Radio frequency cavity analysis, measurement, and calibration of absolute Dee voltage for K-500 superconducting cyclotron at VECC, Kolkata.

Science.gov (United States)

Som, Sumit; Seth, Sudeshna; Mandal, Aditya; Paul, Saikat; Duttagupta, Anjan

2013-02-01

Variable Energy Cyclotron Centre has commissioned a K-500 superconducting cyclotron for various types of nuclear physics experiments. The 3-phase radio-frequency system of superconducting cyclotron has been developed in the frequency range 9-27 MHz with amplitude and phase stability of 100 ppm and ±0.2(0), respectively. The analysis of the RF cavity has been carried out using 3D Computer Simulation Technology (CST) Microwave Studio code and various RF parameters and accelerating voltages ("Dee" voltage) are calculated from simulation. During the RF system commissioning, measurement of different RF parameters has been done and absolute Dee voltage has been calibrated using a CdTe X-ray detector along with its accessories and known X-ray source. The present paper discusses about the measured data and the simulation result.

Determination of local absolute detection efficiency of a ceratron with 55Fe Auger electrons

International Nuclear Information System (INIS)

Mori, C.; Sugiyama, T.; Watanabe, T.

1983-01-01

The local absolute detection efficiency of a Ceratron (channel electron multiplier made of ceramics) was determined with collimated Mn K Auger electrons ( 5 keV) emitted from 55 Fe as a function of electron incident position and applied voltage. The local efficiency at the channel inlet did not depend so much on the applied voltage. The efficiency at the funnel increased with the applied voltage, while it was always lower than that at the channel inlet. (orig.)

Time scales of bias voltage effects in FE/MgO-based magnetic tunnel junctions with voltage-dependent perpendicular anisotropy

International Nuclear Information System (INIS)

Lytvynenko, Ia.M.; Hauet, T.; Montaigne, F.; Bibyk, V.V.; Andrieu, S.

2015-01-01

Interplay between voltage-induced magnetic anisotropy transition and voltage-induced atomic diffusion is studied in epitaxial V/Fe (0.7 nm)/ MgO/ Fe(5 nm)/Co/Au magnetic tunnel junction where thin Fe soft electrode has in-plane or out-of-plane anisotropy depending on the sign of the bias voltage. We investigate the origin of the slow resistance variation occurring when switching bias voltage in opposite polarity. We demonstrate that the time to reach resistance stability after voltage switching is reduced when increasing the voltage amplitude or the temperature. A single energy barrier of about 0.2 eV height is deduced from temperature dependence. Finally, we demonstrate that the resistance change is not correlated to a change in soft electrode anisotropy. This conclusion contrasts with observations recently reported on analogous systems. - Highlights: • Voltage-induced time dependence of resistance is studied in epitaxial Fe/MgO/Fe. • Resistance change is not related to the bottom Fe/MgO interface. • The effect is thermally activated with an energy barrier of the order of 0.2 eV height

Vector spin modeling for magnetic tunnel junctions with voltage dependent effects

International Nuclear Information System (INIS)

Manipatruni, Sasikanth; Nikonov, Dmitri E.; Young, Ian A.

2014-01-01

Integration and co-design of CMOS and spin transfer devices requires accurate vector spin conduction modeling of magnetic tunnel junction (MTJ) devices. A physically realistic model of the MTJ should comprehend the spin torque dynamics of nanomagnet interacting with an injected vector spin current and the voltage dependent spin torque. Vector spin modeling allows for calculation of 3 component spin currents and potentials along with the charge currents/potentials in non-collinear magnetic systems. Here, we show 4-component vector spin conduction modeling of magnetic tunnel junction devices coupled with spin transfer torque in the nanomagnet. Nanomagnet dynamics, voltage dependent spin transport, and thermal noise are comprehended in a self-consistent fashion. We show comparison of the model with experimental magnetoresistance (MR) of MTJs and voltage degradation of MR with voltage. Proposed model enables MTJ circuit design that comprehends voltage dependent spin torque effects, switching error rates, spin degradation, and back hopping effects

Disulfide mapping the voltage-sensing mechanism of a voltage-dependent potassium channel.

Science.gov (United States)

Nozaki, Tomohiro; Ozawa, Shin-Ichiro; Harada, Hitomi; Kimura, Tomomi; Osawa, Masanori; Shimada, Ichio

2016-11-17

Voltage-dependent potassium (Kv) channels allow for the selective permeability of potassium ions in a membrane potential dependent manner, playing crucial roles in neurotransmission and muscle contraction. Kv channel is a tetramer, in which each subunit possesses a voltage-sensing domain (VSD) and a pore domain (PD). Although several lines of evidence indicated that membrane depolarization is sensed as the movement of helix S4 of the VSD, the detailed voltage-sensing mechanism remained elusive, due to the difficulty of structural analyses at resting potential. In this study, we conducted a comprehensive disulfide locking analysis of the VSD using 36 double Cys mutants, in order to identify the proximal residue pairs of the VSD in the presence or absence of a membrane potential. An intramolecular SS-bond was formed between 6 Cys pairs under both polarized and depolarized environment, and one pair only under depolarized environment. The multiple conformations captured by the SS-bond can be divided by two states, up and down, where S4 lies on the extracellular and intracellular sides of the membrane, respectively, with axial rotation of 180°. The transition between these two states is caused by the S4 translocation of 12 Å, enabling allosteric regulation of the gating at the PD.

Manipulating the voltage dependence of tunneling spin torques

KAUST Repository

Manchon, Aurelien

2012-10-01

Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact on current-driven magnetization dynamics and on devices performances. After a brief overview of the progress made to date in the theoretical description of the spin torque in tunnel junctions, I present different ways to alter and control the bias dependence of both components of the spin torque. Engineering the junction (barrier and electrodes) structural asymmetries or controlling the spin accumulation profile in the free layer offer promising tools to design effcient spin devices.

Cytoplasmic Domains and Voltage-Dependent Potassium Channel Gating

Science.gov (United States)

Barros, Francisco; Domínguez, Pedro; de la Peña, Pilar

2012-01-01

The basic architecture of the voltage-dependent K+ channels (Kv channels) corresponds to a transmembrane protein core in which the permeation pore, the voltage-sensing components and the gating machinery (cytoplasmic facing gate and sensor–gate coupler) reside. Usually, large protein tails are attached to this core, hanging toward the inside of the cell. These cytoplasmic regions are essential for normal channel function and, due to their accessibility to the cytoplasmic environment, constitute obvious targets for cell-physiological control of channel behavior. Here we review the present knowledge about the molecular organization of these intracellular channel regions and their role in both setting and controlling Kv voltage-dependent gating properties. This includes the influence that they exert on Kv rapid/N-type inactivation and on activation/deactivation gating of Shaker-like and eag-type Kv channels. Some illustrative examples about the relevance of these cytoplasmic domains determining the possibilities for modulation of Kv channel gating by cellular components are also considered. PMID:22470342

Comparison of absolute speed of screen-film systems measured in seven institutions

International Nuclear Information System (INIS)

Yoshida, Ken-ichi; Murakami, Yasunori; Asahara, Masaki; Nakamura, Satoru; Honda, Mitsugi; Morishita, Junji; Higashida, Yoshiharu; Otsuka, Akiyoshi; Yoshida, Akira.

1998-01-01

We compared the differences in absolute speed of four screen-film systems in seven institutions. Four different screens (HR-4, Fuji; Lanex Medium, Kodak; Lanex 250, Kodak; and HR-12, Fuji) combined with super HRS-30 (Fuji) film and a beam quality of 80 kV tube voltage with a 20 mm aluminum filter were employed. Absolute speeds of the HR-4, Lanex Medium, Lanex 250, and HR-12 in combination with super HRS-30 were 1.83 mR -1 , 2.72 mR -1 , 2.79 mR -1 , and 5.35 mR -1 (average of seven institutions), respectively. The variation in speed was about ±10% for the seven institutions. Two factors (film processor and densitometer) affecting absolute speed were analyzed. The absolute speed measured in seven institutions varied ±14% depending on the film processor (development conditions) and ±3% depending on the densitometer employed in each institution. (author)

Structural mechanism of voltage-dependent gating in an isolated voltage-sensing domain.

Science.gov (United States)

Li, Qufei; Wanderling, Sherry; Paduch, Marcin; Medovoy, David; Singharoy, Abhishek; McGreevy, Ryan; Villalba-Galea, Carlos A; Hulse, Raymond E; Roux, Benoît; Schulten, Klaus; Kossiakoff, Anthony; Perozo, Eduardo

2014-03-01

The transduction of transmembrane electric fields into protein motion has an essential role in the generation and propagation of cellular signals. Voltage-sensing domains (VSDs) carry out these functions through reorientations of positive charges in the S4 helix. Here, we determined crystal structures of the Ciona intestinalis VSD (Ci-VSD) in putatively active and resting conformations. S4 undergoes an ~5-Å displacement along its main axis, accompanied by an ~60° rotation. This movement is stabilized by an exchange in countercharge partners in helices S1 and S3 that generates an estimated net charge transfer of ~1 eo. Gating charges move relative to a ''hydrophobic gasket' that electrically divides intra- and extracellular compartments. EPR spectroscopy confirms the limited nature of S4 movement in a membrane environment. These results provide an explicit mechanism for voltage sensing and set the basis for electromechanical coupling in voltage-dependent enzymes and ion channels.

Relaxation of Isolated Ventricular Cardiomyocytes by a Voltage-Dependent Process

Science.gov (United States)

Bridge, John H. B.; Spitzer, Kenneth W.; Ershler, Philip R.

1988-08-01

Cell contraction and relaxation were measured in single voltage-clamped guinea pig cardiomyocytes to investigate the contribution of sarcolemmal Na+-Ca2+ exchange to mechanical relaxation. Cells clamped from -80 to 0 millivolts displayed initial phasic and subsequent tonic contractions; caffeine reduced or abolished the phasic and enlarged the tonic contraction. The rate of relaxation from tonic contractions was steeply voltage-dependent and was significantly slowed in the absence of a sarcolemmal Na+ gradient. Tonic contractions elicited in the absence of a Na+ gradient promptly relaxed when external Na+ was applied, reflecting activation of Na+-Ca2+ exchange. It appears that a voltage-dependent Na+-Ca2+ exchange can rapidly mechanically relax mammalian heart muscle.

Bias Voltage-Dependent Impedance Spectroscopy Analysis of Hydrothermally Synthesized ZnS Nanoparticles

Science.gov (United States)

Dey, Arka; Dhar, Joydeep; Sil, Sayantan; Jana, Rajkumar; Ray, Partha Pratim

2018-04-01

In this report, bias voltage-dependent dielectric and electron transport properties of ZnS nanoparticles were discussed. ZnS nanoparticles were synthesized by introducing a modified hydrothermal process. The powder XRD pattern indicates the phase purity, and field emission scanning electron microscope image demonstrates the morphology of the synthesized sample. The optical band gap energy (E g = 4.2 eV) from UV measurement explores semiconductor behavior of the synthesized material. The electrical properties were performed at room temperature using complex impedance spectroscopy (CIS) technique as a function of frequency (40 Hz-10 MHz) under different forward dc bias voltages (0-1 V). The CIS analysis demonstrates the contribution of bulk resistance in conduction mechanism and its dependency on forward dc bias voltages. The imaginary part of the impedance versus frequency curve exhibits the existence of relaxation peak which shifts with increasing dc forward bias voltages. The dc bias voltage-dependent ac and dc conductivity of the synthesized ZnS was studied on thin film structure. A possible hopping mechanism for electrical transport processes in the system was investigated. Finally, it is worth to mention that this analysis of bias voltage-dependent dielectric and transport properties of as-synthesized ZnS showed excellent properties for emerging energy applications.

Dependence of hydrogen arcjet operation on electrode geometry

Science.gov (United States)

Pencil, Eric J.; Sankovic, John M.; Sarmiento, Charles J.; Hamley, John A.

1992-01-01

The dependence of 2kW hydrogen arcjet performance on cathode to anode electrode spacing was evaluated at specific impulses of 900 and 1000 s. Less than 2 absolute percent change in efficiency was measured for the spacings tested which did not repeat the 14 absolute percent variation reported in earlier work with similar electrode designs. A different nozzle configuration was used to quantify the variation in hydrogen arcjet performance over an extended range of electrode spacing. Electrode gap variation resulted in less than 3 absolute percent change in efficiency. These null results suggested that electrode spacing is decoupled from hydrogen arcjet ignition. The dependence of breakdown voltage on mass flow rate and electrode agreed with Paschen curves for hydrogen. Preliminary characterization of the dependence of hydrogen arcjet ignition on rates of pulse repetition and pulse voltage rise were also included for comparison with previous results obtained using simulated hydrazine.

Reversible voltage dependent transition of abnormal and normal bipolar resistive switching.

Science.gov (United States)

Wang, Guangyu; Li, Chen; Chen, Yan; Xia, Yidong; Wu, Di; Xu, Qingyu

2016-11-14

Clear understanding the mechanism of resistive switching is the important prerequisite for the realization of high performance nonvolatile resistive random access memory. In this paper, binary metal oxide MoO x layer sandwiched by ITO and Pt electrodes was taken as a model system, reversible transition of abnormal and normal bipolar resistive switching (BRS) in dependence on the maximum voltage was observed. At room temperature, below a critical maximum voltage of 2.6 V, butterfly shaped I-V curves of abnormal BRS has been observed with low resistance state (LRS) to high resistance state (HRS) transition in both polarities and always LRS at zero field. Above 2.6 V, normal BRS was observed, and HRS to LRS transition happened with increasing negative voltage applied. Temperature dependent I-V measurements showed that the critical maximum voltage increased with decreasing temperature, suggesting the thermal activated motion of oxygen vacancies. Abnormal BRS has been explained by the partial compensation of electric field from the induced dipoles opposite to the applied voltage, which has been demonstrated by the clear amplitude-voltage and phase-voltage hysteresis loops observed by piezoelectric force microscopy. The normal BRS was due to the barrier modification at Pt/MoO x interface by the accumulation and depletion of oxygen vacancies.

Optimized expression and purification of NavAb provide the structural insight into the voltage dependence.

Science.gov (United States)

Irie, Katsumasa; Haga, Yukari; Shimomura, Takushi; Fujiyoshi, Yoshinori

2018-01-01

Voltage-gated sodium channels are crucial for electro-signalling in living systems. Analysis of the molecular mechanism requires both fine electrophysiological evaluation and high-resolution channel structures. Here, we optimized a dual expression system of NavAb, which is a well-established standard of prokaryotic voltage-gated sodium channels, for E. coli and insect cells using a single plasmid vector to analyse high-resolution protein structures and measure large ionic currents. Using this expression system, we evaluated the voltage dependence and determined the crystal structures of NavAb wild-type and two mutants, E32Q and N49K, whose voltage dependence were positively shifted and essential interactions were lost in voltage sensor domain. The structural and functional comparison elucidated the molecular mechanisms of the voltage dependence of prokaryotic voltage-gated sodium channels. © 2017 Federation of European Biochemical Societies.

Dependence of hydrogen arcjet operation on electrode geometry

Science.gov (United States)

Pencil, Eric J.; Sankovic, John M.; Sarmiento, Charles J.; Hamley, John A.

1992-01-01

The dependence of 2 kW hydrogen arcjet performance on cathode to anode electrode spacing was evaluated at specific impulses of 900 and 1000 s. Less than 2 absolute percent change in efficiency was measured for the spacings tested which did not repeat the 14 absolute percent variation reported in earlier work with similar electrode designs. A different nozzle configuration was used to quantify the variation in hydrogen arcjet performance over an extended range of electrode spacing. Electrode gap variation resulted in less than 3 absolute percent change in efficiency. These null results suggested that electrode spacing is decoupled from hydrogen arcjet performance considerations over the ranges tested. Initial studies were conducted on hydrogen arcjet ignition. The dependence of breakdown voltage on mass flow rate and hydrogen arcjet ignition on rates of pulse repetition and pulse voltage rise were also included for comparison with previous results obtained using simulated hydrazine.

Origin of the transition voltage in gold–vacuum–gold atomic junctions

International Nuclear Information System (INIS)

Wu Kunlin; Bai Meilin; Hou Shimin; Sanvito, Stefano

2013-01-01

The origin and the distance dependence of the transition voltage of gold–vacuum–gold junctions are investigated by employing first-principles quantum transport simulations. Our calculations show that atomic protrusions always exist on the electrode surface of gold–vacuum–gold junctions fabricated using the mechanically controllable break junction (MCBJ) method. The transition voltage of these gold–vacuum–gold junctions with atomically sharp electrodes is determined by the local density of states (LDOS) of the apex gold atom on the electrode surface rather than by the vacuum barrier shape. More specifically, the absolute value of the transition voltage roughly equals the rising edge of the LDOS peak contributed by the 6p atomic orbitals of the gold atoms protruding from the electrode surface, whose local Fermi level is shifted downwards when a bias voltage is applied. Since the LDOS of the apex gold atom depends strongly on the exact shape of the electrode, the transition voltage is sensitive to the variation of the atomic configuration of the junction. For asymmetric junctions, the transition voltage may also change significantly depending on the bias polarity. Considering that the occurrence of the transition voltage requires the electrode distance to be larger than a critical value, the interaction between the two electrodes is actually rather weak. Consequently, the LDOS of the apex gold atom is mainly determined by its local atomic configuration and the transition voltage only depends weakly on the electrode distance as observed in the MCBJ experiments. (paper)

Monitoring operating temperature and supply voltage in achieving high system dependability

NARCIS (Netherlands)

Khan, M.A.; Kerkhoff, Hans G.

2013-01-01

System dependability being a set of number of attributes, of which the important reliability, heavily depends on operating temperature and supply voltage. Any change beyond the designed specifications may change the system performance and could result in system reliability and hence dependability

Contamination of current-clamp measurement of neuron capacitance by voltage-dependent phenomena

Science.gov (United States)

White, William E.

2013-01-01

Measuring neuron capacitance is important for morphological description, conductance characterization, and neuron modeling. One method to estimate capacitance is to inject current pulses into a neuron and fit the resulting changes in membrane potential with multiple exponentials; if the neuron is purely passive, the amplitude and time constant of the slowest exponential give neuron capacitance (Major G, Evans JD, Jack JJ. Biophys J 65: 423–449, 1993). Golowasch et al. (Golowasch J, Thomas G, Taylor AL, Patel A, Pineda A, Khalil C, Nadim F. J Neurophysiol 102: 2161–2175, 2009) have shown that this is the best method for measuring the capacitance of nonisopotential (i.e., most) neurons. However, prior work has not tested for, or examined how much error would be introduced by, slow voltage-dependent phenomena possibly present at the membrane potentials typically used in such work. We investigated this issue in lobster (Panulirus interruptus) stomatogastric neurons by performing current clamp-based capacitance measurements at multiple membrane potentials. A slow, voltage-dependent phenomenon consistent with residual voltage-dependent conductances was present at all tested membrane potentials (−95 to −35 mV). This phenomenon was the slowest component of the neuron's voltage response, and failure to recognize and exclude it would lead to capacitance overestimates of several hundredfold. Most methods of estimating capacitance depend on the absence of voltage-dependent phenomena. Our demonstration that such phenomena make nonnegligible contributions to neuron responses even at well-hyperpolarized membrane potentials highlights the critical importance of checking for such phenomena in all work measuring neuron capacitance. We show here how to identify such phenomena and minimize their contaminating influence. PMID:23576698

Breakdown voltage mapping through voltage dependent ReBEL intensity imaging of multi-crystalline Si solar cells

Science.gov (United States)

Dix-Peek, RM.; van Dyk, EE.; Vorster, FJ.; Pretorius, CJ.

2018-04-01

Device material quality affects both the efficiency and the longevity of photovoltaic (PV) cells. Therefore, identifying these defects can be beneficial in the development of more efficient and longer lasting PV cells. In this study, a combination of spatially-resolved, electroluminescence (EL), and light beam induced current (LBIC) measurements, were used to identify specific defects and features of a multi-crystalline Si PV cells. In this study, a novel approach is used to map the breakdown voltage of a PV cell through voltage dependent Reverse Bias EL (ReBEL) intensity imaging.

Origin of the transition voltage in gold–vacuum–gold atomic junctions

KAUST Repository

Wu, Kunlin

2012-12-13

The origin and the distance dependence of the transition voltage of gold-vacuum-gold junctions are investigated by employing first-principles quantum transport simulations. Our calculations show that atomic protrusions always exist on the electrode surface of gold-vacuum-gold junctions fabricated using the mechanically controllable break junction (MCBJ) method. The transition voltage of these gold-vacuum-gold junctions with atomically sharp electrodes is determined by the local density of states (LDOS) of the apex gold atom on the electrode surface rather than by the vacuum barrier shape. More specifically, the absolute value of the transition voltage roughly equals the rising edge of the LDOS peak contributed by the 6p atomic orbitals of the gold atoms protruding from the electrode surface, whose local Fermi level is shifted downwards when a bias voltage is applied. Since the LDOS of the apex gold atom depends strongly on the exact shape of the electrode, the transition voltage is sensitive to the variation of the atomic configuration of the junction. For asymmetric junctions, the transition voltage may also change significantly depending on the bias polarity. Considering that the occurrence of the transition voltage requires the electrode distance to be larger than a critical value, the interaction between the two electrodes is actually rather weak. Consequently, the LDOS of the apex gold atom is mainly determined by its local atomic configuration and the transition voltage only depends weakly on the electrode distance as observed in the MCBJ experiments. © 2013 IOP Publishing Ltd.

Calmodulin and calcium differentially regulate the neuronal Nav1.1 voltage-dependent sodium channel

Energy Technology Data Exchange (ETDEWEB)

Gaudioso, Christelle; Carlier, Edmond; Youssouf, Fahamoe [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Clare, Jeffrey J. [Eaton Pharma Consulting, Eaton Socon, Cambridgeshire PE19 8EF (United Kingdom); Debanne, Dominique [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Alcaraz, Gisele, E-mail: gisele.alcaraz@univmed.fr [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France)

2011-07-29

Highlights: {yields} Both Ca{sup ++}-Calmodulin (CaM) and Ca{sup ++}-free CaM bind to the C-terminal region of Nav1.1. {yields} Ca{sup ++} and CaM have both opposite and convergent effects on I{sub Nav1.1}. {yields} Ca{sup ++}-CaM modulates I{sub Nav1.1} amplitude. {yields} CaM hyperpolarizes the voltage-dependence of activation, and increases the inactivation rate. {yields} Ca{sup ++} alone antagonizes CaM for both effects, and depolarizes the voltage-dependence of inactivation. -- Abstract: Mutations in the neuronal Nav1.1 voltage-gated sodium channel are responsible for mild to severe epileptic syndromes. The ubiquitous calcium sensor calmodulin (CaM) bound to rat brain Nav1.1 and to the human Nav1.1 channel expressed by a stably transfected HEK-293 cell line. The C-terminal region of the channel, as a fusion protein or in the yeast two-hybrid system, interacted with CaM via a consensus C-terminal motif, the IQ domain. Patch clamp experiments on HEK1.1 cells showed that CaM overexpression increased peak current in a calcium-dependent way. CaM had no effect on the voltage-dependence of fast inactivation, and accelerated the inactivation kinetics. Elevating Ca{sup ++} depolarized the voltage-dependence of fast inactivation and slowed down the fast inactivation kinetics, and for high concentrations this effect competed with the acceleration induced by CaM alone. Similarly, the depolarizing action of calcium antagonized the hyperpolarizing shift of the voltage-dependence of activation due to CaM overexpression. Fluorescence spectroscopy measurements suggested that Ca{sup ++} could bind the Nav1.1 C-terminal region with micromolar affinity.

Voltage-dependent amplification of synaptic inputs in respiratory motoneurones

Science.gov (United States)

Enríquez Denton, M; Wienecke, J; Zhang, M; Hultborn, H; Kirkwood, P A

2012-01-01

The role of persistent inward currents (PICs) in cat respiratory motoneurones (phrenic inspiratory and thoracic expiratory) was investigated by studying the voltage-dependent amplification of central respiratory drive potentials (CRDPs), recorded intracellularly, with action potentials blocked with the local anaesthetic derivative, QX-314. Decerebrate unanaesthetized or barbiturate-anaesthetized preparations were used. In expiratory motoneurones, plateau potentials were observed in the decerebrates, but not under anaesthesia. For phrenic motoneurones, no plateau potentials were observed in either state (except in one motoneurone after the abolition of the respiratory drive by means of a medullary lesion), but all motoneurones showed voltage-dependent amplification of the CRDPs, over a wide range of membrane potentials, too wide to result mainly from PIC activation. The measurements of the amplification were restricted to the phase of excitation, thus excluding the inhibitory phase. Amplification was found to be greatest for the smallest CRDPs in the lowest resistance motoneurones and was reduced or abolished following intracellular injection of the NMDA channel blocker, MK-801. Plateau potentials were readily evoked in non-phrenic cervical motoneurones in the same (decerebrate) preparations. We conclude that the voltage-dependent amplification of synaptic excitation in phrenic motoneurones is mainly the result of NMDA channel modulation rather than the activation of Ca2+ channel mediated PICs, despite phrenic motoneurones being strongly immunohistochemically labelled for CaV1.3 channels. The differential PIC activation in different motoneurones, all of which are CaV1.3 positive, leads us to postulate that the descending modulation of PICs is more selective than has hitherto been believed. PMID:22495582

Signature and Pathophysiology of Non-canonical Pores in Voltage-Dependent Cation Channels.

Science.gov (United States)

Held, Katharina; Voets, Thomas; Vriens, Joris

2016-01-01

Opening and closing of voltage-gated cation channels allows the regulated flow of cations such as Na(+), K(+), and Ca(2+) across cell membranes, which steers essential physiological processes including shaping of action potentials and triggering Ca(2+)-dependent processes. Classical textbooks describe the voltage-gated cation channels as membrane proteins with a single, central aqueous pore. In recent years, however, evidence has accumulated for the existence of additional ion permeation pathways in this group of cation channels, distinct from the central pore, which here we collectively name non-canonical pores. Whereas the first non-canonical pores were unveiled only after making specific point mutations in the voltage-sensor region of voltage-gated Na(+) and K(+) channels, recent evidence indicates that they may also be functional in non-mutated channels. Moreover, several channelopathies have been linked to mutations that cause the appearance of a non-canonical ion permeation pathway as a new pathological mechanism. This review provides an integrated overview of the biophysical properties of non-canonical pores described in voltage-dependent cation channels (KV, NaV, Cav, Hv1, and TRPM3) and of the (patho)physiological impact of opening of such pores.

Voltage and temperature dependence of the grain boundary tunneling magnetoresistance in manganites

OpenAIRE

Hoefener, C.; Philipp, J. B.; Klein, J.; Alff, L.; Marx, A.; Buechner, B.; Gross, R.

2000-01-01

We have performed a systematic analysis of the voltage and temperature dependence of the tunneling magnetoresistance (TMR) of grain boundaries (GB) in the manganites. We find a strong decrease of the TMR with increasing voltage and temperature. The decrease of the TMR with increasing voltage scales with an increase of the inelastic tunneling current due to multi-step inelastic tunneling via localized defect states in the tunneling barrier. This behavior can be described within a three-current...

Study on temperature dependence of output voltage of electrochemical detector for environmental neutrinos

International Nuclear Information System (INIS)

Halim, Md Abdul; Ishibashi, Kenji; Arima, Hidehiko; Terao, Norichika

2006-01-01

An electrochemical detector with biological material has been applied for the detection of neutrinos on the basis of a new hypothesis. The detector consisted of two electrodes with raw silk and purified water, and gave an appreciable output voltage. The reproducibility of the experimental results was as good as 99.4% at temperature of 300 K. The temperature dependence of the voltage of the detector was studied at 280, 290, 300 and 310 K. Among them, the detector at 310 K produced the highest output voltage and reached 104 mV in 16 days, whereas that at 280 K generated the lowest voltage and it was as low as 1.2 mV in 16 days. The detectors working at 290 and 300 K produced the voltages 18 and 57 mV in 16 days, respectively. The output voltages of the detector increased with temperature and were in good agreement in spite of the history of temperature. The internal resistance and electromotive force (internal voltage) of the experimental detector were obtained at each temperature by individual analysis and least square fitting method. It was found that the electromotive force was almost constant for these temperatures while the internal resistance showed a large dependence on temperature. The reduction of the output voltage with temperature is dominated by this behavior of internal resistance. (author)

Ca2+ and voltage dependence of cardiac ryanodine receptor channel block by sphingosylphosphorylcholine.

Science.gov (United States)

Yasukochi, Midori; Uehara, Akira; Kobayashi, Sei; Berlin, Joshua R

2003-03-01

The effect of sphingosylphosphorylcholine (SPC) on the cytoplasmic Ca(2+) and voltage dependence of channel gating by cardiac ryanodine receptors (RyR) was examined in lipid bilayer experiments. Micromolar concentrations of the lysosphingolipid SPC added to cis solutions rapidly and reversibly decreased the single-channel open probability (P(o)) of reconstituted RyR channels. The SPC-induced decrease in P(o) was marked by an increase in mean closed time and burst-like channel gating. Gating kinetics during intraburst periods were unchanged from those observed in the absence of the sphingolipid, although SPC induced a long-lived closed state that appeared to explain the observed decrease in channel P(o). SPC effects were observed over a broad range of cis [Ca(2+)] but were not competitive with Ca(2+). Interestingly, the sphingolipid-induced, long-lived closed state displayed voltage-dependent kinetics, even though other channel gating kinetics were not sensitive to voltage. Assuming SPC effects represent channel blockade, these results suggest that the blocking rate is independent of voltage whereas the unblocking rate is voltage dependent. Together, these results suggest that SPC binds directly to the cytoplasmic side of the RyR protein in a location in or near the membrane dielectric, but distinct from cytoplasmic Ca(2+) binding sites on the protein.

Simple and accurate model for voltage-dependent resistance of metallic carbon nanotube interconnects: An ab initio study

International Nuclear Information System (INIS)

Yamacli, Serhan; Avci, Mutlu

2009-01-01

In this work, development of a voltage dependent resistance model for metallic carbon nanotubes is aimed. Firstly, the resistance of metallic carbon nanotube interconnects are obtained from ab initio simulations and then the voltage dependence of the resistance is modeled through regression. Self-consistent non-equilibrium Green's function formalism combined with density functional theory is used for calculating the voltage dependent resistance of metallic carbon nanotubes. It is shown that voltage dependent resistances of carbon nanotubes can be accurately modeled as a polynomial function which enables rapid integration of carbon nanotube interconnect models into electronic design automation tools.

Two separate interfaces between the voltage sensor and pore are required for the function of voltage-dependent K(+ channels.

Directory of Open Access Journals (Sweden)

Seok-Yong Lee

2009-03-01

Full Text Available Voltage-dependent K(+ (Kv channels gate open in response to the membrane voltage. To further our understanding of how cell membrane voltage regulates the opening of a Kv channel, we have studied the protein interfaces that attach the voltage-sensor domains to the pore. In the crystal structure, three physical interfaces exist. Only two of these consist of amino acids that are co-evolved across the interface between voltage sensor and pore according to statistical coupling analysis of 360 Kv channel sequences. A first co-evolved interface is formed by the S4-S5 linkers (one from each of four voltage sensors, which form a cuff surrounding the S6-lined pore opening at the intracellular surface. The crystal structure and published mutational studies support the hypothesis that the S4-S5 linkers convert voltage-sensor motions directly into gate opening and closing. A second co-evolved interface forms a small contact surface between S1 of the voltage sensor and the pore helix near the extracellular surface. We demonstrate through mutagenesis that this interface is necessary for the function and/or structure of two different Kv channels. This second interface is well positioned to act as a second anchor point between the voltage sensor and the pore, thus allowing efficient transmission of conformational changes to the pore's gate.

Cation gating and selectivity in a purified, reconstituted, voltage-dependent sodium channel

International Nuclear Information System (INIS)

Barchi, R.L.; Tanaka, J.C.

1984-01-01

In excitable membranes, the voltage-dependent sodium channel controls the primary membrane conductance change necessary for the generation of an action potential. Over the past four decades, the time- and voltage-dependent sodium currents gated by this channel have been thoroughly documented with increasingly sophisticated voltage-clamp techniques. Recent advances in the biochemistry of membrane proteins have led to the solubilization and purification of this channel protein from nerve (6) and from muscle (4) or muscle-derived (1) membranes, and have provided an approach to the correlation of the channel's molecular structure with its functional properties. Each of these sodium channel preparations appears to contain a large glycoprotein either as its sole component (2) or in association with several small subunits (6, 3). Evidence that these purified proteins represent the excitable membrane sodium channel is presented. 8 refs., 1 fig., 1 tab

A thermoelectric voltage effect in polyethylene oxide

International Nuclear Information System (INIS)

Martin, Bjoern; Wagner, Achim; Kliem, Herbert

2003-01-01

The conductivity of polyethylene oxide (PEO) is described with a three-dimensional hopping model considering electrostatic interactions between the ions. Ions fluctuate over energy-barriers in a multi-well potential. To decide whether positive or negative charges are responsible for this conductivity, the thermoelectric voltage is measured. The samples are embedded between two aluminium-electrodes. The oxide on the interface between the electrodes and the PEO serves as a blocking layer. The temperature of each electrode is controlled by a Peltier element. A temperature step is applied to one electrode by changing the temperature of one of the Peltier elements. Due to this temperature gradient, the mobile charges fluctuate thermally activated from the warmer side to the colder side of the sample. The direction of the measured thermoelectric voltage indicates the type of mobile charges. It is found that positive charges are mobile. Further, it is shown that the absolute value of the thermoelectric voltage depends on the energy-barrier heights in the multi-well potential

Bias voltage dependence of tunneling magnetoresistance in granular C60–Co films with current-perpendicular-to-plane geometry

International Nuclear Information System (INIS)

Sakai, Seiji; Mitani, Seiji; Matsumoto, Yoshihiro; Entani, Shiro; Avramov, Pavel; Ohtomo, Manabu; Naramoto, Hiroshi; Takanashi, Koki

2012-01-01

Voltage-dependence of the tunneling magnetoresistance effect in the granular C 60 –Co films has been investigated for the samples with the current-perpendicular-to-plane geometry. The transport measurements under this geometry demonstrate that the granular C 60 –Co films show an unusual exponential bias voltage dependence of the magnetoresistance ratio down to zero voltage. Small characteristic energies of less than 10's meV are derived from the temperature dependences of the characteristic voltage in the exponential relationship. Considering the magnitudes of the voltage drop between Co nanoparticles and also the effect of cotunneling on the energy values, the characteristic energies for the voltage-induced degradation of the spin polarization are found to show a satisfactory agreement with that for the thermally-induced one. It can be reasonably expected that the onset of magnetic disorder to the localized d-electron spins at the interface region of the C 60 -based matrix (C 60 –Co compound) with Co nanoparticles leading to the unusual voltage and temperature dependence of the magnetoresistance ratio and the spin polarization at low temperatures. - Highlights: ► Unusual voltage dependence of the TMR effect in granular C 60 –Co films is studied. ► Linear temperature-characteristic voltage dependence in the MR–V relationship. ► Spin-flip scattering by the exchange-coupled d-electron spins at the interface.

New delay-dependent absolute stability criteria for Lur'e systems with time-varying delay

Science.gov (United States)

Chen, Yonggang; Bi, Weiping; Li, Wenlin

2011-07-01

In this article, the absolute stability problem is investigated for Lur'e systems with time-varying delay and sector-bounded nonlinearity. By employing the delay fractioning idea, the new augmented Lyapunov functional is first constructed. Then, by introducing some slack matrices and by reserving the useful term when estimating the upper bound of the derivative of Lyapunov functional, the new delay-dependent absolute stability criteria are derived in terms of linear matrix inequalities. Several numerical examples are presented to show the effectiveness and the less conservativeness of the proposed method.

Angular dependence of SiO2 etch rate at various bias voltages in a high density CHF3 plasma

International Nuclear Information System (INIS)

Lee, Gyeo-Re; Hwang, Sung-Wook; Min, Jae-Ho; Moon, Sang Heup

2002-01-01

The dependence of the SiO 2 etch rate on the angle of ions incident on the substrate surface was studied over a bias voltage range from -20 to -600 V in a high-density CHF 3 plasma using a Faraday cage to control the ion incident angle. The effect of the bottom plane on the sidewall etching was also examined. Differences in the characteristics of the etch rate as a function of the ion angle were observed for different bias voltage regions. When the absolute value of the bias voltage was smaller than 200 V, the normalized etch rate (NER) defined as the etch rate normalized by the rate on the horizontal surface, changed following a cosine curve with respect to the ion incident angle, defined as the angle between the ion direction and the normal of the substrate surface. When the magnitude of the bias voltage was larger than 200 V, the NER was deviated to higher values from those given by a cosine curve at ion angles between 30 deg. and 70 deg. , and then drastically decreased at angles higher than 70 deg. until a net deposition was observed at angles near 90 deg. . The characteristic etch-rate patterns at ion angles below 70 deg. were determined by the ion energy transferred to the surface, which affected the SiO 2 etch rate and, simultaneously, the rate of removal of a fluorocarbon polymer film formed on the substrate surface. At high ion angles, particles emitted from the bottom plane contributed to polymer formation on and affected the etching characteristics of the substrate

Interplay between tip-induced band bending and voltage-dependent surface corrugation on GaAs(110) surfaces

NARCIS (Netherlands)

Raad, de G.J.; Bruls, D.M.; Koenraad, P.M.; Wolter, J.H.

2002-01-01

Atomically resolved, voltage-dependent scanning tunneling microscopy (STM) images of GaAs(110) are compared to the results of a one-dimensional model used to calculate the amount of tip-induced band bending for a tunneling junction between a metal and a semiconductor. The voltage-dependent changes

Investigation of channel width-dependent threshold voltage variation in a-InGaZnO thin-film transistors

Energy Technology Data Exchange (ETDEWEB)

Liu, Kuan-Hsien; Chou, Wu-Ching [Department of Electrophysics, National Chiao Tung University, Hsinchu, Taiwan (China); Chang, Ting-Chang, E-mail: tcchang@mail.phys.nsysu.edu.tw [Department of Physics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Advanced Optoelectronics Technology Center, National Cheng Kung University, Taiwan (China); Wu, Ming-Siou; Hung, Yi-Syuan; Sze, Simon M. [Department of Electronics Engineering, National Chiao Tung University, Hsinchu, Taiwan (China); Hung, Pei-Hua; Chu, Ann-Kuo [Department of Photonics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Hsieh, Tien-Yu [Department of Physics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Yeh, Bo-Liang [Advanced Display Technology Research Center, AU Optronics, No. 1, Li-Hsin Rd. 2, Hsinchu Science Park, Hsinchu 30078, Taiwan (China)

2014-03-31

This Letter investigates abnormal channel width-dependent threshold voltage variation in amorphous indium-gallium-zinc-oxide (a-IGZO) thin-film transistors. Unlike drain-induced source barrier lowering effect, threshold voltage increases with increasing drain voltage. Furthermore, the wider the channel, the larger the threshold voltage observed. Because of the surrounding oxide and other thermal insulating material and the low thermal conductivity of the IGZO layer, the self-heating effect will be pronounced in wider channel devices and those with a larger operating drain bias. To further clarify the physical mechanism, fast IV measurement is utilized to demonstrate the self-heating induced anomalous channel width-dependent threshold voltage variation.

Josephson tunneling current in the presence of a time-dependent voltage

International Nuclear Information System (INIS)

Harris, R.E.

1975-01-01

The expression for the current through a small Josephson tunnel junction in the presence of a time-dependent voltage is presented. Four terms appear: the usual sine, cosine, and quasiparticle terms, and a reactive part of the quasiparticle current. The latter is displayed graphically as a function of both energy and temperature. It is shown that in the limit of zero dc voltage and small ac voltage, the Josephson device behaves linearly. Interpretation of the in- and out-of-phase components of the current in this linear limit is given to provide physical insight into some of the details of the general expression. Finally, the tunneling current in the linear limit is shown for thin tunneling barriers to be proportional to the current in a single superconductor in the presence of an electromagnetic field

Possible influence of the voltage dependence of the Josephson tunneling current I(V,psi) on the corresponding current-voltage characteristic

International Nuclear Information System (INIS)

Hahlbohm, H.D.; Luebbig, H.; Luther, H.

1975-01-01

Analog computer calculations of the current-voltage characteristic involving the voltage dependence of the amplitudes of the tunneling current equation explicitly, for the case of a current driven tunneling junction at different temperatures are reported on. These studies are based upon the adiabatic representation of the current-phase relation. The influence of retarding effects is not included. Therefore the computational results can lead to practical consequences at best in the range near the transition temperature. (Auth.)

Frequency and voltage dependent electrical responses of poly(triarylamine) thin film-based organic Schottky diode

Science.gov (United States)

Anuar Mohamad, Khairul; Tak Hoh, Hang; Alias, Afishah; Ghosh, Bablu Kumar; Fukuda, Hisashi

2017-11-01

A metal-organic-metal (MOM) type Schottky diode based on poly (triarylamine) (PTAA) thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f) and capacitance-voltage (C-V-f) characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit). Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz) but decreases at high frequency (1 - 10 kHz). The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV-1cm-2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC) signal.

Regulation of KV channel voltage-dependent activation by transmembrane β subunits

Directory of Open Access Journals (Sweden)

Xiaohui eSun

2012-04-01

Full Text Available Voltage-activated K+ (KV channels are important for shaping action potentials and maintaining resting membrane potential in excitable cells. KV channels contain a central pore-gate domain (PGD surrounded by four voltage-sensing domains (VSD. The VSDs will change conformation in response to alterations of the membrane potential thereby inducing the opening of the PGD. Many KV channels are heteromeric protein complexes containing auxiliary β subunits. These β subunits modulate channel expression and activity to increase functional diversity and render tissue specific phenotypes. This review focuses on the KV β subunits that contain transmembrane (TM segments including the KCNE family and the β subunits of large conductance, Ca2+- and voltage-activated K+ (BK channels. These TM β subunits affect the voltage-dependent activation of KV α subunits. Experimental and computational studies have described the structural location of these β subunits in the channel complexes and the biophysical effects on VSD activation, PGD opening and VSD-PGD coupling. These results reveal some common characteristics and mechanistic insights into KV channel modulation by TM β subunits.

Voltage dependency of transmission probability of aperiodic DNA molecule

Science.gov (United States)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Monitoring voltage-dependent charge displacement of Shaker B-IR K+ ion channels using radio frequency interrogation.

Directory of Open Access Journals (Sweden)

Sameera Dharia

2011-02-01

Full Text Available Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR K(+ ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+ addition to the external bath. Cu(2+ is known to bind to the ShB-IR ion channel and inhibit Shaker K(+ conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.

Monitoring voltage-dependent charge displacement of Shaker B-IR K+ ion channels using radio frequency interrogation.

Science.gov (United States)

Dharia, Sameera; Rabbitt, Richard D

2011-02-28

Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+) addition to the external bath. Cu(2+) is known to bind to the ShB-IR ion channel and inhibit Shaker K(+) conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+)-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.

Differences between signal currents for both polarities of applied voltages on cavity ionization chambers

International Nuclear Information System (INIS)

Takata, N.

2000-01-01

It is necessary to obtain precise values of signal currents for the measurement of exposure rates for gamma rays with cavity ionization chambers. Signal currents are usually expected to have the same absolute values for both polarities of applied voltages. In the case of cylindrical cavity ionization chambers, volume recombination loss of ion pairs depends on the polarity of the applied voltage. This is because the values of mobility are different for positive and negative ions. It was found, however, that values of signal currents from a cylindrical ionization chamber change slightly more with a negative than with a positive applied voltage, even after being corrected for volume recombination loss. Moreover, absolute values of saturation currents, which are obtained by extrapolation of correction of initial recombination and diffusion loss, were larger for the negative than for the positive applied voltage. It is known from an experiment with parallel plate ionization chambers that when negative voltage is applied to the repeller electrode, the saturated signal current decreases with an increase in the applied voltage. This is because secondary electrons are accelerated and the stopping power of air for these electrons decreases. When positive voltage is applied, the reverse is true. The effects of acceleration and deceleration of secondary electrons by the electric field thus seem to cause a tendency opposite to the experimental results on the signal currents from cylindrical ionization chambers. The experimental results for the cylindrical ionization chamber can be explained as follows. When negative voltage is applied, secondary electrons are attracted to the central (collecting) electrode. Consequently, the path length of the trajectories of these secondary electrons in the ionization volume increases and signal current increases. The energy gain from the electric field by secondary electrons which stop in the ionization chamber also contributes to the

Electro-chemical coupling in the voltage-dependent phosphatase Ci-VSP

Science.gov (United States)

Kohout, Susy C.; Bell, Sarah C.; Liu, Lijun; Xu, Qiang; Minor, Daniel L.; Isacoff, Ehud Y.

2010-01-01

In the voltage sensing phosphatase, Ci-VSP, a voltage sensing domain (VSD) controls a lipid phosphatase domain (PD). The mechanism by which the domains are allosterically coupled is not well understood. Using an in vivo assay, we find that the inter-domain linker that connects the VSD to the PD is essential for coupling the full-length protein. Biochemical assays show that the linker is also needed for activity in the isolated PD. We identify a late step of VSD motion in the full-length protein that depends on the linker. Strikingly, this VSD motion is found to require PI(4,5)P2, a substrate of Ci-VSP. These results suggest that the voltage-driven motion of the VSD turns the enzyme on by rearranging the linker into an activated conformation, and that this activated conformation is stabilized by PI(4,5)P2. We propose that Ci-VSP activity is self-limited because its decrease of PI(4,5)P2 levels decouples the VSD from the enzyme. PMID:20364128

KCNE5 induces time- and voltage-dependent modulation of the KCNQ1 current

DEFF Research Database (Denmark)

Angelo, Kamilla; Jespersen, Thomas; Grunnet, Morten

2002-01-01

The function of the KCNE5 (KCNE1-like) protein has not previously been described. Here we show that KCNE5 induces both a time- and voltage-dependent modulation of the KCNQ1 current. Interaction of the KCNQ1 channel with KCNE5 shifted the voltage activation curve of KCNQ1 by more than 140 mV in th...... the I(Ks) current in certain parts of the mammalian heart....

Frequency and voltage dependent electrical responses of poly(triarylamine thin film-based organic Schottky diode

Directory of Open Access Journals (Sweden)

Mohamad Khairul Anuar

2017-01-01

Full Text Available A metal-organic-metal (MOM type Schottky diode based on poly (triarylamine (PTAA thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f and capacitance-voltage (C-V-f characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit. Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz but decreases at high frequency (1 – 10 kHz. The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV−1cm−2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC signal.

Cloning and functional expression of a plant voltage-dependent chloride channel.

Science.gov (United States)

Lurin, C; Geelen, D; Barbier-Brygoo, H; Guern, J; Maurel, C

1996-01-01

Plant cell membrane anion channels participate in basic physiological functions, such as cell volume regulation and signal transduction. However, nothing is known about their molecular structure. Using a polymerase chain reaction strategy, we have cloned a tobacco cDNA (CIC-Nt1) encoding a 780-amino acid protein with several putative transmembrane domains. CIC-Nt1 displays 24 to 32% amino acid identity with members of the animal voltage-dependent chloride channel (CIC) family, whose archetype is CIC-0 from the Torpedo marmorata electric organ. Injection of CIC-Nt1 complementary RNA into Xenopus oocytes elicited slowly activating inward currents upon membrane hyperpolarization more negative than -120 mV. These currents were carried mainly by anions, modulated by extracellular anions, and totally blocked by 10 mM extracellular calcium. The identification of CIC-Nt1 extends the CIC family to higher plants and provides a molecular probe for the study of voltage-dependent anion channels in plants. PMID:8624442

Differential expression of T- and L-type voltage-dependent calcium channels in renal resistance vessels

DEFF Research Database (Denmark)

Hansen, Pernille B. Lærkegaard; Jensen, Boye L.; Andreasen, D

2001-01-01

The distribution of voltage-dependent calcium channels in kidney pre- and postglomerular resistance vessels was determined at the molecular and functional levels. Reverse transcription-polymerase chain reaction analysis of microdissected rat preglomerular vessels and cultured smooth muscle cells...... on vascular diameter in the afferent arteriole. We conclude that voltage-dependent L- and T-type calcium channels are expressed and of functional significance in renal cortical preglomerular vessels, in juxtamedullary efferent arterioles, and in outer medullary vasa recta, but not in cortical efferent...

Voltage dependence of carbon-based supercapacitors for pseudocapacitance quantification

OpenAIRE

Ruiz Ruiz, Vanesa; Roldán Luna, Silvia; Villar Masetto, Isabel; Blanco Rodríguez, Clara; Santamaría Ramírez, Ricardo

2013-01-01

In order to understand the participation of electrical double layer and pseudocapacitance to the overall behavior of supercapacitors, a new approach to the analysis of the electrochemical data is proposed. Both the variation of the specific capacitance values and the dependence of these values with the operating voltage window (varying from 0–0.2 V to 0–1 V) were evaluated and used to quantify the contribution arising from each mechanism of energy storage to the total capacitance of the syste...

New insights on the voltage dependence of the KCa3.1 channel block by internal TBA.

Science.gov (United States)

Banderali, Umberto; Klein, Hélène; Garneau, Line; Simoes, Manuel; Parent, Lucie; Sauvé, Rémy

2004-10-01

We present in this work a structural model of the open IKCa (KCa3.1) channel derived by homology modeling from the MthK channel structure, and used this model to compute the transmembrane potential profile along the channel pore. This analysis showed that the selectivity filter and the region extending from the channel inner cavity to the internal medium should respectively account for 81% and 16% of the transmembrane potential difference. We found however that the voltage dependence of the IKCa block by the quaternary ammonium ion TBA applied internally is compatible with an apparent electrical distance delta of 0.49 +/- 0.02 (n = 6) for negative potentials. To reconcile this observation with the electrostatic potential profile predicted for the channel pore, we modeled the IKCa block by TBA assuming that the voltage dependence of the block is governed by both the difference in potential between the channel cavity and the internal medium, and the potential profile along the selectivity filter region through an effect on the filter ion occupancy states. The resulting model predicts that delta should be voltage dependent, being larger at negative than positive potentials. The model also indicates that raising the internal K+ concentration should decrease the value of delta measured at negative potentials independently of the external K+ concentration, whereas raising the external K+ concentration should minimally affect delta for concentrations >50 mM. All these predictions are born out by our current experimental results. Finally, we found that the substitutions V275C and V275A increased the voltage sensitivity of the TBA block, suggesting that TBA could move further into the pore, thus leading to stronger interactions between TBA and the ions in the selectivity filter. Globally, these results support a model whereby the voltage dependence of the TBA block in IKCa is mainly governed by the voltage dependence of the ion occupancy states of the selectivity filter.

Bias voltage effect on electron tunneling across a junction with a ferroelectric–ferromagnetic two-phase composite barrier

International Nuclear Information System (INIS)

Wang Jian; Ju Sheng; Li, Z.Y.

2012-01-01

The effect of bias voltage on electron tunneling across a junction with a ferroelectric–ferromagnetic composite barrier is investigated theoretically. Because of the inversion symmetry breaking of the spontaneous ferroelectric polarization, bias voltage dependence of the electron tunneling shows significant differences between the positive bias and the negative one. The differences of spin filtering or tunnel magnetoresistance increase with the increasing absolute value of bias voltage. Such direction preferred electron tunneling is found intimately related with the unusual asymmetry of the electrical potential profile in two-phase composite barrier and provides a unique change to realize rectifying functions in spintronics. - Highlights: ► Electron tunneling across a ferroelectric–ferromagnetic composite barrier junction. ► TMR effect is different under the same value but opposite direction bias voltage. ► This directionality of the electron tunneling enhances with increasing bias voltage.

Mining Protein Evolution for Insights into Mechanisms of Voltage-Dependent Sodium Channel Auxiliary Subunits.

Science.gov (United States)

Molinarolo, Steven; Granata, Daniele; Carnevale, Vincenzo; Ahern, Christopher A

2018-02-21

Voltage-gated sodium channel (VGSC) beta (β) subunits have been called the "overachieving" auxiliary ion channel subunit. Indeed, these subunits regulate the trafficking of the sodium channel complex at the plasma membrane and simultaneously tune the voltage-dependent properties of the pore-forming alpha-subunit. It is now known that VGSC β-subunits are capable of similar modulation of multiple isoforms of related voltage-gated potassium channels, suggesting that their abilities extend into the broader voltage-gated channels. The gene family for these single transmembrane immunoglobulin beta-fold proteins extends well beyond the traditional VGSC β1-β4 subunit designation, with deep roots into the cell adhesion protein family and myelin-related proteins - where inherited mutations result in a myriad of electrical signaling disorders. Yet, very little is known about how VGSC β-subunits support protein trafficking pathways, the basis for their modulation of voltage-dependent gating, and, ultimately, their role in shaping neuronal excitability. An evolutionary approach can be useful in yielding new clues to such functions as it provides an unbiased assessment of protein residues, folds, and functions. An approach is described here which indicates the greater emergence of the modern β-subunits roughly 400 million years ago in the early neurons of Bilateria and bony fish, and the unexpected presence of distant homologues in bacteriophages. Recent structural breakthroughs containing α and β eukaryotic sodium channels containing subunits suggest a novel role for a highly conserved polar contact that occurs within the transmembrane segments. Overall, a mixture of approaches will ultimately advance our understanding of the mechanism for β-subunit interactions with voltage-sensor containing ion channels and membrane proteins.

Shaping charge excitations in chiral edge states with a time-dependent gate voltage

Science.gov (United States)

Misiorny, Maciej; Fève, Gwendal; Splettstoesser, Janine

2018-02-01

We study a coherent conductor supporting a single edge channel in which alternating current pulses are created by local time-dependent gating and sent on a beam-splitter realized by a quantum point contact. The current response to the gate voltage in this setup is intrinsically linear. Based on a fully self-consistent treatment employing a Floquet scattering theory, we analyze the effect of different voltage shapes and frequencies, as well as the role of the gate geometry on the injected signal. In particular, we highlight the impact of frequency-dependent screening on the process of shaping the current signal. The feasibility of creating true single-particle excitations with this method is confirmed by investigating the suppression of excess noise, which is otherwise created by additional electron-hole pair excitations in the current signal.

Localization and pharmacological characterization of voltage dependent calcium channels in cultured neocortical neurons

DEFF Research Database (Denmark)

Timmermann, D B; Lund, Trine Meldgaard; Belhage, B

2001-01-01

The physiological significance and subcellular distribution of voltage dependent calcium channels was defined using calcium channel blockers to inhibit potassium induced rises in cytosolic calcium concentration in cultured mouse neocortical neurons. The cytosolic calcium concentration was measured...... channels were differentially distributed in somata, neurites and nerve terminals. omega-conotoxin MVIIC (omega-CgTx MVIIC) inhibited approximately 40% of the Ca(2+)-rise in both somata and neurites and 60% of the potassium induced [3H]GABA release, indicating that the Q-type channel is the quantitatively...... most important voltage dependent calcium channel in all parts of the neuron. After treatment with thapsigargin the increase in cytosolic calcium was halved, indicating that calcium release from thapsigargin sensitive intracellular calcium stores is an important component of the potassium induced rise...

Analytical Model for Voltage-Dependent Photo and Dark Currents in Bulk Heterojunction Organic Solar Cells

Directory of Open Access Journals (Sweden)

Mesbahus Saleheen

2016-05-01

Full Text Available A physics-based explicit mathematical model for the external voltage-dependent forward dark current in bulk heterojunction (BHJ organic solar cells is developed by considering Shockley-Read-Hall (SRH recombination and solving the continuity equations for both electrons and holes. An analytical model for the external voltage-dependent photocurrent in BHJ organic solar cells is also proposed by incorporating exponential photon absorption, dissociation efficiency of bound electron-hole pairs (EHPs, carrier trapping, and carrier drift and diffusion in the photon absorption layer. Modified Braun’s model is used to compute the electric field-dependent dissociation efficiency of the bound EHPs. The overall net current is calculated considering the actual solar spectrum. The mathematical models are verified by comparing the model calculations with various published experimental results. We analyze the effects of the contact properties, blend compositions, charge carrier transport properties (carrier mobility and lifetime, and cell design on the current-voltage characteristics. The power conversion efficiency of BHJ organic solar cells mostly depends on electron transport properties of the acceptor layer. The results of this paper indicate that improvement of charge carrier transport (both mobility and lifetime and dissociation of bound EHPs in organic blend are critically important to increase the power conversion efficiency of the BHJ solar cells.

Field and polarity dependence of time-to-resistance increase in Fe-O films studied by constant voltage stress method

International Nuclear Information System (INIS)

Eriguchi, Koji; Ohta, Hiroaki; Ono, Kouichi; Wei Zhiqiang; Takagi, Takeshi

2009-01-01

Constant voltage stress (CVS) was applied to Fe-O films prepared by a sputtering process to investigate a stress-induced resistance increase leading to a fundamental mechanism for switching behaviors. Under the CVS, an abrupt resistance increase was found for both stress polarities. A conduction mechanism after the resistance increase exhibited non-Ohmic transport. The time-to-resistance increase (t r ) under the CVS was revealed to strongly depend on stress voltage as well as the polarity. From a polarity-dependent resistance increase determined by a time-zero measurement, the voltage and polarity-dependent t r were discussed on the basis of field- and structure-enhanced thermochemical reaction mechanisms

Neuroprotective effect of interleukin-6 regulation of voltage-gated Na+ channels of cortical neurons is time- and dose-dependent

Directory of Open Access Journals (Sweden)

Wei Xia

2015-01-01

Full Text Available Interleukin-6 has been shown to be involved in nerve injury and nerve regeneration, but the effects of long-term administration of high concentrations of interleukin-6 on neurons in the central nervous system is poorly understood. This study investigated the effects of 24 hour exposure of interleukin-6 on cortical neurons at various concentrations (0.1, 1, 5 and 10 ng/mL and the effects of 10 ng/mL interleukin-6 exposure to cortical neurons for various durations (2, 4, 8, 24 and 48 hours by studying voltage-gated Na + channels using a patch-clamp technique. Voltage-clamp recording results demonstrated that interleukin-6 suppressed Na + currents through its receptor in a time- and dose-dependent manner, but did not alter voltage-dependent activation and inactivation. Current-clamp recording results were consistent with voltage-clamp recording results. Interleukin-6 reduced the action potential amplitude of cortical neurons, but did not change the action potential threshold. The regulation of voltage-gated Na + channels in rat cortical neurons by interleukin-6 is time- and dose-dependent.

NO involvement in the inhibition of ghrelin on voltage-dependent potassium currents in rat hippocampal cells.

Science.gov (United States)

Lu, Yong; Dang, Shaokang; Wang, Xu; Zhang, Junli; Zhang, Lin; Su, Qian; Zhang, Huiping; Lin, Tianwei; Zhang, Xiaoxiao; Zhang, Yurong; Sun, Hongli; Zhu, Zhongliang; Li, Hui

2018-01-01

Ghrelin is a peptide hormone that plays an important role in promoting appetite, regulating distribution and rate of use of energy, cognition, and mood disorders, but the relevant neural mechanisms of these function are still not clear. In this study, we examined the effect of ghrelin on voltage-dependent potassium (K + ) currents in hippocampal cells of 1-3 days SD rats by whole-cell patch-clamp technique, and discussed whether NO was involved in this process. The results showed that ghrelin significantly inhibited the voltage-dependent K + currents in hippocampal cells, and the inhibitory effect was more significant when l-arginine was co-administered. In contrast, N-nitro- l-arginine methyl ester increased the ghrelin inhibited K + currents and attenuated the inhibitory effect of ghrelin. While d-arginine (D-AA) showed no significant impact on the ghrelin-induced decrease in K + current. These results show that ghrelin may play a physiological role by inhibiting hippocampal voltage dependent K + currents, and the NO pathway may be involved in this process. Copyright © 2017 Elsevier B.V. All rights reserved.

Voltage dependence of a stochastic model of activation of an alpha helical S4 sensor in a K channel membrane

Science.gov (United States)

Vaccaro, S. R.

2011-09-01

The voltage dependence of the ionic and gating currents of a K channel is dependent on the activation barriers of a voltage sensor with a potential function which may be derived from the principal electrostatic forces on an S4 segment in an inhomogeneous dielectric medium. By variation of the parameters of a voltage-sensing domain model, consistent with x-ray structures and biophysical data, the lowest frequency of the survival probability of each stationary state derived from a solution of the Smoluchowski equation provides a good fit to the voltage dependence of the slowest time constant of the ionic current in a depolarized membrane, and the gating current exhibits a rising phase that precedes an exponential relaxation. For each depolarizing potential, the calculated time dependence of the survival probabilities of the closed states of an alpha helical S4 sensor are in accord with an empirical model of the ionic and gating currents recorded during the activation process.

Absolutely relative or relatively absolute: violations of value invariance in human decision making.

Science.gov (United States)

Teodorescu, Andrei R; Moran, Rani; Usher, Marius

2016-02-01

Making decisions based on relative rather than absolute information processing is tied to choice optimality via the accumulation of evidence differences and to canonical neural processing via accumulation of evidence ratios. These theoretical frameworks predict invariance of decision latencies to absolute intensities that maintain differences and ratios, respectively. While information about the absolute values of the choice alternatives is not necessary for choosing the best alternative, it may nevertheless hold valuable information about the context of the decision. To test the sensitivity of human decision making to absolute values, we manipulated the intensities of brightness stimuli pairs while preserving either their differences or their ratios. Although asked to choose the brighter alternative relative to the other, participants responded faster to higher absolute values. Thus, our results provide empirical evidence for human sensitivity to task irrelevant absolute values indicating a hard-wired mechanism that precedes executive control. Computational investigations of several modelling architectures reveal two alternative accounts for this phenomenon, which combine absolute and relative processing. One account involves accumulation of differences with activation dependent processing noise and the other emerges from accumulation of absolute values subject to the temporal dynamics of lateral inhibition. The potential adaptive role of such choice mechanisms is discussed.

Temperature and Voltage Coupling to Channel Opening in Transient Receptor Potential Melastatin 8 (TRPM8)*♦

Science.gov (United States)

Raddatz, Natalia; Castillo, Juan P.; Gonzalez, Carlos; Alvarez, Osvaldo; Latorre, Ramon

2014-01-01

Expressed in somatosensory neurons of the dorsal root and trigeminal ganglion, the transient receptor potential melastatin 8 (TRPM8) channel is a Ca2+-permeable cation channel activated by cold, voltage, phosphatidylinositol 4,5-bisphosphate, and menthol. Although TRPM8 channel gating has been characterized at the single channel and macroscopic current levels, there is currently no consensus regarding the extent to which temperature and voltage sensors couple to the conduction gate. In this study, we extended the range of voltages where TRPM8-induced ionic currents were measured and made careful measurements of the maximum open probability the channel can attain at different temperatures by means of fluctuation analysis. The first direct measurements of TRPM8 channel temperature-driven conformational rearrangements provided here suggest that temperature alone is able to open the channel and that the opening reaction is voltage-independent. Voltage is a partial activator of TRPM8 channels, because absolute open probability values measured with fully activated voltage sensors are less than 1, and they decrease as temperature rises. By unveiling the fast temperature-dependent deactivation process, we show that TRPM8 channel deactivation is well described by a double exponential time course. The fast and slow deactivation processes are temperature-dependent with enthalpy changes of 27.2 and 30.8 kcal mol−1. The overall Q10 for the closing reaction is about 33. A three-tiered allosteric model containing four voltage sensors and four temperature sensors can account for the complex deactivation kinetics and coupling between voltage and temperature sensor activation and channel opening. PMID:25352597

Beyond voltage-gated ion channels: Voltage-operated membrane proteins and cellular processes.

Science.gov (United States)

Zhang, Jianping; Chen, Xingjuan; Xue, Yucong; Gamper, Nikita; Zhang, Xuan

2018-04-18

Voltage-gated ion channels were believed to be the only voltage-sensitive proteins in excitable (and some non-excitable) cells for a long time. Emerging evidence indicates that the voltage-operated model is shared by some other transmembrane proteins expressed in both excitable and non-excitable cells. In this review, we summarize current knowledge about voltage-operated proteins, which are not classic voltage-gated ion channels as well as the voltage-dependent processes in cells for which single voltage-sensitive proteins have yet to be identified. Particularly, we will focus on the following. (1) Voltage-sensitive phosphoinositide phosphatases (VSP) with four transmembrane segments homologous to the voltage sensor domain (VSD) of voltage-gated ion channels; VSPs are the first family of proteins, other than the voltage-gated ion channels, for which there is sufficient evidence for the existence of the VSD domain; (2) Voltage-gated proton channels comprising of a single voltage-sensing domain and lacking an identified pore domain; (3) G protein coupled receptors (GPCRs) that mediate the depolarization-evoked potentiation of Ca 2+ mobilization; (4) Plasma membrane (PM) depolarization-induced but Ca 2+ -independent exocytosis in neurons. (5) Voltage-dependent metabolism of phosphatidylinositol 4,5-bisphosphate (PtdIns[4,5]P 2 , PIP 2 ) in the PM. These recent discoveries expand our understanding of voltage-operated processes within cellular membranes. © 2018 Wiley Periodicals, Inc.

Voltage-dependent gating of KCNH potassium channels lacking a covalent link between voltage-sensing and pore domains

Science.gov (United States)

Lörinczi, Éva; Gómez-Posada, Juan Camilo; de La Peña, Pilar; Tomczak, Adam P.; Fernández-Trillo, Jorge; Leipscher, Ulrike; Stühmer, Walter; Barros, Francisco; Pardo, Luis A.

2015-03-01

Voltage-gated channels open paths for ion permeation upon changes in membrane potential, but how voltage changes are coupled to gating is not entirely understood. Two modules can be recognized in voltage-gated potassium channels, one responsible for voltage sensing (transmembrane segments S1 to S4), the other for permeation (S5 and S6). It is generally assumed that the conversion of a conformational change in the voltage sensor into channel gating occurs through the intracellular S4-S5 linker that provides physical continuity between the two regions. Using the pathophysiologically relevant KCNH family, we show that truncated proteins interrupted at, or lacking the S4-S5 linker produce voltage-gated channels in a heterologous model that recapitulate both the voltage-sensing and permeation properties of the complete protein. These observations indicate that voltage sensing by the S4 segment is transduced to the channel gate in the absence of physical continuity between the modules.

Semi-empirical model for the threshold voltage of a double implanted MOSFET and its temperature dependence

Energy Technology Data Exchange (ETDEWEB)

Arora, N D

1987-05-01

A simple and accurate semi-empirical model for the threshold voltage of a small geometry double implanted enhancement type MOSFET, especially useful in a circuit simulation program like SPICE, has been developed. The effect of short channel length and narrow width on the threshold voltage has been taken into account through a geometrical approximation, which involves parameters whose values can be determined from the curve fitting experimental data. A model for the temperature dependence of the threshold voltage for the implanted devices has also been presented. The temperature coefficient of the threshold voltage was found to change with decreasing channel length and width. Experimental results from various device sizes, both short and narrow, show very good agreement with the model. The model has been implemented in SPICE as part of the complete dc model.

Film size-dependent voltage-modulated magnetism in multiferroic heterostructures

Science.gov (United States)

Hu, J.-M.; Shu, L.; Li, Z.; Gao, Y.; Shen, Y.; Lin, Y. H.; Chen, L. Q.; Nan, C. W.

2014-01-01

The electric-voltage-modulated magnetism in multiferroic heterostructures, also known as the converse magnetoelectric (ME) coupling, has drawn increasing research interest recently owing to its great potential applications in future low-power, high-speed electronic and/or spintronic devices, such as magnetic memory and computer logic. In this article, based on combined theoretical analysis and experimental demonstration, we investigate the film size dependence of such converse ME coupling in multiferroic magnetic/ferroelectric heterostructures, as well as exploring the interaction between two relating coupling mechanisms that are the interfacial strain and possibly the charge effects. We also briefly discuss some issues for the next step and describe new device prototypes that can be enabled by this technology. PMID:24421375

Cellular elements for seeing in the dark: voltage-dependent conductances in cockroach photoreceptors

Directory of Open Access Journals (Sweden)

Salmela Iikka

2012-08-01

Full Text Available Abstract Background The importance of voltage-dependent conductances in sensory information processing is well-established in insect photoreceptors. Here we present the characterization of electrical properties in photoreceptors of the cockroach (Periplaneta americana, a nocturnal insect with a visual system adapted for dim light. Results Whole-cell patch-clamped photoreceptors had high capacitances and input resistances, indicating large photosensitive rhabdomeres suitable for efficient photon capture and amplification of small photocurrents at low light levels. Two voltage-dependent potassium conductances were found in the photoreceptors: a delayed rectifier type (KDR and a fast transient inactivating type (KA. Activation of KDR occurred during physiological voltage responses induced by light stimulation, whereas KA was nearly fully inactivated already at the dark resting potential. In addition, hyperpolarization of photoreceptors activated a small-amplitude inward-rectifying (IR current mediated at least partially by chloride. Computer simulations showed that KDR shapes light responses by opposing the light-induced depolarization and speeding up the membrane time constant, whereas KA and IR have a negligible role in the majority of cells. However, larger KA conductances were found in smaller and rapidly adapting photoreceptors, where KA could have a functional role. Conclusions The relative expression of KA and KDR in cockroach photoreceptors was opposite to the previously hypothesized framework for dark-active insects, necessitating further comparative work on the conductances. In general, the varying deployment of stereotypical K+ conductances in insect photoreceptors highlights their functional flexibility in neural coding.

The Eag domain regulates the voltage-dependent inactivation of rat Eag1 K+ channels.

Directory of Open Access Journals (Sweden)

Ting-Feng Lin

Full Text Available Eag (Kv10 and Erg (Kv11 belong to two distinct subfamilies of the ether-à-go-go K+ channel family (KCNH. While Erg channels are characterized by an inward-rectifying current-voltage relationship that results from a C-type inactivation, mammalian Eag channels display little or no voltage-dependent inactivation. Although the amino (N-terminal region such as the eag domain is not required for the C-type inactivation of Erg channels, an N-terminal deletion in mouse Eag1 has been shown to produce a voltage-dependent inactivation. To further discern the role of the eag domain in the inactivation of Eag1 channels, we generated N-terminal chimeras between rat Eag (rEag1 and human Erg (hERG1 channels that involved swapping the eag domain alone or the complete cytoplasmic N-terminal region. Functional analyses indicated that introduction of the homologous hERG1 eag domain led to both a fast phase and a slow phase of channel inactivation in the rEag1 chimeras. By contrast, the inactivation features were retained in the reverse hERG1 chimeras. Furthermore, an eag domain-lacking rEag1 deletion mutant also showed the fast phase of inactivation that was notably attenuated upon co-expression with the rEag1 eag domain fragment, but not with the hERG1 eag domain fragment. Additionally, we have identified a point mutation in the S4-S5 linker region of rEag1 that resulted in a similar inactivation phenotype. Biophysical analyses of these mutant constructs suggested that the inactivation gating of rEag1 was distinctly different from that of hERG1. Overall, our findings are consistent with the notion that the eag domain plays a critical role in regulating the inactivation gating of rEag1. We propose that the eag domain may destabilize or mask an inherent voltage-dependent inactivation of rEag1 K+ channels.

Analysis and Comparison of Voltage Dependent Charging Strategies for Single-Phase Electric Vehicles in an Unbalanced Danish Distribution Grid

DEFF Research Database (Denmark)

Álvarez, Jorge Nájera; Knezovic, Katarina; Marinelli, Mattia

2016-01-01

This paper studies four voltage dependent solutions for modulating the charging of multiple Electric Vehicles (EVs) in a real Danish network. Uncontrolled EV charging, especially in grid with high EV penetration, can result in overloaded lines and transformers, low-voltages and other performance...

Bias voltage dependence of magnetic tunnel junctions comprising amorphous ferromagnetic CoFeSiB layer with double barriers

International Nuclear Information System (INIS)

Yim, H.I.; Lee, S.Y.; Hwang, J.Y.; Rhee, J.R.; Chun, B.S.; Wang, K.L.; Kim, Y.K.; Kim, T.W.; Lee, S.S.; Hwang, D.G.

2008-01-01

Double-barrier magnetic tunnel junctions (DMTJs) with and without an amorphous ferromagnetic material such as CoFeSiB 10, CoFe 5/CoFeSiB 5, and CoFe 10 (nm) were prepared and compared to investigate the bias voltage dependence of the tunneling magnetoresistance (TMR) ratio. Typical DMTJ structures were Ta 45/Ru 9.5/IrMn 10/CoFe 7/AlO x /free layer 10/AlO x /CoFe 7/IrMn 10/Ru 60 (in nanometers). The interlayer coupling field and the normalized TMR ratios at the applied voltages of +0.4 and -0.4 V of the amorphous CoFeSiB free-layer DMTJ offer lower and higher values than that of the polycrystalline CoFe free-layer DMTJ, respectively. An amorphous ferromagnetic CoFeSiB layer improves the interface roughness of the free layer/tunnel barrier and, as a result, the interlayer coupling field and bias voltage dependence of the TMR ratio are suppressed at a given voltage. (copyright 2008 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

Quadratic dependence of the spin-induced Hall voltage on longitudinal electric field

International Nuclear Information System (INIS)

Miah, M. Idrish

2008-01-01

The effect of optically induced spins in semiconductors in the low electric field is investigated. Here we report an experiment which investigates the effect of a longitudinal electric field (E) on the spin-polarized carriers generated by a circularly polarized light in semiconductors. Our experiment observes the effect as a spin-induced anomalous Hall voltage (V AH ) resulting from spin-carrier electrons accumulating at the transverse edges of the sample. Unlike the ordinary Hall effect, a quadratic dependence of V AH on E is observed, which agrees with the results of the recent theoretical investigations. It is also found that V AH depends on the doping density. The results are discussed

Dependence of absolute magnitudes (energies) of flares on the cluster age containing flare stars

International Nuclear Information System (INIS)

Parsamyan, Eh.S.

1976-01-01

Dependences between Δmsub(u) and msub(u) are given for the Orion, NGC 7000, Pleiades and Praesepe aggregations. Maximum absolute values of flares have been calculated for stars with different luminosities. It has been shown that the values of flares can be limited by a straight line which gives the representation on the distribution of maximum values of amplitudes for the stars with different luminosities in an aggregation. Presented are k and m 0 parameters characterizing the lines fot the Orion, NGC 7000, Pleiades and Praesepe aggregation and their age T dependence. From the dependence between k (angular coefficient of straight lines) and lgT for the aggregation with known T the age of those aggregation involving a great amount of flaring stars can be found. The age of flaring stars in the neighbourhood of the Sun has been determined. The age of UV Ceti has been shown by an order to exceed that of the rest stars

Absolute instrumental neutron activation analysis at Lawrence Livermore Laboratory

International Nuclear Information System (INIS)

Heft, R.E.

1977-01-01

The Environmental Science Division at Lawrence Livermore Laboratory has in use a system of absolute Instrumental Neutron Activation Analysis (INAA). Basically, absolute INAA is dependent upon the absolute measurement of the disintegration rates of the nuclides produced by neutron capture. From such disintegration rate data, the amount of the target element present in the irradiated sample is calculated by dividing the observed disintegration rate for each nuclide by the expected value for the disintegration rate per microgram of the target element that produced the nuclide. In absolute INAA, the expected value for disintegration rate per microgram is calculated from nuclear parameters and from measured values of both thermal and epithermal neutron fluxes which were present during irradiation. Absolute INAA does not depend on the concurrent irradiation of elemental standards but does depend on the values for thermal and epithermal neutron capture cross-sections for the target nuclides. A description of the analytical method is presented

Coexpression of voltage-dependent calcium channels Cav1.2, 2.1a, and 2.1b in vascular myocytes

DEFF Research Database (Denmark)

Andreasen, Ditte; Friis, Ulla G; Uhrenholt, Torben R

2006-01-01

Voltage-dependent Ca2+ channels Cav1.2 (L type) and Cav2.1 (P/Q type) are expressed in vascular smooth muscle cells (VSMCs) and are important for the contraction of renal resistance vessels. In the present study we examined whether native renal VSMCs coexpress L-, P-, and Q-type Ca2+ currents...... microscopy revealed expression of both channels in all of the smooth muscle cells. Whole-cell patch clamp on single preglomerular VSMCs from mice showed L-, P-, and Q-type currents. Blockade of the L-type currents by calciseptine (20 nmol/L) inhibited 35.6+/-3.9% of the voltage-dependent Ca2+ current......-type and P-type channels inhibited 58.0+/-11.8%, and simultaneous inhibition of L-, P-, and Q-type channels led to blockade (88.7+/-5.6%) of the Ca2+ current. We conclude that aortic and renal preglomerular smooth muscle cells express L-, P-, and Q-type voltage-dependent Ca2+ channels in the rat and mouse....

Monitoring Voltage-Dependent Charge Displacement of Shaker B-IR K+ Ion Channels Using Radio Frequency Interrogation

OpenAIRE

Dharia, Sameera; Rabbitt, Richard D.

2011-01-01

Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential a...

Molecular mechanism of voltage sensing in voltage-gated proton channels

Science.gov (United States)

Rebolledo, Santiago; Perez, Marta E.

2013-01-01

Voltage-gated proton (Hv) channels play an essential role in phagocytic cells by generating a hyperpolarizing proton current that electrically compensates for the depolarizing current generated by the NADPH oxidase during the respiratory burst, thereby ensuring a sustained production of reactive oxygen species by the NADPH oxidase in phagocytes to neutralize engulfed bacteria. Despite the importance of the voltage-dependent Hv current, it is at present unclear which residues in Hv channels are responsible for the voltage activation. Here we show that individual neutralizations of three charged residues in the fourth transmembrane domain, S4, all reduce the voltage dependence of activation. In addition, we show that the middle S4 charged residue moves from a position accessible from the cytosolic solution to a position accessible from the extracellular solution, suggesting that this residue moves across most of the membrane electric field during voltage activation of Hv channels. Our results show for the first time that the charge movement of these three S4 charges accounts for almost all of the measured gating charge in Hv channels. PMID:23401575

Quadratic dependence of the spin-induced Hall voltage on longitudinal electric field

Energy Technology Data Exchange (ETDEWEB)

Miah, M. Idrish [Nanoscale Science and Technology Centre, Griffith University, Nathan, Brisbane, QLD 4111 (Australia); School of Biomolecular and Physical Sciences, Griffith University, Nathan, Brisbane, QLD 4111 (Australia); Department of Physics, University of Chittagong, Chittagong 4331 (Bangladesh)], E-mail: m.miah@griffith.edu.au

2008-10-15

The effect of optically induced spins in semiconductors in the low electric field is investigated. Here we report an experiment which investigates the effect of a longitudinal electric field (E) on the spin-polarized carriers generated by a circularly polarized light in semiconductors. Our experiment observes the effect as a spin-induced anomalous Hall voltage (V{sub AH}) resulting from spin-carrier electrons accumulating at the transverse edges of the sample. Unlike the ordinary Hall effect, a quadratic dependence of V{sub AH} on E is observed, which agrees with the results of the recent theoretical investigations. It is also found that V{sub AH} depends on the doping density. The results are discussed.

Voltage-dependent inward currents in smooth muscle cells of skeletal muscle arterioles

Science.gov (United States)

Shirokov, Roman E.

2018-01-01

Voltage-dependent inward currents responsible for the depolarizing phase of action potentials were characterized in smooth muscle cells of 4th order arterioles in mouse skeletal muscle. Currents through L-type Ca2+ channels were expected to be dominant; however, action potentials were not eliminated in nominally Ca2+-free bathing solution or by addition of L-type Ca2+ channel blocker nifedipine (10 μM). Instead, Na+ channel blocker tetrodotoxin (TTX, 1 μM) reduced the maximal velocity of the upstroke at low, but not at normal (2 mM), Ca2+ in the bath. The magnitude of TTX-sensitive currents recorded with 140 mM Na+ was about 20 pA/pF. TTX-sensitive currents decreased five-fold when Ca2+ increased from 2 to 10 mM. The currents reduced three-fold in the presence of 10 mM caffeine, but remained unaltered by 1 mM of isobutylmethylxanthine (IBMX). In addition to L-type Ca2+ currents (15 pA/pF in 20 mM Ca2+), we also found Ca2+ currents that are resistant to 10 μM nifedipine (5 pA/pF in 20 mM Ca2+). Based on their biophysical properties, these Ca2+ currents are likely to be through voltage-gated T-type Ca2+ channels. Our results suggest that Na+ and at least two types (T- and L-) of Ca2+ voltage-gated channels contribute to depolarization of smooth muscle cells in skeletal muscle arterioles. Voltage-gated Na+ channels appear to be under a tight control by Ca2+ signaling. PMID:29694371

Voltage-dependent neuromodulation of Na+ channels by D1-like dopamine receptors in rat hippocampal neurons.

Science.gov (United States)

Cantrell, A R; Scheuer, T; Catterall, W A

1999-07-01

Activation of D1-like dopamine (DA) receptors reduces peak Na+ current in acutely isolated hippocampal neurons through phosphorylation of the alpha subunit of the Na+ channel by cAMP-dependent protein kinase (PKA). Here we report that neuromodulation of Na+ currents by DA receptors via PKA is voltage-dependent in the range of -110 to -70 mV and is also sensitive to concurrent activation of protein kinase C (PKC). Depolarization enhanced the ability of D1-like DA receptors to reduce peak Na+ currents via the PKA pathway. Similar voltage-dependent modulation was observed when PKA was activated directly with the membrane-permeant PKA activator DCl-cBIMPS (cBIMPS; 20 microM), indicating that the membrane potential dependence occurs downstream of PKA. PKA activation caused only a small (-2.9 mV) shift in the voltage dependence of steady-state inactivation and had no effect on slow inactivation or on the rates of entry into the fast or slow inactivated states, suggesting that another mechanism is responsible for coupling of membrane potential changes to PKA modulation. Activation of PKC with a low concentration of the membrane-permeant diacylglycerol analog oleylacetyl glycerol also potentiated modulation by SKF 81297 or cBIMPS, and these effects were most striking at hyperpolarized membrane potentials where PKA modulation was not stimulated by membrane depolarization. Thus, activation of D1-like DA receptors causes a strong reduction in Na+ current via the PKA pathway, but it is effective primarily when it is combined with depolarization or activation of PKC. The convergence of these three distinct signaling modalities on the Na+ channel provides an intriguing mechanism for integration of information from multiple signaling pathways in the hippocampus and CNS.

The human red cell voltage-dependent cation channel. Part III: Distribution homogeneity and pH dependence

DEFF Research Database (Denmark)

Bennekou, P.; Barksmann, T. L.; Christophersen, P.

2006-01-01

The homogeneity of the distribution of the non-selective voltage-dependent cation channel (the NSVDC channel) in the human erythrocyte, and the pH dependence was investigated. Activation of this channel caused a uniform cellular dehydration, which was characterized by the changes in the erythrocyte...... osmotic resistance profiles: After 1/2 h of activation, the osmolarity at 50% hemolysis changed from 73 mM (control) to 34 mM NaCl, corresponding to 0.48% and 0.21% NaCl respectively. Unchanging standard deviations show participation of the entire erythrocyte population, which implies an even distribution...... of the NSVDC channel among the cells. Inactivation of the NSVDC channel with N-ethyl-maleimide (NEM) or blocking of the Cl- conductance with NS1652 retarded the migration of the resistance profiles towards lower osmolarities. The NSVDC channel activation was blocked by a decrease of the intracellular...

Engineering of a genetically encodable fluorescent voltage sensor exploiting fast Ci-VSP voltage-sensing movements.

Science.gov (United States)

Lundby, Alicia; Mutoh, Hiroki; Dimitrov, Dimitar; Akemann, Walther; Knöpfel, Thomas

2008-06-25

Ci-VSP contains a voltage-sensing domain (VSD) homologous to that of voltage-gated potassium channels. Using charge displacement ('gating' current) measurements we show that voltage-sensing movements of this VSD can occur within 1 ms in mammalian membranes. Our analysis lead to development of a genetically encodable fluorescent protein voltage sensor (VSFP) in which the fast, voltage-dependent conformational changes of the Ci-VSP voltage sensor are transduced to similarly fast fluorescence read-outs.

Gating of Connexin Channels by transjunctional-voltage: Conformations and models of open and closed states.

Science.gov (United States)

Bargiello, Thaddeus A; Oh, Seunghoon; Tang, Qingxiu; Bargiello, Nicholas K; Dowd, Terry L; Kwon, Taekyung

2018-01-01

Voltage is an important physiologic regulator of channels formed by the connexin gene family. Connexins are unique among ion channels in that both plasma membrane inserted hemichannels (undocked hemichannels) and intercellular channels (aggregates of which form gap junctions) have important physiological roles. The hemichannel is the fundamental unit of gap junction voltage-gating. Each hemichannel displays two distinct voltage-gating mechanisms that are primarily sensitive to a voltage gradient formed along the length of the channel pore (the transjunctional voltage) rather than sensitivity to the absolute membrane potential (V m or V i-o ). These transjunctional voltage dependent processes have been termed V j - or fast-gating and loop- or slow-gating. Understanding the mechanism of voltage-gating, defined as the sequence of voltage-driven transitions that connect open and closed states, first and foremost requires atomic resolution models of the end states. Although ion channels formed by connexins were among the first to be characterized structurally by electron microscopy and x-ray diffraction in the early 1980's, subsequent progress has been slow. Much of the current understanding of the structure-function relations of connexin channels is based on two crystal structures of Cx26 gap junction channels. Refinement of crystal structure by all-atom molecular dynamics and incorporation of charge changing protein modifications has resulted in an atomic model of the open state that arguably corresponds to the physiologic open state. Obtaining validated atomic models of voltage-dependent closed states is more challenging, as there are currently no methods to solve protein structure while a stable voltage gradient is applied across the length of an oriented channel. It is widely believed that the best approach to solve the atomic structure of a voltage-gated closed ion channel is to apply different but complementary experimental and computational methods and to use

Power conditioning using dynamic voltage restorers under different voltage sag types.

Science.gov (United States)

Saeed, Ahmed M; Abdel Aleem, Shady H E; Ibrahim, Ahmed M; Balci, Murat E; El-Zahab, Essam E A

2016-01-01

Voltage sags can be symmetrical or unsymmetrical depending on the causes of the sag. At the present time, one of the most common procedures for mitigating voltage sags is by the use of dynamic voltage restorers (DVRs). By definition, a DVR is a controlled voltage source inserted between the network and a sensitive load through a booster transformer injecting voltage into the network in order to correct any disturbance affecting a sensitive load voltage. In this paper, modelling of DVR for voltage correction using MatLab software is presented. The performance of the device under different voltage sag types is described, where the voltage sag types are introduced using the different types of short-circuit faults included in the environment of the MatLab/Simulink package. The robustness of the proposed device is evaluated using the common voltage sag indices, while taking into account voltage and current unbalance percentages, where maintaining the total harmonic distortion percentage of the load voltage within a specified range is desired. Finally, several simulation results are shown in order to highlight that the DVR is capable of effective correction of the voltage sag while minimizing the grid voltage unbalance and distortion, regardless of the fault type.

Engineering of a genetically encodable fluorescent voltage sensor exploiting fast Ci-VSP voltage-sensing movements.

Directory of Open Access Journals (Sweden)

Alicia Lundby

2008-06-01

Full Text Available Ci-VSP contains a voltage-sensing domain (VSD homologous to that of voltage-gated potassium channels. Using charge displacement ('gating' current measurements we show that voltage-sensing movements of this VSD can occur within 1 ms in mammalian membranes. Our analysis lead to development of a genetically encodable fluorescent protein voltage sensor (VSFP in which the fast, voltage-dependent conformational changes of the Ci-VSP voltage sensor are transduced to similarly fast fluorescence read-outs.

The Pragmatics of "Unruly" Dative Absolutes in Early Slavic

Directory of Open Access Journals (Sweden)

Daniel E. Collins

2011-08-01

Full Text Available This chapter examines some uses of the dative absolute in Old Church Slavonic and in early recensional Slavonic texts that depart from notions of how Indo-European absolute constructions should behave, either because they have subjects coreferential with the (putative main-clause subjects or because they function as if they were main clauses in their own right. Such "noncanonical" absolutes have generally been written off as mechanistic translations or as mistakes by scribes who did not understand the proper uses of the construction. In reality, the problem is not with literalistic translators or incompetent scribes but with the definition of the construction itself; it is quite possible to redefine the Early Slavic dative absolute in a way that accounts for the supposedly deviant cases. While the absolute is generally dependent semantically on an adjacent unit of discourse, it should not always be regarded as subordinated syntactically. There are good grounds for viewing some absolutes not as dependent clauses but as independent sentences whose collateral character is an issue not of syntax but of the pragmatics of discourse.

Effect of combined platinum and electron on the temperature dependence of forward voltage in fast recovery diode

International Nuclear Information System (INIS)

Jia Yun-Peng; Zhao Bao; Wu Yu; Zhou Xuan; Li Zhe; Tan Jian; Yang Fei

2015-01-01

The temperature dependences of forward voltage drop (V F ) of the fast recovery diodes (FRDs) are remarkably influenced by different lifetime controlled treatments. In this paper the results of an experimental study are presented, which are the lifetime controls of platinum treatment, electron irradiation treatment, and the combined treatment of the above ones. Based on deep level transient spectroscopy (DLTS) measurements, a new level E6 (E C -0.376 eV) is found in the combined lifetime treated (CLT) sample, which is different from the levels of the individual platinum and electron irradiation ones. Comparing the tested V F results of CLT samples with the others, the level E6 is responsible for the degradation of temperature dependence of the forward voltage drop in the FRD. (paper)

Voltage Controlled Dynamic Demand Response

DEFF Research Database (Denmark)

Bhattarai, Bishnu Prasad; Bak-Jensen, Birgitte; Mahat, Pukar

2013-01-01

Future power system is expected to be characterized by increased penetration of intermittent sources. Random and rapid fluctuations in demands together with intermittency in generation impose new challenges for power balancing in the existing system. Conventional techniques of balancing by large...... central or dispersed generations might not be sufficient for future scenario. One of the effective methods to cope with this scenario is to enable demand response. This paper proposes a dynamic voltage regulation based demand response technique to be applied in low voltage (LV) distribution feeders....... An adaptive dynamic model has been developed to determine composite voltage dependency of an aggregated load on feeder level. Following the demand dispatch or control signal, optimum voltage setting at the LV substation is determined based on the voltage dependency of the load. Furthermore, a new technique...

Absolute isotopic abundances of Ti in meteorites

International Nuclear Information System (INIS)

Niederer, F.R.; Papanastassiou, D.A.; Wasserburg, G.J.

1985-01-01

The absolute isotope abundance of Ti has been determined in Ca-Al-rich inclusions from the Allende and Leoville meteorites and in samples of whole meteorites. The absolute Ti isotope abundances differ by a significant mass dependent isotope fractionation transformation from the previously reported abundances, which were normalized for fractionation using 46 Ti/ 48 Ti. Therefore, the absolute compositions define distinct nucleosynthetic components from those previously identified or reflect the existence of significant mass dependent isotope fractionation in nature. We provide a general formalism for determining the possible isotope compositions of the exotic Ti from the measured composition, for different values of isotope fractionation in nature and for different mixing ratios of the exotic and normal components. The absolute Ti and Ca isotopic compositions still support the correlation of 50 Ti and 48 Ca effects in the FUN inclusions and imply contributions from neutron-rich equilibrium or quasi-equilibrium nucleosynthesis. The present identification of endemic effects at 46 Ti, for the absolute composition, implies a shortfall of an explosive-oxygen component or reflects significant isotope fractionation. Additional nucleosynthetic components are required by 47 Ti and 49 Ti effects. Components are also defined in which 48 Ti is enhanced. Results are given and discussed. (author)

Effect of angiotensin II-induced arterial hypertension on the voltage-dependent contractions of mouse arteries.

Science.gov (United States)

Fransen, Paul; Van Hove, Cor E; Leloup, Arthur J A; Schrijvers, Dorien M; De Meyer, Guido R Y; De Keulenaer, Gilles W

2016-02-01

Arterial hypertension (AHT) affects the voltage dependency of L-type Ca(2+) channels in cardiomyocytes. We analyzed the effect of angiotensin II (AngII)-induced AHT on L-type Ca(2+) channel-mediated isometric contractions in conduit arteries. AHT was induced in C57Bl6 mice with AngII-filled osmotic mini-pumps (4 weeks). Normotensive mice treated with saline-filled osmotic mini-pumps were used for comparison. Voltage-dependent contractions mediated by L-type Ca(2+) channels were studied in vaso-reactive studies in vitro in isolated aortic and femoral arteries by using extracellular K(+) concentration-response (KDR) experiments. In aortic segments, AngII-induced AHT significantly sensitized isometric contractions induced by elevated extracellular K(+) and depolarization. This sensitization was partly prevented by normalizing blood pressure with hydralazine, suggesting that it was caused by AHT rather than by direct AngII effects on aortic smooth muscle cells. The EC50 for extracellular K(+) obtained in vitro correlated significantly with the rise in arterial blood pressure induced by AngII in vivo. The AHT-induced sensitization persisted when aortic segments were exposed to levcromakalim or to inhibitors of basal nitric oxide release. Consistent with these observations, AngII-treatment also sensitized the vaso-relaxing effects of the L-type Ca(2+) channel blocker diltiazem during K(+)-induced contractions. Unlike aorta, AngII-treatment desensitized the isometric contractions to depolarization in femoral arteries pointing to vascular bed specific responses of arteries to hypertension. AHT affects the voltage-dependent L-type Ca(2+) channel-mediated contraction of conduit arteries. This effect may contribute to the decreased vascular compliance in AHT and explain the efficacy of Ca(2+) channel blockers to reduce vascular stiffness and central blood pressure in AHT.

Voltage-gated lipid ion channels

DEFF Research Database (Denmark)

Blicher, Andreas; Heimburg, Thomas Rainer

2013-01-01

Synthetic lipid membranes can display channel-like ion conduction events even in the absence of proteins. We show here that these events are voltage-gated with a quadratic voltage dependence as expected from electrostatic theory of capacitors. To this end, we recorded channel traces and current...... histograms in patch-experiments on lipid membranes. We derived a theoretical current-voltage relationship for pores in lipid membranes that describes the experimental data very well when assuming an asymmetric membrane. We determined the equilibrium constant between closed and open state and the open...... probability as a function of voltage. The voltage-dependence of the lipid pores is found comparable to that of protein channels. Lifetime distributions of open and closed events indicate that the channel open distribution does not follow exponential statistics but rather power law behavior for long open times...

Illumination and Voltage Dependence of Electrical Characteristics of Au/0.03 Graphene-Doped PVA/n-Si Structures via Capacitance/Conductance-Voltage Measurements

International Nuclear Information System (INIS)

Sahar, Alialy; Şlemsettin, Altındal; Ahmet, Kaya; İ, Uslu

2015-01-01

Au/n-Si (MS) structures with a high dielectric interlayer (0.03 graphene-doped PVA) are fabricated to investigate the illumination and voltage effects on electrical and dielectric properties by using capacitance-voltage (C-V) and conductance-voltage (G/ω-V) measurements at room temperature and at 1 MHz. Some of the main electrical parameters such as concentration of doping atoms (N D ), barrier height (ϕ B (C - V)), depletion layer width (W D ) and series resistance (R s ) show fairly large illumination dispersion. The voltage-dependent profile of surface states (N ss ) and resistance of the structure (R i ) are also obtained by using the dark-illumination capacitance (C dark -C ill ) and Nicollian-Brews methods, respectively. For a clear observation of changes in electrical parameters with illumination, the values of N D , W D , ϕ B (C - V) and R s are drawn as a function of illumination intensity. The values of N D and W D change almost linearly with illumination intensity. On the other hand, R s decreases almost exponentially with increasing illumination intensity whereas ϕ B (C - V) increases. The experimental results suggest that the use of a high dielectric interlayer (0.03 graphene-doped PVA) considerably passivates or reduces the magnitude of the surface states. The large change or dispersion in main electrical parameters can be attributed to generation of electron-hole pairs in the junction under illumination and to a good light absorption. All of these experimental results confirm that the fabricated Au/0.03 graphene-doped PVA/n-Si structure can be used as a photodiode or a capacitor in optoelectronic applications. (paper)

The supply voltage scaled dependency of the recovery of single event upset in advanced complementary metal—oxide—semiconductor static random-access memory cells

International Nuclear Information System (INIS)

Li Da-Wei; Qin Jun-Rui; Chen Shu-Ming

2013-01-01

Using computer-aided design three-dimensional simulation technology, the supply voltage scaled dependency of the recovery of single event upset and charge collection in static random-access memory cells are investigated. It reveals that the recovery linear energy transfer threshold decreases with the supply voltage reducing, which is quite attractive for dynamic voltage scaling and subthreshold circuit radiation-hardened design. Additionally, the effect of supply voltage on charge collection is also investigated. It is concluded that the supply voltage mainly affects the bipolar gain of the parasitical bipolar junction transistor (BJT) and the existence of the source plays an important role in supply voltage variation. (geophysics, astronomy, and astrophysics)

Advances in high voltage power switching with GTOs

International Nuclear Information System (INIS)

Podlesak, T.F.

1990-01-01

The control of high voltage at high power, particularly opening switches, has been difficult in the past. Using gate turnoff thyristors (GTOs) arranged in series enables large currents to be switched at high voltage. The authors report a high voltage opening switch has been successfully demonstrated. This switch uses GTOs in series and successfully operates at voltages higher than the rated voltage of the individual devices. It is believed that this is the first time this has been successfully demonstrated, in that GTOs have been operated in series before, but always in a manner as to not exceed the voltage capability of the individual devices. In short, the devices have not worked together, sharing the voltage, but one device has been operated using several backup devices. Of particular interest is how well the individual devices share the voltage applied to them. Equal voltage sharing between devices is absolutely essential, in order to not exceed the voltage rating of any of the devices in the series chain. This is accomplished at high (microsecond) switching speeds. Thus, the system is useful for high frequency applications as well as high power, making for a flexible circuit system element. This demonstration system is rated at 5 KV and uses 1 KV devices. A larger 24 KV system is under design and will use 4.5 KV devices. In order to design the 24 KV switch, the safe operating area of the large devices must be known thoroughly

Effects of gamma irradiation on voltage-dependant NA+ and K+ currents in N1E-115 cells

International Nuclear Information System (INIS)

Diserbo, M.; Barbier, M.; Quignard, J.F.

1998-01-01

Effects of 15 Gy gamma irradiation on voltage-dependent Na + and K + currents in differentiated N1E-115 cells are studied by using whole cell recording. Only, we observed an activation of Na + currents at a lower threshold. (authors)

Pulse-voltage fast generator

International Nuclear Information System (INIS)

Valeev, R.I.; Nikiforov, M.G.; Kharchenko, A.F.

1988-01-01

The design is described and the test results of a four-channel pulse-voltage generator with maximum output voltage 200 kV are presented. The measurement results of generator triggering time depending on the value and polarity of the triggering voltage pulse for different triggering circuits are presented. The tests have shown stable triggering of all four channels of the generator in the range up to 40 % from selfbreakdown voltage. The generator triggering delay in the given range is <25 ns, asynchronism in channel triggering is <±1 ns

The Dependence of Cloud Property Trend Detection on Absolute Calibration Accuracy of Passive Satellite Sensors

Science.gov (United States)

Shea, Y.; Wielicki, B. A.; Sun-Mack, S.; Minnis, P.; Zelinka, M. D.

2016-12-01

Detecting trends in climate variables on global, decadal scales requires highly accurate, stable measurements and retrieval algorithms. Trend uncertainty depends on its magnitude, natural variability, and instrument and retrieval algorithm accuracy and stability. We applied a climate accuracy framework to quantify the impact of absolute calibration on cloud property trend uncertainty. The cloud properties studied were cloud fraction, effective temperature, optical thickness, and effective radius retrieved using the Clouds and the Earth's Radiant Energy System (CERES) Cloud Property Retrieval System, which uses Moderate-resolution Imaging Spectroradiometer measurements (MODIS). Modeling experiments from the fifth phase of the Climate Model Intercomparison Project (CMIP5) agree that net cloud feedback is likely positive but disagree regarding its magnitude, mainly due to uncertainty in shortwave cloud feedback. With the climate accuracy framework we determined the time to detect trends for instruments with various calibration accuracies. We estimated a relationship between cloud property trend uncertainty, cloud feedback, and Equilibrium Climate Sensitivity and also between effective radius trend uncertainty and aerosol indirect effect trends. The direct relationship between instrument accuracy requirements and climate model output provides the level of instrument absolute accuracy needed to reduce climate model projection uncertainty. Different cloud types have varied radiative impacts on the climate system depending on several attributes, such as their thermodynamic phase, altitude, and optical thickness. Therefore, we also conducted these studies by cloud types for a clearer understanding of instrument accuracy requirements needed to detect changes in their cloud properties. Combining this information with the radiative impact of different cloud types helps to prioritize among requirements for future satellite sensors and understanding the climate detection

Field and polarity dependence of time-to-resistance increase in Fe–O films studied by constant voltage stress method

OpenAIRE

Eriguchi, Koji; Wei, Zhiqiang; Takagi, Takeshi; Ohta, Hiroaki; Ono, Kouichi

2009-01-01

Constant voltage stress (CVS) was applied to Fe–O films prepared by a sputtering process to investigate a stress-induced resistance increase leading to a fundamental mechanism for switching behaviors. Under the CVS, an abrupt resistance increase was found for both stress polarities. A conduction mechanism after the resistance increase exhibited non-Ohmic transport. The time-to-resistance increase (tr) under the CVS was revealed to strongly depend on stress voltage as well as the polarity. Fro...

Low voltage stress-induced leakage current and traps in ultrathin oxide (1.2 2.5 nm) after constant voltage stresses

Science.gov (United States)

Petit, C.; Zander, D.

2007-10-01

It has been shown that the low voltage gate current in ultrathin oxide metal-oxide-semiconductor devices is very sensitive to electrical stresses. Therefore, it can be used as a reliability monitor when the oxide thickness becomes too small for traditional electrical measurements to be used. In this work, we present a study on n-MOSCAP devices at negative gate bias in the direct tunneling (DT) regime. If the low voltage stress-induced leakage current (LVSILC) depends strongly on the low sense voltages, it also depends strongly on the stress voltage magnitude. We show that two LVSILC peaks appear as a function of the sense voltage in the LVSILC region and that their magnitude, one compared to the other, depends strongly on the stress voltage magnitude. One is larger than the other at low stress voltage and smaller at high stress voltage. From our experimental results, different conduction mechanisms are analyzed. To explain LVSILC variations, we propose a model of the conduction through the ultrathin gate oxide based on two distinctly different trap-assisted tunneling mechanisms: inelastic of gate electron (INE) and trap-assisted electron (ETAT).

A thermoelectric voltage effect in polyethylene oxide

CERN Document Server

Martin, B; Kliem, H

2003-01-01

The conductivity of polyethylene oxide (PEO) is described with a three-dimensional hopping model considering electrostatic interactions between the ions. Ions fluctuate over energy-barriers in a multi-well potential. To decide whether positive or negative charges are responsible for this conductivity, the thermoelectric voltage is measured. The samples are embedded between two aluminium-electrodes. The oxide on the interface between the electrodes and the PEO serves as a blocking layer. The temperature of each electrode is controlled by a Peltier element. A temperature step is applied to one electrode by changing the temperature of one of the Peltier elements. Due to this temperature gradient, the mobile charges fluctuate thermally activated from the warmer side to the colder side of the sample. The direction of the measured thermoelectric voltage indicates the type of mobile charges. It is found that positive charges are mobile. Further, it is shown that the absolute value of the thermoelectric voltage depen...

Dopamine Induces LTP Differentially in Apical and Basal Dendrites through BDNF and Voltage-Dependent Calcium Channels

Science.gov (United States)

Navakkode, Sheeja; Sajikumar, Sreedharan; Korte, Martin; Soong, Tuck Wah

2012-01-01

The dopaminergic modulation of long-term potentiation (LTP) has been studied well, but the mechanism by which dopamine induces LTP (DA-LTP) in CA1 pyramidal neurons is unknown. Here, we report that DA-LTP in basal dendrites is dependent while in apical dendrites it is independent of activation of L-type voltage-gated calcium channels (VDCC).…

Stress-Dependent Voltage Offsets From Polymer Insulators Used in Rock Mechanics and Material Testing

Science.gov (United States)

Carlson, G. G.; Dahlgren, Robert; Gray, Amber; Vanderbilt, V. C.; Freund, F.; Johnston, M. J.; Dunson, C.

2013-01-01

Dielectric insulators are used in a variety of laboratory settings when performing experiments in rock mechanics, petrology, and electromagnetic studies of rocks in the fields of geophysics,material science, and civil engineering. These components may be used to electrically isolate geological samples from the experimental equipment, to perform a mechanical compliance function between brittle samples and the loading equipment, to match ultrasonic transducers, or perform other functions. In manyexperimental configurations the insulators bear the full brunt of force applied to the sample but do not need to withstand high voltages, therefore the insulators are often thin sheets of mechanically tough polymers. From an instrument perspective, transduction from various types of mechanical perturbation has beenqualitatively compared for a number of polymers [1, 2] and these error sources are readily apparent duringhigh-impedance measurements if not mitigated. However even when following best practices, a force dependent voltage signal still remains and its behavior is explored in this presentation. In this experimenttwo thin sheets (0.25 mm) of high-density polyethylene (HDPE) were set up in a stack, held alternatelybetween three aluminum bars; this stack was placed on the platen of a 60T capacity hydraulic testingmachine. The surface area, A, over which the force is applied to the PE sheets in this sandwich is roughly 40 square cm, each sheet forming a parallel-plate capacitor having roughly 320 pF [3], assuming therelative dielectric permittivity of PE is approximately 2.3. The outer two aluminum bars were connected to the LO input ofthe electrometer and the central aluminum bar was connected to the HI input of a Keithley model 617 electrometer. Once the stack is mechanically well-seated with no air gaps, the voltage offset is observed tobe a linear function of the baseline voltage for a given change in applied force. For a periodically appliedforce of 66.7 kN the

Mechanism of voltage-gated channel formation in lipid membranes.

Science.gov (United States)

Guidelli, Rolando; Becucci, Lucia

2016-04-01

Although several molecular models for voltage-gated ion channels in lipid membranes have been proposed, a detailed mechanism accounting for the salient features of experimental data is lacking. A general treatment accounting for peptide dipole orientation in the electric field and their nucleation and growth kinetics with ion channel formation is provided. This is the first treatment that explains all the main features of the experimental current-voltage curves of peptides forming voltage-gated channels available in the literature. It predicts a regime of weakly voltage-dependent conductance, followed by one of strong voltage-dependent conductance at higher voltages. It also predicts values of the parameters expressing the exponential dependence of conductance upon voltage and peptide bulk concentration for both regimes, in good agreement with those reported in the literature. Most importantly, the only two adjustable parameters involved in the kinetics of nucleation and growth of ion channels can be varied over broad ranges without affecting the above predictions to a significant extent. Thus, the fitting of experimental current-voltage curves stems naturally from the treatment and depends only slightly upon the choice of the kinetic parameters. Copyright © 2015 Elsevier B.V. All rights reserved.

Conductance of single-atom platinum contacts: Voltage dependence of the conductance histogram

DEFF Research Database (Denmark)

Nielsen, S.K.; Noat, Y.; Brandbyge, Mads

2003-01-01

The conductance of a single-atom contact is sensitive to the coupling of this contact atom to the atoms in the leads. Notably for the transition metals this gives rise to a considerable spread in the observed conductance values. The mean conductance value and spread can be obtained from the first...... peak in conductance histograms recorded from a large set of contact-breaking cycles. In contrast to the monovalent metals, this mean value for Pt depends strongly on the applied voltage bias and other experimental conditions and values ranging from about 1 G(0) to 2.5 G(0) (G(0)=2e(2)/h) have been...... reported. We find that at low bias the first peak in the conductance histogram is centered around 1.5 G(0). However, as the bias increases past 300 mV the peak shifts to 1.8 G(0). Here we show that this bias dependence is due to a geometric effect where monatomic chains are replaced by single-atom contacts...

Voltage stability in low voltage microgrids in aspects of active and reactive power demand

Directory of Open Access Journals (Sweden)

Parol Mirosław

2016-03-01

Full Text Available Low voltage microgrids are autonomous subsystems, in which generation, storage and power and electrical energy consumption appear. In the paper the main attention has been paid to the voltage stability issue in low voltage microgrid for different variants of its operation. In the introduction a notion of microgrid has been presented, and also the issue of influence of active and reactive power balance on node voltage level has been described. Then description of voltage stability issue has been presented. The conditions of voltage stability and indicators used to determine voltage stability margin in the microgrid have been described. Description of the low voltage test microgrid, as well as research methodology along with definition of considered variants of its operation have been presented further. The results of exemplary calculations carried out for the daily changes in node load of the active and reactive power, i.e. the voltage and the voltage stability margin indexes in nodes have been presented. Furthermore, the changes of voltage stability margin indexes depending on the variant of the microgrid operation have been presented. Summary and formulation of conclusions related to the issue of voltage stability in microgrids have been included at the end of the paper.

Voltage-probe-position dependence and magnetic-flux contribution to the measured voltage in ac transport measurements: which measuring circuit determines the real losses?

International Nuclear Information System (INIS)

Pe, T.; McDonald, J.; Clem, J.R.

1995-01-01

The voltage V ab measured between two voltage taps a and b during magnetic flux transport in a type-II superconductor carrying current I is the sum of two contributions, the line integral from a to b of the electric field along an arbitrary path C s through the superconductor and a term proportional to the time rate of change of magnetic flux through the area bounded by the path C s and the measuring circuit leads. When the current I(t) is oscillating with time t, the apparent ac loss (the time average of the product IV ab ) depends upon the measuring circuit used. Only when the measuring-circuit leads are brought out far from the surface does the apparent power dissipation approach the real (or true) ac loss associated with the length of sample probed. Calculations showing comparisons between the apparent and real ac losses in a flat strip of rectangular cross section will be presented, showing the behavior as a function of the measuring-circuit dimensions. Corresponding calculations also are presented for a sample of elliptical cross section

Pertussis toxin-sensitive alpha-adrenergic modulation of voltage - dependent calcium channels in spontaneously hypertensive rats (SHR)

Czech Academy of Sciences Publication Activity Database

Zicha, Josef; Pintérová, Mária; Dobešová, Zdenka; Líšková, Silvia; Kuneš, Jaroslav

2006-01-01

Roč. 24, č. S6 (2006), s. 34-34 ISSN 0263-6352. [Scientific Meeting of the International Society of Hypertension /21./. 15.10.2006-19.10.2006, Fukuoka] R&D Projects: GA MZd(CZ) NR7786 Institutional research plan: CEZ:AV0Z50110509 Keywords : pertussis toxin * alpha adrenergic vasoconstriction * voltage-dependent calcium channels * SHR rat Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

Thickness dependence of voltage-driven magnetization switching in FeCo/PI/piezoelectric actuator heterostructures

Science.gov (United States)

Cui, B. S.; Guo, X. B.; Wu, K.; Li, D.; Zuo, Y. L.; Xi, L.

2016-03-01

Strain mediated magnetization switching of ferromagnetic/substrate/piezoelectric actuator heterostructures has become a hot issue due to the advantage of low-power consumption. In this work, Fe65Co35 thin films were deposited on a flexible polyamides (PI) substrate, which has quite low Young’s module (~4 GPa for PI as compared to ~180 GPa for Si) and benefits from complete transfer of the strain from the piezoelectric actuator to magnetic thin films. A complete 90° transition of the magnetic easy axis was realized in 50 nm thick FeCo films under the voltage of 70 V, while a less than 90° rotation angle of the magnetic easy axis direction was observed in other samples, which was ascribed to the distribution of the anisotropy field and/or the orthogonal misalignment between stress induced anisotropy and original uniaxial anisotropy. A model considering two uniaxial anisotropies with orthogonal arrangement was used to quantitatively understand the observed results and the linear-like voltage dependent anisotropy field, especially for 10 nm FeCo films, in which the switching mechanism along the easy axis direction can be explained by the domain wall depinning model. It indicates that the magnetic domain-wall movement velocity may be controlled by strain through tuning the energy barrier of the pinning in heterostructures. Moreover, voltage-driven 90° magnetization switching with low-power consumption was achieved in this work.

Thickness dependence of voltage-driven magnetization switching in FeCo/PI/piezoelectric actuator heterostructures

International Nuclear Information System (INIS)

Cui, B S; Guo, X B; Wu, K; Li, D; Zuo, Y L; Xi, L

2016-01-01

Strain mediated magnetization switching of ferromagnetic/substrate/piezoelectric actuator heterostructures has become a hot issue due to the advantage of low-power consumption. In this work, Fe 65 Co 35 thin films were deposited on a flexible polyamides (PI) substrate, which has quite low Young’s module (∼4 GPa for PI as compared to ∼180 GPa for Si) and benefits from complete transfer of the strain from the piezoelectric actuator to magnetic thin films. A complete 90° transition of the magnetic easy axis was realized in 50 nm thick FeCo films under the voltage of 70 V, while a less than 90° rotation angle of the magnetic easy axis direction was observed in other samples, which was ascribed to the distribution of the anisotropy field and/or the orthogonal misalignment between stress induced anisotropy and original uniaxial anisotropy. A model considering two uniaxial anisotropies with orthogonal arrangement was used to quantitatively understand the observed results and the linear-like voltage dependent anisotropy field, especially for 10 nm FeCo films, in which the switching mechanism along the easy axis direction can be explained by the domain wall depinning model. It indicates that the magnetic domain-wall movement velocity may be controlled by strain through tuning the energy barrier of the pinning in heterostructures. Moreover, voltage-driven 90° magnetization switching with low-power consumption was achieved in this work. (paper)

Voltage-Dependent Inhibition of Glycine Receptor Channels by Niflumic Acid

Directory of Open Access Journals (Sweden)

Galyna Maleeva

2017-05-01

Full Text Available Niflumic acid (NFA is a member of the fenamate class of nonsteroidal anti-inflammatory drugs. This compound and its derivatives are used worldwide clinically for the relief of chronic and acute pain. NFA is also a commonly used blocker of voltage-gated chloride channels. Here we present evidence that NFA is an efficient blocker of chloride-permeable glycine receptors (GlyRs with subunit heterogeneity of action. Using the whole-cell configuration of patch-clamp recordings and molecular modeling, we analyzed the action of NFA on homomeric α1ΔIns, α2B, α3L, and heteromeric α1β and α2β GlyRs expressed in CHO cells. NFA inhibited glycine-induced currents in a voltage-dependent manner and its blocking potency in α2 and α3 GlyRs was higher than that in α1 GlyR. The Woodhull analysis suggests that NFA blocks α1 and α2 GlyRs at the fractional electrical distances of 0.16 and 0.65 from the external membrane surface, respectively. Thus, NFA binding site in α1 GlyR is closer to the external part of the membrane, while in α2 GlyR it is significantly deeper in the pore. Mutation G254A at the cytoplasmic part of the α1 GlyR pore-lining TM2 helix (level 2′ increased the NFA blocking potency, while incorporation of the β subunit did not have a significant effect. The Hill plot analysis suggests that α1 and α2 GlyRs are preferably blocked by two and one NFA molecules, respectively. Molecular modeling using Monte Carlo energy minimizations provides the structural rationale for the experimental data and proposes more than one interaction site along the pore where NFA can suppress the ion permeation.

Temperature dependence of the radiation induced change of depletion voltage in silicon PIN detectors

International Nuclear Information System (INIS)

Ziock, H.J.; Holzscheiter, K.; Morgan, A.; Palounek, A.P.T.; Ellison, J.; Heinson, A.P.; Mason, M.; Wimpenny, S.J.; Barberis, E.; Cartiglia, N.; Grillo, A.; O'Shaughnessy, K.; Rahn, J.; Rinaldi, P.; Rowe, W.A.; Sadrozinski, H.F.W.; Seiden, A.; Spencer, E.; Webster, A.; Wichmann, R.; Wilder, M.; Coupal, D.; Pal, T.

1993-01-01

The silicon microstrip detectors that will be used in the SDC experiment at the Superconducting Super Collider (SSC) will be exposed to very large fluences of charged particles, neutrons, and gammas. The authors present a study of how temperature affects the change in the depletion voltage of silicon PIN detectors damaged by radiation. They study the initial radiation damage and the short-term and long-term annealing of that damage as a function of temperature in the range from -10 degrees C to +50 degrees C, and as a function of 800 MeV proton fluence up to 1.5 x 10 14 p/cm 2 . They express the pronounced temperature dependencies in a simple model in terms of two annealing time constants which depend exponentially on the temperature

Irreversible magnetic-field dependence of ferromagnetic resonance and inverse spin Hall effect voltage in CoFeB/Pt bilayer

Energy Technology Data Exchange (ETDEWEB)

Kim, Sang-Il [Department of Materials Science and Engineering, Korea University, Seoul, 136-713 (Korea, Republic of); Spin Engineering Physics Team, Division of Scientific Instrumentation, Korea Basic Science Institute, Daejeon, 305-806 (Korea, Republic of); Seo, Min-Su [Spin Engineering Physics Team, Division of Scientific Instrumentation, Korea Basic Science Institute, Daejeon, 305-806 (Korea, Republic of); Choi, Yeon Suk, E-mail: ychoi@kbsi.re.kr [Spin Engineering Physics Team, Division of Scientific Instrumentation, Korea Basic Science Institute, Daejeon, 305-806 (Korea, Republic of); Park, Seung-Young, E-mail: parksy@kbsi.re.kr [Spin Engineering Physics Team, Division of Scientific Instrumentation, Korea Basic Science Institute, Daejeon, 305-806 (Korea, Republic of)

2017-01-01

Magnetic field (H) sweeping direction dependences of the mixed voltage V{sub mix} induced by the inverse-spin Hall effect(ISHE) and spin-rectified effect (SRE) in a CoFeB (5 nm)/Pt (10 nm) bilayer structure are investigated using the ferromagnetic resonance in the TE mode cavities and coplanar waveguide methods. Conventionally, the magnitude of ISHE voltage V{sub ISH} (symmetric) excluding the SRE (antisymmetric component) was unavoidably separated from the fitting curve of V{sub mix} (a sum of a symmetric and an antisymmetric part) for one direction of H-source. By studying the ratio of the two voltage parts with the bi-directional H sweeping, the optimized V{sub ISH} (no SRE condition) value which also include a well-defined spin Hall angle can be obtained via the linear response relation of ISHE and SRE components. - Highlights: • Hysteretic behavior of ferromagnetic resonance spectra in the CoFeB/Pt sample. • Hysteretic behavior of inverse-spin Hall effect voltage in the CoFeB/Pt sample. • Proportion of inverse spin-Hall effect voltage can be determined by the cavity mode. • The hysteretic behavior arise from the unsaturated magnetization limit. • The well-defined spin Hall angle which consider a hysteresis can be obtained.

Voltage-dependent ion channels in the mouse RPE: comparison with Norrie disease mice.

Science.gov (United States)

Wollmann, Guido; Lenzner, Steffen; Berger, Wolfgang; Rosenthal, Rita; Karl, Mike O; Strauss, Olaf

2006-03-01

We studied electrophysiological properties of cultured retinal pigment epithelial (RPE) cells from mouse and a mouse model for Norrie disease. Wild-type RPE cells revealed the expression of ion channels known from other species: delayed-rectifier K(+) channels composed of Kv1.3 subunits, inward rectifier K(+) channels, Ca(V)1.3 L-type Ca(2+) channels and outwardly rectifying Cl(-) channels. Expression pattern and the ion channel characteristics current density, blocker sensitivity, kinetics and voltage-dependence were compared in cells from wild-type and Norrie mice. Although no significant differences were observed, our study provides a base for future studies on ion channel function and dysfunction in transgenic mouse models.

Grafting voltage and pharmacological sensitivity in potassium channels.

Science.gov (United States)

Lan, Xi; Fan, Chunyan; Ji, Wei; Tian, Fuyun; Xu, Tao; Gao, Zhaobing

2016-08-01

A classical voltage-gated ion channel consists of four voltage-sensing domains (VSDs). However, the roles of each VSD in the channels remain elusive. We developed a GVTDT (Graft VSD To Dimeric TASK3 channels that lack endogenous VSDs) strategy to produce voltage-gated channels with a reduced number of VSDs. TASK3 channels exhibit a high host tolerance to VSDs of various voltage-gated ion channels without interfering with the intrinsic properties of the TASK3 selectivity filter. The constructed channels, exemplified by the channels grafted with one or two VSDs from Kv7.1 channels, exhibit classical voltage sensitivity, including voltage-dependent opening and closing. Furthermore, the grafted Kv7.1 VSD transfers the potentiation activity of benzbromarone, an activator that acts on the VSDs of the donor channels, to the constructed channels. Our study indicates that one VSD is sufficient to voltage-dependently gate the pore and provides new insight into the roles of VSDs.

A new mechanism of voltage-dependent gating exposed by KV10.1 channels interrupted between voltage sensor and pore.

Science.gov (United States)

Tomczak, Adam P; Fernández-Trillo, Jorge; Bharill, Shashank; Papp, Ferenc; Panyi, Gyorgy; Stühmer, Walter; Isacoff, Ehud Y; Pardo, Luis A

2017-05-01

Voltage-gated ion channels couple transmembrane potential changes to ion flow. Conformational changes in the voltage-sensing domain (VSD) of the channel are thought to be transmitted to the pore domain (PD) through an α-helical linker between them (S4-S5 linker). However, our recent work on channels disrupted in the S4-S5 linker has challenged this interpretation for the KCNH family. Furthermore, a recent single-particle cryo-electron microscopy structure of K V 10.1 revealed that the S4-S5 linker is a short loop in this KCNH family member, confirming the need for an alternative gating model. Here we use "split" channels made by expression of VSD and PD as separate fragments to investigate the mechanism of gating in K V 10.1. We find that disruption of the covalent connection within the S4 helix compromises the ability of channels to close at negative voltage, whereas disconnecting the S4-S5 linker from S5 slows down activation and deactivation kinetics. Surprisingly, voltage-clamp fluorometry and MTS accessibility assays show that the motion of the S4 voltage sensor is virtually unaffected when VSD and PD are not covalently bound. Finally, experiments using constitutively open PD mutants suggest that the presence of the VSD is structurally important for the conducting conformation of the pore. Collectively, our observations offer partial support to the gating model that assumes that an inward motion of the C-terminal S4 helix, rather than the S4-S5 linker, closes the channel gate, while also suggesting that control of the pore by the voltage sensor involves more than one mechanism. © 2017 Tomczak et al.

Heparin/heparan sulfates bind to and modulate neuronal L-type (Cav1.2) voltage-dependent Ca²⁺ channels

DEFF Research Database (Denmark)

Garau, Gianpiero; Magotti, Paola; Heine, Martin

2015-01-01

Our previous studies revealed that L-type voltage-dependent Ca2+ channels (Cav1.2 L-VDCCs) are modulated by the neural extracellular matrix backbone, polyanionic glycan hyaluronic acid. Here we used isothermal titration calorimetry and screened a set of peptides derived from the extracellular......M), integrating their enthalpic and entropic binding contributions. Interaction between heparin and recombinant as well as native full-length neuronal Cav1.2α1 channels was confirmed using the heparin–agarose pull down assay. Whole cell patch clamp recordings in HEK293 cells transfected with neuronal Cav1.......2 channels revealed that enzymatic digestion of highly sulfated heparan sulfates with heparinase 1 affects neither voltage-dependence of channel activation nor the level of steady state inactivation, but did speed up channel inactivation. Treatment of hippocampal cultures with heparinase 1 reduced the firing...

Genetically encoded fluorescent voltage sensors using the voltage-sensing domain of Nematostella and Danio phosphatases exhibit fast kinetics.

Science.gov (United States)

Baker, Bradley J; Jin, Lei; Han, Zhou; Cohen, Lawrence B; Popovic, Marko; Platisa, Jelena; Pieribone, Vincent

2012-07-15

A substantial increase in the speed of the optical response of genetically encoded fluorescent protein voltage sensors (FP voltage sensors) was achieved by using the voltage-sensing phosphatase genes of Nematostella vectensis and Danio rerio. A potential N. vectensis voltage-sensing phosphatase was identified in silico. The voltage-sensing domain (S1-S4) of the N. vectensis homolog was used to create an FP voltage sensor called Nema. By replacing the phosphatase with a cerulean/citrine FRET pair, a new FP voltage sensor was synthesized with fast off kinetics (Tau(off)voltage-sensing phosphatase homolog, designated Zahra and Zahra 2, exhibited fast on and off kinetics within 2ms of the time constants observed with the organic voltage-sensitive dye, di4-ANEPPS. Mutagenesis of the S4 region of the Danio FP voltage sensor shifted the voltage dependence to more negative potentials but did not noticeably affect the kinetics of the optical signal. Copyright © 2012 Elsevier B.V. All rights reserved.

Genetically-encoded fluorescent voltage sensors using the voltage-sensing domain of Nematostella and Danio phosphatases exhibit fast kinetics

Science.gov (United States)

Baker, Bradley J.; Jin, Lei; Han, Zhou; Cohen, Lawrence B.; Popovic, Marko; Platisa, Jelena; Pieribone, Vincent

2012-01-01

A substantial increase in the speed of the optical response of genetically-encoded Fluorescent Protein voltage sensors (FP voltage sensors) was achieved by using the voltage-sensing phosphatase genes of Nematostella vectensis and Danio rerio. A potential N. vectensis voltage-sensing phosphatase was identified in silico. The voltage-sensing domain (S1–S4) of the N. vectensis homolog was used to create an FP voltage sensor called Nema. By replacing the phosphatase with a cerulean/citrine FRET pair, a new FP voltage sensor was synthesized with fast off kinetics (Tauoff voltage-sensing phosphatase homolog, designated Zahra and Zahra 2, exhibited fast on and off kinetics within 2 msec of the time constants observed with the organic voltage-sensitive dye, di4-ANEPPS. Mutagenesis of the S4 region of the Danio FP voltage sensor shifted the voltage dependence to more negative potentials but did not noticeably affect the kinetics of the optical signal. PMID:22634212

Dynamic localization and negative absolute conductance in terahertz driven semiconductor superlattices

International Nuclear Information System (INIS)

Keay, B.J.; Allen, S.J.; Campman, K.L.

1995-01-01

We report the first observation of Negative Absolute Conductance (NAC), dynamic localization and multiphoton stimulated emission assisted tunneling in terahertz driven semiconductor superlattices. Theories predicting NAC in semiconductor superlattices subjected to AC electric fields have existed for twenty years, but have never been verified experimentally. Most theories are based upon semiclassical arguments and are only valid for superlattices in the miniband or coherent tunneling regime. We are not aware of models predicting NAC in superlattices in the sequential tunneling regime, although there has been recent theoretical work on double-barrier structures. Perhaps the most remarkable result is found in the power dependence of the current-voltage (I-V) characteristics near zero DC bias. As the laser power is increased the current decreases towards zero and then becomes negative. This result implies that the electrons are absorbing energy from the laser field, producing a net current in the direction opposite to the applied voltage. NAC around zero DC bias is a particularly surprising observation considering photon-assisted tunneling is not expected to be observable between the ground states of neighboring quantum wells in a semiconductor superlattice. Contrary to this believe our results are most readily attributable to photon absorption and multiphoton emission between ground states of neighboring wells. The I-V characteristics measured in the presence of terahertz radiation at low DC bias also contain steps and plateaus analogous to photon-assisted steps observed in superconducting junctions. As many as three steps have been clearly resolved corresponding to stimulated emission into the terahertz field by a three-photon process

Dimerization of the voltage-sensing phosphatase controls its voltage-sensing and catalytic activity.

Science.gov (United States)

Rayaprolu, Vamseedhar; Royal, Perrine; Stengel, Karen; Sandoz, Guillaume; Kohout, Susy C

2018-05-07

Multimerization is a key characteristic of most voltage-sensing proteins. The main exception was thought to be the Ciona intestinalis voltage-sensing phosphatase (Ci-VSP). In this study, we show that multimerization is also critical for Ci-VSP function. Using coimmunoprecipitation and single-molecule pull-down, we find that Ci-VSP stoichiometry is flexible. It exists as both monomers and dimers, with dimers favored at higher concentrations. We show strong dimerization via the voltage-sensing domain (VSD) and weak dimerization via the phosphatase domain. Using voltage-clamp fluorometry, we also find that VSDs cooperate to lower the voltage dependence of activation, thus favoring the activation of Ci-VSP. Finally, using activity assays, we find that dimerization alters Ci-VSP substrate specificity such that only dimeric Ci-VSP is able to dephosphorylate the 3-phosphate from PI(3,4,5)P 3 or PI(3,4)P 2 Our results indicate that dimerization plays a significant role in Ci-VSP function. © 2018 Rayaprolu et al.

Size-dependent dynamic stability analysis of microbeams actuated by piezoelectric voltage based on strain gradient elasticity theory

Energy Technology Data Exchange (ETDEWEB)

Sahmani, Saeid; Bahrami, Mohsen [Amirkabir University of Technology, Tehran (Iran, Islamic Republic of)

2015-01-15

In the current paper, dynamic stability analysis of microbeams subjected to piezoelectric voltage is presented in which the microbeam is integrated with piezoelectric layers on the lower and upper surfaces. Both of the flutter and divergence instabilities of microbeams with clamped-clamped and clamped-free boundary conditions are predicted corresponding to various values of applied voltage. To take size effect into account, the classical Timoshenko beam theory in conjunction with strain gradient elasticity theory is utilized to develop nonclassical beam model containing three additional internal length scale parameters. By using Hamilton's principle, the higher-order governing differential equations and associated boundary conditions are derived. Afterward, generalized differential quadrature method is employed to discretize the size-dependent governing differential equations along with clamped-clamped and clamped-free end supports. The critical piezoelectric voltages corresponding to various values dimensionless length scale parameter are evaluated and compared with those predicted by the classical beam theory. It is revealed that in the case of clamped-free boundary conditions, the both of flutter and divergence instabilities occur. However, for the clamped-clamped microbeams, only divergence instability takes place.

Feasibility studies of high-pressure 4π proportional counter for absolute activity measurement

International Nuclear Information System (INIS)

Hino, Y.; Kawada, Y.

1988-01-01

A high-pressure proportional counter system is constructed. The high pressure 4πβ counter system constructed is made of aluminum and is divided into two 2π counters. The gas pressure is controlled with a pressure regulator and very fine leak valves to keep the balance of a stable pressure and constant flow rate. Investigation of characteristics of th counter shows that there is an almost linear relation between voltage and pressure. The linearlity of gas gain of this counter to the electron energies is measured with different gas pressures. Quite good linear gas multiplication is obtained at 0.9 MPa. Another investigation is made of application of to activity measurement of 109 Cd. When the gas pressure is over 0.5 MPa, the proportion of collected conversion electrons to absolute activity comes to a constant value of 96 %. This is quite good agreement with the decay data of 96.4 % conversion electron emission rate. The study indicated many excellent features for activity measurement. Especially the efficiency variation technique is good for automatic data acquisition with a programmable high voltage supplier. Moreover, since it is possible to obtain absolute activity with only one sample, it will be quite useful for limited samples experiments. (N.K.)

Measurement and statistical analysis of single-molecule current-voltage characteristics, transition voltage spectroscopy, and tunneling barrier height.

Science.gov (United States)

Guo, Shaoyin; Hihath, Joshua; Díez-Pérez, Ismael; Tao, Nongjian

2011-11-30

We report on the measurement and statistical study of thousands of current-voltage characteristics and transition voltage spectra (TVS) of single-molecule junctions with different contact geometries that are rapidly acquired using a new break junction method at room temperature. This capability allows one to obtain current-voltage, conductance voltage, and transition voltage histograms, thus adding a new dimension to the previous conductance histogram analysis at a fixed low-bias voltage for single molecules. This method confirms the low-bias conductance values of alkanedithiols and biphenyldithiol reported in literature. However, at high biases the current shows large nonlinearity and asymmetry, and TVS allows for the determination of a critically important parameter, the tunneling barrier height or energy level alignment between the molecule and the electrodes of single-molecule junctions. The energy level alignment is found to depend on the molecule and also on the contact geometry, revealing the role of contact geometry in both the contact resistance and energy level alignment of a molecular junction. Detailed statistical analysis further reveals that, despite the dependence of the energy level alignment on contact geometry, the variation in single-molecule conductance is primarily due to contact resistance rather than variations in the energy level alignment.

The harmonic composition of the output voltage of a rectifier unit with a PWM voltage booster converter.

OpenAIRE

ПАНЧЕНКО, В В

2015-01-01

The author investigates a rectifier unit constructed on the basis of cascade connection of the main non-controlled m-pulse rectifier and PWM voltage booster converter. The research presents the analysis of the harmonic composition of the output voltage of a rectifier unit with a PWM voltage booster converter on completely controlled keys. The dependence of the relative harmonic amplitude on the commutation corner is defined. The estimation of a rectifier unit electromagnetic compatibility wit...

Absolute risk, absolute risk reduction and relative risk

Directory of Open Access Journals (Sweden)

Jose Andres Calvache

2012-12-01

Full Text Available This article illustrates the epidemiological concepts of absolute risk, absolute risk reduction and relative risk through a clinical example. In addition, it emphasizes the usefulness of these concepts in clinical practice, clinical research and health decision-making process.

Dual Regulation of Voltage-Sensitive Ion Channels by PIP2

Directory of Open Access Journals (Sweden)

Aldo A Rodríguez Menchaca

2012-09-01

Full Text Available Over the past 16 years, there has been an impressive number of ion channels shown to be sensitive to the major phosphoinositide in the plasma membrane, phosphatidilinositol 4,5-bisphosphate (PIP2. Among them are voltage-gated channels, which are crucial for both neuronal and cardiac excitability. Voltage-gated calcium (Cav channels were shown to be regulated bidirectionally by PIP2. On one hand, PIP2 stabilized their activity by reducing current rundown but on the other hand it produced a voltage-dependent inhibition by shifting the activation curve to more positive voltages. For voltage-gated potassium (Kv channels PIP2 was first shown to prevent N-type inactivation. Careful examination of the effects of PIP2 on the activation mechanism of Kv1.2 has shown a similar bidirectional regulation as in the Cav channels. The two effects could be distinguished kinetically, in terms of their sensitivities to PIP2 and by distinct molecular determinants. The rightward shift of the Kv1.2 voltage dependence implicated basic residues in the S4-S5 linker and was consistent with stabilization of the inactive state of the voltage sensor. A third type of a voltage-gated ion channel modulated by PIP2 is the hyperpolarization-activated cyclic nucleotide-gated (HCN channel. PIP2 has been shown to enhance the opening of HCN channels by shifting their voltage-dependent activation toward depolarized potentials. The sea urchin HCN channel, SpIH, showed again a PIP2-mediated bidirectional effect but in reverse order than the depolarization-activated Cav and Kv channels: a voltage-dependent potentiation, like the mammalian HCN channels, but also an inhibition of the cGMP-induced current activation. Just like the Kv1.2 channels, distinct molecular determinants underlied the PIP2 dual effects on SpIH channels. The dual regulation of these very different ion channels, all of which are voltage dependent, points to conserved mechanisms of regulation of these channels by PIP2.

Voltage-Dependent Charge Storage in Cladded Zn0.56Cd0.44Se Quantum Dot MOS Capacitors for Multibit Memory Applications

Science.gov (United States)

Khan, J.; Lingalugari, M.; Al-Amoody, F.; Jain, F.

2013-11-01

As conventional memories approach scaling limitations, new storage methods must be utilized to increase Si yield and produce higher on-chip memory density. Use of II-VI Zn0.56Cd0.44Se quantum dots (QDs) is compatible with epitaxial gate insulators such as ZnS-ZnMgS. Voltage-dependent charging effects in cladded Zn0.56Cd0.44Se QDs are presented in a conventional metal-oxide-semiconductor capacitor structure. Charge storage capabilities in Si and ZnMgS QDs have been reported by various researchers; this work is focused on II-VI material Zn0.56Cd0.44Se QDs nucleated using photoassisted microwave plasma metalorganic chemical vapor deposition. Using capacitance-voltage hysteresis characterization, the multistep charging and discharging capabilities of the QDs at room temperature are presented. Three charging states are presented within a 10 V charging voltage range. These characteristics exemplify discrete charge states in the QD layer, perfect for multibit, QD-functionalized high-density memory applications. Multiple charge states with low operating voltage provide device characteristics that can be used for multibit storage by allowing varying charges to be stored in a QD layer based on the applied "write" voltage.

Exponential dependence of potential barrier height on biased voltages of inorganic/organic static induction transistor

International Nuclear Information System (INIS)

Zhang Yong; Yang Jianhong; Cai Xueyuan; Wang Zaixing

2010-01-01

The exponential dependence of the potential barrier height φ c on the biased voltages of the inorganic/organic static induction transistor (SIT/OSIT) through a normalized approach in the low-current regime is presented. It shows a more accurate description than the linear expression of the potential barrier height. Through the verification of the numerical calculated and experimental results, the exponential dependence of φ c on the applied biases can be used to derive the I-V characteristics. For both SIT and OSIT, the calculated results, using the presented relationship, are agreeable with the experimental results. Compared to the previous linear relationship, the exponential description of φ c can contribute effectively to reduce the error between the theoretical and experimental results of the I-V characteristics. (semiconductor devices)

Biophysical characterization of the fluorescent protein voltage probe VSFP2.3 based on the voltage-sensing domain of Ci-VSP.

Science.gov (United States)

Lundby, Alicia; Akemann, Walther; Knöpfel, Thomas

2010-11-01

A voltage sensitive phosphatase was discovered in the ascidian Ciona intestinalis. The phosphatase, Ci-VSP, contains a voltage-sensing domain homologous to those known from voltage-gated ion channels, but unlike ion channels, the voltage-sensing domain of Ci-VSP can reside in the cell membrane as a monomer. We fused the voltage-sensing domain of Ci-VSP to a pair of fluorescent reporter proteins to generate a genetically encodable voltage-sensing fluorescent probe, VSFP2.3. VSFP2.3 is a fluorescent voltage probe that reports changes in membrane potential as a FRET (fluorescence resonance energy transfer) signal. Here we report sensing current measurements from VSFP2.3, and show that VSFP2.3 carries 1.2 e sensing charges, which are displaced within 1.5 ms. The sensing currents become faster at higher temperatures, and the voltage dependence of the decay time constants is temperature dependent. Neutralization of an arginine in S4, previously suggested to be a sensing charge, and measuring associated sensing currents indicate that this charge is likely to reside at the membrane-aqueous interface rather than within the membrane electric field. The data presented give us insights into the voltage-sensing mechanism of Ci-VSP, which will allow us to further improve the sensitivity and kinetics of the family of VSFP proteins.

Absolute carrier phase effects in the two-color excitation of dipolar molecules

International Nuclear Information System (INIS)

Brown, Alex; Meath, W.J.; Kondo, A.E.

2002-01-01

The pump-probe excitation of a two-level dipolar (d≠0) molecule, where the pump frequency is tuned to the energy level separation while the probe frequency is extremely small, is examined theoretically as an example of absolute phase control of excitation processes. The state populations depend on the probe field's absolute carrier phase but are independent of the pump field's absolute carrier phase. Interestingly, the absolute phase effects occur for pulse durations much longer and field intensities much weaker than those required to see such effects in single pulse excitation

trans-Caryophyllene, a Natural Sesquiterpene, Causes Tracheal Smooth Muscle Relaxation through Blockade of Voltage-Dependent Ca2+ Channels

Directory of Open Access Journals (Sweden)

Jader Santos Cruz

2012-10-01

Full Text Available trans-Caryophyllene is a major component in the essential oils of various species of medicinal plants used in popular medicine in Brazil. It belongs to the chemical class of the sesquiterpenes and has been the subject of a number of studies. Here, we evaluated the effects of this compound in airway smooth muscle. The biological activities of trans-caryophyllene were examined in isolated bath organs to investigate the effect in basal tonus. Electromechanical and pharmacomechanical couplings were evaluated through the responses to K+ depolarization and exposure to acetylcholine (ACh, respectively. Isolated cells of rat tracheal smooth muscle were used to investigate trans-caryophyllene effects on voltage-dependent Ca2+ channels by using the whole-cell voltage-clamp configuration of the patch-clamp technique. trans-Caryophyllene showed more efficiency in the blockade of electromechanical excitation-contraction coupling while it has only minor inhibitory effect on pharmacomechanical coupling. Epithelium removal does not modify tracheal smooth muscle response elicited by trans-caryophyllene in the pharmacomechanical coupling. Under Ca2+-free conditions, pre-exposure to trans-caryophyllene did not reduce the contraction induced by ACh in isolated rat tracheal smooth muscle, regardless of the presence of intact epithelium. In the whole-cell configuration, trans-caryophyllene (3 mM, inhibited the inward Ba2+ current (IBa to approximately 50% of control levels. Altogether, our results demonstrate that trans-caryophyllene has anti-spasmodic activity on rat tracheal smooth muscle which could be explained, at least in part, by the voltage-dependent Ca2+ channels blockade.

Voltage Unbalance Compensation with Smart Three-phase Loads

DEFF Research Database (Denmark)

Douglass, Philip; Trintis, Ionut; Munk-Nielsen, Stig

2016-01-01

unbalance originating in the power supply network. Two variants of the algorithm are tested: first, using phase-neutral voltage as input, second, using phase-phase voltage. The control algorithm is described, and evaluated in simulations and laboratory tests. Two metrics for quantifying voltage unbalance...... are evaluated: one metric based on the maximum deviation of RMS phaseneutral voltage from the average voltage and one metric based on negative sequence voltage. The tests show that controller that uses phase-neutral voltage as input can in most cases eliminate the deviations of phase voltage from the average...... is caused by asymmetrical loads. These results suggest that the optimal algorithm to reduce system unbalance depends on which system parameter is most important: phase-neutral voltage unbalance, phase-phase voltage unbalance, or current unbalance....

Biphasic voltage-dependent inactivation of human NaV 1.3, 1.6 and 1.7 Na+ channels expressed in rodent insulin-secreting cells.

Science.gov (United States)

Godazgar, Mahdieh; Zhang, Quan; Chibalina, Margarita V; Rorsman, Patrik

2018-05-01

Na + current inactivation is biphasic in insulin-secreting cells, proceeding with two voltage dependences that are half-maximal at ∼-100 mV and -60 mV. Inactivation of voltage-gated Na + (Na V ) channels occurs at ∼30 mV more negative voltages in insulin-secreting Ins1 and primary β-cells than in HEK, CHO or glucagon-secreting αTC1-6 cells. The difference in inactivation between Ins1 and non-β-cells persists in the inside-out patch configuration, discounting an involvement of a diffusible factor. In Ins1 cells and primary β-cells, but not in HEK cells, inactivation of a single Na V subtype is biphasic and follows two voltage dependences separated by 30-40 mV. We propose that Na V channels adopt different inactivation behaviours depending on the local membrane environment. Pancreatic β-cells are equipped with voltage-gated Na + channels that undergo biphasic voltage-dependent steady-state inactivation. A small Na + current component (10-15%) inactivates over physiological membrane potentials and contributes to action potential firing. However, the major Na + channel component is completely inactivated at -90 to -80 mV and is therefore inactive in the β-cell. It has been proposed that the biphasic inactivation reflects the contribution of different Na V α-subunits. We tested this possibility by expression of TTX-resistant variants of the Na V subunits found in β-cells (Na V 1.3, Na V 1.6 and Na V 1.7) in insulin-secreting Ins1 cells and in non-β-cells (including HEK and CHO cells). We found that all Na V subunits inactivated at 20-30 mV more negative membrane potentials in Ins1 cells than in HEK or CHO cells. The more negative inactivation in Ins1 cells does not involve a diffusible intracellular factor because the difference between Ins1 and CHO persisted after excision of the membrane. Na V 1.7 inactivated at 15--20 mV more negative membrane potentials than Na V 1.3 and Na V 1.6 in Ins1 cells but this small difference is insufficient to solely

A Novel Index for Online Voltage Stability Assessment Based on Correlation Characteristic of Voltage Profiles

Directory of Open Access Journals (Sweden)

M. R. Aghamohammadi

2011-06-01

Full Text Available Abstract: Voltage instability is a major threat for security of power systems. Preserving voltage security margin at a certain limit is a vital requirement for today’s power systems. Assessment of voltage security margin is a challenging task demanding sophisticated indices. In this paper, for the purpose of on line voltage security assessment a new index based on the correlation characteristic of network voltage profile is proposed. Voltage profile comprising all bus voltages contains the effect of network structure, load-generation patterns and reactive power compensation on the system behaviour and voltage security margin. Therefore, the proposed index is capable to clearly reveal the effect of system characteristics and events on the voltage security margin. The most attractive feature for this index is its fast and easy calculation from synchronously measured voltage profile without any need to system modelling and simulation and without any dependency on network size. At any instant of system operation by merely measuring network voltage profile and no further simulation calculation this index could be evaluated with respect to a specific reference profile. The results show that the behaviour of this index with respect to the change in system security is independent of the selected reference profile. The simplicity and easy calculation make this index very suitable for on line application. The proposed approach has been demonstrated on IEEE 39 bus test system with promising results showing its effectiveness and applicability.

Regional and site-specific absolute humidity data for use in tritium dose calculations

International Nuclear Information System (INIS)

Etnier, E.L.

1980-01-01

Due to the potential variability in average absolute humidity over the continental U.S., and the dependence of atmospheric 3 H specific activity on absolute humidity, availability of regional absolute humidity data is of value in estimating the radiological significance of 3 H releases. Most climatological data are in the form of relative humidity, which must be converted to absolute humidity for dose calculations. Absolute humidity was calculated for 218 points across the U.S., using the 1977 annual summary of U.S. Climatological Data, and is given in a table. Mean regional values are shown on a map. (author)

Inhibition of the voltage-dependent chloride channel of Torpedo electric organ by diisopropylfluorophosphate and its reversal by oximes

International Nuclear Information System (INIS)

Abalis, I.M.; Chiang, P.K.; Wirtz, R.A.; Andre, R.G.

1986-01-01

Diisopropylfluorophosphate (DFP), a potent organophosphate inhibitor of cholinesterases, was found to inhibit the specific binding of [ 35 S]t-butylbicyclophosphorothionate (TBPS), specific chloride channels ligand, to the electric organ membranes of Torpedo, with a Ki of 21 +/- 3 μM. The binding sites of [ 35 S]TBPS in the Torpedo membranes were found not to be GABA receptors or nicotinic acetylcholine receptors as previously described. Interestingly, a stimulation of the binding of [ 35 S]TBPS was observed in the presence of atropine and three oximes, monopyridinium oxime 2-PAM, bispyridinium bis-oxime TMB-4 and H-oxime HI-6. The maximal stimulation was 300-500% of control, after which, the stimulation was reversed at higher concentrations. The three oximes protected by more than 95% the inhibition by 1 mM DFP of the binding of [ 35 S]TBPS to the voltage-dependent chloride channel. However, atropine protected only 20% of the inhibited channel. These results, thus, suggest that the protection against the toxic effects of DFP or other anticholinesterase agents by the tested oximes may not be solely a result of the reactivation of cholinesterases but also the protection of the voltage-dependent chloride channel

Strongly nonlinear theory of rapid solidification near absolute stability

Science.gov (United States)

Kowal, Katarzyna N.; Altieri, Anthony L.; Davis, Stephen H.

2017-10-01

We investigate the nonlinear evolution of the morphological deformation of a solid-liquid interface of a binary melt under rapid solidification conditions near two absolute stability limits. The first of these involves the complete stabilization of the system to cellular instabilities as a result of large enough surface energy. We derive nonlinear evolution equations in several limits in this scenario and investigate the effect of interfacial disequilibrium on the nonlinear deformations that arise. In contrast to the morphological stability problem in equilibrium, in which only cellular instabilities appear and only one absolute stability boundary exists, in disequilibrium the system is prone to oscillatory instabilities and a second absolute stability boundary involving attachment kinetics arises. Large enough attachment kinetics stabilize the oscillatory instabilities. We derive a nonlinear evolution equation to describe the nonlinear development of the solid-liquid interface near this oscillatory absolute stability limit. We find that strong asymmetries develop with time. For uniform oscillations, the evolution equation for the interface reduces to the simple form f''+(βf')2+f =0 , where β is the disequilibrium parameter. Lastly, we investigate a distinguished limit near both absolute stability limits in which the system is prone to both cellular and oscillatory instabilities and derive a nonlinear evolution equation that captures the nonlinear deformations in this limit. Common to all these scenarios is the emergence of larger asymmetries in the resulting shapes of the solid-liquid interface with greater departures from equilibrium and larger morphological numbers. The disturbances additionally sharpen near the oscillatory absolute stability boundary, where the interface becomes deep-rooted. The oscillations are time-periodic only for small-enough initial amplitudes and their frequency depends on a single combination of physical parameters, including the

Exploration of genetically encoded voltage indicators based on a chimeric voltage sensing domain

Directory of Open Access Journals (Sweden)

Yukiko eMishina

2014-09-01

Full Text Available Deciphering how the brain generates cognitive function from patterns of electrical signals is one of the ultimate challenges in neuroscience. To this end, it would be highly desirable to monitor the activities of very large numbers of neurons while an animal engages in complex behaviours. Optical imaging of electrical activity using genetically encoded voltage indicators (GEVIs has the potential to meet this challenge. Currently prevalent GEVIs are based on the voltage-sensitive fluorescent protein (VSFP prototypical design or on the voltage dependent state transitions of microbial opsins.We recently introduced a new VSFP design in which the voltage-sensing domain (VSD is sandwiched between a FRET pair of fluorescent proteins (termed VSFP-Butterflies and also demonstrated a series of chimeric VSD in which portions of the VSD of Ciona intestinalis voltage-sensitive phosphatase (Ci-VSP are substituted by homologous portions of a voltage-gated potassium channel subunit. These chimeric VSD had faster sensing kinetics than that of the native Ci-VSD. Here, we describe a new set of VSFPs that combine chimeric VSD with the Butterfly structure. We show that these chimeric VSFP-Butterflies can report membrane voltage oscillations of up to 200 Hz in cultured cells and report sensory evoked cortical population responses in living mice. This class of GEVIs may be suitable for imaging of brain rhythms in behaving mammalians.

Exploration of genetically encoded voltage indicators based on a chimeric voltage sensing domain.

Science.gov (United States)

Mishina, Yukiko; Mutoh, Hiroki; Song, Chenchen; Knöpfel, Thomas

2014-01-01

Deciphering how the brain generates cognitive function from patterns of electrical signals is one of the ultimate challenges in neuroscience. To this end, it would be highly desirable to monitor the activities of very large numbers of neurons while an animal engages in complex behaviors. Optical imaging of electrical activity using genetically encoded voltage indicators (GEVIs) has the potential to meet this challenge. Currently prevalent GEVIs are based on the voltage-sensitive fluorescent protein (VSFP) prototypical design or on the voltage-dependent state transitions of microbial opsins. We recently introduced a new VSFP design in which the voltage-sensing domain (VSD) is sandwiched between a fluorescence resonance energy transfer pair of fluorescent proteins (termed VSFP-Butterflies) and also demonstrated a series of chimeric VSD in which portions of the VSD of Ciona intestinalis voltage-sensitive phosphatase are substituted by homologous portions of a voltage-gated potassium channel subunit. These chimeric VSD had faster sensing kinetics than that of the native Ci-VSD. Here, we describe a new set of VSFPs that combine chimeric VSD with the Butterfly structure. We show that these chimeric VSFP-Butterflies can report membrane voltage oscillations of up to 200 Hz in cultured cells and report sensory evoked cortical population responses in living mice. This class of GEVIs may be suitable for imaging of brain rhythms in behaving mammalians.

Two distinct voltage-sensing domains control voltage sensitivity and kinetics of current activation in CaV1.1 calcium channels.

Science.gov (United States)

Tuluc, Petronel; Benedetti, Bruno; Coste de Bagneaux, Pierre; Grabner, Manfred; Flucher, Bernhard E

2016-06-01

Alternative splicing of the skeletal muscle CaV1.1 voltage-gated calcium channel gives rise to two channel variants with very different gating properties. The currents of both channels activate slowly; however, insertion of exon 29 in the adult splice variant CaV1.1a causes an ∼30-mV right shift in the voltage dependence of activation. Existing evidence suggests that the S3-S4 linker in repeat IV (containing exon 29) regulates voltage sensitivity in this voltage-sensing domain (VSD) by modulating interactions between the adjacent transmembrane segments IVS3 and IVS4. However, activation kinetics are thought to be determined by corresponding structures in repeat I. Here, we use patch-clamp analysis of dysgenic (CaV1.1 null) myotubes reconstituted with CaV1.1 mutants and chimeras to identify the specific roles of these regions in regulating channel gating properties. Using site-directed mutagenesis, we demonstrate that the structure and/or hydrophobicity of the IVS3-S4 linker is critical for regulating voltage sensitivity in the IV VSD, but by itself cannot modulate voltage sensitivity in the I VSD. Swapping sequence domains between the I and the IV VSDs reveals that IVS4 plus the IVS3-S4 linker is sufficient to confer CaV1.1a-like voltage dependence to the I VSD and that the IS3-S4 linker plus IS4 is sufficient to transfer CaV1.1e-like voltage dependence to the IV VSD. Any mismatch of transmembrane helices S3 and S4 from the I and IV VSDs causes a right shift of voltage sensitivity, indicating that regulation of voltage sensitivity by the IVS3-S4 linker requires specific interaction of IVS4 with its corresponding IVS3 segment. In contrast, slow current kinetics are perturbed by any heterologous sequences inserted into the I VSD and cannot be transferred by moving VSD I sequences to VSD IV. Thus, CaV1.1 calcium channels are organized in a modular manner, and control of voltage sensitivity and activation kinetics is accomplished by specific molecular mechanisms

Encasing the Absolutes

Directory of Open Access Journals (Sweden)

Uroš Martinčič

2014-05-01

Full Text Available The paper explores the issue of structure and case in English absolute constructions, whose subjects are deduced by several descriptive grammars as being in the nominative case due to its supposed neutrality in terms of register. This deduction is countered by systematic accounts presented within the framework of the Minimalist Program which relate the case of absolute constructions to specific grammatical factors. Each proposal is shown as an attempt of analysing absolute constructions as basic predication structures, either full clauses or small clauses. I argue in favour of the small clause approach due to its minimal reliance on transformations and unique stipulations. Furthermore, I propose that small clauses project a singular category, and show that the use of two cases in English absolute constructions can be accounted for if they are analysed as depictive phrases, possibly selected by prepositions. The case of the subject in absolutes is shown to be a result of syntactic and non-syntactic factors. I thus argue in accordance with Minimalist goals that syntactic case does not exist, attributing its role in absolutes to other mechanisms.

Bias voltage dependence of a flux-sensitive Al/GaAs/Al (SNS) interferometer

DEFF Research Database (Denmark)

Kutchinsky, Jonatan; Taboryski, Rafael Jozef; Hansen, Jørn Bindslev

1999-01-01

bias voltage the fabricated interferometers typically exhibit 3% sinusoidal modulation of the conductance as a function of a magnetic field applied perpendicular to the loop. The conductance modulation is caused by resonant Andreev states in the normal GaAs region of the device. With increasing bias...... voltage of the order of a few microvolts the device is driven out of resonance and the conductance oscillations are extinguished. However, at higher bias voltage corresponding to the superconducting energy gap of Al (178 mu V) the conductance oscillations reappear but with reduced amplitude...

Separating inverse spin Hall voltage and spin rectification voltage by inverting spin injection direction

Energy Technology Data Exchange (ETDEWEB)

Zhang, Wenxu, E-mail: xwzhang@uestc.edu.cn; Peng, Bin; Han, Fangbin; Wang, Qiuru; Zhang, Wanli [State Key Laboratory of Electronic Thin Films and Integrated Devices, University of Electronic Science and Technology of China, Chengdu 610054 (China); Soh, Wee Tee; Ong, Chong Kim [Center for Superconducting and Magnetic Materials, Department of Physics, National University of Singapore, 2 Science Drive 3, Singapore 117551 (Singapore)

2016-03-07

We develop a method for universally resolving the important issue of separating the inverse spin Hall effect (ISHE) from the spin rectification effect (SRE) signal. This method is based on the consideration that the two effects depend on the spin injection direction: The ISHE is an odd function of the spin injection direction while the SRE is independent on it. Thus, the inversion of the spin injection direction changes the ISHE voltage signal, while the SRE voltage remains. It applies generally to analyzing the different voltage contributions without fitting them to special line shapes. This fast and simple method can be used in a wide frequency range and has the flexibility of sample preparation.

Gabapentin Modulates HCN4 Channel Voltage-Dependence

Directory of Open Access Journals (Sweden)

Han-Shen Tae

2017-08-01

Full Text Available Gabapentin (GBP is widely used to treat epilepsy and neuropathic pain. There is evidence that GBP can act on hyperpolarization-activated cation (HCN channel-mediated Ih in brain slice experiments. However, evidence showing that GBP directly modulates HCN channels is lacking. The effect of GBP was tested using two-electrode voltage clamp recordings from human HCN1, HCN2, and HCN4 channels expressed in Xenopus oocytes. Whole-cell recordings were also made from mouse spinal cord slices targeting either parvalbumin positive (PV+ or calretinin positive (CR+ inhibitory neurons. The effect of GBP on Ih was measured in each inhibitory neuron population. HCN4 expression was assessed in the spinal cord using immunohistochemistry. When applied to HCN4 channels, GBP (100 μM caused a hyperpolarizing shift in the voltage of half activation (V1/2 thereby reducing the currents. Gabapentin had no impact on the V1/2 of HCN1 or HCN2 channels. There was a robust increase in the time to half activation for HCN4 channels with only a small increase noted for HCN1 channels. Gabapentin also caused a hyperpolarizing shift in the V1/2 of Ih measured from HCN4-expressing PV+ inhibitory neurons in the spinal dorsal horn. Gabapentin had minimal effect on Ih recorded from CR+ neurons. Consistent with this, immunohistochemical analysis revealed that the majority of CR+ inhibitory neurons do not express somatic HCN4 channels. In conclusion, GBP reduces HCN4 channel-mediated currents through a hyperpolarized shift in the V1/2. The HCN channel subtype selectivity of GBP provides a unique tool for investigating HCN4 channel function in the central nervous system. The HCN4 channel is a candidate molecular target for the acute analgesic and anticonvulsant actions of GBP.

Absolute advantage

NARCIS (Netherlands)

J.G.M. van Marrewijk (Charles)

2008-01-01

textabstractA country is said to have an absolute advantage over another country in the production of a good or service if it can produce that good or service using fewer real resources. Equivalently, using the same inputs, the country can produce more output. The concept of absolute advantage can

Current–voltage characteristics of manganite–titanite perovskite junctions

Directory of Open Access Journals (Sweden)

Benedikt Ifland

2015-07-01

Full Text Available After a general introduction into the Shockley theory of current voltage (J–V characteristics of inorganic and organic semiconductor junctions of different bandwidth, we apply the Shockley theory-based, one diode model to a new type of perovskite junctions with polaronic charge carriers. In particular, we studied manganite–titanate p–n heterojunctions made of n-doped SrTi1−yNbyO3, y = 0.002 and p-doped Pr1−xCaxMnO3, x = 0.34 having a strongly correlated electron system. The diffusion length of the polaron carriers was analyzed by electron beam-induced current (EBIC in a thin cross plane lamella of the junction. In the J–V characteristics, the polaronic nature of the charge carriers is exhibited mainly by the temperature dependence of the microscopic parameters, such as the hopping mobility of the series resistance and a colossal electro-resistance (CER effect in the parallel resistance. We conclude that a modification of the Shockley equation incorporating voltage-dependent microscopic polaron parameters is required. Specifically, the voltage dependence of the reverse saturation current density is analyzed and interpreted as a voltage-dependent electron–polaron hole–polaron pair generation and separation at the interface.

Macroeconomic Assessment of Voltage Sags

Directory of Open Access Journals (Sweden)

Sinan Küfeoğlu

2016-12-01

Full Text Available The electric power sector has changed dramatically since the 1980s. Electricity customers are now demanding uninterrupted and high quality service from both utilities and authorities. By becoming more and more dependent on the voltage sensitive electronic equipment, the industry sector is the one which is affected the most by voltage disturbances. Voltage sags are one of the most crucial problems for these customers. The utilities, on the other hand, conduct cost-benefit analyses before going through new investment projects. At this point, understanding the costs of voltage sags become imperative for planning purposes. The characteristics of electric power consumption and hence the susceptibility against voltage sags differ considerably among different industry subsectors. Therefore, a model that will address the estimation of worth of electric power reliability for a large number of customer groups is necessary. This paper introduces a macroeconomic model to calculate Customer Voltage Sag Costs (CVSCs for the industry sector customers. The proposed model makes use of analytical data such as value added, annual energy consumption, working hours, and average outage durations and provides a straightforward, credible, and easy to follow methodology for the estimation of CVSCs.

Current and Voltage Conveyors in Current- and Voltage-Mode Precision Full-Wave Rectifiers

Directory of Open Access Journals (Sweden)

J. Koton

2011-04-01

Full Text Available In this paper new versatile precision full-wave rectifiers using current and/or voltage conveyors as active elements and two diodes are presented. The performance of these circuit solutions is analysed and compared to the opamp based precision rectifier. To analyze the behavior of the functional blocks, the frequency dependent RMS error and DC transient value are evaluated for different values of input voltage amplitudes. Furthermore, experimental results are given that show the feasibilities of the conveyor based rectifiers superior to the corresponding operational amplifier based topology.

Calibration of the precision high voltage dividers of the KATRIN experiment

Energy Technology Data Exchange (ETDEWEB)

Rest, Oliver [Institut fuer Kernphysik, Westfaelische Wilhelms-Universitaet Muenster (Germany); Collaboration: KATRIN-Collaboration

2016-07-01

The KATRIN (KArlsruhe TRItium Neutrino) experiment will measure the endpoint region of the tritium β decay spectrum to determine the neutrino mass with a sensitivity of 200 meV/c{sup 2}. To achieve this sub-eV sensitivity the energy of the decay electrons will be analyzed using a MAC-E type spectrometer. The retarding potential of the MAC-E-filter (up to -35 kV) has to be monitored with a relative precision of 3 . 10{sup -6}. For this purpose the potential will be measured directly via two custom made precision high voltage dividers, which were developed and constructed in cooperation with the Physikalisch-Technische Bundesanstalt Braunschweig. In order to determine the absolute values and the stability of the scale factors of the voltage dividers, regular calibration measurements are essential. Such measurements have been performed during the last years using several different methods. The poster gives an overview of the methods and results of the calibration of the precision high voltage dividers.

Coupling between the voltage-sensing and pore domains in a voltage-gated potassium channel.

Science.gov (United States)

Schow, Eric V; Freites, J Alfredo; Nizkorodov, Alex; White, Stephen H; Tobias, Douglas J

2012-07-01

Voltage-dependent potassium (Kv), sodium (Nav), and calcium channels open and close in response to changes in transmembrane (TM) potential, thus regulating cell excitability by controlling ion flow across the membrane. An outstanding question concerning voltage gating is how voltage-induced conformational changes of the channel voltage-sensing domains (VSDs) are coupled through the S4-S5 interfacial linking helices to the opening and closing of the pore domain (PD). To investigate the coupling between the VSDs and the PD, we generated a closed Kv channel configuration from Aeropyrum pernix (KvAP) using atomistic simulations with experiment-based restraints on the VSDs. Full closure of the channel required, in addition to the experimentally determined TM displacement, that the VSDs be displaced both inwardly and laterally around the PD. This twisting motion generates a tight hydrophobic interface between the S4-S5 linkers and the C-terminal ends of the pore domain S6 helices in agreement with available experimental evidence.

Modulating the Voltage-sensitivity of a Genetically Encoded Voltage Indicator.

Science.gov (United States)

Jung, Arong; Rajakumar, Dhanarajan; Yoon, Bong-June; Baker, Bradley J

2017-10-01

Saturation mutagenesis was performed on a single position in the voltage-sensing domain (VSD) of a genetically encoded voltage indicator (GEVI). The VSD consists of four transmembrane helixes designated S1-S4. The V220 position located near the plasma membrane/extracellular interface had previously been shown to affect the voltage range of the optical signal. Introduction of polar amino acids at this position reduced the voltage-dependent optical signal of the GEVI. Negatively charged amino acids slightly reduced the optical signal by 33 percent while positively charge amino acids at this position reduced the optical signal by 80%. Surprisingly, the range of V220D was similar to that of V220K with shifted optical responses towards negative potentials. In contrast, the V220E mutant mirrored the responses of the V220R mutation suggesting that the length of the side chain plays in role in determining the voltage range of the GEVI. Charged mutations at the 219 position all behaved similarly slightly shifting the optical response to more negative potentials. Charged mutations to the 221 position behaved erratically suggesting interactions with the plasma membrane and/or other amino acids in the VSD. Introduction of bulky amino acids at the V220 position increased the range of the optical response to include hyperpolarizing signals. Combining The V220W mutant with the R217Q mutation resulted in a probe that reduced the depolarizing signal and enhanced the hyperpolarizing signal which may lead to GEVIs that only report neuronal inhibition.

rf power dependence of subharmonic voltage spectra of two-dimensional Josephson-junction arrays

International Nuclear Information System (INIS)

Hebboul, S.E.; Garland, J.C.

1993-01-01

We have measured the rf-bias-current dependence of the ν/2 subharmonic spectral response of planar 300x300 Nb-Au-Nb proximity-coupled Josephson-junction arrays. The ν/2 subharmonic voltage spectrum was examined at two rf-bias frequencies, ν/ν c ∼1.4, 2.0 (ν c ∼120 MHz), and in applied magnetic fields corresponding to f=0,1/2 flux quantum per plaquette. The measurements were compared to analytical predictions for an rf-biased asymmetric superconducting quantum interference device with non-negligble loop inductance and large rf-bias-current amplitudes, based on the resistively shunted Josephson-junction model. Reasonable agreement was found between experiment and theory, suggesting that a possible origin for the observed subharmonic behavior in arrays involves an interplay between array plaquette inductances and junction critical-current variations

C-terminus-mediated voltage gating of Arabidopsis guard cell anion channel QUAC1.

Science.gov (United States)

Mumm, Patrick; Imes, Dennis; Martinoia, Enrico; Al-Rasheid, Khaled A S; Geiger, Dietmar; Marten, Irene; Hedrich, Rainer

2013-09-01

Anion transporters in plants play a fundamental role in volume regulation and signaling. Currently, two plasma membrane-located anion channel families—SLAC/SLAH and ALMT—are known. Among the ALMT family, the root-expressed ALuminium-activated Malate Transporter 1 was identified by comparison of aluminum-tolerant and Al(3+)-sensitive wheat cultivars and was subsequently shown to mediate voltage-independent malate currents. In contrast, ALMT12/QUAC1 (QUickly activating Anion Channel1) is expressed in guard cells transporting malate in an Al(3+)-insensitive and highly voltage-dependent manner. So far, no information is available about the structure and mechanism of voltage-dependent gating with the QUAC1 channel protein. Here, we analyzed gating of QUAC1-type currents in the plasma membrane of guard cells and QUAC1-expressing oocytes revealing similar voltage dependencies and activation–deactivation kinetics. In the heterologous expression system, QUAC1 was electrophysiologically characterized at increasing extra- and intracellular malate concentrations. Thereby, malate additively stimulated the voltage-dependent QUAC1 activity. In search of structural determinants of the gating process, we could not identify transmembrane domains common for voltage-sensitive channels. However, site-directed mutations and deletions at the C-terminus of QUAC1 resulted in altered voltage-dependent channel activity. Interestingly, the replacement of a single glutamate residue, which is conserved in ALMT channels from different clades, by an alanine disrupted QUAC1 activity. Together with C- and N-terminal tagging, these results indicate that the cytosolic C-terminus is involved in the voltage-dependent gating mechanism of QUAC1.

Noradrenergic mechanisms and high blood pressure maintenance in genetic hypertension: The role of Gi proteins and voltage-dependent calcium channels

Czech Academy of Sciences Publication Activity Database

Zicha, Josef; Pintérová, Mária; Líšková, Silvia; Dobešová, Zdenka; Kuneš, Jaroslav

2007-01-01

Roč. 29, č. 4 (2007), s. 229-229 ISSN 1064-1963. [International symposium on SHR /12./. 20.10.2006-21.10.2006, Kyoto] R&D Projects: GA MZd(CZ) NR7786 Institutional research plan: CEZ:AV0Z50110509 Keywords : genetic hypertension * noradrenergic mechanisms * Gi proteins * voltage-dependent calcium channels Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

Imaging Voltage in Genetically Defined Neuronal Subpopulations with a Cre Recombinase-Targeted Hybrid Voltage Sensor.

Science.gov (United States)

Bayguinov, Peter O; Ma, Yihe; Gao, Yu; Zhao, Xinyu; Jackson, Meyer B

2017-09-20

Genetically encoded voltage indicators create an opportunity to monitor electrical activity in defined sets of neurons as they participate in the complex patterns of coordinated electrical activity that underlie nervous system function. Taking full advantage of genetically encoded voltage indicators requires a generalized strategy for targeting the probe to genetically defined populations of cells. To this end, we have generated a mouse line with an optimized hybrid voltage sensor (hVOS) probe within a locus designed for efficient Cre recombinase-dependent expression. Crossing this mouse with Cre drivers generated double transgenics expressing hVOS probe in GABAergic, parvalbumin, and calretinin interneurons, as well as hilar mossy cells, new adult-born neurons, and recently active neurons. In each case, imaging in brain slices from male or female animals revealed electrically evoked optical signals from multiple individual neurons in single trials. These imaging experiments revealed action potentials, dynamic aspects of dendritic integration, and trial-to-trial fluctuations in response latency. The rapid time response of hVOS imaging revealed action potentials with high temporal fidelity, and enabled accurate measurements of spike half-widths characteristic of each cell type. Simultaneous recording of rapid voltage changes in multiple neurons with a common genetic signature offers a powerful approach to the study of neural circuit function and the investigation of how neural networks encode, process, and store information. SIGNIFICANCE STATEMENT Genetically encoded voltage indicators hold great promise in the study of neural circuitry, but realizing their full potential depends on targeting the sensor to distinct cell types. Here we present a new mouse line that expresses a hybrid optical voltage sensor under the control of Cre recombinase. Crossing this line with Cre drivers generated double-transgenic mice, which express this sensor in targeted cell types. In

Voltage-dependent modulation of cardiac ryanodine receptors (RyR2 by protamine.

Directory of Open Access Journals (Sweden)

Paula L Diaz-Sylvester

Full Text Available It has been reported that protamine (>10 microg/ml blocks single skeletal RyR1 channels and inhibits RyR1-mediated Ca2+ release from sarcoplasmic reticulum microsomes. We extended these studies to cardiac RyR2 reconstituted into planar lipid bilayers. We found that protamine (0.02-20 microg/ml added to the cytosolic surface of fully activated RyR2 affected channel activity in a voltage-dependent manner. At membrane voltage (V(m; SR lumen-cytosol = 0 mV, protamine induced conductance transitions to several intermediate states (substates as well as full block of RyR2. At V(m>10 mV, the substate with the highest level of conductance was predominant. Increasing V(m from 0 to +80 mV, decreased the number of transitions and residence of the channel in this substate. The drop in current amplitude (full opening to substate had the same magnitude at 0 and +80 mV despite the approximately 3-fold increase in amplitude of the full opening. This is more similar to rectification of channel conductance induced by other polycations than to the action of selective conductance modifiers (ryanoids, imperatoxin. A distinctive effect of protamine (which might be shared with polylysines and histones but not with non-peptidic polycations is the activation of RyR2 in the presence of nanomolar cytosolic Ca2+ and millimolar Mg2+ levels. Our results suggest that RyRs would be subject to dual modulation (activation and block by polycationic domains of neighboring proteins via electrostatic interactions. Understanding these interactions could be important as such anomalies may be associated with the increased RyR2-mediated Ca2+ leak observed in cardiac diseases.

Simulation of forward dark current voltage characteristics of tandem solar cells

International Nuclear Information System (INIS)

Rubinelli, F.A.

2012-01-01

The transport mechanisms tailoring the shape of dark current–voltage characteristics of amorphous and microcrystalline silicon based tandem solar cell structures are explored with numerical simulations. Our input parameters were calibrated by fitting experimental current voltage curves of single and double junction structures measured under dark and illuminated conditions. At low and intermediate forward voltages the dark current–voltage characteristics show one or two regions with a current–voltage exponential dependence. The diode factor is unique in tandem cells with the same material in both intrinsic layers and two dissimilar diode factors are observed in tandem cells with different materials on the top and bottom intrinsic layers. In the exponential regions the current is controlled by recombination through gap states and by free carrier diffusion. At high forward voltages the current grows more slowly with the applied voltage. The current is influenced by the onset of electron space charge limited current (SCLC) in tandem cells where both intrinsic layers are of amorphous silicon and by series resistance of the bottom cell in tandem cells where both intrinsic layers are of microcrystalline silicon. In the micromorph cell the onset of SCLC becomes visible on the amorphous top sub-cell. The dark current also depends on the thermal generation of electron–hole (e–h) pairs present at the tunneling recombination junction. The highest dependence is observed in the tandem structure where both intrinsic layers are of microcrystalline silicon. The prediction of meaningless dark currents at low forward and reverse voltages by our code is discussed and one solution is given. - Highlights: ► Transport mechanisms shaping the dark current-voltage curves of tandem devices. ► The devices are amorphous and microcrystalline based tandem solar cells. ► Two regions with a current-voltage exponential dependence are observed. ► The tandem J-V diode factor is the

Ion Concentration- and Voltage-Dependent Push and Pull Mechanisms of Potassium Channel Ion Conduction.

Directory of Open Access Journals (Sweden)

Kota Kasahara

Full Text Available The mechanism of ion conduction by potassium channels is one of the central issues in physiology. In particular, it is still unclear how the ion concentration and the membrane voltage drive ion conduction. We have investigated the dynamics of the ion conduction processes in the Kv1.2 pore domain, by molecular dynamics (MD simulations with several different voltages and ion concentrations. By focusing on the detailed ion movements through the pore including selectivity filter (SF and cavity, we found two major conduction mechanisms, called the III-IV-III and III-II-III mechanisms, and the balance between the ion concentration and the voltage determines the mechanism preference. In the III-IV-III mechanism, the outermost ion in the pore is pushed out by a new ion coming from the intracellular fluid, and four-ion states were transiently observed. In the III-II-III mechanism, the outermost ion is pulled out first, without pushing by incoming ions. Increases in the ion concentration and voltage accelerated ion conductions, but their mechanisms were different. The increase in the ion concentrations facilitated the III-IV-III conductions, while the higher voltages increased the III-II-III conductions, indicating that the pore domain of potassium channels permeates ions by using two different driving forces: a push by intracellular ions and a pull by voltage.

On the profile of frequency and voltage dependent interface states and series resistance in MIS structures

Energy Technology Data Exchange (ETDEWEB)

Doekme, Ilbilge [Science Education Department, Faculty of Kirsehir Education, Gazi University, Kirsehir (Turkey)]. E-mail: ilbilgedokme@gazi.edu.tr; Altindal, Semsettin [Physics Department, Faculty of Arts and Sciences, Gazi University, 06500, Teknikokullar, Ankara (Turkey)

2007-04-30

The variation in the capacitance-voltage (C-V) and conductance-voltage (G/{omega}-V) characteristics of Au/SiO{sub 2}/n-Si metal-insulator-semiconductor (MIS) structure have been systematically investigated as a function of frequencies in the frequency range 0.5 kHz-10 MHz at room temperature. In addition, the forward and reverse bias current-voltage (I-V) characteristics of this structure were measured at room temperature. The high value of ideality factor was attributed to the high density of interface states localized at Si/SiO{sub 2} interface and interfacial oxide layer. The density of interface states (N{sub ss}) and the series resistance (R{sub ss}) were calculated from I-V and C-V measurements using different methods and the effect of them on C-V and G/{omega}-V characteristics were deeply researched. At the same energy position near the top of valance band, the calculated N{sub ss} values, obtained without taking into account the series resistance of the devices almost one order of magnitude larger than N{sub ss} values obtained by taking into account R{sub ss} values. It is found that the C-V and G/{omega}-V curves exhibit a peak at low frequencies and the peak values of C and G/{omega} decrease with increasing frequency. Also, the plots of R {sub s} as a function of bias give two peaks in the certain voltage range at low frequencies. These observations indicate that at low frequencies, the charges at interface states can easily follow an AC signal and the number of them increases with decreasing frequency. The I-V, C-V and G/{omega}-V characteristics of the MIS structure are affected not only with R {sub s} but also N {sub ss}. Experimental results show that both the R{sub s} and C{sub o} values should be taken into account in determining frequency-dependent electrical characteristics.

Absolute calibration of TFTR helium proportional counters

International Nuclear Information System (INIS)

Strachan, J.D.; Diesso, M.; Jassby, D.; Johnson, L.; McCauley, S.; Munsat, T.; Roquemore, A.L.; Loughlin, M.

1995-06-01

The TFTR helium proportional counters are located in the central five (5) channels of the TFTR multichannel neutron collimator. These detectors were absolutely calibrated using a 14 MeV neutron generator positioned at the horizontal midplane of the TFTR vacuum vessel. The neutron generator position was scanned in centimeter steps to determine the collimator aperture width to 14 MeV neutrons and the absolute sensitivity of each channel. Neutron profiles were measured for TFTR plasmas with time resolution between 5 msec and 50 msec depending upon count rates. The He detectors were used to measure the burnup of 1 MeV tritons in deuterium plasmas, the transport of tritium in trace tritium experiments, and the residual tritium levels in plasmas following 50:50 DT experiments

Intermediate state trapping of a voltage sensor

DEFF Research Database (Denmark)

Lacroix, Jérôme J; Pless, Stephan Alexander; Maragliano, Luca

2012-01-01

Voltage sensor domains (VSDs) regulate ion channels and enzymes by undergoing conformational changes depending on membrane electrical signals. The molecular mechanisms underlying the VSD transitions are not fully understood. Here, we show that some mutations of I241 in the S1 segment of the Shaker...... Kv channel positively shift the voltage dependence of the VSD movement and alter the functional coupling between VSD and pore domains. Among the I241 mutants, I241W immobilized the VSD movement during activation and deactivation, approximately halfway between the resting and active states......, and drastically shifted the voltage activation of the ionic conductance. This phenotype, which is consistent with a stabilization of an intermediate VSD conformation by the I241W mutation, was diminished by the charge-conserving R2K mutation but not by the charge-neutralizing R2Q mutation. Interestingly, most...

Superheterodyne configuration for two-wavelength interferometry applied to absolute distance measurement

International Nuclear Information System (INIS)

Le Floch, Sebastien; Salvade, Yves; Droz, Nathalie; Mitouassiwou, Rostand; Favre, Patrick

2010-01-01

We present a new superheterodyne technique for long-distance measurements by two-wavelength interferometry (TWI). While conventional systems use two acousto-optic modulators to generate two different heterodyne frequencies, here the two frequencies result from synchronized sweeps of optical and radio frequencies. A distributed feedback laser source is injected in an intensity modulator that is driven at the half-wave voltage mode. A radio-frequency signal is applied to this intensity modulator to generate two optical sidebands around the optical carrier. This applied radio frequency consists of a digital ramp between 13 and 15 GHz, with 1 ms duration and with an accuracy of better than 1 ppm. Simultaneously, the laser source is frequency modulated by a current modulation that is synchronized on the radio-frequency ramp as well as on a triangle waveform. These two frequency-swept optical signals at the output of the modulator illuminate a Michelson interferometer and create two distinct distance-dependent heterodyne frequencies on the photodetector. The superheterodyne signal is then detected and bandpass filtered to retrieve the absolute distance measurement. Experiments between 1 and 15 m confirm the validity of this new concept, leading to a distance accuracy of ± 50 μm for a 1 ms acquisition time.

Nonlinear electrokinetics at large voltages

Energy Technology Data Exchange (ETDEWEB)

Bazant, Martin Z [Department of Chemical Engineering and Institute for Soldier Nanotechnologies, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Sabri Kilic, Mustafa; Ajdari, Armand [Department of Mathematics, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Storey, Brian D [Franklin W Olin College of Engineering, Needham, MA 02492 (United States)], E-mail: bazant@mit.edu

2009-07-15

The classical theory of electrokinetic phenomena assumes a dilute solution of point-like ions in chemical equilibrium with a surface whose double-layer voltage is of order the thermal voltage, k{sub B}T/e=25 mV. In nonlinear 'induced-charge' electrokinetic phenomena, such as ac electro-osmosis, several volts {approx}100k{sub B}T/e are applied to the double layer, and the theory breaks down and cannot explain many observed features. We argue that, under such a large voltage, counterions 'condense' near the surface, even for dilute bulk solutions. Based on simple models, we predict that the double-layer capacitance decreases and the electro-osmotic mobility saturates at large voltages, due to steric repulsion and increased viscosity of the condensed layer, respectively. The former suffices to explain observed high-frequency flow reversal in ac electro-osmosis; the latter leads to a salt concentration dependence of induced-charge flows comparable to experiments, although a complete theory is still lacking.

Wind Power Plant Voltage Stability Evaluation: Preprint

Energy Technology Data Exchange (ETDEWEB)

Muljadi, E.; Zhang, Y. C.

2014-09-01

Voltage stability refers to the ability of a power system to maintain steady voltages at all buses in the system after being subjected to a disturbance from a given initial operating condition. Voltage stability depends on a power system's ability to maintain and/or restore equilibrium between load demand and supply. Instability that may result occurs in the form of a progressive fall or rise of voltages of some buses. Possible outcomes of voltage instability are the loss of load in an area or tripped transmission lines and other elements by their protective systems, which may lead to cascading outages. The loss of synchronism of some generators may result from these outages or from operating conditions that violate a synchronous generator's field current limit, or in the case of variable speed wind turbine generator, the current limits of power switches. This paper investigates the impact of wind power plants on power system voltage stability by using synchrophasor measurements.

Relative and absolute level populations in beam-foil--excited neutral helium

International Nuclear Information System (INIS)

Davidson, J.

1975-01-01

Relative and absolute populations of 19 levels in beam-foil--excited neutral helium at 0.275 MeV have been measured. The singlet angular-momentum sequences show dependences on principal quantum number consistent with n -3 , but the triplet sequences do not. Singlet and triplet angular-momentum sequences show similar dependences on level excitation energy. Excitation functions for six representative levels were measured in the range 0.160 to 0.500 MeV. The absolute level populations increase with energy, whereas the neutral fraction of the beam decreases with energy. Further, the P angular-momentum levels are found to be overpopulated with respect to the S and D levels. The overpopulation decreases with increasing principal quantum number

Heat-pump performance: voltage dip/sag, under-voltage and over-voltage

Directory of Open Access Journals (Sweden)

William J.B. Heffernan

2014-12-01

Full Text Available Reverse cycle air-source heat-pumps are an increasingly significant load in New Zealand and in many other countries. This has raised concern over the impact wide-spread use of heat-pumps may have on the grid. The characteristics of the loads connected to the power system are changing because of heat-pumps. Their performance during under-voltage events such as voltage dips has the potential to compound the event and possibly cause voltage collapse. In this study, results from testing six heat-pumps are presented to assess their performance at various voltages and hence their impact on voltage stability.

A three-axis SQUID-based absolute vector magnetometer

Energy Technology Data Exchange (ETDEWEB)

Schönau, T.; Schmelz, M.; Stolz, R.; Anders, S.; Linzen, S.; Meyer, H.-G. [Department of Quantum Detection, Leibniz Institute of Photonic Technology, Jena 07745 (Germany); Zakosarenko, V.; Meyer, M. [Supracon AG, An der Lehmgrube 11, Jena 07751 (Germany)

2015-10-15

We report on the development of a three-axis absolute vector magnetometer suited for mobile operation in the Earth’s magnetic field. It is based on low critical temperature dc superconducting quantum interference devices (LTS dc SQUIDs) with sub-micrometer sized cross-type Josephson junctions and exhibits a white noise level of about 10 fT/Hz{sup 1/2}. The width of superconducting strip lines is restricted to less than 6 μm in order to avoid flux trapping during cool-down in magnetically unshielded environment. The long-term stability of the flux-to-voltage transfer coefficients of the SQUID electronics is investigated in detail and a method is presented to significantly increase their reproducibility. We further demonstrate the long-term operation of the setup in a magnetic field varying by about 200 μT amplitude without the need for recalibration.

Stabilization of Voltage Parameters of Induction Generator Excited by a Voltage Inverter

Directory of Open Access Journals (Sweden)

Padalko D.A.

2017-12-01

Full Text Available The article reveals the operational aspects of induction generator. Methods for stabilization of induction generator (IG parameters under inverter excitation are investigated. The study was carried out using mathematical description and simulation modeling in MATLAB Simulink. The paper provides analysis of causes of generated voltage amplitude and frequency displacement when the loading condition and the rate vary. Due to the parametric resonance nature of IG self-excitation, the author introduces the expression that allows estimating the capacitor capacitance required to maintain the generation process, depending on the rotor speed of electric machine, load nature and rate. Based on the studies, it was proved that it is possible to stabilize the IG voltage parameters by maintaining the magnetizing circuit inductance Lm at the constant level., and realizing a control law close to U/f = const. The study proves that using the inverter together with the voltage regulator allows ensuring the quality of electricity corresponding to modern standards. The necessity of problem solving of the required quality of the voltage by the harmonic component for the exciter - inverter with PWM is shown. The prospects of the power generation system based on induction machine (IM with a semiconductor frequency converter, which serves as an adjustable supplier of capacitive current for IM for autonomous objects, are substantiated. The use of semiconductor frequency converters makes it possible to provide high stability of the output voltage parameters and good speed of the mechatronic generation system with an asynchronous machine.

Functional diversity of voltage-sensing phosphatases in two urodele amphibians.

Science.gov (United States)

Mutua, Joshua; Jinno, Yuka; Sakata, Souhei; Okochi, Yoshifumi; Ueno, Shuichi; Tsutsui, Hidekazu; Kawai, Takafumi; Iwao, Yasuhiro; Okamura, Yasushi

2014-07-16

Voltage-sensing phosphatases (VSPs) share the molecular architecture of the voltage sensor domain (VSD) with voltage-gated ion channels and the phosphoinositide phosphatase region with the phosphatase and tensin homolog (PTEN), respectively. VSPs enzymatic activities are regulated by the motions of VSD upon depolarization. The physiological role of these proteins has remained elusive, and insights may be gained by investigating biological variations in different animal species. Urodele amphibians are vertebrates with potent activities of regeneration and also show diverse mechanisms of polyspermy prevention. We cloned cDNAs of VSPs from the testes of two urodeles; Hynobius nebulosus and Cynops pyrrhogaster, and compared their expression and voltage-dependent activation. Their molecular architecture is highly conserved in both Hynobius VSP (Hn-VSP) and Cynops VSP (Cp-VSP), including the positively-charged arginine residues in the S4 segment of the VSD and the enzymatic active site for substrate binding, yet the C-terminal C2 domain of Hn-VSP is significantly shorter than that of Cp-VSP and other VSP orthologs. RT-PCR analysis showed that gene expression pattern was distinct between two VSPs. The voltage sensor motions and voltage-dependent phosphatase activities were investigated electrophysiologically by expression in Xenopus oocytes. Both VSPs showed "sensing" currents, indicating that their voltage sensor domains are functional. The phosphatase activity of Cp-VSP was found to be voltage dependent, as shown by its ability to regulate the conductance of coexpressed GIRK2 channels, but Hn-VSP lacked such phosphatase activity due to the truncation of its C2 domain. © 2014 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.

Mitigation of Unbalanced Voltage Sags and Voltage Unbalance in CIGRE Low Voltage Distribution Network

DEFF Research Database (Denmark)

Mustafa, Ghullam; Bak-Jensen, Birgitte; Mahat, Pukar

2013-01-01

Any problem with voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM) etc. can be used to mitigate the voltage problems in the distribution system...... to unbalanced faults. The compensation of unbalanced voltage sags and voltage unbalance in the CIGRE distribution network is done by using the four STATCOM compensators already existing in the test grid. The simulations are carried out in DIgSILENT power factory software version 15.0........ The voltage problems dealt with in this paper are to show how to mitigate unbalanced voltage sags and voltage unbalance in the CIGRE Low Voltage (LV) test network and net-works like this. The voltage unbalances, for the tested cases in the CIGRE LV test network are mainly due to single phase loads and due...

A common pathway for charge transport through voltage-sensing domains.

Science.gov (United States)

Chanda, Baron; Bezanilla, Francisco

2008-02-07

Voltage-gated ion channels derive their voltage sensitivity from the movement of specific charged residues in response to a change in transmembrane potential. Several studies on mechanisms of voltage sensing in ion channels support the idea that these gating charges move through a well-defined permeation pathway. This gating pathway in a voltage-gated ion channel can also be mutated to transport free cations, including protons. The recent discovery of proton channels with sequence homology to the voltage-sensing domains suggests that evolution has perhaps exploited the same gating pathway to generate a bona fide voltage-dependent proton transporter. Here we will discuss implications of these findings on the mechanisms underlying charge (and ion) transport by voltage-sensing domains.

Thermal voltage noise in layered superconductors

International Nuclear Information System (INIS)

Ashkenazy, V.D.; Jung, G.; Shapiro, B.Y.

1995-01-01

Thermal voltage noise in the mixed state of type-II superconductors has been calculated taking into account fluctuation modes of nonrigid vortices. It has been shown that bending of vortices leads to new effects in thermal-voltage-noise spectra at high frequencies. The power spectrum reflecting fluctuations of rigid vortices is suppressed at very low frequencies and saturates into a white spectrum at a characteristic frequency depending on the strip width. At high frequencies tilt modes of flexible vortices start to contribute to the fluctuating voltages and the power spectrum undergoes three subsequent magnitude increases, following ω 1/2 -, ω 2 -, and again ω 1/2 -like behavior before becoming white again. It has been shown that for layered superconductors of a moderate anisotropy the second ω 1/2 -like increase disappears at magnetic fields exceeding a certain threshold field corresponding to the crossover field between two-dimensional and three-dimensional vortex-lattice melting. Field dependencies of characteristic frequencies separating different regimes of spectral behavior have been evaluated and shown to be qualitatively different for low and high magnetic fields

Dual action of a dinoflagellate-derived precursor of Pacific ciguatoxins (P-CTX-4B) on voltage-dependent K(+) and Na(+) channels of single myelinated axons.

Science.gov (United States)

Schlumberger, Sébastien; Mattei, César; Molgó, Jordi; Benoit, Evelyne

2010-10-01

The effects of Pacific ciguatoxin-4B (P-CTX-4B, also named gambiertoxin), extracted from toxic Gambierdiscus dinoflagellates, were assessed on nodal K(+) and Na(+) currents of frog myelinated axons, using a conventional voltage-clamp technique. P-CTX-4B decreased, within a few minutes, both K(+) and Na(+) currents in a dose-dependent manner, without inducing any marked change in current kinetics. The toxin was more effective in blocking K(+) than Na(+) channels. P-CTX-4B shifted the voltage-dependence of Na(+) conductance by about 14 mV towards more negative membrane potentials. This effect was reversed by increasing Ca(2+) in the external solution. A negative shift of about 16 mV in the steady-state Na(+) inactivation-voltage curve was also observed in the presence of the toxin. Unmodified and P-CTX-4B-modified Na(+) currents were similarly affected by the local anaesthetic lidocaine. The decrease of the two currents by lidocaine was dependent on both the concentration and the membrane potential during pre-pulses. In conclusion, P-CTX-4B appears about four times more effective than P-CTX-1B to affect K(+) channels, whereas it is about 50 times less efficient to affect Na(+) channels of axonal membranes. These actions may be related to subtle differences between the two chemical structures of molecules. Copyright 2009 Elsevier Ltd. All rights reserved.

Investigation on the energy spectrums of electrons in atmospheric pressure argon plasma jets and their dependences on the applied voltage

Science.gov (United States)

Chen, Xinxian; Tan, Zhenyu; Liu, Yadi; Li, Xiaotong; Pan, Jie; Wang, Xiaolong

2017-08-01

This work presents a systematical investigation on the spatiotemporal evolution of the energy spectrum of electrons in atmospheric pressure argon plasma jets and its dependence on the applied voltage. The investigations are carried out by means of the numerical simulation based on a particle-in-cell Monte-Carlo collision model. The characteristics of the spatiotemporal evolution of the energy spectrum of electrons (ESE) in the discharge space have been presented, and especially the mechanisms of inducing these characteristics have also been revealed. The present work shows the following conclusions. In the evolution of ESE, there is a characteristic time under each applied voltage. Before the characteristic time, the peak value of ESE decreases, the peak position shifts toward high energy, and the distribution of ESE becomes wider and wider, but the reverse is true after the characteristic time. The formation of these characteristics can be mainly attributed to the transport of electrons toward a low electric field as well as a balance between the energy gained from the electric field including the effect of space charges and the energy loss due to inelastic collisions in the process of electron transport. The characteristic time decreases with the applied voltage. In addition, the average energy of electrons at the characteristic time can be increased by enhancing the applied voltage. The results presented in this work are of importance for regulating and controlling the energy of electrons in the plasma jets applied to plasma medicine.

Frequency and voltage dependent profile of dielectric properties, electric modulus and ac electrical conductivity in the PrBaCoO nanofiber capacitors

Directory of Open Access Journals (Sweden)

S. Demirezen

Full Text Available In this study, praseodymium barium cobalt oxide nanofiber interfacial layer was sandwiched between Au and n-Si. Frequency and voltage dependence of ε′, ε′, tanδ, electric modulus (M′ and M″ and σac of PrBaCoO nanofiber capacitor have been investigated by using impedance spectroscopy method. The obtained experimental results show that the values of ε′, ε′, tanδ, M′, M″ and σac of the PrBaCoO nanofiber capacitor are strongly dependent on frequency of applied bias voltage. The values of ε′, ε″ and tanδ show a steep decrease with increasing frequency for each forward bias voltage, whereas the values of σac and the electric modulus increase with increasing frequency. The high dispersion in ε′ and ε″ values at low frequencies may be attributed to the Maxwell–Wagner and space charge polarization. The high values of ε′ may be due to the interfacial effects within the material, PrBaCoO nanofibers interfacial layer and electron effect. The values of M′ and M″ reach a maximum constant value corresponding to M∞ ≈ 1/ε∞ due to the relaxation process at high frequencies, but both the values of M′ and M″ approach almost to zero at low frequencies. The changes in the dielectric and electrical properties with frequency can be also attributed to the existence of Nss and Rs of the capacitors. As a result, the change in the ε′, ε″, tanδ, M′, M″ and ac electric conductivity (σac is a result of restructuring and reordering of charges at the PrBaCoO/n-Si interface under an external electric field or voltage and interface polarization. Keywords: Thin films, Electrical properties, Interface/interphase

Equilibrium fluctuation relations for voltage coupling in membrane proteins.

Science.gov (United States)

Kim, Ilsoo; Warshel, Arieh

2015-11-01

A general theoretical framework is developed to account for the effects of an external potential on the energetics of membrane proteins. The framework is based on the free energy relation between two (forward/backward) probability densities, which was recently generalized to non-equilibrium processes, culminating in the work-fluctuation theorem. Starting from the probability densities of the conformational states along the "voltage coupling" reaction coordinate, we investigate several interconnected free energy relations between these two conformational states, considering voltage activation of ion channels. The free energy difference between the two conformational states at zero (depolarization) membrane potential (i.e., known as the chemical component of free energy change in ion channels) is shown to be equivalent to the free energy difference between the two "equilibrium" (resting and activated) conformational states along the one-dimensional voltage couplin reaction coordinate. Furthermore, the requirement that the application of linear response approximation to the free energy functionals of voltage coupling should satisfy the general free energy relations, yields a novel closed-form expression for the gating charge in terms of other basic properties of ion channels. This connection is familiar in statistical mechanics, known as the equilibrium fluctuation-response relation. The theory is illustrated by considering the coupling of a unit charge to the external voltage in the two sites near the surface of membrane, representing the activated and resting states. This is done using a coarse-graining (CG) model of membrane proteins, which includes the membrane, the electrolytes and the electrodes. The CG model yields Marcus-type voltage dependent free energy parabolas for the response of the electrostatic environment (electrolytes etc.) to the transition from the initial to the final configuratinal states, leading to equilibrium free energy difference and free

Achieving consistent image quality and overall radiation dose reduction for coronary CT angiography with body mass index-dependent tube voltage and tube current selection

International Nuclear Information System (INIS)

Wang, G.; Gao, J.; Zhao, S.; Sun, X.; Chen, X.; Cui, X.

2014-01-01

Aim: To develop a quantitative body mass index (BMI)-dependent tube voltage and tube current selection method for obtaining consistent image quality and overall dose reduction in computed tomography coronary angiography (CTCA). Methods and materials: The images of 190 consecutive patients (group A) who underwent CTCA with fixed protocols (100 kV/193 mAs for 100 patients with a BMI of <27 and 120 kV/175 mAs for 90 patients with a BMI of >27) were retrospectively analysed and reconstructed with an adaptive statistical iterative reconstruction (ASIR) algorithm at 50% blending. Image noise was measured and the relationship to BMI was studied to establish BMI-dependent tube current for obtaining CTCA images with user-specified image noise. One hundred additional cardiac patients (group B) were examined using prospective triggering with the BMI-dependent tube voltage/current. CTCA image-quality score, image noise, and effective dose from groups B and C (subgroup of A of 100 patients examined with prospective triggering only) were obtained and compared. Results: There was a linear relationship between image noise and BMI in group A. Using a BMI-dependent tube current in group B, an average CTCA image noise of 27.7 HU (target 28 HU) and 31.7 HU (target 33 HU) was obtained for the subgroups of patients with BMIs of >27 and of <27, respectively, and was independent of patient BMI. There was no difference between image-quality scores between groups B and C (4.52 versus 4.60, p > 0.05). The average effective dose for group B (2.56 mSv) was 42% lower than group C (4.38 mSv; p < 0.01). Conclusion: BMI-dependent tube voltage/current selection in CTCA provides an individualized protocol that generates consistent image quality and helps to reduce overall patient radiation dose. - Highlights: • BMI-dependent kVp and mA selection method may be established in CCTA. • BMI-dependent kVp and mA enables consistent CCTA image quality. • Overall dose reduction of 40% can

Relative and absolute level populations in beam-foil-excited neutral helium

Science.gov (United States)

Davidson, J.

1975-01-01

Relative and absolute populations of 19 levels in beam-foil-excited neutral helium at 0.275 MeV have been measured. The singlet angular-momentum sequences show dependences on principal quantum number consistent with n to the -3rd power, but the triplet sequences do not. Singlet and triplet angular-momentum sequences show similar dependences on level excitation energy. Excitation functions for six representative levels were measured in the range from 0.160 to 0.500 MeV. The absolute level populations increase with energy, whereas the neutral fraction of the beam decreases with energy. Further, the P angular-momentum levels are found to be overpopulated with respect to the S and D levels. The overpopulation decreases with increasing principal quantum number.

Free-energy relationships in ion channels activated by voltage and ligand

Science.gov (United States)

Chowdhury, Sandipan

2013-01-01

Many ion channels are modulated by multiple stimuli, which allow them to integrate a variety of cellular signals and precisely respond to physiological needs. Understanding how these different signaling pathways interact has been a challenge in part because of the complexity of underlying models. In this study, we analyzed the energetic relationships in polymodal ion channels using linkage principles. We first show that in proteins dually modulated by voltage and ligand, the net free-energy change can be obtained by measuring the charge-voltage (Q-V) relationship in zero ligand condition and the ligand binding curve at highly depolarizing membrane voltages. Next, we show that the voltage-dependent changes in ligand occupancy of the protein can be directly obtained by measuring the Q-V curves at multiple ligand concentrations. When a single reference ligand binding curve is available, this relationship allows us to reconstruct ligand binding curves at different voltages. More significantly, we establish that the shift of the Q-V curve between zero and saturating ligand concentration is a direct estimate of the interaction energy between the ligand- and voltage-dependent pathway. These free-energy relationships were tested by numerical simulations of a detailed gating model of the BK channel. Furthermore, as a proof of principle, we estimate the interaction energy between the ligand binding and voltage-dependent pathways for HCN2 channels whose ligand binding curves at various voltages are available. These emerging principles will be useful for high-throughput mutagenesis studies aimed at identifying interaction pathways between various regulatory domains in a polymodal ion channel. PMID:23250866

Cloning, chromosomal localization, and functional expression of the alpha 1 subunit of the L-type voltage-dependent calcium channel from normal human heart

NARCIS (Netherlands)

Schultz, D; Mikala, G; Yatani, A; Engle, D B; Iles, D E; Segers, B; Sinke, R J; Weghuis, D O; Klöckner, U; Wakamori, M

1993-01-01

A unique structural variant of the cardiac L-type voltage-dependent calcium channel alpha 1 subunit cDNA was isolated from libraries derived from normal human heart mRNA. The deduced amino acid sequence shows significant homology to other calcium channel alpha 1 subunits. However, differences from

Multi-objective optimization of distributed generation with voltage ...

African Journals Online (AJOL)

DR OKE

1*Department of Electrical Engineering, Kamla Nehru Institute of Technology Sultanpurr, ... of DG in distribution systems for different voltage dependent load models and .... The evaluation of the objective function depends only on location, size ...

Recording membrane potential changes through photoacoustic voltage sensitive dye

DEFF Research Database (Denmark)

Zhang, Haichong K.; Kang, Jeeun; Yan, Ping

2017-01-01

Monitoring of the membrane potential is possible using voltage sensitive dyes (VSD), where fluorescence intensity changes in response to neuronal electrical activity. However, fluorescence imaging is limited by depth of penetration and high scattering losses, which leads to low sensitivity in vivo...... systems for external detection. In contrast, photoacoustic (PA) imaging, an emerging modality, is capable of deep tissue, noninvasive imaging by combining near infrared light excitation and ultrasound detection. In this work, we develop the theoretical concept whereby the voltage-dependent quenching...... the experimental PA intensity change depends on fluorescence and absorbance properties of the dye. These results not only demonstrate the voltage sensing capability of the dye, but also indicate the necessity of considering both fluorescence and absorbance spectral sensitivities in order to optimize...

New method for determining avalanche breakdown voltage of silicon photomultipliers

International Nuclear Information System (INIS)

Chirikov-Zorin, I.

2017-01-01

The avalanche breakdown and Geiger mode of the silicon p-n junction is considered. A precise physically motivated method is proposed for determining the avalanche breakdown voltage of silicon photomultipliers (SiPM). The method is based on measuring the dependence of the relative photon detection efficiency (PDE rel ) on the bias voltage when one type of carriers (electron or hole) is injected into the avalanche multiplication zone of the p-n junction. The injection of electrons or holes from the base region of the SiPM semiconductor structure is performed using short-wave or long-wave light. At a low overvoltage (1-2 V) the detection efficiency is linearly dependent on the bias voltage; therefore, extrapolation to zero PDE rel value determines the SiPM avalanche breakdown voltage with an accuracy within a few millivolts. [ru

Utilization of 1H NMR in the determination of absolute configuration of alcohols

International Nuclear Information System (INIS)

Barreiros, Marizeth L.; David, Jorge M.; David, Juceni P. . E-juceni@ufba.br

2005-01-01

This review reports the determination of absolute configuration of primary and secondary alcohols by 1 H NMR spectroscopy, using the Mosher method. This method consists in the derivatization of an alcohol possessing unknown absolute configuration with one or both enantiomers of an auxiliary reagent. The resulting diastereoisomer spectra are registered and compared, and the chemical shift differences (Δδ R,S = δ R - δ S ) are measured. The determination of the absolute configuration of the alcohol molecule is based on the correlation between its chiral center and the auxiliary reagent's chiral center. Therefore, the determination of the absolute configuration depends on aromatic ring shielding effects on the substituents of the alcohol as evidenced by the 1 H NMR spectrum. (author)

ABSOLUTE NEUTRINO MASSES

DEFF Research Database (Denmark)

Schechter, J.; Shahid, M. N.

2012-01-01

We discuss the possibility of using experiments timing the propagation of neutrino beams over large distances to help determine the absolute masses of the three neutrinos.......We discuss the possibility of using experiments timing the propagation of neutrino beams over large distances to help determine the absolute masses of the three neutrinos....

Modeling hysteresis observed in the human erythrocyte voltage-dependent cation channel

DEFF Research Database (Denmark)

Flyvbjerg, Henrik; Gudowska-Nowak, Ewa; Christophersen, Palle

2012-01-01

The non-selective voltage-activated cation channel from human red cells, which is activated at depolarizing potentials, has been shown to exhibit counter-clockwise gating hysteresis. Here, we analyze this phenomenon with the simplest possible phenomenological models. Specifically, the hysteresis ...

Technical and economic considerations of extra high voltage power transmission

Energy Technology Data Exchange (ETDEWEB)

Kahnt, R

1966-09-01

The reasons for the employment of higher transmission voltages are listed and the points decisive for the selection of three phase ac or dc systems are reviewed. The technical and economic problems arising in three phase extra high voltage transmission are discussed. These include selection of voltage, economical design of power lines, insulation problems, power supply dependability, equipment rating and reactive power and stability problems.

Absolute dose measurement Gafchromic R EBT2 movies. Case Study of Kaposis sarcoma

International Nuclear Information System (INIS)

Pereira, L.; Moral, F. del; Meilan, E.; Azevedo Gomes, J. C. de; Tejeiro Garcia, A. G.; Andrade Alvarez, B.; Vazquez, J.; Nieto, I.; Medal, D.; Lopez Medina, A.; Francisco, S.; Salgado, M.; Munoz, V.

2011-01-01

Because of its high spatial resolution, low energy dependence and good response over a wide energy range, EBT2 Gafchromic films are widely used in many applications in radiotherapy for measuring relative dose. Despite being the most common use can be used to measure absolute dose. This text is an example of using films as EBT2 for in vivo absolute dose in a Kaposis sarcoma.

Analysis of temperature-dependant current–voltage characteristics and extraction of series resistance in Pd/ZnO Schottky barrier diodes

Energy Technology Data Exchange (ETDEWEB)

Mayimele, M A, E-mail: meehleketo@gmail.com; Rensburg, J P van. Janse; Auret, F D; Diale, M

2016-01-01

We report on the analysis of current voltage (I–V) measurements performed on Pd/ZnO Schottky barrier diodes (SBDs) in the 80–320 K temperature range. Assuming thermionic emission (TE) theory, the forward bias I–V characteristics were analysed to extract Pd/ZnO Schottky diode parameters. Comparing Cheung’s method in the extraction of the series resistance with Ohm’s law, it was observed that at lower temperatures (T<180 K) the series resistance decreased with increasing temperature, the absolute minimum was reached near 180 K and increases linearly with temperature at high temperatures (T>200 K). The barrier height and the ideality factor decreased and increased, respectively, with decrease in temperature, attributed to the existence of barrier height inhomogeneity. Such inhomogeneity was explained based on TE with the assumption of Gaussian distribution of barrier heights with a mean barrier height of 0.99 eV and a standard deviation of 0.02 eV. A mean barrier height of 0.11 eV and Richardson constant value of 37 A cm{sup −2} K{sup −2} were determined from the modified Richardson plot that considers the Gaussian distribution of barrier heights.

MOTOR ACCELERATION TIME OPTIMIZATION BY THE CHANGE OF THE SUPPLY VOLTAGE VALUE

Directory of Open Access Journals (Sweden)

G. K. Aslanov

2016-01-01

Full Text Available Abstract. It is proved that the deviation of the voltage from the nominal values, often leads to overheating of the motor windings, which reduces the insulation life to a great extent.The task of determining the change in the acceleration time of the motor depending on the switching time of its supply voltage is set. The modeling of DC motor 2ПН132М operation in the short- run changes in starting voltage from 380 V to 220 V - which is its nominal value-is carried out. By sweep method is determined the optimum time for switching the supply voltage of the motor. Mathematical dependencies and simulation results are presented. 

E-cigarettes: voltage- and concentration-dependent loss in human lung adenocarcinoma viability.

Science.gov (United States)

Otręba, Michał; Kośmider, Leon; Knysak, Jakub; Warncke, Jared D; Sobczak, Andrzej

2018-04-17

E-cigarettes are used by millions of people despite the fact that the harmful effect of aerosol emitted from these products to the human organism is still not clear. In this paper, toxicity of vapor generated using different solutions and battery output voltage on A549 cells viability is presented. The obtained EC 50 values for commercially available propylene glycol/glycerol solution 1:1 e-liquids based on 3.2 V (0.127%), 4.0 V (0.112%) and 4.8 V (0.038%) were about 1.5-4.5 times higher than in tobacco smoke (0.0086%). Furthermore, it was shown that the increase of battery output voltage decreased A549 cell viability. In addition, commercially available extracts were more cytotoxic than laboratory made extracts. Owing to the expansiveness of e-cigarettes, it is very important to estimate their impact on public health. Our results not only confirm less cytotoxicity of e-liquid aerosol than cigarette smoke, but also demonstrate that solutions used in e-liquids and, for the first time, battery output voltage have a significant impact on cytotoxicity of e-cigarette vapor. Thus, the results of this study are very important for the current and future legal regulations on e-cigarettes. Copyright © 2018 John Wiley & Sons, Ltd.

Absorption Voltages and Insulation Resistance in Ceramic Capacitors with Cracks

Science.gov (United States)

Teverovsky, Alexander

2016-01-01

Time dependence of absorption voltages (Vabs) in different types of low-voltage X5R and X7R ceramic capacitors was monitored for a maximum duration of hundred hours after polarization. To evaluate the effect of mechanical defects on Vabs, cracks in the dielectric were introduced either mechanically or by thermal shock. The maximum absorption voltage, time to roll-off, and the rate of voltage decrease are shown to depend on the crack-related leakage currents and insulation resistance in the parts. A simple model that is based on the Dow equivalent circuit for capacitors with absorption has been developed to assess the insulation resistance of capacitors. Standard measurements of the insulation resistance, contrary to the measurements based on Vabs, are not sensitive to the presence of mechanical defects and fail to reveal capacitors with cracks. Index Terms: Ceramic capacitor, insulation resistance, dielectric absorption, cracking.

Absolute nuclear material assay

Science.gov (United States)

Prasad, Manoj K [Pleasanton, CA; Snyderman, Neal J [Berkeley, CA; Rowland, Mark S [Alamo, CA

2010-07-13

A method of absolute nuclear material assay of an unknown source comprising counting neutrons from the unknown source and providing an absolute nuclear material assay utilizing a model to optimally compare to the measured count distributions. In one embodiment, the step of providing an absolute nuclear material assay comprises utilizing a random sampling of analytically computed fission chain distributions to generate a continuous time-evolving sequence of event-counts by spreading the fission chain distribution in time.

Technical and economic considerations of extra high voltage power transmission

Energy Technology Data Exchange (ETDEWEB)

Kahnt, R

1966-09-01

The reasons for the employment of higher transmission voltages are listed and the points decisive for the selection of three phase ac or dc systems are reviewed. This is followed by treatment of the technical and economic problems arising in three phase-extra high voltage transmission. These include selection of voltage, economical design of power lines, insulation problems, power supply dependability, equipment rating, and reactive power and stability problems.

Coordinated Voltage Control of Distributed PV Inverters for Voltage Regulation in Low Voltage Distribution Networks

DEFF Research Database (Denmark)

Nainar, Karthikeyan; Pokhrel, Basanta Raj; Pillai, Jayakrishnan Radhakrishna

2017-01-01

This paper reviews and analyzes the existing voltage control methods of distributed solar PV inverters to improve the voltage regulation and thereby the hosting capacity of a low-voltage distribution network. A novel coordinated voltage control method is proposed based on voltage sensitivity...... optimization. The proposed method is used to calculate the voltage bands and droop settings of PV inverters at each node by the supervisory controller. The local controller of each PV inverter implements the volt/var control and if necessary, the active power curtailment as per the received settings and based...... on measured local voltages. The advantage of the proposed method is that the calculated reactive power and active power droop settings enable fair contribution of the PV inverters at each node to the voltage regulation. Simulation studies are conducted using DigSilent Power factory software on a simplified...

Thermodynamics of negative absolute pressures

International Nuclear Information System (INIS)

Lukacs, B.; Martinas, K.

1984-03-01

The authors show that the possibility of negative absolute pressure can be incorporated into the axiomatic thermodynamics, analogously to the negative absolute temperature. There are examples for such systems (GUT, QCD) processing negative absolute pressure in such domains where it can be expected from thermodynamical considerations. (author)

Sign of inverse spin Hall voltages generated by ferromagnetic resonance and temperature gradients in yttrium iron garnet platinum bilayers

International Nuclear Information System (INIS)

Schreier, Michael; Lotze, Johannes; Gross, Rudolf; Goennenwein, Sebastian T B; Bauer, Gerrit E W; Uchida, Ken-ichi; Daimon, Shunsuke; Kikkawa, Takashi; Saitoh, Eiji; Vasyuchka, Vitaliy I; Lauer, Viktor; Chumak, Andrii V; Serga, Alexander A; Hillebrands, Burkard; Flipse, Joost; Van Wees, Bart J

2015-01-01

We carried out a concerted effort to determine the absolute sign of the inverse spin Hall effect voltage generated by spin currents injected into a normal metal. We focus on yttrium iron garnet (YIG)∣platinum bilayers at room temperature, generating spin currents by microwaves and temperature gradients. We find consistent results for different samples and measurement setups that agree with theory. We suggest a right-hand-rule to define a positive spin Hall angle corresponding to the voltage expected for the simple case of scattering of free electrons from repulsive Coulomb charges. (paper)

Voltage-sensing phosphatase modulation by a C2 domain.

Science.gov (United States)

Castle, Paul M; Zolman, Kevin D; Kohout, Susy C

2015-01-01

The voltage-sensing phosphatase (VSP) is the first example of an enzyme controlled by changes in membrane potential. VSP has four distinct regions: the transmembrane voltage-sensing domain (VSD), the inter-domain linker, the cytosolic catalytic domain, and the C2 domain. The VSD transmits the changes in membrane potential through the inter-domain linker activating the catalytic domain which then dephosphorylates phosphatidylinositol phosphate (PIP) lipids. The role of the C2, however, has not been established. In this study, we explore two possible roles for the C2: catalysis and membrane-binding. The Ci-VSP crystal structures show that the C2 residue Y522 lines the active site suggesting a contribution to catalysis. When we mutated Y522 to phenylalanine, we found a shift in the voltage dependence of activity. This suggests hydrogen bonding as a mechanism of action. Going one step further, when we deleted the entire C2 domain, we found voltage-dependent enzyme activity was no longer detectable. This result clearly indicates the entire C2 is necessary for catalysis as well as for modulating activity. As C2s are known membrane-binding domains, we tested whether the VSP C2 interacts with the membrane. We probed a cluster of four positively charged residues lining the top of the C2 and suggested by previous studies to interact with phosphatidylinositol 4,5-bisphosphate [PI(4,5)P2] (Kalli et al., 2014). Neutralizing those positive charges significantly shifted the voltage dependence of activity to higher voltages. We tested membrane binding by depleting PI(4,5)P2 from the membrane using the 5HT2C receptor and found that the VSD motions as measured by voltage clamp fluorometry (VCF) were not changed. These results suggest that if the C2 domain interacts with the membrane to influence VSP function it may not occur exclusively through PI(4,5)P2. Together, this data advances our understanding of the VSP C2 by demonstrating a necessary and critical role for the C2 domain in

Study of the Dependency on Magnetic Field and Bias Voltage of an AC-Biased TES Microcalorimeter

Science.gov (United States)

Gottardi, L.; Bruijn, M.; denHartog, R.; Hoevers, H.; deKorte, P.; vanderKuur, J.; Linderman, M.; Adams, J.; Bailey, C.; Bandler, S.;

Current-Voltage Characteristics of Bi-dithiolbenzene in Parallel Arrangement

International Nuclear Information System (INIS)

Boudjella, Aissa

2011-01-01

The low voltage conductance of interacting two 1,4-dithiolbenzene (DTB) molecules is investigated. The simulation results show that the electron transport can be controlled either by changing the Fermi level position E f or modifying its inter-molecular spacing d. Molecular assembly system with close interaction between DTB units, affects significantly the conductance. In addition, the position of the Fermi plays an important role in determining the current flow. Moreover, it is important to note that E f affects not only the threshold voltage V th , but also the saturation voltage V sat . When E f approaches the LUMO energy level, V th decreases, while V sat increases. To conclude, the threshold voltage and the saturation voltage depend on the Fermi level position and the inter-molecular spacing.

The sea anemone Bunodosoma caissarum toxin BcIII modulates the sodium current kinetics of rat dorsal root ganglia neurons and is displaced in a voltage-dependent manner.

Science.gov (United States)

Salceda, Emilio; López, Omar; Zaharenko, André J; Garateix, Anoland; Soto, Enrique

2010-03-01

Sea anemone toxins bind to site 3 of the sodium channels, which is partially formed by the extracellular linker connecting S3 and S4 segments of domain IV, slowing down the inactivation process. In this work we have characterized the actions of BcIII, a sea anemone polypeptide toxin isolated from Bunodosoma caissarum, on neuronal sodium currents using the patch clamp technique. Neurons of the dorsal root ganglia of Wistar rats (P5-9) in primary culture were used for this study (n=65). The main effects of BcIII were a concentration-dependent increase in the sodium current inactivation time course (IC(50)=2.8 microM) as well as an increase in the current peak amplitude. BcIII did not modify the voltage at which 50% of the channels are activated or inactivated, nor the reversal potential of sodium current. BcIII shows a voltage-dependent action. A progressive acceleration of sodium current fast inactivation with longer conditioning pulses was observed, which was steeper as more depolarizing were the prepulses. The same was observed for other two anemone toxins (CgNa, from Condylactis gigantea and ATX-II, from Anemonia viridis). These results suggest that the binding affinity of sea anemone toxins may be reduced in a voltage-dependent manner, as has been described for alpha-scorpion toxins. (c) 2009 Elsevier Inc. All rights reserved.

Ropivacaine-Induced Contraction Is Attenuated by Both Endothelial Nitric Oxide and Voltage-Dependent Potassium Channels in Isolated Rat Aortae

Directory of Open Access Journals (Sweden)

Seong-Ho Ok

2013-01-01

Full Text Available This study investigated endothelium-derived vasodilators and potassium channels involved in the modulation of ropivacaine-induced contraction. In endothelium-intact rat aortae, ropivacaine concentration-response curves were generated in the presence or absence of the following inhibitors: the nonspecific nitric oxide synthase (NOS inhibitor Nω-nitro-L-arginine methyl ester (L-NAME, the neuronal NOS inhibitor Nω-propyl-L-arginine hydrochloride, the inducible NOS inhibitor 1400W dihydrochloride, the nitric oxide-sensitive guanylyl cyclase (GC inhibitor ODQ, the NOS and GC inhibitor methylene blue, the phosphoinositide-3 kinase inhibitor wortmannin, the cytochrome p450 epoxygenase inhibitor fluconazole, the voltage-dependent potassium channel inhibitor 4-aminopyridine (4-AP, the calcium-activated potassium channel inhibitor tetraethylammonium (TEA, the inward-rectifying potassium channel inhibitor barium chloride, and the ATP-sensitive potassium channel inhibitor glibenclamide. The effect of ropivacaine on endothelial nitric oxide synthase (eNOS phosphorylation in human umbilical vein endothelial cells was examined by western blotting. Ropivacaine-induced contraction was weaker in endothelium-intact aortae than in endothelium-denuded aortae. L-NAME, ODQ, and methylene blue enhanced ropivacaine-induced contraction, whereas wortmannin, Nω-propyl-L-arginine hydrochloride, 1400W dihydrochloride, and fluconazole had no effect. 4-AP and TEA enhanced ropivacaine-induced contraction; however, barium chloride and glibenclamide had no effect. eNOS phosphorylation was induced by ropivacaine. These results suggest that ropivacaine-induced contraction is attenuated primarily by both endothelial nitric oxide and voltage-dependent potassium channels.

Radiation effects on residual voltage of polyethylene films

International Nuclear Information System (INIS)

Kyokane, Jun; Park, Dae-Hee; Yoshino, Katsumi.

1986-01-01

It has recently been pointed out that diagnosis of deterioration in insulating materials for electric cables used in nuclear power plants and outer space (communications satellite in particular) can be effectively performed based on measurements of residual voltage. In the present study, polyethylene films are irradiated with γ-rays or electron beam to examine the changes in residual voltage characteristics. Irradiation of electron beam and γ-rays are carried out to a dose of 0 - 90 Mrad and 0 - 100 Mrad, respectively. Measurements are made of the dependence of residual voltage on applied voltage, electron beam and γ-ray irradiation, annealing temperature and annealing time. Results show that carriers, which are once trapped after being released from the electrode, move within the material after the opening of the circuit to produce resiual voltage. The residual voltage increases with increasing dose of electron beam or γ-ray and levels off at high dose. Residual voltage is increased about several times by either electron beam or γ-rays, but electron beam tends to cause greater residual voltage than γ-ray. Polyethylene films irradiated with electron beam can recover upon annealing. It is concluded from observations made that residual voltage has close relations with defects in molecular structures caused by radiations, particularly the breaking of backbone chains and alteration in superstructures. (Nogami, K.)

Advanced DVR with Zero-Sequence Voltage Component and Voltage Harmonic Elimination for Three-Phase Three-Wire Distribution Systems

Directory of Open Access Journals (Sweden)

Margo P

2009-11-01

Full Text Available Dynamic Voltage Restorer (DVR is a power electronics device to protect sensitive load when voltage sag occurs. Commonly, sensitive loads are electronic-based devices which generate harmonics. The magnitude and phase of compensated voltage in DVR depend on grounding system and type of fault. If the system is floating, the zero sequence components do not appear on the load side. Meanwhile, in a neutral grounded system, voltage sag is extremely affected by zero sequence components. A blocking transformer is commonly installed in series with DVR to reduce the effect of zero sequence components. This paper proposes a new DVR control scheme that is capable of eliminating the blocking transformer and reducing harmonic distortion. The system uses fuzzy polar controller to replace the conventional PI or FL controller that is commonly used. By taking into account the zero sequence components in the controller design, the effects of zero sequence components can be compensated. Simulated results show the effectiveness of the proposed DVR controller

Skin secretion of Siphonops paulensis (Gymnophiona, Amphibia forms voltage-dependent ionic channels in lipid membranes

Directory of Open Access Journals (Sweden)

E.F. Schwartz

2003-09-01

Full Text Available The effect of the skin secretion of the amphibian Siphonops paulensis was investigated by monitoring the changes in conductance of an artificial planar lipid bilayer. Skin secretion was obtained by exposure of the animals to ether-saturated air, and then rinsing the animals with distilled water. Artificial lipid bilayers were obtained by spreading a solution of azolectin over an aperture of a Delrin cup inserted into a cut-away polyvinyl chloride block. In 9 of 12 experiments, the addition of the skin secretion to lipid bilayers displayed voltage-dependent channels with average unitary conductance of 258 ± 41.67 pS, rather than nonspecific changes in bilayer conductance. These channels were not sensitive to 4-acetamido-4'-isothiocyanatostilbene-2,2'-disulfonic acid or tetraethylammonium ion, but the experimental protocol used does not permit us to specify their characteristics.

Mitigation of Voltage Sags in CIGRE Low Voltage Distribution Network

DEFF Research Database (Denmark)

Mustafa, Ghullam; Bak-Jensen, Birgitte; Mahat, Pukar

2013-01-01

Any problem in voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM), Dynamic Voltage Restorer (DVR) etc. are commonly used for the mitigation of voltage p....... The compensation of voltage sags in the different parts of CIGRE distribution network is done by using the four STATCOM compensators already existing in the test grid. The simulations are carried out in DIgSILENT power factory software version 15.0.......Any problem in voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM), Dynamic Voltage Restorer (DVR) etc. are commonly used for the mitigation of voltage...... problems in the distribution system. The voltage problems dealt with in this paper are to show how to mitigate voltage sags in the CIGRE Low Voltage (LV) test network and networks like this. The voltage sags, for the tested cases in the CIGRE LV test network are mainly due to three phase faults...

Voltage dependent potassium channel remodeling in murine intestinal smooth muscle hypertrophy induced by partial obstruction.

Science.gov (United States)

Liu, Dong-Hai; Huang, Xu; Guo, Xin; Meng, Xiang-Min; Wu, Yi-Song; Lu, Hong-Li; Zhang, Chun-Mei; Kim, Young-chul; Xu, Wen-Xie

2014-01-01

Partial obstruction of the small intestine causes obvious hypertrophy of smooth muscle cells and motility disorder in the bowel proximate to the obstruction. To identify electric remodeling of hypertrophic smooth muscles in partially obstructed murine small intestine, the patch-clamp and intracellular microelectrode recording methods were used to identify the possible electric remodeling and Western blot, immunofluorescence and immunoprecipitation were utilized to examine the channel protein expression and phosphorylation level changes in this research. After 14 days of obstruction, partial obstruction caused obvious smooth muscle hypertrophy in the proximally located intestine. The slow waves of intestinal smooth muscles in the dilated region were significantly suppressed, their amplitude and frequency were reduced, whilst the resting membrane potentials were depolarized compared with normal and sham animals. The current density of voltage dependent potassium channel (KV) was significantly decreased in the hypertrophic smooth muscle cells and the voltage sensitivity of KV activation was altered. The sensitivity of KV currents (IKV) to TEA, a nonselective potassium channel blocker, increased significantly, but the sensitivity of IKv to 4-AP, a KV blocker, stays the same. The protein levels of KV4.3 and KV2.2 were up-regulated in the hypertrophic smooth muscle cell membrane. The serine and threonine phosphorylation levels of KV4.3 and KV2.2 were significantly increased in the hypertrophic smooth muscle cells. Thus this study represents the first identification of KV channel remodeling in murine small intestinal smooth muscle hypertrophy induced by partial obstruction. The enhanced phosphorylations of KV4.3 and KV2.2 may be involved in this process.

ESTIMATION OF DECREASING LOSSES OF ACTIVE POWER IN TRANSFORMERS IN SETTING BATTERY OF LOW-VOLTAGE CAPACITORS

Directory of Open Access Journals (Sweden)

V. N. Radkevich

2014-01-01

Full Text Available This paper describes an estimation method of decreasing losses of active power in power transformers with voltage 10(6/0,4 kV after installation of devices of reactive power compensation on output side depending on voltage level, connected to capacity devices, taking into account dielectric loss in capacitors. Analysis of functional dependences was carried out. Investigation of function with a help of derivations was carried out. Points of function extremum and also its intervals of rise and fall rates were founded. This paper describes graphic investigation of obtained functional dependence, which is introduced by quartic polynominal. It is established that decreasing of losses of active power depends on technical parameters and load factor of transformer, coefficient of loading power of electricity consumers, voltage value connected to capacitor unit.Using obtained functional dependences, calculations for the main size-types of power transformers with voltage 10(6/0,4 kV serie ТМГ 11 and ТМГ12 were done. It is established that depending on technical characteristics of certain transformer, coefficient of its loading and power, there is a definite value of deviation of real voltage value from working voltage of capacitor installation when it will be observed positive technical and economical effect from installed capacitor battery unit. For taken value of loading coefficient and transformer’s power the maximum decrease of losses of active power takes place under voltage directed to capacitor unit, which is lower then nominal value. For all taken size-types of power transformers the argument of investigating function for its maximal value is out of standard permissible of voltage deviations from nominal value.These functional dependents can be used for preliminary calculations, which are needed for making decision on compensation of reactive power in electric power supply systems of industrial objects. Their consideration allows more

Development of a New Cascade Voltage-Doubler for Voltage Multiplication

OpenAIRE

Toudeshki, Arash; Mariun, Norman; Hizam, Hashim; Abdul Wahab, Noor Izzri

2014-01-01

For more than eight decades, cascade voltage-doubler circuits are used as a method to produce DC output voltage higher than the input voltage. In this paper, the topological developments of cascade voltage-doublers are reviewed. A new circuit configuration for cascade voltage-doubler is presented. This circuit can produce a higher value of the DC output voltage and better output quality compared to the conventional cascade voltage-doubler circuits, with the same number of stages.

Distribution of voltage-dependent and intracellular Ca2+ channels in submucosal neurons from rat distal colon.

Science.gov (United States)

Rehn, Matthias; Bader, Sandra; Bell, Anna; Diener, Martin

2013-09-01

We recently observed a bradykinin-induced increase in the cytosolic Ca2+ concentration in submucosal neurons of rat colon, an increase inhibited by blockers of voltage-dependent Ca2+ (Ca(v)) channels. As the types of Ca(v) channels used by this part of the enteric nervous system are unknown, the expression of various Ca(v) subunits has been investigated in whole-mount submucosal preparations by immunohistochemistry. Submucosal neurons, identified by a neuronal marker (microtubule-associated protein 2), are immunoreactive for Ca(v)1.2, Ca(v)1.3 and Ca(v)2.2, expression being confirmed by reverse transcription plus the polymerase chain reaction. These data agree with previous observations that the inhibition of L- and N-type Ca2+ currents strongly inhibits the response to bradykinin. However, whole-cell patch-clamp experiments have revealed that bradykinin does not enhance Ca2+ inward currents under voltage-clamp conditions. Consequently, bradykinin does not directly interact with Ca(v) channels. Instead, the kinin-induced Ca2+ influx is caused indirectly by the membrane depolarization evoked by this peptide. As intracellular Ca2+ channels on Ca(2+)-storing organelles can also contribute to Ca2+ signaling, their expression has been investigated by imaging experiments and immunohistochemistry. Inositol 1,4,5-trisphosphate (IP3) receptors (IP3R) have been functionally demonstrated in submucosal neurons loaded with the Ca(2+)-sensitive fluorescent dye, fura-2. Histamine, a typical agonist coupled to the phospholipase C pathway, induces an increase in the fura-2 signal ratio, which is suppressed by 2-aminophenylborate, a blocker of IP3 receptors. The expression of IP3R1 has been confirmed by immunohistochemistry. In contrast, ryanodine, tested over a wide concentration range, evokes no increase in the cytosolic Ca2+ concentration nor is there immunohistochemical evidence for the expression of ryanodine receptors in these neurons. Thus, rat submucosal neurons are equipped

Ensuring long-term stability of infrared camera absolute calibration.

Science.gov (United States)

Kattnig, Alain; Thetas, Sophie; Primot, Jérôme

2015-07-13

Absolute calibration of cryogenic 3-5 µm and 8-10 µm infrared cameras is notoriously instable and thus has to be repeated before actual measurements. Moreover, the signal to noise ratio of the imagery is lowered, decreasing its quality. These performances degradations strongly lessen the suitability of Infrared Imaging. These defaults are often blamed on detectors reaching a different "response state" after each return to cryogenic conditions, while accounting for the detrimental effects of imperfect stray light management. We show here that detectors are not to be blamed and that the culprit can also dwell in proximity electronics. We identify an unexpected source of instability in the initial voltage of the integrating capacity of detectors. Then we show that this parameter can be easily measured and taken into account. This way we demonstrate that a one month old calibration of a 3-5 µm camera has retained its validity.

Suppressing voltage transients in high voltage power supplies

International Nuclear Information System (INIS)

Lickel, K.F.; Stonebank, R.

1979-01-01

A high voltage power supply for an X-ray tubes includes voltage adjusting means, a high voltage transformer, switch means connected to make and interrupt the primary current of the transformer, and over-voltage suppression means to suppress the voltage transient produced when the current is switched on. In order to reduce the power losses in the suppression means, an impedance is connected in the transformer primary circuit on operation of the switch means and is subsequently short-circuited by a switch controlled by a timer after a period which is automatically adjusted to the duration of the transient overvoltage. (U.K.)

Absolute linear thermal-expansion measurements on copper and aluminum from 5 to 320 K

International Nuclear Information System (INIS)

Kroeger, F.R.; Swenson, C.A.

1977-01-01

A linear absolute dilatometer based on a three-terminal parallel-plate capacitor design has been used to obtain thermal expansion data for high-purity copper and aluminum from 5 to 320 K. These data have an absolute accuracy of +- 0.1% above 20 K for copper and above 30 K for aluminum, and agree well with published data at the higher temperatures. The disagreement which exists with other data below 5 K for copper and below 15 K for aluminum is believed to be sample dependent, but the mechanism is not known. The aluminum results in this region depend on the state of annealing of the sample

Absolute single electron loss in collisions of Ar+ with various atoms

Science.gov (United States)

Reyes, P. G.; Martínez, H.; Castillo, F.

2001-07-01

Absolute differential and total cross sections for single electron loss were measured for Ar+ ions on various atoms in the energy range of 1.5 to 5.0 keV. The laboratory angular scan for the distributions ranged from -2.5 to 2.5 degrees. The measured differential cross sections have been integrated over the experimental angular range providing absolute total cross sections. The behavior of the total electron loss cross sections with the target atomic number, Zt, shows different dependences as the collision energy increases. In all cases it displays a saturation as Zt increases.

Current-voltage-temperature characteristics of DNA origami

Energy Technology Data Exchange (ETDEWEB)

Bellido, Edson P; Bobadilla, Alfredo D; Rangel, Norma L; Seminario, Jorge M [Department of Chemical Engineering, Texas A and M University, College Station, TX 77843 (United States); Zhong Hong; Norton, Michael L [Department of Chemistry, Marshall University, Huntington, WV 25755 (United States); Sinitskii, Alexander [Department of Chemistry, Rice University, Houston, TX 77005 (United States)

2009-04-29

The temperature dependences of the current-voltage characteristics of a sample of triangular DNA origami deposited in a 100 nm gap between platinum electrodes are measured using a probe station. Below 240 K, the sample shows high impedance, similar to that of the substrate. Near room temperature the current shows exponential behavior with respect to the inverse of temperature. Sweep times of 1 s do not yield a steady state; however sweep times of 450 s for the bias voltage secure a steady state. The thermionic emission and hopping conduction models yield similar barriers of {approx}0.7 eV at low voltages. For high voltages, the hopping conduction mechanism yields a barrier of 0.9 eV and the thermionic emission yields 1.1 eV. The experimental data set suggests that the dominant conduction mechanism is hopping in the range 280-320 K. The results are consistent with theoretical and experimental estimates of the barrier for related molecules.

Current-voltage-temperature characteristics of DNA origami

International Nuclear Information System (INIS)

Bellido, Edson P; Bobadilla, Alfredo D; Rangel, Norma L; Seminario, Jorge M; Zhong Hong; Norton, Michael L; Sinitskii, Alexander

2009-01-01

The temperature dependences of the current-voltage characteristics of a sample of triangular DNA origami deposited in a 100 nm gap between platinum electrodes are measured using a probe station. Below 240 K, the sample shows high impedance, similar to that of the substrate. Near room temperature the current shows exponential behavior with respect to the inverse of temperature. Sweep times of 1 s do not yield a steady state; however sweep times of 450 s for the bias voltage secure a steady state. The thermionic emission and hopping conduction models yield similar barriers of ∼0.7 eV at low voltages. For high voltages, the hopping conduction mechanism yields a barrier of 0.9 eV and the thermionic emission yields 1.1 eV. The experimental data set suggests that the dominant conduction mechanism is hopping in the range 280-320 K. The results are consistent with theoretical and experimental estimates of the barrier for related molecules.

Danish Towns during Absolutism

DEFF Research Database (Denmark)

This anthology, No. 4 in the Danish Urban Studies Series, presents in English recent significant research on Denmark's urban development during the Age of Absolutism, 1660-1848, and features 13 articles written by leading Danish urban historians. The years of Absolutism were marked by a general...

Optimization of Passive Voltage Multipliers for Fast Start-up and Multi-voltage Power Supplies in Electromagnetic Energy Harvesting Systems

Science.gov (United States)

Yang, G.; Stark, B. H.; Burrow, S. G.; Hollis, S. J.

2014-11-01

This paper demonstrates the use of passive voltage multipliers for rapid start-up of sub-milliwatt electromagnetic energy harvesting systems. The work describes circuit optimization to make as short as possible the transition from completely depleted energy storage to the first powering-up of an actively controlled switched-mode converter. The dependency of the start-up time on component parameters and topologies is derived by simulation and experimentation. The resulting optimized multiplier design reduces the start-up time from several minutes to 1 second. An additional improvement uses the inherent cascade structure of the voltage multiplier to power sub-systems at different voltages. This multi-rail start-up is shown to reduce the circuit losses of the active converter by 72% with respect to the optimized single-rail system. The experimental results provide insight into the multiplier's transient behaviour, including circuit interactions, in a complete harvesting system, and offer important information to optimize voltage multipliers for rapid start-up.

Optimization of Passive Voltage Multipliers for Fast Start-up and Multi-voltage Power Supplies in Electromagnetic Energy Harvesting Systems

International Nuclear Information System (INIS)

Yang, G; Stark, B H; Burrow, S G; Hollis, S J

2014-01-01

This paper demonstrates the use of passive voltage multipliers for rapid start-up of sub-milliwatt electromagnetic energy harvesting systems. The work describes circuit optimization to make as short as possible the transition from completely depleted energy storage to the first powering-up of an actively controlled switched-mode converter. The dependency of the start-up time on component parameters and topologies is derived by simulation and experimentation. The resulting optimized multiplier design reduces the start-up time from several minutes to 1 second. An additional improvement uses the inherent cascade structure of the voltage multiplier to power sub-systems at different voltages. This multi-rail start-up is shown to reduce the circuit losses of the active converter by 72% with respect to the optimized single-rail system. The experimental results provide insight into the multiplier's transient behaviour, including circuit interactions, in a complete harvesting system, and offer important information to optimize voltage multipliers for rapid start-up

Current-Voltage Characteristic of Nanosecond - Duration Relativistic Electron Beam

Science.gov (United States)

Andreev, Andrey

2005-10-01

The pulsed electron-beam accelerator SINUS-6 was used to measure current-voltage characteristic of nanosecond-duration thin annular relativistic electron beam accelerated in vacuum along axis of a smooth uniform metal tube immersed into strong axial magnetic field. Results of these measurements as well as results of computer simulations performed using 3D MAGIC code show that the electron-beam current dependence on the accelerating voltage at the front of the nanosecond-duration pulse is different from the analogical dependence at the flat part of the pulse. In the steady-state (flat) part of the pulse), the measured electron-beam current is close to Fedosov current [1], which is governed by the conservation law of an electron moment flow for any constant voltage. In the non steady-state part (front) of the pulse, the electron-beam current is higher that the appropriate, for a giving voltage, steady-state (Fedosov) current. [1] A. I. Fedosov, E. A. Litvinov, S. Ya. Belomytsev, and S. P. Bugaev, ``Characteristics of electron beam formed in diodes with magnetic insulation,'' Soviet Physics Journal (A translation of Izvestiya VUZ. Fizika), vol. 20, no. 10, October 1977 (April 20, 1978), pp.1367-1368.

First high-voltage measurements using Ca{sup +} ions at the ALIVE experiment

Energy Technology Data Exchange (ETDEWEB)

König, K., E-mail: kkoenig@ikp.tu-darmstadt.de [Technische Universität Darmstadt, Institut für Kernphysik (Germany); Geppert, Ch. [Universität Mainz, Institut für Kernchemie (Germany); Krämer, J.; Maaß, B. [Technische Universität Darmstadt, Institut für Kernphysik (Germany); Otten, E. W. [Universität Mainz, Institut für Physik (Germany); Ratajczyk, T.; Nörtershäuser, W. [Technische Universität Darmstadt, Institut für Kernphysik (Germany)

2017-11-15

Many physics experiments depend on accurate high-voltage measurements to determine for example the exact retardation potential of an electron spectrometer as in the KATRIN experiment or the acceleration voltage of the ions at ISOL facilities. Until now only precision high-voltage dividers can be used to measure voltages up to 65 kV with an accuracy of 1 ppm. However, these dividers need frequent calibration and cross-checking and the direct traceability is not given. In this article we will describe the status of an experiment which aims to measure high voltages using collinear laser spectroscopy and which has the potential to provide a high-voltage standard and hence, a calibration source for precision high-voltage dividers on the 1 ppm level.

Transient voltage sharing in series-coupled high voltage switches

Directory of Open Access Journals (Sweden)

Editorial Office

1992-07-01

Full Text Available For switching voltages in excess of the maximum blocking voltage of a switching element (for example, thyristor, MOSFET or bipolar transistor such elements are often coupled in series - and additional circuitry has to be provided to ensure equal voltage sharing. Between each such series element and system ground there is a certain parasitic capacitance that may draw a significant current during high-speed voltage transients. The "open" switch is modelled as a ladder network. Analy­sis reveals an exponential progression in the distribution of the applied voltage across the elements. Overstressing thus oc­curs in some of the elements at levels of the total voltage that are significantly below the design value. This difficulty is overcome by grading the voltage sharing circuitry, coupled in parallel with each element, in a prescribed manner, as set out here.

Voltage-sensing phosphatase modulation by a C2 domain

Directory of Open Access Journals (Sweden)

Paul M. Castle

2015-04-01

Full Text Available The voltage-sensing phosphatase (VSP is the first example of an enzyme controlled by changes in membrane potential. VSP has four distinct regions: the transmembrane voltage-sensing domain (VSD, the inter-domain linker, the cytosolic catalytic domain and the C2 domain. The VSD transmits the changes in membrane potential through the inter-domain linker activating the catalytic domain which then dephosphorylates phosphatidylinositol phosphate lipids. The role of the C2, however, has not been established. In this study, we explore two possible roles for the C2: catalysis and membrane-binding. The Ci-VSP crystal structures show that the C2 residue Y522 lines the active site suggesting a contribution to catalysis. When we mutated Y522 to phenylalanine, we found a shift in the voltage dependence of activity. This suggests hydrogen bonding as a mechanism of action. Going one step further, when we deleted the entire C2 domain, we found voltage-dependent enzyme activity was no longer detectable. This result clearly indicates the entire C2 is necessary for catalysis as well as for modulating activity. As C2s are known membrane-binding domains, we tested whether the VSP C2 interacts with the membrane. We probed a cluster of four positively charged residues lining the top of the C2 and suggested by previous studies to interact with phosphatidylinositol 4,5-bisphosphate (PI(4,5P2 (Kalli et al., 2014. Neutralizing those positive charges significantly shifted the voltage dependence of activity to higher voltages. We tested membrane binding by depleting PI(4,5P2 from the membrane using the 5HT2C receptor and found that the VSD motions as measured by voltage clamp fluorometry were not changed. These results suggest that if the C2 domain interacts with the membrane to influence VSP function it may not occur exclusively through PI(4,5P2. Together, this data advances our understanding of the VSP C2 by demonstrating a necessary and critical role for the C2 domain in

Oscillation of Critical Current by Gate Voltage in Cooper Pair Transistor

International Nuclear Information System (INIS)

Kim, N.; Cheong, Y.; Song, W.

2010-01-01

We measured the critical current of a Cooper pair transistor consisting of two Josephson junctions and a gate electrode. The Cooper pair transistors were fabricated by using electron-beam lithography and double-angle evaporation technique. The Gate voltage dependence of critical current was measured by observing voltage jumps at various gate voltages while sweeping bias current. The observed oscillation was 2e-periodic, which shows the Cooper pair transistor had low level of quasiparticle poisoning.

Voltage fluctuations in granular superconductors in the perpendicular configuration

International Nuclear Information System (INIS)

Gerashchenko, O V

2003-01-01

The spectral density of voltage fluctuations in granular YBa 2 Cu 3 O 7-δ superconductors in the perpendicular configuration has been studied in the flux flow mode. It has been found that, in this case, the 1/f-voltage noise observed depends weakly on temperature and is associated with motion of a magnetic flux in the superconductor. A comparison of the data obtained with the results of previous measurements in parallel configuration has shown that voltage noise is produced by a single common source, which is presumably associated with self-organization of the critical state in granular superconductors

Voltage quantization by ballistic vortices in two-dimensional superconductors

International Nuclear Information System (INIS)

Orlando, T.P.; Delin, K.A.

1991-01-01

The voltage generated by moving ballistic vortices with a mass m ν in a two-dimensional superconducting ring is quantized, and this quantization depends on the amount of charge enclosed by the ring. The quantization of the voltage is the dual to flux quantization in a superconductor, and is a manifestation of the Aharonov-Casher effect. The quantization is obtained by applying the Bohr-Sommerfeld criterion to the canonical momentum of the ballistic vortices. The results of this quantization condition can also be used to understand the persistent voltage predicted by van Wees for an array of Josephson junctions

Evolution of Voltage-Dependent Anion Channel Function: From Molecular Sieve to Governator to Actuator of Ferroptosis

Directory of Open Access Journals (Sweden)

John J. Lemasters

2017-12-01

Full Text Available The voltage-dependent anion channel (VDAC is well known as the pathway for passive diffusion of anionic hydrophilic mitochondrial metabolites across the outer membrane, but a more complex functionality of the three isoforms of VDAC has emerged, as addressed in the Frontiers in Oncology Research Topic on “Uncovering the Function of the Mitochondrial Protein VDAC in Health and Disease: from Structure-Function to Novel Therapeutic Strategies.” VDAC as the single most abundant protein in mitochondrial outer membranes is typically involved in isoform-specific interactions of the mitochondrion with its surroundings as, for example, during mitochondria-dependent pathways of cell death. VDAC closure can also act as an adjustable limiter (governator of global mitochondrial metabolism, as during hepatic ethanol metabolism to promote selective oxidation of membrane-permeant acetaldehyde. In cancer cells, high free tubulin inhibits VDAC1 and VDAC2, contributing to suppression of mitochondrial function in the Warburg phenomenon. Erastin, the canonical inducer of ferroptosis, opens VDAC in the presence of tubulin and hyperpolarizes mitochondria, leading to mitochondrial production of reactive oxygen species, mitochondrial dysfunction, and cell death. Our understanding of VDAC function continues to evolve.

Voltage Sensing in Membranes: From Macroscopic Currents to Molecular Motions.

Science.gov (United States)

Freites, J Alfredo; Tobias, Douglas J

2015-06-01

Voltage-sensing domains (VSDs) are integral membrane protein units that sense changes in membrane electric potential, and through the resulting conformational changes, regulate a specific function. VSDs confer voltage-sensitivity to a large superfamily of membrane proteins that includes voltage-gated Na[Formula: see text], K[Formula: see text], Ca[Formula: see text] ,and H[Formula: see text] selective channels, hyperpolarization-activated cyclic nucleotide-gated channels, and voltage-sensing phosphatases. VSDs consist of four transmembrane segments (termed S1 through S4). Their most salient structural feature is the highly conserved positions for charged residues in their sequences. S4 exhibits at least three conserved triplet repeats composed of one basic residue (mostly arginine) followed by two hydrophobic residues. These S4 basic side chains participate in a state-dependent internal salt-bridge network with at least four acidic residues in S1-S3. The signature of voltage-dependent activation in electrophysiology experiments is a transient current (termed gating or sensing current) upon a change in applied membrane potential as the basic side chains in S4 move across the membrane electric field. Thus, the unique structural features of the VSD architecture allow for competing requirements: maintaining a series of stable transmembrane conformations, while allowing charge motion, as briefly reviewed here.

Artifactual voltage response recorded from hair cells with patch-clamp amplifiers.

Science.gov (United States)

Masetto, S; Weng, T; Valli, P; Correia, M J

1999-06-23

Patch-clamp amplifiers (PCAs) are commonly used to characterize voltage- and current-clamp responses in the same cell. However, the cell membrane voltage response can be severely distorted by PCAs working in the current-clamp mode. Here we compare the voltage response of pigeon semicircular canal hair cells in situ, recorded with two different PCAs, and with a classic microelectrode bridge amplifier (BA). We found that the voltage response of hair cells recorded with PCAs differed significantly from that recorded with the BA. The true hair cell membrane voltage response to positive current steps was characterized by a strongly damped oscillation, whose frequency and duration depended on hair cell location in the sensory crista ampullaris.

Voltage dependent potassium channel remodeling in murine intestinal smooth muscle hypertrophy induced by partial obstruction.

Directory of Open Access Journals (Sweden)

Dong-Hai Liu

Full Text Available Partial obstruction of the small intestine causes obvious hypertrophy of smooth muscle cells and motility disorder in the bowel proximate to the obstruction. To identify electric remodeling of hypertrophic smooth muscles in partially obstructed murine small intestine, the patch-clamp and intracellular microelectrode recording methods were used to identify the possible electric remodeling and Western blot, immunofluorescence and immunoprecipitation were utilized to examine the channel protein expression and phosphorylation level changes in this research. After 14 days of obstruction, partial obstruction caused obvious smooth muscle hypertrophy in the proximally located intestine. The slow waves of intestinal smooth muscles in the dilated region were significantly suppressed, their amplitude and frequency were reduced, whilst the resting membrane potentials were depolarized compared with normal and sham animals. The current density of voltage dependent potassium channel (KV was significantly decreased in the hypertrophic smooth muscle cells and the voltage sensitivity of KV activation was altered. The sensitivity of KV currents (IKV to TEA, a nonselective potassium channel blocker, increased significantly, but the sensitivity of IKv to 4-AP, a KV blocker, stays the same. The protein levels of KV4.3 and KV2.2 were up-regulated in the hypertrophic smooth muscle cell membrane. The serine and threonine phosphorylation levels of KV4.3 and KV2.2 were significantly increased in the hypertrophic smooth muscle cells. Thus this study represents the first identification of KV channel remodeling in murine small intestinal smooth muscle hypertrophy induced by partial obstruction. The enhanced phosphorylations of KV4.3 and KV2.2 may be involved in this process.

The Nitric Oxide Donor SNAP-Induced Amino Acid Neurotransmitter Release in Cortical Neurons. Effects of Blockers of Voltage-Dependent Sodium and Calcium Channels

Science.gov (United States)

Merino, José Joaquín; Arce, Carmen; Naddaf, Ahmad; Bellver-Landete, Victor; Oset-Gasque, Maria Jesús; González, María Pilar

2014-01-01

Background The discovery that nitric oxide (NO) functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated. Findings The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA) in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated. Conclusions Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons. PMID:24598811

The nitric oxide donor SNAP-induced amino acid neurotransmitter release in cortical neurons. Effects of blockers of voltage-dependent sodium and calcium channels.

Science.gov (United States)

Merino, José Joaquín; Arce, Carmen; Naddaf, Ahmad; Bellver-Landete, Victor; Oset-Gasque, Maria Jesús; González, María Pilar

2014-01-01

The discovery that nitric oxide (NO) functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated. The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA) in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated. Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons.

The nitric oxide donor SNAP-induced amino acid neurotransmitter release in cortical neurons. Effects of blockers of voltage-dependent sodium and calcium channels.

Directory of Open Access Journals (Sweden)

José Joaquín Merino

Full Text Available The discovery that nitric oxide (NO functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated.The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated.Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons.

Quantum phase slips and voltage fluctuations in superconducting nanowires

Energy Technology Data Exchange (ETDEWEB)

Semenov, Andrew G. [I.E. Tamm Department of Theoretical Physics, P.N. Lebedev Physics Institute, Moscow (Russian Federation); National Research University Higher School of Economics, Moscow (Russian Federation); Zaikin, Andrei D. [I.E. Tamm Department of Theoretical Physics, P.N. Lebedev Physics Institute, Moscow (Russian Federation); Institute of Nanotechnology, Karlsruhe Institute of Technology (KIT), Karlsruhe (Germany)

2017-06-15

We argue that quantum phase slips (QPS) may generate non-equilibrium voltage fluctuations in superconducting nanowires. In the low frequency limit we evaluate all cumulants of the voltage operator which obey Poisson statistics and show a power law dependence on the external bias. We specifically address quantum shot noise which power spectrum S{sub Ω} may depend non-monotonously on temperature. In the long wire limit S{sub Ω} decreases with increasing frequency Ω and vanishes beyond a threshold value of Ω at T → 0. Our predictions can be directly tested in future experiments with superconducting nanowires. (copyright 2017 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

Mitigation of voltage sags in the distribution system with dynamic voltage restorer

International Nuclear Information System (INIS)

Viglas, D.; Belan, A.

2012-01-01

Dynamic voltage restorer is a custom power device that is used to improve voltage sags or swells in electrical distribution system. The components of the Dynamic Voltage Restorer consist of injection transformers, voltage source inverter, passive filters and energy storage. The main function of the Dynamic voltage restorer is used to inject three phase voltage in series and in synchronism with the grid voltages in order to compensate voltage disturbances. This article deals with mitigation of voltage sags caused by three-phase short circuit. Dynamic voltage restorer is modelled in MATLAB/Simulink. (Authors)

Single-InN-Nanowire Nanogenerator with Upto 1 V Output Voltage

KAUST Repository

Huang, Chi-Te

2010-07-30

Piezoelectric potential of a InN nanowire (NW) growing along [011̄0] can be positive, negative, and zero depending on the direction of the applied transverse force. By measuring the output voltage of a InN-NW-based nanogenerator, about 40% to 55% of output voltages are within the range of ?1 and ?20 mV, and 25% to 30% of output voltages would exceed ?100 mV. Some output voltages could reach the magnitude of ?1000 mV, showing its great potential for fabricating high-output nanogenerators. © 2010 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Transport characteristics of n-ZnO/p-Si heterojunction as determined from temperature dependent current–voltage measurements

Energy Technology Data Exchange (ETDEWEB)

Djiokap, S.R. Tankio, E-mail: stive.tankiodjiokap@nmmu.ac.za; Urgessa, Z.N.; Mbulanga, C.M.; Venter, A.; Botha, J.R.

2016-01-01

Zinc oxide (ZnO) nanorods have been synthesized by a two-step chemical bath deposition process on silicon substrates having different dopant densities and orientations. Scanning electron microscopy and X-ray diffraction analysis reveal that the orientation of the Si substrate does not affect the orientation, distribution or crystallinity of the nanostructures. The electrical properties of the ZnO/Si heterojunction are also investigated by current–voltage (I–V) measurements. The ideality factor is found to be 2.6 at 295 K, indicating that complex current transport mechanisms are at play. Temperature dependent I–V characteristics have been used to determine the dominant transport mechanism. The experimental results suggest that in the low bias region the current is dominated by a trap assisted multi-step tunneling process.

Auditory working memory predicts individual differences in absolute pitch learning.

Science.gov (United States)

Van Hedger, Stephen C; Heald, Shannon L M; Koch, Rachelle; Nusbaum, Howard C

2015-07-01

Absolute pitch (AP) is typically defined as the ability to label an isolated tone as a musical note in the absence of a reference tone. At first glance the acquisition of AP note categories seems like a perceptual learning task, since individuals must assign a category label to a stimulus based on a single perceptual dimension (pitch) while ignoring other perceptual dimensions (e.g., loudness, octave, instrument). AP, however, is rarely discussed in terms of domain-general perceptual learning mechanisms. This is because AP is typically assumed to depend on a critical period of development, in which early exposure to pitches and musical labels is thought to be necessary for the development of AP precluding the possibility of adult acquisition of AP. Despite this view of AP, several previous studies have found evidence that absolute pitch category learning is, to an extent, trainable in a post-critical period adult population, even if the performance typically achieved by this population is below the performance of a "true" AP possessor. The current studies attempt to understand the individual differences in learning to categorize notes using absolute pitch cues by testing a specific prediction regarding cognitive capacity related to categorization - to what extent does an individual's general auditory working memory capacity (WMC) predict the success of absolute pitch category acquisition. Since WMC has been shown to predict performance on a wide variety of other perceptual and category learning tasks, we predict that individuals with higher WMC should be better at learning absolute pitch note categories than individuals with lower WMC. Across two studies, we demonstrate that auditory WMC predicts the efficacy of learning absolute pitch note categories. These results suggest that a higher general auditory WMC might underlie the formation of absolute pitch categories for post-critical period adults. Implications for understanding the mechanisms that underlie the

Voltage current characteristics of type III superconductors

International Nuclear Information System (INIS)

Dorofejev, G.L.; Imenitov, A.B.; Klimenko, E.Y.

1980-01-01

An adequate description of voltage-current characteristics is important in order to understand the nature of high critical current for the electrodynamic construction of type-III superconductors and for commercial superconductor specification. Homogeneous monofilament and multifilament Nb-Ti, Nb-Zr,Nb 3 Sn wires were investigated in different ranges of magnetic field, temperature and current. The shape of the voltage-current characteristics of multifilament wires, and the parameter's dependence on temperature and magnetic field may be explained qualitatively by the longitudinal heterogeneous nature of the filaments. A method of attaining the complete specification of the wire's electro-physical properties is proposed. It includes the traditional description of a critical surface (i.e. the surface corresponding to a certain conventional effective resistivity in T,B,J-space) and a description of any increasing parameter that depends on B and T. (author)

Voltage current characteristics of type III superconductors

Energy Technology Data Exchange (ETDEWEB)

Dorofeiev, G L; Imenitov, A B; Klimenko, E Y [Gosudarstvennyi Komitet po Ispol' zovaniyu Atomnoi Ehnergii SSSR, Moscow. Inst. Atomnoi Ehnergii

1980-06-01

An adequate description of voltage-current characteristics is important in order to understand the nature of high critical current for the electrodynamic construction of type-III superconductors and for commercial superconductor specification. Homogeneous monofilament and multifilament Nb-Ti, Nb-Zr,Nb/sub 3/Sn wires were investigated in different ranges of magnetic field, temperature and current. The shape of the voltage-current characteristics of multifilament wires, and the parameter's dependence on temperature and magnetic field may be explained qualitatively by the longitudinal heterogeneous nature of the filaments. A method of attaining the complete specification of the wire's electro-physical properties is proposed. It includes the traditional description of a critical surface (i.e. the surface corresponding to a certain conventional effective resistivity in T,B,J-space) and a description of any increasing parameter that depends on B and T.

Mutagenesis in mammalian cells can be modulated by radiation-induced voltage-dependent potassium channels

International Nuclear Information System (INIS)

Saad, A.H.; Zhou, L.Y.; Lambe, E.K.; Hahn, G.M.

1994-01-01

In mammalian cells, little is known about the initial events whose ultimate consequence is mutagenesis or DNA repair. The role the plasma membrane may play as an initiator of such a pathway is not understood. We show, for the first time, that membrane voltage-dependent potassium (K + ) currents, activated by ionizing radiation play a significant role in radiation mutagenesis. Specifically, we show that the frequency of mutation at the HGPRT locus is increased as expected to 37.6±4.0 mutations per 100,000 survivors by 800 cGy of ionizing radiation from a spontaneous frequency of 1.5±1.5. This increase, however, is abolished if either K + channel blocker, CsCl or BaCl 2 , is present for 2h following irradiation of the cells. RbCl, chemically similar to CsCl but known not to block K + channels, is ineffective in reducing the mutation frequency. Treatment of cells with CsCl or BaCl 2 had no effect on radiation-induced cell killing

Voltage regulating circuit

NARCIS (Netherlands)

2005-01-01

A voltage regulating circuit comprising a rectifier (2) for receiving an AC voltage (Vmains) and for generating a rectified AC voltage (vrec), and a capacitor (3) connected in parallel with said rectified AC voltage for providing a DC voltage (VDC) over a load (5), characterized by a unidirectional

CONTRIBUTIONS OF INTRACELLULAR IONS TO Kv CHANNEL VOLTAGE SENSOR DYNAMICS.

Directory of Open Access Journals (Sweden)

Samuel eGoodchild

2012-06-01

Full Text Available Voltage sensing domains of Kv channels control ionic conductance through coupling of the movement of charged residues in the S4 segment to conformational changes at the cytoplasmic region of the pore domain, that allow K+ ions to flow. Conformational transitions within the voltage sensing domain caused by changes in the applied voltage across the membrane field are coupled to the conducting pore region and the gating of ionic conductance. However, several other factors not directly linked to the voltage dependent movement of charged residues within the voltage sensor impact the dynamics of the voltage sensor, such as inactivation, ionic conductance, intracellular ion identity and block of the channel by intracellular ligands. The effect of intracellular ions on voltage sensor dynamics is of importance in the interpretation of gating current measurements and the physiology of pore/voltage sensor coupling. There is a significant amount of variability in the reported kinetics of voltage sensor deactivation kinetics of Kv channels attributed to different mechanisms such as open state stabilization, immobilization and relaxation processes of the voltage sensor. Here we separate these factors and focus on the causal role that intracellular ions can play in allosterically modulating the dynamics of Kv voltage sensor deactivation kinetics. These considerations are of critical importance in understanding the molecular determinants of the complete channel gating cycle from activation to deactivation.

Gating mechanism of Kv11.1 (hERG) K+ channels without covalent connection between voltage sensor and pore domains.

Science.gov (United States)

de la Peña, Pilar; Domínguez, Pedro; Barros, Francisco

2018-03-01

Kv11.1 (hERG, KCNH2) is a voltage-gated potassium channel crucial in setting the cardiac rhythm and the electrical behaviour of several non-cardiac cell types. Voltage-dependent gating of Kv11.1 can be reconstructed from non-covalently linked voltage sensing and pore modules (split channels), challenging classical views of voltage-dependent channel activation based on a S4-S5 linker acting as a rigid mechanical lever to open the gate. Progressive displacement of the split position from the end to the beginning of the S4-S5 linker induces an increasing negative shift in activation voltage dependence, a reduced z g value and a more negative ΔG 0 for current activation, an almost complete abolition of the activation time course sigmoid shape and a slowing of the voltage-dependent deactivation. Channels disconnected at the S4-S5 linker near the S4 helix show a destabilization of the closed state(s). Furthermore, the isochronal ion current mode shift magnitude is clearly reduced in the different splits. Interestingly, the progressive modifications of voltage dependence activation gating by changing the split position are accompanied by a shift in the voltage-dependent availability to a methanethiosulfonate reagent of a Cys introduced at the upper S4 helix. Our data demonstrate for the first time that alterations in the covalent connection between the voltage sensor and the pore domains impact on the structural reorganizations of the voltage sensor domain. Also, they support the hypothesis that the S4-S5 linker integrates signals coming from other cytoplasmic domains that constitute either an important component or a crucial regulator of the gating machinery in Kv11.1 and other KCNH channels.

Insulation Resistance and Leakage Currents in Low-Voltage Ceramic Capacitors with Cracks

Science.gov (United States)

Teverovsky, Alexander A.

2016-01-01

Measurement of insulation resistance (IR) in multilayer ceramic capacitors (MLCCs) is considered a screening technique that ensures the dielectric is defect-free. This work analyzes the effectiveness of this technique for revealing cracks in ceramic capacitors. It is shown that absorption currents prevail over the intrinsic leakage currents during standard IR measurements at room temperature. Absorption currents, and consequently IR, have a weak temperature dependence, increase linearly with voltage (before saturation), and are not sensitive to the presence of mechanical defects. In contrary, intrinsic leakage currents increase super-linearly with voltage and exponentially with temperature (activation energy is in the range from 0.6 eV to 1.1 eV). Leakage currents associated with the presence of cracks have a weaker dependence on temperature and voltage compared to the intrinsic leakage currents. For this reason, intrinsic leakage currents prevail at high temperatures and voltages, thus masking the presence of defects.

PLZT light transmittance memory driven with an asymmetric voltage pulse

International Nuclear Information System (INIS)

Inoue, Kazuhiko; Morita, Takeshi

2010-01-01

PLZT is a ferroelectric electro-optic material, which has been operated with a constant voltage supply to keep a certain optical property. In this study, we propose an optical transmittance memory effect by controlling the domain conditions. The keypoint is to use an asymmetric voltage pulse. In the positive direction, a sufficiently-large voltage is applied to align the polarization directions. After this operation, a relatively small light transmittance is memorized even after removing the electric field. On the other hand, in the negative direction, the amplitude of the voltage is adjusted to the coercive electric field. In this condition, the domain structure is almost the same as the depolarization state. With this voltage supply, the maximum light transmittance can be kept after removing the electric field. Using these voltage operations, the PLZT can obtain two light transmittance states depending on the domain structure. This memory effect should be useful for innovative optical scanners or shutters in the future.

The allosteric site regulates the voltage sensitivity of muscarinic receptors.

Science.gov (United States)

Hoppe, Anika; Marti-Solano, Maria; Drabek, Matthäus; Bünemann, Moritz; Kolb, Peter; Rinne, Andreas

2018-01-01

Muscarinic receptors (M-Rs) for acetylcholine (ACh) belong to the class A of G protein-coupled receptors. M-Rs are activated by orthosteric agonists that bind to a specific site buried in the M-R transmembrane helix bundle. In the active conformation, receptor function can be modulated either by allosteric modulators, which bind to the extracellular receptor surface or by the membrane potential via an unknown mechanism. Here, we compared the modulation of M 1 -Rs and M 3 -Rs induced by changes in voltage to their allosteric modulation by chemical compounds. We quantified changes in receptor signaling in single HEK 293 cells with a FRET biosensor for the G q protein cycle. In the presence of ACh, M 1 -R signaling was potentiated by voltage, similarly to positive allosteric modulation by benzyl quinolone carboxylic acid. Conversely, signaling of M 3 -R was attenuated by voltage or the negative allosteric modulator gallamine. Because the orthosteric site is highly conserved among M-Rs, but allosteric sites vary, we constructed "allosteric site" M 3 /M 1 -R chimeras and analyzed their voltage dependencies. Exchanging the entire allosteric sites eliminated the voltage sensitivity of ACh responses for both receptors, but did not affect their modulation by allosteric compounds. Furthermore, a point mutation in M 3 -Rs caused functional uncoupling of the allosteric and orthosteric sites and abolished voltage dependence. Molecular dynamics simulations of the receptor variants indicated a subtype-specific crosstalk between both sites, involving the conserved tyrosine lid structure of the orthosteric site. This molecular crosstalk leads to receptor subtype-specific voltage effects. Copyright © 2017 Elsevier Inc. All rights reserved.

"Slow" Voltage-Dependent Inactivation of CaV2.2 Calcium Channels Is Modulated by the PKC Activator Phorbol 12-Myristate 13-Acetate (PMA.

Directory of Open Access Journals (Sweden)

Lei Zhu

Full Text Available CaV2.2 (N-type voltage-gated calcium channels (Ca2+ channels play key roles in neurons and neuroendocrine cells including the control of cellular excitability, neurotransmitter / hormone secretion, and gene expression. Calcium entry is precisely controlled by channel gating properties including multiple forms of inactivation. "Fast" voltage-dependent inactivation is relatively well-characterized and occurs over the tens-to- hundreds of milliseconds timeframe. Superimposed on this is the molecularly distinct, but poorly understood process of "slow" voltage-dependent inactivation, which develops / recovers over seconds-to-minutes. Protein kinases can modulate "slow" inactivation of sodium channels, but little is known about if/how second messengers control "slow" inactivation of Ca2+ channels. We investigated this using recombinant CaV2.2 channels expressed in HEK293 cells and native CaV2 channels endogenously expressed in adrenal chromaffin cells. The PKC activator phorbol 12-myristate 13-acetate (PMA dramatically prolonged recovery from "slow" inactivation, but an inactive control (4α-PMA had no effect. This effect of PMA was prevented by calphostin C, which targets the C1-domain on PKC, but only partially reduced by inhibitors that target the catalytic domain of PKC. The subtype of the channel β-subunit altered the kinetics of inactivation but not the magnitude of slowing produced by PMA. Intracellular GDP-β-S reduced the effect of PMA suggesting a role for G proteins in modulating "slow" inactivation. We postulate that the kinetics of recovery from "slow" inactivation could provide a molecular memory of recent cellular activity and help control CaV2 channel availability, electrical excitability, and neurotransmission in the seconds-to-minutes timeframe.

Influence of Voltage on Main Characteristics of Electric Lighting Lamps

Directory of Open Access Journals (Sweden)

V. B. Kozlovskaya

2009-01-01

Full Text Available An analysis and systemization of data on influence of voltage value on main lighting engineering, electric and economic characteristics of incandescent lamps, gaseous-discharge lamps of low and high pressure have been made in the paper.Analytical and graphical dependences have been obtained that ensure to evaluate quantitative changes of corresponding lamp characteristics at voltage deviation from nominal value.

Voltage breakdown on niobium and copper surfaces

International Nuclear Information System (INIS)

Werner, G.R.; Padamsee, H.; Betzwieser, J.C.; Liu, Y.G.; Rubin, K.H.R.; Shipman, J.E.; Ying, L.T.

2003-01-01

Experiments have shown that voltage breakdown in superconducting niobium RF cavities is in many ways similar to voltage breakdown on niobium cathodes in DC voltage gaps; most striking are the distinctive starburst patterns and craters that mark the site of voltage breakdown in both superconducting cavities and DC vacuum gaps. Therefore, we can learn much about RF breakdown from simpler, faster DC experiments. We have direct evidence, in the form of before'' and ''after'' pictures, that breakdown events caused by high surface electric fields occur with high probability at contaminant particles on surfaces. Although the pre-breakdown behavior (field emission) seems to depend mostly on the contaminant particles present and little on the substrate, the breakdown event itself is greatly affected by the substrate-niobium, heavily oxidized niobium, electropolished copper, and diamond-machined copper cathodes lead to different kinds of breakdown events. By studying DC voltage breakdown we hope to learn more details about the processes involved in the transition from field emission to catastrophic arcing and the cratering of the surface; as well as learning how to prevent breakdown, we would like to learn how to cause breakdown, which could be important when ''processing'' cavities to reduce field emission. (author)

Coordinated control for low voltage ride-through of a PMSG-based wind power plant

Directory of Open Access Journals (Sweden)

Khagendra Thapa

2016-01-01

Full Text Available Wind turbine generators should be kept connected to a power grid, while supporting the voltage recovery in the case of a grid fault to meet low voltage ride-through requirement in some grid codes. This paper proposes a coordinated control scheme that prevents the increase in the DC-link voltage by reducing the active power in the machine side converter of permanent magnet synchronous generators (PMSGs in proportion to the voltage dip at the terminal of PMSGs. The proposed scheme changes the current priorities from the active current to the reactive current to inject more reactive power for a severe fault depending on the voltage dip. In addition, the grid-side converter operates in a voltage control mode with the slope, which is the ratio of reactive current capability to the voltage tolerance around a rated value. Moreover, during the fault, the slope is changed depending on the voltage dip to inject more reactive current. The performance of the proposed scheme is validated for a wind power plant consisting of 20 units of 5-MW PMSGs using an EMTP-RV simulator. The results demonstrate that the scheme enables the PMSGs not only to survive during the fault, but also to provide a dynamic reactive power support.

Simulating threshold voltage shift of MOS devices due to radiation in the low-dose range

CERN Document Server

Wan Xin Heng; Gao Wen Yu; Huang Ru; Wang Yang Yuan

2002-01-01

An analytical MOSFET threshold voltage shift model due to radiation in the low-dose range has been developed for circuit simulations. Experimental data in the literature shows that the model predictions are in good agreement. It is simple in functional form and hence computationally efficient. It can be used as a basic circuit simulation tool for analysing MOSFET exposed to a nuclear environment up to about 1 Mrad(Si). In accordance with common believe, radiation induced absolute change of threshold voltage was found to be larger in irradiated PMOS devices. However, if the radiation sensitivity is defined in the way authors did it, the results indicated NMOS rather than PMOS devices are more sensitive, specially at low doses. This is important from the standpoint of their possible application in dosimetry

A New Method for a Piezoelectric Energy Harvesting System Using a Backtracking Search Algorithm-Based PI Voltage Controller

Directory of Open Access Journals (Sweden)

Mahidur R. Sarker

2016-09-01

Full Text Available This paper presents a new method for a vibration-based piezoelectric energy harvesting system using a backtracking search algorithm (BSA-based proportional-integral (PI voltage controller. This technique eliminates the exhaustive conventional trial-and-error procedure for obtaining optimized parameter values of proportional gain (Kp, and integral gain (Ki for PI voltage controllers. The generated estimate values of Kp and Ki are executed in the PI voltage controller that is developed through the BSA optimization technique. In this study, mean absolute error (MAE is used as an objective function to minimize output error for a piezoelectric energy harvesting system (PEHS. The model for the PEHS is designed and analyzed using the BSA optimization technique. The BSA-based PI voltage controller of the PEHS produces a significant improvement in minimizing the output error of the converter and a robust, regulated pulse-width modulation (PWM signal to convert a MOSFET switch, with the best response in terms of rise time and settling time under various load conditions.

Induced Voltage in an Open Wire

Science.gov (United States)

Morawetz, K.; Gilbert, M.; Trupp, A.

2017-07-01

A puzzle arising from Faraday's law has been considered and solved concerning the question which voltage will be induced in an open wire with a time-varying homogeneous magnetic field. In contrast to closed wires where the voltage is determined by the time variance of the magnetic field and the enclosed area, in an open wire we have to integrate the electric field along the wire. It is found that the longitudinal electric field with respect to the wave vector contributes with 1/3 and the transverse field with 2/3 to the induced voltage. In order to find the electric fields the sources of the magnetic fields are necessary to know. The representation of a spatially homogeneous and time-varying magnetic field implies unavoidably a certain symmetry point or symmetry line which depend on the geometry of the source. As a consequence the induced voltage of an open wire is found to be the area covered with respect to this symmetry line or point perpendicular to the magnetic field. This in turn allows to find the symmetry points of a magnetic field source by measuring the voltage of an open wire placed with different angles in the magnetic field. We present exactly solvable models of the Maxwell equations for a symmetry point and for a symmetry line, respectively. The results are applicable to open circuit problems like corrosion and for astrophysical applications.

Voltage Stress on Y Capacitors from Indirect Lightning Pulses According to ED-14/DO-160

Science.gov (United States)

Meier, F.

2012-05-01

Transients due to lightning strikes on an aircraft's fuselage impose stress on the input filters of elec- tronic equipment. Permanent damage can occur when exceeding the voltage handling capacity of filter components causing a short circuit to ground. In ED-14/DO-160, section 22, a number of waveforms and levels are defined which are used to check the airworthiness of avionics equipment. Depending on pro- cedure and level, Y-capacitors are stressed by transient voltages which exceed their dielectric strength. The design engineer's task is a properly select the type and voltage rating of capacitors. With moderate simplifications, a LCR-series network is justified to calculate the peak voltage dependent on the capacitance.

Voltage-gated calcium flux mediates Escherichia coli mechanosensation.

Science.gov (United States)

Bruni, Giancarlo N; Weekley, R Andrew; Dodd, Benjamin J T; Kralj, Joel M

2017-08-29

Electrically excitable cells harness voltage-coupled calcium influx to transmit intracellular signals, typically studied in neurons and cardiomyocytes. Despite intense study in higher organisms, investigations of voltage and calcium signaling in bacteria have lagged due to their small size and a lack of sensitive tools. Only recently were bacteria shown to modulate their membrane potential on the timescale of seconds, and little is known about the downstream effects from this modulation. In this paper, we report on the effects of electrophysiology in individual bacteria. A genetically encoded calcium sensor expressed in Escherichia coli revealed calcium transients in single cells. A fusion sensor that simultaneously reports voltage and calcium indicated that calcium influx is induced by voltage depolarizations, similar to metazoan action potentials. Cytoplasmic calcium levels and transients increased upon mechanical stimulation with a hydrogel, and single cells altered protein concentrations dependent on the mechanical environment. Blocking voltage and calcium flux altered mechanically induced changes in protein concentration, while inducing calcium flux reproduced these changes. Thus, voltage and calcium relay a bacterial sense of touch and alter cellular lifestyle. Although the calcium effectors remain unknown, these data open a host of new questions about E. coli , including the identity of the underlying molecular players, as well as other signals conveyed by voltage and calcium. These data also provide evidence that dynamic voltage and calcium exists as a signaling modality in the oldest domain of life, and therefore studying electrophysiology beyond canonical electrically excitable cells could yield exciting new findings.

Improvement of Gaofen-3 Absolute Positioning Accuracy Based on Cross-Calibration

Directory of Open Access Journals (Sweden)

Mingjun Deng

2017-12-01

Full Text Available The Chinese Gaofen-3 (GF-3 mission was launched in August 2016, equipped with a full polarimetric synthetic aperture radar (SAR sensor in the C-band, with a resolution of up to 1 m. The absolute positioning accuracy of GF-3 is of great importance, and in-orbit geometric calibration is a key technology for improving absolute positioning accuracy. Conventional geometric calibration is used to accurately calibrate the geometric calibration parameters of the image (internal delay and azimuth shifts using high-precision ground control data, which are highly dependent on the control data of the calibration field, but it remains costly and labor-intensive to monitor changes in GF-3’s geometric calibration parameters. Based on the positioning consistency constraint of the conjugate points, this study presents a geometric cross-calibration method for the rapid and accurate calibration of GF-3. The proposed method can accurately calibrate geometric calibration parameters without using corner reflectors and high-precision digital elevation models, thus improving absolute positioning accuracy of the GF-3 image. GF-3 images from multiple regions were collected to verify the absolute positioning accuracy after cross-calibration. The results show that this method can achieve a calibration accuracy as high as that achieved by the conventional field calibration method.

Near threshold absolute TDCS: First results

International Nuclear Information System (INIS)

Roesel, T.; Schlemmer, P.; Roeder, J.; Frost, L.; Jung, K.; Ehrhardt, H.

1992-01-01

A new method, and first results for an impact energy 2 eV above the threshold of ionisation of helium, are presented for the measurement of absolute triple differential cross sections (TDCS) in a crossed beam experiment. The method is based upon measurement of beam/target overlap densities using known absolute total ionisation cross sections and of detection efficiencies using known absolute double differential cross sections (DDCS). For the present work the necessary absolute DDCS for 1 eV electrons had also to be measured. Results are presented for several different coplanar kinematics and are compared with recent DWBA calculations. (orig.)

Absolute entropy of ions in methanol

International Nuclear Information System (INIS)

Abakshin, V.A.; Kobenin, V.A.; Krestov, G.A.

1978-01-01

By measuring the initial thermoelectromotive forces of chains with bromo-silver electrodes in tetraalkylammonium bromide solutions the absolute entropy of bromide-ion in methanol is determined in the 298.15-318.15 K range. The anti Ssub(Brsup(-))sup(0) = 9.8 entropy units value is used for calculation of the absolute partial molar entropy of alkali metal ions and halogenide ions. It has been found that, absolute entropy of Cs + =12.0 entropy units, I - =14.0 entropy units. The obtained ion absolute entropies in methanol at 298.15 K within 1-2 entropy units is in an agreement with published data

Large time-dependent coercivity and resistivity modification under sustained voltage application in a Pt/Co/AlOx/Pt junction.

NARCIS (Netherlands)

Brink, van den A.; van der Heijden, M.A.J.; Swagten, H.J.M.; Koopmans, B.

2015-01-01

The coercivity and resistivity of a Pt/Co/AlOx/Pt junction are measured under sustained voltage application. High bias voltages of either polarity are determined to cause a strongly enhanced, reversible coercivity modification compared to low voltages. Time-resolved measurements show a logarithmic

Stray voltage mitigation

Energy Technology Data Exchange (ETDEWEB)

Jamali, B.; Piercy, R.; Dick, P. [Kinetrics Inc., Toronto, ON (Canada). Transmission and Distribution Technologies

2008-04-09

This report discussed issues related to farm stray voltage and evaluated mitigation strategies and costs for limiting voltage to farms. A 3-phase, 3-wire system with no neutral ground was used throughout North America before the 1930s. Transformers were connected phase to phase without any electrical connection between the primary and secondary sides of the transformers. Distribution voltage levels were then increased and multi-grounded neutral wires were added. The earth now forms a parallel return path for the neutral current that allows part of the neutral current to flow continuously through the earth. The arrangement is responsible for causing stray voltage. Stray voltage causes uneven milk production, increased incidences of mastitis, and can create a reluctance to drink water amongst cows when stray voltages are present. Off-farm sources of stray voltage include phase unbalances, undersized neutral wire, and high resistance splices on the neutral wire. Mitigation strategies for reducing stray voltage include phase balancing; conversion from single to 3-phase; increasing distribution voltage levels, and changing pole configurations. 22 refs., 5 tabs., 13 figs.

Sensing charges of the Ciona intestinalis voltage-sensing phosphatase.

Science.gov (United States)

Villalba-Galea, Carlos A; Frezza, Ludivine; Sandtner, Walter; Bezanilla, Francisco

2013-11-01

Voltage control over enzymatic activity in voltage-sensitive phosphatases (VSPs) is conferred by a voltage-sensing domain (VSD) located in the N terminus. These VSDs are constituted by four putative transmembrane segments (S1 to S4) resembling those found in voltage-gated ion channels. The putative fourth segment (S4) of the VSD contains positive residues that likely function as voltage-sensing elements. To study in detail how these residues sense the plasma membrane potential, we have focused on five arginines in the S4 segment of the Ciona intestinalis VSP (Ci-VSP). After implementing a histidine scan, here we show that four arginine-to-histidine mutants, namely R223H to R232H, mediate voltage-dependent proton translocation across the membrane, indicating that these residues transit through the hydrophobic core of Ci-VSP as a function of the membrane potential. These observations indicate that the charges carried by these residues are sensing charges. Furthermore, our results also show that the electrical field in VSPs is focused in a narrow hydrophobic region that separates the extracellular and intracellular space and constitutes the energy barrier for charge crossing.

Atomistic Modeling of Ion Conduction through the Voltage-Sensing Domain of the Shaker K+ Ion Channel.

Science.gov (United States)

Wood, Mona L; Freites, J Alfredo; Tombola, Francesco; Tobias, Douglas J

2017-04-20

Voltage-sensing domains (VSDs) sense changes in the membrane electrostatic potential and, through conformational changes, regulate a specific function. The VSDs of wild-type voltage-dependent K + , Na + , and Ca 2+ channels do not conduct ions, but they can become ion-permeable through pathological mutations in the VSD. Relatively little is known about the underlying mechanisms of conduction through VSDs. The most detailed studies have been performed on Shaker K + channel variants in which ion conduction through the VSD is manifested in electrophysiology experiments as a voltage-dependent inward current, the so-called omega current, which appears when the VSDs are in their resting state conformation. Only monovalent cations appear to permeate the Shaker VSD via a pathway that is believed to be, at least in part, the same as that followed by the S4 basic side chains during voltage-dependent activation. We performed μs-time scale atomistic molecular dynamics simulations of a cation-conducting variant of the Shaker VSD under applied electric fields in an experimentally validated resting-state conformation, embedded in a lipid bilayer surrounded by solutions containing guanidinium chloride or potassium chloride. Our simulations provide insights into the Shaker VSD permeation pathway, the protein-ion interactions that control permeation kinetics, and the mechanism of voltage-dependent activation of voltage-gated ion channels.

Current-voltage curve of sodium channels and concentration dependence of sodium permeability in frog skin

DEFF Research Database (Denmark)

Fuchs, W; Larsen, Erik Hviid; Lindemann, B

1977-01-01

1. The inward facing membranes of in vitro frog skin epithelium were depolarized with solutions of high K concentration. The electrical properties of the epithelium are then expected to be governed by the outward facing, Na-selective membrane.2. In this state, the transepithelial voltage (V...... was recorded. This procedure was repeated after blocking the Na channels with amiloride to obtain the current-voltage curve of transmembrane and paracellular shunt pathways. The current-voltage curve of the Na channels was computed by subtracting the shunt current from the total current.4. The instantaneous I...... of the inward facing membranes but reflects the true behaviour of P(Na).6. The steady-state P(Na) at a given (Na)(o) is smaller than the transient P(Na) observed right after a stepwise increase of (Na)(o) to this value. The time constant of P(Na)-relaxation is in the order of seconds.7. In conclusion, Na...

Low voltage electron beam accelerators

International Nuclear Information System (INIS)

Ochi, Masafumi

2003-01-01

Widely used electron accelerators in industries are the electron beams with acceleration voltage at 300 kV or less. The typical examples are shown on manufactures in Japan, equipment configuration, operation, determination of process parameters, and basic maintenance requirement of the electron beam processors. New electron beam processors with acceleration voltage around 100 kV were introduced maintaining the relatively high dose speed capability of around 10,000 kGy x mpm at production by ESI (Energy Science Inc. USA, Iwasaki Electric Group). The application field like printing and coating for packaging requires treating thickness of 30 micron or less. It does not require high voltage over 110 kV. Also recently developed is a miniature bulb type electron beam tube with energy less than 60 kV. The new application area for this new electron beam tube is being searched. The drive force of this technology to spread in the industries would be further development of new application, process and market as well as the price reduction of the equipment, upon which further acknowledgement and acceptance of the technology to societies and industries would entirely depend. (Y. Tanaka)

Low voltage electron beam accelerators

Energy Technology Data Exchange (ETDEWEB)

Ochi, Masafumi [Iwasaki Electric Co., Ltd., Tokyo (Japan)

2003-02-01

Widely used electron accelerators in industries are the electron beams with acceleration voltage at 300 kV or less. The typical examples are shown on manufactures in Japan, equipment configuration, operation, determination of process parameters, and basic maintenance requirement of the electron beam processors. New electron beam processors with acceleration voltage around 100 kV were introduced maintaining the relatively high dose speed capability of around 10,000 kGy x mpm at production by ESI (Energy Science Inc. USA, Iwasaki Electric Group). The application field like printing and coating for packaging requires treating thickness of 30 micron or less. It does not require high voltage over 110 kV. Also recently developed is a miniature bulb type electron beam tube with energy less than 60 kV. The new application area for this new electron beam tube is being searched. The drive force of this technology to spread in the industries would be further development of new application, process and market as well as the price reduction of the equipment, upon which further acknowledgement and acceptance of the technology to societies and industries would entirely depend. (Y. Tanaka)

Unfolding of a Temperature-Sensitive Domain Controls Voltage-Gated Channel Activation.

Science.gov (United States)

Arrigoni, Cristina; Rohaim, Ahmed; Shaya, David; Findeisen, Felix; Stein, Richard A; Nurva, Shailika Reddy; Mishra, Smriti; Mchaourab, Hassane S; Minor, Daniel L

2016-02-25

Voltage-gated ion channels (VGICs) are outfitted with diverse cytoplasmic domains that impact function. To examine how such elements may affect VGIC behavior, we addressed how the bacterial voltage-gated sodium channel (BacNa(V)) C-terminal cytoplasmic domain (CTD) affects function. Our studies show that the BacNa(V) CTD exerts a profound influence on gating through a temperature-dependent unfolding transition in a discrete cytoplasmic domain, the neck domain, proximal to the pore. Structural and functional studies establish that the BacNa(V) CTD comprises a bi-partite four-helix bundle that bears an unusual hydrophilic core whose integrity is central to the unfolding mechanism and that couples directly to the channel activation gate. Together, our findings define a general principle for how the widespread four-helix bundle cytoplasmic domain architecture can control VGIC responses, uncover a mechanism underlying the diverse BacNa(V) voltage dependencies, and demonstrate that a discrete domain can encode the temperature-dependent response of a channel. Copyright © 2016 Elsevier Inc. All rights reserved.

Control of total voltage in the large distributed RF system of LEP

CERN Document Server

Ciapala, Edmond

1995-01-01

The LEP RF system is made up of a large number of independent RF units situated around the ring near the interaction points. These have different available RF voltages depending on their type and they may be inactive or unable to provide full voltage for certain periods. The original RF voltage control system was based on local RF unit voltage function generators pre-loaded with individual tables for energy ramping. This was replaced this year by a more flexible global RF voltage control system. A central controller in the main control room has direct access to the units over the LEP TDM system via multiplexers and local serial links. It continuously checks the state of all the units and adjusts their voltages to maintain the desired total voltage under all conditions. This voltage is distributed among the individual units to reduce the adverse effects of RF voltage asymmetry around the machine as far as possible. The central controller is a VME system with 68040 CPU and real time multitasking operating syste...

Practical experience in the determination of the tube voltage using the Ardran-Crooks cassette

International Nuclear Information System (INIS)

Ewen, K.; Roesner, W.

1984-01-01

Within the framework of quality control measures in X-ray diagnostics and therapy, it is desirable to employ for the determination of tube voltage (e.g. in diagnostic X-ray equipment) methods which are as economical as possible while saving time and being simple to apply in spite of the fact that they are as highly accurate as ever possible. The absorber method described here, represented by the Ardran-Crooks cassette, possesses the advantage of low price and easy application. However, if it is operated in such a way that time is saved (assessment by the eye), it is not so accurate, whereas in accurate operation (assessment via luxmeter) it does require a relatively large amount of time. After the film has been exposed, it is necessary to estimate or measure the agreement of blackenings on one and the same film in order to determine the tube voltage. This voltage is then read off by means of a calibration curve. The error in the determination of the tube voltage via the Ardran-Crooks cassette depends on the accuracy of the calibration curve, which, in turn, depends on the number of measurements performed when producing the curve, and on the correct voltage of the standard X-ray equipment used in producing the calibration curve. In addition, assessment by eye adds a total error of 2.3% to 8%, depending on the amount of tube voltage. If the luxmeter is used instead of the eye, this additional error is less than 1% in relation to the magnitude of the tube voltage. (orig./BWU) [de

Differential Activity of Voltage- and Ca2+-Dependent Potassium Channels in Leukemic T Cell Lines: Jurkat Cells Represent an Exceptional Case

Directory of Open Access Journals (Sweden)

Salvador Valle-Reyes

2018-05-01

Full Text Available Activation of resting T cells relies on sustained Ca2+ influx across the plasma membrane, which in turn depends on the functional expression of potassium channels, whose activity repolarizes the membrane potential. Depending on the T-cells subset, upon activation the expression of Ca2+- or voltage-activated K+ channels, KCa or Kv, is up-regulated. In this study, by means of patch-clamp technique in the whole cell mode, we have studied in detail the characteristics of Kv and KCa currents in resting and activated human T cells, the only well explored human T-leukemic cell line Jurkat, and two additional human leukemic T cell lines, CEM and MOLT-3. Voltage dependence of activation and inactivation of Kv1.3 current were shifted up to by 15 mV to more negative potentials upon a prolonged incubation in the whole cell mode and displayed little difference at a stable state in all cell lines but CEM, where the activation curve was biphasic, with a high and low potential components. In Jurkat, KCa currents were dominated by apamine-sensitive KCa2.2 channels, whereas only KCa3.1 current was detected in healthy T and leukemic CEM and MOLT-3 cells. Despite a high proliferation potential of Jurkat cells, Kv and KCa currents were unexpectedly small, more than 10-fold lesser as compared to activated healthy human T cells, CEM and MOLT-3, which displayed characteristic Kv1.3high:KCa3.1high phenotype. Our results suggest that Jurkat cells represent perhaps a singular case and call for more extensive studies on primary leukemic T cell lines as well as a verification of the therapeutic potential of specific KCa3.1 blockers to combat acute lymphoblastic T leukemias.

Antiausterity activity of arctigenin enantiomers: importance of (2R,3R)-absolute configuration.

Science.gov (United States)

Awale, Suresh; Kato, Mamoru; Dibwe, Dya Fita; Li, Feng; Miyoshi, Chika; Esumi, Hiroyasu; Kadota, Shigetoshi; Tezuka, Yasuhiro

2014-01-01

From a MeOH extract of powdered roots of Wikstroemia indica, six dibenzyl-gamma-butyrolactone-type lignans with (2S,3S)-absolute configuration [(+)-arctigenin (1), (+)-matairesinol (2), (+)-trachelogenin (3), (+)-nortrachelogenin (4), (+)-hinokinin (5), and (+)-kusunokinin (6)] were isolated, whereas three dibenzyl-gamma-butyrolactone-type lignans with (2R,3R)-absolute configuration [(-)-arctigenin (1*), (-)-matairesinol (2*), (-)-trachelogenin (3*)] were isolated from Trachelospermum asiaticum. The in vitro preferential cytotoxic activity of the nine compounds was evaluated against human pancreatic PANC-1 cancer cells in nutrient-deprived medium (NDM), but none of the six lignans (1-6) with (2S,3S)-absolute configuration showed preferential cytotoxicity. On the other hand, three lignans (1*-3*) with (2R,3R)-absolute configuration exhibited preferential cytotoxicity in a concentration-dependent manner with PC50 values of 0.54, 6.82, and 5.85 microM, respectively. Furthermore, the effect of (-)- and (+)-arctigenin was evaluated against the activation of Akt, which is a key process in the tolerance to nutrition starvation. Interestingly, only (-)-arctigenin (1*) strongly suppressed the activation of Akt. These results indicate that the (2R,3R)-absolute configuration of (-)-enantiomers should be required for the preferential cytotoxicity through the inhibition of Akt activation.

Reliability of supply of switchgear for auxiliary low voltage in substations extra high voltage to high voltage

Directory of Open Access Journals (Sweden)

Perić Dragoslav M.

2015-01-01

Full Text Available Switchgear for auxiliary low voltage in substations (SS of extra high voltages (EHV to high voltage (HV - SS EHV/HV kV/kV is of special interest for the functioning of these important SS, as it provides a supply for system of protection and other vital functions of SS. The article addresses several characteristic examples involving MV lines with varying degrees of independence of their supply, and the possible application of direct transformation EHV/LV through special voltage transformers. Auxiliary sources such as inverters and diesel generators, which have limited power and expensive energy, are also used for the supply of switchgear for auxiliary low voltage. Corresponding reliability indices are calculated for all examples including mean expected annual engagement of diesel generators. The applicability of certain solutions of switchgear for auxiliary low voltage SS EHV/HV, taking into account their reliability, feasibility and cost-effectiveness is analyzed too. In particular, the analysis of applications of direct transformation EHV/LV for supply of switchgear for auxiliary low voltage, for both new and existing SS EHV/HV.

Charge-pump voltage converter

Science.gov (United States)

Brainard, John P [Albuquerque, NM; Christenson, Todd R [Albuquerque, NM

2009-11-03

A charge-pump voltage converter for converting a low voltage provided by a low-voltage source to a higher voltage. Charge is inductively generated on a transfer rotor electrode during its transit past an inductor stator electrode and subsequently transferred by the rotating rotor to a collector stator electrode for storage or use. Repetition of the charge transfer process leads to a build-up of voltage on a charge-receiving device. Connection of multiple charge-pump voltage converters in series can generate higher voltages, and connection of multiple charge-pump voltage converters in parallel can generate higher currents. Microelectromechanical (MEMS) embodiments of this invention provide a small and compact high-voltage (several hundred V) voltage source starting with a few-V initial voltage source. The microscale size of many embodiments of this invention make it ideally suited for MEMS- and other micro-applications where integration of the voltage or charge source in a small package is highly desirable.

The recombination correction and the dependence of the response of plane parallel chambers on the polarizing voltage in pulsed electron and photon beams

International Nuclear Information System (INIS)

Roos, M.; Derikum, K.

2000-01-01

Based on an experimental investigation of the recombination effect in plane parallel chambers, a relation is deduced that allows the correction to be calculated from the electrode spacing and from the dose per pulse. It is shown that the uncertainties caused by the application of the Boag formula for volume recombination (recommended in the International Code of Practice TRS-381) amount to not more than about 0.1% for conventional beams. Calculated recombinations are compared with experimental results concerning the dependence of the response of various commercial plane parallel chambers on the polarizing voltage. Since it cannot be excluded that particular chambers collect a non-negligible amount of charge from regions outside the designated collecting volume or that the effective polarizing voltage is reduced by poor contacts, it seems advisable to experimentally check the chambers before use and before application of the analytical relations. (author)

High voltage systems

International Nuclear Information System (INIS)

Martin, M.

1991-01-01

Industrial processes usually require electrical power. This power is used to drive motors, to heat materials, or in electrochemical processes. Often the power requirements of a plant require the electric power to be delivered at high voltage. In this paper high voltage is considered any voltage over 600 V. This voltage could be as high as 138,000 V for some very large facilities. The characteristics of this voltage and the enormous amounts of power being transmitted necessitate special safety considerations. Safety must be considered during the four activities associated with a high voltage electrical system. These activities are: Design; Installation; Operation; and Maintenance

Influence of voltage on magnetization of ferromagnetic semiconductors with colossal magnetoresistance

International Nuclear Information System (INIS)

Povzner, A.A.; Volkov, A.G.

2017-01-01

Graphical abstract: We investigate nonequilibrium states of strongly correlated electron subsystem of lanthanum manganite, resulting in an external electric field. It is shown that the Joule heat leads to localization of electrons. As result, electric resistance, magnetization and other characteristics of the electronic system are depending on the applied voltage. This leads to the formation of the bistable state of the electronic system in the vicinity of the Curie point in an external electric field. This manifests itself in non-linear current-voltage characteristics of these substances, and should lead to oscillations of the magnetization and current. - Abstract: The nonequilibrium processes of “self-heating” arising during the flow of electric current are studied for ferromagnetic semiconductors with colossal magnetoresistance near the Curie temperature. These processes lead to the emergence of “hot” paramagnons and the destruction of ferromagnetic order. The solution to the heat balance equation takes into account the temperature dependence of the electrical conductivity caused by Anderson localization of electrons due to their scattering on magnetic inhomogeneities. Description of delocalized electrons subsystem takes into account the spin-flip processes leading to the double exchange. At that, the value of the Anderson percolation threshold and the double exchange depends on the amplitude of spin fluctuations. It was found that N-shaped current-voltage characteristics and hysteresis dependencies of magnetization on the voltage arise in a steady state due to the emergence of “hot” (by internal sample temperature) semiconductor paramagnetic phase. It is shown that the occurrence of self-oscillations of current and magnetization there may be.

Influence of voltage on magnetization of ferromagnetic semiconductors with colossal magnetoresistance

Energy Technology Data Exchange (ETDEWEB)

Povzner, A.A., E-mail: a.a.povzner@urfu.ru; Volkov, A.G., E-mail: agvolkov@yandex.ru

2017-06-15

Graphical abstract: We investigate nonequilibrium states of strongly correlated electron subsystem of lanthanum manganite, resulting in an external electric field. It is shown that the Joule heat leads to localization of electrons. As result, electric resistance, magnetization and other characteristics of the electronic system are depending on the applied voltage. This leads to the formation of the bistable state of the electronic system in the vicinity of the Curie point in an external electric field. This manifests itself in non-linear current-voltage characteristics of these substances, and should lead to oscillations of the magnetization and current. - Abstract: The nonequilibrium processes of “self-heating” arising during the flow of electric current are studied for ferromagnetic semiconductors with colossal magnetoresistance near the Curie temperature. These processes lead to the emergence of “hot” paramagnons and the destruction of ferromagnetic order. The solution to the heat balance equation takes into account the temperature dependence of the electrical conductivity caused by Anderson localization of electrons due to their scattering on magnetic inhomogeneities. Description of delocalized electrons subsystem takes into account the spin-flip processes leading to the double exchange. At that, the value of the Anderson percolation threshold and the double exchange depends on the amplitude of spin fluctuations. It was found that N-shaped current-voltage characteristics and hysteresis dependencies of magnetization on the voltage arise in a steady state due to the emergence of “hot” (by internal sample temperature) semiconductor paramagnetic phase. It is shown that the occurrence of self-oscillations of current and magnetization there may be.

The local domain wall position in ferromagnetic thin wires: simultaneous measurement of resistive and transverse voltages at multiple points

International Nuclear Information System (INIS)

Hanada, R.; Sugawara, H.; Aoki, Y.; Sato, H.; Shigeto, K.; Shinjo, T.; Ono, T.; Miyajima, H.

2002-01-01

We have simultaneously measured the field dependences of voltages at multiple pairs of resistance and transverse voltage probes in ferromagnetic wires (with either magnetic or non-magnetic voltage probes). Both the resistive (through the giant magnetoresistance and anisotropic magnetoresistance) and transverse voltages (through the planar Hall effect) exhibit abrupt jumps, reflecting discrete motion of domain walls or rotations of magnetization. Voltage probes, even if non-magnetic, are found to affect the jump fields depending on the sample conditions. We demonstrate that the specific information on the domain (wall) motion along a thin ferromagnetic wire could be obtained from the jump fields. (author)

Technical and economic aspects of the transmission of energy at extra high voltages

Energy Technology Data Exchange (ETDEWEB)

Kahnt, R

1967-01-01

The reasons for the employment of higher transmission voltages are listed and the points decisive for the selection of three phase ac or dc systems are reviewed. A treatment of the technical and economic problems arising in three phase extra high voltage transmission is presented. These include selection of voltage, economical design of power lines, insulation problems, power supply dependability, equipment rating and reactive power and stability problems.

Voltage current characteristics of type III superconductors

Science.gov (United States)

Dorofejev, G. L.; Imenitov, A. B.; Klimenko, E. Yu.

1980-06-01

An adequate description of voltage-current characteristics is important in order to understand the nature of high critical current for the electrodynamic construction of type-III superconductors and for commercial superconductor specification. Homogenious monofilament and multifilament Nb-Ti, Nb-Zr, Nb 3Sn wires were investigated in different ranges of magnetic field, temperature and current. The longitudinal electric field for homogenious wires may be described by E=J ρnexp- T c/T 0+ T/T 0+ B/B 0+ J/J 0, where To, Bo, Jo are the increasing parameters, which depend weakly on B and T, of the electric field. The shape of the voltage-current characteristics of multifilament wires, and the parameter's dependence on temperature and magnetic field may be explained qualitatively by the longitudinal heterogeneous nature of the filaments. A method of attaining the complete specification of the wire's electro-physical properties is proposed. It includes the traditional description of a critical surface (ie the surface corresponding to a certain conventional effective resistivity in T, B, J - space) and a description of any increasing parameter that depends on B and T.

Voltage Quench Dynamics of a Kondo System.

Science.gov (United States)

Antipov, Andrey E; Dong, Qiaoyuan; Gull, Emanuel

2016-01-22

We examine the dynamics of a correlated quantum dot in the mixed valence regime. We perform numerically exact calculations of the current after a quantum quench from equilibrium by rapidly applying a bias voltage in a wide range of initial temperatures. The current exhibits short equilibration times and saturates upon the decrease of temperature at all times, indicating Kondo behavior both in the transient regime and in the steady state. The time-dependent current saturation temperature connects the equilibrium Kondo temperature to a substantially increased value at voltages outside of the linear response. These signatures are directly observable by experiments in the time domain.

Observation of electrostatically released DNA from gold electrodes with controlled threshold voltages.

Science.gov (United States)

Takeishi, Shunsaku; Rant, Ulrich; Fujiwara, Tsuyoshi; Buchholz, Karin; Usuki, Tatsuya; Arinaga, Kenji; Takemoto, Kazuya; Yamaguchi, Yoshitaka; Tornow, Marc; Fujita, Shozo; Abstreiter, Gerhard; Yokoyama, Naoki

2004-03-22

DNA oligo-nucleotides, localized at Au metal electrodes in aqueous solution, are found to be released when applying a negative bias voltage to the electrode. The release was confirmed by monitoring the intensity of the fluorescence of cyanine dyes (Cy3) linked to the 5' end of the DNA. The threshold voltage of the release changes depending on the kind of linker added to the DNA 3'-terminal. The amount of released DNA depends on the duration of the voltage pulse. Using this technique, we can retain DNA at Au electrodes or Au needles, and release the desired amount of DNA at a precise location in a target. The results suggest that DNA injection into living cells is possible with this method. (c) 2004 American Institute of Physics

Stimulation of Na+-alanine cotransport activates a voltage-dependent conductance in single proximal tubule cells isolated from frog kidney

Science.gov (United States)

Robson, L; Hunter, M

1999-01-01

The swelling induced by Na+-alanine cotransport in proximal tubule cells of the frog kidney is followed by regulatory volume decrease (RVD). This RVD is inhibited by gadolinium (Gd3+), an inhibitor of stretch-activated channels, but is independent of extracellular Ca2+. In this study, the whole cell patch clamp technique was utilized to examine the effect of Na+-alanine cotransport on two previously identified volume- and Gd3+-sensitive conductances. One conductance is voltage dependent and anion selective (GVD) whilst the other is voltage independent and cation selective (GVI). Addition of 5 mM L-alanine to the bathing solution increased the whole cell conductance and gave a positive (depolarizing) shift in the reversal potential (Vrev, equivalent to the membrane potential in current-clamped cells) consistent with activation of Na+-alanine cotransport. Vrev shifted from -36 ± 4·9 to +12·9 ± 4·2 mV (n= 15). In the presence of alanine, the total whole cell conductance had several components including the cotransporter conductance and GVD and GVI. These conductances were separated using Gd3+, which inhibits both GVD and GVI, and the time dependency of GVD. Of these two volume-sensitive conductances, L-alanine elicited a specific increase in GVD, whereas GVI was unaffected. The L-alanine-induced activation of GVD was significantly reduced when cells were incubated in a hypertonic bathing solution. In summary, in single proximal tubule cells isolated from frog kidney, on stimulation of Na+-alanine cotransport GVD is activated, while GVI is unaffected. Taken with other evidence, this suggests that GVD is activated by cell swelling, consequent upon alanine entry, and may play a role as an anion efflux pathway during alanine-induced volume regulation. PMID:10226159

Nonsensing residues in S3-S4 linker's C terminus affect the voltage sensor set point in K+ channels.

Science.gov (United States)

Carvalho-de-Souza, Joao L; Bezanilla, Francisco

2018-02-05

Voltage sensitivity in ion channels is a function of highly conserved arginine residues in their voltage-sensing domains (VSDs), but this conservation does not explain the diversity in voltage dependence among different K + channels. Here we study the non-voltage-sensing residues 353 to 361 in Shaker K + channels and find that residues 358 and 361 strongly modulate the voltage dependence of the channel. We mutate these two residues into all possible remaining amino acids (AAs) and obtain Q-V and G-V curves. We introduced the nonconducting W434F mutation to record sensing currents in all mutants except L361R, which requires K + depletion because it is affected by W434F. By fitting Q-Vs with a sequential three-state model for two voltage dependence-related parameters ( V 0 , the voltage-dependent transition from the resting to intermediate state and V 1 , from the latter to the active state) and G-Vs with a two-state model for the voltage dependence of the pore domain parameter ( V 1/2 ), Spearman's coefficients denoting variable relationships with hydrophobicity, available area, length, width, and volume of the AAs in 358 and 361 positions could be calculated. We find that mutations in residue 358 shift Q-Vs and G-Vs along the voltage axis by affecting V 0 , V 1 , and V 1/2 according to the hydrophobicity of the AA. Mutations in residue 361 also shift both curves, but V 0 is affected by the hydrophobicity of the AA in position 361, whereas V 1 and V 1/2 are affected by size-related AA indices. Small-to-tiny AAs have opposite effects on V 1 and V 1/2 in position 358 compared with 361. We hypothesize possible coordination points in the protein that residues 358 and 361 would temporarily and differently interact with in an intermediate state of VSD activation. Our data contribute to the accumulating knowledge of voltage-dependent ion channel activation by adding functional information about the effects of so-called non-voltage-sensing residues on VSD dynamics. © 2018

Projective absoluteness for Sacks forcing

NARCIS (Netherlands)

Ikegami, D.

2009-01-01

We show that Sigma(1)(3)-absoluteness for Sacks forcing is equivalent to the nonexistence of a Delta(1)(2) Bernstein set. We also show that Sacks forcing is the weakest forcing notion among all of the preorders that add a new real with respect to Sigma(1)(3) forcing absoluteness.

Forecasting Error Calculation with Mean Absolute Deviation and Mean Absolute Percentage Error

Science.gov (United States)

Khair, Ummul; Fahmi, Hasanul; Hakim, Sarudin Al; Rahim, Robbi

2017-12-01

Prediction using a forecasting method is one of the most important things for an organization, the selection of appropriate forecasting methods is also important but the percentage error of a method is more important in order for decision makers to adopt the right culture, the use of the Mean Absolute Deviation and Mean Absolute Percentage Error to calculate the percentage of mistakes in the least square method resulted in a percentage of 9.77% and it was decided that the least square method be worked for time series and trend data.

Low-Energy Real-Time OS Using Voltage Scheduling Algorithm for Variable Voltage Processors

OpenAIRE

Okuma, Takanori; Yasuura, Hiroto

2001-01-01

This paper presents a real-time OS based on $ mu $ITRON using proposed voltage scheduling algorithm for variable voltage processors which can vary supply voltage dynamically. The proposed voltage scheduling algorithms assign voltage level for each task dynamically in order to minimize energy consumption under timing constraints. Using the presented real-time OS, running tasks with low supply voltage leads to drastic energy reduction. In addition, the presented voltage scheduling algorithm is ...

Extension algorithm for generic low-voltage networks

Science.gov (United States)

Marwitz, S.; Olk, C.

2018-02-01

Distributed energy resources (DERs) are increasingly penetrating the energy system which is driven by climate and sustainability goals. These technologies are mostly connected to low- voltage electrical networks and change the demand and supply situation in these networks. This can cause critical network states. Network topologies vary significantly and depend on several conditions including geography, historical development, network design or number of network connections. In the past, only some of these aspects were taken into account when estimating the network investment needs for Germany on the low-voltage level. Typically, fixed network topologies are examined or a Monte Carlo approach is used to quantify the investment needs at this voltage level. Recent research has revealed that DERs differ substantially between rural, suburban and urban regions. The low-voltage network topologies have different design concepts in these regions, so that different network topologies have to be considered when assessing the need for network extensions and investments due to DERs. An extension algorithm is needed to calculate network extensions and investment needs for the different typologies of generic low-voltage networks. We therefore present a new algorithm, which is capable of calculating the extension for generic low-voltage networks of any given topology based on voltage range deviations and thermal overloads. The algorithm requires information about line and cable lengths, their topology and the network state only. We test the algorithm on a radial, a loop, and a heavily meshed network. Here we show that the algorithm functions for electrical networks with these topologies. We found that the algorithm is able to extend different networks efficiently by placing cables between network nodes. The main value of the algorithm is that it does not require any information about routes for additional cables or positions for additional substations when it comes to estimating

THE ASH’ARITE DOGMA: THE ROOT OF THE ARAB/MUSLIM ABSOLUTISM

Directory of Open Access Journals (Sweden)

Ali Mabrook

2008-02-01

Full Text Available There are three major categories upon which all of the world’s civilizations are established, namely, God, Man and World. The differentiation of worldly civilizations and the diversity of systems of knowledge are due to the way of drawing up the relation thereby the three categories are arranged. Some scholars assumed that these categories are communicated and totally correlated each other, in a way that each cannot be realized except in its connectivity to the others. While some others thought that the three categories should be separated and disconnected, in a way that each of the three is realized as an absolute and dominant one while the two others are marginal and dependent ones. Needless to say, while the first perception provokes the values of tolerance and the acceptance of the other, the second one motivates absolutism and the negation of the other. Unfortunately the Ash’arism, not only a dogma but —and more importantly— a stable and dominant way of thinking, is stimulated by the second perception based on an absolutism and the negation of the other. It departs from that historical fact that this paper argues that absolutism, manifested in political, religious and cultural aspects of nowadays Muslims life, can be related to the dominance ofAsh’arism all over the Muslim world.

Impact of cell-voltage on energy and power performance of supercapacitors with single-walled carbon nanotube electrodes

Energy Technology Data Exchange (ETDEWEB)

Izadi-Najafabadi, Ali; Yamada, Takeo; Futaba, Don N.; Iijima, Sumio [Nanotube Research Center, National Institute of Advanced Industrial Science and Technology, Tsukuba (Japan); Hatori, Hiroaki [Project Headquarters, National Institute of Advanced Industrial Science and Technology, Tsukuba (Japan); Hata, Kenji [Japan Science and Technology Agency JST, Kawaguchi (Japan)

2010-12-15

We report the energy and power voltage-dependencies of supercapacitors using single-walled carbon nanotube electrodes. The energy density was dependent on the cell-voltage cubed (up to 4 V: E = 1.43 x V{sup 3}). The cubic relationship was attributed to the linear increase of the capacitance as a function of voltage, enabled by electrochemical doping. Furthermore, while up to 3.5 V, the maximum power rating of the nanotube electrodes increased as a function of the cell-voltage squared, beyond 3.5 V, a decline in power was observed as a result of depletion of the electrolyte's ions. (author)

Distributed stability control using intelligent voltage-margin relay

Energy Technology Data Exchange (ETDEWEB)

Wiszniewski, A.; Rebizant, W. [Wroclaw Univ. of Technology (Poland); Klimek, A. [Powertech Labs Inc., Surrey, BC (Canada)

2010-07-01

This paper presented an intelligent relay that operates if the load to source impedance ratio decreases to a level that is dangerously close to the stability limit, which leads to power system blackouts. The intelligent voltage-margin/difference relay installed at receiving substations automatically initiates action if the voltage stability margin drops to a dangerously low level. The relay decides if the tap changing devices are to be blocked and if under-voltage load shedding should be initiated, thereby mitigating an evolving instability. The intelligent relay has two levels of operation. At the first stage, which corresponds to the higher load to source impedance ratio, the relay initiates blocking of the tap changer. At the second stage, corresponding to the lower source to load impedance ratio, load shedding is initiated. The relay operates when the load to source impedance ratio reaches a certain predetermined level, but it does not depend either on the level of the source voltage or on the difference of source and load impedance phase angles. The algorithm for the relay is relatively simple and uses only locally available signals. Consequently, the transformer is well controlled to eliminate the cases of voltage instability. 6 refs., 7 figs.

Spectrum analysis of a voltage source converter due to semiconductor voltage drops

DEFF Research Database (Denmark)

Rasmussen, Tonny Wederberg; Eltouki, Mustafa

2017-01-01

It is known that power electronic voltage source converters are non-ideal. This paper presents a state-of-the-art review on the effect of semiconductor voltage drop on the output voltage spectrum, using single-phase H-bridge two-level converter topology with natural sampled pulse width modulation....... The paper describes the analysis of output voltage spectrum, when the semiconductor voltage drop is added. The results of the analysis of the spectral contribution including and excluding semiconductor voltage drop reveal a good agreement between the theoretical results, simulations and laboratory...

Voltage-gated potassium channels regulate calcium-dependent pathways involved in human T lymphocyte activation.

Science.gov (United States)

Lin, C S; Boltz, R C; Blake, J T; Nguyen, M; Talento, A; Fischer, P A; Springer, M S; Sigal, N H; Slaughter, R S; Garcia, M L

1993-03-01

The role that potassium channels play in human T lymphocyte activation has been investigated by using specific potassium channel probes. Charybdotoxin (ChTX), a blocker of small conductance Ca(2+)-activated potassium channels (PK,Ca) and voltage-gated potassium channels (PK,V) that are present in human T cells, inhibits the activation of these cells. ChTX blocks T cell activation induced by signals (e.g., anti-CD2, anti-CD3, ionomycin) that elicit a rise in intracellular calcium ([Ca2+]i) by preventing the elevation of [Ca2+]i in a dose-dependent manner. However, ChTX has no effect on the activation pathways (e.g., anti-CD28, interleukin 2 [IL-2]) that are independent of a rise in [Ca2+]i. In the former case, both proliferative response and lymphokine production (IL-2 and interferon gamma) are inhibited by ChTX. The inhibitory effect of ChTX can be demonstrated when added simultaneously, or up to 4 h after the addition of the stimulants. Since ChTX inhibits both PK,Ca and PK,V, we investigated which channel is responsible for these immunosuppressive effects with the use of two other peptides, noxiustoxin (NxTX) and margatoxin (MgTX), which are specific for PK,V. These studies demonstrate that, similar to ChTX, both NxTX and MgTX inhibit lymphokine production and the rise in [Ca2+]i. Taken together, these data provide evidence that blockade of PK,V affects the Ca(2+)-dependent pathways involved in T lymphocyte proliferation and lymphokine production by diminishing the rise in [Ca2+]i that occurs upon T cell activation.

Simple programmable voltage reference for low frequency noise measurements

Science.gov (United States)

Ivanov, V. E.; Chye, En Un

2018-05-01

The paper presents a circuit design of a low-noise voltage reference based on an electric double-layer capacitor, a microcontroller and a general purpose DAC. A large capacitance value (1F and more) makes it possible to create low-pass filter with a large time constant, effectively reducing low-frequency noise beyond its bandwidth. Choosing the optimum value of the resistor in the RC filter, one can achieve the best ratio between the transient time, the deviation of the output voltage from the set point and the minimum noise cut-off frequency. As experiments have shown, the spectral density of the voltage at a frequency of 1 kHz does not exceed 1.2 nV/√Hz the maximum deviation of the output voltage from the predetermined does not exceed 1.4 % and depends on the holding time of the previous value. Subsequently, this error is reduced to a constant value and can be compensated.

Temperature Dependences of Torque Generation and Membrane Voltage in the Bacterial Flagellar Motor

Science.gov (United States)

Inoue, Yuichi; Baker, Matthew A.B.; Fukuoka, Hajime; Takahashi, Hiroto; Berry, Richard M.; Ishijima, Akihiko

2013-01-01

In their natural habitats bacteria are frequently exposed to sudden changes in temperature that have been shown to affect their swimming. With our believed to be new methods of rapid temperature control for single-molecule microscopy, we measured here the thermal response of the Na+-driven chimeric motor expressed in Escherichia coli cells. Motor torque at low load (0.35 μm bead) increased linearly with temperature, twofold between 15°C and 40°C, and torque at high load (1.0 μm bead) was independent of temperature, as reported for the H+-driven motor. Single cell membrane voltages were measured by fluorescence imaging and these were almost constant (∼120 mV) over the same temperature range. When the motor was heated above 40°C for 1–2 min the torque at high load dropped reversibly, recovering upon cooling below 40°C. This response was repeatable over as many as 10 heating cycles. Both increases and decreases in torque showed stepwise torque changes with unitary size ∼150 pN nm, close to the torque of a single stator at room temperature (∼180 pN nm), indicating that dynamic stator dissociation occurs at high temperature, with rebinding upon cooling. Our results suggest that the temperature-dependent assembly of stators is a general feature of flagellar motors. PMID:24359752

Axonal voltage-gated ion channels as pharmacological targets for pain

DEFF Research Database (Denmark)

Moldovan, Mihai; Alvarez, Susana; Romer Rosberg, Mette

2013-01-01

Upon peripheral nerve injury (caused by trauma or disease process) axons of the dorsal root ganglion (DRG) somatosensory neurons have the ability to sprout and regrow/remyelinate to reinnervate distant target tissue or form a tangled scar mass called a neuroma. This regenerative response can become...... maladaptive leading to a persistent and debilitating pain state referred to as chronic pain corresponding to the clinical description of neuropathic/chronic inflammatory pain. There is little agreement to what causes peripheral chronic pain other than hyperactivity of the nociceptive DRG neurons which...... ultimately depends on the function of voltage-gated ion channels. This review focuses on the pharmacological modulators of voltage-gated ion channels known to be present on axonal membrane which represents by far the largest surface of DRG neurons. Blockers of voltage-gated Na(+) channels, openers of voltage...

Neutral-point voltage dynamic model of three-level NPC inverter for reactive load

DEFF Research Database (Denmark)

Maheshwari, Ram Krishan; Munk-Nielsen, Stig; Busquets-Monge, Sergio

2012-01-01

A three-level neutral-point-clamped inverter needs a controller for the neutral-point voltage. Typically, the controller design is based on a dynamic model. The dynamic model of the neutral-point voltage depends on the pulse width modulation technique used for the inverter. A pulse width modulati...

Cell wall microstructure, pore size distribution and absolute density of hemp shiv

Science.gov (United States)

Jiang, Y.; Lawrence, M.; Ansell, M. P.; Hussain, A.

2018-04-01

This paper, for the first time, fully characterizes the intrinsic physical parameters of hemp shiv including cell wall microstructure, pore size distribution and absolute density. Scanning electron microscopy revealed microstructural features similar to hardwoods. Confocal microscopy revealed three major layers in the cell wall: middle lamella, primary cell wall and secondary cell wall. Computed tomography improved the visualization of pore shape and pore connectivity in three dimensions. Mercury intrusion porosimetry (MIP) showed that the average accessible porosity was 76.67 ± 2.03% and pore size classes could be distinguished into micropores (3-10 nm) and macropores (0.1-1 µm and 20-80 µm). The absolute density was evaluated by helium pycnometry, MIP and Archimedes' methods. The results show that these methods can lead to misinterpretation of absolute density. The MIP method showed a realistic absolute density (1.45 g cm-3) consistent with the density of the known constituents, including lignin, cellulose and hemi-cellulose. However, helium pycnometry and Archimedes' methods gave falsely low values owing to 10% of the volume being inaccessible pores, which require sample pretreatment in order to be filled by liquid or gas. This indicates that the determination of the cell wall density is strongly dependent on sample geometry and preparation.

A Non-canonical Voltage-Sensing Mechanism Controls Gating in K2P K(+) Channels.

Science.gov (United States)

Schewe, Marcus; Nematian-Ardestani, Ehsan; Sun, Han; Musinszki, Marianne; Cordeiro, Sönke; Bucci, Giovanna; de Groot, Bert L; Tucker, Stephen J; Rapedius, Markus; Baukrowitz, Thomas

2016-02-25

Two-pore domain (K2P) K(+) channels are major regulators of excitability that endow cells with an outwardly rectifying background "leak" conductance. In some K2P channels, strong voltage-dependent activation has been observed, but the mechanism remains unresolved because they lack a canonical voltage-sensing domain. Here, we show voltage-dependent gating is common to most K2P channels and that this voltage sensitivity originates from the movement of three to four ions into the high electric field of an inactive selectivity filter. Overall, this ion-flux gating mechanism generates a one-way "check valve" within the filter because outward movement of K(+) induces filter opening, whereas inward movement promotes inactivation. Furthermore, many physiological stimuli switch off this flux gating mode to convert K2P channels into a leak conductance. These findings provide insight into the functional plasticity of a K(+)-selective filter and also refine our understanding of K2P channels and the mechanisms by which ion channels can sense voltage. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Universal Voltage Conveyor and Current Conveyor in Fast Full-Wave Rectifier

Directory of Open Access Journals (Sweden)

Josef Burian

2012-12-01

Full Text Available This paper deals about the design of a fast voltage-mode full-wave rectifier, where universal voltage conveyor and second-generation current conveyor are used as active elements. Thanks to the active elements, the input and output impedance of the non-linear circuit is infinitely high respectively zero in theory. For the rectification only two diodes and three resistors are required as passive elements. The performance of the circuit is shown on experimental measurement results showing the dynamic range, time response, frequency dependent DC transient value and RMS error for different values of input voltage amplitudes.

Low voltage excess noise and shot noise in YBCO bicrystal junctions

DEFF Research Database (Denmark)

Constantinian, K.Y.; Ovsyannikov, G.A.; Borisenko, I.V.

2002-01-01

The spectral density of background noise emitted by symmetric bicrystal YBaCuO Josephson junctions on sapphire substrates have been measured by a low noise cooled HEMT amplifier for bias voltages up to V approximate to 50 mV. At relatively low voltages V noise rise has been...... registered. At large bias voltages V > 30 mV a clear dependence of noise power. exactly coinciding to the asymptote of the Schottky shot noise function, has been observed for the first time. Experimental results are discussed in terms of multiple Andreev reflections which may take place in d...

Listening to membrane potential: photoacoustic voltage-sensitive dye recording

Science.gov (United States)

Zhang, Haichong K.; Yan, Ping; Kang, Jeeun; Abou, Diane S.; Le, Hanh N. D.; Jha, Abhinav K.; Thorek, Daniel L. J.; Kang, Jin U.; Rahmim, Arman; Wong, Dean F.; Boctor, Emad M.; Loew, Leslie M.

2017-04-01

Voltage-sensitive dyes (VSDs) are designed to monitor membrane potential by detecting fluorescence changes in response to neuronal or muscle electrical activity. However, fluorescence imaging is limited by depth of penetration and high scattering losses, which leads to low sensitivity in vivo systems for external detection. By contrast, photoacoustic (PA) imaging, an emerging modality, is capable of deep tissue, noninvasive imaging by combining near-infrared light excitation and ultrasound detection. Here, we show that voltage-dependent quenching of dye fluorescence leads to a reciprocal enhancement of PA intensity. We synthesized a near-infrared photoacoustic VSD (PA-VSD), whose PA intensity change is sensitive to membrane potential. In the polarized state, this cyanine-based probe enhances PA intensity while decreasing fluorescence output in a lipid vesicle membrane model. A theoretical model accounts for how the experimental PA intensity change depends on fluorescence and absorbance properties of the dye. These results not only demonstrate PA voltage sensing but also emphasize the interplay of both fluorescence and absorbance properties in the design of optimized PA probes. Together, our results demonstrate PA sensing as a potential new modality for recording and external imaging of electrophysiological and neurochemical events in the brain.

The voltage-sensing domain of a phosphatase gates the pore of a potassium channel.

Science.gov (United States)

Arrigoni, Cristina; Schroeder, Indra; Romani, Giulia; Van Etten, James L; Thiel, Gerhard; Moroni, Anna

2013-03-01

The modular architecture of voltage-gated K(+) (Kv) channels suggests that they resulted from the fusion of a voltage-sensing domain (VSD) to a pore module. Here, we show that the VSD of Ciona intestinalis phosphatase (Ci-VSP) fused to the viral channel Kcv creates Kv(Synth1), a functional voltage-gated, outwardly rectifying K(+) channel. Kv(Synth1) displays the summed features of its individual components: pore properties of Kcv (selectivity and filter gating) and voltage dependence of Ci-VSP (V(1/2) = +56 mV; z of ~1), including the depolarization-induced mode shift. The degree of outward rectification of the channel is critically dependent on the length of the linker more than on its amino acid composition. This highlights a mechanistic role of the linker in transmitting the movement of the sensor to the pore and shows that electromechanical coupling can occur without coevolution of the two domains.

Threshold-Voltage Shifts in Organic Transistors Due to Self-Assembled Monolayers at the Dielectric: Evidence for Electronic Coupling and Dipolar Effects.

Science.gov (United States)

Aghamohammadi, Mahdieh; Rödel, Reinhold; Zschieschang, Ute; Ocal, Carmen; Boschker, Hans; Weitz, R Thomas; Barrena, Esther; Klauk, Hagen

2015-10-21

The mechanisms behind the threshold-voltage shift in organic transistors due to functionalizing of the gate dielectric with self-assembled monolayers (SAMs) are still under debate. We address the mechanisms by which SAMs determine the threshold voltage, by analyzing whether the threshold voltage depends on the gate-dielectric capacitance. We have investigated transistors based on five oxide thicknesses and two SAMs with rather diverse chemical properties, using the benchmark organic semiconductor dinaphtho[2,3-b:2',3'-f]thieno[3,2-b]thiophene. Unlike several previous studies, we have found that the dependence of the threshold voltage on the gate-dielectric capacitance is completely different for the two SAMs. In transistors with an alkyl SAM, the threshold voltage does not depend on the gate-dielectric capacitance and is determined mainly by the dipolar character of the SAM, whereas in transistors with a fluoroalkyl SAM the threshold voltages exhibit a linear dependence on the inverse of the gate-dielectric capacitance. Kelvin probe force microscopy measurements indicate this behavior is attributed to an electronic coupling between the fluoroalkyl SAM and the organic semiconductor.

Analysis of bias voltage dependent spectral response in Ga0.51In0.49P/Ga0.99In0.01As/Ge triple junction solar cell

International Nuclear Information System (INIS)

Sogabe, Tomah; Ogura, Akio; Okada, Yoshitaka

2014-01-01

Spectral response measurement plays great role in characterizing solar cell device because it directly reflects the efficiency by which the device converts the sunlight into an electrical current. Based on the spectral response results, the short circuit current of each subcell can be quantitatively determined. Although spectral response dependence on wavelength, i.e., the well-known external quantum efficiency (EQE), has been widely used in characterizing multijunction solar cell and has been well interpreted, detailed analysis of spectral response dependence on bias voltage (SR −V bias ) has not been reported so far. In this work, we have performed experimental and numerical studies on the SR −V bias for Ga 0.51 In 0.49 P/Ga 0.99 In 0.01 As/Ge triple junction solar cell. Phenomenological description was given to clarify the mechanism of operation matching point variation in SR −V bias measurements. The profile of SR−V bias curve was explained in detail by solving the coupled two-diode current-voltage characteristic transcend formula for each subcell

Large conductance Ca2+-activated K+ (BK channel: Activation by Ca2+ and voltage

Directory of Open Access Journals (Sweden)

RAMÓN LATORRE

2006-01-01

Full Text Available Large conductance Ca2+-activated K+ (BK channels belong to the S4 superfamily of K+ channels that include voltage-dependent K+ (Kv channels characterized by having six (S1-S6 transmembrane domains and a positively charged S4 domain. As Kv channels, BK channels contain a S4 domain, but they have an extra (S0 transmembrane domain that leads to an external NH2-terminus. The BK channel is activated by internal Ca2+, and using chimeric channels and mutagenesis, three distinct Ca2+-dependent regulatory mechanisms with different divalent cation selectivity have been identified in its large COOH-terminus. Two of these putative Ca2+-binding domains activate the BK channel when cytoplasmic Ca2+ reaches micromolar concentrations, and a low Ca2+ affinity mechanism may be involved in the physiological regulation by Mg2+. The presence in the BK channel of multiple Ca2+-binding sites explains the huge Ca2+ concentration range (0.1 μM-100 μM in which the divalent cation influences channel gating. BK channels are also voltage-dependent, and all the experimental evidence points toward the S4 domain as the domain in charge of sensing the voltage. Calcium can open BK channels when all the voltage sensors are in their resting configuration, and voltage is able to activate channels in the complete absence of Ca2+. Therefore, Ca2+ and voltage act independently to enhance channel opening, and this behavior can be explained using a two-tiered allosteric gating mechanism.

Behavior of Multiclass Pesticide Residue Concentrations during the Transformation from Rose Petals to Rose Absolute.

Science.gov (United States)

Tascone, Oriane; Fillâtre, Yoann; Roy, Céline; Meierhenrich, Uwe J

2015-05-27

This study investigates the concentrations of 54 multiclass pesticides during the transformation processes from rose petal to concrete and absolute using roses spiked with pesticides as a model. The concentrations of the pesticides were followed during the process of transforming the spiked rose flowers from an organic field into concrete and then into absolute. The rose flowers, the concrete, and the absolute, as well as their transformation intermediates, were analyzed for pesticide content using gas chromatography/tandem mass spectrometry. We observed that all the pesticides were extracted and concentrated in the absolute, with the exception of three molecules: fenthion, fenamiphos, and phorate. Typical pesticides were found to be concentrated by a factor of 100-300 from the rose flowers to the rose absolute. The observed effect of pesticide enrichment was also studied in roses and their extracts from four classically phytosanitary treated fields. Seventeen pesticides were detected in at least one of the extracts. Like the case for the spiked samples in our model, the pesticides present in the rose flowers from Turkey were concentrated in the absolute. Two pesticides, methidathion and chlorpyrifos, were quantified in the rose flowers at approximately 0.01 and 0.01-0.05 mg kg(-1), respectively, depending on the treated field. The concentrations determined for the corresponding rose absolutes were 4.7 mg kg(-1) for methidathion and 0.65-27.25 mg kg(-1) for chlorpyrifos.

Physical implication of transition voltage in organic nano-floating-gate nonvolatile memories

Energy Technology Data Exchange (ETDEWEB)

Wang, Shun; Gao, Xu, E-mail: wangsd@suda.edu.cn, E-mail: gaoxu@suda.edu.cn; Zhong, Ya-Nan; Zhang, Zhong-Da; Xu, Jian-Long; Wang, Sui-Dong, E-mail: wangsd@suda.edu.cn, E-mail: gaoxu@suda.edu.cn [Institute of Functional Nano and Soft Materials (FUNSOM), Jiangsu Key Laboratory for Carbon-Based Functional Materials and Devices, Soochow University, Suzhou, Jiangsu 215123 (China)

2016-07-11

High-performance pentacene-based organic field-effect transistor nonvolatile memories, using polystyrene as a tunneling dielectric and Au nanoparticles as a nano-floating-gate, show parallelogram-like transfer characteristics with a featured transition point. The transition voltage at the transition point corresponds to a threshold electric field in the tunneling dielectric, over which stored electrons in the nano-floating-gate will start to leak out. The transition voltage can be modulated depending on the bias configuration and device structure. For p-type active layers, optimized transition voltage should be on the negative side of but close to the reading voltage, which can simultaneously achieve a high ON/OFF ratio and good memory retention.

Investigation of Vacuum Arc Voltage Characteristics Under Different Axial Magnetic Field Profiles

International Nuclear Information System (INIS)

Jia Shenli; Song Xiaochuan; Huo Xintao; Shi Zongqian; Wang Lijun

2010-01-01

Characteristics of the arc voltage under different profiles of axial magnetic field were investigated experimentally in a detachable vacuum chamber with five pairs of specially designed electrodes generating both bell-shaped and saddle-shaped magnetic field profile. The arc column and cathode spot images were photographed by a high speed digital camera. The dependence of the arc voltage on arcing evolution is analyzed. It is indicated that the axial magnetic field profile could affect the arc behaviors significantly, and the arc voltage is closely related to the arc light intensity.

Variance computations for functional of absolute risk estimates.

Science.gov (United States)

Pfeiffer, R M; Petracci, E

2011-07-01

We present a simple influence function based approach to compute the variances of estimates of absolute risk and functions of absolute risk. We apply this approach to criteria that assess the impact of changes in the risk factor distribution on absolute risk for an individual and at the population level. As an illustration we use an absolute risk prediction model for breast cancer that includes modifiable risk factors in addition to standard breast cancer risk factors. Influence function based variance estimates for absolute risk and the criteria are compared to bootstrap variance estimates.

Absolute determination of the deuterium content of heavy water, measurement of absolute density

International Nuclear Information System (INIS)

Ceccaldi, M.; Riedinger, M.; Menache, M.

1975-01-01

The absolute density of two heavy water samples rich in deuterium (with a grade higher than 99.9%) was determined with the hydrostatic method. The exact isotopic composition of this water (hydrogen and oxygen isotopes) was very carefully studied. A theoretical estimate enabled us to get the absolute density value of isotopically pure D 2 16 O. This value was found to be 1104.750 kg.m -3 at t 68 =22.3 0 C and under the pressure of one atmosphere. (orig.) [de

Influence of coupling parameter on current-voltage characteristics of intrinsic Josephson junctions in high-T c superconductors

International Nuclear Information System (INIS)

Shukrinov, Yu.M.; Mahfouzi, F.

2006-01-01

We study the current-voltage characteristics of intrinsic Josephson junctions in high-T c superconductors by numerical calculations and in framework of capacitively coupled Josephson junctions model we obtain the total number of branches. The influence of the coupling parameter α on the current-voltage characteristics at fixed parameter β (β 2 1/β c , where β c is McCumber parameter) and the influence of α on β-dependence of the current-voltage characteristics are investigated. We obtain the α-dependence of the branch's slopes and branch's endpoints. The presented results show new features of the coupling effect on the scheme of hysteresis jumps in current-voltage characteristics of intrinsic Josephson junctions in high-T c superconductors

Study on model current predictive control method of PV grid- connected inverters systems with voltage sag

Science.gov (United States)

Jin, N.; Yang, F.; Shang, S. Y.; Tao, T.; Liu, J. S.

2016-08-01

According to the limitations of the LVRT technology of traditional photovoltaic inverter existed, this paper proposes a low voltage ride through (LVRT) control method based on model current predictive control (MCPC). This method can effectively improve the photovoltaic inverter output characteristics and response speed. The MCPC method of photovoltaic grid-connected inverter designed, the sum of the absolute value of the predictive current and the given current error is adopted as the cost function with the model predictive control method. According to the MCPC, the optimal space voltage vector is selected. Photovoltaic inverter has achieved automatically switches of priority active or reactive power control of two control modes according to the different operating states, which effectively improve the inverter capability of LVRT. The simulation and experimental results proves that the proposed method is correct and effective.

Multifunction Voltage-Mode Filter Using Single Voltage Differencing Differential Difference Amplifier

Directory of Open Access Journals (Sweden)

Chaichana Amornchai

2017-01-01

Full Text Available In this paper, a voltage mode multifunction filter based on single voltage differencing differential difference amplifier (VDDDA is presented. The proposed filter with three input voltages and single output voltage is constructed with single VDDDA, two capacitors and two resistors. Its quality factor can be adjusted without affecting natural frequency. Also, the natural frequency can be electronically tuned via adjusting of bias current. The filter can offer five output responses, high-pas (HP, band-pass (BP, band-reject (BR, low-pass (LP and all-ass (AP functions in the same circuit topology. The output response can be selected by choosing the suitable input voltage without the component matching condition and the requirement of additional double gain voltage amplifier. PSpice simulation results to confirm an operation of the proposed filter correspond to the theory.

Expression, purification, and reconstitution of the voltage-sensing domain from Ci-VSP.

Science.gov (United States)

Li, Qufei; Jogini, Vishwanath; Wanderling, Sherry; Cortes, D Marien; Perozo, Eduardo

2012-10-16

The voltage-sensing domain (VSD) is the common scaffold responsible for the functional behavior of voltage-gated ion channels, voltage sensitive enzymes, and proton channels. Because of the position of the voltage dependence of the available VSD structures, at present, they all represent the activated state of the sensor. Yet in the absence of a consensus resting state structure, the mechanistic details of voltage sensing remain controversial. The voltage dependence of the VSD from Ci-VSP (Ci-VSD) is dramatically right shifted, so that at 0 mV it presumably populates the putative resting state. Appropriate biochemical methods are an essential prerequisite for generating sufficient amounts of Ci-VSD protein for high-resolution structural studies. Here, we present a simple and robust protocol for the expression of eukaryotic Ci-VSD in Escherichia coli at milligram levels. The protein is pure, homogeneous, monodisperse, and well-folded after solubilization in Anzergent 3-14 at the analyzed concentration (~0.3 mg/mL). Ci-VSD can be reconstituted into liposomes of various compositions, and initial site-directed spin labeling and electron paramagnetic resonance (EPR) spectroscopic measurements indicate its first transmembrane segment folds into an α-helix, in agreement with the homologous region of other VSDs. On the basis of our results and enhanced relaxation EPR spectroscopy measurement, Ci-VSD reconstitutes essentially randomly in proteoliposomes, precluding straightforward application of transmembrane voltages in combination with spectroscopic methods. Nevertheless, these results represent an initial step that makes the resting state of a VSD accessible to a variety of biophysical and structural approaches, including X-ray crystallography, spectroscopic methods, and electrophysiology in lipid bilayers.

Expression, Purification and Reconstitution of the Voltage Sensing Domain from Ci-VSP

Science.gov (United States)

Li, Qufei; Jogini, Vishwanath; Wanderling, Sherry; Cortes, D. Marien; Perozo, Eduardo

2013-01-01

The voltage-sensing domain (VSD) is the common scaffold responsible for the functional behavior of voltage gated ion channels, voltage sensitive enzymes and proton channels. Because of the position of the voltage dependence of the available VSD structures, at present, they all represent the activated state of the sensor. Yet, in the absence of a consensus resting state structure, the mechanistic details of voltage sensing remain controversial. The voltage dependence of the VSD from Ci-VSP (Ci-VSD) is dramatically right shifted, so that at 0 mV It presumably populates the putative resting state. Appropriate biochemical methods are an essential prerequisite to generate sufficient amounts of Ci-VSD protein for high-resolution structural studies. Here, we present a simple and robust protocol for the Escherichia coli expression of eukaryotic Ci-VSD at milligram levels. The protein is pure, homogeneous, mono-disperse and well folded after solubilization in Anzergent 3-14 at the analyzed concentration (~ 0.3 mg/mL). Ci-VSD can be reconstituted into liposomes of various compositions and initial site-directed spin labeling and EPR spectroscopic measurements indicate its first transmembrane segment folds into an α-helix, in agreement to the homologous region of other VSDs. Based on current results and enhanced relaxation EPR spectroscopy measurement, Ci-VSD reconstitutes essentially randomly in proteo-liposomes, precluding straightforward application of transmembrane voltages in combination with spectroscopic methods. Nevertheless, the present results represent an initial step that makes the resting state of a VSD accessible to a variety of biophysical and structural approaches, including X-ray crystallography, spectroscopic methods and electrophysiology in lipid bilayers. PMID:22989304

Calculation of Onset Voltage of Sliding Discharge over a Dielectric Barrier

Directory of Open Access Journals (Sweden)

Abdel-Salam Mazen

2016-01-01

Full Text Available This paper is aimed at calculating the onset voltage of a sliding discharge established between two electrodes at the upper and bottom surfaces of a dielectric barrier plate; named sliding dielectric barrier discharge (SDBD driven by AC voltage during negative half cycle. The onset voltage is based on the condition of self-sustenance of avalanche growth in the vicinity of the stressed electrode. This calls at first for calculation of the electric field in the vicinity of stressed electrode. The dependency of onset voltage on the thickness and permittivity of the dielectric barrier as well as the thickness of the stressed electrode and the inter-electrode spacing between the stressed and ground electrodes is investigated. The obtained results are discussed in the light of gas discharge physics.

The absolute environmental performance of buildings

DEFF Research Database (Denmark)

Brejnrod, Kathrine Nykjær; Kalbar, Pradip; Petersen, Steffen

2017-01-01

Our paper presents a novel approach for absolute sustainability assessment of a building's environmental performance. It is demonstrated how the absolute sustainable share of the earth carrying capacity of a specific building type can be estimated using carrying capacity based normalization factors....... A building is considered absolute sustainable if its annual environmental burden is less than its share of the earth environmental carrying capacity. Two case buildings – a standard house and an upcycled single-family house located in Denmark – were assessed according to this approach and both were found...... to exceed the target values of three (almost four) of the eleven impact categories included in the study. The worst-case excess was for the case building, representing prevalent Danish building practices, which utilized 1563% of the Climate Change carrying capacity. Four paths to reach absolute...

Temporary over voltages in the high voltage networks

International Nuclear Information System (INIS)

Vukelja, Petar; Naumov, Radomir; Mrvic, Jovan; Minovski, Risto

2001-01-01

The paper treats the temporary over voltages that may arise in the high voltage networks as a result of: ground faults, loss of load, loss of one or two phases and switching operation. Based on the analysis, the measures for their limitation are proposed. (Original)

Voltage-Dependent Anion Channel 2 of Arabidopsis thaliana (AtVDAC2 Is Involved in ABA-Mediated Early Seedling Development

Directory of Open Access Journals (Sweden)

Xufeng Li

2009-05-01

Full Text Available The voltage-dependent anion channel (VDAC is the major transport protein in the outer membrane of mitochondria and plays crucial roles in energy metabolism, apoptosis, and metabolites transport. In plants, the expression of VDACs can be affected by different stresses, including drought, salinity and pathogen defense. In this study, we investigated the expression pattern of AtVDAC2 in A. thaliana and found ABA suppressed the accumulation of AtVDAC2 transcripts. Further, phenotype analysis of this VDAC deregulated-expression transgenic Arabidopsis plants indicated that AtVDAC2 anti-sense line showed an ABA-insensitivity phenotype during the early seedling development under ABA treatment. The results suggested that AtVDAC2 might be involved in ABA signaling in A. thaliana.

Voltage regulator for generator

Energy Technology Data Exchange (ETDEWEB)

Naoi, K

1989-01-17

It is an object of this invention to provide a voltage regulator for a generator charging a battery, wherein even if the ambient temperature at the voltage regulator rises abnormally high, possible thermal breakage of the semiconductor elements constituting the voltage regulator can be avoided. A feature of this invention is that the semiconductor elements can be protected from thermal breakage, even at an abnormal ambient temperature rise at the voltage regulator for the battery charging generator, by controlling a maximum conduction ratio of a power transistor in the voltage regulator in accordance with the temperature at the voltage regulator. This is achieved through a switching device connected in series to the field coil of the generator and adapted to be controlled in accordance with an output voltage of the generator and the ambient temperature at the voltage regulator. 6 figs.

Absolute continuity for operator valued completely positive maps on C∗-algebras

Science.gov (United States)

Gheondea, Aurelian; Kavruk, Ali Şamil

2009-02-01

Motivated by applicability to quantum operations, quantum information, and quantum probability, we investigate the notion of absolute continuity for operator valued completely positive maps on C∗-algebras, previously introduced by Parthasarathy [in Athens Conference on Applied Probability and Time Series Analysis I (Springer-Verlag, Berlin, 1996), pp. 34-54]. We obtain an intrinsic definition of absolute continuity, we show that the Lebesgue decomposition defined by Parthasarathy is the maximal one among all other Lebesgue-type decompositions and that this maximal Lebesgue decomposition does not depend on the jointly dominating completely positive map, we obtain more flexible formulas for calculating the maximal Lebesgue decomposition, and we point out the nonuniqueness of the Lebesgue decomposition as well as a sufficient condition for uniqueness. In addition, we consider Radon-Nikodym derivatives for absolutely continuous completely positive maps that, in general, are unbounded positive self-adjoint operators affiliated to a certain von Neumann algebra, and we obtain a spectral approximation by bounded Radon-Nikodym derivatives. An application to the existence of the infimum of two completely positive maps is indicated, and formulas in terms of Choi's matrices for the Lebesgue decomposition of completely positive maps in matrix algebras are obtained.

Influence of water trees on breakdown voltage of polymeric cables insulations

Energy Technology Data Exchange (ETDEWEB)

Stancu, Cristina [INCDIE ICPE CA, Bucharest (Romania); Notingher, Petru V.; Plopeanu, Mihai Gabriel [Politehnica University of Bucharest, Bucharest (Romania)

2011-07-01

In a previous paper was shown that water trees development modifies considerably the electric field repartition, which increases significantly in the vicinity of treed areas. In order to find the water trees influence on the breakdown voltage, in the present paper, an experimental study on model cables insulated with low density polyethylene is done. In insulation samples, water trees with various dimensions and densities were developed. For the reduction of the test duration, an electric field with a higher frequency (3-5 kHz) was used. For breakdown voltage measurement an automatic setup was realized. For each value of the ageing time the dimensions and densities of water trees and breakdown voltage were measured and the dependency of the breakdown voltage with these quantities were analysed. The results show a significant reduction of the breakdown voltage of treed cables insulations compared to un-treed ones. Key words: polyethylene, water treeing, electric field, breakdown, power cables.

Absolute Summ

Science.gov (United States)

Phillips, Alfred, Jr.

Summ means the entirety of the multiverse. It seems clear, from the inflation theories of A. Guth and others, that the creation of many universes is plausible. We argue that Absolute cosmological ideas, not unlike those of I. Newton, may be consistent with dynamic multiverse creations. As suggested in W. Heisenberg's uncertainty principle, and with the Anthropic Principle defended by S. Hawking, et al., human consciousness, buttressed by findings of neuroscience, may have to be considered in our models. Predictability, as A. Einstein realized with Invariants and General Relativity, may be required for new ideas to be part of physics. We present here a two postulate model geared to an Absolute Summ. The seedbed of this work is part of Akhnaton's philosophy (see S. Freud, Moses and Monotheism). Most important, however, is that the structure of human consciousness, manifest in Kenya's Rift Valley 200,000 years ago as Homo sapiens, who were the culmination of the six million year co-creation process of Hominins and Nature in Africa, allows us to do the physics that we do. .

Chronic electroconvulsive stimulation but not chronic restraint stress modulates mRNA expression of voltage-dependent potassium channels Kv7.2 and Kv11.1 in the rat piriform cortex

DEFF Research Database (Denmark)

Hjæresen, Marie-Louise; Hageman, Ida; Wörtwein, Gitta

2008-01-01

The mechanisms by which stress and electroconvulsive therapy exert opposite effects on the course of major depression are not known. Potential candidates might include the voltage-dependent potassium channels. Potassium channels play an important role in maintaining the resting membrane potential...... and controlling neuronal excitability. To explore this hypothesis, we examined the effects of one or several electroconvulsive stimulations and chronic restraint stress (6 h/day for 21 days) on the expression of voltage-dependent potassium channel Kv7.2, Kv11.1, and Kv11.3 mRNA in the rat brain using in situ...... hybridization. Repeated, but not acute, electroconvulsive stimulation increased Kv7.2 and Kv11.1 mRNA levels in the piriform cortex. In contrast, restraint stress had no significant effect on mRNA expression of Kv7.2, Kv11.1, or Kv11.3 in any of the brain regions examined. Thus, it appears that the investigated...

Prediction of breakdown voltages in novel gases for high voltage insulation

International Nuclear Information System (INIS)

Koch, M.

2015-01-01

This thesis submitted to the Swiss Federal Institute of Technology ETH in Zurich examines the use of sulphur hexafluoride (SF_6) and similar gases as important insulation media for high voltage equipment. Due to its superior insulation properties, SF_6 is widely used in gas-insulated switchgear. However, the gas also has a very high global warming potential and the content of SF_6 in the atmosphere is constantly increasing. The search for new insulation gases using classical breakdown experiments is discussed. A model for SF_6 based on the stepped leader model is described. This calculates the breakdown voltages in arbitrary electrode configurations and under standard voltage waveforms. Thus, the thesis provides a method for the prediction of breakdown voltages of arbitrary field configurations under standard voltage waveforms for gases with electron-attaching properties. With this, further gases can be characterized for usage as high voltage insulation media

Large Magnetoresistance at High Bias Voltage in Double-layer Organic Spin Valves

Science.gov (United States)

Subedi, R. C.; Liang, S. H.; Geng, R.; Zhang, Q. T.; Lou, L.; Wang, J.; Han, X. F.; Nguyen, T. D.

We report studies of magnetoresistance (MR) in double-layer organic spin valves (DOSV) using tris (8-hydroxyquinolinato) aluminum (Alq3) spacers. The device exhibits three distinct resistance levels depending on the relative magnetizations of the ferromagnetic electrodes. We observed a much weaker bias voltage dependence of MR in the device compared to that in the conventional organic spin valve (OSV). The MR magnitude reduces by the factor of two at 0.7 V bias voltage in the DOSV compared to 0.02 V in the conventional OSV. Remarkably, the MR magnitude reaches 0.3% at 6 V bias in the DOSVs, the largest MR response ever reported in OSVs at this bias. Our finding may have a significant impact on achieving high efficient bipolar OSVs strictly performed at high voltages. University of Georgia start-up fund, Ministry of Education, Singapore, National Natural Science Foundation of China.

Absolute determination of radiation bursts and of proportional counters space charge effect through the influence method

International Nuclear Information System (INIS)

Rios, I.J.; Mayer, R.E.

2016-01-01

When proportional counters are employed in charge integration mode to determine the magnitude of a radiation pulse, so intense that individual detection events take place in a time too short to produce individual output pulses, mostly in pulsed neutron sources, the strong build-up of positive space charge reduces the electric multiplication factor of the proportional detector. Under such conditions the ensuing measurement underestimates the amount of radiation that interacted with the detector. If the geometric characteristics, the filling gas pressure and the voltage applied to that detector are known, it becomes possible to apply an analytical correction method to the measurement. In this article we present a method that allows to determine the absolute value of the detected radiation burst without the need to know the characteristics of the employed detectors. It is necessary to employ more than one detector, taking advantage of the Influence Method. The “Influence Method” is conceived for the absolute determination of a nuclear particle flux in the absence of known detector efficiency and without the need to register coincidences of any kind. This method exploits the influence of the presence of one detector in the count rate of another detector, when they are placed one behind the other and define statistical estimators for the absolute number of incident particles and for the efficiency (Rios and Mayer, 2015 [1,2]). Its practical implementation in the measurement of a moderated neutron flux arising from an isotopic neutron source was exemplified in (Rios and Mayer, 2016 [3]) and the extension for multiple detectors in (Rios and Mayer 2016 [4]). - Highlights: • Absolute determination of radiation burst. • Proportional counters space charge effect. • Radiation measurements on pulsed devices.

Context-dependent utility overrides absolute memory as a determinant of choice

OpenAIRE

Pompilio, Lorena; Kacelnik, Alex

2009-01-01

A core problem of decision theories is that although decisionmakers’ preferences depend on learning, their choices could be driven either by learned representations of the physical properties of each alternative (for instance reward sizes) or of the benefit (utility and fitness) experienced from them. Physical properties are independent of the subject’s state and context, but utility depends on both. We show that starlings’ choices are better explained by memory for context-dependent utility ...

Thermal instability and current-voltage scaling in superconducting fault current limiters

Energy Technology Data Exchange (ETDEWEB)

Zeimetz, B [Department of Materials Science and Metallurgy, Cambridge University, Pembroke Street, Cambridge CB1 3QZ (United Kingdom); Tadinada, K [Department of Engineering, Cambridge University, Trumpington Road, Cambridge CB2 1PZ (United Kingdom); Eves, D E [Department of Engineering, Cambridge University, Trumpington Road, Cambridge CB2 1PZ (United Kingdom); Coombs, T A [Department of Engineering, Cambridge University, Trumpington Road, Cambridge CB2 1PZ (United Kingdom); Evetts, J E [Department of Materials Science and Metallurgy, Cambridge University, Pembroke Street, Cambridge CB1 3QZ (United Kingdom); Campbell, A M [Department of Engineering, Cambridge University, Trumpington Road, Cambridge CB2 1PZ (United Kingdom)

2004-04-01

We have developed a computer model for the simulation of resistive superconducting fault current limiters in three dimensions. The program calculates the electromagnetic and thermal response of a superconductor to a time-dependent overload voltage, with different possible cooling conditions for the surfaces, and locally variable superconducting and thermal properties. We find that the cryogen boil-off parameters critically influence the stability of a limiter. The recovery time after a fault increases strongly with thickness. Above a critical thickness, the temperature is unstable even for a small applied AC voltage. The maximum voltage and maximum current during a short fault are correlated by a simple exponential law.

Absolute flux scale for radioastronomy

International Nuclear Information System (INIS)

Ivanov, V.P.; Stankevich, K.S.

1986-01-01

The authors propose and provide support for a new absolute flux scale for radio astronomy, which is not encumbered with the inadequacies of the previous scales. In constructing it the method of relative spectra was used (a powerful tool for choosing reference spectra). A review is given of previous flux scales. The authors compare the AIS scale with the scale they propose. Both scales are based on absolute measurements by the ''artificial moon'' method, and they are practically coincident in the range from 0.96 to 6 GHz. At frequencies above 6 GHz, 0.96 GHz, the AIS scale is overestimated because of incorrect extrapolation of the spectra of the primary and secondary standards. The major results which have emerged from this review of absolute scales in radio astronomy are summarized

Non-linear Membrane Properties in Entorhinal Cortical Stellate Cells Reduce Modulation of Input-Output Responses by Voltage Fluctuations

Science.gov (United States)

Fernandez, Fernando R.; Malerba, Paola; White, John A.

2015-01-01

The presence of voltage fluctuations arising from synaptic activity is a critical component in models of gain control, neuronal output gating, and spike rate coding. The degree to which individual neuronal input-output functions are modulated by voltage fluctuations, however, is not well established across different cortical areas. Additionally, the extent and mechanisms of input-output modulation through fluctuations have been explored largely in simplified models of spike generation, and with limited consideration for the role of non-linear and voltage-dependent membrane properties. To address these issues, we studied fluctuation-based modulation of input-output responses in medial entorhinal cortical (MEC) stellate cells of rats, which express strong sub-threshold non-linear membrane properties. Using in vitro recordings, dynamic clamp and modeling, we show that the modulation of input-output responses by random voltage fluctuations in stellate cells is significantly limited. In stellate cells, a voltage-dependent increase in membrane resistance at sub-threshold voltages mediated by Na+ conductance activation limits the ability of fluctuations to elicit spikes. Similarly, in exponential leaky integrate-and-fire models using a shallow voltage-dependence for the exponential term that matches stellate cell membrane properties, a low degree of fluctuation-based modulation of input-output responses can be attained. These results demonstrate that fluctuation-based modulation of input-output responses is not a universal feature of neurons and can be significantly limited by subthreshold voltage-gated conductances. PMID:25909971

The cathode-fall of low-pressure hydrogen discharges: Absolute spectral emission and model

Energy Technology Data Exchange (ETDEWEB)

Jelenkovic, B. M. [JILA, National Institute of Standards and Technology and University of Colorado Boulder, Boulder, Colorado 80309-0440 (United States); Institute of Physics, University of Belgrade, Pregrevica 118, 11080 Zenum Belgrade (Serbia); Phelps, A. V. [JILA, National Institute of Standards and Technology and University of Colorado Boulder, Boulder, Colorado 80309-0440 (United States)

2011-10-15

Absolute excitation probabilities from very low to moderate-current hydrogen discharges in parallel-plane geometry are measured and used to test models. Relative emission data are obtained for the H{sub {alpha}} line, the H{sub 2} (a{sup 3}{Sigma}{yields}b{sup 3}{Pi}) near-UV continuum, and the H{sub 2} (G{sup 1}{Sigma}{yields}B{sup 1}{Pi}{sub u}{sup +}) band at pressures of 0.5 and 2 Torr, a 1.05 cm gap, and voltages from 300 to 900 V. Electron behavior is traced using the first negative (A{sup 2}{Sigma}{sub g}{yields} X{sup 2}{Pi}{sub u}, {nu}'' = 0 {yields}{nu}' = 0) band of N{sub 2}{sup +} by adding 2% N{sub 2}. Relative measurements of H{sub {alpha}}, H{sub 2} near-UV, and N{sub 2} 1st negative emission are placed on a absolute scale by normalization to published measurements and Boltzmann calculations of electron excitation. Emission probabilities calculated using a multi-beam kinetics model for the electrons, H{sup +}, H{sub 2}{sup +}, H{sub 3}{sup +}, H{sup -}, H, and H{sub 2} are compared with the calibrated experiments. Fast H atoms are calculated to produce H{sub {alpha}} excitation that is comparable with that of electrons. The calculated emission intensities for H{sub {alpha}} and H{sub 2} near-UV continuum are within a factor of three of the absolute measurements for a range of 5000:1 in current and 4:1 in hydrogen pressure. Calculations at 2 Torr show that most of the space charge electric field responsible for the cathode fall is produced by H{sub 3}{sup +} ions.

On-site voltage measurement with capacitive sensors on high voltage systems

NARCIS (Netherlands)

Wu, L.; Wouters, P.A.A.F.; Heesch, van E.J.M.; Steennis, E.F.

2011-01-01

In Extra/High-Voltage (EHV/HV) power systems, over-voltages occur e.g. due to transients or resonances. At places where no conventional voltage measurement devices can be installed, on-site measurement of these occurrences requires preferably non intrusive sensors, which can be installed with little

Prediction of breakdown voltages in novel gases for high voltage insulation

Energy Technology Data Exchange (ETDEWEB)

Koch, M.

2015-07-01

This thesis submitted to the Swiss Federal Institute of Technology ETH in Zurich examines the use of sulphur hexafluoride (SF{sub 6}) and similar gases as important insulation media for high voltage equipment. Due to its superior insulation properties, SF{sub 6} is widely used in gas-insulated switchgear. However, the gas also has a very high global warming potential and the content of SF{sub 6} in the atmosphere is constantly increasing. The search for new insulation gases using classical breakdown experiments is discussed. A model for SF{sub 6} based on the stepped leader model is described. This calculates the breakdown voltages in arbitrary electrode configurations and under standard voltage waveforms. Thus, the thesis provides a method for the prediction of breakdown voltages of arbitrary field configurations under standard voltage waveforms for gases with electron-attaching properties. With this, further gases can be characterized for usage as high voltage insulation media.

High voltage engineering

CERN Document Server

Rizk, Farouk AM

2014-01-01

Inspired by a new revival of worldwide interest in extra-high-voltage (EHV) and ultra-high-voltage (UHV) transmission, High Voltage Engineering merges the latest research with the extensive experience of the best in the field to deliver a comprehensive treatment of electrical insulation systems for the next generation of utility engineers and electric power professionals. The book offers extensive coverage of the physical basis of high-voltage engineering, from insulation stress and strength to lightning attachment and protection and beyond. Presenting information critical to the design, selec

Frequency and voltage dependence dielectric properties, ac electrical conductivity and electric modulus profiles in Al/Co{sub 3}O{sub 4}-PVA/p-Si structures

Energy Technology Data Exchange (ETDEWEB)

Bilkan, Çiğdem, E-mail: cigdembilkan@gmail.com [Department of Physics, Faculty of Sciences, The University of Çankırı Karatekin, 18100 Çankırı (Turkey); Azizian-Kalandaragh, Yashar [Department of Physics, Faculty of Science, The University of Mohaghegh Ardabili, Ardabil (Iran, Islamic Republic of); Altındal, Şemsettin [Department of Physics, Faculty of Sciences, The University of Gazi, 06500 Ankara (Turkey); Shokrani-Havigh, Roya [Department of Physics, Faculty of Science, The University of Mohaghegh Ardabili, Ardabil (Iran, Islamic Republic of)

2016-11-01

In this research a simple microwave-assisted method have been used for preparation of cobalt oxide nanostructures. The as-prepared sample has been investigated by UV–vis spectroscopy, X-ray diffraction (XRD), scanning electron microscopy (SEM). On the other hand, frequency and voltage dependence of both the real and imaginary parts of dielectric constants (ε′, ε″) and electric modulus (M′ and M″), loss tangent (tanδ), and ac electrical conductivity (σ{sub ac}) values of Al/Co{sub 3}O{sub 4}-PVA/p-Si structures were obtained in the wide range of frequency and voltage using capacitance (C) and conductance (G/ω) data at room temperature. The values of ε′, ε″ and tanδ were found to decrease with increasing frequency almost for each applied bias voltage, but the changes in these parameters become more effective in the depletion region at low frequencies due to the charges at surface states and their relaxation time and polarization effect. While the value of σ is almost constant at low frequency, increases almost as exponentially at high frequency which are corresponding to σ{sub dc} and σ{sub ac}, respectively. The M′ and M″ have low values at low frequencies region and then an increase with frequency due to short-range mobility of charge carriers. While the value of M′ increase with increasing frequency, the value of M″ shows two peak and the peaks positions shifts to higher frequency with increasing applied voltage due to the decrease of the polarization and N{sub ss} effects with increasing frequency.

Device for monitoring cell voltage

Science.gov (United States)

Doepke, Matthias [Garbsen, DE; Eisermann, Henning [Edermissen, DE

2012-08-21

A device for monitoring a rechargeable battery having a number of electrically connected cells includes at least one current interruption switch for interrupting current flowing through at least one associated cell and a plurality of monitoring units for detecting cell voltage. Each monitoring unit is associated with a single cell and includes a reference voltage unit for producing a defined reference threshold voltage and a voltage comparison unit for comparing the reference threshold voltage with a partial cell voltage of the associated cell. The reference voltage unit is electrically supplied from the cell voltage of the associated cell. The voltage comparison unit is coupled to the at least one current interruption switch for interrupting the current of at least the current flowing through the associated cell, with a defined minimum difference between the reference threshold voltage and the partial cell voltage.

A global algorithm for estimating Absolute Salinity

Science.gov (United States)

McDougall, T. J.; Jackett, D. R.; Millero, F. J.; Pawlowicz, R.; Barker, P. M.

2012-12-01

The International Thermodynamic Equation of Seawater - 2010 has defined the thermodynamic properties of seawater in terms of a new salinity variable, Absolute Salinity, which takes into account the spatial variation of the composition of seawater. Absolute Salinity more accurately reflects the effects of the dissolved material in seawater on the thermodynamic properties (particularly density) than does Practical Salinity. When a seawater sample has standard composition (i.e. the ratios of the constituents of sea salt are the same as those of surface water of the North Atlantic), Practical Salinity can be used to accurately evaluate the thermodynamic properties of seawater. When seawater is not of standard composition, Practical Salinity alone is not sufficient and the Absolute Salinity Anomaly needs to be estimated; this anomaly is as large as 0.025 g kg-1 in the northernmost North Pacific. Here we provide an algorithm for estimating Absolute Salinity Anomaly for any location (x, y, p) in the world ocean. To develop this algorithm, we used the Absolute Salinity Anomaly that is found by comparing the density calculated from Practical Salinity to the density measured in the laboratory. These estimates of Absolute Salinity Anomaly however are limited to the number of available observations (namely 811). In order to provide a practical method that can be used at any location in the world ocean, we take advantage of approximate relationships between Absolute Salinity Anomaly and silicate concentrations (which are available globally).

Annealing-temperature-dependent voltage-sign reversal in all-oxide spin Seebeck devices using RuO2

Science.gov (United States)

Kirihara, Akihiro; Ishida, Masahiko; Yuge, Ryota; Ihara, Kazuki; Iwasaki, Yuma; Sawada, Ryohto; Someya, Hiroko; Iguchi, Ryo; Uchida, Ken-ichi; Saitoh, Eiji; Yorozu, Shinichi

2018-04-01

Thermoelectric converters based on the spin Seebeck effect (SSE) have attracted great attention due to their potential to offer novel applications such as energy harvesting and heat-flow sensing. For converting a SSE-induced spin current into an electric current, a transition metal film such as Pt, which exhibits large inverse spin-Hall effect (ISHE), has been typically used. In this work, we show an all-oxide SSE device using ruthenium oxide (RuO2) as a conductive film. We found that both the sign and magnitude of the SSE-induced ISHE voltage V appearing in the RuO2 film changes depending on the post annealing temperature, and that the magnitude can become larger than that of a standard SSE device using Pt. The similar sign change was also observed in Hall-resistance measurements of the RuO2 films. X-ray absorption fine structure (XAFS) spectra of as-deposited and annealed RuO2 revealed that the annealing process substantially improved the long-range crystalline order in RuO2. This suggests that change in the crystalline order may modify the dominant ISHE mechanism or electronic states in RuO2, leading to the sign reversal of V as well as the Hall coefficient. Our result demonstrates that RuO2 is an interesting material not only as a practical ISHE film but also as a testbed to study physics of spin-to-charge converters that depend on their crystalline order.

Moderately nonlinear diffuse-charge dynamics under an ac voltage.

Science.gov (United States)

Stout, Robert F; Khair, Aditya S

2015-09-01

The response of a symmetric binary electrolyte between two parallel, blocking electrodes to a moderate amplitude ac voltage is quantified. The diffuse charge dynamics are modeled via the Poisson-Nernst-Planck equations for a dilute solution of point-like ions. The solution to these equations is expressed as a Fourier series with a voltage perturbation expansion for arbitrary Debye layer thickness and ac frequency. Here, the perturbation expansion in voltage proceeds in powers of V_{o}/(k_{B}T/e), where V_{o} is the amplitude of the driving voltage and k_{B}T/e is the thermal voltage with k_{B} as Boltzmann's constant, T as the temperature, and e as the fundamental charge. We show that the response of the electrolyte remains essentially linear in voltage amplitude at frequencies greater than the RC frequency of Debye layer charging, D/λ_{D}L, where D is the ion diffusivity, λ_{D} is the Debye layer thickness, and L is half the cell width. In contrast, nonlinear response is predicted at frequencies below the RC frequency. We find that the ion densities exhibit symmetric deviations from the (uniform) equilibrium density at even orders of the voltage amplitude. This leads to the voltage dependence of the current in the external circuit arising from the odd orders of voltage. For instance, the first nonlinear contribution to the current is O(V_{o}^{3}) which contains the expected third harmonic but also a component oscillating at the applied frequency. We use this to compute a generalized impedance for moderate voltages, the first nonlinear contribution to which is quadratic in V_{o}. This contribution predicts a decrease in the imaginary part of the impedance at low frequency, which is due to the increase in Debye layer capacitance with increasing V_{o}. In contrast, the real part of the impedance increases at low frequency, due to adsorption of neutral salt from the bulk to the Debye layer.

Moderately nonlinear diffuse-charge dynamics under an ac voltage

Science.gov (United States)

Stout, Robert F.; Khair, Aditya S.

2015-09-01

The response of a symmetric binary electrolyte between two parallel, blocking electrodes to a moderate amplitude ac voltage is quantified. The diffuse charge dynamics are modeled via the Poisson-Nernst-Planck equations for a dilute solution of point-like ions. The solution to these equations is expressed as a Fourier series with a voltage perturbation expansion for arbitrary Debye layer thickness and ac frequency. Here, the perturbation expansion in voltage proceeds in powers of Vo/(kBT /e ) , where Vo is the amplitude of the driving voltage and kBT /e is the thermal voltage with kB as Boltzmann's constant, T as the temperature, and e as the fundamental charge. We show that the response of the electrolyte remains essentially linear in voltage amplitude at frequencies greater than the RC frequency of Debye layer charging, D /λDL , where D is the ion diffusivity, λD is the Debye layer thickness, and L is half the cell width. In contrast, nonlinear response is predicted at frequencies below the RC frequency. We find that the ion densities exhibit symmetric deviations from the (uniform) equilibrium density at even orders of the voltage amplitude. This leads to the voltage dependence of the current in the external circuit arising from the odd orders of voltage. For instance, the first nonlinear contribution to the current is O (Vo3) which contains the expected third harmonic but also a component oscillating at the applied frequency. We use this to compute a generalized impedance for moderate voltages, the first nonlinear contribution to which is quadratic in Vo. This contribution predicts a decrease in the imaginary part of the impedance at low frequency, which is due to the increase in Debye layer capacitance with increasing Vo. In contrast, the real part of the impedance increases at low frequency, due to adsorption of neutral salt from the bulk to the Debye layer.

The effect of external visible light on the breakdown voltage of a long discharge tube

Science.gov (United States)

Shishpanov, A. I.; Ionikh, Yu. Z.; Meshchanov, A. V.

2016-06-01

The breakdown characteristics of a discharge tube with a configuration typical of gas-discharge light sources and electric-discharge lasers (a so-called "long discharge tube") filled with argon or helium at a pressure of 1 Torr have been investigated. A breakdown has been implemented using positive and negative voltage pulses with a linear leading edge having a slope dU/ dt ~ 10-107 V/s. Visible light from an external source (halogen incandescent lamp) is found to affect the breakdown characteristics. The dependences of the dynamic breakdown voltage of the tube on dU/ dt and on the incident light intensity are measured. The breakdown voltage is found to decrease under irradiation of the high-voltage anode of the tube in a wide range of dU/ dt. A dependence of the effect magnitude on the light intensity and spectrum is obtained. Possible physical mechanisms of this phenomenon are discussed.

Voltage dependent anion channel-1 regulates death receptor mediated apoptosis by enabling cleavage of caspase-8

International Nuclear Information System (INIS)

Chacko, Alex D; Liberante, Fabio; Paul, Ian; Longley, Daniel B; Fennell, Dean A

2010-01-01

Activation of the extrinsic apoptosis pathway by tumour necrosis factor related apoptosis inducing ligand (TRAIL) is a novel therapeutic strategy for treating cancer that is currently under clinical evaluation. Identification of molecular biomarkers of resistance is likely to play an important role in predicting clinical anti tumour activity. The involvement of the mitochondrial type 1 voltage dependent anion channel (VDAC1) in regulating apoptosis has been highly debated. To date, a functional role in regulating the extrinsic apoptosis pathway has not been formally excluded. We carried out stable and transient RNAi knockdowns of VDAC1 in non-small cell lung cancer cells, and stimulated the extrinsic apoptotic pathway principally by incubating cells with the death ligand TRAIL. We used in-vitro apoptotic and cell viability assays, as well as western blot for markers of apoptosis, to demonstrate that TRAIL-induced toxicity is VDAC1 dependant. Confocal microscopy and mitochondrial fractionation were used to determine the importance of mitochondria for caspase-8 activation. Here we show that either stable or transient knockdown of VDAC1 is sufficient to antagonize TRAIL mediated apoptosis in non-small cell lung cancer (NSCLC) cells. Specifically, VDAC1 is required for processing of procaspase-8 to its fully active p18 form at the mitochondria. Loss of VDAC1 does not alter mitochondrial sensitivity to exogenous caspase-8-cleaved BID induced mitochondrial depolarization, even though VDAC1 expression is essential for TRAIL dependent activation of the intrinsic apoptosis pathway. Furthermore, expression of exogenous VDAC1 restores the apoptotic response to TRAIL in cells in which endogenous VDAC1 has been selectively silenced. Expression of VDAC1 is required for full processing and activation of caspase-8 and supports a role for mitochondria in regulating apoptosis signaling via the death receptor pathway

76 FR 70721 - Voltage Coordination on High Voltage Grids; Notice of Staff Workshop

Science.gov (United States)

2011-11-15

... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. AD12-5-000] Voltage Coordination on High Voltage Grids; Notice of Staff Workshop Take notice that the Federal Energy Regulatory Commission will hold a Workshop on Voltage Coordination on High Voltage Grids on Thursday, December 1, 2011...

Gigantic transverse voltage induced via off-diagonal thermoelectric effect in CaxCoO2 thin films

Science.gov (United States)

Takahashi, Kouhei; Kanno, Tsutomu; Sakai, Akihiro; Adachi, Hideaki; Yamada, Yuka

2010-07-01

Gigantic transverse voltages exceeding several tens volt have been observed in CaxCoO2 thin films with tilted c-axis orientation upon illumination of nanosecond laser pulses. The voltage signals were highly anisotropic within the film surface showing close relation with the c-axis tilt direction. The magnitude and the decay time of the voltage strongly depended on the film thickness. These results confirm that the large laser-induced voltage originates from a phenomenon termed the off-diagonal thermoelectric effect, by which a film out-of-plane temperature gradient leads to generation of a film in-plane voltage.

Trans-Channel Interactions in Batrachotoxin-Modified Skeletal Muscle Sodium Channels: Voltage-Dependent Block by Cytoplasmic Amines, and the Influence of μ-Conotoxin GIIIA Derivatives and Permeant Ions

Science.gov (United States)

Pavlov, Evgeny; Britvina, Tatiana; McArthur, Jeff R.; Ma, Quanli; Sierralta, Iván; Zamponi, Gerald W.; French, Robert J.

2008-01-01

External μ-conotoxins and internal amine blockers inhibit each other's block of voltage-gated sodium channels. We explore the basis of this interaction by measuring the shifts in voltage-dependence of channel inhibition by internal amines induced by two μ-conotoxin derivatives with different charge distributions and net charges. Charge changes on the toxin were made at residue 13, which is thought to penetrate most deeply into the channel, making it likely to have the strongest individual interaction with an internal charged ligand. When an R13Q or R13E molecule was bound to the channel, the voltage dependence of diethylammonium (DEA)-block shifted toward more depolarized potentials (23 mV for R13Q, and 16 mV for R13E). An electrostatic model of the repulsion between DEA and the toxin simulated these data, with a distance between residue 13 of the μ-conotoxin and the DEA-binding site of ∼15 Å. Surprisingly, for tetrapropylammonium, the shifts were only 9 mV for R13Q, and 7 mV for R13E. The smaller shifts associated with R13E, the toxin with a smaller net charge, are generally consistent with an electrostatic interaction. However, the smaller shifts observed for tetrapropylammonium than for DEA suggest that other factors must be involved. Two observations indicate that the coupling of permeant ion occupancy of the channel to blocker binding may contribute to the overall amine-toxin interaction: 1), R13Q binding decreases the apparent affinity of sodium for the conducting pore by ∼4-fold; and 2), increasing external [Na+] decreases block by DEA at constant voltage. Thus, even though a number of studies suggest that sodium channels are occupied by no more than one ion most of the time, measurable coupling occurs between permeant ions and toxin or amine blockers. Such interactions likely determine, in part, the strength of trans-channel, amine-conotoxin interactions. PMID:18658222

Trans-channel interactions in batrachotoxin-modified skeletal muscle sodium channels: voltage-dependent block by cytoplasmic amines, and the influence of mu-conotoxin GIIIA derivatives and permeant ions.

Science.gov (United States)

Pavlov, Evgeny; Britvina, Tatiana; McArthur, Jeff R; Ma, Quanli; Sierralta, Iván; Zamponi, Gerald W; French, Robert J

2008-11-01

External mu-conotoxins and internal amine blockers inhibit each other's block of voltage-gated sodium channels. We explore the basis of this interaction by measuring the shifts in voltage-dependence of channel inhibition by internal amines induced by two mu-conotoxin derivatives with different charge distributions and net charges. Charge changes on the toxin were made at residue 13, which is thought to penetrate most deeply into the channel, making it likely to have the strongest individual interaction with an internal charged ligand. When an R13Q or R13E molecule was bound to the channel, the voltage dependence of diethylammonium (DEA)-block shifted toward more depolarized potentials (23 mV for R13Q, and 16 mV for R13E). An electrostatic model of the repulsion between DEA and the toxin simulated these data, with a distance between residue 13 of the mu-conotoxin and the DEA-binding site of approximately 15 A. Surprisingly, for tetrapropylammonium, the shifts were only 9 mV for R13Q, and 7 mV for R13E. The smaller shifts associated with R13E, the toxin with a smaller net charge, are generally consistent with an electrostatic interaction. However, the smaller shifts observed for tetrapropylammonium than for DEA suggest that other factors must be involved. Two observations indicate that the coupling of permeant ion occupancy of the channel to blocker binding may contribute to the overall amine-toxin interaction: 1), R13Q binding decreases the apparent affinity of sodium for the conducting pore by approximately 4-fold; and 2), increasing external [Na(+)] decreases block by DEA at constant voltage. Thus, even though a number of studies suggest that sodium channels are occupied by no more than one ion most of the time, measurable coupling occurs between permeant ions and toxin or amine blockers. Such interactions likely determine, in part, the strength of trans-channel, amine-conotoxin interactions.

Dual patch voltage clamp study of low membrane resistance astrocytes in situ.

Science.gov (United States)

Ma, Baofeng; Xu, Guangjin; Wang, Wei; Enyeart, John J; Zhou, Min

2014-03-17

Whole-cell patch clamp recording has been successfully used in identifying the voltage-dependent gating and conductance properties of ion channels in a variety of cells. However, this powerful technique is of limited value in studying low membrane resistance cells, such as astrocytes in situ, because of the inability to control or accurately measure the real amplitude of command voltages. To facilitate the study of ionic conductances of astrocytes, we have developed a dual patch recording method which permits membrane current and membrane potential to be simultaneously recorded from astrocytes in spite of their extraordinarily low membrane resistance. The utility of this technique is demonstrated by measuring the voltage-dependent activation of the inwardly rectifying K+ current abundantly expressed in astrocytes and multiple ionic events associated with astrocytic GABAA receptor activation. This protocol can be performed routinely in the study of astrocytes. This method will be valuable for identifying and characterizing the individual ion channels that orchestrate the electrical activity of low membrane resistance cells.

Voltage-spike analysis for a free-running parallel inverter

Science.gov (United States)

Lee, F. C. Y.; Wilson, T. G.

1974-01-01

Unwanted and sometimes damaging high-amplitude voltage spikes occur during each half cycle in many transistor saturable-core inverters at the moment when the core saturates and the transistors switch. The analysis shows that spikes are an intrinsic characteristic of certain types of inverters even with negligible leakage inductance and purely resistive load. The small but unavoidable after-saturation inductance of the saturable-core transformer plays an essential role in creating these undesired thigh-voltage spikes. State-plane analysis provides insight into the complex interaction between core and transistors, and shows the circuit parameters upon which the magnitude of these spikes depends.

Voltage-Dependent Rhythmogenic Property of Respiratory Pre-Bötzinger Complex Glutamatergic, Dbx1-Derived, and Somatostatin-Expressing Neuron Populations Revealed by Graded Optogenetic Inhibition.

Science.gov (United States)

Koizumi, Hidehiko; Mosher, Bryan; Tariq, Mohammad F; Zhang, Ruli; Koshiya, Naohiro; Smith, Jeffrey C

2016-01-01

The rhythm of breathing in mammals, originating within the brainstem pre-Bötzinger complex (pre-BötC), is presumed to be generated by glutamatergic neurons, but this has not been directly demonstrated. Additionally, developmental expression of the transcription factor Dbx1 or expression of the neuropeptide somatostatin (Sst), has been proposed as a marker for the rhythmogenic pre-BötC glutamatergic neurons, but it is unknown whether these other two phenotypically defined neuronal populations are functionally equivalent to glutamatergic neurons with regard to rhythm generation. To address these problems, we comparatively investigated, by optogenetic approaches, the roles of pre-BötC glutamatergic, Dbx1-derived, and Sst-expressing neurons in respiratory rhythm generation in neonatal transgenic mouse medullary slices in vitro and also more intact adult perfused brainstem-spinal cord preparations in situ. We established three different triple-transgenic mouse lines with Cre-driven Archaerhodopsin-3 (Arch) expression selectively in glutamatergic, Dbx1-derived, or Sst-expressing neurons for targeted photoinhibition. In each line, we identified subpopulations of rhythmically active, Arch-expressing pre-BötC inspiratory neurons by whole-cell recordings in medullary slice preparations in vitro, and established that Arch-mediated hyperpolarization of these inspiratory neurons was laser power dependent with equal efficacy. By site- and population-specific graded photoinhibition, we then demonstrated that inspiratory frequency was reduced by each population with the same neuronal voltage-dependent frequency control mechanism in each state of the respiratory network examined. We infer that enough of the rhythmogenic pre-BötC glutamatergic neurons also have the Dbx1 and Sst expression phenotypes, and thus all three phenotypes share the same voltage-dependent frequency control property.

The calmodulin inhibitor CGS 9343B inhibits voltage-dependent K{sup +} channels in rabbit coronary arterial smooth muscle cells

Energy Technology Data Exchange (ETDEWEB)

Li, Hongliang; Hong, Da Hye; Kim, Han Sol; Kim, Hye Won [Institute of Medical Sciences, Department of Physiology, Kangwon National University School of Medicine, Chuncheon, 200-701 (Korea, Republic of); Jung, Won-Kyo [Department of Biomedical Engineering, Center for Marine-Integrated Biomedical Technology (BK21 Plus), Pukyong National University, Busan 608-737 (Korea, Republic of); Na, Sung Hun [Institute of Medical Sciences, Department of Obstetrics and Gynecology, Kangwon National University Hospital, School of Medicine, Kangwon National University, Chuncheon, 200-701 (Korea, Republic of); Jung, In Duk; Park, Yeong-Min [Department of Immunology, Lab of Dendritic Cell Differentiation and Regulation, College of Medicine, Konkuk University, Chungju 380-701 (Korea, Republic of); Choi, Il-Whan, E-mail: cihima@inje.ac.kr [Department of Microbiology, Inje University College of Medicine, Busan, 614-735 (Korea, Republic of); Park, Won Sun, E-mail: parkws@kangwon.ac.kr [Institute of Medical Sciences, Department of Physiology, Kangwon National University School of Medicine, Chuncheon, 200-701 (Korea, Republic of)

2015-06-15

We investigated the effects of the calmodulin inhibitor CGS 9343B on voltage-dependent K{sup +} (Kv) channels using whole-cell patch clamp technique in freshly isolated rabbit coronary arterial smooth muscle cells. CGS 9343B inhibited Kv currents in a concentration-dependent manner, with a half-maximal inhibitory concentration (IC{sub 50}) value of 0.81 μM. The decay rate of Kv channel inactivation was accelerated by CGS 9343B. The rate constants of association and dissociation for CGS 9343B were 2.77 ± 0.04 μM{sup −1} s{sup −1} and 2.55 ± 1.50 s{sup −1}, respectively. CGS 9343B did not affect the steady-state activation curve, but shifted the inactivation curve toward to a more negative potential. Train pulses (1 or 2 Hz) application progressively increased the CGS 9343B-induced Kv channel inhibition. In addition, the inactivation recovery time constant was increased in the presence of CGS 9343B, suggesting that CGS 9343B-induced inhibition of Kv channel was use-dependent. Another calmodulin inhibitor, W-13, did not affect Kv currents, and did not change the inhibitory effect of CGS 9343B on Kv current. Our results demonstrated that CGS 9343B inhibited Kv currents in a state-, time-, and use-dependent manner, independent of calmodulin inhibition. - Highlights: • We investigated the effects of CGS 9394B on Kv channels. • CGS 9394B inhibited Kv current in a state-, time-, and use-dependent manner. • Caution is required when using CGS 9394B in vascular function studies.

Accurate measurement of the optical activity of alanine crystals and the determination of their absolute chirality

Science.gov (United States)

Ishikawa, Kazuhiko; Terasawa, Yukana; Tanaka, Masahito; Asahi, Toru

2017-05-01

Wavelength dependence measurements of the chiroptical properties in alanine crystals have so far been unsuccessful using conventional spectroscopic techniques. We describe our attempts to measure the wavelength dependence of the optical activity in L- and D-alanine crystals along each crystallographic axis, and to determine the absolute chirality of alanine crystals by correlating the absolute structure to the optical activity using an x-ray diffractometer and a generalized high accuracy universal polarimeter. We have succeeded in accurately measuring the optical rotatory dispersion in the direction, which shows that the optical rotation of the D-alanine crystal is dextrorotatory and that of the L-alanine crystal is laevorotatory, thereby determining the absolute chirality. Furthermore, comparison with the optical activity in solution shows that the optical activity in alanine crystals is different not only in value, but also in the sign. These results have led us to conclude that the optical rotatory power in the crystalline state should not be simply the summation of molecular optical rotatory power values. We propose the necessity of a theory, which contains the contribution of molecular interactions within the crystal, in order to calculate the optical rotatory power of the crystalline state.

A global algorithm for estimating Absolute Salinity

Directory of Open Access Journals (Sweden)

T. J. McDougall

2012-12-01

Full Text Available The International Thermodynamic Equation of Seawater – 2010 has defined the thermodynamic properties of seawater in terms of a new salinity variable, Absolute Salinity, which takes into account the spatial variation of the composition of seawater. Absolute Salinity more accurately reflects the effects of the dissolved material in seawater on the thermodynamic properties (particularly density than does Practical Salinity.

When a seawater sample has standard composition (i.e. the ratios of the constituents of sea salt are the same as those of surface water of the North Atlantic, Practical Salinity can be used to accurately evaluate the thermodynamic properties of seawater. When seawater is not of standard composition, Practical Salinity alone is not sufficient and the Absolute Salinity Anomaly needs to be estimated; this anomaly is as large as 0.025 g kg⁻¹ in the northernmost North Pacific. Here we provide an algorithm for estimating Absolute Salinity Anomaly for any location (x, y, p in the world ocean.

To develop this algorithm, we used the Absolute Salinity Anomaly that is found by comparing the density calculated from Practical Salinity to the density measured in the laboratory. These estimates of Absolute Salinity Anomaly however are limited to the number of available observations (namely 811. In order to provide a practical method that can be used at any location in the world ocean, we take advantage of approximate relationships between Absolute Salinity Anomaly and silicate concentrations (which are available globally.

Nanoscale Thermoelectrics: A Study of the Absolute Seebeck Coefficient of Thin Films

Science.gov (United States)

Mason, Sarah J.

The worlds demand for energy is ever increasing. Likewise, the environmental impact of climate change due generating that energy through combustion of fossil fuels is increasingly alarming. Due to these factors new sources of renewable energies are constantly being sought out. Thermoelectric devices have the ability to generate clean, renewable, energy out of waste heat. However promising that is, their inefficiency severely inhibits applicability and practical use. The usefulness of a thermoelectric material increases with the dimensionless quantity, ZT, which depends on the Seebeck coefficient and electrical and thermal conductivity. These characteristic material parameters have interdependent energy transport contributions that classically prohibit the optimization of one with out the detriment of another. Encouraging advancements of ZT have occurred in the past ten years due to the decoupling of the thermal and electrical conductivity. Further advancements are necessary in order to produce applicable devices. One auspicious way of decoupling or tuning energy transport properties, is through size reduction to the nanoscale. However, with reduced dimensions come complications in measuring material properties. Measurements of properties such as the Seebeck coefficient, S, are primarily contingent upon the measurement apparatus. The Seebeck coefficient is defined as the amount of voltage generated by a thermal gradient. Measuring a thermally generated voltage by traditional methods gives, the voltage measured as a linear function of the Seebeck coefficient of the leads and of the material being tested divided by the applied thermal gradient. If accurate values of the Seebeck coefficients of the leads are available, simple subtraction provides the answer. This is rarely the case in nanoscale measurement devices with leads exclusively made from thin film materials that do not have well known bulk-like thermopower values. We have developed a technique to directly

Statistical Analysis of Partial Discharge Characteristics in Transformer Oil at the “Point-Plane” Electrode at Alternating Voltage

Directory of Open Access Journals (Sweden)

Korobeynikov S.M.

2017-08-01

Full Text Available In this paper, we consider the problems related to measuring and analyzing the characteristics of partial discharges which are the main instrument for oil-filled high-voltage electrical equipment diagnosing. The experiments on recording of partial discharges in transformer oil have been carried out in the “point-plane” electrode system at alternating current. The instantaneous voltage and the apparent charge have been measured depending on the root-mean-square voltage and the phase angle of partial discharges. This paper aimes at carrying out a statistical analysis of the obtained experimental results, in particular, the construction of a parametric probabilistic model of the dependence of the partial discharge inception voltage distribution on the value of the root-mean-square voltage. It differs from usual discharges which occur in liquid dielectric materials in case of sharp inhomogeneous electrode system. It has been suggested that discharges of a different type are the discharges in gas bubbles that occur when partial discharges in a liquid emerge. This assumption is confirmed by the fact that the number of such discharges increases with increasing the root-mean-square voltage value. It is the main novelty of this paper. This corresponds to the nature of the occurrence of such discharges. After rejecting the observations corresponding to discharges in gas bubbles, a parametric probabilistic model has been constructed. The model obtained makes it possible to determine the probability of partial discharge occurrence in a liquid at a given value of the instantaneous voltage depending on the root-mean-square voltage.

Number 13 / Part I. Music. 7. Grounds of Absolute Pitch Development in Yamaha Music School

Directory of Open Access Journals (Sweden)

Iușcă Dorina

2017-03-01

Full Text Available Absolute pitch is defined as the ability to identify the pitch class of a certain given sound without the aid of an external reference pitch (Takeuchi & Hulse, 1993; Deutsch, 2002. The incidence of absolute pitch is extremely rare among the general population, respectively 1 in 10.000 people and it depends on testing conditions such as the number of identified sounds, pitch Chroma, pitch height, timbre, register or requested reaction time, and also on subjects musical training commencing and Eastern-Asian origins. The way absolute pitch develops is described by three models: the tone language theory, the early training theory and the genetic theory. The early training theory states that absolute pitch appears due to the beginning of musical lessons during a critical development period situated before the age of 6. The educational implications of this theory are revealed in the principles and activities of Yamaha Music School which employs didactic strategies that naturally develop absolute pitch. Yamaha Music School is the largest private music education system from Japan, established by Torakusu Yamaha in 1954. Up to this day it has extended in 40 countries from Europe, Asia and the American continents, as it has about 710 million students and 30.000 teachers. The present study aims to illustrate a detailed analysis of the way the learning experiences offered by Yamaha School lead to the development of absolute pitch.

Absolute radiometric calibration of Landsat using a pseudo invariant calibration site

Science.gov (United States)

Helder, D.; Thome, K.J.; Mishra, N.; Chander, G.; Xiong, Xiaoxiong; Angal, A.; Choi, Tae-young

2013-01-01

Pseudo invariant calibration sites (PICS) have been used for on-orbit radiometric trending of optical satellite systems for more than 15 years. This approach to vicarious calibration has demonstrated a high degree of reliability and repeatability at the level of 1-3% depending on the site, spectral channel, and imaging geometries. A variety of sensors have used this approach for trending because it is broadly applicable and easy to implement. Models to describe the surface reflectance properties, as well as the intervening atmosphere have also been developed to improve the precision of the method. However, one limiting factor of using PICS is that an absolute calibration capability has not yet been fully developed. Because of this, PICS are primarily limited to providing only long term trending information for individual sensors or cross-calibration opportunities between two sensors. This paper builds an argument that PICS can be used more extensively for absolute calibration. To illustrate this, a simple empirical model is developed for the well-known Libya 4 PICS based on observations by Terra MODIS and EO-1 Hyperion. The model is validated by comparing model predicted top-of-atmosphere reflectance values to actual measurements made by the Landsat ETM+ sensor reflective bands. Following this, an outline is presented to develop a more comprehensive and accurate PICS absolute calibration model that can be Système international d'unités (SI) traceable. These initial concepts suggest that absolute calibration using PICS is possible on a broad scale and can lead to improved on-orbit calibration capabilities for optical satellite sensors.

High voltage generator circuit with low power and high efficiency applied in EEPROM

International Nuclear Information System (INIS)

Liu Yan; Zhang Shilin; Zhao Yiqiang

2012-01-01

This paper presents a low power and high efficiency high voltage generator circuit embedded in electrically erasable programmable read-only memory (EEPROM). The low power is minimized by a capacitance divider circuit and a regulator circuit using the controlling clock switch technique. The high efficiency is dependent on the zero threshold voltage (V th ) MOSFET and the charge transfer switch (CTS) charge pump. The proposed high voltage generator circuit has been implemented in a 0.35 μm EEPROM CMOS process. Measured results show that the proposed high voltage generator circuit has a low power consumption of about 150.48 μW and a higher pumping efficiency (83.3%) than previously reported circuits. This high voltage generator circuit can also be widely used in low-power flash devices due to its high efficiency and low power dissipation. (semiconductor integrated circuits)

Influence of current limitation on voltage stability with voltage sourced converter HVDC

DEFF Research Database (Denmark)

Zeni, Lorenzo; Jóhannsson, Hjörtur; Hansen, Anca Daniela

2013-01-01

A first study of voltage stability with relevant amount of Voltage Sourced Converter based High Voltage Direct Current (VSC-HVDC) transmission is presented, with particular focus on the converters’ behaviour when reaching their rated current. The detrimental effect of entering the current...

Small--radiation-amplitude dynamical voltage model of an irradiated, externally unbiased Josephson tunnel junction

International Nuclear Information System (INIS)

McAdory, R.T. Jr.

1988-01-01

A theory is presented for the nonequilibrium voltage states of an irradiated Josephson junction shunted by an external resistor but with no external current or voltage biasing. This device, referred to as a free-running Josephson junction, is modeled in a small--radiation-amplitude, deterministic regime extending the previous work of Shenoy and Agarwal. The time-averaged induced voltage is treated as a dynamical variable, the external radiation is modeled as a current source, and the induced junction-radiation vector potential, with and without a mode structure, is treated to first order in the driving currents. A dynamical equation for the time-averaged induced voltage yields a (nonequilibrium) steady-state relation between the time-averaged induced voltage and the incident radiation amplitude valid for a wide range of voltages, including zero. Regions of bistability occur in the voltage--versus--incident-amplitude curves, some of which are dependent on the external resistor. The zero-voltage state breaks down, as the external radiation amplitude is increased, at a critical value of the incident-radiation amplitude inversely proportional to the external resistance

Reliable and Low-Voltage Electrowetting on Thin Parylene Films

NARCIS (Netherlands)

Dhindsa, M.S.; Kuiper, S.; Kumar, R.; Heikenfeld, J.

2011-01-01

The stability of an electrowetting system is dependent upon the choice of liquids, the dielectric material and the operating voltage.Substantial progress is reported herein on use of 300 nm thick poly-tetrafluoro-para-xylylene) (Parylene HT) films for almost 100° of reliable electrowetting

Invariant and Absolute Invariant Means of Double Sequences

Directory of Open Access Journals (Sweden)

Abdullah Alotaibi

2012-01-01

Full Text Available We examine some properties of the invariant mean, define the concepts of strong σ-convergence and absolute σ-convergence for double sequences, and determine the associated sublinear functionals. We also define the absolute invariant mean through which the space of absolutely σ-convergent double sequences is characterized.

Context-dependent utility overrides absolute memory as a determinant of choice.

Science.gov (United States)

Pompilio, Lorena; Kacelnik, Alex

2010-01-05

A core problem of decision theories is that although decisionmakers' preferences depend on learning, their choices could be driven either by learned representations of the physical properties of each alternative (for instance reward sizes) or of the benefit (utility and fitness) experienced from them. Physical properties are independent of the subject's state and context, but utility depends on both. We show that starlings' choices are better explained by memory for context-dependent utility than by representations of the alternatives' physical properties, even when the decisionmakers' state is controlled and they have accurate knowledge about the options' physical properties. Our results support the potential universality of utility-driven preference control.

Vivitron 1995, transient voltage simulation, high voltage insulator tests, electric field calculation

International Nuclear Information System (INIS)

Frick, G.; Osswald, F.; Heusch, B.

1996-01-01

Preliminary investigations showed clearly that, because of the discrete electrode structure of the Vivitron, important overvoltage leading to insulator damage can appear in case of a spark. The first high voltage tests showed damage connected with such events. This fact leads to a severe voltage limitation. This work describes, at first, studies made to understand the effects of transients and the associated over-voltage appearing in the Vivitron. Then we present the high voltage tests made with full size Vivitron components using the CN 6 MV machine as a pilot machine. Extensive field calculations were made. These involve simulations of static stresses and transient overvoltages, on insulating boards and electrodes. This work gave us the solutions for arrangements and modifications in the machine. After application, the Vivitron runs now without any sparks and damage at 20 MV. In the same manner, we tested column insulators of a new design and so we will find out how to get to higher voltages. Electric field calculation around the tie bars connecting the discrete electrodes together showed field enhancements when the voltages applied on the discrete electrodes are not equally distributed. This fact is one of the sources of discharges and voltage limitations. A scenario of a spark event is described and indications are given how to proceed towards higher voltages, in the 30 MV range. (orig.)

An impact analysis of the fault impedance on voltage sags

Energy Technology Data Exchange (ETDEWEB)

Ramos, Alessandro Candido Lopes [CELG - Companhia Energetica de Goias, Goiania, GO (Brazil). Generation and Transmission. System' s Operation Center], E-mail: alessandro.clr@celg.com.br; Batista, Adalberto Jose [Federal University of Goias (UFG), Goiania, GO (Brazil)], E-mail: batista@eee.ufg.br; Leborgne, Roberto Chouhy [Federal University of Rio Grande do Sul (UFRGS), Porto Alegre, RS (Brazil)], E-mail: rcl@ece.ufrgs.br; Emiliano, Pedro Henrique Mota, E-mail: ph@phph.com.br

2009-07-01

This paper presents an impact analysis of the fault impedance, in terms of its module and angle, on voltage sags caused by faults. Symmetrical and asymmetrical faults are simulated, at transmission and distribution lines, by using a frequency-domain fault simulation software called ANAFAS. Voltage sags are monitored at buses where sensitive end-users are connected. In order to overcome some intrinsic limitations of this software concerning its automatic execution for several cases, a computational tool was developed in Java programming language. This solution allows the automatic simulation of cases including the effect of the fault position, the fault type, and the proper fault impedance. The main conclusion is that the module and angle of the fault impedance can have a significant influence on voltage sag depending on the fault characteristics. (author)

Effects of symmetrical voltage sags on squirrel-cage induction motors

Energy Technology Data Exchange (ETDEWEB)

Pedra, Joaquin; Sainz, Luis; Corcoles, Felipe [Department of Electrical Engineering, ETSEIB-UPC, Av. Diagonal, 647, 08028 Barcelona (Spain)

2007-10-15

This paper analyzes the symmetrical voltage sag consequences on the induction motor behavior when single- and double-cage models are considered, namely current and torque peaks, and speed loss. These effects depend on several variables like sag type, duration and depth. Voltage sag effects are studied by using single- and double-cage models for three motors of different rated power. The double-cage model always predicts torque and current peaks higher than those of the single-cage model. The single-cage model predicts that voltage sags can produce motor instability, whereas the double-cage model is always stable. Therefore, the double-cage model must be used for the simulation of the squirrel-cage induction motor, because the single-cage model can give erroneous results in some situations. (author)

Absolute measurement of a tritium standard

International Nuclear Information System (INIS)

Hadzisehovic, M.; Mocilnik, I.; Buraei, K.; Pongrac, S.; Milojevic, A.

1978-01-01

For the determination of a tritium absolute activity standard, a method of internal gas counting has been used. The procedure involves water reduction by uranium and zinc further the measurement of the absolute disintegration rate of tritium per unit of the effective volume of the counter by a compensation method. Criteria for the choice of methods and procedures concerning the determination and measurement of gaseous 3 H yield, parameters of gaseous hydrogen, sample mass of HTO and the absolute disintegration rate of tritium are discussed. In order to obtain gaseous sources of 3 H (and 2 H), the same reversible chemical reaction was used, namely, the water - uranium hydride - hydrogen system. This reaction was proved to be quantitative above 500 deg C by measuring the yield of the gas obtained and the absolute activity of an HTO standard. A brief description of the measuring apparatus is given, as well as a critical discussion of the brass counter quality and the possibility of obtaining equal working conditions at the counter ends. (T.G.)

Developing Fast Fluorescent Protein Voltage Sensors by Optimizing FRET Interactions.

Directory of Open Access Journals (Sweden)

Uhna Sung

Full Text Available FRET (Förster Resonance Energy Transfer-based protein voltage sensors can be useful for monitoring neuronal activity in vivo because the ratio of signals between the donor and acceptor pair reduces common sources of noise such as heart beat artifacts. We improved the performance of FRET based genetically encoded Fluorescent Protein (FP voltage sensors by optimizing the location of donor and acceptor FPs flanking the voltage sensitive domain of the Ciona intestinalis voltage sensitive phosphatase. First, we created 39 different "Nabi1" constructs by positioning the donor FP, UKG, at 8 different locations downstream of the voltage-sensing domain and the acceptor FP, mKO, at 6 positions upstream. Several of these combinations resulted in large voltage dependent signals and relatively fast kinetics. Nabi1 probes responded with signal size up to 11% ΔF/F for a 100 mV depolarization and fast response time constants both for signal activation (~2 ms and signal decay (~3 ms. We improved expression in neuronal cells by replacing the mKO and UKG FRET pair with Clover (donor FP and mRuby2 (acceptor FP to create Nabi2 probes. Nabi2 probes also had large signals and relatively fast time constants in HEK293 cells. In primary neuronal culture, a Nabi2 probe was able to differentiate individual action potentials at 45 Hz.

Modulation of voltage-gated channel currents by harmaline and harmane.

Science.gov (United States)

Splettstoesser, Frank; Bonnet, Udo; Wiemann, Martin; Bingmann, Dieter; Büsselberg, Dietrich

2005-01-01

Harmala alkaloids are endogenous substances, which are involved in neurodegenerative disorders such as M. Parkinson, but some of them also have neuroprotective effects in the nervous system. While several sites of action at the cellular level (e.g. benzodiazepine receptors, 5-HT and GABA(A) receptors) have been identified, there is no report on how harmala alkaloids interact with voltage-gated membrane channels. The aim of this study was to investigate the effects of harmaline and harmane on voltage-activated calcium- (I(Ca(V))), sodium- (I(Na(V))) and potassium (I(K(V)))-channel currents, using the whole-cell patch-clamp method with cultured dorsal root ganglion neurones of 3-week-old rats. Currents were elicited by voltage steps from the holding potential to different command potentials. Harmaline and harmane reduced I(Ca(V)), I(Na(V)) and I(K(V)) concentration-dependent (10-500 microM) over the voltage range tested. I(Ca(V)) was reduced with an IC(50) of 100.6 microM for harmaline and by a significantly lower concentration of 75.8 microM (P<0.001, t-test) for harmane. The Hill coefficient was close to 1. Threshold concentration was around 10 microM for both substances. The steady state of inhibition of I(Ca(V)) by harmaline or harmane was reached within several minutes. The action was not use-dependent and at least partly reversible. It was mainly due to a reduction in the sustained calcium channel current (I(Ca(L+N))), while the transient voltage-gated calcium channel current (I(Ca(T))) was only partially affected. We conclude that harmaline and harmane are modulators of I(Ca(V)) in vitro. This might be related to their neuroprotective effects.

Cryogenic, Absolute, High Pressure Sensor

Science.gov (United States)

Chapman, John J. (Inventor); Shams. Qamar A. (Inventor); Powers, William T. (Inventor)

2001-01-01

A pressure sensor is provided for cryogenic, high pressure applications. A highly doped silicon piezoresistive pressure sensor is bonded to a silicon substrate in an absolute pressure sensing configuration. The absolute pressure sensor is bonded to an aluminum nitride substrate. Aluminum nitride has appropriate coefficient of thermal expansion for use with highly doped silicon at cryogenic temperatures. A group of sensors, either two sensors on two substrates or four sensors on a single substrate are packaged in a pressure vessel.

Technological Aspects: High Voltage

CERN Document Server

Faircloth, D.C.

2013-12-16

This paper covers the theory and technological aspects of high-voltage design for ion sources. Electric field strengths are critical to understanding high-voltage breakdown. The equations governing electric fields and the techniques to solve them are discussed. The fundamental physics of high-voltage breakdown and electrical discharges are outlined. Different types of electrical discharges are catalogued and their behaviour in environments ranging from air to vacuum are detailed. The importance of surfaces is discussed. The principles of designing electrodes and insulators are introduced. The use of high-voltage platforms and their relation to system design are discussed. The use of commercially available high-voltage technology such as connectors, feedthroughs and cables are considered. Different power supply technologies and their procurement are briefly outlined. High-voltage safety, electric shocks and system design rules are covered.

Capacitor Voltages Measurement and Balancing in Flying Capacitor Multilevel Converters Utilizing a Single Voltage Sensor

DEFF Research Database (Denmark)

Farivar, Glen; Ghias, Amer M. Y. M.; Hredzak, Branislav

2017-01-01

This paper proposes a new method for measuring capacitor voltages in multilevel flying capacitor (FC) converters that requires only one voltage sensor per phase leg. Multiple dc voltage sensors traditionally used to measure the capacitor voltages are replaced with a single voltage sensor at the ac...... side of the phase leg. The proposed method is subsequently used to balance the capacitor voltages using only the measured ac voltage. The operation of the proposed measurement and balancing method is independent of the number of the converter levels. Experimental results presented for a five-level FC...

A developmental study of latent absolute pitch memory.

Science.gov (United States)

Jakubowski, Kelly; Müllensiefen, Daniel; Stewart, Lauren

2017-03-01

The ability to recall the absolute pitch level of familiar music (latent absolute pitch memory) is widespread in adults, in contrast to the rare ability to label single pitches without a reference tone (overt absolute pitch memory). The present research investigated the developmental profile of latent absolute pitch (AP) memory and explored individual differences related to this ability. In two experiments, 288 children from 4 to12 years of age performed significantly above chance at recognizing the absolute pitch level of familiar melodies. No age-related improvement or decline, nor effects of musical training, gender, or familiarity with the stimuli were found in regard to latent AP task performance. These findings suggest that latent AP memory is a stable ability that is developed from as early as age 4 and persists into adulthood.

Flexible Compensation of Voltage and Current Unbalance and Harmonics in Microgrids

Directory of Open Access Journals (Sweden)

Seyyed Yousef Mousazadeh Mousavi

2017-10-01

Full Text Available In recent years, the harmonics and unbalance problems endanger the voltage and current quality of power systems, due to increasing usage of nonlinear and unbalanced loads. Use of Distributed Generation (DG-interfacing inverters is proposed for voltage or current compensation. In this paper, a flexible control method is proposed to compensate voltage and current unbalance and harmonics using the distributed generation (DG-interfacing inverters. This method is applicable to both grid-connected and islanded Microgrids (MGs. In the proposed method, not only the proper control of active and reactive powers can be achieved, but also there is flexibility in compensating the voltage or current quality problems at DG terminals or Points of Common Coupling (PCCs. This control strategy consists of active and reactive power controllers and a voltage/current quality-improvement block. The controller is designed in a stationary (αβ frame. An extensive simulation study has been performed and the results demonstrate the effectiveness of the proposed control scheme. Depending on the compensation modes, the harmonics and unbalance compensation of DG output current, MG-injected current to the grid, as well as PCC and DG voltages, can be achieved in grid-connected operation of MG while in the islanded operation, and the PCC and DG voltages compensation can be obtained through the proposed control scheme.

The irradiance and temperature dependent mathematical model for estimation of photovoltaic panel performances

International Nuclear Information System (INIS)

Barukčić, M.; Ćorluka, V.; Miklošević, K.

2015-01-01

Highlights: • The temperature and irradiance dependent model for the I–V curve estimation is presented. • The purely mathematical model based on the analysis of the I–V curve shape is presented. • The model includes the Gompertz function with temperature and irradiance dependent parameters. • The input data are extracted from the data sheet I–V curves. - Abstract: The temperature and irradiance dependent mathematical model for photovoltaic panel performances estimation is proposed in the paper. The base of the model is the mathematical function of the photovoltaic panel current–voltage curve. The model of the current–voltage curve is based on the sigmoid function with temperature and irradiance dependent parameters. The temperature and irradiance dependencies of the parameters are proposed in the form of analytic functions. The constant parameters are involved in the analytical functions. The constant parameters need to be estimated to get the temperature and irradiance dependent current–voltage curve. The mathematical model contains 12 constant parameters and they are estimated by using the evolutionary algorithm. The optimization problem is defined for this purpose. The optimization problem objective function is based on estimated and extracted (measured) current and voltage values. The current and voltage values are extracted from current–voltage curves given in datasheet of the photovoltaic panels. The new procedure for estimation of open circuit voltage value at any temperature and irradiance is proposed in the model. The performance of the proposed mathematical model is presented for three different photovoltaic panel technologies. The simulation results indicate that the proposed mathematical model is acceptable for estimation of temperature and irradiance dependent current–voltage curve and photovoltaic panel performances within temperature and irradiance ranges

Control and Testing of a Dynamic Voltage Restorer (DVR) at Medium Voltage Level

DEFF Research Database (Denmark)

Nielsen, John Godsk; Newman, Michael; Nielsen, Hans Ove

2004-01-01

power sensitive loads from voltage sags. This paper reports practical test results obtained on a medium voltage (10 kV) level using a DVR at a Distribution test facility in Kyndby, Denmark. The DVR was designed to protect a 400-kVA load from a 0.5-p.u. maximum voltage sag. The reported DVR verifies......The dynamic voltage restorer (DVR) has become popular as a cost effective solution for the protection of sensitive loads from voltage sags. Implementations of the DVR have been proposed at both a low voltage (LV) level, as well as a medium voltage (MV) level; and give an opportunity to protect high...... the use of a feed-forward and feed-back technique of the controller and it obtains both good transient and steady state responses. The effect of the DVR on the system is experimentally investigated under both faulted and non-faulted system states, for a variety of linear and non-linear loads. Variable...

Mitigation of the voltage fluctuations using an efficient disturbance extraction technique

Energy Technology Data Exchange (ETDEWEB)

Elnady, Amr; Salama, M.M.A. [University of Waterloo, Electrical and Computer Engineering, 200 University Ave. West, Waterloo, Ont. (Canada N2L3G1)

2007-03-15

This paper introduces an efficient technique for extracting the disturbance signal of the voltage flicker. The proposed technique depends on the supervised state estimation that is controlled by the Widrow-Hoff delta rule. The extracted disturbance signal is employed for mitigating the cyclic voltage flicker by using series and parallel mitigating devices. The speed and accuracy of the proposed technique are verified by simulation results with EMTDC/PSCAD. In addition, experimental results are presented to prove the validity of the proposed algorithm. (author)

Development of a Compensation Scheme for a Measurement Voltage Transformer Using the Hysteresis Characteristics of a Core

Directory of Open Access Journals (Sweden)

Hyewon Lee

2015-04-01

Full Text Available This paper describes the design, evaluation, and implementation of a compensation scheme for a measurement voltage transformer (VT using the hysteresis characteristics of the core. The error of a VT is caused by the primary winding voltage and secondary winding voltage. The latter depends on the secondary current, whereas the former depends on the primary current, which is an aggregate of the exciting and secondary currents. The secondary current is obtained directly from the secondary voltage and is used to obtain the voltage across the secondary winding. For the primary current, the exciting current is decomposed into two components: core-loss and magnetizing currents. The magnetizing current is obtained by the flux-magnetizing current curve instead of the hysteresis loop to minimize the required loops for compensation. The core-loss current is obtained by dividing the primary induced voltage by the core-loss resistance. Finally, the estimated voltages across the primary and secondary windings are added to the measured secondary voltage for compensation. The scheme can significantly improve the accuracy of a VT. The results of the performance of compensator are shown in the experimental test. The accuracy of the measurement VT improves from 1.0C class to 0.1C class. The scheme can help to significantly reduce the required core cross section of a measurement VT in an electrical energy system.

PC-based control of a high-voltage injector

International Nuclear Information System (INIS)

Constantin, F.

1998-01-01

The stability of high voltage injectors is one of the major problems in any accelerator system. Most of the troubles encountered in the normal operation of an accelerator are connected with the ion source and associated high voltage platforms, regardless of the source or high voltage generator type. The quality of the ion beam injected in the accelerator strongly depends on the power supplies used in the injector and on the ability to control the non-electrical parameters (gas-flow, temperature, etc.). A wide used method in controlling is based on optical links between high-voltage platform and computer, the adjustments being more or less automated. Although the method mentioned above can be still useful in injector control, a different approach is presented in this work, i.e., the computer itself is placed inside the high-voltage terminal. Only one optical link is still necessary to connect this computer with an user-friendly host at ground potential. Requirements: - varying and monitoring the filament current; - gas flow control in the ion source; - reading the vacuum values; - current and voltage control for the anodic, magnet, extraction, suppression and lens' sources. Even in the high voltage terminal there are compartments with different voltages regardless the floating ground. In our injector the extraction voltage is applied on the top of the ion source including the filament and the anodic voltage. The extraction voltage is of maximum 30 kV. In this situation a second optical link is required to transfer the control for the anodic and magnet source power supply assuming the dedicated computer on the floating ground. One PC is placed inside the high voltage terminal and one PC outside the injector. The optical link (more precisely two optical wires) connects the serial ports. The inside computer is equipped with two multipurpose ADC/DAC and digital I/O card. They permit to read or output DC levels ranging between 0 to 10 volts or TTL signals. The filament

Scorpion β-toxin interference with NaV channel voltage sensor gives rise to excitatory and depressant modes

Science.gov (United States)

Leipold, Enrico; Borges, Adolfo

2012-01-01

Scorpion β toxins, peptides of ∼70 residues, specifically target voltage-gated sodium (NaV) channels to cause use-dependent subthreshold channel openings via a voltage–sensor trapping mechanism. This excitatory action is often overlaid by a not yet understood depressant mode in which NaV channel activity is inhibited. Here, we analyzed these two modes of gating modification by β-toxin Tz1 from Tityus zulianus on heterologously expressed NaV1.4 and NaV1.5 channels using the whole cell patch-clamp method. Tz1 facilitated the opening of NaV1.4 in a use-dependent manner and inhibited channel opening with a reversed use dependence. In contrast, the opening of NaV1.5 was exclusively inhibited without noticeable use dependence. Using chimeras of NaV1.4 and NaV1.5 channels, we demonstrated that gating modification by Tz1 depends on the specific structure of the voltage sensor in domain 2. Although residue G658 in NaV1.4 promotes the use-dependent transitions between Tz1 modification phenotypes, the equivalent residue in NaV1.5, N803, abolishes them. Gating charge neutralizations in the NaV1.4 domain 2 voltage sensor identified arginine residues at positions 663 and 669 as crucial for the outward and inward movement of this sensor, respectively. Our data support a model in which Tz1 can stabilize two conformations of the domain 2 voltage sensor: a preactivated outward position leading to NaV channels that open at subthreshold potentials, and a deactivated inward position preventing channels from opening. The results are best explained by a two-state voltage–sensor trapping model in that bound scorpion β toxin slows the activation as well as the deactivation kinetics of the voltage sensor in domain 2. PMID:22450487

Static Electricity as Part of Electromagnetic Environment on High-Voltage Electrical Substation

Directory of Open Access Journals (Sweden)

M. I. Fursanov

2012-01-01

Full Text Available Causes of occurrences electrostatic discharges (ESD on high-voltage electric substation were investigated and dependences values ESD’s on parameters interaction structures, humidity of air were found. Experimental research values ESD’s on high-voltage electric substation and in man-made conditions was fulfilled. Uncertainty measurement’s was taken into consideration by research results analyze. Matching with research of other authors was made. Danger ESD’s for electric devises was established.

Current-voltage characteristics of porous-silicon structures

International Nuclear Information System (INIS)

Diligenti, A.; Nannini, A.; Pennelli, G.; Pieri, F.; Fuso, F.; Allegrini, M.

1996-01-01

I-V DC characteristics have been measured on metal/porous-silicon structures. In particular, the measurements on metal/free-standing porous-silicon film/metal devices confirmed the result, already obtained, that the metal/porous-silicon interface plays a crucial role in the transport of any device. Four-contacts measurements on free-standing layers showed that the current linearly depends on the voltage and that the conduction process is thermally activated, the activation energy depending on the porous silicon film production parameters. Finally, annealing experiments performed in order to improve the conduction of rectifying contacts, are described

Low voltage initiation of damaging arcs between electrical contacts

International Nuclear Information System (INIS)

Cuthrell, R.E.

1975-07-01

Metallic arcs were found to precede the firm contacting of electrical contacts which were closed without bounce. When the open-circuit voltages were below the ionization potential, the initiation of these arcs was found to depend on the presence of asperities on the surfaces and on asperity contracting, melting, and pinching off by magnetic forces. The arc is thought to be initiated inductively when the molten metallic asperity contact is pinched off, and the electrode damage is similar to that produced by the arcing of opening contacts. Arcing could not be produced for exceptionally smooth surfaces, or, for rough surfaces when the open-circuit potential was below the melting voltages of the electrode metals. In order to prevent damage to contact surfaces by melting or arcing, it is suggested that test potentials be limited to below the melting voltages, that the current be limited, the test circuits be designed to prevent inductively generated high voltage transients, and the contact surfaces be very smooth. In order to facilitate arc initiation in arc welding applications, it is suggested that the surfaces of electrodes and work pieces be roughened. (U.S.)

Technological Aspects: High Voltage

International Nuclear Information System (INIS)

Faircloth, D C

2013-01-01

This paper covers the theory and technological aspects of high-voltage design for ion sources. Electric field strengths are critical to understanding high-voltage breakdown. The equations governing electric fields and the techniques to solve them are discussed. The fundamental physics of high-voltage breakdown and electrical discharges are outlined. Different types of electrical discharges are catalogued and their behaviour in environments ranging from air to vacuum are detailed. The importance of surfaces is discussed. The principles of designing electrodes and insulators are introduced. The use of high-voltage platforms and their relation to system design are discussed. The use of commercially available high-voltage technology such as connectors, feedthroughs and cables are considered. Different power supply technologies and their procurement are briefly outlined. High-voltage safety, electric shocks and system design rules are covered. (author)

Innovation of High Voltage Supply Adjustment Device on Diagnostic X-Ray Machine

International Nuclear Information System (INIS)

Sujatno; Wiranto Budi Santoso

2010-01-01

Innovation of high voltage supply adjustment device on diagnostic x-ray machine has been carried out. The innovation is conducted by utilizing an electronic circuit as a high voltage adjustment device. Usually a diagnostic x-ray machine utilizes a transformer or an auto-transformer as a high voltage supply adjustment device. A high power diagnostic x-ray machine needs a high power transformer which has big physical dimension. Therefore a box control where the transformer is located has to have big physical dimension. Besides, the price of the transformer is expensive and hardly found in local markets. In this innovation, the transformer is replaced by an electronic circuit. The main component of the electronic circuit is Triac BTA-40. As adjustment device, the triac is controlled by a variable resistor which is coupled by a stepper motor. A step movement of stepper motor varies a value of resistor. The resistor value determines the triac gate voltage. Furthermore the triac will open according to the value of electrical current flowing to the gate. When the gate is open, electrical voltage and current will flow from cathode to anode of the triac. The value of these electrical voltage and current depend on gate open condition. Then this triac output voltage is feed to diagnostic x-ray machine high voltage supply. Therefore the high voltage value of diagnostic x-ray machine is adjusted by the output voltage of the electronic circuit. By using this electronic circuit, the physical dimension of diagnostic x-ray machine box control and the price of the equipment can be reduced. (author)

Classification of methods for measuring current-voltage characteristics of semiconductor devices

Directory of Open Access Journals (Sweden)

Iermolenko Ia. O.

2014-06-01

Full Text Available It is shown that computer systems for measuring current-voltage characteristics are very important for semiconductor devices production. The main criteria of efficiency of such systems are defined. It is shown that efficiency of such systems significantly depends on the methods for measuring current-voltage characteristics of semiconductor devices. The aim of this work is to analyze existing methods for measuring current-voltage characteristics of semiconductor devices and to create the classification of these methods in order to specify the most effective solutions in terms of defined criteria. To achieve this aim, the most common classifications of methods for measuring current-voltage characteristics of semiconductor devices and their main disadvantages are considered. Automated and manual, continuous, pulse, mixed, isothermal and isodynamic methods for measuring current-voltage characteristics are analyzed. As a result of the analysis and generalization of existing methods the next classification criteria are defined: the level of automation, the form of measurement signals, the condition of semiconductor device during the measurements, and the use of mathematical processing of the measurement results. With the use of these criteria the classification scheme of methods for measuring current-voltage characteristics of semiconductor devices is composed and the most effective methods are specified.

Voltage Management in Unbalanced Low Voltage Networks Using a Decoupled Phase-Tap-Changer Transformer

DEFF Research Database (Denmark)

Coppo, Massimiliano; Turri, Roberto; Marinelli, Mattia

2014-01-01

The paper studies a medium voltage-low voltage transformer with a decoupled on load tap changer capability on each phase. The overall objective is the evaluation of the potential benefits on a low voltage network of such possibility. A realistic Danish low voltage network is used for the analysis...

Automatic voltage imbalance detector

Science.gov (United States)

Bobbett, Ronald E.; McCormick, J. Byron; Kerwin, William J.

1984-01-01

A device for indicating and preventing damage to voltage cells such as galvanic cells and fuel cells connected in series by detecting sequential voltages and comparing these voltages to adjacent voltage cells. The device is implemented by using operational amplifiers and switching circuitry is provided by transistors. The device can be utilized in battery powered electric vehicles to prevent galvanic cell damage and also in series connected fuel cells to prevent fuel cell damage.

Advancing Absolute Calibration for JWST and Other Applications

Science.gov (United States)

Rieke, George; Bohlin, Ralph; Boyajian, Tabetha; Carey, Sean; Casagrande, Luca; Deustua, Susana; Gordon, Karl; Kraemer, Kathleen; Marengo, Massimo; Schlawin, Everett; Su, Kate; Sloan, Greg; Volk, Kevin

2017-10-01

We propose to exploit the unique optical stability of the Spitzer telescope, along with that of IRAC, to (1) transfer the accurate absolute calibration obtained with MSX on very bright stars directly to two reference stars within the dynamic range of the JWST imagers (and of other modern instrumentation); (2) establish a second accurate absolute calibration based on the absolutely calibrated spectrum of the sun, transferred onto the astronomical system via alpha Cen A; and (3) provide accurate infrared measurements for the 11 (of 15) highest priority stars with no such data but with accurate interferometrically measured diameters, allowing us to optimize determinations of effective temperatures using the infrared flux method and thus to extend the accurate absolute calibration spectrally. This program is integral to plans for an accurate absolute calibration of JWST and will also provide a valuable Spitzer legacy.

Voltage Control of Antiferromagnetic Phases at Near-Terahertz Frequencies

Science.gov (United States)

Barra, Anthony; Domann, John; Kim, Ki Wook; Carman, Greg

2018-03-01

A method to control antiferromagnetism using voltage-induced strain is proposed and theoretically examined. Voltage-induced magnetoelastic anisotropy is shown to provide sufficient torque to switch an antiferromagnetic domain 90° either from out of plane to in plane or between in-plane axes. Numerical results indicate that strain-mediated antiferromagnetic switching can occur in an 80-nm nanopatterned disk at frequencies approaching 1 THz but that the switching speed heavily depends on the system's mechanical design. Furthermore, the energy cost to induce magnetic switching is only 450 aJ, indicating that magnetoelastic control of antiferromagnetism is substantially more energy efficient than other approaches.

Dynamics of the resistive state of a narrow superconducting channel in the ac voltage-driven regime

International Nuclear Information System (INIS)

Yerin, Yu.S.; Fenchenko, V.N.

2013-01-01

Within the time-dependent Ginzburg-Landau equations the dynamics of the order parameter in superconducting narrow channels of different lengths is investigated in the ac voltage-driven regime. The resistive state of the system at low frequencies of the applied voltage is characterized by the formation of periodic-in-time groups of oscillating phase-slip centers (PSC). An increase in frequency reduces the duration of the existence of these periodic groups. Depending on the length of the channel the ac voltage either tends to revert the channel to the state with one central PSC in periodic groups or minimizes the number of forming PSCs and orders their pattern in the system. A further increase in frequency for rather short channels leads to suppression of the order parameter without any creation of PSCs. For systems, whose length exceeds the specified limit, the formation of PSC occurs after a certain time which increases rapidly with frequency. The current-voltage characteristics of rather short channels at different applied voltage frequencies are calculated too. It is found that the current-voltage characteristics have a step-like structure, and the height of the first step is determined by the quadruple value of the Josephson frequency.

The Coefficient of the Voltage Induced Frequency Shift Measurement on a Quartz Tuning Fork

Directory of Open Access Journals (Sweden)

Yubin Hou

2014-11-01

Full Text Available We have measured the coefficient of the voltage induced frequency shift (VIFS of a 32.768 KHz quartz tuning fork. Three vibration modes were studied: one prong oscillating, two prongs oscillating in the same direction, and two prongs oscillating in opposite directions. They all showed a parabolic dependence of the eigen-frequency shift on the bias voltage applied across the fork, due to the voltage-induced internal stress, which varies as the fork oscillates. The average coefficient of the VIFS effect is as low as several hundred nano-Hz per millivolt, implying that fast-response voltage-controlled oscillators and phase-locked loops with nano-Hz resolution can be built.

Capacitive divider for output voltage measurement of intense electron beam accelerator

International Nuclear Information System (INIS)

Ding Desheng; Yi Lingzhi; Yu Binxiong; Hong Zhiqiang; Liu Jinliang

2012-01-01

A kind of simple-mechanism, easy-disassembly self-integrating capacitive divider used for measuring diode output voltage of intense electron beam accelerator (IEBA) is developed. The structure of the capacitive divider is described, and the capacitance value of the capacitive divider is calculated by theoretical analysis and electromagnetic simulation. The dependence of measurement voltage on electrical parameters such as stray capacitance, earth capacitance of front resistance is obtained by PSpice simulation. Measured waveforms appear overshoot phenomenon when stray capacitance of front resistance is larger, and the wavefront will be affected when earth capacitance of front resistance is larger. The diode output voltage waveforms of intense electron beam accelerator, are measured by capacitive divider and calibrated by water resistance divider, which is accordance with that measured by a resistive divider, the division ratio is about 563007. The designed capacitive divider can be used to measure high-voltage pulse with 100 ns full width at half maximum. (authors)

Gating transitions in the selectivity filter region of a sodium channel are coupled to the domain IV voltage sensor.

Science.gov (United States)

Capes, Deborah L; Arcisio-Miranda, Manoel; Jarecki, Brian W; French, Robert J; Chanda, Baron

2012-02-14

Voltage-dependent ion channels are crucial for generation and propagation of electrical activity in biological systems. The primary mechanism for voltage transduction in these proteins involves the movement of a voltage-sensing domain (D), which opens a gate located on the cytoplasmic side. A distinct conformational change in the selectivity filter near the extracellular side has been implicated in slow inactivation gating, which is important for spike frequency adaptation in neural circuits. However, it remains an open question whether gating transitions in the selectivity filter region are also actuated by voltage sensors. Here, we examine conformational coupling between each of the four voltage sensors and the outer pore of a eukaryotic voltage-dependent sodium channel. The voltage sensors of these sodium channels are not structurally symmetric and exhibit functional specialization. To track the conformational rearrangements of individual voltage-sensing domains, we recorded domain-specific gating pore currents. Our data show that, of the four voltage sensors, only the domain IV voltage sensor is coupled to the conformation of the selectivity filter region of the sodium channel. Trapping the outer pore in a particular conformation with a high-affinity toxin or disulphide crossbridge impedes the return of this voltage sensor to its resting conformation. Our findings directly establish that, in addition to the canonical electromechanical coupling between voltage sensor and inner pore gates of a sodium channel, gating transitions in the selectivity filter region are also coupled to the movement of a voltage sensor. Furthermore, our results also imply that the voltage sensor of domain IV is unique in this linkage and in the ability to initiate slow inactivation in sodium channels.

Electrocardiogram voltage discordance: Interpretation of low QRS voltage only in the precordial leads.

Science.gov (United States)

Kim, Diana H; Verdino, Ralph J

To define clinical correlates of low voltage isolated to precordial leads on the surface electrocardiogram (ECG). Low voltage (V) on the ECG is defined as QRS Vvoltage isolated to the precordial leads with normal limb lead voltages is unclear. Twelve-lead ECGs with QRS V>5mm in one or more limb leads and voltage was found in 256 of 150,000 ECGs (~0.2%). 50.4% of patients had discordant ECGs that correlated with classic etiologies, with a higher incidence of LV dilation in those with classic etiologies than those without. Low precordial voltage is associated with classic etiologies and LV dilation. Copyright © 2017 Elsevier Inc. All rights reserved.

Current-voltage characteristics of bulk heterojunction organic solar cells: connection between light and dark curves

Energy Technology Data Exchange (ETDEWEB)

Boix, Pablo P.; Guerrero, Antonio; Garcia-Belmonte, Germa; Bisquert, Juan [Photovoltaic and Optoelectronic Devices Group, Departament de Fisica, Universitat Jaume I, ES-12071 Castello (Spain); Marchesi, Luis F. [Laboratorio Interdisciplinar de, Eletroquimica e Ceramica (LIEC), Universidade Federal de Sao Carlos (Brazil); Photovoltaic and Optoelectronic Devices Group, Departament de Fisica, Universitat Jaume I, ES-12071 Castello (Spain)

2011-11-15

A connection is established between recombination and series resistances extracted from impedance spectroscopy and current-voltage curves of polythiophene:fullerene organic solar cells. Recombination is shown to depend exclusively on the (Fermi level) voltage, which allows construction of the current-voltage characteristics in any required conditions based on a restricted set of measurements. The analysis highlights carrier recombination current as the determining mechanism of organic solar cell performance. (Copyright copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

A real space calculation of absolutely unstable modes for two-plasmon decay in inhomogeneous plasma

International Nuclear Information System (INIS)

Powers, L.V.; Berger, R.L.

1986-01-01

Growth rates for absolute modes of two-plasmon decay are obtained by solving for eigenmodes of the coupled mode equations for obliquely scattered Langmuir waves in real space. This analysis establishes a connection both to previous analysis in Fourier transform space and to other parametric instabilities, the analysis of which is commonly done in real space. The essential feature of the instability which admits absolute modes in an inhomogeneous plasma is the strong spatial dependence of the coupling coefficients. Landau damping limits the perpendicular wavenumbers of the most unstable modes and raises the instability thresholds for background plasma temperatures above 1 keV. (author)

Current-voltage characteristic of a Josephson junction with randomly distributed Abrikosov vortices

International Nuclear Information System (INIS)

Fistul, M.V.; Giuliani, G.F.

1997-01-01

We have developed a theory of the current-voltage characteristic of a Josephson junction in the presence of randomly distributed, pinned misaligned Abrikosov vortices oriented perpendicularly to the junction plane. Under these conditions the Josephson phase difference var-phi acquires an interesting stochastic dependence on the position in the plane of the junction. In this situation it is possible to define an average critical current which is determined by the spatial correlations of this function. Due to the inhomogeneity, we find that for finite voltage bias the electromagnetic waves propagating in the junction display a broad spectrum of wavelengths. This is at variance with the situation encountered in homogeneous junctions. The amplitude of these modes is found to decrease as the bias is increased. We predict that the presence of these excitations is directly related to a remarkable feature in the current-voltage characteristic. The dependence of the position and the magnitude of this feature on the vortex concentration has been determined. copyright 1997 The American Physical Society

Origin of the transition voltage in gold–vacuum–gold atomic junctions

KAUST Repository

Wu, Kunlin; Bai, Meilin; Sanvito, Stefano; Hou, Shimin

2012-01-01

The origin and the distance dependence of the transition voltage of gold-vacuum-gold junctions are investigated by employing first-principles quantum transport simulations. Our calculations show that atomic protrusions always exist on the electrode

Regulation of the Output Voltage of an Inverter in Case of Load Variation

Science.gov (United States)

Diouri, Omar; Errahimi, Fatima; Es-Sbai, Najia

2018-05-01

In a DC/AC photovoltaic application, the stability of the output voltage of the inverter plays a very important role in the electrical systems. Such a photovoltaic system is constituted by an inverter, which makes it possible to convert the continuous energy to the alternative energy used in systems which operate under a voltage of 230V. The output of this inverter can be connected to a single load or more, at which time a second load is added in parallel with the first load. In this case, it proves a voltage drop at the output of the inverter. This problem influences the proper functioning of the electrical loads. Therefore, our contribution is to give a solution to this by compensating this voltage drop using a boost converter at the input of the inverter. This boost converter will play the role of the compensator that will provide the necessary voltage to the inverter in order to increase the voltage across the loads. But the use of this boost without controlling it is not enough because it generates a voltage that depends on the duty cycle of the control signal. To stabilize the output voltage of the inverter, we used a Proportional, Integral, and Derivative control (PID), which makes it possible to generate the necessary control signal for the voltage boost in order to have a good regulation of the output voltage of the inverter. Finally, we have solved the problem of the voltage drop even though there is loads variation.

Identification of an HV 1 voltage-gated proton channel in insects.

Science.gov (United States)

Chaves, Gustavo; Derst, Christian; Franzen, Arne; Mashimo, Yuta; Machida, Ryuichiro; Musset, Boris

2016-04-01

The voltage-gated proton channel 1 (HV 1) is an important component of the cellular proton extrusion machinery and is essential for charge compensation during the respiratory burst of phagocytes. HV 1 has been identified in a wide range of eukaryotes throughout the animal kingdom, with the exception of insects. Therefore, it has been proposed that insects do not possess an HV 1 channel. In the present study, we report the existence of an HV 1-type proton channel in insects. We searched insect transcriptome shotgun assembly (TSA) sequence databases and found putative HV 1 orthologues in various polyneopteran insects. To confirm that these putative HV 1 orthologues were functional channels, we studied the HV 1 channel of Nicoletia phytophila (NpHV 1), an insect of the Zygentoma order, in more detail. NpHV 1 comprises 239 amino acids and is 33% identical to the human voltage-gated proton channel 1. Patch clamp measurements in a heterologous expression system showed proton selectivity, as well as pH- and voltage-dependent gating. Interestingly, NpHV 1 shows slightly enhanced pH-dependent gating compared to the human channel. Mutations in the first transmembrane segment at position 66 (Asp66), the presumed selectivity filter, lead to a loss of proton-selective conduction, confirming the importance of this aspartate residue in voltage-gated proton channels. Nucleotide sequence data have been deposited in the GenBank database under accession number KT780722. © 2016 Federation of European Biochemical Societies.

Selective decentralized underfrequency protection. Load shedding depending on underfrequency; Selektiver dezentraler Unterfrequenzschutz. Unterfrequenzabhaengiger Lastabwurf

Energy Technology Data Exchange (ETDEWEB)

Worgull, Alexander; Horenkamp, Willi; Kaliwoda, Michael; Rehtanz, Christian [Technische Univ. Dortmund (Germany). Inst. fuer Energiesysteme, Energieeffizienz und Energiewirtschaft

2013-03-11

In the case of major disruptions, the underfrequency depending load shedding serves to restore the performance balance between generation and consumption. If a switching off of electrical consumers due to an actual underfrequency event is required, individual grid areas are separated from the residual power grid by means of a frequency relay. Normally, the disconnection from the mains takes place at the medium voltage level of the 110 kV transformer. In addition to consumers, also decentralized energy transformation plants are disconnected. Thus, the performance deficit will be enhanced, if necessary. Thus, a procedure considering the actual load situation and feed-in situation is absolutely essential in the future. The Institute of Energy Systems, Energy Efficiency and Energy Economics at the Dortmund Technical University (Dortmund, Federal Republic of Germany) develops which realizes a future-oriented selective underfrequency protection by means of smart metering systems.

NGS Absolute Gravity Data

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — The NGS Absolute Gravity data (78 stations) was received in July 1993. Principal gravity parameters include Gravity Value, Uncertainty, and Vertical Gradient. The...

Communicating cardiovascular disease risk: an interview study of General Practitioners' use of absolute risk within tailored communication strategies.

Science.gov (United States)

Bonner, Carissa; Jansen, Jesse; McKinn, Shannon; Irwig, Les; Doust, Jenny; Glasziou, Paul; McCaffery, Kirsten

2014-05-29

Cardiovascular disease (CVD) prevention guidelines encourage assessment of absolute CVD risk - the probability of a CVD event within a fixed time period, based on the most predictive risk factors. However, few General Practitioners (GPs) use absolute CVD risk consistently, and communication difficulties have been identified as a barrier to changing practice. This study aimed to explore GPs' descriptions of their CVD risk communication strategies, including the role of absolute risk. Semi-structured interviews were conducted with a purposive sample of 25 GPs in New South Wales, Australia. Transcribed audio-recordings were thematically coded, using the Framework Analysis method to ensure rigour. GPs used absolute CVD risk within three different communication strategies: 'positive', 'scare tactic', and 'indirect'. A 'positive' strategy, which aimed to reassure and motivate, was used for patients with low risk, determination to change lifestyle, and some concern about CVD risk. Absolute risk was used to show how they could reduce risk. A 'scare tactic' strategy was used for patients with high risk, lack of motivation, and a dismissive attitude. Absolute risk was used to 'scare' them into taking action. An 'indirect' strategy, where CVD risk was not the main focus, was used for patients with low risk but some lifestyle risk factors, high anxiety, high resistance to change, or difficulty understanding probabilities. Non-quantitative absolute risk formats were found to be helpful in these situations. This study demonstrated how GPs use three different communication strategies to address the issue of CVD risk, depending on their perception of patient risk, motivation and anxiety. Absolute risk played a different role within each strategy. Providing GPs with alternative ways of explaining absolute risk, in order to achieve different communication aims, may improve their use of absolute CVD risk assessment in practice.

Low-Voltage Consumption Coordination for Loss Minimization and Voltage Control

DEFF Research Database (Denmark)

Juelsgaard, Morten; Sloth, Christoffer; Wisniewski, Rafal

2014-01-01

This work presents a strategy for minimizing active power losses in low-voltage grids, by coordinating the consumption of electric vehicles and power generation from solar panels. We show that minimizing losses, also reduces voltage variations, and illustrate how this may be employed for increasing...

Sinusoidal voltage protocols for rapid characterisation of ion channel kinetics.

Science.gov (United States)

Beattie, Kylie A; Hill, Adam P; Bardenet, Rémi; Cui, Yi; Vandenberg, Jamie I; Gavaghan, David J; de Boer, Teun P; Mirams, Gary R

2018-03-24

Ion current kinetics are commonly represented by current-voltage relationships, time constant-voltage relationships and subsequently mathematical models fitted to these. These experiments take substantial time, which means they are rarely performed in the same cell. Rather than traditional square-wave voltage clamps, we fitted a model to the current evoked by a novel sum-of-sinusoids voltage clamp that was only 8 s long. Short protocols that can be performed multiple times within a single cell will offer many new opportunities to measure how ion current kinetics are affected by changing conditions. The new model predicts the current under traditional square-wave protocols well, with better predictions of underlying currents than literature models. The current under a novel physiologically relevant series of action potential clamps is predicted extremely well. The short sinusoidal protocols allow a model to be fully fitted to individual cells, allowing us to examine cell-cell variability in current kinetics for the first time. Understanding the roles of ion currents is crucial to predict the action of pharmaceuticals and mutations in different scenarios, and thereby to guide clinical interventions in the heart, brain and other electrophysiological systems. Our ability to predict how ion currents contribute to cellular electrophysiology is in turn critically dependent on our characterisation of ion channel kinetics - the voltage-dependent rates of transition between open, closed and inactivated channel states. We present a new method for rapidly exploring and characterising ion channel kinetics, applying it to the hERG potassium channel as an example, with the aim of generating a quantitatively predictive representation of the ion current. We fitted a mathematical model to currents evoked by a novel 8 second sinusoidal voltage clamp in CHO cells overexpressing hERG1a. The model was then used to predict over 5 minutes of recordings in the same cell in response to

DC-link Voltage Control to Compensate Voltage Deviation for PV–BESSs Integrated System in Low-Voltage (LV Networks

Directory of Open Access Journals (Sweden)

Lee Gyu-sub

2016-01-01

Full Text Available The exhaustion of fossil fuel and the greenhouse gas emission are one of the most significant energy and environmental issues, respectively. Photovoltaic (PV generators and battery energy storage systems (BESSs have been significantly increased for recent years. The BESSs are mainly used for smoothing active power fluctuation of the PV. In this paper, PV–BESSs integration of two DC/DC converters and one AC/DC converter is investigated and DC-link voltage control to compensate the AC voltage deviation is proposed for the PV‒BESS system in low-voltage (LV networks.

Impact of distributed generators on the power loss and voltage profile of sub-transmission network

Directory of Open Access Journals (Sweden)

A.S.O. Ogunjuyigbe

2016-05-01

Full Text Available This paper presents the impact of distributed generator (DG on the power loss and voltage profile of sub-transmission network at different penetration levels (PLs. The various DG technologies are modeled based on their electrical output characteristics. Voltage profile index which allows a single value to represent how well the voltage matches the ideal value is developed. The index allows a fair comparison of the voltage profile obtained from different scenarios. The extent to which DGs affect power losses and voltage profile depend on the type of DG technology, PL and the location in which the DG is connected to the grid. The integration of DGs reduces power losses on the network, however, as the PL increases, the power losses begin to increase. A PL of 50–75% is achieved on 69 kV voltage level and 25–50% penetration on 13.8 kV voltage level without an increase in the power loss. Also more DG can be integrated into the network at point of common connection of higher voltage level compared to the low voltage level.

High voltage test techniques

CERN Document Server

Kind, Dieter

2001-01-01

The second edition of High Voltage Test Techniques has been completely revised. The present revision takes into account the latest international developments in High Voltage and Measurement technology, making it an essential reference for engineers in the testing field.High Voltage Technology belongs to the traditional area of Electrical Engineering. However, this is not to say that the area has stood still. New insulating materials, computing methods and voltage levels repeatedly pose new problems or open up methods of solution; electromagnetic compatibility (EMC) or components and systems al

Low-temperature VRH conduction through complex materials in the presence of a temperature-dependent voltage threshold: A semi-classical percolative approach

International Nuclear Information System (INIS)

Sen, A.K.; Bhattacharya, S.

2006-12-01

In this paper, we study the variation of low temperature (T) dc conductance, G(T), of a semi-classical percolative Random Resistor cum Tunneling-bond Network (RRTN), in the presence of a linearly temperature-dependent microscopic voltage threshold, υ g (T). This model (proposed by our group in the early 90's) considers a phenomenological semi-classical tunneling (or, hopping through a barrier) process. Just as in our previous constant-υ g case, we find in the present study also that the variable range hopping (VRH) exponent γ varies continuously with the ohmic concentration p in a non-monotonic fashion. In addition, we observe a new shoulder-like behaviour of G(T) in the intermediate temperature range, below the conductance maximum. (author)

Flexible Compensation of Voltage and Current Unbalance and Harmonics in Microgrids

DEFF Research Database (Denmark)

Mousazadeh, Seyyed Yousef; Jalilian, Alireza; Savaghebi, Mehdi

2017-01-01

In recent years, the harmonics and unbalance problem endanger the voltage and current quality of power systems due to increasing usage of nonlinear and unbalance loads. Using DG interfacing inverters is proposed for voltage or current compensation. In this paper, a flexible control method...... is proposed to compensate voltage and current unbalance and harmonics using the Distributed Generation (DG) interfacing inverters. This method is applicable to both grid-connected and islanded microgrids. In the proposed method, not only the proper control of active and reactive powers can be achieved......) frame. An extensive simulation study has been performed and the results demonstrate the effectiveness of the proposed control scheme. The results show that depending on the compensation mode, the harmonics and unbalance compensation of DGs’ output current, MG’s injected current to the grid as well...

Low-voltage gyrotrons

International Nuclear Information System (INIS)

Glyavin, M. Yu.; Zavolskiy, N. A.; Sedov, A. S.; Nusinovich, G. S.

2013-01-01

For a long time, the gyrotrons were primarily developed for electron cyclotron heating and current drive of plasmas in controlled fusion reactors where a multi-megawatt, quasi-continuous millimeter-wave power is required. In addition to this important application, there are other applications (and their number increases with time) which do not require a very high power level, but such issues as the ability to operate at low voltages and have compact devices are very important. For example, gyrotrons are of interest for a dynamic nuclear polarization, which improves the sensitivity of the nuclear magnetic resonance spectroscopy. In this paper, some issues important for operation of gyrotrons driven by low-voltage electron beams are analyzed. An emphasis is made on the efficiency of low-voltage gyrotron operation at the fundamental and higher cyclotron harmonics. These efficiencies calculated with the account for ohmic losses were, first, determined in the framework of the generalized gyrotron theory based on the cold-cavity approximation. Then, more accurate, self-consistent calculations for the fundamental and second harmonic low-voltage sub-THz gyrotron designs were carried out. Results of these calculations are presented and discussed. It is shown that operation of the fundamental and second harmonic gyrotrons with noticeable efficiencies is possible even at voltages as low as 5–10 kV. Even the third harmonic gyrotrons can operate at voltages about 15 kV, albeit with rather low efficiency (1%–2% in the submillimeter wavelength region).

Advanced Control of the Dynamic Voltage Restorer for Mitigating Voltage Sags in Power Systems

Directory of Open Access Journals (Sweden)

Dung Vo Tien

2018-01-01

Full Text Available The paper presents a vector control with two cascaded loops to improve the properties of Dynamic Voltage Restorer (DVR to minimize Voltage Sags on the grid. Thereby, a vector controlled structure was built on the rotating dq-coordinate system with the combination of voltage control and the current control. The proposed DVR control method is modelled using MATLAB-Simulink. It is tested using balanced/unbalanced voltage sags as well as fluctuant and distorted voltages. As a result, by using this controlling method, the dynamic characteristics of the system have been improved significantly. The system performed with higher accuracy, faster response and lower distortion in the voltage sags compensation. The paper presents real time experimental results to verify the performance of the proposed method in real environments.

Investigating Absolute Value: A Real World Application

Science.gov (United States)

Kidd, Margaret; Pagni, David

2009-01-01

Making connections between various representations is important in mathematics. In this article, the authors discuss the numeric, algebraic, and graphical representations of sums of absolute values of linear functions. The initial explanations are accessible to all students who have experience graphing and who understand that absolute value simply…

Ciguatoxins: Cyclic Polyether Modulators of Voltage-gated Iion Channel Function

Science.gov (United States)

Nicholson, Graham M.; Lewis, Richard J.

2006-01-01

Ciguatoxins are cyclic polyether toxins, derived from marine dinoflagellates, which are responsible for the symptoms of ciguatera poisoning. Ingestion of tropical and subtropical fin fish contaminated by ciguatoxins results in an illness characterised by neurological, cardiovascular and gastrointestinal disorders. The pharmacology of ciguatoxins is characterised by their ability to cause persistent activation of voltage-gated sodium channels, to increase neuronal excitability and neurotransmitter release, to impair synaptic vesicle recycling, and to cause cell swelling. It is these effects, in combination with an action to block voltage-gated potassium channels at high doses, which are believed to underlie the complex of symptoms associated with ciguatera. This review examines the sources, structures and pharmacology of ciguatoxins. In particular, attention is placed on their cellular modes of actions to modulate voltage-gated ion channels and other Na+-dependent mechanisms in numerous cell types and to current approaches for detection and treatment of ciguatera.

Observation of asymmetric transverse voltage in granular high-T c superconductors

International Nuclear Information System (INIS)

Luz, M.S. da; Carvalho, F.J.H. de; Santos, C.A.M. dos; Shigue, C.Y.; Machado, A.J.S.; Ricardo da Silva, R.

2005-01-01

This work reports the influence of the granularity on the transverse voltage as a function of the temperature, V XY (T), in polycrystalline samples of Bi 2 Sr 2 Ca 0.8 Pr 0.2 Cu 2 O 8+δ composition. It is observed nonzero transverse voltage at zero external magnetic field in the vicinity of the superconducting transition while far away from it, both above and below, no such voltage was detected. Measurements of V XY (T) in both directions of magnetic field allowed to calculate the symmetric and asymmetric transverse voltages in the full range of the applied magnetic field studied (zero up to 9 T). The symmetric transverse voltage as a function of the temperature presents sign reversal of the Hall resistance and positive Hall voltage at normal state such as expected for hole-doped high critical temperature superconductors. On the other hand, the asymmetric component of V XY (T) shows a peak near the superconducting transition which has been recently reported in literature. V XY (T) curves measured in a sample with double superconducting transition, which was confirmed by ac-susceptibility measurements and hysteresis loops of the magneto-resistance, present two peaks in the asymmetric component. These peaks are related to the intergranular and intragranular transitions and can be explained within the framework of Josephson and Abrikosov vortices and anti-vortices motion. By comparing the temperature dependence of the asymmetric transverse voltage and the derivative of longitudinal voltage is possible to observe a specific relation between both transport properties, which is noted to be valid not only at zero applied magnetic field but also under applied field

Integrative Approach with Electrophysiological and Theoretical Methods Reveals a New Role of S4 Positively Charged Residues in PKD2L1 Channel Voltage-Sensing.

Science.gov (United States)

Numata, Tomohiro; Tsumoto, Kunichika; Yamada, Kazunori; Kurokawa, Tatsuki; Hirose, Shinichi; Nomura, Hideki; Kawano, Mitsuhiro; Kurachi, Yoshihisa; Inoue, Ryuji; Mori, Yasuo

2017-08-29

Numerical model-based simulations provide important insights into ion channel gating when experimental limitations exist. Here, a novel strategy combining numerical simulations with patch clamp experiments was used to investigate the net positive charges in the putative transmembrane segment 4 (S4) of the atypical, positively-shifted voltage-dependence of polycystic kidney disease 2-like 1 (PKD2L1) channel. Charge-neutralising mutations (K452Q, K455Q and K461Q) in S4 reduced gating charges, positively shifted the Boltzmann-type activation curve [i.e., open probability (P open )-V curve] and altered the time-courses of activation/deactivation of PKD2L1, indicating that this region constitutes part of a voltage sensor. Numerical reconstruction of wild-type (WT) and mutant PKD2L1-mediated currents necessitated, besides their voltage-dependent gating parameters, a scaling factor that describes the voltage-dependence of maximal conductance, G max . Subsequent single-channel conductance (γ) measurements revealed that voltage-dependence of G max in WT can be explained by the inward-rectifying property of γ, which is greatly changed in PKD2L1 mutants. Homology modelling based on PKD2 and Na V Ab structures suggest that such voltage dependence of P open and γ in PKD2L1 could both reflect the charged state of the S4 domain. The present conjunctive experimental and theoretical approaches provide a framework to explore the undetermined mechanism(s) regulating TRP channels that possess non-classical voltage-dependent properties.

Mitigating voltage lead errors of an AC Josephson voltage standard by impedance matching

Science.gov (United States)

Zhao, Dongsheng; van den Brom, Helko E.; Houtzager, Ernest

2017-09-01

A pulse-driven AC Josephson voltage standard (ACJVS) generates calculable AC voltage signals at low temperatures, whereas measurements are performed with a device under test (DUT) at room temperature. The voltage leads cause the output voltage to show deviations that scale with the frequency squared. Error correction mechanisms investigated so far allow the ACJVS to be operational for frequencies up to 100 kHz. In this paper, calculations are presented to deal with these errors in terms of reflected waves. Impedance matching at the source side of the system, which is loaded with a high-impedance DUT, is proposed as an accurate method to mitigate these errors for frequencies up to 1 MHz. Simulations show that the influence of non-ideal component characteristics, such as the tolerance of the matching resistor, the capacitance of the load input impedance, losses in the voltage leads, non-homogeneity in the voltage leads, a non-ideal on-chip connection and inductors between the Josephson junction array and the voltage leads, can be corrected for using the proposed procedures. The results show that an expanded uncertainty of 12 parts in 106 (k  =  2) at 1 MHz and 0.5 part in 106 (k  =  2) at 100 kHz is within reach.

Inhibition of large conductance calcium-dependent potassium ...

African Journals Online (AJOL)

conductance, calcium and voltage- dependent potassium (BKCa) channels thereby promoting vasoconstriction. Our results show that the Rho-kinase inhibitor, Y-27632, induced concentration-dependent relaxation in rat mesenteric artery.

Self-aligned photolithography for the fabrication of fully transparent high-voltage devices

Science.gov (United States)

Zhang, Yonghui; Mei, Zengxia; Huo, Wenxing; Wang, Tao; Liang, Huili; Du, Xiaolong

2018-05-01

High-voltage devices, working in the range of hundreds of volts, are indispensable elements in the driving or readout circuits for various kinds of displays, integrated microelectromechanical systems and x-ray imaging sensors. However, the device performances are found hardly uniform or repeatable due to the misalignment issue, which are extremely common for offset drain high-voltage devices. To resolve this issue, this article reports a set of self-aligned photolithography technology for the fabrication of high-voltage devices. High-performance fully-transparent high-voltage thin film transistors, diodes and logic inverters are successfully fabricated with this technology. Unlike other self-aligned routes, opaque masks are introduced on the backside of the transparent substrate to facilitate proximity exposure method. The photolithography process is simulated and analyzed with technology computer aided design simulation to explain the working principle of the proximity exposure method. The substrate thickness is found to be vital for the implementation of this technology based on both simulation and experimental results. The electrical performance of high-voltage devices is dependent on the offset length, which can be delicately modulated by changing the exposure dose. The presented self-aligned photolithography technology is proved to be feasible in high-voltage circuits, demonstrating its huge potential in practical industrial applications.

Voltage-Dependent Rhythmogenic Property of Respiratory Pre-Bötzinger Complex Glutamatergic, Dbx1-Derived, and Somatostatin-Expressing Neuron Populations Revealed by Graded Optogenetic Inhibition123

Science.gov (United States)

Koizumi, Hidehiko; Mosher, Bryan; Tariq, Mohammad F.; Zhang, Ruli

2016-01-01

Abstract The rhythm of breathing in mammals, originating within the brainstem pre-Bötzinger complex (pre-BötC), is presumed to be generated by glutamatergic neurons, but this has not been directly demonstrated. Additionally, developmental expression of the transcription factor Dbx1 or expression of the neuropeptide somatostatin (Sst), has been proposed as a marker for the rhythmogenic pre-BötC glutamatergic neurons, but it is unknown whether these other two phenotypically defined neuronal populations are functionally equivalent to glutamatergic neurons with regard to rhythm generation. To address these problems, we comparatively investigated, by optogenetic approaches, the roles of pre-BötC glutamatergic, Dbx1-derived, and Sst-expressing neurons in respiratory rhythm generation in neonatal transgenic mouse medullary slices in vitro and also more intact adult perfused brainstem-spinal cord preparations in situ. We established three different triple-transgenic mouse lines with Cre-driven Archaerhodopsin-3 (Arch) expression selectively in glutamatergic, Dbx1-derived, or Sst-expressing neurons for targeted photoinhibition. In each line, we identified subpopulations of rhythmically active, Arch-expressing pre-BötC inspiratory neurons by whole-cell recordings in medullary slice preparations in vitro, and established that Arch-mediated hyperpolarization of these inspiratory neurons was laser power dependent with equal efficacy. By site- and population-specific graded photoinhibition, we then demonstrated that inspiratory frequency was reduced by each population with the same neuronal voltage-dependent frequency control mechanism in each state of the respiratory network examined. We infer that enough of the rhythmogenic pre-BötC glutamatergic neurons also have the Dbx1 and Sst expression phenotypes, and thus all three phenotypes share the same voltage-dependent frequency control property. PMID:27275007

Synchro-betatron resonance due to gap voltage asymmetry