lavage fluid (BALF) samples. The study involved 162 patients with clinical diagnosis of pneumocystis pneumonia (PcP) of human immunodeficiency virus/acquired immune deficiency syndrome (HIV/AIDS) patients and other immunocompromised patients. P. jirovecii cysts or trophozoites were detected in IS and BALF by cytological method. The mitochondrial 5S ribosomal ribonucleic acid (rRNA) gene of P. jirovecii was amplified from these samples by using FTA filters together with a one-step PCR method (FTA-PCR). With the FTA-PCR method, the sensitivity and specificity of the test compared to microscopic examination were 67% and 90% for IS, while they were 67% and 91% for BALF, respectively. The sensitivity and specificity of the FTA-PCR test was also comparable to PCR with the conventional deoxyribonucleic acid (DNA) extraction method. We concluded that FTA-PCR is useful to detect P. jirovecii in noninvasive IS.
Straight and branched-chain fatty acids in preorbital glands of sika deer, Cervus nippon.
Wood, William F
2004-02-01
Using GC-MS analysis, 11 major volatile compounds were found in the preorbital gland secretion from a female sika deer, Cervus nippon. These compounds are the C14 through C18 straight-chain fatty acids, (ZZ)-9,12-octadecadienoic acid, 12-methyltridecanoic acid, 13-methyltetradecanoic acid, 14-methylpentadecanoic acid, 14-methylhexadecanoic acid, and 15-methylhexadecanoic acid. The five branched-chain acids make up over 29% of the volatiles in the gland. This is the first time branched-chain carboxylic acids have been reported from ungulate preorbital glands.
Diagnosis of Leishmania infantum infection by Polymerase Chain Reaction in wild mammals
Directory of Open Access Journals (Sweden)
Mayara C. Lombardi
2014-12-01
Full Text Available Visceral leishmaniasis is a chronic infectious disease caused by Leishmania infantum (synonym: Leishmania chagasi and transmitted by the sandfly Lutzomyia longipalpis in Brazil. It is an endemic zoonosis in several regions of the country, including Belo Horizonte (State of Minas Gerais. In urban areas, the domestic dog is susceptible and considered the most important animal reservoir. However, L. infantum has been previously diagnosed in other species, including captive primates and canids. This study aimed to evaluate the presence of the agent DNA in captive animals as well as some free ranging animals from the Zoo-Botanical Foundation of Belo Horizonte by Polymerase Chain Reaction. Eighty one blood samples from primates, carnivores, ruminants, edentates, marsupial, and a monogastric herbivore were analyzed. Three primates Alouatta guariba (brown howler monkey, and two canids Speothos venaticus (bush dog were positive, demonstrating the importance of leishmaniasis control in endemic areas for preservation of wildlife species in captivity.
Cho, Pyo Yun; Na, Byoung-Kuk; Mi Choi, Kyung; Kim, Jin Su; Cho, Shin-Hyeong; Lee, Won-Ja; Lim, Sung-Bin; Cha, Seok Ho; Park, Yun-Kyu; Pak, Jhang Ho; Lee, Hyeong-Woo; Hong, Sung-Jong; Kim, Tong-Soo
2013-01-01
Microscopic examination of eggs of parasitic helminths in stool samples has been the most widely used classical diagnostic method for infections, but tiny and low numbers of eggs in stool samples often hamper diagnosis of helminthic infections with classical microscopic examination. Moreover, it is also difficult to differentiate parasite eggs by the classical method, if they have similar morphological characteristics. In this study, we developed a rapid and sensitive polymerase chain reaction (PCR)-based molecular diagnostic method for detection of Clonorchis sinensis eggs in stool samples. Nine primers were designed based on the long-terminal repeat (LTR) of C. sinensis retrotransposon1 (CsRn1) gene, and seven PCR primer sets were paired. Polymerase chain reaction with each primer pair produced specific amplicons for C. sinensis, but not for other trematodes including Metagonimus yokogawai and Paragonimus westermani. Particularly, three primer sets were able to detect 10 C. sinensis eggs and were applicable to amplify specific amplicons from DNA samples purified from stool of C. sinensis-infected patients. This PCR method could be useful for diagnosis of C. sinensis infections in human stool samples with a high level of specificity and sensitivity. PMID:23916334
Directory of Open Access Journals (Sweden)
Achmad Himawan, Yohanes Berchmans umardiyono, Susamto Somowiyarjo, Yohanes Andi Trisyono & Andrew Beattie.
2011-11-01
Full Text Available Detection using PCR (Polymerase Chain Reaction Candidatus Liberibacter asiaticus, Huanglongbing causal Organism on Siem Mandarin with different types of symptoms. Huanglongbing (HLB or Citrus Vein Phloem Degeration (CVPD is one of major diseases on Siem mandarin in Indonesia. HLB is caused by bacteria Candidatus liberibacter asiatus (LAS. The bacteria only live in the phloem cells of host tree and only recently it was reported to be successfully cultured on agar medium. Early detection method of LAS is needed to support healthy Siem mandarin cultivation program. This research was conducted to detect LAS in different types of HLB leaf symptoms based on Polymerase Chain Reaction (PCR method with specific primer forward MHO 353 and reverse MHO 354. The results suggested that 8 types of HLB leaf symptoms were found on the samples used in this experiment. LAS was detected at 60% on the leaves without any symptom followed by the leaves with completely chlorosis symptom at 66%. The leaves with unevenly yellow showing higher percentage of LAS detection ranged from 80-86%. PCR technique successfully amplified DNA of LAS with the size target of 600 bp.
[Odd- and branched-chain fatty acids in milk fat--characteristic and health properties].
Adamska, Agata; Rutkowska, Jarosława
2014-08-22
This review analyzes the current state of knowledge on odd- and branched-chain fatty acids present in milk fat. Special attention is devoted to the characteristic, synthesis in ruminants, factors affecting their content in milk fat and pro-health properties of these compounds. The group of odd- and branched-chain fatty acids includes mainly saturated fatty acids with one or more methyl branches in the iso or anteiso position. These fatty acids are largely derived from ruminal bacteria and they have been transferred to ruminant tissue (milk and meat). For that reason they have been used as biomarkers of rumen fermentation. Odd- and branched-chain fatty acids are exogenous products for humans, and therefore have specific properties. The results of research from recent decades show that odd- and branched-chain fatty acids have anti-cancer activity. Branched-chain fatty acids may reduce the incidence of necrotizing enterocolitis. Additionally, these compounds have a beneficial effect on proper tissue function and on functioning and development of the infant gut, whereas odd-chain fatty acids are considered as biomarkers of milk fat intake by humans. So far, not all the mechanisms of activity of these compounds are known thoroughly. They should be more carefully studied for application of their biological effects in prevention and treatment.
Baquião, Arianne Costa; Luna, Janaina Oliveira; Medina, Aziz Orro; Sanfilippo, Luiz Francisco; de Faria, Maria Jacinta; dos Santos, Manuel Armando Azevedo
2014-03-01
The objectives of this study were to optimize nested polymerase chain reaction (PCR) for Mycobacterium avium complex and Mycobacterium tuberculosis complex and apply them on samples from parrots. Results were negative for the presence of these Mycobacterium in the samples, and nested PCR was specific, faster, and more sensitive than other tests, thereby justifying its use in antemortem diagnosis.
Principles and applications of polymerase chain reaction in medical diagnostic fields: a review.
Valones, Marcela Agne Alves; Guimarães, Rafael Lima; Brandão, Lucas André Cavalcanti; de Souza, Paulo Roberto Eleutério; de Albuquerque Tavares Carvalho, Alessandra; Crovela, Sergio
2009-01-01
Recent developments in molecular methods have revolutionized the detection and characterization of microorganisms in a broad range of medical diagnostic fields, including virology, mycology, parasitology, microbiology and dentistry. Among these methods, Polymerase Chain Reaction (PCR) has generated great benefits and allowed scientific advancements. PCR is an excellent technique for the rapid detection of pathogens, including those difficult to culture. Along with conventional PCR techniques, Real-Time PCR has emerged as a technological innovation and is playing an ever-increasing role in clinical diagnostics and research laboratories. Due to its capacity to generate both qualitative and quantitative results, Real-Time PCR is considered a fast and accurate platform. The aim of the present literature review is to explore the clinical usefulness and potential of both conventional PCR and Real-Time PCR assays in diverse medical fields, addressing its main uses and advances.
Rubio, J.M.; Post, R.J.; Docters van Leeuwen, W.M.; Henry, M.C.; Lindergard, G.; Hommel, M.
2002-01-01
A simplified protocol for the identification of Plasmodium species by semi-nested multiplex polymerase chain reaction (SnM-PCR) in human blood samples is compared with microscopical examination of thin and thick blood films in 2 field trials in Côte d'Ivoire and Cameroon. Also, dried blood spots or
Cocolin, L; Manzano, M; Aggio, D; Cantoni, C; Comi, G
2001-05-01
A new molecular method consisting of polymerase chain reaction (PCR) amplification and denaturing gradient gel electrophoresis (DGGE) of a small fragment from the 16S rRNA gene identified the Micrococcaceae strains isolated from natural fermented Italian sausages. Lactic acid bacteria, total aerobic mesophilic flora, Enterobacteriaceae and faecal enterococci were also monitored. Micrococcaceaea control strains from international collections were used to optimise the method and 90 strains, isolated from fermented sausages, were identified by biochemical tests and PCR-DGGE. No differences were observed between the methods used. The results reported in this paper prove that Staphylococcus xylosus is the main bacterium involved in fermented sausage production, representing, from the tenth day of ripening, the only Micrococcaceaea species isolated.
DEFF Research Database (Denmark)
Andresen, K; Gaafar, A; El-Hassan, A M
1996-01-01
We have compared the sensitivity of the polymerase chain reaction (PCR) as a diagnostic tool against conventional microscopical diagnostic techniques in patients with cutaneous leishmaniasis from the Sudan. Twenty-eight patients were diagnosed according to clinical criteria followed by microscopi......We have compared the sensitivity of the polymerase chain reaction (PCR) as a diagnostic tool against conventional microscopical diagnostic techniques in patients with cutaneous leishmaniasis from the Sudan. Twenty-eight patients were diagnosed according to clinical criteria followed......%, respectively. The PCR should be considered as a valuable and sensitive diagnostic tool in the diagnosis of cutaneous leishmaniasis; it has the added advantage of identification of the species of Leishmania causing the lesion....
Directory of Open Access Journals (Sweden)
Susan Maphilindawati Noor
2014-10-01
Full Text Available Brucella abortus Strain Specific-Polymerase Chain Reaction (BaSS-PCR is a single multiplex PCRtechnique which able to identify and differentiate between Brucella abortus field strains (biovar 1, 2, and4, B. abortus vaccine strains, Brucella species, and non-Brucella species. In this study, BaSS-PCR wasapplied to identify local isolates of B. abortus in order to investigate the B. abortus strains that infectedcattle in Indonesia. Fifty local strains of B.abortus isolated from infected cattle in Java (Jakarta andBandung, South Sulawesi (Maros, East Nusa Tenggara (Kupang and Belu were used in this study. TheDNA bands were observed by agarose gel in the presence of ethidium bromide. Identification was performedbased on the size and number of DNA products amplified by PCR from each isolates. The results showedthat the 50 isolates were of B. abortus field strains. This finding showed that the cause of bovine brucellosisin Indonesia is B. abortus field strains.
The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...
Lopez, Karen M; Fleming, Gregory J; Mylniczenko, Natalie D
2016-12-01
Reports of equine herpesvirus (EHV) 1 and EHV-9 causing clinical disease in a wide range of species have been well documented in the literature. It is thought that zebras are the natural hosts of EHV-9 both in the wild and in captive collections. Concerns about potential interspecies transmission of EHV-1 and EHV-9 in a mixed species savannah exhibit prompted serologic and polymerase chain reaction surveys. Eighteen Burchell's zebras ( Equus quagga ), 11 Hartmann's mountain zebras ( Equus zebra hartmannae), and 14 Thomson's gazelles ( Eudorcas thomsonii ) cohabitating the same exhibit were examined for EHV-1 virus neutralization titers, and evidence of virus via EHV 1-5 polymerase chain reactions. None of the animals had previous exposure to vaccination with EHV-1 or EHV-4. All tested zebras had positive EHV-1 titers, ranging from 4 to 384. All zebras and Thomson's gazelles had negative polymerase chain reaction results for all targeted equine herpesviruses. EHV-9-specific assays are not available but EHV-1, EHV-4, and EHV-9 cross-react serologically. Positive serology results indicate a potential latent equine herpesvirus in the zebra population, which prompted initiation of an equine herpesvirus vaccine protocol, changes in pregnant zebra mare management, and equine herpesvirus polymerase chain reaction screening prior to shipment to or from the study site.
Hong, Chi Rac; Lee, Gyu Whan; Paik, Hyun-Dong; Chang, Pahn-Shick; Choi, Seung Jun
2018-01-15
This study confirmed the possibility of biopolymer-type stabilizers to increase the saturation concentration of branched-chain amino acids by preventing their crystallization/precipitation. Although microfluidization increased the initial solubility, it failed to increase the saturation concentration of the branched-chain amino acids. The saturation concentration of the branched-chain amino acids increased from 3.81% to 4.42% and 4.85% after the incorporation of food hydrocolloids and proteins, respectively. However, the branched-chain amino acids:stabilizer ratio did not affect the solubility. In the case of food hydrocolloid-based solutions, crystal formation and growth of branched-chain amino acids occurred during storage, resulting in the precipitation of branched-chain amino acid crystals. However, food proteins effectively increased the stability of the solubilized branched-chain amino acids. The improved solubility and stability of the solubilized branched-chain amino acids could be attributed to interactions between the functional groups (carboxyl, amine, sulfate, aliphatic, aromatic, etc.) of the stabilizer and the branched-chain amino acid molecules. Copyright © 2017 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Skøt, J; Lerche, A G; Kolmos, H J
1995-01-01
was performed. The sensitivity and specificity were 85 and 100% 934/40 and 77/77) respectively. A non-radioactive labelling system BluGENE was evaluated on all specimens, and found to be as effective as P32-labelling. To increase the speed and convenience of detection, a dot blot system was tested......To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe...... the evaluated PCR cannot replace routine microbiological methods for detection of Pneumocystis carinii, on either BAL fluid or induced sputum....
Longstaff, Louise; Porter, Emily; Crossley, Victoria J; Hayhow, Sophie E; Helps, Christopher R; Tasker, Séverine
2017-02-01
Objectives The aim of the study was to determine whether feline coronavirus (FCoV) RNA in effusion samples can be used as a diagnostic marker of feline infectious peritonitis (FIP); and in FCoV RNA-positive samples to examine amino acid codons in the FCoV spike protein at positions 1058 and 1060 where leucine and alanine, respectively, have been associated with systemic or virulent (FIP) FCoV infection. Methods Total RNA was extracted from effusion samples from 20 cats with confirmed FIP and 23 cats with other diseases. Feline coronavirus RNA was detected using a reverse transcriptase quantitative polymerase chain reaction assay (qRT-PCR), and positive samples underwent pyrosequencing of position 1058 with or without Sanger sequencing of position 1060 in the FCoV spike protein. Results Seventeen (85%) of the effusion samples from 20 cats with FIP were positive for FCoV RNA, whereas none of the 23 cats with other diseases were positive. Pyrosequencing of the 17 FCoV-positive samples showed that 11 (65%) of the cats had leucine and two (12%) had methionine at position 1058. Of the latter two samples with methionine, one had alanine at position 1060. Conclusions and relevance A positive FCoV qRT-PCR result on effusions appears specific for FIP and may be a useful diagnostic marker for FIP in cats with effusions. The majority of FCoVs contained amino acid changes previously associated with systemic spread or virulence (FIP) of the virus.
Identification of exopolysaccharides-producing lactic acid bacteria ...
African Journals Online (AJOL)
Spacer region between 16S and 23 S rRNA genes of thirteen lactic acid bacteria strains from Burkina Faso fermented milk samples were amplified by the polymerase chain reaction (PCR). Lactobacillus delbrueckii, Lactobacillus acidophilus, Lactobacillus fermentum, Streptococcus thermophilus, Pediococcus spp, ...
Impact of Fungicide Residues on Polymerase Chain Reaction and on Yeast Metabolism
Directory of Open Access Journals (Sweden)
Gildo Almeida da Silva
Full Text Available ABSTRACT The indiscriminate use of pesticides on grape crops is harmful for consumers´ healthin “in natura” consumption and in the ingestion of wine and grape juice. During winemaking, a rapid and efficient fermentation stage is critical to avoid proliferation of contaminating microorganisms and to guarantee the product´s quality. Polymerase chain reaction (PCR has the advantage of detecting these contaminants in the early stages of fermentation. However,this enzymatic reaction may also be susceptible to specific problems, reducing its efficiency. Agricultural practices, such as fungicide treatments, may be a source of PCR inhibiting factors and may also interfere in the normal course of fermentation.The action of the pesticides captan and folpet on PCR and on yeast metabolism was evaluated, once these phthalimide compounds are widely employed in Brazilian vineyards. DNA amplification was only observed at 75 and 37.5 µg/mL of captan concentrations, whereas with folpet, amplification was observed only in the two lowest concentrations tested (42.2 and 21.1µg/mL.Besides the strong inhibition on Taq polymerase activity, phthalimides also inhibited yeast metabolism at all concentrations analyzed.Grape must containing captan and folpet residues could not be transformed into wine due to stuck fermentation caused by the inhibition of yeast metabolism. Non-compliance with the waiting period for phthalimide fungicides may result in financial liabilities to the viticulture sector.The use of yeasts with high fungicide sensitivity should be selected for must fermentation as a strategy for sustainable wine production and to assure that products comply with health and food safety standards.
Tanaka, Hideko; Harauma, Akiko; Takimoto, Mao; Moriguchi, Toru
2015-06-01
In our previously study, we reported lower tear volume in with an n-3 fatty acid deficient mice and that the docosahexaenoic acid and total n-3 fatty acid levels in these mice are significantly reduced in the meibomian gland, which secretes an oily tear product. Furthermore, we noted very long chain fatty acids (≥25 carbons) in the meibomian gland. To verify the detailed mechanism of the low tear volume in the n-3 fatty acid-deficient mice, we identified the very long chain fatty acids in the meibomian gland, measured the fatty acid composition in the tear product. Very long chain fatty acids were found to exist as monoesters. In particular, very long chain fatty acids with 25-29 carbons existed for the most part as iso or anteiso branched-chain fatty acids. n-3 fatty acid deficiency was decreased the amount of meibum secretion from meibomian gland without change of fatty acid composition. These results suggest that the n-3 fatty acid deficiency causes the enhancement of evaporation of tear film by reducing oily tear secretion along with the decrease of meibomian gland function. Copyright © 2015 Elsevier Ltd. All rights reserved.
Prestes, Suzane Ribeiro; Guerra, Jorge Augusto de Oliveira; Romero, Gustavo Adolfo Sierra; Magalhaes, Laylah Kelre Costa; Santana, Rosa Amelia Gonçalves; Maciel, Marcel Gonçalves; Custódio, Ana; Barbosa, Maria das Graças Vale; Silveira, Henrique
2015-01-01
In the Americas, mucosal leishmaniasis is primarily associated with infection by Leishmania (Viannia) braziliensis. However, Leishmania (Viannia) guyanensis is another important cause of this disease in the Brazilian Amazon. In this study, we aimed at detecting Leishmaniadeoxyribonucleic acid (DNA) within paraffin-embedded fragments of mucosal tissues, and characterizing the infecting parasite species. We evaluated samples collected from 114 patients treated at a reference center in the Brazilian Amazon by polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) analyses. Direct examination of biopsy imprints detected parasites in 10 of the 114 samples, while evaluation of hematoxylin and eosin-stained slides detected amastigotes in an additional 17 samples. Meanwhile, 31/114 samples (27.2%) were positive for Leishmania spp. kinetoplast deoxyribonucleic acid (kDNA) by PCR analysis. Of these, 17 (54.8%) yielded amplification of the mini-exon PCR target, thereby allowing for PCR-RFLP-based identification. Six of the samples were identified as L. (V.) braziliensis, while the remaining 11 were identified as L. (V.) guyanensis. The results of this study demonstrate the feasibility of applying molecular techniques for the diagnosis of human parasites within paraffin-embedded tissues. Moreover, our findings confirm that L. (V.) guyanensisis a relevant causative agent of mucosal leishmaniasis in the Brazilian Amazon.
Almy, Frederic S.; Ladd, Sabine M.; Sponenberg, D. Phillip; Crisman, Mark V.; Messick, Joanne B.
2006-01-01
Blood smear examination in a 4-day-old alpaca revealed massive erythrocyte parasitism by Mycoplasma haemolamae. Blood collected from both the nonparasitemic dam and the cria were positive for M. haemolamae by polymerase chain reaction (PCR) analysis. These findings suggest in utero transmission of M. haemolamae in camelids, even when the dam is not parasitemic.
International Nuclear Information System (INIS)
Tamer, Gulden S.; Turk, M.; Dagci, H.; Pektas, B.; Guruz, Adnan Y.; Uner, A.; Guy, E.C.
2007-01-01
Objective was to verify the incidence of cryptosporidiosis among Turkish elementary school students. The study was conducted in the Dept. of Parasitology, Faculty of Medicine, Ege University, Turkey during a 3-month period in 2006. We assessed the fecal samples of 707 children using modified acid-fast and phenol-auramine staining followed by modified Ritchie concentration method. All cryptosporidium species isolates were analysed by nested polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) to differentiate genotypes of the isolates. After the coprological examination, 4 samples were found to be positive for cryptosporidium species oocysts. In the present study, all 4 oocysts were of zoonotic origin and belonged to cryptoporodium parvum genotype 2 indicating that in Turkey the potential sources of human cryptosporidiosis is from animals. The application of genotyping to clinical isolates of cryptosporidium has significantly increased our knowledge and understanding of the distribution and epidemiology of this parasite. The PCR and RFLP techniques represent a more rapid and simple method of genotyping to support epidemiological and clinical investigations than conventional analytical DNA techniques. (author)
Directory of Open Access Journals (Sweden)
I Nyoman Suartha
2008-03-01
Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.
Directory of Open Access Journals (Sweden)
Dastur R
2003-01-01
Full Text Available The diagnosis of Duchenne Muscular Dystrophy (DMD and Becker Muscular Dystrophy (BMD is mainly based on clinical profile, serum CPK values, muscle biopsy and immunostaining for dystrophin. Most recent and accurate method for diagnosing DMD/BMD is by detection of mutations in the DMD gene. This was done in 100 unrelated patients using 19 exons including the promoter region in two sets of multiplex polymerase chain reaction (PCR. These primers amplify most of the exons in the deletion prone ′hotspot′ regions allowing determination of deletion end point. Intragenic deletions were detected in 74 patients indicating that the use of PCR-based assays will allow deletion detection help in prenatal diagnosis for most of the DMD/BMD patients. The frequency of deletions observed in the present study was 74%.
Faham Khamesipour; Esmat Noshadi; Mitra Moradi; Mehdi Raissy
2014-01-01
Shrimp is one of the most important fishery products of the coastal provinces in the Persian Gulf in Iran. Vibriosis has been an important cause of production loss due to bacterial disease in shrimp farms in south Iran in recent years. The objective of this study was to detect the prevalence of Vibrio spp. in shrimp samples from farms in the southern provinces of Iran by polymerase chain reaction (PCR). A total number of 36 shrimp were caught from south coast of Iran and were stud...
Product differentiation by analysis of DNA melting curves during the polymerase chain reaction.
Ririe, K M; Rasmussen, R P; Wittwer, C T
1997-02-15
A microvolume fluorometer integrated with a thermal cycler was used to acquire DNA melting curves during polymerase chain reaction by fluorescence monitoring of the double-stranded DNA specific dye SYBR Green I. Plotting fluorescence as a function of temperature as the thermal cycler heats through the dissociation temperature of the product gives a DNA melting curve. The shape and position of this DNA melting curve are functions of the GC/AT ratio, length, and sequence and can be used to differentiate amplification products separated by less than 2 degrees C in melting temperature. Desired products can be distinguished from undesirable products, in many cases eliminating the need for gel electrophoresis. Analysis of melting curves can extend the dynamic range of initial template quantification when amplification is monitored with double-stranded DNA specific dyes. Complete amplification and analysis of products can be performed in less than 15 min.
International Nuclear Information System (INIS)
Gokahmetoglu, S.; Deniz, E.
2007-01-01
To compare the real-time (RT) and qualitative (Q) polymerase chain reaction (PCR) assays for detection of Cytomegalovirus (CMV) DNA. The study took place in the Department of Microbiology, Erciyes University, Kayseri and in Iontek Laboratory, Istanbul, Turkey, from August to December 2006. One hundred and seven clinical specimens from 67 patients were included in the study. Cytomegalovirus DNA was investigated using RT-PCR kit (Fluorion Iontek, Turkey) and Q-PCR kit (Fluorion Iontek, Turkey). Deoxyribonucleic acid sequencing was applied to the samples that yielded discrepant results in both assays. Mac Nema's Chi Square test was used for statistical analysis. Of the specimens, 27 were found positive with both assays: 9 with only RT-PCR, and 11 with only Q-PCR assay. Both assays were found negative in 60 of the specimens. There was a good agreement between the 2 assays in 87(81.3%) of the specimens. There was no statistical significant difference between the assays (p>0.05). Two of the 11 samples that RT-PCR negative Q-PCR positive, and 3 of 9 samples that RT-PCR positive Q-PCR negative were found to be CMV DNA positive by DNA sequencing. A good level of concordance between RT-PCR and Q-PCR assays for CMV DNA detection has been found. (author)
Directory of Open Access Journals (Sweden)
Eduardus Bimo Aksono
2017-06-01
Full Text Available Legionella pneumophila is a Gram-negative bacillus that causes nosocomial and community-acquired pneumonia. The aim of this research was to detect the presence of bacteria of L. pneumophila species in the swimming pools water of Surabaya city by using nested Polymerase Chain Reaction (PCR assay of a specific gene for L. pneumophila (mip gene. This study used purposive sampling method. A total of 10 water samples were collected from five swimming pools consisting of 200 mL water for each swimming pool. The results showed that of 10 samples tested by nested PCR, one sample was positive for L. pneumophila, and nine samples were negative. L. pneumophila were found in pool water samples with a higher temperature (>30ºC.Serogrouping analysis of positive sample that L. pneumophila bacteria detected in the water sample of swimming pool in Surabaya was L. pneumophila serogroup 9 (98% and serogroup 10 (98%. L. pneumophila detection of bacteria is expected to raise the awareness of physician and microbiologists about the transmission of L. pneumophila and will also be useful for controlling the agents. ABSTRAK Legionella pneumophila adalah bakteri Gram-negatif berbentuk batang yang dapat menyebabkan penyakit nosokomial dan pneumonia. Tujuan penelitian ini adalah untuk mendeteksi keberadaan bakteri L. pneumophila pada air kolam renang di Kota Surabaya dengan menggunakan nested Polymerase Chain Reaction (PCR berbasis gen spesifik L. pneumophila (mip gene. Penelitian ini menggunakan metode purposive sampling. Sebanyak sepuluh sampel diambil dari lima kolam renang. Sampel diambil sebanyak 200 mL dari air kolam renang di setiap lokasi. Hasil dari 10 sampel yang diuji menggunakan nested PCR, satu sampel menunjukkan hasil positif untuk L.pneumophila, dan sembilan sampel menunjukkan hasil negatif. Bakteri L. pneumophila ditemukan pada sampel air kolam dengan suhu yang lebih tinggi (>30ºC. Satu sampel positip tersebut ketika dilanjutkan terhadap analisis serogrup
Murakami, Taro; Matsuo, Masayuki; Shimizu, Ayako; Shimomura, Yoshiharu
2005-02-01
Branched-chain alpha-keto acid dehydrogenase kinase (BDK) phosphorylates and inactivates the branched-chain alpha-keto acid dehydrogenase complex (BCKDC), which is the rate-limiting enzyme in the branched-chain amino acid catabolism. BDK has been believed to be bound to the BCKDC. However, recent our studies demonstrated that protein-protein interaction between BDK and BCKDC is one of the factors to regulate BDK activity. Furthermore, only the bound form of BDK appears to have its activity. In the present study, we examined effects of BDK inhibitors on the amount of BDK bound to the BCKDC using rat liver extracts. The bound form of BDK in the extracts of liver from low protein diet-fed rats was measured by an immunoprecipitation pull down assay with or without BDK inhibitors. Among the BDK inhibitors. alpha-ketoisocaproate, alpha-chloroisocaproate, and a-ketoisovalerate released the BDK from the complex. Furthermore, the releasing effect of these inhibitors on the BDK appeared to depend on their inhibition constants. On the other hand, clofibric acid and thiamine pyrophosphate had no effect on the protein-protein interaction between two enzymes. These results suggest that the dissociation of the BDK from the BCKDC is one of the mechanisms responsible for the action of some inhibitors to BDK.
Low-Cost Temperature Logger for a Polymerase Chain Reaction Thermal Cycler
Directory of Open Access Journals (Sweden)
Chan-Young Park
2016-10-01
Full Text Available Polymerase chain reaction (PCR is a method of amplifying DNA which is normally carried out with a thermal cycler. To obtain more accurate and reliable PCR results, the temperature change within the chamber of the thermal cycler needs to be verified and calibrated regularly. Commercially available temperature loggers commonly used for temperature verification tests usually require a graphical user interface (GUI attached to the logger for convenience and straightforward understanding of the device. In this study, a host-local architecture for the temperature logger that significantly reduces the development time and cost is proposed. Employing standard computing devices as the host gives better development environment and user-friendly GUI. This paper presents the hardware and software design of the host-local temperature logger, and demonstrates the use of the local temperature logger connected to a personal computer with a Windows operating system. The probe design, thermistor resistance measurement, temperature filtering, and temperature calibration is described in detail. The thermistor self-heating problem was investigated in particular to determine the reference resistor that was serially connected to the thermistor. The temperature accuracy and temporal precision of the proposed system was 0.1 K.
Ladd, Sabine M.; Sponenberg, D. Phillip; Crisman, Mark V.; Messick, Joanne B.
2006-01-01
Abstract Blood smear examination in a 4-day-old alpaca revealed massive erythrocyte parasitism by Mycoplasma haemolamae. Blood collected from both the nonparasitemic dam and the cria were positive for M. haemolamae by polymerase chain reaction (PCR) analysis. These findings suggest in utero transmission of M. haemolamae in camelids, even when the dam is not parasitemic. PMID:16604978
gamma-linolenic acid does not augment long-chain polyunsaturated fatty acid omega-3 status
Brouwer, DAJ; Hettema, Y; van Doormaal, JJ; Muskiet, FAJ
Augmentation of long chain polyunsaturated omega 3 fatty acid (LCPUFA omega 3) status can be reached by consumption of fish oil or by improvement of the conversion of a-linolenic acid (ALA) to LCPUFA omega 3. Since gamma-linolenic acid (GLA) might activate the rate-limiting Delta-6 desaturation, we
Brito, Barbara P; Gardner, Ian A; Hietala, Sharon K; Crossley, Beate M
2011-07-01
Bluetongue is a vector-borne viral disease that affects domestic and wild ruminants. The epidemiology of this disease has recently changed, with occurrence in new geographic areas. Various real-time quantitative reverse transcription polymerase chain reaction (real-time qRT-PCR) assays are used to detect Bluetongue virus (BTV); however, the impact of biologic differences between New World camelids and domestic ruminant samples on PCR efficiency, for which the BTV real-time qRT-PCR was initially validated are unknown. New world camelids are known to have important biologic differences in whole blood composition, including hemoglobin concentration, which can alter PCR performance. In the present study, sheep, cattle, and alpaca blood were spiked with BTV serotypes 10, 11, 13, and 17 and analyzed in 10-fold dilutions by real-time qRT-PCR to determine if species affected nucleic acid recovery and assay performance. A separate experiment was performed using spiked alpaca blood subsequently diluted in 10-fold series in sheep blood to assess the influence of alpaca blood on performance efficiency of the BTV real-time qRT-PCR assay. Results showed that BTV-specific nucleic acid detection from alpaca blood was consistently 1-2 logs lower than from sheep and cattle blood, and results were similar for each of the 4 BTV serotypes analyzed.
Odd- and branched-chain fatty acids in milk fat – characteristic and health properties
Directory of Open Access Journals (Sweden)
Agata Adamska
2014-08-01
Full Text Available This review analyzes the current state of knowledge on odd- and branched-chain fatty acids present in milk fat. Special attention is devoted to the characteristic, synthesis in ruminants, factors affecting their content in milk fat and pro-health properties of these compounds. The group of odd- and branched-chain fatty acids includes mainly saturated fatty acids with one or more methyl branches in the iso or anteiso position. These fatty acids are largely derived from ruminal bacteria and they have been transferred to ruminant tissue (milk and meat. For that reason they have been used as biomarkers of rumen fermentation. Odd- and branched-chain fatty acids are exogenous products for humans, and therefore have specific properties. The results of research from recent decades show that odd- and branched-chain fatty acids have anti-cancer activity. Branched-chain fatty acids may reduce the incidence of necrotizing enterocolitis. Additionally, these compounds have a beneficial effect on proper tissue function and on functioning and development of the infant gut, whereas odd-chain fatty acids are considered as biomarkers of milk fat intake by humans. So far, not all the mechanisms of activity of these compounds are known thoroughly. They should be more carefully studied for application of their biological effects in prevention and treatment.
Wubetu, Gizachew Yismaw; Utsunomiya, Tohru; Ishikawa, Daichi; Ikemoto, Tetsuya; Yamada, Shinichiro; Morine, Yuji; Iwahashi, Shuichi; Saito, Yu; Arakawa, Yusuke; Imura, Satoru; Arimochi, Hideki; Shimada, Mitsuo
2014-09-01
Branched chain amino acid (BCAA) dietary supplementation inhibits activation of the insulin-like growth factor (IGF)/IGF-I receptor (IGF-IR) axis in diabetic animal models. However, the in vitro effect of BCAA on human cancer cell lines under hyper-insulinemic conditions remains unclear. Colon (HCT-116) and hepatic (HepG2) tumor cells were treated with varying concentrations of BCAA with or without fluorouracil (5-FU). The effect of BCAA on insulin-initiated proliferation was determined. Gene and protein expression was analyzed by quantitative real-time polymerase chain reaction (qRT-PCR) and western blotting, respectively. BCAA supplementation had no significant effect on cell proliferation and did not show significant synergistic or antagonistic effects with 5-FU. However, BCAA significantly decreased insulin-initiated proliferation of human colon and hepatic cancer cell lines in vitro. BCAA supplementation caused a marked decrease in activated IGF-IR expression and significantly enhanced both mRNA and protein expression of LC3-II and BECN1 (BECLIN-1). BCAA could be a useful chemopreventive modality for cancer in hyperinsulinemic conditions. Copyright© 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
International Nuclear Information System (INIS)
Nie Leng; Gao Lizeng; Yan Xiyun; Wang Taihong
2007-01-01
Functionalized tetrapodal ZnO nanostructures are tested in plasmid DNA experiments (1) as a solid-phase adsorbent for plasmid DNA purification (2) as improving reagents in a polymerase chain reaction (PCR) and (3) as novel carriers for gene delivery. The amino-modification, the tetrapod-like shape of the nanostructure and its high biocompatibility all contribute to measurements showing promise for applications. A sol-gel method is used for silica coating and amino-modification. Plasmid DNA is purified through reversible conjugations of amino-modified ZnO tetrapods with DNA. Also, as additional reagents, functionalized tetrapods are shown to improve the amount of PCR product. For transfection, ZnO tetrapods provide some protection against deoxyribonuclease cleavage of plasmid DNA and deliver plasmid DNA into cells with little cytotoxicity
Bartzavali-Louki, Christina; Dimitracopoulos, George; Spiliopoulou, Iris
2003-06-01
Characterization of clinical isolates of methicillin-resistant Staphylococcus aureus (MRSA) and representatives of three MRSA clones from other hospitals was performed by arbitrarily primed polymerase chain reaction (AP-PCR) and antibiotic susceptibility patterns. All isolates were mecA-positive and two main antibiotypes have been characterized. Two major clones were identified with AP-PCR related to the aforementioned antibiotypes. The combination of antibiotypes with AP-PCR patterns successfully identified the two major clones in our hospital, which are identical with the MRSA clones previously characterized in Athens and in Central and North Greece.
Directory of Open Access Journals (Sweden)
João Bortoletti Filho
2013-01-01
Full Text Available A brief report on the nature and epidemiology of T. gondii infection is firstly presented. The importance of the specific IgG avidity test and polymerase chain reaction (PCR for toxoplasmosis is discussed, along with their significance and importance as auxiliary methods for determining the most likely time for the initial infection by this coccidian and for defining the therapeutic strategy. Lastly, practical comments are made in relation to the classical therapeutic regimens, with special attention to the indications for fetal treatment, when this is necessary.
Kang, Daoxian; Ran, Yuping; Li, Conghui; Dai, Yaling; Lama, Jebina
2013-01-01
We report a case of Arthroderma vanbreuseghemii (a teleomorph of Trichophyton interdigitale) infection around the nostrils in a 3-year-old girl. The culture was negative, so the pathogenic agent was identified using polymerase chain reaction-based sequencing of the crusts taken from the lesion on the nostril. Treatment with oral itraconazole and topical 1% naftifine/0.25% ketoconazole cream after a topical wash with ketoconazole shampoo was effective. © 2012 Wiley Periodicals, Inc.
Detection of canine cytokine gene expression by reverse transcription-polymerase chain reaction.
Pinelli, E; van der Kaaij, S Y; Slappendel, R; Fragio, C; Ruitenberg, E J; Bernadina, W; Rutten, V P
1999-08-02
Further characterization of the canine immune system will greatly benefit from the availability of tools to detect canine cytokines. Our interest concerns the study on the role of cytokines in canine visceral leishmaniasis. For this purpose, we have designed specific primers using previously published sequences for the detection of canine IL-2, IFN-gamma and IL10 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). For IL-4, we have cloned and sequenced this cytokine gene, and developed canine-specific primers. To control for sample-to-sample variation in the quantity of mRNA and variation in the RT and PCR reactions, the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), a housekeeping gene, were determined in parallel. Primers to amplify G3PDH were designed from consensus sequences obtained from the Genbank database. The mRNA levels of the cytokines mentioned here were detected from ConA-stimulated peripheral mononuclear cells derived from Leishmania-infected dogs. A different pattern of cytokine production among infected animals was found.
The generation of radiolabeled DNA and RNA probes with polymerase chain reaction
International Nuclear Information System (INIS)
Schowalter, D.B.; Sommer, S.S.
1989-01-01
By including a radioactive triphosphate during polymerase chain reaction (PCR), probes of very high specific activity can be generated. The advantages of PCR labeling include (1) uniform labeling with a specific activity of 5 X 10(9) cpm/micrograms or higher (sensitivity of detection: 0.028 pg of target DNA per 24 h); (2) ease of regulation of both the specific activity and the amount of labeled probe produced; (3) efficient labeling of fragments less than 500 bp; (4) efficient incorporation over a wide range of input DNA template; (5) labeling with subnanogram amounts of input DNA; and (6) direct labeling of genomic DNA. The minimal amount of input DNA allows a virtually unlimited number of PCR labeling reactions to be performed on DNA generated by one amplification under the previously described nonlabeling conditions. This obviates the need for CsCl gradients or other large scale methods of DNA preparation. The above advantages except for the very high specific activity can also be achieved by transcript labeling after an amplification where one or both of PCR primers contain a phage promoter sequence
van Belkum, A.; Duim, B.; Regelink, A.; Möller, L.; Quint, W.; van Alphen, L.
1994-01-01
Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by
VANBELKUM, A; DUIM, B; REGELINK, A; MOLLER, L; QUINT, W; VANALPHEN, L
Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by
Brüggemann, M.; White, H.; Gaulard, P.; Garcia-Sanz, R.; Gameiro, P.; Oeschger, S.; Jasani, B.; Ott, M.; Delsol, G.; Orfao, A.; Tiemann, M.; Herbst, H.; Langerak, A. W.; Spaargaren, M.; Moreau, E.; Groenen, P. J. T. A.; Sambade, C.; Foroni, L.; Carter, G. I.; Hummel, M.; Bastard, C.; Davi, F.; Delfau-Larue, M.-H.; Kneba, M.; van Dongen, J. J. M.; Beldjord, K.; Molina, T. J.
2007-01-01
Polymerase chain reaction (PCR) assessment of clonal T-cell receptor (TCR) and immunoglobulin (Ig) gene rearrangements is an important diagnostic tool in mature T-cell neoplasms. However, lack of standardized primers and PCR protocols has hampered comparability of data in previous clonality studies.
Williams, James A; Ofner, Susan; Batteiger, Byron E; Fortenberry, J Dennis; Van Der Pol, Barbara
2014-03-01
To avoid positive results attributable to residual DNA, the Centers for Disease Control and Prevention recommends avoiding repeat testing with nucleic-acid based tests within 3 weeks after treatment of chlamydial (Chlamydia trachomatis [CT]) or gonococcal (Neisseria gonorrhoeae [GC]) infection. We retrospectively analyzed the duration of detectable DNA from a longitudinal cohort of adolescent women after diagnosis and treatment of infection with CT, GC, or Trichomonas vaginalis (TV). Vaginal swabs were obtained weekly from young women for up to 12 weeks (observation period) after treatment of CT, GC and TV infections. Swabs were tested using a commercially available first generation nucleic acid amplification test (NAAT) for CT and GC, and a laboratory developed NAAT for TV. Kaplan-Meier statistics were used to estimate median time to the first negative DNA-based polymerase chain reaction (PCR) result. Observation periods were available for analysis for 195, 82 and 102 treatments for CT, GC, and TV infection, respectively. Median time to a first negative PCR result for CT, GC, and TV was 9 (range 0-84), 6 (0-76), and 7 (0-84) days, and by day 21, 89%, 95%, and 85% were negative, respectively. Data from this retrospective analysis indicate that greater than 85% of these young women did not have detectable CT, GC, or TV DNA by day 21 post-treatment. This data may be useful to clinicians for patient management and post-treatment testing purposes.
Meletiadis, J.; Melchers, W.J.G.; Meis, J.F.G.M.; Hurk, P.J.J.C. van den; Jannes, G.; Verweij, P.E.
2003-01-01
An assay system in which polymerase chain reaction (PCR) amplification of the ITS-1 region of ribosomal DNA (rDNA) is combined with a reverse-hybridization line probe assay (LiPA) was used for the identification of six Candida species and four Aspergillus species in pure cultures of clinical
A Micro Polymerase Chain Reaction Module for Integrated and Portable DNA Analysis Systems
Directory of Open Access Journals (Sweden)
Elisa Morganti
2011-01-01
Full Text Available This work deals with the design, fabrication, and thermal characterization of a disposable miniaturized Polymerase Chain Reaction (PCR module that will be integrated in a portable and fast DNA analysis system. It is composed of two independent parts: a silicon substrate with embedded heater and thermometers and a PDMS (PolyDiMethylSiloxane chamber reactor as disposable element; the contact between the two parts is assured by a mechanical clamping obtained using a Plastic Leaded Chip Carrier (PLCC. This PLCC is also useful, avoid the PCR mix evaporation during the thermal cycles. Finite Element Analysis was used to evaluate the thermal requirements of the device. The thermal behaviour of the device was characterized revealing that the temperature can be controlled with a precision of ±0.5°C. Different concentrations of carbon nanopowder were mixed to the PDMS curing agent in order to increase the PDMS thermal conductivity and so the temperature control accuracy.
Directory of Open Access Journals (Sweden)
Laurent Dacheux
2016-07-01
Full Text Available The definitive diagnosis of lyssavirus infection (including rabies in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR and a second reaction using an intercalating dye (SYBR Green to detect other lyssavirus species (pan-lyssa RT-qPCR. The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135 including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5% and saliva (54% samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco. This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for
Dacheux, Laurent; Larrous, Florence; Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve
2016-07-01
The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus
DEFF Research Database (Denmark)
Høgdall, Estrid; Vuust, Jens; Lind, Peter
2000-01-01
of using TGR gene variants as markers to distinguish among T. gondii isolates from different animals and different geographical sources. Based on the band patterns obtained by restriction fragment length polymorphism (RFLP) analysis of the polymerase chain reaction (PCR) amplified TGR sequences, the T...
Rosado, A.S.; Seldin, L.; Wolters, A.; Elsas, van J.D.
1996-01-01
A molecular method for the detection of Paenibacillus azotofixans in soil and the wheat rhizosphere was developed. The system consisted of polymerase chain reaction (PCR) amplification of part of the variable V1 to V4 regions of the 16S ribosomal RNA gene, followed by hybridization with a specific
Metabolism of Very Long-Chain Fatty Acids: Genes and Pathophysiology
Sassa, Takayuki; Kihara, Akio
2014-01-01
Fatty acids (FAs) are highly diverse in terms of carbon (C) chain-length and number of double bonds. FAs with C>20 are called very long-chain fatty acids (VLCFAs). VLCFAs are found not only as constituents of cellular lipids such as sphingolipids and glycerophospholipids but also as precursors of lipid mediators. Our understanding on the function of VLCFAs is growing in parallel with the identification of enzymes involved in VLCFA synthesis or degradation. A variety of inherited diseases, suc...
Marcos Lázaro Moreli; Ricardo Luiz Moro de Sousa; Luiz Tadeu Moraes Figueiredo
2004-01-01
We report a nested reverse transcription-polymerase chain reaction (RT-PCR) assay for hantavirus using primers selected to match high homology regions of hantavirus genomes detected from the whole blood of hantavirus cardiopulmonary syndrome (HCPS) patients from Brazil, also including the N gene nucleotide sequence of Araraquara virus. Hantavirus genomes were detected in eight out of nine blood samples from the HCPS patients by RT-PCR (88.9% positivity) and in all 9 blood samples (100% positi...
Directory of Open Access Journals (Sweden)
PD Andrade
2013-01-01
Full Text Available BACKGROUND: Human cytomegalovirus is an important cause of morbidity and mortality in immunocompromised patients. Qualitative polymerase chain reaction (PCR has proven to be a sensitive and effective technique in defining active cytomegalovirus infection, in addition to having low cost and being a useful test for situations in which there is no need for quantification. Real-time PCR has the advantage of quantification; however, the high cost of this methodology makes it impractical for routine use.
Directory of Open Access Journals (Sweden)
Bramastha Rosadi
2015-01-01
Full Text Available Background: Benign Prostatic Hyperplasia (BPH has been correlated with chronic prostatitis according recent study. Chronic pelvic pain is the chief complain of BPH followed by prostatitis. The gold standard of the etiological diagnosis is urine culture, but the negativity rate is still high. Multiplex polymerase chain reaction (PCR as a diagnostic tool in search of etiological causes could identify microorganism on DNA level. This research aims to find out the role of multiplex polymerase chain reaction as diagnostic tools on prostatitis patients. Material and Method: A total of 12 samples collected during the TURP procedure in Sanglah General Hospital Denpasar – Bali from February until May 2015. All of the samples has been diagnosed prostatitis clinically and perform urine culture test. The prostate specimen taken was sent to the Pathological anatomy for histopathology diagnostic and underwent multiplex PCR for etiologic diagnostic. Result: 12 samples have been declared as prostatitis based on histopathology examination, and then were analyzed using multiplex PCR. 10 samples were positive (6 were E. coli, 2 were C. trachomatis, the rest were N. gonorrhea and P. aeruginosa. The urine culture revealed 9 positive, within the result 6 were E. coli, and the others were P. aeruginosa, M. morganii and A. haemolyticus. Conclusion: In prostatitis patient, the etiological diagnostic was important. Multiplex PCR as diagnostic tools could detect the microorganism on a negative urine culture. The combination of the urine culture test and multiplex PCR revealed a better result on etiologic diagnosis which leads to a better management of the disease.
Chua, Ang Lim; Aziah, Ismail; Balaram, Prabha; Bhuvanendran, Saatheeyavaane; Anthony, Amy Amilda; Mohmad, Siti Norazura; Nasir, Norhafiza M; Hassan, Haslizai; Naim, Rochman; Meran, Lila P; Hussin, Hani M; Ismail, Asma
2015-03-01
Chronic carriers of Salmonella Typhi act as reservoirs for the organism and become the agents of typhoid outbreaks in a community. In this study, chronic carriers in Kelantan, Malaysia were first identified using the culture and polymerase chain reaction method. Then, a novel serological tool, designated Typhidot-C, was evaluated in retrospect using the detected individuals as control positives. Chronic carriage positive by the culture and polymerase chain reaction method was recorded at 3.6% (4 out of 110) among individuals who previously had acute typhoid fever and a 9.4% (10 out of 106) carriage rate was observed among food handlers screened during outbreaks. The Typhidot-C assay was able to detect all these positive carriers showing its potential as a viable carrier screening tool and can be used for efficient detection of typhoid carriers in an endemic area. These findings were used to establish the first carrier registry for S Typhi carriers in Malaysia. © 2012 APJPH.
Hadders-Algra, Mijna
2008-01-01
This review addresses the effect of prenatal long-chain polyunsaturated fatty acid (LCPUFA) status on neuro-developmental outcome. It focuses on the major LPCUFA doxosahexaenoic acid (DNA; 22:6 omega 3) and arachidonic acid (AA; 20:4 omega 6). Due to enzymatic competition high DHA intake results in
Polymerase chain reaction for detection of invasive Shigella flexneri in food.
Lampel, K A; Jagow, J A; Trucksess, M; Hill, W E
1990-06-01
The polymerase chain reaction (PCR) was used to amplify a 760-base-pair (bp) fragment with the 220-kbp invasive plasmids of enteroinvasive Escherichia coli, Shigella flexneri, Shigella dysenteriae, Shigella boydii, and Shigella sonnei as templates. This PCR product was easily detected by agarose gel electrophoresis. A 210-bp AccI-PstI fragment lying within the amplified region was used as a probe in Southern hybridization blots and showed that the PCR-generated product was derived from the invasive plasmid. The application of PCR as a rapid method to detect enteroinvasive bacteria in foods was tested by inoculating lettuce with 10(4) S. flexneri cells per g in shigella broth base. Plasmid DNA was isolated from cultures of inoculated and uninoculated lettuce in broth after 0, 4, and 24 h of incubation. With the PCR, the 760-bp fragment was generated only from lettuce inoculated with S. flexneri, as shown by gel electrophoresis and confirmed both by Southern blotting and by nucleotide sequencing of the amplified region. Because the isolation of plasmid DNA, the performance of PCR, and gel electrophoresis all can be completed in 6 to 7 h, invasive enteric bacteria can be detected in less than 1 day.
Energy Technology Data Exchange (ETDEWEB)
Jovanovic, Jelena V. [Cancer Genetics Laboratory, Department of Medical and Molecular Genetics, King’s College London School of Medicine, London (United Kingdom); Rennie, Kristian [GSTS Pathology, Guy’s Hospital, London (United Kingdom); Culligan, Dominic [Department of Haematology, Aberdeen Royal Infirmary, Aberdeen (United Kingdom); Peniket, Andrew [Department of Haematology, John Radcliffe Hospital, Oxford (United Kingdom); Lennard, Anne [Department of Haematology, Royal Victoria Infirmary, Newcastle (United Kingdom); Harrison, Justin [Department of Haematology, Hemel Hempstead Hospital, Hemel Hempstead (United Kingdom); Vyas, Paresh [Medical Research Council Molecular Haematology Unit, Weatherall Institute of Molecular Medicine, Oxford (United Kingdom); Grimwade, David, E-mail: david.grimwade@genetics.kcl.ac.uk [Cancer Genetics Laboratory, Department of Medical and Molecular Genetics, King’s College London School of Medicine, London (United Kingdom)
2011-10-25
Molecular detection of minimal residual disease (MRD) has become established to assess remission status and guide therapy in patients with ProMyelocytic Leukemia–RARA+ acute promyelocytic leukemia (APL). However, there are few data on tracking disease response in patients with rarer retinoid resistant subtypes of APL, characterized by PLZF–RARA and STAT5b–RARA. Despite their rarity (<1% of APL) we identified 6 cases (PLZF–RARA, n = 5; STAT5b–RARA, n = 1), established the respective breakpoint junction regions and designed reverse transcription-quantitative real-time polymerase chain reaction (RT-qPCR) assays to detect leukemic transcripts. The relative level of fusion gene expression in diagnostic samples was comparable to that observed in t(15;17) – associated APL, affording assay sensitivities of ∼1 in 10{sup 4}−10{sup 5}. Serial samples were available from two PLZF–RARA APL patients. One showed persistent polymerase chain reaction positivity, predicting subsequent relapse, and remains in CR2, ∼11 years post-autograft. The other, achieved molecular remission (CRm) with combination chemotherapy, remaining in CR1 at 6 years. The STAT5b–RARA patient failed to achieve CRm following frontline combination chemotherapy and ultimately proceeded to allogeneic transplant on the basis of a steadily rising fusion transcript level. These data highlight the potential of RT-qPCR detection of MRD to facilitate development of more individualized approaches to the management of rarer molecularly defined subsets of acute leukemia.
International Nuclear Information System (INIS)
Jovanovic, Jelena V.; Rennie, Kristian; Culligan, Dominic; Peniket, Andrew; Lennard, Anne; Harrison, Justin; Vyas, Paresh; Grimwade, David
2011-01-01
Molecular detection of minimal residual disease (MRD) has become established to assess remission status and guide therapy in patients with ProMyelocytic Leukemia–RARA+ acute promyelocytic leukemia (APL). However, there are few data on tracking disease response in patients with rarer retinoid resistant subtypes of APL, characterized by PLZF–RARA and STAT5b–RARA. Despite their rarity (<1% of APL) we identified 6 cases (PLZF–RARA, n = 5; STAT5b–RARA, n = 1), established the respective breakpoint junction regions and designed reverse transcription-quantitative real-time polymerase chain reaction (RT-qPCR) assays to detect leukemic transcripts. The relative level of fusion gene expression in diagnostic samples was comparable to that observed in t(15;17) – associated APL, affording assay sensitivities of ∼1 in 10 4 −10 5 . Serial samples were available from two PLZF–RARA APL patients. One showed persistent polymerase chain reaction positivity, predicting subsequent relapse, and remains in CR2, ∼11 years post-autograft. The other, achieved molecular remission (CRm) with combination chemotherapy, remaining in CR1 at 6 years. The STAT5b–RARA patient failed to achieve CRm following frontline combination chemotherapy and ultimately proceeded to allogeneic transplant on the basis of a steadily rising fusion transcript level. These data highlight the potential of RT-qPCR detection of MRD to facilitate development of more individualized approaches to the management of rarer molecularly defined subsets of acute leukemia.
Directory of Open Access Journals (Sweden)
JANNOTTI-PASSOS Liana Konovaloff
2000-01-01
Full Text Available In order to determine Schistosoma mansoni infection rates in Biomphalaria tenagophila and B. straminea, low stringency polymerase chain reaction (LS-PCR technique was used as a complementary method to light exposure technique. LS-PCR has already been standardized in our laboratory to detect the trematode DNA in B. glabrata. Higher S. mansoni infection rates were detected using conventional method and LS-PCR. The parasite DNA profile was detected in both species after 7-day exposure to miracidia, using LS-PCR. This technique enables early detection of schistosomiasis transmission focuses, in endemic areas, before the beginning of cercariae shedding.
Fogt-Wyrwas, R; Jarosz, W; Mizgajska-Wiktor, H
2007-03-01
A polymerase chain reaction (PCR) technique has been used for the differentiation of T. canis and T. cati eggs isolated from soil and previously identified from microscopical observations. The method, using specific primers for the identification of the two Toxocara species, was assessed in both the field and laboratory. Successful results were obtained when only a single or large numbers of eggs were recovered from 40 g soil samples. The method is sensitive, allows analysis of material independent of the stage of egg development and can be adapted for the recovery of other species of parasites from soil.
Chaya, Dr; Parija, Subhash Chandra
2014-01-01
Cystic echinococcosis (CE) is a chronic zoonosis which presents with variable clinical manifestations. Currently the diagnosis of this disease is based on radiological findings and serological tests which lack specificity. Although antigen detection from the cyst fluid is the most specific, it is seldom done due to the complications involved. Detecting the presence of Echinococcus granulosus specific deoxyribonucleic acid (DNA) by the polymerase chain reaction (PCR) could provide a definitive diagnosis of CE. An in-house PCR assay was devised to detect E. granulosus specific DNA in serum, urine and hydatid cyst fluid. The ability of the PCR to detect E. granulosus in the above mentioned samples were observed in comparison with other antigen and antibody detection tests. Serum samples from surgically confirmed patients of CE with ruptured cysts contained the corresponding DNA while the in the majority of cases who had an intact cyst had no DNA of E. granulosus in their serum. DNA of E. granulosus was not found to be excreted in urine. PCR performed equal to antigen detection ELISA while testing hydatid cyst fluid samples. Serum and urine might not serve as useful samples for the molecular diagnosis of cystic echinococcosis. However, PCR can be useful on serum samples to detect ruptured hydatid cysts and on hydatid cyst fluid to confirm the parasitic diagnosis.
International Nuclear Information System (INIS)
Desai, S.P.; Bistrian, B.R.; Moldawer, L.L.; Blackburn, G.L.
1985-01-01
Fifteen patients undergoing gastric bypass surgery for morbid obesity received preoperatively a standard crystalline amino acid solution containing 15.6% branched-chain amino acids. During the first five postoperative days, the patients were randomized to receive one of three amino acid solutions of different branched-chain amino acid content. Whole-body amino acid appearance and oxidation were estimated using a continuous intravenous infusion of L-(U- 14 C)-tyrosine preoperatively and on the third postoperative day. This study suggests that an adequate nitrogen intake of a balanced amino acid mixture, as well as a solution enriched with branched-chain amino acids, maintains protein homeostasis and supports protein synthesis similarly in well-nourished patients following major abdominal surgery. A diet containing only branched-chain amino acids in isomolar ratios was as effective at maintaining protein retention and whole-body protein synthesis and albumin renewal postoperatively when compared with a standard amino acid formula
Winther, Birgit; Alper, Cuneyt M; Mandel, Ellen M; Doyle, William J; Hendley, J Owen
2007-06-01
Otitis media is a frequent complication of a viral upper respiratory tract infection, and the reported co-incidence of those diseases increases with assay sensitivity and sampling density. We determined the incidence of otitis-media complications in young children when referenced to cold-like illnesses and to concurrent virus recovery from the nasopharynx. A total of 60 children from 24 families were followed from October 2003 through April 30, 2004, by daily parental recording of illness signs, weekly pneumatic otoscopic examinations, and periodic polymerase chain reaction assay of collected nasal fluids for common viruses. One hundred ninety-nine cold-like illnesses were observed, but a sample for virus assay was not collected concurrent with 71 episodes. Of the remainder, 73% of cold-like illnesses were temporally related to recovery of 1 or a combination of the assayed viruses, with rhinovirus predominating. For non-cold-like illness periods, 54 (18%) of 297 assays were positive for virus, and the virus frequency distribution was similar to that for cold-like illnesses. There were 93 diagnosed otitis-media episodes; 65 (70%) of these occurred during a cold-like illness. For the 79 otitis-media episodes with available nasal samples, 61 (77%) were associated with a positive virus result. In this population, the otitis-media complication rate for a cold-like illness was 33%. A cold-like illness was not a prerequisite for polymerase chain reaction detection of viruses in the nose and nasopharynx of young children. Viral detection by polymerase chain reaction in the absence of a cold-like illness is associated with complications in some subjects. Otitis media is a complication of viral infection both with and without concurrent cold-like illnesses, thus downwardly biasing coincidence estimates that use cold-based illnesses as the denominator.
Maxson, T R; Meurs, K M; Lehmkuhl, L B; Magnon, A L; Weisbrode, S E; Atkins, C E
2001-01-01
To perform polymerase chain reaction (PCR) analysis on paraffin-embedded myocardium from dogs with dilated cardiomyopathy (DCM) and dogs with myocarditis to screen for canine parvovirus, adenovirus types 1 and 2, and herpesvirus. Myocardial specimens from 18 dogs with an antemortem diagnosis of DCM and 9 dogs with a histopathologic diagnosis of myocarditis were evaluated. Paraffin-embedded myocardial specimens were screened for viral genome by PCR analysis. Positive-control specimens were developed from cell cultures as well as paraffin-embedded tissue specimens from dogs with clinical and histopathologic diagnoses of viral infection with canine parvovirus, adenovirus types 1 and 2, and herpesvirus. The histologic characteristics of all myocardial specimens were classified regarding extent, location, and type of inflammation and fibrosis. Canine adenovirus type 1 was amplified from 1 specimen from a dog with DCM. Canine parvovirus, adenovirus type 2, and herpesvirus were not amplified from any myocardial specimens. Histologic analysis of specimens from dogs with DCM revealed variable amounts of fibrosis; myocardial inflammation was observed in 1 affected dog. Histopathologic analysis of specimens from dogs with myocarditis disclosed variable degrees of inflammation and fibrosis. Viral agents canine parvovirus, adenovirus types 1 and 2, and herpesvirus are not commonly associated with DCM or active myocarditis in dogs. Additional studies evaluating for nucleic acid from viruses that less commonly affect dogs or different types of infectious agents may be warranted to gain insight into the cause of DCM and myocarditis in dogs.
Identification of aflatoxigenic fungi using polymerase chain reaction-based assay
Directory of Open Access Journals (Sweden)
Šošo Vladislava M.
2014-01-01
Full Text Available As the aflatoxins represent a health-risk for humans because of their proven carcinogenicity, food-borne fungi that produce them as secondary metabolites, mainly Aspergillus flavus and Aspergillus parasiticus, have to be isolated and identified. The best argument for identifying problem fungi is that it indicates control points within the food system as part of a hazard analysis critical control point (HACCP approach. This assumes there is a close link between fungus and toxin. Conventional methods for isolation and identification of fungi are time consuming and require admirably dedicated taxonomists. Hence, it is imperative to develop methodologies that are relatively rapid, highly specific and as an alternative to the existing methods. The polymerase chain reaction (PCR facilitates the in vitro amplification of the target sequence. The main advantages of PCR is that organisms need not be cultured, at least not for a long time, prior to their detection, target DNA can be detected even in a complex mixture, no radioactive probes are required, it is rapid, sensitive and highly versatile. The gene afl-2 has been isolated and shown to regulate aflatoxin biosynthesis in A. flavus. Also, the PCR reaction was targeted against aflatoxin synthesis regulatory gene (aflR1 since these genes are nearly identical in A. flavus and A. parasiticus in order to indicate the possibility of detection of both the species with the same PCR system (primers/reaction. [Projekat Ministarstva nauke Republike Srbije, br. III46009
Directory of Open Access Journals (Sweden)
Hetal N. Prajapati
2011-09-01
Full Text Available Lipids consisting of medium chain fatty acids are commonly used in the development of lipid-based selfemulsifying and self-microemulsifying drug delivery systems. However, no systematic approach to selecting one lipid over another has been reported in the literature. In this study, propylene glycol (PG monoester (PG monocaprylate, Capmul PG-8® and PG diester (PG dicaprylocaprate, Captex 200P® of C8-fatty acids were compared with PG monoester (PG monolaurate, Capmul PG-12® and PG diester (PG dilaurate, Capmul PG-2L® of C12-fatty acids with respect to their phase diagrams, and especially for their ability to form microemulsions in the presence of a common surfactant, Cremophor EL®, and water. The solubility of two model drugs, danazol and probucol, in the lipids and lipid/surfactant mixtures were also compared. The effect of the chain length of medium-chain fatty acids (C8 versus C12 on the phase diagrams of the lipids was minimal. Both shorter and longer chain lipids formed essentially similar microemulsion and emulsion regions in the presence of Cremophor EL® and water, although the C12-fatty acid esters formed larger gel regions in the phase diagrams than the C8-fatty acid esters. When monoesters were mixed with their respective diesters at 1:1 ratios, larger microemulsion regions with lower lipid particle sizes were observed compared to those obtained with individual lipids alone. While the solubility of both danazol and probucol increased greatly in all lipids studied, compared to their aqueous solubility, the solubility in C12-fatty acid esters was found to be lower than in C8-fatty acid esters when the lipids were used alone. This difference in solubility due to the difference in fatty acid chain length, practically disappeared when the lipids were combined with the surfactant.
International Nuclear Information System (INIS)
Khalafalla, A.I.; Buettner, M.; Rziha, H.-J.
2005-01-01
Rapid identification and differentiation of camel pox (CMP) and camel contagious ecthyma (CCE) were achieved by polymerase chain reaction (PCR) with primers that distinguish Orthopoxvirus (OPV) and Parapovirus (PPV). Forty scab specimens collected from sick camels and sheep were treated by 3 different DNA extraction procedures and examined by PCR. The sensitivity of the PCR was compared with that of electron microscopy and virus isolation in cell culture. Procedure 1, in which viral DNA was extracted directly from scab specimens followed by PCR, proved to be superior and more sensitive. Procedure 2 enables a fast specific diagnosis of PPV and OPV infections directly from scab materials without the need for DNA extraction. These assays provide a rapid and feasible alternative to electron microscopy and virus isolation. (author)
Directory of Open Access Journals (Sweden)
Edina Rodrigues Pires
1997-01-01
Full Text Available Although Biomphalaria occidentalis and B. tenagophila are indistinguishable on the basis of shell morphology and the majority of their genital organs, only the latter is susceptible to infection with Schistosoma mansoni. Thus, the identification of these species is fundamental to epidemiological studies of schistosomiasis. Here we describe a simple and rapid method for differentiating B. tenagophila from B. occidentalis based on low stringency polymerase chain reaction and using a pair of primers specific for the amplification of the 18S rRNA gene. Analysis of the low stringency product profiles of populations of these snails from different geographical regions confirmed this approach as being applicable to the identification of B. tenagophila and B. occidentalis in cases where classical morphology is inconclusive
Main chain acid-degradable polymers for the delivery of bioactive materials
Frechet, Jean M. J. [Oakland, CA; Standley, Stephany M [Evanston, IL; Jain, Rachna [Milpitas, CA; Lee, Cameron C [Cambridge, MA
2012-03-20
Novel main chain acid degradable polymer backbones and drug delivery systems comprised of materials capable of delivering bioactive materials to cells for use as vaccines or other therapeutic agents are described. The polymers are synthesized using monomers that contain acid-degradable linkages cleavable under mild acidic conditions. The main chain of the resulting polymers readily degrade into many small molecules at low pH, but remain relatively stable and intact at physiological pH. The new materials have the common characteristic of being able to degrade by acid hydrolysis under conditions commonly found within the endosomal or lysosomal compartments of cells thereby releasing their payload within the cell. The materials can also be used for the delivery of therapeutics to the acidic regions of tumors and other sites of inflammation.
Directory of Open Access Journals (Sweden)
Winny Xie
2013-12-01
Full Text Available BACKGROUND: According to a report from WHO, cases of rubella infection in Indonesia has increased up to 10-fold from 2007 to 2011. Despite no data of congenital rubella syndrome in the report, there are approximately 45,000 cases of babies born with heart failure and 0.1-0.3% live births with congenital deafness in Indonesia. Allegedly, rubella infection during pregnancy may play a role in this condition. This study aimed to optimize and validate a real-time reverse transcriptase polymerase chain reaction (RT-qPCR method to detect rubella virus RNA as an aid for the diagnosis of congenital rubella infection. METHODS: Method optimization was conducted using nucleic acids extracted from Trimovax Merieux vaccine with the High Pure Viral Nucleic Acid Kit. One step RT-qPCR was performed with Quantifast Multiplex RTPCR+R Kit. Target synthetic DNA was designed and used to determine the sensitivity of the method. RNA internal control was synthesized to control the process of extraction and amplification. RESULTS: The analytical sensitivity of this method was as low as 5 copies target synthetic DNA/μl. The mean Coefficient of Variation (CV % of the critical threshold (Ct obtained were 2.71%, 1.20%, 1.62%, and 1.59% for within run, between run, between kit lots, and between operators, respectively. Recovery of the target synthetic DNA from amniotic fluid was 100.51% (by the log copies/μl at the concentration of 1,000,000 copies/μl. CONCLUSIONS: RT-qPCR is successfully used for the detection of rubella virus RNA in vaccine and synthetic nucleic acid. With its high sensitivity, good precision and recovery, this method offers a means to improve the diagnosis of congenital rubella infection in developing countries like Indonesia. KEYWORDS: congenital rubella, RT-qPCR, prenatal diagnosis, amniotic fluid.
CONTENT OF LONG CHAIN OMEGA-3 FATTY ACID COMPOSITION IN SOME IRANIAN CANNED FISH
Directory of Open Access Journals (Sweden)
Bahar Nazari
2010-12-01
Full Text Available Abstract BACKGROUND: Ecological studies have found a negative correlation between the risk of developing heart disease and fish consumption because of their long chain omega-3 fatty acids. This study was undertaken to determine the amounts of the common fatty acid content of several commercial canned fish marketing in Iran, with particular attention to long chain omega-3 fatty acids. METHODS: The most consumed available brands of canned fish were randomly selected seven times from products available in supermarkets. Total lipids were extracted by using the Folch method and prepared for fatty acid analysis. Individual fatty acids were quantified by gas chromatography (GC with 60 meter capillary column and flame ionization detector. RESULTS: The most common saturated fatty acids (SFA in Iranian canned fish was palmitic acid (C16:0 followed by stearic acid (C18:0. The amount of all trans fatty acids (TFAs except elaidic acid (C18:1 9t was 0%. The highest amount of polyunsaturated fatty acids (PUFAs related to long chain omega-3 fatty acids include eicosapentaenoic acid (EPA and docosahexaenoic acid (DHA. The most abundant monounsaturated fatty acids (MUFAs were oleic acid (C18:1 9c. CONCLUSION: This study showed higher contents of EPA and DHA in Iranian commercially available canned fish compared to the canned fish in other countries. Keywords: Iranian canned fish, fatty acids, long chain omega-3 fatty acids, gas chromatography.
Martín, Maria Cruz; del Rio, Beatriz; Martínez, Noelia; Magadán, Alfonso H; Alvarez, Miguel A
2008-12-01
One of the main microbiological problems of the dairy industry is the susceptibility of starter bacteria to virus infections. Lactobacillus delbrueckii, a component of thermophilic starter cultures used in the manufacture of several fermented dairy products, including yogurt, is also sensitive to bacteriophage attacks. To avoid the problems associated with these viruses, quick and sensitive detection methods are necessary. In the present study, a fast real-time quantitative polymerase chain reaction assay for the direct detection and quantification of L. delbrueckii phages in milk was developed. A set of primers and a TaqMan MGB probe was designed, based on the lysin gene sequence of different L. delbrueckii phages. The results show the proposed method to be a rapid (total processing time 30 min), specific and highly sensitive technique for detecting L. delbrueckii phages in milk.
A targeted metabolomic protocol for short-chain fatty acids and branched-chain amino acids.
Zheng, Xiaojiao; Qiu, Yunping; Zhong, Wei; Baxter, Sarah; Su, Mingming; Li, Qiong; Xie, Guoxiang; Ore, Brandon M; Qiao, Shanlei; Spencer, Melanie D; Zeisel, Steven H; Zhou, Zhanxiang; Zhao, Aihua; Jia, Wei
2013-08-01
Research in obesity and metabolic disorders that involve intestinal microbiota demands reliable methods for the precise measurement of the short-chain fatty acids (SCFAs) and branched-chain amino acids (BCAAs) concentration. Here, we report a rapid method of simultaneously determining SCFAs and BCAAs in biological samples using propyl chloroformate (PCF) derivatization followed by gas chromatography mass spectrometry (GC-MS) analysis. A one-step derivatization using 100 µL of PCF in a reaction system of water, propanol, and pyridine (v/v/v = 8:3:2) at pH 8 provided the optimal derivatization efficiency. The best extraction efficiency of the derivatized products was achieved by a two-step extraction with hexane. The method exhibited good derivatization efficiency and recovery for a wide range of concentrations with a low limit of detection for each compound. The relative standard deviations (RSDs) of all targeted compounds showed good intra- and inter-day (within 7 days) precision (< 10%), and good stability (< 20%) within 4 days at room temperature (23-25 °C), or 7 days when stored at -20 °C. We applied our method to measure SCFA and BCAA levels in fecal samples from rats administrated with different diet. Both univariate and multivariate statistics analysis of the concentrations of these target metabolites could differentiate three groups with ethanol intervention and different oils in diet. This method was also successfully employed to determine SCFA and BCAA in the feces, plasma and urine from normal humans, providing important baseline information of the concentrations of these metabolites. This novel metabolic profile study has great potential for translational research.
Aguilera Galaviz, Luis Alejandro; Aceves Medina, Ma del Carmen; Estrada García, Iris C
2002-01-01
Streptococcus mutans is a pathogen related to the occurrence of human dental caries. The determination of total amounts of mutans streptococci, as well as the proportion related to other oral bacteria, is of interest when assessing the risk of developing caries. In this context, it is better to use a sensitive, specific and non-time consuming method such as the polymerase chain reaction (PCR), than to use culture and biochemical identification methods. In this work we identified potentially cariogenic strains of S. mutans and assessed the relationship with the dmft, DMFT or dmft/DMFT index. Using DNA isolated from dental plaque, a 192 bp sequence was identified and amplified from the spaP gene and a 722 bp sequence from the dexA gene. The results suggest that it is important to evaluate the presence of cariogenic S. mutans strains in plaque content rather than the accumulation of plaque itself However, other factors like diet, hygiene, genetic background, the flow rate of saliva and the presence of specific antibodies, also play a key role in the development of caries.
Directory of Open Access Journals (Sweden)
Partha Sarathi Mandal
2017-03-01
Full Text Available Aim: The study was undertaken to detect the clinical signs, postmortem lesions of embryonated duck plague (DP infected eggs, and histopathological changes of chorioallantoic membrane (CAM in non-descriptive ducks of West Bengal with special reference to standardize nested polymerase chain reaction (PCR. Materials and Methods: After postmortem of suspected carcasses, samples were collected for virus isolation and identification through specific pathogen free (Khaki Campbell embryonated duck eggs. PCR was also done as confirmatory test after doing postmortem of duck embryos. DP specific nested PCR was standardized for better confirmation of the disease. Sensitivity of nested primers was also tested for DP virus. Results: Gross, postmortem and histopathological changes were prominent in dead embryos. First set of primer was able to detect 602 bp fragments of DNA polymerase gene of duck enteritis virus from infected CAM. Subsequently, a DP specific nested PCR which was very much sensitive for very small amount of viral genome was successfully standardized. After NCBI blast nucleotide sequence of nested PCR product (Accession No. HG425076 showed homology with the sequences data available in GenBank. Conclusion: The study concludes that PCR assay is very much helpful to diagnose DP disease and developed nested PCR is a double confirmatory diagnostic tool for DP.
Pochop, Jaroslav; Kačániová, Miroslava; Hleba, Lukáš; Lopasovský, L'ubomír; Bobková, Alica; Zeleňáková, Lucia; Stričík, Michal
2012-01-01
The aim of this study was to follow contamination of ready-to-eat food with Listeria monocytogenes by using the Step One real time polymerase chain reaction (PCR). We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and MicroSEQ® Listeria monocytogenes Detection Kit for the real-time PCR performance. In 30 samples of ready-to-eat milk and meat products without incubation we detected strains of Listeria monocytogenes in five samples (swabs). Internal positive control (IPC) was positive in all samples. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in ready-to-eat food without incubation.
DEFF Research Database (Denmark)
Wernike, Kerstin; Bonilauri, Paolo; Dauber, Malte
2012-01-01
To compare the real-time reverse transcription quantitative polymerase chain reaction (RT-qPCR) assays used for the diagnosis of Porcine reproductive and respiratory syndrome virus (PRRSV), a Europe-wide interlaboratory ring trial was conducted. A variety of PRRSV strains including North American...... (NA) and European (EU) genotype isolates were analyzed by the participants. Great differences regarding qualitative diagnostics as well as analytical sensitivity were observed between the individual RT-qPCR systems, especially when investigating strains from the EU genotype. None of the assays...
A Simple Reverse Transcription-Polymerase Chain Reaction for Dengue Type 2 Virus Identification
Directory of Open Access Journals (Sweden)
Luiz Tadeu M Figueiredo
1997-05-01
Full Text Available We show here a simplified reverse transcription-polymerase chain reaction (RT-PCR for identification of dengue type 2 virus. Three dengue type 2 virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD, as a negative control, were used in this study. C6/36 cells were infected with the virus, and tissue culture fluids were collected after 7 days of infection period. The RT-PCR, a combination of RT and PCR done after a single addition of reagents in a single reaction vessel was carried out following a digestion of virus with 1% Nonidet P-40. The 50ml assay reaction mixture included 50 pmol of a dengue type 2 specific primer pair amplifying a 210 base pair sequence of the envelope protein gene, 0.1 mM of the four deoxynucleoside triphosphates, 7.5U of reverse transcriptase, and 1U of thermostable Taq DNA polymerase. The reagent mixture was incubated for 15 min at 37oC for RT followed by a variable amount of cycles of two-step PCR amplification (92oC for 60 sec, 53oC for 60 sec with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized with UV light after gel incubation in ethidium bromide solution. DNA bands were observed after 25 and 30 cycles of PCR. Virus amount as low as 102.8 TCID50/ml was detected by RT-PCR. Specific DNA amplification was observed with the three dengue type 2 strains. This assay has advantages compared to other RT-PCRs: it avoids laborious extraction of virus RNA; the combination of RT and PCR reduces assay time, facilitates the performance and reduces risk of contamination; the two-step PCR cycle produces a clear DNA amplification, saves assay time and simplifies the technique
Alphonse, Sébastien; Arnold, Jamie J; Bhattacharya, Shibani; Wang, Hsin; Kloss, Brian; Cameron, Craig E; Ghose, Ranajeet
2014-07-15
In bacteriophages of the cystovirus family, the polymerase complex (PX) encodes a 75-kDa RNA-directed RNA polymerase (P2) that transcribes the double-stranded RNA genome. Also a constituent of the PX is the essential protein P7 that, in addition to accelerating PX assembly and facilitating genome packaging, plays a regulatory role in transcription. Deletion of P7 from the PX leads to aberrant plus-strand synthesis suggesting its influence on the transcriptase activity of P2. Here, using solution NMR techniques and the P2 and P7 proteins from cystovirus ϕ12, we demonstrate their largely electrostatic interaction in vitro. Chemical shift perturbations on P7 in the presence of P2 suggest that this interaction involves the dynamic C-terminal tail of P7, more specifically an acidic cluster therein. Patterns of chemical shift changes induced on P2 by the P7 C-terminus resemble those seen in the presence of single-stranded RNA suggesting similarities in binding. This association between P2 and P7 reduces the affinity of the former toward template RNA and results in its decreased activity both in de novo RNA synthesis and in extending a short primer. Given the presence of C-terminal acidic tracts on all cystoviral P7 proteins, the electrostatic nature of the P2/P7 interaction is likely conserved within the family and could constitute a mechanism through which P7 regulates transcription in cystoviruses. Copyright © 2014 Elsevier Ltd. All rights reserved.
Aysan, Ayse Beyza; Knejzlík, Zdeněk; Ulbrich, Pavel; Šoltys, Marek; Zadražil, Aleš; Štěpánek, František
2017-05-01
The combination of nanoparticles with the polymerase chain reaction (PCR) can have benefits such as easier sample handling or higher sensitivity, but also drawbacks such as loss of colloidal stability or inhibition of the PCR. The present work systematically investigates the interaction of magnetic iron oxide nanoparticles (MIONs) with the PCR in terms of colloidal stability and potential PCR inhibition due to interaction between the PCR components and the nanoparticle surface. Several types of MIONs with and without surface functionalisation by sodium citrate, dextran and 3-aminopropyl-triethoxysilane (APTES) were prepared and characterised by Transmission Electron Microscopy (TEM), dynamic light scattering (DLS) and Fourier Transform Infrared (FT-IR) spectroscopy. Colloidal stability in the presence of the PCR components was investigated both at room temperature and under PCR thermo-cycling. Dextran-stabilized MIONs show the best colloidal stability in the PCR mix at both room and elevated temperatures. Citrate- and APTES-stabilised as well as uncoated MIONs show a comparable PCR inhibition near the concentration 0.1mgml -1 while the inhibition of dextran stabilized MIONs became apparent near 0.5mgml -1 . It was demonstrated that the PCR could be effectively carried out even in the presence of elevated concentration of MIONs up to 2mgml -1 by choosing the right coating approach and supplementing the reaction mix by critical components, Taq DNA polymerase and Mg 2+ ions. Copyright © 2017 Elsevier B.V. All rights reserved.
Bjerregaard, Henriette; Pedersen, Shona; Kristensen, Søren Risom; Marcussen, Niels
2011-12-01
Differentiation between malignant renal cell carcinoma and benign oncocytoma is of great importance to choose the optimal treatment. Accurate preoperative diagnosis of renal tumor is therefore crucial; however, existing imaging techniques and histologic examinations are incapable of providing an optimal differentiation profile. Analysis of gene expression of molecular markers is a new possibility but relies on appropriate standardization to compare different samples. The aim of this study was to identify stably expressed reference genes suitable for the normalization of results extracted from gene expression analysis of renal tumors. Expression levels of 8 potential reference genes (ATP5J, HMBS, HPRT1, PPIA, TBP, 18S, GAPDH, and POLR2A) were examined by real-time reverse transcription polymerase chain reaction in tumor and normal tissue from removed kidneys from 13 patients with renal cell carcinoma and 5 patients with oncocytoma. The expression levels of genes were compared by gene stability value M, average gene stability M, pairwise variation V, and coefficient of variation CV. More candidates were not suitable for the purpose, but a combination of HMBS, PPIA, ATP5J, and TBP was found to be the best combination with an average gene stability value M of 0.9 and a CV of 0.4 in the 18 tumors and normal tissues. A combination of 4 genes, HMBS, PPIA, ATP5J, and TBP, is a possible reference in renal tumor gene expression analysis by reverse transcription polymerase chain reaction. A combination of four genes, HMBS, PPIA, ATP5J and TBP, being stably expressed in tissues from RCC is possible reference genes for gene expression analysis.
A Tc-99m-labeled long chain fatty acid derivative for myocardial imaging.
Magata, Yasuhiro; Kawaguchi, Takayoshi; Ukon, Misa; Yamamura, Norio; Uehara, Tomoya; Ogawa, Kazuma; Arano, Yasushi; Temma, Takashi; Mukai, Takahiro; Tadamura, Eiji; Saji, Hideo
2004-01-01
C-11- and I-123-labeled long chain fatty acid derivatives have been reported as useful radiopharmaceuticals for the estimation of myocardial fatty acid metabolism. We have reported that Tc-99m-labeled N-[[[(2-mercaptoethyl)amino]carbonyl]methyl]-N-(2-mercaptoethyl)-6-aminohexanoic acid ([(99m)Tc]MAMA-HA), a medium chain fatty acid derivative, is metabolized by beta-oxidation in the liver and that the MAMA ligand is useful for attaching to the omega-position of fatty acid derivatives as a chelating group for Tc-99m. On the basis of these findings, we focused on developing a Tc-99m-labeled long chain fatty acid derivative that reflected fatty acid metabolism in the myocardium. In this study, we synthesized a dodecanoic acid derivative, MAMA-DA, and a hexadecanoic acid derivative, MAMA-HDA, and performed radiolabeling and biodistribution studies. [(99m)Tc]MAMA-DA and [(99m)Tc]MAMA-HDA were prepared using a ligand-exchange reaction. Biodistribution studies were carried out in normal mice and rats. Then, a high initial uptake of Tc-99m was observed, followed by a rapid clearance from the heart. The maximum heart/blood ratio was 3.6 at 2 min postinjection of [(99m)Tc]MAMA-HDA. These kinetics were similar to those with postinjection of p-[(125)I]iodophenylpentadecanoic acid. Metabolite analysis showed [(99m)Tc]MAMA-HDA was metabolized by beta-oxidation in the body. In conclusion, [(99m)Tc]MAMA-HDA is a promising compound as a long chain fatty acid analogue for estimating beta-oxidation of fatty acid in the heart.
Directory of Open Access Journals (Sweden)
Rose Mary Corrêa Santos
2006-06-01
specific for IS6110 of the Mycobacterium tuberculosis complex in testing sputum samples from indigenous (Amerindian and non-indigenous patients. METHODS: A total of 214 sputum samples (154 from indigenous patients and 60 from non-indigenous patients were analyzed in order to determine the accuracy of smear microscopy (direct and concentrated versions for acid-fast bacilli, culture, and polymerase chain reaction. RESULTS: Both microscopy methods presented low sensitivity in comparison with culture and polymerase chain reaction. Specificity ranged from 91% to 100%, the concentrated acid-fast smear technique being the least specific. Nontuberculous mycobacteria were isolated three times more frequently in samples from indigenous patients than in those from non-indigenous patients. False-positive and false-negative polymerase chain reaction results were more common in the indigenous population. CONCLUSION: Positivity and isolation of nontuberculous mycobacteria in the acid-fast smear in conjunction with polymerase chain reaction positivity raise the following hypotheses: nontuberculous mycobacteria species with DNA regions homologous to, or even still possessing, the M. tuberculosis IS6110 exist in the Amazon; colonization of the oropharynx or of a tuberculous lesion accelerates the growth of the nontuberculous mycobacteria present in the sputum samples, making it impossible to isolate M. tuberculosis; A history of tuberculosis results in positivity for M. tuberculosis DNA. The absence of bacteriological positivity in the presence of polymerase chain reaction positivity raises questions regarding the inherent technical characteristics of the bacteriological methods or regarding patient history of tuberculosis.
Hossain, M A Motalib; Ali, Md Eaqub; Sultana, Sharmin; Asing; Bonny, Sharmin Quazi; Kader, Md Abdul; Rahman, M Aminur
2017-05-17
Cattle, buffalo, and porcine materials are widely adulterated, and their quantification might safeguard health, religious, economic, and social sanctity. Recently, conventional polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism (RFLP) assays have been documented but they are just suitable for identification, cannot quantify adulterations. We described here a quantitative tetraplex real-time PCR assay with TaqMan Probes to quantify contributions from cattle, buffalo, and porcine materials simultaneously. Amplicon-sizes were very short (106-, 90-, and 146-bp for cattle, buffalo, and porcine) because longer targets could be broken down, bringing serious ambiguity in molecular diagnostics. False negative detection was eliminated through an endogenous control (141-bp site of eukaryotic 18S rRNA). Analysis of 27 frankfurters and 27 meatballs reflected 84-115% target recovery at 0.1-10% adulterations. Finally, a test of 36 commercial products revealed 71% beef frankfurters, 100% meatballs, and 85% burgers contained buffalo adulteration, but no porcine was found in beef products.
Directory of Open Access Journals (Sweden)
Shyamala G
2008-01-01
Full Text Available Background: Perinatal viral infections of fetus are among the leading causes of congenital cataract and identifying the viral etiology is important. Objectives: To detect the presence of Rubella virus (RV, herpes simplex virus (HSV and cytomegalovirus (CMV in lens aspirate specimens obtained from patients with congenital cataract and relate the results with serology. Setting and Design: Prospective study carried out in tertiary care hospital. Materials and Methods: Fifty lens aspirates from 50 infants with congenital cataract were subjected to HSV, RV isolation and polymerase chain reaction (PCR for detection of HSV and CMV. Reverse transcription polymerase chain reaction (RT-PCR was applied for RV detection. Peripheral blood specimens were screened for anti-HSV, RV and CMV antibodies by enzyme-linked immunosorbant assay (ELISA. Results: Rubella virus was detected in nine (18% lens aspirates, by nRT-PCR which includes six positive by culture. HSV-2 DNA was detected in nine other lens aspirates, while CMV was not detected by PCR. Serological results did not correlate with the presence of viruses in the lens aspirates. This is the first report of detection of HSV-2 DNA in cases of congenital cataract. Conclusions: Cytomegalovirus may not be playing a significant role in causation of congenital cataract. The role of serology in identifying causative viral infection for congenital cataract needs to be re-evaluated.
Developmental changes in rat liver branched-chain 2-oxo acid dehydrogenase.
May, E E; May, M E; Aftring, R P; Buse, M G
1982-01-01
Branched-chain 2-oxo acid dehydrogenase catalyses the first irreversible step in the degradation of the branched-chain amino acids leucine, isoleucine and valine. With specifically labelled 4-methyl-2-oxo[1-14C]pentanoate as substrate, the enzyme's activity was measured in rat liver homogenates. Activity (per g wet wL of liver or per mg of protein) increased most rapidly during the perinatal period (2 days before to 1 day after birth), reaching approximately adult values by the time of weanin...
Morel, P A; Dorman, J S; Todd, J A; McDevitt, H O; Trucco, M
1988-01-01
One hundred seventy-two members from 27 randomly selected multiple case Caucasian families of patients with insulin-dependent diabetes mellitus (IDDM) were studied at the DNA level to ascertain the reliability of codon 57 of the HLA-DQ beta-chain gene as a disease protection/susceptibility marker. The analysis was carried out by polymerase chain reaction amplification of DNA encoding the first domain of the DQ beta chain and by dot blot analysis of the amplified material with allele-specific ...
Degradation of amino acids to short-chain fatty acids in humans. An in vitro study
DEFF Research Database (Denmark)
Rasmussen, H S; Holtug, K; Mortensen, P B
1988-01-01
Short-chain fatty acids (SCFA) originate mainly in the colon through bacterial fermentation of polysaccharides. To test the hypothesis that SCFA may originate from polypeptides as well, the production of these acids from albumin and specific amino acids was examined in a faecal incubation system....... Albumin was converted to all C2-C5-fatty acids, whereas amino acids generally were converted to specific SCFA, most often through the combination of a deamination and decarboxylation of the amino acids, although more complex processes also took place. This study indicates that a part of the intestinal...
Chisi, Songelwayo L; Schmidt, Tracy; Akol, George W; Van Heerden, Henriette
2017-09-27
Serology is primarily used in the diagnosis of bovine brucellosis. Bacterial culture and isolation is the gold standard in diagnosing brucellosis but, like serology, it does not offer complete (100%) diagnostic sensitivity and specificity. Polymerase chain reaction (PCR) has been suggested to offer better specificity and sensitivity. In this study, we evaluated the performance of Brucella abortus species specific (BaSS) PCR directly from different samples in the diagnosis of bovine brucellosis in naturally infected cattle in KwaZulu-Natal province of South Africa with known infectious status from culture. The BaSS PCR had a low diagnostic sensitivity (DSe) of 70%, but was able to identify vaccine strains using abomasal fluid from aborted foetuses and detect Brucella DNA from decomposing samples. The best sample for the BaSS PCR was abomasal fluid.
Zhu, Guiming; Saleh, Abdulmomen Ali Mohammed; Bahwal, Said Ahmed; Wang, Kunfu; Wang, Mingfu; Wang, Didi; Ge, Tangdong; Sun, Jie
2014-09-01
Three long-chain polyunsaturated fatty acids, docosahexaenoic acid (DHA, 22:6n-3), eicosapentaenoic acid (EPA, 20:5n-3) and arachidonic acid (ARA, 20:4n-6), are the most biologically active polyunsaturated fatty acids in the body. They are important in developing and maintaining the brain function, and in preventing and treating many diseases such as cardiovascular disease, inflammation and cancer. Although mammals can biosynthesize these long-chain polyunsaturated fatty acids, the efficiency is very low and dietary intake is needed to meet the requirement. In this study, a multiple-genes expression vector carrying mammalian A6/A5 fatty acid desaturases and multiple-genes expression vector carrying mammalian Δ6/Δ5 fatty acid desaturases and Δ6/Δ5 fatty acid elongases coding genes was used to transfect HEK293T cells, then the overexpression of the target genes was detected. GC-MS analysis shows that the biosynthesis efficiency and level of DHA, EPA and ARA were significantly increased in cells transfected with the multiple-genes expression vector. Particularly, DHA level in these cells was 2.5 times higher than in the control cells. This study indicates mammal possess a certain mechanism for suppression of high level of biosynthesis of long chain polyunsaturated fatty acids, and the overexpression of Δ6/Δ5 fatty acid desaturases and Δ6/Δ5 fatty acid elongases broke this suppression mechanism so that the level of DHA, EPA and ARA was significantly increased. This study also provides a basis for potential applications of this gene construct in transgenic animal to produce high level of these long-chain polyunsaturated fatty acid.
Wu, Wenming; Trinh, Kieu The Loan; Lee, Nae Yoon
2015-03-07
We introduce a new strategy for fabricating a seamless three-dimensional (3D) helical microreactor utilizing a silicone tube and a paraffin mold. With this method, various shapes and sizes of 3D helical microreactors were fabricated, and a complicated and laborious photolithographic process, or 3D printing, was eliminated. With dramatically enhanced portability at a significantly reduced fabrication cost, such a device can be considered to be the simplest microreactor, developed to date, for performing the flow-through polymerase chain reaction (PCR).
Critical analysis: use of polymerase chain reaction to diagnose leprosy
Directory of Open Access Journals (Sweden)
Flaviane Granero Maltempe
Full Text Available ABSTRACT Leprosy is a neglected tropical disease and an important public health problem, especially in developing countries. It is a chronic infectious disease that is caused by Mycobacterium leprae, which has a predilection for the skin and peripheral nerves. Although it has low sensitivity, slit-skin smear (SSS remains the conventional auxiliary laboratory technique for the clinical diagnosis of leprosy. Polymerase chain reaction (PCR is a molecular biology technique that holds promise as a simple and sensitive diagnostic tool. In the present study, the performance of two PCR methods, using different targets, PCR-LP and PCR-P, were compared with SSS with regard to leprosy diagnosis in a reference laboratory. M. leprae DNA was extracted from 106 lymph samples of 40 patients who had clinical suspicion of leprosy. The samples were subjected to both PCR techniques and SSS. Amplification of the human b-globin gene was used as PCR inhibitor control. The specificity of both PCR techniques was 100%, and sensitivity was 0.007 and 0.015 µg/ml for PCR-LP and PCR-P, respectively. No significant difference was found between either the PCR-LP or PCR-P results and SSS results (p > 0.05. Although PCR is not yet a replacement for SSS in the diagnosis of leprosy, this technique may be used as an efficient auxiliary tool for early detection of the disease, especially in endemic regions. This strategy may also be useful in cases in which SSS results are negative (e.g., in paucibacillary patients and cases in which skin biopsy cannot be performed.
Takemoto, Yasuhiko; Suzuki, Yasuyuki; Horibe, Ryoko; Shimozawa, Nobuyuki; Wanders, Ronald J. A.; Kondo, Naomi
2003-01-01
Very long chain fatty acids (VLCFAs) and docosahexaenoic acid (DHA), phytanic acid, and plasmalogens are usually measured individually. A novel method for the screening of peroxisomal disorders, using gas chromatography/mass spectrometry (GC/MS), was developed. Saturated and unsaturated fatty acids,
The Role of GPR84 in Medium-chain Saturated Fatty Acid Taste Transduction
Liu, Yan
2016-01-01
Previous research has shown the gustatory recognition of the long-chain unsaturated fatty acids. In this study, I showed for the first time that medium-chain saturated fatty acids (MCFAs) are effective taste stimuli at both the cellular and behavioral levels. The mechanisms of gustatory recognition of MCFAs in mice were also partially elucidated using pharmaceutical approaches. The inward currents induced by capric acid in mouse taste cells were significantly inhibited by the antagonists of G...
Two-stage medium chain fatty acid (MCFA) production from municipal solid waste and ethanol
Grootscholten, T.I.M.; Strik, D.P.B.T.B.; Steinbusch, K.J.J.; Buisman, C.J.N.; Hamelers, B.
2014-01-01
Chain elongation is an anaerobic fermentation that produces medium chain fatty acids (MCFAs) from volatile fatty acids and ethanol. These MCFAs can be used as biochemical building blocks for fuel production and other chemical processes. Producing MCFAs from the organic fraction of municipal solid
Brehm, Mary A; Gordon, Katie; Firan, Miahil; Rady, Peter; Agim, Nnenna
2016-05-01
Focal epithelial hyperplasia (FEH), or Heck's disease, is an uncommon benign proliferation of oral mucosa caused by the human papillomavirus (HPV), particularly subtypes 13 and 32. The disease typically presents in young Native American patients and is characterized by multiple asymptomatic papules and nodules on the oral mucosa, lips, tongue, and gingiva. The factors that determine susceptibility to FEH are unknown, but the ethnic and geographic distribution of FEH suggests that genetic predisposition, particularly having the human lymphocytic antigen DR4 type, may be involved in pathogenesis. We report a case of FEH with polymerase chain reaction detection of HPV13 in a healthy 11-year-old Hispanic girl and discuss the current understanding of disease pathogenesis, susceptibility, and treatment. © 2016 Wiley Periodicals, Inc.
Trends and advances in food analysis by real-time polymerase chain reaction.
Salihah, Nur Thaqifah; Hossain, Mohammad Mosharraf; Lubis, Hamadah; Ahmed, Minhaz Uddin
2016-05-01
Analyses to ensure food safety and quality are more relevant now because of rapid changes in the quantity, diversity and mobility of food. Food-contamination must be determined to maintain health and up-hold laws, as well as for ethical and cultural concerns. Real-time polymerase chain reaction (RT-PCR), a rapid and inexpensive quantitative method to detect the presence of targeted DNA-segments in samples, helps in determining both accidental and intentional adulterations of foods by biological contaminants. This review presents recent developments in theory, techniques, and applications of RT-PCR in food analyses, RT-PCR addresses the limitations of traditional food analyses in terms of sensitivity, range of analytes, multiplexing ability, cost, time, and point-of-care applications. A range of targets, including species of plants or animals which are used as food ingredients, food-borne bacteria or viruses, genetically modified organisms, and allergens, even in highly processed foods can be identified by RT-PCR, even at very low concentrations. Microfluidic RT-PCR eliminates the separate sample-processing step to create opportunities for point-of-care analyses. We also cover the challenges related to using RT-PCR for food analyses, such as the need to further improve sample handling.
Toxin genotyping of Clostridium perfringens strains using a polymerase chain reaction protocol
Directory of Open Access Journals (Sweden)
Elisabetta Di Giannatale
2010-03-01
Full Text Available A polymerase chain reaction protocol consisting of a multiplex to identify the cpa, cpb1, cpetx, cpi genes and a duplex to identify the cpe and cpb2 genes encoding for a, b1, e, i, enterotoxin and b2 toxins, respectively, was applied to DNA extracted from two collections of Clostridium perfringens strains. The first collection involved 19 isolates from rabbits. The second collection of 41 isolates came from routine necropsies. The cpa gene alone, or in association with the cpb2 gene, was detected in all DNA samples examined. The cpa gene, together with cpb2 gene, were detected in seven of the rabbit C. perfringens strains (36.8% and in nine isolates from necropsies (21.9%. The cpa gene was found in 63.2% of rabbit strains and 76.9% of strains from other animal species. In rabbits, the pathological lesions associated with C. perfringens detection were predominantly forms of non-inflammatory enteropathies. In other species, C. perfringens was mainly associated with congestive-haemorrhagic enteropathy, but also with fatal traumatic lesions, degenerative diseases and organs with post-mortem autolysis. No clear correlation was observed between detection of b2 toxin gene and species-specific pathological features.
Yamamoto, Keisuke; Tsuchisaka, Atsunari; Yukawa, Hideaki
Branched-chain amino acids (BCAAs), viz., L-isoleucine, L-leucine, and L-valine, are essential amino acids that cannot be synthesized in higher organisms and are important nutrition for humans as well as livestock. They are also valued as synthetic intermediates for pharmaceuticals. Therefore, the demand for BCAAs in the feed and pharmaceutical industries is increasing continuously. Traditional industrial fermentative production of BCAAs was performed using microorganisms isolated by random mutagenesis. A collection of these classical strains was also scientifically useful to clarify the details of the BCAA biosynthetic pathways, which are tightly regulated by feedback inhibition and transcriptional attenuation. Based on this understanding of the metabolism of BCAAs, it is now possible for us to pursue strains with higher BCAA productivity using rational design and advanced molecular biology techniques. Additionally, systems biology approaches using augmented omics information help us to optimize carbon flux toward BCAA production. Here, we describe the biosynthetic pathways of BCAAs and their regulation and then overview the microorganisms developed for BCAA production. Other chemicals, including isobutanol, i.e., a second-generation biofuel, can be synthesized by branching the BCAA biosynthetic pathways, which are also outlined.
Long-chain polyunsaturated fatty acids in maternal and infant nutrition
Muskiet, Frits A. J.; van Goor, Saskia A.; Kuipers, Remko S.; Velzing-Aarts, Francien V.; Smit, Ella N.; Bouwstra, Hylco; Dijck-Brouwer, D. A. Janneke; Boersma, E. Rudy; Hadders-Algra, Mijna
Homo sapiens has evolved on a diet rich in alpha-linolenic acid and long chain polyunsaturated fatty acids (LCP). We have, however, gradually changed our diet from about 10,000 years ago and accelerated this change from about 100 to 200 years ago. The many dietary changes, including lower intake of
Rojas, María; González, Isabel; Pavón, Miguel Angel; Pegels, Nicolette; Lago, Adriana; Hernández, Pablo E; García, Teresa; Martín, Rosario
2010-06-01
Species-specific real-time polymerase chain reaction (PCR) assays using TaqMan probes have been developed for verifying the labeling of meat and commercial meat products from game birds, including quail, pheasant, partridge, guinea fowl, pigeon, Eurasian woodcock and song thrush. The method combines the use of species-specific primers and TaqMan probes that amplify small fragments (amplicons meat products from the target species demonstrated the suitability of the assay for the detection of the target DNAs.
Sun, Yong-sheng; Lou, Si-quan; Wen, Jian-min; Lv, Wei-xin; Jiao, Chang-geng; Yang, Su-min; Xu, Hai-bin
2011-02-01
To assess the clinical value of polymerase chain reaction (PCR) in the diagnosis and differential diagnosis of joint tuberculosis (TB). PCR was used blindly to detect the DNA of Mycobacterium tuberculosis (M.TB) in five specimens of M.TB, 5 of BCG, and 10 of other bacteria. Then, M. TB in 98 samples from patients with joint TB and 100 samples from patients with non-tubercular joint disorders were detected by PCR, acid-fast staining and culture,. The sensitivity, specificity, accuracy, positive predictive value, and negative predictive value of PCR were calculated. The χ2 test was used for statistical analysis of the frequency of various factors. At the same time, some problems with PCR were also systematically analyzed. (1) In the "standard samples", both M. TB and BCG showed positive while other bacteria were negative. (2) In 98 cases from patients with joint TB, 81 were positive by PCR, 6 by acid-fast staining, and 17 by culture. In 100 cases from patients with non-tuberculous joint disorders, 9 were positive by PCR, and none by either acid-fast staining or culture. Sensitivity, specificity, accuracy, positive and negative predictive value of PCR were 82.65% (81/98), 91.00% (91/100), 86.87% (172/198), 90.00% (81/90) and 84.26% (91/108), respectively. (3) The positive rates for PCR, acid-fast staining and culture in detection of M. TB were 82.65% (81/98), 6.12% (6/98), and 17.34% (17/98), respectively. There were statistically significant differences between the three methods (P < 0.001). (4) The process of PCR is automatic, and can be completed within 3 to 6 hours, whereas 4 to 8 weeks are required for the conventional culture of M. TB. PCR is a sensitive, specific, rapid, simple and minimally invasive method for detection of M. TB in samples from joint TB, and can play an important role in early and rapid diagnosis and differential diagnosis of joint TB. But it also has some limitations, such as false positivity and false negativity. © 2011 Tianjin Hospital
Langer, S; Scislowski, P W; Brown, D S; Dewey, P; Fuller, M F
2000-01-01
The present experiment was designed to elucidate the mechanism of the methionine-sparing effect of excess branched-chain amino acids (BCAA) reported in the previous paper (Langer & Fuller, 2000). Twelve growing gilts (30-35 kg) were prepared with arterial catheters. After recovery, they received for 7 d a semipurified diet with a balanced amino acid pattern. On the 7th day blood samples were taken before (16 h postabsorptive) and after the morning meal (4 h postprandial). The animals were then divided into three groups and received for a further 7 d a methionine-limiting diet (80% of requirement) (1) without any amino acid excess; (2) with excess leucine (50% over requirement); or (3) with excesses of all three BCAA (leucine, isoleucine, valine, each 50% over the requirement). On the 7th day blood samples were taken as in the first period, after which the animals were killed and liver and muscle samples taken. Plasma amino acid and branched-chain keto acid (BCKA) concentrations in the blood and branched-chain keto-acid dehydrogenase (BCKDH; EC 1.2.4.4) activity in liver and muscle homogenates were determined. Compared with those on the balanced diet, pigs fed on methionine-limiting diets had significantly lower (P < 0.05) plasma methionine concentrations in the postprandial but not in the postabsorptive state. There was no effect of either leucine or a mixture of all three BCAA fed in excess on plasma methionine concentrations. Excess dietary leucine reduced (P < 0.05) the plasma concentrations of isoleucine and valine in both the postprandial and postabsorptive states. Plasma concentrations of the BCKA reflected the changes in the corresponding amino acids. Basal BCKDH activity in the liver and total BCKDH activity in the biceps femoris muscle were significantly (P < 0.05) increased by excesses of leucine or all BCAA.
Litschko, Christa; Oldrini, Davide; Budde, Insa; Berger, Monika; Meens, Jochen; Gerardy-Schahn, Rita; Berti, Francesco; Schubert, Mario; Fiebig, Timm
2018-05-29
Group 2 capsule polymers represent crucial virulence factors of Gram-negative pathogenic bacteria. They are synthesized by enzymes called capsule polymerases. In this report, we describe a new family of polymerases that combine glycosyltransferase and hexose- and polyol-phosphate transferase activity to generate complex poly(oligosaccharide phosphate) and poly(glycosylpolyol phosphate) polymers, the latter of which display similarity to wall teichoic acid (WTA), a cell wall component of Gram-positive bacteria. Using modeling and multiple-sequence alignment, we showed homology between the predicted polymerase domains and WTA type I biosynthesis enzymes, creating a link between Gram-negative and Gram-positive cell wall biosynthesis processes. The polymerases of the new family are highly abundant and found in a variety of capsule-expressing pathogens such as Neisseria meningitidis , Actinobacillus pleuropneumoniae , Haemophilus influenzae , Bibersteinia trehalosi , and Escherichia coli with both human and animal hosts. Five representative candidates were purified, their activities were confirmed using nuclear magnetic resonance (NMR) spectroscopy, and their predicted folds were validated by site-directed mutagenesis. IMPORTANCE Bacterial capsules play an important role in the interaction between a pathogen and the immune system of its host. During the last decade, capsule polymerases have become attractive tools for the production of capsule polymers applied as antigens in glycoconjugate vaccine formulations. Conventional production of glycoconjugate vaccines requires the cultivation of the pathogen and thus the highest biosafety standards, leading to tremendous costs. With regard to animal husbandry, where vaccines could avoid the extensive use of antibiotics, conventional production is not sufficiently cost-effective. In contrast, enzymatic synthesis of capsule polymers is pathogen-free and fast, offers high stereo- and regioselectivity, and works with high efficacy
The influence of aliphatic side chain of anacardic acid on molecular ...
African Journals Online (AJOL)
Interestingly, the presence of the aliphatic side chain in AnMcr resulted in more uniform imprinted beads as compared to particle agglomerates obtained from SaMcr in the presence of propranolol template. Therefore, the aliphatic side chain of anacardic acid improves both molecular recognition of imprinted polymers as ...
Cao, Weidong; Bean, Brian; Corey, Scott; Coursey, Johnathan S; Hasson, Kenton C; Inoue, Hiroshi; Isano, Taisuke; Kanderian, Sami; Lane, Ben; Liang, Hongye; Murphy, Brian; Owen, Greg; Shinoda, Nobuhiko; Zeng, Shulin; Knight, Ivor T
2016-06-01
We report the development of an automated genetic analyzer for human sample testing based on microfluidic rapid polymerase chain reaction (PCR) with high-resolution melting analysis (HRMA). The integrated DNA microfluidic cartridge was used on a platform designed with a robotic pipettor system that works by sequentially picking up different test solutions from a 384-well plate, mixing them in the tips, and delivering mixed fluids to the DNA cartridge. A novel image feedback flow control system based on a Canon 5D Mark II digital camera was developed for controlling fluid movement through a complex microfluidic branching network without the use of valves. The same camera was used for measuring the high-resolution melt curve of DNA amplicons that were generated in the microfluidic chip. Owing to fast heating and cooling as well as sensitive temperature measurement in the microfluidic channels, the time frame for PCR and HRMA was dramatically reduced from hours to minutes. Preliminary testing results demonstrated that rapid serial PCR and HRMA are possible while still achieving high data quality that is suitable for human sample testing. © 2015 Society for Laboratory Automation and Screening.
Silvar, C; Díaz, J; Merino, F
2005-12-01
ABSTRACT Reliable and sensitive quantification of Phytophthora capsici in pepper plants is of crucial importance in managing the multiple syndromes caused by this pathogen. A real-time polymerase chain reaction (PCR) assay was developed for the determination of P. capsici in pepper tissues. DNA levels of a highly virulent and a less virulent isolate were measured in different pepper genotypes with varying degrees of resistance. Using SYBR Green and specific primers for P. capsici, the minimal amount of pathogen DNA quantified was 10 pg. Pathogen DNA was recorded as early as 8 h postinoculation. Thereafter, the increase was rapid in susceptible cultivars and slower in resistant ones. The amount of pathogen DNA quantified in each pepper genotype correlated with susceptibility to Phytophthora root rot. Likewise, there was a relationship between the virulence of the pathogen and the degree of colonization. Differences also were found in oomycete amount among pepper tissues, with maximal pathogen biomass occurring in stems. The real-time PCR technique developed in this study was sensitive and robust enough to assess both pathogen development and resistance to Phytophthora root rot in different pepper genotypes.
DEFF Research Database (Denmark)
Hansen, Heinz Johs. Max; Carey, E.M.; Dils, R.
1970-01-01
- 1. Gas-liquid and paper chromatography have been used to determine the chain-lengths of fatty acids synthesised by purified rat liver fatty acid synthetase from [1-14C]acetyl-CoA, [1,3-14C2]malonyl-CoA and from [1-14C]acetyl-CoA plus partially purified rat liver acetyl-CoA carboxylase. - 2....... A wide range (C4:0–C18:0) of fatty acids was synthesised and the proportions were modified by substrate concentrations in the same manner as for purified rabbit mammary gland fatty acid synthetase. - 3. The relative amount of radioactivity incorporated from added acetyl-CoA and malonyl-CoA depended...... of long-chain fatty acids was synthesised from carboxylated acetyl-CoA than from added malonyl-CoA. - 5. It is suggested that acetyl-CoA carboxylase may carboxylate acetate bound to fatty acid synthetase....
Jafari, Zahra; Motamedi, Marjan; Jalalizand, Nilufar; Shokoohi, Gholam R; Charsizadeh, Arezu; Mirhendi, Hossein
2017-09-01
The epidemiological alteration in the distribution of Candida species, as well as the significantly increasing trend of either intrinsic or acquired resistance of some of these fungi highlights the need for a reliable method for the identification of the species. Polymerase chain reaction (PCR) is one of the methods facilitating the quick and precise identification of Candida species. The aim of this study was to compare the efficiency of CHROMagar, PCR-restriction fragment length polymorphism (PCR-RFLP), and PCR-fragment size polymorphism (PCR-FSP) assays in the identification of Candida species to determine the benefits and limitations of these methods. This study was conducted on 107 Candida strains, including 20 standard strains and 87 clinical isolates. The identification of the isolates was accomplished by using CHROMagar as a conventional method. The PCR-RFLP assay was performed on the entire internal transcribed spacer (ITS) region of ribosomal DNA (rDNA), and the consequent enzymatic digestion was compared with PCR-FSP results in which ITS1 and ITS2 regions were separately PCR amplified. In both molecular assays, yeast identification was carried out through the specific electrophoretic profiles of the PCR products. According to the results, the utilization of CHROMagar resulted in the identification of 29 (33.3%) Candida isolates, while the PCR-RFLP and PCR-FSP facilitated the identification of 83 (95.4%) and 80 (91.9%) clinical isolates, respectively. The obtained concordances between CHROMagar and PCR-RFLP, between CHROMagar and PCR-FSP, as well as between PCR-RFLP and PCR-FSP were 0.23, 0.20, and 0.77, respectively. The recognition of the benefits and limitations of PCR methods allows for the selection of the most efficient technique for a fast and correct differentiation. The PCR-RFLP and PCR-FSP assays had satisfactory concordance. The PCR-FSP provides a rapid, technically simple, and cost-effective method for the identification of Candida species
Meurs, K M; Fox, P R; Magnon, A L; Liu, S; Towbin, J A
2000-01-01
Viral myocarditis has been suggested as an etiology for cardiomyopathy in several mammalian species. Myocarditis and idiopathic cardiomyopathy have been reported in the domestic cat, although a viral etiology has not been demonstrated. Because of the continuing interest in the potential relationship between viral myocarditis and cardiomyopathy, we evaluated hearts from cats with spontaneous, idiopathic cardiomyopathy for viral genomic material within myocytes by polymerase chain reaction, and for the presence of myocarditis by light microscopy. Thirty-one (31) formalin-fixed hearts from domestic cats who died of idiopathic cardiomyopathy were randomly selected from pathology archives. Seventeen (17) formalin-fixed hearts from healthy cats were similarly selected as normal controls. The polymerase chain reaction (PCR) was used to evaluate myocardial tissue for the presence of viral genome from feline panleukopenia virus, herpes virus, calici virus, and corona virus. Hearts were examined using light microscopy for histologic evidence of myocarditis according to the Dallas criteria. Panleukopenia virus was identified by PCR in 10 of 31 cats with cardiomyopathy but in none of the controls. Neither cardiomyopathic or control cats tested positive by PCR for herpes virus, calici virus, and corona virus. Myocarditis was detected by histologic examination in 18 of 31 cardiomyopathic cats and in none of 17 control cats. Myocarditis and or feline panleukopenia virus genome was detected in felines with idiopathic hypertrophic, dilated, and restrictive cardiomyopathy, suggesting a possible role of viral infection and inflammation in the pathogenesis of cardiomyopathy in this species.
Zheng, Wenjun; Wang, Qingsong; Bi, Qun
2016-04-01
Pfu DNA polymerase (Pfu) is a DNA polymerase isolated from the hyperthermophilic archaeon Pyrococcus furiosus. With its excellent thermostability and high fidelity, Pfu is well known as one of the enzymes widely used in the polymerase chain reaction. In this study, the recombinant plasmid pLysS His6-tagged Pfu-pET28a was constructed. His-tagged Pfu was expressed in Escherichia coli BL21 (DE3) competent cells and then successfully purified with the ÄKTAprime plus compact one-step purification system by Ni(2+) chelating affinity chromatography after optimization of the purification conditions. The authenticity of the purified Pfu was further confirmed by peptide mass fingerprinting. A bio-assay indicated that its activity in the polymerase chain reaction was equivalent to that of commercial Pfu and its isoelectric point was found to be between 6.85 and 7.35. These results will be useful for further studies on Pfu and its wide application in the future.
Normalised quantitative polymerase chain reaction for diagnosis of tuberculosis-associated uveitis.
Barik, Manas Ranjan; Rath, Soveeta; Modi, Rohit; Rana, Rajkishori; Reddy, Mamatha M; Basu, Soumyava
2018-05-01
Polymerase chain reaction (PCR)-based diagnosis of tuberculosis-associated uveitis (TBU) in TB-endemic countries is challenging due to likelihood of latent mycobacterial infection in both immune and non-immune cells. In this study, we investigated normalised quantitative PCR (nqPCR) in ocular fluids (aqueous/vitreous) for diagnosis of TBU in a TB-endemic population. Mycobacterial copy numbers (mpb64 gene) were normalised to host genome copy numbers (RNAse P RNA component H1 [RPPH1] gene) in TBU (n = 16) and control (n = 13) samples (discovery cohort). The mpb64:RPPH1 ratios (normalised value) from each TBU and control sample were tested against the current reference standard i.e. clinically-diagnosed TBU, to generate Receiver Operating Characteristic (ROC) curves. The optimum cut-off value of mpb64:RPPH1 ratio (0.011) for diagnosing TBU was identified from the highest Youden index. This cut-off value was then tested in a different cohort of TBU and controls (validation cohort, 20 cases and 18 controls), where it yielded specificity, sensitivity and diagnostic accuracy of 94.4%, 85.0%, and 89.4% respectively. The above values for conventional quantitative PCR (≥1 copy of mpb64 per reaction) were 61.1%, 90.0%, and 74.3% respectively. Normalisation markedly improved the specificity and diagnostic accuracy of quantitative PCR for diagnosis of TBU. Copyright © 2018 Elsevier Ltd. All rights reserved.
Kledmanee, Kan; Suwanpakdee, Sarin; Krajangwong, Sakranmanee; Chatsiriwech, Jarin; Suksai, Parut; Suwannachat, Pongpun; Sariya, Ladawan; Buddhirongawatr, Ruangrat; Charoonrut, Phingphol; Chaichoun, Kridsada
2009-01-01
A multiplex polymerase chain reaction (PCR) has been developed for simultaneous detection of canine blood parasites, Ehrlichia canis, Babesia spp and Hepatozoon canis, from blood samples in a single reaction. The multiplex PCR primers were specific to E. canis VirB9, Babesia spp 16S rRNA and H. canis 16S rRNA genes. Specificity of the amplicons was confirmed by DNA sequencing. The assay was evaluated using normal canine and infected blood samples, which were detected by microscopic examination. This multiplex PCR offers scope for simultaneous detection of three important canine blood parasites and should be valuable in monitoring parasite infections in dogs and ticks.
Directory of Open Access Journals (Sweden)
Aline Lavado Tolardo
2016-06-01
Full Text Available Vesiculoviruses (VSV are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections.
Focke, Felix; Haase, Ilka; Fischer, Markus
2011-01-26
Usually spices are identified morphologically using simple methods like magnifying glasses or microscopic instruments. On the other hand, molecular biological methods like the polymerase chain reaction (PCR) enable an accurate and specific detection also in complex matrices. Generally, the origins of spices are plants with diverse genetic backgrounds and relationships. The processing methods used for the production of spices are complex and individual. Consequently, the development of a reliable DNA-based method for spice analysis is a challenging intention. However, once established, this method will be easily adapted to less difficult food matrices. In the current study, several alternative methods for the isolation of DNA from spices have been developed and evaluated in detail with regard to (i) its purity (photometric), (ii) yield (fluorimetric methods), and (iii) its amplifiability (PCR). Whole genome amplification methods were used to preamplify isolates to improve the ratio between amplifiable DNA and inhibiting substances. Specific primer sets were designed, and the PCR conditions were optimized to detect 18 spices selectively. Assays of self-made spice mixtures were performed to proof the applicability of the developed methods.
International Nuclear Information System (INIS)
Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.
1991-01-01
A Polymerase chain reaction (PCR) technique was used to detect deletions in the mouse retinoblastoma (mRb) gene using microtomed sections from paraffin-embedded radiation-induced and spontaneous tumors as the DNA source. Six mRb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. Absence of any of these fragments relative to control PCR products on a Southern blot indicated a deletion of that portion of the mRb gene. Tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death. Spontaneous tumors as well as those from irradiated mice (569 cGy of 60 Co γ rays or 60 cGy of JANUS neutrons) were analyzed. Tumors in six neutron-irradiated mice also had no mRb deletions. However, one of six tumors from γ-irradiated mice and 6 of 18 spontaneous tumors from unirradiated mice showed a deletion in one or both mRb alleles. All deletions detected were in the 5' region of the mRb gene
Directory of Open Access Journals (Sweden)
Ji Yeon Kwon
2013-09-01
Full Text Available A detection system based on a multiplex reverse transcription (RT polymerase chain reaction (PCR was developed to simultaneously identify multiple viruses in the lily plant. The most common viruses infecting lily plants are the cucumber mosaic virus (CMV, lily mottle virus (LMoV, lily symptomless virus (LSV. Leaf samples were collected at lily-cultivation facilities located in the Kangwon province of Korea and used to evaluate the detection system. Simplex and multiplex RT-PCR were performed using virus-specific primers to detect single-or mixed viral infections in lily plants. Our results demonstrate the selective detection of 3 different viruses (CMV, LMoV and LSV by using specific primers as well as the potential of simultaneously detecting 2 or 3 different viruses in lily plants with mixed infections. Three sets of primers for each target virus, and one set of internal control primers were used to evaluate the detection system for efficiency, reliability, and reproducibility.
Özenci, Volkan; Patel, Robin; Ullberg, Måns; Strålin, Kristoffer
2018-01-18
Although there are several US Food and Drug Administration (FDA)-approved/cleared molecular microbiology diagnostics for direct analysis of patient samples, all are single target or panel-based tests. There is no FDA-approved/cleared diagnostic for broad microbial detection. Polymerase chain reaction (PCR)/electrospray ionization-mass spectrometry (PCR/ESI-MS), commercialized as the IRIDICA system (Abbott) and formerly PLEX-ID, had been under development for over a decade and had become CE-marked and commercially available in Europe in 2014. Capable of detecting a large number of microorganisms, it was under review at the FDA when, in April 2017, Abbott discontinued it. This turn of events represents not only the loss of a potential diagnostic tool for infectious diseases but may be a harbinger of similar situations with other emerging and expensive microbial diagnostics, especially genomic tests. © The Author(s) 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Nikhil Moorchung
2011-01-01
Full Text Available Background: Lymphoid malignancies are a heterogeneous group of disorders which may be difficult to differentiate from reactive proliferations even after immunohistochemistry. Polymerase chain reaction (PCR is believed to be a good adjunct tool for diagnosis. Materials and Methods: We examined 24 cases of neoplastic and non-neoplastic lymphoproliferative lesions in this study and evaluated the PCR as an additional tool in the confirmation of the diagnosis. Two different PCR methodologies were evaluated. Results: In the evaluation of the T-cell PCR, it was seen that the correlation using both the commercial kits and the custom-synthesized primers was highly significant at a P value of 0.05. Conclusions: Both the methods showed an excellent concordance for T-cell γ gene rearrangements, However, the same was not seen in the B-cell receptor rearrangements. This may be because of the small sample size or the inability of consensus V primers to recognize complementary DNA sequences in all of the V segments.
Sakuraoka, Yuhki; Sawada, Tokihiko; Shiraki, Takayuki; Park, Kyunghwa; Sakurai, Yuhichiro; Tomosugi, Naohisa; Kubota, Keiichi
2012-07-28
To establish methods for quantitative polymerase chain reaction (PCR) for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of hepatocellular carcinoma (HCC). Total RNA from paraffin-embedded sections was isolated from 68 paraffin-embedded samples of HCC. Samples came from 54 male and 14 female patients with a mean age of 66.8 ± 7.8 years. Quantitative PCR was performed. Immunohistochemistry and in situ hybridization for hepcidin were also performed. Quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections of HCC was performed successfully. The expression level of hepcidin mRNA in cancer tissues was significantly higher than that in non-cancer tissues. A method of in situ hybridization for hepcidin was established successfully, and this demonstrated that hepcidin mRNA was expressed in non-cancerous tissue but absent in cancerous tissue. We have established novel methods for quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of HCC.
Directory of Open Access Journals (Sweden)
Eiichi Uchio
2010-11-01
Full Text Available Eiichi Uchio1, Hirotoshi Inoue1, Kazuaki Kadonosono21Department of Ophthalmology, Fukuoka University School of Medicine, Fukuoka, Japan; 2Department of Ophthalmology, Yokohama City University Medical Center, Yokohama, JapanPurpose: Adenoviral keratoconjunctivitis is recognized as one of the major pathogens of ophthalmological nosocomial infection worldwide. N-Chlorotaurine (Cl–HN–CH2–CH2–SO3H, NCT is the N-chloro derivative of the amino acid taurine, which is an oxidant produced by human granulocytes and monocytes during inflammatory reactions. Using conventional viral plaque assay, it was previously shown that NCT causes inactivation of several human adenovirus (HAdV serotypes. In this study, we evaluated the antiadenoviral effect of NCT by quantitative polymerase chain reaction (PCR methods.Methods: A549 cells were used for viral cell culture, and HAdV serotypes 3, 4, 8, 19, and 37 were used. After calculating 50% cytotoxic concentration (CC50 of NCT by MTS (3-(4,5-dimethylthiazol-2-yl-5-(3-carboxymethoxyphenyl-2-(4-sulfophenyl-2H-tetrazolium method, HAdV was cultured with NCT for 7 days, and extracted adenoviral DNA was quantitatively measured by real-time PCR.Results: A statistically significant (P < 0.05 dose-dependent inhibition was indicated for all serotypes except HAdV type 4 (HAdV4, which was maximally inhibited by only ~50%. Among the serotypes, NCT was particularly effective against HAdV8, HAdV19a, and HAdV37. The 50% effective concentration (EC50 obtained by real-time PCR of NCT ranged between 49 and 256 µM. EC50 of NCT against HAdV3 was slightly higher than that against serotypes of species D. The selective index (CC50/EC50 ranged between 41 and 60 except for HAdV4 (11.5.Conclusions: These results show that NCT has an antiviral effect against most serotypes of human HAdV inducing keratoconjunctivitis, indicating its possible therapeutic use.Keywords: adenovirus, N-chlorotaurine, epidemic keratoconjunctivitis, antiviral
DEFF Research Database (Denmark)
Bu, Minqiang; Perch-Nielsen, Ivan R.; Sørensen, Karen Skotte
2013-01-01
steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature-dependent fluorescence......We present a temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with an external heater and a temperature sensor. The method employs optimized temperature overshooting and undershooting...
Pournajaf, Abazar; Rajabnia, Ramazan; Sedighi, Mansour; Kassani, Aziz; Moqarabzadeh, Vahid; Lotfollahi, Lida; Ardebilli, Abdollah; Emadi, Behzad; Irajian, Gholamreza
2016-01-01
This study aimed to determine the prevalence, and virulence factors of Listeria monocytogenes isolated from various samples by multiplex polymerase chain reaction (MPCR). A total of 617 isolates were obtained and MPCR was employed for detection of the inlA, inlC, and inlJ genes. L. monocytogenes was detected in 46 (7.45%) of the 617 specimens. inlA, inlC, and inlJ were detected in 100%, 76.26%, and 71% isolates, respectively. This study validated MPCR in the analysis and rapid detection of L. monocytogenes. The role of the genes in pathogenesis of the strains can also be affirmed.
Pinar, Ahmet; Ramirez, Julio A; Schindler, Laura L; Miller, Richard D; Summersgill, James T
2002-03-01
Air conditioner condensates have not been previously associated with cases of Legionnaires' disease. We report the possible transmission of Legionella pneumophila serogroup 1 from a malfunctioning automobile air conditioning system's leaking water onto the floorboard of a car driven for a long distance by the patient. Heteroduplex analysis of polymerase chain reaction products was used to help establish an epidemiologic link between the water specimen and the patient.
Cloning and expression of cell wall acid invertase gene fragment ...
African Journals Online (AJOL)
A fragment of invertase gene containing catalytic sites of cysteine was cloned from poinsettia (Euphorbia pulcherrima wild.) by using the polymerase chain reaction (PCR) method. The length of the fragment was 521 bp, encoding 173 amino acids and containing a part of open reading frames, but no intron. It had a high ...
Ji, L L; Miller, R H; Nagle, F J; Lardy, H A; Stratman, F W
1987-08-01
The influence of endurance training and an acute bout of exercise on plasma concentrations of free amino acids and the intermediates of branched-chain amino acid (BCAA) metabolism were investigated in the rat. Training did not affect the plasma amino acid levels in the resting state. Plasma concentrations of alanine (Ala), aspartic acid (Asp), asparagine (Asn), arginine (Arg), histidine (His), isoleucine (Ile), leucine (Leu), lysine (Lys), methionine (Met), phenylalanine (Phe), proline (Pro), serine (Ser), threonine (Thr), and valine (Val) were significantly lower, whereas glutamate (Glu), glycine (Gly), ornithine (Orn), tryptophan (Trp), tyrosine (Tyr), creatinine, urea, and ammonia levels were unchanged, after one hour of treadmill running in the trained rats. Plasma concentration of glutamine (Glu), the branched-chain keto acids (BCKA) and short-chain acyl carnitines were elevated with exercise. Ratios of plasma BCAA/BCKA were dramatically lowered by exercise in the trained rats. A decrease in plasma-free carnitine levels was also observed. These data suggest that amino acid metabolism is enhanced by exercise even in the trained state. BCAA may only be partially metabolized within muscle and some of their carbon skeletons are released into the circulation in forms of BCKA and short-chain acyl carnitines.
Lušnic Polak, M.; Demšar, L.; Luzar, U.; Polak, T.
2017-09-01
The link between the basic chemical and fatty acid composition of trout feed on one hand and trout (Oncorhynchus mykiss) meat (fillet) was investigated.. The content of 52 fatty acids from feed and trout meat lipids was determined by in-situ transesterification and capillary column gas-liquid chromatography. On average, 100 g of trout feed contained 7.4 g of moisture, 47.7 g of proteins, 6.09 g of ash, 21.4 g of fat, and as for fatty acid composition, 47.8 wt. % were monounsaturated, 34.0 wt. % were polyunsaturated and 18.1 wt. % were saturated fatty acids, with the PS ratio 1.88, n-6/n-3 ratio 1.74, 0.80 wt. % of trans and 3.28 wt. % of very long chain n-3 fatty acids. On average, 100 g of trout meat contained 76.1 g of moisture, 21.4 g of proteins, 1.34 g of ash, 2.52 g of fat, and in the fatty acid composition 42.1 wt. % were monounsaturated, 38.2 wt. % were polyunsaturated and 18.9 wt. % were saturated fatty acids, with the PS ratio 2.02, n-6/n-3 ratio 0.98, 0.95 wt. % of trans and 13.25 wt. % of very long chain n-3 fatty acids.
DEFF Research Database (Denmark)
Bu, Minqiang; R. Perch-Nielsen, Ivan; Sørensen, Karen Skotte
steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature dependent fluorescence......We present a new temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with external heater and temperature sensor. The method employs optimized temperature overshooting and undershooting...
Shrihari, Rohinishree Yadahalli; Singh, Negi Pradeep
2012-02-01
Staphylococcus aureus survives well in different stress conditions. The ability of this organism to adapt to various stresses is the result of a complex regulatory response, which is attributed to regulation of multiple genes. The aims of the present study were (1) to develop a multiplex PCR for the detection of genes which are involved in stress adaptation (asp23, dnaK, and groEL); alternative sigma factor (sigB) and virulence determination (entB and spa) and (2) to study the expression of these genes during stress conditions for S. aureus culture collection strains (FRI 722 and ATCC 6538) and S. aureus food isolates at mRNA level using multiplex reverse transcription polymerase chain reaction (RT-PCR). During heat shock treatment groEL, dnaK, asp23, sodA, entB, spa, and sigB genes were up regulated up to 2.58, 2.07, 2.76, 2.55, 3.55, 2.71, and 2.62- folds, respectively, whereas in acid shock treatment, sodA and groEL were up regulated; dnaK was downregulated; and entB and sigB genes were not expressed in food isolates. Multiplex PCR assay standardized in this study offers an inexpensive alternative to uniplex PCR for detection of various virulence and stress response genes. This study is relevant to rapid and accurate detection of potential pathogenic S. aureus in foods. © 2012 Institute of Food Technologists®
DEFF Research Database (Denmark)
Vistisen, Bodil; Nybo, L.; Xu, Xuebing
2003-01-01
after consumption of specific structured triacylglycerol, consisting of a mixture of medium-chain fatty acids and long-chain fatty acids, to prevent the adverse effects observed by MCT (pure medium-chain fatty acids) regarding gastrointestinal distress. Seven well-trained subjects cycled 3 h at 55......% of maximum 02 uptake during which they ingested CHO or CHO plus specific structured triacylglycerols. Immediately after the constant-load cycling, the subjects performed a time trial of similar to50-min duration. Breath and blood samples were obtained regularly during the experiment. Fatty acid composition...... of plasma triacylglycerols, fatty acids, and phospholipids was determined. Performance was similar after administration of CHO plus specific structured triacylglycerol [medium-, long-, and medium-chain fatty acid (MLM)] compared with CHO (50.0 +/- 1.8 and 50.8 +/- 3.6 min, respectively). No plasma 8...
Orphan drugs in development for long-chain fatty acid oxidation disorders: challenges and progress
Directory of Open Access Journals (Sweden)
Sun A
2015-04-01
Full Text Available Angela Sun, J Lawrence Merritt II Department of Pediatrics, University of Washington, Seattle, WA, USA Abstract: Fatty acid oxidation disorders are inborn errors of metabolism resulting in failure of ß-oxidation within or transport of fatty acids into the mitochondria. The long-chain fatty acid oxidation disorders are characterized by variable presentations ranging from newborn cardiomyopathy, to infantile hypoketotic hypoglycemia resulting from liver involvement, to skeletal myopathy often resulting in rhabdomyolysis in adolescents and adults. Treatments for these long-chain fatty acid oxidation disorders have typically focused upon avoidance of fasting with dietary fat restriction and medium-chain triglyceride supplementation. These treatments have resulted in only a partial response with improvements in hypoglycemia, reduction in frequency of rhabdomyolysis, and improvement in cardiomyopathy with early therapy, but significant risk remains. Recent advances in therapies for long-chain fatty acid oxidation disorders are reviewed in this article. These include sodium D,L-3-hydroxybutyrate, triheptanoin, gene therapy, and bezafibrates. Sodium D,L-3-hydroxybutyrate has shown clinical effect, with improvements in muscle tone, neurological abnormalities, and some cases of cardiomyopathy and leukodystrophy. Triheptanoin has been used as an alternative medium-chain triglyceride in a number of fatty acid oxidation disorders and has shown promising findings in the treatment of cardiomyopathy and hypoglycemia. However, it does not significantly reduce episodes of rhabdomyolysis. Gene therapy has been shown to improve acylcarnitine levels in very-long-chain acyl-coenzyme A dehydrogenase deficiency mouse models, with preservation of glucose levels. Bezafibrates have shown improvements in acylcarnitine concentrations in fibroblast studies, but clinical observations have not demonstrated consistent effects. Together, these treatments have shown some
Objective: Branched-chain alpha-keto acid dehydrogenase complex (BCKDC) regulates branched-chain amino acid (BCAA) metabolism at the level of branched chain alpha-ketoacid (BCKA) catabolism. It has been demonstrated that the activity of hepatic BCKDC is markedly decreased in type 2 diabetic animal...
Directory of Open Access Journals (Sweden)
Daniela Camargos Costa
2014-02-01
Full Text Available The polymerase chain reaction (PCR-based methods for the diagnosis of malaria infection are expected to accurately identify submicroscopic parasite carriers. Although a significant number of PCR protocols have been described, few studies have addressed the performance of PCR amplification in cases of field samples with submicroscopic malaria infection. Here, the reproducibility of two well-established PCR protocols (nested-PCR and real-time PCR for the Plasmodium 18 small subunit rRNA gene were evaluated in a panel of 34 blood field samples from individuals that are potential reservoirs of malaria infection, but were negative for malaria by optical microscopy. Regardless of the PCR protocol, a large variation between the PCR replicates was observed, leading to alternating positive and negative results in 38% (13 out of 34 of the samples. These findings were quite different from those obtained from the microscopy-positive patients or the unexposed individuals; the diagnosis of these individuals could be confirmed based on the high reproducibility and specificity of the PCR-based protocols. The limitation of PCR amplification was restricted to the field samples with very low levels of parasitaemia because titrations of the DNA templates were able to detect < 3 parasites/µL in the blood. In conclusion, conventional PCR protocols require careful interpretation in cases of submicroscopic malaria infection, as inconsistent and false-negative results can occur.
Branched-chain amino acids for people with hepatic encephalopathy
DEFF Research Database (Denmark)
Gluud, Lise Lotte; Dam, Gitte; Les, Iñigo
2015-01-01
-chain amino acids (BCAA) versus control interventions has evaluated if BCAA may benefit people with hepatic encephalopathy. OBJECTIVES: To evaluate the beneficial and harmful effects of BCAA versus any control intervention for people with hepatic encephalopathy. SEARCH METHODS: We identified trials through...
Branched-chain amino acids for people with hepatic encephalopathy
DEFF Research Database (Denmark)
Gluud, Lise Lotte; Dam, Gitte; Les, Iñigo
2017-01-01
-chain amino acids (BCAA) versus control interventions has evaluated if BCAA may benefit people with hepatic encephalopathy. Objectives: To evaluate the beneficial and harmful effects of BCAA versus any control intervention for people with hepatic encephalopathy. Search methods: We identified trials through...
DEFF Research Database (Denmark)
Hviid, Thomas Vauvert F.; Madsen, Hans O; Morling, Niels
1992-01-01
We have used the polymerase chain reaction (PCR) in combination with the restriction fragment length polymorphism (RFLP) technique for HLA-DBP1 typing. After PCR amplification of the polymorphic second exon of the HLA-DPB1 locus, the PCR product was digested with seven allele-specific restriction...... endonucleases: RsaI, FokI, ApaI, SacI, BstUI, EcoNI, and DdeI, and the DNA fragments were separated by electrophoresis in agarose gels. Altogether, 71 individuals were investigated and 16 different HLA-DPB1 types were observed in 26 different heterozygotic combinations, as well as five possible homozygotes....... Four heterozygotes could not be unequivocally typed with the PCR-RFLP method. The HLA-DPB1 typing results obtained with the PCR-RFLP method were compared with the typing results obtained with PCR allele-specific oligonucleotides (PCR-ASO) in 50 individuals. The results obtained with the two methods...
Typing of Poultry Influenza Virus (H5 and H7 by Reverse Transcription- Polymerase Chain Reaction
Directory of Open Access Journals (Sweden)
Cesare Bonacina
2010-01-01
Full Text Available The ability of the influenza Orthomixovirus to undergo to continually antigenically changes that can affect its pathogenicity and its diffusion, explains the growing seriousness of this disease and the recent epizoozies in various parts of the world. There have been 15 HA and 9 NA type A sub-types of the influenza virus identified all of which are present in birds. Until now the very virulent avian influenza viruses identified were all included to the H5 and H7 sub-types. We here show that is possible to identify the H5 and H7 sub-types with reverse transcription-polymerase chain reaction (RT-PCR by using a set of specific primers for each HA sub-type. The RT-PCR is a quick and sensitive method of identifying the HA sub-types of the influenza virus directly from homogenised organs.
Brucella contamination in raw milk by polymerase chain reaction
Directory of Open Access Journals (Sweden)
Mohammad Khalili
2016-10-01
Full Text Available Background: Human brucellosis is a significant public health problem in many middle east countries including Iran. Brucella organisms, which are small aerobic, facultative intracellular coccobacilli, localize in the reproductive organs of host animals, causing abortions and sterility. They are shed in large numbers in the animal’s urine, milk, placental fluid, and other fluids. Dairy product from raw milk are a potential threat to public health in endemic developing countries. The gold standard for the diagnosis of brucellosis is isolation of Brucella species. However, isolation Brucella species is time consuming and needed to level 3 biocontainment facilities and highly skilled technical personnel to handle samples and live bacteria for eventual identification. Handling Brucella species increase risk of laboratory infection. Polymerase chain reaction (PCR with high sensitivity and specifity overcomed to these disadvantages. The aim of this study was to detect Brucella species in milk from dairy cattle farms in Kerman province, Iran by PCR technique. Methods: Forty and eight bulk tank milk (BTM were collected from October 2015 to March 2016 from 48 dairy cattle farm including 4200 cows. DNA of milk samples extracted by lysis buffer and proteinase K method. All milk samples were examined by PCR to detect Brucella-specific DNA targeting IS 711. Positive samples must be showed 317 bp amplified, corresponding to the expected size of the IS 711 genome region in all Brucella species. Results: Using IS711 primer were detected in 4 samples (8.3% Brucella spp. from 48 BTM samples in this area. Conclusion: The results indicate that brucellosis by Brucella species is endemic in the Kerman province dairy farms. Consumption of raw milk dairy products by individual farmers operating under poor hygienic conditions represents an high risk to public health. The need for implementing control measures and raising public awareness on zoonotic transmission of
The Role of Short-Chain Fatty Acids, Produced by Anaerobic Bacteria, in the Cystic Fibrosis Airway.
Mirković, Bojana; Murray, Michelle A; Lavelle, Gillian M; Molloy, Kevin; Azim, Ahmed Abdul; Gunaratnam, Cedric; Healy, Fiona; Slattery, Dubhfeasa; McNally, Paul; Hatch, Joe; Wolfgang, Matthew; Tunney, Michael M; Muhlebach, Marianne S; Devery, Rosaleen; Greene, Catherine M; McElvaney, Noel G
2015-12-01
Anaerobic bacteria are present in large numbers in the airways of people with cystic fibrosis (PWCF). In the gut, anaerobes produce short-chain fatty acids (SCFAs) that modulate immune and inflammatory processes. To investigate the capacity of anaerobes to contribute to cystic fibrosis (CF) airway pathogenesis via SCFAs. Samples of 109 PWCF were processed using anaerobic microbiological culture with bacteria present identified by 16S RNA sequencing. SCFA levels in anaerobic supernatants and bronchoalveolar lavage (BAL) were determined by gas chromatography. The mRNA and/or protein expression of two SCFA receptors, GPR41 and GPR43, in CF and non-CF bronchial brushings and 16HBE14o(-) and CFBE41o(-) cells were evaluated using reverse transcription polymerase chain reaction, Western blot analysis, laser scanning cytometry, and confocal microscopy. SCFA-induced IL-8 secretion was monitored by ELISA. Fifty-seven (52.3%) of 109 PWCF were anaerobe positive. Prevalence increased with age, from 33.3% to 57.7% in PWCF younger (n = 24) and older (n = 85) than 6 years of age. All evaluated anaerobes produced millimolar concentrations of SCFAs, including acetic, propionic, and butyric acids. SCFA levels were higher in BAL samples of adults than in those of children. GPR41 levels were elevated in CFBE41o(-) versus 16HBE14o(-) cells; CF versus non-CF bronchial brushings; and 16HBE14o(-) cells after treatment with cystic fibrosis transmembrane conductance regulator inhibitor CFTR(inh)-172, CF BAL, or inducers of endoplasmic reticulum stress. SCFAs induced a dose-dependent and pertussis toxin-sensitive IL-8 response in bronchial epithelial cells, with a higher production of IL-8 in CFBE41o(-) than in 16HBE14o(-) cells. This study illustrates that SCFAs contribute to excessive production of IL-8 in CF airways colonized with anaerobes via up-regulated GPR41.
Johnson, Stephanie T; Van Tassell, Eric R; Tonnetti, Laura; Cable, Ritchard G; Berardi, Victor P; Leiby, David A
2013-11-01
Babesia microti, an intraerythrocytic parasite, has been implicated in transfusion transmission. B. microti seroprevalence in Connecticut (CT) blood donors is approximately 1%; however, it is not known what percentage of donors is parasitemic and poses a risk for transmitting infection. Therefore, we determined the prevalence of demonstrable B. microti DNA in donors from a highly endemic area of CT and compared observed rates with concurrent immunofluorescence assay (IFA) testing results. Blood samples from consenting donors in southeastern CT were collected from mid-August through early October 2009 and tested by IFA for immunoglobulin G antibodies and real-time polymerase chain reaction (PCR) for B. microti DNA. IFA specificity was determined using blood donor samples collected in northwestern Vermont (VT), an area nonendemic for Babesia. Of 1002 CT donors, 25 (2.5%) were IFA positive and three (0.3%) were real-time PCR positive. Among the three real-time PCR-positive donors, two were also IFA positive, while one was IFA negative and may represent a window period infection. The two IFA- and real-time PCR-positive donors appeared to subsequently clear infection. The other real-time PCR-positive donor did not provide follow-up samples. Of 1015 VT donors tested by IFA, only one (0.1%) was positive, but may have acquired infection during travel to an endemic area. We prospectively identified several real-time PCR-positive blood donors, including an IFA-negative real-time PCR-positive donor, in an area highly endemic for B. microti. These results suggest the need to include nucleic acid testing in planned mitigation strategies for B. microti. © 2013 American Association of Blood Banks.
DEFF Research Database (Denmark)
Olsen, S.F.; Hansen, Harald S.; Jensen, B.
1989-01-01
of long-chain n-3 FA to arachidonic acid (the (3/6) ratio) was used as the most relevant single measure of exposure. In 18 women with certain gestational age and with spontaneous onset of delivery, gestational age was significantly associated with the (3/6) ratio quantified in PC (correlation coefficient......Dietary long-chain n-3 fatty acids (FA) may prolong gestation by inhibiting formation of prostaglandins from arachidonic acid. FA were quantified in phosphatidylcholine (PC), phosphatidylethanolamine (PE), and total lipids (TL) of red cells sampled during pregnancy from 29 Faroese women. The ratio...
Directory of Open Access Journals (Sweden)
Francisco Palma Rennó
2013-11-01
Full Text Available The objective of this study was to evaluate the utilization of different sources of unsaturated long-chain fatty acids in diets for dairy cows during the transition period and early lactation on the milk fatty acid profile and composition of the protein fraction. Thirty-six Holstein cows were divided into three groups, fed the following diets: control (C; soybean oil (SO; and calcium salts of long-chain unsaturated fatty acids (CS. The milk samples utilized for analysis were obtained weekly from parturition to twelve weeks of lactation; each one of the samples originated from two daily milkings. Milk composition and total nitrogen, non-protein nitrogen and non-casein nitrogen levels were analyzed. The cows receiving the diet with calcium salts had lower concentrations of non-protein nitrogen (%CP in milk compared with the animals fed the diet with soybean oil. There was a decrease in concentration of medium-chain fatty acids C12-C16, and a concomitant increase in concentrations of long-chain fatty acids >C18 in milk fat for the animals fed the diets CS and SO when compared with diet C. Soybean oil and CS diets increased milk-fat concentrations of the acids C18: 1 trans-11, C18: 2 cis-9, trans-11 and C18: 2 trans-10 cis-12 in relation to diet C. The utilization of sources of long-chain fatty acids in the diet of dairy cows increases the biological value of milk in early lactation due to higher concentrations of specific fatty acids such as CLA C18: 2cis-9, trans-11.
DEFF Research Database (Denmark)
Tholstrup, T.; Ehnholm, C.; Jauhiainen, M.
2004-01-01
Background: Dietary medium-chain fatty acids (MCFAs) are of nutritional interest because they are more easily absorbed from dietary medium-chain triacylglycerols (MCTs) than are long-chain fatty acids from, for example, vegetable oils. It has generally been claimed that MCFAs do not increase plasma...... cholesterol, although this claim is poorly documented. Objective: We compared the effects of a diet rich in either MCFAs or oleic acid on fasting blood lipids, lipoproteins, glucose, insulin, and lipid transfer protein activities in healthy men. Design: In a study with a double-blind, randomized, crossover...... plasma total triacylglycerol (P = 0.0361), and higher plasma glucose (P = 0.033). Plasma HDL-cholesterol and insulin concentrations and activities of cholesterol ester transfer protein and phospholipid transfer protein did not differ significantly between the diets. Conclusions: Compared with fat high...
Evolving a polymerase for hydrophobic base analogues.
Loakes, David; Gallego, José; Pinheiro, Vitor B; Kool, Eric T; Holliger, Philipp
2009-10-21
Hydrophobic base analogues (HBAs) have shown great promise for the expansion of the chemical and coding potential of nucleic acids but are generally poor polymerase substrates. While extensive synthetic efforts have yielded examples of HBAs with favorable substrate properties, their discovery has remained challenging. Here we describe a complementary strategy for improving HBA substrate properties by directed evolution of a dedicated polymerase using compartmentalized self-replication (CSR) with the archetypal HBA 5-nitroindole (d5NI) and its derivative 5-nitroindole-3-carboxamide (d5NIC) as selection substrates. Starting from a repertoire of chimeric polymerases generated by molecular breeding of DNA polymerase genes from the genus Thermus, we isolated a polymerase (5D4) with a generically enhanced ability to utilize HBAs. The selected polymerase. 5D4 was able to form and extend d5NI and d5NIC (d5NI(C)) self-pairs as well as d5NI(C) heteropairs with all four bases with efficiencies approaching, or exceeding, those of the cognate Watson-Crick pairs, despite significant distortions caused by the intercalation of the d5NI(C) heterocycles into the opposing strand base stack, as shown by nuclear magnetic resonance spectroscopy (NMR). Unlike Taq polymerase, 5D4 was also able to extend HBA pairs such as Pyrene: varphi (abasic site), d5NI: varphi, and isocarbostyril (ICS): 7-azaindole (7AI), allowed bypass of a chemically diverse spectrum of HBAs, and enabled PCR amplification with primers comprising multiple d5NI(C)-substitutions, while maintaining high levels of catalytic activity and fidelity. The selected polymerase 5D4 promises to expand the range of nucleobase analogues amenable to replication and should find numerous applications, including the synthesis and replication of nucleic acid polymers with expanded chemical and functional diversity.
Popescu, Gabriel Adrian; Serban, Roxana; Pistol, Adriana; Niculcea, Andreea; Preda, Andreea; Lemeni, Daniela; Macovei, Ioana Sabina; Tălăpan, Daniela; Rafila, Alexandru; Florea, Dragoş
2018-03-15
To investigate the epidemiology of Clostridium difficile infection in Romanian hospitals. A survey was conducted at nine hospitals throughout Romania between November 2013 and February 2014. The survey identified 393 patients with Clostridium difficile infection. The median age was 67 years (range: 2-94 years); 56% of patients were aged >65 years. The mean prevalence of Clostridium difficile infection was 5.2 cases per 10.000 patient-days. The highest prevalences were 24.9 and 20 per 10.000 patient-days in hospitals specializing in gastroenterology and infectious diseases, respectively. Clostridium difficile infections were health care-associated in 70.5% patients and community-acquired in 10.2%. The origin was not determined in 19.3%. Clostridium difficile infection was severe in 12.3% of patients, and the in-hospital all-cause mortality was 8.8%. Polymerase chain reaction ribotype 027 had the highest prevalence in all participating hospitals and represented 82.6% of the total ribotyped isolates. The minimum inhibitory concentration of moxifloxacin was >4 μg/mL for 59 of 80 tested isolates (73.8%). Of 59 isolates, 54 were highly resistant to moxifloxacin (minimum inhibitory concentration ≥32 μg/mL), and the majority were polymerase chain reaction ribotype 027 (pClostridium difficile infections in Romania. In some specialized hospitals, the prevalence of Clostridium difficile infection was higher than the European mean prevalence, and this demonstrates the need for strict adherence to infection control programs.
Trapping social wasps (Hymenoptera: Vespidae) with acetic acid and saturated short chain alcohols.
Landolt, P J; Smithhisler, C S; Reed, H C; McDonough, L M
2000-12-01
Nineteen compounds were evaluated in combination with a solution of acetic acid as baits for trapping the German yellowjacket, Vespula germanica (F.), the western yellowjacket Vespula pensylvanica (Sausssure), and the golden paper wasp Polistes aurifer Saussure. Compounds with three to six carbon chains or branched chains and with a hydroxy functional group were selected for testing based on their similarity to isobutanol. They were compared with isobutanol with acetic acid, which is a known wasp attractant. None of the compounds tested were superior to isobutanol when presented with acetic acid as a lure for these species of wasps. However, traps baited with either the S-(-)- or the racemic mixture of 2-methyl-1-butanol in combination with acetic acid captured similar numbers of both species of yellowjackets, compared with isobutanol with acetic acid. Polistes aurifer responded strongly to the S-(-)-enantiomer and to the racemic mixture of 2-methyl-1-butanol with acetic acid and not to the R-(+)-enantiomer with acetic acid.
Mechanism of long chain monoenoic fatty acids acting on the energy metabolism of heart
Energy Technology Data Exchange (ETDEWEB)
Buddecke, E; Filipovic, I; Wortberg, B; Seher, A
1975-01-01
The oxidation of 1-/sup 14/C-erucic (Csub(22:1)) and 1-/sup 14/C-nervonic (Csub(24:1)) acid was studied compared to 1-/sup 14/C-palmitic and -oleic acid in isolated rat and pig heart mitochondria. After mitochondrial incubation with the albumin-bound fatty acids only small amounts of /sup 14/CO/sub 2/ developed from the oxidation of the long chain monoenoic acids as compared to palmitic or oleic acid. The slow down of the oxidation rate was more pronounced in rat than in pig heart mitochondria. The oxidation of palmitic or oleic acid was not found to be inhibited by the C/sub 20/-C/sub 24/-monoeneic acids, whereas palmitic or oleic acid inhibited the oxidation of erucic acid competitively. From present findings an idea may be developed of the interference on fatty acid metabolism in heart muscle by erucic and other long chain monenoic acids.
DNA polymerase preference determines PCR priming efficiency.
Pan, Wenjing; Byrne-Steele, Miranda; Wang, Chunlin; Lu, Stanley; Clemmons, Scott; Zahorchak, Robert J; Han, Jian
2014-01-30
Polymerase chain reaction (PCR) is one of the most important developments in modern biotechnology. However, PCR is known to introduce biases, especially during multiplex reactions. Recent studies have implicated the DNA polymerase as the primary source of bias, particularly initiation of polymerization on the template strand. In our study, amplification from a synthetic library containing a 12 nucleotide random portion was used to provide an in-depth characterization of DNA polymerase priming bias. The synthetic library was amplified with three commercially available DNA polymerases using an anchored primer with a random 3' hexamer end. After normalization, the next generation sequencing (NGS) results of the amplified libraries were directly compared to the unamplified synthetic library. Here, high throughput sequencing was used to systematically demonstrate and characterize DNA polymerase priming bias. We demonstrate that certain sequence motifs are preferred over others as primers where the six nucleotide sequences at the 3' end of the primer, as well as the sequences four base pairs downstream of the priming site, may influence priming efficiencies. DNA polymerases in the same family from two different commercial vendors prefer similar motifs, while another commercially available enzyme from a different DNA polymerase family prefers different motifs. Furthermore, the preferred priming motifs are GC-rich. The DNA polymerase preference for certain sequence motifs was verified by amplification from single-primer templates. We incorporated the observed DNA polymerase preference into a primer-design program that guides the placement of the primer to an optimal location on the template. DNA polymerase priming bias was characterized using a synthetic library amplification system and NGS. The characterization of DNA polymerase priming bias was then utilized to guide the primer-design process and demonstrate varying amplification efficiencies among three commercially
Directory of Open Access Journals (Sweden)
Pooja H. Gupta
2015-05-01
Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.
Directory of Open Access Journals (Sweden)
Abazar Pournajaf
Full Text Available Abstract INTRODUCTION: This study aimed to determine the prevalence, and virulence factors of Listeria monocytogenes isolated from various samples by multiplex polymerase chain reaction (MPCR. METHODS: A total of 617 isolates were obtained and MPCR was employed for detection of the inlA, inlC, and inlJ genes. RESULTS: L. monocytogenes was detected in 46 (7.45% of the 617 specimens. inlA, inlC, and inlJ were detected in 100%, 76.26%, and 71% isolates, respectively. CONCLUSIONS: This study validated MPCR in the analysis and rapid detection of L. monocytogenes. The role of the genes in pathogenesis of the strains can also be affirmed.
Directory of Open Access Journals (Sweden)
Mini P Singh
2017-01-01
Full Text Available Detecting high-risk-human papillomavirus (HPV types has become an integral part of the cervical cancer screening programmes. This study aimed to develop a multiplex polymerase chain reaction (PCR for identification of HPV types 16 and 18 along with the beta globin gene in formalin-fixed and paraffin-embedded cervical biopsy specimens. A total of 59 samples from patients with cervical abnormalities were tested. HPV 16 positivity was 50% in cervical cancers and 52.9% in cervical intraepithelial neoplasia. Our multiplex PCR protocol can be used as a simple and cost-effective tool for high-risk-HPV detection in cervical cancer screening programmes.
Tetranucleotide repeat polymorphism at the human prostatic acid phosphatase (ACPP) gene
Energy Technology Data Exchange (ETDEWEB)
Polymeropoulos, M H; Xiao, Hong; Rath, D S; Merril, C R [National Inst. of Mental Health Neuroscience Center, Washington, DC (United States)
1991-09-11
The polymorphic (AAAT){sub n} repeat begins at base pair 2342 of the human prostatic acid phosphatase gene on chromosome 3q21-qter. The polymorphism can be typed using the polymerase chain reaction (PCR) as described previously. The predicted length of the amplified sequence was 275 bp. Co-dominant segregation was observed in two informative families. The human prostatic acid phosphatase gene has been assigned to chromosome 3q21-qter.
Metabolism of very long-chain Fatty acids: genes and pathophysiology.
Sassa, Takayuki; Kihara, Akio
2014-02-01
Fatty acids (FAs) are highly diverse in terms of carbon (C) chain-length and number of double bonds. FAs with C>20 are called very long-chain fatty acids (VLCFAs). VLCFAs are found not only as constituents of cellular lipids such as sphingolipids and glycerophospholipids but also as precursors of lipid mediators. Our understanding on the function of VLCFAs is growing in parallel with the identification of enzymes involved in VLCFA synthesis or degradation. A variety of inherited diseases, such as ichthyosis, macular degeneration, myopathy, mental retardation, and demyelination, are caused by mutations in the genes encoding VLCFA metabolizing enzymes. In this review, we describe mammalian VLCFAs by highlighting their tissue distribution and metabolic pathways, and we discuss responsible genes and enzymes with reference to their roles in pathophysiology.
Siqueira, José F; Rôças, Isabela N; Andrade, Arnaldo F B; de Uzeda, Milton
2003-02-01
A 16S rDNA-based polymerase chain reaction (PCR) method was used to detect Peptostreptococcus micros in primary root canal infections. Samples were collected from 50 teeth having carious lesions, necrotic pulps, and different forms of periradicular diseases. DNA extracted from the samples was amplified using the PCR assay, which yielded a specific fragment of P. micros 16S rDNA. P. micros was detected in 6 of 22 root canals associated with asymptomatic chronic periradicular lesions (27.3%), 2 of 8 teeth with acute apical periodontitis (25%), and 6 of 20 cases of acute periradicular abscess (30%). In general, P. micros was found in 14 of 50 cases (28%). There was no correlation between the presence of P. micros and the occurrence of symptoms. Findings suggested that P. micros can be involved in the pathogenesis of different forms of periradicular lesions.
DEFF Research Database (Denmark)
Guil-Luna, S.; Stenvang, Jan; Brünner, Nils
2014-01-01
and its isoforms in formalin-fixed, paraffin-embedded tissue samples from canine mammary lesions (4 dysplasias, 10 benign tumors, and 46 carcinomas) using 1-step SYBR Green quantitative real-time polymerase chain reaction (RT-qPCR). Progesterone receptor was expressed in 75% of dysplasias, all benign...... in the expression of isoform A versus B. Analysis of progesterone receptor mRNA isoforms by RT-qPCR was successful in routinely formalin-fixed, paraffin-embedded tissue samples and enabled the distribution of isoforms A and B to be identified for the first time in dysplasias, benign tumors, and malignant tumors...
Branched-chain amino acid metabolism in rat muscle: abnormal regulation in acidosis
International Nuclear Information System (INIS)
May, R.C.; Hara, Y.; Kelly, R.A.; Block, K.P.; Buse, M.G.; Mitch, W.E.
1987-01-01
Branched-chain amino acid (BCAA) metabolism is frequently abnormal in pathological conditions accompanied by chronic metabolic acidosis. To study how metabolic acidosis affects BCAA metabolism in muscle, rats were gavage fed a 14% protein diet with or without 4 mmol NH 4 Cl x 100 g body wt -1 x day -1 . Epitrochlearis muscles were incubated with L-[1- 14 C]-valine and L-[1- 14 C]leucine, and rates of decarboxylation, net transamination, and incorporation into muscle protein were measured. Plasma and muscle BCAA levels were lower in acidotic rats. Rates of valine and leucine decarboxylation and net transamination were higher in muscles from acidotic rats; these differences were associated with a 79% increase in the total activity of branched-chain α-keto acid dehydrogenase and a 146% increase in the activated form of the enzyme. They conclude that acidosis affects the regulation of BCAA metabolism by enhancing flux through the transaminase and by directly stimulating oxidative catabolism through activation of branched-chain α-keto acid dehydrogenase
Zinc absorption in experimental osmotic diarrhea: effect of long-chain fatty acids.
Lee, S Y; Wapnir, R A
1993-03-01
The effect of free fatty acids on zinc absorption was studied in a rat model of chronic osmotic diarrhea induced with magnesium citrate and phenolphthalein. In vivo rates of zinc removal from the lumen and analysis of tissue for zinc uptake and metallothionein alterations were monitored. One mmol/L stearate enhanced zinc absorption in rats with or without diarrhea, from 207 +/- 22 and 353 +/- 13 pmol/min x cm to 676 +/- 34 and 610 +/- 26 pmol/min x cm, respectively. Palmitate was only effective in normal rats. Zinc absorption inversely correlated with mucosal zinc content in the perfused intestinal segments, in both type of rats. Hepatic metallothionein was enhanced by zinc and even more by oleate plus zinc in both groups; kidney metallothionein in animals with diarrhea was normalized by either oleate or zinc. The data support previous reports on the effect of long-chain fatty acids on the enhancement of zinc absorption: saturation and a longer chain appear to be positive factors. A membrane modification role of long-chain fatty acids could have nutritional implications in the formulation of special diets.
Branched-chain amino acid metabolism in rat muscle: abnormal regulation in acidosis
Energy Technology Data Exchange (ETDEWEB)
May, R.C.; Hara, Y.; Kelly, R.A.; Block, K.P.; Buse, M.G.; Mitch, W.E.
1987-06-01
Branched-chain amino acid (BCAA) metabolism is frequently abnormal in pathological conditions accompanied by chronic metabolic acidosis. To study how metabolic acidosis affects BCAA metabolism in muscle, rats were gavage fed a 14% protein diet with or without 4 mmol NH/sub 4/Cl x 100 g body wt/sup -1/ x day/sup -1/. Epitrochlearis muscles were incubated with L-(1-/sup 14/C)-valine and L-(1-/sup 14/C)leucine, and rates of decarboxylation, net transamination, and incorporation into muscle protein were measured. Plasma and muscle BCAA levels were lower in acidotic rats. Rates of valine and leucine decarboxylation and net transamination were higher in muscles from acidotic rats; these differences were associated with a 79% increase in the total activity of branched-chain ..cap alpha..-keto acid dehydrogenase and a 146% increase in the activated form of the enzyme. They conclude that acidosis affects the regulation of BCAA metabolism by enhancing flux through the transaminase and by directly stimulating oxidative catabolism through activation of branched-chain ..cap alpha..-keto acid dehydrogenase.
An exceptional series of phase transitions in hydrophobic amino acids with linear side chains
Directory of Open Access Journals (Sweden)
Carl Henrik Görbitz
2016-09-01
Full Text Available The solid-state phase transitions and intermediate structures of S-2-aminobutanoic acid (l-2-aminobutyric acid, S-2-aminopentanoic acid (l-norvaline, S-2-aminohexanoic acid (l-norleucine and l-methionine between 100 and 470 K, identified by differential scanning calorimetry, have been characterized in a comprehensive single-crystal X-ray diffraction investigation. Unlike other enantiomeric amino acids investigated until now, this group featuring linear side chains displays up to five distinct phases. The multiple transitions between them involve a number of different processes: alteration of the hydrogen-bond pattern, to our knowledge the first example of this observed for an amino acid, sliding of molecular bilayers, seen previously only for racemates and quasiracemates, concerted side-chain rearrangements and abrupt as well as gradual modifications of the side-chain disorder. Ordering of l-norleucine upon cooling even proceeds via an incommensurately modulated structure. l-Methionine has previously been described as being fully ordered at room temperature. An accurate refinement now reveals extensive disorder for both molecules in the asymmetric unit, while two previously unknown phases occur above room temperature.
Jia, Ruan; Chengjun, Sun; Heng, Chen; Chen, Zhou; Yuanqian, Li; Yongxin, Li
2015-07-01
Enterovirus 71 and Coxsackievirus A16 are the main pathogens causing hand-foot-mouth disease. In this paper, microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse transcript-polymerase chain reaction has been developed for the detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens. The specific reverse transcription-polymerase chain reaction amplicons labeled with SYBR Orange were separated by microchip capillary electrophoresis and detected by laser induced fluorescence detector within 7 min. The intraday and interday relative standard deviation of migration time for DNA Marker was in the range of 1.36-2.94 and 2.78-3.96%, respectively. The detection limits were as low as 2.06 × 10(3) copies/mL for Enterovirus 71 and 5 × 10(3) copies/mL for Coxsackievirus A16. No cross-reactivity was observed with rotavirus, astrovirus, norovirus, and adenovirus, which showed good specificity of the method. This assay was validated using 100 throat swab specimens that were detected by real-time reverse-transcript polymerase chain reaction in parallel and the two methods produced the same results. This study provided a rapid, sensitive and specific method for the detection of Enterovirus 71 and Coxsackievirus A16, which make a contribution to significant time and cost saving for the identification and treatment of patients. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Directory of Open Access Journals (Sweden)
Stephen B. Hughes
2013-08-01
Full Text Available The insulin-like growth factor system (insulin-like growth factor 1, insulin-like growth factor 2, insulin-like growth factor 1 receptor, insulin-like growth factor 2 receptor and six insulin-like growth factor-binding proteins and insulin are essential to muscle metabolism and most aspects of male and female reproduction. Insulin-like growth factor and insulin play important roles in the regulation of cell growth, differentiation and the maintenance of cell differentiation in mammals. In order to better understand the local factors that regulate equine physiology, such as muscle metabolism and reproduction (e.g., germ cell development and fertilisation, real-time reverse transcription polymerase chain reaction assays for quantification of equine insulin-like growth factor 1 receptor and insulin receptor messenger ribonucleic acid were developed. The assays were sensitive: 192 copies/µLand 891 copies/µL for insulin-like growth factor 1 receptor, messenger ribonucleic acid and insulin receptor respectively (95%limit of detection, and efficient: 1.01 for the insulin-like growth factor 1 receptor assay and 0.95 for the insulin receptor assay. The assays had a broad linear range of detection (seven logs for insulin-like growth factor 1 receptor and six logs for insulin receptor. This allowed for analysis of very small amounts of messenger ribonucleic acid. Low concentrations of both insulin-like growth factor 1 receptor and insulin receptor messenger ribonucleic acid were detected in endometrium, lung and spleen samples, whilst high concentrations were detected in heart, muscle and kidney samples, this was most likely due to the high level of glucose metabolism and glucose utilisation by these tissues. The assays developed for insulin-like growth factor 1 receptor and insulin receptor messenger ribonucleic acid expression have been shown to work on equine tissue and will contribute to the understanding of insulin and insulin-like growth factor 1
Than, Leslie Thian Lung; Chong, Pei Pei; Ng, Kee Peng; Seow, Heng Fong
2015-01-01
The number of invasive candidiasis cases has risen especially with an increase in the number of immunosuppressed and immunocom promised patients. The early detection of Candida species which is specific and sensitive is important in determining the correct administration of antifungal drugs to patients. This study aims to develop a method for the detection, identification and quantitation of medically important Candida species through quantitative polymerase chain reaction (qPCR). The isocitrate lyase (ICL) gene which is not found in mammals was chosen as the target gene of real-time PCR. Absolute quantitation of the gene copy number was achieved by constructing the plasmid containing the ICL gene which is used to generate standard curve. Twenty fungal species, two bacterial species and human DNA were tested to check the specificity of the detection method. All eight Candida species were successfully detected, identified and quantitated based on the ICL gene. A seven-log range of the gene copy number and a minimum detection limit of 10(3) copies were achieved. A one-tube absolute quantification real-time PCR that differentiates medically important Candida species via individual unique melting temperature was achieved. Analytical sensitivity and specificity were not compromised.
Use of the polymerase chain reaction for detection of Fusarium graminearum in bulgur wheat
Directory of Open Access Journals (Sweden)
Carla Bertechini Faria
2012-03-01
Full Text Available The detection of mycotoxigenic fungi in foodstuff is important because their presence may indicate the possible associated mycotoxin contamination. Fusarium graminearum is a wheat pathogen and a producer of micotoxins. The polymerase chain reaction (PCR has been employed for the specific identification of F. graminearum. However, this methodology has not been commonly used for detection of F. graminearum in food. Thus, the objective of the present study was to develop a molecular methodology to detect F. graminearum in commercial samples of bulgur wheat. Two methods were tested. In the first method, a sample of this cereal was contaminated with F. graminearum mycelia. The genomic DNA was extracted from this mixture and used in a F. graminearum specific PCR reaction. The F. graminearum species was detected only in samples that were heavily contaminated. In the second method, samples of bulgur wheat were inoculated on a solid medium, and isolates having F. graminearum culture characteristics were obtained. The DNA extracted from these isolates was tested in F. graminearum specific PCR reactions. An isolate obtained had its trichothecene genotype identified by PCR. The established methodology could be used in surveys of food contamination with F. graminearum.
Directory of Open Access Journals (Sweden)
Lai-yu Kwok
Full Text Available The human gut microbiota consists of complex microbial communities, which possibly play crucial roles in physiological functioning and health maintenance. China has evolved into a multicultural society consisting of the major ethnic group, Han, and 55 official ethnic minority groups. Nowadays, these minority groups inhabit in different Chinese provinces and some of them still keep their unique culture and lifestyle. Currently, only limited data are available on the gut microbiota of these Chinese ethnic groups. In this study, 10 major fecal bacterial groups of 314 healthy individuals from 7 Chinese ethnic origins were enumerated by quantitative polymerase chain reaction. Our data confirmed that the selected bacterial groups were common to all 7 surveyed ethnicities, but the amount of the individual bacterial groups varied to different degree. By principal component and canonical variate analyses of the 314 individuals or the 91 Han subjects, no distinct group clustering pattern was observed. Nevertheless, weak differences were noted between the Han and Zhuang from other ethnic minority groups, and between the Heilongjiang Hans from those of the other provinces. Thus, our results suggest that the ethnic origin may contribute to shaping the human gut microbiota.
Outcome of polymerase chain reaction (PCR) analysis in 100 suspected cases of infectious uveitis.
Kharel Sitaula, Ranju; Janani, M K; Madhavan, H N; Biswas, Jyotirmay
2018-01-10
Polymerase chain reaction (PCR) analysis is an important tool in the diagnosis of infectious uveitis. A retrospective, interventional study of PCR analysis of ocular fluid in suspected infectious uveitis cases between January 2014 to July 2016 was done. Nested, real-time and broad range PCR was performed for detection of the genome of Mycobacterium tuberculosis, herpes virus family, Chikungunya virus, Toxoplasma gondii, fungus, eubacterium and propionibacterium acne. Total of 100 cases included, mean age was 39.2 ± 15.4 years. Uveitis was unilateral in 82% and granulomatous in 40%. Mean visual acuity at the initial visit and final visit was 0.73 logMar and 0.63 logMar respectively. PCR analysis confirmed the clinical diagnosis in 70.1% patients. The sensitivity, specificity, positive predictive value and negative predictive value of PCR analysis was 90.2%, 93.9%, 93.9% and 90.2% respectively. The quantitative value of real-time M. tb. Positive PCR ranged from 32c/ml to 2722 c/ml. PCR assay is an accurate technique with high sensitivity and specificity to diagnose the DNA genome in infectious uveitis.
Five years' experience of classical swine fever polymerase chain reaction ring trials in France.
Po, F; Le Dimna, M; Le Potier, M F
2011-12-01
Since 2004, the French National Reference Laboratory for classical swine fever (CSF) has conducted an annual proficiency test (PT) to evaluate the ability of local veterinary laboratories to perform real-time polymerase chain reaction (PCR) for CSF virus. The results of five years of testing (2004-2008) are described here. The PT was conducted under blind conditions on 20 samples. The same batch of samples was used for all five years. The number of laboratories that analysed the samples increased from four in 2004 to 13 in 2008. The results of the PT showed the following: cross-contamination between samples and deficiencies in RNA preparation can occur even in experienced laboratories; sample homogeneity should be checked carefully before selection; samples stored at-80 degrees C for several years remain stable; and poor shipment conditions do not damage the samples with regard to detection of CSF virus genome. These results will enable redesign of the panel to improve the overall quality of the PT, which will encourage laboratories to check and improve their PCR procedures and expertise. This is an excellent way to determine laboratory performance.
Subcritical Water Hydrolysis of Peptides: Amino Acid Side-Chain Modifications
Powell, Thomas; Bowra, Steve; Cooper, Helen J.
2017-09-01
Previously we have shown that subcritical water may be used as an alternative to enzymatic digestion in the proteolysis of proteins for bottom-up proteomics. Subcritical water hydrolysis of proteins was shown to result in protein sequence coverages greater than or equal to that obtained following digestion with trypsin; however, the percentage of peptide spectral matches for the samples treated with trypsin were consistently greater than for those treated with subcritical water. This observation suggests that in addition to cleavage of the peptide bond, subcritical water treatment results in other hydrolysis products, possibly due to modifications of amino acid side chains. Here, a model peptide comprising all common amino acid residues (VQSIKCADFLHYMENPTWGR) and two further model peptides (VCFQYMDRGDR and VQSIKADFLHYENPTWGR) were treated with subcritical water with the aim of probing any induced amino acid side-chain modifications. The hydrolysis products were analyzed by direct infusion electrospray tandem mass spectrometry, either collision-induced dissociation or electron transfer dissociation, and liquid chromatography collision-induced dissociation tandem mass spectrometry. The results show preferential oxidation of cysteine to sulfinic and sulfonic acid, and oxidation of methionine. In the absence of cysteine and methionine, oxidation of tryptophan was observed. In addition, water loss from aspartic acid and C-terminal amidation were observed in harsher subcritical water conditions. [Figure not available: see fulltext.
de Haas, V.; Breunis, W. B.; dee, R.; Verhagen, O. J. H. M.; Kroes, W.; van Wering, E. R.; van Dongen, J. J. M.; van den Berg, H.; van der Schoot, C. E.
2002-01-01
Prospective studies in children with B-precursor acute lymphoblastic leukaemia (ALL) have shown that polymerase chain reaction (PCR)-based detection of minimal residual disease (MRD) using immunoglobin (Ig) and T-cell receptor (TCR) gene rearrangements as targets can be used to identify patients
Plasma phospholipid long-chain n-3 polyunsaturated fatty acids and body weight change
DEFF Research Database (Denmark)
Jakobsen, Marianne Uhre; Dethlefsen, Claus; Due, Karen Margrete
2011-01-01
We investigated the association between the proportion of long-chain n-3 polyunsaturated fatty acids (PUFA) in plasma phospholipids from blood samples drawn at enrollment and subsequent change in body weight. Sex, age, and BMI were considered as potential effect modifiers.......We investigated the association between the proportion of long-chain n-3 polyunsaturated fatty acids (PUFA) in plasma phospholipids from blood samples drawn at enrollment and subsequent change in body weight. Sex, age, and BMI were considered as potential effect modifiers....
Directory of Open Access Journals (Sweden)
Jobin Thomas
2014-11-01
Full Text Available Aim: The aim of this study was to screen the suspected samples by polymerase chain reaction (PCR and epidemiological analysis of positive cases of canine parvovirus type2. Materials and Methods: Fecal samples were collected from dogs suspected for canine parvovirus type 2 (CPV-2 and viral DNA was extracted. Primers were designed, and PCR was done with all extracted DNA samples. Age, sex and breed wise distribution of positive cases were analyzed. Results: Out of a total 44 collected fecal samples, 23 were found to be positive for CPV-2 by developed PCR. The disease was found to be more common in Labrador male pups of 3-6 months of age. The percentage of positive cases in vaccinated dogs was found to be around 17.4%. Conclusion: Almost half (52.3% of total collected samples were found to be positive by PCR. However, number of field samples are needed to further validate this test and additionally sequence analysis needs to be done to ensure the prevalent field strain of CPV-2.
Directory of Open Access Journals (Sweden)
Richard Atherton
2013-06-01
Full Text Available The aim of this study was to determine the genetic diversity of Giardia duodenalis present in a human population living in a northern Ecuadorian rain forest. All Giardia positive samples (based on an ELISA assay were analysed using a semi-nested polymerase chain reaction-restriction fragment length polymorphism assay that targets the glutamate dehydrogenase (gdh gene; those amplified were subsequently genotyped using NlaIV and RsaI enzymes. The gdh gene was successfully amplified in 74 of 154 ELISA positive samples; 69 of the 74 samples were subsequently genotyped. Of these 69 samples, 42 (61% were classified as assemblage B (26 as BIII and 16 as BIV, 22 (32% as assemblage A (3 as AI and 19 as AII and five (7% as mixed AII and BIII types. In this study site we observe similar diversity in genotypes to other regions in Latin America, though in contrast to some previous studies, we found similar levels of diarrheal symptoms in those individuals infected with assemblage B compared with those infected with assemblage A.
Czech Academy of Sciences Publication Activity Database
Güixens-Gallardo, Pedro; Hocek, Michal; Perlíková, Pavla
2016-01-01
Roč. 26, č. 2 (2016), s. 288-291 ISSN 0960-894X R&D Projects: GA ČR GBP206/12/G151 Institutional support: RVO:61388963 Keywords : DNA polymerases * nucleotide addition * primer extension * oligonucleotides * twisted intercalating nucleic acid Subject RIV: CC - Organic Chemistry Impact factor: 2.454, year: 2016
Directory of Open Access Journals (Sweden)
Valdes R. Bollela
1999-06-01
: This study was undertaken in Ribeirão Preto, S. Paulo State, Brazil. Forty-two sputum samples from suspected cases of tuberculosis attending the municipal health care centers were sent to the microbiology laboratory. The samples were processed for the detection of Mycobacterium tuberculosis by acid-fast bacilli determination, culture in Lowenstein-Jensen medium, and by a polymerase chain reaction that amplified a fragment of 123 base pairs of the Mycobacterium tuberculosis genome. RESULTS: Of the forty-two samples studied, one was contaminated and excluded from the study, ten were culture positive, ten were positive for the presence of acid-fast bacilli, and sixteen were polymerase chain reaction positive. The sensitivity and specificity of this technique were 90% and 81%, respectively. CONCLUSIONS: The polymerase chain reaction presented a sensitivity comparable to the culture and the whole procedure took only one day to complete. The results presented here make it a strong candidate for rapid diagnosis of tuberculosis in clinical settings making it possible to begin the specific therapy early in the course of the disease. However, standardization of the technique is necessary, and the correlation with clinical findings is of paramount importance due to the high sensitivity of this technique.
Goldbach, Verena
2016-11-09
Dicarboxylic acids are compounds of high value, but to date long-chain alpha,omega-dicarboxylic acids have been difficult to access in a direct way. Unsaturated fatty acids are ideal starting materials with their molecular structure of long methylene sequences and a carboxylate functionality, in addition to a double bond that offers itself for functionalization. Within this paper, we established a direct access to alpha,omega-dicarboxylic acids by combining isomerization and selective terminal carbonylation of the internal double bond with water as a nucleophile on unsaturated fatty acids. We identified the key elements of this reaction: a homogeneous reaction mixture ensuring sufficient contact between all reactants and a catalyst system allowing for activation of the Pd precursor under aqueous conditions. Experiments under pressure reactor conditions with [(dtbpx)Pd(OTf)(2)] as catalyst precursor revealed the importance of nucleophile and reactant concentrations and the addition of the diprotonated diphosphine ligand (dtbpxH(2))(OTf)(2) to achieve turnover numbers >120. A variety of unsaturated fatty acids, including a triglyceride, were converted to valuable long-chain dicarboxylic acids with high turnover numbers and selectivities for the linear product of >90%. We unraveled the activation pathway of the Pd-II precursor, which proceeds via a reductive elimination step forming a Pd species and oxidative addition of the diprotonated diphosphine ligand, resulting in the formation of the catalytically active Pd hydride species. Theoretical calculations identified the hydrolysis as the rate-determining step. A low nucleophile concentration in the reaction mixture in combination with this high energetic barrier limits the potential of this reaction. In conclusion, water can be utilized as a nucleophile in isomerizing functionalization reactions and gives access to long-chain dicarboxylic acids from a variety of unsaturated substrates. The activity of the catalytic
Identification of duck plague virus by polymerase chain reaction
Hansen, W.R.; Brown, Sean E.; Nashold, S.W.; Knudson, D.L.
1999-01-01
A polymerase chain reaction (PCR) assay was developed for detecting duck plague virus. A 765-bp EcoRI fragment cloned from the genome of the duck plague vaccine (DP-VAC) virus was sequenced for PCR primer development. The fragment sequence was found by GenBank alignment searches to be similar to the 3a?? ends of an undefined open reading frame and the gene for DNA polymerase protein in other herpesviruses. Three of four primer sets were found to be specific for the DP-VAC virus and 100% (7/7) of field isolates but did not amplify DNA from inclusion body disease of cranes virus. The specificity of one primer set was tested with genome templates from other avian herpesviruses, including those from a golden eagle, bald eagle, great horned owl, snowy owl, peregrine falcon, prairie falcon, pigeon, psittacine, and chicken (infectious laryngotracheitis), but amplicons were not produced. Hence, this PCR test is highly specific for duck plague virus DNA. Two primer sets were able to detect 1 fg of DNA from the duck plague vaccine strain, equivalent to five genome copies. In addition, the ratio of tissue culture infectious doses to genome copies of duck plague vaccine virus from infected duck embryo cells was determined to be 1:100, making the PCR assay 20 times more sensitive than tissue culture for detecting duck plague virus. The speed, sensitivity, and specificity of this PCR provide a greatly improved diagnostic and research tool for studying the epizootiology of duck plague. /// Se desarroll?? una prueba de reacci??n en cadena por la polimerasa para detectar el virus de la peste del pato. Un fragmento EcoRI de 765 pares de bases clonado del genoma del virus vacunal de la peste del pato fue secuenciado para la obtenci??n de los iniciadores de la prueba de la reacci??n en cadena por la polimerasa. En investigaciones de alineaci??n en el banco de genes ('GenBank') se encontr?? que la secuencia del fragmento era similar a los extremos 3a?? de un marco de lectura abierto
Chen, Hao; Saksa, Kristen; Zhao, Feiyi; Qiu, Joyce; Xiong, Liming
2010-01-01
The branched-chain amino acids (BCAAs) valine, leucine and isoleucine are essential amino acids that play critical roles in animal growth and development. Animals cannot synthesize these amino acids and must obtain them from their diet. Plants
Medium-chain fatty acid binding to albumin and transfer to phospholipid bilayers
International Nuclear Information System (INIS)
Hamilton, J.A.
1989-01-01
Temperature-dependent (5-42 degree C) 13 C NMR spectra of albumin complexes with 90% isotopically substituted [1- 13 C]octanoic or [1- 13 C]decanoic acids showed a single peak at >30 degree C but three peaks at lower temperatures. The chemical-shift differences result from different ionic and/or hydrogen-bonding interactions between amino acid side chains and the fatty acid carboxyl carbon. Rapid exchange of fatty acid among binding sites obscures these sites at temperatures >30 degree C. Rate constants for exchange at 33 degree C were 350 sec -1 for octanoate and 20 sec -1 for decanoate. Temperature-dependent data for octanoate showed an activation energy of 2 kcal/mol for exchange. Spectra of albumin complexes with the 12-carbon saturated fatty acid, lauric acid, had several narrow laurate carboxyl peaks at 35 degree C, indicating longer lifetimes in the different binding sites. Fatty acid exchange between albumin and model membranes (phosphatidylcholine bilayers) occurred on a time scale comparable to that for exchange among albumin binding sites, following the order octanoate > decanoate > laurate. The equilibrium distribution of fatty acid between lipid bilayers and protein was measured directly from NMR spectra. Decreasing pH increased the relative affinity of fatty acid for the lipid bilayer. The results predict that the relative affinity of octanoic acid for albumin and membranes will be similar to that of long-chain fatty acids, but the rate of equilibration will be ∼ 10 4 faster for octanoic acid
Branched Chain Amino Acid Oxidation in Cultured Rat Skeletal Muscle Cells
Pardridge, William M.; Casanello-Ertl, Delia; Duducgian-Vartavarian, Luiza
1980-01-01
Leucine metabolism in skeletal muscle is linked to protein turnover. Since clofibrate is known both to cause myopathy and to decrease muscle protein content, the present investigations were designed to examine the effects of acute clofibrate treatment on leucine oxidation. Rat skeletal muscle cells in tissue culture were used in these studies because cultivated skeletal muscle cells, like muscle in vivo, have been shown to actively utilize branched chain amino acids and to produce alanine. The conversion of [1-14C]leucine to 14CO2 or to the [1-14C]keto-acid of leucine (α-keto-isocaproate) was linear for at least 2 h of incubation; the production of 14CO2 from [1-14C]leucine was saturable with a Km = 6.3 mM and a maximum oxidation rate (Vmax) = 31 nmol/mg protein per 120 min. Clofibric acid selectively inhibited the oxidation of [1-14C]leucine (Ki = 0.85 mM) and [U-14C]isoleucine, but had no effect on the oxidation of [U-14C]glutamate, -alanine, -lactate, or -palmitate. The inhibition of [1-14C]leucine oxidation by clofibrate was also observed in the rat quarter-diaphragm preparation. Clofibrate primarily inhibited the production of 14CO2 and had relatively little effect on the production of [1-14C]keto-acid of leucine. A physiological concentration—3.0 g/100 ml—of albumin, which actively binds clofibric acid, inhibited but did not abolish the effects of a 2-mM concentration of clofibric acid on leucine oxidation. Clofibrate treatment stimulated the net consumption of pyruvate, and inhibited the net production of alanine. The drug also increased the cytosolic NADH/NAD+ ratio as reflected by an increase in the lactate/pyruvate ratio, in association with a decrease in cell aspartate levels. The changes in pyruvate metabolism and cell redox state induced by the drug were delayed compared with the nearly immediate inhibition of leucine oxidation. These studies suggest that clofibric acid, in concentrations that approximate high therapeutic levels of the drug
DEFF Research Database (Denmark)
Corydon, M J; Gregersen, N; Lehnert, W
1996-01-01
Ethylmalonic aciduria is a common biochemical finding in patients with inborn errors of short chain fatty acid beta-oxidation. The urinary excretion of ethylmalonic acid (EMA) may stem from decreased oxidation by short chain acyl-CoA dehydrogenase (SCAD) of butyryl-CoA, which is alternatively...
Yang, Weizhun; Ramadan, Sherif; Yang, Bo; Yoshida, Keisuke; Huang, Xuefei
2016-01-01
Among many hurdles in synthesizing proteoglycan glycopeptides, one challenge is the incorporation of aspartic acid in the peptide backbone and acid sensitive O-sulfated glycan chains. To overcome this, a new strategy was developed utilizing homoserine as an aspartic acid precursor. The conversion of homoserine to aspartic acid in the glycopeptide was successfully accomplished by late stage oxidation using 2,2,6,6-tetramethyl-1-piperidinyloxy (TEMPO) and bis(acetoxy)iodobenzene (BAIB). This is...
Sydor, Tobias; von Bargen, Kristine; Hsu, Fong-Fu; Huth, Gitta; Holst, Otto; Wohlmann, Jens; Becken, Ulrike; Dykstra, Tobias; Söhl, Kristina; Lindner, Buko; Prescott, John F; Schaible, Ulrich E; Utermöhlen, Olaf; Haas, Albert
2013-03-01
Rhodococcus equi is a close relative of Mycobacterium spp. and a facultative intracellular pathogen which arrests phagosome maturation in macrophages before the late endocytic stage. We have screened a transposon mutant library of R. equi for mutants with decreased capability to prevent phagolysosome formation. This screen yielded a mutant in the gene for β-ketoacyl-(acyl carrier protein)-synthase A (KasA), a key enzyme of the long-chain mycolic acid synthesizing FAS-II system. The longest kasA mutant mycolic acid chains were 10 carbon units shorter than those of wild-type bacteria. Coating of non-pathogenic E. coli with purified wild-type trehalose dimycolate reduced phagolysosome formation substantially which was not the case with shorter kasA mutant-derived trehalose dimycolate. The mutant was moderately attenuated in macrophages and in a mouse infection model, but was fully cytotoxic.Whereas loss of KasA is lethal in mycobacteria, R. equi kasA mutant multiplication in broth was normal proving that long-chain mycolic acid compounds are not necessarily required for cellular integrity and viability of the bacteria that typically produce them. This study demonstrates a central role of mycolic acid chain length in diversion of trafficking by R. equi. © 2012 Blackwell Publishing Ltd.
Self-assembly of long chain fatty acids: Effect of a methyl branch
DEFF Research Database (Denmark)
Liljeblad, Jonathan F. D.; Tyrode, Eric; Thormann, Esben
2014-01-01
chains of the straight chain fatty acids appear to be oriented perpendicular to the sample surface, based on an orientational analysis of VSFS data and the odd/even effect. In addition, the selection of the subphase (neat water or CdCl2 containing water buffered to pH 6.0) used for the LB-deposition has...
Directory of Open Access Journals (Sweden)
Tiana Milanda
2014-12-01
Full Text Available Pseudomonas aeruginosa is an opportunistic Gram negative bacteria, which may cause infection in eyes, ears, skin, bones, central nervous system, gastrointestinal tract, circulatory system, heart, respiratory system, and urinary tract. Recently, chloramphenicol is no longer used as the main option of the therapy due of its resistance case. The aim of this research was to detect the presence of gene which is responsible to chloramphenicol resistance in clinical isolates of P.aeruginosa. These bacteria isolated from pus of external otitis patients in Hasan Sadikin Hospital in Bandung City. Polymerase Chain Reaction (PCR method (colony-PCR and DNA-PCR were performed to detect this resistance gene. Electropherogram from PCR products showed that the chloramphenicol resistance in clinical isolates of P. aeruginosa was caused by cat gene (317 bp. Based on this research, cat gene may be used to detect the chloramphenicol resistance in patients with external ostitis.
Takabatake, Reona; Onishi, Mari; Koiwa, Tomohiro; Futo, Satoshi; Minegishi, Yasutaka; Akiyama, Hiroshi; Teshima, Reiko; Kurashima, Takeyo; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi
2013-01-01
A novel real-time polymerase chain reaction (PCR)-based quantitative screening method was developed for three genetically modified soybeans: RRS, A2704-12, and MON89788. The 35S promoter (P35S) of cauliflower mosaic virus is introduced into RRS and A2704-12 but not MON89788. We then designed a screening method comprised of the combination of the quantification of P35S and the event-specific quantification of MON89788. The conversion factor (Cf) required to convert the amount of a genetically modified organism (GMO) from a copy number ratio to a weight ratio was determined experimentally. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDR), respectively. The determined RSDR values for the method were less than 25% for both targets. We consider that the developed method would be suitable for the simple detection and approximate quantification of GMO.
Real time polymerase chain reaction in diagnosis of chronic myeloid leukemia
International Nuclear Information System (INIS)
Tashfeen, S.; Ahmed, S.; Bhatti, F.A.; Ali, N.
2014-01-01
Objective: To compare the sensitivity and specificity of Real Time Polymerase Chain Reaction (RT-PCR) with conventional cytogenetics in diagnosis of chronic myeloid leukemia. Study Design: A cross-sectional, analytical study. Place and Duration of Study: The Armed Forces Institute of Pathology (AFIP), Rawalpindi, from December 2010 to January 2012. Methodology: A total number of 40 patients were studied, in which all were diagnosed as CML on peripheral blood and bone marrow aspiration. The subjects were tested for the presence of Philadelphia (Ph) chromosome by cytogenetics and BCR-ABL fusion gene by RT-PCR. 2-3 ml of venous blood was collected, half in sodium heparin (anti-coagulant) for cytogenetics and half in EDTA for PCR. For cytogenetics, cells were cultured for 72 hours in RPMI 1640 medium and examined by arresting in metaphase using Colchicine to identify Philadelphia chromosome. For PCR, RNA extraction was done by Tri Reagent LS (MRC, USA) and cDNA was synthesized using reverse transcriptase and gene specific primer. RT- PCR was done on ABI-7500. The positive samples were identified when fluorescence exceeded threshold limit. Results of cytogenetics and RT PCR were compared. Results: Out of the 40 patients, PCR showed 37 (92.5%) were positive and 3 (7.5%) were negative for BCR-ABL fusion gene, whereas in cytogenetics 28 (70%) were positive for Ph chromosome and 12 (30%) were negative for Ph chromosome. Sensitivity and specificity of cytogenetics was 75.6% and 100% respectively. Conclusion: Real time PCR as compared to cytogenetics is less tedious, gives quick results, does not require multiple sampling due to culture failure and can be done on peripheral blood. (author)
Hwang, Jung-Taek; Baik, Seung-Ho; Choi, Jin-Soo; Lee, Kweon-Haeng; Rhee, Seung-Koo
2011-01-03
In an attempt to observe the genetic traits of avascular necrosis of the femoral head, we analyzed the genomic alterations in blood samples of 18 patients with avascular necrosis of the femoral head (9 idiopathic and 9 alcoholic cases) using the array comparative genomic hybridization method and real-time polymerase chain reaction. Several candidate genes were identified that may induce avascular necrosis of the femoral head, and we investigated their role in the pathomechanism of osteonecrosis of bone. The frequency of each candidate gene over all the categories of avascular necrosis of the femoral head was also calculated by real-time polymerase chain reaction. The highest frequency specific genes in each category were FLJ40296, CYP27C1, and CTDP1. FLJ40296 and CYP27C1 had the highest frequency (55.6%) in the idiopathic category. FLJ40296 had a high frequency (44.4%) in the alcoholic category, but CYP27C1 had a relatively low frequency (33.3%) in the alcoholic category. However, CTDP1 showed a significantly high frequency (55.6%) in the alcoholic category and a low frequency (22.2%) in the idiopathic category. Although we statistically analyzed the frequency of each gene with Fisher's exact test, we could not prove statistical significance due to the small number of samples. Further studies are needed with larger sample numbers. If the causal genes of avascular necrosis of the femoral head are found, they may be used for early detection, prognosis prediction, and genomic treatment of avascular necrosis of the femoral head in the future. Copyright 2011, SLACK Incorporated.
Directory of Open Access Journals (Sweden)
Gabriel Adrian Popescu
2018-03-01
Full Text Available Aims: To investigate the epidemiology of Clostridium difficile infection in Romanian hospitals. Methods: A survey was conducted at nine hospitals throughout Romania between November 2013 and February 2014. Results: The survey identified 393 patients with Clostridium difficile infection. The median age was 67 years (range: 2-94 years; 56% of patients were aged >65 years. The mean prevalence of Clostridium difficile infection was 5.2 cases per 10.000 patient-days. The highest prevalences were 24.9 and 20 per 10.000 patient-days in hospitals specializing in gastroenterology and infectious diseases, respectively. Clostridium difficile infections were health care-associated in 70.5% patients and community-acquired in 10.2%. The origin was not determined in 19.3%. Clostridium difficile infection was severe in 12.3% of patients, and the in-hospital all-cause mortality was 8.8%. Polymerase chain reaction ribotype 027 had the highest prevalence in all participating hospitals and represented 82.6% of the total ribotyped isolates. The minimum inhibitory concentration of moxifloxacin was >4 μg/mL for 59 of 80 tested isolates (73.8%. Of 59 isolates, 54 were highly resistant to moxifloxacin (minimum inhibitory concentration ≥32 μg/mL, and the majority were polymerase chain reaction ribotype 027 (p<0.0001. Conclusion: The ribotype 027 was the predominant cause of Clostridium difficile infections in Romania. In some specialized hospitals, the prevalence of Clostridium difficile infection was higher than the European mean prevalence, and this demonstrates the need for strict adherence to infection control programs.
Wang, K W; Chueh, L L; Wang, M H; Huang, Y T; Fang, B H; Chang, C Y; Fang, M C; Chou, J Y; Hsieh, S C; Wan, C H
2013-04-01
Mouse parvoviruses are among the most prevalent infectious pathogens in contemporary mouse colonies. To improve the efficiency of routine screening for mouse parvovirus infections, a multiplex polymerase chain reaction (PCR) assay targeting the VP gene was developed. The assay detected minute virus of mice (MVM), mouse parvovirus (MPV) and a mouse housekeeping gene (α-actin) and was able to specifically detect MVM and MPV at levels as low as 50 copies. Co-infection with the two viruses with up to 200-fold differences in viral concentrations can easily be detected. The multiplex PCR assay developed here could be a useful tool for monitoring mouse health and the viral contamination of biological materials.
International Nuclear Information System (INIS)
Aleksandrov, I.D.; Lapidus, I.L.; Aleksandrova, M.V.; Karpovskij, A.L.; Korablinova, S.V.; Levkovich, N.V.
1998-01-01
A total of 27 independent isolated spontaneous and gamma-ray-induced heritable mutations at the vestigial gene of Drosophila melanogaster were analysed by a rapid deletion screening method with polymerase chain reaction (PCR) amplification. According to the results obtained 36.4% (4 of 11) of spontaneous mutants and 62.5% (10 of 16) of gamma-ray-induced ones have revealed deficiency of one or more fragments studied. The rest of spontaneous and radiation mutants showed no alterations in the PCR patterns, indicating possible small scale changes (point mutations) inside the gene region studied or, probably, the gross lesions situated elsewhere. The distribution of the mutation damages in the gene region studied are discussed
Nol, P.; Williamson, J.L.; Rocke, T.E.; Yuill, Thomas M.
2004-01-01
We established a method of directly detecting Clostridium botulinum type C cells, while minimizing spore detection, in the intestinal contents of Mozambique tilapia (Oreochromis mossambicus). This technique involved extraction of predominantly cellular DNA from tilapia intestinal tracts and used a polymerase chain reaction assay to detect presence of type C1 toxin gene. We consistently detected C. botulinum type C cells in tilapia gastrointestinal contents at a level of 7.5×104 cells per 0.25 g material or 1.9×103 cells. This technique is useful for determining prevalence of the potentially active organisms within a given population of fish and may be adapted to other types of C. botulinum and vertebrate populations as well.
Son, Na Ry; Seo, Dong Joo; Lee, Min Hwa; Seo, Sheungwoo; Wang, Xiaoyu; Lee, Bog-Hieu; Lee, Jeong-Su; Joo, In-Sun; Hwang, In-Gyun; Choi, Changsun
2014-09-01
The aim of this study was to develop an optimal technique for detecting hepatitis E virus (HEV) in swine livers. Here, three elution buffers and two concentration methods were compared with respect to enhancing recovery of HEV from swine liver samples. Real-time reverse transcription-polymerase chain reaction (RT-PCR) and nested RT-PCR were performed to detect HEV RNA. When phosphate-buffered saline (PBS, pH 7.4) was used to concentrate HEV in swine liver samples using ultrafiltration, real-time RT-PCR detected HEV in 6 of the 26 samples. When threonine buffer was used to concentrate HEV using polyethylene glycol (PEG) precipitation and ultrafiltration, real-time RT-PCR detected HEV in 1 and 3 of the 26 samples, respectively. When glycine buffer was used to concentrate HEV using ultrafiltration and PEG precipitation, real-time RT-PCR detected HEV in 1 and 3 samples of the 26 samples, respectively. When nested RT-PCR was used to detect HEV, all samples tested negative regardless of the type of elution buffer or concentration method used. Therefore, the combination of real-time RT-PCR and ultrafiltration with PBS buffer was the most sensitive and reliable method for detecting HEV in swine livers. Copyright © 2014 Elsevier B.V. All rights reserved.
Clofibric acid stimulates branched-chain amino acid catabolism by three mechanisms.
Kobayashi, Rumi; Murakami, Taro; Obayashi, Mariko; Nakai, Naoya; Jaskiewicz, Jerzy; Fujiwara, Yoko; Shimomura, Yoshiharu; Harris, Robert A
2002-11-15
Clofibrate promotes catabolism of branched-chain amino acids by increasing the activity of the branched-chain alpha-keto acid dehydrogenase [BCKDH] complex. Depending upon the sex of the rats, nutritional state, and tissue being studied, clofibrate can affect BCKDH complex activity by three different mechanisms. First, by directly inhibiting BCKDH kinase activity, clofibrate can increase the proportion of the BCKDH complex in the active, dephosphorylated state. This occurs in situations in which the BCKDH complex is largely inactive due to phosphorylation, e.g., in the skeletal muscle of chow-fed rats or in the liver of female rats late in the light cycle. Second, by increasing the levels at which the enzyme components of the BCKDH complex are expressed, clofibrate can increase the total enzymatic activity of the BCKDH complex. This is readily demonstrated in livers of rats fed a low-protein diet, a nutritional condition that induces a decrease in the level of expression of the BCKDH complex. Third, by decreasing the amount of BCKDH kinase expressed and therefore its activity, clofibrate induces an increase in the percentage of the BCKDH complex in the active, dephosphorylated state. This occurs in the livers of rats fed a low-protein diet, a nutritional condition that causes inactivation of the BCKDH complex due to upregulation of the amount of BCKDH kinase. WY-14,643, which, like clofibric acid, is a ligand for the peroxisome-proliferator-activated receptor alpha [PPARalpha], does not directly inhibit BCKDH kinase but produces the same long-term effects as clofibrate on expression of the BCKDH complex and its kinase. Thus, clofibrate is unique in its capacity to stimulate BCAA oxidation through inhibition of BCKDH kinase activity, whereas PPARalpha activators in general promote BCAA oxidation by increasing expression of components of the BCKDH complex and decreasing expression of the BCKDH kinase.
DEFF Research Database (Denmark)
Horn, P; Schouenborg, P Øland; Brandslund, I
2007-01-01
OBJECTIVE: The objective of this study was to test a polymerase chain reaction (PCR) assay intended as a tool for monitoring hand hygiene in hospital wards. METHODS: The hands of 20 health-care workers were sampled for 10 days using real-time PCR for quantification of Staphylococcus aureus and S....... epidermidis. Reference intervals (CI) and biological variation were evaluated using index of individuality (II) and critical difference (CD). RESULTS: 45% of the participants were positive for S. aureus on all 10 days. Intra-individual biological variation (CVI) was 129% for S. aureus and 62% for S...
Directory of Open Access Journals (Sweden)
Alice Vismarra
2017-02-01
Full Text Available Toxoplasmosis is a zoonotic disease caused by the protozoan Toxoplasma gondii. Ingestion of raw milk has been suggested as a risk for transmission to humans. Here the authors evaluated pre-treatment protocols for DNA extraction on T. gondii tachyzoite-spiked sheep milk with the aim of identifying the method that resulted in the most rapid and reliable polymerase chain reaction (PCR positivity. This protocol was then used to analyse milk samples from sheep of three different farms in Southern Italy, including real time PCR for DNA quantification and PCR-restriction fragment length polymorphism for genotyping. The pre-treatment protocol using ethylenediaminetetraacetic acid and Tris-HCl to remove casein gave the best results in the least amount of time compared to the others on spiked milk samples. One sample of 21 collected from sheep farms was positive on one-step PCR, real time PCR and resulted in a Type I genotype at one locus (SAG3. Milk usually contains a low number of tachyzoites and this could be a limiting factor for molecular identification. Our preliminary data has evaluated a rapid, cost-effective and sensitive protocol to treat milk before DNA extraction. The results of the present study also confirm the possibility of T. gondii transmission through consumption of raw milk and its unpasteurised derivatives.
Directory of Open Access Journals (Sweden)
Keyuan Liu
2017-11-01
Full Text Available Objective This study aims to identify the relationship between odd- and branched-chain fatty acids (OBCFAs and microbial nucleic acid bases in the rumen, and to establish a model to accurately predict microbial protein flow by using OBCFA. Methods To develop the regression equations, data on the rumen contents of individual cows were obtained from 2 feeding experiments. In the first experiment, 3 rumen-fistulated dry dairy cows arranged in a 3×3 Latin square were fed diets of differing forage to concentration ratios (F:C. The second experiment consisted of 9 lactating Holstein dairy cows of similar body weights at the same stage of pregnancy. For each lactation stage, 3 cows with similar milk production were selected. The rumen contents were sampled at 4 time points of every two hours after morning feeding 6 h, and then to analyse the concentrations of OBCFA and microbial nucleic acid bases in the rumen samples. Results The ruminal bacteria nucleic acid bases were significantly influenced by feeding diets of differing forge to concentration ratios and lactation stages of dairy cows (p<0.05. The concentrations of OBCFAs, especially odd-chain fatty acids and C15:0 isomers, strongly correlated with the microbial nucleic acid bases in the rumen (p<0.05. The equations of ruminal microbial nucleic acid bases established by ruminal OBCFAs contents showed a good predictive capacity, as indicated by reasonably low standard errors and high R-squared values. Conclusion This finding suggests that the rumen OBCFA composition could be used as an internal marker of rumen microbial matter.
Directory of Open Access Journals (Sweden)
Natália Malaguti
2015-01-01
Full Text Available Bacterial vaginosis (BV is characterized by a polymicrobial proliferation of anaerobic bacteria and depletion of lactobacilli, which are components of natural vaginal microbiota. Currently, there are limited conventional methods for BV diagnosis, and these methods are time-consuming, expensive, and rarely allow for the detection of more than one agent simultaneously. Therefore, we conceived and validated a multiplex polymerase chain reaction (M-PCR assay for the simultaneous screening of thirteen bacterial vaginosis-associated agents (BV-AAs related to symptomatic BV: Gardnerella vaginalis, Mobiluncus curtisii, Mobiluncus mulieris, Bacteroides fragilis, Mycoplasma hominis, Atopobium vaginae, Ureaplasma urealyticum, Megasphaera type I, Clostridia-like bacteria vaginosis-associated bacteria (BVABs 1, 2, and 3, Sneathia sanguinegens, and Mycoplasma genitalium. The overall validation parameters of M-PCR compared to single PCR (sPCR were extremely high, including agreement of 99.1% and sensitivity, specificity, and positive predictive values of 100.0%, negative predictive value of 97.0%, accuracy of 99.3%, and agreement with Nugent results of 100.0%. The prevalence of BV-AAs was very high (72.6%, and simultaneous agents were detected in 53.0%, which demonstrates the effectiveness of the M-PCR assay. Therefore, the M-PCR assay has great potential to impact BV diagnostic methods in vaginal samples and diminish associated complications in the near future.
Designing a Polymerase Chain Reaction Device Working with Radiation and Convection Heat Transfer
Madadelahi, M.; Kalan, K.; Shamloo, A.
2018-05-01
Gene proliferation is vital for infectious and genetic diseases diagnosis from a blood sample, even before birth. In addition, DNA sequencing, genetic finger-print analyzing, and genetic mutation detecting can be mentioned as other procedures requiring gene reproduction. Polymerase chain reaction, briefly known as PCR, is a convenient and effective way to accomplish this task; where the DNA containing sample faces three temperature phases alternatively. These phases are known as denaturation, annealing, and elongation/extension which in this study -regarding the type of the primers and the target DNA sequence- are set to occur at 95, 58, and 72 degrees of Celsius. In this study, a PCR device has been designed and fabricated which uses radiation and convection heat transfer at the same time to set and control the mentioned thermal sections. A 300W incandescent light bulb able to immediately turn off and on along with two 8×8 cm DC fans, controlled by a microcontroller as well as PID and PD controller codes are used to monitor the applied thermal cycles. In designing the controller codes it has been concerned that they not only control the temperature over the set-points as well as possible, but also increase the temperature variation rate between each two phases. The temperature data were plotted and DNA samples were used to assess the device function.
Directory of Open Access Journals (Sweden)
M. Usta
2005-08-01
Full Text Available In order to have a more detailed understanding of the various factors influencing a reverse transcriptase polymerase chain reaction (RT-PCR, a number of important parameters such as Mg+2, primer, enzyme concentration and others were optimized for the detection of Prunus necrotic ringspot virus (PNRSV. Using a PNRSV isolate with a pair of primers, complementary DNA of viral genome as template, and an appropriate enzyme together with magnesium chloride, the following optimal conditions were identified: primer concentration between 0.2 and 0.0002 pmol µl-1 and 0.06–2 units µl-1 for Taq DNA polymerase enzyme for a 50 µl reaction volume when other parameters were optimum; magnesium chloride concentration less than 2.5 mM; dNTP concentration between 1 and 10 mM. The optimum cDNA amount should be ~360 ng for a 50 µl reaction mixture. When these optimized concentrations and/or values of the main PCR parameters were brought together for a new RT-PCR, a clear and a reliable PNRSV detection having no background was performed from both growth-chamber and field-grown PNRSV-infected plants.
Directory of Open Access Journals (Sweden)
U. Pagnini
2010-02-01
Full Text Available A multiplex reverse transcription- polymerase chain reaction (mRT-PCR assay that detects Bovine Viral Diarrhoea Virus, Bovine Coronavirus, and Group A Rotaviruses in infected cell-culture fluids and clinical faecal samples is described. One hundred twenty faecal samples from buffalo calves with acute gastroenteritis were tested. The mRT-PCR was validated against simplex RT-PCR with published primers for Pestivirus, Coronavirus and Rotavirus. The multiplex RT-PCR was equally sensitive and specific in detecting viral infections compared with simplex RT-PCR. The mRT-PCR readily identified viruses by discriminating the size of their amplified gene products. This mRT-PCR may be a sensitive and rapid assay for surveillance of buffalo enteric viruses in field specimens. This novel multiplex RT-PCR is an attractive technique for the rapid, specific, and cost-effective laboratory diagnosis of acute gastroenteritis.
Directory of Open Access Journals (Sweden)
W Suryapratama
2009-05-01
Full Text Available A study was conducted to evaluate the potential of branched-chain volatile fatty acids (isobutyric, α-methylbutyric and β-methylbutiric that supplemented into the diet on the colony of ruminal bacteria and the cell of protozoa population. Five progeny Friesian Holstein males with initial weight 348±29 kg were used in a 5x5 Latin square design (30-d periods. The basal diet composed of 55% forage and 45% concentrate containing 10.5 MJ ME/kg and 15% crude protein (CP. There were five dietary treatments where A: basal diet, B: A+139 mg urea/kg W0.75, C: B+28 mg CaSO4/kg W0.75, D: C+0.05 mM isobutyric acid+0.05 mM β-methylbutyric acid, and E: D+0.05 mM α-methylbutyric acid. Rearing period was 30 days, consists of feed adaptation period 20 days, then growth observation was done within the last 10 days. Collection of ruminal fluid was done within the last day of observation period, and took 3-4 h after the feeding. The results showed that supplementation branched chain volatile fatty acids did not significant affect on the number of colonies of bacteria and protozoa population, but the significant effect (P<0.05 on the concentration of branched chain volatile fatty acids in the rumen fluid. The supplementation of α-methylbutyric (P <0.05 decreased of concentration of isobutyric and isovaleric in rumen fluid than the other treatments. It is concluded that supplementation of branched chain volatile fatty acids not used by rumen bacteria for their growth but for the elongation of fatty acid synthesis. The supplementation of branched chain volatile fatty acids was 0.05 mM not enough strong influence on the growth of colony of rumen bacteria. (Animal Production 11(2: 129-134 (2009 Key Words: rumen fermentation, branched-chain fatty acid, ruminal bacteria, protozoa
McMeel, O M; Hoey, E M; Ferguson, A
2001-01-01
The cDNA nucleotide sequences of the lactate dehydrogenase alleles LDH-C1*90 and *100 of brown trout (Salmo trutta) were found to differ at position 308 where an A is present in the *100 allele but a G is present in the *90 allele. This base substitution results in an amino acid change from aspartic acid at position 82 in the LDH-C1 100 allozyme to a glycine in the 90 allozyme. Since aspartic acid has a net negative charge whilst glycine is uncharged, this is consistent with the electrophoretic observation that the LDH-C1 100 allozyme has a more anodal mobility relative to the LDH-C1 90 allozyme. Based on alignment of the cDNA sequence with the mouse genomic sequence, a local primer set was designed, incorporating the variable position, and was found to give very good amplification with brown trout genomic DNA. Sequencing of this fragment confirmed the difference in both homozygous and heterozygous individuals. Digestion of the polymerase chain reaction products with BslI, a restriction enzyme specific for the site difference, gave one, two and three fragments for the two homozygotes and the heterozygote, respectively, following electrophoretic separation. This provides a DNA-based means of routine screening of the highly informative LDH-C1* polymorphism in brown trout population genetic studies. Primer sets presented could be used to sequence cDNA of other LDH* genes of brown trout and other species.
You, Yi-Qian Nancy; Ling, Pei-Ra; Qu, Jason Zhensheng; Bistrian, Bruce R
2008-01-01
Fatty acid absorption patterns can have a major impact on the fatty acid composition in the portal, intestinal lymph, and systemic circulation. This study sought to determine the effects of long-chain triglycerides (LCT), medium-chain triglycerides (MCT), and 2-monododecanoin (2mono) on intestinal fatty acid composition during continuous feeding over a brief period. The lipid sources were 100% LCT, 100% MCT, a 50:50 mixture of LCT and MCT (LCT/MCT), and a 50:50 mixture of LCT and 2mono (LCT/2mono). A total of 27 rats were randomly given 1 of the 4 diets at 200 kcal/kg/d, with 30% of total calories from lipids over 3 hours. MCT significantly increased each of the medium-chain fatty acids (C6:0, C8:0, and C10:0) as free fatty acids in the portal vein and about 10%/mol of C10:0 as triglycerides in the lymph compared with the other groups. There was significantly less C10:0 in lymphatic triglycerides with LCT/MCT than with MCT, but more than in the LCT and LCT/2mono diets. MCT also significantly increased the contents of C16:0, C18:0, C18:1, and C20:4 in the lymphatic triglycerides compared with all other groups including LCT/MCT. The amount of linoleic acid (C18:2) in lymphatic triglycerides followed the relative amounts of this fatty acid in the diet, with the greatest in LCT followed by LCT/MCT and LCT/2mono and least in MCT. A so-called structured lipid composed of the medium-chain fatty acid dodecanoic acid on the 2 position and long-chain fatty acids on the 1 and 3 positions appeared to be endogenously synthesized in response to the LCT/2mono diet. The original differences in MCT and LCT content in the diets were preserved in the fatty acid composition in the intestinal free fatty acids and triglycerides during feeding. In addition, the duration of lipid administration can play a role in altering fatty acid composition in the intestine.
Nancy You, Yi-Qian; Ling, Pei-Ra; Qu, Jason Zhensheng; Bistrian, Bruce R.
2011-01-01
Background Fatty acid absorption patterns can have a major impact on the fatty acid composition in the portal, intestinal lymph, and systemic circulation. This study sought to determine the effects of long-chain triglycerides (LCT), medium-chain triglycerides (MCT), and 2-monododecanoin (2mono) on intestinal fatty acid composition during continuous feeding over a brief period. Methods The lipid sources were 100% LCT, 100% MCT, a 50:50 mixture of LCT and MCT (LCT/MCT), and a 50:50 mixture of LCT and 2mono (LCT/2mono). A total of 27 rats were randomly given 1 of the 4 diets at 200 kcal/kg/d, with 30% of total calories from lipids over 3 hours. Results MCT significantly increased each of the medium-chain fatty acids (C6:0, C8:0, and C10:0) as free fatty acids in the portal vein and about 10%/mol of C10:0 as triglycerides in the lymph compared with the other groups. There was significantly less C10:0 in lymphatic triglycerides with LCT/MCT than with MCT, but more than in the LCT and LCT/2mono diets. MCT also significantly increased the contents of C16:0, C18:0, C18:1, and C20:4 in the lymphatic triglycerides compared with all other groups including LCT/MCT. The amount of linoleic acid (C18:2) in lymphatic triglycerides followed the relative amounts of this fatty acid in the diet, with the greatest in LCT followed by LCT/MCT and LCT/2mono and least in MCT. A so-called structured lipid composed of the medium-chain fatty acid dodecanoic acid on the 2 position and long-chain fatty acids on the 1 and 3 positions appeared to be endogenously synthesized in response to the LCT/2mono diet. Conclusions The original differences in MCT and LCT content in the diets were preserved in the fatty acid composition in the intestinal free fatty acids and triglycerides during feeding. In addition, the duration of lipid administration can play a role in altering fatty acid composition in the intestine. PMID:18407910
Branched-chain amino acids in metabolic signaling and insulin resistance
Branched-chain amino acids (BCAAs) are important directly- and indirectly-acting nutrient signals. Frequently, their actions have been reported to be anti-obesity in nature, especially in rodent models. Yet, circulating BCAAs tend to be elevated in obesity, and even associated with poorer metaboli...
Lou, Binghai; Song, Yaqin; RoyChowdhury, Moytri; Deng, Chongling; Niu, Ying; Fan, Qijun; Tang, Yan; Zhou, Changyong
2018-02-01
Huanglongbing (HLB) is one of the most destructive diseases in citrus production worldwide. Early detection of HLB pathogens can facilitate timely removal of infected citrus trees in the field. However, low titer and uneven distribution of HLB pathogens in host plants make reliable detection challenging. Therefore, the development of effective detection methods with high sensitivity is imperative. This study reports the development of a novel method, tandem repeat-based polymerase chain displacement reaction (TR-PCDR), for the detection of 'Candidatus Liberibacter asiaticus', a widely distributed HLB-associated bacterium. A uniquely designed primer set (TR2-PCDR-F/TR2-PCDR-1R) and a thermostable Taq DNA polymerase mutant with strand displacement activity were used for TR-PCDR amplification. Performed in a regular thermal cycler, TR-PCDR could produce more than two amplicons after each amplification cycle. Sensitivity of the developed TR-PCDR was 10 copies of target DNA fragment. The sensitive level was proven to be 100× higher than conventional PCR and similar to real-time PCR. Data from the detection of 'Ca. L. asiaticus' with filed samples using the above three methods also showed similar results. No false-positive TR-PCDR amplification was observed from healthy citrus samples and water controls. These results thereby illustrated that the developed TR-PCDR method can be applied to the reliable, highly sensitive, and cost-effective detection of 'Ca. L. asiaticus'.
Mogeni, Polycarp; Williams, Thomas N; Omedo, Irene; Kimani, Domtila; Ngoi, Joyce M; Mwacharo, Jedida; Morter, Richard; Nyundo, Christopher; Wambua, Juliana; Nyangweso, George; Kapulu, Melissa; Fegan, Gregory; Bejon, Philip
2017-11-27
Malaria control strategies need to respond to geographical hotspots of transmission. Detection of hotspots depends on the sensitivity of the diagnostic tool used. We conducted cross-sectional surveys in 3 sites within Kilifi County, Kenya, that had variable transmission intensities. Rapid diagnostic test (RDT), microscopy, and polymerase chain reaction (PCR) were used to detect asymptomatic parasitemia, and hotspots were detected using the spatial scan statistic. Eight thousand five hundred eighty-one study participants were surveyed in 3 sites. There were statistically significant malaria hotspots by RDT, microscopy, and PCR for all sites except by microscopy in 1 low transmission site. Pooled data analysis of hotspots by PCR overlapped with hotspots by microscopy at a moderate setting but not at 2 lower transmission settings. However, variations in degree of overlap were noted when data were analyzed by year. Hotspots by RDT were predictive of PCR/microscopy at the moderate setting, but not at the 2 low transmission settings. We observed long-term stability of hotspots by PCR and microscopy but not RDT. Malaria control programs may consider PCR testing to guide asymptomatic malaria hotspot detection once the prevalence of infection falls. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America.
Directory of Open Access Journals (Sweden)
K. Rathore
2018-04-01
Full Text Available Aim: This study was designed to evaluate the potential of the use of multiplex polymerase chain reaction (PCR as an alternative to conventional antibiotic sensitivity test. Materials and Methods: Isolates of Staphylococcus aureus (total = 36 from clinical cases presented to Teaching Veterinary Clinical Complex of College of Veterinary and Animal Sciences (CVAS, Navania, Udaipur, were characterized by morphological, cultural, and biochemical methods. Then, the isolates were further subjected to molecular characterization by PCR targeting S. aureus-specific sequence (107 bp. Phenotypic antibiotic sensitivity pattern was analyzed by Kirby Bauer disc diffusion method against 11 commonly used antibiotics in veterinary medicine in and around Udaipur region. The genotypic antibiotic sensitivity pattern was studied against methicillin, aminoglycosides, and tetracycline targeting the gene mecA, aacA-aphD, and tetK by multiplex PCR. Results: There was 100% correlation between the phenotype and genotype of aminoglycoside resistance, more than 90% correlation for methicillin resistance, and 58.3% in the case tetracycline resistance. Conclusion: As there is a good correlation between phenotype and genotype of antibiotic resistance, multiplex PCR can be used as an alternative to the conventional antibiotic susceptibility testing, as it can give a rapid and true prediction of antibiotic sensitivity pattern.
Quantification of Xylella fastidiosa from Citrus Trees by Real-Time Polymerase Chain Reaction Assay.
Oliveira, Antonio C; Vallim, Marcelo A; Semighini, Camile P; Araújo, Welington L; Goldman, Gustavo H; Machado, Marcos A
2002-10-01
ABSTRACT Xylella fastidiosa is the causal agent of citrus variegated chlorosis (CVC), a destructive disease of sweet orange cultivars in Brazil. Polymerase chain reaction (PCR)-based assays constitute the principal diagnostic method for detection of these bacteria. In this work, we established a real-time quantitative PCR (QPCR) assay to quantify X. fastidiosa in naturally and artificially infected citrus. The X. fastidiosa cell number detected in the leaves increased according to the age of the leaf, and bacteria were not detected in the upper midrib section in young leaves, indicating temporal and spatial distribution patterns of bacteria, respectively. In addition, the X. fastidiosa cell number quantified in leaves of 'Pera' orange and 'Murcott' tangor reflected the susceptible and resistant status of these citrus cultivars. None of the 12 endophytic citrus bacteria or the four strains of X. fastidiosa nonpathogenic to citrus that were tested showed an increase in the fluorescence signal during QPCR. In contrast, all 10 CVC-causing strains exhibited an increase in fluorescence signal, thus indicating the specificity of this QPCR assay. Our QPCR provides a powerful tool for studies of different aspects of the Xylella-citrus interactions, and can be incorporated into breeding programs in order to select CVC-resistant plants more quickly.
In Silico Screening Hepatitis B Virus DNA Polymerase Inhibitors from Medicinal Plants
Directory of Open Access Journals (Sweden)
Mokhtar Nosrati
2017-08-01
Full Text Available Abstract Background: Hepatitis B virus infection (HBV is a significant global health problem and is a major cause of morbidity and mortality worldwide. Therefore, currently, introducing novel anti Hepatitis B drugs is taken into consideration. This study was planned to in silico screening novel Hepatitis B virus DNA polymerase inhibitors from two medicinal plants Terminalis chebula and Caesalpinia sappan. Materials and Methods: This is a descriptive-analytic study. In the study, three-dimensional structure of the Hepatitis B virus DNA polymerase was predicted using homology modeling method. A set of phytochemicals from mentioned plants were retrieved from Pubchem database in SDF format. In silico screening was carried out using molecular docking between mentioned phytochemicals and modeled polymerase by iGemdock 2.1 software. Results: Results of the study confirmed that all evaluated ligands have appropriate interactions to the polymerase with least toxicity and without genotoxicity potential. Results also showed that most interactions occur in reverse transcriptase domain which located in 354-694 area in the amino acid sequence of tested polymerase. Analysis of energy and amino acids involved in ligand-polymerase interaction revealed that Terchebin, Chebulinic Acid and Terflavin A have more effective interaction with the polymerase in compared to other ligands. Conclusion: Based on the results it can be concluded that evaluated compounds could be good candidates for in vitro and in vivo research in order to develop novel anti- Hepatitis B drugs.
Directory of Open Access Journals (Sweden)
Virginia Carfora
2013-04-01
Full Text Available Yoghurt is one of very popular flavorful and healthful dairy product obtained by fermentation of lactic acid bacteria including Lactobacillus delbrueckii bulgaricus and Streptococcus thermophilus. Its production and consumption is growing continuously due to its therapeutic properties beside its high nutritive value. Thirty samples of yoghurt from short supply chain produced in 2 factory localized in Lazio region were analyzed with the aim of determining how certain microbiological and physicochemical characteristics change during their shelf life. Different types of yoghurt were studied: plain (12, fruit (14 and cereal yoghurt (4 produced with cow (8 and goat milk (22.The obtained results show: no presence of Enterobacteria, occasional presence of moulds and a considerable presence of yeasts. On the other hand, all the products analyzed have shown an almost constant amount of lactic acid bacteria during their shelf life. Lactic acid bacteria were identified by a biochemical and polymerase chain reaction assay. The presence of undesired microorganisms like yeasts was found. However, the quality of products was satisfying for the concentration of lactic acid bacteria detected in their shelf life.
Shimizu, Eri; Kato, Hisashi; Nakagawa, Yuki; Kodama, Takashi; Futo, Satoshi; Minegishi, Yasutaka; Watanabe, Takahiro; Akiyama, Hiroshi; Teshima, Reiko; Furui, Satoshi; Hino, Akihiro; Kitta, Kazumi
2008-07-23
A novel type of quantitative competitive polymerase chain reaction (QC-PCR) system for the detection and quantification of the Roundup Ready soybean (RRS) was developed. This system was designed based on the advantage of a fully validated real-time PCR method used for the quantification of RRS in Japan. A plasmid was constructed as a competitor plasmid for the detection and quantification of genetically modified soy, RRS. The plasmid contained the construct-specific sequence of RRS and the taxon-specific sequence of lectin1 (Le1), and both had 21 bp oligonucleotide insertion in the sequences. The plasmid DNA was used as a reference molecule instead of ground seeds, which enabled us to precisely and stably adjust the copy number of targets. The present study demonstrated that the novel plasmid-based QC-PCR method could be a simple and feasible alternative to the real-time PCR method used for the quantification of genetically modified organism contents.
Kiss, S; Zsikla, V; Frank, A; Willi, N; Cathomas, G
2016-04-01
Helicobacter-negative gastritis has been increasingly reported. Molecular techniques as the polymerase chain reaction (PCR) may detect bacterial DNA in histologically negative gastritis. To evaluate of Helicobacter PCR in gastric biopsies for the daily diagnostics of Helicobacter-negative gastritis. Over a 5-year period, routine biopsies with chronic gastritis reminiscent of Helicobacter infection, but negative by histology, were tested by using a H. pylori specific PCR. Subsequently, PCR-negative samples were re-evaluated using PCR for other Helicobacter species. Of the 9184 gastric biopsies, 339 (3.7%) with histological-negative gastritis and adequate material were forwarded to PCR analysis for H. pylori and 146 (43.1%) revealed a positive result. In 193 H. pylori DNA-negative biopsies, re-analysis using PCR primers for other Helicobacter species, revealed further 23 (11.9%) positive biopsies, including 4 (2.1%) biopsies with H. heilmannii sensu lato. PCR-positive biopsies showed a higher overall inflammatory score, more lymphoid follicles/aggregates and neutrophils (P gastritis. © 2016 John Wiley & Sons Ltd.
International Nuclear Information System (INIS)
Nelson, D.L.; Ledbetter, S.A.; Corbo, L.; Victoria, M.F.; Ramirez-Solis, R.; Webster, T.D.; Ledbetter, D.H.; Caskey, C.T.
1989-01-01
Current efforts to map the human genome are focused on individual chromosomes or smaller regions and frequently rely on the use of somatic cell hybrids. The authors report the application of the polymerase chain reaction to direct amplification of human DNA from hybrid cells containing regions of the human genome in rodent cell backgrounds using primers directed to the human Alu repeat element. They demonstrate Alu-directed amplification of a fragment of the human HPRT gene from both hybrid cell and cloned DNA and identify through sequence analysis the Alu repeats involved in this amplification. They also demonstrate the application of this technique to identify the chromosomal locations of large fragments of the human X chromosome cloned in a yeast artificial chromosome and the general applicability of the method to the preparation of DNA probes from cloned human sequences. The technique allows rapid gene mapping and provides a simple method for the isolation and analysis of specific chromosomal regions
Espinoza-León, Fabiola; Arocha, Francisco; Hassanhi, Manzur; Arévalo, Julio
2010-09-01
Borrelia burgdorferi is the causative agent of Lyme Borreliosis, an infectious multisystemic disease transmitted to humans by the Ixodes ticks bite. A possible association of Borrelia burgdorferi with localized scleroderma has been postulated. However, published data do not provide unequivocal results. Previous serologic analysis of patients with localized scleroderma in South American countries (including Venezuela), have been reported as yielding some reactivity. The present study looked for evidence of Borrelia burgdorferi infection in venezuelan patients with localized scleroderma, using the polymerase chain reaction to analyze 21 skin samples of patients with this skin condition. The results were negative in all the samples studied. Our data do not support an association of Borrelia burgdorferi infection and the sclerotic lesions of localized scleroderma; but do not rule out the possibility of a relationship between localized scleroderma and an unknown geno-specie of Borrelia burgdorferi sensu lato complex, a different Borrelia specie or a different spirochetal organism, as the etiological agents of the skin lesions in this area.
Patwardhan, Vrushali; Bhalla, Preena; Rawat, Deepti; Garg, Vijay Kumar; Sardana, Kabir; Sethi, Sumit
2017-01-01
To compare laboratory tests that can simultaneously detect and type herpes simplex virus (HSV) directly from the genital ulcer specimens in clinically suspected cases of genital herpes. A study was conducted over 10 months and 44 adult male and female patients clinically suspected with genital herpes were recruited. Genital ulcer swab specimens were subjected to glycoprotein-G gene-based conventional polymerase chain reaction (PCR) and commercially available direct fluorescent antibody (DFA) test and the results were compared. PCR for HSV was positive in 82% (36/44) cases. DFA was positive in 68.2% (30/44) cases. There was 100% agreement between HSV types detected by DFA and PCR. The strength of agreement between the results was better in primary genital herpes than recurrent cases. PCR was found to be better in the detection of HSV in recurrent genital herpes patients. It is a better modality, especially when genital herpes clinically presents with ulcerative or crusted lesions, and is also a cheaper alternative as compared to DFA.
Directory of Open Access Journals (Sweden)
Tiana Milanda
2014-09-01
Full Text Available Escherichia coli is a rod negative Gram which could be pathogenic, if its value increases or located in outer gastrointestinal tract. Pathogenic E. coli will produce enterotoxin which will cause diarrhoea or infection in urine tract. Ampicilin was one of particular antibiotics to overcome infection. Ampicilin nowadays is no longer used as primary medicine, because of its resistance case. The aim of this research is to detect the presence of gene which is responsible to ampicilin resistant E. coli. We used isolated midstream urine from cystitis object in Hasan Sadikin Hospital (RSHS as samples. Polymerase Chain Reaction (PCR method (colony-PCR and DNA-PCR were done to invenstigate the antibiotic resistency. Based on the result of antibiotic susceptibility testing to ampicillin, E. coli samples were resistant to ampicilin. Elektroforegram products of colony-PCR and DNA-PCR showed that the resistance case of ampicilin caused by bla gene (199 bp. Selective and rational antibiotic treatment is required to prevent ampicillin resistance in patients with symptoms
Significance of long chain polyunsaturated fatty acids in human health
Czech Academy of Sciences Publication Activity Database
Zárate, R.; El Jaber-Vazdekis, Nabil; Tejera, N.; Pérez, J.A.; Rodrígues, C.
2017-01-01
Roč. 6, JUL 27 (2017), s. 1-19, č. článku 25. ISSN 2001-1326 R&D Projects: GA MŠk(CZ) LO1416 Institutional support: RVO:61388971 Keywords : Lipidomics * Lipids * Long chain polyunsaturated fatty acids Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology
Gut microbiota–derived short-chain fatty acids and kidney diseases
Directory of Open Access Journals (Sweden)
Li L
2017-12-01
Full Text Available Lingzhi Li, Liang Ma, Ping Fu Kidney Research Institute, Department of Nephrology, West China Hospital of Sichuan University, Chengdu 610041, China Abstract: Gut microbiota and its metabolites play pivotal roles in host physiology and pathology. Short-chain fatty acids (SCFAs, as a group of metabolites, exert positive regulatory effects on energy metabolism, hormone secretion, immune inflammation, hypertension, and cancer. The functions of SCFAs are related to their activation of transmembrane G protein-coupled receptors and their inhibition of histone acetylation. Though controversial, growing evidence suggests that SCFAs, which regulate inflammation, oxidative stress, and fibrosis, have been involved in kidney disease through the activation of the gut–kidney axis; however, the molecular relationship among gut microbiota–derived metabolites, signaling pathways, and kidney disease remains to be elucidated. This review will provide an overview of the physiology and functions of SCFAs in kidney disease. Keywords: gut microbiome, short-chain fatty acids, kidney diseases, gut–kidney axis
Lipase-catalyzed esterification of lactic acid with straight-chain alcohols
DEFF Research Database (Denmark)
Rønne, Torben Harald; Xu, Xuebing; Tan, Tianwei
2005-01-01
Enzymatic synthesis of esters of lactic acid and straight-chain alcohols with different chain lengths (C6–C18) were investigated in batch reactions with hexadecanol (C16) as the model alcohol. Cyclohexane was the best solvent for higher ester yields, and the best biocatalyst was the immobilized...... Candida antarctica lipase B (Novozym 435) as well as the textile-immobilized Candida sp. lipase. A method was established to obtain ester yields in the range of 71 to 82% for the different alcohols, and the most favorable conditions for the esterification reaction using Novozym 435 were an equimolar ratio...... of lactic acid to alcohol, each at a concentration of 120 mM each; a 50°C reaction temperature; 190 rpm shaking speed; and the addition of 100 mg molecular sieves (4 Å) for drying. The ester yield increased with increasing lipase load, and a yield of 79.2% could be obtained after 24 h of reaction at 20 wt...
Directory of Open Access Journals (Sweden)
Raden Wasito
2015-05-01
Full Text Available Avian influenza virus subtype H5N1 (AIV H5N1 is highly pathogenic and fatal in poultry. The virusis still endemic with low virulence rate, although it may play a critical role in causing high morbidity andmortality rates in poultry in Indonesia. In general, diagnostic approach for AIV H5N1 is based onconventional serological and viral isolation methods that have the potential to produce consumings oftime and relatively expensive cost within the laboratory without compromising test utility. Thus, amolecular approach of multiplex reverse transcription-polymerase chain reaction (mRT-PCR was developedand applied for the detection of matrix gene type A influenza viruses, AIV subtype subtype H5hemagglutinin gene with simultaneous detection of N1 nucleoprotein gene. Thirty sera specimens fromthe diseased commercial chickens that were specifically amplified positive-RT-PCR for AIV H5N1 wereselected for mRT-PCR. The mRT-PCR products were visualized by agarose gel electrophoresis and consistedof DNA fragments of AIV of 245 bp, 545 bp and 343 bp for M, H5 and N1 genes, respectively. Thus, themRT-PCR that can rapidly differentiate simultaneously between these genes is very important for thecontrol and even eradication of AIV transmission in poultry in Indonesia.
International Nuclear Information System (INIS)
Black, P.N.
1987-01-01
Escherichia coli transports long-chain fatty acids across the dual membrane by a high affinity, saturable, energy-dependent process. The fadL gene codes for an outer membrane protein which appears to act specifically as a long-chain fatty acid binding protein when fatty acid utilization is blocked by mutation. In an effort to understand the function of the fadL gene product, FLP, membranes have been isolated from fadL + and fadL - strains following osmotic lysis. Following isolation, total membranes were separated into inner and outer membrane fractions and assayed for long-chain fatty acid binding activity. Outer membrane vesicles were incubated 2-5 min at 37 0 C with 3 H oleate (C/sub 18:1/), cooled to 0 0 C, and centrifuged through a Lipidex 100 column for 3 min to remove the unbound fatty acid. The level of fatty acid binding was quantitated by scintillation counting of the eluate. Outer membrane vesicles generated from a fadL + strain bind 325 pmol fatty acid/mg protein whereas vesicles generated for a mutant strain bind 175 pmol fatty acid/mg protein. These data suggest that FLP acts at least as a long-chain fatty acid binding protein on the surface of the cell
Directory of Open Access Journals (Sweden)
Amanda Mahoney
2012-01-01
Full Text Available Setting. Tanzania. Objective. To compare microscopy as conducted in direct observation of treatment, short course centers to pouched rats as detectors of Mycobacterium tuberculosis. Design. Ten pouched rats were trained to detect tuberculosis in sputum using operant conditioning techniques. The rats evaluated 910 samples previously evaluated by smear microscopy. All samples were also evaluated through culturing and multiplex polymerase chain reaction was performed on culture growths to classify the bacteria. Results. The patientwise sensitivity of microscopy was 58.0%, and the patient-wise specificity was 97.3%. Used as a group of 10 with a cutoff (defined as the number of rat indications to classify a sample as positive for Mycobacterium tuberculosis of 1, the rats increased new case detection by 46.8% relative to microscopy alone. The average samplewise sensitivity of the individual rats was 68.4% (range 61.1–73.8%, and the mean specificity was 87.3% (range 84.7–90.3%. Conclusion. These results suggest that pouched rats are a valuable adjunct to, and may be a viable substitute for, sputum smear microscopy as a tuberculosis diagnostic in resource-poor countries.
Xia, Minghui; Qi, Qingguo
2013-01-01
We used denaturing gradient gel electrophoresis (DGGE) to compare bacterial profiles in periodontium and root canals of teeth with combined periodontal-endodontic lesions. Samples of dental plaque and necrotic pulp were collected from thirteen extracted teeth with advanced periodontitis. Genomic DNA was extracted for polymerase chain reaction (PCR) analysis using universal bacterial primers. The PCR products were then loaded onto DGGE gels to obtain fractionated bands. Characteristic DGGE bands were excised and DNA was cloned and sequenced. The number of bands, which indicates the number of bacterial species, was compared between dental plaques and necrotic pulp tissues from the same tooth. Although the difference was statistically significant (P bacteria species were present in both the periodontal pockets and root canals of the same tooth; however, periodontal bacteria did not always invade the root canals, and some bacteria in root canals were not present in periodontal pockets of the same tooth. In some teeth, unique bacteria in root canals had not passed from periodontal pockets. A basic local alignment search tool (BLAST) sequence search in Genbank indicated that new bacteria species were present in periodontal pockets and root canals. Their characteristics must thus be further analyzed.
Rampersad, Joanne; Wang, Xiaohui; Gayadeen, Helen; Ramsewak, Samuel; Ammons, David
2007-11-01
To provide a preliminary assessment of in-house polymerase chain reaction (PCR) as an alternative to the more costly commercial test for detection of asymptomatic infection by Chlamydia trachomatis and to provide much needed demographic data on infection indicators within the Trinidad and Tobago public health care system. An inexpensive in-house nested-PCR with an Internal Amplification Control was used to detect C. trachomatis and Neisseria gonorrhoeae in urine samples collected from 273 apparently healthy, pregnant women from March-September 2004 in Trinidad, West Indies. Demographic information on participants was collected and subjected to statistical analyses. C. trachomatis was detected in 57/273 (21%) samples, of which 5 (2%) were also positive for N. gonorrhoeae. Infection correlated well with certain demographic parameters, with the highest incidence of C. trachomatis infection found among pregnant women that were single or of African descent. Given the lack of commercial tests in Trinidad, in-house PCR is an inexpensive alternative that can be used to detect asymptomatic infections of C. trachomatis and to provide demographic information needed for interventions by the public health care system.
Directory of Open Access Journals (Sweden)
Zhouli Wang
Full Text Available A combination of immunomagnetic separation (IMS and polymerase chain reaction (PCR was used to detect Alicyclobacillus acidoterrestris (A. acidoterrestris in apple juice. The optimum technological parameters of the IMS system were investigated. The results indicated that the immunocapture reactions could be finished in 60 min and the quantity of IMPs used for IMS was 2.5 mg/mL. Then the combined IMS-PCR procedure was assessed by detecting A. acidoterrestris in apple juice samples. The agarose gel electrophoresis results of 20 different strains showed that the IMS-PCR procedure presented high specificity to the A. acidoterrestris. The sensitivity of the IMS-PCR was 2×10(1 CFU/mL and the total detection time was 3 to 4 h. Of the 78 naturally contaminated apple juice samples examined, the sensitivity, specificity and accuracy of IMS-PCR compared with the standardized pour plate method were 90.9%, 97.0% and 96.2%, respectively. The results exhibited that the developed IMS-PCR method will be a valuable tool for detecting A. acidoterrestris and improving food quality in juice samples.
Fan, Hongxin; Robetorye, Ryan S
2013-01-01
Although established diagnostic criteria exist for mature T-cell neoplasms, a definitive diagnosis of a T-cell lymphoproliferative disorder cannot always be obtained using more conventional techniques such as flow cytometric immunophenotyping, conventional cytogenetics, fluorescence in situ hybridization, or immunohistochemistry. However, because T-cell malignancies contain identically rearranged T-cell receptor gamma (TCRG) and/or beta (TCRB) genes, the polymerase chain reaction (PCR) can be a fast, convenient, and dependable option to identify clonal T-cell processes. This chapter describes the use of PCR and capillary electrophoresis to identify clonal TCRB and TCRG gene rearrangements (TCRB and TCRG PCR) using a commercially available method employing multiple multiplex PCR tubes that was originally developed as the result of a large European BIOMED-2 collaborative study (Invivoscribe Technologies). The core protocol for the TCRB assay involves the use of three separate multiplex master mix tubes. Tubes A and B target the framework regions within the variable and joining regions of the TCRB gene, and Tube C targets the diversity and joining regions of the TCRB gene. The core protocol for the TCRG assay utilizes two multiplex master mix tubes (Tubes A and B) that target the variable and joining regions of the TCRG gene. Use of the five BIOMED-2 TCRB and TCRG PCR multiplex tubes in parallel can detect approximately 94% of clonal TCR gene rearrangements.
Medium-chain fatty acids as ligands for orphan G protein-coupled receptor GPR84.
Wang, Jinghong; Wu, Xiaosu; Simonavicius, Nicole; Tian, Hui; Ling, Lei
2006-11-10
Free fatty acids (FFAs) play important physiological roles in many tissues as an energy source and as signaling molecules in various cellular processes. Elevated levels of circulating FFAs are associated with obesity, dyslipidemia, and diabetes. Here we show that GPR84, a previously orphan G protein-coupled receptor, functions as a receptor for medium-chain FFAs with carbon chain lengths of 9-14. Medium-chain FFAs elicit calcium mobilization, inhibit 3',5'-cyclic AMP production, and stimulate [35S]guanosine 5'-O-(3-thiotriphosphate) binding in a GPR84-dependent manner. The activation of GPR84 by medium-chain FFAs couples primarily to a pertussis toxin-sensitive G(i/o) pathway. In addition, we show that GPR84 is selectively expressed in leukocytes and markedly induced in monocytes/macrophages upon activation by lipopolysaccharide. Furthermore, we demonstrate that medium-chain FFAs amplify lipopolysaccharide-stimulated production of the proinflammatory cytokine interleukin-12 p40 through GPR84. Our results indicate a role for GPR84 in directly linking fatty acid metabolism to immunological regulation.
Majidiani, Hamidreza; Nabavi, Reza; Ganjali, Maryam; Saadati, Dariush
2015-01-01
Theileria annulata is common in tropical and subtropical regions especially in Iran and causes great economic losses in cattle industry. In Iran the epidemiological aspects of bovine theileriosis in different breeds of cattle is poorly understood. The aim of present study is comparison of the number of T. annulata carriers in the two major cattle breeds (Holstein–Friesian and Sistani) in Sistan of Iran by giemsa and polymerase chain reaction (PCR) methods. During winter 2013, 160 native cattl...
International Nuclear Information System (INIS)
Wang Shutao; Song Yanlin; Jiang Lei
2007-01-01
Inspired by the lotus effect, we fabricate new microscale and nanoscale hierarchical structured copper mesh films by a simple electrochemical deposition. After modification of the long-chain fatty acid monolayer, these films show superhydrophobic and superoleophilic properties, which could be used for the effective separation of oil and water. The length of the fatty acid chain strongly influences the surface wettability of as-prepared films. It is confirmed that the cooperative effect of the hierarchical structure of the copper film and the nature of the long-chain fatty acid contribute to this unique surface wettability
Directory of Open Access Journals (Sweden)
CUNHA Regina Ayr Florio da
1998-01-01
Full Text Available The objective of the present study was to determine the prevalence of certain mycoplasma species, i.e., Mycoplasma hominis, Ureaplasma urealyticum and Mycoplasma penetrans, in urethral swabs from HIV-1 infected patients compared to swabs from a control group. Mycoplasmas were detected by routine culture techniques and by the Polymerase Chain Reaction (PCR technique, using 16SrRNA generic primers of conserved region and Mycoplasma penetrans specific primers. The positivity rates obtained with the two methods were comparable. Nevertheless, PCR was more sensitive, while the culture techniques allowed the quantification of the isolates. The results showed no significant difference (p < 0.05 in positivity rates between the methods used for mycoplasma detection.
DEFF Research Database (Denmark)
Zornhagen, K. W.; Kristensen, A. T.; Hansen, Anders Elias
2015-01-01
Quantitative real-time reverse transcription polymerase chain reaction (RT-qPCR) is a sensitive technique for quantifying gene expression. Stably expressed reference genes are necessary for normalization of RT-qPCR data. Only a few articles have been published on reference genes in canine tumours....... The objective of this study was to demonstrate how to identify suitable reference genes for normalization of genes of interest in canine soft tissue sarcomas using RT-qPCR. Primer pairs for 17 potential reference genes were designed and tested in archival tumour biopsies from six dogs. The geNorm algorithm...
Wang, Qiao; Du, Xiuxiu; Ma, Ke; Shi, Ping; Liu, Wenbin; Sun, Jing; Peng, Min; Huang, Zhiwei
2018-03-01
Elongases FEN1/ELO2 and SUR4/ELO3 are important enzymes involved in the elongation of long-chain fatty acids (LCFAs) to very long-chain fatty acids (VLCFAs) in Saccharomyces cerevisiae. The molecular mechanism of the involvement of these elongases in lipotoxicity is unclear. In the present study, we investigated the role of VLCFA elongases in oleic acid-mediated yeast cytotoxicity. The spot test showed that yeast strains with the deletion of ELO2 or ELO3 were strikingly sensitive to oleic acid, while there was no change on the growth of strain with deleted ELO1 which was involved in the elongation of C 14 fatty acid (FA) to C 16 FA. By using GC-MS, the unsaturation index was increased in elo2△ and elo3△ mutants after treatment with oleic acid (OLA). However, the proportion of VLCFAs was increased in response to OLA in the wild-type strain. The growth inhibition of elo2△ and elo3△ could be partially rescued by two commonly used antioxidant agents N-acetyl cysteine (NAC) and Ascorbic acid (VC). The further study showed that exposure to excess OLA led to an increase in the levels of reactive oxygen species (ROS) and thiobarbituric acid reactive substances (TBARS), and a decline in the quantity of reduced glutathione (GSH) in both the wild type and mutant strains. However, the antioxidant enzyme activities of superoxide dismutase (SOD) and catalase (CAT) were increased in the wild type and elo1△ strains, while they were significantly decreased in the mutants of elo2△ and elo3△ after treated with excess OLA. Thus, oxidative damage mainly contributed to the cell death induced by OLA in ole2△ and ole3△. Taken together, although disruption of ELO2 or ELO3 did not affect the cellular lipid unsaturation, they altered the distribution and propotion of cellular VLCFAs, leading to the cell membrane impairment, which augmented the ability of OLA to permeabilize the plasma membrane. The data suggest that the very long-chain fatty acids elongases ELO2 and ELO3
Rahman, Md Mahfujur; Ali, Md Eaqub; Hamid, Sharifah Bee Abd; Mustafa, Shuhaimi; Hashim, Uda; Hanapi, Ummi Kalthum
2014-08-01
A polymerase chain reaction (PCR) assay for the assessment of dog meat adulteration in meatballs was developed. The assay selectively amplified a 100-bp region of canine mitochondrial cytochrome b gene from pure, raw, processed and mixed backgrounds. The specificity of the assay was tested against 11 animals and 3 plants species, commonly available for meatball formulation. The stability of the assay was proven under extensively autoclaving conditions that breakdown target DNA. A blind test from ready to eat chicken and beef meatballs showed that the assay can repeatedly detect 0.2% canine meat tissues under complex matrices using 0.04 ng of dog DNA extracted from differentially treated meatballs. The simplicity, stability and sensitivity of the assay suggested that it could be used in halal food industry for the authentication of canine derivatives in processed foods. Copyright © 2014 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Kiarash Ghazvini
2012-01-01
Full Text Available Planning for appropriate preventive measures against Chlamydia trachomatis, a common cause of sexually transmitted disease, requires knowledge of prevalence of infection so that interventions can be targeted in a cost-effective manner. This study was performed on 178 male patients presenting with urethritis in the Mashhad province to determine the prevalence of chlamydial infection in Northeast Iran. A cotton swab and first voided urine specimen were collected according to standard procedures. Polymerase chain reaction (PCR tests were used for the detection of C. trachomatis in the specimens collected and the results were analyzed using SPSS program. Results showed that 10.6% of male patients in this group were infected with C. trachomatis. This study provides strong evidence that prevalence of Chlamydia in the Northeast Iran is high and suggests that Chlamydia screening as a routine part of STD investigations is highly necessary in this area.
Jaspers, Stephen R.; Henriksen, Erik; Jacob, Stephan; Tischler, Marc E.
1989-01-01
The effects of muscle unloading, adrenalectomy, and cortisol treatment on the metabolism of branched-chain amino acids in the soleus and extensor digitorum longus of tail-cast suspended rats were investigated using C-14-labeled lucine, isoleucine, and valine in incubation studies. It was found that, compared to not suspended controls, the degradation of branched-chain amino acids in hind limb muscles was accelerated in tail-cast suspended rats. Adrenalectomy was found to abolish the aminotransferase flux and to diminish the dehydrogenase flux in the soleus. The data also suggest that cortisol treatment increases the rate of metabolism of branched-chain amino acids at the dehydrogenase step.
International Nuclear Information System (INIS)
Ali, J.; Khan, S.A.; Rauf, S.E.; Ayyub, M.; Ali, N.
2017-01-01
To compare the sensitivity and specificity of fluorescence in situ hybridization (FISH) with real time polymerase chain reaction (RT-PCR) in the diagnosis of Chronic Myeloid Leukemia (CML). Study Design: A cross-sectional, analytical study. Place and Duration of Study: Haematology Department, Armed Forces Institute of Pathology, Rawalpindi, from January 2012 to February 2014. Methodology:A total number of 87 patients of CML were studied. The diagnosis was made on the basis of clinical history, peripheral blood and bone marrow aspiration. These patients were tested for the presence of BCR-ABL1 fusion gene by RT-PCR and FISH. About 5 ml of venous blood was collected, half was taken in heparin for FISH and half in ethylenediamine tetra-acetic acid (EDTA) for CBC and PCR. For FISH, cells were cultured for 24 hours in RPMI 1640 medium and evaluated using BX51 fluorescence microscope for dual fusion signal of yellow colour. Samples having 20 or more interphases positive for dual fusion signals were taken as positive. For PCR, RNA extraction was done by Tri-Reagent LS (MRC, USA) and cDNA was synthesized using reverse transcriptase and gene specific primer. RT-PCR was done on ABI-7500. The positive samples were identified when fluorescence exceeded threshold limit. Results of RT-PCR and FISH were compared. Results: Out of the 87 patients, 85 (97.7%) were PCR positive and 2 (2.3%) were PCR negative, whereas in FISH 83 (95.4%) were positive and 4 (4.5%) were negative. Sensitivity and specificity of FISH was 97.6% and 100%, respectively. Conclusion: FISH is a reliable supplementary method to PCR for detection of BCR-ABL1 fusion gene in the diagnosis of CML. (author)
Chuang, Yu-Chung; Chang, Shan-Chwen; Wang, Wei-Kung
2012-08-01
Bacteremia caused by Acinetobacter baumannii is becoming more frequent among critically ill patients, and has been associated with high mortality and prolonged hospital stay. Multidrug resistance and delay in blood culture have been shown to be significant barriers to appropriate antibiotic treatment. Quantitative polymerase chain reaction assays were recently used to monitor bacterial loads; we hypothesized that the rate of bacterial clearance determined by quantitative polymerase chain reaction can be used as a timely surrogate marker to evaluate the appropriateness of antibiotic usage. Prospective observational study. University hospital and research laboratory. Patients with culture-proven A. baumannii bacteremia in the intensive care units were prospectively enrolled from April 2008 to February 2009. Plasmid Oxa-51/pCRII-TOPO, which contained a 431-bp fragment of the A. baumannii-specific Oxa-51 gene in a pCRII-TOPO vector, was used as the standard. Sequential bacterial DNA loads in the blood were measured by a quantitative polymerase chain reaction assay. We enrolled 51 patients with A. baumannii bacteremia, and examined 318 sequential whole blood samples. The initial mean bacterial load was 2.15 log copies/mL, and the rate of bacterial clearance was 0.088 log copies/mL/day. Multivariate linear regression using the generalized estimation equation approach revealed that the use of immunosuppressants was an independent predictor for slower bacterial clearance (coefficient, 1.116; pcritical patients. These findings highlight the importance of appropriate antibiotic usage and development of effective antibiotics against A. baumannii in an era of emerging antibiotic resistance. The rate of bacterial clearance could serve as a timely surrogate marker for evaluating the appropriateness of antibiotics.
Diabetes and branched-chain amino acids: What is the link?
Bloomgarden, Zachary
2018-05-01
Branched-chain amino acids (BCAA) have increasingly been studied as playing a role in diabetes, with the PubMed search string "diabetes" AND "branched chain amino acids" showing particular growth in studies of the topic over the past decade (Fig. ). In the Young Finn's Study, BCAA and, to a lesser extent, the aromatic amino acids phenylalanine and tyrosine were associated with insulin resistance (IR) in men but not in women, whereas the gluconeogenic amino acids alanine, glutamine, or glycine, and several other amino acids (i.e. histidine, arginine, and tryptophan) did not show an association with IR. Obesity may track more strongly than metabolic syndrome and diabetes with elevated BCAA. In a study of 1302 people aged 40-79; higher levels of BCAA tracked with older age, male sex, and metabolic syndrome, as well as with obesity, cardiovascular risk, dyslipidemia, hypertension, and uric acid. Medium- and long-chain acylcarnitines, by-products of mitochondrial catabolism of BCAAs, as well as branched-chain keto acids and the BCAA themselves distinguished obese people having versus not having features of IR, and in a study of 898 patients with essential hypertension, the BCAA and tyrosine and phenylalanine were associated with metabolic syndrome and impaired fasting glucose. In a meta-analysis of three genome-wide association studies, elevations in BCAA and, to a lesser extent, in alanine tracked with IR, whereas higher levels of glutamine and glycine were associated with lesser likelihood of IR. Given these associations with IR, it is not surprising that a number of studies have shown higher BCAA levels in people with and prior to development of type 2 diabetes (T2D), although this has particularly been shown in Caucasian and Asian ethnic groups while not appearing to occur in African Americans. Similarly, higher BCAA levels track with cardiovascular disease. [Figure: see text] The metabolism of BCAA involves two processes: (i) a reversible process catalysed by a
Clinical value of polymerase chain reaction in detecting group B streptococcus during labor.
Koppes, Dorothea Maria; Vriends, Antonius Arnoldus Cornelis Maria; van Rijn, Michiel; van Heesewijk, Antonine Dimphne
2017-06-01
To reduce the intrapartum use of antibiotics in women with prolonged rupture of the membranes (PROM) by restriction of antibiotics to women who are colonized with group B streptococci (GBS), as identified with the Cepheid Gene Xpert polymerase chain reaction (PCR) for detecting GBS. We conducted a randomized controlled trial among full-term delivering women with PROM. Fifty-four women were enrolled, based on a power calculation with a significance level of 5% and a power of 95%. Twenty-seven women received the standard treatment (rectovaginal swab [RVS] for bacterial culture and antibiotics). For another 27 women PCR was performed on the RVS and antibiotics were used only when the PCR was positive. The primary outcome was reduction in antibiotic use, defined as the percentage of women who received antibiotics during labor. 54 Women were enrolled in the study between 1 May and 18 November 2014. There were no significant differences in baseline characteristics. In total, 10 of the 54 women were GBS positive (18.5%). Of those 10 women, three were identified on bacterial culture and seven on PCR. In the bacterial culture group all the women received antibiotics. In the PCR group 10 women (37%) received antibiotics (P = 0.002). Two false-positive PCR tests were identified. There were no false-negative PCR tests. Real-time identification of GBS on PCR reduces the intrapartum use of antibiotics in women with PROM. © 2017 Japan Society of Obstetrics and Gynecology.
Bioavailability of omega-3 long-chain polyunsaturated fatty acids from foods
DEFF Research Database (Denmark)
Mu, Huiling
2008-01-01
Increasing recognition of the importance of the omega-3 long chain polyunsaturated fatty acids (LCPUFA) has caused greater attention about dietary intake of these fatty acids. Fatty fish is the major dietary source of these fatty acids. Because of the low intake of fish at many places, foods...... enriched with omega-3 LCPUFA can be good alternatives to improve the intake of these fatty acids. Effects of lipid structures and food matrices on bioavailability of omega-3 LCPUFA have been investigated. Short term studies showed that both lipid structure and food matrix affect the bioavailability...... of these fatty acids, whereas diverse results have been reported from long-term studies. Therefore more studies are encouraged to clarify the long-term effects....
Yang, Weizhun; Ramadan, Sherif; Yang, Bo; Yoshida, Keisuke; Huang, Xuefei
2016-12-02
Among many hurdles in synthesizing proteoglycan glycopeptides, one challenge is the incorporation of aspartic acid in the peptide backbone and acid sensitive O-sulfated glycan chains. To overcome this, a new strategy was developed utilizing homoserine as an aspartic acid precursor. The conversion of homoserine to aspartic acid in the glycopeptide was successfully accomplished by late stage oxidation using (2,2,6,6-tetramethyl-piperidin-1-yl)oxyl (TEMPO) and bis(acetoxy)iodobenzene (BAIB). This is the first time that a glycopeptide containing aspartic acid and an O-sulfated glycan was synthesized.
Scaglia, Fernando; Carter, Susan; O'Brien, William E; Lee, Brendan
2004-04-01
Urea cycle disorders (UCDs) are a group of inborn errors of hepatic metabolism caused by the loss of enzymatic activities that mediate the transfer of nitrogen from ammonia to urea. These disorders often result in life-threatening hyperammonemia and hyperglutaminemia. A combination of sodium phenylbutyrate and sodium phenylacetate/benzoate is used in the clinical management of children with urea cycle defects as a glutamine trap, diverting nitrogen from urea synthesis to alternatives routes of excretion. We have observed that patients treated with these compounds have selective branched chain amino acid (BCAA) deficiency despite adequate dietary protein intake. However, the direct effect of alternative therapy on the steady state levels of plasma branched chain amino acids has not been well characterized. We have measured steady state plasma branched chain and other essential non-branched chain amino acids in control subjects, untreated ornithine transcarbamylase deficiency females and treated null activity urea cycle disorder patients in the fed steady state during the course of stable isotope studies. Steady-state leucine levels were noted to be significantly lower in treated urea cycle disorder patients when compared to either untreated ornithine transcarbamylase deficiency females or control subjects (Purea cycle disorder patients. These findings suggest that better titration of protein restriction could be achieved with branched chain amino acid supplementation in patients with UCDs who are on alternative route therapy.
Directory of Open Access Journals (Sweden)
Xu Q
2015-06-01
Full Text Available Qing Xu,1,* Yazhen Zhu,2,* Yali Bai,1 Xiumin Wei,1 Xirun Zheng,2 Mao Mao,1 Guangjuan Zheng21Translational Bioscience and Diagnostics, WuXi AppTec, Shanghai, 2Department of Pathology, Guangdong Provincial Hospital of TCM, Guangzhou University of Chinese Medicine, Guangdong Provincial Academy of Chinese Medical Sciences, Guangzhou, People’s Republic of China*These authors contributed equally to this workBackground: Two types of epidermal growth factor receptor (EGFR mutations in exon 19 and exon 21 (ex19del and L858R are prevalent in lung cancer patients and sensitive to targeted EGFR inhibition. A resistance mutation in exon 20 (T790M has been found to accompany drug treatment when patients relapse. These three mutations are valuable companion diagnostic biomarkers for guiding personalized treatment. Quantitative polymerase chain reaction (qPCR-based methods have been widely used in the clinic by physicians to guide treatment decisions. The aim of this study was to evaluate the technical and clinical sensitivity and specificity of the droplet digital polymerase chain reaction (ddPCR method in detecting the three EGFR mutations in patients with lung cancer.Methods: Genomic DNA from H1975 and PC-9 cells, as well as 92 normal human blood specimens, was used to determine the technical sensitivity and specificity of the ddPCR assays. Genomic DNA of formalin-fixed, paraffin-embedded specimens from 78 Chinese patients with lung adenocarcinoma were assayed using both qPCR and ddPCR.Results: The three ddPCR assays had a limit of detection of 0.02% and a wide dynamic range from 1 to 20,000 copies measurement. The L858R and ex19del assays had a 0% background level in the technical and clinical settings. The T790M assay appeared to have a 0.03% technical background. The ddPCR assays were robust for correct determination of EGFR mutation status in patients, and the dynamic range appeared to be better than qPCR methods. The ddPCR assay for T790M could detect
International Nuclear Information System (INIS)
Cook, H.W.; Spence, M.W.
1987-01-01
Recent research in various biological systems has revived interest in interactions between the (n-6) and (n-3) essential fatty acids. We have utilized cultured glioma cells to show that linolenic acid, 18:3(n-3), is rapidly desaturated and chain elongated; 20:5(n-3) is the major product and accumulates almost exclusively in phospholipids. We examined effects of various (n-6), (n-3), (n-9) and (n-7) fatty acids at 40 microM concentration on desaturation and chain elongation processes using [1- 14 C]18:3(n-3) as substrate. In general, monoenoic fatty acids were without effect. The (n-6) fatty acids (18:2, 18:3, 20:3, 20:4 and 22:4) had little effect on total product formed. There was a shift of labeled product to triacylglycerol, and in phospholipids, slightly enhanced conversion of 20:5 to 22:5 was evident. In contrast, 22:6(n-3) was inhibitory, whereas 20:3(n-3) and 20:5(n-3) had much less effect. At concentrations less than 75 microM, all acids were inhibitory. Most products were esterified to phosphatidylcholine, but phosphatidylethanolamine also contained a major portion of 20:5 and 22:5. We provide a condensed overview of how the (n-6) and (n-3) fatty acids interact to modify relative rates of desaturation and chain elongation, depending on the essential fatty acid precursor. Thus, the balance between these dietary acids can markedly influence enzymes providing crucial membrane components and substrates for biologically active oxygenated derivatives
Mathematical Modeling of the Process for Microbial Production of Branched Chained Amino Acids
Directory of Open Access Journals (Sweden)
Todorov K.
2009-12-01
Full Text Available This article deals with modelling of branched chained amino acids production. One of important branched chained amino acid is L-valine. The aim of the article is synthesis of dynamic unstructured model of fed-batch fermentation process with intensive droppings for L-valine production. The presented approach of the investigation includes the following main procedures: description of the process by generalized stoichiometric equations; preliminary data processing and calculation of specific rates for main kinetic variables; identification of the specific rates takes into account the dissolved oxygen tension; establishment and optimisation of dynamic model of the process; simulation researches. MATLAB is used as a research environment.
Directory of Open Access Journals (Sweden)
Emre Koyuncu
Full Text Available Human cytomegalovirus hijacks host cell metabolism, increasing the flux of carbon from glucose to malonyl-CoA, the committed precursor to fatty acid synthesis and elongation. Inhibition of acetyl-CoA carboxylase blocks the production of progeny virus. To probe further the role of fatty acid metabolism during infection, we performed an siRNA screen to identify host cell metabolic enzymes needed for the production of infectious cytomegalovirus progeny. The screen predicted that multiple long chain acyl-CoA synthetases and fatty acid elongases are needed during infection, and the levels of RNAs encoding several of these enzymes were upregulated by the virus. Roles for acyl-CoA synthetases and elongases during infection were confirmed by using small molecule antagonists. Consistent with a role for these enzymes, mass spectrometry-based fatty acid analysis with ¹³C-labeling revealed that malonyl-CoA is consumed by elongases to produce very long chain fatty acids, generating an approximately 8-fold increase in C26-C34 fatty acid tails in infected cells. The virion envelope was yet further enriched in C26-C34 saturated fatty acids, and elongase inhibitors caused the production of virions with lower levels of these fatty acids and markedly reduced infectivity. These results reveal a dependence of cytomegalovirus on very long chain fatty acid metabolism.
DEFF Research Database (Denmark)
Wang, Yingyao; Xia, Luan; Xu, Xuebing
2012-01-01
Lipase-catalyzed acidolysis of canola oil with caprylic acid was performed to produce structured lipids (SLs) containing medium-chain fatty acid (M) at position sn-1,3 and long-chain fatty acid (L) at the sn-2 position in a solvent-free system. Six commercial lipases from different sources were...
DEFF Research Database (Denmark)
Vistisen, Bodil; Mu, Huiling; Høy, Carl-Erik
2006-01-01
Specific structured triacylglycerols, MLM (M = medium-chain fatty acid, L = long-chain fatty acid), rapidly deliver energy and long-chain fatty acids to the body and are used for longer periods in human enteral feeding. In the present study rats were fed diets of 10 wt% MLM or LLL (L = oleic acid......% and 45%, respectively). However, the recovery of exogenous 18:1 n-9 was higher after a single bolus of MLM compared with a bolus of LLL in rats on the MLM diet (40% and 24%, respectively, P = 0.009). The recovery of lymphatic 18:1 n-9 of the LLL bolus tended to depend on the diet triacylglycerol...... structure and composition (P = 0.07). This study demonstrated that with a diet containing specific structured triacylglycerol, the lymphatic recovery of 18:1 n-9 after a single bolus of fat was dependent on the triacylglycerol structure of the bolus. This indicates that the lymphatic recovery of long...
S Sonnet, Davis; N O'Leary, Monique; A Gutierrez, Mark; M Nguyen, Steven; Mateen, Samiha; Hsu, Yuehmei; P Mitchell, Kylie; J Lopez, Antonio; Vockley, Jerry; K Kennedy, Brian; Ramanathan, Arvind
2016-07-04
Maple Syrup Urine Disease (MSUD) is an inherited disorder caused by the dysfunction in the branched chain keto-acid dehydrogenase (BCKDH) enzyme. This leads to buildup of branched-chain keto-acids (BCKA) and branched-chain amino acids (BCAA) in body fluids (e.g. keto-isocaproic acid from the BCAA leucine), leading to numerous clinical features including a less understood skeletal muscle dysfunction in patients. KIC is an inhibitor of mitochondrial function at disease relevant concentrations. A murine model of intermediate MSUD (iMSUD) shows significant skeletal muscle dysfunction as by judged decreased muscle fiber diameter. MSUD is an orphan disease with a need for novel drug interventions. Here using a 96-well plate (liquid chromatography- mass spectrometry (LC-MS) based drug-screening platform we show that Metformin, a widely used anti-diabetic drug, reduces levels of KIC in patient-derived fibroblasts by 20-50%. This Metformin-mediated effect was conserved in vivo; Metformin-treatment significantly reduced levels of KIC in the muscle (by 69%) and serum (by 56%) isolated from iMSUD mice, and restored levels of mitochondrial metabolites (e.g. AMP and other TCA). The drug also decreased the expression of mitochondrial branched chain amino transferase (BCAT) which produces KIC in skeletal muscle. This suggests that Metformin can restore skeletal muscle homeostasis in MSUD by decreasing mitochondrial KIC production.
Bubble-free on-chip continuous-flow polymerase chain reaction: concept and application.
Wu, Wenming; Kang, Kyung-Tae; Lee, Nae Yoon
2011-06-07
Bubble formation inside a microscale channel is a significant problem in general microfluidic experiments. The problem becomes especially crucial when performing a polymerase chain reaction (PCR) on a chip which is subject to repetitive temperature changes. In this paper, we propose a bubble-free sample injection scheme applicable for continuous-flow PCR inside a glass/PDMS hybrid microfluidic chip, and attempt to provide a theoretical basis concerning bubble formation and elimination. Highly viscous paraffin oil plugs are employed in both the anterior and posterior ends of a sample plug, completely encapsulating the sample and eliminating possible nucleation sites for bubbles. In this way, internal channel pressure is increased, and vaporization of the sample is prevented, suppressing bubble formation. Use of an oil plug in the posterior end of the sample plug aids in maintaining a stable flow of a sample at a constant rate inside a heated microchannel throughout the entire reaction, as compared to using an air plug. By adopting the proposed sample injection scheme, we demonstrate various practical applications. On-chip continuous-flow PCR is performed employing genomic DNA extracted from a clinical single hair root sample, and its D1S80 locus is successfully amplified. Also, chip reusability is assessed using a plasmid vector. A single chip is used up to 10 times repeatedly without being destroyed, maintaining almost equal intensities of the resulting amplicons after each run, ensuring the reliability and reproducibility of the proposed sample injection scheme. In addition, the use of a commercially-available and highly cost-effective hot plate as a potential candidate for the heating source is investigated.
Cavallaro, Nicole Landa; Garry, Jamie; Shi, Xu; Gerszten, Robert E.; Anderson, Ellen J.; Walford, Geoffrey A.
2016-01-01
Background: Elevated fasting levels of branched chain amino acids (BCAAs: valine, isoleucine, leucine) in venous blood are associated with a variety of metabolic impairments, including increased risk of type 2 diabetes (T2D). Fasting BCAA levels are influenced by non-dietary factors. However, it is unknown whether fasting BCAAs can be altered through manipulation of dietary intake alone.Objective: To test whether a specific dietary intervention, using differences in BCAA intake, alters fastin...
Maedi in slaughtered sheep: a pathology and polymerase chain reaction study in southwestern Iran.
Azizi, Shahrzad; Tajbakhsh, Elahe; Fathi, Farzad; Oryan, Ahmad; Momtaz, Hassan; Goodarzi, Mehdi
2012-01-01
Maedi-visna (MV) is an important slow viral disease of sheep leading to a progressive lymphoproliferative disease. It affects multiple organs primarily the lungs, where it causes interstitial pneumonia (maedi). In this study, the lungs of 1,000 sheep carcasses were grossly inspected and those suspected to have maedi were studied at histopathological and molecular levels. A polymerase chain reaction (PCR) technique that amplified a 291-base pair DNA in the long terminal repeat (LTR) sequence of MV provirus was conducted on all the 50 suspected lungs together with 10 normal appearing lungs as controls. Amplicons of the expected size were detected in 11 (n=11/50) suspected sheep, and one of the 10 control sheep. Histopathologic study of the pulmonary lesions of all 11 (n=11/11) positive sheep showed MV lesions, including hyperplasia of the perivascular and peribronchiolar lymphoid cells, interstitial lymphoplasmacytic infiltration and smooth muscle hyperplasia and the histopathologic findings were correlated with PCR results. In contrast, the tissue sections of control animals were almost normal at histopathological level; however, PCR technique demonstrated that one of them was affected by maedi. This study showed that the LTR-PCR had high specificity and sensitivity in diagnosis of this viral infection. This study is the first to evaluate the prevalence of MV virus infection in sheep in Iran.
International Nuclear Information System (INIS)
Tak, Yu Kyung; Kim, Won Young; Kim, Min Jung; Han, Eunyoung; Han, Myun Soo; Kim, Jong Jin; Kim, Wook; Lee, Jong Eun; Song, Joon Myong
2012-01-01
Highlights: ► Genomic DNA quantification were performed using a quantum dot-labeled Alu sequence. ► This probe provided PCR-free determination of human genomic DNA. ► Qdot-labeled Alu probe-hybridized genomic DNAs had a 2.5-femtogram detection limit. ► Qdot-labeled Alu sequence was used to assess DNA samples for human identification. - Abstract: Forensic DNA samples can degrade easily due to exposure to light and moisture at the crime scene. In addition, the amount of DNA acquired at a criminal site is inherently limited. This limited amount of human DNA has to be quantified accurately after the process of DNA extraction. The accurately quantified extracted genomic DNA is then used as a DNA template in polymerase chain reaction (PCR) amplification for short tandem repeat (STR) human identification. Accordingly, highly sensitive and human-specific quantification of forensic DNA samples is an essential issue in forensic study. In this work, a quantum dot (Qdot)-labeled Alu sequence was developed as a probe to simultaneously satisfy both the high sensitivity and human genome selectivity for quantification of forensic DNA samples. This probe provided PCR-free determination of human genomic DNA and had a 2.5-femtogram detection limit due to the strong emission and photostability of the Qdot. The Qdot-labeled Alu sequence has been used successfully to assess 18 different forensic DNA samples for STR human identification.
Directory of Open Access Journals (Sweden)
Zeinab Abiri
2016-02-01
Full Text Available Background: Coxiella burnetii is an important intracellular pathogen that ruminants can act as primary reservoirs. Reservoirs may excrete the bacterium into the placenta, vaginal mucus and feces. Objectives: The aim of this study was to detect C. burnetii in aborted samples from ruminant flocks in Mashhad city, northeast of Iran, using the polymerase chain reaction (PCR assay. Materials and Methods: A total number of 154 fetal tissue samples of cattle, sheep and goat were subjected to nested PCR assay. Results: Sixteen (17.3% out of 92 samples from sheep and 15 (25% from 60 cattle fetuses were positive. Conclusions: The results of this study indicate the presence of C. burnetii in aborted ruminants and these can be the potential reservoirs of C. burnetii in the mentioned area.
The activity state of the branched-chain 2-oxo acid dehydrogenase complex in rat tissues.
Wagenmakers, A J; Schepens, J T; Veldhuizen, J A; Veerkamp, J H
1984-01-01
An assay is described to define the proportion of the branched-chain 2-oxo acid dehydrogenase complex that is present in the active state in rat tissues. Activities are measured in homogenates in two ways: actual activities, present in tissues, by blocking both the kinase and phosphatase of the enzyme complex during homogenization, preincubation, and incubation with 1-14C-labelled branched-chain 2-oxo acid, and total activities by blocking only the kinase during the 5 min preincubation (neces...
Differential Gene Expression of Longan Under Simulated Acid Rain Stress.
Zheng, Shan; Pan, Tengfei; Ma, Cuilan; Qiu, Dongliang
2017-05-01
Differential gene expression profile was studied in Dimocarpus longan Lour. in response to treatments of simulated acid rain with pH 2.5, 3.5, and a control (pH 5.6) using differential display reverse transcription polymerase chain reaction (DDRT-PCR). Results showed that mRNA differential display conditions were optimized to find an expressed sequence tag (EST) related with acid rain stress. The potential encoding products had 80% similarity with a transcription initiation factor IIF of Gossypium raimondii and 81% similarity with a protein product of Theobroma cacao. This fragment is the transcription factor activated by second messenger substances in longan leaves after signal perception of acid rain.
Zhao, Y; Jaskiewicz, J; Harris, R A
1992-01-01
Feeding clofibric acid to rats caused little or no change in total activity of the liver branched-chain 2-oxo acid dehydrogenase complex (BCODC). No change in mass of liver BCODC was detected by immunoblot analysis in response to dietary clofibric acid. No changes in abundance of mRNAs for the BCODC E1 alpha, E1 beta and E2 subunits were detected by Northern-blot analysis. Likewise, dietary clofibric acid had no effect on the activity state of liver BCODC (percentage of enzyme in the dephosphorylated, active, form) of rats fed on a chow diet. However, dietary clofibric acid greatly increased the activity state of liver BCODC of rats fed on a diet deficient in protein. No stable change in liver BCODC kinase activity was found in response to clofibric acid in either chow-fed or low-protein-fed rats. Clofibric acid had a biphasic effect on flux through BCODC in hepatocytes prepared from low-protein-fed rats. Stimulation of BCODC flux at low concentrations was due to clofibric acid inhibition of BCODC kinase, which in turn allowed activation of BCODC by BCODC phosphatase. Inhibition of BCODC flux at high concentrations was due to direct inhibition of BCODC by clofibric acid. The results suggest that the effects of clofibric acid in vivo on branched-chain amino acid metabolism can be explained by the inhibitory effects of this drug on BCODC kinase. Images Fig. 2. Fig. 3. PMID:1637295
Histone Deacetylase Inhibition and Dietary Short-Chain Fatty Acids
Licciardi, Paul V.; Ververis, Katherine; Karagiannis, Tom C.
2011-01-01
Changes in diet can also have dramatic effects on the composition of gut microbiota. Commensal bacteria of the gastrointestinal tract are critical regulators of health and disease by protecting against pathogen encounter whilst also maintaining immune tolerance to certain allergens. Moreover, consumption of fibre and vegetables typical of a non-Western diet generates substantial quantities of short-chain fatty acids (SCFAs) which have potent anti-inflammatory properties. Dietary interventions...
Directory of Open Access Journals (Sweden)
Carroll Bernie
2010-03-01
Full Text Available Abstract Background The purpose of this study was to apply an arbitrarily primed methylation sensitive polymerase chain reaction (PCR assay called Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR to investigate the methylation profiles of somatic and germ cells obtained from Holstein bulls. Methods Genomic DNA was extracted from sperm, leukocytes and fibroblasts obtained from three bulls and digested with a methylation sensitive endonuclease (HpaII. The native genomic and enzyme treated DNA samples were used as templates in an arbitrarily primed-PCR assay with 30 sets of single short oligonucleotide primer. The PCR products were separated on silver stained denaturing polyacrylamide gels. Three types of PCR markers; digestion resistant-, digestion sensitive-, and digestion dependent markers, were analyzed based on the presence/absence polymorphism of the markers between the two templates. Results Approximately 1,000 PCR markers per sample were produced from 27 sets of primer and most of them (>90% were digestion resistant markers. The highest percentage of digestion resistant markers was found in leukocytic DNA (94.8% and the lowest in fibroblastic DNA (92.3%, P ≤ 0.05. Spermatozoa contained a higher number of digestion sensitive markers when compared with the others (3.6% vs. 2.2% and 2.6% in leukocytes and fibroblasts respectively, P ≤ 0.05. Conclusions The powerfulness of the AMP PCR assay was the generation of methylation-associated markers without any prior knowledge of the genomic sequence. The data obtained from different primers provided an overview of genome wide DNA methylation content in different cell types. By using this technique, we found that DNA methylation profile is tissue-specific. Male germ cells were hypomethylated at the HpaII locations when compared with somatic cells, while the chromatin of the well-characterized somatic cells was heavily methylated when compared with that of the versatile somatic
Furutani, Shunsuke; Hagihara, Yoshihisa; Nagai, Hidenori
2017-09-01
Correct labeling of foods is critical for consumers who wish to avoid a specific meat species for religious or cultural reasons. Therefore, gene-based point-of-care food analysis by real-time Polymerase Chain Reaction (PCR) is expected to contribute to the quality control in the food industry. In this study, we perform rapid identification of meat species by our portable rapid real-time PCR system, following a very simple DNA extraction method. Applying these techniques, we correctly identified beef, pork, chicken, rabbit, horse, and mutton in processed foods in 20min. Our system was sensitive enough to detect the interfusion of about 0.1% chicken egg-derived DNA in a processed food sample. Our rapid real-time PCR system is expected to contribute to the quality control in food industries because it can be applied for the identification of meat species, and future applications can expand its functionality to the detection of genetically modified organisms or mutations. Copyright © 2017 Elsevier Ltd. All rights reserved.
Qvarnstrom, Yvonne; Xayavong, Maniphet; da Silva, Ana Cristina Aramburu; Park, Sarah Y; Whelen, A Christian; Calimlim, Precilia S; Sciulli, Rebecca H; Honda, Stacey A A; Higa, Karen; Kitsutani, Paul; Chea, Nora; Heng, Seng; Johnson, Stuart; Graeff-Teixeira, Carlos; Fox, LeAnne M; da Silva, Alexandre J
2016-01-01
Angiostrongylus cantonensis is the most common infectious cause of eosinophilic meningitis. Timely diagnosis of these infections is difficult, partly because reliable laboratory diagnostic methods are unavailable. The aim of this study was to evaluate the usefulness of a real-time polymerase chain reaction (PCR) assay for the detection of A. cantonensis DNA in human cerebrospinal fluid (CSF) specimens. A total of 49 CSF specimens from 33 patients with eosinophilic meningitis were included: A. cantonensis DNA was detected in 32 CSF specimens, from 22 patients. Four patients had intermittently positive and negative real-time PCR results on subsequent samples, indicating that the level of A. cantonensis DNA present in CSF may fluctuate during the course of the illness. Immunodiagnosis and/or supplemental PCR testing supported the real-time PCR findings for 30 patients. On the basis of these observations, this real-time PCR assay can be useful to detect A. cantonensis in the CSF from patients with eosinophilic meningitis. © The American Society of Tropical Medicine and Hygiene.
DEFF Research Database (Denmark)
Green, Tina M; Jensen, Andreas K; Holst, René
2016-01-01
We present a multiplex analysis for genes known to have prognostic value in an attempt to design a clinically useful classification model in patients with diffuse large B-cell lymphoma (DLBCL). Real-time polymerase chain reaction was used to measure transcript levels of 28 relevant genes in 194 de...... models. The best model was validated in data from an online available R-CHOP treated cohort. With progression-free survival (PFS) as primary endpoint, the best performing IPI independent model incorporated the LMO2 and HLADQA1 as well as gene interactions for GCSAMxMIB1, GCSAMxCTGF and FOXP1xPDE4B....... This model assigned 33% of patients (n = 60) to poor outcome with an estimated 3-year PFS of 40% vs. 87% for low risk (n = 61) and intermediate (n = 60) risk groups (P model incorporated LMO2 and BCL2 and assigned 33% of the patients with a 3-year PFS of 35% vs...
Makowska, Joanna; Bagińska, Katarzyna; Liwo, Adam; Chmurzyński, Lech; Scheraga, Harold A
2008-01-01
The purpose of this work was to evaluate the effect of the nature of the ionizable end groups, and the solvent, on their acid-base properties in alanine-based peptides. Hence, the acid-base properties of three alanine-based peptides: Ac-KK-(A)(7)-KK-NH(2) (KAK), Ac-OO-(A)(7)-DD-NH(2) (OAD), Ac-KK-(A)(7)-EE-NH(2) (KAE), where A, D, E, K, and O denote alanine, aspartic acid, glutamic acid, lysine, and ornithine, respectively, were determined in water and in methanol by potentiometry. With the availability of these data, the ability of two theoretical methods to simulate pH-metric titration of those peptides was assessed: (i) the electrostatically driven Monte Carlo method with the ECEPP/3 force field and the Poisson-Boltzmann approach to compute solvation energy (EDMC/PB/pH), and (ii) the molecular dynamics method with the AMBER force field and the Generalized Born model (MD/GB/pH). For OAD and KAE, pK(a1) and pK(a2) correspond to the acidic side chains. For all three compounds in both solvents, the pK(a1) value is remarkably lower than the pK(a) of a compound modeling the respective isolated side chain, which can be explained by the influence of the electrostatic field from positively charged ornithine or lysine side chains. The experimental titration curves are reproduced well by the MD/GB/pH approach, the agreement being better if restraints derived from NMR measurements are incorporated in the conformational search. Poorer agreement is achieved by the EDMC/PB/pH method.
Parasuram, Ramya; Coulther, Timothy A; Hollander, Judith M; Keston-Smith, Elise; Ondrechen, Mary Jo; Beuning, Penny J
2018-02-20
The process of DNA replication is carried out with high efficiency and accuracy by DNA polymerases. The replicative polymerase in E. coli is DNA Pol III, which is a complex of 10 different subunits that coordinates simultaneous replication on the leading and lagging strands. The 1160-residue Pol III alpha subunit is responsible for the polymerase activity and copies DNA accurately, making one error per 10 5 nucleotide incorporations. The goal of this research is to determine the residues that contribute to the activity of the polymerase subunit. Homology modeling and the computational methods of THEMATICS and POOL were used to predict functionally important amino acid residues through their computed chemical properties. Site-directed mutagenesis and biochemical assays were used to validate these predictions. Primer extension, steady-state single-nucleotide incorporation kinetics, and thermal denaturation assays were performed to understand the contribution of these residues to the function of the polymerase. This work shows that the top 15 residues predicted by POOL, a set that includes the three previously known catalytic aspartate residues, seven remote residues, plus five previously unexplored first-layer residues, are important for function. Six previously unidentified residues, R362, D405, K553, Y686, E688, and H760, are each essential to Pol III activity; three additional residues, Y340, R390, and K758, play important roles in activity.
DEFF Research Database (Denmark)
Thage, B.V.; Rattray, F.P.; Laustsen, M.W.
2004-01-01
Purification and characterization of an aminotransferase (AT) specific for the degradation of branched-chain amino acids from Lactobacillus paracasei subsp. paracasei CHCC 2115. Methods and Results: The purification protocol consisted of anion exchange chromatography, affinity chromatography...... of other metal ions, thiol- and carbonyl-binding agents. The N-terminal sequence of the enzyme was SVNIDWNNLGFDYMQLPYRYVAHXKDGVXD, and had at the amino acid level, 60 and 53% identity to a branched-chain amino acid AT of Lact. plantarum and Lactococcus lactis, respectively. Conclusions: The results suggest...
From labdanes to drimanes. Degradation of the side chain of dihydrozamoranic acid.
Rodilla, Jesús M L; Díez, D; Urones, J G; Rocha, Pedro M
2004-04-30
A new route for the degradation of the saturated side chain of dihydrozamoranic acid has been devised, giving an advanced intermediate, compound 14, useful for the synthesis of insect antifeedants such as warburganal and polygodial.
Das, P; Pandey, P; Harishankar, A; Chandy, M; Bhattacharya, S; Chakrabarti, A
2017-01-01
Standardization of Aspergillus polymerase chain reaction (PCR) poses two technical challenges (a) standardization of DNA extraction, (b) optimization of PCR against various medically important Aspergillus species. Many cases of aspergillosis go undiagnosed because of relative insensitivity of conventional diagnostic methods such as microscopy, culture or antigen detection. The present study is an attempt to standardize real-time PCR assay for rapid sensitive and specific detection of Aspergillus DNA in EDTA whole blood. Three nucleic acid extraction protocols were compared and a two-step real-time PCR assay was developed and validated following the recommendations of the European Aspergillus PCR Initiative in our setup. In the first PCR step (pan-Aspergillus PCR), the target was 28S rDNA gene, whereas in the second step, species specific PCR the targets were beta-tubulin (for Aspergillus fumigatus, Aspergillus flavus, Aspergillus terreus), gene and calmodulin gene (for Aspergillus niger). Species specific identification of four medically important Aspergillus species, namely, A. fumigatus, A. flavus, A. niger and A. terreus were achieved by this PCR. Specificity of the PCR was tested against 34 different DNA source including bacteria, virus, yeast, other Aspergillus sp., other fungal species and for human DNA and had no false-positive reactions. The analytical sensitivity of the PCR was found to be 102 CFU/ml. The present protocol of two-step real-time PCR assays for genus- and species-specific identification for commonly isolated species in whole blood for diagnosis of invasive Aspergillus infections offers a rapid, sensitive and specific assay option and requires clinical validation at multiple centers.
Alvarez, J; Mar, J; Varela-Ledo, E; Garea, M; Matinez-Lamas, L; Rodriguez, J; Regueiro, B
2012-11-01
Antibiotic treatment for septic shock is generally prescribed on an empirical basis using broad-spectrum antibiotics. Molecular diagnostic techniques can detect the presence of microbial DNA in blood within a few hours and facilitate early, targeted treatment. The aim of this study was to evaluate the economic impact of a real-time polymerase chain reaction technique, LightCycler SeptiFast (LSC), in patients with sepsis. A cost-minimisation study was carried out in patients admitted with a diagnosis of severe sepsis or septic shock to the intensive care unit of a university hospital. The stay in the intensive care unit, hospital admission, 28-day and six-month mortality, and the economic cost of the clinical process were also evaluated. The study involved 48 patients in the LSC group and 54 patients in the control group. The total cost was €42,198 in the control group versus €32,228 in the LCS group with statistically significant differences (P average net saving of €9970 per patient. The mortality rate was similar in both groups. The main finding of this study was the significant economic saving afforded by the use of the LCS technique, due to the shortening of intensive care unit stay and the use of fewer antibiotics.
Nested polymerase chain reaction (PCR) targeting 16S rDNA for bacterial identification in empyema.
Prasad, Rajniti; Kumari, Chhaya; Das, B K; Nath, Gopal
2014-05-01
Empyema in children causes significant morbidity and mortality. However, identification of organisms is a major concern. To detect bacterial pathogens in pus specimens of children with empyema by 16S rDNA nested polymerase chain reaction (PCR) and correlate it with culture and sensitivity. Sixty-six children admitted to the paediatric ward with a diagnosis of empyema were enrolled prospectively. Aspirated pus was subjected to cytochemical examination, culture and sensitivity, and nested PCR targeting 16S rDNA using a universal eubacterial primer. Mean (SD) age was 5·8 (1·8) years (range 1-13). Analysis of aspirated pus demonstrated total leucocyte count >1000×10(6)/L, elevated protein (≧20 g/L) and decreased glucose (≤2·2 mmol/L) in 80·3%, 98·5% and 100%, respectively. Gram-positive cocci were detected in 29 (43·9%) and Gram-negative bacilli in two patients. Nested PCR for the presence of bacterial pathogens was positive in 50·0%, compared with 36·3% for culture. 16S rDNA PCR improves rates of detection of bacteria in pleural fluid, and can detect bacterial species in a single assay as well as identifying unusual and unexpected causal agents.
Branched-chain amino acid supplementation and the immune response of long-distance athletes.
Bassit, Reinaldo A; Sawada, Letícia A; Bacurau, Reury F P; Navarro, Franciso; Martins, Eivor; Santos, Ronaldo V T; Caperuto, Erico C; Rogeri, Patrícia; Costa Rosa, Luís F B P
2002-05-01
Intense long-duration exercise has been associated with immunosuppression, which affects natural killer cells, lymphokine-activated killer cells, and lymphocytes. The mechanisms involved, however, are not fully determined and seem to be multifactorial, including endocrine changes and alteration of plasma glutamine concentration. Therefore, we evaluated the effect of branched-chain amino acid supplementation on the immune response of triathletes and long-distance runners. Peripheral blood was collected prior to and immediately after an Olympic Triathlon or a 30k run. Lymphocyte proliferation, cytokine production by cultured cells, and plasma glutamine were measured. After the exercise bout, athletes from the placebo group presented a decreased plasma glutamine concentration that was abolished by branched-chain amino acid supplementation and an increased proliferative response in their peripheral blood mononuclear cells. Those cells also produced, after exercise, less tumor necrosis factor, interleukins-1 and -4, and interferon and 48% more interleukin-2. Supplementation stimulated the production of interleukin-2 and interferon after exercise and a more pronounced decrease in the production of interleukin-4, indicating a diversion toward a Th1 type immune response. Our results indicate that branched-chain amino acid (BCAA) supplementation recovers the ability of peripheral blood mononuclear cells proliferate in response to mitogens after a long distance intense exercise, as well as plasma glutamine concentration. The amino acids also modify the pattern of cytokine production leading to a diversion of the immune response toward a Th1 type of immune response.
Huang, Tengfang; Jander, Georg
2017-10-01
Whereas proline accumulates through de novo biosynthesis in plants subjected to osmotic stress, leucine, isoleucine, and valine accumulation in drought-stressed Arabidopsis thaliana is caused by abscisic acid-regulated protein degradation. In response to several kinds of abiotic stress, plants greatly increase their accumulation of free amino acids. Although stress-induced proline increases have been studied the most extensively, the fold-increase of other amino acids, in particular branched-chain amino acids (BCAAs; leucine, isoleucine, and valine), is often higher than that of proline. In Arabidopsis thaliana (Arabidopsis), BCAAs accumulate in response to drought, salt, mannitol, polyethylene glycol, herbicide treatment, and nitrogen starvation. Plants that are deficient in abscisic acid signaling accumulate lower amounts of BCAAs, but not proline and most other amino acids. Previous bioinformatic studies had suggested that amino acid synthesis, rather than protein degradation, is responsible for the observed BCAA increase in osmotically stressed Arabidopsis. However, whereas treatment with the protease inhibitor MG132 decreased drought-induced BCAA accumulation, inhibition of BCAA biosynthesis with the acetolactate synthase inhibitors chlorsulfuron and imazapyr did not. Additionally, overexpression of BRANCHED-CHAIN AMINO ACID TRANSFERASE2 (BCAT2), which is upregulated in response to osmotic stress and functions in BCAA degradation, decreased drought-induced BCAA accumulation. Together, these results demonstrate that BCAA accumulation in osmotically stressed Arabidopsis is primarily the result of protein degradation. After relief of the osmotic stress, BCAA homeostasis is restored over time by amino acid degradation involving BCAT2. Thus, drought-induced BCAA accumulation is different from that of proline, which is accumulated due to de novo synthesis in an abscisic acid-independent manner and remains elevated for a more prolonged period of time after removal of
Directory of Open Access Journals (Sweden)
Fábio Takenori Higa
2013-04-01
Full Text Available We evaluated the use of a newly described sodC-based real-time-polymerase chain reaction (RT-PCR assay for detecting Neisseria meningitidis in normally sterile sites, such as cerebrospinal fluid and serum. The sodC-based RT-PCR assay has an advantage over ctrA for detecting nongroupable N. meningitidis isolates, which are commonly present in asymptomatic pharyngeal carriage. However, in our study, sodC-based RT-PCR was 7.5% less sensitive than ctrA. Given the public health impact of possible false-negative results due to the use of the sodC target gene alone, sodC-based RT-PCR for the diagnosis of meningococcal meningitis should be used with caution.
Grabska, Justyna; Beć, Krzysztof B; Ishigaki, Mika; Wójcik, Marek J; Ozaki, Yukihiro
2017-10-05
Quantum chemical reproduction of entire NIR spectra is a new trend, enabled by contemporary advances in the anharmonic approaches. At the same time, recent increase of the importance of NIR spectroscopy of biological samples raises high demand for gaining deeper understanding of NIR spectra of biomolecules, i.e. fatty acids. In this work we investigate saturated and unsaturated medium-chain fatty acids, hexanoic acid and sorbic acid, in the near-infrared region. By employing fully anharmonic density functional theory (DFT) calculations we reproduce the experimental NIR spectra of these systems, including the highly specific spectral features corresponding to the dimerization of fatty acids. Broad range of concentration levels from 5·10 -4 M in CCl 4 to pure samples are investigated. The major role of cyclic dimers can be evidenced for the vast majority of these samples. A highly specific NIR feature of fatty acids, the elevation of spectral baseline around 6500-4000cm -1 , is being explained by the contributions of combination bands resulting from the vibrations of hydrogen-bonded OH groups in the cyclic dimers. Based on the high agreement between the calculated and experimental NIR spectra, a detailed NIR band assignments are proposed for hexanoic acid and sorbic acid. Subsequently, the correlations between the structure and NIR spectra are elucidated, emphasizing the regions in which clear and universal traces of specific bands corresponding to saturated and unsaturated alkyl chains can be established, thus demonstrating the wavenumber regions highly valuable for structural identifications. Copyright © 2017 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Lee, Ai Cheng; Dai, Ziyu; Chen, Baowei; Wu, Hong; Wang, Jun; Zhang, Aiguo; Zhang, Lurong; Lim, Tit-Meng; Lin, Yuehe
2008-12-01
We describe a novel electrochemical branched-DNA (bDNA) assay for polymerase chain reaction (PCR)-free detection and quantification of p185 BCR-ABL leukemia fusion transcript in the population of messenger RNA (mRNA) extracted from cell lines. The bDNA amplifier carrying high loading of alkaline phosphatase (ALP) tracers was used to amplify targets signal. The targets were captured on microplate well surfaces through cooperative sandwich hybridization prior to the labeling of bDNA. The activity of captured ALP was monitored by square-wave voltammetric (SWV) analysis of the electroactive enzymatic product in the presence of 1-napthyl-phosphate. The specificity and sensitivity of assay enabled direct detection of target transcript in as little as 4.6 ng mRNA without PCR amplification. In combination with the use of a well-quantified standard, the electrochemical bDNA assay was capable of direct use for a PCR-free quantitative analysis of target transcript in total mRNA population. The approach thus provides a simple, sensitive, accurate and quantitative tool alternate to the RQ-PCR for early disease diagnosis.
Directory of Open Access Journals (Sweden)
Azzedine Bounamous
2014-07-01
Full Text Available A total of 131 phlebotomine Algerian sandflies have been processed in the present study. They belong to the species Phlebotomus bergeroti, Phlebotomus alexandri, Phlebotomus sergenti, Phlebotomus chabaudi, Phlebotomus riouxi, Phlebotomus perniciosus, Phlebotomus longicuspis, Phlebotomus perfiliewi, Phlebotomus ariasi, Phlebotomus chadlii, Sergentomyia fallax, Sergentomyia minuta, Sergentomyia antennata, Sergentomyia schwetzi, Sergentomyia clydei, Sergentomyia christophersi and Grassomyia dreyfussi. They have been characterised by sequencing of a part of the cytochrome b (cyt b, t RNA serine and NADH1 on the one hand and of the cytochrome C oxidase I of the mitochondrial DNA (mtDNA on the other hand. Our study highlights two sympatric populations within P. sergenti in the area of its type-locality and new haplotypes of P. perniciosus and P. longicuspis without recording the specimens called lcx previously found in North Africa. We tried to use a polymerase chain reaction-restriction fragment length polymorphism method based on a combined double digestion of each marker. These method is not interesting to identify sandflies all over the Mediterranean Basin.
Abdeldaim, Guma M K; Strålin, Kristoffer; Kirsebom, Leif A; Olcén, Per; Blomberg, Jonas; Herrmann, Björn
2009-08-01
A quantitative real-time polymerase chain reaction (PCR) based on the omp P6 gene was developed to detect Haemophilus influenzae. Its specificity was determined by analysis of 29 strains of 11 different Haemophilus spp. and was compared with PCR assays having other target genes: rnpB, 16S rRNA, and bexA. The method was evaluated on nasopharyngeal aspirates from 166 adult patients with community-acquired pneumonia. When 10(4) DNA copies/mL was used as cutoff limit for the method, P6 PCR had a sensitivity of 97.5% and a specificity of 96.0% compared with the culture. Of 20 culture-negative but P6 PCR-positive cases, 18 were confirmed by fucK PCR as H. influenzae. Five (5.9%) of 84 nasopharyngeal aspirates from adult controls tested PCR positive. We conclude that the P6 real-time PCR is both sensitive and specific for identification of H. influenzae in respiratory secretions. Quantification facilitates discrimination between disease-causing H. influenzae strains and commensal colonization.
Abdeldaim, Guma M K; Strålin, Kristoffer; Olcén, Per; Blomberg, Jonas; Mölling, Paula; Herrmann, Björn
2013-06-01
A quantitative polymerase chain reaction (PCR) for the fucK gene was developed for specific detection of Haemophilus influenzae. The method was tested on sputum and nasopharyngeal aspirate (NPA) from 78 patients with community-acquired pneumonia (CAP). With a reference standard of sputum culture and/or serology against the patient's own nasopharyngeal isolate, H. influenzae etiology was detected in 20 patients. Compared with the reference standard, fucK PCR (using the detection limit 10(5) DNA copies/mL) on sputum and NPA showed a sensitivity of 95.0% (19/20) in both cases, and specificities of 87.9% (51/58) and 89.5% (52/58), respectively. In a receiver operating characteristic curve analysis, sputum fucK PCR was found to be significantly superior to sputum P6 PCR for detection of H. influenzae CAP. NPA fucK PCR was positive in 3 of 54 adult controls without respiratory symptoms. In conclusion, quantitative fucK real-time PCR provides a sensitive and specific identification of H. influenzae in respiratory secretions. Copyright © 2013 Elsevier Inc. All rights reserved.
Johnson, Jennifer A; Wright, Michael E; Sheperd, Lyndsay A; Musher, Daniel M; Dang, Bich N
2015-01-01
The role at admission of nasal polymerase chain reaction (PCR) for patients with methicillin-resistant Staphylococcus aureus (MRSA) in guiding antibiotic therapy for lower respiratory tract infection is unknown. To determine whether nasal MRSA PCR at admission can predict the absence of MRSA in lower respiratory tract secretions. We performed a retrospective study of adult patients admitted to a large urban hospital. Patients had a nasal MRSA PCR test and a lower respiratory tract culture obtained within 48 hours of admission and the culture yielded S aureus. Sensitivity, specificity, and positive and negative predictive values. Our results showed high sensitivity (93.3%) and negative predictive value (95.2%) of nasal PCR for MRSA in the lower respiratory tract. With its high sensitivity and negative predictive value, a nasal MRSA PCR test performed within 48 hours of hospital admission could help guide the discontinuation of MRSA-directed empiric antibiotic therapy in patients who are unlikely to be infected with this organism. A prospective study is needed to confirm these findings.
Rigouin, Coraline; Gueroult, Marc; Croux, Christian; Dubois, Gwendoline; Borsenberger, Vinciane; Barbe, Sophie; Marty, Alain; Daboussi, Fayza; André, Isabelle; Bordes, Florence
2017-10-20
Yarrowia lipolytica is a promising organism for the production of lipids of biotechnological interest and particularly for biofuel. In this study, we engineered the key enzyme involved in lipid biosynthesis, the giant multifunctional fatty acid synthase (FAS), to shorten chain length of the synthesized fatty acids. Taking as starting point that the ketoacyl synthase (KS) domain of Yarrowia lipolytica FAS is directly involved in chain length specificity, we used molecular modeling to investigate molecular recognition of palmitic acid (C16 fatty acid) by the KS. This enabled to point out the key role of an isoleucine residue, I1220, from the fatty acid binding site, which could be targeted by mutagenesis. To address this challenge, TALEN (transcription activator-like effector nucleases)-based genome editing technology was applied for the first time to Yarrowia lipolytica and proved to be very efficient for inducing targeted genome modifications. Among the generated FAS mutants, those having a bulky aromatic amino acid residue in place of the native isoleucine at position 1220 led to a significant increase of myristic acid (C14) production compared to parental wild-type KS. Particularly, the best performing mutant, I1220W, accumulates C14 at a level of 11.6% total fatty acids. Overall, this work illustrates how a combination of molecular modeling and genome-editing technology can offer novel opportunities to rationally engineer complex systems for synthetic biology.
Xie, Liji; Xie, Zhixun; Huang, Li; Wang, Sheng; Huang, Jiaoling; Zhang, Yanfang; Zeng, Tingting; Luo, Sisi
2017-11-01
Sequence analysis of duck plague virus (DPV) revealed that there was a 528bp (B fragment) deletion within the UL2 gene of DPV attenuated vaccine strain in comparison with field virulent strains. The finding of gene deletion provides a potential differentiation test between DPV virulent strain and attenuated strain based on their UL2 gene sizes. Thus we developed a polymerase chain reaction (PCR) assay targeting to the DPV UL2 gene for simultaneous detection of DPV virulent strain and attenuated strain, 827bp for virulent strain and 299bp for attenuated strain. This newly developed PCR for DPV was highly sensitive and specific. It detected as low as 100fg of DNA on both DPV virulent and attenuated strains, no same size bands were amplified from other duck viruses including duck paramyxovirus, duck tembusu virus, duck circovirus, Muscovy duck parvovirus, duck hepatitis virus type I, avian influenza virus and gosling plague virus. Therefore, this PCR assay can be used for the rapid, sensitive and specific detection of DPV virulent and attenuated strains affecting ducks. Copyright © 2017. Published by Elsevier B.V.
Carrera, E; García, T; Céspedes, A; González, I; Sanz, B; Hernández, P E; Martín, R
1998-04-01
Restriction site analysis of polymerase chain reaction (PCR) products from a conserved region of the cytochrome b gene has been used for the identification of fresh and smoked samples of Atlantic salmon (Salmo salar) and rainbow trout (Oncorhynchus mykiss). Digestion of the 359-bp PCR product with the endonucleases EcoRV and TaqI yielded specific banding patterns for salmon and trout. This genetic marker can be very useful for detecting fraudulent substitution of the cheaper smoked trout for the more expensive smoked salmon.
Influence of the chain length on the biological behaviour of 131I fatty acids
International Nuclear Information System (INIS)
Riche, F.; Mathieu, J.P.; Comet, M.; Vidal, M.; Pernin, C.; Marti-Batlle, D.; Busquet, G.; Bardy, A.
1983-01-01
Saturated and acetylenic fatty acids labeled with 131 I in ω position, differing by their chain length (C8 to C20) and the number odd or even of their carbon atoms are injected in mice. The evolution of the activity in myocardium, blood, liver and kidney is measured until 10 minutes after injection. The myocardial activity increases with chain length from C8 to C16 then decreases for C18 and C20. The odd or even number of carbon atoms does not influence myocardial activity but in the liver, activity is inferior with the odd fatty acids. The presence of a triple bond accelerates the output of activity from the myocardium and these fatty acids are not well suited for the study of myocardial metabolism [fr
DEFF Research Database (Denmark)
Hansen, K K; Vestbo, Jørgen; Benfield, T
1997-01-01
Bronchoalveolar lavage (BAL) fluids and serum samples from 153 patients with pulmonary symptoms who were infected with human immunodeficiency virus (HIV) and underwent BAL were examined for the presence of cytomegalovirus (CMV) by conventional culture and by polymerase chain reaction (PCR...... technique than conventional culture. Detection of CMV DNA in BAL fluid or serum predicted subsequent development of extrapulmonary CMV disease but not death for HIV-infected patients with pulmonary symptoms....
Stelzer, Erin A.; Strickler, Kriston M.; Schill, William B.
2012-01-01
During summer and early fall 2010, 15 river samples and 6 fecal-source samples were collected in West Virginia. These samples were analyzed by three laboratories for three microbial source tracking (MST) markers: AllBac, a general fecal indicator; BacHum, a human-associated fecal indicator; and BoBac, a ruminant-associated fecal indicator. MST markers were analyzed by means of the quantitative polymerase chain reaction (qPCR) method. The aim was to assess interlaboratory precision when the three laboratories used the same MST marker and shared deoxyribonucleic acid (DNA) extracts of the samples, but different equipment, reagents, and analyst experience levels. The term assay refers to both the markers and the procedure differences listed above. Interlaboratory precision was best for all three MST assays when using the geometric mean absolute relative percent difference (ARPD) and Friedman's statistical test as a measure of interlaboratory precision. Adjustment factors (one for each MST assay) were calculated using results from fecal-source samples analyzed by all three laboratories and applied retrospectively to sample concentrations to account for differences in qPCR results among labs using different standards and procedures. Following the application of adjustment factors to qPCR results, ARPDs were lower; however, statistically significant differences between labs were still observed for the BacHum and BoBac assays. This was a small study and two of the MST assays had 52 percent of samples with concentrations at or below the limit of accurate quantification; hence, more testing could be done to determine if the adjustment factors would work better if the majority of sample concentrations were above the quantification limit.
Negishi, Osamu; Negishi, Yukiko
2017-09-01
Enzyme catalyzing the cleavage of the phenylpropanoid side chain was partially purified by ion exchange and gel filtration column chromatography after (NH 4 ) 2 SO 4 precipitation. Enzyme activities were dependent on the concentration of dithiothreitol (DTT) or glutathione (GSH) and activated by addition of 0.5 mM Fe 2+ . Enzyme activity for ferulic acid was as high as for 4-coumaric acid in the presence of GSH, suggesting that GSH acts as an endogenous reductant in vanillin biosynthesis. Analyses of the enzymatic reaction products with quantitative NMR (qNMR) indicated that an amount of glyoxylic acid (GA) proportional to vanillin was released from ferulic acid by the enzymatic reaction. These results suggest that phenylpropanoid 2,3-dioxygenase is involved in the cleavage of the ferulic acid side chain to form vanillin and GA in Vanilla planifolia.
Bouwstra, Hylco
2007-01-01
Long-chain metabolites of the parent essential fatty acids called long-chain polyunsaturated fatty acids (LCPUFAs) are major membrane components in the central nervous system. Dictary intake partly determines the availability of LCPUFAs as building btocks for neuronal structures. Fifty till sixty
Multiplex polymerase chain reaction test for the diagnosis of acute viral hepatitis A.
Heo, Nae-Yun; Lim, Young-Suk; An, Jihyun; Ko, Sun-Young; Oh, Heung-Bum
2012-12-01
The early diagnosis of acute hepatitis A (AHA) is hindered because serum IgM against hepatitis A virus (HAV) can yield false-negative results during the window period. This study evaluated the diagnostic accuracy of a polymerase chain reaction (PCR) kit for HAV RNA for the diagnosis of AHA. Samples were collected from 136 patients with acute severe hepatitis at their admission to Asan Medical Center between June 2010 and July 2010. Samples were analyzed for serum IgM anti-HAV using an immunoassay test and for qualitative HAV RNA using the Magicplex HepaTrio PCR test kit. The diagnostic accuracies of these methods were tested on the basis of clinical and laboratory diagnoses of AHA. The concordance rate and kappa value between IgM anti-HAV and HAV RNA PCR were 88.2% and 0.707, respectively. For the diagnosis of AHA, the sensitivity and specificity of IgM anti-HAV were 90.7% and 100%, respectively, when an "equivocal" result was regarded as positive; and 79.1% and 100%, respectively, when an "equivocal" result was regarded as negative. The sensitivity and specificity of HAV RNA PCR were 81.4% and 100%, respectively. All four patients with negative IgM anti-HAV and positive HAV RNA PCR results and all four patients with equivocal IgM anti-HAV RNA and positive HAV RNA PCR results were eventually diagnosed with AHA. The qualitative HAV RNA PCR test has an equivalent diagnostic accuracy for AHA compared to IgM anti-HAV and may be more sensitive during the window period.
Barrier properties of lipid bilayers composed of lecithins with odd chain fatty acids
Salvati, S.; Serlupi-Crescenzi, G.; Gier, J. de
Lecithins with fatty acid chain length of 17 carbon atoms and different degrees of unsaturation were synthesized. The thermotropic behaviour and barrier function of derived liposomal bilayers were studied.
From Labdanes to Drimanes. Degradation of the Side Chain of Dihydrozamoranic Acid.
Directory of Open Access Journals (Sweden)
Pedro M. Rocha
2004-04-01
Full Text Available A new route for the degradation of the saturated side chain of dihydrozamoranic acid has been devised, giving an advanced intermediate, compound 14, useful for the synthesis of insect antifeedants such as warburganal and polygodial.