Eigenvalue distributions for a class of covariance matrices with application to Bienenstock-Cooper-Munro neurons under noisy conditions.

Science.gov (United States)

Bazzani, Armando; Castellani, Gastone C; Cooper, Leon N

2010-05-01

We analyze the effects of noise correlations in the input to, or among, Bienenstock-Cooper-Munro neurons using the Wigner semicircular law to construct random, positive-definite symmetric correlation matrices and compute their eigenvalue distributions. In the finite dimensional case, we compare our analytic results with numerical simulations and show the effects of correlations on the lifetimes of synaptic strengths in various visual environments. These correlations can be due either to correlations in the noise from the input lateral geniculate nucleus neurons, or correlations in the variability of lateral connections in a network of neurons. In particular, we find that for fixed dimensionality, a large noise variance can give rise to long lifetimes of synaptic strengths. This may be of physiological significance.

Assessment of Skin Pathological Responses in the Yellowfin Seabream (Acanthopagrus latus under the Aeromonas hydrophila Exposure

Directory of Open Access Journals (Sweden)

Fatemeh Azadbakht

2018-01-01

Full Text Available Background: Bacterial diseases in cultured fish are considered the main problem to aquaculture system. Skin is the structure that covers the body in fish. Skin histopatological alterations were used to assess the effects of Aeromonas hydrophila exposure on the yellowfin seabream Acanthopagrus latus(. Methods: In this regard, 90 A. latus were exposed to sublethal concentrations of A. hydrophila (103,106 CFU/ml for 3 weeks. Results: Some more severe alternations found in the skin of fish exposed. The most frequent histopathological changes detected in the skin including hyperplasia of epidermis, hypertrophy and hyperplasia of the mucosal cells and dermis edema. Some more severe alternations found in the skin of fish exposed to higher level of A. hydrophila (106 CFU/ml included telangiectasia of dermis layer. In addition, according to the results of histometrical studies in treated fish compared to control group showed that thickness of epidermis and dermis layers were increased significantly (P<0.05. Conclusion: A. hydrophila can cause major histophatological changes in the skin of A. latus. In addition, histopathological changes of the skin provide helpful information about the environmental conditions and as particular biomarkers may provide imminent into evaluating the general health and stress status of fish.

The Munroe-Meyer Approach: Continuous Integration of Didactic Instruction, Research, and Clinical Practice.

Science.gov (United States)

Zangrillo, Amanda N; Warzak, William J; Volkert, Valerie M; Valleley, Rachel J; Shriver, Mark D; Rodriguez, Nicole M; Roberts, Holly J; Piazza, Cathleen C; Peterson, Kathryn M; Milnes, Suzanne M; Menousek, Kathryn M; Mathews, Terri L; Luczynski, Kevin C; Kupzyk, Sara S; Kuhn, Brett R; Higgins, William J; Grennan, Allison O; Greer, Brian D; Fisher, Wayne W; Evans, Joseph H; Allen, Keith D

2016-05-01

Increased demand for applied behavior analysis (ABA) services has increased the need for additional masters-level practitioners and doctoral-level academicians and clinical directors. Based on these needs, the University of Nebraska Medical Center's (UNMC) Munroe-Meyer Institute has developed a PhD program. The academic structure at UNMC allowed us to create our PhD program in a relatively quick and efficient manner. Our PhD program has many unique features, including (a) close integration of didactic instruction with clinical and research training provided by leading experts in ABA in which students immediately apply concepts introduced in the classroom during coordinated clinical and research practica; (b) structured grant writing training in which students learn to write and submit an NIH-level grant; (c) financial support in the form of a stipend of $23,400 per year, free health benefits, and a full-tuition waiver for up to 12 credits per semester for UNMC courses (a benefits package worth approximately $50,000 per year for an out-of-state student); and (d) encouragement and financial support to present papers at local, regional, and national behavior analysis conferences.

Effect of Phenanthrene on the Tissue Structure of Liver and Aminotransferase Enzymes in Yellowfin Seabream (Acanthopagrus latus

Directory of Open Access Journals (Sweden)

Mehrnaz Shirmohammadi*

2017-06-01

Full Text Available Background: Polycyclic aromatic hydrocarbons (PAHs such as phenanthrene (Phe represent one of the most abundant forms of organic pollutants. The aim of this study was to assess changes in plasma levels of aminotransferase enzymes, total protein and liver tissue as biomarkers of yellowfin seabream (Acanthopagrus latus exposed to Phe for 14 d. Methods: The research was carried out in January 2016 at Khorramshahr University of Marine Sciences and Technology, Khorramshahr, Iran. Some 72 fish were injected with 2, 20, 40 and 70 mg/kg of Phe. Then tissue and blood samples were obtained at 1, 4, 7 and 14 d after injection. Results: Exposure of fish to Phe resulted in a significant increase of alanine aminotransferase (ALT, aspartate aminotransferase (AST and decrease of total protein after 7 d of the experiment (P<0.05. The main histopathological alteration was showed in different sampling days including nucleus margination, hypertrophy, vacuolation, melanomacrophages aggregates, sinusoid dilation, degeneration and picnotic nucleus. Degree of tissue change (DTC of liver was recorded in the Phe-exposed fish from normal range to moderate changes. Conclusion: The studied biomarkers such as changes in concentrations of ALT, AST and total protein as well as tissue damages in liver may be served as beneficial biomarker to assess Phe toxicity in yellowfin seabream.

Gastrointestinal uptake of cadmium and zinc by a marine teleost Acanthopagrus schlegeli

International Nuclear Information System (INIS)

Zhang Li; Wang Wenxiong

2007-01-01

Gastrointestinal metal uptake represents a potential route for metal bioaccumulation in marine fish. Drinking of seawater for osmoregulation causes constant waterborne exposure of the gastrointestinal tract. Tissue specific Cd and Zn accumulation and distribution were investigated in juvenile black sea bream (Acanthopagrus schlegeli) exposed to waterborne Cd (5.7 nM) and Zn (2.6 nM) for 4 h-7 days. The intestine accumulated a large portion of the Cd (43-58%) and Zn (18-28%), and had the highest Cd (>1.0 nmol g -1 ) and Zn (>1.8 nmol g -1 ) concentrations of all body fractions, suggesting that the intestines were the major uptake sites for these waterborne metals. Among all the segments of the gastrointestinal tract, the anterior intestine played the most important role in Cd and Zn uptake. A gastrointestinal injection assay was conducted to distinguish waterborne metal uptake by the intestines and the gills. The intestine contained over 90% of the Cd in the body after depuration for 3-7 days, suggesting that little waterborne Cd entered the rest of the body through the intestine, and that Cd may exert its toxic effects on the gastrointestinal system. In contrast, intestine retained less than 20% of the total Zn after depuration, suggesting that Zn tended to be transported from the intestine to the internal tissues via the cardiovascular system. The uptake kinetics of waterborne Cd and Zn by the intestines and the gills were determined as a first-order and saturated pattern, respectively, over a wide range of ambient metal concentrations (6.2 nM-4.5 μM for Cd, and 13 nM-15 μM for Zn). An in vitro intestinal perfusion assay investigated the effects of intestinal metal composition and drinking rate on uptake. The presence of EDTA significantly reduced intestinal Zn uptake to 11%, while cysteine improved it by 59%. The intestinal Cd and Zn uptake rates were unaffected by the perfusion rate

Growth and physiological responses of two phenotypically distinct accessions of centipedegrass (Eremochloa ophiuroides (Munro) Hack.) to salt stress.

Science.gov (United States)

Li, JianJian; Ma, Jingjing; Guo, Hailin; Zong, Junqin; Chen, Jingbo; Wang, Yi; Li, Dandan; Li, Ling; Wang, Jingjing; Liu, Jianxiu

2018-05-01

Salinity is one of the major abiotic environmental stress factors affecting plant growth and development. Centipedegrass (Eremochloa ophiuroides [Munro)] Hack.) is an important warm-season turfgrass species with low turf maintenance requirements, but is sensitive to salinity stress. To explore salt tolerant germplasms in centipedegrass and better understand the growth and physiological responses of centipedegrass to salinity, we conducted anatomic observation and phytochemical quantification, examined growth parameters, and investigated photosynthetic machinery and antioxidant system in two phenotypically distinct centipedegrass accessions under NaCl salt stress. The morphophenotypical difference of the stems in the two accessions mainly depends on whether or not a thickened epidermal horny layer with purple colour was formed, which was caused by anthocyanin accumulation in the tissue. Successive salinity treatment was found to result in an inhibition of leaf growth, a marked decrease in photosynthesis, chlorophyll contents, and the maximal photochemical efficiency of PSII (Fv/Fm). Under the same treatment, purple-stem accession (E092) showed a lower degree of inhibition or decrease than green-stem one (E092-1). With the exception of malondialdehyde level, both proline content and antioxidant enzymes were upregulated to a greater extent in E092 following exposure to salinity condition. Meanwhile, significant enhancements of anthocyanin accumulation and total protein synthesis were detected in E092 after salt treatment, but not in E092-1. These results demonstrated that E092 favor better accumulation of anthocyanins under salinity condition, which contribute to salt tolerance by adjusting physiological functions and osmotic balance, and better maintenance of high turf quality. Hence, genetic phenotype can be utilized as a key indicator in E. ophiuroides breeding for salt-tolerance. Copyright © 2018. Published by Elsevier Masson SAS.

Acanthopagrus schlegeli

Indian Academy of Sciences (India)

The conditions for amplification were 5 min at 95. ◦. C, fol- lowed by 30 cycles of ... This work was supported by the National Natural Science Foun- dation of China (NSFC) ... Sadovy Y. and Cornish A. S. 2000 Reef fishes of Hong Kong. Hong.

Differential changes in production measures for an estuarine-resident sparid in deep and shallow waters following increases in hypoxia

Science.gov (United States)

Cottingham, Alan; Hall, Norman G.; Hesp, S. Alex; Potter, Ian C.

2018-03-01

This study determined how productivity measures for a fish species in different water depths of an estuary changed in response to the increase in hypoxia in deep waters, which had previously been shown to occur between 1993-95 and 2007-11. Annual data on length and age compositions, body mass, growth, abundance, biomass, production and production to biomass ratio (P/B) were thus determined for the estuarine-resident Acanthopagrus butcheri in nearshore shallow (compositions imply that the increase in hypoxia was accompanied by the distribution of the majority of the older and larger A. butcheri changing from deep to shallow waters, where the small fish typically reside. Annual densities, biomass and production in shallow waters of fish m-2, 2-4 g m-2 and ∼2 g m-2 y-1 in the earlier period were far lower than the 0.1-0.2 fish m-2, 8-15 g m-2 and 5-10 g m-2 y-1 in the later period, whereas the reverse trend occurred in deep waters, with values of 6-9 fish net-1, 2000-3900 g net-1, 900-1700 g net-1 y-1 in the earlier period vs fish net-1, ∼110 g net-1 and 27-45 g net-1 y-1 in the later period. Within the later period, and in contrast to the trends with annual abundance and biomass, the production in shallow waters was least during 2008/09, rather than greatest, reflecting the slow growth in that particularly cool year. The presence of substantial aggregations of both small and large fish in shallow waters accounts for the abundance, biomass and production in those waters increasing between those periods and thus, through a density-dependent effect, provide a basis for the overall reduction in growth. In marked contrast to the trends with the other three production measures, annual production to biomass ratios (P/B) in shallow waters in the two years in the earlier period, and in three of the four years of the later period, fell within the same range, i.e. 0.6-0.9 y-1, but was only 0.2 y-1 in 2008/09, reflecting the poor growth in that year. This emphasises the need

An investigation of the quality of meat sold in Lesotho

Directory of Open Access Journals (Sweden)

T.M. Seeiso

2009-05-01

Full Text Available Since the closure of the Lesotho abattoir in 2003, only imported meat can be legally sold. However, it was estimated in 2007 that 80 % of the meat sold at butcheries comes from informal slaughter. The aim of this study was to investigate the situation. The number and location of informal butcheries in Lesotho (n = 143 were recorded and mapped using Geographical Information Systems. Observations (photographs of informal slaughter indicated a lack of hygiene, unskilled slaughtermen and illegal disposal of offal with possible environmental pollution. In addition, a cross-sectional study was undertaken to determine the microbiological quality of meat from randomly selected carcasses (n = 237 of cattle, sheep and pigs from a sample of 44 butcheries, 4 of which were associated with registered supermarkets. As a control, samples for microbiological assay were taken from imported meat originating from carcasses (n = 20 slaughtered at a registered abattoir in South Africa. Of the 44 butcheries investigated only the 4 commercial butcheries associated with supermarkets sold imported meat only; 3 butcheries sold meat inspected at government slaughter slabs (n = 3, while the rest (n = 37 sold both imported and informally slaughtered meat. In terms of Lesotho legislation, informally slaughtered meat is only for home consumption. The bacteriological counts from all samples showed a total bacterial plate count exceeding 30 organisms per mℓ in contrast with the controls which all showed a count less than 5 colonies per mℓ. This was found for both imported and informally slaughtered meat sold in Lesotho. In addition, meat samples from butcheries showed the presence of the potential pathogens Salmonella (n = 2, Staphylococcus aureus (n = 12 and Escherichia coli (n=15. During the study, anthrax was confirmed in 9 human patients, 5 of whom died, after consumption of informally slaughtered livestock. Although no cases of animal abuse were detected, it was

Effect of gamma irradiation on the pigments and the biological activities of methanolic extracts from leaves of centipedegrass (Eremochloa ophiuroides Munro)

International Nuclear Information System (INIS)

Lee, Eun Mi; Lee, Seung Sik; Bai, Hyoung-Woo; Cho, Jae-Young; Kim, Tae Hoon; Chung, Byung Yeoup

2013-01-01

Extracts from centipedegrass (Eremochloa ophiuroides Munro) have been previously identified as having beneficial effects medically and cosmetically. In this study, the effects of gamma irradiation on pigment removal and biological activities of centipedegrass extracts to promote industrial application were investigated. The methanolic extracts were exposed to gamma irradiation at dose ranging from 2 to 20 kGy. The major pigments of centipedegrass extracts, cyanidin-3-O-glucoside and cyanidin-3-O-(6″-malonyl-)glucoside, were found to be effectively removed by gamma irradiation above 10 kGy. Although the reddish-orange color of the cyanidins was markedly decreased by gamma irradiation, the biological activities were relatively unaffected. The biological activities such as 2, 2-diphenyl-1-picrylhydrazyl (DPPH) radical-scavenging activity, inhibition of tyrosinase activity, and inhibition of elastase activity in methanolic extracts were modulated from 50.5% to 70.2%, from 50.9% to 65.8% and from 65.6% to 94.0%, respectively. Surprisingly, the biological activities have the highest activities after 6–8 kGy of gamma irradiation. These results indicate that despite pigment degradation, biological activities were maintained or increased by gamma irradiation. Based on these results, gamma irradiation may be a useful tool to remove the undesirable reddish-orange color present in centipedegrass without any loss of biological activities, thereby promoting its utility in industrial applications such as manufacturing of cosmetic products. - Highlights: • The pigments of centipedegrass extracts were decreased by gamma irradiation. • The contents of maysin and its derivatives were slightly changed by gamma irradiation. • The biological activities of centipedegrass extracts were retained or increased by gamma irradiation

Dietary DHA/EPA ratio affected tissue fatty acid profiles, antioxidant capacity, hematological characteristics and expression of lipid-related genes but not growth in juvenile black seabream (Acanthopagrus schlegelii).

Science.gov (United States)

Jin, Min; Monroig, Óscar; Lu, You; Yuan, Ye; Li, Yi; Ding, Liyun; Tocher, Douglas R; Zhou, Qicun

2017-01-01

An 8-week feeding trial was conducted to investigate the effects of dietary docosahexaenoic to eicosapentaenoic acid ratio (DHA/EPA) on growth performance, fatty acid profiles, antioxidant capacity, hematological characteristics and expression of some lipid metabolism related genes of juvenile black seabream (Acanthopagrus schlegelii) of initial weight 9.47 ± 0.03 g. Five isonitrogenous and isolipidic diets (45% crude protein and 14% crude lipid) were formulated to contain graded DHA/EPA ratios of 0.65, 1.16, 1.60, 2.03 and 2.67. There were no differences in growth performance and feed utilization among treatments. Fish fed higher DHA/EPA ratios had higher malondialdehyde (MDA) contents in serum than lower ratios. Serum triacylglycerol (TAG) content was significantly higher in fish fed the lowest DHA/EPA ratio. Tissue fatty acid profiles reflected the diets despite down-regulation of LC-PUFA biosynthesis genes, fatty acyl desaturase 2 (fads2) and elongase of very long-chain fatty acids 5 (elovl5), by high DHA/EPA ratios. Expression of acetyl-CoA carboxylase alpha (accα) and carnitine palmitoyl transferase 1A (cpt1a) were up-regulated by high DHA/EPA ratio, whereas sterol regulatory element-binding protein-1 (srebp-1) and hormone-sensitive lipase (hsl) were down-regulated. Fatty acid synthase (fas), 6-phosphogluconate dehydrogenase (6pgd) and peroxisome proliferator-activated receptor alpha (pparα) showed highest expression in fish fed intermediate (1.16) DHA/EPA ratio. Overall, this study indicated that dietary DHA/EPA ratio affected fatty acid profiles and significantly influenced lipid metabolism including LC-PUFA biosynthesis and other anabolic and catabolic pathways, and also had impacts on antioxidant capacity and hematological characteristics.

Biomarker responses and PAH ratios in fish inhabiting an estuarine urban waterway.

Science.gov (United States)

Duarte, Rafael Mendonça; Sadauskas-Henrique, Helen; de Almeida-Val, Vera Maria Fonseca; Val, Adalberto Luis; Nice, Helen Elizabeth; Gagnon, Marthe Monique

2017-10-01

Many cities worldwide are established adjacent to estuaries and their catchments resulting in estuarine contamination due to intense anthropogenic activities. The aim of this study was to evaluate if fish living in an estuarine urban waterway were affected by contamination, via the measurement of a suite of biomarkers of fish health. Black bream (Acanthopagrus butcheri) were sampled in a small urban embayment and a suite of biomarkers of fish health measured. These were condition factor (CF), liver somatic index (LSI), gonadosomatic index (GSI), hepatic EROD activity, polycyclic aromatic hydrocarbon (PAH) biliary metabolites, serum sorbitol dehydrogenase (s-SDH) and branchial enzymes cytochrome C oxidase (CCO), and lactate dehydrogenase (LDH) activities. The biomarkers of exposure EROD activity, and pyrene- and B(a)P-type biliary metabolites confirmed current or recent exposure of the fish and that fish were metabolizing contaminants. Relative to a reference site, LSI was higher in fish collected in the urban inlet as was the metabolic enzyme LDH activity. CF, GSI, s-SDH, CCO, and naphthalene-type metabolites were at similar levels in the urban inlet relative to the reference site. PAH biliary metabolite ratios of high-molecular-weight to low-molecular-weight suggest that fish from the urban inlet were exposed to pyrogenic PAHs, likely from legacy contamination and road runoff entering the embayment. Similarly, the sediment PAH ratios and the freshness indices suggested legacy contamination of a pyrogenic source, likely originating from the adjacent historic gasworks site and a degree of contamination of petrogenic nature entering the inlet via storm water discharge. Biomarkers of exposure and effect confirmed that black bream collected in the Claisebrook Cove inlet, Western Australia, are currently exposed to contamination and are experiencing metabolic perturbations not observed in fish collected at a nearby reference site. © 2017 Wiley Periodicals, Inc.

Southern African Business Review - Vol 19, No 2 (2015)

African Journals Online (AJOL)

Theatre Strategies to Develop Emotional Intelligence Skills in Business Communication: An Exploratory Study · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. M Munro, A Munro, K Lemmer, M Pretorius, 1-26 ...

A Typology of Maritally Violent Men and Correlates of Violence in a Community Sample.

Science.gov (United States)

Delsol, Catherine; Margolin, Gyala; John, Richard S.

2003-01-01

Tests A. Holtzworth-Munroe and G. L. Stuart's (1994) typology of male batterers in a community sample. Analyses based on severity of physical aggression, generality of violence, and psychopathology partially replicated the Holtzworth-Munroe and Stuart typology by identifying 3 types of violent men: family-only, medium-violence, and generally…

New evidence for hominin carcass processing strategies at 1.5 Ma, Koobi Fora, Kenya.

Science.gov (United States)

Pobiner, Briana L; Rogers, Michael J; Monahan, Christopher M; Harris, John W K

2008-07-01

Reconstruction of early Pleistocene hominin carcass acquisition and processing behaviors are necessarily based at least in part on butchered fossil bones. This paper provides zooarchaeological and taphonomic analyses and behavioral interpretations of three approximately 1.5 million-year-old archaeofaunas from areas 1A and 103 in the Okote Member of the Koobi Fora Formation, northern Kenya: FwJj14A, FwJj14B, and GaJi14. These sites are all located in similar paleoenvironmental contexts, near shallow water with swampy, seasonally flooded areas, and some evidence for more wooded or gallery forest settings. Both individual specimen--and assemblage-level analyses of butchery-marked bones indicate that the hominins appear to have practiced similar butchery strategies at all of these sites, with butchery (defleshing, disarticulation, and marrow extraction) of both high- and low-ranked skeletal elements with no apparent preference for prey size, skeletal region, limb class, or limb portion. Only four tooth-marked specimens, including one likely crocodile-tooth-marked bone, are preserved in all three archaeofaunas. A paucity of limb epiphyses suggests that bone-crunching hyenids may have deleted these portions subsequent to hominin butchery. Strangely, there are no stone tools preserved with the 292 cut-marked and 27 percussion-marked faunal specimens (out of a total of 6,039 specimens), suggesting that raw material availability may have conditioned hominin lithic discard patterns at these locales. These assemblages increase our knowledge of the dietary behavior and ecology of Homo erectus, and provide support for variability in early Pleistocene hominin carcass foraging patterns.

Fish diets in a freshwater-deprived semiarid estuary (The Coorong, Australia) as inferred by stable isotope analysis

Science.gov (United States)

Lamontagne, S.; Deegan, B. M.; Aldridge, K. T.; Brookes, J. D.; Geddes, M. C.

2016-09-01

In 2007, high rates of water extraction combined with a regional drought stopped freshwater discharge to the Coorong, a ∼120 km estuarine and coastal lagoon system at the outlet of the River Murray (Australia). The sources of organic matter sustaining the Coorong food web in the absence of river-borne organic matter and nutrient inputs were evaluated by measuring δ13C, δ15N and δ34S in large-bodied fish and their prey. In general, the δ34S of the food web (mean = 11.3‰; range = 4.32-18.9‰) suggested a comparable contribution from autochthonous pelagic (∼21‰) and benthic (<5‰) primary production. A relatively high δ13C in all organisms (-20 to -9.2‰) was also consistent with a dominant contribution from autochtonous sources to the food web. A Bayesian mixing model framework (SIMMR) was used to estimate the diet of large-bodied fish for statistically-determined prey groups based on their similarity in isotopic composition. Argyrosomus japonicus preyed primarily on Fish Group 1 (small pelagic fish like galaxiids and Hyperlophus vittatus), Rhombosolea tapirina on Invertebrate Group 2 (polychaetes like Capitella spp.) but Acanthopagrus butcheri fed on a wide variety of fish and invertebrate groups. A partial switch in diet to other prey groups suggested larger Ar. japonicus fed on larger prey, such as crabs and adult Aldrichetta forsteri. Despite being numerically abundant at the time, Fish Group 2 (benthic species) was a relatively low proportion of large-bodied fish diets. This probably reflected the tendency of some salt-tolerant members of this group (such as Atherinosoma microstoma) to prefer hypersaline habitats, which the large-bodied fish avoided. As the heavily preyed-on Fish Group 1 included species with a marine component to their life-cycle, marine productivity may also help to maintain this estuarine ecosystem in the absence of river-borne organic matter inputs.

Transgenic Centipedegrass (Eremochloa ophiuroides [Munro] Hack. Overexpressing S-Adenosylmethionine Decarboxylase (SAMDC Gene for Improved Cold Tolerance Through Involvement of H2O2 and NO Signaling

Directory of Open Access Journals (Sweden)

Jianhao Luo

2017-09-01

Full Text Available Centipedegrass (Eremochloa ophiuroides [Munro] Hack. is an important warm-season turfgrass species. Transgenic centipedgrass plants overexpressing S-adenosylmethionine decarboxylase from bermudagrass (CdSAMDC1 that was induced in response to cold were generated in this study. Higher levels of CdSAMDC1 transcript and sperimidine (Spd and spermin (Spm concentrations and enhanced freezing and chilling tolerance were observed in transgenic plants as compared with the wild type (WT. Transgenic plants had higher levels of polyamine oxidase (PAO activity and H2O2 than WT, which were blocked by pretreatment with methylglyoxal bis (guanylhydrazone or MGBG, inhibitor of SAMDC, indicating that the increased PAO and H2O2 were a result of expression of CdSAMDC1. In addition, transgenic plants had higher levels of nitrate reductase (NR activity and nitric oxide (NO concentration. The increased NR activity were blocked by pretreatment with MGBG and ascorbic acid (AsA, scavenger of H2O2, while the increased NO level was blocked by MGBG, AsA, and inhibitors of NR, indicating that the enhanced NR-derived NO was dependent upon H2O2, as a result of expression CdSAMDC1. Elevated superoxide dismutase (SOD and catalase (CAT activities were observed in transgenic plants than in WT, which were blocked by pretreatment with MGBG, AsA, inhibitors of NR and scavenger of NO, indicating that the increased activities of SOD and CAT depends on expression of CdSAMDC1, H2O2, and NR-derived NO. Our results suggest that the elevated cold tolerance was associated with PAO catalyzed production of H2O2, which in turn led to NR-derived NO production and induced antioxidant enzyme activities in transgenic plants.

Transgenic Centipedegrass (Eremochloa ophiuroides [Munro] Hack.) Overexpressing S-Adenosylmethionine Decarboxylase (SAMDC) Gene for Improved Cold Tolerance Through Involvement of H2O2 and NO Signaling.

Science.gov (United States)

Luo, Jianhao; Liu, Mingxi; Zhang, Chendong; Zhang, Peipei; Chen, Jingjing; Guo, Zhenfei; Lu, Shaoyun

2017-01-01

Centipedegrass ( Eremochloa ophiuroides [Munro] Hack.) is an important warm-season turfgrass species. Transgenic centipedgrass plants overexpressing S-adenosylmethionine decarboxylase from bermudagrass ( CdSAMDC1 ) that was induced in response to cold were generated in this study. Higher levels of CdSAMDC1 transcript and sperimidine (Spd) and spermin (Spm) concentrations and enhanced freezing and chilling tolerance were observed in transgenic plants as compared with the wild type (WT). Transgenic plants had higher levels of polyamine oxidase (PAO) activity and H 2 O 2 than WT, which were blocked by pretreatment with methylglyoxal bis (guanylhydrazone) or MGBG, inhibitor of SAMDC, indicating that the increased PAO and H 2 O 2 were a result of expression of CdSAMDC1 . In addition, transgenic plants had higher levels of nitrate reductase (NR) activity and nitric oxide (NO) concentration. The increased NR activity were blocked by pretreatment with MGBG and ascorbic acid (AsA), scavenger of H 2 O 2 , while the increased NO level was blocked by MGBG, AsA, and inhibitors of NR, indicating that the enhanced NR-derived NO was dependent upon H 2 O 2 , as a result of expression CdSAMDC1 . Elevated superoxide dismutase (SOD) and catalase (CAT) activities were observed in transgenic plants than in WT, which were blocked by pretreatment with MGBG, AsA, inhibitors of NR and scavenger of NO, indicating that the increased activities of SOD and CAT depends on expression of CdSAMDC1 , H 2 O 2 , and NR-derived NO. Our results suggest that the elevated cold tolerance was associated with PAO catalyzed production of H 2 O 2 , which in turn led to NR-derived NO production and induced antioxidant enzyme activities in transgenic plants.

VacA and cagA genotypes of Helicobacter pylori isolated from raw meat in Isfahan province, Iran.

Science.gov (United States)

Gilani, Ali; Razavilar, Vadood; Rokni, Nordahr; Rahimi, Ebrahim

2017-01-01

Foods with animal origins play a substantial role in the transmission of Helicobacter pylori . The present investigation was carried out to study the vacA and cagA genotypes status of H. pylori isolated from various types of meat samples. Two hundred and twenty meat samples were collected and cultured. H. pylori -positive strains were analyzed for the presence of vacA and cagA genotypes. Eleven out of 220 (5.00%) samples were positive for H. pylori . Findings were confirmed by nested PCR. Prevalence of H. pylori in the meat samples of slaughterhouses and butcheries were 72.20% and 27.70%, respectively. The most commonly detected genotypes in the meat samples of slaughterhouses and butcheries were vacA m1a (66.66%) and vacA s1a (37.50%), respectively. The S1am1a was the most commonly detected genotype. Meat sampled from butcheries had the higher prevalence of H. pylori and its genotypes than those of slaughterhouses ( p meat samples could be the potential sources of virulent strains of H. pylori . Application of sanitary measures in the storage, transportation and sale of meat is essential for reducing the levels of H. pylori cross contamination.

Fate of Malathion in an Activated Sludge Municipal Wastewater Treatment System

Science.gov (United States)

2013-03-01

abdominal cramps, diarrhea, muscle fasciculation or weakness, and increased salivation , lacrimation, urination, and perspiration (Casarett, Doull...has a hydrolysis half-life of 1,000 hours at pH 7, and an extremely low volatility of 10.5 mg/m3 (Sidell, 1997; Munro et al., 1999). In comparison...soman 4 has the next lowest hydrolysis half-life of 60 hrs at pH 6, respectively (Munro et al., 1999). Tabun has the second lowest volatility of

Is quality assurance in higher education contextually relative ...

African Journals Online (AJOL)

It does this by raising questions such as whether quality in higher education is the same as, for example, quality of clothing or the quality of meat in local butcheries. The article questions ... AJOL African Journals Online. HOW TO USE AJOL.

Re-Os systematics of komatiites and komatiitic basalts at Dundonald Beach, Ontario, Canada: Evidence for a complex alteration history and implications of a late-Archean chondritic mantle source

Science.gov (United States)

Gangopadhyay, Amitava; Sproule, Rebecca A.; Walker, Richard J.; Lesher, C. Michael

2005-11-01

Osmium isotopic compositions, and Re and Os concentrations have been examined in one komatiite unit and two komatiitic basalt units at Dundonald Beach, part of the 2.7 Ga Kidd-Munro volcanic assemblage in the Abitibi greenstone belt, Ontario, Canada. The komatiitic rocks in this locality record at least three episodes of alteration of Re-Os elemental and isotope systematics. First, an average of 40% and as much as 75% Re may have been lost due to shallow degassing during eruption and/or hydrothermal leaching during or immediately after emplacement. Second, the Re-Os isotope systematics of whole rock samples with 187Re/ 188Os ratios >1 were reset at ˜2.5 Ga, possibly due to a regional metamorphic event. Third, there is evidence for relatively recent gain and loss of Re in some rocks. Despite the open-system behavior, some aspects of the Re-Os systematics of these rocks can be deciphered. The bulk distribution coefficient for Os (D Ossolid/liquid) for the Dundonald rocks is ˜3 ± 1 and is well within the estimated D values obtained for komatiites from the nearby Alexo area and stratigraphically-equivalent komatiites from Munro Township. This suggests that Os was moderately compatible during crystal-liquid fractionation of the magmas parental to the Kidd-Munro komatiitic rocks. Whole-rock samples and chromite separates with low 187Re/ 188Os ratios (Gorgona Island, arc-related rocks and present-day ocean island basalts. This suggests that the Kidd-Munro komatiites sampled a late-Archean mantle source region that was significantly more homogeneous with respect to Re/Os relative to most modern mantle-derived rocks.

Low Noise PAV Ducted Propeller using Automotive Manufacturing, Phase II

Data.gov (United States)

National Aeronautics and Space Administration — Munro & Assoc. and MISATS (MU&M) recognize the explosive market pull for low cost airplanes, i.e. PAV, that provide affordable, comfortable and safe...

The Stock Concept Applicability for the Economic Evaluation of Marine Ecosystem Exploitation

DEFF Research Database (Denmark)

Ravn-Jonsen, Lars

Stock models, in which production is interpreted as if it were the population growth of a stock, have been the preferred tool for fishery economics since Clark and Munro (1975) introduced capital theory in these models. Ravn-Jonsen (2009) applied capital theory to a model in which the production ...... of a stock. The concept of a stock is rather an illusion, as is the concept of an optimal stock level. It is essential to liberate fishery economics from a simplified view of population and communities.......Stock models, in which production is interpreted as if it were the population growth of a stock, have been the preferred tool for fishery economics since Clark and Munro (1975) introduced capital theory in these models. Ravn-Jonsen (2009) applied capital theory to a model in which the production...

A notable Ichthyological find in the Kruger National Park

Directory of Open Access Journals (Sweden)

U de V. Pienaar

1971-05-01

Full Text Available A notable ichthyological find has been made in the Kruger National Park with the recording, during April 1970, of a specimen of the marine fish, Acanthopagrus berda Forskal near the confluence of the Crocodile and Komati Rivers. This is the first record of the River or Mud Bream within the fresh water river system of the Transvaal and also the furthest point inland that this fish has been collected.

China Report, Economic Affairs, No. 381

Science.gov (United States)

1983-09-13

taxes must be levied on the purchase and sales of livestock. Livestock butchery taxes must be imposed on livestock butchers . The regulations also...20 yuan is taxable and any sales below 20 yuan is exempt from taxation. Fire- wood, grass, poultry , eggs, vegetables, melons, fruits, and potatoes...aquatic products, poultry , fresh eggs, beef cattle, mutton sheep, frontier marketed tea, vegetables, cotton, cotton for wadding, silkworm cocoons

Spawning of riverbream, Acanthopagrus berda, in Kosi estuary

African Journals Online (AJOL)

1992-01-23

Jan 23, 1992 ... Sexed fish were tagged in an effort to produce evidence of protandrous sex change in this species. It is ... behaviour and the reproductive strategy of protandrous .... The successful artificial fertilization of A. berda eggs, and.

A Challenge to Classical Facial Proportionality Studies: Conventional Profile and 3d Photography Versus Silhouettes

Science.gov (United States)

2012-04-01

possible that his theory of Divine Proportions apply to societies’ views of attractiveness thirty years later? Drs. Pancherz, Knapp, Erbe, and Heiss...Hreczko TA, Kolar JC, Munro IR. Vertical and Horizontal Proportions of the Face in Young Adult North American Caucasians: Revision of Neoclassical

Speeches and Presentations on Day 1: Opening and Introductory ...

International Development Research Centre (IDRC) Digital Library (Canada)

4 nov. 2010 ... Pr. Dieudonné OUEDRAOGO, Director of ISSP Centre d'Excellence de l'UEMOA and Regional Coordinator of PARSEP;; M. Lauchlan MUNRO, Vice-president, Corporate Strategy and Regional Management, IDRC ;; M. Jules SAVARIA, Ambassador to the Embassy of Canada in Ouagadougou (Burkina ...

The taphonomy of a Middle Devensian (MIS 3) vertebrate assemblage from Lynford, Norfolk, UK, and its implications for Middle Palaeolithic subsistence strategies

Science.gov (United States)

Schreve, Danielle C.

2006-07-01

The association of a rich lithic assemblage with a Middle Devensian mammalian assemblage at Lynford was initially thought indicative of a mammoth butchery locality, a rare occurrence for a European Middle Palaeolithic open site. However, taphonomic analyses suggest that the specimens have very different depositional histories and were incorporated into a palaeochannel in several stages. Most specimens are extremely fragmentary, probably the result of extensive trampling, and signs of weathering and root-damage provide further indications of exposure before burial. Carnivore damage is minimal but establishing the degree of interaction between the mammal fauna and alternative predators, such as Neanderthals, is problematic. Direct evidence of butchery is not present and the best indication of any form of mammoth exploitation lies in more circumstantial evidence such as the virtual absence of long bones from the main channel deposit and the mammoth age profiles. Instances of pathologies are also unusually common in the mammoths, implying that their greater vulnerability may have led to an accelerated demise either naturally or at the hands of a predator. The best evidence for direct faunal exploitation at the site is from green bone fractures and broken teeth that suggest marrow extraction in horse, reindeer and woolly rhinoceros. Copyright

Taiwan: America’s Next War?

Science.gov (United States)

1998-04-08

7. 29 Megatrends China, Beijing: Hauling Publishing House, May 1996, as cited in Richard Bernstein and Ross H. Munro, The Coming Conflict with...other economic interests in Asia  To prevent, deter and reduce the threat of nuclear, biological , and chemical (NBC) attacks on the U.S. and its

L. Munro 2011-2012 Travel & Hospitality English.xlsx

International Development Research Centre (IDRC) Digital Library (Canada)

acray

Quarter 3. October 19. Manchester, UK. Meetings and Lectures. 10,062.48. 2,960.98. 267.50. 13,290.96. November 17 to December 12 New Delhi, India and Harare, Zimbabwe Conference and Regional Office Visit. Quarter 4. February 10. Washington DC, USA. Memorial Service. March 2. Ottawa, Canada. Meeting.

Overcoming dormancy and enhancing germination of Sphaeralcea munroana seeds

Science.gov (United States)

Olga A. Kildisheva; R. Kasten Dumroese; Anthony S. Davis

2011-01-01

The results of a series of experiments involving a variety of dormancy-breaking treatments indicate that Munro's globemallow [Sphaeralcea munroana (Douglas) Spach] seeds are physically dormant, possess a cap-like structure in the occlusion of the water gap, which inhibits imbibition, and can be artificially dislodged through boiling water scarification. The...

Pisces : Perciformes, Ambassidae

African Journals Online (AJOL)

1985-05-28

May 28, 1985 ... Munro 1967; Allen 1982). During the course of a study of the biology of the .... predorsal scales 13-16; preorbital bone with exposed, posteriorly directed ... Figure 1 Head of Ambassidae showing ridges and edges of bones where spines of taxonomic importance occur (after Fraser-. Brunner, 1956). Table 2 ...

Loss to follow-up in a community clinic in South Africa – roles of ...

African Journals Online (AJOL)

B Wang, E Losina, R Stark, A Munro, RP Walensky, M Wilke, D Martin, Z Lu, KA Freedberg, R Wood ... Patients initiating ART between April 2004 and October 2006 in one South African Catholic Bishops' Conference HIV treatment clinic who had at least one follow-up visit were included and routinely monitored every 6 ...

Preoperative Use of lntranasal Ketorolac Tromethamine (Sprix) in Periodontal Flap Surgery

Science.gov (United States)

2015-06-01

generalized chronic or aggressive periodontitis . Patients requiring periodontal flap surgery would receive one of the following procedures...Corps United States Navy A thesis submitted to the Faculty of the Periodontics Graduate Program Naval Postgraduate Dental School Uniformed...ervisor Thu P. Getka, DDS, MS CAPT, DC, USN . Chairman, Periodontics Department Glenri\\. Munro, DDS, MBA CAPT, DC, USN Dean, Naval Postgraduate

Succinct Representations of Binary Trees for Range Minimum Queries

DEFF Research Database (Denmark)

Davoodi, Pooya; Raman, Rajeev; Satti, Srinivasa

2012-01-01

is a modification of the representation of Farzan and Munro (SWAT 2008); a consequence of this result is that we can represent the Cartesian tree of a random permutation in 1.92n + o(n) bits in expectation. The second one uses a well-known transformation between binary trees and ordinal trees, and ordinal tree...

Ameerika bestsellerid jäid auhindadest ilma / Neeme Raud

Index Scriptorium Estoniae

Raud, Neeme, 1969-

1999-01-01

Ameerika Raamatukriitikute Ühenduse (National Book Critic Circle) aastapreemiad 1998: ilukirjandus - Alice Munro novellikogu "The love of a good woman"; tõsielukirjandus - Philip Gourevitchi raamat "We wish to inform you that tomorrow we will be killed with our families" (Rwanda 1994. a. massimõrvadest); biograafiad - Sylvia Nasari "A beautiful mind" geniaalsest matemaatikust John Forbes Nashist ; luule - Marie Ponsot' "Bird catcher".

Control of Disease Recurrence by Tumor-Infiltrating T Cells in Ovarian Cancer

Science.gov (United States)

2011-03-01

size of at least 1 million clonotypes René L. Warren,1 J. Douglas Freeman,1 Thomas Zeng,1 Gina Choe,1 Sarah Munro,1 Richard Moore,1 John R. Webb,2 and...gene therapy. Hum. Gene Ther. 20, 1106. Van Camp, K., Cools, N., Stein, B., Van de Velde, A., Goossens , H., Berneman, Z. N., Van Tendeloo, V., 2010

ANAEROBIC DIGESTION MODEL ANALYSIS OF THE FERMENTATION PROCESS IN PSYCHROPHILIC AND MESOPHILIC CHAMBER IN ACCORDANCE WITH THE AMOUNT OF BIOGAS SOURCED

Directory of Open Access Journals (Sweden)

Dariusz Zdebik

2015-03-01

Full Text Available The paper presents problems concerning the modelling of anaerobic sludge stabilization, with the additional substrate (waste transported, dairy butchery sewage in psychrophilic fermentation conditions in the range 10–20 °C and mesophilic at 35 °C. Simulation test was conducted in the two digesters. Results of the study allowed to evaluate the effectiveness of conducting these processes in separate chambers, i.e. the psychrophilic and mesophilic chamber. During the simulations, terms of obtaining volatile fatty acids and biogas in conjunction with the operating conditions of the chambers indicated.

Etude de la composition de la carcasse de taurillons Ankole en fonction de l'âge ou poids vif et de l'embouche de courte durée

Directory of Open Access Journals (Sweden)

Pozy, P.

1985-01-01

Full Text Available Study of carcass composition of Ankole bulls according to weight or age and to duration of fattening period. Thirty two young bulls divided into 2 categories of live weight were used to study the effect of the initial weight and of an intensive fattening period on the composition of the carcass. The slaughterings were carried out in Bujumbura, according to the techniques usually done for the carving of the carcass. A short period of intensive fattening does not improve the composition of the carcass into pieces of great value in butchery.

Depth and degree of melting of komatiites

Science.gov (United States)

Herzberg, Claude

1992-04-01

High pressure melting experiments have permitted new constraints to be placed on the depth and degree of partial melting of komatiites. Komatiites from Gorgona Island were formed by relatively low degrees of pseudoinvariant melting involving L + Ol + Opx + Cpx + Gt on the solidus at 40 kbar, about 130 km depth. Munro-type komatiites were separated from a harzburgite residue (L + Ol + Opx) at pressures that were poorly constrained, but were probably around 50 kbar, about 165 km depth; the degree of partial melting was less than 40 percent. Secular variations in the geochemistry of komatiites could have formed in response to a reduction in the temperature and pressure of melting with time. The 3.5 Ga Barberton komatiites and the 2.7 Ga Munro-type komatiities could have formed in plumes that were hotter than the present-day mantle by 500 deg and 300 deg, respectively. When excess temperatures are this size, melting is deeper and volcanism changes from basaltic to momatiitic. The komatiities from Gorgona Island, which are Mesozoic in age, may be representative of komatiities that are predicted to occur in oceanic plateaus of Cretaceous age throughout the Pacific (Storey et al., 1991).

Improving Symptom Control, QOL, and Quality of Care for Women with Breast Cancer: Developing a Research Program on Neurological Effects via Doctoral Education

Science.gov (United States)

2005-05-01

not complicated by significant neuro-toxicity. European Journal of Cancer 2002;38(387-391. 285. Van Manen Max: Researching Lived Experience: Human...thoracotomy. Journal of Thoracic & Cardiovascular Surgery 1998; 115(4):841-847. 27. Benner Patricia: Interpretive Phenomenology : Embodiment, Caring, and... Phenomenology . Thousand Oaks, CA: Sage, 1995, pp 129-138. 90. Dixon Jane K: Factor Analysis, in Munro B (ed): Statistical methods for health care

Lasers in Periodontics: Review of Literature

Science.gov (United States)

2015-06-01

Alex Printed Name Orofacial Pain Fellowship Naval Postgraduate Dental School Program and Program Location Uniformed Services University LASERS IN...PERIODONTICS: REVIEW OF THE LITERATURE By Alex Smith MAJ, DC, USA A thesis submitted to the Faculty of the Orofacial Pain Graduate Program Naval...Department Chair Orofaci I Pain Department Glenn Munro, CAPT, DC, USN Dean, Naval Postgraduate Dental School NAVAL POSTGRADUATE DENTAL SCHOOL BETHESDA

Medical Entomology Project.

Science.gov (United States)

1984-01-01

Manion, Anne G. 08 MAR 76 - 01 JUN 76 Markowitz, Norman L. 01 JUN 75 - 22 MAY 76 Munro, Susan Gale 21 OCT 79 - 31 DEC 82 Page, Ellen M. 29 OCT 74 - 26...Sunthorn, Dr. 01 JUN 74 - 30 JUN 80 Smallwood , Penelope B. 01 JUN 74 - 30 JUN 80 *Entomologist 29 SV Sohn, Young T. 01 JUN 7)4 - 31 JAN 81 Spangler

Pembuatan Arang 4 Jenis Bambu dengan Cara Timbun

OpenAIRE

Nurhayati, Tjutju

1990-01-01

A study on charcoal manufacture using pit method was carried out 4 bamboo species from West Java, namely andong (Gigantochloa verticillata Munro), ater (Gigantochloa ater Kurz), bitung (Dendrocalamus asper Back) and tali (Giganiochloa apus Kurz). The charcoal produced which was completed after 2 days, were then subjected to chemical analysis. The analysis consist of specific gravity, moisture content, ash, volatile matter and fixed carbon. In addition to the abou...

The Unbroken Chain: A Case Study in Nth Order Effects

Science.gov (United States)

2008-06-13

18 Center for Army Lessons Learned, 92. 19 Alan Munro. Arab Storm: Politics, Diplomacy behind the Gulf War (London: I. B. Tauris...Robert Fisk, The Great War for Civilisation : The Conquest of the Middle East (London: Alfred A. Knopf, 2006), 646. 45 Bush, National Security Directive...65. 91 Anonymous, 84. 92 Armstrong, 66. 93 Adam Robinson, Bin Laden: Behind the Mask of the Terrorist (New York: Arcade Publishing, 2001), 87. 94

Observation and Control of Shock Waves in Individual Nanoplasmas

Science.gov (United States)

2014-03-18

quasimonoenergetic ions with an energy spread of less than 15%. Numerical hydrodynamic calculations confirm the appearance of accelerating shock waves and provide...and observed ion energies indicates that the hydrodynamic calculations capture the physics of the plasma expansion. The hydrodynamic calculations ...2006). [23] A. Kawabata and R. Kubo , J. Phys. Soc. Jpn. 21, 1765 (1966). [24] M.M. Marinak, G. D. Kerbel, N. A. Gentile, O. Jones, D. Munro, S

Research progress of protein and energy ratio in ruminant nutrition%蛋白能量比在反刍动物营养上的研究进展

Institute of Scientific and Technical Information of China (English)

张卫兵; 刁其玉; 国春艳

2008-01-01

@@ 自1816年Magendie提出含氮物质是动物日粮中的必需营养素以来(Munro,1964;Marliss,1977),动物蛋白质营养代谢一直是研究的热点问题.能量是评价饲料的重要指标,饲料能量浓度高低决定动物采食

Violent men in couple relationships: mental disorders and typological profiles

OpenAIRE

Echeburúa, Enrique; J. Amor, Pedro; de Corral, Paz

2010-01-01

The aims of this theoretical paper are to analyze the mental disorders and the most relevant psychological deficits of intimate partner violent men, as well as to identify different types of batterers according to the classifications of Holtzworth-Munroe and Stuart (1994) and of Fernandez- Montalvo and Echeburúa (1997). A review of multiple theoretical and empirical papers has been carried out with this purpose. The main results show that the aggressors usually show psychological deficits –la...

Family-Only Perpetrators of Intimate Partner Violence: A Systematic Review.

Science.gov (United States)

Petersson, Joakim; Strand, Susanne J M

2018-01-01

This article presents the first systematic review of family-only intimate partner violence (IPV) perpetrators (as originally proposed by Holtzworth-Munroe & Stuart). The aims of the present review were to summarize and describe the prevalence of the family-only perpetrator subtype, as well as to investigate what characteristics were associated with perpetrators within this subtype. Electronic literature searches in several databases (e.g., PsychINFO, Web of Science, and PubMed) were carried out. Of the 3,434 studies identified, 30 studies met the inclusion criteria as well as the methodological quality criteria. Thematic analyses were conducted, where several themes and subthemes were identified. The proportion of family-only perpetrators, averaged across sample types, was 47.5%. Drawing on the thematic analyses of the reviewed studies, family-only perpetrators presented as a less violent subtype, displaying several pro-social personality traits, as well as a lower degree of psychopathology. The findings were in line with Holtzworth-Munroe and Stuart's predictions. The findings also demonstrated the utility of a 2-fold typology, consisting of a family-only and a generally violent (GV) subtype, as well as the need to reconsider the one-size-fits-all approach to IPV treatment. We also included a discussion of the terminology of the subtypes and propose an adoption of the terms "partner only violent" and "generally violent" subtypes.

BRAZILIAN COMPANIES RELATIONSHIP MARKETING PRACTICES: OVERVIEW AND PERFORMANCE

OpenAIRE

LUCIANA TERRA TARGINO

2009-01-01

Alguns autores apontam que o marketing de relacionamento veio para suplantar o então considerado obsoleto marketing transacional. Para testar essa afirmação, autores como Brodie e Munro (1997) e Coviello, Milley e Macolin (2001), baseados nas definições de marketing relacional de Grönroos (1996), definiram diferentes tipos de marketing de relacionamento, que foram posteriormente testados em pesquisas realizadas com empresas em vários países. Essas pesquisas, porém, revelaram...

Stochastic model of cell rearrangements in convergent extension of ascidian notochord

Science.gov (United States)

Lubkin, Sharon; Backes, Tracy; Latterman, Russell; Small, Stephen

2007-03-01

We present a discrete stochastic cell based model of convergent extension of the ascidian notochord. Our work derives from research that clarifies the coupling of invagination and convergent extension in ascidian notochord morphogenesis (Odell and Munro, 2002). We have tested the roles of cell-cell adhesion, cell-extracellular matrix adhesion, random motion, and extension of individual cells, as well as the presence or absence of various tissue types, and determined which factors are necessary and/or sufficient for convergent extension.

A Critical Comparison of Some Methods for Interpolation of Scattered Data

Science.gov (United States)

1979-12-01

Albuquerque, NM 87185 Patrick W. Gaffney Union Carbide/Nuclear Division Computer Sciences Division Box Y Oak Ridge , TN 37830 Dr. Carl de Boor...Robert Rlffenburgh Codel18 Naval Ocean System Center San Diego$ CA 92152 John K. Munro,, Jr. Bldg. 9104-2 Oak Ridge National Laboratory P. 0. Box Y Oak... Ridge , T4 37830 Paul Peterson Woodw~ard Governor Co. 5001 N. 2nd St. Rockford, IL 61101 John Babbitt * Continental Oil Co. P. 0. Bnx 1267 Ponca City

Romance and Freedom: Nelson and Winnie Mandela’s Politics of Gender in Three Post-Apartheid Novels

OpenAIRE

Mari, Lorenzo

2014-01-01

This paper aims to retrace the influence of the politics of gender enacted by Nelson and Winnie Mandela on post-apartheid gender relationships, as represented in three novels: Phaswane Mpe’s Welcome to Our Hillbrow (2001), Njabulo Ndebele’s The Cry of Winnie Mandela (2003) and Lewis Nkosi’s Mandela’s Ego (2006). Recently, Nelson and Winnie Mandela’s marriage has been also described as the “unusual founding-family romance” (Munro 2014) of the post-apartheid nation. Their marriage lasted fr...

Recherche d'un âge optimal de castration chez la race bovine Alur en système d'élevage extensif au Zaïre

Directory of Open Access Journals (Sweden)

Dibanzilua, M.

1993-01-01

Full Text Available Determination of the optimum age for castration by the Alur cattle breed under extensive production in Zaire. Considering a few difficultes which seem to hinder the popularization of the castration technique in the real environment of Ituri (North Eastern Zaire, the authors suggest the trend towards the reducing of the age margin regularly observed during the running of that operation. It appeared that the age between 3 and 5 months seems favourable for the popularizer as well as for the animal and the breeder regarding the operation, the stress and the meat quality. Considering the yields in butchery the carcass weights of castrated animals are nearly the same as those of non castrated ones.

Comportamento estrutural de vigas de concreto reforçadas com ripas de bambu cravejadas de pinos

OpenAIRE

Braga Filho,Antonio C.; Lima Júnior,Humberto C.; Barbosa,Normando P.; Willrich,Fabio L.

2010-01-01

Uma das deficiências do bambu reforçando vigas de concreto armado está relacionada com deslocamentos relativos entre os dois materiais. A investigação aqui reportada teve como objetivo avaliar experimentalmente a possibilidade de se melhorar o trabalho conjunto bambu-concreto, através do cravejamento de pinos nas ripas de bambu usadas como reforço. Para tanto, oito vigas de concreto foram ensaiadas, das quais seis foram reforçadas com ripas de bambu Dendrocalamus giganteus Munro cravejadas de...

Essential oil of Cymbopogon khasianus (Munro ex Hack.) Bor from Northeastern India

NARCIS (Netherlands)

Choudhury, S.N.; Leclercq, P.A.

1995-01-01

The essential oil obtained by hydrodistillation of the fresh leaves of Cymbopogon khasianus collected from the northeastern region in India was analyzed by GC/MS. It was found that the major components were geraniol (78.4%), geranyl acetate (7.3%), linalool (2.2%) and geraniol (1.6%).

In vitro seed germination of economically important edible bamboo Dendrocalamus membranaceus Munro.

Science.gov (United States)

Brar, Jasmine; Anand, Manju; Sood, Anil

2013-01-01

An in vitro propagation protocol using mature seeds of D. membranaceus was successfully established. Scarcity of seeds in bamboos because of their long flowering periods and irregular seed set resulting in low viability and germination potential, motivated us to undertake the present study. The effects of sterilants, light conditions, exogenous application of plant growth regulators and temperature in overcoming germination barriers in ageing seeds of bamboo were studied. It was found that HgCl2 (0.1%) along with bleach (15%) was more effective in raising aseptic cultures. Dark conditions, high temperatures around 30 degrees C and soaking of seeds in GA3 solution (50 ppm) overnight stimulated high percent of seed germination with corresponding increase in shoot length (2.7 +/- 0.7 mm) and number of sprouts (2.1 +/- 0.7) per explants during culture initiation. 6-benzylaminopurine acted synergistically with kinetin to give optimum germination rate of 70 +/- 13.9% as compared to 63.13% when used individually. For prolonged maintenance of cultures, 2% sucrose was found to be suitable for promoting photomixotrophic micropropagation. Following this procedure, about 65% survival of plantlets could be achieved during hardening. Biochemically seeds consume starchy endosperm for emergence of radicle which is taken as a sign of germination as also evident from the present study. Loss of viability and vigour after a year was confirmed by Tetrazolium chloride test. Micropropagation protocol developed here will ensure regeneration of large number of plants in a relatively short time. Conclusively, in vitro propagation protocol developed in D. membranaceus using mature seeds as an explants is reported for the first time.

Old stones' song: use-wear experiments and analysis of the Oldowan quartz and quartzite assemblage from Kanjera South (Kenya).

Science.gov (United States)

Lemorini, Cristina; Plummer, Thomas W; Braun, David R; Crittenden, Alyssa N; Ditchfield, Peter W; Bishop, Laura C; Hertel, Fritz; Oliver, James S; Marlowe, Frank W; Schoeninger, Margaret J; Potts, Richard

2014-07-01

Evidence of Oldowan tools by ∼2.6 million years ago (Ma) may signal a major adaptive shift in hominin evolution. While tool-dependent butchery of large mammals was important by at least 2.0 Ma, the use of artifacts for tasks other than faunal processing has been difficult to diagnose. Here we report on use-wear analysis of ∼2.0 Ma quartz and quartzite artifacts from Kanjera South, Kenya. A use-wear framework that links processing of specific materials and tool motions to their resultant use-wear patterns was developed. A blind test was then carried out to assess and improve the efficacy of this experimental use-wear framework, which was then applied to the analysis of 62 Oldowan artifacts from Kanjera South. Use-wear on a total of 23 artifact edges was attributed to the processing of specific materials. Use-wear on seven edges (30%) was attributed to animal tissue processing, corroborating zooarchaeological evidence for butchery at the site. Use-wear on 16 edges (70%) was attributed to the processing of plant tissues, including wood, grit-covered plant tissues that we interpret as underground storage organs (USOs), and stems of grass or sedges. These results expand our knowledge of the suite of behaviours carried out in the vicinity of Kanjera South to include the processing of materials that would be 'invisible' using standard archaeological methods. Wood cutting and scraping may represent the production and/or maintenance of wooden tools. Use-wear related to USO processing extends the archaeological evidence for hominin acquisition and consumption of this resource by over 1.5 Ma. Cutting of grasses, sedges or reeds may be related to a subsistence task (e.g., grass seed harvesting, cutting out papyrus culm for consumption) and/or a non-subsistence related task (e.g., production of 'twine,' simple carrying devices, or bedding). These results highlight the adaptive significance of lithic technology for hominins at Kanjera. Copyright © 2014 Elsevier Ltd. All

Generating optimal states for a homodyne Bell test

International Nuclear Information System (INIS)

Daffer, S.; Knight, P.L.

2005-01-01

Full text: We present a protocol that produces a conditionally prepared state that can be used for a Bell test based on homodyne detection. Based on the results of Munro, the state is near-optimal for Bell inequality violations based on quadrature-phase homodyne measurements that use correlated photon-number states. The scheme utilizes the Gaussian entanglement distillation protocol of Eisert et. al. and uses only beam splitters and photodetection to conditionally prepare a non-Gaussian state from a source of two-mode squeezed states with low squeezing parameter, permitting a loophole-free test of Bell inequalities. (author)

Feticism and irony of the pornographic ékphrasis in Lichen by Alice Munro

Directory of Open Access Journals (Sweden)

Beatrice Seligardi

2013-06-01

Full Text Available The aim of this article is to trace the relationship between ekphrasis, fetish and desire in Alice Munro’s short story Lichen. The core of the story is the description of a Polaroid snapshot which represents a female sexual organ. The analysis will focus on the different perspectives between male and female gazes that are represented in the story. On the one hand, from the male point of view the image is fetish, as it assumes an erotic and pornographic dimension. On the other hand, the female gaze deconstructs the violence inscribed in the image by using a verbal and rhetorical strategy that operates through irony and epiphany.

Can Science Lead Us to a Definition of Art?

Directory of Open Access Journals (Sweden)

Kathryn Coe

2013-12-01

Full Text Available For approximately two thousand years, human thinkers have been attempting to define a  behaviour, referred to as art, that humans have been practicing for tens of thousands of  years.  Defining this term has proved to be so difficult that Munro (1949: 5 to claim that the arts “are too intangible and changing to be defined or classified.” In this paper a 12-property cluster theory proposed by Denis Dutton is critically evaluated not in light of how well it fits with current thinking in aesthetics, but in light of its scientific strength and its usefulness for examining art across cultures.

A revision of Ichneumonopsis Hardy, 1973 (Diptera: Tephritidae: Dacinae: Gastrozonini, Oriental bamboo-shoot fruit flies

Directory of Open Access Journals (Sweden)

Amnon Freidberg

2017-05-01

Full Text Available Ichneumonopsis Hardy,1973, a genus of oriental fruit flies, is revised and two new species, I. hancocki sp. nov. (from Peninsular Malaysia and I. taiwanensis sp. nov. (from Taiwan, are described. A key to the three species of Ichneumonopsis is presented. In northern Thailand larvae of I. burmensis Hardy, 1973 develop in bamboo shoots of Pseudoxytenanthera albociliata (Munro Nguyen and Dendrocalamus strictus (Roxburgh Nees (Poaceae, not Melocalamus compactiflorus as previously reported. The recently discovered association of I. burmensis with bamboo substantiates our previous assumption assigning Ichneumonopsis to the primarily bamboo-inhabiting tribe Gastrozonini. Hence, we synonymize Ichneumonopsidini under Gastrozonini (syn. nov..

Interactive drivers of activity in a free-ranging estuarine predator.

Directory of Open Access Journals (Sweden)

Matthew D Taylor

Full Text Available Animal activity patterns evolve as an optimal balance between energy use, energy acquisition, and predation risk, so understanding how animals partition activity relative to extrinsic environmental fluctuations is central to understanding their ecology, biology and physiology. Here we use accelerometry to examine the degree to which activity patterns of an estuarine teleost predator are driven by a series of rhythmic and arrhythmic environmental fluctuations. We implanted free-ranging bream Acanthopagrus australis with acoustic transmitters that measured bi-axial acceleration and pressure (depth, and simultaneously monitored a series of environmental variables (photosynthetically active radiation, tidal height, temperature, turbidity, and lunar phase for a period of approximately four months. Linear modeling showed an interaction between fish activity, light level and tidal height; with activity rates also negatively correlated with fish depth. These patterns highlight the relatively-complex trade-offs that are required to persist in highly variable environments. This study demonstrates how novel acoustic sensor tags can reveal interactive links between environmental cycles and animal behavior.

Caracterização bromatológica e mineral dos resíduos de broto de bambu, visando a sua utilização como alimento animal Mineral and bromatologic characterization of bamboo shoot residues as animal food

Directory of Open Access Journals (Sweden)

Anisio Azzini

1995-01-01

Full Text Available Nesse estudo, realizado em 1992, nos Institutos Agronômico, de Tecnologia de Alimentos e de Zootecnia, procedeu-se à caracterização bromatológica e mineral dos resíduos de broto de bambu (Dendrocalamus giganteus Munro, a fim de utilizá-los como alimento animal. Os resultados mostraram que tais resíduos, constituídos basicamente por bainhas e pedaços tenros de colmo, apresentaram elevados teores de proteína (131,4 g/kg, açúcares (115,3 g/kg, fibras (235,4 g/kg e ácido cianídrico (213 mg/kg. Essa concentração de ácido cianídrico pode causar efeito tóxico em animais, devendo-se, portanto, eliminá-lo, adotando o mesmo procedimento utilizado para a fração comestível do broto, o qual se resume no cozimento em água fervente durante 20 minutos. Após esse tratamento, os resíduos de broto de bambu podem ser utilizados como alimento animal.The mineral and bromatologic characterization of bamboo shoot residues (Dendrocalamus giganteus Munro were determined as animal food. The results showed that the bamboo shoot residues (sheaths and pieces of soft culms presented hight contents of protein (131.4 g/kg, sugars (115.3 g/kg, fibers (235.4 g/kg and hydrocyanic acid (213 mg/kg. This hydrocyanic acid concentration can be toxic for animals, then this cyanogenic componed must be eliminated using boiling water during 20 minutes. This treatment is similar to the treatment used for edible parts of bamboo shoot. After this treatment for hydrocyanic acid elimination the bamboo shoot residues can be used as animal food.

Evaluation of Physicochemical and Microbiological Parameters of Smoked Sausages

Directory of Open Access Journals (Sweden)

Melinda Nagy

2015-11-01

Full Text Available Meat and meat products continue to supply nutrients and play a vital role in human life because of their high biological value protein, iron, zinc, selenium and vitamin B12 contents, being a crucial component of a well balanced diet. The objective of this paper was to analyse the microbiological and physicochemical characteristics of smoked sausage obtain by a modern recipe. The meat  material was obtained from local butchery (Cluj-Napoca, Romania. The physicochemical analyses highlighted the moisture (Drying-oven at 105 ºC, protein (Kjeldahl method and fat (Soxhlet method content, as well as nitrite (Griess method and sodium chloride concentrations (Mohr method of the final products. Microbiological and physicochemical analysis of the examined samples found no deviations from legal norms imposed for smoked sausage.  All of the quality parameters comply with the limits stipulated by STAS. 

Lead in game birds in Denmark - levels and sources

DEFF Research Database (Denmark)

Kanstrup, Niels

2012-01-01

In June 2008, the National Food Agency contacted Bjarne Frost Vildt against the background that the Danish surveillance of heavy metals in food (EU Directive 96/23 of 29 April 1996) had, for several years, shown elevated lead levels in game meat. These elevated levels exceeded the official...... project to identify the source of lead in game meat. In July 2008, the Danish Academy of Hunting was tasked to design and carry out the investigation, in cooperation with the Veterinary Institute (Technical University of Denmark) and Food Region North (Ministry of Food, Agriculture and Fisheries....../2009 and 2009/2010 may be driven by three The biggest Danish butchery for game meat different reasons: reduced illegal use of lead shot due to the campaign initiated in 2008; reduced concentration of lead in bismuth shot (2009/2010) due to the conclusions of this study; and/or reluctance to deliver pheasants...

Culture clash: alcohol marketing and public health aspirations.

Science.gov (United States)

Munro, Geoffrey; de Wever, Johanna

2008-03-01

It is of no coincidence that a number of recent Harm Reduction Digests have addressed the issue of the reduction of alcohol-related harm. Despite the dominant focus on illicit drug use in the popular discourse, alcohol remains Australia's number one drug problem, as it is in many other developed countries. In this Digest Munro and de Wever use the 'four Ps' of marketing: product, price, place and promotion, to critique the two decades industry self-regulation of alcohol marketing. They conclude that if we are going to develop policies which effectively change Australian drinking culture to reduce alcohol-related harm, we need first to accept that the alcohol industry and the health field have separate and conflicting interests.

Improved antifungal activity and stability of chitosan nanofibers using cellulose nanocrystal on banknote papers.

Science.gov (United States)

Mohammadi Amirabad, Leila; Jonoobi, Mehdi; Mousavi, Narges Sharif; Oksman, Kristiina; Kaboorani, Alireza; Yousefi, Hossein

2018-06-01

Microorganisms can spread on the surface of banknotes and cause many infectious diseases. Chitosan nanofibers (CNFs) and cellulose nanocrystals (CNCs) are nanomaterials, which can affect the antimicrobial properties. In this study, the fungal species that grew on the surfaces of collected banknotes from different places were identified. To examine the antifungal effect of the both nanomaterials on the banknotes, the stable coatings using CNFs and CNCs emulsions were prepared by roller coating. The results revealed that the most colonies in the banknotes obtained from the bakeries and butcheries were Aspergillus sp., whereas the colonies in bus terminals and the hospitals were Aspergillus niger and Penicillium, respectively. The results showed that the CNCs had no antifungal effect alone on the aforementioned species, but it could improve the antifungal effect, adhesion, and stability of CNFs on the banknote surfaces. This study suggested a new approach to decrease the infection spreads through banknotes. Copyright © 2018 Elsevier Ltd. All rights reserved.

Observation of seasonal effects in traveling ionospheric disturbances by the directional deviation technique

International Nuclear Information System (INIS)

Walton, E.K.; Bailey, A.D.

1976-01-01

An experiment was performed during the years 1962 through 1964 in which direction of arrival data were collected on pulse signals received over a 450 km east-west path. In order to determine the effect that traveling ionospheric disturbances (TIDs) had on these data, a ''corrugation'' model was proposed. The corrugation model assumes that TIDs can be treated as if they were moving cylindrical sinusoidal perturbations on the ionospheric reflecting surface. Lateral deviations in the experimental data of the type predicted by this model were found to be quite common. Variations in the detected TIDs as a function of time of year were found to be consistent with the ''seasonal effect'' studied by Munro in 1958, Jones 1969, and Davies and Jones in 1971

Propagation of Chusquea tessellata (Munro culms at different naphthaleneacetic acid concentrations and in different substrates

Directory of Open Access Journals (Sweden)

Jennyfer Insuasty-Torres

2011-12-01

Full Text Available Chusquea tessellata is native specie of Colombian wet páramos. Despite the ecological importance of this ecosystem, production activities have altered the structure of the C. tessellata patches. The aim of this study was to evaluate vegetative propagation from sections of culm stimulating their rooting, to have a lot of material for transplantation and with high survival. We tested 56 treatments with three combined factors: phytohormone NAA concentration, type of substrate and type of culm section. After three months we assessed the frequency and number of roots and vegetative shoots. The results suggest that the frequency and quantity of roots and shoots are affected mainly by the type of culm section, the best results is the basal sections, because these sections of culm have the morphological characteristics that allow successful propagation. Shoot production is also affected by interactions between other factors, substrate and NAA concentration

Studies of fuel-bulk flows using charged-particle and neutron spectrometry on OMEGA and the NIF

Science.gov (United States)

Gatu Johnson, M.; Rinderknecht, H.; Rosenberg, M.; Sio, H.; Zylstra, A.; Frenje, J.; Li, C. K.; Seguin, F.; Petrasso, R.; Delettrez, J.; Glebov, V.; Knauer, J.; McKenty, P.; Sangster, T. C.; Appelbe, B.; Amendt, P.; Bellei, C.; Bionta, R.; Bleuel, D.; Caggiano, J.; Casey, D.; Edwards, J.; Hatarik, R.; Hatchett, S.; Landen, O.

2013-10-01

A. MACKINNON, J. MCNANEY, D. MUNRO, J. PINO, S. WILKS, C. YEAMANS, LLNL, J. KILKENNY, A. NIKROO, GA - Charged-particle and neutron spectra are used to study fuel-bulk flows, which are indicative of implosion asymmetries and inefficient conversion of kinetic energy to thermal energy. We distinguish between (i) collective, directional motion of the burn region, which manifests itself as a directional shift of the fusion-product spectrum, and (ii) radial flow, which appears as an additional broadening of the spectrum relative to expected based on Ti Doppler broadening. In this talk, we will present neutron and charged particle spectra from OMEGA and the NIF, which display the effect of these phenomena and their relation to implosion asymmetry. This work was supported in part by the U.S. DOE, LLNL and LLE.

Entrevista com Caetano Galindo, o autor de Ensaio sobre entendimento humano

Directory of Open Access Journals (Sweden)

Lucas Menezes de Moraes

2017-06-01

Full Text Available Caetano Waldrigues Galindo é paranaense, 43 anos, Doutor em linguística pela Universidade Federal do Paraná e tradutor de obras consagradas da literatura mundial, como Graça Infinita, de David Foster Wallace, e Vida Querida, da vencedora do Prêmio Nobel de Literatura, Alice Munro. Galindo já recebeu prêmios importantes como o Jabuti, APCA, bem como o da Academia Brasileira de Letras por sua tradução de Ulysses, de James Joyce. Como escritor, já publicou Sim, eu digo sim: Uma visita guiada ao Ulysses  de James Joyce e Ensaio sobre o entendimento humano, livro que recebeu o Prêmio Paraná de Literatura de 2013. Um ano antes, Galindo foi eleito uma das 100 pessoas mais influentes do Brasil.

PREFACE: Quantum information processing

Science.gov (United States)

Briggs, Andrew; Ferry, David; Stoneham, Marshall

2006-05-01

Microelectronics and the classical information technologies transformed the physics of semiconductors. Photonics has given optical materials a new direction. Quantum information technologies, we believe, will have immense impact on condensed matter physics. The novel systems of quantum information processing need to be designed and made. Their behaviours must be manipulated in ways that are intrinsically quantal and generally nanoscale. Both in this special issue and in previous issues (see e.g., Spiller T P and Munro W J 2006 J. Phys.: Condens. Matter 18 V1-10) we see the emergence of new ideas that link the fundamentals of science to the pragmatism of market-led industry. We hope these papers will be followed by many others on quantum information processing in the Journal of Physics: Condensed Matter.

Nanoparticles in Polymers: Assembly, Rheology and Properties

Science.gov (United States)

Rao, Yuanqiao

Inorganic nanoparticles have the potential of providing functionalities that are difficult to realize using organic materials; and nanocomposites is an effective mean to impart processibility and construct bulk materials with breakthrough properties. The dispersion and assembly of nanoparticles are critical to both processibility and properties of the resulting product. In this talk, we will discuss several methods to control the hierarchical structure of nanoparticles in polymers and resulting rheological, mechanical and optical properties. In one example, polymer-particle interaction and secondary microstructure were designed to provide a low viscosity composition comprising exfoliated high aspect ratio clay nanoparticles; in another example, the microstructure control through templates was shown to enable unique thermal mechanical and optical properties. Jeff Munro, Stephanie Potisek, Phillip Hustad; all of the Dow Chemical Company are co-authors.

Morphological and Chemical Characterization of Green Bamboo (Dendrocalamopsis oldhami (Munro Keng f. for Dissolving Pulp Production

Directory of Open Access Journals (Sweden)

Shilin Cao

2014-06-01

Full Text Available With the sustained growth of dissolving pulp demand all over the world, the search for alternative bamboo materials has come into focus in China due to the shortage of wood and the abundance of bamboo resources. In this study, to obtain updated information concerning green bamboo growing in southeastern China and to develop its processing technologies for dissolving pulp, the fiber morphology, chemical composition, elemental composition, degree of polymerization (DP of cellulose, and crystallinity index (CrI of cellulose were investigated. The experimental results show that green bamboo has potential for use as dissolving pulp because it has a lower Runkel ratio and fines content than moso bamboo, and a much lower lignin content and similar α-cellulose and hemicellulose contents compared to softwoods and hardwoods. Compared to the cortex and culm, the node had the shortest fibers and more than 30% of fines, the highest content of extractives and lignin, and the lowest α-cellulose content. As a result, a de-knotting operation prior to cooking can contribute to the production of high-grade dissolving pulp. The DP and CrI of cellulose from the node were much lower than that of cellulose from the culm and cortex. Moreover, green bamboo had the high content of ash, primarily distributed in the cortex. The concentration of Si was 4487 ppm in the cortex, nearly five times higher than that in the culm and node.

Propagation of Chusquea tessellata (Munro culms at different naphthalene acetic acid concentrations and in different substrates.

Directory of Open Access Journals (Sweden)

Insuasty Torres Jennyfer

2011-12-01

Full Text Available

WITHDRAWN: The Palaeocene Cerro Munro tonalite intrusion (Chubut Province, Argentina): A plutonic remnant of explosive volcanism?

Science.gov (United States)

Rodríguez, C.; Aragón, E.; Castro, A.; Pedreira, R.; Sánchez-Navas, A.; Díaz-Alvarado, J.; D´Eramo, F.; Pinotti, L.; Aguilera, Y.; Cavarozzi, C.; Demartis, M.; Hernando, I. R.; Fuentes, T.

2017-10-01

The publisher regrets that an error occurred which led to the premature publication of this paper. This error bears no reflection on the article or its authors. The publisher apologizes to the authors and the readers for this unfortunate error in Journal of South American Earth Sciences, 78C (2017) 30 - 60, http://dx.doi.org/10.1016/j.jsames.2017.06.002. The full Elsevier Policy on Article Withdrawal can be found at https://www.elsevier.com/about/our-business/policies/article-withdrawal

Consumer characterization of three types of meat (beef, chicken, and pork in the metropolitan area of the México valley

Directory of Open Access Journals (Sweden)

José Saturnino Mora-Flores

2011-12-01

Full Text Available Consumption of any kind of meat is important for the proper functioning and development of the human organism. The Metropolitan Area of the Valley of Mexico (MAVM is the main meat marketing and consumption center in the country. The objective of this work was to characterize the consumers of the three main types of meat (beef, chicken, and pork in the MAVM in order to know the products demanded, associated to variables such as income level, consumption, product value-added services, among others. The methodology used was the CHAID algorithm (Chi-squares Automatic Interaction Detection, and association tests through the X2 distribution, economic and social quantitative segmentation variables. The information was obtained through a semi-structured survey applied to 440 individuals. Data analysis was done on contingency tables with relative frequencies. The results showed that low and medium level consumers, with low and middle incomes, mainly demand popular cuts; they buy them in local supermarkets, open markets, and neighborhood butcheries. Mostly consumed is unrefrigerated meat with few value-added services.

Differences in Health-related Fatty Acids, Intramuscular Fat and the Physico-chemical Quality in Mutton as Affected by Season, Place of Purchase and Meat Portion

Directory of Open Access Journals (Sweden)

Zikhona T. Rani

2014-11-01

Full Text Available The objective of the study was to determine the quality and fatty acid profiles of mutton cuts purchased from rural and urban localities in South Africa. Five hundred and ten samples were collected in four seasons from both rural and urban shops and butcheries. Samples were immediately transported to the laboratory in cooler boxes with ice where the following physico-chemical characteristics of mutton were determined; meat pH, color (L*, a*, and b*, cooking losses and Warner Braztler shear force and replicates stored at −20°C pending fatty acid analysis. Meat L* values were lowest (24.7±0.49 in winter and highest (32.2±0.49 in spring. The loin and sirloin cuts recorded the highest intramuscular fat whilst rib and leg cuts recorded the lowest intramuscular fat. In conclusion intramuscular fat, fatty acid profiles and physico-chemical quality of mutton were significantly affected by season and meat portion and not necessarily by the locality and class of shop.

Dietary options and behavior suggested by plant biomarker evidence in an early human habitat

Science.gov (United States)

Magill, Clayton R.; Ashley, Gail M.; Domínguez-Rodrigo, Manuel; Freeman, Katherine H.

2016-03-01

The availability of plants and freshwater shapes the diets and social behavior of chimpanzees, our closest living relative. However, limited evidence about the spatial relationships shared between ancestral human (hominin) remains, edible resources, refuge, and freshwater leaves the influence of local resources on our species' evolution open to debate. Exceptionally well-preserved organic geochemical fossils-biomarkers-preserved in a soil horizon resolve different plant communities at meter scales across a contiguous 25,000 m2 archaeological land surface at Olduvai Gorge from about 2 Ma. Biomarkers reveal hominins had access to aquatic plants and protective woods in a patchwork landscape, which included a spring-fed wetland near a woodland that both were surrounded by open grassland. Numerous cut-marked animal bones are located within the wooded area, and within meters of wetland vegetation delineated by biomarkers for ferns and sedges. Taken together, plant biomarkers, clustered bone debris, and hominin remains define a clear spatial pattern that places animal butchery amid the refuge of an isolated forest patch and near freshwater with diverse edible resources.

Early hominin diet included diverse terrestrial and aquatic animals 1.95 Ma in East Turkana, Kenya.

Science.gov (United States)

Braun, David R; Harris, John W K; Levin, Naomi E; McCoy, Jack T; Herries, Andy I R; Bamford, Marion K; Bishop, Laura C; Richmond, Brian G; Kibunjia, Mzalendo

2010-06-01

The manufacture of stone tools and their use to access animal tissues by Pliocene hominins marks the origin of a key adaptation in human evolutionary history. Here we report an in situ archaeological assemblage from the Koobi Fora Formation in northern Kenya that provides a unique combination of faunal remains, some with direct evidence of butchery, and Oldowan artifacts, which are well dated to 1.95 Ma. This site provides the oldest in situ evidence that hominins, predating Homo erectus, enjoyed access to carcasses of terrestrial and aquatic animals that they butchered in a well-watered habitat. It also provides the earliest definitive evidence of the incorporation into the hominin diet of various aquatic animals including turtles, crocodiles, and fish, which are rich sources of specific nutrients needed in human brain growth. The evidence here shows that these critical brain-growth compounds were part of the diets of hominins before the appearance of Homo ergaster/erectus and could have played an important role in the evolution of larger brains in the early history of our lineage.

Seasonal effect on biomarkers of exposure to petroleum hydrocarbons in fish from Kuwait's marine area.

Science.gov (United States)

Beg, M U; Al-Subiai, S N; Al-Jandal, N; Butt, S A; Beg, K R; Al-Husaini, M

2015-11-30

The aquatic biota of the Arabian Gulf deals with exposure to chronic oil pollution, several constituents of which cause induction of Cytochrome P450 1A that serves as a biomarker of AhR ligand exposure. In this study, fluorescent aromatic compounds (FACs) in bile and 7-ethoxyresorufin-o-deethylase (EROD) catalytic activity were determined as a measure of exposure biomarkers in two fish species, yellow fin seabream (Acanthopagrus latus) and tonguesole (Cynoglossus arel) captured from Kuwait Bay and outside the Bay area. FACs in fish bile determined by using fixed-wavelength fluorescence (FF) showed high fluorescence ratios between FF290/335 and FF380/430 indicating predominant exposure to low molecular weight, naphthalene-rich petroleum products (375±91.0 pg ml(-1)). Exposures to benzo(a)pyrene-type high-molecular weight polycyclic aromatic hydrocarbons (PAHs) originating from burnt fuel were also present in appreciable concentration in the bile. The ratio of petrogenic to pyrogenic hydrocarbon was twofold higher in winter compared to summer months in both species. Seasonal effect on EROD was significant in tonguesole in Auha site (Ppollution in Kuwait Bay area. Copyright © 2015 Elsevier Ltd. All rights reserved.

Ecological conversion efficiency and its influencers in twelve species of fish in the Yellow Sea Ecosystem

Science.gov (United States)

Tang, Qisheng; Guo, Xuewu; Sun, Yao; Zhang, Bo

2007-09-01

The ecological conversion efficiencies in twelve species of fish in the Yellow Sea Ecosystem, i.e., anchovy ( Engraulis japonicus), rednose anchovy ( Thrissa kammalensis), chub mackerel ( Scomber japonicus), halfbeak ( Hyporhamphus sajori), gizzard shad ( Konosirus punctatus), sand lance ( Ammodytes personatus), red seabream ( Pagrus major), black porgy ( Acanthopagrus schlegeli), black rockfish ( Sebastes schlegeli), finespot goby ( Chaeturichthys stigmatias), tiger puffer ( Takifugu rubripes), and fat greenling ( Hexagrammos otakii), were estimated through experiments conducted either in situ or in a laboratory. The ecological conversion efficiencies were significantly different among these species. As indicated, the food conversion efficiencies and the energy conversion efficiencies varied from 12.9% to 42.1% and from 12.7% to 43.0%, respectively. Water temperature and ration level are the main factors influencing the ecological conversion efficiencies of marine fish. The higher conversion efficiency of a given species in a natural ecosystem is acquired only under the moderate environment conditions. A negative relationship between ecological conversion efficiency and trophic level among ten species was observed. Such a relationship indicates that the ecological efficiency in the upper trophic levels would increase after fishing down marine food web in the Yellow Sea ecosystem.

Food safety knowledge and practices of abattoir and butchery shops and the microbial profile of meat in Mekelle City, Ethiopia

Science.gov (United States)

Haileselassie, Mekonnen; Taddele, Habtamu; Adhana, Kelali; Kalayou, Shewit

2013-01-01

Objective To assess the food safety knowledge and practices in meat handling, and to determine microbial load and pathogenic organisms in meat at Mekelle city. Methods A descriptive survey design was used to answer questions concerning the current status of food hygiene and sanitation practiced in the abattoir and butcher shops. Workers from the abattoir and butcher shops were interviewed through a structured questionnaire to assess their food safety knowledge. Bacterial load was assessed by serial dilution method and the major bacterial pathogens were isolated by using standard procedures. Results 15.4% of the abattoir workers had no health certificate and there was no hot water, sterilizer and cooling facility in the abattoir. 11.3% of the butchers didn't use protective clothes. There was a food safety knowledge gap within the abattoir and butcher shop workers. The mean values of bacterial load of abattoir meat, butcher shops and street meat sale was found to be 1.1×105, 5.6×105 and 4.3×106 cfu/g, respectively. The major bacterial pathogens isolated were Escherichia coli, Staphylococcus aureus and Bacillus cereus. Conclusions The study revealed that there is a reasonable gap on food safety knowledge by abattoir and butcher shop workers. The microbial profile was also higher compared to standards set by World Health Organization. Due attention should be given by the government to improve the food safety knowledge and the quality standard of meat sold in the city. PMID:23646306

The broiler meat system in Nairobi, Kenya: Using a value chain framework to understand animal and product flows, governance and sanitary risks.

Science.gov (United States)

Carron, Maud; Alarcon, Pablo; Karani, Maurice; Muinde, Patrick; Akoko, James; Onono, Joshua; Fèvre, Eric M; Häsler, Barbara; Rushton, Jonathan

2017-11-01

Livestock food systems play key subsistence and income generation roles in low to middle income countries and are important networks for zoonotic disease transmission. The aim of this study was to use a value chain framework to characterize the broiler chicken meat system of Nairobi, its governance and sanitary risks. A total of 4 focus groups and 8 key informant interviews were used to collect cross-sectional data from: small-scale broiler farmers in selected Nairobi peri-urban and informal settlement areas; medium to large integrated broiler production companies; traders and meat inspectors in live chicken and chicken meat markets in Nairobi. Qualitative data were collected on types of people operating in the system, their interactions, sanitary measures in place, sourcing and selling of broiler chickens and products. Framework analysis was used to identify governance themes and risky sanitary practices present in the system. One large company was identified to supply 60% of Nairobi's day-old chicks to farmers, mainly through agrovet shops. Broiler meat products from integrated companies were sold in high-end retailers whereas their low value products were channelled through independent traders to consumers in informal settlements. Peri-urban small-scale farmers reported to slaughter the broilers on the farm and to sell carcasses to retailers (hotels and butcheries mainly) through brokers (80%), while farmers in the informal settlement reported to sell their broilers live to retailers (butcheries, hotels and hawkers mainly) directly. Broiler heads and legs were sold in informal settlements via roadside vendors. Sanitary risks identified were related to lack of biosecurity, cold chain and access to water, poor hygiene practices, lack of inspection at farm slaughter and limited health inspection in markets.
 Large companies dominated the governance of the broiler system through the control of day-old chick production. Overall government control was described as

Comportamento estrutural de vigas de concreto reforçadas com ripas de bambu cravejadas de pinos Structural behavior of concrete beams reinforced with pinned bamboo-splints

Directory of Open Access Journals (Sweden)

Antonio C. Braga Filho

2010-10-01

Full Text Available Uma das deficiências do bambu reforçando vigas de concreto armado está relacionada com deslocamentos relativos entre os dois materiais. A investigação aqui reportada teve como objetivo avaliar experimentalmente a possibilidade de se melhorar o trabalho conjunto bambu-concreto, através do cravejamento de pinos nas ripas de bambu usadas como reforço. Para tanto, oito vigas de concreto foram ensaiadas, das quais seis foram reforçadas com ripas de bambu Dendrocalamus giganteus Munro cravejadas de pinos e duas armadas com ripas de bambu sem a presença dos pinos, como referência. Usaram-se dois tipos de pino: de aço ou de bambu, em número de dois, três ou quatro pinos entre nós. Curvas força-deslocamento e força-deformação dos materiais são apresentadas e discutidas, em que os resultados mostraram que a cravação dos pinos produziu um aumento de rigidez das vigas; contudo, o furo feito para colocação do pino reduziu localmente a seção transversal da ripa de bambu e, consequentemente, a resistência última das vigas. Finalmente, resultados similares foram obtidos em vigas reforçadas com pino de aço ou de bambu.One drawback of bamboo as concrete reinforcement beams is the relative displacement between the two materials. The research reported in this paper aimed to experimentally investigate the improvement of bamboo-concrete-bond by means of nailing. Eight concrete beams were tested, six of them reinforced with Dendrocalamus giganteus Munro nailed bamboo-splints and two reference beams, reinforced with bamboo-splints without pins. Steel pins or bamboo pins were used. Two, three and four pins were nailed between bamboo nodes. Load-displacement and load-strain curves are presented and discussed. The results showed that the pins improved the beam stiffness; nevertheless, they reduced locally the transversal section of the bamboo splint and, consequently, the ultimate load. Finally, similar results were showed by beams reinforced

Defining Small and Medium Enterprises: a critical review

Directory of Open Access Journals (Sweden)

Gentrit Berisha

2015-03-01

Full Text Available The OECD estimates that small and medium enterprises account for 90% of firms and employ 63% of the workforce in the world (Munro: 2013. Small and medium enterprises account for that amount of businesses thatit is senseless the arbitrariness with which they are defined. Language mainly used for definition is numbers, but it is difficult to find two institutions, statistical agencies or countries who speak the same language in terms of small and medium enterprises. Academics, authors, policy makers apply SMEdefinitions in terms of dichotomy between universality and standardization of a unique definition and relativity and sectored specialization. Although qualitative criteria-characteristics of SMEs easily distinguish them from large businesses, quantitative criteria are mainlyused for their dimensional classification. This paper deals with a critical approachto the definition of small and medium enterprises, inconsistencies in criteria and various proposed approaches to the definition towards universal acceptance.

Normal frontal lobe gray matter-white matter CT volume ratio in children

International Nuclear Information System (INIS)

Thompson, J.R.; Engelhart, J.; Hasso, A.N.; Hinshaw, D.B. Jr.

1985-01-01

We attempted to establish a computed tomographic value representing the normal volume ratio of gray matter to white matter (G/W) in children in order to have a baseline for studying various developmental disorders such as white matter hypoplasia. The records of 150 children 16 years of age or younger who had normal cranial computed tomography were reviewed. From these a group of 119 were excluded for various reasons. The remaining 3 were presumed to have normal brains. Using the region of interest function for tracing gray and white matter boundaries, superior and ventral to the foramen of Munro area, measurements were determined for consecutive adjacent frontal slices. Volumes were then calculated for both gray and white matter. A volume ratio of 2.010 (sigma=0.349), G/W, was then derived from each of 31 children. The clinical value of this ratio will be determined by future investigation. (orig.)

Análise química do bambu-gigante (Dendrocalamus giganteus Wall. ex Munro em diferentes idades

Directory of Open Access Journals (Sweden)

Nelson Potenciano Marinho

2012-06-01

Full Text Available http://dx.doi.org/10.5902/198050985749O bambu é uma planta monocotiledônea de origem tropical, de rápido crescimento, sendo considerado um importante regenerador ambiental devido ao seu sistema radicular. O Dendrocalamus giganteus é popularmente conhecido por bambu-gigante, sendo uma espécie entouceirante de grande porte, cujos colmos podem variar de 24 a 40 metros de altura, com diâmetros entre 10 e 20 cm. Esse trabalho teve como objetivo analisar quimicamente os colmos do bambu-gigante visando fornecer informações sobre a sua composição química nas idades de 2 a 6 anos. Os colmos do bambu foram coletados na área Experimental Agrícola do Departamento de Engenharia Mecânica da UNESP-Bauru, onde é realizado o manejo sistemático de diversas espécies de bambu para fins de pesquisas e divulgação dessa planta. Foram retiradas amostras da base entre bambus com idade de 2 a 6 anos de uma mesma touceira, totalizando 5 amostras, com 2 metros de altura cada, colhidas na lua minguante no mês de março. As análises químicas foram feitas com os entrenós, utilizando as normas e procedimentos da TAPPI. A porcentagem média de extrativos em água quente, extrativos em água fria, extrativos totais e teor de cinzas não apresentaram relação direta com a idade. A maior porcentagem de extrativos em água quente, com valor de 12,04%, extrativos em água fria, com 10,25%, e extrativos totais, com 12,91%, foi observada aos 2 anos de idade. A maior porcentagem de cinzas foi obtida aos três anos, com valores de 1,09%. O teor médio de extrativos em NaOH diminui de 25,72% aos dois anos para 20,17% aos seis anos de idade. O mesmo comportamento foi observado para os extrativos em etanol tolueno, diminuindo de 10,91% para 4,61%. O teor médio de lignina não sofreu influência da idade, variando de 22,66 a 24,11%.

Earliest porotic hyperostosis on a 1.5-million-year-old hominin, olduvai gorge, Tanzania.

Directory of Open Access Journals (Sweden)

Manuel Domínguez-Rodrigo

Full Text Available Meat-eating was an important factor affecting early hominin brain expansion, social organization and geographic movement. Stone tool butchery marks on ungulate fossils in several African archaeological assemblages demonstrate a significant level of carnivory by Pleistocene hominins, but the discovery at Olduvai Gorge of a child's pathological cranial fragments indicates that some hominins probably experienced scarcity of animal foods during various stages of their life histories. The child's parietal fragments, excavated from 1.5-million-year-old sediments, show porotic hyperostosis, a pathology associated with anemia. Nutritional deficiencies, including anemia, are most common at weaning, when children lose passive immunity received through their mothers' milk. Our results suggest, alternatively, that (1 the developmentally disruptive potential of weaning reached far beyond sedentary Holocene food-producing societies and into the early Pleistocene, or that (2 a hominin mother's meat-deficient diet negatively altered the nutritional content of her breast milk to the extent that her nursing child ultimately died from malnourishment. Either way, this discovery highlights that by at least 1.5 million years ago early human physiology was already adapted to a diet that included the regular consumption of meat.

Short-term memory of TiO2-based electrochemical capacitors: empirical analysis with adoption of a sliding threshold

International Nuclear Information System (INIS)

Lim, Hyungkwang; Kim, Inho; Kim, Jin-Sang; Jeong, Doo Seok; Seong Hwang, Cheol

2013-01-01

Chemical synapses are important components of the large-scaled neural network in the hippocampus of the mammalian brain, and a change in their weight is thought to be in charge of learning and memory. Thus, the realization of artificial chemical synapses is of crucial importance in achieving artificial neural networks emulating the brain’s functionalities to some extent. This kind of research is often referred to as neuromorphic engineering. In this study, we report short-term memory behaviours of electrochemical capacitors (ECs) utilizing TiO 2 mixed ionic–electronic conductor and various reactive electrode materials e.g. Ti, Ni, and Cr. By experiments, it turned out that the potentiation behaviours did not represent unlimited growth of synaptic weight. Instead, the behaviours exhibited limited synaptic weight growth that can be understood by means of an empirical equation similar to the Bienenstock–Cooper–Munro rule, employing a sliding threshold. The observed potentiation behaviours were analysed using the empirical equation and the differences between the different ECs were parameterized. (paper)

Volumetric, Viscometric and Excess Properties of Binary Mixtures of 1-Iodobutane with Benzene, Toluene, o-Xylene, m-Xylene, p-Xylene, and Mesitylene at Temperatures from 303.15 to 313.15 K

Directory of Open Access Journals (Sweden)

Sangita Sharma

2013-01-01

Full Text Available Densities and viscosities have been determined for binary mixtures of 1-iodobutane with benzene, toluene, o-xylene, m-xylene, p-xylene, and mesitylene at 303.15, 308.15, and 313.15 K for the entire composition range at atmospheric pressure. The excess molar volumes, , deviations in viscosity, Δη, and excess Gibbs’ free energy of activation flow, Δ have been calculated from the experimental values. The experimental data were fitted to Redlich-Kister polynomial equation. The variations of these parameters with composition of the mixtures and temperature have been discussed in terms of molecular interactions occurring in these mixtures. Further, the viscosities of these binary mixtures were calculated theoretically from their corresponding pure component data by using empirical relations like Bingham, Arrhenius and Eyring, Kendall and Munroe, Hind, Katti and Chaudhari, Grunberg and Nissan, and Tamura and Kurata. Comparison of various interaction parameters has been expressed to explain the intermolecular interactions between iodobutane and selected hydrocarbons.

A mediação da informação aliada ao uso das tecnologias da informação e comunicação em uma biblioteca escolar.

Directory of Open Access Journals (Sweden)

Silvana Aparecida Borsetti Gregorio Vidotti

2014-10-01

Full Text Available Introdução: A mediação da informação promove a aproximação entre o usuário e o conteúdo de seu interesse.Objetivos: Apresentar um recorte da dissertação “Apropriação das Tecnologias de Informação e Comunicação em bibliotecas escolares: em busca de um espaço dinâmico”, onde mostraremos as diversas formas para que sejam realizadas interferências no sentido de satisfazer as necessidades informacionais em uma biblioteca escolar, baseada nas propostas do “Manifesto de um bibliotecário 2.0” de Laura Cohen, bibliotecária da Universidade de Albany, nos Estados Unidos, além de apresentar estudos feitos pelo grupo de bibliotecárias australianas: Helen Partridge, Julie Lee e Carrie Munro, que organizaram um projeto para identificar as principais habilidades, conhecimentos e atributos exigidos pelo “bibliotecário 2.0”, do qual participaram 81 profissionais australianos.Metodologia: Esse estudo buscou uma pesquisa qualitativa e com análise bibliográfica das investigações apresentadas pela bibliotecária norte americana Laura Cohen e das três pesquisadoras australianas Helen Partridge, Julie Lee e Carrie Munro, para dessa forma fazermos uma comparação entre realidades e experiências, tão adversas e ao mesmo tempo semelhantes com a nossa realidade brasileira.Resultados: Não basta utilizar as TIC na biblioteca só pela modernidade ou variedade de aplicações. É necessário ter consciência da utilidade destes ou de qualquer outro meio de interesse dos alunos para poder mostrar sua qualidade e a utilidade prática. O bibliotecário, antes de utilizar as TIC, deve fazer um levantamento profundo sobre as problemáticas com as quais esse instrumento de trabalho pode contribuir de forma relevante.Conclusão: Eventos, atividades e estruturação física do ambiente proporcionam um claro exemplo de mediação da informação em uma biblioteca escolar, evidenciando a interferência positiva que o profissional da informa

Effects of mesh size and escape gaps on discarding in an Australian giant mud crab (Scylla serrata trap fishery.

Directory of Open Access Journals (Sweden)

Matt K Broadhurst

Full Text Available In response to concerns over excessive discarding from Australian recreational round traps (with four funnel entrances used to target giant mud crabs, Scylla serrata, an experiment was done to assess the independent and cumulative utility of paired, bottom-located horizontal escape gaps (46×120 mm and increasing mesh size (from 51 to 101 mm. Compared to conventional traps comprising 51-mm mesh throughout, those with the same mesh size and escape gaps caught significantly fewer (by 95% undersize (<85 mm carapace length--CL crabs while maintaining legal catches. Traps made from 101-mm mesh (but with the same funnel entrances as conventional designs and with and without escape gaps similarly retained fewer undersize crabs and also yellowfin bream Acanthopagrus australis (the key bycatch species by up to 94%, but there were concomitant reductions in fishing power for legal sizes of S. serrata. Although there were no immediate mortalities among any discarded crabs, there was a greater bias towards wounding among post molts than late inter-molts and less damage to individuals in the 101-mm conventional than 51-mm conventional traps (without escape gaps. The results support retrospectively fitting escape gaps in conventional S. serrata traps as a means for reducing discarding, but additional work is required to determine appropriate mesh sizes/configurations that maximize species and size selectivity.

Activity associated with the solar origin of coronal mass ejections

Science.gov (United States)

Webb, D. F.; Hundhausen, A. J.

1987-01-01

Solar coronal mass ejections (CMEs) observed in 1980 with the HAO Coronagraph/Polarimeter on the Solar Maximum Mission (SMM) satellite are compared with other forms of solar activity that might be physically related to the ejections. The solar phenomena checked and the method of association used were intentionally patterned after those of Munro et al.'s (1979) analysis of mass ejections observed with the Skylab coronagraph to facilitate comparison of the two epochs. Comparison of the results reveals that the types and degree of CME associations are similar near solar activity minimum and at maximum. For both epochs, most CMEs with associations had associated eruptive prominences, and the proportions of association of all types of activity were similar. A high percentage of association between SMM CMEs and X-ray long duration events is also found, in agreement with Skylab results. It is concluded that most CMEs are the result of the destabilization and eruption of a prominence and its overlying coronal structure, or of a magnetic structure capable of supporting a prominence.

Local stem cell depletion model for normal tissue damage

International Nuclear Information System (INIS)

Yaes, R.J.; Keland, A.

1987-01-01

The hypothesis that radiation causes normal tissue damage by completely depleting local regions of tissue of viable stem cells leads to a simple mathematical model for such damage. In organs like skin and spinal cord where destruction of a small volume of tissue leads to a clinically apparent complication, the complication probability is expressed as a function of dose, volume and stem cell number by a simple triple negative exponential function analogous to the double exponential function of Munro and Gilbert for tumor control. The steep dose response curves for radiation myelitis that are obtained with our model are compared with the experimental data for radiation myelitis in laboratory rats. The model can be generalized to include other types or organs, high LET radiation, fractionated courses of radiation, and cases where an organ with a heterogeneous stem cell population receives an inhomogeneous dose of radiation. In principle it would thus be possible to determine the probability of tumor control and of damage to any organ within the radiation field if the dose distribution in three dimensional space within a patient is known

Implosion anisotropy of neutron kinetic energy distributions as measured with the neutron time-of-flight diagnostics at the National Ignition Facility

Science.gov (United States)

Hartouni, Edward; Eckart, Mark; Field, John; Grim, Gary; Hatarik, Robert; Moore, Alastair; Munro, David; Sayer, Daniel; Schlossberg, David

2017-10-01

Neutron kinetic energy distributions from fusion reactions are characterized predominantly by the excess energy, Q, of the fusion reaction and the variance of kinetic energy which is related to the thermal temperature of the plasma as shown by e.g. Brysk. High statistics, high quality neutron time-of-flight spectra obtained at the National Ignition Facility provide a means of measuring small changes to the neutron kinetic energy due to the spatial and temporal distribution of plasma temperature, density and velocity. The modifications to the neutron kinetic energy distribution as described by Munro include plasma velocity terms with spatial orientation, suggesting that the neutron kinetic energy distributions could be anisotropic when viewed by multiple lines-of-sight. These anisotropies provide a diagnostic of burn averaged plasma velocity distributions. We present the results of measurements made for a variety of DT implosions and discuss their possible physical interpretations. This work was performed under the auspices of the U.S. Department of Energy by Lawrence Livermore National Laboratory under contract DE-AC52-07NA27344. Lawrence Livermore National Security, LLC.

Ribonucleic acids in different tea fungus beverages

Directory of Open Access Journals (Sweden)

Malbaša Radomir V.

2003-01-01

Full Text Available In human nutrition, nucleic acids have to be balanced and limited up to 2 g/day because purines are degraded to urate, and excessive production of urate is a cause of gout which primarily affects adult males. Tea fungus beverage is a well known drink with high nutritional value and certain curative effects. Its benefits have been proved in a number of studies but it is still necessary to examine some potential harmful effects of this beverage. The aim of this paper was to investigate content of ribonucleic acids (RNA produced during tea fungus fermentation on a usual substrate sweetened black tea, and on Jerusalem artichoke tubers (J.A.T extract using method by Munro and Fleck (1966. pH, ribonucleic acids and also the production of proteins that affect purity of nucleic acids preparations were monitored. A higher value of RNA has been noticed in J.A.T. beverage (0.57 mg/ml and with observation of usual daily dose of the beverage it is completely safe and useful one.

The physical structure of coronal holes

International Nuclear Information System (INIS)

Pneuman, G.W.

1978-11-01

The longitudinal geometrical structure of solar wind streams as observed at the orbit of earth is governed by two mechanisms - solar rotation and, most importantly, the geometry of the inner coronal magnetic fields. Here, we study the influence of the latter for the polar coronal hole observed by Skylab in 1973 and modeled by Munro and Jackson (1977). The influence of coronal heating on the properties of the solar wind in this geometry is also investigated. To do this, a crude exponentially damped heating function similar to that used by Kopp and Orrall (1976) is introduced into the solar wind equations. We find that increased heating produces higher temperatures in the inner corona but has little effect upon the temperature at 1 A.U. However, the density at 1 A.U. is increased significantly due to the increase in scale height. The most surprising consequence of coronal heating is its effect on the solar wind velocity, being that the velocity at 1 A.U. is actually decreased by heating in the inner corona. Physical reasons for this effect are discussed. (orig./WL) [de

Nonlinear Hebbian Learning as a Unifying Principle in Receptive Field Formation.

Science.gov (United States)

Brito, Carlos S N; Gerstner, Wulfram

2016-09-01

The development of sensory receptive fields has been modeled in the past by a variety of models including normative models such as sparse coding or independent component analysis and bottom-up models such as spike-timing dependent plasticity or the Bienenstock-Cooper-Munro model of synaptic plasticity. Here we show that the above variety of approaches can all be unified into a single common principle, namely nonlinear Hebbian learning. When nonlinear Hebbian learning is applied to natural images, receptive field shapes were strongly constrained by the input statistics and preprocessing, but exhibited only modest variation across different choices of nonlinearities in neuron models or synaptic plasticity rules. Neither overcompleteness nor sparse network activity are necessary for the development of localized receptive fields. The analysis of alternative sensory modalities such as auditory models or V2 development lead to the same conclusions. In all examples, receptive fields can be predicted a priori by reformulating an abstract model as nonlinear Hebbian learning. Thus nonlinear Hebbian learning and natural statistics can account for many aspects of receptive field formation across models and sensory modalities.

The depositional environments of Schöningen 13 II-4 and their archaeological implications.

Science.gov (United States)

Stahlschmidt, Mareike C; Miller, Christopher E; Ligouis, Bertrand; Goldberg, Paul; Berna, Francesco; Urban, Brigitte; Conard, Nicholas J

2015-12-01

Geoarchaeological research at the Middle Pleistocene site of Schöningen 13 II-4, often referred to as the Speerhorizont, has focused on describing and evaluating the depositional contexts of the well-known wooden spears, butchered horses, and stone tools. These finds were recovered from the transitional contact between a lacustrine marl and an overlying organic mud, originally thought to be a peat that accumulated in place under variable moisture conditions. The original excavators proposed that hominin activity, including hunting and butchery, occurred on a dry lake shore and was followed by a rapid sedimentation of organic deposits that embedded and preserved the artifacts. Our geoarchaeological analysis challenges this model. Here, we present evidence that the sediments of Schöningen 13 II-4 were deposited in a constantly submerged area of a paleolake. Although we cannot exclude the possibility that the artifacts were deposited during a short, extreme drying event, there are no sedimentary features indicative of surface exposure in the sediments. Accordingly, this paper explores three main alternative models of site formation: anthropogenic disposal of materials into the lake, a geological relocation of the artifacts, and hunting or caching on lake-ice. These models have different behavioral ramifications concerning hominin knowledge and exploitation of the landscape and their subsistence strategies. Copyright © 2015 Elsevier Ltd. All rights reserved.

Assessment of statistical agreement of three techniques for the study of cut marks: 3D digital microscope, laser scanning confocal microscopy and micro-photogrammetry.

Science.gov (United States)

Maté-González, Miguel Ángel; Aramendi, Julia; Yravedra, José; Blasco, Ruth; Rosell, Jordi; González-Aguilera, Diego; Domínguez-Rodrigo, Manuel

2017-09-01

In the last few years, the study of cut marks on bone surfaces has become fundamental for the interpretation of prehistoric butchery practices. Due to the difficulties in the correct identification of cut marks, many criteria for their description and classification have been suggested. Different techniques, such as three-dimensional digital microscope (3D DM), laser scanning confocal microscopy (LSCM) and micro-photogrammetry (M-PG) have been recently applied to the study of cut marks. Although the 3D DM and LSCM microscopic techniques are the most commonly used for the 3D identification of cut marks, M-PG has also proved to be very efficient and a low-cost method. M-PG is a noninvasive technique that allows the study of the cortical surface without any previous preparation of the samples, and that generates high-resolution models. Despite the current application of microscopic and micro-photogrammetric techniques to taphonomy, their reliability has never been tested. In this paper, we compare 3D DM, LSCM and M-PG in order to assess their resolution and results. In this study, we analyse 26 experimental cut marks generated with a metal knife. The quantitative and qualitative information registered is analysed by means of standard multivariate statistics and geometric morphometrics to assess the similarities and differences obtained with the different methodologies. © 2017 The Authors Journal of Microscopy © 2017 Royal Microscopical Society.

Copper uptake kinetics and regulation in a marine fish after waterborne copper acclimation

International Nuclear Information System (INIS)

Dang Fei; Zhong Huan; Wang Wenxiong

2009-01-01

The uptake kinetics and regulation of copper in a marine predatory fish, the black sea bream Acanthopagrus schlegeli after acclimation to waterborne Cu were examined, using radiotracer techniques. The dissolved Cu uptake followed a linear pattern during the time of exposure, and the calculated uptake rate constant was 6.24 L kg -1 day -1 . The efflux rate constant was 0.091 day -1 following dietary uptake of Cu, and the dietary assimilation efficiency (AE) of Cu varied between 1.7% and 10.9% after the fish were fed with three types of prey (oysters, clams and brine shrimp). After the fish were acclimated at a nominal concentration of 50 μg Cu L -1 for 14 days, the Cu uptake rate and efflux rate constant did not change significantly, but the Cu body concentrations and metallothionein (MT) concentrations in fish tissues increased significantly. Subcellular Cu distributions were also modified. Significant MT induction was observed in response to increased Cu tissue concentrations, indicating that MT rather than the uptake kinetics may play a primary role in Cu regulation during waterborne Cu acclimation in this marine fish. Moreover, the high Cu efflux may also be important in Cu regulation during long-term exposure. Our modeling calculations indicated that dietary uptake was likely to be the main route for Cu bioaccumulation in the fish, and the relative contribution of waterborne and dietary uptake depended on the bioconcentration factor (BCF) of the prey and ingestion rate of fish.

Do coronal holes influence cosmic ray daily harmonics

International Nuclear Information System (INIS)

Ahluwalia, H.S.

1977-01-01

Coronal holes are identified by their low emissivity in either EUV (Munro and Withrobe, 1973) or in X-rays (Krieger et al, 1973). They are seats of unidirectional magnetic fields. Also, high speed solar wind streams originate in them. Also, high speed solar wind streams originate in then (Krieger et al, 1973; Neupert and Pizzo, 1974; Nolte et al, 1976). Coronal holes often extend over a wide range of heliolatitudes (Timothy et al, 1975). Elsewhere in the Proceedings we have presented results on the long term changes observed in the amplitudes and the times of maximum of the diurnal, the semidiurnal and the tridiurnal variations of cosmic rays, at low (neutrons) and at high (underground muons) primary rigidities (Ahluwalia, 1977). We have shown that a dramatic shift to early hours is noticeable in the times of maxima of the harmonics during 1971-72 period. In this paper we examine the nature of the contributions of off-ecliptic cosmic rays of high enough rigidity, streaming under the influence of large scale ordered interplanetary magnetic field set up by the coronal holes, to the cosmic ray daily harmonics. Some models are presented and discussed in a preliminary fashion. (author)

Romance and Freedom: Nelson and Winnie Mandela’s Politics of Gender in Three Post-Apartheid Novels

Directory of Open Access Journals (Sweden)

Lorenzo Mari

2014-11-01

Full Text Available This paper aims to retrace the influence of the politics of gender enacted by Nelson and Winnie Mandela on post-apartheid gender relationships, as represented in three novels: Phaswane Mpe’s Welcome to Our Hillbrow (2001, Njabulo Ndebele’s The Cry of Winnie Mandela (2003 and Lewis Nkosi’s Mandela’s Ego (2006. Recently, Nelson and Winnie Mandela’s marriage has been also described as the “unusual founding-family romance” (Munro 2014 of the post-apartheid nation. Their marriage lasted from 1958 to 1992, including, thus, the last decades of the anti-apartheid struggle, as well as the demise of the apartheid regime. Their separation, which was due in the first place to Nelson Mandela’s imprisonment and, later, to their divorce, eventually marked the disruption of this founding-family romance, making it “unusual”. As a consequence, the deconstructive take on Nelson Mandela’s fatherhood and masculinity and Winnie Mandela’s femininity and motherhood which is enacted in the three novels also allows to reassess the possibility of that “founding-family romance”, envisioning an alternative understanding of the origins of the post-apartheid South African nation.

Effects of thermal treatment on the physicochemical characteristics of giant bamboo

Directory of Open Access Journals (Sweden)

Wandivaldi Antonio Colla

2011-09-01

Full Text Available Despite countless use possibilities for bamboo, this material has two major disadvantages. One drawback is the low natural durability of most bamboo species due to presence of starch in their parenchyma cells. The other equally important drawback is the tendency bamboo has to present dimensional variations if subjected to environmental change conditions. In an attempt to minimize these inconveniences, strips (laths of Dendrocalamus giganteus Munro were taken from different portions of the culm and subjected to several temperatures, namely 140 °C, 180 °C, 220 °C, 260 °C and 300 °C under laboratory conditions, at the ESALQ-USP college of agriculture. The thermal treatment process was conducted in noninert and inert atmospheres (with nitrogen, depending on temperature Specimens were then subjected to physicomechanical characterization tests in order to determine optimum thermal treatment conditions in which to preserve to the extent possible the original bamboo properties. Results revealed that there is an optimum temperature range, between 140 ° and 220 °C, whereby thermally treated bamboo does not significantly lose its mechanical properties while at the same time showing greater dimensional stability in the presence of moisture.

Nonlinear Hebbian Learning as a Unifying Principle in Receptive Field Formation.

Directory of Open Access Journals (Sweden)

Carlos S N Brito

2016-09-01

Full Text Available The development of sensory receptive fields has been modeled in the past by a variety of models including normative models such as sparse coding or independent component analysis and bottom-up models such as spike-timing dependent plasticity or the Bienenstock-Cooper-Munro model of synaptic plasticity. Here we show that the above variety of approaches can all be unified into a single common principle, namely nonlinear Hebbian learning. When nonlinear Hebbian learning is applied to natural images, receptive field shapes were strongly constrained by the input statistics and preprocessing, but exhibited only modest variation across different choices of nonlinearities in neuron models or synaptic plasticity rules. Neither overcompleteness nor sparse network activity are necessary for the development of localized receptive fields. The analysis of alternative sensory modalities such as auditory models or V2 development lead to the same conclusions. In all examples, receptive fields can be predicted a priori by reformulating an abstract model as nonlinear Hebbian learning. Thus nonlinear Hebbian learning and natural statistics can account for many aspects of receptive field formation across models and sensory modalities.

Numerical modeling for longwall pillar design: a case study from a typical longwall panel in China

Science.gov (United States)

Zhang, Guangchao; Liang, Saijiang; Tan, Yunliang; Xie, Fuxing; Chen, Shaojie; Jia, Hongguo

2018-02-01

This paper presents a new numerical modeling procedure and design principle for longwall pillar design with the assistance of numerical simulation of FLAC3D. A coal mine located in Yanzhou city, Shandong Province, China, was selected for this case study. A meticulously validated numerical model was developed to investigate the stress changes across the longwall pillar with various sizes. In order to improve the reliability of the numerical modeling, a calibration procedure is undertaken to match the Salamon and Munro pillar strength formula for the coal pillar, while a similar calibration procedure is used to estimate the stress-strain response of a gob. The model results demonstrated that when the coal pillar width was 7-8 m, most of the vertical load was carried by the panel rib, whilst the gateroad was overall in a relatively low stress environment and could keep its stability with proper supports. Thus, the rational longwall pillar width was set as 8 m and the field monitoring results confirmed the feasibility of this pillar size. The proposed numerical simulation procedure and design principle presented in this study could be a viable alternative approach for longwall pillar design for other similar projects.

Avaliação de estrutura de bambu como elemento construtivo para casa de vegetação Evaluation of the bamboo structure use as constructive element for greenhouses

Directory of Open Access Journals (Sweden)

Wellington Mary

2007-04-01

Full Text Available O uso da tecnologia do cultivo protegido no Brasil, para a produção de hortaliças e plantas ornamentais, passou por diversas fases de adaptação, visando a atender às necessidades de oferta e de qualidade dos produtos, com a preocupação de minimizar os custos de produção e os efeitos negativos do clima. A grande maioria dessas adaptações partiu da iniciativa dos próprios agricultores, utilizando-se de diferentes materiais e de outros artifícios para contornar problemas cotidianos. O experimento foi realizado na área da Faculdade de Engenharia Agrícola/UNICAMP, no período compreendido entre dezembro de 2002 e janeiro de 2003, com o objetivo de avaliar as deformações do sistema construtivo de estrutura de bambu para utilização em casa de vegetação, em diferentes espaçamentos entre colunas e sob diferentes esforços verticais de cargas. Testou-se o uso de vigas e colunas construídas com colmos de bambu da espécie Bambusa tuldoides Munro e estruturadas com espaçadores de plástico, especialmente projetados para facilitar e padronizar a construção, conferindo-lhe maior resistência e estabilidade. Foram avaliados três espaçamentos entre colunas (2,0; 2,5 e 3,0 m sob diferentes esforços de carga, dos quais o melhor resultado foi obtido com o espaçamento de 2,5 m.The use of technology to protect and produce vegetables and ornamental plants was developed over several adaptation phases that supported the demand for quality and amount of products. These developments also reduced production costs and climate damage to the crops. Many of these adaptations were carried out by farmers on their own initiative, using different materials and devices to solve their problems. This study was carried out at Agricultural Engineering College - Campinas University/UNICAMP, from December 2002 to January 2003, with the objective of evaluating the deformations of the constructive system of bamboo structure for greenhouses, submitted to

Characterization and antibiotic susceptibility of Listeria monocytogenes isolated from poultry and red meat in Morocco

Directory of Open Access Journals (Sweden)

Hayat Ennaji

2008-09-01

Full Text Available Hayat Ennaji1,2, Mohammed Timinouni2, My Mustapha Ennaji3, Mohammed Hassar1, Nozha Cohen11Laboratoire de Microbiologie et Hygiène des Aliments et de l’Environnement, Institut Pasteur du Maroc., Casablanca, Morocco; 2Laboratoire de Microbiologie et Biologie Moléculaire, Institut Pasteur du Maroc., Casablanca, Morocco; 3Laboratoire de Virologie et Hygiène and Microbiologie., Faculté des Sciences et Techniques - Mohammedia, Université Hassan II, Mohammedia, MoroccoAbstract: This study was carried out on 426 samples of raw meats collected from butcheries and supermarkets in Casablanca, Morocco. The samples were examined for the occurrence of Listeria species. Strains of Listeria monocytogenes were characterized by several biochemical tests and confirmed by polymerase chain reaction (PCR. β-hemolytic cultures and nonhemolytic isolates were tested for biochemical properties with the Listeria API test. Among the 43 Listeria species isolates; we identified 10 strains for L. monocytogenes (23.3%, 31 strains for L. innocua (72.1% and 2 strains for L. welshimeri (4.6%. Strains of L. monocytogenes were separated by multiplex PCR; two serogroups IIb and IVb were thus differentiated. Antibiotic susceptibility of L. monocytogenes to 21 antibiotics was determined by the disk diffusion method. All isolates were susceptible to a wide range of the tested antibiotics with the exception of nalidixic acid, colistine and cephalosporins second and third generation for which they were all resistant.Keywords: antibiotic susceptibility, Listeria monocytogenes, meat, PCR

Contamination of bovine, sheep and goat meat with Brucella spp.

Directory of Open Access Journals (Sweden)

Francesco Casalinuovo

2016-06-01

Full Text Available A study was conducted in order to evaluate the contamination by Brucella spp. of meat from animals slaughtered because they had resulted positive for brucellosis at some time during their life. After slaughter and before delivery to market outlets, swab samples were taken from 307 carcasses of infected animals: 40 cattle, 60 sheep and 207 goats. The swabs were subsequently analysed by means of polymerase chain reaction (PCR tests. In addition, bacteriological tests were carried out on the lymph nodes and internal organs of the same animals. Brucella spp. was detected by means of PCR in 25/307 carcasses (8%: 1 bovine (2.5%, 9 sheep (15% and 15 goats (7.2% and was isolated by means of a cultural method in 136/307 carcasses (44%. Moreover, additional analysis, performed on lymph nodes from the same carcasses that had proved positive by PCR, allowed highlighting type 3 Brucella abortus in the bovine carcass and type 3 Brucella melitensis in the sheep and goat carcasses. The study shows that cattle, sheep and goats meat of animals slaughtered because they had tested positive for brucellosis may be contaminated by Brucella spp. As this could constitute a real risk of transmission to both butchery personnel and consumers, the meat of animals infected by Brucella spp. should be analysed before being marketed. In this respect, PCR technique performed on swabs proved to be more useful, practical and faster than the traditional bacteriological method.

Copper uptake kinetics and regulation in a marine fish after waterborne copper acclimation

Energy Technology Data Exchange (ETDEWEB)

Dang Fei; Zhong Huan [AMCE and Department of Biology, Hong Kong University of Science and Technology (HKUST), Clear Water Bay, Kowloon (Hong Kong); Wang Wenxiong, E-mail: wwang@ust.hk [AMCE and Department of Biology, Hong Kong University of Science and Technology (HKUST), Clear Water Bay, Kowloon (Hong Kong)

2009-09-14

The uptake kinetics and regulation of copper in a marine predatory fish, the black sea bream Acanthopagrus schlegeli after acclimation to waterborne Cu were examined, using radiotracer techniques. The dissolved Cu uptake followed a linear pattern during the time of exposure, and the calculated uptake rate constant was 6.24 L kg{sup -1} day{sup -1}. The efflux rate constant was 0.091 day{sup -1} following dietary uptake of Cu, and the dietary assimilation efficiency (AE) of Cu varied between 1.7% and 10.9% after the fish were fed with three types of prey (oysters, clams and brine shrimp). After the fish were acclimated at a nominal concentration of 50 {mu}g Cu L{sup -1} for 14 days, the Cu uptake rate and efflux rate constant did not change significantly, but the Cu body concentrations and metallothionein (MT) concentrations in fish tissues increased significantly. Subcellular Cu distributions were also modified. Significant MT induction was observed in response to increased Cu tissue concentrations, indicating that MT rather than the uptake kinetics may play a primary role in Cu regulation during waterborne Cu acclimation in this marine fish. Moreover, the high Cu efflux may also be important in Cu regulation during long-term exposure. Our modeling calculations indicated that dietary uptake was likely to be the main route for Cu bioaccumulation in the fish, and the relative contribution of waterborne and dietary uptake depended on the bioconcentration factor (BCF) of the prey and ingestion rate of fish.

Mercury Bioaccumulation in Tropical Mangrove Wetland Fishes: Evaluating Potential Risk to Coastal Wildlife.

Science.gov (United States)

Le, Dung Quang; Satyanarayana, Behara; Fui, Siau Yin; Shirai, Kotaro

2018-03-26

The present study, aimed at observing the total concentration of mercury (Hg) in edible finfish species with an implication to human health risk, was carried out from the Setiu mangrove wetlands on the east coast of Peninsular Malaysia. Out of 20 species observed, the highest Hg concentrations were found among carnivores-fish/invertebrate-feeders, followed by omnivores and carnivores-invertebrate-feeders, while the lowest concentrations in herbivores. The Hg concentrations varied widely with fish species and body size, from 0.12 to 2.10 mg/kg dry weight. A positive relationship between body weight and Hg concentration was observed in particular for Toxotes jaculatrix and Tetraodon nigroviridis. Besides the permissible range of Hg concentration up to 0.3 mg/kg (cf. United States Environmental Protection Agency (USEPA)) in majority of species, the carnivore feeders such as Acanthopagrus pacificus, Gerres filamentosus, and Caranx ignobilis have shown excess amounts (> 0.40 mg/kg flesh weight) that raising concerns over the consumption by local people. However, the weekly intake of mercury-estimated through the fish consumption in all three trophic levels-suggests that the present Hg concentrations are still within the range of Provisional Tolerable Weekly Intake (PTWI) reported by the Joint FAO/WHO Expert Committee on Food Additives (JECFA). Perhaps, a multi-species design for Hg monitoring at Setiu wetlands would be able to provide further insights into the level of toxicity transfer among other aquatic organisms and thereby a strong health risk assessment for the local communities.

Evolution of depleted mantle: The lead perspective

Science.gov (United States)

Tilton, George R.

1983-07-01

Isotopic data have established that, compared to estimated bulk earth abundances, the sources of oceanic basaltic lavas have been depleted in large ion lithophile elements for at least several billions of years. Various data on the Tertiary-Mesozoic Gorgona komatiite and Cretaceous Oka carbonatite show that those rocks also sample depleted mantle sources. This information is used by analogy to compare Pb isotopic data from 2.6 billion year old komatiite and carbonatite from the Suomussalmi belt of eastern Finland and Munro Township, Ontario that are with associated granitic rocks and ores that should contain marked crustal components. Within experimental error no differences are detected in the isotopic composition of initial Pb in either of the rock suites. These observations agree closely with Sr and Nd data from other laboratories showing that depleted mantle could not have originated in those areas more than a few tenths of billions of years before the rocks were emplaced. On a world-wide basis the Pb isotope data are consistent with production of depleted mantle by continuous differentiation processes acting over approximately the past 3 billion years. The data show that Pb evolution is more complex than the simpler models derived from the Rb-Sr and Sm-Nd systems. The nature of the complexity is still poorly understood.

Psoriasiform Dermatophytosis in a Bulgarian Child

Directory of Open Access Journals (Sweden)

Anastasiya Atanasova Chokoeva

2018-01-01

Full Text Available Although tinea capitis is the most common fungal infection in children, significant changes have been reported in its epidemiology worldwide, as a result from certain geographic, climatic and cultural differences in one hand, as well as the changes in its etiologic pattern. The clinical manifestation of the infection and the stage of inflammation vary from mild desquamation to severe suppurative indurated plaques in kerion - like the pattern, depending on the nature of the etiologic agent and the host-immune response. We report a case of tinea capitis profunda, caused by Trichophyton verrucosum in a 5 – year - old male patient, presented as a severe scalp and cutaneous desquamation, resembling histopathologically psoriasis, associated with severely indurated ringworm plaque in the temporal area. The performed histological examination revealed a psoriasiform pattern, without the typical Munro abscesses or Kogoj pustules. With the presented case, we want to emphasize the importance of the host’s immune reaction to zoophilic dermatophytes, such as Trichophyton verrucosum, resulting in severe and often atypical clinical manifestation, as well as the possible “Id reaction”, to avoid or minimise misdiagnosis and delayed therapy. The presented patient was treated with topical oleum acidy salicylic 10% and Terbinafine 125 mg daily with significant resolution of the complaints within the following two months.

Is food store type associated with the consumption of ultra-processed food and drink products in Brazil?

Science.gov (United States)

Machado, Priscila Pereira; Claro, Rafael Moreira; Martins, Ana Paula Bortoletto; Costa, Janaína Calu; Levy, Renata Bertazzi

2018-01-01

To analyse the association between food store type and the consumption of ultra-processed products in Brazil. Data from the 2008-2009 Household Budget Survey involving a probabilistic sample of 55 970 Brazilian households. Food stores were grouped into nine categories. Foods and drinks were grouped according to characteristics of food processing. The contribution of each food store type to the total energy acquired from each food processing group, and according to quintiles of consumption of ultra-processed products, was estimated. Exploratory factor analysis was conducted to identify a pattern of food store usage. Linear regression models were performed to estimate the relationship between the purchase pattern and the consumption of ultra-processed products. In line with their larger market share, supermarkets accounted for 59 % of total energy and participated most in acquisition for three food groups, with emphasis on ultra-processed products (60·4 % of energy). The participation of supermarkets in total purchase tended to increase in populations with higher consumption of ultra-processed products, while the participation of small markets and small producers tended to decrease. The purchase pattern characterized by use of traditional retail (street fairs and vendors, small markets, small farmers, butcheries) was associated with a smaller consumption of ultra-processed products. Food policies and interventions aiming to reduce the consumption of ultra-processed products should consider the influence of supermarkets on the consumption of these products. A purchase pattern based on traditional retail constitutes an important tool for promoting healthy eating in Brazil.

Applying acoustic telemetry to understand contaminant exposure and bioaccumulation patterns in mobile fishes.

Science.gov (United States)

Taylor, Matthew D; van der Meulen, Dylan E; Brodie, Stephanie; Cadiou, Gwenaël; Knott, Nathan A

2018-06-01

Contamination in urbanised estuaries presents a risk to human health, and to the viability of populations of exploited species. Assessing animal movements in relation to contaminated areas may help to explain patterns in bioaccumulation, and assist in the effective management of health risks associated with consumption of exploited species. Using polychlorinated dibenzodioxin and polychlorinated dibenzofuran (PCDD/Fs) contamination in Sydney Harbour estuary as a case study, we present a study that links movement patterns resolved using acoustic telemetry to the accumulation of contaminants in mobile fish on a multi-species basis. Fifty-four individuals across six exploited species (Sea Mullet Mugil cephalus; Luderick Girella tricuspidata; Yellowfin Bream Acanthopagrus australis; Silver Trevally Pseudocaranx georgianus; Mulloway Argyrosomus japonicus; Yellowtail Kingfish Seriola lalandi) were tagged with acoustic transmitters, and their movements tracked for up to 3years. There was substantial inter-specific variation in fish distribution along the estuary. The proportion of distribution that overlapped with contaminated areas explained 84-98% of the inter-specific variation in lipid-standardised biota PCDD/F concentration. There was some seasonal variation in distribution along the estuary, but movement patterns indicated that Sea Mullet, Yellowfin Bream, Silver Trevally, and Mulloway were likely to be exposed to contaminated areas during the period of gonadal maturation. Acoustic telemetry allows examination of spatial and temporal patterns in exposure to contamination. When used alongside biota sampling and testing, this offers a powerful approach to assess exposure, bioaccumulation, and potential risks faced by different species, as well as human health risks associated with their consumption. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

Assessment of gill pathological responses in the tropical fish yellowfin seabream of Persian Gulf under mercury exposure

Directory of Open Access Journals (Sweden)

Leila Hassaninezhad

2014-01-01

Full Text Available Gill histomorphological alterations were used to assess the effects of chronic exposure to HgCl2 on the yellowfin seabream, Acanthopagrus latus. In this regard, 90 A. latus were exposed to sublethal concentrations of HgCl2 (10, 20, 35 and 50 μg/L for 3 weeks. Treated fish were erratic and showed respiratory distress. The most common morphological abnormalities included: filaments disorganization, increase of mucus secretion, debris and blood plaques on the filaments, losing or shortening of some filaments. The most frequent histopathological changes detected in the gills included extensive lifting of the lamellar epithelium and edema of lamellae with enlarged sub-epithelial spaces, exfoliated epithelium of lamellae, telangiectasia, hypertrophy and hyperplasia of the epithelial cell resulted in partial fusion of the secondary lamellae and a reduction of the water space, club shaping of gill lamellae, blood congestion. Some more severe alternations found in the gill of fish exposed to higher levels of HgCl2 (35 and 50 μg/L included lamellar aneurysm and hemorrhages with rupture of the lamellar epithelium. According to the results of the present study, mercuric chloride could cause major histomorphological changes in the gill of A. latus, decreasing its gas exchange capability. Two mercury concentrations (10 and 20 μg/L used in the present study were in agreement with the concentration of mercury in the water of different parts of Mahshahr creeks (the north of Persian Gulf (3.66 to 15 μg/L. Therefore, based on the results the presence of pathological alteration in A. latus inhibited in the natural environment (Mahshahr creeks seems to be logical.

Hombres violentos contra la pareja: trastornos mentales y perfiles tipológicos

Directory of Open Access Journals (Sweden)

Enrique Echeburúa

2009-01-01

Full Text Available Los objetivos de este artículo teórico son analizar los trastornos mentales y los déficits psicológicos más relevantes de los hombres violentos contra la pareja, así como señalar los distintos tipos de maltratadores existentes según las clasificaciones de Holtzworth-Munroe y Stuart (1994 y de Fernández-Montalvo y Echeburúa (1997. Para ello se ha realizado una revisión de múltiples trabajos teóricos y empíricos. Los principales resultados indican que los agresores suelen presentar con frecuencia alteraciones psicológicas -falta de control sobre la ira, dificultades en la expresión de emociones, distorsiones cognitivas, déficits de habilidades de comunicación y de solución de problemas y baja autoestima-, y, en menor medida, cuadros clínicos bien definidos (por ejemplo, alcoholismo, trastornos de la personalidad, celos delirantes. En conclusión, existen diferentes tipos de hombres violentos -agresores limitados al ámbito familiar, agresores con características borderline/disfóricas y agresores violentos en general/antisociales- que requieren programas de tratamiento, adaptados a sus características y necesidades específicas. Por último, se comentan las líneas de investigación más urgentes.

Proceedings of the Northwest regional energy conference

Energy Technology Data Exchange (ETDEWEB)

Denman, A S; Comstock, D R [eds.

1978-12-01

The conference was directed toward two main objectives. First, a major portion of the proceedings were to focus on the policies, programs, and priorities of the new US DOE, and their relationships to the Pacific Northwest region. Second, the conference was to explore specific energy issues of regional significance and provide an opportunity for regional feedback on energy policies. The 10 sessions of the conference are Keynote Session: Congress, and the National Energy Plan Sen. Henry Jackson; National Perspectives on Energy Issues (I): An Overview of the NEP, Programs and Priorities of DOE (Alvin Alm and NEP - Conservation and Solar Applications (Don Beattie); and Luncheon address - Alaska Energy Issues (Robert LeResche); National Perspectives on Energy Issues (II): Utility Rate Reform - National Provisions and Relationships to the Pacific Northwest (David Bardin) and Technology for Energy and Long Term Short Alternatives (Robert Thorne); Concurrent Interest Group Sessions: State and Local Roles in Energy Planning and Decision-Making and Industry and University Roles in DOE Research and Programs; Banquet address. The US Energy Future (James Schlesinger); Regional Perspectives on Energy Issues: DOE-X - Organization and Response to Regional Needs (Randall Hardy). What Comes After Number 13 (Sterling Munro), Hanford 1978 (Alex Fremling), and Low Head Hydro and Geothermal (Richard Wood); Lucheon address - The Washington Perspective on Energy (Dixie Lee Ray); Regional Power Planning (Panel); and Conference Wrap Up Session. (MCW)

A combined analysis of the Frost Multidimensional Perfectionism Scale (FMPS), Child and Adolescent Perfectionism Scale (CAPS), and Almost Perfect Scale-Revised (APS-R): Different perfectionist profiles in adolescent high school students.

Science.gov (United States)

Sironic, Amanda; Reeve, Robert A

2015-12-01

To investigate differences and similarities in the dimensional constructs of the Frost Multidimensional Perfectionism Scale (FMPS; Frost, Marten, Lahart, & Rosenblate, 1990), Child and Adolescent Perfectionism Scale (CAPS; Flett, Hewitt, Boucher, Davidson, & Munro, 2000), and Almost Perfect Scale-Revised (APS-R; Slaney, Rice, Mobley, Trippi, & Ashby, 2001), 938 high school students completed the 3 perfectionism questionnaires, as well as the Depression Anxiety Stress Scales (DASS; Lovibond & Lovibond, 1995). Preliminary analyses revealed commonly observed factor structures for each perfectionism questionnaire. Exploratory factor analysis of item responses from the questionnaires (combined) yielded a 4-factor solution (factors were labeled High Personal Standards, Concerns, Doubts and Discrepancy, Externally Motivated Perfectionism, and Organization and Order). A latent class analysis of individuals' mean ratings on each of the 4 factors yielded a 6-class solution. Three of the 6 classes represented perfectionist subgroups (labeled adaptive perfectionist, externally motivated maladaptive perfectionist, and mixed maladaptive perfectionist), and 3 represented nonperfectionist subgroups (labeled nonperfectionist A, nonperfectionist B, and order and organization nonperfectionist). Each of the 6 subgroups was meaningfully associated with the DASS. Findings showed that 3 out of 10 students were classified as maladaptive perfectionists, and maladaptive perfectionists were more prevalent than adaptive perfectionists. In sum, it is evident that combined ratings from the FMPS, CAPS, and APS-R offer a meaningful characterization of perfectionism. (c) 2015 APA, all rights reserved).

Psoriasis or not? Review of 51 clinically confirmed cases reveals an expanded histopathologic spectrum of psoriasis.

Science.gov (United States)

Chau, Thinh; Parsi, Kory K; Ogawa, Toru; Kiuru, Maija; Konia, Thomas; Li, Chin-Shang; Fung, Maxwell A

2017-12-01

Psoriasis is usually diagnosed clinically, so only non-classic or refractory cases tend to be biopsied. Diagnostic uncertainty persists when dermatopathologists encounter features regarded as non-classic for psoriasis. Define and document classic and non-classic histologic features in skin biopsies from patients with clinically confirmed psoriasis. Minimal clinical diagnostic criteria were informally validated and applied to a consecutive series of biopsies histologically consistent with psoriasis. Clinical confirmation required 2 of the following criteria: (1) classic morphology, (2) classic distribution, (3) nail pitting, and (4) family history, with #1 and/or #2 as 1 criterion in every case RESULTS: Fifty-one biopsies from 46 patients were examined. Classic features of psoriasis included hypogranulosis (96%), club-shaped rete ridges (96%), dermal papilla capillary ectasia (90%), Munro microabscess (78%), suprapapillary plate thinning (63%), spongiform pustules (53%), and regular acanthosis (14%). Non-classic features included irregular acanthosis (84%), junctional vacuolar alteration (76%), spongiosis (76%), dermal neutrophils (69%), necrotic keratinocytes (67%), hypergranulosis (65%), neutrophilic spongiosis (61%), dermal eosinophils (49%), compact orthokeratosis (37%), papillary dermal fibrosis (35%), lichenoid infiltrate (25%), plasma cells (16%), and eosinophilic spongiosis (8%). Psoriasis exhibits a broader histopathologic spectrum. The presence of some non-classic features does not necessarily exclude the possibility of psoriasis. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Differential profile in partner aggressors: Prison vs. mandatory community intervention programs

Directory of Open Access Journals (Sweden)

Jesús J. García-Jiménez

2014-07-01

Full Text Available In Spain, there are two types of sentence for partner aggressors: prison sentence and the alternative measure, specifically psychosocial intervention programs. The goal of this study was to determine differences in the delinquent and psychopathological profile of these aggressors as a function of the prison sentence received, for which the models proposed by Dutton (1995 and Holtzworth-Munroe and Stuart (1994 were followed. The sample was made up of 50 incarcerated aggressors and 40 men sentenced to mandatory community orders. The variables were obtained through a mixed method, with supervision of penitentiary case files, clinical interview for personality disorder (SCID-II, and self-reports for the personality profile (NEO-PI-R. Binary logistic regression was used to identify the final model, which best reveals the differences between both groups. The results describe the incarcerated aggressors' profile as having more altered risk factors at the socioeconomic, delinquent, and psychopathological levels. The three variables that increase the probability of belonging to the prison inmate group, according to the final model obtained were: use of weapons, drug consumption, and personality disorder. In contrast to other investigations, the high incidence in the outcomes of the target variables, mainly drug use and personality disorder, makes us wonder whether the diagnostic method used influenced the results in contrast to the exclusive use of self-reports, a goal to be confirmed in future studies.

LLE Review 117 (October-December 2008)

Energy Technology Data Exchange (ETDEWEB)

Bittle, W., editor

2009-05-28

This volume of the LLE Review, covering October-December 2008, features 'Demonstration of the Shock-Timing Technique for Ignition Targets at the National Ignition Facility' by T. R. Boehly, V. N. Goncharov, S. X. Hu, J. A. Marozas, T. C. Sangster, D. D. Meyerhofer (LLE), D. Munro, P. M. Celliers, D. G. Hicks, G. W. Collins, H. F. Robey, O. L. Landen (LLNL), and R. E. Olson (SNL). In this article (p. 1) the authors report on a technique to measure the velocity and timing of shock waves in a capsule contained within hohlraum targets. This technique is critical for optimizing the drive profiles for high-performance inertial-confinement-fusion capsules, which are compressed by multiple precisely timed shock waves. The shock-timing technique was demonstrated on OMEGA using surrogate hohlraum targets heated to 180 eV and fitted with a re-entrant cone and quartz window to facilitate velocity measurements using velocity interferometry. Cryogenic experiments using targets filled with liquid deuterium further demonstrated the entire timing technique in a hohlraum environment. Direct-drive cryogenic targets with multiple spherical shocks were also used to validate this technique, including convergence effects at relevant pressures (velocities) and sizes. These results provide confidence that shock velocity and timing can be measured in NIF ignition targets, thereby optimizing these critical parameters.

Contribution of myeloperoxidase and inducible nitric oxide synthase to pathogenesis of psoriasis

Directory of Open Access Journals (Sweden)

Nursel Dilek

2016-12-01

Full Text Available Introduction : Histological changes of psoriasis include invasion of neutrophils into the epidermis and formation of Munro abscesses in the epidermis. Neutrophils are the predominant white blood cells in circulation when stimulated; they discharge the abundant myeloperoxidase (MPO enzyme that uses hydrogen peroxide to oxidize chloride for killing ingested bacteria. Aim: To investigate the contribution of neutrophils to the pathogenesis of psoriasis at the blood and tissue levels through inducible nitric oxide synthase (iNOS and MPO. Material and methods: A total of 50 adult patients with a chronic plaque form of psoriasis and 25 healthy controls were enrolled to this study. Serum MPO and iNOS levels were measured using ELISA method. Two biopsy specimens were taken in each patient from the center of the lesion and uninvolved skin. Immunohistochemistry was performed for MPO and iNOS on both normal and psoriasis vulgaris biopsies. Results: While a significant difference between serum myeloperoxidase levels were detected, a similar statistical difference between participants in the serum iNOS levels was not found. In immunohistochemistry, intensely stained leukocytes with MPO and intensely staining with iNOS in psoriatic skin was observed. Conclusions : Neutrophils in psoriasis lesions are actively producing MPO and this indirectly triggers the synthesis of iNOS. Targeting of MPO or synthesis of MPO in the lesion area may contribute to development of a new treatment option.

As Práticas de marketing, entre transações e relacionamentos, de empresas no Brasil

Directory of Open Access Journals (Sweden)

Luciana Terra Targino

2013-01-01

Full Text Available O marketing transacional, por tempos, reinou na teo ria e na prática (SHETH; PARVATIYAR, 1995, destacando os 4Ps (KOTLER, 2006. Porém algu mas companhias, principalmente as de serviços e de indústria, começaram a ter dificul dade com a falta de personalização e de interação de tal prática (HANKANSSON, 1982, (BRENT ANI, 1991. Nesse contexto, surgiu o Programa de Práticas de Marketing Contemporâneas (CMP. Nele, Coviello; Brodie e Munro (1997 e Coviello, Milley e Macolin (2001, a partir de concepções de Grönroos (1996, apontaram cinco tipos de marketing em funçã o da interação empresa/cliente, sendo quatro de relacionamento e um transacional. Os resu ltados em diversos países revelaram a coexistência dos marketings relacional e transacion al em muitas firmas, mas em composições variadas. Mas, afinal, como se dá tal fenômeno no B rasil? Como cada prática de marketing se liga ao desempenho empresarial? Trata-se de uma pes quisa descritiva, com dados levantados de executivos, usando-se o questionário padrão do C MP, acrescido de uma bateria sobre desempenho.

Contrast normalization contributes to a biologically-plausible model of receptive-field development in primary visual cortex (V1)

Science.gov (United States)

Willmore, Ben D.B.; Bulstrode, Harry; Tolhurst, David J.

2012-01-01

Neuronal populations in the primary visual cortex (V1) of mammals exhibit contrast normalization. Neurons that respond strongly to simple visual stimuli – such as sinusoidal gratings – respond less well to the same stimuli when they are presented as part of a more complex stimulus which also excites other, neighboring neurons. This phenomenon is generally attributed to generalized patterns of inhibitory connections between nearby V1 neurons. The Bienenstock, Cooper and Munro (BCM) rule is a neural network learning rule that, when trained on natural images, produces model neurons which, individually, have many tuning properties in common with real V1 neurons. However, when viewed as a population, a BCM network is very different from V1 – each member of the BCM population tends to respond to the same dominant features of visual input, producing an incomplete, highly redundant code for visual information. Here, we demonstrate that, by adding contrast normalization into the BCM rule, we arrive at a neurally-plausible Hebbian learning rule that can learn an efficient sparse, overcomplete representation that is a better model for stimulus selectivity in V1. This suggests that one role of contrast normalization in V1 is to guide the neonatal development of receptive fields, so that neurons respond to different features of visual input. PMID:22230381

BMJ open the iMpact on practice, oUtcomes and costs of New roles for health pROfeSsionals: A study protocol for MUNROS

NARCIS (Netherlands)

C.M. Bond (Christine); H. Bruhn (Hanne); A.A. de Bont (Antoinette); N.J.A. van Exel (Job); R. Busse (Reinhard); M. Sutton (Matthew); R. Elliott (Robert)

2016-01-01

textabstractIntroduction: The size and composition of the European Union healthcare workforce are key drivers of expenditure and performance; it now includes new health professions and enhanced roles for established professions. This project will systematically analyse how this has contributed to

Role of mariculture in the loading and speciation of mercury at the coast of the East China Sea.

Science.gov (United States)

Liang, Peng; Gao, Xuefei; You, Qiongzhi; Zhang, Jin; Cao, Yucheng; Zhang, Chan; Wong, Ming-Hung; Wu, Sheng-Chun

2016-11-01

The effects of mariculture on mercury (Hg) contamination and speciation in water, sediment and cultured fish in a typical mariculture zone located in Xiangshan bay, Zhejiang province, east China, were studied. Water, sediment and fish samples were collected from mariculture sites (MS) and from corresponding reference sites (RS) 2500 m away from the MS. The THg concentration in overlying water in Xiangshan bay reached as high as 16.6 ± 19.5 ng L -1 , indicating that anthropogenic sources in this bay may contribution on Hg contamination in overlying water. Mariculture activities resulted in an increase in THg concentration in water from surface and bottom layers, which may be attributed to the discharge of domestic sewage and the accumulation of unconsumed fish feed and fish excreta in the benthic environment. Methylmercury (MeHg) concentrations in the bottom layer of overlying water and top surface layer of porewater underneath MS were higher than at RS, implying that mariculture activities promote Hg methylation in the interface between sediments and water. In addition, the concentrations of MeHg in sediment and porewater were significantly higher in summer than winter. It was observed that THg and MeHg contents in the muscle of blackhead seabream (Acanthopagrus schlegelii) (fed by the trash fish) were significantly higher (p < 0.001) than those in red snapper (Lutjanus campechanus) or perch (Perca fluviatilis) (fed by pellet fish feed). The THg and MeHg concentrations in the fish meat were closely related to the feeding mode, which indicate that fish feed rather than environmental media is the major pathway for Hg accumulation in fish muscle. Copyright © 2016 Elsevier Ltd. All rights reserved.

Two alternatively spliced GPR39 transcripts in seabream: molecular cloning, genomic organization, and regulation of gene expression by metabolic signals.

Science.gov (United States)

Zhang, Yong; Liu, Yun; Huang, Xigui; Liu, Xiaochun; Jiao, Baowei; Meng, Zining; Zhu, Pei; Li, Shuisheng; Lin, Haoran; Cheng, Christopher H K

2008-12-01

Two GPR39 transcripts, designated as sbGPR39-1a and sbGPR39-1b, were identified in black seabream (Acanthopagrus schlegeli). The deduced amino acid (aa) sequence of sbGPR39-1a contains 423 residues with seven putative transmembrane (TM) domains. On the other hand, sbGPR39-1b contains 284 aa residues with only five putative TM domains. Northern blot analysis confirmed the presence of two GPR39 transcripts in the seabream intestine, stomach, and liver. Apart from seabream, the presence of two GPR39 transcripts was also found to exist in a number of teleosts (zebrafish and pufferfish) and mammals (human and mouse). Analysis of the GPR39 gene structure in different species suggests that the two GPR39 transcripts are generated by alternative splicing. When the seabream receptors were expressed in cultured HEK293 cells, Zn(2)(+) could trigger sbGPR39-1a signaling through the serum response element pathway, but no such functionality could be detected for the sbGPR39-1b receptor. The two receptors were found to be differentially expressed in seabream tissues. sbGPR39-1a is predominantly expressed in the gastrointestinal tract. On the other hand, sbGPR39-1b is widely expressed in most central and peripheral tissues except muscle and ovary. The expression of sbGPR39-1a in the intestine and the expression of sbGPR39-1b in the hypothalamus were decreased significantly during food deprivation in seabream. On the contrary, the expression of the GH secretagogue receptors (sbGHSR-1a and sbGHSR-1b) was significantly increased in the hypothalamus of the food-deprived seabream. The reciprocal regulatory patterns of expression of these two genes suggest that both of them are involved in controlling the physiological response of the organism during starvation.

A Study of Eimeria Species in Sheep in Mosul City

Directory of Open Access Journals (Sweden)

M. H. Hasan

2012-01-01

Full Text Available The study was conducted to diagnose and study species of Eimeria in sheep in Mosul city from beginning of September2009 to end May 2010, as well as to determine the percentage and intensity of infection of Eimeria species. Five hundredfecal samples of sheep with different ages were collected from different areas of the Mosul city. The results showed that totalpercentage of Emeria infection was 63.6%. The variations in percentage of infection were recorded according to month ofstudy. Highest percentage was recorded in March being 89.2% and the lowest in September 25.9%. The species E. ovinarecorded the highest infection rate 86.7%, while the species E. granulosa represented lowest infection rate 10%. Moreover theintensity of infection was higher in young ages and lower in adult. The results were detected that indoor sheep infection withhigh parasitic infection 69.9% whereas outdoor animals have an infection rate 25.3%. The morphological characters of oocystswere varied according to species of Eimeria has been studied. Fifty of intestinal and abomasal samples from both slaughteredin shops butchery in Mosul city and dead animals were examined to detect Eimeria infection, and results show that infectionpercentage was 56.4% in intestine of slaughtered animals and 36.3% in dead animal. Moreover no infection of Eimeria weredetected in abomasums in both slaughtered and dead animals. The oocysts of (E. parva, E.pallida and E. ovinoidalis detectedat more than 5000 oocysts per gram of intestinal contents. The intestinal secraping stained with Giemsa stain reveals thepresence of different developmental stages of parasites in wall of intestine. The histopathological sections of intestine revealedthe different pathological changes concerning of Eimeria infection.

Reality and confusion in the recognition of post-depositional alterations and use-wear: an experimental approach on basalt tools

Directory of Open Access Journals (Sweden)

Lena Asryan

2014-03-01

Full Text Available While many experimental studies have been done on siliceous and metamorphic rocks for both use-wear and post depositional surface modification (PDSM events, little is known about such experiments on volcanic materials (other than obsidian, and on basalt in particular. Here we present the preliminary results of several experiments related to: a evidence for basalt use (e.g., butchery and fresh hide scraping and the subsequent characteristic use-wear patterns that can be seen; and b post-depositional surface modifications caused by bear (Ursidae trampling on experimental basalt flakes and subsequent use of these flakes for a tumbling experiment in a special tumbling machine.The results of these experiments were compared to better understand some surface modifications noted on the Middle to Upper Pleistocene lithic assemblages of the Azokh Cave site (Nagorno Karabagh, Lesser Caucasus.Although some aspects of both events (use-wear and PDSM remain to be studied in depth, the experiments have improved our understanding of the effects of use-wear and post-depositional trampling and tumbling on basalt lithic artefacts. In particular, it has allowed us to recognise mechanical alterations (e.g., cracks, striations, fractures, edge damage caused by trampling and tumbling and to note differences between these modifications and those caused by use. In particular, the experiments have shown that macroscopic modifications are rarely diagnostic, especially those observed after use. Microscopic wear features such as edge rounding, polish, abrasion and striations were the most evident types of alteration on basalt flakes, although occurring at different times and from different types of use. Distribution and orientation of alterations may be key in distinguishing use-wear from post-depositional alterations on basalt artefacts.

A Voltage-Based STDP Rule Combined with Fast BCM-Like Metaplasticity Accounts for LTP and Concurrent "Heterosynaptic" LTD in the Dentate Gyrus In Vivo.

Directory of Open Access Journals (Sweden)

Peter Jedlicka

2015-11-01

Full Text Available Long-term potentiation (LTP and long-term depression (LTD are widely accepted to be synaptic mechanisms involved in learning and memory. It remains uncertain, however, which particular activity rules are utilized by hippocampal neurons to induce LTP and LTD in behaving animals. Recent experiments in the dentate gyrus of freely moving rats revealed an unexpected pattern of LTP and LTD from high-frequency perforant path stimulation. While 400 Hz theta-burst stimulation (400-TBS and 400 Hz delta-burst stimulation (400-DBS elicited substantial LTP of the tetanized medial path input and, concurrently, LTD of the non-tetanized lateral path input, 100 Hz theta-burst stimulation (100-TBS, a normally efficient LTP protocol for in vitro preparations produced only weak LTP and concurrent LTD. Here we show in a biophysically realistic compartmental granule cell model that this pattern of results can be accounted for by a voltage-based spike-timing-dependent plasticity (STDP rule combined with a relatively fast Bienenstock-Cooper-Munro (BCM-like homeostatic metaplasticity rule, all on a background of ongoing spontaneous activity in the input fibers. Our results suggest that, at least for dentate granule cells, the interplay of STDP-BCM plasticity rules and ongoing pre- and postsynaptic background activity determines not only the degree of input-specific LTP elicited by various plasticity-inducing protocols, but also the degree of associated LTD in neighboring non-tetanized inputs, as generated by the ongoing constitutive activity at these synapses.

Predictive modeling of hazardous waste landfill total above-ground biomass using passive optical and LIDAR remotely sensed data

Science.gov (United States)

Hadley, Brian Christopher

This dissertation assessed remotely sensed data and geospatial modeling technique(s) to map the spatial distribution of total above-ground biomass present on the surface of the Savannah River National Laboratory's (SRNL) Mixed Waste Management Facility (MWMF) hazardous waste landfill. Ordinary least squares (OLS) regression, regression kriging, and tree-structured regression were employed to model the empirical relationship between in-situ measured Bahia (Paspalum notatum Flugge) and Centipede [Eremochloa ophiuroides (Munro) Hack.] grass biomass against an assortment of explanatory variables extracted from fine spatial resolution passive optical and LIDAR remotely sensed data. Explanatory variables included: (1) discrete channels of visible, near-infrared (NIR), and short-wave infrared (SWIR) reflectance, (2) spectral vegetation indices (SVI), (3) spectral mixture analysis (SMA) modeled fractions, (4) narrow-band derivative-based vegetation indices, and (5) LIDAR derived topographic variables (i.e. elevation, slope, and aspect). Results showed that a linear combination of the first- (1DZ_DGVI), second- (2DZ_DGVI), and third-derivative of green vegetation indices (3DZ_DGVI) calculated from hyperspectral data recorded over the 400--960 nm wavelengths of the electromagnetic spectrum explained the largest percentage of statistical variation (R2 = 0.5184) in the total above-ground biomass measurements. In general, the topographic variables did not correlate well with the MWMF biomass data, accounting for less than five percent of the statistical variation. It was concluded that tree-structured regression represented the optimum geospatial modeling technique due to a combination of model performance and efficiency/flexibility factors.

Love as a subjective corrlate of interpersonal relationships: attempts of defining of the concepts and methods of measurment

Directory of Open Access Journals (Sweden)

O. P. Zolotnyik

2015-04-01

Full Text Available This article is devoted to overview the scientific study of the phenomenon of love. Attempts of scientific knowledge presented by developed by sociologists and psychologists love theories, which defined, classified and measure this phenomenon. The paper proposed to review the most popular theory of love studying: the triangular theory of love for Robert J. Sternberg, classification styles love for John Alan Lee and transformational concept of A.Giddens. The importance of studying this subject is explained by the subjective definition by respondents of the role of love as correlates of interpersonal relationships. Love is considered as a factor that acts as a marriage motive and components, which ensures its durability. The complexity of the scientific understanding of love is the absence of clear empirical referents for fixation. The examined theory reaffirms their scientific hypotheses through the use of specific methods of measurement. It is offered for review: Scale of love and sympathy by Z.Rubin, Love Attitude Scale by Hendrick C. and Hendrick S. and scale of romantic relationships by Munro­Adams. These methodologies are widely used in modern scientific research, been undergo with modifications and adaptation depending on the cultural characteristics of the respondents. The phenomenon of love needs more scientific study with the aim of further categorization, require range of techniques selection and should be included  as a component in the sociological survey of interpersonal relationships.

Bone taphonomy of the Schöningen "Spear Horizon South" and its implications for site formation and hominin meat provisioning.

Science.gov (United States)

Starkovich, Britt M; Conard, Nicholas J

2015-12-01

This paper presents the faunal remains from the new excavation area at the Lower Paleolithic site of Schöningen. The focus of the study is on the southern extension of the main find horizon (Spear Horizon South), which includes the layer that yielded the famous Schöningen spears (13 II-4). Taxonomic data corroborate previous studies, that hominins primarily hunted Equus mosbachensis, a large Pleistocene horse. Equid body part representation at the site suggests that the animals were hunted and butchered locally. There is no evidence for density-mediated attrition in the assemblage. Weathering damage is uncommon, though there is ample evidence that carnivores had access to the bone. Carnivore bite sizes were measured and compared to experimental data provided by previous authors. Based on relationships between bite size and carnivore behavior and body size, we conclude that the primary modifying agents were large carnivores (i.e., wolves or saber-toothed cats). Previous studies show that carnivores often had secondary access to the remains, after hominins. Cut marks are commonly arranged haphazardly on the bones. This may indicate that multiple hominins participated in the butchery of horse skeletons, or that they were butchered over the course of hours or days. Cut marks on axial elements are more "orderly," which probably reflects the physical logistics of orienting one's body in relation to a large carcass. These data differ from sites formed by Middle and Upper Paleolithic hominins, which might suggest that in later times, a system of organized meat provisioning was already in place. Taken together, the faunal evidence from the Spear Horizon South indicates that late Lower Paleolithic hominins using the site understood the behaviors of different prey species, hunted socially to take down large game, and successfully competed with large carnivores on the landscape for primary access to ungulate remains. Copyright © 2015 Elsevier Ltd. All rights reserved.

A decorated raven bone from the Zaskalnaya VI (Kolosovskaya) Neanderthal site, Crimea

Science.gov (United States)

Evans, Sarah; Stepanchuk, Vadim; Tsvelykh, Alexander; d’Errico, Francesco

2017-01-01

We analyze a radius bone fragment of a raven (Corvus corax) from Zaskalnaya VI rock shelter, Crimea. The object bears seven notches and comes from an archaeological level attributed to a Micoquian industry dated to between 38 and 43 cal kyr BP. Our study aims to examine the degree of regularity and intentionality of this set of notches through their technological and morphometric analysis, complemented by comparative experimental work. Microscopic analysis of the notches indicate that they were produced by the to-and-fro movement of a lithic cutting edge and that two notches were added to fill in the gap left between previously cut notches, probably to increase the visual consistency of the pattern. Multivariate analysis of morphometric data recorded on the archaeological notches and sets of notches cut by nine modern experimenters on radii of domestic turkeys shows that the variations recorded on the Zaskalnaya set are comparable to experimental sets made with the aim of producing similar, parallel, equidistant notches. Identification of the Weber Fraction, the constant that accounts for error in human perception, for equidistant notches cut on bone rods and its application to the Zaskalnaya set of notches and thirty-six sets of notches incised on seventeen Upper Palaeolithic bone objects from seven sites indicate that the Zaskalnaya set falls within the range of variation of regularly spaced experimental and Upper Palaeolithic sets of notches. This suggests that even if the production of the notches may have had a utilitarian reason the notches were made with the goal of producing a visually consistent pattern. This object represents the first instance of a bird bone from a Neanderthal site bearing modifications that cannot be explained as the result of butchery activities and for which a symbolic argument can be built on direct rather than circumstantial evidence. PMID:28355292

Lessons learned from a textbook outbreak: EHEC-O157:H7 infections associated with the consumption of raw meat products, June 2012, Limburg, Belgium.

Science.gov (United States)

Braeye, Toon; Denayer, Sarah; De Rauw, Klara; Forier, Anmarie; Verluyten, Jurgen; Fourie, Ludo; Dierick, Katelijne; Botteldoorn, Nadine; Quoilin, Sophie; Cosse, Pascale; Noyen, Jeannine; Pierard, Denis

2014-01-01

On 5 June 2012 several enterohemorrhagic Escherichia coli, EHEC, O157:H7 infections were reported to the public health authorities of Limburg. We performed a case-control study, a trace back/forward investigation and compared strains isolated from human cases and food samples. A case was defined as anyone with a laboratory-confirmed E. coli O157:H7-infection in North-East Limburg from May 30 2012 till July 15 2012. Family members with bloody diarrhea were also included as cases. E. coli O157 was isolated by culture and the presence of the virulence genes was verified using (q)PCR. Isolates were genotyped and compared by Pulsed Field Gel Electrophoresis (PFGE) and insertion sequence 629-printing (IS629-printing). The outbreak involved 24 cases, of which 17 were laboratory-confirmed. Five cases developed Hemolytic Uremic Syndrome (HUS) and fifteen were hospitalized. Cases reported a significantly higher consumption of "steak tartare", a raw meat product (OR 48.12; 95% CI; 5.62- 416.01). Cases were also more likely to buy meat-products at certain butcheries (OR 11.67; 95% CI; 1.41 - 96.49). PFGE and IS629-printing demonstrated that the vtx1a vtx2a eae ehxA positive EHEC O157:H7 strains isolated from three meat products and all seventeen human stool samples were identical. In a slaughterhouse, identified by the trace-back investigation, a carcass infected with a different EHEC strain was found and confiscated. We present a well described and effectively investigated foodborne outbreak associated with meat products. Our main recommendations are the facilitation and acceleration of the outbreak detection and the development of a communication plan to reaches all persons at risk. Foodborne diseases, Shiga-toxigenic Escherichia coli, Enterohemorrhagic Escherichia coli, Meat products, Case control studies, Electrophoresis, Gel, Pulsed-Field.

Assessing the significance of Palaeolithic engraved cortexes. A case study from the Mousterian site of Kiik-Koba, Crimea.

Directory of Open Access Journals (Sweden)

Ana Majkić

Full Text Available Twenty-Seven Lower and Middle Paleolithic sites from Europe and the Middle East are reported in the literature to have yielded incised stones. At eleven of these sites incisions are present on flint cortexes. Even when it is possible to demonstrate that the engravings are ancient and human made, it is often difficult to distinguish incisions resulting from functional activities such as butchery or use as a cutting board, from those produced deliberately, and even more difficult to identify the scope of the latter. In this paper we present results of the analysis of an engraved cortical flint flake found at Kiik-Koba, a key Mousterian site from Crimea, and create an interpretative framework to guide the interpretation of incised cortexes. The frame of inference that we propose allows for a reasoned evaluation of the actions playing a role in the marking process and aims at narrowing down the interpretation of the evidence. The object comes from layer IV, the same layer in which a Neanderthal child burial was unearthed, which contains a para-Micoquian industry of Kiik-Koba type dated to between c.35 and 37 cal kyr BP. The microscopic analysis and 3D reconstruction of the grooves on the cortex of this small flint flake, demonstrate that the incisions represent a deliberate engraving made by a skilled craftsman, probably with two different points. The lines are nearly perfectly framed into the cortex, testifying of well controlled motions. This is especially the case considering the small size of the object, which makes this a difficult task. The production of the engraving required excellent neuromotor and volitional control, which implies focused attention. Evaluation of the Kiik-Koba evidence in the light of the proposed interpretative framework supports the view that the engraving was made with a representational intent.

A decorated raven bone from the Zaskalnaya VI (Kolosovskaya) Neanderthal site, Crimea.

Science.gov (United States)

Majkić, Ana; Evans, Sarah; Stepanchuk, Vadim; Tsvelykh, Alexander; d'Errico, Francesco

2017-01-01

We analyze a radius bone fragment of a raven (Corvus corax) from Zaskalnaya VI rock shelter, Crimea. The object bears seven notches and comes from an archaeological level attributed to a Micoquian industry dated to between 38 and 43 cal kyr BP. Our study aims to examine the degree of regularity and intentionality of this set of notches through their technological and morphometric analysis, complemented by comparative experimental work. Microscopic analysis of the notches indicate that they were produced by the to-and-fro movement of a lithic cutting edge and that two notches were added to fill in the gap left between previously cut notches, probably to increase the visual consistency of the pattern. Multivariate analysis of morphometric data recorded on the archaeological notches and sets of notches cut by nine modern experimenters on radii of domestic turkeys shows that the variations recorded on the Zaskalnaya set are comparable to experimental sets made with the aim of producing similar, parallel, equidistant notches. Identification of the Weber Fraction, the constant that accounts for error in human perception, for equidistant notches cut on bone rods and its application to the Zaskalnaya set of notches and thirty-six sets of notches incised on seventeen Upper Palaeolithic bone objects from seven sites indicate that the Zaskalnaya set falls within the range of variation of regularly spaced experimental and Upper Palaeolithic sets of notches. This suggests that even if the production of the notches may have had a utilitarian reason the notches were made with the goal of producing a visually consistent pattern. This object represents the first instance of a bird bone from a Neanderthal site bearing modifications that cannot be explained as the result of butchery activities and for which a symbolic argument can be built on direct rather than circumstantial evidence.

The risk of pathogenic intestinal parasite infections in Kisii Municipality, Kenya

Directory of Open Access Journals (Sweden)

Kabiru Ephantus W

2008-07-01

Full Text Available Abstract Background Intestinal parasitic infections are among the most common infections worldwide. Various epidemiological studies indicate that the prevalence of intestinal parasites is high especially in developing countries, although in many of these, the environmental risk factors have not been clearly elucidated. The objective of this study was to determine the risk of pathogenic intestinal parasites infections in Kisii Municipality. Methods Random sampling was used in the selection of the study samples. Stool parasitological profiles of food handlers were done by direct smear and formalin-ethyl acetate sedimentation method. Both vegetable and meat samples were examined for the presence of intestinal parasites. The storage and meat handling practices of the various butcheries were observed. Results Types of samples examined for occurrence of intestinal parasites includes, a total of 84 vegetable, 440 meat and 168 stool samples. Fifty five (65.5% vegetable, 334 (75.9% meat and 69 (41.1% of the stool samples were found positive for intestinal parasites indicating a high overall risk (66.18% for intestinal parasite infections. Of the parasites detected, the most common parasites infesting the foodstuffs and infecting the food handlers were Ascaris lumbricoides and Entamoeba histolytica. Parasites were significantly less likely to be present on meat that was refrigerated during display than meat that was displayed at ambient temperature. Conclusion There is a high risk of infection with intestinal parasites in the sampled Municipal markets. About half of the food handlers surveyed (41.1 % at the Municipal Hospital had one or more parasitic infections. Furthermore, meat (65.5% and vegetables (75.9% sold at the Municipal market were found to be contaminated with parasites hence the inhabitants requires a need for education on food safety, good distribution practices and improvement on sanitary conditions.

Modelos de afilamento para o sortimento do fuste de Pinus taeda L Taper function for assortment of Pinus taeda L. stem

Directory of Open Access Journals (Sweden)

Carlos Alberto Martinelli de Souza

2008-12-01

Full Text Available Este trabalho teve como objetivo avaliar diferentes modelos de afilamento do fuste de Pinus taeda para estimar variáveis de interesse ao longo do fuste. Foram avaliadas as funções propostas por Anony, Kozak, Munro, Silva & Sterba, Prodan e o Polinômio de 5° grau. O estudo teve como base dados de cubagem rigorosa de 68 árvores, provenientes de plantios com idade de 25 anos, pertencentes à empresa Florestal Gateados Ltda, localizada no município de Campo Belo do Sul, Santa Catarina (SC, Brasil. A partir das estatísticas coeficiente de determinação ajustado (R²aj, erro padrão das estimativas (Syx, desvio médio, média das diferenças (md e desvio padrão das diferenças (dpd foi selecionado o Polinômio do 5° grau para estimar as variáveis ao longo do fuste, como a altura comercial, o volume comercial, os diâmetros e os volumes das 1ª e 2ª toras. Em relação à altura comercial, a equação proveniente do modelo escolhido apresentou resultados sem tendências e com erros oscilando em intervalo pequeno. Em se tratando do volume comercial, pode ser observada certa tendência em subestimativas para as árvores com menores DAP e uma leve tendência para aquelas árvores com maior DAP. Em relação ao diâmetro e ao volume da 1a tora, houve superestimativa dos valores, mas com erros baixos, principalmente para o diâmetro. Para as estimativas do diâmetro e do volume da 2ª tora, os resultados foram melhores do que os encontrados na 1a tora, com leve tendência em subestimar o diâmetro e, praticamente, sem tendência para o volume.This research had as objective to evaluate different taper models for Pinus taeda and select the best one to estimate variables of interest throughout the stem. The functions proposed by Anony, Kozak, Munro, Silva & Sterba, Prodan and the 5° degree Polynomial were evaluated. With data from rigorous cubage of 68 trees, with 25 years old, coming from plantation of Florestal Gateados Ltda, located, in the

The story of Ferdinand: De Nueva York a Salamanca

Directory of Open Access Journals (Sweden)

Roberto Martínez-Mateo

2014-11-01

Full Text Available El objetivo de este trabajo es analizar dos versiones en lengua española realizadas a partir del álbum ilustrado originalmente escrito en inglés The story of Ferdinand (1935 por Munro Leaf e ilustrado por Robert Lawson. La comparación de este tipo específico de narrativa se establece entre dos traducciones al castellano y sus ilustraciones cuya fecha de publicación dista más de 30 años y cuyo lugar de publicación está separado por el océano Atlántico Norte (una americana de 1962 y otra española de 1994. Este artículo presta especial atención a la relación multimodal que se establece entre el código semiótico visual y escrito de ambas versiones españolas de cara a dilucidar la distinta orientación ideológica que cada traducción asume al dirigirse a un público receptor, principalmente de carácter infantil. La obra fue escrita a las puertas del estallido de la Guerra Civil española, donde ya sabemos por la historia que la oleada de violencia había llegado a unos extremos de gran crudeza. Es interesante indagar en la actualidad que cobra en España este álbum ilustrado de origen americano al poco de publicarse con el estallido de la Guerra Civil española y, poco después, en el continente Europeo con la 2ª Guerra Mundial. Haciendo un uso metafórico de una fiesta tradicional española caracterizada también por su violencia y crueldad, la imaginería y la traducción de cada versión en castellano dan respuesta a unas motivaciones comunicativas (Moya y Pinar, 2007, p.22 que condicionan la recepción del texto en el lector y cultura meta. This paper aims to analyze two Spanish editions of the picture book The story of Ferdinand (1935 written by Munro Leaf and illustrated by Robert Lawson. The comparison of this specific narrative type is made between two translations into Spanish and their illustrations whose release dates are more than 30 years apart and that were published on both shores of the North Atlantic Ocean (one

A study of clinicohistopathological correlation in patients of psoriasis and psoriasiform dermatitis

Directory of Open Access Journals (Sweden)

Mehta Shilpa

2009-01-01

Full Text Available Background: Psoriasis has different clinical variants, which mimic diverse dermatological conditions and may require a histopathological confirmation of the diagnosis. Studies to establish a clinicohistopathological concordance (and its determinants, in psoriasis and psoriasiform dermatitis are lacking . Aims : The present study was designed (a to correlate the clinicohistopathological features of psoriasis and psoriasiform dermatitis, and (b to identify determinant(s that may contribute to the diagnosis of psoriasis and psoriasiform dermatitis. Methods : This was a prospective study involving 100 patients, with a single clinical diagnosis of psoriasis or with psoriasis as one of the differential diagnoses, and its correlation with histopathological features. Results : The clinical features of typical scale (P = 0.0001 and Auspitz′s sign (P = 0.0001, and histological evidence of suprapapillary thinning (P = 0.0001 and absent granular cell layer (P = 0.0001 were found to be statistically significant contributors to the clinicohistological concordance in cases of psoriasis. Vertical orientation of collagen bundles (P = 0.0001 and lymphocytic exocytosis (P = 0.003 were found to be significantly associated with diagnosis of psoriasiform dermatitis. Conclusion : The present study reconfirms the diagnostic accuracy of silvery white scale, Auspitz′s sign, and Koebner′s phenomenon in a clinical setting suggestive of psoriasis. However, in their absence, histological evidence of suprapapillary thinning and absent granular layer, in addition to the Munro microabscess and Kogoj′s abscess, may contribute to the diagnosis of psoriasis. Similarly, vertical orientation of collagen bundles and lymphocytic exocytosis may point toward a diagnosis of psoriasiform dermatitis.

Threshold of toxicological concern values for non-genotoxic effects in industrial chemicals: re-evaluation of the Cramer classification.

Science.gov (United States)

Kalkhof, H; Herzler, M; Stahlmann, R; Gundert-Remy, U

2012-01-01

The TTC concept employs available data from animal testing to derive a distribution of NOAELs. Taking a probabilistic view, the 5th percentile of the distribution is taken as a threshold value for toxicity. In this paper, we use 824 NOAELs from repeated dose toxicity studies of industrial chemicals to re-evaluate the currently employed TTC values, which have been derived for substances grouped according to the Cramer scheme (Cramer et al. in Food Cosm Toxicol 16:255-276, 1978) by Munro et al. (Food Chem Toxicol 34:829-867, 1996) and refined by Kroes and Kozianowski (Toxicol Lett 127:43-46, 2002), Kroes et al. 2000. In our data set, consisting of 756 NOAELs from 28-day repeated dose testing and 57 NOAELs from 90-days repeated dose testing, the experimental NOAEL had to be extrapolated to chronic TTC using regulatory accepted extrapolation factors. The TTC values derived from our data set were higher than the currently used TTC values confirming the safety of the latter. We analysed the prediction of the Cramer classification by comparing the classification by this tool with the guidance values for classification according to the Globally Harmonised System of classification and labelling of the United Nations (GHS). Nearly 90% of the chemicals were in Cramer class 3 and assumed as highly toxic compared to 22% according to the GHS. The Cramer classification does underestimate the toxicity of chemicals only in 4.6% of the cases. Hence, from a regulatory perspective, the Cramer classification scheme might be applied as it overestimates hazard of a chemical.

NRC Information No. 90-21: Potential failure of motor-operated butterfly valves to operate because valve seat friction was underestimated

International Nuclear Information System (INIS)

Rossi, C.E.

1992-01-01

In October 1988, at Catawba Nuclear Station Unit 1, a motor-operated butterfly valve in the service water system failed to open under high differential pressure conditions. The licensee concluded that the valve manufacturer, BIF/General Signal Corporation, had underestimated the degree to which the material used in the valve seat would harden with age (the responsibility for these valves has been transferred to Paul-Munroe Enertech). This underestimation of the age hardening had led the manufacturer to assume valve seat friction forces that were less than the actual friction forces in the installed valve. To overcome the larger-than-anticipated friction forces, the licensee's engineering staff recommended the open torque switch for 56 butterfly valves be reset to the maximum allowable value. The systems in which these valves are located include the component cooling water system, service water system, and various ventilation systems. By July 26, 1989, the torque switch adjustments were completed at Catawba Units 1 and 2. After reviewing the final settings, the licensee's engineering staff determined that the actuators for three butterfly valves in the component cooling water system might not be able to overcome the friction forces resulting from maximum seat hardening. On December 13, 1989, the licensee determined that the failure of these BIF/General Signal motor-operated valves (MOVs) could cause a loss of cooling water to residual heat removal system heat exchangers. To resolve the concern regarding the operability of these BIF/General Signal valves, a torque switch bypass was installed on two of the actuators to allow full motor capability during opening

SYSTEMATIC GROUPING AND CRITICAL ANALYSIS OF ABNORMAL UTERINE BLEEDING (AUB CASES ACCORDING TO FIGO’S PALM-COEIN’S CLASSIFICATION- A RETROSPECTIVE STUDY

Directory of Open Access Journals (Sweden)

Chagalmarai Amulya

2017-06-01

Full Text Available BACKGROUND There is general inconsistency in the nomenclature used to describe abnormal uterine bleefing(AUB in addition to a plethora of potential causes, which may coexist in an individual to develop consistent and universally accepted classification system to facilitate clinicians for better communication, clinical care and research. The aim of the study is to study the analysis of AUB cases grouped under FIGO PALM-COEIN Classification System. MATERIALS AND METHODS A retrospective study of 100 women presenting with AUB admitted in Gynaecology Department, KGH, during 2015-2016 were studied. Women of reproductive, peri and postmenopausal age group presented with excessive or prolonged bleeding are analysed according to PALM-COEIN classification system. Inclusion Criteria- AUB of reproductive, peri and postmenopausal woman. Exclusion Criteria- Pregnancy-related complications, cervical and vaginal lesions. RESULTS In our study, most of the cases have combined causes. Structural causes- PALM group- 82%; non-structural- COEIN group- 9%, coexistent- 9%. The present study is compared with Khrouf et al, Munro et al, Madhra et al, Bahamondes and Ali. Most of the patients are in AUB-L, AUB-A and in the age group of 40-49 years (42.33%, common presenting complaint was heavy menstrual bleeding (62%. Qureshi and Yusuf in 2013, AUB-L- 25%, AUB-O -24%. Gouri et al in May 2016, AUB-O is 27% and AUB-L is 24%. CONCLUSION PALM-COEIN classification is simple and feasible and encourages focus on optimal approach to modern management, clinical teaching and research.

Learning Structure of Sensory Inputs with Synaptic Plasticity Leads to Interference

Directory of Open Access Journals (Sweden)

Joseph eChrol-Cannon

2015-08-01

Full Text Available Synaptic plasticity is often explored as a form of unsupervised adaptationin cortical microcircuits to learn the structure of complex sensoryinputs and thereby improve performance of classification and prediction. The question of whether the specific structure of the input patterns is encoded in the structure of neural networks has been largely neglected. Existing studies that have analyzed input-specific structural adaptation have used simplified, synthetic inputs in contrast to complex and noisy patterns found in real-world sensory data.In this work, input-specific structural changes are analyzed forthree empirically derived models of plasticity applied to three temporal sensory classification tasks that include complex, real-world visual and auditory data. Two forms of spike-timing dependent plasticity (STDP and the Bienenstock-Cooper-Munro (BCM plasticity rule are used to adapt the recurrent network structure during the training process before performance is tested on the pattern recognition tasks.It is shown that synaptic adaptation is highly sensitive to specific classes of input pattern. However, plasticity does not improve the performance on sensory pattern recognition tasks, partly due to synaptic interference between consecutively presented input samples. The changes in synaptic strength produced by one stimulus are reversed by thepresentation of another, thus largely preventing input-specific synaptic changes from being retained in the structure of the network.To solve the problem of interference, we suggest that models of plasticitybe extended to restrict neural activity and synaptic modification to a subset of the neural circuit, which is increasingly found to be the casein experimental neuroscience.

The reticulating phylogeny of island biogeography theory.

Science.gov (United States)

Lomolino, Mark V; Brown, James H

2009-12-01

Biogeographers study all patterns in the geographic variation of life, from the spatial variation in genetic and physiological characteristics of cells and individuals, to the diversity and dynamics of biological communities among continental biotas or across oceanic archipelagoes. The field of island biogeography, in particular, has provided some genuinely transformative insights for the biological sciences, especially ecology and evolutionary biology. Our purpose here is to review the historical development of island biogeography theory during the 20th century by identifying the common threads that run through four sets of contributions made during this period, including those by Eugene Gordon Munroe (1948, 1953), Edward O. Wilson (1959, 1961), Frank W. Preston (1962a,b), and the seminal collaborations between Wilson and Robert H. MacArthur (1963, 1967), which revolutionized the field and served as its paradigm for nearly four decades. This epistemological account not only reviews the intriguing history of island theory, but it also includes fundamental lessons for advancing science through transformative integrations. Indeed, as is likely the case with many disciplines, island theory advanced not as a simple accumulation of facts and an orderly succession of theories and paradigms, but rather in fits and starts through a reticulating phylogeny of ideas and alternating periods of specialization and reintegration. We conclude this review with a summary of the salient features of this scientific revolution in the contest of Kuhn's structure, which strongly influenced theoretical advances during this period, and we then describe some of the fundamental assumptions and tenets of an emerging reintegration of island biogeography theory.

A BCM theory of meta-plasticity for online self-reorganizing fuzzy-associative learning.

Science.gov (United States)

Tan, Javan; Quek, Chai

2010-06-01

Self-organizing neurofuzzy approaches have matured in their online learning of fuzzy-associative structures under time-invariant conditions. To maximize their operative value for online reasoning, these self-sustaining mechanisms must also be able to reorganize fuzzy-associative knowledge in real-time dynamic environments. Hence, it is critical to recognize that they would require self-reorganizational skills to rebuild fluid associative structures when their existing organizations fail to respond well to changing circumstances. In this light, while Hebbian theory (Hebb, 1949) is the basic computational framework for associative learning, it is less attractive for time-variant online learning because it suffers from stability limitations that impedes unlearning. Instead, this paper adopts the Bienenstock-Cooper-Munro (BCM) theory of neurological learning via meta-plasticity principles (Bienenstock et al., 1982) that provides for both online associative and dissociative learning. For almost three decades, BCM theory has been shown to effectively brace physiological evidence of synaptic potentiation (association) and depression (dissociation) into a sound mathematical framework for computational learning. This paper proposes an interpretation of the BCM theory of meta-plasticity for an online self-reorganizing fuzzy-associative learning system to realize online-reasoning capabilities. Experimental findings are twofold: 1) the analysis using S&P-500 stock index illustrated that the self-reorganizing approach could follow the trajectory shifts in the time-variant S&P-500 index for about 60 years, and 2) the benchmark profiles showed that the fuzzy-associative approach yielded comparable results with other fuzzy-precision models with similar online objectives.

Use of PIT tag and underwater video recording in assessing estuarine fish movement in a high intertidal mangrove and salt marsh creek

Science.gov (United States)

Meynecke, Jan-Olaf; Poole, Geoffrey C.; Werry, Jonathan; Lee, Shing Yip

2008-08-01

We assessed movement patterns in relation to habitat availability (reflected by the extent of tidal flooding) for several commercially and recreationally important species in and out of a small mangrove creek within the subtropical Burrum River estuary (25°10'S 152°37'E) in Queensland, Australia. Movement patterns of Acanthopagrus australis, Pomadasys kaakan, Lutjanus russelli and Mugil cephalus were examined between December 2006 and April 2007 using a stationary passive integrated transponder (PIT) system adapted for saline environments (30-38 ppt) and underwater digital video cameras (DVCs). This is the second known application of a stationary PIT tag system to studying fish movement in estuarine environments. The transponder system was set in place for 104 days and recorded >5000 detections. Overall 'recapture' rate of tagged fish by the transponder system was >40%. We used PIT tags implanted in a total of 75 fish from a tidal creek connected to the main channel of the estuary. We also developed a high-resolution digital elevation (2.5 m cell size) model of the estuary derived from airborne light detection and ranging (LIDAR) and aerial imagery to estimate inundation dynamics within the tidal creek, and related the timing of inundation in various habitats to the timing of fish immigration to and emigration from the creek. Over 50% of all tagged fish were moving in and out of the creek at a threshold level when 50% of the mangrove forest became flooded. Individuals of all four species moved into and out of the tidal creek repeatedly at different times depending on species and size, indicating strong residential behaviour within the estuary. The main activity of fishes was at night time. Manual interpretation of video from >700 fish sightings at three different mangrove sites confirmed the findings of the stationary PIT system, that the function of shelter vs food in mangrove habitat may be size dependent. Our established techniques assess the spatial ecology

Retraction notice to "The Palaeocene Cerro Munro tonalite intrusion (Chubut Province, Argentina): A plutonic remnant of explosive volcanism?"[J. S. Am. Earth Sci. 78C 38-60

Science.gov (United States)

Rodríguez, C.; Aragón, E.; Castro, A.; Pedreira, R.; Sánchez-Navas, A.; Díaz-Alvarado, J.; D´Eramo, F.; Pinotti, L.; Aguilera, Y.; Cavarozzi, C.; Demartis, M.; Hernando, I. R.; Fuentes, T.

2017-10-01

The publisher regrets that an error occurred which led to the premature publication of this paper. This error bears no reflection on the article or its authors. The publisher apologizes to the authors and the readers for this unfortunate error in Journal of South American Earth Sciences, 78C (2017) 38-60, http://dx.doi.org/10.1016/j.jsames.2017.06.002.

Significance of clinicopathological correlation in psoriasis

Directory of Open Access Journals (Sweden)

Gopal Ambadasrao Pandit

2015-01-01

Full Text Available Context: Psoriasis affects about 1.5% to 3% of world′s population. Other papulosquamous dermatoses are Pityriasis rosea, Lichen planus, Seborrheic dermatitis, Pityriasis rubra pilaris and Parapsoriasis. Drug eruptions, tinea corporis, and secondary syphilis may also have papulosquamous morphology. Because all papulosquamous disorders are characterized by scaling papules, clinical confusion may result during their diagnosis. Separation of each of these becomes important because the treatment and prognosis for each tends to be disease-specific. Aim: To study the pattern of clinical and histopathological features of psoriasis of the skin with clinicopathological correlation. Material and methods: The present study of 42 cases of psoriasis of the skin was carried out in the Department of Pathology of a tertiary care centre from December 2009 to October 2011. In this study, the patients which were clinically diagnosed as psoriasis of skin, before starting the treatment and attending the outdoor skin department were selected. Histopathological findings were interpreted in light of clinical details. Results: Out of 42 cases of psoriasis 24 (57.14% were males, 18 (42.86% were females with male to female ratio of 1.33:1. Mean age was 34.45 years. Maximum number of cases 22 (52.38% were encountered in 3rd and 4th decade of life. Histopathological findings: parakeratosis, acanthosis, suprapapillary thinning, Munro microabscesses and hypogranulosis were noted in most of the cases. Conclusion: Histopathology serves as a diagnostic tool and rules out other lesions which mimic psoriasis. The most accurate diagnosis is the one that most closely correlates with clinical outcome and helps to direct the most appropriate clinical intervention.

Gravity driven and in situ fractional crystallization processes in the Centre Hill complex, Abitibi Subprovince, Canada: Evidence from bilaterally-paired cyclic units

Science.gov (United States)

Thériault, R. D.; Fowler, A. D.

1996-12-01

The formation of layers in mafic intrusions has been explained by various processes, making it the subject of much controversy. The concept that layering originates from gravitational settling of crystals has been superseded in recent years by models involving in situ fractional crystallization. Here we present evidence from the Centre Hill complex that both processes may be operative simultaneously within the same intrusion. The Centre Hill complex is part of the Munro Lake sill, an Archean layered mafic intrusion emplaced in volcanic rocks of the Abitibi Subprovince. The Centre Hill complex comprises the following lithostratigraphic units: six lower cyclic units of peridotite and clinopyroxenite; a middle unit of leucogabbro; six upper cyclic units of branching-textured gabbro (BTG) and clotted-textured gabbro (CTG), the uppermost of these units being overlain by a marginal zone of fine-grained gabbro. The cyclic units of peridotite/clinopyroxenite and BTG/CTG are interpreted to have formed concurrently through fractional crystallization, associated with periodic replenishment of magma to the chamber. The units of peridotite and clinopyroxenite formed by gravitational accumulation of crystals that grew under the roof. The cyclic units of BTG and CTG formed along the upper margin of the sill by two different mechanisms: (1) layers of BTG crystallized in situ along an inward-growing roof and (2) layers of CTG formed by accumulation of buoyant plagioclase crystals. The layers of BTG are characterized by branching pseudomorphs after fayalite up to 50 cm in length that extend away from the upper margin. The original branching crystals are interpreted to have grown from stagnant intercumulus melt in a high thermal gradient resulting from the injection of new magma to the chamber.

An examination of how alcohol brands use sport to engage consumers on social media.

Science.gov (United States)

Westberg, Kate; Stavros, Constantino; Smith, Aaron C T; Munro, Geoff; Argus, Kevin

2018-01-01

To examine how alcohol brands use sport in their communication activities on social media. Despite extensive research exploring alcohol advertising and sponsorship through sport, minimal attention has been given to digital platforms. This study undertakes a qualitative content analysis to examine the social media activity of alcohol brands sponsoring the three largest spectator sports in Australia: Australian rules football, rugby league and cricket. Four sport-related social media strategies are identified through which alcohol brands solicit interaction with consumers, often involving co-creation of content and social activation. These strategies act as 'calls to action' and through the association of sport and alcohol encourage consumers to engage in competition, collaboration, celebration and consumption. These strategies are further strengthened by communications which draw upon themes of identity and camaraderie to resonate with the consumer. Sport-linked social media strategies utilised by alcohol brands extend beyond just promoting their product. They seek higher levels of engagement with the consumer to amplify and augment the connection between alcohol and the sport spectator experience. The discussion highlights the powerful combination of sport and social media as a mechanism by which these brands seek to interact with consumers and encourage them to both create and promote content to their social networks. These strategies allow alcohol brands to extend their marketing efforts in a manner which can elude alcohol codes and prove difficult for regulators to identify and control. [Westberg K, Stavros C, Smith ACT, Munro G, Argus K. An examination of how alcohol brands use sport to engage consumers on social media. Drug Alcohol Rev 2018;37:28-35]. © 2016 Australasian Professional Society on Alcohol and other Drugs.

NEWS: Why choose science?

Science.gov (United States)

2000-05-01

National concerns over the uptake of science subjects and an analysis of how school science departments together with careers programmes influence students' subject choices feature in a recent report from the UK's National Institute for Careers Education and Counselling. It points out that decisions on science subjects are taken very early in pupils' education, often well before the implications of those choices can be clearly understood. If pupils are to be encouraged to keep science options open, then both science teachers and careers advisers have important roles to play. Physics is in fact singled out in the report's recommendations as in need of special attention, due to its perceived difficulty both within the double-award science course and also at A-level. The lack of qualified teachers in physics is noted as a problem for schools and the many initiatives to address these issues should be encouraged according to the report, but within an overall high-profile and well funded national strategy for developing science education in schools. The report also notes that science teachers do not feel able to keep up with career information, whilst few careers advisers have a science background and have little opportunity to build up their knowledge of science syllabuses or of science and engineering careers. More contact between both types of specialist is naturally advocated. Copies of the full report, Choosing Science at 16 by Mary Munro and David Elsom, are available from NICEC, Sheraton House, Castle Park, Cambridge CB3 0AX on receipt of an A4 stamped (70p) addressed envelope. A NICEC briefing summary is also available from the same address (20p stamp required).

Intestinal parasites in paper money circulating in the city of Diamantina (Minas Gerais, Brazil

Directory of Open Access Journals (Sweden)

Costa MA

2018-05-01

Full Text Available Marina A Costa,1 Layane M Teodoro,1 Gustavo H Bahia-de-Oliveira,2 Ana Paula N Nunes,3 Ricardo A Barata1 1Laboratório de Parasitologia, Departamento de Ciências Biológicas, Universidade Federal dos Vales dos Jequitinhonha e Mucuri, Diamantina, MG, Brazil; 2Laboratório de Doenças Parasitárias, Departamento de Farmácia, Universidade Federal dos Vales dos Jequitinhonha e Mucuri, Diamantina, MG, Brazil; 3Laboratório de Bioestatística e Epidemiologia, Departamento de Ciências Básicas, Universidade Federal dos Vales dos Jequitinhonha e Mucuri, Diamantina, MG, Brazil Background: Banknotes are objects of great turnover and diffusion among the population, and can be efficient mechanisms in the dissemination of several intestinal parasites. This study investigated the presence of biological forms of intestinal parasites present in circulating cash banknotes in the city of Diamantina, Minas Gerais, Brazil, aiming to propose interventions aimed at improving local public health. Materials and methods: Between February and April 2017, samples of banknotes collected in five commercial establishments of the city were analyzed, namely: 1 gas station, 2 supermarket, 3 butchery, 4 pharmacy and 5 free fair. Ten circulating banknotes of each value (R$2.00, R$5.00, R$10.00, R$20.00, R$50.00 and R$100.00 were exchanged for new banknotes, washed with Tween 80 and, after spontaneous sedimentation, analyzed under an optical microscope with a magnification of 10× and 40×. Results: Cysts of Entamoeba coli (74.60%, cysts of Endolimax nana (16.94%, Giardia lamblia cysts (4.44%, unidentified nematode larvae (2.02%, Hymenolepis sp. (0.81%, Taenia sp. (0.81% and Ancylostomidae larvae (0.40% were found. Conclusions: The results revealed the need for improvements in basic sanitation, health and education activities that emphasized the importance of proper hand hygiene. Keywords: intestinal parasites, banknotes, Diamantina

Prevalence of Clostridium difficile in raw beef, cow, sheep, goat, camel and buffalo meat in Iran.

Science.gov (United States)

Rahimi, Ebrahim; Jalali, Mohammad; Weese, J Scott

2014-02-05

Clostridium difficile has been shown to be a nosocomial pathogen associated with diarrhoea and pseudomembranous colitis in hospitalised patients and the infection is believed to be acquired nosocomially. Recent studies have shown the occurrence of C. difficile in food animals which may act as a source of infection to humans.The aim of this study was to determine the occurrence of C. difficile in retail raw beef, cow, sheep, goat, camel and buffalo meat in Iran. From April to October 2012, a total of 660 raw meat samples from beef, cow, sheep, goat, camel and buffalo were purchased from 49 butcheries in Isfahan and Khuzestan provinces, Iran, and were evaluated for the presence of C. difficile using a method including selective enrichment in C. difficile broth, subsequent alcohol shock-treatment and plating onto C. difficile selective medium. C. difficile isolates were tested for the presence of toxin genes and were typed using PCR ribotyping. In this study, 13 of 660 meat samples (2%) were contaminated with C. difficile. The highest prevalence of C. difficile was found in buffalo meat (9%), followed by goat meat (3.3%), beef meat (1.7%), cow (0.94%) and sheep meat (0.9%). Seven of the 13C. difficile strains (53.9%) were positive for tcdA, tcdB and cdtB toxin genes and were classified as ribotype 078. Four strains (30.8%) were positive tcdA, and tcdB, and one strain (7.7%) was possessed only tcdB. The remaining isolate was non-toxigenic. Susceptibilities of 13C. difficile isolates were determined for 11 antimicrobial drugs using the disk diffusion assay. Resistance to clindamycin, gentamycin, and nalidixic acid was the most common finding. To our knowledge, the present study is the first report of the isolation of C. difficile from raw buffalo meat. This study indicates the potential importance of food, including buffalo meat, as a source of transmission of C. difficile to humans.

Excavations at Schöningen and paradigm shifts in human evolution.

Science.gov (United States)

Conard, Nicholas J; Serangeli, Jordi; Böhner, Utz; Starkovich, Britt M; Miller, Christopher E; Urban, Brigitte; Van Kolfschoten, Thijs

2015-12-01

The exceptional preservation at Schöningen together with a mixture of perseverance, hard work, and sheer luck led to the recovery of unique finds in an exceptional context. The 1995 discovery of numerous wooden artifacts, most notably at least 10 carefully made spears together with the skeletons of at least 20 to 25 butchered horses, brought the debate about hunting versus scavenging among late archaic hominins and analogous arguments about the purportedly primitive behavior of Homo heidelbergensis and Neanderthals to an end. Work under H. Thieme's lead from 1992 to 2008 and results from the current team since 2008 demonstrate that late H. heidelbergensis or early Neanderthals used sophisticated artifacts made from floral and faunal materials, in addition to lithic artifacts more typically recovered at Lower Paleolithic sites. The finds from the famous Horse Butchery Site and two dozen other archaeological horizons from the edges of the open-cast mine at Schöningen provide many new insights into the technology and behavioral patterns of hominins about 300 ka BP during MIS 9 on the Northern European Plain. An analysis of the finds from Schöningen and their contexts shows that the inhabitants of the site were skilled hunters at the top of the food chain and exhibited a high level of planning depth. These hominins had command of effective means of communication about the here and now, and the past and the future, that allowed them to repeatedly execute well-coordinated and successful group activities that likely culminated in a division of labor and social and economic patterns radically different from those of all non-human primates. The unique preservation and high quality excavations have led to a major paradigm shift or "Schöningen Effect" that changed our views of human evolution during the late Lower Paleolithic. In this respect, we can view the behaviors documented at Schöningen as a plausible baseline for the behavioral sophistication of archaic hominins

In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

Directory of Open Access Journals (Sweden)

J.A. Khan

2013-09-01

Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

Food availability and predation risk drive the distributional patterns of two pulmonate gastropods in a mangrove-saltmarsh transitional habitat.

Science.gov (United States)

Peng, Yisheng; Zhang, Min; Lee, Shing Yip

2017-09-01

The pulmonate gastropods, Phallomedusa solida (Martens, 1878) and Ophicardelus ornatus (Férussac, 1821), exhibit characteristic distributional patterns at the upper intertidal zones in estuarine mangrove and saltmarsh habitats on the eastern Australian coast. Past studies suggested inundation condition, soil salinity, and percent of vegetation cover were responsible for these patterns. In this study, the role of environmental parameters, food availability, physical stress, and predation pressure in determining the distributional patterns of these gastropods was evaluated along transects spanning saltmarsh, mangrove, and the ecotone habitats. For both species, the maximum population abundance occurred in the upper saltmarsh and the ecotone between mangrove and saltmarsh at 361.0 and 358.0 ind.m -2 , respectively, which was four times that of the lower saltmarsh. Mangroves were evaluated as the optimal habitat for the pulmonates in terms of the environmental parameters moisture content and food availability. However, due to its longer inundation duration within each tidal cycle, use of the mangrove habitat by the pulmonates was impeded because of difficulties in oxygen acquisition under submerged conditions. Laboratory experiments revealed the oxygen intake of the pulmonates dropped abruptly to 4.3-9.0% of aerial rates when submerged. This result indicated that mangroves were not the optimal habitat for the pulmonates. Furthermore, the visiting frequency of predators (yellowfin bream Acanthopagrus australis and toadfishes, Tetraodontidae) was 1.3 times higher in the mangrove compared to those in the ecotone and upper saltmarsh habitats. Underwater video recording also suggested high mortality of these gastropods at 31.7-88.9% in mangrove and 0.80-0.98 times higher than that in saltmarsh, resulting from the predators preying in the mangrove habitat during high tides. Despite the abiotic factors facilitating the distribution of the pulmonates in the mangrove, the

Spatial distribution and variability of carbon storage in different sympodial bamboo species in China.

Science.gov (United States)

Teng, Jiangnan; Xiang, Tingting; Huang, Zhangting; Wu, Jiasen; Jiang, Peikun; Meng, Cifu; Li, Yongfu; Fuhrmann, Jeffry J

2016-03-01

Selection of tree species is potentially an important management decision for increasing carbon storage in forest ecosystems. This study investigated and compared spatial distribution and variability of carbon storage in 8 sympodial bamboo species in China. The results of this study showed that average carbon densities (CDs) in the different organs decreased in the order: culms (0.4754 g g(-1)) > below-ground (0.4701 g g(-1)) > branches (0.4662 g g(-1)) > leaves (0.4420 g g(-1)). Spatial distribution of carbon storage (CS) on an area basis in the biomass of 8 sympodial bamboo species was in the order: culms (17.4-77.1%) > below-ground (10.6-71.7%) > branches (3.8-11.6%) > leaves (0.9-5.1%). Total CSs in the sympodial bamboo ecosystems ranged from 103.6 Mg C ha(-1) in Bambusa textilis McClure stand to 194.2 Mg C ha(-1) in Dendrocalamus giganteus Munro stand. Spatial distribution of CSs in 8 sympodial bamboo ecosystems decreased in the order: soil (68.0-83.5%) > vegetation (16.8-31.1%) > litter (0.3-1.7%). Total current CS and biomass carbon sequestration rate in the sympodial bamboo stands studied in China is 93.184 × 10(6) Mg C ha(-1) and 8.573 × 10(6) Mg C yr(-1), respectively. The sympodial bamboos had a greater CSs and higher carbon sequestration rates relative to other bamboo species. Sympodial bamboos can play an important role in improving climate and economy in the widely cultivated areas of the world. Copyright © 2015 Elsevier Ltd. All rights reserved.

Chemical Constituents and Structural Characterization of Polysaccharides from Four Typical Bamboo Species Leaves

Directory of Open Access Journals (Sweden)

Cheng-Zhang Wang

2015-03-01

Full Text Available In order to find bamboo leaves with high contents of bioactive polysaccharides, 32 samples were chosen to analyze their polysaccharide content by GC and sulfuric acid-anthrone colorimetric assays. Purified polysaccharides (BLPS were separated from the four varieties P. nigra (Lodd. Munro (PN, P. vivax McClure (PV, Chimonobambusa quadrangularis (Fenzi Makino (CQ, and P. bambussoides cv. Tanakae (PB by ultrasound extraction, solution precipitation, ion exchange resin, DEAE-52 and Sephadex G-100 chromatography. BLPS structural characterization was accomplished by HPLC-GPC, Fourier transform infra-red spectroscopy (FTIR and NaIO4-HIO4 oxidation reactions. The results showed that the total polysaccharides of the bamboo leaves in samples 1–32 ranged between 1.4% and 5.4%, Samples No. 29–No. 32 (PN, PV, CQ, and PB contained 2–3 fold more polysaccharides than No. 1~No. 28 among the 32 different species, particularly the content of galactose was in a range of 21.5%–34.1% for these four typical bamboo species leaves, which was also more than 2–3 fold higher than in No. 1–No. 28. Sugar analysis indicated that PN-PBLPS-1, PV-PBLPS-1, CQ-PBLPS-1 and PB-PBLPS-1 from the four varieties were homogeneous polysaccharides with molecular weights of 2.04 × 104, 1.15 × 104, 8.75 × 104 and 1.48 × 104 Da, respectively. PB-PBLPS-1 was a mixture of α-galactopyranose and β-d-glucopyranose linkages with α-(1→6 or β-(1→6glycosidic bonds, while PN-PBLPS-1, PV-PBLPS-1, and CQ-PBLPS-1 had α galactopyranose linkages with α-(1→6 glycosidic bonds.

Dyadic violence and readiness to change among male intimate partner violence offenders.

Science.gov (United States)

Crane, Cory A; Schlauch, Robert C; Eckhardt, Christopher I

2015-12-10

Although readiness to change is associated with mandated partner violence treatment compliance and subsequent violent behaviour among male offenders (e.g. Scott and Wolfe, 2003; Eckhardt et al., 2004), our understanding of the factors associated with pretreatment change remains limited. Offender research indicates that individual and dyadic violent behaviour are highly variable and that such variability may provide insight into levels of pretreatment change (Holtzworth-Munroe and Stuart, 1994; Archer, 2002). We sought to examine the associations between indicators of change and individual as well as dyadic violence frequency in a sample of male partner violence offenders. To determine whether severity and perceived concordance in the use of violence among male offenders and their female partners influenced readiness to change at pretreatment, 82 recently adjudicated male perpetrators of intimate partner violence were recruited into the current study and administered measures of readiness to change violent behaviour (Revised Safe at Home Scale; Begun et al., 2008) as well as partner violence experiences (Revised Conflict Tactics Scale; Straus et al., 1996). Analyses revealed an interaction between offender-reported male and female violence in the prediction of pretreatment readiness to change such that greater male violence was associated with greater readiness to change among males who reported that their female partners perpetrated low, but not high, levels of violence. Consistently, greater female violence was associated with lower readiness to change only among the most violent male offenders. Results provide support for the assertion that the most violent offenders may be the most resistant to partner violence intervention efforts, particularly when they perceive themselves to be victims as well. Enhanced motivational and couples programming may facilitate treatment engagement among the high-risk group of male offenders who report concordant relationship

Efficiency Problems of Child Protection in Lithuania

Directory of Open Access Journals (Sweden)

Ilona Tamutienė

2018-05-01

Full Text Available This article identifies the main problems which have negative impact on efficiency of child protection. The article is based on case analysis of 203 families at social risk carried out in 2015–2016 and on qualitative interviews of 23 children growing in families at social risk which were conducted in 2016–2017. The content and context analysis are performed of the basis of this data. The protection procedures starting with reports to the Department of Child Rights’ Protection, case investigations, application of relevant interventions and finally evaluation of help efficiency are reconstructed. The principles of effective child protection distinguished by Eileen Munro has been chosen as the basis of the evaluation and identification of the main barrier to the efficient child protection. It has been identified that the process of practical protection is not centred on the child’s problems and needs, but it only focuses on the parents’ problems. Children are not sufficiently enabled to participate in their own protection process. Majority of the neglected and abused children are not helped because they are not listened to and their experiences are ignored, although 5 institutional professionals are “working” with the family. The fragments of social work with child has been found only among the experiences of the children attending Children’s Care Day Centres. It can be certainly stated that there is clear lack of services for children. Therefore, it is necessary to strengthen the Children’s Day Care Centres, to find possibilities to finance social workers and psychologists to work with children, since only family (adults centred protection is not effective. It is recommended to improve the training of child care specialists and raise the professional level of those in practice.

Microhabitats de mosquitos (Diptera, Culicidae em internódios de taquara na Mata Atlântica, Paraná, Brasil Mosquitoes microhabitats (Diptera, Culicidae in bamboo internodes in Atlantic forest, Paraná, Brazil

Directory of Open Access Journals (Sweden)

Ana Leuch Lozovei

Full Text Available During two consecutive years, from January 1985 to December 1986, a comparative study of mosquitoes preferences for breeding habitat was carried out in the Atlantic Forest of the Serra do Mar, Paraná State, Brazil. To achieve it, 1875 bamboo internodes aligned vertically in live green, bamboo plants Merostachys speciosa Munro and Merostachys sp. were used, in which metabolic water was exuded from the plant itself, and presenting different size/pattern holes at their lateral walls, bored by the local sylvan fauna. Another group of 1200 individual internode traps was used as comparative element, carved out with a transversal cut by a saw, filled with local stream water and held in branches at different heights in the vegetal strata nearby. At both microhabitat types, a total of 17 culicid species was registered. Culex (Microculex neglectus Lutz, 1904, Cx. (Carrollia soperi Antunes & Lane, 1937, Sabethes (Sabethes batesi Lane & Cerqueira, 1942 and Sa. (Sabethinus melanonymphe (Dyar, 1924colonized exclusively live plant internodes, while Culex (Microculex elongatus Rozeboom & Lane, 1950, Cx. (Carrollia iridescens (Lutz, 1905, Cx. (Carrollia kompi Valencia,1973and Trichoprosopon (Trichoprosopon soaresi Dyar & Knab, 1907 bred only in internode traps. The remaining nine species colonized both habitats indistinctly. Quantitatively, was detected the abundance of 60.1% at live green internodes, against 39.9% for internode traps. Concerning the different patterns of bored live internode holes, 40.3% of the total computed specimens were collected in square or rectangular holes, 31.9% in two hole internodes, one minute circular, the other wider, and the remaining 28.8% of specimens distributed in other pattern type internodes. The mosquitoes breeding at these microhabitats fall in the culicid entomofauna specialized at locating and detecting peculiar and propitious mesogen conditions for breeding purposes.

Stabilization of the Rayleigh-Taylor instability by convection and thermal conduction in smooth density gradient: WKB analysis

International Nuclear Information System (INIS)

Bud'ko, A.B.; Liberman, M.A.; Bondarenko, E.A.

1992-01-01

Since development of the RT modes in the ablatively accelerated plasma of laser targets imposes crucial limitations on symmetry of spherical implosions and hence on energy cumulation, it has been the subject of intensive numerical and analytical analysis in the recent years, particularly in the context of inertial confinement fusion. Recent thin-foil ablative-acceleration experiments as well as the results of 2D numerical simulations demonstrated substantial reduction of the instability growth rates compared with the classical theory predictions up to the total stabilization in the short-wavelength limit. The numerical results indicated that the main stabilization mechanism is convection. To derive the scaling laws for the RT growth rates and cut-off wavenumbers in the wide range of flow parameters, analytical solutions attract special interest. The analytical approach based on the discontinuity model was developed to analyze the reduction of the RT growth rates by the plasma convective flow and the thermal conductivity effects. The following major problem arises in the discontinuity approximation, which leaves the solution undetermined: the number of the boundary conditions on the perturbed ablation surface is not sufficient to derive the dispersion equation. One needs additional boundary conditions not associated with the conservation laws on the discontinuity surface to close the system of linearized equations for small perturbations. The stabilization effect of highly structured hydrodynamic profiles was studied by Mikaelian and Munro for a stationary plasma. Nevertheless, no reasonable analytical model was constructed taking into account the combined convective, thermal conductivity and density gradient reduction of the RT growth rates. In this report we develop the analytical approach based on the WKB approximation to analyze the stabilization of the RT modes in plasma with smooth density and velocity gradients. (author) 9 refs., 1 fig

Sarcocystis sinensis is the most prevalent thick-walled Sarcocystis species in beef on sale for consumers in Germany.

Science.gov (United States)

Moré, G; Pantchev, A; Skuballa, J; Langenmayer, M C; Maksimov, P; Conraths, F J; Venturini, M C; Schares, G

2014-06-01

Bovines are intermediate hosts of Sarcocystis cruzi, Sarcocystis hirsuta, and Sarcocystis hominis, which use canids, felids, or primates as definitive hosts, respectively. Cattle represent also intermediate hosts of Sarcocystis sinensis, but the definitive hosts of this parasite are not yet known. Sarcocystosis in cattle is frequently asymptomatic. The infection is characterized by the presence of thin-walled (S. cruzi) or thick-walled muscle cysts or sarcocysts (S. hominis, S. sinensis, and S. hirsuta). Recent reports suggest high prevalence of the zoonotic S. hominis in beef in Europe. We therefore aimed at differentiating Sarcocystis spp. in beef offered to consumers in Germany using molecular and microscopical methods, focusing on those species producing thick-walled sarcocysts. A total of 257 beef samples were obtained from different butcheries and supermarkets in Germany and processed by conventional and multiplex real-time PCR. In addition, 130 of these samples were processed by light microscopy and in 24.6% thick-walled cysts were detected. Transmission electron microscopical analysis of six of these samples revealed an ultrastructural cyst wall pattern compatible with S. sinensis in five samples and with S. hominis in one sample. PCR-amplified 18S ribosomal DNA (rDNA) fragments of 28 individual thick-walled cysts were sequenced, and sequence identities of ≥98% with S. sinensis (n = 22), S. hominis (n = 5) and S. hirsuta (n = 1) were observed. Moreover, nine Sarcocystis sp. 18S rDNA full length gene sequences were obtained, five of S. sinensis, three of S. hominis, and one of S. hirsuta. Out of all samples (n = 257), 174 (67.7%) tested positive by conventional PCR and 179 (69.6%) by multiplex real-time PCR for Sarcocystis spp. Regarding individual species, 134 (52%), 95 (37%), 17 (6.6%), and 16 (6.2%) were positive for S. cruzi, S. sinensis, S. hirsuta, and S. hominis, respectively. In conclusion, S. sinensis is the most prevalent thick

The Validity of Likeability as a New Construct of ESL Pronunciation

Directory of Open Access Journals (Sweden)

Hmoud Alotaibi

2014-06-01

Full Text Available The most significant constructs of ESL pronunciation models are accentedness, intelligibility, and comprehensibility (Derwing & Munro 2005; Jenkins, 2000; Pickering, 2006. It is clear though that the assessment of these characteristics shows no consideration for the potential affection of the assessor towards the speaker. Thus, the study presented here proposes a notion named “likeability” (L to examine whether the ratings of listeners are determined in part by the esteem in which they hold the speaker. A questionnaire compiled by Murphy (2014 was given to 11 US and 11 ELLs. Participants were provided with three YouTube links of interviews of Nelson Mandela, a former President of South Africa, Ban Ki-Moon, the current Secretary-General of the United Nations, and Bandar Bin Sultan, the former Saudi ambassador to the United States. The first hypothesis of the study is that the American raters would be harsher in their judgments of Ban Ki-moon and Bin Sultan due to the political conflict and the dramatic events that have been associated with them in the past but this would not be the case with Mandela who has many ardent admirers in the U.S.A. The second hypothesis is that the participants among the international group who share the language background of the speaker would rate that speaker more highly than the others. Unexpectedly, however, both US and ELL listeners rated Mandela the lowest in terms of comprehensibility and Bin Sultan the most comprehensible. All the participants in the international group provided similar ratings regardless of whether they share the language background of the speaker or not. The paper concludes with a suggestion for more thorough investigation of the concept of likeability in selecting ESL speech models, particularly with assigning speakers with different professional fields, ethnicity, and language background. This investigation is crucial in finding the most suitable models for pronunciation teaching.

Pharmacological interventions for adolescents and adults with ADHD: stimulant and nonstimulant medications and misuse of prescription stimulants

Directory of Open Access Journals (Sweden)

Weyandt LL

2014-09-01

Full Text Available Lisa L Weyandt, Danielle R Oster, Marisa E Marraccini, Bergljot Gyda Gudmundsdottir, Bailey A Munro, Brynheld Martinez Zavras, Ben Kuhar Department of Psychology, University of Rhode Island, Kingston, RI, USA Abstract: Attention-deficit/hyperactivity disorder (ADHD is a neurodevelopmental disorder characterized by symptoms of inattention, hyperactivity, and impulsivity that cause functional impairment. Recent research indicates that symptoms persist into adulthood in the majority of cases, with prevalence estimates of approximately 5% in the school age population and 2.5%–4% in the adult population. Although students with ADHD are at greater risk for academic underachievement and psychosocial problems, increasing numbers of students with ADHD are graduating from high school and pursuing higher education. Stimulant medications are considered the first line of pharmacotherapy for individuals with ADHD, including college students. Although preliminary evidence indicates that prescription stimulants are safe and effective for college students with ADHD when used as prescribed, very few controlled studies have been conducted concerning the efficacy of prescription stimulants with college students. In addition, misuse of prescription stimulants has become a serious problem on college campuses across the US and has been recently documented in other countries as well. The purpose of the present systematic review was to investigate the efficacy of prescription stimulants for adolescents and young adults with ADHD and the nonmedical use and misuse of prescription stimulants. Results revealed that both prostimulant and stimulant medications, including lisdexamfetamine dimesylate, methylphenidate, amphetamines, and mixed-amphetamine salts, are effective at reducing ADHD symptoms in adolescents and adults with ADHD. Findings also suggest that individuals with ADHD may have higher rates of stimulant misuse than individuals without the disorder, and

Static Compression of Hydrous Komatiite Liquid

Science.gov (United States)

Agee, C. B.

2005-12-01

High pressure sink/float experiments have been performed on komatiite with 3 and 10 wt% added H2O in order to investigate the effect of water on magma density at high pressure and to determine if density crossovers between equilibrium olivine and hydrous komatiite can exist in the upper mantle. The starting composition komatiite, from Munro Township, with MgO=28 wt%, has been previously studied using sink/float experiments under anhydrous conditions up to 9.3 GPa (Agee and Walker, 1988, 1993). In the present study the starting material mechanical mixtures consisted of powdered komatiite, brucite, fayalite, and reagent oxides of SiO2, Al203, and CaO. Samples were contained in compression-sealed molybdenum capsules. Sink/float marker spheres implemented were gem quality synthetic forsterite (Fo100) and San Carlos olivine (Fo90). Experimental run times were 30 seconds, thus minimizing sphere-liquid reactions and liquid reaction with capsule and pressure media. All experiments were carried out in a Walker multi-anvil apparatus at the Institute of Meteoritics, University of New Mexico. The komatiite + 3 wt% H2O liquid density was bracketed at 1900-1950°C by a float of Fo100 at 7 GPa and a sink at 6 GPa. Neutral buoyancy of Fo100 was observed at 6.4 GPa. An additional neutral buoyancy of Fo90 was observed at 9 GPa. These preliminary results suggest that a density crossover between equilibrium olivine (Fo93) and hydrous komatiite with up to 3 wt% H2O can exist in the mantle, thus lending support to the water filter hypothesis for the region above the 410 km discontinuity (Bercovici and Karato, 2003). Our results for static compression of komatiite + 3 wt% H2O are in good agreement with diamond sink/float observations by Sakamaki et al.(2005) on MORB + 2 wt% H2O. Our komatiite + 10 wt% H2O liquid density measurements are still in progress; however, flotation of Fo100 has not been observed in these experiments up to 9.2 GPa.

Population ecology of the tonguefish Symphurus thermophilus (Pisces; Pleuronectiformes; Cynoglossidae) at sulphur-rich hydrothermal vents on volcanoes of the northern Mariana Arc

Science.gov (United States)

Tunnicliffe, Verena; Tyler, Jennifer; Dower, John F.

2013-08-01

Flatfish are a major component of the hydrothermal vent community on three seamounts of the northern Mariana Volcanic Arc in the northwest Pacific. Nikko, Kasuga-2 and Daikoku seamounts host vent fields between 375 and 480 m depth where high temperature vents release molten sulphur. The small cynoglossid tonguefish, Symphurus thermophilus Munroe and Hashimoto, is ubiquitous in all vent habitats observed on these seamounts: among extensive fields of tubeworms and mussels and on solid sulphur surfaces on Nikko; on sulphur-rich sediments and barnacle-covered boulders on Kasuga-2; and on recent sulphur flows and on broad areas of loose and semi-consolidated sediments on Daikoku. We recorded repeated forays by individuals onto flows of molten sulphur as these surfaces cooled. Based on observations using ROVs, the mean density is 90 fish/m2 with maximum counts over 200 fish/m2 on Daikoku sediments. Compared to collected tonguefish from Daikoku and Kasuga-2, those from Nikko have significantly greater lengths and, on average, six times the mass. Otolith data indicate upper ages of 13 years with Nikko tonguefish growing significantly faster. Diets of tonguefish on the three seamounts reflect the different habitats and prey availability; in Daikoku specimens, small crustaceans and polychaetes are most common while on Nikko, gut contents are predominantly larger shrimp. We made the unusual observation of stunned midwater fish falling to the seafloor near the vents where S. thermophilus immediately attacked them. This tonguefish has a wide diet range and foraging behaviour that likely influence the differing growth rates and sizes of fish inhabiting the different vent sites. Limited genetic data suggest that larval exchange probably occurs among sites where the common habitat factor is high levels of elemental sulphur forming hard and partly unconsolidated substrata. Here, in the northern range of the Mariana Trench Marine National Monument, S. thermophilus, despite having an

Human health risks related to the consumption of foodstuffs of animal origin contaminated by bisphenol A.

Science.gov (United States)

Gorecki, Sébastien; Bemrah, Nawel; Roudot, Alain-Claude; Marchioni, Eric; Le Bizec, Bruno; Faivre, Franck; Kadawathagedara, Manik; Botton, Jérémie; Rivière, Gilles

2017-12-01

, despite extensive sampling performed in several different shops (butcheries, supermarkets …. ) and in different conditions (fresh, prepared, frozen …), the source(s) of the contamination could not be specifically identified. Copyright © 2017 Elsevier Ltd. All rights reserved.

Hydrographic and chemical water parameters collected by CTD and other instruments from the Pelican and the Tommy Munro in coastal waters of Louisiana from 1994-07-24 to 1997-07-29 (NCEI Accession 0164298)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Hydrographic and chemical data were collected for a week in late July between 1994-1997 in order to survey the coastal hypoxia on Louisiana continental shelf....

Properties of Modern Dust Accumulating in the Uinta Mountains, Utah, USA, and Soil Evidence of Long-Term Dust Deposition

Science.gov (United States)

Munroe, J. S.

2013-12-01

Modern eolian sediment was collected at four locations in the alpine zone of the Uinta Mountains (Utah, USA) between July 2011 and July 2012. Collectors were a passive design based on the classic marble dust trap, but modified for use in this high-precipitation environment. On average the collectors accumulated 1.5 gm of dust, corresponding to an annual flux of 4.4 g/m2. This result is similar to values measured from snowpack samples in the Wind River (Wyoming) and San Juan (Colorado) Mountains. Dust flux was 3 to 5x higher during the winter compared with summer at the two sites featuring continuous vegetation, but was consistent between the seasons at the two collectors surrounded by a greater area of exposed soil. XRD analysis reveals that dust samples are dominated by quartz, potassium feldspar, plagioclase, and illite. Some samples contain amphibole and chlorite. In contrast, samples of fine sediment collected from the surface of modern snowbanks are dominated by clay with no feldspar or quartz, suggesting that these minerals are derived from the surrounding soil surface, which is snow-covered in the winter. ICP-MS analysis reveals that the geochemistry of the coarse (>63-μm) fraction of the dust resembles that of the underlying bedrock, confirming a local origin for this sediment. In contrast, the fine (horizon, supporting an eolian origin for the ubiquitous layer of fines that mantles soil profiles throughout the Uinta Mountains. Grain size analysis with laser scattering reveals that modern dust is very well-sorted, with a median size of 8 μm (7.0 Φ). Using the annual dust flux and mean grain size, and taking into account the measured bulk density (0.95 gm/cm3), organic matter content (20%), and silt content (32%) of this loess cap, the extrapolated loess accretion rate is ~18 cm per 10,000 years. Given that prior studies (Bockheim et al., 2000 Catena; Munroe, 2007, Arctic, Antarctic, and Alpine Research) have reported mean loess thickness from 16 to 25 cm

Reinforcement course 2013. Challenges at the operation end of nuclear power plants

International Nuclear Information System (INIS)

Rey, Matthias

2014-01-01

The reinforcement course 2013 of the Nuclear Forum in Switzerland dedicated itself to the question, of which challenges are implicated by decommissioning and dismantling nuclear power plants. The course has been divided into 4 blocks, discussing concepts regarding decommissioning, special points such as organisational or psychological aspects as well as juridical and practical questions. Around 140 persons accepted the invitation of the committee for educational questions under the patronage of Urs Weidmann, head of the nuclear power plant Beznau. Altogether 17 presentations dealt with the following topics: 'Strategies and Steps of Decommissioning' by Roger Lundmark, 'Decommissioning from the Perspective of the Swiss Regulatory Authority' by Hannes Haenggi, 'Operating Period Management Using the Example of the Nuclear Power Plant Leibstadt' by Johannis Noeggerath, 'Questions and Concepts from the Perspective of a Nuclear Power Plant Operator' by Roland Schmidiger, 'Decommissioning of nuclear facilities in the UK' by Andrew Munro, 'Practical experiences of transferring nuclear power plants from operating to out of operation' by Gerd Reinstrom, 'Dismantling of Nuclear Facilities: From the Pilot Scheme to Industrialized Disassembling' by Anke Traichel and Thomas Seipolt, 'Organisational challenges: From Decommissioning Strategy to Decommissioning Targets' by Michael Kruse, Anton von Gunten, Julia Heizinger, Joerg Sokoll, 'Knowing That and Knowing How - Motivational Aspects of Safety-Related Knowledge Management for the Post-Operational phase and dismantling' by Frank Ritz, 'The Juridical Frame of Decommissioning' by Peter Koch, 'The Path to the Decommissioning Order and its Guidelines Ensi-G17' by Torsten Krietsch, 'Requirements for a Safe and Economical Decommissioning From the Perspective of the Operator' by Anton Von Gunten, Michael Kruse, Thomas Herren, Erwin Neukaeter, Mario Radke and Anton Schegg, 'Evaluation of Activation Distribution in a Nuclear Power Plant

The role of tephra studies in African paleoanthropology as exemplified by the Sidi Hakoma Tuff

Science.gov (United States)

WoldeGabriel, Giday; Endale, Tamrat; White, Tim D.; Thouveny, Nicolas; Hart, William K.; Renne, Paul R.; Asfaw, Berhane

2013-01-01

Beginning in the 1960s, geological and paleoanthropological exploration of the Ethiopian rift system's basins have led to the discovery and assembly of the most comprehensive record of human biological and technological change during the last 6 million years. The hominid fossils, including partial skeletons, were primarily discovered in the Afar Rift, the Main Ethiopian Rift, and in the Omo Basin of the broadly rifted zone of SW Ethiopia. The paleoanthropological research areas within the SW Afar Rift that have yielded many diverse hominid species and the oldest stone tools are, from north to south, Woranso-Mille (aff. Ardipithecus and Au. afarensis), Hadar (Au. afarensis, Homo sp.), Dikika (Au. afarensis), Gona (Ar. kadabba, Ar. ramidus, H. erectus, and oldest stone tools), Middle Awash (Ar. kadabba, Ar. ramidus, Au. anamensis, Au. afarensis, Au. garhi, H. erectus, H. rhodesiensis, H. sapiens idaltu, and the oldest paleo-butchery locality), and Galili (Au. afarensis). Additional hominid remains were discovered at Melka Kunture on the banks of the Awash River near its source along the western margin of the central part of the Main Ethiopian Rift (H. erectus), at Konso (H. erectus and A. boisei), and at the southern end of the MER, and in the Omo Basin (Au. anamensis, Au. afarensis, Au. aethiopicus, Au. boisei, H. habilis, and H. erectus). Distal and sometimes proximal tephra units interbedded within fossilifeous sedimentary deposits have become key elements in this work by providing chronological and correlative control and depositional contexts. Several regional tephra markers have been identified within the northern half of the eastern African rift valley in Ethiopia and Kenya, and in marine sediments of the Gulf of Aden Rift and the NW Indian Ocean. Out of the many regional tephra stratigraphic markers that range in age from the early Pliocene (3.97 Ma) to the late Pleistocene (0.16 Ma), the Sidi Hakoma Tuff (SHT) has been more widely identified and thoroughly

Reinforcement course 2013. Challenges at the operation end of nuclear power plants; Vertiefungskurs 2013. Herausforderungen am Betriebsende von Kernkraftwerken

Energy Technology Data Exchange (ETDEWEB)

Rey, Matthias [Nuklearforum Schweiz/Forum nucleaire suisse, Bern (Switzerland)

2014-03-15

The reinforcement course 2013 of the Nuclear Forum in Switzerland dedicated itself to the question, of which challenges are implicated by decommissioning and dismantling nuclear power plants. The course has been divided into 4 blocks, discussing concepts regarding decommissioning, special points such as organisational or psychological aspects as well as juridical and practical questions. Around 140 persons accepted the invitation of the committee for educational questions under the patronage of Urs Weidmann, head of the nuclear power plant Beznau. Altogether 17 presentations dealt with the following topics: 'Strategies and Steps of Decommissioning' by Roger Lundmark, 'Decommissioning from the Perspective of the Swiss Regulatory Authority' by Hannes Haenggi, 'Operating Period Management Using the Example of the Nuclear Power Plant Leibstadt' by Johannis Noeggerath, 'Questions and Concepts from the Perspective of a Nuclear Power Plant Operator' by Roland Schmidiger, 'Decommissioning of nuclear facilities in the UK' by Andrew Munro, 'Practical experiences of transferring nuclear power plants from operating to out of operation' by Gerd Reinstrom, 'Dismantling of Nuclear Facilities: From the Pilot Scheme to Industrialized Disassembling' by Anke Traichel and Thomas Seipolt, 'Organisational challenges: From Decommissioning Strategy to Decommissioning Targets' by Michael Kruse, Anton von Gunten, Julia Heizinger, Joerg Sokoll, 'Knowing That and Knowing How - Motivational Aspects of Safety-Related Knowledge Management for the Post-Operational phase and dismantling' by Frank Ritz, 'The Juridical Frame of Decommissioning' by Peter Koch, 'The Path to the Decommissioning Order and its Guidelines Ensi-G17' by Torsten Krietsch, 'Requirements for a Safe and Economical Decommissioning From the Perspective of the Operator' by Anton Von Gunten, Michael Kruse, Thomas

Plasma ion sources and ion beam technology in microfabrications

International Nuclear Information System (INIS)

Ji, Lili

2007-01-01

For over decades, focused ion beam (FIB) has been playing a very important role in microscale technology and research, among which, semiconductor microfabrication is one of its biggest application area. As the dimensions of IC devices are scaled down, it has shown the need for new ion beam tools and new approaches to the fabrication of small-scale devices. In the meanwhile, nanotechnology has also deeply involved in material science research and bioresearch in recent years. The conventional FIB systems which utilize liquid gallium ion sources to achieve nanometer scale resolution can no longer meet the various requirements raised from such a wide application area such as low contamination, high throughput and so on. The drive towards controlling materials properties at nanometer length scales relies on the availability of efficient tools. In this thesis, three novel ion beam tools have been developed and investigated as the alternatives for the conventional FIB systems in some particular applications. An integrated focused ion beam (FIB) and scanning electron microscope (SEM) system has been developed for direct doping or surface modification. This new instrument employs a mini-RF driven plasma source to generate focused ion beam with various ion species, a FEI two-lens electron (2LE) column for SEM imaging, and a five-axis manipulator system for sample positioning. An all-electrostatic two-lens column has been designed to focus the ion beam extracted from the source. Based on the Munro ion optics simulation, beam spot sizes as small as 100 nm can be achieved at beam energies between 5 to 35 keV if a 5 (micro)m-diameter extraction aperture is used. Smaller beam spot sizes can be obtained with smaller apertures at sacrifice of some beam current. The FEI 2LE column, which utilizes Schottky emission, electrostatic focusing optics, and stacked-disk column construction, can provide high-resolution (as small as 20 nm) imaging capability, with fairly long working distance

Teores de colesterol, lipídios totais e ácidos graxos em cortes de carne suína Cholesterol, total lipds and fatty acids in cuts of pork

Directory of Open Access Journals (Sweden)

Neura Bragagnolo

2002-01-01

Full Text Available A carne suína é um alimento considerado rico em colesterol, lipídios e ácidos graxos saturados. De acordo com a AMERICAN HEART ASSOCIATION, para manter baixos níveis de colesterol sangüíneo, a alimentação deve ser pobre em colesterol e lipídios, principalmente gordura saturada. No presente trabalho foram determinados os teores de colesterol, lipídios totais e ácidos graxos em lombo, pernil, paleta e toucinho, comercializados em açougues da cidade de Campinas, São Paulo. Foi verificado também o efeito da inclusão da gordura externa nos níveis destes componentes. O teor médio de lipídios totais foi de 3 a 5g/100g nos cortes de carne e 83g/100g no toucinho. O colesterol variou, em média, de 42 a 53mg/100g, sendo menor no lombo e maior no toucinho. Não houve diferença significativa (p³0,05 no nível de colesterol entre lombo com e sem gordura externa. Em todos os cortes e no toucinho, foram identificados trinta e seis (36 ácidos graxos, os principais dos quais foram: 18:1ômega9, 16:0, 18:2ômega6, 18:0, 16:1ômega7 e 18:1ômega7. O total de ácidos graxos saturados, monoinsaturados e poliinsaturados variou de 33 a 41%, 42 a 48% e 11 a 25%, respectivamente.Pork is a food considered to be rich in cholesterol, lipids and saturated fatty acids. According to the American Heart Association, the diet must be low in cholesterol and lipids, especially saturated fat. In the present work, total lipids, cholesterol and fatty acids were determined in pork loin, fresh ham, pork shoulder and backfat, commercialized in butchery of Campinas City, São Paulo State, Brazil. The mean total lipids was 3 to 5g/100g in the meat cuts and 83g/100g in backfat. Cholesterol varied, on the average, from 42 to 53mg/100g, being lower in pork loin and higher in backfat. No significant difference (p³0,05 in cholesterol content was seen in pork loin with or without external fat. Thirty-six fatty acids were identified in all cuts and the backfat, with

Development and validation of a method to predict coal pillar life in South Africa

Energy Technology Data Exchange (ETDEWEB)

Van Der Merwe, J.N. [Pretoria Univ., Dept. of Mining Engineering (South Africa)

2005-07-01

One of the most difficult aspects of mine closure procedures, is to predict the long term stability of pillars in the case of coal mining. In South African coal mining, pillars have been designed since the late 1960's with the aid of a pillar strength formula based on statistical analysis of failed pillar cases by the well known team of Salamon and Munro. They developed the widely used power formula for pillar strength. Since that time, however, the data base of failed pillars has effectively doubled in size and re-analysis of the new data indicated that the original pillar strength of small pillars may have been over estimated. The data was then extensively re-analysed and a more effective linear formula for pillar strength was found. The most important differences between the two formulae are that the predicted strength of small pillars are lower and the strength of larger pillars, higher with the new formula. However, neither of the two methods explicitly cater for the prediction of the expected time of stability of coal pillars. No direct correlation between the safety factors and the period of stability of pillars could be found. It was then determined that the most frequent mode of pillar failure was by progressive scaling. Using the new formula to determine a minimum value of pillar safety factor (i.e. the safety factor at which failure can be taken as guaranteed to occur), the final sizes - after scaling - at which the failed pillars had to be in order to fail, were determined. The differences between the original dimensions and the postulated final dimensions were then used to calculate a rate of pillar scaling. The rate was then re-applied to the original data bases of both failed and intact pillar cases and distinct differences were found. The projected lives of the failed pillars were substantially shorter than the projected lives of the intact pillars. While this inspired confidence in the procedure, it was still based on an assumed and unproven

Dosimetric characterization of the GammaClip™{sup 169}Yb low dose rate permanent implant brachytherapy source for the treatment of nonsmall cell lung cancer postwedge resection

Energy Technology Data Exchange (ETDEWEB)

Currier, Blake [Medical Physics, University of Massachusetts Lowell, 1 University Avenue, Lowell, Massachusetts 01854 (United States); Munro, John J. III [Source Production and Equipment Co., Inc., 113 Teal Street, St. Rose, Louisiana 70087 (United States); Medich, David C. [Department of Physics, Worcester Polytechnic Institute, 100 Institute Road, Worcester, Massachusetts 01609 (United States)

2013-08-15

Purpose: A novel {sup 169}Yb low dose rate permanent implant brachytherapy source, the GammaClip™, was developed by Source Production and Equipment Co. (New Orleans, LA) which is designed similar to a surgical staple while delivering therapeutic radiation. In this report, the brachytherapy source was characterized in terms of “Dose calculation for photon-emitting brachytherapy sources with average energy higher than 50 keV: Report of the AAPM and ESTRO” by Perez-Calatayud et al. [Med. Phys. 39, 2904–2929 (2012)] using the updated AAPM Task Group Report No. 43 formalism.Methods: Monte Carlo calculations were performed using Monte Carlo N-Particle 5, version 1.6 in water and air, the in-air photon spectrum filtered to remove photon energies below 10 keV in accordance with TG-43U1 recommendations and previously reviewed {sup 169}Yb energy cutoff levels [D. C. Medich, M. A. Tries, and J. M. Munro, “Monte Carlo characterization of an Ytterbium-169 high dose rate brachytherapy source with analysis of statistical uncertainty,” Med. Phys. 33, 163–172 (2006)]. TG-43U1 dosimetric data, including S{sub K}, D-dot (r,θ), Λ, g{sub L}(r), F(r, θ), φ{sub an}(r), and φ{sub an} were calculated along with their statistical uncertainties. Since the source is not axially symmetric, an additional set of calculations were performed to assess the resulting axial anisotropy.Results: The brachytherapy source's dose rate constant was calculated to be (1.22 ± 0.03) cGy h{sup −1} U{sup −1}. The uncertainty in the dose to water calculations, D-dot (r,θ), was determined to be 2.5%, dominated by the uncertainties in the cross sections. The anisotropy constant, φ{sub an}, was calculated to be 0.960 ± 0.011 and was obtained by integrating the anisotropy factor between 1 and 10 cm using a weighting factor proportional to r{sup −2}. The radial dose function was calculated at distances between 0.5 and 12 cm, with a maximum value of 1.20 at 5.15 ± 0.03 cm. Radial dose

Development and validation of a method to predict coal pillar life in South Africa

International Nuclear Information System (INIS)

Van Der Merwe, J.N.

2005-01-01

One of the most difficult aspects of mine closure procedures, is to predict the long term stability of pillars in the case of coal mining. In South African coal mining, pillars have been designed since the late 1960's with the aid of a pillar strength formula based on statistical analysis of failed pillar cases by the well known team of Salamon and Munro. They developed the widely used power formula for pillar strength. Since that time, however, the data base of failed pillars has effectively doubled in size and re-analysis of the new data indicated that the original pillar strength of small pillars may have been over estimated. The data was then extensively re-analysed and a more effective linear formula for pillar strength was found. The most important differences between the two formulae are that the predicted strength of small pillars are lower and the strength of larger pillars, higher with the new formula. However, neither of the two methods explicitly cater for the prediction of the expected time of stability of coal pillars. No direct correlation between the safety factors and the period of stability of pillars could be found. It was then determined that the most frequent mode of pillar failure was by progressive scaling. Using the new formula to determine a minimum value of pillar safety factor (i.e. the safety factor at which failure can be taken as guaranteed to occur), the final sizes - after scaling - at which the failed pillars had to be in order to fail, were determined. The differences between the original dimensions and the postulated final dimensions were then used to calculate a rate of pillar scaling. The rate was then re-applied to the original data bases of both failed and intact pillar cases and distinct differences were found. The projected lives of the failed pillars were substantially shorter than the projected lives of the intact pillars. While this inspired confidence in the procedure, it was still based on an assumed and unproven rate

Geochemistry of komatiites and basalts from the Rio das Velhas and Pitangui greenstone belts, São Francisco Craton, Brazil: Implications for the origin, evolution, and tectonic setting

Science.gov (United States)

Verma, Sanjeet K.; Oliveira, Elson P.; Silva, Paola M.; Moreno, Juan A.; Amaral, Wagner S.

2017-07-01

The Neoarchean Rio das Velhas and Pitangui greenstone belts are situated in the southern São Francisco Craton, Minas Gerais, Brazil. These greenstone belts were formed between ca. 2.79-2.73 Ga, and consist mostly of mafic to ultramafic volcanics and clastic sediments, with minor chemical sediments and felsic volcanics that were metamorphosed under greenschist facies. Komatiites are found only in the Rio das Velhas greenstone belt, which is composed of high-MgO volcanic rocks that have been identified as komatiites and high-Mg basalts, based on their distinctive geochemical characteristics. The Rio das Velhas komatiites are composed of tremolite + actinolite + serpentine + albite with a relict spinifex-texture. The Rio das Velhas komatiites have a high magnesium content ((MgO)adj ≥ 28 wt.%), an Al-undepleted Munro-type [(Al2O3/TiO2)adj and (CaO/Al2O3)adj] ratio ranging from 27 to 47 and 0.48 to 0.89, relatively low abundances of incompatible elements, a depletion of light rare earth elements (LREE), a pattern of non-fractionated heavy rare- earth elements (HREE), and a low (Gd/Yb)PM ratio (≤ 1.0). Negative Ce anomalies suggest that alteration occurred during greenschist facies metamorphism for the komatiites and high-Mg basalts. The low [(Gd/Yb)PM 18] and high HREE, Y, and Zr content suggest that the Rio das Velhas komatiites were derived from the shallow upper mantle without garnet involvement in the residue. The chemical compositions [(Al2O3/TiO2)adj, (FeO)adj, (MgO)adj, (CaO/Al2O3)adj, Na, Th, Ta, Ni, Cr, Zr, Y, Hf, and REE] indicate that the formation of the komatiites, high-Mg basalts and basalts occurred at different depths and temperatures in a heterogeneous mantle. The komatiites and high-Mg basalts melted at liquidus temperatures of 1450-1550 °C. The Pitangui basalts are enriched in the highly incompatible LILE (large-ion lithophile elements) relative to the moderately incompatible HFS (high field strength) elements. The Zr/Th ratio ranging from 76 to

Physical Properties of the SKYLAB North Polar Coronal Hole with an Extended Base and its MHD Self-Consistent Modelling

Science.gov (United States)

Bravo, S.; Ocania, G.

1991-04-01

RESUMEN Con base en las observaciones del Skylab del Sol en rayos X que permitieron r la forma de la frontera del hoyo coronal del polo norte y en las observaciones de l 'z que permitieron derivar un perfil de densidad para el flujo de viento solar (IC ese hoyo, Murno yjackson (1977) concluyeron que se requiere una adici6n t l clc energfa al flujo hasta al menos 5 R8. En este trabajo, recalculamos los perfiles de y de temperatura para el mismo hoyo pero considerando una frontera Cs mas ancha en la base, de acuerdo con las observaciones del coron6metro-K del IIAO, los espectroheliogramas en EUV del OSO-7 y las fotografias de la corona solar cerca de los 4 E)()O A. Se tomaron tambien las incertidumbres en el perfil de densidad electr6nica inl & a las observaciones de luz blanca y se consideraron diversos valores posibles dCl fl 'jo (lC masa 1 UA. Encontramos que las diferencias introducidas no son suficientes par clcsc' la necesidad de una energetizaci6n extensa del viento solar, pero una dC las s posibles muestra una concordancia muy buena con el modelado MHD (l( l flujo con el unico t6rmino adicional de la fuerza de Lorentz en la ecuaci6n de # (). ABSTRACT Based on the near to the Sun boundary of the Skylab north polar coroi ' l estimated from the AS & E X-ray photographs and on the density profile fi-C)I white light data, Munro and Jackson (1977) concluded that substantial energy the solar wind flux is required up to at least 5 Rs. In this paper we recalculate `eloci y and temperature profiles for the same hole but considering a different bo ' ry for flux tube which is larger at its base, according to the HAO K- obser"' (i()I0 , the OSO-7 EUV spectroheliograms and pictures of the solar 4500 A. è take into account the uncertainties inherent in the white light observations () electron density profile and consider different possible values of the solar I .' fltix at 1 AU. We that the differences introduced are not sufficient to discard ii y of an extended

A petrological view of early Earth geodynamics

Science.gov (United States)

Herzberg, C.

2003-04-01

Xenoliths of low T Archean cratonic mantle consist mostly of harzburgite and lherzolite with geochemical depletions that are characterisitc of igneous residues. Many authors have identified the complementary magmas as komatiites. This model is re-examined in light of work presented in Herzberg & O'Hara (2002) and found to be problematic. Munro-type alumina-undepleted komatiites from Alexo, Pyke Hill, and other locations often contain olivine phenocrysts with maximum Mg# \\cong 94. Residues of fractional melting would consist of pure dunite having Mg# = 97-98, but these are not observed. Residues of equilibrium melting would also be pure dunite with Mg# = 94, but these are also not observed. Olivines with Mg# = 94 are found in rare harzburgites, indicating that residues of alumina-undepleted komatiite have either been overprinted by subsequent magmatism or they have been geodynamically eroded. Alumina-undepleted komatiites can be successfully modeled with a primary magma containing 30% MgO produced by 0.5 mass fractions of equilibrium melting of depleted peridotite. A hot plume interpretation is consistent with both the petrology and helium isotopic compositions of alumina-undepleted komatiites. But what about cratonic mantle? The FeO and MgO contents of residues of fertile mantle peridotite formed by both equilibrium and fractional melting can be predicted and applied to xenoliths of cratonic mantle in most cases. Application to xenoliths from the Kaapvaal and Slave cratons is not possible owing to a second stage of Opx enrichment, but results can be applied to most xenoliths from Siberia, Tanzania, Somerset Island, and east Greenland as they contain less than 45% SiO_2. These xenoliths are very similar to residues produced by fractional melting. Pressures of initial melting were mostly 3 to 5 GPa, but can be as high 7 GPa. Pressures of final melting were highly variable and can be as low as 1 GPa. Potential temperatures (T_P) were typically 1450 to 1600oC and

Implications of Nb/U, Th/U and Sm/Nd in plume magmas for the relationship between continental and oceanic crust formation and the development of the depleted mantle

Science.gov (United States)

Campbell, Ian H.

2002-05-01

The Nb/U and Th/U of the primitive mantle are 34 and 4.04 respectively, which compare with 9.7 and 3.96 for the continental crust. Extraction of continental crust from the mantle therefore has a profound influence on its Nb/U but little influence on its Th/U. Conversely, extraction of midocean ridge-type basalts lowers the Th/U of the mantle residue but has little influence on its Nb/U. As a consequence, variations in Th/U and Nb/U with Sm/Nd can be used to evaluate the relative importance of continental and basaltic crust extraction in the formation of the depleted (Sm/Nd enriched) mantle reservoir. This study evaluates Nb/U, Th/U, and Sm/Nd variations in suites of komatiites, picrites, and their associated basalts, of various ages, to determine whether basalt and/or continental crust have been extracted from their source region. Emphasis is placed on komatiites and picrites because they formed at high degrees of partial melting and are expected to have Nb/U, Th/U, and Sm/Nd that are essentially the same as the mantle that melted to produce them. The results show that all of the studied suites, with the exception of the Barberton, have had both continental crust and basaltic crust extracted from their mantle source region. The high Sm/Nd of the Gorgona and Munro komatiites require the elevated ratios seen in these suites to be due primarily to extraction of basaltic crust from their source regions, whereas basaltic and continental crust extraction are of subequal importance in the source regions of the Yilgarn and Belingwe komatiites. The Sm/Nd of modern midocean ridge basalts lies above the crustal extraction curve on a plot of Sm/Nd against Nb/U, which requires the upper mantle to have had both basaltic and continental crust extracted from it. It is suggested that the extraction of the basaltic reservoir from the mantle occurs at midocean ridges and that the basaltic crust, together with its complementary depleted mantle residue, is subducted to the core

Effect of 2,4-dichlorophenoxyacetic acid on rat maternal behavior

International Nuclear Information System (INIS)

Stuertz, Nelson; Deis, Ricardo P.; Jahn, Graciela A.; Duffard, Ricardo; Evangelista de Duffard, Ana Maria.

2008-01-01

Exposure to 2,4-dichlorophenoxyacetic acid (2,4-D) has several deleterious effects on the nervous system such as alterations in the concentrations of neurotransmitters in the brain and/or behavioral changes, myelination rate, ganglioside pattern [Bortolozzi, A., Duffard, R., Antonelli, M., Evangelista de Duffard, A.M., 2002. Increased sensitivity in dopamine D(2)-like brain receptors from 2,4-dichlorophenoxyacetic acid (2,4-D)-exposed and amphetamine-challenged rats. Ann. N.Y. Acad. Sci. 965, 314-323; Duffard, R., Garcia, G., Rosso, S., Bortolozzi, A., Madariaga, M., DiPaolo, O., Evangelista de Duffard, A.M., 1996. Central nervous system myelin deficit in rats exposed to 2,4-dichlorophenoxyacetic acid throughout lactation. Neurotoxicol. Teratol. 18, 691-696; Evangelista de Duffard, A.M., Orta, C., Duffard, R., 1990. Behavioral changes in rats fed a diet containing 2,4-dichlorophenoxyacetic butyl ester. Neurotoxicology 11, 563-572; Evangelista de Duffard, A.M., Bortolozzi, A., Duffard, R.O., 1995. Altered behavioral responses in 2,4-dichlorophenoxyacetic acid treated and amphetamine challenged rats. Neurotoxicology 16, 479-488; Munro, I.C., Carlo, G.L., Orr, J.C., Sund, K., Wilson, R.M. Kennepohl, E. Lynch, B., Jablinske, M., Lee, N., 1992. A comprehensive, integrated review and evaluation of the scientific evidence relating to the safety of the herbicide 2,4-D. J. Am. Coll. Toxicol. 11, 559-664; Rosso et al., 2000], and its administration to pregnant and lactating rats adversely affects litter growth and milk quality. Since normal growth of the offspring depends on adequate maternal nursing and care, we evaluated the effect of 2,4-D on rat maternal behavior as well as the dam's monoamine levels in arcuate nucleus (AcN) and serum prolactin (PRL) levels. Wistar dams were exposed to the herbicide through the food from post partum day (PPD) 1 to PPD 7. Dams were fed either with a 2,4-D treated diet (15, 25 or 50 mg 2,4-D/kg/day bw) or with a control diet. We observed

Cruise report for a seismic investigation of gas hydrates in the Mississippi Canyon region, northern Gulf of Mexico; cruise M1-98-GM

Science.gov (United States)

Cooper, Alan K.; Hart, Patrick E.; Pecher, Ingo

1998-01-01

During June 1998, the U.S. Geological Survey (USGS) and the University of Mississippi Marine Minerals Technology Center (MMTC) conducted a 12-day cruise in the Mississippi Canyon region of the Gulf of Mexico (Fig. 1). The R/V Tommy Munro, owned by the Marine Research Institute of the University of Southern Mississippi, was chartered for the cruise. The general objective was to acquire very high resolution seismic-reflection data across of the upper and middle continental slope (200-1200-m water depths) to study the acoustic character, distribution and potential effects of gas hydrates within the shallow subsurface, extending from the sea floor down to the base of the gas-hydrate stability zone. The Gulf of Mexico is well known for hydrocarbon resources that include petroleum and related gases. Areas of the Gulf that lie in waters deeper than about 250 m potentially have conditions (e.g., pressure, temperature, near-surface gas content, etc.) that are right for the shallow-subsurface formation of the ice-like substance (gas and water) known as gas hydrate (Kvenvolden, 1993). Gas hydrates have previously been sampled in sea-floor cores and observed as massive mounds in several parts of the northern Gulf, including the Mississippi Canyon region (e.g., Anderson et al., 1992). Extensive seismic data have been recorded in the Gulf, in support of commercial drilling efforts, but few very high resolution data exist in the public domain to aid in gas-hydrate studies. Studies of long-term interest include those on the resource potential of gas hydrates, the geologic hazards associated with dissociation and formation of hydrates, and the impact, if any, of gas-hydrate dissociation on atmospheric warming (i.e., via release of methane, a "greenhouse" gas). Several very high resolution seismic systems (surface-towed, deep-towed, and sea-floor) were used during the cruise to test the feasibility of using such data for detailed structural (geometric) and stratigraphic (physical

Private-Sector Social Franchising to Accelerate Family Planning Access, Choice, and Quality: Results From Marie Stopes International.

Science.gov (United States)

Munroe, Erik; Hayes, Brendan; Taft, Julia

2015-06-17

them reporting having never previously used family planning at all. Analysis of age and poverty levels of clients indicate mixed results in bridging equity gaps: 57.4% of clients lived on under US$2.50/day in 2013 (95% CI = 54.9, 60.0) and 26.1% were 15-24 years old (95% CI = 23.8, 28.4), but only 15.1% lived on less than $1.25/day (95% CI = 13.8, 16.4) and 5.0% were 15-19 years old (95% CI = 3.9, 6.1). The services provided via social franchising are estimated to avert 4,958,000 unintended pregnancies and 7,150 maternal deaths. Social franchising through the existing private sector has the ability to rapidly scale-up access to high-quality family planning services, including LARCs, for the general population as well as young women and the poor, providing a promising model to help achieve the global FP2020 goal. © Munroe et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are properly cited. To view a copy of the license, visit http://creativecommons.org/licenses/by/3.0/

Characterizing aerodynamic roughness length (z0) for a debris-covered glacier: aerodynamic inversion and SfM-derived microtopographic approaches

Science.gov (United States)

Miles, Evan; Steiner, Jakob; Brun, Fanny; Detert, Martin; Buri, Pascal; Pellicciotti, Francesca

2016-04-01

Aerodynamic surface roughness is an essential parameter in surface energy balance studies. While actual measurements on bare ice glaciers are rare, a wide range of literature values exist for ice and snow surfaces. There are very few values suggested for debris covered glaciers and actual measurements are even scarcer - studies instead optimize z0 or use a reference value. The increased use of photogrammetry on glaciers provides an opportunity to characterize the range of z0 values meaningful for debris-covered glaciers. We apply Agisoft's Structure-from-Motion process chain to produce high resolution DEMs for five 1m x 1m plots (1mm resolution) with differing grain-size distributions, as well as a large ~180m x ~180m depression (5cm) on Lirung Glacier in the Nepalese Himalayas. For each plot, we calculate z0 according to transect-based microtopographic parameterisations. We compare individual-transect z0 estimates based on profile position and direction, and develop a grid version of the algorithms aggregating height data from all bidirectional transects. This grid approach is applied to our larger DEM to characterize the variability of z0 across the study site for each algorithm. For the plot DEMs, z0 estimated by any algorithm varies by an order of magnitude based on transect position. Although the algorithms reproduce the same variability among transects and plots, z0 estimates vary by an order of magnitude between algorithms. For any algorithm, however, we find minimal difference between cross- and down-glacier profile directions. At the basin scale, results from different algorithms are strongly correlated and results are more closely clustered with the exception of the Rounce (2015) algorithm, while any algorithm's values range by two orders of magnitude across the study depression. The Rounce algorithm consistently produced the highest z0 values, while the Lettau (1969) and Munro (1989) methods produced the lowest values, and use of the Nield (2013

Platinum Group Elements (PGE) geochemistry of komatiites and boninites from Dharwar Craton, India: Implications for mantle melting processes

Science.gov (United States)

Saha, Abhishek; Manikyamba, C.; Santosh, M.; Ganguly, Sohini; Khelen, Arubam C.; Subramanyam, K. S. V.

2015-06-01

, Os and Ru concentrations range from 0.6 to 2.2 ppb, 0.2 to 0.6 ppb and 1.4 to 2.6 ppb respectively in IPGE. The PGE abundances in Bababudan komatiites were controlled by olivine fractionation whereas that in Gadwal boninites were influenced by fractionation of chromite and sulphides. The Al-undepleted Bababudan komatiites are characterized by low CaO/Al2O3, (Gd/Yb)N, (La/Yb)N, with positive Zr, Hf, Ti anomalies and high Cu/Pd, Pd/Ir ratios at low Pd concentrations suggesting the derivation of parent magma by high degrees (>30%) partial melting of mantle under anhydrous conditions at shallow depth with garnet as a residual phase in the mantle restite. The komatiites are geochemically analogous to Al-undepleted Munro type komatiites and their PGE compositions are consistent with Alexo and Gorgona komatiites. The S-undersaturated character of Bababudan komatiites is attributed to decompression and assimilation of lower crustal materials during magma ascent and emplacement. In contrast, the higher Al2O3/TiO2, lower (Gd/Yb)N, for Gadwal boninites in combination with negative Nb, Zr, Hf, Ti anomalies and lower Cu/Pd at relatively higher Pd/Ir and Pd concentrations reflect high degree melting of refractory mantle wedge under hydrous conditions in an intraoceanic subduction zone setting. Higher Pd/Ir ratios and S-undersaturation of these boninites conform to influx of fluids derived by dehydration of subducted slab resulting into high fluid pressure and metasomatism of mantle wedge.

Book reviews

Directory of Open Access Journals (Sweden)

Redactie KITLV

2011-12-01

Rich Puerto Rican Citizen: History and Political Identity in Twentieth-Century New York City, by Lorrin Thomas (reviewed by Jorge Duany Livestock, Sugar and Slavery: Contested Terrain in Colonial Jamaica, by Verene A. Shepherd (reviewed by Justin Roberts Daddy Sharpe: A Narrative of the Life and Adventures of Samuel Sharpe, a West Indian Slave Written by Himself, 1832, by Fred W. Kennedy (reviewed by Gad Heuman Becoming Rasta: Origins of Rastafari Identity in Jamaica, by Charles Price (reviewed by Jahlani A. Niaah Reggaeton, edited by Raquel Z. Rivera, Wayne Marshall & Deborah Pacini Hernandez (reviewed by Alexandrine Boudreault-Fournier Carriacou String Band Serenade: Performing Identity in the Eastern Caribbean, by Rebecca S. Miller (reviewed by Nanette de Jong Caribbean Visionary: A.R.F. Webber and the Making of the Guyanese Nation, by Selwyn R. Cudjoe (reviewed by Clem Seecharan Guyana Diaries: Women’s Lives Across Difference, by Kimberely D. Nettles (reviewed by D. Alissa Trotz Writers of the Caribbean Diaspora: Shifting Homelands, Travelling Identities, edited by Jasbir Jain & Supriya Agarwal (reviewed by Joy Mahabir Queen of the Virgins: Pageantry and Black Womanhood in the Caribbean, by M. Cynthia Oliver (reviewed by Tami Navarro Notions of Identity, Diaspora, and Gender in Caribbean Women’s Writing, by Brinda Mehta (reviewed by Marie-Hélène Laforest Authority and Authorship in V.S. Naipaul, by Imraan Coovadia (reviewed by A shley Tellis Typo/Topo/Poéthique sur Frankétienne, by Jean Jonassaint (reviewed by Martin Munro Creoles in Education: An Appraisal of Current Programs and Projects, edited by Bettina Migge, Isabelle Léglise & Angela Bartens (reviewed by Jeff Siegel Material Culture in Anglo-America: Regional Identity and Urbanity in the Tidewater, Lowcountry, and Caribbean, edited by David S. Shields (reviewed by Susan Kern Tibes: People, Power, and Ritual at the Center of the Cosmos

Deep brain stimulation targeting the fornix for mild Alzheimer dementia: design of the ADvance randomized controlled trial

Directory of Open Access Journals (Sweden)

Holroyd KB

2015-07-01

Full Text Available Kathryn B Holroyd,1 Lisa Fosdick,2 Gwenn S Smith,1 Jeannie-Marie Leoutsakos,1 Cynthia A Munro,1 Esther S Oh,1 Kristen E Drake,2 Paul B Rosenberg,1 William S Anderson,1 Stephen Salloway,3–5 J Cara Pendergrass,6 Anna D Burke,7 David A Wolk,8 David F Tang-Wai,9–11 Francisco A Ponce,12 Wael F Asaad,13,14 Marwan N Sabbagh,15 Michael S Okun,16 Gordon Baltuch,17 Kelly D Foote,18 Steven D Targum,2,6 Andres M Lozano,10,11 Constantine G Lyketsos1 1Johns Hopkins University Memory and Alzheimer's Treatment Center, Baltimore, MD, 2Functional Neuromodulation Ltd, Minneapolis, MN, 3Department of Neurology, Butler Hospital, 4Department of Neurology, Rhode Island Hospital, 5Department of Neurology, Warren Alpert Medical School of Brown University, Providence, RI, 6Clintara LLC, Boston, MA, 7Banner Alzheimer's Institute, Phoenix, AZ, 8Penn Memory Center, Department of Neurology, University of Pennsylvania, Philadelphia, PA, USA; 9Department of Neurology, 10Department of Neurosurgery, University of Toronto, 11Division of Neurology, University Health Network Memory Clinic, Toronto, ON, Canada; 12Division of Neurological Surgery, Barrow Neurological Institute, St Joseph's Hospital and Medical Center, Phoenix, AZ, 13Department of Neurosurgery, Rhode Island Hospital, 14Department of Neurosurgery, Warren Alpert Medical School of Brown University, Providence, RI, 15Banner Sun Health Research Institute, Sun City, AZ, 16Center for Movement Disorders and Neurorestoration, Department of Neurology, University of Florida – Gainsville, Gainsville, FL, 17Center for Functional and Restorative Neurosurgery, University of Pennsylvania, Philadelphia, PA, 18Department of Neurosurgery, Center for Movement Disorders and Neurorestoration, University of Florida, Gainsville, FL, USA Background: There are currently few available treatments and no cure for Alzheimer disease (AD, a growing public health burden. Animal models and an open-label human trial have indicated that deep brain

Book Reviews

Directory of Open Access Journals (Sweden)

Redactie KITLV

1995-01-01

: Development of Afro-Latin Religion among Puerto Ricans in the United States. A study into the Interpenetration of civilizations in the New World. New York: AMS Press, 1991. xvi + 273 pp. -Frank Jan van Dijk, Mihlawhdh Faristzaddi, Itations of Jamaica and I Rastafari (The Second Itation, the Revelation. Miami: Judah Anbesa Ihntahnah-shinahl, 1991. -Derwin S. Munroe, Nelson W. Keith ,The Social Origins of Democratic Socialism in Jamaica. Philadelphia: Temple University Press, 1992. xxiv + 320 pp., Novella Z. Keith (eds -Virginia Heyer Young, Errol Miller, Education for all: Caribbean Perspectives and Imperatives. Washington DC: Inter-American Development Bank, 1992. 267 pp. -Virginia R. Dominguez, Günter Böhm, Los sefardíes en los dominios holandeses de América del Sur y del Caribe, 1630-1750. Frankfurt: Vervuert, 1992. 243 pp. -Virginia R. Dominguez, Robert M. Levine, Tropical diaspora: The Jewish Experience in Cuba. Gainesville: University Press of Florida, 1993. xvii + 398 pp. -Aline Helg, John L. Offner, An unwanted war: The diplomacy of the United States and Spain over Cuba, 1895-1898. Chapel Hill: University of North Carolina Press, 1992. xii + 306 pp. -David J. Carroll, Eliana Cardoso ,Cuba after Communism. Cambridge MA: MIT Press, 1992. xiii + 148 pp., Ann Helwege (eds -Antoni Kapcia, Ian Isadore Smart, Nicolás Guillén: Popular Poet of the Caribbean. Columbia: University of Missouri Press, 1990. 187 pp. -Sue N. Greene, Moira Ferguson, The Hart Sisters: Early African Caribbean Writers, Evangelicals, and Radicals. Lincoln: University of Nebraska Press, 1993. xi + 214 pp. -Michael Craton, James A. Lewis, The final campaign of the American revolution: Rise and fall of the Spanish Bahamas. Columbia: University of South Carolina Press, 1991. xi + 149 pp. -David Geggus, Clarence J. Munford, The black ordeal of slavery and slave trading in the French West Indies, 1625-1715. Lewiston NY: The Edwin Mellen Press, 1991. 3 vols. xxii + 1054 pp. -Paul E. Sigmund, Timothy P

Book Reviews

Directory of Open Access Journals (Sweden)

Redactie KITLV

1997-01-01

NJ: Africa World Press, 1993. xxv + 115 pp. -Sandra Burr, Gretchen Gerzina, Black London: Life before emancipation. New Brunswick NJ: Rutgers University Press, 1995. xii + 244 pp. -Carlene J. Edie, Trevor Munroe, The cold war and the Jamaican Left 1950-1955: Reopening the files. Kingston: Kingston Publishers, 1992. xii + 242 pp. -Carlene J. Edie, David Panton, Jamaica's Michael Manley: The great transformation (1972-92. Kingston: Kingston Publishers, 1993. xx + 225 pp. -Percy C. Hintzen, Cary Fraser, Ambivalent anti-colonialism: The United States and the genesis of West Indian independence, 1940-1964. Westport CT: Greenwood, 1994. vii + 233 pp. -Anthony J. Payne, Carlene J. Edie, Democracy in the Caribbean: Myths and realities. Westport CT: Praeger, 1994. xvi + 296 pp. -Alma H. Young, Jean Grugel, Politics and development in the Caribbean basin: Central America and the Caribbean in the New World Order. Bloomington: Indiana University Press, 1995. xii + 270 pp. -Alma H. Young, Douglas G. Lockhart ,The development process in small island states. London: Routledge, 1993. xv + 275 pp., David Drakakis-Smith, John Schembri (eds -Virginia Heyer Young, José Solis, Public school reform in Puerto Rico: Sustaining colonial models of development. Westport CT: Greenwood Press, 1994. x + 171 pp. -Carolyn Cooper, Christian Habekost, Verbal Riddim: The politics and aesthetics of African-Caribbean Dub poetry. Amsterdam: Rodopi, 1993. vii + 262 pp. -Clarisse Zimra, Jaqueline Leiner, Aimé Césaire: Le terreau primordial. Tübingen: Gunter Narr Verlag, 1993. 175 pp. -Clarisse Zimra, Abiola Írélé, Aimé Césaire: Cahier d'un retour au pays natal. With introduction, commentary and notes. Abiola Írélé. Ibadan: New Horn Press, 1994. 158 pp. -Alvina Ruprecht, Stella Algoo-Baksh, Austin C. Clarke: A biography. Barbados: The Press - University of the West Indies; Toronto: ECW Press, 1994. 234 pp. -Sue N. Greene, Glyne A. Griffith, Deconstruction, imperialism and the West Indian novel

Book Reviews

Directory of Open Access Journals (Sweden)

Redactie KITLV

1993-01-01

Full Text Available -Louis Allaire, Samuel M. Wilson, Hispaniola: Caribbean chiefdoms in the age of Columbus. Tuscaloosa: University of Alabama Press, 1990. xi + 170 pp. -Douglas Melvin Haynes, Philip D. Curtin, Death by migration: Europe's encounter with the tropical world in the nineteenth century. Cambridge: Cambridge University Press, 1989. xviii + 251 pp. -Dale Tomich, J.H. Galloway, The sugar cane industry: An historical geography from its origins to 1914. Cambridge: Cambridge University Press, 1989. xii + 266 pp. -Myriam Cottias, Dale Tomich, Slavery in the circuit of sugar: Martinique and the world economy, 1830 -1848. Baltimore: John Hopkins University Press, 1990. xiv + 352 pp. -Robert Forster, Pierre Dessalles, La vie d'un colon à la Martinique au XIXe siècle. Pré-senté par Henri de Frémont. Courbevoie: s.n., 1984-1988, four volumes, 1310 pp. -Hilary Beckles, Douglas V. Armstrong, The old village and the great house: An archaeological and historical examination of Drax Hall Plantation, St Ann's Bay, Jamaica. Chicago: University of Illinois Press, 1990. xiii + 393 pp. -John Stewart, John A. Lent, Caribbean popular culture. Bowling Green OH: Bowling Green State University Popular Press, 1990. 157 pp. -W. Marvin Will, Susanne Jonas ,Democracy in Latin America: Visions and realities. New York: Bergin & Garvey Publishers, 1990. viii + 224 pp., Nancy Stein (eds -Forrest D. Colburn, Kathy McAfee, Storm signals: Structural adjustment and development alternatives in the Caribbean. London: Zed books, 1991. xii + 259 pp. -Derwin S. Munroe, Peggy Antrobus ,In the shadows of the sun: Caribbean development alternatives and U.S. policy. Carmen Diana Deere (coordinator, Peter Phillips, Marcia Rivera & Helen Safa. Boulder CO: Westview Press, 1990. xvii + 246 pp., Lynne Bolles, Edwin Melendez (eds -William Roseberry, Louis A. Pérez, Jr., Lords of the mountain: Social banditry and peasant protest in Cuba, 1878-1918. Pittsburgh: University of Pittsburgh Press, 1989

De la modernización a la "Gran Sociedad": continuidades y cambios en el Trabajo Social en el Reino Unido

Directory of Open Access Journals (Sweden)

Iain Ferguson

2012-02-01

seguimiento estructurado a través de un estricto régimen de regulación e inspección, a menudo ha dado lugar a una práctica profesional mecanicista y defensiva. Según un reciente informe encargado por el gobierno, titulado Revisión de la protección de la infancia en Inglaterra, el establecimiento de la gestión del rendimiento ha tenido profundas implicaciones en la ética de la práctica profesional. En palabras de Munro, poner excesivo énfasis en la preparación de las personas para realizar inspecciones y para alcanzar objetivos e indicadores de resultados ha llevado a una situación en la que el sistema ha focalizado la preocupación de las personas en «hacer las cosas bien» en lugar de en «hacer lo correcto» (Munro, 2010, p. 14.Otro elemento clave del Nuevo Laborismo sobre la modernización de Trabajo Social está basado en involucrar cada vez más a los profesionales para que incorporen de manera ineludible las tecnologías de la información y la comunicación (TICs. De este modo en el sistema de protección de la infancia, los trabajadores sociales deben dedicar entre un 60 y un 80 por ciento de su tiempo de trabajo a la introducción de datos en los sistemas de información, lo que no parece que sea la mejor forma de utilizar el tiempo de un profesional y, desde luego, está muy lejos de poder recurrir a los aspectos relacionales que constituyen la esencia de la actuación del Trabajo Social, que ha sido lo que prioritariamente, ha atraído a muchos trabajadores sociales a la profesión (White, Wastell, Broadhurst y Hall, 2010. Por todo ello, ha habido un considerable descontento en la profesión sobre la forma en que el Nuevo Laborismo introdujo en su agenda la modernización del Trabajo Social, que ha sido vivida como un debilitamiento, tanto de los valores fundamentales de la profesión como de los aspectos terapéuticos y humanísticos, del Trabajo Social y que la ha reducido a una profesión puramente técnica «sin valores». Además, los

Book Reviews

Directory of Open Access Journals (Sweden)

Redactie KITLV

1992-01-01

the Spanish by Phillip Berryman. Maryknoll NY: Orbis, 1988. xii + 151 pp. -Fernando Picó, John M. Kirk, Between God and the party: religion and politics in revolutionary Cuba. Tampa FL: University of South Florida Press, 1989. xxi + 231 pp. -Andrés Serbin, Carmen Gautier Mayoral ,Puerto Rico en la economía política del Caribe, Río Piedras PR; Ediciones Huracán, 1990. 204 pp., Angel I. Rivera Ortiz, Idsa E. Alegría Ortega (eds -Andrés Serbin, Carmen Gautier Mayoral ,Puerto Rico en las relaciones internacionales del Caribe, Río Piedras PR: Ediciones Huracán, 1990. 195 pp., Angel I. Rivera Ortiz, Idsa E. Alegría Ortega (eds -Jay R. Mandle, Jorge Heine, A revolution aborted : the lessons of Grenada, Pittsburgh: University of Pittsburgh Press, 1990. x + 351 pp. -Douglas Midgett, Rhoda Reddock, Elma Francois: the NWCSA and the workers' struggle for change in the Caribbean in the 1930's, London: New Beacon Books, 1988. vii + 60 pp. -Douglas Midgett, Susan Craig, Smiles and blood: the ruling class response to the workers' rebellion of 1937 in Trinidad and Tobago, London: New Beacon Books, 1988. vii + 70 pp. -Ken Post, Carlene J. Edie, Democracy by default: dependency and clientelism in Jamaica, Kingston, Jamaica: Ian Randle Publishers, and Boulder CO: Lynne Rienner Publishers, 1991. xiv + 170 pp. -Ken Post, Trevor Munroe, Jamaican politics: a Marxist perspective in transition, Kingston, Jamaica: Heinemann Publishers (Caribbean and Boulder CO: Lynne Rienner Publishers, 1991. 322 pp. -Wendell Bell, Darrell E. Levi, Michael Manley: the making of a leader, Athens GA: University of Georgia Press, 1990, 349 pp. -Wim Hoogbergen, Mavis C. Campbell, The Maroons of Jamaica, 1655-1796: a history of resistance, collaboration and betrayal, Granby MA Bergin & Garvey, 1988. vi + 296 pp. -Kenneth M. Bilby, Rebekah Michele Mulvaney, Rastafari and reggae: a dictionary and sourcebook, Westport CT: Greenwood, 1990. xvi + 253 pp. -Robert Dirks, Jerome S. Handler ,Searching for a slave