
Sample records for abs

  1. Fotfavoriten AB


    Søilen, Klaus Solberg; HUBER, Stefan


    Fotfavoriten AB, a foot care company located in Sollefttå in Northern Sweden, is an example of how local government fires staff only to reengage them as entrepreneurs delivering similar service. The case is typical for the social sector and may mark a trend. The result is often felt to be positive both by the entrepreneur, who is now more directly in charge of her or his earnings, and the end consumer. The CEO of Fotfavoriten AB, Eva Wörmann, waited a long time before she dared to take the ne...

  2. ABS 497 Complete Class




    ABS 497 Complete Class   To purchase this material click below link   For more classes visit   ABS 497 Week 1 Assignment Community Change ABS 497 Week 1 DQ 1 Fabian's Story ABS 497 Week 1 DQ 2 Doug's Story ABS 497 Week 2 DQ 1 Parenting Styles ABS 497 Week 2 DQ 2 Ethnicity and Learning Theory ABS 497 Week 3 ...

  3. ABS 497 ASH Tutorial / Uoptutorial


    Latifa Baka


    For more course tutorials visit   ABS 497 Week 1 Assignment Community Change ABS 497 Week 1 DQ 1 Fabian's Story ABS 497 Week 1 DQ 2 Doug's Story ABS 497 Week 2 DQ 1 Parenting Styles ABS 497 Week 2 DQ 2 Ethnicity and Learning Theory ABS 497 Week 3 DQ 1 Suicide ABS 497 Week 3 DQ 2 Development Theories ABS 497 Week 3 Assignment communication PowerPoint Presentation ABS 497 Week 4 DQ 1 Leadership Theories ABS 497 Week 4 ...

  4. ABS 497 ASH TUTORIAL / Uoptutorial




    For more course tutorials visit   ABS 497 Week 1 Assignment Community Change ABS 497 Week 1 DQ 1 Fabian's Story ABS 497 Week 1 DQ 2 Doug's Story ABS 497 Week 2 DQ 1 Parenting Styles ABS 497 Week 2 DQ 2 Ethnicity and Learning Theory ABS 497 Week 3 DQ 1 Suicide ABS 497 Week 3 DQ 2 Development Theories ABS 497 Week 3 Assignment communication PowerPoint Presentation ABS 497 Week 4 DQ 1 Leadership Theories ABS 497 Week 4...

  5. ABS 497 Courses/snaptutorial




    For more classes visit   ABS 497 Week 1 Assignment Community Change ABS 497 Week 1 DQ 1 Fabian's Story ABS 497 Week 1 DQ 2 Doug's Story ABS 497 Week 2 DQ 1 Parenting Styles ABS 497 Week 2 DQ 2 Ethnicity and Learning Theory ABS 497 Week 3 DQ 1 Suicide ABS 497 Week 3 DQ 2 Development Theories ABS 497 Week 3 Assignment communication PowerPoint Presentation ABS 497 Week 4 DQ 1 Leadership Theories ABS 497 Week 4 DQ ...

  6. Verdivurdering av SAS AB


    Gangås, Silje Garberg


    Formålet med denne mastergradsavhandlingen har vært å beregne den teoretiske verdien på det børsnoterte selskapet SAS AB og på bakgrunn av denne gi en handlingsanbefaling på selskapets aksje. Forskningsspørsmålet for oppgaven er utledet som følger: ”Hva er verdien av SAS AB?” SAS AB er inne i en fundamental omstillingsprosses hvor den nye strategien, 4XNG, ble presentert og påbegynt november 2012. Omstillingsprosessen innebærer blant annet en omfattende omstrukturering i organisasjonen ...

  7. ABS 497 ASH Tutorial/Uoptutorial




    ABS 497 Week 1 Assignment Community Change ABS 497 Week 1 DQ 1 Fabian's Story ABS 497 Week 1 DQ 2 Doug's Story ABS 497 Week 2 DQ 1 Parenting Styles ABS 497 Week 2 DQ 2 Ethnicity and Learning Theory ABS 497 Week 3 DQ 1 Suicide ABS 497 Week 3 DQ 2 Development Theories ABS 497 Week 3 Assignment communication PowerPoint Presentation ABS 497 Week 4 DQ 1 Leadership Theories ABS 497 Week 4 DQ 2 Problems of Adolescence ABS 497 Week 5 DQ Macro Social Systems...

  8. The AB Staff Plan

    CERN Document Server

    Boillot, J; Delahaye, J P; Myers, S; CERN. Geneva. AB Department


    The present report summarises the staff plan of the newly created Accelerators and Beams (AB) Division following the restructuring of the Accelerator Sector and covering the period 2003 to 2010. It underlines the refocusing of the staff on priority work, especially the LHC Project and is coherent with the recently adopted CERN Long Term Plan (LTP). It compares the requested and available manpower (both staff and industrial support) for each Project, Programme and Activity (PPA) split in work packages and highlights the missing manpower for each category of personnel.

  9. AB Manpower Plan 2007

    CERN Document Server

    Myers, Stephen


    The present exercise is not as such a "manpower plan" but a purely budgetary comparison of known plus requested resources with the known commitments over the period 2007-2012. From a purely budgetary point of view, AB will have the capacity to maintain all those recently hired staff who fulfill the criteria for long term employment at CERN. Following this budgetary exercise, AB proposes to perform a CERN-wide staff work plan so as to compare the manpower available to the quantity of work to be done in the totality of the work-packages. If there is a significant mismatch between these two quantities then we propose the following measures which would create personnel economies and allow us to redress the mismatch by increased recruitment: a new job severance scheme; CERN restructuring; use of the new CERN-ITER agreement; more flexibility in transfers from Materials to Personnel budgets. Failing this a re-examination of possible closure of lower priority facilities may be needed.

  10. ABS 497 ASH Tutorial Course/Uoptutorial




    For More Course Tutorials Visit   ABS 497 Week 1 Assignment Community Change ABS 497 Week 1 DQ 1 Fabian's Story ABS 497 Week 1 DQ 2 Doug's Story ABS 497 Week 2 DQ 1 Parenting Styles ABS 497 Week 2 DQ 2 Ethnicity and Learning Theory ABS 497 Week 3 DQ 1 Suicide ABS 497 Week 3 DQ 2 Development Theories ABS 497 Week 3 Assignment communication PowerPoint Presentation ABS 497 Week 4 DQ 1 Leadership Theories ABS 497 Week 4 ...

  11. abs417ashcoursesTutorial /uophelp




    For more course tutorials visit     ABS 417 Week 1 DQ 1 ( The Power of Many )    ABS 417 Week 1 DQ 2 ( Social Change Model )    ABS 417 Week 2 DQ 1 ( Empowerment, Disempowerment and Social Change )   ABS 417 Week 2 DQ 2 ( Non-Profit vs. For-Profit Organizations )    ABS 417 Week 2 Assignment ( Reflection Paper )    ABS 417 Week 3 DQ 1 ( Social Problems )  &nb...

  12. Opstellen Aaltjes Beheersing Strategie (ABS)

    NARCIS (Netherlands)

    Beers, van T.G.


    Dit artikel gaat dieper in op het opstellen van een Aaltjes Beheersing Strategie (ABS): inventarisatie, preventie, vruchtwisseling en aanvullende maatregelen. Per onderdeel worden aandachtspunten genoemd en er worden tips gegeven.

  13. Equity valuation : Atlas Copco AB


    Santos, Ricardo Manuel Castro Lopes Alba


    This Dissertation presents a literature review of some of the most appraised theories on equity valuation models. A thoughtful analysis is made, presenting the main advantages and restrictions of each model and setting the path for a discussion about improvements to be made on this field of study. A practical implementation follows, proposing a fair value estimation of Atlas Copco AB shares. Atlas Copco is a Swedish-based capital goods company, operating across four differen...

  14. Thermonuclear Reflect AB-Reactor

    CERN Document Server

    Bolonkin, Alexander


    The author offers a new kind of thermonuclear reflect reactor. The remarkable feature of this new reactor is a three net AB reflector, which confines the high temperature plasma. The plasma loses part of its energy when it contacts with the net but this loss can be compensated by an additional permanent plasma heating. When the plasma is rarefied (has a small density), the heat flow to the AB reflector is not large and the temperature in the triple reflector net is lower than 2000 - 3000 K. This offered AB-reactor has significantly less power then the currently contemplated power reactors with magnetic or inertial confinement (hundreds-thousands of kW, not millions of kW). But it is enough for many vehicles and ships and particularly valuable for tunnelers, subs and space apparatus, where air to burn chemical fuel is at a premium or simply not available. The author has made a number of innovations in this reactor, researched its theory, developed methods of computation, made a sample computation of typical pr...

  15. AB Levitator and Electricity Storage

    CERN Document Server

    Bolonkin, A


    The author researched this new idea - support of flight by any aerial vehicles at significant altitude solely by the magnetic field of the planet. It is shown that current technology allows humans to create a light propulsion (AB engine) which does not depend on air, water or ground terrain. Simultaniosly, this revolutionary thruster is a device for the storage of electricity which is extracted and is replenished (during braking) from/into the storage with 100 percent efficiency. The relative weight ratio of this engine is 0.01 - 0.1 (from thrust). For some types of AB engine (toroidal form) the thrust easily may be changed in any direction without turning of engine. The author computed many projects using different versions of offered AB engine: small device for levitation-flight of a human (including flight from Earth to Outer Space), fly VTOL car (track), big VTOL aircrat, suspended low altitude stationary satellite, powerful Space Shuttle-like booster for travel to the Moon and Mars without spending energ...

  16. ABS: Sequence alignment by scanning

    KAUST Repository

    Bonny, Mohamed Talal


    Sequence alignment is an essential tool in almost any computational biology research. It processes large database sequences and considered to be high consumers of computation time. Heuristic algorithms are used to get approximate but fast results. We introduce fast alignment algorithm, called Alignment By Scanning (ABS), to provide an approximate alignment of two DNA sequences. We compare our algorithm with the well-known alignment algorithms, the FASTA (which is heuristic) and the \\'Needleman-Wunsch\\' (which is optimal). The proposed algorithm achieves up to 76% enhancement in alignment score when it is compared with the FASTA Algorithm. The evaluations are conducted using different lengths of DNA sequences. © 2011 IEEE.

  17. AP calculus AB/BC

    CERN Document Server

    Schwartz, Stu


    All Access for the AP® Calculus AB & BC Exams Book + Web + Mobile Everything you need to prepare for the Advanced Placement® exam, in a study system built around you! There are many different ways to prepare for an Advanced Placement® exam. What's best for you depends on how much time you have to study and how comfortable you are with the subject matter. To score your highest, you need a system that can be customized to fit you: your schedule, your learning style, and your current level of knowledge. This book, and the free online tools that come with it, will help you personalize your AP® Cal

  18. Microwave Study of Recycled ABS Resins

    Institute of Scientific and Technical Information of China (English)

    A; M; Hasna


    This article provides a review of the research unde rt aken in order to determine the suitability of utilizing microwave technology in the production of Recycled ABS Acrylonitrile Butadiene Styrene resin for mouldin gs. The experimental investigation determined the suitability of the existing re cycled ABS material, the mould material used with respect to performance and lon gevity, potential commercial plant and equipment, end mould compression. Introduction Frequency Characterization of ABS The first ...

  19. abs497ashcoursesTutorial /uophelp




    For more course tutorials visit       I.        ABS 497 Week 1 Assignment Community Change   II.        ABS 497 Week 1 DQ 1 Fabian's Story III.        ABS 497 Week 1 DQ 2 Doug's Story IV.        ABS 497 Week 2 DQ 1 Parenting Styles   V.      &nb...

  20. ABS test equipment design%ABS 测试设备设计

    Institute of Scientific and Technical Information of China (English)



      This article simply introduces the structure and operating principle of ABS. and a new equipment for ABS signal testing is designed and put into use.%  简要介绍了 ABS 的组成及其工作原理,并结合自身情况,设计了测试 ABS 信号的设备,并投入使用。

  1. Ab-Initio Molecular Dynamics

    CERN Document Server

    Kühne, Thomas D


    Computer simulations and molecular dynamics in particular, is a very powerful method to provide detailed and essentially exact informations of classical many-body problems. With the advent of \\textit{ab-initio} molecular dynamics, where the forces are computed on-the-fly by accurate electronic structure calculations, the scope of either method has been greatly extended. This new approach, which unifies Newton's and Schr\\"odinger's equations, allows for complex simulations without relying on any adjustable parameter. This review is intended to outline the basic principles as well as a survey of the field. Beginning with the derivation of Born-Oppenheimer molecular dynamics, the Car-Parrinello method as well as novel hybrid scheme that unifies best of either approach are discussed. The predictive power is demonstrated by a series of applications ranging from insulators to semiconductors and even metals in condensed phases.

  2. Ultrasound Biomicroscopy Comparison of Ab Interno and Ab Externo Intraocular Lens Scleral Fixation. (United States)

    Horiguchi, Lie; Garcia, Patricia Novita; Malavazzi, Gustavo Ricci; Allemann, Norma; Gomes, Rachel L R


    Purpose. To compare ab interno and ab externo scleral fixation of posterior chamber intraocular lenses (PCIOL) using ultrasound biomicroscopy (UBM). Methods. Randomized patients underwent ab externo or ab interno scleral fixation of a PCIOL. Ultrasound biomicroscopy was performed 3 to 6 months postoperatively, to determine PCIOL centration, IOL distance to the iris at 12, 3, 6, and 9 hours, and haptics placement in relation to the ciliary sulcus. Results. Fifteen patients were enrolled in the study. The ab externo technique was used in 7 eyes (46.6%) and the ab interno in 8 eyes (53.3%). In the ab externo technique, 14 haptics were located: 4 (28.57%) in the ciliary sulcus; 2 (14.28%) anterior to the sulcus; and 8 (57.14%) posterior to the sulcus, 6 in the ciliary body and 2 posterior to the ciliary body. In the ab interno group, 4 haptics (25.0%) were in the ciliary sulcus, 2 (12.50%) anterior to the sulcus, and 10 (75.0%) posterior to the sulcus, 4 in the ciliary body and 6 posterior to the ciliary body. Conclusions. Ab externo and ab interno scleral fixation techniques presented similar results in haptic placement. Ab externo technique presented higher vertical tilt when compared to the ab interno.

  3. Ultrasound Biomicroscopy Comparison of Ab Interno and Ab Externo Intraocular Lens Scleral Fixation

    Directory of Open Access Journals (Sweden)

    Lie Horiguchi


    Full Text Available Purpose. To compare ab interno and ab externo scleral fixation of posterior chamber intraocular lenses (PCIOL using ultrasound biomicroscopy (UBM. Methods. Randomized patients underwent ab externo or ab interno scleral fixation of a PCIOL. Ultrasound biomicroscopy was performed 3 to 6 months postoperatively, to determine PCIOL centration, IOL distance to the iris at 12, 3, 6, and 9 hours, and haptics placement in relation to the ciliary sulcus. Results. Fifteen patients were enrolled in the study. The ab externo technique was used in 7 eyes (46.6% and the ab interno in 8 eyes (53.3%. In the ab externo technique, 14 haptics were located: 4 (28.57% in the ciliary sulcus; 2 (14.28% anterior to the sulcus; and 8 (57.14% posterior to the sulcus, 6 in the ciliary body and 2 posterior to the ciliary body. In the ab interno group, 4 haptics (25.0% were in the ciliary sulcus, 2 (12.50% anterior to the sulcus, and 10 (75.0% posterior to the sulcus, 4 in the ciliary body and 6 posterior to the ciliary body. Conclusions. Ab externo and ab interno scleral fixation techniques presented similar results in haptic placement. Ab externo technique presented higher vertical tilt when compared to the ab interno.

  4. Ultrasound Biomicroscopy Comparison of Ab Interno and Ab Externo Intraocular Lens Scleral Fixation (United States)

    Horiguchi, Lie; Garcia, Patricia Novita; Malavazzi, Gustavo Ricci; Allemann, Norma


    Purpose. To compare ab interno and ab externo scleral fixation of posterior chamber intraocular lenses (PCIOL) using ultrasound biomicroscopy (UBM). Methods. Randomized patients underwent ab externo or ab interno scleral fixation of a PCIOL. Ultrasound biomicroscopy was performed 3 to 6 months postoperatively, to determine PCIOL centration, IOL distance to the iris at 12, 3, 6, and 9 hours, and haptics placement in relation to the ciliary sulcus. Results. Fifteen patients were enrolled in the study. The ab externo technique was used in 7 eyes (46.6%) and the ab interno in 8 eyes (53.3%). In the ab externo technique, 14 haptics were located: 4 (28.57%) in the ciliary sulcus; 2 (14.28%) anterior to the sulcus; and 8 (57.14%) posterior to the sulcus, 6 in the ciliary body and 2 posterior to the ciliary body. In the ab interno group, 4 haptics (25.0%) were in the ciliary sulcus, 2 (12.50%) anterior to the sulcus, and 10 (75.0%) posterior to the sulcus, 4 in the ciliary body and 6 posterior to the ciliary body. Conclusions. Ab externo and ab interno scleral fixation techniques presented similar results in haptic placement. Ab externo technique presented higher vertical tilt when compared to the ab interno. PMID:27293878

  5. Multiwavelength Observations of AB Doradus

    CERN Document Server

    Slee, O B; Johnston-Hollitt, M; Budding, E


    We have observed the bright, magnetically active multiple star AB Doradus in a multiwavelength campaign centring around two large facility allocations in November 2006 and January, 2007. Our observations have covered at least three large flares. These flares were observed to produce significant hardening of the X-ray spectra during their very initial stages. We monitored flare-related effects using the Suzaku X-ray satellite and the Australia Telescope Compact Array at 3.6 and 6 cm. Observations at 11 and 21 cm were also included, but they were compromised by interference. From our multiwavelength coverage we find that the observed effects can be mainly associated with a large active region near longitude zero. The second major X-ray and microwave flare of Jan 8, 2007 was observed with a favourable geometry that allowed its initial high-energy impulsive phase to be observed in the higher frequency range of Suzaku's XIS detectors. The fractional circular polarisation was measured for the complete runs, for 25 ...

  6. GINGA Observations of AB Doradus (United States)

    Vilhu, O.; Tsuru, T.; Collier Cameron, A.

    We report GINGA observations of the pre main sequence star AB Doradus (HD 36705), performed during 8 - 12 January, 1990. Some rotational modulation might be present. four X-ray flares were detected. Three of these events were similar to the EINSTEIN HRI-flare (Vilhu and Linsky, 1987), with decay times around 25 min. The last flare had long rise and decay times (100 min), resembling the EXOSAT flares observed by Collier Cameron (1988). The mean flare spectrum can be fitted by a thermal bremstrahlung with temperature 5.0 keV, or by a power-law model with photon index 2.2. The 3 upper limit of the Iron line equivalent width in the flare spectrum is 1 keV, weaker than predicted by thermal models. This Iron line anomaly was first discussed in the case of UX Ari by Tsuru et. al. (1989). However, normal equivalent widths can be derived from several EXOSAT spectra of active cool stars (Pallavicini and Tagliaferri, 1990). We discuss the possibility that the continuum from non-thermal electrons (producing also the microwave emission) could occasionally lower the apparent equivalent width. The mechanism works for reasonably low magnetic field strengths and electon power-law indexes. However, a large population of non-thermal electrons is needed (comparable to the thermal one). Stronger magnetic fields could explain the radio emission with less electrons, but then the non-thermal X-ray continuum remains small.

  7. Collective rotation from ab initio theory

    CERN Document Server

    Caprio, M A; Vary, J P; Smith, R


    Through ab initio approaches in nuclear theory, we may now seek to quantitatively understand the wealth of nuclear collective phenomena starting from the underlying internucleon interactions. No-core configuration interaction (NCCI) calculations for p-shell nuclei give rise to rotational bands, as evidenced by rotational patterns for excitation energies, electromagnetic moments, and electromagnetic transitions. In this review, NCCI calculations of 7-9Be are used to illustrate and explore ab initio rotational structure, and the resulting predictions for rotational band properties are compared with experiment. We highlight the robustness of ab initio rotational predictions across different choices for the internucleon interaction.

  8. AP calculus AB & BC crash course

    CERN Document Server

    Rosebush, J


    AP Calculus AB & BC Crash Course - Gets You a Higher Advanced Placement Score in Less Time Crash Course is perfect for the time-crunched student, the last-minute studier, or anyone who wants a refresher on the subject. AP Calculus AB & BC Crash Course gives you: Targeted, Focused Review - Study Only What You Need to Know Crash Course is based on an in-depth analysis of the AP Calculus AB & BC course description outline and actual AP test questions. It covers only the information tested on the exams, so you can make the most of your valuable study time. Written by experienced math teachers, our


    Lifescience Database Archive (English)

    Full Text Available DREDR1ATRD29AB S000152 23-June-2006 (last modified) kehi Related to responsiveness ...dependent in the ABA-responsive expression of the rd29A in Arabidopsis; DRE; drought; water stress; oxidativ

  10. Reference: DREDR1ATRD29AB [PLACE

    Lifescience Database Archive (English)

    Full Text Available ization and expression of two Arabidopsis DREB2 genes encoding DRE-binding proteins...DREDR1ATRD29AB Nakashima K, Shinwari ZK, Sakuma Y, Seki M, Miura S, Shinozaki K, Yamaguchi-Shinozaki K Organ

  11. Ab initio valence calculations in chemistry

    CERN Document Server

    Cook, D B


    Ab Initio Valence Calculations in Chemistry describes the theory and practice of ab initio valence calculations in chemistry and applies the ideas to a specific example, linear BeH2. Topics covered include the Schrödinger equation and the orbital approximation to atomic orbitals; molecular orbital and valence bond methods; practical molecular wave functions; and molecular integrals. Open shell systems, molecular symmetry, and localized descriptions of electronic structure are also discussed. This book is comprised of 13 chapters and begins by introducing the reader to the use of the Schrödinge

  12. MELCOR 1.8.2 assessment: Aerosol experiments ABCOVE AB5, AB6, AB7, and LACE LA2

    Energy Technology Data Exchange (ETDEWEB)

    Souto, F.J.; Haskin, F.E. [Univ. of New Mexico, Albuquerque, NM (United States). Dept. of Chemical and Nuclear Engineering; Kmetyk, L.N. [Sandia National Labs., Albuquerque, NM (United States)


    The MELCOR computer code has been used to model four of the large-scale aerosol behavior experiments conducted in the Containment System Test Facility (CSTF) vessel. Tests AB5, AB6 and AB7 of the ABCOVE program simulate the dry aerosol conditions during a hypothetical severe accident in an LMFBR. Test LA2 of the LACE program simulates aerosol behavior in a condensing steam environment during a postulated severe accident in an LWR with failure to isolate the containment. The comparison of code results to experimental data show that MELCOR is able to correctly predict most of the thermal-hydraulic results in the four tests. MELCOR predicts reasonably well the dry aerosol behavior of the ABCOVE tests, but significant disagreements are found in the aerosol behavior modelling for the LA2 experiment. These results tend to support some of the concerns about the MELCOR modelling of steam condensation onto aerosols expressed in previous works. During these analyses, a limitation in the MELCOR input was detected for the specification of the aerosol parameters for more than one component. A Latin Hypercube Sampling (LHS) sensitivity study of the aerosol dynamic constants is presented for test AB6. The study shows the importance of the aerosol shape factors in the aerosol deposition behavior, and reveals that MELCOR input/output processing is highly labor intensive for uncertainty and sensitivity analyses based on LHS.

  13. Ab interno trabeculectomy: A comprehensive review

    Directory of Open Access Journals (Sweden)

    Ting Ting Liu


    Full Text Available PURPOSE To summarize the original literature on ab interno trabeculectomy with the Trabectome system and to review its efficacy and safety in the treatment of glaucoma. METHOD A literature search in PubMed was performed on ab interno trabeculectomy with the Trabectome system, and clinical relevant information was reviewed and summarized. RESULTS Ab interno trabeculectomy with the Trabectome system on average lowered intraocular pressure (IOP to the mid-teens, and decreased the number of required glaucoma medications. Greater preoperative IOP correlated to a greater percent reduction in IOP. The success rates varied among studies, and the definition of success differed by authors. Intraoperative blood reflux was found in nearly all cases. Incidences of early hypotony and IOP spikes were low. No cases of endophthalmitis, wound leak, aqueous misdirection, choroidal hemorrhage or effusions, and irreversible visual acuity decrease (≥2 Snellen lines have been reported. Available studies had a significant amount of data overlap. Only limited data on long-term results was available. There was no randomized controlled trial to date. CONCLUSIONS Ab interno trabeculectomy with the Trabectome system is an effective and safe surgical approach for patients with various types of open angle glaucoma. On average, the procedure at least in the short term lowers IOP to the mid teens regardless of preoperative IOP with or without the aid of topical medications.

  14. Reference: DREDR1ATRD29AB [PLACE

    Lifescience Database Archive (English)

    Full Text Available DREDR1ATRD29AB Narusaka Y, Nakashima K, Shinwari ZK, Sakuma Y, Furihata T, Abe H, N... ABA-dependent expression of Arabidopsis rd29A gene in response to dehydration and high-salinity stresses. Plant J. 34: 137-148 (2003) PubMed: 12694590; ...


    Institute of Scientific and Technical Information of China (English)

    Min-qiang Yu; Zhi-ping Zhou; De-yue Yan


    This work deals with the kinetics of co-condensation polymerization of AB2 and AB monomers, giving expressions of the two-dimensional molecular weight distribution function and the number/weight average molecular weights of the resulting copolymers. The two-dimensional molecular weight distribution depends on two indices, n and l, which are the respective numbers of AB2 and AB units in a copolymer species. The evolution of the two-dimensional weight and z distributions during the co-condensation polymerization has been evaluated systematically. Finally, the two-dimensional distribution was transformed into a one-dimensional molecular weight distribution with only one variable (the molecular weight of the products instead of the degree of polymerization). The calculated results show that the highly branched copolymer has a very broad molecular weight distribution when the co-condensation polymerization approaches completion.

  16. On the Strain Rate Sensitivity of Abs and Abs Plus Fused Deposition Modeling Parts (United States)

    Vairis, A.; Petousis, M.; Vidakis, N.; Savvakis, K.


    In this work the effect of strain rate on the tensile strength of fused deposition modeling parts built with Acrylonitrile-butadiene-styrene (ABS) and ABS plus material is presented. ASTM D638-02a specimens were built with ABS and ABS plus and they were tested on a Schenck Trebel Co. tensile test machine at three different test speeds, equal, lower, and higher to the test speed required by the ASTM D638-02a standard. The experimental tensile strength results were compared and evaluated. The fracture surfaces of selected specimens were examined with a scanning electron microscope, to determine failure mode of the filament strands. It was found that, as the test speed increases, specimens develop higher tensile strength and have higher elastic modulus. Specimens tested in the highest speed of the experiment had on average about 10% higher elastic modulus and developed on average about 11% higher tensile strength.

  17. Leaching behaviour of the Swedish KBS-glasses ABS 39 and ABS 41

    International Nuclear Information System (INIS)

    The planned Swedish KBS glass corrosion investigation program comprises experiments with inactive glasses containing simulated waste, prolonged in-situ tests, the characterization of corrosion products, immiscibility studies, and corrosion experiments with hot glass. This presentation gives a short description of the entire program. It focuses thereafter on some recent leaching results with the inactive KBS glass qualities ABS 39 and ABS 41, which were leached in a manner similar to the PNL MCC-1 test procedure. 5 figures, 9 tables

  18. Thermomechanical properties of ABS/PA AND ABS/PC blends


    GUINAULT, Alain; Sollogoub, Cyrille


    International audience The significant increase of Waste Electric and Electronic Equipment (WEEE) has led to an important research in upgrading recycled engineering plastics by means of a blending technique. Classical twin-screw extrusion is compared to a new blending technique, where two polymers are combined together and then flow in several static mixers. This technique allows to obtain different morphologies of compatibilized ABS/PA or ABS/PC blends and the aim of this work is to evalu...

  19. Genetics Home Reference: GM2-gangliosidosis, AB variant (United States)

    ... of GM2-gangliosidosis, AB variant: Genetic Testing Registry: Tay-Sachs disease, variant AB These resources from MedlinePlus offer ... AB variant Activator Deficiency/GM2 Gangliosidosis Activator-deficient Tay-Sachs disease GM2 Activator Deficiency Disease GM2 gangliosidosis, type ...

  20. Investigation of high level of AsAb, EmAb in fertility female serum infected by chlamydia trachomatis

    International Nuclear Information System (INIS)

    Objective: To investigate the mechanism of chlamydia trachomatis. AsAb, EmAb in female fertility. Methods: LPS antigen of chlamydia in reproduction tract of fertility female was detected by monoclonal antibody and immunology chromatography; the content of AsAb, EmAb in serum of fertility female was detected by ELISA. Results: Infections rate of chlamydia trachomatis in fertility female was higher than that in the control AsAb, EmAb in serum of the fertility patients who were infected with chlamydia trachomatis showed a significant difference from that in the control group. Conclusion: The level of AsAb, EmAb increases in patients who have been infected with chlamydia trachomatis and these cytokines is involved in the course of female fertility

  1. Ab initio mass tensor molecular dynamics


    Tsuchida, Eiji


    Mass tensor molecular dynamics was first introduced by Bennett [J. Comput. Phys. 19, 267 (1975)] for efficient sampling of phase space through the use of generalized atomic masses. Here, we show how to apply this method to ab initio molecular dynamics simulations with minimal computational overhead. Test calculations on liquid water show a threefold reduction in computational effort without making the fixed geometry approximation. We also present a simple recipe for estimating the optimal ato...

  2. Reciprocity Theorems for Ab Initio Force Calculations

    CERN Document Server

    Wei, C; Mele, E J; Rappe, A M; Lewis, Steven P.; Rappe, Andrew M.


    We present a method for calculating ab initio interatomic forces which scales quadratically with the size of the system and provides a physically transparent representation of the force in terms of the spatial variation of the electronic charge density. The method is based on a reciprocity theorem for evaluating an effective potential acting on a charged ion in the core of each atom. We illustrate the method with calculations for diatomic molecules.

  3. Ab interno trabeculectomy: patient selection and perspectives (United States)

    Vinod, Kateki; Gedde, Steven J


    Ab interno trabeculectomy is one among several recently introduced minimally invasive glaucoma surgeries that avoid a conjunctival incision and full-thickness sclerostomy involved in traditional glaucoma surgery. Ablation of the trabecular meshwork and inner wall of Schlemm’s canal is performed in an arcuate fashion via a clear corneal incision, alone or in combination with phacoemulsification cataract surgery. Intraocular pressure reduction following ab interno trabeculectomy is limited by resistance in distal outflow pathways and generally stabilizes in the mid-to-high teens. Relief of medication burden has been demonstrated by some studies. A very low rate of complications, most commonly transient hyphema and intraocular pressure elevations in the immediate postoperative period, have been reported. However, available data are derived from small retrospective and prospective case series. Randomized, controlled trials are needed to better elucidate the potential merits of ab interno trabeculectomy in the combined setting versus phacoemulsification cataract surgery alone and to compare it with other minimally invasive glaucoma surgeries. PMID:27574396

  4. Highly scalable Ab initio genomic motif identification

    KAUST Repository

    Marchand, Benoît


    We present results of scaling an ab initio motif family identification system, Dragon Motif Finder (DMF), to 65,536 processor cores of IBM Blue Gene/P. DMF seeks groups of mutually similar polynucleotide patterns within a set of genomic sequences and builds various motif families from them. Such information is of relevance to many problems in life sciences. Prior attempts to scale such ab initio motif-finding algorithms achieved limited success. We solve the scalability issues using a combination of mixed-mode MPI-OpenMP parallel programming, master-slave work assignment, multi-level workload distribution, multi-level MPI collectives, and serial optimizations. While the scalability of our algorithm was excellent (94% parallel efficiency on 65,536 cores relative to 256 cores on a modest-size problem), the final speedup with respect to the original serial code exceeded 250,000 when serial optimizations are included. This enabled us to carry out many large-scale ab initio motiffinding simulations in a few hours while the original serial code would have needed decades of execution time. Copyright 2011 ACM.

  5. 汽车ABS/ASR/ACC集成化系统%Integrated ABS/ASR/ACC System for the Car

    Institute of Scientific and Technical Information of China (English)

    刘昭度; 卢江; 时开斌; 安巍


    叙述了ACC系统和ABS/ASR系统在改善汽车高速行驶主动安全性方面的功用,阐述了ACC系统是ABS/ASR系统功能的延伸、逻辑的发展及它们之间的内在联系,指出了在ABS/ASR的基础上只需增加测距装置和添加巡航控制子程序,就可方便地实现ABS/ASR/ACC集成化系统,并给出了集成化系统的控制框图和控制方法,论述了ABS/ASR/ACC集成化系统比孤立的ABS/ASR和ACC系统的优越性.%The individual functions of ACC and ABS/ASR are described in the improvements of active safety while the road vehicles travel at a high speed. Being a logic extension of and many inherent connections with ABS/BSR, ACC is easily integrated with ABS/ASR to form an integrated system by adding the headway distance*$-detecting device to the existing ABS/ASR system and expanding the ABS/ASR software. The algorithm flowcharts and control methods of the ABS/ASR/ACC are given. The advantages of the ABS/ASR/ACC system compared with those using the stand alone systems ABS, ASR and ACC are mentioned in details.

  6. Ab Initio Molecular Dynamics: A Virtual Laboratory


    Hobbi Mobarhan, Milad


    In this thesis, we perform ab initio molecular dynamics (MD) simulations at the Hartree-Fock level, where the forces are computed on-the-fly using the Born-Oppenheimer approximation. The theory behind the Hartree-Fock method is discussed in detail and an implementation of this method based on Gaussian basis functions is explained. We also demonstrate how to calculate the analytic energy derivatives needed for obtaining the forces acting on the nuclei. Hartree-Fock calculations on the ground s...

  7. Asiakassuhdehallinnan kehityssuunnitelma : Case: Oy Combi Cool Ab


    Puikkonen, Touko


    Tässä insinöörityössä tutustuttiin Oy Combi Cool Ab:n asiakassuhdehallintaan ja siinä havaittuihin puutteisiin ja kehitystarpeisiin. Työn tarkoituksena oli luoda yritykselle ajan tasalla oleva asiakasrekisteri ja sen pohjalta kehittää asiakassuhdehallintaa etenkin myynnin, oston ja johdon henkilöstön tarpeita ajatellen muovaamalla siitä henkilöstön myynti- ja asiakaspalvelutyöskentelyä tehostava toimiva kokonaisuus. Combi Cool on vuonna 1985 perustettu kylmäalan tukkuliike, joka on vajaan 30 ...

  8. Ab Initio Study on Hypothetical Silver Nitride

    Institute of Scientific and Technical Information of China (English)

    DELIGOZ Engin; COLAKOGLU Kemal; CIFTCI Yasemin Oztekin


    We perform the ab initio calculations based on norm-conserving pseudopotentials and density functional theory to investigate the structural, elastic, and thermodynamical properties for silver nitride (AgN) compound that is a member of the 4d transition metal group and has not been synthesized yet. The obtained results are compared with the other available theoretical data, and the agreement is, generally, quite good. We also present the pressure-dependent behaviour of some mechanical and thermodynamical properties for the same compounds.

  9. Testing Distributed ABS System with Fault Injection (United States)

    Trawczyński, Dawid; Sosnowski, Janusz; Gawkowski, Piotr

    The paper deals with the problem of adapting software implemented fault injection technique (SWIFI) to evaluate dependability of reactive microcontroller systems. We present an original methodology of disturbing controller operation and analyzing fault effects taking into account reactions of the controlled object and the impact of the system environment. Faults can be injected randomly (in space and time) or targeted at the most sensitive elements of the controller to check it at high stresses. This approach allows identifying rarely encountered problems, usually missed in classical approaches. The developed methodology has been used successfully to verify dependability of ABS system. Experimental results are commented in the paper.

  10. Quantum phases of AB 2 fermionic chains (United States)

    Murcia-Correa, L. S.; Franco, R.; Silva-Valencia, J.


    A fermionic chain is a one-dimensional system with fermions that interact locally and can jump between sites in the lattice, in particular an AB n chain type, where A and B are sites that exhibit a difference in energy level of Δ and site B is repeated n-times, such that the unit cell has n +1 sites. A limit case of this model, called the ionic Hubbard model (n = 1), has been widely studied due to its interesting physics and applications. In this paper, we study the ground state of an AB 2 chain, which describes the material R 4[Pt 2(P 2O5H2)4X] · nH 2 O. Specifically, we consider a filling with two electrons per unit cell, and using the density matrix renormalization group method we found that the system exhibits the band insulator and Mott correlated insulator phases, as well as an intermediate phase between them. For couplings of Δ = 2,10 and 20, we estimate the critical points that separate these phases through the structure factor and the energy gap in the sector of charge and spin, finding that the position of the critical point rises as a function of Δ.

  11. Biosorption of Acid Blue 290 (AB 290) and Acid Blue 324 (AB 324) dyes on Spirogyra rhizopus

    International Nuclear Information System (INIS)

    In this study, the biosorption of Acid Blue 290 and Acid Blue 324 on Spirogyra rhizopus, a green algae growing on fresh water, was studied with respect to initial pH, temperature, initial dye concentration and biosorbent concentration. The optimum initial pH and temperature values for AB 290 and AB 324 biosorption were found to be 2.0, 30 deg. C and 3.0, 25 deg. C, respectively. It was observed that the adsorbed AB 290 and AB 324 amounts increased with increasing the initial dye concentration up to 1500 and 750 mg/L, respectively. The Langmuir, Freundlich, Redlich-Peterson and Koble-Corrigan isotherm models were applied to the experimental equilibrium data and the isotherm constants were determined by using Polymath 4.1 software. The monolayer coverage capacities of S. rhizopus for AB 290 and AB 324 dyes were found as 1356.6 mg/g and 367.0 mg/g, respectively. The intraparticle diffusion model and the pseudo-second order kinetic model were applied to the experimental data in order to describe the removal mechanism of these acidic dyes by S. rhizopus. The pseudo-second order kinetic model described very well the biosorption kinetics of AB 290 and AB 324 dyes. Thermodynamic studies showed that the biosorption of AB 290 and AB 324 on S. rhizopus was exothermic in nature

  12. Workshop on automated beam steering and shaping (ABS). Proceedings

    International Nuclear Information System (INIS)

    A workshop on Automated Beam Steering and Shaping (ABS) was held at CERN in December 1998. This was the first workshop dedicated to this subject. The workshop had two major goals: to review the present status of ABS algorithms and systems around the world and to create a worldwide ABS community. These proceedings contain summary reports from all sessions, contributions from several presentations held at the workshop, and a complete set of abstracts for all presentations. (orig.)

  13. Bacillus thuringiensis Cry34Ab1/Cry35Ab1 interactions with western corn rootworm midgut membrane binding sites.

    Directory of Open Access Journals (Sweden)

    Huarong Li

    Full Text Available BACKGROUND: Bacillus thuringiensis (Bt Cry34Ab1/Cry35Ab1 are binary insecticidal proteins that are co-expressed in transgenic corn hybrids for control of western corn rootworm, Diabrotica virgifera virgifera LeConte. Bt crystal (Cry proteins with limited potential for field-relevant cross-resistance are used in combination, along with non-transgenic corn refuges, as a strategy to delay development of resistant rootworm populations. Differences in insect midgut membrane binding site interactions are one line of evidence that Bt protein mechanisms of action differ and that the probability of receptor-mediated cross-resistance is low. METHODOLOGY/PRINCIPAL FINDINGS: Binding site interactions were investigated between Cry34Ab1/Cry35Ab1 and coleopteran active insecticidal proteins Cry3Aa, Cry6Aa, and Cry8Ba on western corn rootworm midgut brush border membrane vesicles (BBMV. Competitive binding of radio-labeled proteins to western corn rootworm BBMV was used as a measure of shared binding sites. Our work shows that (125I-Cry35Ab1 binds to rootworm BBMV, Cry34Ab1 enhances (125I-Cry35Ab1 specific binding, and that (125I-Cry35Ab1 with or without unlabeled Cry34Ab1 does not share binding sites with Cry3Aa, Cry6Aa, or Cry8Ba. Two primary lines of evidence presented here support the lack of shared binding sites between Cry34Ab1/Cry35Ab1 and the aforementioned proteins: 1 No competitive binding to rootworm BBMV was observed for competitor proteins when used in excess with (125I-Cry35Ab1 alone or combined with unlabeled Cry34Ab1, and 2 No competitive binding to rootworm BBMV was observed for unlabeled Cry34Ab1 and Cry35Ab1, or a combination of the two, when used in excess with (125I-Cry3Aa, or (125I-Cry8Ba. CONCLUSIONS/SIGNIFICANCE: Combining two or more insecticidal proteins active against the same target pest is one tactic to delay the onset of resistance to either protein. We conclude that Cry34Ab1/Cry35Ab1 are compatible with Cry3Aa, Cry6Aa, or Cry8Ba

  14. Singularities of Type-Q ABS Equations

    Directory of Open Access Journals (Sweden)

    James Atkinson


    Full Text Available The type-Q equations lie on the top level of the hierarchy introduced by Adler, Bobenko and Suris (ABS in their classification of discrete counterparts of KdV-type integrable partial differential equations. We ask what singularities are possible in the solutions of these equations, and examine the relationship between the singularities and the principal integrability feature of multidimensional consistency. These questions are considered in the global setting and therefore extend previous considerations of singularities which have been local. What emerges are some simple geometric criteria that determine the allowed singularities, and the interesting discovery that generically the presence of singularities leads to a breakdown in the global consistency of such systems despite their local consistency property. This failure to be globally consistent is quantified by introducing a natural notion of monodromy for isolated singularities.

  15. Ab initio alpha-alpha scattering

    CERN Document Server

    Elhatisari, Serdar; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A; Luu, Thomas; Meißner, Ulf-G


    Processes involving alpha particles and alpha-like nuclei comprise a major part of stellar nucleosynthesis and hypothesized mechanisms for thermonuclear supernovae. In an effort towards understanding alpha processes from first principles, we describe in this letter the first ab initio calculation of alpha-alpha scattering. We use lattice effective field theory to describe the low-energy interactions of nucleons and apply a technique called the adiabatic projection method to reduce the eight-body system to an effective two-cluster system. We find good agreement between lattice results and experimental phase shifts for S-wave and D-wave scattering. The computational scaling with particle number suggests that alpha processes involving heavier nuclei are also within reach in the near future.

  16. Ab initio molar volumes and Gaussian radii. (United States)

    Parsons, Drew F; Ninham, Barry W


    Ab initio molar volumes are calculated and used to derive radii for ions and neutral molecules using a spatially diffuse model of the electron distribution with Gaussian spread. The Gaussian radii obtained can be used for computation of nonelectrostatic ion-ion dispersion forces that underlie Hofmeister specific ion effects. Equivalent hard-sphere radii are also derived, and these are in reasonable agreement with crystalline ionic radii. The Born electrostatic self-energy is derived for a Gaussian model of the electronic charge distribution. It is shown that the ionic volumes used in electrostatic calculations of strongly hydrated cosmotropic ions ought best to include the first hydration shell. Ionic volumes for weakly hydrated chaotropic metal cations should exclude electron overlap (in electrostatic calculations). Spherical radii are calculated as well as nonisotropic ellipsoidal radii for nonspherical ions, via their nonisotropic static polarizability tensors. PMID:19140766

  17. Ab Initio Path to Heavy Nuclei

    CERN Document Server

    Binder, Sven; Calci, Angelo; Roth, Robert


    We present the first ab initio calculations of nuclear ground states up into the domain of heavy nuclei, spanning the range from 16-O to 132-Sn based on two- plus three-nucleon interactions derived within chiral effective field theory. We employ the similarity renormalization group for preparing the Hamiltonian and use coupled-cluster theory to solve the many-body problem for nuclei with closed sub-shells. Through an analysis of theoretical uncertainties resulting from various truncations in this framework, we identify and eliminate the technical hurdles that previously inhibited the step beyond medium-mass nuclei, allowing for reliable validations of nuclear Hamiltonians in the heavy regime. Following this path we show that chiral Hamiltonians qualitatively reproduce the systematics of nuclear ground-state energies up to the neutron-rich Sn isotopes.

  18. Ab initio alpha-alpha scattering (United States)

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A.; Luu, Thomas; Meißner, Ulf-G.


    Processes such as the scattering of alpha particles (4He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei—nuclei with even and equal numbers of protons and neutrons—is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the ‘adiabatic projection method’ to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  19. Ablation dynamics in laser sclerotomy ab externo (United States)

    Brinkmann, Ralf; Droege, Gerit; Mohrenstecher, Dirk; Scheu, M.; Birngruber, Reginald


    Laser sclerostomy ab externo with flashlamp excited mid-IR laser systems emitting in the 2-3 micrometer spectral range is in phase II clinical trials. Although acutely high success rates were achieved, the restenosis rate after several months is about 40%. Laser pulses of several hundreds of microseconds, known to induce thermo-mechanical explosive evaporation were used for this procedure. We investigated the ablation dynamics in tissue and the cavitation bubble dynamics in water by means of an Er:YAG laser system to estimate the extent of mechanical damage zones in the sclera and in the anterior chamber, which may contribute to the clinical failure. We found substantial mechanical tissue deformation during the ablation process caused by the cavitation effects. Stress waves up to several bar generated by explosive evaporization were measured. The fast mechanical stretching and collapsing of the scleral tissue induced by cavitation resulted in tissue dissection as could be proved by flash photography and histology. The observed high restenosis might be a result of a subsequent enhanced wound healing process. Early fistula occlusions due to iris adherences, observed in about 20% of the clinical cases may be attributed to intraocular trauma induced by vapor bubble expansion through the anterior chamber after scleral perforation. An automatic feedback system minimizing adverse effects by steering and terminating the laser process during scleral fistulization is demonstrated. Moreover, a new approach in laser sclerostomy ab externo is presented using a cw-IR laser diode system emitting at the 1.94 micrometer mid-IR water absorption peak. This system was used in vitro and showed smaller damage zones compared to the pulsed laser radiation.

  20. Ab initio alpha-alpha scattering. (United States)

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A; Luu, Thomas; Meißner, Ulf-G


    Processes such as the scattering of alpha particles ((4)He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei--nuclei with even and equal numbers of protons and neutrons--is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the 'adiabatic projection method' to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  1. Dicty_cDB: FCL-AB06 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AB06 (Link to dictyBase) - - - Contig-U15603-1 FCL-AB06P ...(Link to Original site) FCL-AB06F 694 FCL-AB06Z 573 FCL-AB06P 1267 - - Show FCL-AB06 Library FCL (Link to library) Clone ID FCL-...3-1 Original site URL Representative seq. ID FCL-AB06P (Link to Original site) Representative DNA sequence >FCL-AB06 (FCL-AB06Q) /CSM/FCL/FCL-...AB/FCL-AB06Q.Seq.d/ CAATTTTATCGGAACCATCAATTCATGCAGGTTCTGTATTTAGTATTAATTTAACCAAAT CTAGACA

  2. Kopplung von Dichtefunktional- und ab-initio-Methoden


    Goll, Erich


    Im Rahmen der Doktorarbeit wurde untersucht, inwieweit die Kopplung von Dichtefunktionalmethoden und ab-initio-Korrelationsmethoden der Quantenchemie eine Verbesserung bezüglich beider Grenzmethoden erbringt. Die Kopplung erfolgt durch eine Aufspaltung des interelektronischen Hamiltonoperators (abstoßende Coulombwechselwirkung). Die kurzreichweitige Wechselwirkung wird mit Dichtefunktionaltheorie behandelt, die langreichweitige mit Hilfe von ab-initio-Methoden. Diese Aufteilung soll dazu dien...

  3. A Case of Laptop Computer-Induced Erythema Ab Igne

    Directory of Open Access Journals (Sweden)

    Nurettin Özgür Doğan


    Full Text Available Erythema ab igne, also known as toasted skin syndrome, is a skin reaction characterized by reticulate erythema, brown pigmentation, and telangiectasia. In some cases, epidermal atrophy and scaling are also identified. The condition is usually caused by prolonged exposure to a source of heat or infrared radiation. Here, we report a case of erythema ab igne associated with laptop computer use.

  4. ABS, MBS and CDO compared : An empirical analysis

    NARCIS (Netherlands)

    Vink, D.; Thibeault, A.


    The capital market in which the asset-backed securities are issued and traded is composed of three main categories: ABS, MBS and CDOs. We were able to examine a total number of 3,951 loans (worth €730.25 billion) of which 1,129 (worth €208.94 billion) have been classified as ABS. MBS issues represen

  5. ABS, MBS and CDO pricing comparisons : An empirical analysis

    NARCIS (Netherlands)

    Vink, D.; Thibeault, A.


    The capital market in which asset-backed securities are issued and traded is composed of three main categories: ABS, MBS and CDOs. The authors examined a total of 3,466 loans (worth €548.51 billion) of which 1,102 (worth €163.90 billion) have been classified as ABS. MBS issues represent 1,782 issues

  6. Preparation of grafted ABS and compatibilization of r-PET/ABS blends by the grafted ABS%ABS接枝物的制备及其对r-PET/ABS的增容作用

    Institute of Scientific and Technical Information of China (English)

    陈智军; 王益龙; 郑辰


    Two kinds of grafted acrylonitrile-butadiene-styrene copolymer(ABS), i.e. maleic anhydride (MAH) grafted ABS(ABS-g-MAH) and glycidyl methacrylate (GMA) grafted ABS (ABS-g-GMA), were prepared via reactive extrusion and were used as compatibilizer for recycled polyethylene glycol terephthalate (r-PET)/ABS blends. The results show that ABS-g-MAH and ABS-g-GMA can greatly improve the impact strength of the blends. ABS-g-MAH is superior to ABS-g-GMA in compatibilization effect. The optimal compatibilization effect is acquired when the grafting ratio of ABS-g-MAH is 1.35% and the mass content of the copolymer is 5%. Under such conditions, the notched and unnotched *Charpy impact strength of the r-PET/ABS/ABS-g--MAH blends rise by 42% and 23%, respectively, in comparison with those of r-PET/ ABS. The observation by scanning electron microscope(SEM) shows that adding grafted ABS can make ABS be dispersed more homogeneously in the r-PET continuous phase and make particle size more even.%通过反应挤出法制备马来酸酐(MAH)接枝丙烯腈-丁二烯-苯乙烯三元共聚物(ABS)(ABS-g-MAH)和甲基丙烯酸缩水甘油酯(GMA)接枝ABS(ABS-g-GMA),将其用于增容回收聚对苯二甲酸乙二酯(PET)瓶片(r-PET)/ABS共混物,发现能显著提高其混物的冲击强度.ABS-g-MAH的增容效果优于ABS-g-GMA;ABS-g-MAH的接枝率为1.35%,w(ABS-g-MAH)为5%时对r-PET/ABS的增容作用最佳,此时r-PET/ABS/ABS-g-MAH的简支梁缺口冲击强度和无缺口冲击强度比r-PET/ABS分别提高了42%和23%.扫描电子显微镜观察表明,加入ABS接枝物能使ABS在r-PET连续相中的分散更均匀,粒径尺寸更均一.

  7. Structural and biophysical characterization of Bacillus thuringiensis insecticidal proteins Cry34Ab1 and Cry35Ab1.

    Directory of Open Access Journals (Sweden)

    Matthew S Kelker

    Full Text Available Bacillus thuringiensis strains are well known for the production of insecticidal proteins upon sporulation and these proteins are deposited in parasporal crystalline inclusions. The majority of these insect-specific toxins exhibit three domains in the mature toxin sequence. However, other Cry toxins are structurally and evolutionarily unrelated to this three-domain family and little is known of their three dimensional structures, limiting our understanding of their mechanisms of action and our ability to engineer the proteins to enhance their function. Among the non-three domain Cry toxins, the Cry34Ab1 and Cry35Ab1 proteins from B. thuringiensis strain PS149B1 are required to act together to produce toxicity to the western corn rootworm (WCR Diabrotica virgifera virgifera Le Conte via a pore forming mechanism of action. Cry34Ab1 is a protein of ∼14 kDa with features of the aegerolysin family (Pfam06355 of proteins that have known membrane disrupting activity, while Cry35Ab1 is a ∼44 kDa member of the toxin_10 family (Pfam05431 that includes other insecticidal proteins such as the binary toxin BinA/BinB. The Cry34Ab1/Cry35Ab1 proteins represent an important seed trait technology having been developed as insect resistance traits in commercialized corn hybrids for control of WCR. The structures of Cry34Ab1 and Cry35Ab1 have been elucidated to 2.15 Å and 1.80 Å resolution, respectively. The solution structures of the toxins were further studied by small angle X-ray scattering and native electrospray ion mobility mass spectrometry. We present here the first published structure from the aegerolysin protein domain family and the structural comparisons of Cry34Ab1 and Cry35Ab1 with other pore forming toxins.

  8. Ab interno trabeculectomy in the adult patient. (United States)

    SooHoo, Jeffrey R; Seibold, Leonard K; Kahook, Malik Y


    Glaucoma is a potentially blinding disease that affects millions of people worldwide. The mainstay of treatment is lowering of intraocular pressure (IOP) through the use of medications, laser and/or incisional surgery. The trabecular meshwork (TM) is thought to be the site of significant resistance to aqueous outflow in open angle glaucoma. Theoretically, an incision through TM or TM removal should decrease this resistance and lead to a significant reduction in IOP. This approach, commonly referred to as goniotomy or trabeculotomy, has been validated in the pediatric population and has been associated with long-term IOP control. In adults, however, removal of TM tissue has been historically associated with more limited and short-lived success. More recent evidence, reveals that even adult patients may benefit significantly from removal of diseased TM tissue and can lead to a significant reduction in IOP that is long-lasting and safe. In this review, we discuss current evidence and techniques for ab interno trabeculectomy using various devices in the adult patient.

  9. Ab initio calculation of the Hoyle state

    CERN Document Server

    Epelbaum, Evgeny; Lee, Dean; Meißner, Ulf-G


    The Hoyle state plays a crucial role in the hydrogen burning of stars heavier than our sun and in the production of carbon and other elements necessary for life. This excited state of the carbon-12 nucleus was postulated by Hoyle^{1} as a necessary ingredient for the fusion of three alpha particles to produce carbon at stellar temperatures. Although the Hoyle state was seen experimentally more than a half century ago^{2,3}, nuclear theorists have not yet uncovered the nature of this state from first principles. In this letter we report the first ab initio calculation of the low-lying states of carbon-12 using supercomputer lattice simulations and a theoretical framework known as effective field theory. In addition to the ground state and excited spin-2 state, we find a resonance at -85(3) MeV with all of properties of the Hoyle state and in agreement with the experimentally observed energy. These lattice simulations provide insight into the structure of this unique state and new clues as to the amount of fine...

  10. Current techniques for AB0-incompatible living donor liver transplantation (United States)

    Rummler, Silke; Bauschke, Astrid; Bärthel, Erik; Jütte, Heike; Maier, Katrin; Ziehm, Patrice; Malessa, Christina; Settmacher, Utz


    For a long time, it was considered medical malpractice to neglect the blood group system during transplantation. Because there are far more patients waiting for organs than organs available, a variety of attempts have been made to transplant AB0-incompatible (AB0i) grafts. Improvements in AB0i graft survival rates have been achieved with immunosuppression regimens and plasma treatment procedures. Nevertheless, some grafts are rejected early after AB0i living donor liver transplantation (LDLT) due to antibody mediated rejection or later biliary complications that affect the quality of life. Therefore, the AB0i LDLT is an option only for emergency situations, and it requires careful planning. This review compares the treatment possibilities and their effect on the patients’ graft outcome from 2010 to the present. We compared 11 transplant center regimens and their outcomes. The best improvement, next to plasma treatment procedures, has been reached with the prophylactic use of rituximab more than one week before AB0i LDLT. Unfortunately, no standardized treatment protocols are available. Each center treats its patients with its own scheme. Nevertheless, the transplant results are homogeneous. Due to refined treatment strategies, AB0i LDLT is a feasible option today and almost free of severe complications. PMID:27683633

  11. On the hierarchical parallelization of ab initio simulations

    CERN Document Server

    Ruiz-Barragan, Sergi; Shiga, Motoyuki


    A hierarchical parallelization has been implemented in a new unified code PIMD-SMASH for ab initio simulation where the replicas and the Born-Oppenheimer forces are parallelized. It is demonstrated that ab initio path integral molecular dynamics simulations can be carried out very efficiently for systems up to a few tens of water molecules. The code was then used to study a Diels-Alder reaction of cyclopentadiene and butenone by ab initio string method. A reduction in the reaction energy barrier is found in the presence of hydrogen-bonded water, in accordance with experiment.

  12. Ab initio derivation of model energy density functionals (United States)

    Dobaczewski, Jacek


    I propose a simple and manageable method that allows for deriving coupling constants of model energy density functionals (EDFs) directly from ab initio calculations performed for finite fermion systems. A proof-of-principle application allows for linking properties of finite nuclei, determined by using the nuclear nonlocal Gogny functional, to the coupling constants of the quasilocal Skyrme functional. The method does not rely on properties of infinite fermion systems but on the ab initio calculations in finite systems. It also allows for quantifying merits of different model EDFs in describing the ab initio results.

  13. Eritema ab igne: relato de um caso Erythema ab igne: a case report

    Directory of Open Access Journals (Sweden)

    Magda Blessmann Weber


    Full Text Available A lesão cutânea do eritema ab igne é caracterizada por eritema reticulado, hiperpigmentação, descamação fina, atrofia epidérmica e telangiectasias. Atualmente, a região lombar é a mais atingida, devido ao uso de bolsas de água quente, para alívio de dores crônicas, e por constantes exposições a calor profundo em sessões de fisioterapia. Os autores alertam sobre uma dermatose pouco diagnosticada e que talvez seja mais prevalente pela alta freqüência com que são realizados tratamentos fisioterápicos.The cutaneous lesion of erythema ab igne is characterized by a reticulate erythema, hyperpigmentation, fine scaling, epidermal atrophy and telangiectasis. Currently the lumbar region is the most affected, due to the use of hot water bottles to relieve chronic pains, and by constant exposure to deep heat in physiotherapy sessions. The authors call attention to a dermatosis that is not often diagnosed, and that may be more prevalent, because of the high frequency with which such physiotherapeutic treatments are performed.

  14. Energy conservation campaign at Sandvik AB in Sandviken

    Energy Technology Data Exchange (ETDEWEB)

    Larsson, Rune


    Sandvik AB's performed an analysis showing oil consumption for steam production was increasing considerably. Energy conservation measures were implemented to decrease the oil consumption and to make lasting changes.

  15. Tensile deformation mechanisms of ABS/PMMA/EMA blends (United States)

    Wang, S. H.; Gao, J.; Lin, S. X.; Zhang, P.; Huang, J.; Xu, L. L.


    The tensile deformation mechanisms of acrylonitrile - butadiene - styrene (ABS) / polymethyl methacrylate (PMMA) blends toughened by ethylene methacrylate (EMA) copolymer was investigated by analysing the fracture morphology. ABS/PMMA was blended with EMA copolymer by melt mixing technique using co-rotating twin extruder. Tensile tests show that the elongation at break of ABS/PMMA blends can be efficiently improved with the increase in EMA content. Fracture morphology of ABS/PMMA/EMA blends reveals that the material yield induced by hollowing-out of EMA particles and its propagation into yield zone is the main toughening mechanism. Moreover, the appearance that EMA particles in the central area are given priority to hollowing-out may be related to the skin-core structure of the injection moulded parts caused by the different cooling rate between surface and inside in the process of injection moulding.

  16. Rescue of failed filtering blebs with ab interno trephination. (United States)

    Shihadeh, Wisam A; Ritch, Robert; Liebmann, Jeffrey M


    We evaluated the effectiveness of ab interno automated trephination as a technique for rescuing failed mature filtering blebs. A retrospective chart review of 40 failed blebs of 38 patients who had a posttrephination follow-up period of at least 3 months was done. With success defined as intraocular pressure (IOP) control with other modalities of management. Complications were few. We believe that ab interno trephination is an excellent option for rescuing selected failed filtering blebs.

  17. Evaluation of the Urotest AB antibacterial substance detection test.


    Blondeau, J. M.; Yaschuk, Y; Galenzoski, D; Hrabok, D; Isaacson, M; Lee, L.(Department of Physics, Yale University, New Haven, CT, USA); Link, H; Walshaw, L


    The Urotest AB was used to detect antimicrobial substances in urine samples. Of 1022 urine specimens evaluated, Urotest AB detected inhibitors in 38.9%. Of 159 urine specimens from patients thought to be taking an antibiotic, inhibitors were detected in 80.5%. This test may help to explain culture negative urine samples from symptomatic patients, and could help elucidate treatment failures and the epidemiology of antibiotic resistance.

  18. Young Modulus of Crystalline Polyethylene from ab Initio Molecular Dynamics


    Hageman, J.C.L.; Meier, Robert J.; M. Heinemann; de Groot, R. A.


    The Young modulus for crystalline polyethylene is calculated using ab initio molecular dynamics based on density functional theory in the local density approximation (DFT-LDA). This modulus, which can be seen as the ultimate value for the Young modulus of polyethylene fibers, is found to be 334 GPa. For the first time the modulus is evaluated ab initio (no bias from experimental data) with demonstrated basis set convergence.

  19. 基于ABS的ABS/ASR集成液压系统设计%ABS/ASR Integrated Hydraulic System Based on ABS

    Institute of Scientific and Technical Information of China (English)

    马岳峰; 刘昭度; 吴利军; 王国业


    介绍一种基于JETTA GTX轿车ABS液压系统的ABS/ASR集成液压系统改造方案,该ABS/ASR集成液压系统在原有ABS液压系统的基础上增加较少的液压元件实现全部ABS功能和ASR制动干预控制功能,改造后的集成系统工作可靠,不影响原有的常规制动和ABS制动过程.

  20. Ab Initio No-Core Shell Model

    Energy Technology Data Exchange (ETDEWEB)

    Barrett, B R; Navratil, P; Vary, J P


    A long-standing goal of nuclear theory is to determine the properties of atomic nuclei based on the fundamental interactions among the protons and neutrons (i.e., nucleons). By adopting nucleon-nucleon (NN), three-nucleon (NNN) and higher-nucleon interactions determined from either meson-exchange theory or QCD, with couplings fixed by few-body systems, we preserve the predictive power of nuclear theory. This foundation enables tests of nature's fundamental symmetries and offers new vistas for the full range of complex nuclear phenomena. Basic questions that drive our quest for a microscopic predictive theory of nuclear phenomena include: (1) What controls nuclear saturation; (2) How the nuclear shell model emerges from the underlying theory; (3) What are the properties of nuclei with extreme neutron/proton ratios; (4) Can we predict useful cross sections that cannot be measured; (5) Can nuclei provide precision tests of the fundamental laws of nature; and (6) Under what conditions do we need QCD to describe nuclear structure, among others. Along with other ab initio nuclear theory groups, we have pursued these questions with meson-theoretical NN interactions, such as CD-Bonn and Argonne V18, that were tuned to provide high-quality descriptions of the NN scattering phase shifts and deuteron properties. We then add meson-theoretic NNN interactions such as the Tucson-Melbourne or Urbana IX interactions. More recently, we have adopted realistic NN and NNN interactions with ties to QCD. Chiral perturbation theory within effective field theory ({chi}EFT) provides us with a promising bridge between QCD and hadronic systems. In this approach one works consistently with systems of increasing nucleon number and makes use of the explicit and spontaneous breaking of chiral symmetry to expand the strong interaction in terms of a dimensionless constant, the ratio of a generic small momentum divided by the chiral symmetry breaking scale taken to be about 1 GeV/c. The

  1. Ab Initio No-Core Shell Model

    International Nuclear Information System (INIS)

    A long-standing goal of nuclear theory is to determine the properties of atomic nuclei based on the fundamental interactions among the protons and neutrons (i.e., nucleons). By adopting nucleon-nucleon (NN), three-nucleon (NNN) and higher-nucleon interactions determined from either meson-exchange theory or QCD, with couplings fixed by few-body systems, we preserve the predictive power of nuclear theory. This foundation enables tests of nature's fundamental symmetries and offers new vistas for the full range of complex nuclear phenomena. Basic questions that drive our quest for a microscopic predictive theory of nuclear phenomena include: (1) What controls nuclear saturation; (2) How the nuclear shell model emerges from the underlying theory; (3) What are the properties of nuclei with extreme neutron/proton ratios; (4) Can we predict useful cross sections that cannot be measured; (5) Can nuclei provide precision tests of the fundamental laws of nature; and (6) Under what conditions do we need QCD to describe nuclear structure, among others. Along with other ab initio nuclear theory groups, we have pursued these questions with meson-theoretical NN interactions, such as CD-Bonn and Argonne V18, that were tuned to provide high-quality descriptions of the NN scattering phase shifts and deuteron properties. We then add meson-theoretic NNN interactions such as the Tucson-Melbourne or Urbana IX interactions. More recently, we have adopted realistic NN and NNN interactions with ties to QCD. Chiral perturbation theory within effective field theory (χEFT) provides us with a promising bridge between QCD and hadronic systems. In this approach one works consistently with systems of increasing nucleon number and makes use of the explicit and spontaneous breaking of chiral symmetry to expand the strong interaction in terms of a dimensionless constant, the ratio of a generic small momentum divided by the chiral symmetry breaking scale taken to be about 1 GeV/c. The resulting NN

  2. Bacillus thuringiensis Cry34Ab1/Cry35Ab1 Interactions with Western Corn Rootworm Midgut Membrane Binding Sites


    Huarong Li; Monica Olson; Gaofeng Lin; Timothy Hey; Sek Yee Tan; Narva, Kenneth E.


    BACKGROUND: Bacillus thuringiensis (Bt) Cry34Ab1/Cry35Ab1 are binary insecticidal proteins that are co-expressed in transgenic corn hybrids for control of western corn rootworm, Diabrotica virgifera virgifera LeConte. Bt crystal (Cry) proteins with limited potential for field-relevant cross-resistance are used in combination, along with non-transgenic corn refuges, as a strategy to delay development of resistant rootworm populations. Differences in insect midgut membrane binding site interact...

  3. Dicty_cDB: FCL-AB19 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AB19 (Link to dictyBase) - - - Contig-U15232-1 FCL-AB19Z ...(Link to Original site) - - FCL-AB19Z 697 - - - - Show FCL-AB19 Library FCL (Link to library) Clone ID FCL-A... Representative seq. ID FCL-...AB19Z (Link to Original site) Representative DNA sequence >FCL-AB19 (FCL-AB19Q) /CSM/FCL/FCL-AB/FCL-...KLINFSIFQ* Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value FCL-

  4. Ab Initio Studies of Stratospheric Ozone Depletion Chemistry (United States)

    Lee, Timothy J.; Head-Gordon, Martin; Langhoff, Stephen R. (Technical Monitor)


    An overview of the current understanding of ozone depletion chemistry, particularly with regards the formation of the so-called Antarctic ozone hole, will be presented together with an outline as to how ab initio quantum chemistry can be used to further our understanding of stratospheric chemistry. The ability of modern state-of-the art ab initio quantum chemical techniques to characterize reliably the gas-phase molecular structure, vibrational spectrum, electronic spectrum, and thermal stability of fluorine, chlorine, bromine and nitrogen oxide species will be demonstrated by presentation of some example studies. The ab initio results will be shown to be in excellent agreement with the available experimental data, and where the experimental data are either not known or are inconclusive, the theoretical results are shown to fill in the gaps and to resolve experimental controversies. In addition, ab initio studies in which the electronic spectra and the characterization of excited electronic states of halogen oxide species will also be presented. Again where available, the ab initio results are compared to experimental observations, and are used to aid in the interpretation of experimental studies.

  5. The over-expression of two transcription factors, ABS5/bHLH30 and ABS7/MYB101, leads to upwardly curly leaves.

    Directory of Open Access Journals (Sweden)

    Rui An

    Full Text Available Proper leaf development is essential for plant growth and development, and leaf morphogenesis is under the control of intricate networks of genetic and environmental cues. We are interested in dissecting these regulatory circuits genetically and report here the isolation of two Arabidopsis dominant mutants, abnormal shoot5-1D (abs5-1D and abs7-1D identified through activation tagging screens. Both abs5-1D and abs7-1D display an intriguing upwardly curly leaf phenotype. Molecular cloning showed that the elevated expression of a bHLH transcription factor ABS5/T5L1/bHLH30 or a MYB transcription factor ABS7/MYB101 is the cause for the abnormal leaf phenotypes found in abs5-1D or abs7-1D, respectively. Protoplast transient expression assays confirmed that both ABS5/T5L1 and ABS7/MYB101 are targeted to the nucleus. Interestingly, the expression domains of auxin response reporter DR5::GUS were abnormal in leaves of abs5-1D and ABS5/T5L1 over-expression lines. Moreover, cotyledon venation analysis showed that more areoles and free-ending veins are formed in abs5-1D. We found that the epidermis-specific expressions of ABS5/T5L1 or ABS7/MYB101 driven by the Arabidopsis Meristem Layer 1 promoter (PAtML1 were sufficient to recapitulate the curly leaf phenotype of abs5-1D or abs7-1D. In addition, PAtML1::ABS5 lines exhibited similar changes in DR5::GUS expression patterns as those found in 35S-driven ABS5/T5L1 over-expression lines. Our work demonstrated that enhanced expressions of two transcription factors, ABS5/T5L1 and ABS7/MYB101, are able to alter leaf lamina development and reinforce the notion that leaf epidermis plays critical roles in regulating plant organ morphogenesis.

  6. Ab initio simulation of transport phenomena in rarefied gases. (United States)

    Sharipov, Felix; Strapasson, José L


    Ab initio potentials are implemented into the direct simulation Monte Carlo (DSMC) method. Such an implementation allows us to model transport phenomena in rarefied gases without any fitting parameter of intermolecular collisions usually extracted from experimental data. Applying the method proposed by Sharipov and Strapasson [Phys. Fluids 24, 011703 (2012)], the use of ab initio potentials in the DSMC requires the same computational efforts as the widely used potentials such as hard spheres, variable hard sphere, variable soft spheres, etc. At the same time, the ab initio potentials provide more reliable results than any other one. As an example, the transport coefficients of a binary mixture He-Ar, viz., viscosity, thermal conductivity, and thermal diffusion factor, have been calculated for several values of the mole fraction. PMID:23030889

  7. Simplest AB-Thermonuclear Space Propulsion and Electric Generator

    CERN Document Server

    Bolonkin, A


    The author applies, develops and researches mini-sized Micro- AB Thermonuclear Reactors for space propulsion and space power systems. These small engines directly convert the high speed charged particles produced in the thermonuclear reactor into vehicle thrust or vehicle electricity with maximum efficiency. The simplest AB-thermonuclear propulsion offered allows spaceships to reach speeds of 20,000 50,000 km/s (1/6 of light speed) for fuel ratio 0.1 and produces a huge amount of useful electric energy. Offered propulsion system permits flight to any planet of our Solar system in short time and to the nearest non-Sun stars by E-being or intellectual robots during a single human life period. Key words: AB-propulsion, thermonuclear propulsion, space propulsion, thermonuclear power system.

  8. Surface Modification of AB2. and AB5 Hydrogen Storage Alloy Electrodes by the Hot-Charging Treatment

    Institute of Scientific and Technical Information of China (English)


    The effect of the hot-charging treatment on the performance ofAB2 and AB5 hydrogen storage alloy electrodes was investigated. The result showed that the treatment can markedly improve the voltage plateau ratio (VPR), the high rate discharge ability (HRDA), the diffusion coefficient of hydrogen DH and the discharge capacity of the AB2 hydrogen storage alloy electrode. The SEM analysis showed that the hot-charging treatment brings about a Ni-rich surface due to the dissolution of Zr oxides. It is also very helpful for the improvement of the kinetic properties of AB2 hydrogen storage alloy electrode because the microcracking o.f the surface results in fresh surface. This can be the basic modification treatment for NiMH battery used in electric vehicles (EVs) in the future. But for AB5 type alloys, the treatment has the disadvantage of impairing the comprehensive electrochemical properties, because the surface of the alloy may be corroded during the treatment. The mechanism of the surface modification of the electrode is also proposed.

  9. Stimulation of UvrD helicase by UvrAB. (United States)

    Atkinson, John; Guy, Colin P; Cadman, Chris J; Moolenaar, Geri F; Goosen, Nora; McGlynn, Peter


    Helicases play critical roles in all aspects of nucleic acid metabolism by catalyzing the remodeling of DNA and RNA structures. UvrD is an abundant helicase in Escherichia coli with well characterized functions in mismatch and nucleotide excision repair and a possible role in displacement of proteins such as RecA from single-stranded DNA. The mismatch repair protein MutL is known to stimulate UvrD. Here we show that the nucleotide excision repair proteins UvrA and UvrB can together stimulate UvrD-catalyzed unwinding of a range of DNA substrates containing strand discontinuities, including forked DNA substrates. The stimulation is specific for UvrD, as UvrAB failed to stimulate Rep helicase, a UvrD homologue. Moreover, although UvrAB can promote limited strand displacement, stimulation of UvrD did not require the strand displacement function of UvrAB. We conclude that UvrAB, like MutL, modulate UvrD helicase activity. This stimulation likely plays a role in DNA strand and protein displacement by UvrD in nucleotide excision repair. Promotion of UvrD-catalyzed unwinding of nicked duplexes by UvrAB may also explain the need for UvrAB and UvrD in Okazaki fragment processing in cells lacking DNA polymerase I. More generally, these data support the idea that helicase activity is regulated in vivo, with helicases acting as part of multisubunit complexes rather than in isolation. PMID:19208629

  10. AB Levitrons and their Applications to Earth's Motionless Satellites

    CERN Document Server

    Bolonkin, Alexander


    Author offers the new and distinctly revolutionary method of levitation in artificial magnetic field. It is shown that a very big space station and small satellites may be suspended over the Earth's surface and used as motionless radio-TV translators, telecommunication boosters, absolute geographic position locators, personal and mass entertainment and as planet-observation platforms. Presented here is the theory of big AB artificial magnetic field and levitation in it is generally developed. Computation of three macro-projects: space station at altitude 100 km, TV-communication antenna at height 500 m, and multi-path magnetic highway. Key words: levitation, AB Levitrons, motionless space satellite.

  11. Report on the Personnel Dosimetry at AB Atomenergi during 1962

    International Nuclear Information System (INIS)

    This report presents the results of the personnel dosimetry at AB Atomenergi during 1962. No doses exceeding the recommendations of ICRP have been reported. The sum of the reported external total body doses (≥ 100 mrem/quarter) is for the whole of AB Atomenergi during this year 74. 2 manrem corresponding to about 50 mrem/year and person or 1 % of the maximum permissible dose. 32500 gamma films and 6200 neutron films have been evaluated. The total number of urine analyses is 2700 and of whole body measurements 10

  12. Report on the Personnel Dosimetry at AB Atomenergi during 1962

    International Nuclear Information System (INIS)

    This report presents the results of the personnel dosimetry at AB Atomenergi during 1963. No doses exceeding the recommendations of ICRP have been reported. The sum of the reported external total body doses during the year is for AB Atomenergi 64.2 manrem which, distributed over the whole company personnel, corresponds to about 40 mrem per year and person or about 1 % of the maximum permissible dose. 37800 gamma films and 6700 neutron films have been evaluated. The total number of urine analyses is 3603 and of whole body measurements 211

  13. Intern kontroll : - En studie om Schroff Scandinavia ABs interna kontroll


    Huldt, Martin; Björksved, Patrick


    Sammanfattning: ”Intern kontroll- En studie om Schroff Scandinavia ABs interna kontroll” Datum:  2014-06-11 Nivå: Kandidatuppsats i företagsekonomi, 15 ECTS Institution: Akademin för Ekonomi, Samhälle och Teknik, EST,                 Mälardalen Högskola Författare: Patrick Björksved, Martin Huldt Titel: Intern kontroll- En studie om Schroff Scandinavia ABs interna kontroll Handledare : Magnus Linderström Nyckelord: Intern kontroll, intern revision, intern styrning, COSO-modellen, Lean product...

  14. Utveckling av ergoterapitjänster vid Helsingfors ergoterapi Ab


    Sandells, Linn


    Syftet med examensarbetet är att ta fram kvalitativa rekommendationer på ergoterapitjänster för barn i behov av särskilt stöd. Det har gjorts genom en processinriktad metod, rekommendationerna på ergoterapitjänster har tagits fram för Helsingfors ergoterapi Ab. Aktivitetsrättvisa är den teoretiska referensramen i arbetet. Den frågeställning som besvarats är vilka ergoterapitjänster kan rekommenderas till Helsingfors ergoterapi Ab. För att uppnå resultatet har materialinsamling och intervjuer ...

  15. Bruksmakt och maktbruk : Robertsfors AB 1897-1968


    Holmström, Per


    This thesis studies seven strategic decisions made in the family-owned forestry company Robertsfors AB, in Northern Sweden. During the present century Ro­bertsfors AB has developed from a patriarchally concern controlled into a capi­talistic industrial company. This also meant a radical change in the decision­making process. Two factors were decisive in this process: the managing direc­tor's values, and altered power relationships both within the company and exter­nally in relation to e g sta...

  16. P-V Relation for Mercuric Calcogenides: Ab Initio Method

    Directory of Open Access Journals (Sweden)

    G. Misra


    Full Text Available Mercuric Calcogenides found many applications in electronic and optical devices as semiconducting materials. An equation of state provides useful information about the relationship between pressure (P, volume (V and temperature (T that helps to understand the behaviour of materials under the effect of high pressure and high temperature. The present paper sheds light on the electronic structure of Mercuric Calcogenides by simulating its electronic properties through ab initio method. This ab initio method is extended to derive the equation of state for Mercuric Calcogenides. The present equation of state has also been tested for the prediction of End Point. The computed results compare well with Quantum statistical data.

  17. Towards new horizons in ab initio nuclear structure theory

    International Nuclear Information System (INIS)

    We review recent advances in ab initio nuclear structure theory, which have changed the horizons of this field. Starting from chiral effective field theory to construct the nuclear Hamiltonian and the similarity renormalization group to further soften it, we address several many-body approaches that have seen major developments over the past few years. We show that the domain of ab initio nuclear structure theory has been pushed well beyond the p-shell and that quantitative QCD-based predictions are becoming possible all the way from the proton to the neutron drip line up into the medium-mass regime. (authors)

  18. Recent achievements in ab initio modelling of liquid water

    CERN Document Server

    Khaliullin, Rustam Z


    The application of newly developed first-principle modeling techniques to liquid water deepens our understanding of the microscopic origins of its unusual macroscopic properties and behaviour. Here, we review two novel ab initio computational methods: second-generation Car-Parrinello molecular dynamics and decomposition analysis based on absolutely localized molecular orbitals. We show that these two methods in combination not only enable ab initio molecular dynamics simulations on previously inaccessible time and length scales, but also provide unprecedented insights into the nature of hydrogen bonding between water molecules. We discuss recent applications of these methods to water clusters and bulk water.

  19. Use of ab initio quantum chemical methods in battery technology

    Energy Technology Data Exchange (ETDEWEB)

    Deiss, E. [Paul Scherrer Inst. (PSI), Villigen (Switzerland)


    Ab initio quantum chemistry can nowadays predict physical and chemical properties of molecules and solids. An attempt should be made to use this tool more widely for predicting technologically favourable materials. To demonstrate the use of ab initio quantum chemistry in battery technology, the theoretical energy density (energy per volume of active electrode material) and specific energy (energy per mass of active electrode material) of a rechargeable lithium-ion battery consisting of a graphite electrode and a nickel oxide electrode has been calculated with this method. (author) 1 fig., 1 tab., 7 refs.

  20. GJ 282 AB (WDS 07400-0336 AB = BGH 3 AB) and GICLAS 112-29: A Very Wide System in Process of Dissociation (United States)

    Rica, F. M.; Benavides, R.


    Very wide binaries are interesting objects that shed light on the binary formation process and their dynamical evolution. Poveda et al. (2009) studied the possible physical relation of the near (14.2 pc) and wide (~58") binary star GJ 282 AB and the extremely wide (1.09º; ~55,000 AU) companion, NLTT 18149, and they concluded that this very wide system is in the process of dynamical disintegration. In this work, we confirm the same conclusion but using a different method. We first study dynamically GJ 282 AB, confirmed that it is a bound system and then we determine possible orbital solutions. Later, we calculate the relative velocity of NLTT 18149 with respect to the GJ 282 AB's center mass using their (U, V, W) galactocentric velocity. The relative velocity, Vrel = 1.98 ± 0.16 km s-1, is much larger than the escape velocity (0.25 ± 0.01 km s-1). Therefore, with a significance level of 11s, we also conclude that this very wide system is in a process of dynamical disintegration.

  1. 7 CFR Exhibits A-B to Subpart G... - [Reserved (United States)


    ... PRIMARILY FOR REAL ESTATE PURPOSES RURAL HOUSING LOANS AND GRANTS Rural Housing Site Loan Policies... 7 Agriculture 12 2010-01-01 2010-01-01 false A Exhibits A-B to Subpart G to Part 1822 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING SERVICE, RURAL...

  2. Move of Purchasing Offices TS – AB* – AT*

    CERN Multimedia

    FI Department


    The TS – AB* - AT* Purchasing Offices and the Purchasing Pool have moved to Building 5 – 2nd and *3rd floors. The phone and fax numbers are unchanged. We apologize for any inconvenience caused by the move. Thank you for your understanding. Finance Department – Purchasing Service.

  3. Ab initio molecular dynamics simulation of laser melting of silicon

    NARCIS (Netherlands)

    Silvestrelli, P.-L.; Alavi, A.; Parrinello, M.; Frenkel, D.


    The method of ab initio molecular dynamics, based on finite temperature density functional theory, is used to simulate laser heating of crystal silicon. We have found that a high concentration of excited electrons dramatically weakens the covalent bond. As a result, the system undergoes a melting tr

  4. Food for Thought on the "ABS Academic Journal Quality Guide" (United States)

    Hussain, Simon


    This paper discusses issues relating to the use of the Association of Business Schools' (ABS) "Academic Journal Quality Guide" within UK business schools. It also looks at several specific issues raised by the Chair of the British Accounting Association/British Accounting and Finance Association regarding the ratings for top…

  5. Discovery of New Substrates for LuxAB Bacterial Bioluminescence. (United States)

    Jiang, Tianyu; Wang, Weishan; Wu, Xingkang; Wu, Wenxiao; Bai, Haixiu; Ma, Zhao; Shen, Yuemao; Yang, Keqian; Li, Minyong


    In this article, four novel substrates with long halftime have been designed and synthesized successfully for luxAB bacterial bioluminescence. After in vitro and in vivo biological evaluation, these molecules can emit obvious bioluminescence emission with known bacterial luciferase, thus indicating a new promising approach to developing the bacterial bioluminescent system. PMID:26896339

  6. 78 FR 33010 - Airworthiness Directives; Saab AB, Saab Aerosystems Airplanes (United States)


    ... in an aircraft maintenance manual is incorrect for Saab 340B airplane. This proposed AD would require... information identified in this proposed AD, contact Saab AB, Saab Aeronautics, SE-581 88, Link ping, Sweden... Aircraft Maintenance Manual (AMM), which quotes an elevator position of 4 degrees trailing edge down...

  7. Discovery of New Substrates for LuxAB Bacterial Bioluminescence. (United States)

    Jiang, Tianyu; Wang, Weishan; Wu, Xingkang; Wu, Wenxiao; Bai, Haixiu; Ma, Zhao; Shen, Yuemao; Yang, Keqian; Li, Minyong


    In this article, four novel substrates with long halftime have been designed and synthesized successfully for luxAB bacterial bioluminescence. After in vitro and in vivo biological evaluation, these molecules can emit obvious bioluminescence emission with known bacterial luciferase, thus indicating a new promising approach to developing the bacterial bioluminescent system.

  8. Ultra-Low Voltage Class AB Switched Current Memory Cell

    DEFF Research Database (Denmark)

    Igor, Mucha


    This paper presents the theoretical basis for the design of class AB switched current memory cells employing floating-gate MOS transistors, suitable for ultra-low-voltage applications. To support the theoretical assumptions circuits based on these cells were designed using a CMOS process with...

  9. Cyanogen Azide. Ionization Potentials and Ab Initio SCF MO Calculation

    DEFF Research Database (Denmark)

    Bak, Börge; Jansen, Peter; Stafast, Herbert


    The Ne(I) and He(I) photoelectron(PE) spectra of cyanogen azide, NCN3, have been recorded at high resolution. Their interpretation is achieved by comparison with the PE spectrum of HN3 and an ab initio LCGO SCF MO calculation. Deviations from Koopmans' theorem of quite different magnitudes are fo...

  10. Relaxation of Small Molecules: an ab initio Study

    Institute of Scientific and Technical Information of China (English)

    CAO Yi-Gang; JIAO Zheng-Kuan; A. Antons; K. Schroeder; S. Blügel2


    Using an ab initio total energy and force method, we have relaxed several group IV and group V elementalclusters, in detail the arsenic and antimony dimers, silicon, phosphorus, arsenic and antimony tetramers. The obtainedbond lengths and cohesive energies are more accurate than other calculating methods, and in excellent agreement withthe experimental results.

  11. Relaxation of Small Molecules:an ab initio Study

    Institute of Scientific and Technical Information of China (English)

    CAOYi-Gang; A.Antons; 等


    Using an ab inito total energy and force method,we have relaxed several group IV and group V elemental clusters,in detail the arsenic and antimony dimers,silicon,phosphorus,arsenic and antimony tetraners,The obtained bond lengths and cohesive energies are more accurate than other calculating methods,and in excellent agreement with the experimental results.

  12. Young Modulus of Crystalline Polyethylene from ab Initio Molecular Dynamics

    NARCIS (Netherlands)

    Hageman, J.C.L.; Meier, Robert J.; Heinemann, M.; Groot, R.A. de


    The Young modulus for crystalline polyethylene is calculated using ab initio molecular dynamics based on density functional theory in the local density approximation (DFT-LDA). This modulus, which can be seen as the ultimate value for the Young modulus of polyethylene fibers, is found to be 334 GPa.

  13. AB 1725 Model Accountability System. California Community Colleges. Revised. (United States)

    California Community Colleges, Sacramento. Board of Governors.

    This report proposes a model accountability system for the California community colleges to comply with the directives of Assembly Bill 1725 (AB 1725). The purpose of the accountability system is to provide colleges and districts, the board of governors, and the California legislature with information that will allow for the continued improvement…

  14. Protective mAbs and Cross-Reactive mAbs Raised by Immunization with Engineered Marburg Virus GPs.

    Directory of Open Access Journals (Sweden)

    Marnie L Fusco


    Full Text Available The filoviruses, which include the marburg- and ebolaviruses, have caused multiple outbreaks among humans this decade. Antibodies against the filovirus surface glycoprotein (GP have been shown to provide life-saving therapy in nonhuman primates, but such antibodies are generally virus-specific. Many monoclonal antibodies (mAbs have been described against Ebola virus. In contrast, relatively few have been described against Marburg virus. Here we present ten mAbs elicited by immunization of mice using recombinant mucin-deleted GPs from different Marburg virus (MARV strains. Surprisingly, two of the mAbs raised against MARV GP also cross-react with the mucin-deleted GP cores of all tested ebolaviruses (Ebola, Sudan, Bundibugyo, Reston, but these epitopes are masked differently by the mucin-like domains themselves. The most efficacious mAbs in this panel were found to recognize a novel "wing" feature on the GP2 subunit that is unique to Marburg and does not exist in Ebola. Two of these anti-wing antibodies confer 90 and 100% protection, respectively, one hour post-exposure in mice challenged with MARV.

  15. Augmented wave ab initio EFG calculations: some methodological warnings

    Energy Technology Data Exchange (ETDEWEB)

    Errico, Leonardo A. [Departamento de Fisica-IFLP (CONICET), Facultad de Ciencias Exactas, Universidad Nacional de La Plata, CC67 (1900) La Plata (Argentina); Renteria, Mario [Departamento de Fisica-IFLP (CONICET), Facultad de Ciencias Exactas, Universidad Nacional de La Plata, CC67 (1900) La Plata (Argentina); Petrilli, Helena M. [Instituto de Fisica-DFMT, Universidade de Sao Paulo, C.P. 66318, 05315-970 Sao Paulo, SP (Brazil)]. E-mail:


    We discuss some accuracy aspects inherent to ab initio electronic structure calculations in the understanding of nuclear quadrupole interactions. We use the projector augmented wave method to study the electric-field gradient (EFG) at both Sn and O sites in the prototype cases SnO and SnO{sub 2}. The term ab initio is used in the standard context of the also called first principles methods in the framework of the Density Functional Theory. As the main contributions of EFG calculations to problems in condensed matter physics are related to structural characterizations on the atomic scale, we discuss the 'state of the art' on theoretical EFG calculations and make a brief critical review on the subject, calling attention to some fundamental theoretical aspects.

  16. Understanding phonon transport in thermoelectric materials using ab initio approaches (United States)

    Broido, David

    Good thermoelectric materials have low phonon thermal conductivity, kph. Accurate theories to describe kph are important components in developing predictive models of thermoelectric efficiency that can help guide synthesis and measurement efforts. We have developed ab initio approaches to calculate kph, in which phonon modes and phonon scattering rates are computed using interatomic force constants determined from density functional theory, and a full solution of the Boltzmann transport equation for phonons is implemented. A recent approach to calculate interatomic force constants using ab initio molecular dynamics has yielded a good description of the thermal properties of Bi2Te3. But, the complexity of new promising candidate thermoelectric materials introduces computational challenges in assessing their thermal properties. An example is germanane, a germanium based hydrogen-terminated layered semiconductor, which we will discuss in this talk.

  17. Chemical and Electrochemical Metallic Covering of ABS polymers

    Directory of Open Access Journals (Sweden)

    Florentina Cziple


    Full Text Available The aim of this paper is the deposition of metallic layers on the surface of ABS plastic material, by means of two consecutive procedures, namely: the first is represented by the conductibility through chemical or electro-chemical metallic covering of the polymeric support and the second procedure is the electrodeposition of the metal through galvanization. The chemical mehtod consists in the submission of ABS polymers to some conductibility operations of the plastic material surface through chemical copper plating (chemical roughing, degreasing with ultra-sounds, chemical sensitivation, activation and proper conductibility of the material surface. The electrochemical deposition of nickel was made on the plastic material activated in the mixture solution of graphite with potassium carbonate.

  18. The density matrix renormalization group for ab initio quantum chemistry

    CERN Document Server

    Wouters, Sebastian


    During the past 15 years, the density matrix renormalization group (DMRG) has become increasingly important for ab initio quantum chemistry. Its underlying wavefunction ansatz, the matrix product state (MPS), is a low-rank decomposition of the full configuration interaction tensor. The virtual dimension of the MPS, the rank of the decomposition, controls the size of the corner of the many-body Hilbert space that can be reached with the ansatz. This parameter can be systematically increased until numerical convergence is reached. The MPS ansatz naturally captures exponentially decaying correlation functions. Therefore DMRG works extremely well for noncritical one-dimensional systems. The active orbital spaces in quantum chemistry are however often far from one-dimensional, and relatively large virtual dimensions are required to use DMRG for ab initio quantum chemistry (QC-DMRG). The QC-DMRG algorithm, its computational cost, and its properties are discussed. Two important aspects to reduce the computational co...

  19. Toward the Ab-initio Description of Medium Mass Nuclei

    CERN Document Server

    Barbieri, C; Soma, V; Duguet, T; Navratil, P


    As ab-initio calculations of atomic nuclei enter the A=40-100 mass range, a great challenge is how to approach the vast majority of open-shell (degenerate) isotopes. We add realistic three-nucleon interactions to the state of the art many-body Green's function theory of closed-shells, and find that physics of neutron driplines is reproduced with very good quality. Further, we introduce the Gorkov formalism to extend ab-initio theory to semi-magic, fully open-shell, isotopes. Proof-of-principle calculations for Ca-44 and Ni-74 confirm that this approach is indeed feasible. Combining these two advances (open-shells and three-nucleon interactions) requires longer, technical, work but it is otherwise within reach.

  20. Ab-initio calculations on melting of thorium (United States)

    Mukherjee, D.; Sahoo, B. D.; Joshi, K. D.; Kaushik, T. C.; Gupta, Satish C.


    Ab-initio molecular dynamics study has been performed on face centered cubic structured thorium to determine its melting temperature at room pressure. The ion-electron interaction potential energy calculated as a function of temperature for three volumes (a0)3 and (1.02a0)3 and (1.04a0)3 increases gradually with temperature and undergoes a sharp jump at ~2200 K, ~2100 K and ~1800 K, respectively. Here, a0 = 5.043 Å is the equilibrium lattice parameter at 0 K obtained from ab-initio calculations. These jumps in interaction energy are treated as due to the onset of melting and corresponding temperatures as melting point. The melting point of 2100 K is close to the experimental value of 2023K. Further, the same has been verified by plotting the atomic arrangement evolved at various temperatures and corresponding pair correlation functions.

  1. Serine Proteases an Ab Initio Molecular Dynamics Study

    CERN Document Server

    De Santis, L


    In serine proteases (SP's), the H-bond between His-57 and Asp-102, and that between Gly-193 and the transition state intermediate play a crucial role for enzymatic function. To shed light on the nature of these interactions, we have carried out ab initio molecular dynamics simulations on complexes representing adducts between the reaction intermediate and elastase (one protein belonging to the SP family). Our calculations indicate the presence of a low--barrier H-bond between His-57 and Asp-102, in complete agreement with NMR experiments on enzyme--transition state analog complexes. Comparison with an ab initio molecular dynamics simulation on a model of the substrate--enzyme adduct indicates that the Gly-193--induced strong stabilization of the intermediate is accomplished by charge/dipole interactions and not by H-bonding as previously suggested. Inclusion of the protein electric field in the calculations does not affect significantly the charge distribution.

  2. The density matrix renormalization group for ab initio quantum chemistry


    Wouters, Sebastian


    During the past 15 years, the density matrix renormalization group (DMRG) has become increasingly important for ab initio quantum chemistry. It is used as a numerically exact solver for highly correlated regions in molecules. While the method works extremely well for one-dimensional systems, the correlated regions of interest are often far from one-dimensional. In this introductory talk, I will discuss the DMRG algorithm from a quantum information perspective, how quantum information theory h...

  3. Molexpl: a tool for ab initio data exploration and visualization


    Wang, Xueying; Onofrio, Nicolas,; Strachan, Alejandro


    Density functional theory (DFT) based on ab initio theory, is a powerful method to resolve the electronic structure of atoms, molecules and solids. However, in practical, DFT is limited to few hundreds of atoms. To overcome this limitation, researchers have developed empirical interatomic potentials implemented in molecular dynamics (MD) simulations. MD ignores the movements of electrons and describes bonding and non-bonding interaction as a function of the distance between atoms called force...

  4. Ab initio calculation of tight-binding parameters

    Energy Technology Data Exchange (ETDEWEB)

    McMahan, A.K.; Klepeis, J.E.


    We calculate ab initio values of tight-binding parameters for the f- electron metal Ce and various phases of Si, from local-density functional one-electron Hamiltonian and overlap matrix elements. Our approach allows us to unambiguously test the validity of the common minimal basis and two-center approximations as well as to determine the degree of transferability of both nonorthogonal and orthogonal hopping parameters in the cases considered.

  5. Social Media Marketing : CASE: OY SUOMEN LYYRA AB


    Eriksson, Irene


    This bachelor thesis was commissioned by Oy Suomen Lyyra Ab, the largest student online media and student card producer for higher education students in Finland. The the-sis objective was to understanding the current social media situation and activity among the students of higher education in Finland, the social media networks that the case company currently uses as well as understanding how to use these networks for successful marketing activities. The quantitative research was conducted in...

  6. Integrated Design of Antibodies for Systems Biology Using Ab Designer


    Pisitkun, Trairak; Dummer, Patrick; Somparn, Poorichaya; Hirankarn, Nattiya; Kopp, Jeffrey B.; Knepper, Mark A.


    In the current era of large-scale biology, systems biology has evolved as a powerful approach to identify complex interactions within biological systems. In addition to high throughput identification and quantification techniques, methods based on high-quality mono-specific antibodies remain an essential element of the approach. To assist the large-scale design and production of peptide-directed antibodies for systems biology studies, we developed a fully integrated online application, AbDesi...

  7. GAUSSIAN 76: an ab initio molecular orbital program

    Energy Technology Data Exchange (ETDEWEB)

    Binkley, J. S.; Whiteside, R.; Hariharan, P. C.; Seeger, R.; Hehre, W. J.; Lathan, W. A.; Newton, M. D.; Ditchfield, R.; Pople, J. A.


    Gaussian 76 is a general-purpose computer program for ab initio Hartree-Fock molecular orbital calculations. It can handle basis sets involving s, p and d-type gaussian functions. Certain standard sets (STO-3G, 4-31G, 6-31G*, etc.) are stored internally for easy use. Closed shell (RHF) or unrestricted open shell (UHF) wave functions can be obtained. Facilities are provided for geometry optimization to potential minima and for limited potential surface scans.

  8. P-V Relation for Mercuric Calcogenides: Ab Initio Method


    G. Misra; S. Tenguria; Gautam, M.


    Mercuric Calcogenides found many applications in electronic and optical devices as semiconducting materials. An equation of state provides useful information about the relationship between pressure (P), volume (V) and temperature (T) that helps to understand the behaviour of materials under the effect of high pressure and high temperature. The present paper sheds light on the electronic structure of Mercuric Calcogenides by simulating its electronic properties through ab initio method. This a...

  9. Preparation of F(ab')2 fragments of immunoglobulin G. (United States)

    Killion, J J; Holtgrewe, E M


    We describe a simple protocol for the preparation of F(ab')2 fragments of immunoglobulin G, based upon the known Fc- binding properties of protein A-Sepharose. The fragment preparations of xenogeneic and allogeneic anti-IgG were noncytotoxic to intact target cells, and were able to block the cytotoxicity of intact antibody. This method should therefore be useful for functional studies not requiring biochemical homogeneity.

  10. Ab-initio calculations for dilute magnetic semiconductors


    Belhadji, Brahim


    This thesis focusses on ab-initio calculations for the electronic structure and the magnetic properties of dilute magnetic semiconductors (DMS). In particular we aim at the understanding of the complex exchange interactions in these systems. Our calculations are based on density functional theory, being ideally suited for a description of the material specific properties of the considered DMS. Moreover we use the KKR Green function method in connection with the coherent potential approximatio...

  11. Thermochemical data for CVD modeling from ab initio calculations

    Energy Technology Data Exchange (ETDEWEB)

    Ho, P. [Sandia National Labs., Albuquerque, NM (United States); Melius, C.F. [Sandia National Labs., Livermore, CA (United States)


    Ab initio electronic-structure calculations are combined with empirical bond-additivity corrections to yield thermochemical properties of gas-phase molecules. A self-consistent set of heats of formation for molecules in the Si-H, Si-H-Cl, Si-H-F, Si-N-H and Si-N-H-F systems is presented, along with preliminary values for some Si-O-C-H species.

  12. Near Resonant Electronic and Rotational Energy Transfer AB(1П, J) + C(slj) → AB(1П, J') + C(slj')

    Institute of Scientific and Technical Information of China (English)

    WANG Wei-Li; SONG Peng; SHEN Yang; MA Feng-Cai


    In our previous theoretical study, the theoretical model of the collision-induced electronic and rotational energy transfer of AB(1∑, J) + C(slj) → AB(1∑, J') + C(slj') was presented. To further study the collision-induced electronic and rotational energy transfer theoretically on AB(1∏,J)+C(slj)→AB(1∏,J1)+C(slj') a theoretical model is presented, based on the time-dependent first-order Born approximation, taking into account the anisotropic LennardJones interaction potential and "straight-line" trajectory approximation. The changing tendency of the transitional probabilities with the anisotropic parameter is discussed.

  13. Pressure tracking control of vehicle ABS using piezo valve modulator (United States)

    Jeon, Juncheol; Choi, Seung-Bok


    This paper presents a wheel slip control for the ABS(anti-lock brake system) of a passenger vehicle using a controllable piezo valve modulator. The ABS is designed to optimize for braking effectiveness and good steerability. As a first step, the principal design parameters of the piezo valve and pressure modulator are appropriately determined by considering the braking pressure variation during the ABS operation. The proposed piezo valve consists of a flapper, pneumatic circuit and a piezostack actuator. In order to get wide control range of the pressure, the pressure modulator is desired. The modulator consists of a dual-type cylinder filled with different substances (fluid and gas) and a piston rod moving vertical axis to transmit the force. Subsequently, a quarter car wheel slip model is formulated and integrated with the governing equation of the piezo valve modulator. A sliding mode controller to achieve the desired slip rate is then designed and implemented. Braking control performances such as brake pressure and slip rate are evaluated via computer simulations.

  14. Ab Initio Nuclear Structure and Reaction Calculations for Rare Isotopes

    Energy Technology Data Exchange (ETDEWEB)

    Draayer, Jerry P. [Louisiana State Univ., Baton Rouge, LA (United States)


    We have developed a novel ab initio symmetry-adapted no-core shell model (SA-NCSM), which has opened the intermediate-mass region for ab initio investigations, thereby providing an opportunity for first-principle symmetry-guided applications to nuclear structure and reactions for nuclear isotopes from the lightest p-shell systems to intermediate-mass nuclei. This includes short-lived proton-rich nuclei on the path of X-ray burst nucleosynthesis and rare neutron-rich isotopes to be produced by the Facility for Rare Isotope Beams (FRIB). We have provided ab initio descriptions of high accuracy for low-lying (including collectivity-driven) states of isotopes of Li, He, Be, C, O, Ne, Mg, Al, and Si, and studied related strong- and weak-interaction driven reactions that are important, in astrophysics, for further understanding stellar evolution, X-ray bursts and triggering of s, p, and rp processes, and in applied physics, for electron and neutrino-nucleus scattering experiments as well as for fusion ignition at the National Ignition Facility (NIF).

  15. A highly accurate ab initio potential energy surface for methane (United States)

    Owens, Alec; Yurchenko, Sergei N.; Yachmenev, Andrey; Tennyson, Jonathan; Thiel, Walter


    A new nine-dimensional potential energy surface (PES) for methane has been generated using state-of-the-art ab initio theory. The PES is based on explicitly correlated coupled cluster calculations with extrapolation to the complete basis set limit and incorporates a range of higher-level additive energy corrections. These include core-valence electron correlation, higher-order coupled cluster terms beyond perturbative triples, scalar relativistic effects, and the diagonal Born-Oppenheimer correction. Sub-wavenumber accuracy is achieved for the majority of experimentally known vibrational energy levels with the four fundamentals of 12CH4 reproduced with a root-mean-square error of 0.70 cm-1. The computed ab initio equilibrium C-H bond length is in excellent agreement with previous values despite pure rotational energies displaying minor systematic errors as J (rotational excitation) increases. It is shown that these errors can be significantly reduced by adjusting the equilibrium geometry. The PES represents the most accurate ab initio surface to date and will serve as a good starting point for empirical refinement.

  16. Acceleration of the Convergence in ab initio Atomic Relaxations (United States)

    Zhao, Zhengji; Wang, Lin-Wang; Meza, Juan


    Atomic relaxations is often required to accurately describe the properties of nanosystems. In ab initio calculations, a common practice is to use a standard search algorithm, such as BFGS (Broyden-Fletcher-Goldfarb-Shanno) or CG (conjugate gradient) method, which starts the atomic relaxations without any knowledge of the Hessian matrix of the system. For example, the initial Hessian in BFGS method is often set to identity, and there is no preconditioning to CG method. One way to accelerate the convergence of the atomic relaxations is to estimate an approximate Hessian matrix of the system and then use it as the initial Hessian in BFGS method or a preconditioner in CG method. Previous attempts to obtain the approximated Hessian were focused on the use of classical force field models which rely on the existence of good parameters. Here, we present an alternative method to estimate the Hessian matrix of a nanosystem. First, we decompose the system into motifs which consist of a few atoms, then calculate the Hessian matrix elements on different motif types from ab initio calculations for small prototype systems. Then we generate the Hessian Matrix of the whole system by putting together these motif Hessians. We have applied our motif-based Hessian matrix in ab initio atomic relaxations in several bulk (with/without impurity) and quantum dot systems, and have found a speed up factor of 2 to 4 depending on the system size.

  17. Studies on the runaway reaction of ABS polymerization process

    Energy Technology Data Exchange (ETDEWEB)

    Hu, K.-H. [Department of Occupational Safety and Health, Jen-Teh Junior College of Medicine, Nursing and Management, Miaoli, Taiwan (China); Kao, C.-S. [Department of Safety, Health and Environmental Engineering, National United University, Taiwan (China); Duh, Y.-S. [Department of Occupational Safety and Health, Jen-Teh Junior College of Medicine, Nursing and Management, Miaoli, Taiwan (China)], E-mail:


    Taiwan has the largest acrylonitrile-butadiene-styrene (ABS) copolymer production in the world. Preventing on unexpected exothermic reactions and related emergency relief hazard is essential in the safety control of ABS emulsion polymerization. A VSP2 (Vent Sizing Package 2) apparatus is capable of studying both normal and abnormal conditions (e.g., cooling failure, mischarge, etc.) of industrial process. In this study, the scenarios were verified from the following abnormal conditions: loss of cooling, double charge of initiator, overcharge of monomer, without charge of solvent, and external fire. An external fire with constant heating will promote higher self-heat rate and this is recommended as the worst case scenario of emulsion polymerization on butadiene. Cooling failure coupled with bulk system of reactant was determined to be the credible worst case in ABS emulsion polymerization. Finally, the emergency vent sizing based on thermokinetics from VSP associated with DIERS methodology were used for evaluating the vent sizing and compared to that of the industrial plants.

  18. Converting of Matter to Nuclear Energy by AB-Generator

    Directory of Open Access Journals (Sweden)

    Alexander Bolonkin


    Full Text Available Problem statement: Researcher offered a new nuclear generator which allowed to convert any matter to nuclear energy in accordance with Einstein equation E = mc2. The method was based upon tapping the energy potential of a Micro Black Hole (MBH and Hawking radiation created by this MBH. Researcher did not meet the idea and its research in literature to develop the method for getting a cheap energy. Approach: As is well-known, vacuum continuously produced virtual pairs of particles and antiparticles, in particular, photons and anti-photons. MBH event horizon allowed separating them. Anti-photons can be moved to MBH and be annihilated, decreasing mass of MBH, resulting photons leave the MBH neighborhood as Hawking radiation. The offered nuclear generator (named by Researcher as AB-generator utilized Hawking radiation and injected the matter into MBH and kept MBH in a stable state with near-constant mass. Results: AB-generator can be produced gigantic energy outputs and should be cheaper than a conventional electric station by a factor of hundreds of times. One also may be used in aerospace as a photon rocket or as a power source for many vehicles. Conclusion: Many scientists expect Large Hadron Collider at CERN may be produced one MBH every second. A technology to capture them may be developed; than they may be used for the AB-generator.

  19. Monte Carlo simulation of AB-copolymers with saturating bonds

    CERN Document Server

    Chertovich, A V; Khokhlov, A R; Bohr, J


    Structural transitions in a single AB-copolymer chain where saturating bonds can be formed between A-and B-units are studied by means of Monte Carlo computer simulations using the bond fluctuation model. Three transitions are found, coil-globule, coil-hairpin and globule-hairpin, depending on the nature of a particular AB-sequence: statistical random sequence, diblock sequence and 'random-complementary' sequence (one-half of such an AB-sequence is random with Bernoulli statistics while the other half is complementary to the first one). The properties of random-complementary sequences are closer to those of diblock sequences than to the properties of random sequences. The model (although quite rough) is expected to represent some basic features of real RNA molecules, i.e. the formation of secondary structure of RNA due to hydrogen bonding of corresponding bases and stacking interactions of the base pairs in helixes. We introduce the notation of RNA-like copolymers and discuss in what sense the sequences studie...

  20. Ab initio multiple cloning algorithm for quantum nonadiabatic molecular dynamics (United States)

    Makhov, Dmitry V.; Glover, William J.; Martinez, Todd J.; Shalashilin, Dmitrii V.


    We present a new algorithm for ab initio quantum nonadiabatic molecular dynamics that combines the best features of ab initio Multiple Spawning (AIMS) and Multiconfigurational Ehrenfest (MCE) methods. In this new method, ab initio multiple cloning (AIMC), the individual trajectory basis functions (TBFs) follow Ehrenfest equations of motion (as in MCE). However, the basis set is expanded (as in AIMS) when these TBFs become sufficiently mixed, preventing prolonged evolution on an averaged potential energy surface. We refer to the expansion of the basis set as "cloning," in analogy to the "spawning" procedure in AIMS. This synthesis of AIMS and MCE allows us to leverage the benefits of mean-field evolution during periods of strong nonadiabatic coupling while simultaneously avoiding mean-field artifacts in Ehrenfest dynamics. We explore the use of time-displaced basis sets, "trains," as a means of expanding the basis set for little cost. We also introduce a new bra-ket averaged Taylor expansion (BAT) to approximate the necessary potential energy and nonadiabatic coupling matrix elements. The BAT approximation avoids the necessity of computing electronic structure information at intermediate points between TBFs, as is usually done in saddle-point approximations used in AIMS. The efficiency of AIMC is demonstrated on the nonradiative decay of the first excited state of ethylene. The AIMC method has been implemented within the AIMS-MOLPRO package, which was extended to include Ehrenfest basis functions.

  1. Ab initio multiple cloning algorithm for quantum nonadiabatic molecular dynamics

    Energy Technology Data Exchange (ETDEWEB)

    Makhov, Dmitry V.; Shalashilin, Dmitrii V. [Department of Chemistry, University of Leeds, Leeds LS2 9JT (United Kingdom); Glover, William J.; Martinez, Todd J. [Department of Chemistry and The PULSE Institute, Stanford University, Stanford, California 94305, USA and SLAC National Accelerator Laboratory, Menlo Park, California 94025 (United States)


    We present a new algorithm for ab initio quantum nonadiabatic molecular dynamics that combines the best features of ab initio Multiple Spawning (AIMS) and Multiconfigurational Ehrenfest (MCE) methods. In this new method, ab initio multiple cloning (AIMC), the individual trajectory basis functions (TBFs) follow Ehrenfest equations of motion (as in MCE). However, the basis set is expanded (as in AIMS) when these TBFs become sufficiently mixed, preventing prolonged evolution on an averaged potential energy surface. We refer to the expansion of the basis set as “cloning,” in analogy to the “spawning” procedure in AIMS. This synthesis of AIMS and MCE allows us to leverage the benefits of mean-field evolution during periods of strong nonadiabatic coupling while simultaneously avoiding mean-field artifacts in Ehrenfest dynamics. We explore the use of time-displaced basis sets, “trains,” as a means of expanding the basis set for little cost. We also introduce a new bra-ket averaged Taylor expansion (BAT) to approximate the necessary potential energy and nonadiabatic coupling matrix elements. The BAT approximation avoids the necessity of computing electronic structure information at intermediate points between TBFs, as is usually done in saddle-point approximations used in AIMS. The efficiency of AIMC is demonstrated on the nonradiative decay of the first excited state of ethylene. The AIMC method has been implemented within the AIMS-MOLPRO package, which was extended to include Ehrenfest basis functions.

  2. A Complete and Accurate Ab Initio Repeat Finding Algorithm. (United States)

    Lian, Shuaibin; Chen, Xinwu; Wang, Peng; Zhang, Xiaoli; Dai, Xianhua


    It has become clear that repetitive sequences have played multiple roles in eukaryotic genome evolution including increasing genetic diversity through mutation, changes in gene expression and facilitating generation of novel genes. However, identification of repetitive elements can be difficult in the ab initio manner. Currently, some classical ab initio tools of finding repeats have already presented and compared. The completeness and accuracy of detecting repeats of them are little pool. To this end, we proposed a new ab initio repeat finding tool, named HashRepeatFinder, which is based on hash index and word counting. Furthermore, we assessed the performances of HashRepeatFinder with other two famous tools, such as RepeatScout and Repeatfinder, in human genome data hg19. The results indicated the following three conclusions: (1) The completeness of HashRepeatFinder is the best one among these three compared tools in almost all chromosomes, especially in chr9 (8 times of RepeatScout, 10 times of Repeatfinder); (2) in terms of detecting large repeats, HashRepeatFinder also performed best in all chromosomes, especially in chr3 (24 times of RepeatScout and 250 times of Repeatfinder) and chr19 (12 times of RepeatScout and 60 times of Repeatfinder); (3) in terms of accuracy, HashRepeatFinder can merge the abundant repeats with high accuracy. PMID:26272474

  3. Ab initio nuclear structure - the large sparse matrix eigenvalue problem

    International Nuclear Information System (INIS)

    The structure and reactions of light nuclei represent fundamental and formidable challenges for microscopic theory based on realistic strong interaction potentials. Several ab initio methods have now emerged that provide nearly exact solutions for some nuclear properties. The ab initio no core shell model (NCSM) and the no core full configuration (NCFC) method, frame this quantum many-particle problem as a large sparse matrix eigenvalue problem where one evaluates the Hamiltonian matrix in a basis space consisting of many-fermion Slater determinants and then solves for a set of the lowest eigenvalues and their associated eigenvectors. The resulting eigenvectors are employed to evaluate a set of experimental quantities to test the underlying potential. For fundamental problems of interest, the matrix dimension often exceeds 1010 and the number of nonzero matrix elements may saturate available storage on present-day leadership class facilities. We survey recent results and advances in solving this large sparse matrix eigenvalue problem. We also outline the challenges that lie ahead for achieving further breakthroughs in fundamental nuclear theory using these ab initio approaches.

  4. Towards hydrogen metallization: an Ab initio approach; Vers la metallisation de l`hydrogene: approche AB initio

    Energy Technology Data Exchange (ETDEWEB)

    Bernard, St


    The quest for metallic hydrogen is a major goal for both theoretical and experimental condensed matter physics. Hydrogen and deuterium have been compressed up to 200 GPa in diamond anvil cells, without any clear evidence for a metallic behaviour. Loubeyere has recently suggested that hydrogen could metallize, at pressures within experimental range, in a new Van der Waals compound: Ar(H{sub 2}){sub 2} which is characterized at ambient pressure by an open and anisotropic sublattice of hydrogen molecules, stabilized by an argon skeleton. This thesis deals with a detailed ab initio investigation, by Car-Parrinello molecular dynamics methods, of the evolution under pressure of this compound. In a last chapter, we go to much higher pressures and temperatures, in order to compare orbital and orbital free ab initio methods for the dense hydrogen plasma. (author) 109 refs.

  5. A ProActive Backend for ABS: from Modelling to Deployment


    Rochas, Justine; Henrio, Ludovic


    ABS is an object-oriented modeling language that is based on a concurrent object group model, derived itself from the active object model. Its goal is to describe distributed and concurrent applications in order to verify their properties and make them safer. Thanks to the ABS Tool Suite, ABS programs can be translated into the Java programming language (among others), and executed in the JVM. This paper presents a new ABS backend that translates ABS programs into ProActive programs. ProActiv...

  6. 40 CFR 174.506 - Bacillus thuringiensis Cry34Ab1 and Cry35Ab1 proteins in corn; exemption from the requirement of... (United States)


    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Bacillus thuringiensis Cry34Ab1 and Cry35Ab1 proteins in corn; exemption from the requirement of a tolerance. 174.506 Section 174.506 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS PROCEDURES AND REQUIREMENTS FOR PLANT-INCORPORATED...

  7. GQ Lup Ab Visible & Near-Infrared Photometric Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Marois, C; Macintosh, B; Barman, T


    We have re-analyzed archival HST R and I band images and Subaru CH{sub 4}, H, Ks and L{prime} data of the recently discovered planetary mass companion (PMC) GQ Lup Ab. With these we produce the first R and I band photometry of the companion and fit a radius and effective temperature using detailed model atmospheres. We find an effective temperature of 2338 {+-} 100K, and a radius of 0.37 {+-} 0.05R{sub {circle_dot}} and luminosity of log(L/L{sub {circle_dot}}) = -2.43 {+-} 0.07 (at 140pc). Since we fit wavelengths that span most of the emitted radiation from GQ Lup this luminosity estimate is robust, with uncertainty dominated by the distance uncertainty. The radius obtained for 140pc (0.37R{sub {circle_dot}}) is significantly larger than the one originally derived. The mass of the object is much more model-dependent than the radiative properties, but for the GAIA dusty models we find a mass between 9-20 M{sub Jup}, in the range of the brown dwarf and PMC deuterium burning boundary. Assuming a distance of 140pc, observations fit to 1{sigma} the Baraffe evolution model for a {approx} 15 M{sub Jup} brown dwarf. Additionally, the F606W photometric band is significantly overluminous compared to model predictions. Such overluminosity could be explained by a bright H{alpha} emission from chromospheric activity, interaction with another undetected companion, or accretion. Assuming that GQ Lup Ab has a bright H{alpha} emission line, its H{alpha} emission strength is 10{sup -1.71 {+-} 0.10} L{sub bol}, significantly larger than field late-type dwarfs. GQ Lup Ab might be strongly accreting and still be in its formation phase.

  8. Ab initio structure determination via powder X-ray diffraction

    Indian Academy of Sciences (India)

    Digamber G Porob; T N Guru Row


    Structure determination by powder X-ray diffraction data has gone through a recent surge since it has become important to get to the structural information of materials which do not yield good quality single crystals. Although the method of structure completion when once the starting model is provided is facile through the Rietveld refinement technique, the structure solution ab initio os still not push-button technology. In this article a survey of the recent development in this area is provided with an illustration of the structure determination of -NaBi3V2O10.

  9. Electrostriction coefficient of ferroelectric materials from ab initio computation

    Directory of Open Access Journals (Sweden)

    Z. Jiang


    Full Text Available Electrostriction is an important material property that characterizes how strain changes with the development of polarization inside a material. We show that ab initio techniques developed in recent years can be exploited to compute and understand electrostriction of ferroelectric materials. Here, electrostriction coefficients of ferroelectric BaTiO3, PbTiO3, as well as dielectric BaZrO3, are obtained and analyzed. Possible causes of the difference between experimental and numerical results are discussed. We also identified that relative displacements between certain ions at a given polarization could be a good indicator of a material’s electrostriction property.

  10. Tailoring magnetoresistance at the atomic level: An ab initio study

    KAUST Repository

    Tao, Kun


    The possibility of manipulating the tunneling magnetoresistance (TMR) of antiferromagnetic nanostructures is predicted in the framework of ab initio calculations. By the example of a junction composed of an antiferromagnetic dimer and a spin-polarized scanning tunneling microscopy tip we show that the TMR can be tuned and even reversed in sign by lateral and vertical movements of the tip. Moreover, our finite-bias calculations demonstrate that the magnitude and the sign of the TMR can also be tuned by an external voltage. © 2012 American Physical Society.

  11. Magnetoband structures of AB-stacked zigzag nanographite ribbons

    Energy Technology Data Exchange (ETDEWEB)

    Chang, C.P.; Chiu, C.W.; Shyu, F.L.; Chen, R.B.; Lin, M.F


    Magnetoband structures of AB-stacked zigzag nanographite ribbons are studied by the tight-binding model. The magnetic field changes band width, energy space, and energy dispersions (the produce of Landau subbands and Landau levels). It causes many zero energy points. Such points and corresponding localized states are studied in detail. There are certain important differences between localized states and edge states. Oscillation period of Landau subbands are determined by these points. The interribbon interactions also affect magnetoband structures, such as energy dispersions, band width, oscillation period of Landau subbands, and flux dependence of Hofstadter butterflies.

  12. Ab initio study of neutron drops with chiral Hamiltonians

    Directory of Open Access Journals (Sweden)

    H.D. Potter


    Full Text Available We report ab initio calculations for neutron drops in a 10 MeV external harmonic-oscillator trap using chiral nucleon–nucleon plus three-nucleon interactions. We present total binding energies, internal energies, radii and odd–even energy differences for neutron numbers N=2–18 using the no-core shell model with and without importance truncation. Furthermore, we present total binding energies for N=8,16,20,28,40,50 obtained in a coupled-cluster approach. Comparisons with quantum Monte Carlo results, where available, using Argonne v8′ with three-nucleon interactions reveal important dependences on the chosen Hamiltonian.

  13. Accelerating ab initio molecular dynamics simulations by linear prediction methods (United States)

    Herr, Jonathan D.; Steele, Ryan P.


    Acceleration of ab initio molecular dynamics (AIMD) simulations can be reliably achieved by extrapolation of electronic data from previous timesteps. Existing techniques utilize polynomial least-squares regression to fit previous steps' Fock or density matrix elements. In this work, the recursive Burg 'linear prediction' technique is shown to be a viable alternative to polynomial regression, and the extrapolation-predicted Fock matrix elements were three orders of magnitude closer to converged elements. Accelerations of 1.8-3.4× were observed in test systems, and in all cases, linear prediction outperformed polynomial extrapolation. Importantly, these accelerations were achieved without reducing the MD integration timestep.

  14. Equations of state of heavy metals: ab initio approaches

    International Nuclear Information System (INIS)

    The determination of equations of states of heavy metals through ab initio calculation, i.e. without any adjustable parameter, allows to access to pressure and temperature thermodynamic conditions sometimes inaccessible to experiment. To perform such calculations, density functional theory (DFT) is a good starting point: when electronic densities are homogeneous enough, the local density approximation (LDA) remarkably accounts for thermodynamic properties of heavy metals, such as tantalum, or the light actinides, as well for static properties - equilibrium volume, elastic constants - as for dynamical quantities like phonon spectra. For heavier elements, like neptunium or plutonium, relativistic effects and strong electronic interactions must be taken into account, which requires more sophisticated theoretical approaches. (authors)

  15. Ab initio calculations and modelling of atomic cluster structure

    DEFF Research Database (Denmark)

    Solov'yov, Ilia; Lyalin, Andrey G.; Solov'yov, Andrey V.;


    The optimized structure and electronic properties of small sodium and magnesium clusters have been investigated using it ab initio theoretical methods based on density-functional theory and post-Hartree-Fock many-body perturbation theory accounting for all electrons in the system. A new theoretical...... framework for modelling the fusion process of noble gas clusters is presented. We report the striking correspondence of the peaks in the experimentally measured abundance mass spectra with the peaks in the size-dependence of the second derivative of the binding energy per atom calculated for the chain...... of the noble gas clusters up to 150 atoms....

  16. Ab initio Study of He Stability in hcp-Ti

    Institute of Scientific and Technical Information of China (English)

    DAI Yun-Ya; YANG Li; PENG Shu-Ming; LONG Xing-Gui; GAO Fei; ZU Xiao-Tao


    @@ The stability of He in hcp-Ti is studied using the ab initio method based on the density functional theory.The results indicate that a single He atom prefers to occupy the tetrahedral site rather than the octahedral site.The interaction of He defects with Ti atoms is employed to explain the relative stabilities of He point defects in hcp-Ti.The relative stability of He defects in hcp-Ti is useful for He clustering and bubble nucleation in metal tritides,which provides the basis for development of improved atomistic models.

  17. Polymeric nitrogen in a graphene matrix: An ab initio study (United States)

    Timoshevskii, V.; Ji, Wei; Abou-Rachid, Hakima; Lussier, Louis-Simon; Guo, H.


    A hybrid material where polymeric nitrogen chains are sandwiched between graphene sheets in the form of a three-dimensional crystal, is predicted by means of ab initio simulations. It is demonstrated that chainlike polymeric nitrogen phase becomes stable at ambient pressure when intercalated in a multilayer graphene matrix. The physical origin of this stabilization is identified by studying the electronic properties of the system. This approach of stabilizing polymeric nitrogen by means of external three-dimensional matrix constitutes a path toward synthesizing different types of nitrogen-based high-energy materials.

  18. Ab-initio study of transition metal hydrides

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, Ramesh [Dept. of Physics, Feroze Gandhi Insititute of Engineering and Technology, Raebareli-229001 (India); Shukla, Seema, E-mail:; Dwivedi, Shalini, E-mail:; Sharma, Yamini, E-mail: [Theoretical Condensed Matter Physics Laboratory, Dept. of Physics Feroze Gandhi College, Raebareli-229001 (India)


    We have performed ab initio self consistent calculations based on Full potential linearized augmented plane wave (FP-LAPW) method to investigate the optical and thermal properties of yttrium hydrides. From the band structure and density of states, the optical absorption spectra and specific heats have been calculated. The band structure of Yttrium metal changes dramatically due to hybridization of Y sp orbitals with H s orbitals and there is a net charge transfer from metal to hydrogen site. The electrical resistivity and specific heats of yttrium hydrides are lowered but the thermal conductivity is slightly enhanced due to increase in scattering from hydrogen sites.

  19. Ab initio study of phase equilibria in TiCx

    DEFF Research Database (Denmark)

    Korzhavyi, P.A.; Pourovskii, L.V.; Hugosson, H.W.;


    The phase diagram for the vacancy-ordered structures in the substoichiometric TiCx (x = 0.5-1.0) has been established from Monte Carlo simulations with the long-range pair and multisite effective interactions obtained from ab initio calculations. Three ordered superstructures of vacancies (Ti2C, Ti......3C2, and Ti6C5) are found to be ground state configurations. Their stability has been verified by full-potential total energy calculations of the fully relaxed structures....

  20. Accelerating Ab Initio Nuclear Physics Calculations with GPUs

    CERN Document Server

    Potter, Hugh; Maris, Pieter; Sosonkina, Masha; Vary, James; Binder, Sven; Calci, Angelo; Langhammer, Joachim; Roth, Robert; Çatalyürek, Ümit; Saule, Erik


    This paper describes some applications of GPU acceleration in ab initio nuclear structure calculations. Specifically, we discuss GPU acceleration of the software package MFDn, a parallel nuclear structure eigensolver. We modify the matrix construction stage to run partly on the GPU. On the Titan supercomputer at the Oak Ridge Leadership Computing Facility, this produces a speedup of approximately 2.2x - 2.7x for the matrix construction stage and 1.2x - 1.4x for the entire run.

  1. Pharmacokinetics of radioimmunotherapeutic agent of direct labeling mAb 188Re-HAb18

    Institute of Scientific and Technical Information of China (English)

    Chao Lou; Zhi-Nan Chen; Hui-Jie Bian; Jie Li; Shou-Bo Zhou


    AIM: To labed Anti-hepatoma monoclonal antibody (mAb)fragment HAb18 F (ab')2 was labeled with 188 Re for thepharmacokinetic model of 188 Re-HAb18 F (ab')2 and toevaluate its pharmacokinetic parameters in hepatoma-bearing nude mice.METHODS: HAb18 F(ab')2 was directly labeled with 188Reusing 2-mercaptoethanol (2-ME) as reducing agents.Labeling efficiency and immunoreactivity of 188 Re-HAb18 F( ab')2 were evaluated by Whatman 3MM paperchromatography and live cell assay, respectively.Biodiatribution analysis was also conducted in nude micebearing human hepatoma in which animals were sacrificed atdifferent time points(1, 4, 18, 24 and 24h) after 188Re-HAb18F(ab' )2 was injected through tail-vein into hepatoma-bearingnude mice. The blood and radioactivity of organs and masswere measured. The concentrations of 188 Re-HAb18 F(ab')2were evaluated with a pharmacokinetic 3P97 software.RESULTS: The optimum labeling efficiency andimmunoreactive fraction were 91.7% and 0.78%,respectively. The parameters of 188Re-HAb18 F(ab')2 were:T1/2, 2.29h; Vd, 1.49 × 10-9L@ Bq- 1; AUC, 20.49 × 109Bq@ h@L-1 ;CL, 0.45 × 10-3L@ h- 1. 188Re- HAb18 F(ab')2 could locatespecially in hepatoma with high selective reactivity of HAb18F(ab')2. 188 Re-HAb18 F(ab')2 was mainly eliminated bykidney. The maximal tumor to blood ratio was at 48h, andmaximal tumor to liver ratio was at 18h.CONCLUTION: The pharmacokinetics of 188Re-HAb18 F(ab')2fit a I-compartment model. 188 Re-HAb18 F(ab')2 can beuptaken selectively at the hepatoma site.

  2. Electrocatalytic reduction of nitrate and selenate by NapAB. (United States)

    Gates, Andrew J; Butler, Clive S; Richardson, David J; Butt, Julea N


    Bacterial cellular metabolism is renowned for its metabolic diversity and adaptability. However, certain environments present particular challenges. Aerobic metabolism of highly reduced carbon substrates by soil bacteria such as Paracoccus pantotrophus presents one such challenge since it may result in excessive electron delivery to the respiratory redox chain when compared with the availability of terminal oxidant, O2. The level of a periplasmic ubiquinol-dependent nitrate reductase, NAP, is up-regulated in the presence of highly reduced carbon substrates. NAP oxidizes ubiquinol at the periplasmic face of the cytoplasmic membrane and reduces nitrate in the periplasm. Thus its activity counteracts the accumulation of excess reducing equivalents in ubiquinol, thereby maintaining the redox poise of the ubiquinone/ubiquinol pool without contributing to the protonmotive force across the cytoplasmic membrane. Although P. pantotrophus NapAB shows a high level of substrate specificity towards nitrate, the enzyme has also been reported to reduce selenate in spectrophotometric solution assays. This transaction draws on our current knowledge concerning the bacterial respiratory nitrate reductases and extends the application of PFE (protein film electrochemistry) to resolve and quantify the selenate reductase activity of NapAB. PMID:21265780

  3. Ab Initio Protein Structure Prediction Using Pathway Models

    Directory of Open Access Journals (Sweden)

    Christopher Bystroff


    Full Text Available Ab initio prediction is the challenging attempt to predict protein structures based only on sequence information and without using templates. It is often divided into two distinct sub-problems: (a the scoring function that can distinguish native, or native-like structures, from non-native ones; and (b the method of searching the conformational space. Currently, there is no reliable scoring function that can always drive a search to the native fold, and there is no general search method that can guarantee a significant sampling of near-natives. Pathway models combine the scoring function and the search. In this short review, we explore some of the ways pathway models are used in folding, in published works since 2001, and present a new pathway model, HMMSTR-CM, that uses a fragment library and a set of nucleation/propagation-based rules. The new method was used for ab initio predictions as part of CASP5. This work was presented at the Winter School in Bioinformatics, Bologna, Italy, 10–14 February 2003.

  4. Ab initio dynamics of the cytochrome P450 hydroxylation reaction

    Energy Technology Data Exchange (ETDEWEB)

    Elenewski, Justin E.; Hackett, John C, E-mail: [Department of Physiology and Biophysics and The Massey Cancer Center, School of Medicine, Virginia Commonwealth University, 401 College Street, Richmond, Virginia 23219-1540 (United States)


    The iron(IV)-oxo porphyrin π-cation radical known as Compound I is the primary oxidant within the cytochromes P450, allowing these enzymes to affect the substrate hydroxylation. In the course of this reaction, a hydrogen atom is abstracted from the substrate to generate hydroxyiron(IV) porphyrin and a substrate-centered radical. The hydroxy radical then rebounds from the iron to the substrate, yielding the hydroxylated product. While Compound I has succumbed to theoretical and spectroscopic characterization, the associated hydroxyiron species is elusive as a consequence of its very short lifetime, for which there are no quantitative estimates. To ascertain the physical mechanism underlying substrate hydroxylation and probe this timescale, ab initio molecular dynamics simulations and free energy calculations are performed for a model of Compound I catalysis. Semiclassical estimates based on these calculations reveal the hydrogen atom abstraction step to be extremely fast, kinetically comparable to enzymes such as carbonic anhydrase. Using an ensemble of ab initio simulations, the resultant hydroxyiron species is found to have a similarly short lifetime, ranging between 300 fs and 3600 fs, putatively depending on the enzyme active site architecture. The addition of tunneling corrections to these rates suggests a strong contribution from nuclear quantum effects, which should accelerate every step of substrate hydroxylation by an order of magnitude. These observations have strong implications for the detection of individual hydroxylation intermediates during P450 catalysis.

  5. Unified ab initio approaches to nuclear structure and reactions (United States)

    Navrátil, Petr; Quaglioni, Sofia; Hupin, Guillaume; Romero-Redondo, Carolina; Calci, Angelo


    The description of nuclei starting from the constituent nucleons and the realistic interactions among them has been a long-standing goal in nuclear physics. In addition to the complex nature of the nuclear forces, with two-, three- and possibly higher many-nucleon components, one faces the quantum-mechanical many-nucleon problem governed by an interplay between bound and continuum states. In recent years, significant progress has been made in ab initio nuclear structure and reaction calculations based on input from QCD-employing Hamiltonians constructed within chiral effective field theory. After a brief overview of the field, we focus on ab initio many-body approaches—built upon the no-core shell model—that are capable of simultaneously describing both bound and scattering nuclear states, and present results for resonances in light nuclei, reactions important for astrophysics and fusion research. In particular, we review recent calculations of resonances in the 6He halo nucleus, of five- and six-nucleon scattering, and an investigation of the role of chiral three-nucleon interactions in the structure of 9Be. Further, we discuss applications to the 7Be {({{p}},γ )}8{{B}} radiative capture. Finally, we highlight our efforts to describe transfer reactions including the 3H{({{d}},{{n}})}4He fusion.

  6. Three-cluster dynamics within an ab initio framework

    CERN Document Server

    Quaglioni, S; Navrátil, P


    We introduce a fully antisymmetrized treatment of three-cluster dynamics within the ab initio framework of the no-core shell model/resonating-group method (NCSM/RGM). Energy-independent non-local interactions among the three nuclear fragments are obtained from realistic nucleon-nucleon interactions and consistent ab initio many-body wave functions of the clusters. The three-cluster Schr\\"odinger equation is solved with bound-state boundary conditions by means of the hyperspherical-harmonic method on a Lagrange mesh. We discuss the formalism in detail and give algebraic expressions for systems of two single nucleons plus a nucleus. Using a soft similarity-renormalization-group evolved chiral nucleon-nucleon potential, we apply the method to an $^4$He+$n+n$ description of $^6$He and compare the results to experiment and to a six-body diagonalization of the Hamiltonian performed within the harmonic-oscillator expansions of the NCSM. Differences between the two calculations provide a measure of core ($^4$He) pola...


    International Nuclear Information System (INIS)

    We determine basic thermodynamic and transport properties of hydrogen-helium-water mixtures for the extreme conditions along Jupiter's adiabat via ab initio simulations, which are compiled in an accurate and consistent data set. In particular, we calculate the electrical and thermal conductivity, the shear and longitudinal viscosity, and diffusion coefficients of the nuclei. We present results for associated quantities like the magnetic and thermal diffusivity and the kinematic shear viscosity along an adiabat that is taken from a state-of-the-art interior structure model. Furthermore, the heat capacities, the thermal expansion coefficient, the isothermal compressibility, the Grüneisen parameter, and the speed of sound are calculated. We find that the onset of dissociation and ionization of hydrogen at about 0.9 Jupiter radii marks a region where the material properties change drastically. In the deep interior, where the electrons are degenerate, many of the material properties remain relatively constant. Our ab initio data will serve as a robust foundation for applications that require accurate knowledge of the material properties in Jupiter's interior, e.g., models for the dynamo generation.

  8. Ab initio and kinetic modeling studies of formic acid oxidation

    DEFF Research Database (Denmark)

    Marshall, Paul; Glarborg, Peter


    A detailed chemical kinetic model for oxidation of formic acid (HOCHO) in flames has been developed, based on theoretical work and data from literature. Ab initio calculations were used to obtain rate coefficients for reactions of HOCHO with H, O, and HO2. Modeling predictions with the mechanism ...... as the fate of HOCO, determines the oxidation rate of formic acid. At lower temperatures HO2, formed from HOCO + O2, is an important chain carrier and modeling predictions become sensitive to the HOCHO + HO2 reaction. © 2014 The Combustion Institute.......A detailed chemical kinetic model for oxidation of formic acid (HOCHO) in flames has been developed, based on theoretical work and data from literature. Ab initio calculations were used to obtain rate coefficients for reactions of HOCHO with H, O, and HO2. Modeling predictions with the mechanism...... on calculations with the kinetic model. Formic acid is consumed mainly by reaction with OH, yielding OCHO, which dissociates rapidly to CO2 + H, and HOCO, which may dissociate to CO + OH or CO2 + H, or react with H, OH, or O2 to form more stable products. The branching fraction of the HOCHO + OH reaction, as well...

  9. Unified ab initio approaches to nuclear structure and reactions

    CERN Document Server

    Navratil, Petr; Hupin, Guillaume; Romero-Redondo, Carolina; Calci, Angelo


    The description of nuclei starting from the constituent nucleons and the realistic interactions among them has been a long-standing goal in nuclear physics. In addition to the complex nature of the nuclear forces, with two-, three- and possibly higher many-nucleon components, one faces the quantum-mechanical many-nucleon problem governed by an interplay between bound and continuum states. In recent years, significant progress has been made in {\\em ab initio} nuclear structure and reaction calculations based on input from QCD-employing Hamiltonians constructed within chiral effective field theory. After a brief overview of the field, we focus on ab initio many-body approaches - built upon the No-Core Shell Model - that are capable of simultaneously describing both bound and scattering nuclear states, and present results for resonances in light nuclei, reactions important for astrophysics and fusion research. In particular, we review recent calculations of resonances in the $^6$He halo nucleus, of five- and six...

  10. Effect of gamma irradiation on nutritional components and Cry1Ab protein in the transgenic rice with a synthetic cry1Ab gene from Bacillus thuringiensis[Transgenic rice; Gamma irradiation; Nutritional components; Cry1Ab protein

    Energy Technology Data Exchange (ETDEWEB)

    Wu Dianxing E-mail:; Ye Qingfu; Wang Zhonghua; Xia Yingwu


    The effects of gamma irradiation on the transgenic rice containing a synthetic cry1Ab gene from Bacillus thuringiensis were investigated. There was almost no difference in the content of the major nutritional components, i.e. crude protein, crude lipid, eight essential amino acids and total ash between the irradiated grains and the non-irradiated transgenic rice. However, the amounts of Cry1Ab protein and apparent amylose in the irradiated transgenic rice were reduced significantly by the doses higher than 200 Gy. In vivo observation showed that Cry1Ab protein contents also decreased in the fresh leaf tissues of survival seedlings after irradiation with 200 Gy or higher doses and showed inhibition of seedling growth. The results indicate that gamma irradiation might improve the quality of transgenic rice due to removal of the toxic Cry1Ab protein.

  11. Cry1Ab protein from Bacillus thuringiensis and MON810 cry1Ab-transgenic maize exerts no adjuvant effect after airway exposure. (United States)

    Andreassen, M; Bøhn, T; Wikmark, O-G; Van den Berg, J; Løvik, M; Traavik, T; Nygaard, U C


    The genetically modified (GM) maize event MON810 has been inserted with a processed version of the transgene, cry1Ab, derived from the soil bacterium Bacillus thuringiensis (Bt) to express proteins with insecticidal properties. Such proteins may introduce new allergens and also act as adjuvants that promote allergic responses. While focus has been on safe consumption and hence the oral exposure to GM food and feed, little is known regarding inhalation of pollen and desiccated airborne plant material from GM crops. The aim of this study was to investigate whether plant material from the Cry1Ab-expressing maize variety MON810, or trypsin-activated Cry1Ab (trypCry1Ab) protein produced in recombinant bacteria, may act as adjuvants against the allergen ovalbumin (OVA) in a mouse model of airway allergy. A clear proallergic adjuvant effect of the mucosal adjuvant cholera toxin (CT) was demonstrated, determined as increased specific IgE, eosinophils and Th2 cytokines in MLN cell supernates, while no elevation in OVA-specific antibodies or cytokine release from MLN cells after stimulation with OVA were observed in mice receiving Cry1Ab-containing plant materials or the trypCry1Ab protein. Our data suggest that Cry1Ab proteins had no detectable systemic adjuvant effect in mice after airway exposure. Further experiments with purified plant proteins, as well as long-term exposures needs be conducted to further evaluate exposures experienced in real-life situations. PMID:25564738

  12. Living with an imperfect cell wall: compensation of femAB inactivation in Staphylococcus aureus.


    Bierbaum Gabriele; Harris Llinos G; Majcherczyk Paul A; Schäfer Juliane; Kotte Oliver; Jansen Andrea; Hübscher Judith; Heinemann Matthias; Berger-Bächi Brigitte


    Abstract Background Synthesis of the Staphylococcus aureus peptidoglycan pentaglycine interpeptide bridge is catalyzed by the nonribosomal peptidyl transferases FemX, FemA and FemB. Inactivation of the femAB operon reduces the interpeptide to a monoglycine, leading to a poorly crosslinked peptidoglycan. femAB mutants show a reduced growth rate and are hypersusceptible to virtually all antibiotics, including methicillin, making FemAB a potential target to restore β-lactam susceptibility in met...

  13. Performance of the Molecular Alere i Influenza A&B Test Compared to That of the Xpert Flu A/B Assay


    Chapin, Kimberle C.; Flores-Cortez, Estefany J.


    Data on the performance of rapid molecular point-of-care use platforms for diagnosis of influenza are lacking. We validated nasopharyngeal (NP) flocked specimens in universal transport medium (UTM) and evaluated the clinical sensitivity and specificity of the Alere i influenza A&B test compared to those of the Xpert flu A/B assay. The Alere i influenza A&B test had an overall sensitivity and specificity of 93.8% and 62.5% for influenza A, respectively, and of 91.8% and 53.6% for influenza B, ...

  14. Effect of Rapid Quenching on Electrochemical Properties of AB5 and AB3.5-Type Hydrogen Storage Alloys

    Institute of Scientific and Technical Information of China (English)

    Li Ping; Zheng Xueping; An Fuqiang; Islam S. Humail; Qu Xuanhui


    Effect of rapid quenching on the electrochemical properties of AB5 and AB3.5-type hydrogen storage alloys was studied. The results indicated that the discharge capacities of the rapid quenching MmNi3.55 Co0.75 Mn0.4Al0.3 alloys decrease under 25 and -35℃ with the increase of the quenching rate. Comparatively, the decrease extent of the quenching alloys at -35℃ is lower than that at 25℃. The result on the study of the cycle life indicated that the quenching process was favorable to improve the cycle stabilities of the MmNi3.55Co0.75-Mn0.4Al0.3alloys under 25 and -35℃. Whereas, the effect of the quenching process on the La0.7Mg0.3(Ni0.85Co0.15)3.5 alloy was different at 25℃ from at -35℃. Under 25℃, the cycle life of the alloy was obviously improved by the quenching process, however, the quenching process did not improve but decreased slightly the cycle life at -35℃.

  15. Effect of Flame Retardant Containing Phosphorus and Silicone on Thermal Performance of PC/ABS

    Institute of Scientific and Technical Information of China (English)

    WEI Ping; WU Dan; ZHONG Hanfang; DU Jianxin


    A flame retardant (DPA-SiN) containing phosphorus, nitrogen and silicon elements was synthesized. The halogen free flame retardant was incorporated into PC/ABS to improve its flame retardancy. The flame-retardant properties of the PC/ABS/DPA-SiN blends were estimated bylimiting oxygen index (LOI) values and CONE Calorimeter, while thermal stabilities were investi-gated through thermo gravimetric analysis (TGA). The PC/ABS/DPA-SiN blends were thermally de-graded at 400 ℃ for different amounts of time and studied by Fourier transform infrared spectros-copy (FTIR) to better understand the degradation behavior of PC/ABS/DPA-SiN.

  16. Adsorption of insecticidal Cry1Ab protein to humic substances. 1. Experimental approach and mechanistic aspects. (United States)

    Sander, Michael; Tomaszewski, Jeanne E; Madliger, Michael; Schwarzenbach, René P


    Adsorption is a key process affecting the fate of insecticidal Cry proteins (Bt toxins), produced by genetically modified Bt crops, in soils. However, the mechanisms of adsorption to soil organic matter (SOM) remain poorly understood. This work assesses the forces driving the adsorption of Cry1Ab to Leonardite humic acid (LHA), used as a model for SOM. We studied the effects of solution pH and ionic strength (I) on adsorption using a quartz crystal microbalance with dissipation monitoring and optical waveguide lightmode spectroscopy. Initial Cry1Ab adsorption rates were close to diffusion-limited and resulted in extensive adsorption, even at pH >6, at which LHA and Cry1Ab carry negative net charges. Adsorption increased with decreasing I at pH >6, indicating Cry1Ab-LHA patch-controlled electrostatic attraction via positively charged domains of Cry1Ab. Upon rinsing, only a fraction of Cry1Ab desorbed, suggesting a range of interaction energies of Cry1Ab with LHA. Different interaction energies likely resulted from nonuniformity in the LHA surface polarity, with higher Cry1Ab affinities to more apolar LHA regions due to the hydrophobic effect. Contributions from the hydrophobic effect were substantiated by comparison of the adsorption of Cry1Ab and the reference proteins albumin and lysozyme to LHA and to apolar and polar model surfaces. PMID:22862304

  17. Comparative Study of Electroless Copper Film on Different Self-Assembled Monolayers Modified ABS Substrate

    Directory of Open Access Journals (Sweden)

    Jiushuai Xu


    Full Text Available Copper films were grown on (3-Mercaptopropyltrimethoxysilane (MPTMS, (3-Aminopropyltriethoxysilane (APTES and 6-(3-(triethoxysilylpropylamino-1,3,5- triazine-2,4-dithiol monosodium (TES self-assembled monolayers (SAMs modified acrylonitrile-butadiene-styrene (ABS substrate via electroless copper plating. The copper films were examined using scanning electron microscopy (SEM and X-ray diffraction (XRD. Their individual deposition rate and contact angle were also investigated to compare the properties of SAMs and electroless copper films. The results indicated that the formation of copper nuclei on the TES-SAMs modified ABS substrate was faster than those on the MPTMS-SAMs and APTES-SAMs modified ABS substrate. SEM images revealed that the copper film on TES-SAM modified ABS substrate was smooth and uniform, and the density of copper nuclei was much higher. Compared with that of TES-SAMs modified resin, the coverage of copper nuclei on MPTMS and APTES modified ABS substrate was very limited and the copper particle size was too big. The adhesion property test demonstrated that all the SAMs enhanced the interfacial interaction between copper plating and ABS substrate. XRD analysis showed that the copper film deposited on SAM-modified ABS substrate had a structure with Cu(111 preferred orientation, and the copper film deposited on TES-SAMs modified ABS substrate is better than that deposited on MPTMS-SAMs or APTES-SAMs modified ABS resins in electromigrtion resistance.

  18. Internetmarknadsföring inom turismen : Case Esbo Turism Ab


    Gothoni, Jenny


    I detta arbetet behandlas kundförnöjsamheten med Esbo Turism Abs hemsidor, och ifall dessa kan förbättras ytterligare. Teorin baserar sig mycket på marknadsföring samt kundens beteende och behov, internetsidor samt kvalitet och segmentering. Undersökningen har genomförts med hjälp av webbenkäter och litet djupare e-post intervjuer under våren 2010. I undersökningen deltog 30 personer i enkäterna och tre stycken i intervjuerna. Störst svarskvot bildades av 15-25 åringar från Helsingfors. ...

  19. The ab-initio density matrix renormalization group in practice

    Energy Technology Data Exchange (ETDEWEB)

    Olivares-Amaya, Roberto; Hu, Weifeng; Sharma, Sandeep; Yang, Jun; Chan, Garnet Kin-Lic [Department of Chemistry, Princeton University, Princeton, New Jersey 08544 (United States); Nakatani, Naoki [Department of Chemistry, Princeton University, Princeton, New Jersey 08544 (United States); Catalysis Research Center, Hokkaido University, Kita 21 Nishi 10, Sapporo, Hokkaido 001-0021 (Japan)


    The ab-initio density matrix renormalization group (DMRG) is a tool that can be applied to a wide variety of interesting problems in quantum chemistry. Here, we examine the density matrix renormalization group from the vantage point of the quantum chemistry user. What kinds of problems is the DMRG well-suited to? What are the largest systems that can be treated at practical cost? What sort of accuracies can be obtained, and how do we reason about the computational difficulty in different molecules? By examining a diverse benchmark set of molecules: π-electron systems, benchmark main-group and transition metal dimers, and the Mn-oxo-salen and Fe-porphine organometallic compounds, we provide some answers to these questions, and show how the density matrix renormalization group is used in practice.

  20. Ab initio study of the transition-metal carbene cations

    Institute of Scientific and Technical Information of China (English)

    李吉海; 冯大诚; 冯圣玉


    The geometries and bonding characteristics of the first-row transition-metal carbene cations MCH2+ were investigated by ab initio molecular orbital theory (HF/LANL2DZ). All of MCH2+ are coplanar. In the closed shell structures the C bonds to M with double bonds; while in the open shell structures the partial double bonds are formed, because one of the σ and π orbitals is singly occupied. It is mainly the π-type overlap between the 2px orbital of C and 4px, 3dxz, orbitals of M+ that forms the π orbitals. The dissociation energies of C—M bond appear in periodic trend from Sc to Cu. Most of the calculated bond dissociation energies are close to the experimental ones.

  1. High-throughput ab-initio dilute solute diffusion database. (United States)

    Wu, Henry; Mayeshiba, Tam; Morgan, Dane


    We demonstrate automated generation of diffusion databases from high-throughput density functional theory (DFT) calculations. A total of more than 230 dilute solute diffusion systems in Mg, Al, Cu, Ni, Pd, and Pt host lattices have been determined using multi-frequency diffusion models. We apply a correction method for solute diffusion in alloys using experimental and simulated values of host self-diffusivity. We find good agreement with experimental solute diffusion data, obtaining a weighted activation barrier RMS error of 0.176 eV when excluding magnetic solutes in non-magnetic alloys. The compiled database is the largest collection of consistently calculated ab-initio solute diffusion data in the world. PMID:27434308

  2. Transport coefficients in diamond from ab-initio calculations (United States)

    Löfâs, Henrik; Grigoriev, Anton; Isberg, Jan; Ahuja, Rajeev


    By combining the Boltzmann transport equation with ab-initio electronic structure calculations, we obtain transport coefficients for boron-doped diamond. We find the temperature dependence of the resistivity and the hall coefficients in good agreement with experimental measurements. Doping in the samples is treated via the rigid band approximation and scattering is treated in the relaxation time approximation. In contrast to previous results, the acoustic phonon scattering is the dominating scattering mechanism for the considered doping range. At room temperature, we find the thermopower, S, in the range 1-1.6 mV/K and the power factor, S2σ, in the range 0.004-0.16 μW /cm K2.

  3. Efficient Ab initio Modeling of Random Multicomponent Alloys. (United States)

    Jiang, Chao; Uberuaga, Blas P


    We present in this Letter a novel small set of ordered structures (SSOS) method that allows extremely efficient ab initio modeling of random multicomponent alloys. Using inverse II-III spinel oxides and equiatomic quinary bcc (so-called high entropy) alloys as examples, we demonstrate that a SSOS can achieve the same accuracy as a large supercell or a well-converged cluster expansion, but with significantly reduced computational cost. In particular, because of this efficiency, a large number of quinary alloy compositions can be quickly screened, leading to the identification of several new possible high-entropy alloy chemistries. The SSOS method developed here can be broadly useful for the rapid computational design of multicomponent materials, especially those with a large number of alloying elements, a challenging problem for other approaches. PMID:27015491

  4. Efficient Ab initio Modeling of Random Multicomponent Alloys (United States)

    Jiang, Chao; Uberuaga, Blas P.


    We present in this Letter a novel small set of ordered structures (SSOS) method that allows extremely efficient ab initio modeling of random multicomponent alloys. Using inverse II-III spinel oxides and equiatomic quinary bcc (so-called high entropy) alloys as examples, we demonstrate that a SSOS can achieve the same accuracy as a large supercell or a well-converged cluster expansion, but with significantly reduced computational cost. In particular, because of this efficiency, a large number of quinary alloy compositions can be quickly screened, leading to the identification of several new possible high-entropy alloy chemistries. The SSOS method developed here can be broadly useful for the rapid computational design of multicomponent materials, especially those with a large number of alloying elements, a challenging problem for other approaches.

  5. Ab initio electronic structure and optical conductivity of bismuth tellurohalides

    CERN Document Server

    Schwalbe, Sebastian; Starke, Ronald; Schober, Giulio A H; Kortus, Jens


    We investigate the electronic structure, dielectric and optical properties of bismuth tellurohalides BiTeX (X = I, Cl, Br) by means of all-electron density functional theory. In particular, we present the ab initio conductivities and dielectric tensors calculated over a wide frequency range, and compare our results with the recent measurements by Akrap et al. , Makhnev et al. , and Rusinov et al. . We show how the low-frequency branch of the optical conductivity can be used to identify characteristic intra- and interband transitions between the Rashba spin-split bands in all three bismuth tellurohalides. We further calculate the refractive indices and dielectric constants, which in turn are systematically compared to previous predictions and measurements. We expect that our quantitative analysis will contribute to the general assessment of bulk Rashba materials for their potential use in spintronics devices.

  6. Ab initio H2O in realistic hydrophilic confinement. (United States)

    Allolio, Christoph; Klameth, Felix; Vogel, Michael; Sebastiani, Daniel


    A protocol for the ab initio construction of a realistic cylindrical pore in amorphous silica, serving as a geometric nanoscale confinement for liquids and solutions, is presented. Upon filling the pore with liquid water at different densities, the structure and dynamics of the liquid inside the confinement can be characterized. At high density, the pore introduces long-range oscillations into the water density profile, which makes the water structure unlike that of the bulk across the entire pore. The tetrahedral structure of water is also affected up to the second solvation shell of the pore wall. Furthermore, the effects of the confinement on hydrogen bonding and diffusion, resulting in a weakening and distortion of the water structure at the pore walls and a slowdown in diffusion, are characterized. PMID:25208765

  7. Quantum plasmonics: from jellium models to ab initio calculations

    Directory of Open Access Journals (Sweden)

    Varas Alejandro


    Full Text Available Light-matter interaction in plasmonic nanostructures is often treated within the realm of classical optics. However, recent experimental findings show the need to go beyond the classical models to explain and predict the plasmonic response at the nanoscale. A prototypical system is a nanoparticle dimer, extensively studied using both classical and quantum prescriptions. However, only very recently, fully ab initio time-dependent density functional theory (TDDFT calculations of the optical response of these dimers have been carried out. Here, we review the recent work on the impact of the atomic structure on the optical properties of such systems. We show that TDDFT can be an invaluable tool to simulate the time evolution of plasmonic modes, providing fundamental understanding into the underlying microscopical mechanisms.

  8. Highly anisotropic thermal conductivity of arsenene: An ab initio study (United States)

    Zeraati, Majid; Vaez Allaei, S. Mehdi; Abdolhosseini Sarsari, I.; Pourfath, Mahdi; Donadio, Davide


    Elemental two-dimensional (2D) materials exhibit intriguing heat transport and phononic properties. Here we have investigated the lattice thermal conductivity of newly proposed arsenene, the 2D honeycomb structure of arsenic, using ab initio calculations. Solving the Boltzmann transport equation for phonons, we predict a highly anisotropic thermal conductivity of 30.4 and 7.8 W/mK along the zigzag and armchair directions, respectively, at room temperature. Our calculations reveal that phonons with mean free paths between 20 nm and 1 μ m provide the main contribution to the large thermal conductivity in the zigzag direction; mean free paths of phonons contributing to heat transport in the armchair directions range between 20 and 100 nm. The obtained anisotropic thermal conductivity and feasibility of synthesis, in addition to high electron mobility reported elsewhere, make arsenene a promising material for nanoelectronic applications and thermal management.

  9. Molecular ion LiHe+: ab initio study

    International Nuclear Information System (INIS)

    Highlights: ► Excited electronic states of LiHe+ are studied. ► Potential energy curves of thirteen states are calculated. ► Dipole moment and transition dipole moment functions are determined. ► Basic spectroscopic properties of the electronic states are derived. - Abstract: High level ab initio calculations are performed on the molecular ion LiHe+. Potential energy curves for the low-lying singlet and triplet electronic states are calculated using the multi-reference configuration interaction and single-reference coupled cluster methods with large basis sets. The corresponding dipole moments and transition dipole moments functions are also determined. The basic spectroscopic properties and excitation energies of the electronic states are derived from rovibrational bound state calculations.

  10. AB "DNB" banko įvaizdžio valdymas


    Vaškelytė, Virginija


    Šio darbo tikslas - išnagrinėji AB „DNB“ banko įvaizdžio formavimą ir valdymą teoriniu bei praktiniu aspektu ir konstatavus įvaizdžio formavimo bei valdymo problemas sukurti banko įvaizdžio tobulinimo modelį. Teorinėje darbo dalyje analizuojama organizacijos įvaizdžio samprata, kūrimo lygiai, pagrindiniai veiksniai, formuojantys organizacijos įvaizdį. Taip pat teorinėje dalyje analizuojami, lyginami organizacijos įvaizdžio kūrimo modeliai bei banko įvaizdžio valdymas. Analitinėje baigiamojo d...

  11. Socialiai atsakingo verslo koncepcijos įgyvendinimas AB "Lietuvos draudimas"


    Žukauskienė, Justina


    Bakalauro baigiamajame darbe nagrinėjama socialiai atsakingo verslo koncepcija, pateikiami socialinės atsakomybės modeliai, kuriais remiantis įmonės gali įgyvendinti socialinę atsakomybę. Apžvelgiama Lietuvos patirtis socialinės atsakomybės srityje. Pateikiama ne tik socialinės atsakomybės nauda įmonei ir visuomenei, bet ir kritiškas požiūris į socialinę atsakomybę. Darbe analizuojamas AB „Lietuvos draudimas“ įgyvendinamas socialinės atsakomybės modelis. Nustatyta, kad įmonė socialinę atsakom...

  12. Ab initio methods for electron-molecule collisions

    International Nuclear Information System (INIS)

    This review concentrates on the recent advances in treating the electronic aspect of the electron-molecule interaction and leaves to other articles the description of the rotational and vibrational motions. Those methods which give the most complete treatment of the direct, exchange, and correlation effects are focused on. Such full treatments are generally necessary at energies below a few Rydbergs (≅ 60 eV). This choice unfortunately necessitates omission of those active and vital areas devoted to the development of model potentials and approximate scattering formulations. The ab initio and model approaches complement each other and are both extremely important to the full explication of the electron-scattering process. Due to the rapid developments of recent years, the approaches that provide the fullest treatment are concentrated on. 81 refs

  13. An Efficient Approach to Ab Initio Monte Carlo Simulation

    CERN Document Server

    Leiding, Jeff


    We present a Nested Markov Chain Monte Carlo (NMC) scheme for building equilibrium averages based on accurate potentials such as density functional theory. Metropolis sampling of a reference system, defined by an inexpensive but approximate potential, is used to substantially decorrelate configurations at which the potential of interest is evaluated, thereby dramatically reducing the number needed to build ensemble averages at a given level of precision. The efficiency of this procedure is maximized on-the-fly through variation of the reference system thermodynamic state (characterized here by its inverse temperature \\beta^0), which is otherwise unconstrained. Local density approximation (LDA) results are presented for shocked states in argon at pressures from 4 to 60 GPa. Depending on the quality of the reference potential, the acceptance probability is enhanced by factors of 1.2-28 relative to unoptimized NMC sampling, and the procedure's efficiency is found to be competitive with that of standard ab initio...

  14. Ab-initio melting curve and principal Hugoniot of tantalum

    International Nuclear Information System (INIS)

    We report first principles calculations of the melting curve and principal Hugoniot (P - V curve) of body centered cubic (bcc) tantalum in the pressure range 0-300 GPa. A description of lattice dynamics and thermal properties of bcc Ta using finite temperature density functional theory (DFT) is presented. The approach works within the projector augmented wave (PAW) implementation of DFT and explicitly treats in valence the 5p, 6s and 5d electrons. The principal Hugoniot (P - V curve), obtained using the Rankine-Hugoniot equation, is investigated using the generalized gradient approximations (GGA). Very good agreement with the shock experiments is obtained with GGA in all the range of pressure. We also report the temperature-pressure relation on the shock Hugoniot and the full ab-initio melting curve of Ta

  15. Diode laser welding of ABS: Experiments and process modeling

    CERN Document Server

    Ilie, Mariana; Mattei, Simone; Cicala, Eugen; Stoica, Virgil; 10.1016/j.optlastec.2008.10.005


    The laser beam weldability of acrylonitrile/butadiene/styrene (ABS) plates is determined by combining both experimental and theoretical aspects. In modeling the process, an optical model is used to determine how the laser beam is attenuated by the first material and to obtain the laser beam profile at the interface. Using this information as the input data to a thermal model, the evolution of the temperature field within the two components can be estimated. The thermal model is based on the first principles of heat transfer and utilizes the temperature variation laws of material properties. Corroborating the numerical results with the experimental results, some important insights concerning the fundamental phenomena that govern the process could be extracted. This approach proved to be an efficient tool in determining the weldability of polimeric materials and assures a significant reduction of time and costs with the experimental exploration.

  16. Ab Initio Study of KCl and NaCl Clusters (United States)

    Brownrigg, Clifton; Hira, Ajit; Pacheco, Jose; Salazar, Justin


    We continue our interest in the theoretical study of molecular clusters to examine the chemical properties of small KnCln and NanCln clusters (n = 2 - 15). The potentially important role of these molecular species in biochemical and medicinal processes is well known. This work applies the hybrid ab initio methods of quantum chemistry to derive the different alkali-halide (MnHn) geometries. Of particular interest is the competition between hexagonal ring geometries and rock salt structures. Electronic energies, rotational constants, dipole moments, and vibrational frequencies for these geometries are calculated. Magic numbers for cluster stability are identified and are related to the property of cluster compactness. Mapping of the singlet, triplet, and quintet, potential energy surfaces is performed. Calculations have been performed to examine the interactions of these clusters with some atoms and molecules of biological interest, including O, O2, and Fe. The potential for design of new medicinal drugs is explored.

  17. Ab initio electronic stopping power of protons in bulk materials (United States)

    Shukri, Abdullah Atef; Bruneval, Fabien; Reining, Lucia


    The electronic stopping power is a crucial quantity for ion irradiation: it governs the deposited heat, the damage profile, and the implantation depth. Whereas experimental data are readily available for elemental solids, the data are much more scarce for compounds. Here we develop a fully ab initio computational scheme based on linear response time-dependent density-functional theory to predict the random electronic stopping power (RESP) of materials without any empirical fitting. We show that the calculated RESP compares well with experimental data, when at full convergence, with the inclusion of the core states and of the exchange correlation. We evaluate the unexpectedly limited magnitude of the nonlinear terms in the RESP by comparing with other approaches based on the time propagation of time-dependent density-functional theory. Finally, we check the validity of a few empirical rules of thumbs that are commonly used to estimate the electronic stopping power.

  18. Interatomic Coulombic decay widths of helium trimer: Ab initio calculations

    Energy Technology Data Exchange (ETDEWEB)

    Kolorenč, Přemysl, E-mail: [Charles University in Prague, Faculty of Mathematics and Physics, Institute of Theoretical Physics, V Holešovičkách 2, 180 00 Prague (Czech Republic); Sisourat, Nicolas [Sorbonne Universités, UPMC Univ Paris 06, UMR 7614, Laboratoire de Chimie Physique Matière et Rayonnement, F-75005 Paris (France); CNRS, UMR 7614, Laboratoire de Chimie Physique Matière et Rayonnement, F-75005 Paris (France)


    We report on an extensive study of interatomic Coulombic decay (ICD) widths in helium trimer computed using a fully ab initio method based on the Fano theory of resonances. Algebraic diagrammatic construction for one-particle Green’s function is utilized for the solution of the many-electron problem. An advanced and universal approach to partitioning of the configuration space into discrete states and continuum subspaces is described and employed. Total decay widths are presented for all ICD-active states of the trimer characterized by one-site ionization and additional excitation of an electron into the second shell. Selected partial decay widths are analyzed in detail, showing how three-body effects can qualitatively change the character of certain relaxation transitions. Previously unreported type of three-electron decay processes is identified in one class of the metastable states.


    Institute of Scientific and Technical Information of China (English)

    Huang Chenghung; Fung Chinping; Chang Shihhsing; Hwang Jiunren; Doong Jiliang


    The optimization of injection molding process for polycarbonate/acrylonitrile-butadiene-styrene (PC/ABS) blends is studied using Taguchi method and principal component analysis (PCA). Four controllable process factors are studied at three levels each in the manufacturing process. The L9 orthogonal array is conducted to determine the optimum process factor/level combination for single quality of mechanical properties. In addition, the principal component analysis is employed to transform the correlated mechanical properties to a set of uncorrelated components and to evaluate a comprehensive index for multi-response cases. Then the optimum process factor/level combination for multiple qualities can be determined. Finally, the analysis of variance is used to find out the most influential injection molding parameter for single and multiple qualities problems.

  20. Ab initio study of II-(VI){sub 2} dichalcogenides

    Energy Technology Data Exchange (ETDEWEB)

    Olsson, P; Vidal, J; Lincot, D, E-mail: [Institut de R and D sur l' energie photovoltaique (IRDEP), UMR 7174-EDF-CNRS-ENSCP, 6 quai Watier, 78401 Chatou Cedex (France)


    The structural stabilities of the (Zn,Cd)(S,Se,Te){sub 2} dichalcogenides have been determined ab initio. These compounds are shown to be stable in the pyrite phase, in agreement with available experiments. Structural parameters for the ZnTe{sub 2} pyrite semiconductor compound proposed here are presented. The opto-electronic properties of these dichalcogenide compounds have been calculated using quasiparticle GW theory. Bandgaps, band structures and effective masses are proposed as well as absorption coefficients and refraction indices. The compounds are all indirect semiconductors with very flat conduction band dispersion and high absorption coefficients. The work functions and surface properties are predicted. The Te and Se based compounds could be of interest as absorber materials in photovoltaic applications. (paper)

  1. Ab initio Potential Energy Surface for H-H2 (United States)

    Partridge, Harry; Bauschlicher, Charles W., Jr.; Stallcop, James R.; Levin, Eugene


    Ab initio calculations employing large basis sets are performed to determine an accurate potential energy surface for H-H2 interactions for a broad range of separation distances. At large distances, the spherically averaged potential determined from the calculated energies agrees well with the corresponding results determined from dispersion coefficients; the van der Waals well depth is predicted to be 75 +/- (mu)E(sub h). Large basis sets have also been applied to reexamine the accuracy of theoretical repulsive potential energy surfaces. Multipolar expansions of the computed H-H2 potential energy surface are reported for four internuclear separation distances (1.2, 1.401, 1.449, and 1.7a(sub 0) of the hydrogen molecule. The differential elastic scattering cross section calculated from the present results is compared with the measurements from a crossed beam experiment.

  2. Ab initio investigation of the mechanical properties of copper

    Institute of Scientific and Technical Information of China (English)

    Liu Yue-Lin; Gui Li-Jiang; Jin Shuo


    Employing the ab initio total energy method based on the density functional theory with the generalized gradient approximation,we have systematically investigated the theoretical mechanical properties of copper (Cu).The theoretical tensile strengths are calculated to be 25.3 GPa,5.9 GPa,and 37.6 GPa for the fcc Cu single crystal in the [001],[110],and [111] directions,respectively.Among the three directions,the [110] direction is the weakest one due to the occurrence of structure transition at the lower strain and the weakest interaction of atoms between the (110) planes,while the [111] direction is the strongest direction because of the strongest interaction of atoms between the (111) planes.In terms of the elastic constants of Cu single crystal,we also estimate some mechanical quantities of polycrystalline Cu,including bulk modulus B,shear modulus G,Young's modulus Ep,and Poisson's ratio v.

  3. Ab Initio Prediction of 29Si-NMR Chemical Shifts

    Institute of Scientific and Technical Information of China (English)

    CHU Shidong; LI Yingxia; SONG Ni; GUAN Huashi


    The ability of several ab initio models to predict experimental 29Si-NMR chemical shift is examined. The shielding values of trimethylsilyl chloride (A), t-butyldimethylsilyl chloride (B) and allyltrimethylsilane (C) are calculated by GIAO, CSGT and IGAIM methods, using HF/6-31G*, B3LYP/6-31G*, HF/6-311+G**, B3LYP/6-311+G** and MPWlPW91/6-311+G** models respectively. The 29Si chemical shifts calculated by GIAO method using HF/6-311+G**model are highly in agreement with those obtained experimentally. All of the models above reproduce the trends of chemical shifts in all cases studied, suggesting that the models are of practical value.

  4. A Review on Ab Initio Approaches for Multielectron Dynamics

    CERN Document Server

    Ishikawa, Kenichi L


    In parallel with the evolution of femtosecond and attosecond laser as well as free-electron laser technology, a variety of theoretical methods have been developed to describe the behavior of atoms, molecules, clusters, and solids under the action of those laser pulses. Here we review major ab initio wave-function-based numerical approaches to simulate multielectron dynamics in atoms and molecules driven by intense long-wavelength and/or ultrashort short-wavelength laser pulses. Direct solution of the time-dependent Schr\\"odinger equation (TDSE), though its applicability is limited to He, ${\\rm H}_2$, and Li, can provide an exact description and has been greatly contributing to the understanding of dynamical electron-electron correlation. Multiconfiguration self-consistent-field (MCSCF) approach offers a flexible framework from which a variety of methods can be derived to treat both atoms and molecules, with possibility to systematically control the accuracy. The equations of motion of configuration interactio...

  5. Ab initio quantum dynamics using coupled-cluster. (United States)

    Kvaal, Simen


    The curse of dimensionality (COD) limits the current state-of-the-art ab initio propagation methods for non-relativistic quantum mechanics to relatively few particles. For stationary structure calculations, the coupled-cluster (CC) method overcomes the COD in the sense that the method scales polynomially with the number of particles while still being size-consistent and extensive. We generalize the CC method to the time domain while allowing the single-particle functions to vary in an adaptive fashion as well, thereby creating a highly flexible, polynomially scaling approximation to the time-dependent Schrödinger equation. The method inherits size-consistency and extensivity from the CC method. The method is dubbed orbital-adaptive time-dependent coupled-cluster, and is a hierarchy of approximations to the now standard multi-configurational time-dependent Hartree method for fermions. A numerical experiment is also given. PMID:22612082

  6. Energiutredning på Chips AB, Åland


    Renström, Thom; Sundbäck, Henrik


    En energikartläggning har gjorts hos Chips AB för att undersöka hur energin fördelas över de olika produktionslinjerna. Energianvändningen från processer som är gemensamma för alla produktionslinjer har också undersökts. Energianvändningen för dessa har fördelats över pro- duktionslinjerna eftersom produkterna även ska bära upp dessa energikostnader. Där det vi- sade sig att chipslinjen använder överlägset mest energi under ett år, 13 200 MWh, men den linjen körs mest o...

  7. Ab initio engineering of materials with stacked hexagonal tin frameworks (United States)

    Shao, Junping; Beaufils, Clément; Kolmogorov, Aleksey N.


    The group-IV tin has been hypothesized to possess intriguing electronic properties in an atom-thick hexagonal form. An attractive pathway of producing sizable 2D crystallites of tin is based on deintercalation of bulk compounds with suitable tin frameworks. Here, we have identified a new synthesizable metal distannide, NaSn2, with a 3D stacking of flat hexagonal layers and examined a known compound, BaSn2, with buckled hexagonal layers. Our ab initio results illustrate that despite being an exception to the 8-electron rule, NaSn2 should form under pressures easily achievable in multi-anvil cells and remain (meta)stable under ambient conditions. Based on calculated Z2 invariants, the predicted NaSn2 may display topologically non-trivial behavior and the known BaSn2 could be a strong topological insulator. PMID:27387140

  8. Ab initio Molecular Dynamics Study on Small Carbon Nanotubes

    Institute of Scientific and Technical Information of China (English)

    叶林晖; 刘邦贵; 王鼎盛


    Ab initio molecular dynamics simulations are performed on small single wall nanotubes. By structural relaxation,the equilibrium C-C bond lengths and bond angles are determined. Our result shows that for both zigzag and armchair nanotubes there are two nonequivalent bond lengths. One bond stretches from that of the graphene sheet, while the other shrinks. Small variations on bond angles are also shown. Energy bands are calculated for the optimized structures. It is found that the intrinsic curvature of the very small nanotube greatly modifies the energy band which can no longer be well described in the tight-binding zone-folding picture. In our calculation very small nanotubes are metallic. The energy per atom fits quite well with the relation of E(R) = E0 + f/R2 even for the extreme small radius. The implications of the results on the properties of small nanotubes are discussed.

  9. Effect of gamma irradiation on nutritional components and Cry1Ab protein in the transgenic rice with a synthetic cry1Ab gene from Bacillus thuringiensis

    International Nuclear Information System (INIS)

    The effects of gamma irradiation on the transgenic rice containing a synthetic cry1Ab gene from Bacillus thuringiensis were investigated. There was almost no difference in the content of the major nutritional components, i.e. crude protein, crude lipid, eight essential amino acids and total ash between the irradiated grains and the non-irradiated transgenic rice. However, the amounts of Cry1Ab protein and apparent amylose in the irradiated transgenic rice were reduced significantly by the doses higher than 200 Gy. In vivo observation showed that Cry1Ab protein contents also decreased in the fresh leaf tissues of survival seedlings after irradiation with 200 Gy or higher doses and showed inhibition of seedling growth. The results indicate that gamma irradiation might improve the quality of transgenic rice due to removal of the toxic Cry1Ab protein

  10. Effect of gamma irradiation on nutritional components and Cry1Ab protein in the transgenic rice with a synthetic cry1Ab gene from Bacillus thuringiensis (United States)

    Wu, Dianxing; Ye, Qingfu; Wang, Zhonghua; Xia, Yingwu


    The effects of gamma irradiation on the transgenic rice containing a synthetic cry1Ab gene from Bacillus thuringiensis were investigated. There was almost no difference in the content of the major nutritional components, i.e. crude protein, crude lipid, eight essential amino acids and total ash between the irradiated grains and the non-irradiated transgenic rice. However, the amounts of Cry1Ab protein and apparent amylose in the irradiated transgenic rice were reduced significantly by the doses higher than 200 Gy. In vivo observation showed that Cry1Ab protein contents also decreased in the fresh leaf tissues of survival seedlings after irradiation with 200 Gy or higher doses and showed inhibition of seedling growth. The results indicate that gamma irradiation might improve the quality of transgenic rice due to removal of the toxic Cry1Ab protein.

  11. 一种AB PLC与Profibus DP网络通信的方法%A Solution for Communication between AB PLC and Profibus DP Network

    Institute of Scientific and Technical Information of China (English)



    Industrial automation communication network is variousness. This paper presents a solution for communication be-tween AB PLC and Profibus DP network, introduces an example that an AB PLC system communicates with Siemens S120 drives through Profibus DP network by using MVI56-PDPMV1 module.%工业自动化通信网络具有多样性的特点, wenz对AB PLC与Profibus DP网络通信的方法进行探究,用设计实例探讨AB PLC系统通过MVI56-PDPMV1通信模块与西门子S120驱动系统构建Profibus-DP通信网络的设计与编程设置。

  12. 弹性体对ABS/PVC合金性能的影响%Effect of Elastomer on ABS/PVC Alloy

    Institute of Scientific and Technical Information of China (English)

    洪重奎; 鲁建春; 韩秀山; 华幼卿



  13. Expression of Cry1Ab and Cry2Ab by a polycistronic transgene with a self-cleavage peptide in rice.

    Directory of Open Access Journals (Sweden)

    Qichao Zhao

    Full Text Available Insect resistance to Bacillus thuringiensis (Bt crystal protein is a major threat to the long-term use of transgenic Bt crops. Gene stacking is a readily deployable strategy to delay the development of insect resistance while it may also broaden insecticidal spectrum. Here, we report the creation of transgenic rice expressing discrete Cry1Ab and Cry2Ab simultaneously from a single expression cassette using 2A self-cleaving peptides, which are autonomous elements from virus guiding the polycistronic viral gene expression in eukaryotes. The synthetic coding sequences of Cry1Ab and Cry2Ab, linked by the coding sequence of a 2A peptide from either foot and mouth disease virus or porcine teschovirus-1, regardless of order, were all expressed as discrete Cry1Ab and Cry2Ab at high levels in the transgenic rice. Insect bioassays demonstrated that the transgenic plants were highly resistant to lepidopteran pests. This study suggested that 2A peptide can be utilized to express multiple Bt genes at high levels in transgenic crops.

  14. ABS/PET合金的相容化研究%Study on the Compatibility of ABS/PET Alloy

    Institute of Scientific and Technical Information of China (English)

    刘辉辉; 杜一凡; 谷志杰; 许海燕



  15. Explicit and Implicit Subject Bias in the "ABS Journal Quality Guide" (United States)

    Hoepner, Andreas G. F.; Unerman, Jeffrey


    This paper addresses issues raised in two recent papers published in this journal about the UK "Association of Business Schools' Journal Quality Guide (ABS Guide)". While much of the debate about journal rankings in general, and the "ABS Guide" in particular, has focused on the construction, power and (mis)use of these…

  16. Dynamics of immature mAb glycoform secretion during CHO cell culture

    DEFF Research Database (Denmark)

    Jimenez del Val, Ioscani; Fan, Yuzhou; Weilguny, Dietmar


    required to minimise mAb glycoform variability. Our results suggest that the availability of glycosylation machinery relative to cellular secretory capacity may play a crucial role in mAb glycosylation. In the future, the modelling framework presented here may aid in selecting and engineering cell lines...

  17. Leonid Apananski müüs AB Grupi maa oma firmale / Silva Männik

    Index Scriptorium Estoniae

    Männik, Silva, 1974-


    Ilmunud ka: Den za Dnjom Nov/26 lk. 8. Apananski müüs AB Kindlustuse Grupile kuulunud Maakri tänava kinnistu. Skeem: AB Grupist on välja viidud ligikaudu 70 milj. krooni. Ilmunud ka: Den za Dnjom 23. nov. lk. 3

  18. Ultra-low-power, class-AB, CMOS four-quadrant current multiplier

    NARCIS (Netherlands)

    Sawigun, C.; Serdijn, W.A.


    A class-AB four-quadrant current multiplier constituted by a class-AB current amplifier and a current splitter which can handle input signals in excess of ten times the bias current is presented. The proposed circuit operation is based on the exponential characteristic of BJTs or subthreshold MOSFET

  19. Towards a fair and equitable abs regime: is Nagoya leading us in the right direction?

    NARCIS (Netherlands)

    Jonge, de B.


    A historical overview of the concept of Access and Benefit Sharing (ABS) suggests that ABS is all about compensation, i.e. a benefit sharing mechanism that provides one with compensation for allowing access to one’s resources. The principles of entitlement (based on sovereign rights) and desert (bas

  20. Prediction on Antigenic Epitope Characteristics of Bt Cry2Ab Protein in Transgenic Crops

    Institute of Scientific and Technical Information of China (English)

    Jierong GAO; Ying HE; Zehong ZOU; Ailin TAO; Yuncan AI


    Abstract [Objective] This study aimed to predict the structural characteristics of Bt Cry2Ab protein in transgenic crops with bioinformatic analysis to provide the theoreti- cal clues for design of antibody Cry2Ab. [Method] The amino acid sequence of Cry2Ab protein was searched from NCBI database. The B cell epitopes were pre- dicted with DNAStar. The binding affinity between Cry2Ab protein and MHC-II molecules was analyzed with NetMHCII 2.2 Server to predict the T cell epitopes. [Result] Prediction result suggested the potential B cell epitope of Cry2Ab locating in the region of 208-215. Analysis of the binding affinity between Cry2Ab and MHC-II molecules suggested the regions of 177-185, 299-307 and 255-263 were the po- tential T cell epitopes. Human with HLA-DRB10101 alleles and HLA-DRB10701 al- leles were more sensitive to Cry2Ab protein. [Conclusion] This study facilitates to un- derstand the structural characteristics of Cry2Ab protein and provides a new clue to improve the assessment method for potential allergenicity of genetically modified food.

  1. Electronic Brake-Force Distribution Control Methods of ABS-Equipped Vehicles During Cornering Braking

    Institute of Scientific and Technical Information of China (English)

    WANG Guo-ye; LIU Zhao-du; MA Yue-feng; QI Zhi-quan


    Based on the dynamics of ABS-equipped vehicles during cornering braking,the electronic brakeforce distribution (EBD) control methods of ABS-equipped vehicles during cornering braking are proposed.According to the dynamics and the tire model under tire adhesion limit,the stability acceptance criteria of vehicles during cornering braking are proposed.According to the stability acceptance criteria and the ABS control,the EBD control methods of ABS-equipped vehicles during cornering braking are implemented by adjusting the threshold values of tires slip independently.The vehicle states during cornering braking at two typical initial velocities of the vehicle are analyzed by the EBD control methods,whose results indicate the EBD control methods can improve the braking performances of the vehicle during cornering braking comparing with the ABS control.

  2. Influence of Cellulose on the Mechanical and Thermal Stability of ABS Plastic Composites

    Directory of Open Access Journals (Sweden)

    K. Crews


    Full Text Available Microcrystalline cellulose was explored as possible biodegradable fillers in the fabrication of ABS plastic composites. TGA indicates that upon inclusion of cellulose microcrystals the thermal stability of the ABS plastics was improved significantly when compared to the neat ABS plastic counterparts. Furthermore, inclusion of extracted cellulose from plant biomass showed a higher thermal stability with maximum decomposition temperatures around 131.95°C and 124.19°C for cellulose from cotton and Hibiscus sabdariffa, respectively, when compared to that of the purchased cellulose. In addition, TMA revealed that the average CTE value for the neat ABS and 1 : 1 ratio of cellulose to ABS fabricated in this study was significantly lower than the reported CTE (ca. 73.8 μm/m°C.

  3. Hydrogenation of AB{sub 5} and AB{sub 2} metal hydride alloys studied by in situ X-ray diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Wang, L. [Department of Chemical Engineering and Materials Science, Wayne State University, Detroit, MI 48202 (United States); BASF – Battery Materials Ovonic, 2983 Waterview Drive, Rochester Hills, MI 48309 (United States); Young, K., E-mail: [BASF – Battery Materials Ovonic, 2983 Waterview Drive, Rochester Hills, MI 48309 (United States); Nei, J.; Pawlik, D. [BASF – Battery Materials Ovonic, 2983 Waterview Drive, Rochester Hills, MI 48309 (United States); Ng, K.Y.S. [Department of Chemical Engineering and Materials Science, Wayne State University, Detroit, MI 48202 (United States)


    Highlights: • Hydrogenation process of an AB{sub 5} alloy and two AB{sub 2} alloys were studied by quasi in-situ XRD. • In both AB{sub 5} and AB{sub 2} metal alloy, hydrogen occupation sites on the half-plane were taken first. • In the C14/C15 mixed alloy, C14 phase is the main hydrogen storage phase with a lower equilibrium pressure. • In the C14/C15 mixed alloy, C15 phase is the catalyst hydrogen storage phase with a higher equilibrium pressure. • Small amount of C15 was hydrided first but not completed until C14 phase was fully hydrided. - Abstract: The evolution of lattice constants and abundances of metal (α) and metal hydride (β) phases during the hydrogenation process of an AB{sub 5} alloy with a CaCu{sub 5} crystal structure, an AB{sub 2} alloy with a predominating C14 structure, and a C14/C15-mixed AB{sub 2} alloy were reported. The preferred hydrogen insertion sites at different states of charge in both the α and β phases were studied based on the lattice parameter changes during hydrogenation. During the hydrogenation of the AB{sub 5} alloy, the ratio between lattice parameters a and c (a/c ratio) in the α phase decreases, stabilizes, and then decreases again while that in the β phase decreases and then stabilizes. The trends in unit cell volume changes are increasing, plateauing, and increasing again in the α phase and increasing followed by plateauing in the β phase as the hydrogenation level increases. In the C14-predominant AB{sub 2} alloy, the a/c ratio in the α phase increases at the beginning and then stabilizes while that in the β phase remains about the same and then increases during the addition of hydrogen. Moreover, the unit cell volume in the α phase increases slightly during hydrogenation, comparing to the increasing, decreasing, and then increasing trend in the β phase. In the C14/C15 mixed AB{sub 2} alloy, hydrogenation of the C15 phase starts at the beginning and promotes the hydrogenation of the C14 phase. The C14

  4. Performance Study of ABS/Graphite/NBR Thermal Conductive Composites%ABS/石墨/NBR导热复合材料性能的研究

    Institute of Scientific and Technical Information of China (English)

    傅伟宁; 张云灿; 韦亚兵; 成敏


    采用熔融共混法制备丙烯腈-丁二烯-苯乙烯共聚物(ABS)/石墨/丁腈橡胶(NBR)导热复合材料,通过热常数分析仪、同步热分析仪、扫描电子显微镜、力学性能测试等手段研究了NBR、ABS高胶粉及石墨(G)的添加量对ABS复合材料导热性能及力学性能的影响.结果表明,ABS高胶粉和NBR均能明显提高ABS的热导率和缺口冲击强度,但是丁腈胶粉的改性效果优于高胶粉.以NBR作为ABS复合材料的增韧剂,随着石墨含量的增大,增韧效果下降,ABS复合材料的热导率提高到纯ABS的5倍,热分解温度提高40℃左右,热膨胀系数下降.当ABS/G/NBR复合材料的质量比为60/15/25时,其热导率为纯ABS的2倍,缺口冲击强度达21.8 kJ/m2,明显高于纯ABS(2.6 kJ/m2).%Thermally conductive ABS/graphite/nitrile butadiene rubber (NBR) composites were prepared by melt bleding method.The effects of NBR,ABS and graphite content on the thermal conductivity and mechanical property of the ABS composites were studied respectively by the thermal constant analyzer,synchronous thermal analysis,scanning electron microscopy and mechanical properties testing means.The results showed that ABS high glue powder and NBR could increase the thermal conductivity and Notched impact strength of ABS,but NBR was more suitable as a toughening agent for ABS composite.The toughening effect decreased as the graphite content increased.Meanwhile the thermal conductivity of the ABS composite was up to five times than that of the pure ABS.The thermal decomposition temperature of the composite increased by about 40 ℃ and the thermal expansion coefficient failed.When the mass ratio of ABS/G/NBR was 60/15/25,the thermal conductivity was two times than that of pure ABS and the impact strength was up to 21.8 kJ/m2 which was larger than that of pure ABS (2.6 kJ/m2).

  5. AB-8大孔树脂对蓝莓花色苷的纯化研究%The purification study of blueberry anthocyanin on resin AB-8

    Institute of Scientific and Technical Information of China (English)

    黄月鹏; 黄翠贤


    花色苷是一种水溶性的安全的天然色素。本论文以蓝莓花色苷提取液为原料。使用AB-8树脂对蓝莓花色苷精制工艺进行了研究。结果表明:AB-8树脂吸附流速为10mL/min,用40%乙醇洗脱,解吸流速为5mL/min。AB-8树脂饱和吸附量1.25mg/mL,树脂量是蓝莓花色苷量的3BV。蓝莓花色苷的纯度为38.1%。%Anthocyanin was a water-soluble, safe and natural pigment. Extraction of blueberry anthocyanin was used as raw material in this was studied that technology of purifing resin AB-8 to blueberry anthocyanin. The results showed that the absorption speed of resin AB-8 was 10ml/min,the anthocyanin from blueberry was eluted with 40% ethanol at the flow rate of 5mL/min.The absorption capacity of the resin AB-8 was determined to be 1.25mg/mL. It revealed that ratio of resinAB-8 to blueberry anthocyanin solvent were 3BV. The purification of blueberry anthocyanin was 38.1%.

  6. The wonderful complexity of the Mira AB system

    CERN Document Server

    Ramstedt, S; Vlemmings, W H T; Maercker, M; Montez, R; Baudry, A; De Beck, E; Lindqvist, M; Olofsson, H; Humphreys, E M L; Jorissen, A; Kerschbaum, F; Mayer, A; Wittkowski, M; Cox, N L J; Lagadec, E; Leal-Ferreira, M L; Paladini, C; Pérez-Sánchez, A; Sacuto, S


    We have mapped the CO(3-2) line emission around the Mira AB system at 0.5 resolution using the Atacama Large Millimeter/submillimeter Array (ALMA). The CO map shows amazing complexity. The circumstellar gas has been shaped by different dynamical actors during the evolution of the system and several morphological components can be identified. The companion is marginally resolved in continuum emission and is currently at 0.487$\\pm$0.006 separation. In the main line component, centered on the stellar velocity, spiral arcs around Mira A are found. The spiral appears to be relatively flat and oriented in the orbital plane. An accretion wake behind the companion is clearly visible and the projected arc separation is of order 5''. In the blue wing of the line emission, offset from the main line, several large ($\\sim$5-10''), opposing arcs are found. We tentatively suggest that this structure is created by the wind of Mira B blowing a bubble in the expanding envelope of Mira A.

  7. Histopathological Study of Trabeculum after Excimer Laser Trabeculectomy ab Interno

    Institute of Scientific and Technical Information of China (English)

    Shengsong Huang; Minbin Yu; Guangqiang Feng; Ping Zhang; Changyu Qiu


    Purpose: To study the clinical manifestations and histopathologic changes of trabeculum after excimer laser trabeculectomy ab interno (ELT), and to investigate the mechanisms of ELT in reducing intraocular pressure. Methods : ELT was performed on ten rabbit eves and postoperative responses were documented. Comeoscleral tissue samples were harvested consecutively each week until the 5th postoperative week and these samples were examined under light and electrical microscopy. Results: Mild stimulation signs were present postoperatix'ely in nine of ten eyes, but no serious complications were experienced. Obvious inflammation was observed in one rabbit eye as a result of iris damage during the surgical manipulations. Local kactures on the trabecular meshwork and openings into Schlemm' s canal were detected in all tissue samples under light microscope. Mitochondria were found to be turgescent and dilated like vacuoles and endoplasmic reticula were found to be dilated under electrical microscope in the early postoperative period. Later, all trabecular cells returned normal and no fihroblast cells were ever detected. Conclusions: Permanent openings through trabecular meshwork into the inner wall of Schlemm's canal can be created with ELT. The outflow resistance of aqueous humor can be reduced with these openings and intraocular pressure can be controlled thereafter. Eye Science 2001; 17:11 ~ 15.

  8. Exploring the free energy surface using ab initio molecular dynamics. (United States)

    Samanta, Amit; Morales, Miguel A; Schwegler, Eric


    Efficient exploration of configuration space and identification of metastable structures in condensed phase systems are challenging from both computational and algorithmic perspectives. In this regard, schemes that utilize a set of pre-defined order parameters to sample the relevant parts of the configuration space [L. Maragliano and E. Vanden-Eijnden, Chem. Phys. Lett. 426, 168 (2006); J. B. Abrams and M. E. Tuckerman, J. Phys. Chem. B 112, 15742 (2008)] have proved useful. Here, we demonstrate how these order-parameter aided temperature accelerated sampling schemes can be used within the Born-Oppenheimer and the Car-Parrinello frameworks of ab initio molecular dynamics to efficiently and systematically explore free energy surfaces, and search for metastable states and reaction pathways. We have used these methods to identify the metastable structures and reaction pathways in SiO2 and Ti. In addition, we have used the string method [W. E, W. Ren, and E. Vanden-Eijnden, Phys. Rev. B 66, 052301 (2002); L. Maragliano et al., J. Chem. Phys. 125, 024106 (2006)] within the density functional theory to study the melting pathways in the high pressure cotunnite phase of SiO2 and the hexagonal closed packed to face centered cubic phase transition in Ti. PMID:27131525

  9. Ab initio no-core solutions for $^6$Li

    CERN Document Server

    Shin, Ik Jae; Maris, Pieter; Vary, James P; Forssén, Christian; Rotureau, Jimmy; Michel, Nicolas


    We solve for properties of $^6$Li in the ab initio No-Core Full Configuration approach and we separately solve for its ground state and $J^{\\pi}=2_{2}^{+}$ resonance with the Gamow Shell Model in the Berggren basis. We employ both the JISP16 and chiral NNLO$_{opt}$ realistic nucleon-nucleon interactions and investigate the ground state energy, excitation energies, point proton root-mean-square radius and a suite of electroweak observables. We also extend and test methods to extrapolate the ground state energy, point proton root-mean-square radius, and electric quadrupole moment. We attain improved estimates of these observables in the No-Core Full Configuration approach by using basis spaces up through N$_{max}$=18 that enable more definitive comparisons with experiment. Using the Density Matrix Renormalization Group approach with the JISP16 interaction, we find that we can significantly improve the convergence of the Gamow Shell Model treatment of the $^6$Li ground state and $J^{\\pi}=2_{2}^{+}$ resonance by ...

  10. Ab initio evaluations of the He solubility in liquid Li

    Energy Technology Data Exchange (ETDEWEB)

    Sedano, Luis A. [EURATOM-CIEMAT Assoc., Materials for Fusion Program, Bd. 43 P0.04, Avda. Complutense 22, 28040 Madrid (Spain)]. E-mail:; Hassanein, Ahmed [Argonne Nat. Lab, 9700 South Class Av., Argonne, IL (United States)]. E-mail:; Sanz, Javier [ETSII-UNED, c/Juan del Rosal, 12, 28040 Madrid (E) (Spain)]. E-mail:


    Modified embedding atom methods (MEAM) are developed to have predictions of the partial molar heat of solution (-H{sub s}) by direct simulation of metal cohesion, He-metal and He-He interaction. Transitions from crystalline Li to configurations, having the liquid Li structure's factors (h-bar (q)), are simulated ab initio. Once h-bar (q) reproduced, He atoms are added, one by one, to the Li system. Parallel lines for each case, with slopes clearly independent on the number of He atoms in the system, are obtained for energy versus pressure at given temperatures. Average differences between two adjacent parallels at zero pressure, once kinetic energy of the system discounted, represents the energy gained by an He atom when added to the Li system, related to the solution energy -H{sub s}. The molar excess entropy of gas in solution (S-bar {sub l}{sup ex}) is previously evaluated following diverse fundamental approaches: a 'thermodynamic liquid-hole' (TL-H) model for alkali liquids and a statistical-mechanics (Neff and McQuarrie's) model (SMM). Between 600 and 900 deg. C, a typical range of interest for the use of Li in fusion technology, the computed values for the (He) Henry's constant in Li range from 8x10{sup -14} to 10{sup -13} at. fr. Pa{sup -1}.

  11. Ab initio simulations of pseudomorphic silicene and germanene bidimensional heterostructures (United States)

    Debernardi, Alberto; Marchetti, Luigi


    Among the novel two-dimensional (2D) materials, silicene and germanene, which are two honeycomb crystal structures composed of a monolayer of Si and Ge, respectively, have attracted the attention of material scientists because they combine the advantages of the new 2D ultimate-scaled electronics with their compatibility with industrial processes presently based on Si and Ge. We envisage pseudomorphic lateral heterostructures based on ribbons of silicene and germanene, which are the 2D analogs of conventional 3D Si/Ge superlattices and quantum wells. In spite of the considerable lattice mismatch (˜4 % ) between free-standing silicene and germanene, our ab initio simulations predict that, considering striped 2D lateral heterostructures made by alternating silicene and germanene ribbons of constant width, the silicene/germanene junction remains pseudomorphic—i.e., it maintains lattice-matched edges—up to critical ribbon widths that can reach some tens of nanometers. Such critical widths are one order of magnitude larger than the critical thickness measured in 3D pseudomorphic Si/Ge heterostructures and the resolution of state-of-the-art lithography, thus enabling the possibility of lithography patterned silicene/germanene junctions. We computed how the strain produced by the pseudomorphic growth modifies the crystal structure and electronic bands of the ribbons, providing a mechanism for band-structure engineering. Our results pave the way for lithography patterned lateral heterostructures that can serve as the building blocks of novel 2D electronics.

  12. Ab initio studies of phoshorene island single electron transistor. (United States)

    Ray, S J; Venkata Kamalakar, M; Chowdhury, R


    Phosphorene is a newly unveiled two-dimensional crystal with immense potential for nanoelectronic and optoelectronic applications. Its unique electronic structure and two dimensionality also present opportunities for single electron devices. Here we report the behaviour of a single electron transistor (SET) made of a phosphorene island, explored for the first time using ab initio calculations. We find that the band gap and the charging energy decrease monotonically with increasing layer numbers due to weak quantum confinement. When compared to two other novel 2D crystals such as graphene and MoS2, our investigation reveals larger adsorption energies of gas molecules on phosphorene, which indicates better a sensing ability. The calculated charge stability diagrams show distinct changes in the presence of an individual molecule which can be applied to detect the presence of different molecules with sensitivity at a single molecular level. The higher charging energies of the molecules within the SET display operational viability at room temperature, which is promising for possible ultra sensitive detection applications. PMID:27093536

  13. Ab initio studies of phosphorene island single electron transistor (United States)

    Ray, S. J.; Venkata Kamalakar, M.; Chowdhury, R.


    Phosphorene is a newly unveiled two-dimensional crystal with immense potential for nanoelectronic and optoelectronic applications. Its unique electronic structure and two dimensionality also present opportunities for single electron devices. Here we report the behaviour of a single electron transistor (SET) made of a phosphorene island, explored for the first time using ab initio calculations. We find that the band gap and the charging energy decrease monotonically with increasing layer numbers due to weak quantum confinement. When compared to two other novel 2D crystals such as graphene and MoS2, our investigation reveals larger adsorption energies of gas molecules on phosphorene, which indicates better a sensing ability. The calculated charge stability diagrams show distinct changes in the presence of an individual molecule which can be applied to detect the presence of different molecules with sensitivity at a single molecular level. The higher charging energies of the molecules within the SET display operational viability at room temperature, which is promising for possible ultra sensitive detection applications.

  14. Ab initio calculation of double ionization of atoms

    Energy Technology Data Exchange (ETDEWEB)

    Serov, V. V., E-mail: [Saratov State University, Department of Theoretical Physics (Russian Federation)


    The Solov'ev-Vinitsky method was used to perform an ab initio calculation of the triple-differential cross section for the double single-photon photoionization of helium for the case of equal emitted-electron energies. A Gaussian width {gamma} describing angular electron-electron correlations at the total electron energy E taking values in range between 0.1 and 100 eV was obtained for this cross section. The results agree with available experimental data, but they raise a doubt as to whether the well-known Wannier law {gamma} {proportional_to} E{sup 1/4} is applicable at experimentally accessible energies. The Gaussian width {gamma} was investigated as a function of the total emitted-electron energy for targets that have a strongly asymmetric configuration of the initial state-specifically, a negative atomic-hydrogen ion H{sup -} and heliumin the 1s2s{sup 1}S and 1s3s{sup 1}S excited states. It was found that this function, {gamma}(E), had a maximum at low energies. It was also shown that, at low energies, the dependence of the double-differential cross section on the angle between the emitted-electron momenta for the targets indicated above differed substantially from the Gaussian dependence, featuring maxima whose number was equal to the number of radial nodes in the initial state. This opens new possibilities for a qualitative analysis of the electron structure of targets.

  15. Accurate ab initio vibrational energies of methyl chloride

    Energy Technology Data Exchange (ETDEWEB)

    Owens, Alec, E-mail: [Max-Planck-Institut für Kohlenforschung, Kaiser-Wilhelm-Platz 1, 45470 Mülheim an der Ruhr (Germany); Department of Physics and Astronomy, University College London, Gower Street, WC1E 6BT London (United Kingdom); Yurchenko, Sergei N.; Yachmenev, Andrey; Tennyson, Jonathan [Department of Physics and Astronomy, University College London, Gower Street, WC1E 6BT London (United Kingdom); Thiel, Walter [Max-Planck-Institut für Kohlenforschung, Kaiser-Wilhelm-Platz 1, 45470 Mülheim an der Ruhr (Germany)


    Two new nine-dimensional potential energy surfaces (PESs) have been generated using high-level ab initio theory for the two main isotopologues of methyl chloride, CH{sub 3}{sup 35}Cl and CH{sub 3}{sup 37}Cl. The respective PESs, CBS-35{sup  HL}, and CBS-37{sup  HL}, are based on explicitly correlated coupled cluster calculations with extrapolation to the complete basis set (CBS) limit, and incorporate a range of higher-level (HL) additive energy corrections to account for core-valence electron correlation, higher-order coupled cluster terms, scalar relativistic effects, and diagonal Born-Oppenheimer corrections. Variational calculations of the vibrational energy levels were performed using the computer program TROVE, whose functionality has been extended to handle molecules of the form XY {sub 3}Z. Fully converged energies were obtained by means of a complete vibrational basis set extrapolation. The CBS-35{sup  HL} and CBS-37{sup  HL} PESs reproduce the fundamental term values with root-mean-square errors of 0.75 and 1.00 cm{sup −1}, respectively. An analysis of the combined effect of the HL corrections and CBS extrapolation on the vibrational wavenumbers indicates that both are needed to compute accurate theoretical results for methyl chloride. We believe that it would be extremely challenging to go beyond the accuracy currently achieved for CH{sub 3}Cl without empirical refinement of the respective PESs.

  16. Rational design of electrolyte components by ab initio calculations

    Energy Technology Data Exchange (ETDEWEB)

    Johansson, Patrik; Jacobsson, Per [Department of Applied Physics, Chalmers University of Technology, SE-412 96 Goeteborg (Sweden)


    This paper is a small review of the use of computer simulations and especially the use of standard quantum-mechanical ab initio electronic structure calculations to rationally design and investigate different choices of chemicals/systems for lithium battery electrolytes. Covered systems and strategies to enhance the performance of electrolytes will range from assisting the interpretation of vibrational spectroscopy experiments over development of potentials for molecular dynamics simulations, to the design of new lithium salts and the lithium ion coordination in liquid, polymer, and gel polymer electrolytes. Examples of studied properties include the vibrational spectra of anions and ion pairs to characterize the nature and extent of the interactions present, the lithium ion affinities of anions, important for the salt solvation and the ability to provide a high concentration of charge carriers, the HOMO energies of the anions to estimate the stability versus oxidation, the anion volumes that correlate to the anion mobility, the lithium ion coordination and dynamics to reveal the limiting steps of lithium ion transport, etc. (author)

  17. Volumic omit maps in ab initio dual-space phasing. (United States)

    Oszlányi, Gábor; Sütő, András


    Alternating-projection-type dual-space algorithms have a clear construction, but are susceptible to stagnation and, thus, inefficient for solving the phase problem ab initio. To improve this behaviour new omit maps are introduced, which are real-space perturbations applied periodically during the iteration process. The omit maps are called volumic, because they delete some predetermined subvolume of the unit cell without searching for atomic regions or analysing the electron density in any other way. The basic algorithms of positivity, histogram matching and low-density elimination are tested by their solution statistics. It is concluded that, while all these algorithms based on weak constraints are practically useless in their pure forms, appropriate volumic omit maps can transform them to practically useful methods. In addition, the efficiency of the already useful reflector-type charge-flipping algorithm can be further improved. It is important that these results are obtained by using non-sharpened structure factors and without any weighting scheme or reciprocal-space perturbation. The mathematical background of volumic omit maps and their expected applications are also discussed. PMID:27357850

  18. A coupled "AB" system: Rogue waves and modulation instabilities (United States)

    Wu, C. F.; Grimshaw, R. H. J.; Chow, K. W.; Chan, H. N.


    Rogue waves are unexpectedly large and localized displacements from an equilibrium position or an otherwise calm background. For the nonlinear Schrödinger (NLS) model widely used in fluid mechanics and optics, these waves can occur only when dispersion and nonlinearity are of the same sign, a regime of modulation instability. For coupled NLS equations, rogue waves will arise even if dispersion and nonlinearity are of opposite signs in each component as new regimes of modulation instability will appear in the coupled system. The same phenomenon will be demonstrated here for a coupled "AB" system, a wave-current interaction model describing baroclinic instability processes in geophysical flows. Indeed, the onset of modulation instability correlates precisely with the existence criterion for rogue waves for this system. Transitions from "elevation" rogue waves to "depression" rogue waves are elucidated analytically. The dispersion relation as a polynomial of the fourth order may possess double pairs of complex roots, leading to multiple configurations of rogue waves for a given set of input parameters. For special parameter regimes, the dispersion relation reduces to a cubic polynomial, allowing the existence criterion for rogue waves to be computed explicitly. Numerical tests correlating modulation instability and evolution of rogue waves were conducted.

  19. Atmospheric Characterization of the Hot Jupiter Kepler-13Ab

    CERN Document Server

    Shporer, Avi; Knutson, Heather A; Szabo, Gyula M; Zhao, Ming; Burrows, Adam; Fortney, Jonathan; Agol, Eric; Cowan, Nicolas B; Desert, Jean-Michel; Howard, Andrew W; Isaacson, Howard; Lewis, Nikole A; Showman, Adam P; Todorov, Kamen O


    (abridged) Kepler-13Ab (= KOI-13.01) is one of very few known short-period (1.76 day) transiting planets orbiting a bright A-type star. The availability of Kepler data allows a measurement of the planet's occultation (secondary eclipse) and orbital phase curve, which we combine with occultations observed by Spitzer at 3.6 micron and 4.5 micron and a ground-based occultation observation in the $Ks$ band (2.1 micron). For the day-side hemisphere we derive a temperate of 2,750 $\\pm$ 160 K as the effective temperature of a black body that will show the same occultation depths, and a high geometric albedo $A_g$ = 0.33$^{+0.04}_{-0.06}$. Comparing the occultation depths with one-dimensional planetary atmosphere models suggests the presence of an atmospheric temperature inversion. The Kepler mid-occultation time measured here is 34.0 $\\pm$ 6.9 s earlier than expected based on the mid-transit time reported in the literature and the expected time delay due to light travel time. This could be due to a small orbital ecc...

  20. Ab-initio calculations for dilute magnetic semiconductors

    Energy Technology Data Exchange (ETDEWEB)

    Belhadji, Brahim


    This thesis focusses on ab-initio calculations for the electronic structure and the magnetic properties of dilute magnetic semiconductors (DMS). In particular we aim at the understanding of the complex exchange interactions in these systems. Our calculations are based on density functional theory, being ideally suited for a description of the material specific properties of the considered DMS. Moreover we use the KKR Green function method in connection with the coherent potential approximation (CPA), which allows to include the random substitutional disorder in a mean field-like approximation for the electronic structure. Finally we calculate the exchange coupling constants J{sub ij} between two impurities in a CPA medium by using the Lichtenstein formula and from this calculate the Curie temperature by a numerically exact Monte Carlo method. Based on this analysis we found and investigated four different exchange mechanisms being of importance in DMS systems: Double exchange, p-d exchange, antiferromagnetic superexchanges, and ferromagnetic superexchange. A second topic we have investigated in this thesis is the pressure dependence of the exchange interactions and the Curie temperatures in (Ga,Mn)As and (In,Mn)As, using the LDA and the LDA+U approximations. Exact calculations of T{sub C} by Monte Carlo simulations show a somehow different behavior. (orig.)

  1. Ab initio transport across bismuth selenide surface barriers

    KAUST Repository

    Narayan, Awadhesh


    © 2014 American Physical Society. We investigate the effect of potential barriers in the form of step edges on the scattering properties of Bi2Se3(111) topological surface states by means of large-scale ab initio transport simulations. Our results demonstrate the suppression of perfect backscattering, while all other scattering processes, which do not entail a complete spin and momentum reversal, are allowed. Furthermore, we find that the spin of the surface state develops an out-of-plane component as it traverses the barrier. Our calculations reveal the existence of quasibound states in the vicinity of the surface barriers, which appear in the form of an enhanced density of states in the energy window corresponding to the topological state. For double barriers we demonstrate the formation of quantum well states. To complement our first-principles results we construct a two-dimensional low-energy effective model and illustrate its shortcomings. Our findings are discussed in the context of a number of recent experimental works.

  2. Engineering Room-temperature Superconductors Via ab-initio Calculations (United States)

    Gulian, Mamikon; Melkonyan, Gurgen; Gulian, Armen

    The BCS, or bosonic model of superconductivity, as Little and Ginzburg have first argued, can bring in superconductivity at room temperatures in the case of high-enough frequency of bosonic mode. It was further elucidated by Kirzhnitset al., that the condition for existence of high-temperature superconductivity is closely related to negative values of the real part of the dielectric function at finite values of the reciprocal lattice vectors. In view of these findings, the task is to calculate the dielectric function for real materials. Then the poles of this function will indicate the existence of bosonic excitations which can serve as a "glue" for Cooper pairing, and if the frequency is high enough, and the dielectric matrix is simultaneously negative, this material is a good candidate for very high-Tc superconductivity. Thus, our approach is to elaborate a methodology of ab-initio calculation of the dielectric function of various materials, and then point out appropriate candidates. We used the powerful codes (TDDF with the DP package in conjunction with ABINIT) for computing dielectric responses at finite values of the wave vectors in the reciprocal lattice space. Though our report is concerned with the particular problem of superconductivity, the application range of the data processing methodology is much wider. The ability to compute the dielectric function of existing and still non-existing (though being predicted!) materials will have many more repercussions not only in fundamental sciences but also in technology and industry.

  3. The Solar-System-Scale Disk Around AB Aurigae

    CERN Document Server

    Oppenheimer, Ben R; Hinkley, Sasha; Zimmerman, Neil; Sivaramakrishnan, Anand; Soummer, Remi; Kuhn, Jeffrey; Graham, James R; Perrin, Marshall; Lloyd, James P; Roberts, Lewis C Jr; Harrington, David M


    The young star AB Aurigae is surrounded by a complex combination of gas-rich and dust dominated structures. The inner disk which has not been studied previously at sufficient resolution and imaging dynamic range seems to contain very little gas inside a radius of least 130 astronomical units (AU) from the star. Using adaptive-optics coronagraphy and polarimetry we have imaged the dust in an annulus between 43 and 302 AU from the star, a region never seen before. An azimuthal gap in an annulus of dust at a radius of 102 AU, along with a clearing at closer radii inside this annulus, suggests the formation of at least one small body at an orbital distance of about 100 AU. This structure seems consistent with crude models of mean motion resonances, or accumulation of material at two of the Lagrange points relative to the putative object and the star. We also report a low significance detection of a point source in this outer annulus of dust. This source may be an overdensity in the disk due to dust accreting onto...

  4. The Hydration Structure of Carbon Monoxide by Ab Initio Methods

    CERN Document Server

    Awoonor-Williams, Ernest


    The solvation of carbon monoxide (CO) in liquid water is important for understanding its toxicological effects and biochemical roles. In this paper, we use ab initio molecular dynamics (AIMD) and CCSD(T)-F12 calculations to assess the accuracy of the Straub and Karplus molecular mechanical (MM) model for CO(aq). The CCSD(T)-F12 CO--H2O potential energy surfaces show that the most stable structure corresponds to water donating a hydrogen bond to the C center. The MM-calculated surface it incorrectly predicts that the O atom is a stronger hydrogen bond acceptor than the C atom. The AIMD simulations indicate that CO is solvated like a hydrophobic solute, with very limited hydrogen bonding with water. The MM model tends to overestimate the degree of hydrogen bonding and overestimates the atomic radius of the C atom. The calculated Gibbs energy of hydration is in good agreement with experiment (9.3 kJ/mol calc. vs 10.7 kJ/mol exptl.). The calculated diffusivity of CO(aq) in TIP3P-model water was 5.19 x 10-5 cm2/s ...

  5. Proteolytic Activation of Bacillus thuringiensis Cry2Ab through a Belt-and-Braces Approach. (United States)

    Xu, Lian; Pan, Zhi-Zhen; Zhang, Jing; Liu, Bo; Zhu, Yu-Jing; Chen, Qing-Xi


    Proteolytic processing of Bacillus thuringiensis (Bt) crystal toxins by insect midgut proteases plays an essential role in their insecticidal toxicities against target insects. In the present study, proteolysis of Bt crystal toxin Cry2Ab by Plutella xylostella L. midgut proteases (PxMJ) was evaluated. Both trypsin and chymotrypsin were identified involving the proteolytic activation of Cry2Ab and cleaving Cry2Ab at Arg(139) and Leu(144), respectively. Three Cry2Ab mutants (R139A, L144A, and R139A-L144A) were constructed by replacing residues Arg(139), Leu(144), and Arg(139)-Leu(144) with alanine. Proteolysis assays revealed that mutants R139A and L144A but not R139A-L144A could be cleaved into 50 kDa activated toxins by PxMJ. Bioassays showed that mutants R139A and L144A were highly toxic against P. xylostella larvae, while mutant R139A-L144A was almost non-insecticidal. Those results demonstrated that proteolysis by PxMJ was associated with the toxicity of Cry2Ab against P. xylostella. It also revealed that either trypsin or chymotrypsin was enough to activate Cry2Ab protoxin. This characteristic was regarded as a belt-and-braces approach and might contribute to the control of resistance development in target insects. Our studies characterized the proteolytic processing of Cry2Ab and provided new insight into the activation of this Bt toxin.

  6. A test of Automatic Blowing snow Station (ABS) in the French Alps (United States)

    Ito, Yoichi; Naaim-Bouvet, Florence; Nishimura, Kouichi; Bellot, Hervé; Fontaine, Firmin


    Blowing snow is a significant factor to estimate snow distribution in alpine, Arctic and Antarctic regions. The Snow Particle Counter (SPC) is well used for mass flux measurement of the blowing snow, however, the SPC deployment is not always possible for automatic observation under harsh conditions. Recently Automatic Blowing snow Station (ABS), which is a simpler device than the SPC, have been developed in Japan. We installed the ABS system with the SPCs at the Lac Blanc Pass in the French Alps (2700 m a.s.l.) to examine the relationship between the ABS output and snow particle mass flux. The ABS worked well, without problems, for the entire 4-month period in the winter 2014. The ABS output was converted to mass flux using wind-dependent power function which obtained from calibration procedure in a cold wind-tunnel. The mass flux obtained from the ABS showed a good agreement with the SPC, particularly around the peak of blowing snow event. Based on tests under controlled (cold wind-tunnel) and field conditions, we conclude that the ABS is suitable for practical use.

  7. On Maintenance of Electronic Anti-lock Braking System (ABS)%电控防抱死制动系统(ABS)的检修

    Institute of Scientific and Technical Information of China (English)



    随着汽车制动系统技术的不断改进,电控防抱死ABS系统已逐渐成为汽车的标准配件,了解电控防抱死ABS系统的维修技术对汽车制动系统的维修和故障诊断工作十分重要.ABS主要部件的检修包括:ABS ECU的检修、轮速传感器的检修、液压控制装置的检修、制动压力调节器的检修.%With the continuous improvement of technology related to automobile braking system,electronic anti-lock ABS system has gradually become one of the standard fittings of automobile,to learn maintenance technology related to electronic anti-lock ABS system is of great importance to maintain and fault diagnosing of automobile braking system.The maintenance for main components of ABS includes the maintenance for ABS ECU,wheel speed sensor,hydraulic controlled devices,braking pressure regulator,etc.

  8. The adnAB Locus, Encoding a Putative Helicase-Nuclease Activity, Is Essential in Streptomyces


    Zhang, Lingli; Nguyen, Hoang Chuong; Chipot, Ludovic; Piotrowski, Emilie; Bertrand, Claire; Thibessard, Annabelle; Leblond, Pierre


    Homologous recombination is a crucial mechanism that repairs a wide range of DNA lesions, including the most deleterious ones, double-strand breaks (DSBs). This multistep process is initiated by the resection of the broken DNA ends by a multisubunit helicase-nuclease complex exemplified by Escherichia coli RecBCD, Bacillus subtilis AddAB, and newly discovered Mycobacterium tuberculosis AdnAB. Here we show that in Streptomyces, neither recBCD nor addAB homologues could be detected. The only pu...

  9. AdnAB: a new DSB-resecting motor–nuclease from mycobacteria


    Sinha, Krishna Murari; Unciuleac, Mihaela-Carmen; Glickman, Michael S.; Shuman, Stewart


    The resection of DNA double-strand breaks (DSBs) in bacteria is a motor-driven process performed by a multisubunit helicase–nuclease complex: either an Escherichia coli-type RecBCD enzyme or a Bacillus-type AddAB enzyme. Here we identify mycobacterial AdnAB as the founder of a new family of heterodimeric helicase–nucleases with distinctive properties. The AdnA and AdnB subunits are each composed of an N-terminal UvrD-like motor domain and a C-terminal nuclease module. The AdnAB ATPase is trig...

  10. Studies on Synthesis and Antitumor Activity of Phosphorylated Achyranthes bidentata Polysaccharide (P-AbPS)

    Institute of Scientific and Technical Information of China (English)

    CHEN,Xiao-Ming(陈晓明); ZHANG,Jian(张健); TIAN,Geng-Yuan(田庚元)


    The synthesis of phosphorylated Achyranthes bidentata polysaccharide (P-AbPS) was reported based on different strategies.The P-AbPS with high degree of substitution (D.S. >0.5) was obtained when phosphorus oxychloride (POCl3) was used as a phosphorylating agent and trimethyl phosphate-pyridine or dimethyl formamide was used as solvent. The influences of different solvents and reaction conditins were discussed. Thepharmacology assay shows that P-AbPS possesses antitumor activity against sarcoma 180 and Lewis lung carner in mice.

  11. PirAB Toxin from Photorhabdus asymbiotica as a Larvicide against Dengue Vectors▿


    Ahantarig, Arunee; Chantawat, Nantarat; Waterfield, Nicholas R.; ffrench-Constant, Richard; Kittayapong, Pattamaporn


    We have evaluated Photorhabdus insect-related protein (Pir) from Photorhabdus asymbiotica against dengue vectors. PirAB shows larvicidal activity against both Aedes aegypti and Aedes albopictus larvae but did not affect the Mesocyclops thermocyclopoides predator. PirAB expressed the strongest toxicity compared to PirA, PirB, or the mixture of PirA plus PirB. Whether the presence of an enterobacterial repetitive intergenic consensus sequence in PirAB, but not in PirA, PirB, or the mixture of P...

  12. PirAB toxin from Photorhabdus asymbiotica as a larvicide against dengue vectors. (United States)

    Ahantarig, Arunee; Chantawat, Nantarat; Waterfield, Nicholas R; ffrench-Constant, Richard; Kittayapong, Pattamaporn


    We have evaluated Photorhabdus insect-related protein (Pir) from Photorhabdus asymbiotica against dengue vectors. PirAB shows larvicidal activity against both Aedes aegypti and Aedes albopictus larvae but did not affect the Mesocyclops thermocyclopoides predator. PirAB expressed the strongest toxicity compared to PirA, PirB, or the mixture of PirA plus PirB. Whether the presence of an enterobacterial repetitive intergenic consensus sequence in PirAB, but not in PirA, PirB, or the mixture of PirA plus PirB, has any impact on biological control efficacy needs further investigation.


    Institute of Scientific and Technical Information of China (English)

    Ying Quan; Ming-shah Yang; Qing Yah


    The preparation technology of flame-retardant PC/ABS alloys was studied in this paper. Using a high-efficiency flame retardant system and by means of multiple-ingredient compatibilizing, PC/ABS alloys with excellent impact strength and flame retardant property were prepared. The experimental results showed that by using PS-g-MAH and SMA as synergistic compatibilizers, the notched Izod impact strength and flammability of PC/ABS alloy obtained in the present work can be up to 175 J/m and UL-94 V0, respectively.

  14. Emergence of rotational bands in ab initio no-core configuration interaction calculations

    CERN Document Server

    Caprio, M A; Vary, J P; Smith, R


    Rotational bands have been observed to emerge in ab initio no-core configuration interaction (NCCI) calculations for p-shell nuclei, as evidenced by rotational patterns for excitation energies, electromagnetic moments, and electromagnetic transitions. We investigate the ab initio emergence of nuclear rotation in the Be isotopes, focusing on 9Be for illustration, and make use of basis extrapolation methods to obtain ab initio predictions of rotational band parameters for comparison with experiment. We find robust signatures for rotational motion, which reproduce both qualitative and quantitative features of the experimentally observed bands.

  15. Performance of the molecular Alere I influenza A&B test compared to that of the xpert flu A/B assay. (United States)

    Chapin, Kimberle C; Flores-Cortez, Estefany J


    Data on the performance of rapid molecular point-of-care use platforms for diagnosis of influenza are lacking. We validated nasopharyngeal (NP) flocked specimens in universal transport medium (UTM) and evaluated the clinical sensitivity and specificity of the Alere i influenza A&B test compared to those of the Xpert flu A/B assay. The Alere i influenza A&B test had an overall sensitivity and specificity of 93.8% and 62.5% for influenza A, respectively, and of 91.8% and 53.6% for influenza B, respectively. The poor specificity was due to influenza virus samples determined positive for both type A and B. PMID:25502527

  16. Performance of the Molecular Alere i Influenza A&B Test Compared to That of the Xpert Flu A/B Assay (United States)

    Flores-Cortez, Estefany J.


    Data on the performance of rapid molecular point-of-care use platforms for diagnosis of influenza are lacking. We validated nasopharyngeal (NP) flocked specimens in universal transport medium (UTM) and evaluated the clinical sensitivity and specificity of the Alere i influenza A&B test compared to those of the Xpert flu A/B assay. The Alere i influenza A&B test had an overall sensitivity and specificity of 93.8% and 62.5% for influenza A, respectively, and of 91.8% and 53.6% for influenza B, respectively. The poor specificity was due to influenza virus samples determined positive for both type A and B. PMID:25502527

  17. Atmospheric characterization of the hot Jupiter Kepler-13Ab

    International Nuclear Information System (INIS)

    Kepler-13Ab (= KOI-13.01) is a unique transiting hot Jupiter. It is one of very few known short-period planets orbiting a hot A-type star, making it one of the hottest planets currently known. The availability of Kepler data allows us to measure the planet's occultation (secondary eclipse) and phase curve in the optical, which we combine with occultations observed by warm Spitzer at 4.5 μm and 3.6 μm and a ground-based occultation observation in the Ks band (2.1 μm). We derive a day-side hemisphere temperature of 2750 ± 160 K as the effective temperature of a black body showing the same occultation depths. Comparing the occultation depths with one-dimensional planetary atmosphere models suggests the presence of an atmospheric temperature inversion. Our analysis shows evidence for a relatively high geometric albedo, A g = 0.33−0.06+0.04. While measured with a simplistic method, a high A g is supported also by the fact that the one-dimensional atmosphere models underestimate the occultation depth in the optical. We use stellar spectra to determine the dilution, in the four wide bands where occultation was measured, due to the visual stellar binary companion 1.''15 ± 0.''05 away. The revised stellar parameters measured using these spectra are combined with other measurements, leading to revised planetary mass and radius estimates of Mp = 4.94-8.09 M J and Rp = 1.406 ± 0.038 R J. Finally, we measure a Kepler midoccultation time that is 34.0 ± 6.9 s earlier than expected based on the midtransit time and the delay due to light-travel time and discuss possible scenarios.

  18. Atmospheric Characterization of the Hot Jupiter Kepler-13Ab (United States)

    Shporer, Avi; O'Rourke, Joseph G.; Knutson, Heather A.; Szabó, Gyula M.; Zhao, Ming; Burrows, Adam; Fortney, Jonathan; Agol, Eric; Cowan, Nicolas B.; Desert, Jean-Michel; Howard, Andrew W.; Isaacson, Howard; Lewis, Nikole K.; Showman, Adam P.; Todorov, Kamen O.


    Kepler-13Ab (= KOI-13.01) is a unique transiting hot Jupiter. It is one of very few known short-period planets orbiting a hot A-type star, making it one of the hottest planets currently known. The availability of Kepler data allows us to measure the planet's occultation (secondary eclipse) and phase curve in the optical, which we combine with occultations observed by warm Spitzer at 4.5 μm and 3.6 μm and a ground-based occultation observation in the Ks band (2.1 μm). We derive a day-side hemisphere temperature of 2750 ± 160 K as the effective temperature of a black body showing the same occultation depths. Comparing the occultation depths with one-dimensional planetary atmosphere models suggests the presence of an atmospheric temperature inversion. Our analysis shows evidence for a relatively high geometric albedo, A g = 0.33^{+0.04}_{-0.06}. While measured with a simplistic method, a high A g is supported also by the fact that the one-dimensional atmosphere models underestimate the occultation depth in the optical. We use stellar spectra to determine the dilution, in the four wide bands where occultation was measured, due to the visual stellar binary companion 1.''15 ± 0.''05 away. The revised stellar parameters measured using these spectra are combined with other measurements, leading to revised planetary mass and radius estimates of Mp = 4.94-8.09 M J and Rp = 1.406 ± 0.038 R J. Finally, we measure a Kepler midoccultation time that is 34.0 ± 6.9 s earlier than expected based on the midtransit time and the delay due to light-travel time and discuss possible scenarios.

  19. Ab initio no-core shell model with continuum (United States)

    Navratil, Petr


    The ab initio no-core shell model (NCSM) is a many-body approach to nuclear structure of light nuclei. The NCSM adopts an effective interaction theory to transform fundamental inter-nucleon interactions into effective interactions for a specified nucleus in a selected harmonic oscillator basis space [1]. The method is capable of predicting nuclear structure from inter-nucleon forces derived from quantum chromodynamics by means of chiral effective field theory [2]. NCSM extensions to the microscopic description of nuclear reactions are now under development. In my talk, I will first discuss our recent calculations of the ^4He total photo-absorption cross section using two- and three-nucleon interactions from chiral effective field theory [3]. I will then outline our effort to augment the NCSM by the resonating group method (RGM) technique to develop a new method capable of describing simultaneously both bound states and nuclear reactions on light nuclei [4]. This approach, which preserves translational symmetry and the Pauli principle, will allow us to calculate cross sections of reactions important for astrophysics and describe weakly-bound systems from first principles. I will present our first phase shift results for neutron scattering off ^3H, ^4He and ^7Li and proton scattering off ^3He, ^4He and ^7Be using realistic nucleon-nucleon potentials. 3mm [1] P. Navr'atil, J. P. Vary and B. R. Barrett, Phys. Rev. C 62, 054311 (2000). [2] P. Navr'atil and V. G. Gueorguiev and J. P. Vary, W. E. Ormand and A. Nogga, Phys. Rev. Lett. 99, 042501 (2007). [3] S. Quaglioni and P. Navr'atil, Phys. Lett. B 652, 370 (2007). [4] S. Quaglioni and P. Navr'atil, arXiv:0712.0855.

  20. Atmospheric characterization of the hot Jupiter Kepler-13Ab

    Energy Technology Data Exchange (ETDEWEB)

    Shporer, Avi; O' Rourke, Joseph G.; Knutson, Heather A. [Division of Geological and Planetary Sciences, California Institute of Technology, Pasadena, CA 91125 (United States); Szabó, Gyula M. [ELTE Gothard Astrophysical Observatory, H-9704 Szombathely, Szent Imre herceg út 112 (Hungary); Zhao, Ming [Department of Astronomy and Astrophysics, 525 Davey Laboratory, The Pennsylvania State University, University Park, PA 16802 (United States); Burrows, Adam [Department of Astrophysical Sciences, Princeton University, Princeton, NJ 08544 (United States); Fortney, Jonathan [Department of Astronomy and Astrophysics, University of California, Santa Cruz, CA 95064 (United States); Agol, Eric [Department of Astronomy, University of Washington, Seattle, WA 98195 (United States); Cowan, Nicolas B. [Center for Interdisciplinary Exploration and Research in Astrophysics and Department of Physics and Astronomy, Northwestern University, 2131 Tech Drive, Evanston, IL 60208 (United States); Desert, Jean-Michel [CASA, Department of Astrophysical and Planetary Sciences, University of Colorado, 389-UCB, Boulder, CO 80309 (United States); Howard, Andrew W. [Institute for Astronomy, University of Hawaii, 2680 Woodlawn Drive, Honolulu, HI 96822 (United States); Isaacson, Howard [University of California, Berkeley, CA 94720 (United States); Lewis, Nikole K.; Showman, Adam P. [Department of Planetary Sciences and Lunar and Planetary Laboratory, The University of Arizona, Tucson, AZ 85721 (United States); Todorov, Kamen O. [Institute for Astronomy, ETH Zürich, Wolfgang-Pauli-Strasse 27, 8093 Zürich (Switzerland)


    Kepler-13Ab (= KOI-13.01) is a unique transiting hot Jupiter. It is one of very few known short-period planets orbiting a hot A-type star, making it one of the hottest planets currently known. The availability of Kepler data allows us to measure the planet's occultation (secondary eclipse) and phase curve in the optical, which we combine with occultations observed by warm Spitzer at 4.5 μm and 3.6 μm and a ground-based occultation observation in the K{sub s} band (2.1 μm). We derive a day-side hemisphere temperature of 2750 ± 160 K as the effective temperature of a black body showing the same occultation depths. Comparing the occultation depths with one-dimensional planetary atmosphere models suggests the presence of an atmospheric temperature inversion. Our analysis shows evidence for a relatively high geometric albedo, A {sub g} = 0.33{sub −0.06}{sup +0.04}. While measured with a simplistic method, a high A {sub g} is supported also by the fact that the one-dimensional atmosphere models underestimate the occultation depth in the optical. We use stellar spectra to determine the dilution, in the four wide bands where occultation was measured, due to the visual stellar binary companion 1.''15 ± 0.''05 away. The revised stellar parameters measured using these spectra are combined with other measurements, leading to revised planetary mass and radius estimates of M{sub p} = 4.94-8.09 M {sub J} and R{sub p} = 1.406 ± 0.038 R {sub J}. Finally, we measure a Kepler midoccultation time that is 34.0 ± 6.9 s earlier than expected based on the midtransit time and the delay due to light-travel time and discuss possible scenarios.

  1. Lithium Insertion In Silicon Nanowires: An ab Initio Study

    KAUST Repository

    Zhang, Qianfan


    The ultrahigh specific lithium ion storage capacity of Si nanowires (SiNWs) has been demonstrated recently and has opened up exciting opportunities for energy storage. However, a systematic theoretical study on lithium insertion in SiNWs remains a challenge, and as a result, understanding of the fundamental interaction and microscopic dynamics during lithium insertion is still lacking. This paper focuses on the study of single Li atom insertion into SiNWs with different sizes and axis orientations by using full ab initio calculations. We show that the binding energy of interstitial Li increases as the SiNW diameter grows. The binding energies at different insertion sites, which can be classified as surface, intermediate, and core sites, are quite different. We find that surface sites are energetically the most favorable insertion positions and that intermediate sites are the most unfavorable insertion positions. Compared with the other growth directions, the [110] SiNWs with different diameters always present the highest binding energies on various insertion locations, which indicates that [110] SiNWs are more favorable by Li doping. Furthermore, we study Li diffusion inside SiNWs. The results show that the Li surface diffusion has a much higher chance to occur than the surface to core diffusion, which is consistent with the experimental observation that the Li insertion in SiNWs is layer by layer from surface to inner region. After overcoming a large barrier crossing surface-to-intermediate region, the diffusion toward center has a higher possibility to occur than the inverse process. © 2010 American Chemical Society.

  2. Rapid Solidification of AB{sub 5} Hydrogen Storage Alloys

    Energy Technology Data Exchange (ETDEWEB)

    Gulbrandsen-Dahl, Sverre


    This doctoral thesis is concerned with rapid solidification of AB{sub 5} materials suitable for electrochemical hydrogen storage. The primary objective of the work has been to characterise the microstructure and crystal structure of the produced AB{sub 5} materials as a function of the process parameters, e.g. the cooling rate during rapid solidification, the determination of which has been paid special attention to. The thesis is divided into 6 parts, of which Part I is a literature review, starting with a short presentation of energy storage alternatives. Then a general review of metal hydrides and their utilisation as energy carriers is presented. This part also includes more detailed descriptions of the crystal structure, the chemical composition and the hydrogen storage properties of AB{sub 5} materials. Furthermore, a description of the chill-block melt spinning process and the gas atomisation process is given. In Part II of the thesis a digital photo calorimetric technique has been developed and applied for obtaining in situ temperature measurements during chill-block melt spinning of a Mm(NiCoMnA1){sub 5} hydride forming alloy (Mm = Mischmetal of rare earths). Compared with conventional colour transmission temperature measurements, this technique offers a special advantage in terms of a high temperature resolutional and positional accuracy, which under the prevailing experimental conditions were found to be {+-}29 K and {+-} 0.1 mm, respectively. Moreover, it is shown that the cooling rate in solid state is approximately 2.5 times higher than that observed during solidification, indicating that the solid ribbon stayed in intimate contact with the wheel surface down to very low metal temperatures before the bond was broken. During this contact period the cooling regime shifted from near ideal in the melt puddle to near Newtonian towards the end, when the heat transfer from the solid ribbon to the wheel became the rate controlling step. In Part III of the

  3. Rapid Solidification of AB{sub 5} Hydrogen Storage Alloys

    Energy Technology Data Exchange (ETDEWEB)

    Gulbrandsen-Dahl, Sverre


    This doctoral thesis is concerned with rapid solidification of AB{sub 5} materials suitable for electrochemical hydrogen storage. The primary objective of the work has been to characterise the microstructure and crystal structure of the produced AB{sub 5} materials as a function of the process parameters, e.g. the cooling rate during rapid solidification, the determination of which has been paid special attention to. The thesis is divided into 6 parts, of which Part I is a literature review, starting with a short presentation of energy storage alternatives. Then a general review of metal hydrides and their utilisation as energy carriers is presented. This part also includes more detailed descriptions of the crystal structure, the chemical composition and the hydrogen storage properties of AB{sub 5} materials. Furthermore, a description of the chill-block melt spinning process and the gas atomisation process is given. In Part II of the thesis a digital photo calorimetric technique has been developed and applied for obtaining in situ temperature measurements during chill-block melt spinning of a Mm(NiCoMnA1){sub 5} hydride forming alloy (Mm = Mischmetal of rare earths). Compared with conventional colour transmission temperature measurements, this technique offers a special advantage in terms of a high temperature resolutional and positional accuracy, which under the prevailing experimental conditions were found to be {+-}29 K and {+-} 0.1 mm, respectively. Moreover, it is shown that the cooling rate in solid state is approximately 2.5 times higher than that observed during solidification, indicating that the solid ribbon stayed in intimate contact with the wheel surface down to very low metal temperatures before the bond was broken. During this contact period the cooling regime shifted from near ideal in the melt puddle to near Newtonian towards the end, when the heat transfer from the solid ribbon to the wheel became the rate controlling step. In Part III of the

  4. ABS/PVC合金的热稳定性分析%Analysis on the Heat Stability of ABS&PVC Blends

    Institute of Scientific and Technical Information of China (English)

    马玫; 故行俊; 雷祖碧; 唐金桂



  5. Resistance to Bacillus thuringiensis Toxin Cry2Ab in Trichoplusia ni Is Conferred by a Novel Genetic Mechanism


    Song, Xiaozhao; Kain, Wendy; Cassidy, Douglas; Wang, Ping


    The resistance to the Bacillus thuringiensis (Bt) toxin Cry2Ab in a greenhouse-originated Trichoplusia ni strain resistant to both Bt toxins Cry1Ac and Cry2Ab was characterized. Biological assays determined that the Cry2Ab resistance in the T. ni strain was a monogenic recessive trait independent of Cry1Ac resistance, and there existed no significant cross-resistance between Cry1Ac and Cry2Ab in T. ni. From the dual-toxin-resistant T. ni strain, a strain resistant to Cry2Ab only was isolated,...

  6. The end of a myth—Bt (Cry1Ab) maize does not harm green lacewings (United States)

    Romeis, Jörg; Meissle, Michael; Naranjo, Steven E.; Li, Yunhe; Bigler, Franz


    A concern with Bt-transgenic insect-resistant plants is their potential to harm non-target organisms. Early studies reported that Cry1Ab-producing Bt maize and purified Cry1Ab harmed larvae of the green lacewing, Chrysoperla carnea. Although these effects could not be confirmed in subsequent studies, some authors still refer to them as evidence that Bt maize harms beneficial species. We provide a comprehensive review of the studies evaluating the effects of Bt (Cry1Ab) maize on C. carnea. The evidence indicates that this important predator is not affected by Bt maize or by the produced Cry1Ab protein. We discuss how conceptual models can assist environmental risk assessments, and we emphasize the importance of robust and reproducible studies. PMID:25161661

  7. The end of a myth-Bt (Cry1Ab) maize does not harm green lacewings. (United States)

    Romeis, Jörg; Meissle, Michael; Naranjo, Steven E; Li, Yunhe; Bigler, Franz


    A concern with Bt-transgenic insect-resistant plants is their potential to harm non-target organisms. Early studies reported that Cry1Ab-producing Bt maize and purified Cry1Ab harmed larvae of the green lacewing, Chrysoperla carnea. Although these effects could not be confirmed in subsequent studies, some authors still refer to them as evidence that Bt maize harms beneficial species. We provide a comprehensive review of the studies evaluating the effects of Bt (Cry1Ab) maize on C. carnea. The evidence indicates that this important predator is not affected by Bt maize or by the produced Cry1Ab protein. We discuss how conceptual models can assist environmental risk assessments, and we emphasize the importance of robust and reproducible studies.

  8. Domino Wittig Diels-Alder reaction: An expeditious entry into the AB ring system of furanosesquiterpenes

    Digital Repository Service at National Institute of Oceanography (India)

    Patre, R.E.; Gawas, S.; Sen, S.; Parameswaran, P.S.; Tilve, S.G.

    A domino Wittig Diels - Alder reaction has been employed in delineating a short and flexible synthetic stratagem for ready access to the AB ring system and the tricyclic framework of furanosesquiterpenes, such as the bioactive natural products...

  9. Effects of alloying side B on Ti-based AB2 hydrogen storage alloys

    Institute of Scientific and Technical Information of China (English)

    王家淳; 于荣海; 刘庆


    Ti-based AB2-type hydrogen storage alloys are a group of promising materials, which will probably replace the prevalent rare earth-based AB5-type alloys and be adopted as the main cathode materials of nickelmetal hydride (Ni-MH) batteries in the near future. Alloying in side B is a major way to improve the performance of Ti-based AB2-type alloys. Based on recent studies, the effects of alloying elements in side B upon the performance of Ti-based AB2 -type hydrogen storage alloys are systematically reviewed here. These performances are divided into two categories, namely PCI characteristics, including hydrogen storage capacity (HSC), plateau pressure (PP), pressure hysteresis (PH) and pressure plateau sloping (PPS) , and electrochemical properties, including discharge capacity (DC), activation property (AP), cycling stability (CS) and high-rate dischargeability (HRD). Furthermore, the existing problems in these investigations and some suggestions for future research are proposed.

  10. Hydrogen adsorption on boron doped graphene: an {\\it ab initio} study


    Miwa, R. H.; Martins, T B; Fazzio, A.


    The electronic and structural properties of (i) boron doped graphene sheets, and (ii) the chemisorption processes of hydrogen adatoms on the boron doped graphene sheets have been examined by {\\it ab initio} total energy calculations.

  11. Phosphoric acid doped AB-PBI membranes and its applications in high temperature PEMFC

    DEFF Research Database (Denmark)

    He, Ronghuan; Qingfeng, Li; Bjerrum, Niels


    Poly(2,5-benzimidazole) (ab-PBI) was prepared from 3,4-diaminobenzoic acid via a polymerisation reaction. The obtained polymer exhibits excellent thermal stability in a temperature range ….. The membrane of ab-PBI when doped with phosphoric acid at room temperaturepresents high proton conductivity...... in a wide temperature range.. The conductivity of the acid doped ab-PBI membranes was studied in a temperature range of 80oC to 200oC under different relative humidity and with different acid doping levels. PEMFC test results indicated that the fuel cell could be operated at temperatures up to 200o......C with phosphoric acid doped ab-PBI as the electrolyte under atmospheric pressure at 200°C without humidification....

  12. Time-resolved photoelectron spectroscopy and ab initio multiple spawning studies of hexamethylcyclopentadiene

    DEFF Research Database (Denmark)

    Wolf, T. J. A.; Kuhlman, Thomas Scheby; Schalk, O.;


    Time-resolved photoelectron spectroscopy and ab initio multiple spawning were applied to the ultrafast non-adiabatic dynamics of hexamethylcyclopentadiene. The high level of agreement between experiment and theory associates wavepacket motion with a distinct degree of freedom....

  13. Data of evolutionary structure change: 1D3AB-1LLDA [Confc[Archive

    Lifescience Database Archive (English)


  14. Isolation and Characterization of a Virulent Bacteriophage AB1 of Acinetobacter baumannii

    Directory of Open Access Journals (Sweden)

    Jia Shiru


    Full Text Available Abstract Background Acinetobacter baumannii is an emerging nosocomial pathogen worldwide with increasing prevalence of multi-drug and pan-drug resistance. A. baumannii exists widely in natural environment, especially in health care settings, and has been shown difficult to be eradicated. Bacteriophages are often considered alternative agent for controlling bacterial infection and contamination. In this study, we described the isolation and characterization of one virulent bacteriophage AB1 capable of specifically infecting A. baumannii. Results A virulent bacteriophage AB1, specific for infecting a clinical strain A. baumannii KD311, was first isolated from marine sediment sample. Restriction analysis indicated that phage AB1 was a dsDNA virus with an approximate genome size of 45.2 kb to 46.9 kb. Transmission electron microscopy showed that phage AB1 had an icosahedral head with a non-contractile tail and collar or whisker structures, and might be tentatively classified as a member of the Siphoviridae family. Proteomic pattern of phage AB1, generated by SDS-PAGE using purified phage particles, revealed five major bands and six minor bands with molecular weight ranging from 14 to 80 kilo-dalton. Also determined was the adsorption rate of phage AB1 to the host bacterium, which was significantly enhanced by addition of 10 mM CaCl2. In a single step growth test, phage AB1 was shown having a latent period of 18 minutes and a burst size of 409. Moreover, pH and thermal stability of phage AB1 were also investigated. At the optimal pH 6.0, 73.2% of phages survived after 60 min incubation at 50°C. When phage AB1 was used to infect four additional clinical isolates of A. baumannii, one clinical isolate of Stenotrophomonas maltophilia, and Pseudomonas aeruginosa lab strains PAK and PAO1, none of the tested strains was found susceptible, indicating a relatively narrow host range for phage AB1. Conclusion Phage AB1 was capable of eliciting efficient lysis

  15. AdnAB: a new DSB-resecting motor-nuclease from mycobacteria. (United States)

    Sinha, Krishna Murari; Unciuleac, Mihaela-Carmen; Glickman, Michael S; Shuman, Stewart


    The resection of DNA double-strand breaks (DSBs) in bacteria is a motor-driven process performed by a multisubunit helicase-nuclease complex: either an Escherichia coli-type RecBCD enzyme or a Bacillus-type AddAB enzyme. Here we identify mycobacterial AdnAB as the founder of a new family of heterodimeric helicase-nucleases with distinctive properties. The AdnA and AdnB subunits are each composed of an N-terminal UvrD-like motor domain and a C-terminal nuclease module. The AdnAB ATPase is triggered by dsDNA with free ends and the energy of ATP hydrolysis is coupled to DSB end resection by the AdnAB nuclease. The mycobacterial nonhomologous end-joining (NHEJ) protein Ku protects DSBs from resection by AdnAB. We find that AdnAB incises ssDNA by measuring the distance from the free 5' end to dictate the sites of cleavage, which are predominantly 5 or 6 nucleotides (nt) from the 5' end. The "molecular ruler" of AdnAB is regulated by ATP, which elicits an increase in ssDNA cleavage rate and a distal displacement of the cleavage sites 16-17 nt from the 5' terminus. AdnAB is a dual nuclease with a clear division of labor between the subunits. Mutations in the nuclease active site of the AdnB subunit ablate the ATP-inducible cleavages; the corresponding changes in AdnA abolish ATP-independent cleavage. Complete suppression of DSB end resection requires simultaneous mutation of both subunit nucleases. The nuclease-null AdnAB is a helicase that unwinds linear plasmid DNA without degrading the displaced single strands. Mutations of the phosphohydrolase active site of the AdnB subunit ablate DNA-dependent ATPase activity, DSB end resection, and ATP-inducible ssDNA cleavage; the equivalent mutations of the AdnA subunit have comparatively little effect. AdnAB is a novel signature of the Actinomycetales taxon. Mycobacteria are exceptional in that they encode both AdnAB and RecBCD, suggesting the existence of alternative end-resecting motor-nuclease complexes. PMID:19470566

  16. Improving the control of work-in-process at VSM Group AB


    Karlsson, Per-Johan; Porto, Mariana


    Today many companies face problems with inventory management. The importance of adequate inventory management has become more evident, while organizations try to reduce their costs and increase their service level. This master thesis was conducted at VSM Group AB in Huskvarna, which is a manufacturer that produces and delivers sewing machines to a worldwide market. VSM Group AB has problems with the management and the refilling of the work-in-process (WIP) inventories and also with lack of in...

  17. An ab initio Non-Equilibrium Green Function Approach to Charge Transport: Dithiolethine

    Institute of Scientific and Technical Information of China (English)

    Alexander Schnurpfeil; SONG Bo; Martin Albrecht


    @@ We present a novel ab initio non-equilibrium approach to calculate the current across a molecular junction. The method rests on a wavefunction-based full ab initio description of the central region of the junction combined with a tight binding approximation for the electrodes in the frame of the Keldysh Green function formalism. Our procedure is demonstrated for a dithiolethine molecule located between silver electrodes. The main conducting channel is identified and the full current-voltage characteristic is calculated.

  18. Effects of POSS nanoparticles on ABS-g-Ma thermo oxidation resistance


    Vilà Ramirez, N.; Sánchez Soto, Miguel


    Thermo oxidative degradation at and beyond process- ing temperatures has been carried out on ABS copoly- mer grafted with Maleic Anhydride (ABS- g -Ma) and three nanocomposites with the above material melt-blended with different types of POSS, being amino-propyl isobutyl (APOSS), glycidyl (GPOSS), and trisilanol (TPOSS). The incorporation adequacy of the nanofillers into the matrix has been assessed with scanning electron microscopy (SEM) and differential scan...



    He, Yao


    Oy Golden Crop Ab has been founded in 2012 February and is food trading company in Finland which supplies the Asian restaurants all over the Finland. For example, Chinese restaurants, Sushi restaurants, Thai restaurants, Indian restaurants and Vietnamese restaurants. Due to the high competition in the Helsinki region, the company needs to improve its system from customer perspective The aim of this thesis is to generate models to manage customer life-cycle for Oy Golden Crop Ab. Therefor...

  20. Enantioselective synthesis of the predominant AB ring system of the Schisandra nortriterpenoid natural products. (United States)

    Gockel, Birgit; Goh, Shermin S; Puttock, Emma J; Baars, Hannah; Chaubet, Guilhem; Anderson, Edward A


    An enantioselective synthesis of the AB ring system common to the majority of the Schisandra nortriterpenoid natural products is reported. Key steps include a stereospecific ring opening of a trisubstituted epoxide and the use of a β-lactone to enable installation of the gem-dimethyl functionality of the B ring. An acetalization strategy played a key role in a late-stage biomimetic AB ring bicyclization.

  1. AbCD: arbitrary coverage design for sequencing-based genetic studies


    Kang, Jian; Huang, Kuan-Chieh; Xu, Zheng; Wang, Yunfei; Abecasis, Gonçalo R.; Li, Yun


    Summary: Recent advances in sequencing technologies have revolutionized genetic studies. Although high-coverage sequencing can uncover most variants present in the sequenced sample, low-coverage sequencing is appealing for its cost effectiveness. Here, we present AbCD (arbitrary coverage design) to aid the design of sequencing-based studies. AbCD is a user-friendly interface providing pre-estimated effective sample sizes, specific to each minor allele frequency category, for designs with arbi...

  2. Immunoglobulin fragments, F(ab')2, that are cytotoxic to enzyme-treated cells. (United States)

    Holtgrewe, E M; Killion, J J


    Bivalent immunoglobulin fragments of IgG, F(ab')2, prepared from normal murine sera were found to be cytotoxic to neuraminidase-treated cells. The fragments were cytotoxic to both allogenic and syngeneic targets (with respect to the source of the sera), suggesting that the antigen bound by the F(ab')2 is not related to the major histocompatibility locus of mice (H-2).

  3. Plasmid-Mediated OqxAB Is an Important Mechanism for Nitrofurantoin Resistance in Escherichia coli. (United States)

    Ho, Pak-Leung; Ng, Ka-Ying; Lo, Wai-U; Law, Pierra Y; Lai, Eileen Ling-Yi; Wang, Ya; Chow, Kin-Hung


    Increasing consumption of nitrofurantoin (NIT) for treatment of acute uncomplicated urinary tract infections (UTI) highlights the need to monitor emerging NIT resistance mechanisms. This study investigated the molecular epidemiology of the multidrug-resistant efflux gene oqxAB and its contribution to nitrofurantoin resistance by using Escherichia coli isolates originating from patients with UTI (n = 205; collected in 2004 to 2013) and food-producing animals (n = 136; collected in 2012 to 2013) in Hong Kong. The oqxAB gene was highly prevalent among NIT-intermediate (11.5% to 45.5%) and -resistant (39.2% to 65.5%) isolates but rare (0% to 1.7%) among NIT-susceptible (NIT-S) isolates. In our isolates, the oqxAB gene was associated with IS26 and was carried by plasmids of diverse replicon types. Multilocus sequence typing revealed that the clones of oqxAB-positive E. coli were diverse. The combination of oqxAB and nfsA mutations was found to be sufficient for high-level NIT resistance. Curing of oqxAB-carrying plasmids from 20 NIT-intermediate/resistant UTI isolates markedly reduced the geometric mean MIC of NIT from 168.9 μg/ml to 34.3 μg/ml. In the plasmid-cured variants, 20% (1/5) of isolates with nfsA mutations were NIT-S, while 80% (12/15) of isolates without nfsA mutations were NIT-S (P = 0.015). The presence of plasmid-based oqxAB increased the mutation prevention concentration of NIT from 128 μg/ml to 256 μg/ml and facilitated the development of clinically important levels of nitrofurantoin resistance. In conclusion, plasmid-mediated oqxAB is an important nitrofurantoin resistance mechanism. There is a great need to monitor the dissemination of this transferable multidrug-resistant efflux pump.

  4. High Yield Chemical Vapor Deposition Growth of High Quality Large-Area AB Stacked Bilayer Graphene


    Liu, Lixin; Zhou, Hailong; Cheng, Rui; Yu, Woo Jong; Liu, Yuan; Chen, Yu; Shaw, Jonathan; Zhong, Xing; Huang, Yu; Duan, Xiangfeng


    Bernal stacked (AB stacked) bilayer graphene is of significant interest for functional electronic and photonic devices due to the feasibility to continuously tune its band gap with a vertical electrical field. Mechanical exfoliation can be used to produce AB stacked bilayer graphene flakes but typically with the sizes limited to a few micrometers. Chemical vapor deposition (CVD) has been recently explored for the synthesis of bilayer graphene but usually with limited coverage and a mixture of...

  5. Composition of the Putative Prepore Complex of Bacillus thuringiensis Cry1Ab Toxin


    Nair, Manoj S; Dean, Donald H.


    Prepore formation is hypothesized to be an obligate step in the insertion of Cry1Ab toxin into insect brush border membrane vesicles. We examined the architecture of the putative prepore when isolated using the published protocols [1] [2]. Our results demonstrate that the putative prepore form of Cry1Ab is a combination of receptor proteins attached to the toxin, when purified. The results also suggest that this prepore form as prepared by the methods published is different from other membran...

  6. Hidroponik Tanaman Sayuran Sawi Beda Varietas Dengan Formulasi Nurtisi Ab Mix Dan Formulasi Racikan


    Siagian, Vyvian W.


    Vyvian W Siagian, research “Hydroponics of Mustard Vegetable Crops Different Varieties with AB Mix Nutrient and Self-made Nutrient Formulation”, supervised by Ir. Bintang, MP and Ir. Fauzi, MP. This research is aimed to find a differences production from hydroponics of mustard vegetable crops which is have a different varity within AB Mix nutrient and self-made nutrient formulation. It was located at Kompleks Citra Arkadia Jl. Bunga Wijaya Padang Bulan, Medan on June 2015 until September 2015...

  7. URHEILUN SPONSOROINTI JA LUMILAUTAILU : FOREX Bank Ab:n mahdollisuudet lumilautailun sponsorointiin


    Autio, Suvi


    FOREX Bank Ab on Pohjoismaiden suurin valuutanvaihtoon erikoistunut yritys. FOREXin liikeideana on tarjota maasta lähteville ja maahan saapuville matkailijoille valuuttaa joustaviin kellonaikoihin, keskeisillä paikoilla, sekä kilpailukykyisillä kursseilla ja toimitusmaksuilla. Opinnäytetyön aiheena oli urheilun sponsorointi ja lumilautailu. Opinnäytetyön tarkoituksena oli selvittää FOREX Bank Ab:n sponsoroinnin nykytilaa ja lumilautailun sopivuutta FOREXin sponsorointikohteeksi. Teoriaosu...

  8. Offering Students a Selection of Multiple Class B/AB Power Amplifiers as a Remote Laboratory

    Directory of Open Access Journals (Sweden)

    Dag Andreas Hals Samuelsen


    Full Text Available In this paper a remote laboratory setup for conducting experiments on a class B/AB power amplifier is presented, addressing the problems related to running experiments requiring temperature matching between transistors and bias diodes, in order to avoid thermal runaway in the transistors. In addition there is an option for the student to quickly examine a range of different transistors in both class B and class AB setups.

  9. A Novel Variant in CMAH Is Associated with Blood Type AB in Ragdoll Cats (United States)

    Gandolfi, Barbara; Grahn, Robert A.; Gustafson, Nicholas A.; Proverbio, Daniela; Spada, Eva; Adhikari, Badri; Cheng, Janling; Andrews, Gordon; Lyons, Leslie A.; Helps, Chris R.


    The enzyme cytidine monophospho-N-acetylneuraminic acid hydroxylase is associated with the production of sialic acids on cat red blood cells. The cat has one major blood group with three serotypes; the most common blood type A being dominant to type B. A third rare blood type is known as AB and has an unclear mode of inheritance. Cat blood type antigens are defined, with N-glycolylneuraminic acid being associated with type A and N-acetylneuraminic acid with type B. Blood type AB is serologically characterized by agglutination using typing reagents directed against both A and B epitopes. While a genetic characterization of blood type B has been achieved, the rare type AB serotype remains genetically uncharacterized. A genome-wide association study in Ragdoll cats (22 cases and 15 controls) detected a significant association between blood type AB and SNPs on cat chromosome B2, with the most highly associated SNP being at position 4,487,432 near the candidate gene cytidine monophospho-N-acetylneuraminic acid hydroxylase. A novel variant, c.364C>T, was identified that is highly associated with blood type AB in Ragdoll cats and, to a lesser degree, with type AB in random bred cats. The newly identified variant is probably linked with blood type AB in Ragdoll cats, and is associated with the expression of both antigens (N-glycolylneuraminic acid and N-acetylneuraminic acid) on the red blood cell membrane. Other variants, not identified by this work, are likely to be associated with blood type AB in other breeds of cat. PMID:27171395

  10. An ab initio study of plutonium oxides surfaces; Etude ab initio des surfaces d'oxydes de Pu

    Energy Technology Data Exchange (ETDEWEB)

    Jomard, G.; Bottin, F.; Amadon, B


    By means of first-principles calculations, we have studied the atomic structure as well as the thermodynamic stability of various plutonium dioxide surfaces in function of their environment (in terms of oxygen partial pressure and temperature). All these simulations have been performed with the ABINIT code. It is well known that DFT fails to describe correctly plutonium-based materials since 5f electrons in such systems are strongly correlated. In order to go beyond DFT, we have treated PuO{sub 2} and {beta}-Pu{sub 2}O{sub 3} in a DFT+U framework. We show that the couple of parameters (U,J) that works well for pure Pu is also well designed for describing ground state (GS) properties of these two oxides. The major improvement with respect with DFT is that we are able to predict an insulating GS in agreement with experiments. The presence of a gap in the DOS (Density of States) of plutonium oxides should play a significant role in the predicted surface reactivity. However, performing DFT+U calculations on surfaces of plutonium oxide from scratch was too ambitious. That is why we decided, as a first step, to study the stability of the (100), (110) and (111) surfaces of PuO{sub 2} in a DFT-GGA framework. For each of these orientations, we considered various terminations. These ab initio results have been introduced in a thermodynamic model which allows us to predict the relative stability of the different terminations as a function of temperature and oxygen partial pressure (p{sub O{sub 2}}). We conclude that at room temperature and for p{sub O{sub 2}}{approx}10 atm., the polar O{sub 2}-(100) termination is favoured. The stabilization of such a polar stoichiometric surface is surprising and should be confirmed by DFT+U calculations before any final conclusion. (authors)

  11. Hepatoma-Targeted Radionuclide Immune Albumin Nanospheres: (131)I-antiAFPMcAb-GCV-BSA-NPs. (United States)

    Lin, Mei; Huang, Junxing; Zhang, Dongsheng; Jiang, Xingmao; Zhang, Jia; Yu, Hong; Xiao, Yanhong; Shi, Yujuan; Guo, Ting


    An effective strategy has been developed for synthesis of radionuclide immune albumin nanospheres ((131)I-antiAFPMcAb-GCV-BSA-NPs). In vitro as well as in vivo targeting of (131)I-antiAFPMcAb-GCV-BSA-NPs to AFP-positive hepatoma was examined. In cultured HepG2 cells, the uptake and retention rates of (131)I-antiAFPMcAb-GCV-BSA-NPs were remarkably higher than those of (131)I alone. As well, the uptake rate and retention ratios of (131)I-antiAFPMcAb-GCV-BSA-NPs in AFP-positive HepG2 cells were also significantly higher than those in AFP-negative HEK293 cells. Compared to (131)I alone, (131)I-antiAFPMcAb-GCV-BSA-NPs were much more easily taken in and retained by hepatoma tissue, with a much higher T/NT. Due to good drug-loading, high encapsulation ratio, and highly selective affinity for AFP-positive tumors, the (131)I-antiAFPMcAb-GCV-BSA-NPs are promising for further effective radiation-gene therapy of hepatoma.

  12. Treatment with Anti-EGF Ab Ameliorates Experimental Autoimmune Encephalomyelitis via Induction of Neurogenesis and Oligodendrogenesis

    Directory of Open Access Journals (Sweden)

    Yifat Amir-Levy


    Full Text Available Background. The neural stem cells (NSCs migrate to the damaged sites in multiple sclerosis (MS and in experimental autoimmune encephalomyelitis (EAE. However, the differentiation into neurons or oligodendrocytes is blocked. Epidermal growth factor (EGF stimulates NSC proliferation and mobilization to demyelinated lesions but also induces astrogenesis and glial scar. Objective. To examine the clinical and histopathological effects of EGF neutralization on EAE. Methods. EAE-induced SJL mice were intravenously treated with either anti-EGF neutralizing antibody (Ab or isotype control or PBS. On day 9 after immunization, 3 mice of each group were daily treated for 9 days with BrdU and then sacrificed for immunohistochemical analysis. Results. Treatment with anti-EGF Ab significantly ameliorated EAE symptoms during the second relapse. Anti-EGF Ab induced a shift from BrdU+GFAP+ NSCs to BrdU+DCX+ neuroblasts in the subventricular zone (SVZ, increased BrdU+NeuN+ neurons in the granular cell layer of the dentate gyrus, and increased BrdU+O4+ oligodendrocytes in the SVZ. There was no change in the inflammatory infiltrates in response to anti-EGF Ab. Conclusions. Therapy with anti-EGF Ab ameliorates EAE via induction of neurogenesis and oligodendrogenesis. No immunosuppressive effect was found. Further investigation is needed to support these notions of beneficial effect of anti-EGF Ab in MS.

  13. Formation of reflective and conductive silver film on ABS surface via covalent grafting and solution spray

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Dexin; Zhang, Yan [School of Mechanical and Automotive Engineering, South China University of Technology, 381 Wushan, Guangzhou 510640 (China); Bessho, Takeshi [Higashifuji Technical Center, Toyota Motor Corporation, 1200 Mishuku, Susono, Shizuoka 410-1193 (Japan); Kudo, Takahiro; Sang, Jing; Hirahara, Hidetoshi; Mori, Kunio [Faculty of Engineering, Iwate University, 4-3-5 Ueda, Morioka 020-8551 (Japan); Kang, Zhixin, E-mail: [School of Mechanical and Automotive Engineering, South China University of Technology, 381 Wushan, Guangzhou 510640 (China)


    Highlights: • A pure and homogenous silver film was deposited by spray-style plating technique. • The mechanism of covalent bonding between coating and substrate was studied. • The silver coating is highly reflective and conductive. • UV light was used to activate the ABS surface with triazine azide derivative. - Abstract: Conductive and reflective silver layers on acrylonitrile butadiene styrene (ABS) plastics have been prepared by photo grafting of triazine azides upon ultraviolet activation, self-assembling of triazine dithiols and silver electroless plating by solution spray based on silver mirror reaction. The as-prepared silver film exhibited excellent adhesion with ABS owing to covalent bonds between coating and substrate, and the detailed bonding mechanism have been investigated by X-ray photoelectron spectroscopy (XPS). X-ray diffraction (XRD) result revealed that silver film on ABS was pure and with a nanocrystalline structure. Atomic force microscope (AFM) analysis demonstrated that massive silver particles with sizes varying from 80 to 120 nm were deposited on ABS and formed a homogenous and smooth coating, resulting in highly reflective surface. Furthermore, silver maintained its unique conductivity even as film on ABS surface in term of four-point probe method.

  14. Transcriptional silencing and developmental reactivation of cry1Ab gene in transgenic rice

    Institute of Scientific and Technical Information of China (English)

    WU; Gang(吴刚); CUI; Hairui(崔海瑞); SHU; Qingyao(舒庆尧); YE; Gongyin(叶恭银); XIA; Yingwu(夏英武); GAO; Mingwei(高明蔚); Illimar; Altosaar; LI; Yi(李毅)


    One transgenic rice line lacking Cry1Ab expression product was screened in the progenies of Agrobacterium-transformed transgenic rice variety Zhong 8215 with a cry1Ab gene under field releasing conditions by using GUS histochemical assay and Western blot. Molecular hybridization results revealed that the cry1Ab gene was silenced in the transgenic rice variety Zhong 8215 and two copies of ubiquitin promoter were integrated into the rice genome. The silencing of cry1Ab gene in transgenic rice was found to be due to the methylation of the ubiquitin promoter as revealed by methylation analysis. Meanwhile, different concentrations of demethylation reagent 5-azacytidine combining with different treatment time were employed to treat the silenced transgenic rice seeds. The results indicated that 5-azacytidine could reactivate 8%-30% of the silenced transgenic rice plants and the expression level of the reactivated cry1Ab transgene could reach as high as 0.147% of the total soluble protein. Treatment with low concentration of 5-azacytidine(45 mg/L for 1 d and 2 d) could lead to the highest reactivation ratio and the highest expression level of the cry1Ab gene.

  15. Cry1Ab protein from Bt transgenic rice does not residue in rhizosphere soil

    International Nuclear Information System (INIS)

    Expression of Cry1Ab protein in Bt transgenic rice (KMD) and its residue in the rhizosphere soil during the whole growth in field, as well as degradation of the protein from KMD straw in five soils under laboratory incubation were studied. The residue of Cry1Ab protein in KMD rhizosphere soil was undetectable (below the limit of 0.5 ng/g air-dried soil). The Cry1Ab protein contents in the shoot and root of KMD were 3.23-8.22 and 0.68-0.89 μg/g (fresh weight), respectively. The half-lives of the Cry1Ab protein in the soils amended with KMD straw (4%, w/w) ranged from 11.5 to 34.3 d. The residence time of the protein varied significantly in a Fluvio-marine yellow loamy soil amended with KMD straw at the rate of 3, 4 and 7%, with half-lives of 9.9, 13.8 and 18 d, respectively. In addition, an extraction method for Cry1Ab protein in soil was developed, with extraction efficiencies of 46.4-82.3%. - Cry1Ab protein was not detected in the rhizosphere soil of field-grown Bt transgenic rice

  16. Yeast killer toxin-like candidacidal Ab6 antibodies elicited through the manipulation of the idiotypic cascade. (United States)

    Polonelli, Luciano; Beninati, Concetta; Teti, Giuseppe; Felici, Franco; Ciociola, Tecla; Giovati, Laura; Sperindè, Martina; Lo Passo, Carla; Pernice, Ida; Domina, Maria; Arigò, Milena; Papasergi, Salvatore; Mancuso, Giuseppe; Conti, Stefania; Magliani, Walter


    A mouse anti-anti-anti-idiotypic (Id) IgM monoclonal antibody (mAb K20, Ab4), functionally mimicking a Wyckerhamomyces anomalus (Pichia anomala) killer toxin (KT) characterized by fungicidal activity against yeasts presenting specific cell wall receptors (KTR) mainly constituted by β-1,3-glucan, was produced from animals presenting anti-KT Abs (Ab3) following immunization with a rat IgM anti-Id KT-like mAb (mAb K10, Ab2). MAb K10 was produced by immunization with a KT-neutralizing mAb (mAb KT4, Ab1) bearing the internal image of KTR. MAb K20, likewise mAb K10, proved to be fungicidal in vitro against KT-sensitive Candida albicans cells, an activity neutralized by mAb KT4, and was capable of binding to β-1,3-glucan. MAb K20 and mAb K10 competed with each other and with KT for binding to C. albicans KTR. MAb K20 was used to identify peptide mimics of KTR by the selection of phage clones from random peptide phage display libraries. Using this strategy, four peptides (TK 1-4) were selected and used as immunogen in mice in the form of either keyhole limpet hemocyanin (KLH) conjugates or peptide-encoding minigenes. Peptide and DNA immunization could induce serum Abs characterized by candidacidal activity, which was inhibited by laminarin, a soluble β-1,3-glucan, but not by pustulan, a β-1,6-glucan. These findings show that the idiotypic cascade can not only overcome the barrier of animal species but also the nature of immunogens and the type of technology adopted. PMID:25162681

  17. Yeast killer toxin-like candidacidal Ab6 antibodies elicited through the manipulation of the idiotypic cascade.

    Directory of Open Access Journals (Sweden)

    Luciano Polonelli

    Full Text Available A mouse anti-anti-anti-idiotypic (Id IgM monoclonal antibody (mAb K20, Ab4, functionally mimicking a Wyckerhamomyces anomalus (Pichia anomala killer toxin (KT characterized by fungicidal activity against yeasts presenting specific cell wall receptors (KTR mainly constituted by β-1,3-glucan, was produced from animals presenting anti-KT Abs (Ab3 following immunization with a rat IgM anti-Id KT-like mAb (mAb K10, Ab2. MAb K10 was produced by immunization with a KT-neutralizing mAb (mAb KT4, Ab1 bearing the internal image of KTR. MAb K20, likewise mAb K10, proved to be fungicidal in vitro against KT-sensitive Candida albicans cells, an activity neutralized by mAb KT4, and was capable of binding to β-1,3-glucan. MAb K20 and mAb K10 competed with each other and with KT for binding to C. albicans KTR. MAb K20 was used to identify peptide mimics of KTR by the selection of phage clones from random peptide phage display libraries. Using this strategy, four peptides (TK 1-4 were selected and used as immunogen in mice in the form of either keyhole limpet hemocyanin (KLH conjugates or peptide-encoding minigenes. Peptide and DNA immunization could induce serum Abs characterized by candidacidal activity, which was inhibited by laminarin, a soluble β-1,3-glucan, but not by pustulan, a β-1,6-glucan. These findings show that the idiotypic cascade can not only overcome the barrier of animal species but also the nature of immunogens and the type of technology adopted.

  18. Characterization of the mechanism of action of the genetically modified Cry1AbMod toxin that is active against Cry1Ab-resistant insects. (United States)

    Muñóz-Garay, Carlos; Portugal, Leivi; Pardo-López, Liliana; Jiménez-Juárez, Nuria; Arenas, Ivan; Gómez, Isabel; Sánchez-López, Rosana; Arroyo, Raquel; Holzenburg, Andreas; Savva, Christos G; Soberón, Mario; Bravo, Alejandra


    Bacillus thuringiensis Cry toxins are used in the control of insect pests. They are pore-forming toxins with a complex mechanism that involves the sequential interaction with receptors. They are produced as protoxins, which are activated by midgut proteases. Activated toxin binds to cadherin receptor, inducing an extra cleavage including helix alpha-1, facilitating the formation of a pre-pore oligomer. The toxin oligomer binds to secondary receptors such as aminopeptidase and inserts into lipid rafts forming pores and causing larval death. The primary threat to efficacy of Bt-toxins is the evolution of insect resistance. Engineered Cry1AMod toxins, devoid of helix alpha-1, could be used for the control of resistance in lepidopterans by bypassing the altered cadherin receptor, killing resistant insects affected in this receptor. Here we analyzed the mechanism of action of Cry1AbMod. We found that alkaline pH and the presence of membrane lipids facilitates the oligomerization of Cry1AbMod. In addition, tryptophan fluorescence emission spectra, ELISA binding to pure aminopeptidase receptor, calcein release assay and analysis of ionic-conductance in planar lipid bilayers, indicated that the secondary steps in mode of action that take place after interaction with cadherin receptor such as oligomerization, receptor binding and pore formation are similar in the Cry1AbMod and in the wild type Cry1Ab. Finally, the membrane-associated structure of Cry1AbMod oligomer was analyzed by electron crystallography showing that it forms a complex with a trimeric organization. PMID:19559004

  19. Generation of Monoclonal Antibodies against Non-structural Protein 3AB of Foot-and-Mouth Disease Virus

    Institute of Scientific and Technical Information of China (English)

    Tong Lin; Junjun Shao; Huiyun Chang; Shandian Gao; Guozheng Cong; Junzheng Du


    To identify linear epitopes on the non-structural protein 3AB of foot-and-mouth disease virus (FMDV),BABL/c mice were immunized with the 3AB protein and splenocytes of BALB/c mice were fused with myeloma Sp2/0 cells.Two hybridoma monoclonal antibodies (mAbs) cell lines against the 3AB protein of foot-and-mouth disease virus (FMDV) were obtained,named C6 and E7 respectively.The microneutralization titer was 1∶1024 for mAb C6,and 1∶512 for E7.Both mAbs contain kappa light chains,and were of subclass IgG2b.In order to define the mAbs binding epitopes,the reactivity of these mAbs against FMDV were examined by indirect ELISA.The results showed that both mAbs can react with FMDV,but had no cross-reactivity with Swine Vesicular Disease (SVD) antigens.The titers in abdomen liquor were 1∶5×106 for C6 and 1∶2×106 for E7.In conclusion,the mAbs obtained from this study are specific for the detection of FMDV,can be used for etiological and immunological researches on FMDV,and have potential use in diagnosis and future vaccine designs.

  20. Proteolytic Activation of Bacillus thuringiensis Cry2Ab through a Belt-and-Braces Approach. (United States)

    Xu, Lian; Pan, Zhi-Zhen; Zhang, Jing; Liu, Bo; Zhu, Yu-Jing; Chen, Qing-Xi


    Proteolytic processing of Bacillus thuringiensis (Bt) crystal toxins by insect midgut proteases plays an essential role in their insecticidal toxicities against target insects. In the present study, proteolysis of Bt crystal toxin Cry2Ab by Plutella xylostella L. midgut proteases (PxMJ) was evaluated. Both trypsin and chymotrypsin were identified involving the proteolytic activation of Cry2Ab and cleaving Cry2Ab at Arg(139) and Leu(144), respectively. Three Cry2Ab mutants (R139A, L144A, and R139A-L144A) were constructed by replacing residues Arg(139), Leu(144), and Arg(139)-Leu(144) with alanine. Proteolysis assays revealed that mutants R139A and L144A but not R139A-L144A could be cleaved into 50 kDa activated toxins by PxMJ. Bioassays showed that mutants R139A and L144A were highly toxic against P. xylostella larvae, while mutant R139A-L144A was almost non-insecticidal. Those results demonstrated that proteolysis by PxMJ was associated with the toxicity of Cry2Ab against P. xylostella. It also revealed that either trypsin or chymotrypsin was enough to activate Cry2Ab protoxin. This characteristic was regarded as a belt-and-braces approach and might contribute to the control of resistance development in target insects. Our studies characterized the proteolytic processing of Cry2Ab and provided new insight into the activation of this Bt toxin. PMID:27598769

  1. HEK293 cells express dystrophin Dp71 with nucleus-specific localization of Dp71ab. (United States)

    Nishida, Atsushi; Yasuno, Sato; Takeuchi, Atsuko; Awano, Hiroyuki; Lee, Tomoko; Niba, Emma Tabe Eko; Fujimoto, Takahiro; Itoh, Kyoko; Takeshima, Yasuhiro; Nishio, Hisahide; Matsuo, Masafumi


    The dystrophin gene consists of 79 exons and encodes tissue-specific isoforms. Mutations in the dystrophin gene cause Duchenne muscular dystrophy, of which a substantial proportion of cases are complicated by non-progressive mental retardation. Abnormalities of Dp71, an isoform transcribed from a promoter in intron 62, are a suspected cause of mental retardation. However, the roles of Dp71 in human brain have not been fully elucidated. Here, we characterized dystrophin in human HEK293 cells with the neuronal lineage. Reverse transcription-PCR amplification of the full-length dystrophin transcript revealed the absence of fragments covering the 5' part of the dystrophin cDNA. In contrast, fragments covering exons 64-79 were present. The Dp71 promoter-specific exon G1 was shown spliced to exon 63. We demonstrated that the Dp71 transcript comprised two subisoforms: one lacking exon 78 (Dp71b) and the other lacking both exons 71 and 78 (Dp71ab). Western blotting of cell lysates using an antibody against the dystrophin C-terminal region revealed two bands, corresponding to Dp71b and Dp71ab. Immunohistochemical examination with the dystrophin antibody revealed scattered punctate signals in the cytoplasm and the nucleus. Western blotting revealed one band corresponding to Dp71b in the cytoplasm and two bands corresponding to Dp71b and Dp71ab in the nucleus, with Dp71b being predominant. These results indicated that Dp71ab is a nucleus-specific subisoform. We concluded that Dp71, comprising Dp71b and Dp71ab, was expressed exclusively in HEK293 cells and that Dp71ab was specifically localized to the nucleus. Our findings suggest that Dp71ab in the nucleus contributes to the diverse functions of HEK293 cells.

  2. Islet biology, the CDKN2A/B locus and type 2 diabetes risk. (United States)

    Kong, Yahui; Sharma, Rohit B; Nwosu, Benjamin U; Alonso, Laura C


    Type 2 diabetes, fuelled by the obesity epidemic, is an escalating worldwide cause of personal hardship and public cost. Diabetes incidence increases with age, and many studies link the classic senescence and ageing protein p16(INK4A) to diabetes pathophysiology via pancreatic islet biology. Genome-wide association studies (GWASs) have unequivocally linked the CDKN2A/B locus, which encodes p16 inhibitor of cyclin-dependent kinase (p16(INK4A)) and three other gene products, p14 alternate reading frame (p14(ARF)), p15(INK4B) and antisense non-coding RNA in the INK4 locus (ANRIL), with human diabetes risk. However, the mechanism by which the CDKN2A/B locus influences diabetes risk remains uncertain. Here, we weigh the evidence that CDKN2A/B polymorphisms impact metabolic health via islet biology vs effects in other tissues. Structured in a bedside-to-bench-to-bedside approach, we begin with a summary of the evidence that the CDKN2A/B locus impacts diabetes risk and a brief review of the basic biology of CDKN2A/B gene products. The main emphasis of this work is an in-depth look at the nuanced roles that CDKN2A/B gene products and related proteins play in the regulation of beta cell mass, proliferation and insulin secretory function, as well as roles in other metabolic tissues. We finish with a synthesis of basic biology and clinical observations, incorporating human physiology data. We conclude that it is likely that the CDKN2A/B locus influences diabetes risk through both islet and non-islet mechanisms. PMID:27155872


    Institute of Scientific and Technical Information of China (English)


    The preparation process-dependent phase morphology of blends composed of nylon 6 and acryionitrile-butadienestyrene(ABS)over a composition range of 30-70 wt% using a styrene-maleic anhydride(SMA)copolymer as the compatibilizing agent with a constant content(5phr)was investigated.The results of the scanning electron microscope (SEM)observation revealed that compared with the binary blends of nylon 6 and ABS,the existence of SMA caused a composition shift of phase inversion to a higher weight fraction of nylon 6 when ABS was blended with the preblended nylon 6/SMA blend,while the co-continuous structures could be observed over a considerably narrower composition range when nylon 6 was blended with the pre-blended ABS/SMA blend.An examination through dynamic mechanical analysis (DMA)tests confirmed the results obtained with SEM.It is found that near the phase inversion region a remarkable change in the dynamic storage modulus(G')and the loss tangent(tanδ)appears.Moreover,the influence of blending sequence on the size of dispersed particles has been probed for uncompatibilized and compatibilized blends of nylon 6 and ABS over a wide range of compositions below or beyond the phase inversion points.For the blends of ABS dispersed in a nylon 6 matrix,little discernible effects of blending sequence on particle size could be observed.Furthermore,there exists a significant difference in morphologies of the blends prepared by nylon 6 particles dispersing in a ABS matrix in cases of different blending sequences used.Some possible factors responsible for the above asymmetric behaviors have been proposed.

  4. Living with an imperfect cell wall: compensation of femAB inactivation in Staphylococcus aureus

    Directory of Open Access Journals (Sweden)

    Bierbaum Gabriele


    Full Text Available Abstract Background Synthesis of the Staphylococcus aureus peptidoglycan pentaglycine interpeptide bridge is catalyzed by the nonribosomal peptidyl transferases FemX, FemA and FemB. Inactivation of the femAB operon reduces the interpeptide to a monoglycine, leading to a poorly crosslinked peptidoglycan. femAB mutants show a reduced growth rate and are hypersusceptible to virtually all antibiotics, including methicillin, making FemAB a potential target to restore β-lactam susceptibility in methicillin-resistant S. aureus (MRSA. Cis-complementation with wild type femAB only restores synthesis of the pentaglycine interpeptide and methicillin resistance, but the growth rate remains low. This study characterizes the adaptations that ensured survival of the cells after femAB inactivation. Results In addition to slow growth, the cis-complemented femAB mutant showed temperature sensitivity and a higher methicillin resistance than the wild type. Transcriptional profiling paired with reporter metabolite analysis revealed multiple changes in the global transcriptome. A number of transporters for sugars, glycerol, and glycine betaine, some of which could serve as osmoprotectants, were upregulated. Striking differences were found in the transcription of several genes involved in nitrogen metabolism and the arginine-deiminase pathway, an alternative for ATP production. In addition, microarray data indicated enhanced expression of virulence factors that correlated with premature expression of the global regulators sae, sarA, and agr. Conclusion Survival under conditions preventing normal cell wall formation triggered complex adaptations that incurred a fitness cost, showing the remarkable flexibility of S. aureus to circumvent cell wall damage. Potential FemAB inhibitors would have to be used in combination with other antibiotics to prevent selection of resistant survivors.

  5. An investigation of ab initio shell-model interactions derived by no-core shell model (United States)

    Wang, XiaoBao; Dong, GuoXiang; Li, QingFeng; Shen, CaiWan; Yu, ShaoYing


    The microscopic shell-model effective interactions are mainly based on the many-body perturbation theory (MBPT), the first work of which can be traced to Brown and Kuo's first attempt in 1966, derived from the Hamada-Johnston nucleon-nucleon potential. However, the convergence of the MBPT is still unclear. On the other hand, ab initio theories, such as Green's function Monte Carlo (GFMC), no-core shell model (NCSM), and coupled-cluster theory with single and double excitations (CCSD), have made many progress in recent years. However, due to the increasing demanding of computing resources, these ab initio applications are usually limited to nuclei with mass up to A = 16. Recently, people have realized the ab initio construction of valence-space effective interactions, which is obtained through a second-time renormalization, or to be more exactly, projecting the full-manybody Hamiltonian into core, one-body, and two-body cluster parts. In this paper, we present the investigation of such ab initio shell-model interactions, by the recent derived sd-shell effective interactions based on effective J-matrix Inverse Scattering Potential (JISP) and chiral effective-field theory (EFT) through NCSM. In this work, we have seen the similarity between the ab initio shellmodel interactions and the interactions obtained by MBPT or by empirical fitting. Without the inclusion of three-body (3-bd) force, the ab initio shell-model interactions still share similar defects with the microscopic interactions by MBPT, i.e., T = 1 channel is more attractive while T = 0 channel is more repulsive than empirical interactions. The progress to include more many-body correlations and 3-bd force is still badly needed, to see whether such efforts of ab initio shell-model interactions can reach similar precision as the interactions fitted to experimental data.

  6. Characterization of molecular mechanisms controlling fabAB transcription in Pseudomonas aeruginosa.

    Directory of Open Access Journals (Sweden)

    Herbert P Schweizer

    Full Text Available BACKGROUND: The FabAB pathway is one of the unsaturated fatty acid (UFA synthesis pathways for Pseudomonas aeruginosa. It was previously noted that this operon was upregulated in biofilms and repressed by exogenous UFAs. Deletion of a 30 nt fabA upstream sequence, which is conserved in P. aeruginosa, P. putida, and P. syringae, led to a significant decrease in fabA transcription, suggesting positive regulation by an unknown positive regulatory mechanism. METHODS/PRINCIPAL FINDINGS: Here, genetic and biochemical approaches were employed to identify a potential fabAB activator. Deletion of candidate genes such as PA1611 or PA1627 was performed to determine if any of these gene products act as a fabAB activator. However, none of these genes were involved in the regulation of fabAB transcription. Use of mariner-based random mutagenesis to screen for fabA activator(s showed that several genes encoding unknown functions, rpoN and DesA may be involved in fabA regulation, but probably via indirect mechanisms. Biochemical attempts performed did fail to isolate an activator of fabAB operon. CONCLUSION/SIGNIFICANCE: The data suggest that fabA expression might not be regulated by protein-binding, but by a distinct mechanism such as a regulatory RNA-based mechanism.

  7. Differential screening of phage-ab libraries by oligonucleotide microarray technology.

    Directory of Open Access Journals (Sweden)

    Paolo Monaci

    Full Text Available A novel and efficient tagArray technology was developed that allows rapid identification of antibodies which bind to receptors with a specific expression profile, in the absence of biological information. This method is based on the cloning of a specific, short nucleotide sequence (tag in the phagemid coding for each phage-displayed antibody fragment (phage-Ab present in a library. In order to set up and validate the method we identified about 10,000 different phage-Abs binding to receptors expressed in their native form on the cell surface (10 k Membranome collection and tagged each individual phage-Ab. The frequency of each phage-Ab in a given population can at this point be inferred by measuring the frequency of its associated tag sequence through standard DNA hybridization methods. Using tiny amounts of biological samples we identified phage-Abs binding to receptors preferentially expressed on primary tumor cells rather than on cells obtained from matched normal tissues. These antibodies inhibited cell proliferation in vitro and tumor development in vivo, thus representing therapeutic lead candidates.

  8. Physical and Mechanical Characteristics of Kevlar Fiber-Reinforced PC/ABS Composites

    Directory of Open Access Journals (Sweden)

    Kuljira Sujirote


    Full Text Available In this research, the composites between polycarbonate (PC and acrylonitrile-butadiene-styrene (ABS alloy and Kevlar fiber were prepared. The flexural and tensile properties of PC/ABS alloy and its composites were determined using a universal testing machine. The synergistic behavior of flexural modulus was observed for all regions of PC contents, while the synergism of flexural strength and tensile strength were found in some PC contents. It was found that the optimum weight ratio of PC:ABS was 60:40. In the Kevlar Fiber-reinforced PC/ABS composite system at PC:ABS of 60:40, both flexural modulus and strength were increased with matrix contents. Additionally, the flexural strength drastically increased with the matrix content and then reached the maximum value of 167 MPa at the matrix content of 33.4 wt%. The results from peel test, water contact measurement, and scanning electron microscopy (SEM reveal that the interfacial adhesion between the Kevlar fiber and the polymer matrix could be improved by increasing the PC content in the matrix.

  9. AB Blanket for Cities (for continual pleasant weather and protection from chemical, biological and radioactive weapons)

    CERN Document Server

    Bolonkin, Alexander


    In a series of previous articles (see references) the author offered to cover a city or other important large installations or subregions by a transparent thin film supported by a small additional air overpressure under the form of an AB Dome. The building of a gigantic inflatable AB Dome over an empty flat surface is not difficult. However, if we want to cover a city, garden, forest or other obstacle course we cannot easily deploy the thin film over building or trees. In this article is suggested a new method which solves this problem. The idea is to design a double film blanket filled by light gas (for example, methane, hydrogen, or helium). Sections of this AB Blanket are lighter then air and fly in atmosphere. They can be made on a flat area (serving as an assembly area) and delivered by dirigible or helicopter to station at altitude over the city. Here they connect to the already assembled AB Blanket subassemblies, cover the city in an AB Dome and protect it from bad weather, chemical, biological and rad...

  10. Synthesis of an A'B' Precursor to Angelmicin B: Product Diversification in the Suárez Lactol Fragmentation. (United States)

    Li, Jialiang; Todaro, Louis; Mootoo, David R


    We describe a synthetic strategy for the angelimicin family of anthraquinoid natural products that involves converting a central highly oxygenated decalin intermediate to the AB and A'B' subunits. Herein, we report the synthesis of the bicyclic A'B' subunit that complements our earlier route to the tricyclic AB framework. The differentiating tact in the two syntheses focused on controlling the Suárez radical fragmentation of lactol precursors by modulating the substrate's structural rigidity. A more flexible lactol gave the tricyclic AB framework, whereas a more rigid substrate led to the bicyclic A'B' precursor, presumably through divergent pathways from the radical produced in the initial fragmentation step. These results establish a versatile advanced synthetic precursor for the angelimicins, and on a more general note, illustrate strategies for applying the Suárez fragmentation to diverse and complex molecular frameworks.

  11. Electrochemical hydrogen storage performance of AB_5-CoB composites synthesized by a simple mixing method

    Institute of Scientific and Technical Information of China (English)

    SONG Dawei; WANG Yijing; WANG Yaping; JIAO Lifang; YUAN Huatang


    AB5 (MINi_(4.0)Al_(0.3)Cu_(0.5)Zn_(0.2)) alloy and CoB alloy were prepared by arc melting. AB_5-CoB composites were synthesized by simple mixing of AB_5 alloy powders and CoB alloy powders, and their electrochemical hydrogen storage properties were studied as negative electrodes in KOH aqueous solution. The maximum discharge capacity of the AB_5-CoB(50%) composite (the content of CoB in the composite is 50 wt.%) reached 365.3 mAh·g~(-1). After 100 charge-discharge cycles, the discharge capacity of the AB_5-CoB(50%) composite was still much higher than that of the AB5 alloy. The high rate discharge capability (HRD) and potentiodynamic polarzafion were also tested.

  12. 汽车ABS/ASR性能检测试验台的初步设计%A Preliminary Design for Test-bed for the Detection of Automobile ABS/ASR Performance

    Institute of Scientific and Technical Information of China (English)



    Automobile ABS/ASR performance test-bed (performance test-bed for automotive anti-lock braking system/acceleration slip regulation system ), aimed at solving the problem that there is no corresponding automobile ABS/ASR performance testing equipment in respect to current technology.%汽车ABS/ASR性能检测试验台(汽车防抱死制动系统/驱动防滑控制系统性能检测试验台),旨在解决现有技术中没有相应汽车ABS/ASR性能检测设备的问题。

  13. Transport and optical properties of warm dense aluminum in the two-temperature regime: Ab initio calculation and semiempirical approximation


    Knyazev, D. V.; Levashov, P. R.


    This work is devoted to the investigation of transport and optical properties of liquid aluminum in the two-temperature case. At first optical properties, static electrical and thermal conductivities were obtained in the \\textit{ab initio} calculation. The \\textit{ab initio} calculation is based on the quantum molecular dynamics, density functional theory and the Kubo-Greenwood formula. The semiempirical approximation was constructed based on the results of the \\textit{ab initio} caculation. ...

  14. Electrical resistivity of NaPb compound-forming liquid alloy using ab initio pseudopotentials

    Indian Academy of Sciences (India)

    Anil Thakur; N S Negi; P K Ahluwalla


    The study of electrical resistivity of compound-forming liquid alloy, NaPb, is presented as a function of concentration. Hard sphere diameters of Na and Pb are obtained through the interionic pair potentials evaluated using Troullier and Martins ab initio pseudopotential, which have been used to calculate the partial structure factors (). Considering the liquid alloy to be a ternary mixture, Ziman formula, modified for complex formation has been used for calculating resistivity of binary liquid alloys. Form factors are calculated using ab initio pseudopotentials. The results suggest that Ziman formalism, when used with ab initio pseudopotentials, are quite successful in explaining the electrical resistivity data of compound-forming binary liquid alloys.

  15. Ab initio calculations of phosphorus and arsenic clustering parameters for the improvement of process simulation models

    Energy Technology Data Exchange (ETDEWEB)

    Sahli, Beat [Integrated Systems Laboratory, ETH Zurich, Gloriastrasse 35, 8092 Zurich (Switzerland)], E-mail:; Vollenweider, Kilian [Integrated Systems Laboratory, ETH Zurich, Gloriastrasse 35, 8092 Zurich (Switzerland); Zographos, Nikolas; Zechner, Christoph [Synopsys Switzerland LLC, Affolternstrasse 52, 8050 Zurich (Switzerland)


    We present the results of extensive ab initio simulations for phosphorus clusters, arsenic clusters and mixed phosphorus/arsenic clusters in silicon. The specific defects and the parameters that are investigated are selected according to the needs of state-of-the-art diffusion and activation models, taking into account the availability of experimental data, the capabilities of current ab initio methods and the requirements for advanced technology development. The calculated binding energies are used to determine a good starting point for the calibration of a new clustering model implemented in an atomistic process simulator. The defect species V, I, P, PV, PI, As, AsV, AsI and clusters containing up to four dopant atoms and up to one V or I are considered in all relevant charge states. The ab initio results are discussed as well as the challenges arising in the transfer of this information into the process simulation model.

  16. Adsorptive Thermodynamic Properties and Kinetics of trans-1,2- Cyclohexandiol onto AB-8 Resin

    Institute of Scientific and Technical Information of China (English)

    谢艳新; 侯丽丽; 杨倩; 蒋登高


    AB-8 resin was used as an adsorbent for the removal of trans-1,2-cyclohexandiol(CHD) from aqueous solutions.Batch experiments were carried out to investigate the effect of contact time and temperature on sorption efficiency.The adsorptive thermodynamic properties and kinetics of CHD from water onto AB-8 resin were studied.The Langmuir and Freundlich isotherm models were employed to discuss the adsorption behavior.Thermodynamic parameters such as G,H and S were calculated.The results indicate that the equilibrium data are perfectly represented by Langmuir isotherm model.Thermodynamic study reveals that it is an exothermic process in nature and mainly physical adsorption enhanced by chemisorption with a decrease of entropy process.The kinetics of CHD adsorption is well described by the pseudo second-order model.The adsorbed CHD can be eluted from AB-8 resin by 5% ethanol aqueous solution with 100% elution percentage.

  17. An Efficient Time-Stepping Scheme for Ab Initio Molecular Dynamics Simulations (United States)

    Tsuchida, Eiji


    In ab initio molecular dynamics simulations of real-world problems, the simple Verlet method is still widely used for integrating the equations of motion, while more efficient algorithms are routinely used in classical molecular dynamics. We show that if the Verlet method is used in conjunction with pre- and postprocessing, the accuracy of the time integration is significantly improved with only a small computational overhead. We also propose several extensions of the algorithm required for use in ab initio molecular dynamics. The validity of the processed Verlet method is demonstrated in several examples including ab initio molecular dynamics simulations of liquid water. The structural properties obtained from the processed Verlet method are found to be sufficiently accurate even for large time steps close to the stability limit. This approach results in a 2× performance gain over the standard Verlet method for a given accuracy. We also show how to generate a canonical ensemble within this approach.

  18. Exploring the speed and performance of molecular replacement with AMPLE using QUARK ab initio protein models

    Energy Technology Data Exchange (ETDEWEB)

    Keegan, Ronan M. [STFC Rutherford Appleton Laboratory, Didcot OX11 0FA (United Kingdom); Bibby, Jaclyn; Thomas, Jens [University of Liverpool, Liverpool L69 7ZB (United Kingdom); Xu, Dong [Sanford-Burnham Medical Research Institute, 10901 North Torrey Pines Road, La Jolla, CA 92037 (United States); Zhang, Yang [University of Michigan, Ann Arbor, MI 48109 (United States); Mayans, Olga [University of Liverpool, Liverpool L69 7ZB (United Kingdom); Winn, Martyn D. [Science and Technology Facilities Council Daresbury Laboratory, Warrington WA4 4AD (United Kingdom); Rigden, Daniel J., E-mail: [University of Liverpool, Liverpool L69 7ZB (United Kingdom); STFC Rutherford Appleton Laboratory, Didcot OX11 0FA (United Kingdom)


    Two ab initio modelling programs solve complementary sets of targets, enhancing the success of AMPLE with small proteins. AMPLE clusters and truncates ab initio protein structure predictions, producing search models for molecular replacement. Here, an interesting degree of complementarity is shown between targets solved using the different ab initio modelling programs QUARK and ROSETTA. Search models derived from either program collectively solve almost all of the all-helical targets in the test set. Initial solutions produced by Phaser after only 5 min perform surprisingly well, improving the prospects for in situ structure solution by AMPLE during synchrotron visits. Taken together, the results show the potential for AMPLE to run more quickly and successfully solve more targets than previously suspected.

  19. Hardware-in the-loop Simulator for ABS based on MATLAB/Simulink

    Institute of Scientific and Technical Information of China (English)

    Pan,Wei; Gao,jinghui; Zhou,Yafu; Song,Zhenhuan


    A method for building a Hardware-in the-loop Simulator of ABS base on MATLAB/Simulink is presented in this paper. In this method, the vehicle transmission model, the AT model and ABS algorithm is built in Simulink. This system can simulate a vehicle system in the Simulink environment. Further more, the Hardware-in the-loop Simulator system can be connected with the real ABS by I/O boards to observe the algorithm is reasonable or not. At the same time, user can simulate some different conditions by changing the parameter. The system help the user heightening the efficiency when developing the electronic device. Also, the system can be used as teaching demo software.

  20. Relativistic Two-Dimensional Harmonic Oscillator Plus Cornell Potentials in External Magnetic and AB Fields

    Directory of Open Access Journals (Sweden)

    Sameer M. Ikhdair


    Full Text Available The Klein-Gordon (KG equation for the two-dimensional scalar-vector harmonic oscillator plus Cornell potentials in the presence of external magnetic and Aharonov-Bohm (AB flux fields is solved using the wave function ansatz method. The exact energy eigenvalues and the wave functions are obtained in terms of potential parameters, magnetic field strength, AB flux field, and magnetic quantum number. The results obtained by using different Larmor frequencies are compared with the results in the absence of both magnetic field (ωL = 0 and AB flux field (ξ=0 cases. Effect of external fields on the nonrelativistic energy eigenvalues and wave function solutions is also precisely presented. Some special cases like harmonic oscillator and Coulombic fields are also studied.

  1. Semirational solutions and baseband modulational instability of the AB system in fluid mechanics (United States)

    Wang, Lei; Wang, Zi-Zhe; Jiang, Dong-Yang; Qi, Feng-Hua; Guo, Rui


    Under investigation in this paper is the AB system describing marginally unstable baroclinic wave packets in geophysical fluids. By means of the n -fold modified Darboux transformation, the semirational solutions in terms of the determinants of the AB system are derived. These solutions, which are a combination of rational and exponential functions, can be used to model the nonlinear superposition of the Akhmediev breathers (or the Kuznetsov-Ma breathers) and the rogue waves. The k -order rogue wave of the AB system is produced by the interaction between the l-order rogue wave with 1/2(k-l)(k+l+1) neighboring elements in the (k-l)-order breathers (0

  2. Measurement of Ab at the Z0 resonance using a jet-charge technique

    International Nuclear Information System (INIS)

    The authors present a new preliminary measurement of the parity-violation parameter Ab using a self-calibrating jet-charge technique. In the SLD experiment they observe hadronic decays of Z0 bosons produced in collisions between longitudinally polarized electrons and unpolarized positrons a the SLAC Linear Collider. A sample of b anti b events is selected using the topologically reconstructed mass of B hadrons. From the 1997--1998 data sample of approximately 200,000 hadronic Z0 decays, they obtain Ab = 0.824 ± 0.031(stat) ± 0.032(syst). Together with the previous 1993--1995 result, it yields a preliminary combined SLD jet-charge measurement of: Ab = 0.849 ± 0.026(stat) ± 0.031(syst)

  3. Matrix Product Operators, Matrix Product States, and ab initio Density Matrix Renormalization Group algorithms

    CERN Document Server

    Chan, Garnet Kin-Lic; Nakatani, Naoki; Li, Zhendong; White, Steven R


    Current descriptions of the ab initio DMRG algorithm use two superficially different languages: an older language of the renormalization group and renormalized operators, and a more recent language of matrix product states and matrix product operators. The same algorithm can appear dramatically different when written in the two different vocabularies. In this work, we carefully describe the translation between the two languages in several contexts. First, we describe how to efficiently implement the ab-initio DMRG sweep using a matrix product operator based code, and the equivalence to the original renormalized operator implementation. Next we describe how to implement the general matrix product operator/matrix product state algebra within a pure renormalized operator-based DMRG code. Finally, we discuss two improvements of the ab initio DMRG sweep algorithm motivated by matrix product operator language: Hamiltonian compression, and a sum over operators representation that allows for perfect computational par...

  4. Crystallization of BMP receptor type IA bound to the antibody Fab fragment AbD1556

    International Nuclear Information System (INIS)

    The crystallization of BMP receptor type IA bound to the neutralizing antibody Fab fragment AbD1556 obtained by phage-display selection is reported. An antibody Fab fragment, AbD1556, was selected against the extracellular domain of BMP receptor type IA, which blocks the binding of BMP-2 to BMPR-IA and thereby neutralizes BMP-2 activity. To study the mechanism by which BMPR-IA is recognized and bound by the Fab fragment, the complex of AbD1556 bound to BMPR-IA was prepared and crystallized. Crystals of this binary complex belonged to the monoclinic space group P21, with unit-cell parameters a = 89.32, b = 129.25, c = 100.24 Å, β = 92.27°

  5. Zebrafish Rab5 proteins and a role for Rab5ab in nodal signalling. (United States)

    Kenyon, Emma J; Campos, Isabel; Bull, James C; Williams, P Huw; Stemple, Derek L; Clark, Matthew D


    The RAB5 gene family is the best characterised of all human RAB families and is essential for in vitro homotypic fusion of early endosomes. In recent years, the disruption or activation of Rab5 family proteins has been used as a tool to understand growth factor signal transduction in whole animal systems such as Drosophila melanogaster and zebrafish. In this study we have examined the functions for four rab5 genes in zebrafish. Disruption of rab5ab expression by antisense morpholino oligonucleotide (MO) knockdown abolishes nodal signalling in early zebrafish embryos, whereas overexpression of rab5ab mRNA leads to ectopic expression of markers that are normally downstream of nodal signalling. By contrast MO disruption of other zebrafish rab5 genes shows little or no effect on expression of markers of dorsal organiser development. We conclude that rab5ab is essential for nodal signalling and organizer specification in the developing zebrafish embryo.

  6. 马自达626ABS/TCS系统故障自诊断与测试

    Institute of Scientific and Technical Information of China (English)



    @@ 1.预诊断检查 马自达626轿车制动防抱死系统(Anti-Lock Braking System,简称ABS)和牵引力控制系统(Traction Control System,简称TCS)的控制模块是集成于一体的,记为ABS/TCS控制模块.直观检查ABS/TCS系统部件有助于识别出简单故障的原因,确保ABS/TCS警告指示灯工作正常.

  7. 基于CAN的城市客车ABS/ASR/ECB集中控制系统%ABS/ASR/ECB Integrated Control System Based on CAN for City Bus

    Institute of Scientific and Technical Information of China (English)

    匡珑; 李刚炎; 胡剑


    在分析基于CAN的ABS(Anti-Lock Braking System,防抱死制动系统)、ASR(Anti-Slide Retractor,驱动防滑控制)和ECB(Eddy Current Brake,电涡流缓速器)集中控制系统CAN总线接口的基础上,实现了基于CAN的ABS、ASR和ECB集中控制.


    Energy Technology Data Exchange (ETDEWEB)

    Simón-Díaz, S. [Instituto de Astrofísica de Canarias, E-38200 La Laguna, Tenerife (Spain); Caballero, J. A.; Apellániz, J. Maíz [Centro de Astrobiología (CSIC-INTA), ESAC Campus, P.O. Box 78, E-28691 Villanueva de la Cañada, Madrid (Spain); Lorenzo, J.; Negueruela, I.; Dorda, R.; Marco, A. [Departamento de Física, Ingeniería de Sistemas y Teoría de la Señal, Escuela Politécnica Superior, University of Alicante, Apdo. 99, E-03080 Alicante (Spain); Schneider, F. R. N. [Argelander-Institut für Astronomie der Universität Bonn, Auf dem Hügel 71, D-53121 Bonn (Germany); Barbá, R. H. [Departamento de Física, Universidad de La Serena, Benavente 980, La Serena (Chile); Montes, D. [Departamento Astrofísica, Facultad de Ciencias Físicas, Universidad Complutense de Madrid, E-28040 Madrid (Spain); Pellerin, A. [Department of Physics and Astronomy, State University of New York at Geneseo, 1 College Circle, Geneseo, NY 14454 (United States); Sanchez-Bermudez, J.; Sota, A. [Instituto de Astrofísica de Andalucía (CSIC), Glorieta de la Astronomía s/n, E-18008 Granada (Spain); Sódor, Á., E-mail: [Konkoly Observatory, Research Centre for Astronomy and Earth Sciences, Hungarian Academy of Sciences, H-01121 Budapest (Hungary)


    We provide a complete characterization of the astrophysical properties of the σ Ori Aa, Ab, B hierarchical triple system and an improved set of orbital parameters for the highly eccentric σ Ori Aa, Ab spectroscopic binary. We compiled a spectroscopic data set comprising 90 high-resolution spectra covering a total time span of 1963 days. We applied the Lehman-Filhés method for a detailed orbital analysis of the radial velocity curves and performed a combined quantitative spectroscopic analysis of the σ Ori Aa, Ab, B system by means of the stellar atmosphere code FASTWIND. We used our own plus other available information on photometry and distance to the system for measuring the radii, luminosities, and spectroscopic masses of the three components. We also inferred evolutionary masses and stellar ages using the Bayesian code BONNSAI. The orbital analysis of the new radial velocity curves led to a very accurate orbital solution of the σ Ori Aa, Ab pair. We provided indirect arguments indicating that σ Ori B is a fast-rotating early B dwarf. The FASTWIND+BONNSAI analysis showed that the Aa, Ab pair contains the hottest and most massive components of the triple system while σ Ori B is a bit cooler and less massive. The derived stellar ages of the inner pair are intriguingly younger than the one widely accepted for the σ Orionis cluster, at 3 ± 1 Ma. The outcome of this study will be of key importance for a precise determination of the distance to the σ Orionis cluster, the interpretation of the strong X-ray emission detected for σ Ori Aa, Ab, B, and the investigation of the formation and evolution of multiple massive stellar systems and substellar objects.

  9. Some effects of multiple injection moulding on selected properties of ABS

    Directory of Open Access Journals (Sweden)

    M. Żenkiewicz


    Full Text Available Purpose: The purpose of this work was to investigate the influence of multiple (up to 10 times injection moulding of acrylonitrile butadiene styrene (ABS on some properties of the obtained moulded pieces.Design/methodology/approach: The investigated samples were obtained during the industrial injection moulding. There were determined the sample mechanical properties (by a tensile test, melt flow rate, temperatures of phase transitions (by differential scanning calorimetry, DSC, temperatures of thermal degradation (by thermogravimetric analysis, TGA, as well as storage modulus and damping coefficient (both by dynamic mechanical analysis, DMA.Findings: After the first injection mouldings, minor decreases (ca. 2.0 % in the tensile strength were observed. After the next injection mouldings, this quantity did not change much. The melt flow rate increased along with the number of injection mouldings. The glass transition temperatures (from DSC of butadiene and acrylonitrile styrene fractions don’t vary with the number of injection mouldings and are ca. 61 and +104ºC, respectively.Research limitations/implications: In order to confirm that degradation process occurs in ABS during injection mouldings, further investigation is necessary, mostly that on variations in the mean molecular weight of ABS.Practical implications: The studies carried out by now indicate that there are no arguments not to subject the ABS technological waste to the management by material recycling.Originality/value: It has been observed that the largest changes in the tensile strength and melt flow rate of ABS occur during its first injection moulding and a melt flow rate increases slightly with the number of injection mouldings. The temperatures of phase transitions and thermal as well as the storage modulus and damping coefficient of ABS do not essentially change after repeated injection mouldings.

  10. Antigen-Antibody Interaction Database (AgAbDb): a compendium of antigen-antibody interactions. (United States)

    Kulkarni-Kale, Urmila; Raskar-Renuse, Snehal; Natekar-Kalantre, Girija; Saxena, Smita A


    Antigen-Antibody Interaction Database (AgAbDb) is an immunoinformatics resource developed at the Bioinformatics Centre, University of Pune, and is available online at Antigen-antibody interactions are a special class of protein-protein interactions that are characterized by high affinity and strict specificity of antibodies towards their antigens. Several co-crystal structures of antigen-antibody complexes have been solved and are available in the Protein Data Bank (PDB). AgAbDb is a derived knowledgebase developed with an objective to compile, curate, and analyze determinants of interactions between the respective antigen-antibody molecules. AgAbDb lists not only the residues of binding sites of antigens and antibodies, but also interacting residue pairs. It also helps in the identification of interacting residues and buried residues that constitute antibody-binding sites of protein and peptide antigens. The Antigen-Antibody Interaction Finder (AAIF), a program developed in-house, is used to compile the molecular interactions, viz. van der Waals interactions, salt bridges, and hydrogen bonds. A module for curating water-mediated interactions has also been developed. In addition, various residue-level features, viz. accessible surface area, data on epitope segment, and secondary structural state of binding site residues, are also compiled. Apart from the PDB numbering, Wu-Kabat numbering and explicit definitions of complementarity-determining regions are provided for residues of antibodies. The molecular interactions can be visualized using the program Jmol. AgAbDb can be used as a benchmark dataset to validate algorithms for prediction of B-cell epitopes. It can as well be used to improve accuracy of existing algorithms and to design new algorithms. AgAbDb can also be used to design mimotopes representing antigens as well as aid in designing processes leading to humanization of antibodies. PMID:25048123

  11. Modelling of nuclear glasses by classical and ab initio molecular dynamics; Modelisation de verres intervenant dans le conditionnement des dechets radioactifs par dynamiques moleculaires classique et ab initio

    Energy Technology Data Exchange (ETDEWEB)

    Ganster, P


    A calcium aluminosilicate glass of molar composition 67 % SiO{sub 2} - 12 % Al{sub 2}O{sub 3} - 21 % CaO was modelled by classical and ab initio molecular dynamics. The size effect study in classical MD shows that the systems of 100 atoms are more ordered than the larger ones. These effects are mainly due to the 3-body terms in the empirical potentials. Nevertheless, these effects are small and the structures generated are in agreement with experimental data. In such kind of glass, we denote an aluminium avoidance and an excess of non bridging oxygens which can be compensated by tri coordinated oxygens. When the dynamics of systems of 100 and 200 atoms is followed by ab initio MD, some local arrangements occurs (bond length, angular distributions). Thus, more realistic vibrational properties are obtained in ab initio MD. The modelling of thin films shows that aluminium atoms extend to the most external part of the surface and they are all tri-coordinated. Calcium atoms are set in the sub layer part of the surface and they produce a depolymerization of the network. In classical MD, tri-coordinated aluminium atoms produce an important electric field above the surface. With non bridging oxygens, they constitute attractive sites for single water molecules. (author)

  12. Ab initio calculations versus polarized neutron diffraction for the spin density of free radicals

    International Nuclear Information System (INIS)

    The determination of the magnetization distribution using polarized neutron diffraction has played a key role during the last twenty years in the field of molecular magnetism. This distribution can also be obtained by first principle ab initio calculations. Such calculations always rely on approximations and the question that arises is to know whether the obtained results are reliable enough to represent accurately the properties of these molecules. The comparison between polarized neutron experimental results and ab initio calculations has turned to provide stringent tests for these methods. In the resent article a comparison between experimental and theoretical results is made and is illustrated by examples based on magnetic free radicals. (author)

  13. Attenuation coefficient determination of printed ABS and PLA samples in diagnostic radiology standard beams (United States)

    Veneziani, G. R.; Corrêa, E. L.; Potiens, M. P. A.; Campos, L. L.


    IAEA code of practice TRS-457 states that standard phantoms should offer the same primary attenuation and scatter production as relevant body section of a representative patient. Material cost, availability and dimensional stability must also be considered. The goal of this study is to determine the attenuation coefficient of printed ABS and PLA samples in standard X-ray beams, verifying if phantoms printed with these materials could be an easier-handle substitute for PMMA, enabling the creation of different designs in an easier and cheaper way. Results show that PMMA presents higher attenuation coefficient, followed by PLA and ABS, which means that thinner PMMA layer creates higher radiation attenuation.

  14. Exploring the ab initio/classical free energy perturbation method: The hydration free energy of water (United States)

    Sakane, Shinichi; Yezdimer, Eric M.; Liu, Wenbin; Barriocanal, Jose A.; Doren, Douglas J.; Wood, Robert H.


    The ab initio/classical free energy perturbation (ABC-FEP) method proposed previously by Wood et al. [J. Chem. Phys. 110, 1329 (1999)] uses classical simulations to calculate solvation free energies within an empirical potential model, then applies free energy perturbation theory to determine the effect of changing the empirical solute-solvent interactions to corresponding interactions calculated from ab initio methods. This approach allows accurate calculation of solvation free energies using an atomistic description of the solvent and solute, with interactions calculated from first principles. Results can be obtained at a feasible computational cost without making use of approximations such as a continuum solvent or an empirical cavity formation energy. As such, the method can be used far from ambient conditions, where the empirical parameters needed for approximate theories of solvation may not be available. The sources of error in the ABC-FEP method are the approximations in the ab initio method, the finite sample of configurations, and the classical solvent model. This article explores the accuracy of various approximations used in the ABC-FEP method by comparing to the experimentally well-known free energy of hydration of water at two state points (ambient conditions, and 973.15 K and 600 kg/m3). The TIP4P-FQ model [J. Chem. Phys. 101, 6141 (1994)] is found to be a reliable solvent model for use with this method, even at supercritical conditions. Results depend strongly on the ab initio method used: a gradient-corrected density functional theory is not adequate, but a localized MP2 method yields excellent agreement with experiment. Computational costs are reduced by using a cluster approximation, in which ab initio pair interaction energies are calculated between the solute and up to 60 solvent molecules, while multi-body interactions are calculated with only a small cluster (5 to 12 solvent molecules). Sampling errors for the ab initio contribution to

  15. Exploring the speed and performance of molecular replacement with AMPLE using QUARK ab initio protein models. (United States)

    Keegan, Ronan M; Bibby, Jaclyn; Thomas, Jens; Xu, Dong; Zhang, Yang; Mayans, Olga; Winn, Martyn D; Rigden, Daniel J


    AMPLE clusters and truncates ab initio protein structure predictions, producing search models for molecular replacement. Here, an interesting degree of complementarity is shown between targets solved using the different ab initio modelling programs QUARK and ROSETTA. Search models derived from either program collectively solve almost all of the all-helical targets in the test set. Initial solutions produced by Phaser after only 5 min perform surprisingly well, improving the prospects for in situ structure solution by AMPLE during synchrotron visits. Taken together, the results show the potential for AMPLE to run more quickly and successfully solve more targets than previously suspected.

  16. Attenuation coefficient determination of printed ABS and PLA samples in diagnostic radiology standard beams

    Energy Technology Data Exchange (ETDEWEB)

    Veneziani, G.R.; Correa, E.L.; Potiens, M.P.A.; Campos, L.L., E-mail: [Instituto de Pesquisas Energeticas e Nucleres (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)


    IAEA code of practice TRS-457 states that standard phantoms should offer the same primary attenuation and scatter production as relevant body section of a representative patient. Material cost, availability and dimensional stability must also be considered. The goal of this study is to determine the attenuation coefficient of printed ABS and PLA in standard X-ray beams, verifying if phantoms printed with these materials could be an easier-handle substitute for PMMA, enabling the creation of different designs in an easier and cheaper way. Results show that PMMA presents higher attenuation coefficient, followed by PLA and ABS, which means that thinner PMMA layer creates higher radiation attenuation. (author)

  17. An ab initio study on single electron transfer between ClO2 and phenol

    Institute of Scientific and Technical Information of China (English)

    崔崇威; 黄君礼


    The SET mechanism between chlorine dioxide (ClO2 ) and phenol was studied by using ab initio method at 4-31G* level. Geometries of the reactants, intermediate and products of the reaction were optimized and the single point energy calculations of the species were performed. The relative structure data of the reactants, intermediate and products are given. The SET mechanism between ClO2 and phenol was confirmed by ab initio calculations. The reaction is exothermic about 200. 88 k J/mol.

  18. A novel variant in CMAH is associated with blood type AB in Ragdoll cats


    Barbara Gandolfi; Grahn, Robert A.; Gustafson, Nicholas A.; Daniela Proverbio; Eva Spada; Badri Adhikari; Janling Cheng; Gordon Andrews; Lyons, Leslie A.; Helps, Chris R.


    The enzyme cytidine monophospho-N-acetylneuraminic acid hydroxylase is associated with the production of sialic acids on cat red blood cells. The cat has one major blood group with three serotypes; the most common blood type A being dominant to type B. A third rare blood type is known as AB and has an unclear mode of inheritance. Cat blood type antigens are defined, with N-glycolylneuraminic acid being associated with type A and N-acetylneuraminic acid with type B. Blood type AB is serologica...

  19. Design of Zr-based AB2 type hydrogen storage alloys

    Institute of Scientific and Technical Information of China (English)

    文明芬; 王秋萍; 王兴海; 翟玉春; 陈廉


    The influences of the ratio of the radius of atom A(rA)to radius of atom B(rB),electronegativity and electron number were discussed on the Laves phase formation and the characteristics of Zr-based AB2 type hydrogen storage alloy.An enthalpy model of Zr-based AB2 alloy was obtained from known data and twelve Zr-based alloys were designed to test the model.The results show that the predicted values are in good agreement with the experimental values.The model can be used for predicting enthalpy values of Zr-based hydrogen storage alloys and settles a foundation for experiments.

  20. Ab Initio Calculations of Deuterium Isotope Effects on Chemical Shifts of Salt-Bridged Lysines

    DEFF Research Database (Denmark)

    Ullah, Saif; Ishimoto, Takayoshi; Williamson, Mike P.;


    Deuterium isotope effects measure the change in chemical shift on substitution of a proton by deuterium. They have been calculated by direct treatment of the H/D nuclear quantum effect using a multicomponent ab initio molecular orbital method based on a non-Born−Oppenheimer approximation. This me......Deuterium isotope effects measure the change in chemical shift on substitution of a proton by deuterium. They have been calculated by direct treatment of the H/D nuclear quantum effect using a multicomponent ab initio molecular orbital method based on a non-Born−Oppenheimer approximation...

  1. Post-exilic conflict as “possible” historical background to Psalm 69:10ab


    Alphonso Groenewald


    As is the case with Psalm 8a, Psalm 69:10a, also commences with the emphatic particle kî. 10a and 10b are syndetically bound together by means of the conjunction “and”. What has already been stated in cola 8ab, is repeated and even expressed in clearer terms in these cola (10ab). The supplicant does not believe that he deserves his present distress. Actually, the distress and insult he is enduring come as a direct result of his devotion to God and God’s service. Even his fasting and mourning ...

  2. AB Nordea Bank Finland Plc Lietuvos skyriaus darbdavio vidinio įvaizdžio stiprinimas


    Stundytė, Inga


    Ši tema pasirinkta siekiant išanalizuoti Nordea banko esamą darbdavio įvaizdį, bei išaiškinti darbuotojų pasitenkinimo juo lygį. Nagrinėti darbdavio įvaizdį svarbu dėl to, kad egzistuoja ryšis tarp pasitenkinimo darbdaviu bei įsipareigojimo organizacijai. Darbo tikslas: Parengti rekomendacijas AB Nordea Bank Finland Plc Lietuvos skyriaus vidinio darbdavio įvaizdžio stiprinimui. Darbo uždaviniai: Nustatyti veiksnius, neigiamai įtakojančius AB Nordea Bank Finland Plc Lietuvos skyriaus ...

  3. Caracterización de las propiedades de mezclas de PC/ABS recicladas


    Hierso, Axel


    Doble titulació El objetivo de este PFC ha sido de estudiar la evolución de las propiedades de dos mezclas muy diferentes de PC/ABS. Una ha sido preparada en el CCP (Centro Catalán del plástico) denominada material A y la otra es una mezcla Bayblend PC/ABS FR 2000 producida por Bayer que se denomina material B en este estudio. Las letras FR significan "Flame Retardant" (retardante de llama). Estas mezclas han sido inyectadas cinco veces cada una. Después de cada ciclo de iny...

  4. Ab Initio Calculation on Self-Assembled Base-Functionalized Single-Walled Carbon Nanotubes

    Institute of Scientific and Technical Information of China (English)

    SONG Chen; XIA Yue-Yuan; ZHAO Ming-Wen; LIU Xiang-Dong; LI Ji-Ling; LI Li-Juan; LI Feng; HUANG Bo-Da


    @@ We perform ab initio calculations on the self-assembled base-functionalized single-walled carbon nanotubes (SWNTs) which exhibit the quasi-1D ‘ladder’ structure. The optimized configuration in the ab initio calculation is very similar to that obtainedfrom molecular dynamics simulation. We also calculate the electronic structures of the self-assembled base-functionalized SWNTs that exhibit distinct difference from the single-branch base-functionalized SWNT with a localized state lying just below the Fermi level, which may result from the coupling interaction between the bases accompanied by the self-assembly behaviour.

  5. Study on Rheological Behavior of PET/ABS/SMA Blends%PET/ABS/SMA共混物流变性能的研究

    Institute of Scientific and Technical Information of China (English)

    张少峰; 李迎春; 郭晓晨; 郑佳星; 王超


    Polyester terephthalate ( PET)/acrylonitrile butadiene styrene(ABS) blends were compatibi-lized with styrene-maleic anhydride copolymer (SMA) as a compatibilizer, the rheological behavior was measured by means of melt flow rate testing machine and XLY- II capillary rheometer. The cures of lgyw~ lgrw, lgya ~ lgyw, lgηa ~ 1/T were obtained. The results of the experiments showed that PET/ABS/SMA blends were pseudo plastic fluids in the range of 260 ~266 ℃. And the shear stress of 2. 45 × 10 4 ~7. 35 × 10 4 Pa. Adding SMA in blends caused the non-Newtonian decreasing and the flow activation energy of PET increased remarkably, but too much SMA would make the flow activation energy decreased. With the increases of SMA content, the viscosity of the melts first increased and then decreased, and it reached the maximum value when the SMA content was 5% (wt).%以苯乙烯接枝马来酸酐共聚物(SMA)为增容剂对聚对苯二甲酸乙二醇酯(PET)/丙烯腈-丁二烯-苯乙烯(ABS)共混物进行研究;采用熔体质量流动速率试验机和毛细管流变仪研究了PET/ABS/SMA共混物的流变行为,并对其lgγw~lgτw、lgηa~lgγw、lgηa~ 1/T曲线进行了分析.结果表明:在260 ~ 266℃及剪切应力为24.5~73.5 MPa时,PET/ABS/SMA共混物均为假塑性流体;增容剂SMA的加入明显地降低了共混物的非牛顿指数(n),并且使PET的黏流活化能(△E)较大幅度的升高,但过量的SMA会使AE下降.随着SMA的增加,共混物的黏度先增加后减小,SMA用量达到5%时,达到最大值.

  6. Resistance to Bacillus thuringiensis Toxin Cry2Ab in Trichoplusia ni Is Conferred by a Novel Genetic Mechanism. (United States)

    Song, Xiaozhao; Kain, Wendy; Cassidy, Douglas; Wang, Ping


    The resistance to the Bacillus thuringiensis (Bt) toxin Cry2Ab in a greenhouse-originated Trichoplusia ni strain resistant to both Bt toxins Cry1Ac and Cry2Ab was characterized. Biological assays determined that the Cry2Ab resistance in the T. ni strain was a monogenic recessive trait independent of Cry1Ac resistance, and there existed no significant cross-resistance between Cry1Ac and Cry2Ab in T. ni. From the dual-toxin-resistant T. ni strain, a strain resistant to Cry2Ab only was isolated, and the Cry2Ab resistance trait was introgressed into a susceptible laboratory strain to facilitate comparative analysis of the Cry2Ab resistance with the susceptible T. ni strain. Results from biochemical analysis showed no significant difference between the Cry2Ab-resistant and -susceptible T. ni larvae in midgut proteases, including caseinolytic proteolytic activity and zymogram profile and serine protease activities, in midgut aminopeptidase and alkaline phosphatase activity, and in midgut esterases and hemolymph plasma melanization activity. For analysis of genetic linkage of Cry2Ab resistance with potential Cry toxin receptor genes, molecular markers for the midgut cadherin, alkaline phosphatase (ALP), and aminopeptidase N (APN) genes were identified between the original greenhouse-derived dual-toxin-resistant and the susceptible laboratory T. ni strains. Genetic linkage analysis showed that the Cry2Ab resistance in T. ni was not genetically associated with the midgut genes coding for the cadherin, ALP, and 6 APNs (APN1 to APN6) nor associated with the ABC transporter gene ABCC2. Therefore, the Cry2Ab resistance in T. ni is conferred by a novel but unknown genetic mechanism. PMID:26025894

  7. Ab-initio modeling of an anion $C_{60}^-$ pseudopotential for fullerene-based compounds

    CERN Document Server

    Vrubel, I I; Ivanov, V K


    A pseudopotential of $C_{60}^-$ has been constructed from ab-initio quantum-mechanical calculations. Since the obtained pseudopotential can be easily fitted by rather simple analytical approximation it can be effectively used both in classical and quantum molecular dynamics of fullerene-based compounds.

  8. Mechanical properties of carbynes investigated by ab initio total-energy calculations

    DEFF Research Database (Denmark)

    Castelli, Ivano E.; Salvestrini, Paolo; Manini, Nicola


    As sp carbon chains (carbynes) are relatively rigid molecular objects, can we exploit them as construction elements in nanomechanics? To answer this question, we investigate their remarkable mechanical properties by ab initio total-energy simulations. In particular, we evaluate their linear respo...


    Institute of Scientific and Technical Information of China (English)

    Liang-moMei; GuanPeng; 等


    The equilibrium geometries of several Hn(n=4,5,6,7,9,13) clsters with certain symmetry have been optimized by the ab inito Murtaug-Sargent(MS) method.We find that the stability of a centered cluster depends on the structure,the spin symmetry and the coordinate number,and the latter plays a more important role.

  10. Matrix product operators, matrix product states, and ab initio density matrix renormalization group algorithms. (United States)

    Chan, Garnet Kin-Lic; Keselman, Anna; Nakatani, Naoki; Li, Zhendong; White, Steven R


    Current descriptions of the ab initio density matrix renormalization group (DMRG) algorithm use two superficially different languages: an older language of the renormalization group and renormalized operators, and a more recent language of matrix product states and matrix product operators. The same algorithm can appear dramatically different when written in the two different vocabularies. In this work, we carefully describe the translation between the two languages in several contexts. First, we describe how to efficiently implement the ab initio DMRG sweep using a matrix product operator based code, and the equivalence to the original renormalized operator implementation. Next we describe how to implement the general matrix product operator/matrix product state algebra within a pure renormalized operator-based DMRG code. Finally, we discuss two improvements of the ab initio DMRG sweep algorithm motivated by matrix product operator language: Hamiltonian compression, and a sum over operators representation that allows for perfect computational parallelism. The connections and correspondences described here serve to link the future developments with the past and are important in the efficient implementation of continuing advances in ab initio DMRG and related algorithms. PMID:27394094

  11. Improvements to a five-phase ABS algorithm for experimental validation (United States)

    Gerard, Mathieu; Pasillas-Lépine, William; de Vries, Edwin; Verhaegen, Michel


    The anti-lock braking system (ABS) is the most important active safety system for passenger cars. Unfortunately, the literature is not really precise about its description, stability and performance. This research improves a five-phase hybrid ABS control algorithm based on wheel deceleration [W. Pasillas-Lépine, Hybrid modeling and limit cycle analysis for a class of five-phase anti-lock brake algorithms, Veh. Syst. Dyn. 44 (2006), pp. 173-188] and validates it on a tyre-in-the-loop laboratory facility. Five relevant effects are modelled so that the simulation matches the reality: oscillations in measurements, wheel acceleration reconstruction, brake pressure dynamics, brake efficiency changes and tyre relaxation. The time delays in measurement and actuation have been identified as the main difficulty for the initial algorithm to work in practice. Three methods are proposed in order to deal with these delays. It is verified that the ABS limit cycles encircle the optimal braking point, without assuming any tyre parameter being a priori known. The ABS algorithm is compared with the commercial algorithm developed by Bosch.

  12. Ab Initio Investigations of the C2F4S Isomers and of Their Interconversions

    DEFF Research Database (Denmark)

    Shim, Irene; Vallano-Lorenzo, Sandra; Lisbona-Martin, Pilar;


    The transition states and the activation energies for the unobserved isomerization reactions between the three possible C2F4S isomers with divalent sulfur, trifluorothioacetyl fluoride 1, tetrafluorothiirane 2, and trifluoroethenesulfenyl fluoride 3, have been determined by ab initio Hartree-Fock...

  13. Accurate radio and optical positions for the radio star HD 36705 (AB Doradus) (United States)

    White, Graeme L.; Jauncey, David L.; Batty, Michael J.; Peters, W. L.; Gulkis, S.


    Arc-second position measurements of the active star HD 36705 (AB Dor) and of the variable radio source found nearby are presented. These measurements show that the radio source is clearly identified with HD 36705 and not with the nearby red-dwarf star Rst 137B.

  14. Ab initio prediction of vacancy properties in concentrated alloys: The case of fcc Cu-Ni

    NARCIS (Netherlands)

    Zhang, X.; Sluiter, M.H.F.


    Vacancy properties in concentrated alloys continue to be of great interest because nowadays ab initio supercell simulations reach a scale where even defect properties in disordered alloys appear to be within reach. We show that vacancy properties cannot generally be extracted from supercell total en

  15. New approaches for molecular conformer force field analysis in combination with ab initio results (United States)

    Kuramshina, G. M.; Pentin, Yu. A.; Yagola, A. G.


    Ab initio and DFT results on harmonic force constants for trans- and gauche-conformers of CH 3CH 2CH 2Cl, CF 3CH 2CH 2Cl and CCl 3CH 2CH 2Cl are used for formulating constraints in molecular force field models described compounds with hindered internal rotation around the C-C bond.

  16. Sorbitol crystallization-induced aggregation in frozen mAb formulations. (United States)

    Piedmonte, Deirdre Murphy; Hair, Alison; Baker, Priti; Brych, Lejla; Nagapudi, Karthik; Lin, Hong; Cao, Wenjin; Hershenson, Susan; Ratnaswamy, Gayathri


    Sorbitol crystallization-induced aggregation of mAbs in the frozen state was evaluated. The effect of protein aggregation resulting from sorbitol crystallization was measured as a function of formulation variables such as protein concentration and pH. Long-term studies were performed on both IgG1 and IgG2 mAbs over the protein concentration range of 0.1-120 mg/mL. Protein aggregation was measured by size-exclusion HPLC (SE-HPLC) and further characterized by capillary-electrophoresis SDS. Sorbitol crystallization was monitored and characterized by subambient differential scanning calorimetry and X-ray diffraction. Aggregation due to sorbitol crystallization is inversely proportional to both protein concentration and formulation pH. At high protein concentrations, sorbitol crystallization was suppressed, and minimal aggregation by SE-HPLC resulted, presumably because of self-stabilization of the mAbs. The glass transition temperature (Tg ') and fragility index measurements were made to assess the influence of molecular mobility on the crystallization of sorbitol. Tg ' increased with increasing protein concentration for both mAbs. The fragility index decreased with increasing protein concentration, suggesting that it is increasingly difficult for sorbitol to crystallize at high protein concentrations.

  17. AB-Net Method of Protection from Projectiles (city, military base, battle-front, etc.)

    CERN Document Server

    Bolonkin, Alexander


    The author suggests a low cost special AB-Net from artificial fiber, which may protect cities and important objects from rockets, artillery and mortar shells, projectiles, bullets, and strategic weapons. The idea is as follows: The offered AB-Net joins an incoming projectile to a small braking parachute and this incoming projectile loses speed by air braking after a drag distance of 50 - 150 meters. A following interception net after the first may serve to collect the slowed projectiles and their fragments or bomblets so that they do not reach the aimpoint. The author offers the design of AB-Net, a developed theory of snagging with a small braking parachute by AB-Net; and sample computations. These nets may be used for defense of a town, city, military base, battle-front line, road (from terrorists), or any important objects or installations (for example nuclear electric station, government buildings, etc.). Computed projects are: Net to counter small rockets (for example, from Qassam), net to counter artille...

  18. The prevalence of OqxAB multidrug efflux pump amongst olaquindox resistant Escherichia coli in pigs

    DEFF Research Database (Denmark)

    Hansen, L. H.; Sørensen, S. J.; Jørgensen, H. S.;


    The quinoxaline olaquindox has been used extensively as a growth promoter for pigs. Recently, we isolated a plasmid (pOLA52) conferring resistance to olaquindox from swine manure. On this plasmid, the oqxA and oqxB genes encode an RND-family multidrug efflux pump, OqxAB. It facilitates resistance...

  19. Preparative Purification and Bioassay of Bt Toxin from Cry1Ab Transgenic Rice

    Institute of Scientific and Technical Information of China (English)

    WU Jian-min; YE Qin-fu


    A method of extracting and purifying Cry1Ab protein(Bt toxin) from Cry1Ab transgenic rice was established. Most of the Bt toxin present in the tissue of Cry1Ab transgenic rice was extracted effectively with a solution of 50 mmol/LNa2CO3 and NaHCO3. The crude protein containing Bt toxin was obtained after the pretreatment of Cry1Ab transgenic rice with ultra-filtration, ammonium sulfate precipitation and centrifugation. The dialysed crude protein was futher separated on DEAE Sephadex A-50 columns and Sephadex G-150 columns. The protein bound on DEAE Sephadex A-50 gel was eluted with buffer solution B(10 mmol/L trisHCl buffer+1. 0 mmol/L EDTA, pH=8.0) mixed with 0. 1, 0. 3, 0. 5 and 0. 8 mol/L NaCl in a discontinuous gradient elution mode. The peak of the Bt toxin eluted from the columns was identified by ELISA and bioassayed with larvae of tobacco hornworms and silkworms. The purity and the bioactivity of the Bt toxin were determined by means of SDS-PAGE and larvicidal assay, respectively. The purity of the Bt toxin obtained by this method is high, and its insecticidal activity is retained after the toxin is purified.

  20. Draft Genome Sequence of Haloalkaliphilic Exiguobacterium sp. AB2 from Manleluag Ophiolitic Spring, Philippines (United States)

    Argayosa, Vina B.; Lazaro, Jose Enrico H.; Argayosa, Anacleto M.; Arcilla, Carlo A.


    Exiguobacterium sp. AB2 is a haloalkaliphilic bacterium isolated from a hyperalkaline spring in Manleluag, Pangasinan, Philippines. Sequencing of bacterial DNA assembled a 2.85 MB draft genome. Analysis suggests the presence of genes for tolerance to stresses such as elevated pH and salt concentrations and toxic metals. PMID:25125654

  1. Draft Genome Sequence of Haloalkaliphilic Exiguobacterium sp. Strain AB2 from Manleluag Ophiolitic Spring, Philippines. (United States)

    Cabria, Gamaliel Lysander B; Argayosa, Vina B; Lazaro, Jose Enrico H; Argayosa, Anacleto M; Arcilla, Carlo A


    Exiguobacterium sp. AB2 is a haloalkaliphilic bacterium isolated from a hyperalkaline spring in Manleluag, Pangasinan, Philippines. Sequencing of bacterial DNA assembled a 2.85 MB draft genome. Analysis suggests the presence of genes for tolerance to stresses such as elevated pH and salt concentrations and toxic metals.

  2. Neglschisandrins A-B: Two New Dibenzocyclooctene Lignans from Schisandra neglecta

    Directory of Open Access Journals (Sweden)

    Chengzhi Huang


    Full Text Available Two new dibenzocyclooctene lignans, neglschisandrins A-B (1-2, were isolatedfrom the stems of Schisandra neglecta. Their structures and stereochemistries wereelucidated by spectroscopic methods, including 1D- and 2D-NMR and HR-ESI-MStechniques.

  3. Transgenic Cry1Ab rice does not impact ecological fitness and predation of a generalist spider.

    Directory of Open Access Journals (Sweden)

    Jun-Ce Tian

    Full Text Available BACKGROUND: The commercial release of rice genetically engineered to express a Cry1Ab protein from Bacillus thuringiensis (Bt for control of Lepidoptera in China is a subject of debate. One major point of the debate has focused on the ecological safety of Bt rice on nontarget organisms, especially predators and parasitoids that help control populations of insect pests. METHODOLOGY/PRINCIPAL FINDINGS: A tritrophic bioassay was conducted to evaluate the potential impact of Cry1Ab-expressing rice on fitness parameters of a predaceous ground spider (Pardosa pseudoannulata (Bösenberg et Strand that had fed on Bt rice-fed brown planthopper (Nilaparvata lugens (Stål nymphs. Survival, development time and fecundity of this spider were not different when they were fed with Bt rice-fed or non-Bt rice-fed prey. Furthermore, ELISA and PCR gut assays, as well as a functional response trial, indicated that predation by P. pseudoannulata was not significantly different in Bt rice or non-Bt rice fields. CONCLUSIONS/SIGNIFICANCE: The transgenic Cry1Ab rice lines tested in this study had no adverse effects on the survival, developmental time and fecundity of P. pseudoannulata in the laboratory or on predation under field conditions. This suggests that this important predator would not be harmed if transgenic Cry1Ab rice were commercialized.

  4. Ultra Low Voltage Class AB Switched Current Memory Cells Based on Floating Gate Transistors

    DEFF Research Database (Denmark)

    Mucha, Igor


    A proposal for a class AB switched current memory cell, suitable for ultra-low-voltage applications is presented. The proposal employs transistors with floating gates, allowing to build analog building blocks for ultralow supply voltage operation also in CMOS processes with high threshold voltages...

  5. Ab initio and work function and surface energy anisotropy of LaB6

    NARCIS (Netherlands)

    Uijttewaal, M. A.; de Wijs, G. A.; de Groot, R. A.


    Lanthanum hexaboride is one of the cathode materials most used in high-power electronics technology, but the many experimental results do not provide a consistent picture of the surface properties. Therefore, we report the first ab initio calculations of the work functions and surface energies of th

  6. Ab initio I-V characteristics of short C-20 chains

    DEFF Research Database (Denmark)

    Roland, C.; Larade, B.; Taylor, Jeremy Philip;


    We have calculated the I-V characteristics of short chains of C-20 molecular cages between Al and Au leads with an ab initio formalism. The results indicate that a linear chain of such molecules acts primarily as metallic nanowires. The transmission, however, depends sensitively both on the...

  7. Possible Future Monoclonal Antibody (mAb-Based Therapy against Arbovirus Infections

    Directory of Open Access Journals (Sweden)

    Giuseppe Sautto


    Full Text Available More than 150 arboviruses belonging to different families are known to infect humans, causing endemic infections as well as epidemic outbreaks. Effective vaccines to limit the occurrence of some of these infections have been licensed, while for the others several new immunogens are under development mostly for their improvements concerning safety and effectiveness profiles. On the other hand, specific and effective antiviral drugs are not yet available, posing an urgent medical need in particular for emergency cases. Neutralizing monoclonal antibodies (mAbs have been demonstrated to be effective in the treatment of several infectious diseases as well as in preliminary in vitro and in vivo models of arbovirus-related infections. Given their specific antiviral activity as well-tolerated molecules with limited side effects, mAbs could represent a new therapeutic approach for the development of an effective treatment, as well as useful tools in the study of the host-virus interplay and in the development of more effective immunogens. However, before their use as candidate therapeutics, possible hurdles (e.g., Ab-dependent enhancement of infection, occurrence of viral escape variants must be carefully evaluated. In this review are described the main arboviruses infecting humans and candidate mAbs to be possibly used in a future passive immunotherapy.

  8. Case note: ECLI:NL:CRVB:2014:3733 : AB/2015/94

    NARCIS (Netherlands)

    Tollenaar, Albertjan


    Zoals de Raad eerder heeft overwogen (uitspraak van 1 mei 2013, ECLI:NL:CRVB:2013:BZ9635 , AB 2013/255 ) dient het Zorgkantoor de discretionaire bevoegdheid om pgb’s lager vast te stellen uit te oefenen met inachtneming van het geschreven en het ongeschreven recht, daaronder begrepen de in artikel 3

  9. Labelling of MoAb with 153SmH1ETA: Preliminary results

    International Nuclear Information System (INIS)

    A method to label MoAb with Sm-153 using 1,5,9,13-tetraazacyclohexadecane N,N',N'',N''' tetraacetic acid (H4ETA) as a bifunctional chelator was developed. H4ETA and SmH1ETA were synthesized in our laboratory and characterized by IR spectroscopy, TGA (thermogravimetric analysis), SEM (Scattering Electronic Microscopy), EDAX (Elemental Dispersion Analysis by X-rays) and EPR (Electron Paramagnetic Resonance) at 6 K. The 153SmH1ETAMoAb was prepared by a simple incubation of the MoAb ior cea1, and the 153SmH1ETA complex at neutral pH and at room temperature for 24 h. The specific activity of the labelled antibody was 111 MBq/mg (3 mCi/mg). Sm-153(III) is commercially available with specific activities up to 318.2 GBq/mg. Therefore, under the conditions described above 153SmH1ETA labelled MoAb could be obtained with specific activity up to 1.14 GBq/mg (30.7 mCi/mg). (author)

  10. Matrix product operators, matrix product states, and ab initio density matrix renormalization group algorithms (United States)

    Chan, Garnet Kin-Lic; Keselman, Anna; Nakatani, Naoki; Li, Zhendong; White, Steven R.


    Current descriptions of the ab initio density matrix renormalization group (DMRG) algorithm use two superficially different languages: an older language of the renormalization group and renormalized operators, and a more recent language of matrix product states and matrix product operators. The same algorithm can appear dramatically different when written in the two different vocabularies. In this work, we carefully describe the translation between the two languages in several contexts. First, we describe how to efficiently implement the ab initio DMRG sweep using a matrix product operator based code, and the equivalence to the original renormalized operator implementation. Next we describe how to implement the general matrix product operator/matrix product state algebra within a pure renormalized operator-based DMRG code. Finally, we discuss two improvements of the ab initio DMRG sweep algorithm motivated by matrix product operator language: Hamiltonian compression, and a sum over operators representation that allows for perfect computational parallelism. The connections and correspondences described here serve to link the future developments with the past and are important in the efficient implementation of continuing advances in ab initio DMRG and related algorithms.

  11. Stabilization of Ab Initio Molecular Dynamics Simulations at Large Time Steps

    CERN Document Server

    Tsuchida, Eiji


    The Verlet method is still widely used to integrate the equations of motion in ab initio molecular dynamics simulations. We show that the stability limit of the Verlet method may be significantly increased by setting an upper limit on the kinetic energy of each atom with only a small loss in accuracy. The validity of this approach is demonstrated for molten lithium fluoride.

  12. Two-component injection moulding simulation of ABS-POM micro structured surfaces

    DEFF Research Database (Denmark)

    Tosello, Guido; Hansen, Hans Nørgaard; Islam, Aminul


    a pair of thermoplastic materials (ABS and POM) were conducted. Three dimensional process simulations based on the finite element method have been performed to explore the capability of predicting filling pattern shape at component-level and surface micro feature-level in a polymer/polymer overmoulding...

  13. Computer simulation of acetonitrile and methanol with ab initio-based pair potentials (United States)

    Hloucha, M.; Sum, A. K.; Sandler, S. I.


    This study address the adequacy of ab initio pair interaction energy potentials for the prediction of macroscopic properties. Recently, Bukowski et al. [J. Phys. Chem. A 103, 7322 (1999)] performed a comprehensive study of the potential energy surfaces for several pairs of molecules using symmetry-adapted perturbation theory. These ab initio energies were then fit to an appropriate site-site potential form. In an attempt to bridge the gap between ab initio interaction energy information and macroscopic properties prediction, we performed Gibbs ensemble Monte Carlo (GEMC) simulations using their developed pair potentials for acetonitrile and methanol. The simulations results show that the phase behavior of acetonitrile is well described by just the pair interaction potential. For methanol, on the other hand, pair interactions are insufficient to properly predict its vapor-liquid phase behavior, and its saturated liquid density. We also explored simplified forms for representing the ab initio interaction energies by refitting a selected range of the data to a site-site Lennard-Jones and to a modified Buckingham (exponential-6) potentials plus Coulombic interactions. These were also used in GEMC simulations in order to evaluate the quality and computational efficiency of these different potential forms. It was found that the phase behavior prediction for acetonitrile and methanol are highly dependent on the details of the interaction potentials developed.

  14. New ab initio based pair potential for accurate simulation of phase transitions in ZnO

    NARCIS (Netherlands)

    Wang, Shuaiwei; Fan, Zhaochuan; Koster, Rik S.; Fang, Changming; Van Huis, Marijn A.; Yalcin, Anil O.; Tichelaar, Frans D.; Zandbergen, Henny W.; Vlugt, Thijs J H


    A set of interatomic pair potentials is developed for ZnO based on the partially charged rigid ion model (PCRIM). The derivation of the potentials combines lattice inversion, empirical fitting, and ab initio energy surface fitting. We show that, despite the low number of parameters in this model (8)

  15. Variability in the cadherin gene in an Ostrinia nubilalis strain selected for Cry1Ab resistance. (United States)

    Bel, Yolanda; Siqueira, Herbert A A; Siegfried, Blair D; Ferré, Juan; Escriche, Baltasar


    Transgenic corn expressing Cry1Ab (a Bacillus thuringiensis toxin) is highly effective in the control of Ostrinia nubilalis. For its toxic action, Cry1Ab has to bind to specific insect midgut proteins. To date, in three Lepidoptera species resistance to a Cry1A toxin has been conferred by mutations in cadherin, a protein of the Lepidoptera midgut membrane. The implication of cadherin in the resistance of an Ostrinia nubilalis colony (Europe-R) selected with Bacillus thuringiensis Cry1Ab protoxin was investigated. Several major mutations in the cadherin (cdh) gene were found, which introduced premature termination codons and/or large deletions (ranging from 1383 to 1701bp). The contribution of these major mutations to the resistance was analyzed in resistant individuals that survived exposure to a high concentration of Cry1Ab protoxin. The results indicated that the presence of major mutations was drastically reduced in individuals that survived exposure. Previous inheritance experiments with the Europe-R strain indicated the involvement of more than one genetic locus and reduced amounts of the cadherin receptor. The results of the present work support a polygenic inheritance of resistance in the Europe-R strain, in which mutations in the cdh gene would contribute to resistance by means of an additive effect. PMID:19114103

  16. Relativistic ab initio spectroscopy study of forbidden lines of singly ionized zinc

    NARCIS (Netherlands)

    Dixit, Gopal; Sahoo, Bijaya K.; Chaudhuri, Rajat K.; Majumder, Sonjoy


    The ab initio calculation has been carried out to study the astrophysically important forbidden electromagnetic transition rates of singly ionized zinc (Zn II). Electron correlations are considered to all orders using coupled-cluster theory in the relativistic framework. Calculated excitation energi

  17. Ab initio Defect Energetics in LaBO3 Perovskite Solid Oxide Fuel Cell Materials

    DEFF Research Database (Denmark)

    Lee, Yueh-Lin; Morgan, Dane; Kleis, Jesper;


    Perovskite materials of the form ABO3 are a promising family of compounds for use in solid oxide fuel cell (SOFC) cathodes. Study of the physics of these compounds under SOFC conditions with ab initio methods is particularly challenging due to high temperatures, exchange of oxygen with O2 gas, and...

  18. Raman and ab initio studies of simple and binary 1-alkyl-3-methylimidazolium ionic liquids

    DEFF Research Database (Denmark)

    Berg, R.W.; Deetlefs, M.; Seddon, K.R.;


    Raman spectra of the ionic liquids, 1-butyl-3-methylimidazolium hexafluorophosphate ([C(4)mim][PF6]), 1-hexyl-3-methylimidazolium chloride ([C(6)mim]Cl), and 1-hexyl-3-methylimidazolium hexafluorophosphate ([C(6)mim][PF6]), and binary mixtures thereof, have been assigned using ab initio MP2...

  19. Orbital and physical properties of the $\\sigma$ Ori Aa,Ab,B triple system

    CERN Document Server

    Simón-Díaz,; Lorenzo, J; Apellániz, J Maíz; Schneider, F R N; Negueruela, I; Barbá, R H; Dorda, R; Marco, A; Montes, D; Pellerin, A; Sanchez-Bermudez, J; Sódor, Á; Sota, A


    We provide a complete characterization of the astrophysical properties of the $\\sigma$ Ori Aa,Ab,B hierarchical triple system, and an improved set of orbital parameters for the highly eccentric $\\sigma$ Ori Aa,Ab spectroscopic binary. We compiled a spectroscopic dataset comprising 90 high-resolution spectra covering a total time span of 1963 days. We applied the Lehman-Filh\\'es method for a detailed orbital analysis of the radial velocity curves and performed a combined quantitative spectroscopic analysis of the {$\\sigma$ Ori Aa,Ab,B} system by means of the stellar atmosphere code FASTWIND. We used our own plus other available information on photometry and distance to the system for measuring the radii, luminosities, and spectroscopic masses of the three components. We also inferred evolutionary masses and stellar ages using the Bayesian code BONNSAI. The orbital analysis of the new radial velocity curves led to a very accurate orbital solution of the $\\sigma$ Ori Aa,Ab pair. We provided indirect arguments in...

  20. Ab initio charge-carrier mobility model for amorphous molecular semiconductors (United States)

    Massé, Andrea; Friederich, Pascal; Symalla, Franz; Liu, Feilong; Nitsche, Robert; Coehoorn, Reinder; Wenzel, Wolfgang; Bobbert, Peter A.


    Accurate charge-carrier mobility models of amorphous organic molecular semiconductors are essential to describe the electrical properties of devices based on these materials. The disordered nature of these semiconductors leads to percolative charge transport with a large characteristic length scale, posing a challenge to the development of such models from ab initio simulations. Here, we develop an ab initio mobility model using a four-step procedure. First, the amorphous morphology together with its energy disorder and intermolecular charge-transfer integrals are obtained from ab initio simulations in a small box. Next, the ab initio information is used to set up a stochastic model for the morphology and transfer integrals. This stochastic model is then employed to generate a large simulation box with modeled morphology and transfer integrals, which can fully capture the percolative charge transport. Finally, the charge-carrier mobility in this simulation box is calculated by solving a master equation, yielding a mobility function depending on temperature, carrier concentration, and electric field. We demonstrate the procedure for hole transport in two important molecular semiconductors, α -NPD and TCTA. In contrast to a previous study, we conclude that spatial correlations in the energy disorder are unimportant for α -NPD. We apply our mobility model to two types of hole-only α -NPD devices and find that the experimental temperature-dependent current density-voltage characteristics of all devices can be well described by only slightly decreasing the simulated energy disorder strength.

  1. 控制量的计算研究%Calculation and Study on ABS Control Quantity

    Institute of Scientific and Technical Information of China (English)

    项承寨; 夏群生; 何乐


    ABS关键技术之一是控制量的计算。无论采用何种控制逻辑来实现防抱功能,准确控制量的取得是ABS正常工作的前提。提出了评价ABS控制量算法的标准,并对比分析了各种算法。实车实验证明,将研究的计算结果应用于实际的ABS控制中,取得了预期效果。%One of key technologies of ABS is how to calculate the control quantity. Obtaining an accurate control quantity is a prerequisite for normal ABS work no matter what control logics are used to realize the anti-blocking function. The criterion of assessing algorithm of ABS control quantity is put forward in this paper and all algorithms are compared and analyzed each other. It is proved by actual vehicle tests that the predictive effect has been achieved when provide the studied calculation results in the actual ABS control application.

  2. USA püüab vältida halba mainet araabia riikides / Neeme Raud

    Index Scriptorium Estoniae

    Raud, Neeme, 1969-


    Samal ajal kui G. W. Bushi administratsioon püüab Washingtonis sõlmida uusi sidemeid araabia riikidega, otsustas New Yorgi linnapea Rudolf Giuliani mitte vastu võtta Saudi Araabia printsi Alwaleed bin Talali abitshekki 10 milj. dollarile

  3. RssAB signaling coordinates early development of surface multicellularity in Serratia marcescens.

    Directory of Open Access Journals (Sweden)

    Yu-Huan Tsai

    Full Text Available Bacteria can coordinate several multicellular behaviors in response to environmental changes. Among these, swarming and biofilm formation have attracted significant attention for their correlation with bacterial pathogenicity. However, little is known about when and where the signaling occurs to trigger either swarming or biofilm formation. We have previously identified an RssAB two-component system involved in the regulation of swarming motility and biofilm formation in Serratia marcescens. Here we monitored the RssAB signaling status within single cells by tracing the location of the translational fusion protein EGFP-RssB following development of swarming or biofilm formation. RssAB signaling is specifically activated before surface migration in swarming development and during the early stage of biofilm formation. The activation results in the release of RssB from its cognate inner membrane sensor kinase, RssA, to the cytoplasm where the downstream gene promoters are located. Such dynamic localization of RssB requires phosphorylation of this regulator. By revealing the temporal activation of RssAB signaling following development of surface multicellular behavior, our findings contribute to an improved understanding of how bacteria coordinate their lifestyle on a surface.

  4. Hexamethylcyclopentadiene: time-resolved photoelectron spectroscopy and ab initio multiple spawning simulations

    DEFF Research Database (Denmark)

    Wolf, T. J. A.; Kuhlman, Thomas Scheby; Schalk, O.;


    comparing time-resolved photoelectron spectroscopy (TRPES) with ab initio multiple spawning (AIMS) simulations on the MS-MR-CASPT2 level of theory. We disentangle the relationship between two phenomena that dominate the immediate molecular response upon light absorption: a spectrally dependent delay of the...

  5. Ab initio study of energy-level alignments in polymer-dye blends

    NARCIS (Netherlands)

    Pasveer, W.F.; Bobbert, P.A.; Michels, M.A.J.; Langeveld-Voss, B.M.W.; Schoo, H.F.M.; Bastiaansen, J.J.A.M.


    Polymers with a small amount of dye blended in offer an attractive possibility to change the color of the emitted light by changing the dye. We present ab initio calculations within density-functional theory of the HOMO/ LUMO energies for dipyrrolomethane dyes, polyphenylenevinylene and polyfluorene

  6. Electronic transport properties of fullerene functionalized carbon nanotubes: Ab initio and tight-binding calculations

    DEFF Research Database (Denmark)

    Fürst, Joachim Alexander; Hashemi, J.; Markussen, Troels;


    Fullerene functionalized carbon nanotubes-NanoBuds-form a novel class of hybrid carbon materials, which possesses many advantageous properties as compared to the pristine components. Here, we report a theoretical study of the electronic transport properties of these compounds. We use both ab init...

  7. The Pu–U–Am system: An ab initio informed CALPHAD thermodynamic study

    Energy Technology Data Exchange (ETDEWEB)

    Perron, A., E-mail: [Lawrence Livermore National Laboratory, Livermore, CA 94550 (United States); Turchi, P.E.A.; Landa, A.; Söderlind, P. [Lawrence Livermore National Laboratory, Livermore, CA 94550 (United States); Ravat, B.; Oudot, B.; Delaunay, F. [CEA-Centre de Valduc, 21120 Is sur Tille (France)


    Highlights: • The ab initio informed CALPHAD assessment of the Am–U system has been realized. • A strong tendency toward phase separation across the whole composition range is predicted. • The ab initio informed Pu–U–Am thermodynamic database has been developed. • The solubility of Am and U in the liquid phase is improved by adding Pu. • The δ-Pu (fcc) phase is strongly stabilized by Am, on the contrary to the bcc phase. - Abstract: Phase diagram and thermodynamic properties of the Am–U system, that are experimentally unknown, are calculated using the CALPHAD method with input from ab initio electronic-structure calculations for the fcc and bcc phases. A strong tendency toward phase separation across the whole composition range is predicted. In addition, ab initio informed Pu–U and Am–Pu thermodynamic assessments are combined to build a Pu–U–Am thermodynamic database. Regarding the Pu-rich corner of the ternary system, predictions indicate that Am acts as a powerful δ-Pu (fcc) stabilizer. In the U-rich corner, similar predictions are made but to a lesser extent. In both cases, the bcc phase is destabilized and the fcc phase is enhanced. Finally, results and methodology are discussed and compared with previous assessments and guidelines are provided for further experimental studies.

  8. Ab initio electronic properties of dual phosphorus monolayers in silicon

    DEFF Research Database (Denmark)

    Drumm, Daniel W.; Per, Manolo C.; Budi, Akin;


    In the midst of the epitaxial circuitry revolution in silicon technology, we look ahead to the next paradigm shift: effective use of the third dimension - in particular, its combination with epitaxial technology. We perform ab initio calculations of atomically thin epitaxial bilayers in silicon, ...

  9. Matrix product operators, matrix product states, and ab initio density matrix renormalization group algorithms. (United States)

    Chan, Garnet Kin-Lic; Keselman, Anna; Nakatani, Naoki; Li, Zhendong; White, Steven R


    Current descriptions of the ab initio density matrix renormalization group (DMRG) algorithm use two superficially different languages: an older language of the renormalization group and renormalized operators, and a more recent language of matrix product states and matrix product operators. The same algorithm can appear dramatically different when written in the two different vocabularies. In this work, we carefully describe the translation between the two languages in several contexts. First, we describe how to efficiently implement the ab initio DMRG sweep using a matrix product operator based code, and the equivalence to the original renormalized operator implementation. Next we describe how to implement the general matrix product operator/matrix product state algebra within a pure renormalized operator-based DMRG code. Finally, we discuss two improvements of the ab initio DMRG sweep algorithm motivated by matrix product operator language: Hamiltonian compression, and a sum over operators representation that allows for perfect computational parallelism. The connections and correspondences described here serve to link the future developments with the past and are important in the efficient implementation of continuing advances in ab initio DMRG and related algorithms.

  10. Study of Thermal Properties of Mixed (PP/EPR/ABS with Five Model Compatibilizers

    Directory of Open Access Journals (Sweden)

    Pierre Marcel Anicet Noah


    Full Text Available The influences of incorporating compatibilizers E-EA-MAH, E-MA-GMA, E-AM, SEBS KRATON G, or PP-g-MAH on the thermal properties of mixed (polypropylene/ethylene propylene rubber/acrylonitrile butadiene styrene (PP/EPR/ABS have been investigated. DSC investigations have revealed that the incorporation of 5% of ABS in the copolymer (PP/EPR does not fundamentally affect the thermal properties of the basic copolymer; additionally, the addition of 1.5% of each of the compatibilizers in the basic mixture does not significantly alter the crystallization temperature values and the melting of the -P- sequences. There is a variation of melting enthalpy values of the -P- sequences of 18.23% using SEBS KRATON G and of 10.38% using E-AM-GMA. When the rate of each of the compatibilizers increases to 5%, overall crystallization enthalpies of -P- sequences are almost kept unchanged, except for the case of using the compatibilizer E-AM-GMA with a variation of 8.42%. There is a minor variation of the melting enthalpy of -P- sequences with higher levels of compatibilizer. The incorporation of 5% ABS copolymer in the PP/EPR does not significantly alter the thermal properties of the basic structure of (PP/EPR/ABS.

  11. Living with an imperfect cell wall : compensation of femAB inactivation in Staphylococcus aureus

    NARCIS (Netherlands)

    Hübscher, Judith; Jansen, Andrea; Kotte, Oliver; Schäfer, Juliane; Majcherczyk, Paul A.; Harris, Llinos G.; Bierbaum, Gabriele; Heinemann, Matthias; Berger-Bächi, Brigitte


    Background: Synthesis of the Staphylococcus aureus peptidoglycan pentaglycine interpeptide bridge is catalyzed by the nonribosomal peptidyl transferases FemX, FemA and FemB. Inactivation of the femAB operon reduces the interpeptide to a monoglycine, leading to a poorly crosslinked peptidoglycan. fem

  12. All-electron ab initio investigations of the electronic states of the NiC molecule

    DEFF Research Database (Denmark)

    Shim, Irene; Gingerich, Karl. A.


    The low-lying electronic states of NiC are investigated by all-electron ab initio multi-configuration self-consistent-field (CASSCF) calculations including relativistic corrections. The electronic structure of NiC is interpreted as perturbed antiferromagnetic couplings of the localized angular...

  13. Isotopic composition of trace elements in presolar silicon carbide A+B grains (United States)

    Savina, M.; Tripa, C.; Pellin, M.; Davis, A.; Clayton, R.; Lewis, R.; Amari, S.


    Presolar SiC are classified into several types based on C, N, and Si isotopic compositions. Most are mainstream, which are generally believed to derive from low-mass asymptotic giant branch (AGB) stars. Among the less common grains, A+B grains, which comprise ˜3-4% of presolar SiC, are perhaps the least well understood. Recent measurements of trace element concentration patterns in individual grains suggest that A+B grains can be divided into at least 4 groups, and thus have multiple astrophysical sites of origin^1. We report here our Resonant Ionization Mass Spectrometry (RIMS) measurements of Zr, Mo, Ba, and Fe isotopic compositions in individual mainstream and type A+B presolar SiC. While the mainstream grains show isotopic compositions compatible with condensation around low-mass AGB stars, most A+B grains have near-solar isotopic compositions, though some show Zr, Mo, and Fe isotope patterns that have not been observed in other types of presolar SiC grains. We discuss these results in terms of possible astrophysical sites for the production of these unusual grains. This work was supported in part by the Department of Energy, BES-Materials Sciences through Contract No. W-31-109-ENG-38. ^1 Amari S., Nittler L. R., Zinner E., Lodders K., and Lewis R. S. (2001) Astrophys. J. 559, 463-483.

  14. Detection and analysis of tupaia hepatocytes via mAbs against tupaia serum albumin. (United States)

    Liu, Xuan; Yuan, Lunzhi; Yuan, Quan; Zhang, Yali; Wu, Kun; Zhang, Tianying; Wu, Yong; Hou, Wangheng; Wang, Tengyun; Liu, Pingguo; Shih, James Wai Kuo; Cheng, Tong; Xia, Ningshao


    On the basis of its close phylogenetic relationship with primates, the development of Tupaia belangeri as an infection animal model and drug metabolism model could provide a new option for preclinical studies, especially in hepatitis virus research. As a replacement for primary human hepatocytes (PHHs), primary tupaia hepatocytes (PTHs) have been widely used. Similar to human serum albumin, tupaia serum albumin (TSA) is the most common liver synthesis protein and is an important biomarker for PTHs and liver function. However, no detection or quantitative method for TSA has been reported. In this study, mouse monoclonal antibodies (mAbs) 4G5 and 9H3 against TSA were developed to recognize PTHs, and they did not show cross-reactivity with serum albumin from common experimental animals, such as the mouse, rat, cow, rabbit, goat, monkey, and chicken. The two mAbs also exhibited good performance in fluorescence activated cell sorting (FACS) analysis and immunofluorescence (IF) detection of PTHs. A chemiluminescent enzyme immune assay method using the two mAbs, with a linear range from 96.89 pg/ml to 49,609.38 pg/ml, was developed for the quantitative detection of TSA. The mAbs and the CLEIA method provide useful tools for research on TSA and PTHs. PMID:26597317

  15. Study on the surface hydroxyl group on solid breeding materials by ab-initio calculations

    Energy Technology Data Exchange (ETDEWEB)

    Tanaka, Satoru; Taniguchi, Masaki [Tokyo Univ. (Japan). Faculty of Engineering


    The nature of -OH on the surface of Li{sub 2}O was analyzed with the ab-initio quantum chemical calculation technique. Calculation results showed that the stretching vibration of O-H is affected by the chemical species around the -OH. (author)

  16. 75 FR 45160 - SKF Aeroengine Falconer a Subsidiary of AB SKF Including On-Site Leased Workers From Manpower... (United States)


    ..., Falconer, New York. The notice was published in the Federal Register on March 12, 2010 (75 FR 11924). At... Employment and Training Administration SKF Aeroengine Falconer a Subsidiary of AB SKF Including On-Site... February 4, 2010, applicable to workers of SKF Aeroengine Falconer, a subsidiary of AB SKF, including...

  17. Overexpression of MexAB-OprM efflux pump in carbapenem-resistant Pseudomonas aeruginosa. (United States)

    Pan, Ya-Ping; Xu, Yuan-Hong; Wang, Zhong-Xin; Fang, Ya-Ping; Shen, Ji-Lu


    Efflux pump systems are one of the most important mechanisms conferring multidrug resistance in Pseudomonas aeruginosa. MexAB-OprM efflux pump is one of the largest multi-drug resistant efflux pumps with high-level expression, which is controlled by regulatory genes mexR, nalC, and nalD. This study investigated the role of efflux pump MexAB-OprM in 75 strains of carbapenem-resistant P. aeruginosa and evaluated the influence of point mutation of the regulatory genes. The minimum inhibitory concentrations of imipenem and meropenem, with or without MC207110, an efflux pump inhibitor, were determined by agar dilution method to select the positive strains for an overexpressed active efflux pump. Carba NP test and EDTA-disk synergy test were used for the detection of carbapenemase and metallo-β-lactamases, respectively. The gene mexA, responsible for the fusion protein structure, and the reference gene rpoD of the MexAB-OprM pump were amplified by real-time PCR. The quantity of relative mRNA expression was determined simultaneously. By PCR method, the efflux regulatory genes mexR, nalC, and nalD and outer membrane protein OprD2 were amplified for the strains showing overexpression of MexAB-OprM and subsequently analyzed by BLAST. Among the 75 P. aeruginosa strains, the prevalence of efflux pump-positive phenotype was 17.3 % (13/75). Carba NP test and EDTA-disk synergy test were all negative in the 13 strains. PCR assay results showed that ten strains overexpressed the MexAB-OprM efflux pump and were all positive for the regulatory genes mexR, nalC, and nalD. Sequence analysis indicated that of the ten isolates, nine had a mutation (Gly → Glu) at 71st amino acid position in NalC, and eight also had a mutation (Ser → Arg) at 209th position in NalC. Only one strain had a mutation (Thr → Ile) at the 158th amino acid position in NalD, whereas eight isolates had mutations in MexR. In conclusion, overexpression of efflux pump MexAB-OprM plays an important role in

  18. Preparation of a pure [sup 99m]Tc-F(ab')[sub 2] radioimmunoconjugate by direct labeling methods

    Energy Technology Data Exchange (ETDEWEB)

    Griffiths, G.L.; Jones, A.L.; Hansen, H.J. (Immunomedics Inc., Morris Plains, NJ (United States)); Goldenberg, D.M. (Center for Molecular Medicine and Immunology, Newark, NJ (United States))


    Intact IgG and Fab' can be labeled directly with [sup 99m]Tc to give quantitative incorporation of radioactivity into the protein. With F(ab')[sub 2] the reductive conditions yield a mixture of [sup 99m]Tc-F(ab')[sub 2] and [sup 99m]Tc-Fab'. We now report a direct labeling method to produce only [sup 99m]Tc-F(ab')[sub 2] in quantitative yield and contaminated with [sup 99m]Tc-Fab'. The properties, stability and biodistribution of the [sup 99m]Tc-F(ab')[sub 2] have been compared to [sup 99m]Tc-Fab'. This new technology will allow us to compare technetium direct-labeled IgG, F(ab')[sub 2] and Fab' derivatives of the same antibody for radioimmunodetection. (author).

  19. AbsIDconvert: An absolute approach for converting genetic identifiers at different granularities

    Directory of Open Access Journals (Sweden)

    Mohammad Fahim


    Full Text Available Abstract Background High-throughput molecular biology techniques yield vast amounts of data, often by detecting small portions of ribonucleotides corresponding to specific identifiers. Existing bioinformatic methodologies categorize and compare these elements using inferred descriptive annotation given this sequence information irrespective of the fact that it may not be representative of the identifier as a whole. Results All annotations, no matter the granularity, can be aligned to genomic sequences and therefore annotated by genomic intervals. We have developed AbsIDconvert, a methodology for converting between genomic identifiers by first mapping them onto a common universal coordinate system using an interval tree which is subsequently queried for overlapping identifiers. AbsIDconvert has many potential uses, including gene identifier conversion, identification of features within a genomic region, and cross-species comparisons. The utility is demonstrated in three case studies: 1 comparative genomic study mapping plasmodium gene sequences to corresponding human and mosquito transcriptional regions; 2 cross-species study of Incyte clone sequences; and 3 analysis of human Ensembl transcripts mapped by Affymetrix®; and Agilent microarray probes. AbsIDconvert currently supports ID conversion of 53 species for a given list of input identifiers, genomic sequence, or genome intervals. Conclusion AbsIDconvert provides an efficient and reliable mechanism for conversion between identifier domains of interest. The flexibility of this tool allows for custom definition identifier domains contingent upon the availability and determination of a genomic mapping interval. As the genomes and the sequences for genetic elements are further refined, this tool will become increasingly useful and accurate. AbsIDconvert is freely available as a web application or downloadable as a virtual machine at:

  20. The Use of Solitaire AB Stents in Coil Embolization of Wide-Necked Cerebral Aneurysms.

    Directory of Open Access Journals (Sweden)

    Teng-Fei Li

    Full Text Available The Solitaire AB stent is one of many assistant stents used for treating wide-necked cerebral aneurysm, and has been used since 2003. However, large sample studies on its safety and effectiveness are lacking. The objective of this study was to evaluate the effectiveness and safety of the Solitaire AB stent in the coil embolization of wide-necked cerebral aneurysms.Retrospective review of the clinical and image data of 116 patients with wide-necked cerebral aneurysms who had been enrolled at six interventional neuroradiology centers from February 2010 to February 2014 and had been treated by coil embolization; in total, 120 Solitaire AB stents were used. The degree of aneurysm occlusion was examined using digital subtraction angiography (DSA immediately after the procedure and during follow-up, and was graded using the modified Raymond classification. We also observed complications to evaluate the safety and effectiveness of this therapy.The 120 Solitaire AB stents (4 mm × 15 mm, four stents; 4 mm × 20 mm, 16 stents; 6 mm × 20 mm, 36 stents; 6 mm × 30 mm, 64 stents were inserted to treat 120 wide-necked cerebral aneurysms. All stents were inserted successfully. DSA immediately post-surgery revealed 55 cases of complete occlusion, 59 cases of neck remnant, and six cases of aneurysm remnant. Perioperatively, there were four cases of hemorrhage and four cases of stent thrombosis. The follow-up spanned 3-37 months; of 92 patients examined by DSA at the 6-month follow up, 12 had disease recurrence.The Solitaire AB stent is effective with a good technical success rate and short-term effect for assisting coil embolization of wide-necked cerebral aneurysms.

  1. Investigation of polarization effects in the gramicidin A channel from ab initio molecular dynamics simulations (United States)

    Timko, Jeff; Kuyucak, Serdar


    Polarization is an important component of molecular interactions and is expected to play a particularly significant role in inhomogeneous environments such as pores and interfaces. Here we investigate the effects of polarization in the gramicidin A ion channel by performing quantum mechanics/molecular mechanics molecular dynamics (MD) simulations and comparing the results with those obtained from classical MD simulations with non-polarizable force fields. We consider the dipole moments of backbone carbonyl groups and channel water molecules as well as a number of structural quantities of interest. The ab initio results show that the dipole moments of the carbonyl groups and water molecules are highly sensitive to the hydrogen bonds (H-bonds) they participate in. In the absence of a K+ ion, water molecules in the channel are quite mobile, making the H-bond network highly dynamic. A central K+ ion acts as an anchor for the channel waters, stabilizing the H-bond network and thereby increasing their average dipole moments. In contrast, the K+ ion has little effect on the dipole moments of the neighboring carbonyl groups. The weakness of the ion-peptide interactions helps to explain the near diffusion-rate conductance of K+ ions through the channel. We also address the sampling issue in relatively short ab initio MD simulations. Results obtained from a continuous 20 ps ab initio MD simulation are compared with those generated by sampling ten windows from a much longer classical MD simulation and running each window for 2 ps with ab initio MD. Both methods yield similar results for a number of quantities of interest, indicating that fluctuations are fast enough to justify the short ab initio MD simulations.

  2. Investigation of polarization effects in the gramicidin A channel from ab initio molecular dynamics simulations. (United States)

    Timko, Jeff; Kuyucak, Serdar


    Polarization is an important component of molecular interactions and is expected to play a particularly significant role in inhomogeneous environments such as pores and interfaces. Here we investigate the effects of polarization in the gramicidin A ion channel by performing quantum mechanics/molecular mechanics molecular dynamics (MD) simulations and comparing the results with those obtained from classical MD simulations with non-polarizable force fields. We consider the dipole moments of backbone carbonyl groups and channel water molecules as well as a number of structural quantities of interest. The ab initio results show that the dipole moments of the carbonyl groups and water molecules are highly sensitive to the hydrogen bonds (H-bonds) they participate in. In the absence of a K(+) ion, water molecules in the channel are quite mobile, making the H-bond network highly dynamic. A central K(+) ion acts as an anchor for the channel waters, stabilizing the H-bond network and thereby increasing their average dipole moments. In contrast, the K(+) ion has little effect on the dipole moments of the neighboring carbonyl groups. The weakness of the ion-peptide interactions helps to explain the near diffusion-rate conductance of K(+) ions through the channel. We also address the sampling issue in relatively short ab initio MD simulations. Results obtained from a continuous 20 ps ab initio MD simulation are compared with those generated by sampling ten windows from a much longer classical MD simulation and running each window for 2 ps with ab initio MD. Both methods yield similar results for a number of quantities of interest, indicating that fluctuations are fast enough to justify the short ab initio MD simulations.

  3. Accuracy of the Fluorescence-Activated Cell Sorting Assay for the Aquaporin-4 Antibody (AQP4-Ab): Comparison with the Commercial AQP4-Ab Assay Kit (United States)

    Kim, Yoo-Jin; Cheon, So Young; Kim, Boram; Jung, Kyeong Cheon; Park, Kyung Seok


    Background The aquaporin-4 antibody (AQP4-Ab) is a disease-specific autoantibody to neuromyelitis optica (NMO). We aimed to evaluate the accuracy of the FACS assay in detecting the AQP4-Ab compared with the commercial cell-based assay (C-CBA) kit. Methods Human embryonic kidney-293 cells were transfected with human aquaporin-4 (M23) cDNA. The optimal cut off values of FACS assay was tested using 1123 serum samples from patients with clinically definite NMO, those at high risk for NMO, patients with multiple sclerosis, patients with other idiopathic inflammatory demyelinating diseases, and negative controls. The accuracy of FACS assay and C-CBA were compared in consecutive 225 samples that were collected between January 2014 and June 2014. Results With a cut-off value of MFIi of 3.5 and MFIr of 2.0, the receiver operating characteristic curve for the FACS assay showed an area under the curve of 0.876. Among 225 consecutive sera, the FACS assay and C-CBA had a sensitivity of 77.3% and 69.7%, respectively, in differentiating the sera of definite NMO patients from sera of controls without IDD or of MS. Both assay had a good specificity of 100% in it. The overall positivity of the C-CBA among FACS-positive sera was 81.5%; moreover, its positivity was low as 50% among FACS-positive sera with relatively low MFIis. Conclusions Both the FACS assay and C-CBA are sensitive and highly specific assays in detecting AQP4-Ab. However, in some sera with relatively low antibody titer, FACS-assay can be a more sensitive assay option. In real practice, complementary use of FACS assay and C-CBA will benefit the diagnosis of NMO patients, because the former can be more sensitive among low titer sera and the latter are easier to use therefore can be widely used. PMID:27658059

  4. Tobacco plants expressing the Cry1AbMod toxin suppress tolerance to Cry1Ab toxin of Manduca sexta cadherin-silenced larvae. (United States)

    Porta, Helena; Jiménez, Gladys; Cordoba, Elizabeth; León, Patricia; Soberón, Mario; Bravo, Alejandra


    Cry toxins produced by Bacillus thuringiensis bacteria are insecticidal proteins used worldwide in the control of different insect pests. Alterations in toxin-receptor interaction represent the most common mechanism to induce resistance to Cry toxins in lepidopteran insects. Cry toxins bind with high affinity to the cadherin protein present in the midgut cells and this interaction facilitates the proteolytic removal of helix α-1 and pre-pore oligomer formation. Resistance to Cry toxins has been linked with mutations in the cadherin gene. One strategy effective to overcome larval resistance to Cry1A toxins is the production of Cry1AMod toxins that lack helix α-1. Cry1AMod are able to form oligomeric structures without binding to cadherin receptor and were shown to be toxic to cadherin-silenced Manduca sexta larvae and Pectinophora gossypiella strain with resistance linked to mutations in a cadherin gene. We developed Cry1AbMod tobacco transgenic plants to analyze if Cry1AMod toxins can be expressed in transgenic crops, do not affect plant development and are able to control insect pests. Our results show that production of the Cry1AbMod toxin in transgenic plants does not affect plant development, since these plants exhibited healthy growth, produced abundant seeds, and were virtually undistinguishable from control plants. Most importantly, Cry1AbMod protein produced in tobacco plants retains its functional toxic activity against susceptible and tolerant M. sexta larvae due to the silencing of cadherin receptor by RNAi. These results suggest that CryMod toxins could potentially be expressed in other transgenic crops to protect them against both toxin-susceptible and resistant lepidopteran larvae affected in cadherin gene. PMID:21621616

  5. 汽车防抱死制动系统(ABS)试验研究及评价方法%ABS test, research and appraisal methods

    Institute of Scientific and Technical Information of China (English)




  6. ABS"Luna"ECR(R)设备的最新进展和使用效果%Latest Developments and Results of ABS "Luna" ECR(R) Plant

    Institute of Scientific and Technical Information of China (English)

    F.Alzetta; F.Toschi



  7. Serious Gaming for Test & Evaluation of Clean-Slate (Ab Initio) National Airspace System (NAS) Designs (United States)

    Allen, B. Danette; Alexandrov, Natalia


    Incremental approaches to air transportation system development inherit current architectural constraints, which, in turn, place hard bounds on system capacity, efficiency of performance, and complexity. To enable airspace operations of the future, a clean-slate (ab initio) airspace design(s) must be considered. This ab initio National Airspace System (NAS) must be capable of accommodating increased traffic density, a broader diversity of aircraft, and on-demand mobility. System and subsystem designs should scale to accommodate the inevitable demand for airspace services that include large numbers of autonomous Unmanned Aerial Vehicles and a paradigm shift in general aviation (e.g., personal air vehicles) in addition to more traditional aerial vehicles such as commercial jetliners and weather balloons. The complex and adaptive nature of ab initio designs for the future NAS requires new approaches to validation, adding a significant physical experimentation component to analytical and simulation tools. In addition to software modeling and simulation, the ability to exercise system solutions in a flight environment will be an essential aspect of validation. The NASA Langley Research Center (LaRC) Autonomy Incubator seeks to develop a flight simulation infrastructure for ab initio modeling and simulation that assumes no specific NAS architecture and models vehicle-to-vehicle behavior to examine interactions and emergent behaviors among hundreds of intelligent aerial agents exhibiting collaborative, cooperative, coordinative, selfish, and malicious behaviors. The air transportation system of the future will be a complex adaptive system (CAS) characterized by complex and sometimes unpredictable (or unpredicted) behaviors that result from temporal and spatial interactions among large numbers of participants. A CAS not only evolves with a changing environment and adapts to it, it is closely coupled to all systems that constitute the environment. Thus, the ecosystem that

  8. Sequencing and bioinformatic analysis of genome of Acinetobacter baumannii bacteriophage AB3%鲍曼不动杆菌噬菌体AB3的全基因组测序及生物信息学分析

    Institute of Scientific and Technical Information of China (English)

    张劼; 刘茜; 甘丹


    目的 对本研究小组分离的鲍曼不动杆菌噬菌体AB3进行测序和基因组生物信息学分析,阐明其亲缘关系.方法 采用鸟枪法和重叠群组装的策略对噬菌体AB3进行基因组测序,并通过EditSeq、tRNAscan-SE、TRF、FindTerm、ORF finder、BPROM、GeneMarkTM、Clustalx、phylip等软件对所获噬菌体AB3基因组的一般特性、编码基因的功能预测、RNA聚合酶基因系统的进化进行分析.结果 噬菌体AB3基因组为全长31 185 bp的双链DNA,G+C含量为39.18%,包含28个预测基因,1个转录终止子和4个可能的启动子序列.结论 基因分析和RNA聚合酶基因进化分析显示噬菌体AB3与噬菌体AB1类似,均属于phiKMV-like病毒属.%Objective To sequence the Acinetobacter baumannii bacteriophage AB3 separated by our team,and to perform bioinformatics analysis,so as to identify the classification of its phylogenetic relationship.Methods Shot-gun library and config package strategy were carried out for sequencing the genome of bacteriophage AB3.Such software as EditSeq,tRNAscan-SE,TRF,FindTerm,ORF finder,BPROM and GeneMarkTM were applied to predict both general characteristics of the bacteriophage AB3 genome and the coding gene function.In addition,the evolution of RNA polymerase gene system was analyzed with the software of Clustalx and phylip.Results The genome of bacteriophage AB3 was a double-strand DNA with a full length of 31 185 bp,in which G + C mol% was 39.18% and 28 predicted genes,1 transcription terminator,and 4 possible promoter sequences were included.Conclusion Genetic analysis and RNA polymerase gene evolution analysis indicate that bacteriophage AB3 is similar to bacteriophage AB1,and both of them belong to phiKMV-like virus.

  9. Expression of cry1Ab gene from a novel Bacillus thuringiensis strain SY49-1 active on pest insects. (United States)

    Azizoglu, Ugur; Ayvaz, Abdurrahman; Yılmaz, Semih; Karabörklü, Salih; Temizgul, Rıdvan


    In this study, the cry1Ab gene of previously characterized and Lepidoptera-, Diptera-, and Coleoptera-active Bacillus thuringiensis SY49-1 strain was cloned, expressed and individually tested on Ephestia kuehniella (Lepidoptera: Pyralidae) and Plodia interpunctella (Lepidoptera: Pyralidae) larvae. pET-cry1Ab plasmids were constructed by ligating the cry1Ab into pET28a (+) expression vector. Constructed plasmids were transferred to an Escherichia coli BL21 (DE3) strain rendered competent with CaCl2. Isopropyl β-d-1-thiogalactopyranoside was used to induce the expression of cry1Ab in E. coli BL21(DE3), and consequently, ∼130kDa of Cry1Ab was obtained. Bioassay results indicated that recombinant Cry1Ab at a dose of 1000μgg(-1) caused 40% and 64% mortality on P. interpunctella and E. kuehniella larvae, respectively. However, the mortality rates of Bt SY49-1 strains' spore-crystal mixture at the same dose were observed to be 70% on P. interpunctella and 90% on E. kuehniella larvae. The results indicated that cry1Ab may be considered as a good candidate in transgenic crop production and as an alternative biocontrol agent in controlling stored product moths.

  10. Expression of cry1Ab gene from a novel Bacillus thuringiensis strain SY49-1 active on pest insects. (United States)

    Azizoglu, Ugur; Ayvaz, Abdurrahman; Yılmaz, Semih; Karabörklü, Salih; Temizgul, Rıdvan


    In this study, the cry1Ab gene of previously characterized and Lepidoptera-, Diptera-, and Coleoptera-active Bacillus thuringiensis SY49-1 strain was cloned, expressed and individually tested on Ephestia kuehniella (Lepidoptera: Pyralidae) and Plodia interpunctella (Lepidoptera: Pyralidae) larvae. pET-cry1Ab plasmids were constructed by ligating the cry1Ab into pET28a (+) expression vector. Constructed plasmids were transferred to an Escherichia coli BL21 (DE3) strain rendered competent with CaCl2. Isopropyl β-d-1-thiogalactopyranoside was used to induce the expression of cry1Ab in E. coli BL21(DE3), and consequently, ∼130kDa of Cry1Ab was obtained. Bioassay results indicated that recombinant Cry1Ab at a dose of 1000μgg(-1) caused 40% and 64% mortality on P. interpunctella and E. kuehniella larvae, respectively. However, the mortality rates of Bt SY49-1 strains' spore-crystal mixture at the same dose were observed to be 70% on P. interpunctella and 90% on E. kuehniella larvae. The results indicated that cry1Ab may be considered as a good candidate in transgenic crop production and as an alternative biocontrol agent in controlling stored product moths. PMID:27143037

  11. Impact of enrofloxacin and florfenicol therapy on the spread of OqxAB gene and intestinal microbiota in chickens. (United States)

    Chen, Yi; Sun, Jian; Liao, Xiao-Ping; Shao, Yang; Li, Liang; Fang, Liang-Xing; Liu, Ya-Hong


    Horizontal transfer of plasmid-encoded multidrug-resistant determinants is a major health problem and has attracted much public attention. We studied the dissemination of the efflux pump gene oqxAB located on transferable plasmid pHXY0908 between Salmonella Typhimurium and Escherichia coli in the gut of chickens. After an inoculation with Salmonella Typhimurium harboring oqxAB-bearing plasmid pHXY0908, chickens were treated with enrofloxacin and florfenicol. Inoculated, but non-treated chickens were included as a control group. Our results revealed that commensal E. coli isolates from the gut of chickens acquired the oqxAB-bearing plasmid in both treated and non-treated groups. Additionally, in the florfenicol treatment group, the average isolation rate of oqxAB-positive E. coli was significantly higher than that in the non-treated group. PFGE analysis showed that oqxAB-positive E. coli strains belonged to different patterns with one predominating. Moreover, multilocus sequence typing analysis revealed that E. coli ST533 was closely associated with the spread of oqxAB gene. qPCR analysis indicated that antibiotic administration provided selective advantages for sustaining a significantly high level of oqxAB gene from the DNA extracted from the feces. There was also a fluctuation in the intestinal microbiota with antibiotic therapy. In conclusion, the present study indicates that the oqxAB gene could be readily spread within the intestinal microflora. This could be enhanced by administrated with clinical doses of florfenicol and enrofloxacin, resulting in the enlargement of resistance gene reservoirs. In addition, ST533 E. coli isolates were found to contribute to transfer of the oqxAB gene. PMID:27527758

  12. Ab initio calculations on the magnetic properties of transition metal complexes

    International Nuclear Information System (INIS)

    We present a protocol for the ab initio determination of the magnetic properties of mono- and polynuclear transition metal compounds. First, we obtain the low lying electronic states by multireference methods. Then, we include spin-orbit coupling and an external magnetic field for the determination of zero-field splitting and g-tensors. For the polynuclear complexes the magnetic exchange coupling constants are determined by a modified complete active space self consistent field method. Based on the results of the ab initio calculations, magnetic data such as magnetic susceptibility or magnetization are simulated and compared to experimental data. The results obtained for the polynuclear complexes are further analysed by calculations on model complexes where part of the magnetic centers are substituted by diamagnetic ions. The methods are applied to different Co and Ni containing transition metal complexes

  13. The second Studsvik AB - JAEA meeting for cooperation in nuclear energy research and development

    International Nuclear Information System (INIS)

    The second annual meeting was held at Studsvik AB in Sweden to exchange information on radioactive waste treatment technology including recycling of materials and technical developments for the neutron irradiation experiments in materials testing reactors. The information exchange meeting was held on the basis of the implemental agreement between the Studsvik AB and the Japan Atomic Energy Agency (JAEA) for cooperation in nuclear energy research and development. The major items of the information exchange were the present status of waste treatment in both organizations including acceptance criteria of wastes in Studsvik facilities, experience and current status of RI production technology in both organizations as well as the sensor development. The future plan in cooperative program was also discussed. This report describes contents of the information exchange and discussions in two cooperation areas. (author)

  14. Radio Emission from Binary Stars in the AB Doradus Moving Group (United States)

    Azulay, R.; Guirado, J. C.; Marcaide, J. M.; Martí-Vidal, I.; Ros, E.


    Precise determination of dynamical masses of pre-main-sequence stars is essential for calibrating stellar evolution models, that are widely used to derive theoretical masses of young low-mass objects. We have determined the individual masses of the pair AB Dor Ba/Bb using Australian Long Baseline Array observations and archive infrared data, as part of a larger program directed to monitor binary systems in the AB Doradus moving group. We have detected, for the first time, compact radio emission from both stars. This has allowed us to determine the orbital parameters of both the relative and absolute orbits and, consequently, their individual dynamical masses: 0.28+/-0.05 M⊙ and 0.25+/-0.05 M⊙. Comparisons of the dynamical masses with the prediction of pre-main-sequence (PMS) evolutionary models show that the models underpredict the dynamical masses of the binary components Ba and Bb by 10-30% and 10-40%, respectively.

  15. Accelerating chemical reactions: Exploring reactive free-energy surfaces using accelerated ab initio molecular dynamics (United States)

    Pierce, Levi C. T.; Markwick, Phineus R. L.; McCammon, J. Andrew; Doltsinis, Nikos L.


    A biased potential molecular dynamics simulation approach, accelerated molecular dynamics (AMD), has been implemented in the framework of ab initio molecular dynamics for the study of chemical reactions. Using two examples, the double proton transfer reaction in formic acid dimer and the hypothetical adiabatic ring opening and subsequent rearrangement reactions in methylenecyclopropane, it is demonstrated that ab initio AMD can be readily employed to efficiently explore the reactive potential energy surface, allowing the prediction of chemical reactions and the identification of metastable states. An adaptive variant of the AMD method is developed, which additionally affords an accurate representation of both the free-energy surface and the mechanism associated with the chemical reaction of interest and can also provide an estimate of the reaction rate. PMID:21548673

  16. B28: the smallest all-boron cage from an ab initio global search (United States)

    Zhao, Jijun; Huang, Xiaoming; Shi, Ruili; Liu, Hongsheng; Su, Yan; King, R. Bruce


    Our ab initio global searches reveal the lowest-energy cage for B28, which is built from two B12 units and prevails over the competing structural isomers such as planar, bowl, and tube. This smallest boron cage extends the scope of all-boron fullerene and provides a new structural motif of boron clusters and nanostructures.Our ab initio global searches reveal the lowest-energy cage for B28, which is built from two B12 units and prevails over the competing structural isomers such as planar, bowl, and tube. This smallest boron cage extends the scope of all-boron fullerene and provides a new structural motif of boron clusters and nanostructures. Electronic supplementary information (ESI) available: Planar isomer structures of B28 and spatial distributions of front molecular orbitals. See DOI: 10.1039/c5nr04034e

  17. A highly accurate {\\it ab initio} potential energy surface for methane

    CERN Document Server

    Owens, Alec; Yachmenev, Andrey; Tennyson, Jonathan; Thiel, Walter


    A new nine-dimensional potential energy surface (PES) for methane has been generated using state-of-the-art \\textit{ab initio} theory. The PES is based on explicitly correlated coupled cluster calculations with extrapolation to the complete basis set limit and incorporates a range of higher-level additive energy corrections. These include: core-valence electron correlation, higher-order coupled cluster terms beyond perturbative triples, scalar relativistic effects and the diagonal Born-Oppenheimer correction. Sub-wavenumber accuracy is achieved for the majority of experimentally known vibrational energy levels with the four fundamentals of $^{12}$CH$_4$ reproduced with a root-mean-square error of $0.70{\\,}$cm$^{-1}$. The computed \\textit{ab initio} equilibrium C{--}H bond length is in excellent agreement with previous values despite pure rotational energies displaying minor systematic errors as $J$ (rotational excitation) increases. It is shown that these errors can be significantly reduced by adjusting the e...

  18. An Ionized Outflow from AB Aur, a Herbig Ae Star with a Transitional Disk

    CERN Document Server

    Rodriguez, Luis F; Dzib, Sergio A; Ortiz-Leon, Gisela; Loinard, Laurent; Macias, Enrique; Anglada, Guillem


    AB Aur is a Herbig Ae star with a transitional disk. Transitional disks present substantial dust clearing in their inner regions, most probably because of the formation of one or more planets, although other explanations are still viable. In transitional objects, accretion is found to be about an order of magnitude smaller than in classical full disks. Since accretion is believed to be correlated with outflow activity, centimeter free-free jets are expected to be present in association with these systems, at weaker levels than in classical protoplanetary (full) systems. We present new observations of the centimeter radio emission associated with the inner regions of AB Aur and conclude that the morphology, orientation, spectral index and lack of temporal variability of the centimeter source imply the presence of a collimated, ionized outflow. The radio luminosity of this radio jet is, however, about 20 times smaller than that expected for a classical system of similar bolometric luminosity. We conclude that c...

  19. Electronic properties of liquid Hg-In alloys : Ab-initio molecular dynamics study (United States)

    Sharma, Nalini; Thakur, Anil; Ahluwalia, P. K.


    Ab-initio molecular dynamics simulations are performed to study the structural properties of liquid Hg-In alloys. The interatomic interactions are described by ab-initio pseudopotentials given by Troullier and Martins. Three liquid Hg-In alloys (Hg10In90, Hg30In70,. Hg50In50, Hg70In30, and Hg90Pb10) at 299 K are considered. The calculated results for liquid Hg (l-Hg) and lead (l-In) are also drawn. Along with the calculated results of considered five liquid alloys of Hg-In alloy. The results obtained from electronic properties namely total density of state and partial density of states help to find the local arrangement of Hg and In atoms and the presence of liquid state in the considered five alloys.

  20. Ultracold mixtures of metastable He and Rb: Scattering lengths from ab initio calculations and thermalization measurements (United States)

    Knoop, S.; Żuchowski, P. S.; KÈ©dziera, D.; Mentel, Ł.; Puchalski, M.; Mishra, H. P.; Flores, A. S.; Vassen, W.


    We have investigated the ultracold interspecies scattering properties of metastable triplet He and Rb. We performed state-of-the-art ab initio calculations of the relevant interaction potential, and measured the interspecies elastic cross section for an ultracold mixture of metastable triplet He4 and Rb87 in a quadrupole magnetic trap at a temperature of 0.5 mK. Our combined theoretical and experimental study gives an interspecies scattering length a4+87=+17-4+1a0, which prior to this work was unknown. More general, our work shows the possibility of obtaining accurate scattering lengths using ab initio calculations for a system containing a heavy, many-electron atom, such as Rb.

  1. Ab initio study of AlxMoNbTiV high-entropy alloys. (United States)

    Cao, Peiyu; Ni, Xiaodong; Tian, Fuyang; Varga, Lajos K; Vitos, Levente


    The Al(x)MoNbTiV (x = 0-1.5) high-entropy alloys (HEAs) adopt a single solid-solution phase, having the body centered cubic (bcc) crystal structure. Here we employ the ab initio exact muffin-tin orbitals method in combination with the coherent potential approximation to investigate the equilibrium volume, elastic constants, and polycrystalline elastic moduli of Al(x)MoNbTiV HEAs. A comparison between the ab initio and experimental equilibrium volumes demonstrates the validity and accuracy of the present approach. Our results indicate that Al addition decreases the thermodynamic stability of the bcc structure with respect to face-centered cubic and hexagonal close packed lattices. For the elastically isotropic Al(0.4)MoNbTiV HEAs, the valence electron concentration (VEC) is about 4.82, which is slightly different from VEC ∼ 4.72 obtained for the isotropic Gum metals and refractory--HEAs. PMID:25640032

  2. Ab initio intermolecular potential energy surface of He-LiH

    Institute of Scientific and Technical Information of China (English)

    鄢国森; 杨明晖; 谢代前


    The intermolecular potential energy surface of He-LiH complex was studied using the full-electronic complete forth-order Miller-Plesset perturbation (MPPT) method.In ab initio calculations,the bond length of LiH was fixed at 0 159 5 nm.The potential has two local minima of Vm=-179.93 cm for the linear He LiH geormetrv at Rm=0.227 nm and Vm=-10.44 cm-1 for the linear He-HL1 geometry at Rm=0.516 nm The potemal exhibits strong anisotropy The analytic potential function with 31 parameters was determined by fitting to the calculated ab,mtio potentials The influence of variation of LiH bond length on the potential energy surface was also studied

  3. Ab Initio Calculations for the BaTiO3 (001) Surface Structure

    Institute of Scientific and Technical Information of China (English)

    XUE Xu-Yan; WANG Chun-Lei; ZHONG Wei-Lie


    @@ The ab initio method within the local density approximation is applied to calculate cubic BaTiO3 (001) surface relaxation and rumpling for two different terminations (BaO and TiO2). Our calculations demonstrate that cubic perovskite BaTiO3 crystals possess surface polarization, accompanied by the presence of the relevant electric field.We analyse their electronic structures (band structure, density of states and the electronic density redistribution with emphasis on the covalency effects). The results are also compared with that of the previous ab initio calculations. Considerable increases of Ti-O chemical bond covalency nearby the surface have been observed.The band gap reduces especially for the TiO2 termination.

  4. Liquid Be, Ca and Ba. An orbital-free ab-initio molecular dynamics study

    Energy Technology Data Exchange (ETDEWEB)

    Rio, B. G. del; González, L. E. [Departamento de Física Teórica, Atómica y Óptica, Universidad de Valladolid, 47011 Valladolid (Spain)


    Several static and dynamic properties of liquid beryllium (l-Be), liquid calcium (l-Ca) and liquid barium (l-Ba) near their triple point have been evaluated by the orbital-free ab initio molecular dynamics method (OF-AIMD), where the interaction between valence electrons and ions is described by means of local pseudopotentials. These local pseudopotentials used were constructed through a force-matching process with those obtained from a Kohn-Sham ab initio molecular dynamics study (KS-AIMD) of a reduced system with non-local pseudopotentials. The calculated static structures show good agreement with the available experimental data, including an asymmetric second peak in the structure factor which has been linked to the existence of a marked icosahedral short-range order in the liquid. As for the dynamic properties, we obtain collective density excitations whose associated dispersion relations exhibit a positive dispersion.

  5. Different failure modes for V-containing and V-free AB2 metal hydride alloys (United States)

    Young, K.; Wong, D. F.; Yasuoka, S.; Ishida, J.; Nei, J.; Koch, J.


    Failure modes of a V-containing and a V-free AB2 Laves phase-based metal hydride alloy were studied by the combination of X-ray diffractometer, scanning electron microscope, X-ray energy dispersive spectroscopy, inductively coupled plasma, Soxhlet extraction, and magnetic susceptibility measurement. Cells with the V-containing alloy exhibited less capacity degradation up until venting occurred in the cells, after which the capacity rapidly degraded. Cells with the V-free alloy remained linear in capacity degradation throughout the cycle life test. The failure mechanism for the V-containing alloy is related to the formation of an oxide layer that penetrates deeper into the alloy particles due to high V leaching and impedes gas recombination, while the failure mechanism for the V-free alloy is related to the continuous pulverization of the main AB2 phase.

  6. Combined SLD Measurement of $A_{b}$ at the $Z^{0}$ Resonance using Various Techniques

    CERN Document Server

    Abe, K; Akagi, T; Akimoto, H; Allen, N J; Ash, William W; Aston, D; Baird, K G; Baltay, C; Band, H R; Barakat, M B; Bardon, O; Barklow, Timothy L; Bashindzhagian, G L; Bauer, J M; Bellodi, G; Benvenuti, Alberto C; Bilei, G M; Bisello, D; Blaylock, G; Bogart, J R; Bower, G R; Brau, J E; Breidenbach, M; Bugg, W M; Burke, D; Burnett, T H; Burrows, P N; Byrne, R M; Calcaterra, A; Calloway, D H; Camanzi, B; Carpinelli, M; Cassell, R; Castaldi, R; Castro, A; Cavalli-Sforza, M; Chou, A; Church, E; Cohn, H O; Coller, J A; Convery, M R; Cook, V; Cowan, R F; Coyne, D G; Crawford, G; Damerell, C J S; Danielson, M N; Daoudi, M; De Groot, N; Dell'Orso, R; Dervan, P J; De Sangro, R; Dima, M; Dong, D N; Doser, Michael; Dubois, R; Eisenstein, B I; Erofeeva, I; Eschenburg, V; Etzion, E; Fahey, S; Falciai, D; Fan, C; Fernández, J P; Fero, M J; Flood, K; Frey, R; Gifford, J A; Gillman, T; Gladding, G E; González, S; Goodman, E R; Hart, E L; Harton, J L; Hasuko, K; Hedges, S J; Hertzbach, S S; Hildreth, M D; Huber, J; Huffer, M E; Hughes, E W; Huynh, X; Hwang, H; Iwasaki, M; Jackson, D J; Jacques, P; Jaros, J A; Jiang, Z Y; Johnson, A S; Johnson, J R; Johnson, R A; Junk, T R; Kajikawa, R; Kalelkar, M S; Kamyshkov, Yu A; Kang, H J; Karliner, I; Kawahara, H; Kim, Y D; King, M E; King, R; Kofler, R R; Krishna, N M; Kroeger, R S; Langston, M; Lath, A; Leith, D W G S; Lia, V; Lin, C; Liu, M X; Liu, X; Loreti, M; Lu, A; Lynch, H L; Ma, J; Mahjouri, M; Mancinelli, G; Manly, S L; Mantovani, G C; Markiewicz, T W; Maruyama, T; Masuda, H; Mazzucato, E; McKemey, A K; Meadows, B T; Menegatti, G; Messner, R; Mockett, P M; Moffeit, K C; Moore, T B; Morii, M; Müller, D; Murzin, V S; Nagamine, T; Narita, S; Nauenberg, U; Neal, H A; Nussbaum, M; Oishi, N; Onoprienko, D V; Osborne, L S; Panvini, R S; Park, C H; Pavel, T J; Peruzzi, I; Piccolo, M; Piemontese, L; Pitts, K T; Plano, R J; Prepost, R; Prescott, C Y; Punkar, G D; Quigley, J; Ratcliff, B N; Reeves, T W; Reidy, J; Reinertsen, P L; Rensing, P E; Rochester, L S; Rowson, P C; Russell, J J; Saxton, O H; Schalk, T L; Schindler, R H; Schumm, B A; Schwiening, J; Sen, S; Serbo, V V; Shaevitz, M H; Shank, J T; Shapiro, G; Sherden, D J; Shmakov, K D; Simopoulos, C; Sinev, N B; Smith, S R; Smy, M B; Snyder, J A; Stängle, H; Stahl, A; Stamer, P E; Steiner, H; Steiner, R; Strauss, M G; Su, D; Suekane, F; Sugiyama, A; Suzuki, S; Swartz, M; Szumilo, A; Takahashi, T; Taylor, F E; Thom, J; Torrence, E; Toumbas, N K; Usher, T; Vannini, C; Vavra, J; Vella, E N; Venuti, J P; Verdier, R; Verdini, P G; Wagner, D L; Wagner, S R; Waite, A P; Walston, S; Watts, S J; Weidemann, A W; Weiss, E R; Whitaker, J S; White, S L; Wickens, F J; Williams, B; Williams, D C; Williams, S H; Willocq, S; Wilson, R J; Wisniewski, W J; Wittlin, J L; Woods, M; Word, G B; Wright, T R; Wyss, J; Yamamoto, R K; Yamartino, J M; Yang, X; Yashima, J; Yellin, S J; Young, C C; Yuta, H; Zapalac, G H; Zdarko, R W; Zhou, J


    We present a new preliminary combination of measurements of the parity-violation parameter Ab made by the SLD collaboration using various experimental techniques. The techniques differ in detail, but in general a sample of bb events is selected or enhanced by using the topologically reconstructed mass of the separated vertices formed by decaying B hadrons. The direction of the b(bbar) quark is signed by one of four final state tags: jet charge, vertex charge, leptons, or identified K+- from the b vertex. We account for statistical and systematic correlations between the four analyses to arrive at our combined result: Ab=0.905 +/- 0.017 {stat} +/- 0.020 (syst).

  7. Direct Measurement of $A_{b}$ using Charged Kaons at the SLD Detector

    CERN Document Server

    Abe, K; Akagi, T; Akimoto, H; Allen, N J; Ash, William W; Aston, D; Baird, K G; Baltay, C; Band, H R; Barakat, M B; Bardon, O; Barklow, Timothy L; Bashindzhagian, G L; Bauer, J M; Bellodi, G; Benvenuti, Alberto C; Bilei, G M; Bisello, D; Blaylock, G; Bogart, J R; Bower, G R; Brau, J E; Breidenbach, M; Bugg, W M; Burke, D; Burnett, T H; Burrows, P N; Byrne, R M; Calcaterra, A; Calloway, D H; Camanzi, B; Carpinelli, M; Cassell, R; Castaldi, R; Castro, A; Cavalli-Sforza, M; Chou, A; Church, E; Cohn, H O; Coller, J A; Convery, M R; Cook, V; Cowan, R F; Coyne, D G; Crawford, G; Damerell, C J S; Danielson, M N; Daoudi, M; De Groot, N; Dell'Orso, R; Dervan, P J; De Sangro, R; Dima, M; Dong, D N; Doser, Michael; Dubois, R; Eisenstein, B I; Erofeeva, I; Eschenburg, V; Etzion, E; Fahey, S; Falciai, D; Fan, C; Fernández, J P; Fero, M J; Flood, K; Frey, R; Gifford, J A; Gillman, T; Gladding, G E; González, S; Goodman, E R; Hart, E L; Harton, J L; Hasuko, K; Hedges, S J; Hertzbach, S S; Hildreth, M D; Huber, J; Huffer, M E; Hughes, E W; Huynh, X; Hwang, H; Iwasaki, M; Jackson, D J; Jacques, P; Jaros, J A; Jiang, Z Y; Johnson, A S; Johnson, J R; Johnson, R A; Junk, T R; Kajikawa, R; Kalelkar, M S; Kamyshkov, Yu A; Kang, H J; Karliner, I; Kawahara, H; Kim, Y D; King, M E; King, R; Kofler, R R; Krishna, N M; Kroeger, R S; Langston, M; Lath, A; Leith, D W G S; Lia, V; Lin, C; Liu, M X; Liu, X; Loreti, M; Lu, A; Lynch, H L; Ma, J; Mahjouri, M; Mancinelli, G; Manly, S L; Mantovani, G C; Markiewicz, T W; Maruyama, T; Masuda, H; Mazzucato, E; McKemey, A K; Meadows, B T; Menegatti, G; Messner, R; Mockett, P M; Moffeit, K C; Moore, T B; Morii, M; Müller, D; Murzin, V S; Nagamine, T; Narita, S; Nauenberg, U; Neal, H A; Nussbaum, M; Oishi, N; Onoprienko, D V; Osborne, L S; Panvini, R S; Park, C H; Pavel, T J; Peruzzi, I; Piccolo, M; Piemontese, L; Pitts, K T; Plano, R J; Prepost, R; Prescott, C Y; Punkar, G D; Quigley, J; Ratcliff, B N; Reeves, T W; Reidy, J; Reinertsen, P L; Rensing, P E; Rochester, L S; Rowson, P C; Russell, J J; Saxton, O H; Schalk, T L; Schindler, R H; Schumm, B A; Schwiening, J; Sen, S; Serbo, V V; Shaevitz, M H; Shank, J T; Shapiro, G; Sherden, D J; Shmakov, K D; Simopoulos, C; Sinev, N B; Smith, S R; Smy, M B; Snyder, J A; Stängle, H; Stahl, A; Stamer, P E; Steiner, H; Steiner, R; Strauss, M G; Su, D; Suekane, F; Sugiyama, A; Suzuki, S; Swartz, M; Szumilo, A; Takahashi, T; Taylor, F E; Thom, J; Torrence, E; Toumbas, N K; Usher, T; Vannini, C; Vavra, J; Vella, E N; Venuti, J P; Verdier, R; Verdini, P G; Wagner, D L; Wagner, S R; Waite, A P; Walston, S; Watts, S J; Weidemann, A W; Weiss, E R; Whitaker, J S; White, S L; Wickens, F J; Williams, B; Williams, D C; Williams, S H; Willocq, S; Wilson, R J; Wisniewski, W J; Wittlin, J L; Woods, M; Word, G B; Wright, T R; Wyss, J; Yamamoto, R K; Yamartino, J M; Yang, X; Yashima, J; Yellin, S J; Young, C C; Yuta, H; Zapalac, G H; Zdarko, R W; Zhou, J


    We report a new measurement of A_b using data obtained by SLD in 1997-98. This measurement uses a vertex tag technique, where the selection of a b hemisphere is based on the reconstructed mass of the bottom hadron decay vertex. The method uses the 3D vertexing capabilities of SLD's CCD vertex detector and the small and stable SLC beams to obtain a high b-event tagging efficiency and purity of 78% and 97%, respectively. Charged kaons identified by the CRID detector provide an efficient quark-antiquark tag, with the analyzing power calibrated from the data. We obtain a preliminary result of A_b = 0.997

  8. Unusual amnesia in a patient with VGKC-Ab limbic encephalitis: a case study. (United States)

    Kartsounis, Luke D; de Silva, Rajith


    We describe the case of a patient with confirmed voltage-gated potassium channel antibody-associated encephalitis (VGKC-Ab). MRI studies revealed bilateral hyper-intensity in the hippocampi, with their volumes preserved. At presentation, the patient's anterograde and retrograde memory skills were found to be impaired and he showed fluctuation in his ability to recall familiar information. Following treatment with immunotherapy, his condition improved considerably and, in a series of follow up assessments, he performed satisfactorily (i.e., within the average range or above) on formal tests of memory, as well as on a range of other cognitive tests, including tests of executive function. By contrast, in the context of contemporaneous unstructured interviews, he showed a strong tendency to confabulate. We argue that the reported case broadens the phenomenology of VGKC-Ab limbic encephalitis and raises important theoretical questions about the aetiology of this patient's most unusual memory disorder.

  9. Study of atomic structure of liquid Hg-In alloys using ab-initio molecular dynamics

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, Nalini; Ahluwalia, P. K. [Department of Physics, Himachal Pradesh University, Shimla(HP)-171005 (India); Thakur, Anil [Department of Physics, Govt. P. G. College Solan (HP)-173212 (India)


    Ab-initio molecular dynamics simulations are performed to study the structural properties of liquid Hg-In alloys. The interatomic interactions are described by ab-initio pseudopotentials given by Troullier and Martins. Five liquid Hg-In mixtures (Hg{sub 10}In{sub 90}, Hg{sub 30}In{sub 70}, Hg{sub 50}In{sub 50}, Hg{sub 70}In{sub 30} and Hg{sub 90}In{sub 10}) at 299K are considered. The radial distribution function g(r) and structure factor S(q) of considered alloys are compared with respective experimental results for liquid Hg (l-Hg) and (l-In). The radial distribution function g(r) shows the presence of short range order in the systems considered. Smooth curves of Bhatia-Thornton partial structure factors factor shows the presence of liquid state in the considered alloys.

  10. Study of atomic structure of liquid Hg-In alloys using ab-initio molecular dynamics

    International Nuclear Information System (INIS)

    Ab-initio molecular dynamics simulations are performed to study the structural properties of liquid Hg-In alloys. The interatomic interactions are described by ab-initio pseudopotentials given by Troullier and Martins. Five liquid Hg-In mixtures (Hg10In90, Hg30In70, Hg50In50, Hg70In30 and Hg90In10) at 299K are considered. The radial distribution function g(r) and structure factor S(q) of considered alloys are compared with respective experimental results for liquid Hg (l-Hg) and (l-In). The radial distribution function g(r) shows the presence of short range order in the systems considered. Smooth curves of Bhatia-Thornton partial structure factors factor shows the presence of liquid state in the considered alloys

  11. Interatomic potentials for Al and Ni from experimental data and ab initio calculations

    Energy Technology Data Exchange (ETDEWEB)

    Mishin, Y.; Farkas, D.; Miehl, M.J.; Papaconstantopoulos, D.A.


    New embedded-atom potentials for Al and Ni have been developed by fitting to both experimental data and the results of ab initio calculations. The ab initio data were obtained in the form of energies of different alternative computer-generated crystalline structures of these metals. The potentials accurately reproduce basic equilibrium properties of Al and Ni such as the elastic constants, phonon dispersion curves, vacancy formation and migration energies, stacking fault energies, and surface energies. The equilibrium energies of various alternative structures not included in the fitting database are calculated with these potentials. The results are compared with predictions of total-energy tight-binding calculations for the same structures. The embedded-atom potentials correctly reproduce the structural stability trends, which suggests that they are transferable to different local environments encountered in atomistic simulations of lattice defects.

  12. Melting of sodium under high pressure. An ab-initio study

    Energy Technology Data Exchange (ETDEWEB)

    González, D. J.; González, L. E. [Departamento de Física Teórica, Atómica y Optica, Universidad de Valladolid, 47011 Valladolid (Spain)


    We report ab-initio molecular dynamics simulations of dense liquid/solid sodium for a pressure range from 0 to 100 GPa. The simulations have been performed with the orbital free ab-initio molecular dynamics method which, by using the electron density as the basic variable, allows to perform simulations with large samples and for long runs. The calculated melting curve shows a maximum at a pressure ≈ 30 GPa and it is followed by a long, steep decrease. These features are in good agreement with the experimental data. For various pressures along the melting curve, we have calculated several liquid static properties (pair distribution functions, static structure factors and short-range order parameters) in order to analyze the structural effects of pressure.

  13. An efficient time-stepping scheme for ab initio molecular dynamics simulations

    CERN Document Server

    Tsuchida, Eiji


    In ab initio molecular dynamics simulations of real-world problems, the simple Verlet method is still widely used for integrating the equations of motion, while more efficient algorithms are routinely used in classical molecular dynamics. We show that if the Verlet method is used in conjunction with pre- and postprocessing, the accuracy of the time integration is significantly improved with only a small computational overhead. The validity of the processed Verlet method is demonstrated in several examples including ab initio molecular dynamics simulations of liquid water. The structural properties obtained from the processed Verlet method are found to be sufficiently accurate even for large time steps close to the stability limit. This approach results in a 2x performance gain over the standard Verlet method for a given accuracy.

  14. The coronal FeXXI 1354.094 line in AB Doradus

    CERN Document Server

    Vilhu, O R; Mewe, R; Hakala, P


    The active late-type star AB Doradus was observed in February 1996 with the Goddard High Resolution Spectrograph of the Hubble Space Telescope using the low resolution G140L grating. The observations covered one half of the star's rotation cycle (P = 0.514 d) with 11.5 min time resolution. The strong coronal Fe XXI 1354.094 line formed at 10^7 K was analysed and its emission measure (EM) derived. This EM is much higher than that derived from recent XMM-Newton observations (Guedel et al. 2001), and earlier EXOSAT (Collier Cameron et al. 1988) and ASCA/EUVE (Mewe et al. 1996) data, as well, requiring a variability by a factor of 5. The physical reason for the variability remains unknown, since (outside flares) the observed broad band variability of AB Dor is much smaller.

  15. An ab initio potential function for the ν13 vibrational mode of 1,3-butadiene (United States)

    Senent, M. L.


    The restricted potential of the ν13 torsional mode of 1,3-butadiene has been determined from ab initio calculations. The relative energy and geometry of the second rotamer were calculated with the optimized couple cluster method with double substitutions. This ab initio level provides that the second stable structure attaches to a gauche form situated at 140.8°. The potential energy function was obtained by fitting to a symmetry-adapted Fourier series the total electronic energies of several selected conformations. These energies were calculated by the Möller-Plesset perturbation theory up to the second order (MP2) with full and partial optimization of the geometry. Torsional Raman band positions and fundamental frequencies were determined from the periodic potentials with a good agreement with experimental data. The convenience of performing fully optimized calculations to determine the restricted function is also refuted.

  16. Ab-initio molecular dynamics simulation of liquid water by Quantum Monte Carlo

    CERN Document Server

    Zen, Andrea; Mazzola, Guglielmo; Guidoni, Leonardo; Sorella, Sandro


    Despite liquid water is ubiquitous in chemical reactions at roots of life and climate on earth, the prediction of its properties by high-level ab initio molecular dynamics simulations still represents a formidable task for quantum chemistry. In this article we present a room temperature simulation of liquid water based on the potential energy surface obtained by a many-body wave function through quantum Monte Carlo (QMC) methods. The simulated properties are in excellent agreement with recent neutron scattering and X-ray experiments, particularly concerning the position of the oxygen-oxygen peak in the radial distribution function, at variance of previous Density Functional Theory attempts. Given the excellent performances of QMC on large scale supercomputers, this work opens new perspectives for predictive and reliable ab-initio simulations of complex chemical systems.

  17. Ab Initio Calculations and Raman and SERS Spectral Analyses of Amphetamine Species

    DEFF Research Database (Denmark)

    Berg, Rolf W.; Nørbygaard, Thomas; White, Peter C.;


    For the first time, the differences between the spectra of amphetamine and amphetamine-H+ and between different conformers are thoroughly studied by ab initio model calculations, and Raman and surface-enhanced Raman spectroscopy (SERS) spectra are measured for different species of amphetamine....... The spectra of amphetamine and amphetamine-H+ sampleswere obtained and assigned according to a comparison of the experimental spectra and the ab initio MO calculations, performed using the Gaussian 03W program (Gaussian, Inc., Pittsburgh, PA). The analyses were based on complete geometry minimization...... of the conformational energy of the S-plus-amphetamine molecule and the S-plus-amphetamine-H+ ion. The harmonic frequency calculations provide information about the characteristic features of the Raman spectra and the nature of the bonding in the molecule. It is concluded that vibrational bands from salt anions...

  18. Investigation of A+c- and Ab-Hypernuclei in Relativistic Mean-Field Model

    Institute of Scientific and Technical Information of China (English)

    TANYu-Hong; CAIChong-Hai; LILei; NINGPing-Zhi


    We investigate the properties of A+c- and Ab-hypernuclei within the framework of the relativistic mean-field model (RMF). It is found that no A+c bound states can exist if the A+c potential well depth |UA+c| in nuclear matter is less than 10 MeV. If |UA+c|is less than 20 MeV, A+c cannot bind to the heavier nuclei with atomic number larger than 100. We suggest it is preferable to search the A+c-hypernuclei from medium-heavy nuclear systems in experiment. Very small spin-orbit splitting for the A+c in hypernuclei is a/so observed, and for the Ab it is nearly zero.

  19. Electrical Resistivity of Na-K Binary Liquid Alloy Using Ab-Initio Pseudopotentials

    Institute of Scientific and Technical Information of China (English)

    Anil Thakur; P. K. Ahluwalia


    @@ The study of electrical resistivity of simple binary liquid alloy Na-K is presented as a function of concentration.Hard sphere diameters of sodium (Na) and potassium (K) are obtained through the inter ionic pair potentials evaluated using Troullier and Martins ab-initio pseudopotentials, which have been used to calculate partial structure factors S(q). The Ziman formula for calculating resistivity of binary liquid alloys has been used. Form factors are calculated using ab-initio pseudopotentials. The results suggest that the first principle approach for calculating pseudopotentials with in the frame work of Ziman formalism is quite successful in explaining the electrical resistivity data of compound forming binary liquid alloys.

  20. Large-scale ab initio configuration interaction calculations for light nuclei (United States)

    Maris, Pieter; Metin Aktulga, H.; Caprio, Mark A.; Çatalyürek, Ümit V.; Ng, Esmond G.; Oryspayev, Dossay; Potter, Hugh; Saule, Erik; Sosonkina, Masha; Vary, James P.; Yang, Chao; Zhou, Zheng


    In ab-initio Configuration Interaction calculations, the nuclear wavefunction is expanded in Slater determinants of single-nucleon wavefunctions and the many-body Schrodinger equation becomes a large sparse matrix problem. The challenge is to reach numerical convergence to within quantified numerical uncertainties for physical observables using finite truncations of the infinite-dimensional basis space. We discuss strategies for constructing and solving the resulting large sparse matrix eigenvalue problems on current multicore computer architectures. Several of these strategies have been implemented in the code MFDn, a hybrid MPI/OpenMP Fortran code for ab-initio nuclear structure calculations that can scale to 100,000 cores and more. Finally, we will conclude with some recent results for 12C including emerging collective phenomena such as rotational band structures using SRG evolved chiral N3LO interactions.

  1. Ab-initio Gorkov-Green's function calculations of open-shell nuclei

    CERN Document Server

    Soma, V; Duguet, T


    We present results from a new ab-initio method that uses the self-consistent Gorkov Green's function theory to address truly open-shell systems. The formalism has been recently worked out up to second order and is implemented here in nuclei for the first time on the basis of realistic nuclear forces. We find good convergence of the results with respect to the basis size in Ca44 and Ni74 and discuss quantities of experimental interest including ground-state energies, pairing gaps and particle addition/removal spectroscopy. These results demonstrate that the Gorkov method is a valid alternative to multireference approaches for tackling degenerate or near degenerate quantum systems. In particular, it increases the number of mid-mass nuclei accessible in an ab-initio fashion from a few tens to a few hundreds.

  2. Ab initio studies of equations of state and chemical reactions of reactive structural materials (United States)

    Zaharieva, Roussislava

    subject of studies of the shock or thermally induced chemical reactions of the two solids comprising these reactive materials, from first principles, is a relatively new field of study. The published literature on ab initio techniques or quantum mechanics based approaches consists of the ab initio or ab initio-molecular dynamics studies in related fields that contain a solid and a gas. One such study in the literature involves a gas and a solid. This is an investigation of the adsorption of gasses such as carbon monoxide (CO) on Tungsten. The motivation for these studies is to synthesize alternate or synthetic fuel technology by Fischer-Tropsch process. In this thesis these studies are first to establish the procedure for solid-solid reaction and then to extend that to consider the effects of mechanical strain and temperature on the binding energy and chemisorptions of CO on tungsten. Then in this thesis, similar studies are also conducted on the effect of mechanical strain and temperature on the binding energies of Titanium and hydrogen. The motivations are again to understand the method and extend the method to such solid-solid reactions. A second motivation is to seek strained conditions that favor hydrogen storage and strain conditions that release hydrogen easily when needed. Following the establishment of ab initio and ab initio studies of chemical reactions between a solid and a gas, the next step of research is to study thermally induced chemical reaction between two solids (Ni+Al). Thus, specific new studies of the thesis are as follows: (1) Ab initio Studies of Binding energies associated with chemisorption of (a) CO on W surfaces (111, and 100) at elevated temperatures and strains and (b) adsorption of hydrogen in titanium base. (2) Equations of state of mixtures of reactive material structures from ab initio methods. (3) Ab initio studies of the reaction initiation, transition states and reaction products of intermetallic mixtures of (Ni+Al) at elevated

  3. Effect of Fe and Cu on Electrochemical Characteristics of Low-Co AB5 Type Alloys

    Institute of Scientific and Technical Information of China (English)

    Zhu Xilin; Zhou Yu; Chong Fayao; Li Xiaochun; Pan Weilin


    In order to further reduce the cost of AB5 type rare earth-based hydrogen storage alloy, a low-Co AB5 type hydrogen storage alloy were by substituting Co with Cu and Fe.The characteristics of these alloys have been investigated by means of XRD, PCT, and measurement of electrochemical capacity and cycle life.The test results show that the effect of these two kinds of substituting elements on discharge capacity is Cu > Fe, and the cycle life is on the contrary.Both of them have no distinct influence on activity speed, but activity speed increases with the decrease of Co.By the order way, the high discharge rate characteristics rise with the addition of Cu and decreasing of Co.

  4. Properties of metals during the heating by intense laser irradiation using ab initio simulations (United States)

    Holst, Bastian; Recoules, Vanina; Torrent, Marc; Mazevet, Stephane


    Ultrashort laser pulses irradiating a target heat the electrons to very high temperatures. In contrast, the ionic lattice is unaffected on the time scale of the laser pulse since the heat capacity of electrons is much smaller than that of the lattice. This non-equilibrium system can be described as a composition of two subsystems: one consisting of hot electrons and the other of an ionic lattice at low temperature. We studied the effect of this intense electronic excitations on the optical properties of gold using ab initio simulations. We additionally use ab initio linear response to compute the phonon spectrum and the electron-phonon coupling constant within Density Functional Theory for several electronic temperatures of few eV. LULI, Ecole Polytechnique, CNRS, CEA, UPMC, 91128 Palaiseau, France.

  5. Digital 1 V 82 μW Pseudo-Two-Stage Class-AB OTA

    Institute of Scientific and Technical Information of China (English)

    YIN Shujuan; SUN Yihe; LI Xiangyu


    A low power digital operational transconductance amplifier (OTA) was developed for low voltage switched capacitor applications. The OTA has a high slew rate (SR) and a large open loop gain with a dif-ferential pseudo-two-stage Class-AB structure. A fully compensated depletion mode capacitor is used in the switched capacitor common mode feedback block instead of a metal-insulator-metal (MIM) capacitor to re-duce the fabrication cost. Simulations show that with a 1.0-V supply voltage and a 34-pF load at each output terminal, this digital differential pseudo-two-stage Class-AB OTA realized in 0.13-μm technology achieves a 63.5-dB DC gain and a 0.83-V output swing. The slew rate is ±16.29 V/ps and the total power dissipation is only 82 μW.

  6. Adaptive Noise Cancellation Method Used for Wheel Speed Signal of Integrate ABS/ASR System

    Institute of Scientific and Technical Information of China (English)

    MA Yue-feng; LIU Zhao-du; QI Zhi-quan; CUI Hai-feng


    A novel adaptive noise cancellation method for wheel speed signal of the anti-lock braking system/anti-slip regulation(ABS/ASR) control system is proposed. Based on the spectrum distribution of vehicle's wheel speed signal got from fast Fourier transform under various conditions, the high-pass filter is used to deal with original wheel speed signals sampled to get reference noise signal and the original wheel speed signals are used as adaptive filter's desired outputs. The difference between original signals and reference noise signals is used as the error signal for the adaptive FIR filter and also used as the whole adaptive noise cancellation system's final output. This method can obtain the noise signal on-line and is easy to use for real control system,which is useful to improve the performance of integrate system ABS/ASR.

  7. Ab initio calculation of valley splitting in monolayer δ-doped phosphorus in silicon. (United States)

    Drumm, Daniel W; Budi, Akin; Per, Manolo C; Russo, Salvy P; L Hollenberg, Lloyd C


    : The differences in energy between electronic bands due to valley splitting are of paramount importance in interpreting transport spectroscopy experiments on state-of-the-art quantum devices defined by scanning tunnelling microscope lithography. Using vasp, we develop a plane-wave density functional theory description of systems which is size limited due to computational tractability. Nonetheless, we provide valuable data for the benchmarking of empirical modelling techniques more capable of extending this discussion to confined disordered systems or actual devices. We then develop a less resource-intensive alternative via localised basis functions in siesta, retaining the physics of the plane-wave description, and extend this model beyond the capability of plane-wave methods to determine the ab initio valley splitting of well-isolated δ-layers. In obtaining an agreement between plane-wave and localised methods, we show that valley splitting has been overestimated in previous ab initio calculations by more than 50%.

  8. A fully ab initio potential energy surface for ClH2 reactive system

    Institute of Scientific and Technical Information of China (English)


    An ab initio analytical potential energy surface called BW3 for the ClH2 reactive system is presented. The fit of this surface is based on about 1 200 ab initio energy points, computed with multi-reference configuration interaction(MRCI) and scaling external correlation (SEC) method and a very large basis set. The precision in the fit is very high. The BW3 surface could reproduce correctly the dissociation energy of H2 and HCl, and the endothermicity of the Cl + H2 abstraction reaction. For the Cl + H2 abstraction reaction, the saddle point of BW3 lies in collinear geometries, and the barrier height is 32.84 kJ/mol; for the H + ClH exchange reaction, the barrier of BW3 is also linear, with a height of 77.40 kJ/mol.

  9. A fully ab initio potential energy surface for C1H2 reactive system

    Institute of Scientific and Technical Information of China (English)

    边文生; 刘成卜; H.J.Werner


    An ab initio analytical potential energy surface called BW3 for the CIH2 reactive system is presented. The fit of this surface is based on about 1 200 ab initio energy points, computed with multi-reference configuration interaction(MRCI) and scaling external correlation (SEC) method and a very large basis set. The precision in the fit is very high. The BW3 surface could reproduce correctly the dissociation energy of H2 and HCI, and the endothermicity of the Cl + H2 abstraction reaction. For the Cl + H2 abstraction reaction, the saddle point of BW3 lies in collinear geometries, and the barrier height is 32.84 kJ/mol; for the H + CIH exchange reaction, the barrier of BW3 is also linear, with a height of 77.40 kJ/mol.

  10. Ab initio calculations on twisted graphene/hBN: Electronic structure and STM image simulation (United States)

    Correa, J. D.; Cisternas, E.


    By performing ab initio calculations we obtained theoretical scanning tunneling microscopy (STM) images and studied the electronic properties of graphene on a hexagonal boron-nitrite (hBN) layer. Three different stack configurations and four twisted angles were considered. All calculations were performed using density functional theory, including van der Waals interactions as implemented in the SIESTA ab initio package. Our results show that the electronic structure of graphene is preserved, although some small changes are induced by the interaction with the hBN layer, particularly in the total density of states at 1.5 eV under the Fermi level. When layers present a twisted angle, the density of states shows several van Hove singularities under the Fermi level, which are associated to moiré patterns observed in theoretical STM images.

  11. {\\it Ab initio} nuclear structure - the large sparse matrix eigenvalue problem

    CERN Document Server

    Vary, James P; Ng, Esmond; Yang, Chao; Sosonkina, Masha


    The structure and reactions of light nuclei represent fundamental and formidable challenges for microscopic theory based on realistic strong interaction potentials. Several {\\it ab initio} methods have now emerged that provide nearly exact solutions for some nuclear properties. The {\\it ab initio} no core shell model (NCSM) and the no core full configuration (NCFC) method, frame this quantum many-particle problem as a large sparse matrix eigenvalue problem where one evaluates the Hamiltonian matrix in a basis space consisting of many-fermion Slater determinants and then solves for a set of the lowest eigenvalues and their associated eigenvectors. The resulting eigenvectors are employed to evaluate a set of experimental quantities to test the underlying potential. For fundamental problems of interest, the matrix dimension often exceeds $10^{10}$ and the number of nonzero matrix elements may saturate available storage on present-day leadership class facilities. We survey recent results and advances in solving t...

  12. Ab initio modelling of the behaviour of point defects and fission products in nuclear fuel

    International Nuclear Information System (INIS)

    The aim of this work is to determine precisely the mechanisms of formation and migration of defects and fission products as well as the associated energies. Examples on uranium dioxide UO2 (standard nuclear fuel) and on uranium carbide UC (potential fuel for new generation reactors) are given. The obtained results are discussed and compared with the experimental results carried out. The ab initio method used is the Projector Augmented-Wave (PAW) method based on the density functional theory. The particular electronic properties of actinides are especially studied because, on account of their 5f orbitals more or less localized around the nucleus, it is difficult to model the actinide compounds by the DFT method. In particular, the modelling of the exchange-correlation interaction of the 5f electrons of UO2 requires approximations (as GGA+U) beyond those more currently used in ab initio calculations (LDA or GGA). (O.M.)

  13. Ab initio calculations to support accurate modelling of the rovibronic spectroscopy calculations of vanadium monoxide (VO)

    CERN Document Server

    McKemmish, Laura K; Tennyson, Jonathan


    Accurate knowledge of the rovibronic near-infrared and visible spectra of vanadium monoxide (VO) is very important for studies of cool stellar and hot planetary atmospheres. Here, the required ab initio dipole moment and spin-orbit coupling curves for VO are produced. This data forms the basis of a new VO line list considering 13 different electronic states and containing over 277 million transitions. Open shell transition, metal diatomics are challenging species to model through ab initio quantum mechanics due to the large number of low-lying electronic states, significant spin-orbit coupling and strong static and dynamic electron correlation. Multi-reference configuration interaction methodologies using orbitals from a complete active space self-consistent-field (CASSCF) calculation are the standard technique for these systems. We use different state-specific or minimal-state CASSCF orbitals for each electronic state to maximise the calculation accuracy. The off-diagonal dipole moment controls the intensity...

  14. Ab initio molecular dynamics simulation of liquid water by quantum Monte Carlo

    Energy Technology Data Exchange (ETDEWEB)

    Zen, Andrea, E-mail: [Dipartimento di Fisica, “La Sapienza” - Università di Roma, piazzale Aldo Moro 5, 00185 Rome (Italy); London Centre for Nanotechnology, University College London, London WC1E 6BT (United Kingdom); Luo, Ye, E-mail:; Mazzola, Guglielmo, E-mail:; Sorella, Sandro, E-mail: [SISSA–International School for Advanced Studies, Via Bonomea 26, 34136 Trieste (Italy); Democritos Simulation Center CNR–IOM Istituto Officina dei Materiali, 34151 Trieste (Italy); Guidoni, Leonardo, E-mail: [Dipartimento di Fisica, “La Sapienza” - Università di Roma, piazzale Aldo Moro 5, 00185 Rome (Italy); Dipartimento di Scienze Fisiche e Chimiche, Università degli Studi dell’ Aquila, via Vetoio, 67100 L’ Aquila (Italy)


    Although liquid water is ubiquitous in chemical reactions at roots of life and climate on the earth, the prediction of its properties by high-level ab initio molecular dynamics simulations still represents a formidable task for quantum chemistry. In this article, we present a room temperature simulation of liquid water based on the potential energy surface obtained by a many-body wave function through quantum Monte Carlo (QMC) methods. The simulated properties are in good agreement with recent neutron scattering and X-ray experiments, particularly concerning the position of the oxygen-oxygen peak in the radial distribution function, at variance of previous density functional theory attempts. Given the excellent performances of QMC on large scale supercomputers, this work opens new perspectives for predictive and reliable ab initio simulations of complex chemical systems.

  15. Experimental studies and ab initio calculations on characteristics of the C state of SF2 radical

    International Nuclear Information System (INIS)

    SF2 radicals were generated by a pulsed dc discharge in the mixture gas beam of SF2 and Ar. The (2+1) resonance-enhanced multiphoton ionization (REMPI) excitation spectroscopy of SF2 radical was obtained between 325 and 365 nm. The SF+ ion signals were also observed in the same wavelength range. The analysis shows that the spectrum can be assigned as the two-photon resonant excitation of SF2 radical (B-tilde1 B1 and (C-tilde1 A1 states). And also, ab initio calculations suggest that the C-tilde state is a bonding state with Rydberg characteristic. The potential energy surfaces (PESs) of SF2 and SF2+ by ab initio calculations suggest that SF+ ions originate from dissociation processes of excited SF2+ ions. (author)

  16. Emergent properties of nuclei from ab initio coupled-cluster calculations

    CERN Document Server

    Hagen, G; Hjorth-Jensen, M; Papenbrock, T


    Emergent properties such as nuclear saturation and deformation, and the effects on shell structure due to the proximity of the scattering continuum and particle decay channels are fascinating phenomena in atomic nuclei. In recent years, ab initio approaches to nuclei have taken the first steps towards tackling the computational challenge of describing these phenomena from Hamiltonians with microscopic degrees of freedom. This endeavor is now possible due to ideas from effective field theories, novel optimization strategies for nuclear interactions, ab initio methods exhibiting a soft scaling with mass number, and ever-increasing computational power. This paper reviews some of the recent accomplishments. We also present new results. The recently optimized chiral interaction NNLO$_{\\rm sat}$ is shown to provide an accurate description of both charge radii and binding energies in selected light- and medium-mass nuclei up to $^{56}$Ni. We derive an efficient scheme for including continuum effects in coupled-clust...

  17. Characterization of the Mycobacterial AdnAB DNA Motor Provides Insights into the Evolution of Bacterial Motor-Nuclease Machines*


    Unciuleac, Mihaela-Carmen; Shuman, Stewart


    Mycobacterial AdnAB exemplifies a family of heterodimeric motor-nucleases involved in processing DNA double strand breaks (DSBs). The AdnA and AdnB subunits are each composed of an N-terminal UvrD-like motor domain and a C-terminal RecB-like nuclease module. Here we conducted a biochemical characterization of the AdnAB motor, using a nuclease-inactivated heterodimer. AdnAB is a vigorous single strand DNA (ssDNA)-dependent ATPase (kcat 415 s−1), and the affinity of the motor for the ssDNA cofa...

  18. A Single Stage Low Gain Pseudo Differential Class- AB telescopic Cascoded Op-amp for Pipelined ADC

    Directory of Open Access Journals (Sweden)

    D.S.Shylu Dr.D.Jackuline Moni 2 Anita Antony 3 A J Sowjanya.K 4 Neetha C John 5


    Full Text Available In this paper, a low gain pseudo differential classAB telescopic op-amp for pipelined ADC is presented. By applying split capacitor CDS technique in a pipelined ADC, finite op-amp gain errors of low gain op-amps are eliminated. This significantly reduces the power consumption of the pipelined ADC. A pseudo differential class AB opamp is chosen as the suitable op-amp topology because of its high power efficiency and large signal swing compared to other topologies.Additional class AB capacitors used further enhances the DC gain and bandwidth of the amplifier.

  19. Characterisation of five candidate genes within the ETEC F4ab/ac candidate region in pigs

    DEFF Research Database (Denmark)

    Jacobsen, Mette Juul; Cirera Salicio, Susanna; Joller, David;


    dominant Mendelian trait. Indentifying the genetics behind this trait will greatly benefit pig welfare as well as the pig breeding industry by providing an opportunity to select against genetically susceptible animals, thereby reducing the number of diarrhoea outbreaks. The trait has recently been mapped...... between ETEC F4ab/ac resistant and ETEC F4ab/ac susceptible animals in any of the tested tissues. CONCLUSIONS: None of the identified polymorphisms are obvious causative mutations for ETEC F4ab/ac susceptibility, as they have no impact on the level of the overall mRNA expression nor predicted to influence...

  20. Ab interno laser sclerostomy in aphakic patients with glaucoma and chronic inflammation. (United States)

    Wilson, R P; Javitt, J C


    Five patients with aphakia, glaucoma, and chronic inflammation were treated with ab interno sclerostomy by using the continuous wave Nd:YAG laser focused through a sapphire probe. After a follow-up period of 24 to 28 months, three of five patients had good intraocular pressure control. The sclerostomy failed in one patient when it was occluded by vitreous. The second failure was attributed to closure of the sclerostomy because of chronic intraocular inflammation.

  1. A Deep Learning Network Approach to ab initio Protein Secondary Structure Prediction


    Spencer, Matt; Eickholt, Jesse; Cheng, Jianlin


    Ab initio protein secondary structure (SS) predictions are utilized to generate tertiary structure predictions, which are increasingly demanded due to the rapid discovery of proteins. Although recent developments have slightly exceeded previous methods of SS prediction, accuracy has stagnated around 80% and many wonder if prediction cannot be advanced beyond this ceiling. Disciplines that have traditionally employed neural networks are experimenting with novel deep learning techniques in atte...

  2. Ab Initio Study on the Anti-HIV Activities of Hydroxyflavones

    Institute of Scientific and Technical Information of China (English)

    ZHANG Yu


    Flavone and 95 hydroxyflavones have been studied with ab initio method, and their total energies, atomic charges, dipole moments, multipole moments, molecular orbital compositions, orbital energies etc. were obtained. Among them the relationship between total atomic charges and activities against HIV is basically in accordance with the experimental results. The beneficial references are provided for the extraction and synthesis of strong active anti-HIV medicines.

  3. Ab-initio simulation and experimental validation of beta-titanium alloys


    Raabe, D.; Sander, B.; Friák, M.; Ma, D.; Neugebauer, J.


    In this progress report we present a new approach to the ab-initio guided bottom up design of beta-Ti alloys for biomedical applications using a quantum mechanical simulation method in conjunction with experiments. Parameter-free density functional theory calculations are used to provide theoretical guidance in selecting and optimizing Ti-based alloys with respect to three constraints: (i) the use of non-toxic alloy elements; (ii) the stabilization of the body centered cubic beta phase at roo...

  4. LOFT CIS analysis S-5B penetration 3'' IA-296-AB

    International Nuclear Information System (INIS)

    The 3'' IA-296-AB line from the containment penetration S-5B was analyzed to ASME Code, Subsection NC (Class 2) criteria. This section of piping is part of the Containment Isolation System; the model considered the line from penetration S-5B outward through a series of elbows and through the third isolation valve. Results of this analysis show that the section of line described will meet Class 2 requirements if additional supports are installed at three locations

  5. Ab Initio Studies on Hematite Surface and the Adsorption of Phosphate


    Swati Chaudhury; Chandrika Varadachari; Kunal Ghosh


    This investigation explores the ab initio DFT method for understanding surface structure of hematite and the nature and energetics of phosphate adsorption. Using the full potential linearized plane wave method (FP-LAPW), we derived the structure and energies of various magnetic forms of hematite. The antiferromagnetic (AFM) form was observed to be the most stable. Hematite surfaces with Fe-termination, O-termination, or OH-termination were studied. The OH-terminated surface was the most stabl...

  6. Ab initio molecular dynamics simulation of hydrogen fluoride at several thermodynamic states

    DEFF Research Database (Denmark)

    Kreitmeir, M.; Bertagnolli, H.; Mortensen, Jens Jørgen;


    Liquid hydrogen fluoride is a simple but interesting system for studies of the influence of hydrogen bonds on physical properties. We have performed ab initio molecular dynamics simulations of HF at several thermodynamic states, where we examine the microscopic structure of the liquid as well...... as its static and dynamic properties. The results obtained show good agreement with well established data, and, moreover, we were able to show significant changes within the structure depending on the system's temperature and density....

  7. Adaptation of hybrid five-phase ABS algorithms for experimental validation


    Gerard, Mathieu; Pasillas-Lépine, William; De Vries, Edwin; Verhaegen, Michel


    The Anti-lock Braking System (ABS) is the most important active safety system for passenger cars, but unfortunately the literature is not really precise about its description, stability and performance. This research improves a five-phase hybrid algorithm based on wheel deceleration and validate it on a tyre-in-the-loop laboratory facility. Five relevant effects are modelled so that the simulation matches the reality. Two methods to deal with the time delays are proposed. It can be verified t...

  8. Surface Tension of Ab Initio Liquid Water at the Water-Air Interface


    Nagata, Yuki; Ohto, Tatsuhiko; Bonn, Mischa; Kühne, Thomas D.


    We report calculations of the surface tension of the water-air interface using ab initio molecular dynamics (AIMD) simulations. We investigate the simulation cell size dependence of the surface tension of water from force field molecular dynamics (MD) simulations, which show that the calculated surface tension increases with increasing simulation cell size, thereby illustrating that a correction for finite size effects is required for the small system used in the AIMD simulation. The AIMD sim...

  9. First fully ab initio potential energy surface of methane with a spectroscopic accuracy (United States)

    Nikitin, A. V.; Rey, M.; Tyuterev, Vl. G.


    Full 9-dimensional ab initio potential energy surfaces for the methane molecule are constructed using extended electronic structure coupled-cluster calculations with various series of basis sets following increasing X cardinal numbers: cc-pVXZ (X = 3, 4, 5, 6), aug-cc-ACVXZ (X = 3, 4, 5), and cc-pCVXZ-F12 (X = 3, 4). High-order dynamic electron correlations including triple and quadrupole excitations as well as relativistic and diagonal Born-Oppenheimer breakdown corrections were accounted for. Analytical potential functions are parametrized as non-polynomial expansions in internal coordinates in irreducible tensor representation. Vibrational energy levels are reported using global variational nuclear motion calculations with exact kinetic energy operator and a full account of the tetrahedral symmetry of CH4. Our best ab initio surface including above-mentioned contributions provides the rms (obs.-calc.) errors of less than 0.11 cm-1 for vibrational band centers below 4700 cm-1, and ˜0.3 cm-1 for all 229 assigned experimentally determined vibrational levels up to the Icosad range <7900 cm-1 without empirically adjusted parameters. These results improve the accuracy of ab initio methane vibrational predictions by more than an order of magnitude with respect to previous works. This is an unprecedented accuracy of first-principles calculations of a five-atomic molecule for such a large data set. New ab initio potential results in significantly better band center predictions even in comparison with best available empirically corrected potential energy surfaces. The issues related to the basis set extrapolation and an additivity of various corrections at this level of accuracy are discussed.

  10. AcrAB efflux pump plays a role in decreased susceptibility to tigecycline in Morganella morganii. (United States)

    Ruzin, Alexey; Keeney, David; Bradford, Patricia A


    Transposon mutagenesis of a clinical isolate of Morganella morganii, G1492 (tigecycline MIC of 4 microg/ml), yielded two insertion knockout mutants for which tigecycline MICs were 0.03 microg/ml. Transposon insertions mapped to acrA, which is constitutively overexpressed in G1492, suggesting a role of the AcrAB efflux pump in decreased susceptibility to tigecycline in M. morganii.

  11. Ab initio potential energy surface for the highly nonlinear dynamics of the KCN molecule

    Energy Technology Data Exchange (ETDEWEB)

    Párraga, H.; Arranz, F. J., E-mail:; Benito, R. M., E-mail: [Grupo de Sistemas Complejos, ETSI Agrónomos, Universidad Politécnica de Madrid, 28040 Madrid (Spain); Borondo, F., E-mail: [Departamento de Química and Instituto de Ciencias Matemáticas (ICMAT), Universidad Autónoma de Madrid, Cantoblanco, 28049-Madrid (Spain)


    An accurate ab initio quantum chemistry study at level of quadratic configuration interaction method of the electronic ground state of the KCN molecule is presented. A fitting of the results to an analytical series expansion was performed to obtain a global potential energy surface suitable for the study of the associated vibrational dynamics. Additionally, classical Poincaré surfaces of section for different energies and quantum eigenstates were calculated, showing the highly nonlinear behavior of this system.

  12. Utveckling av universaladapter för torkblad i samarbete med European Automotive Supplier AB


    Eklund, Peter; Haugthon, Johan


    This report looks at the possibility of designing a universal adapter for Flat Blade windshield wipers in cooperation with European Automotive Supplier AB. To understand and see if this is possible, a research and an extensive patent search where done. Then to add structure to the project a Ganttschematic were developed. To generate good and solid ideas, different methods for product development were looked upon. When a method was chosen and applied, a series of concepts emerged. Now the focu...

  13. [Correlation between Staphylococcus carriage, specific antibody-production and AB0-blood grouping in plasma donors]. (United States)

    Nemyrovs'ka, L M; Patoka, V V


    Interaction peculiarities of three components of the immune human homeostasis-antigens of blood groups AB0, staphylococcus antigens and antistaphylococcus antibodies have been investigated. Donors (85) of antistaphylococcus plasma immunized by staphylococcus anatoxin have been investigated. It is found that the nasal staphylococcus carriage in donors depends on the level of specific and natural antibodies and on the coincidence between the staphylococcus antigen structure and the protein substance of the specific blood group factors. PMID:12190026

  14. Die Deutschlandklausel im EG-Beihilfenrecht (Art. 87 Abs. 2 lit.c EGV)


    Wössner, Barbara


    Art. 87 Abs. 2 lit. c EGV sieht vor, daß Bestimmte Beihilfen mit dem gemeinsamen Markt vereinbar sind, 'Beihilfen für die Wirtschaft bestimmter durch die Teilung Deutschlands betroffener Gebiete der Bundesrepublik Deutschland, soweit sie zum Ausgleich der durch die Teilung verursachten wirtschaftlichen Nachteile erforderlich sind'. Der Anwendungsbereich der sogenannten Deutschlandklausel ist sowohl in räumlicher als auch in sachlicher Hinsicht seit der Wiedervereinigung Deutschlands 1990 umst...

  15. IT Product Realization Process towards Marketing Consultancy Automation – Case Study: Customer Value Sweden AB


    Paralykidis, Georgios


    Management consulting is a growing field [1] that is of great importance for organisations to optimise their performance and develop plans for future improvements. In the recent years, many companies use experienced consultants in order to create a strong competitive advantage to withstand the competition and to easily find solutions suitable to different problems. Customer Value Sweden AB is a - start-up - consultancy firm that have been operating the last years in the Swedish market and off...

  16. ERK Activation by Fucoidan Leads to Inhibition of Melanogenesis in Mel-Ab Cells


    Song, Yu Seok; Balcos, Marie Carmel; Yun, Hye-Young; Baek, Kwang Jin; Kwon, Nyoun Soo; Kim, Myo-Kyoung; Kim, Dong-Seok


    Fucoidan, a fucose-rich sulfated polysaccharide derived from brown seaweed in the class Phaeophyceae, has been widely studied for its possible health benefits. However, the potential of fucoidan as a possible treatment for hyperpigmentation is not fully understood. This study investigated the effects of fucoidan on melanogenesis and related signaling pathways using Mel-Ab cells. Fucoidan significantly decreased melanin content. While fucoidan treatment decreased tyrosinase activity, it did no...

  17. Ab initio calculation of positron distribution, ACAR and lifetime in TTF-TCNQ

    International Nuclear Information System (INIS)

    We have performed ab initio calculations of positron distribution, ACAR and lifetime in the quasi-one-dimensional organic conductor TTF-TCNQ. The electronic structure is obtained within the LDA, while the positron state is calculated either with the LDA or with the GGA. Except the positron lifetime, differences between the LDA and GGA results are rather small. The obtained results are compared with our previous experiments and calculations.

  18. Ab initio calculation of positron distribution, ACAR and lifetime in TTF-TCNQ (United States)

    Ishibashi, Shoji; Kohyama, Masanori


    We have performed ab initio calculations of positron distribution, ACAR and lifetime in the quasi-one-dimensional organic conductor TTF-TCNQ. The electronic structure is obtained within the LDA, while the positron state is calculated either with the LDA or with the GGA. Except the positron lifetime, differences between the LDA and GGA results are rather small. The obtained results are compared with our previous experiments and calculations.

  19. GM2 gangliosidosis AB variant: novel mutation from India – a case report with a review


    Sheth, Jayesh; Datar, Chaitanya; Mistri, Mehul; Bhavsar, Riddhi; Sheth, Frenny; Shah, Krati


    Background GM2 gangliosidosis-AB variants a rare autosomal recessive neurodegenerative disorder occurring due to deficiency of GM2 activator protein resulting from the mutation in GM2A gene. Only seven mutations in nine cases have been reported from different population except India. Case presentation Present case is a one year old male born to 3rd degree consanguineous Indian parents from Maharashtra. He was presented with global developmental delay, hypotonia and sensitive to hyperacusis. H...

  20. \\textit{Ab initio} calculation of transport and optical properties of aluminum: influence of simulation parameters


    Knyazev, D. V.; Levashov, P. R.


    This work is devoted to the \\textit{ab initio} calculation of transport and optical properties of aluminum. The calculation is based on the quantum molecular dynamics simulation, density functional theory and the Kubo-Greenwood formula. Mainly the calculations are performed for liquid aluminum at near-normal densities for the temperatures from melting up to 20000 K. The results on dynamic electrical conductivity, static electrical conductivity and thermal conductivity are obtained and compare...

  1. Large scale ab initio calculations based on three levels of parallelization


    Bottin, François; Leroux, Stéphane; Knyazev, Andrew; Zérah, Gilles


    We suggest and implement a parallelization scheme based on an efficient multiband eigenvalue solver, called the locally optimal block preconditioned conjugate gradient LOBPCG method, and using an optimized three-dimensional (3D) fast Fourier transform (FFT) in the ab initio}plane-wave code ABINIT. In addition to the standard data partitioning over processors corresponding to different k-points, we introduce data partitioning with respect to blocks of bands as well as spatial partitioning in t...

  2. Bacillus anthracis HssRS signaling to HrtAB regulates heme resistance during infection


    Stauff, Devin L; Skaar, Eric P.


    Bacillus anthracis proliferates to high levels within vertebrate tissues during the pathogenesis of anthrax. This growth is facilitated by the acquisition of nutrient iron from host heme. However, heme acquisition can lead to the accumulation of toxic amounts of heme within B. anthracis. Here, we show that B. anthracis resists heme toxicity by sensing heme through the HssRS two-component system, which regulates expression of the heme-detoxifying transporter HrtAB. In addition, we demonstrate ...

  3. Ab initio study on the magnetostructural properties of MnAs


    Sanvito, Stefano; RUNGGER, IVAN


    The magnetic and structural properties of MnAs are studied with ab initio methods, and by mapping total energies onto a Heisenberg model. The stability of the different phases is found to depend mainly on the volume and on the amount of magnetic order, confirming previous experimental findings and phenomenological models. It is generally found that for large lattice constants the ferromagnetic state is favored, whereas for small lattice constants different antiferromagnetic states can be stab...

  4. Fungal-specific transcription factor AbPf2 activates pathogenicity in Alternaria brassicicola

    Energy Technology Data Exchange (ETDEWEB)

    Cho, Yangrae; Ohm, Robin A.; Grigoriev, Igor V.; Srivastava, Akhil


    Alternaria brassicicola is a successful saprophyte and necrotrophic plant pathogen. To identify molecular determinants of pathogenicity, we created non-pathogenic mutants of a transcription factor-encoding gene, AbPf2. The frequency and timing of germination and appressorium formation on host plants were similar between the non-pathogenic abpf2 mutants and wild-type A. brassicicola. The mutants were also similar in vitro to wild-type A. brassicicola in terms of vegetative growth, conidium production, and responses to a phytoalexin, reactive oxygen species and osmolites. The hyphae of the mutants grew slowly but did not cause disease symptoms on the surface of host plants. Transcripts of the AbPf2 gene increased exponentially soon after wild-type conidia contacted their host plants . A small amount of AbPf2 protein, as monitored using GFP fusions, was present in young, mature conidia. The protein level decreased during saprophytic growth, but increased and was located primarily in fungal nuclei during pathogenesis. Levels of the proteins and transcripts sharply decreased following colonization of host tissues beyond the initial infection site. When expression of the transcription factor was induced in the wild-type during early pathogenesis, 106 fungal genes were also induced in the wild-type but not in the abpf2 mutants. Notably, 33 of the 106 genes encoded secreted proteins, including eight putative effector proteins. Plants inoculated with abpf2 mutants expressed higher levels of genes associated with photosynthesis, the pentose phosphate pathway and primary metabolism, but lower levels of defense-related genes. Our results suggest that AbPf2 is an important regulator of pathogenesis, but does not affect other cellular processes in A. brassicicola.

  5. Plant Recycling for Molecular Biofarming to Produce Recombinant Anti-cancer mAb

    Directory of Open Access Journals (Sweden)

    Deuk-Su Kim


    Full Text Available The expression and glycosylation patterns of anti-colorectal cancer therapeutic monoclonal antibody (mAb CO17-1A recognizing the tumor-associated antigen GA733-2, expressed in human colorectal carcinoma cells, were observed in the leaf and stem tissues of primary (T2; 0 cycle secondary (1 cycle, and tertiary (2 cycle growths of seedlings obtained from the stem cut of T2 plants. The bottom portion of the stem of T2 seedlings was cut to induce the 1 cycle shoot growth, which was again cut to induce the 2 cycle shoot growth. In the 1 and 2 cycle growths, the periods for floral organ formation was shorter (35 days than that (100 days for the 0 cycle growth. The genes of heavy and light chains of mAb CO17-1A existed at the top, middle, and basal portions of the leaves and stem obtained from the 0, 1, and 2 cycle plants. The protein levels in the leaves and stem tissues from the 1 and 2 cycles were similar to those in the tissues from the 0 cycle. The glycosylation level and pattern in the leaf and stem did not alter dramatically over the different cycles. Surface plasmon resonance (SPR confirmed that mAbs CO17-1A obtained from leaf and stem tissues of the 0, 1, and 2 cycles had similar binding affinity for the GA733-2 antigen. These data suggest that the shoot growth by bottom stem cutting is applicable to speed up the growth of plant biomass expressing anti-colorectal cancer mAb without variation of expression, glycosylation, and functionality.

  6. On limits of ab initio calculations of pairing gap in nuclei


    Saperstein, E. E.; Baldo, M.; Lombardo, U.; Pankratov, S. S.; Zverev, M. V.


    A brief review of recent microscopic calculations of nuclear pairing gap is given. A semi-microscopic model is suggested in which the ab-initio effective pairing interaction is supplemented with a small phenomenological addendum. It involves a parameter which is universal for all medium and heavy nuclei. Calculations for several isotopic and isotonic chains of semi-magic nuclei confirm the relevance of the model.

  7. Projector augmented wave method: ab initio molecular dynamics with full wave functions

    Indian Academy of Sciences (India)

    Peter E Blöchl; Clemens J Först; Johannes Schimpl


    A brief introduction to the projector augmented wave method is given and recent developments are reviewed. The projector augmented wave method is an all-electron method for efficient ab initio molecular dynamics simulations with full wave functions. It extends and combines the traditions of existing augmented wave methods and the pseudopotential approach. Without sacrificing efficiency, the PAW method avoids transferability problems of the pseudopotential approach and it has been valuable to predict properties that depend on the full wave functions.

  8. N3LO NN interaction adjusted to light nuclei in ab exitu approach (United States)

    Shirokov, A. M.; Shin, I. J.; Kim, Y.; Sosonkina, M.; Maris, P.; Vary, J. P.


    We use phase-equivalent transformations to adjust off-shell properties of similarity renormalization group evolved chiral effective field theory NN interaction (Idaho N3LO) to fit selected binding energies and spectra of light nuclei in an ab exitu approach. We then test the transformed interaction on a set of additional observables in light nuclei to verify that it provides reasonable descriptions of these observables with an apparent reduced need for three- and many-nucleon interactions.

  9. Simulation of Ab Initio Molecular Dynamics of Shock Wave on Copper

    Institute of Scientific and Technical Information of China (English)

    张林; 蔡灵仓; 向士凯; 经福谦; 陈栋泉


    The relation between particle velocity Up, up to 4 km/s, and shock wave velocity Us in copper has been simulated with ab initio molecular dynamics. The simulated relationship without considering the correction of zero-point and finite temperature effects is Us = 4.23 + 1.53Up. After considering the correction the relation becomes Us = 4.08 + 1.53Up, which is consistent with the experimental result.

  10. Multi-criteria selection of structural adhesives to bond ABS parts obtained by rapid prototyping


    Arenas, Jose Manuel; Alia, Cristina; Blaya, Fernando; Sanz Lobera, Alfredo


    One of the most used methods in rapidprototyping is Fused Deposition Modeling (FDM), which provides components with a reasonable strength in plastic materials such as ABS and has a low environmental impact. However, the FDM process exhibits low levels of surface finishing, difficulty in getting complex and/or small geometries and low consistency in “slim” elements of the parts. Furthermore, “cantilever” elements need large material structures to be supported. The solution of these deficiencie...

  11. Ab initio theory of galvanomagnetic phenomena in ferromagnetic metals and disordered alloys


    Turek, Ilja; Kudrnovsky, Josef; Drchal, Vaclav


    We present an ab initio theory of transport quantities of metallic ferromagnets developed in the framework of the fully relativistic tight-binding linear muffin-tin orbital method. The approach is based on the Kubo-Streda formula for the conductivity tensor, on the coherent potential approximation for random alloys, and on the concept of interatomic electron transport. The developed formalism is applied to pure 3d transition metals (Fe, Co, Ni) and to random Ni-based ferromagnetic alloys (Ni-...

  12. Ab initio simulations of liquid NaSn alloys: Zintl anions and network formation


    Schoene, M.; Kaschner, R.; Seifert, G


    Using the Car-Parrinello technique, ab initio molecular dynamics simulations are performed for liquid NaSn alloys in five different compositions (20, 40, 50, 57 and 80 % sodium). The obtained structure factors agree well with the data from neutron scattering experiments. The measured prepeak in the structure factor is reproduced qualitatively for most compositions. The calculated and measured positions of all peaks show the same trend as function of the composition.\\\\ The dynamic simulations ...

  13. Equations of state of magnesium perovskite and postperovskite: diagnostics from ab initio simulations


    Belousov, Roman; Prencipe, Mauro


    The isothermal compression of magnesium perovskite and postperovskite is examined through the F-f plot and the diagnostic plot of Vinet universal model theoretically from the ab initio quantum-mechanical calculations at the hybrid Hartree-Fock / Density Functional Theory level. A purely numerical approach, first time applied in this paper, shows that the discrepancies largely observed between studies on the perovskite and criticized in geophysical applications are due to the inadequate choice...

  14. Ab initio molecular dynamics study of liquid sodium and cesium up to critical point

    Energy Technology Data Exchange (ETDEWEB)

    Yuryev, Anatoly A. [Institute of Metallurgy of Ural Branch of the Russian Academy of Sciences, Amundsen st. 101,620016, Yekaterinburg (Russian Federation); Ural Federal University, Vira st. 19, 620002, Yekaterinburg (Russian Federation); Gelchinski, Boris R. [Institute of Metallurgy of Ural Branch of the Russian Academy of Sciences, Amundsen st. 101,620016, Yekaterinburg (Russian Federation)


    Ab initio modeling of liquid metals Na and K is carried out using the program SIESTA. We have determined the parameters of the model (the optimal step, the number of particles, the initial state etc) and calculated a wide range of properties: the total energy, pair correlation function, coefficient of self-diffusion, heat capacity, statistics of Voronoi polyhedra, the density of electronic states up to the critical temperature.

  15. STAT5A/B Gene Locus Undergoes Amplification during Human Prostate Cancer Progression


    Haddad, Bassem R.; Gu, Lei; Mirtti, Tuomas; Dagvadorj, Ayush; Vogiatzi, Paraskevi; Hoang, David T.; Bajaj, Renu; Leiby, Benjamin; Ellsworth, Elyse; Blackmon, Shauna; Ruiz, Christian; Curtis, Mark; Fortina, Paolo; Ertel, Adam; Liu, Chengbao


    The molecular mechanisms underlying progression of prostate cancer (PCa) to castrate-resistant (CR) and metastatic disease are poorly understood. Our previous mechanistic work shows that inhibition of transcription factor Stat5 by multiple alternative methods induces extensive rapid apoptotic death of Stat5-positive PCa cells in vitro and inhibits PCa xenograft tumor growth in nude mice. Furthermore, STAT5A/B induces invasive behavior of PCa cells in vitro and in vivo, suggesting involvement ...

  16. Hyperfine tensors of nitrogen-vacancy center in diamond from \\emph{ab initio} calculations


    Gali, Adam


    We determine and analyze the charge and spin density distributions of nitrogen-vacancy (N-V) center in diamond for both the ground and excited states by \\emph{ab initio} supercell calculations. We show that the hyperfine tensor of $^{15}$N nuclear spin is negative and strongly anisotropic in the excited state, in contrast to previous models used extensively to explain electron spin resonance measurements. In addition, we detect a significant redistribution of the spin density due to excitatio...

  17. Mechanical thrombectomy with the Solitaire AB device in large intracerebral artery occlusions

    International Nuclear Information System (INIS)

    Mechanical thrombectomy has the potential to revolutionise the treatment of acute stroke. The Solitaire AB device is used for clot retrieval with unprecedented revascularisation rates being reported. Our aim is to report our experiences of the safety and efficacy of the Solitaire AB device in acute ischaemic stroke. A retrospective dual-centre study of 21 patients with acute ischaemic stroke who underwent mechanical thrombectomy with the Solitaire AB device between 1 October 2010 and 1 December 2011 was carried out. Using clinical data recovered from patients' case notes, we identified time intervals from groin puncture to recanalisation, revascularisation rates, procedural complications and neurological status before and after treatment (using the National Institutes of Health Stroke Scale (NIHSS) and modified Rankin scale (mRS) respectively). Successful revascularisation, defined as Thrombosis in Cerebral Ischemia Grade 2 or 3, was achieved in 81% of cases. The mean NIHSS score at presentation was 18.5. The mean number of passes required to achieve recanalisation was 1.95 and the median duration of the procedure from groin puncture to recanalisation was 65min. Procedural events included distal emboli (n=2), arterial dissection (n=1) and arterial perforation (n=1).There were three cases of asymptomatic intracranial haemorrhage. Forty-eight per cent of patients achieved a good functional outcome at 3 months (mRS score ≤2). The mortality rate at 3 months was 19% (n=4). There was no procedure-related mortality. Mechanical thrombectomy with the Solitaire AB device is safe and achieves high rates of revascularisation in acute stroke with good clinical outcomes.

  18. Electrochemical impedance studies of AB{sub 5}-type hydrogen storage alloy

    Energy Technology Data Exchange (ETDEWEB)

    Slepski, Pawel; Darowicki, Kazimierz; Andrearczyk, Karolina [Department of Electrochemistry Corrosion and Materials Engineering, Gdansk University of Technology, 11/12 Narutowicza Street, 80-233 Gdansk (Poland); Kopczyk, Maciej; Sierczynska, Agnieszka [Institute of Non-ferrous Metals, Department in Poznan, Central Laboratory of Batteries and Cells, 12 Forteczna Street, 61-362 Poznan (Poland)


    Electrochemical impedance spectroscopy technique was used to describe behavior of AB{sub 5}-type hydrogen storage alloy. Impedance investigations were performed during cyclic voltammetry measurement and charge/discharge cycles. The comprehensive interpretation of instantaneous impedance spectra obtained in potentiostatic mode allowed further to interpret impedance results in galvanostatic mode. Proposed methodology enabled to trace electrical parameters as a function of state of charge (SOC) and depth of discharge (DOD). (author)

  19. In pursuit of the ab initio limit for conformational energy prototypes (United States)

    Császár, Attila G.; Allen, Wesley D.; Schaefer, Henry F.


    The convergence of ab initio predictions to the one- and n-particle limits has been systematically explored for several conformational energy prototypes: the inversion barriers of ammonia, water, and isocyanic acid, the torsional barrier of ethane, the E/Z rotamer separation of formic acid, and the barrier to linearity of silicon dicarbide. Explicit ab initio results were obtained with atomic-orbital basis sets as large as [7s6p5d4f3g2h1i/6s5p4d3f2g1h] and electron correlation treatments as extensive as fifth-order Møller-Plesset perturbation theory (MP5), the full coupled-cluster method through triple excitations (CCSDT), and Brueckner doubles theory including perturbational corrections for both triple and quadruple excitations [BD(TQ)]. Subsequently, basis set and electron correlation extrapolation schemes were invoked to gauge any further variations in arriving at the ab initio limit. Physical effects which are tacitly neglected in most theoretical work have also been quantified by computations of non-Born-Oppenheimer (BODC), relativistic, and core correlation shifts of relative energies. Instructive conclusions are drawn for the pursuit of spectroscopic accuracy in theoretical conformational analyses, and precise predictions for the key energetic quantities of the molecular prototypes are advanced.

  20. Detection of Mycolactone A/B in Mycobacterium ulcerans–Infected Human Tissue (United States)

    Sarfo, Fred Stephen; Phillips, Richard O.; Rangers, Brian; Mahrous, Engy A.; Lee, Richard E.; Tarelli, Edward; Asiedu, Kingsley B.; Small, Pamela L.; Wansbrough-Jones, Mark H.


    Background Mycobacterium ulcerans disease (Buruli ulcer) is a neglected tropical disease common amongst children in rural West Africa. Animal experiments have shown that tissue destruction is caused by a toxin called mycolactone. Methodology/Principal Findings A molecule was identified among acetone-soluble lipid extracts from M. ulcerans (Mu)-infected human lesions with chemical and biological properties of mycolactone A/B. On thin layer chromatography this molecule had a retention factor value of 0.23, MS analyses showed it had an m/z of 765.6 [M+Na+] and on MS:MS fragmented to produce the core lactone ring with m/z of 429.4 and the polyketide side chain of mycolactone A/B with m/z of 359.2. Acetone-soluble lipids from lesions demonstrated significant cytotoxic, pro-apoptotic and anti-inflammatory activities on cultured fibroblast and macrophage cell lines. Mycolactone A/B was detected in all of 10 tissue samples from patients with ulcerative and pre-ulcerative Mu disease. Conclusions/Significance Mycolactone can be detected in human tissue infected with Mu. This could have important implications for successful management of Mu infection by antibiotic treatment but further studies are needed to measure its concentration. PMID:20052267