
Sample records for abs 1b bis

  1. Antidiabetic Bis-Maltolato-OxoVanadium(IV): Conversion of inactive trans- to bioactive cis-BMOV for possible binding to target PTP-1B (United States)

    Scior, Thomas; Mack, Hans-Georg; García, José Antonio Guevara; Koch, Wolfhard


    The postulated transition of Bis-Maltolato-OxoVanadium(IV) (BMOV) from its inactive trans- into its cis-aquo-BMOV isomeric form in solution was simulated by means of computational molecular modeling. The rotational barrier was calculated with DFT – B3LYP under a stepwise optimization protocol with STO-3G, 3-21G, 3-21G*, and 6-31G ab initio basis sets. Our computed results are consistent with reports on the putative molecular mechanism of BMOV triggering the insulin-like cellular response (insulin mimetic) as a potent inhibitor of the protein tyrosine phosphatase-1B (PTP-1B). Initially, trans-BMOV is present in its solid dosage form but in aqueous solution, and during oral administration, it is readily converted into a mixture of “open-type” and “closed-type” complexes of cis-aquo-BMOV under equilibrium conditions. However, in the same measure as the “closed-type” complex binds to the cytosolic PTP-1B, it disappears from solution, and the equilibrium shifts towards the “closed-type” species. In full accordance, the computed binding mode of cis-BMOV is energetically favored over sterically hindered trans-BMOV. In view of our earlier report on prodrug hypothesis of vanadium organic compounds the present results suggest that cis-BMOV is the bioactive species. PMID:19920909


    NARCIS (Netherlands)



    We report the immunomodulatory effects of an intravenous treatment with F(ab')(2) fragments of the bispecific monoclonal antibody BIS-1 during subcutaneous recombinant interleukin 2 (rIL-2) therapy of renal cell cancer (RCC) patients. BIS-1 is directed against both the CD3 antigen on T cells and the

  3. Antidiabetic Bis-Maltolato-OxoVanadium(IV: Conversion of inactive trans- to bioactive cis-BMOV for possible binding to target PTP-1B

    Directory of Open Access Journals (Sweden)

    Thomas Scior


    Full Text Available Thomas Scior1, Hans-Georg Mack2, José Antonio Guevara García3, Wolfhard Koch41Departamento de Farmacia. Facultad de Ciencias Químicas, Benemérita Universidad Autónoma de Puebla, Colonia San Manuel, Puebla, Mexico; 2Institut für Physikalische Chemie, Universität Tübingen, Tübingen, Germany; 3Laboratorio de Investigación en Bioinorgánica y Biorremediación (LIByB. Departamento de Ciencias Básicas, Ingeniería y Tecnología, Universidad Autónoma de Tlaxcala, Apizaco, Tlaxcala, Mexico; 4Facultad de Estudios Superiores Zaragoza (FESZ, Universidad Nacional Autónoma de México (UNAM, Colonia Ejército de Oriente, Delegación Iztapalapa, Mexico City, MexicoAbstract: The postulated transition of Bis-Maltolato-OxoVanadium(IV (BMOV from its inactive trans- into its cis-aquo-BMOV isomeric form in solution was simulated by means of computational molecular modeling. The rotational barrier was calculated with DFT – B3LYP under a stepwise optimization protocol with STO-3G, 3-21G, 3-21G*, and 6-31G ab initio basis sets. Our computed results are consistent with reports on the putative molecular mechanism of BMOV triggering the insulin-like cellular response (insulin mimetic as a potent inhibitor of the protein tyrosine phosphatase-1B (PTP-1B. Initially, trans-BMOV is present in its solid dosage form but in aqueous solution, and during oral administration, it is readily converted into a mixture of “open-type” and “closed-type” complexes of cis-aquo-BMOV under equilibrium conditions. However, in the same measure as the “closed-type” complex binds to the cytosolic PTP-1B, it disappears from solution, and the equilibrium shifts towards the “closed-type” species. In full accordance, the computed binding mode of cis-BMOV is energetically favored over sterically hindered trans-BMOV. In view of our earlier report on prodrug hypothesis of vanadium organic compounds the present results suggest that cis-BMOV is the bioactive species

  4. New ab initio adiabatic potential energy surfaces and bound state calculations for the singlet ground X˜ 1A1 and excited C˜ 1B2(21A') states of SO2 (United States)

    Kłos, Jacek; Alexander, Millard H.; Kumar, Praveen; Poirier, Bill; Jiang, Bin; Guo, Hua


    We report new and more accurate adiabatic potential energy surfaces (PESs) for the ground X˜ 1A1 and electronically excited C˜ 1B2(21A') states of the SO2 molecule. Ab initio points are calculated using the explicitly correlated internally contracted multi-reference configuration interaction (icMRCI-F12) method. A second less accurate PES for the ground X ˜ state is also calculated using an explicitly correlated single-reference coupled-cluster method with single, double, and non-iterative triple excitations [CCSD(T)-F12]. With these new three-dimensional PESs, we determine energies of the vibrational bound states and compare these values to existing literature data and experiment.

  5. Ab initio MO study on equilibrium bond distance between Fe and pyridine in bis(pyridine)(porphinato) iron for various electronic states (United States)

    Saito, Minoru; Kashiwagi, Hiroshi


    For bis(pyridine)(porphinato) iron [FeP(py)2], a correlation between the iron electronic state and the equilibrium Fe-Npy distance was investigated. Potential energy curves as a function of the Fe-Npy distance were calculated for low-spin, intermediate-spin, and high-spin states of the ferric and ferrous ions by the ab initio SCF MO method. The equilibrium Fe-Npy distances were obtained from the potential curves. The values obtained for the ferric low-spin and high-spin states were in good agreement with the experimental values for Fe(III)(OEP)(3-Clpy)2 within the differences, ±0.05 Å. The following significant features were found. The equilibrium distance is elongated by the occupation of the 3dz2 orbital and is shortened by the oxidation of the iron atom. The distance and the force constant for the symmetrical py-Fe-py stretching are strongly correlated with the overlap population between the 3dz2 orbital and pyridine-nitrogen orbitals.

  6. Experimental and ab Initio Study of Catena(bis(μ2-iodo)-6-methylquinoline-copper(I)) under Pressure: Synthesis, Crystal Structure, Electronic, and Luminescence Properties. (United States)

    Aguirrechu-Comerón, Amagoia; Hernández-Molina, Rita; Rodríguez-Hernández, Plácida; Muñoz, Alfonso; Rodríguez-Mendoza, Ulises R; Lavín, Vı́ctor; Angel, Ross J; Gonzalez-Platas, Javier


    Copper(I) iodine compounds can exhibit interesting mechanochromic and thermochromic luminescent properties with important technological applications. We report the synthesis and structure determination by X-ray diffraction of a new polymeric staircase copper(I) iodine compound catena(bis(μ2-iodo)-6-methylquinoline-copper(I), [C10H9CuIN]. The structure is composed of isolated polymeric staircase chains of copper-iodine coordinated to organic ligands through Cu-N bonds. High pressure X-ray diffraction to 6.45 GPa shows that the material is soft, with a bulk modulus K0 = 10.2(2)GPa and a first derivative K'0 = 8.1(3), typical for organometallic compounds. The unit-cell compression is very anisotropic with the stiffest direction [302] arising from a combination of the stiff CuI ladders and the shear of the planar quinolone ligands over one another. Full structure refinements at elevated pressures show that pressures reduce the Cu···Cu distances in the compound. This effect is detected in luminescence spectra with the appearance of four sub-bands at 515, 600, 647, and 712 nm above 3.5 GPa. Red-shifts are observed, and they are tentatively associated with interactions between copper(I) ions due to the shortening of the Cu···Cu distances induced by pressure, below twice the van der Waals limit (2.8 Å). Additionally, ab initio simulations were performed, and they confirmed the structure and the results obtained experimentally for the equation of state. The simulation allowed the band structure and the electronic density of states of this copper(I) iodine complex to be determined. In particular, the band gap decreases slowly with pressure in a quadratic way with dEg/dP = -0.011 eV/GPa and d(2)Eg/dP(2) = 0.001 eV/GPa(2). PMID:27429246

  7. Crystal Structure, Vibrational Spectroscopy and ab Initio Density Functional Theory Calculations on the Ionic Liquid forming 1,1,3,3-Tetramethylguanidinium bis{(trifluoromethyl)sulfonyl}amide

    DEFF Research Database (Denmark)

    Berg, Rolf W.; Riisager, Anders; Nguyen van Buu, Olivier;


    was found to be monoclinic, space group P2(1)/n with a = 11.349(2), b = 11.631(2), c = 11.887(2) angstrom, and beta = 90.44(3)degrees. Raman and IR spectra are presented and interpreted. The results are interpreted using ab initio quantum mechanics calculations that also predicted vibrational spectra...

  8. BIS 220 Tutorials /bis220dotcom




    BIS 220 Entire Course   For more course tutorials visit   BIS 220 Week 1 Individual Assignment Information Technology Acts Paper BIS 220 Week 1 DQ 1 BIS 220 Week 1 DQ 2 BIS 220 Week 2 LT Reflection Summary BIS 220 Week 2 Individual Assignment Information Systems Proposal BIS 220 Week 2 DQ 1 BIS 220 Week 2 DQ 2 BIS 220 Week 3 Individual Assignment Types of Electronic Commerce Activity BIS 220 Week 3 LT Reflection Summ...

  9. BIS 220 Tutorials / bis220dotcom




    BIS 220 Entire Course   For more course tutorials visit   BIS 220 Week 1 Individual Assignment Information Technology Acts Paper BIS 220 Week 1 DQ 1 BIS 220 Week 1 DQ 2 BIS 220 Week 2 LT Reflection Summary BIS 220 Week 2 Individual Assignment Information Systems Proposal BIS 220 Week 2 DQ 1 BIS 220 Week 2 DQ 2 BIS 220 Week 3 Individual Assignment Types of Electronic Commerce Activity BIS 220 Week 3 LT Reflection Summ...

  10. Interferon Gamma-1b Injection (United States)

    Interferon gamma-1b injection is used to reduce the frequency and severity of serious infections in people ... with severe, malignant osteopetrosis (an inherited bone disease). Interferon gamma-1b is in a class of medications ...

  11. Interferon Beta-1b Injection (United States)

    Interferon beta-1b injection is used to reduce episodes of symptoms in patients with relapsing-remitting (course ... and problems with vision, speech, and bladder control). Interferon beta-1b is in a class of medications ...

  12. BIS 220 Uop Material-bis220dotcom




    BIS 220 Entire Course For more course tutorials visit BIS 220 Week 1 Individual Assignment Information Technology Acts Paper BIS 220 Week 1 DQ 1 BIS 220 Week 1 DQ 2 BIS 220 Week 2 LT Reflection Summary BIS 220 Week 2 Individual Assignment Information Systems Proposal BIS 220 Week 2 DQ 1 BIS 220 Week 2 DQ 2 BIS 220 Week 3 Individual Assignment Types of Electronic Commerce Activity BIS 220 Week 3 LT Reflection Summary BIS 220 Week 3...

  13. Fotfavoriten AB


    Søilen, Klaus Solberg; HUBER, Stefan


    Fotfavoriten AB, a foot care company located in Sollefttå in Northern Sweden, is an example of how local government fires staff only to reengage them as entrepreneurs delivering similar service. The case is typical for the social sector and may mark a trend. The result is often felt to be positive both by the entrepreneur, who is now more directly in charge of her or his earnings, and the end consumer. The CEO of Fotfavoriten AB, Eva Wörmann, waited a long time before she dared to take the ne...

  14. The capsular polysaccharide Vi from Salmonella typhi is a B1b antigen. (United States)

    Marshall, Jennifer L; Flores-Langarica, Adriana; Kingsley, Robert A; Hitchcock, Jessica R; Ross, Ewan A; López-Macías, Constantino; Lakey, Jeremy; Martin, Laura B; Toellner, Kai-Michael; MacLennan, Calman A; MacLennan, Ian C; Henderson, Ian R; Dougan, Gordon; Cunningham, Adam F


    Vaccination with purified capsular polysaccharide Vi Ag from Salmonella typhi can protect against typhoid fever, although the mechanism for its efficacy is not clearly established. In this study, we have characterized the B cell response to this vaccine in wild-type and T cell-deficient mice. We show that immunization with typhoid Vi polysaccharide vaccine rapidly induces proliferation in B1b peritoneal cells, but not in B1a cells or marginal zone B cells. This induction of B1b proliferation is concomitant with the detection of splenic Vi-specific Ab-secreting cells and protective Ab in Rag1-deficient B1b cell chimeras generated by adoptive transfer-induced specific Ab after Vi immunization. Furthermore, Ab derived from peritoneal B cells is sufficient to confer protection against Salmonella that express Vi Ag. Expression of Vi by Salmonella during infection did not inhibit the development of early Ab responses to non-Vi Ags. Despite this, the protection conferred by immunization of mice with porin proteins from Salmonella, which induce Ab-mediated protection, was reduced postinfection with Vi-expressing Salmonella, although protection was not totally abrogated. This work therefore suggests that, in mice, B1b cells contribute to the protection induced by Vi Ag, and targeting non-Vi Ags as subunit vaccines may offer an attractive strategy to augment current Vi-based vaccine strategies.

  15. ABS 497 Complete Class




    ABS 497 Complete Class   To purchase this material click below link   For more classes visit   ABS 497 Week 1 Assignment Community Change ABS 497 Week 1 DQ 1 Fabian's Story ABS 497 Week 1 DQ 2 Doug's Story ABS 497 Week 2 DQ 1 Parenting Styles ABS 497 Week 2 DQ 2 Ethnicity and Learning Theory ABS 497 Week 3 ...

  16. Introduction to BIS statistics


    Bank for International Settlements


    The BIS has expanded its statistics by publishing additional data, revamping their dissemination and strengthening their policy orientation. This special feature, prepared by members of the BIS Monetary and Economic Department, briefly describes each BIS data set and explains how the statistics can be used for analysis.

  17. Main: 1B37 [RPSD[Archive

    Lifescience Database Archive (English)

    Full Text Available 1B37 トウモロコシ Corn Zea mays L. Polyamine Oxidase Precursor Name=Pao; Zea Mays Molecul...FSNWPVGVNRYEYDQLRAPVGRVYFTGEHTSEHYNGYVHGAYLSGIDSAEILINCAQKKMCKYHVQGKYD corn_1B37.jpg ...

  18. Construction of HEK293 cells stably expressing wild-type organic anion transporting polypeptide 1B1 (OATP1B1*1a) and variant OATP1B1*1b and OATP1B1*15. (United States)

    Chen, M; Qu, B X; Chen, X L; Hu, H H; Jiang, H D; Yu, L S; Zhou, Q; Zeng, S


    A transgenic cell line stably expressing the human organic anion transporting polypeptide (OATP1B1) was established. Human Embryonic Kidney 293 (HEK293) cell line stably expressing OATP1B1*1a sequence was amplified through PCR with the extracted total RNA as templates from human liver, then subcloned into the plasmid pMD19-T and verified by sequencing. OATP1B1*1b/OATP1B1*15 mutant sequences were obtained by site-directed mutation PCR with pMD19-T/ OATP1B1*1a as templates. The plasmids pcDNA3.1(+)/OATP1B1*1a, *1b and *15 were constructed and transfected into HEK293 cell line using Lipofectamine 2000 transfection reagent. Several stable transfected clones were obtained after selection with G418. Using rosuvastatin as a probe substrate of OATP1B1, the intracellular rosuvastatin accumulation in HEK293 and HEK-OATP1B1*1a, *1b and *15 monoclone cells were validated by a ultra-performance liquid chromatography-tandem mass spectrometry. OATP1B1 mRNA and protein expression were detected by RT-PCR and Western blot, respectively. The results from RT-PCR, rosuvastatin uptake and Western blot assay indicated that human OATP1B1 was highly expressed in transfected cells compared with controls. The HEK-293 cell lines stably expressing human OATP1B1-wild and variant (HEK-OATP1B1, *1b and *15) are potential models to study drug transport in vitro. PMID:27455553

  19. Construction of HEK293 cells stably expressing wild-type organic anion transporting polypeptide 1B1 (OATP1B1*1a) and variant OATP1B1*1b and OATP1B1*15. (United States)

    Chen, M; Qu, B X; Chen, X L; Hu, H H; Jiang, H D; Yu, L S; Zhou, Q; Zeng, S


    A transgenic cell line stably expressing the human organic anion transporting polypeptide (OATP1B1) was established. Human Embryonic Kidney 293 (HEK293) cell line stably expressing OATP1B1*1a sequence was amplified through PCR with the extracted total RNA as templates from human liver, then subcloned into the plasmid pMD19-T and verified by sequencing. OATP1B1*1b/OATP1B1*15 mutant sequences were obtained by site-directed mutation PCR with pMD19-T/ OATP1B1*1a as templates. The plasmids pcDNA3.1(+)/OATP1B1*1a, *1b and *15 were constructed and transfected into HEK293 cell line using Lipofectamine 2000 transfection reagent. Several stable transfected clones were obtained after selection with G418. Using rosuvastatin as a probe substrate of OATP1B1, the intracellular rosuvastatin accumulation in HEK293 and HEK-OATP1B1*1a, *1b and *15 monoclone cells were validated by a ultra-performance liquid chromatography-tandem mass spectrometry. OATP1B1 mRNA and protein expression were detected by RT-PCR and Western blot, respectively. The results from RT-PCR, rosuvastatin uptake and Western blot assay indicated that human OATP1B1 was highly expressed in transfected cells compared with controls. The HEK-293 cell lines stably expressing human OATP1B1-wild and variant (HEK-OATP1B1, *1b and *15) are potential models to study drug transport in vitro.

  20. Intramolecular Electron Transfer in Bis(tetraalkyl Hydrazine) and Bis(hydrazyl) Radical Cations. (United States)

    Chang, Hao

    A series of multicyclic bis(hydrazine) and bis(diazenium) compounds connected by relatively rigid hydrocarbon frameworks were prepared for the study of intramolecular electron transfer. The thermodynamics of electron removal of these compounds was investigated by cyclic voltammetry. The difference between the first and second oxidation potentials for the 4 sigma-bonded species was found to be larger for the bis(hydrazyl) radical systems than for the bis(hydrazines) by ca. 0.2 V (4.6 kcal/mol). This indicates a greater degree of interaction between the two nitrogen moieties for the hydrazyl systems, which is consistent with a greater degree of electronic coupling (H _{rm AB}) in these systems. The ESR spectra of the 4 sigma -bonded bis(hydrazine) radical cations indicate localized radical cations, which corresponds to slow intramolecular electron transfer on the ESR timescale. Conversely, the ESR spectra of the corresponding bis(hydrazyl) radical cation systems show nitrogen hyperfine splittings of a(4N) of ca. 4.5 G. This indicates that intramolecular electron transfer between the two nitrogen moieties is fast on the ESR timescale; the rate of exchange, k_ {rm ex} was estimated to be well above 1.9 times 10^8 s^{-1}. The contrast in exchange rates is consistent with the large geometry change upon oxidation which is characteristic of hydrazines. The hydrazyls undergo a smaller geometry change upon oxidation, and thus are expected to exhibit smaller inner-sphere reorganization energies. The optical spectra of these radical species was investigated in hopes of observing absorption bands corresponding to intramolecular electron transfer, as predicted by Hush theory. A broad absorption band was observed in the near IR region for the saturated bis(hydrazyl) radical cation system at 1060 nm (9420 cm^{-1} ) in acetonitrile at room temperature, and was accompanied by a narrower band at 1430 nm (6993 cm^ {-1}). The width of this band was estimated to be 545 nm (6496 cm^{-1

  1. Bacterial Expression and Purification of an Active ω-Atracotoxin-Ar1b from Spider Atrax robustus

    Institute of Scientific and Technical Information of China (English)

    WANG Yu-qin; WANG Jue; LI Jian; LIU Qiang; HUANG Shi-di; WANG Dun


    The ω-atracotoxin-Ar1b toxin(ω-ACTX-Ar1b)is one of the arthropod-selective peptide neurotoxins from the venom of Australian funnel-web spider Atrax robustus.The gene of Ar1b was synthesized and cloned into pET-32a(+)vector to allow expression of Ar1b as a fusion protein with thioredoxin and the His-tag(rTrx-Ar1b)in E.coli BL21(DE3).The optimal condition for inducing the expression of rTrx-Ar1b was 1.0 mmol L-1 IPTG for 6 h at 28℃.The fusion protein rTrx-Ar1b was expressed in soluble form and was purified effectively by His Trap HP affinity column and rpHLPC and a final yield of purified rTrx-Ar1b was 95 mg from 1000 mL E.coli culture.The LD50 values for Mythimna separate and Tenebrio molitor were 111.66 and 11.04 μg g-1 determined by injection of the purified rTrx-Ar1b.The results indicated that the recombinant Ar1b protein was successfully expressed in E.coli and it was high toxicity against tested insects.

  2. Gene profiling of growth factor independence 1B gene (Gfi-1B) in leukemic cells. (United States)

    Koldehoff, Michael; Zakrzewski, Johannes L; Klein-Hitpass, Ludger; Beelen, Dietrich W; Elmaagacli, Ahmet H


    To investigate the molecular effects of growth factor independence 1B (Gfi-1B), a transcription factor essential for the development of hematopoietic cells and differentiation of erythroid and megakaryocytic lineages, the naturally Gfi-1B overexpressing cell line K562 was cultured in the presence of Gfi-1B target-specific small interfering RNA (siRNA). SiRNA treatment significantly knocked down Gfi-1B expression with an efficiency of nearly 90%. Analysis of the siRNA silencing protocol by colony-forming units ensured that it was not cytotoxic. Samples from Gfi-1B overexpressing cells and cells with knocked-down Gfi-1B were analyzed by oligonucleotide microarray technology and based upon rigorous statistical analysis of the data; relevant genes were chosen for confirmation by reserve transcriptase-polymerase chain reaction, including MYC/MYCBP and CDKN1A. Interestingly, transcripts within components of the signalling cascade of immune cells (PLD1, LAMP1, HSP90, IL6ST), of the tyrosine kinase pathway (TPR, RAC3) and of the transcription factors (RAC3, CEP290, JEM-1, ATR, MYC, SMC3, RARA, RBBP6) were found to be differentially expressed in Gfi-1B overexpressing cells compared to controls. Individual genes such as ZDHHC17, DMXL1, ZNF292 were found to be upregulated in Gfi-1B overexpressing cells. In addition, down-regulated transcripts showed cell signaling transcripts for several chemokine gene members including GNAL, CXCL5, GNL3L, GPR65, TMEM30, BCL11B and transcription factors (GTF2H3, ATXN3). In conclusion, several essential cell signalling factors, as well as transcriptional and post-translational regulation genes were differentially expressed in cells that overexpressed Gfi-1B compared to control cells with knocked-down Gfi-1B. Our data indicate that Gfi-1B signalling is important for commitment and maturation of hematopoietic cell populations. PMID:18224412

  3. 2000 Johnston Site 1B-P (United States)

    US Fish and Wildlife Service, Department of the Interior — Underwater Site 1B-P was established at Johnston Atoll by Dr. James Maragos, U.S. Fish & Wildlife Service, on June 29, 2000. With a start point (meter 0) at...

  4. Unusual rearrangement in the photochemical addition of bis(alkylidene)disilacyclobutanes to C[sub 60

    Energy Technology Data Exchange (ETDEWEB)

    Kusukawa, Takahiro; Kabe, Yoshio; Erata, Tomoki; Nestler, B.; Ando, Wataru (Univ. of Tsukuba (Japan))


    The photochemical reaction of bis(alkylidene)-disilacyclobutanes 1a, b with C[sub 60] afforded the stable 1:1 adducts 3a,b, resulting from an unexpected rearrangement of the disilacyclobutane unit. The structures of 3a,b were determined by spectroscopic methods, including [sup 29]Si-[sup 1]H HMBC hetero nuclear shift correlation experiments. 18 refs., 2 figs.

  5. ABS 497 ASH Tutorial / Uoptutorial


    Latifa Baka


    For more course tutorials visit   ABS 497 Week 1 Assignment Community Change ABS 497 Week 1 DQ 1 Fabian's Story ABS 497 Week 1 DQ 2 Doug's Story ABS 497 Week 2 DQ 1 Parenting Styles ABS 497 Week 2 DQ 2 Ethnicity and Learning Theory ABS 497 Week 3 DQ 1 Suicide ABS 497 Week 3 DQ 2 Development Theories ABS 497 Week 3 Assignment communication PowerPoint Presentation ABS 497 Week 4 DQ 1 Leadership Theories ABS 497 Week 4 ...

  6. ABS 497 ASH TUTORIAL / Uoptutorial




    For more course tutorials visit   ABS 497 Week 1 Assignment Community Change ABS 497 Week 1 DQ 1 Fabian's Story ABS 497 Week 1 DQ 2 Doug's Story ABS 497 Week 2 DQ 1 Parenting Styles ABS 497 Week 2 DQ 2 Ethnicity and Learning Theory ABS 497 Week 3 DQ 1 Suicide ABS 497 Week 3 DQ 2 Development Theories ABS 497 Week 3 Assignment communication PowerPoint Presentation ABS 497 Week 4 DQ 1 Leadership Theories ABS 497 Week 4...

  7. ABS 497 Courses/snaptutorial




    For more classes visit   ABS 497 Week 1 Assignment Community Change ABS 497 Week 1 DQ 1 Fabian's Story ABS 497 Week 1 DQ 2 Doug's Story ABS 497 Week 2 DQ 1 Parenting Styles ABS 497 Week 2 DQ 2 Ethnicity and Learning Theory ABS 497 Week 3 DQ 1 Suicide ABS 497 Week 3 DQ 2 Development Theories ABS 497 Week 3 Assignment communication PowerPoint Presentation ABS 497 Week 4 DQ 1 Leadership Theories ABS 497 Week 4 DQ ...

  8. Substituierte Erdalkalimetall-bis(pentolide) und –bis(trialkylzinkate)


    Gückel, Christian


    Im Gegensatz zu den Alkalimetall-pentoliden erweckt das Gebiet der Erdalkalimetallbis( pentolide) erst seit einigen Jahren das Interesse einiger Arbeitsgruppen. Westerhausen et al. konnten vor einigen Jahren bei der Umsetzung von Diphenylbutadiin mit Calcium- und Strontium-bis[bis(trimethylsilyl)phosphanid] die Bildung von Erdalkalimetall-bis(phospholid) nachweisen. Ein alternativer Weg nutzt die Metallierung von 1-Chlor-substituierten Pentolen durch Erdalkalimetalle zu Nutze. ...

  9. Main: 1B5Q [RPSD[Archive

    Lifescience Database Archive (English)


  10. Mutation of Oryza sativa CORONATINE INSENSITIVE 1b (OsCOI1b) delays leaf senescence

    Institute of Scientific and Technical Information of China (English)

    Sang-Hwa Lee; Yasuhito Sakuraba; Taeyoung Lee; Kyu-Won Kim; Gynheung An; Han Yong Lee; Nam-Chon Paek


    Jasmonic acid (JA) functions in plant development, including senescence and immunity. Arabidopsis thaliana CORONATINE INSENSITIVE 1 encodes a JA receptor and functions in the JA‐responsive signaling pathway. The Arabidopsis genome harbors a single COI gene, but the rice (Oryza sativa) genome harbors three COI homologs, OsCOI1a, OsCOI1b, and OsCOI2. Thus, it remains unclear whether each OsCOI has distinct, additive, synergistic, or redundant func-tions in development. Here, we use the oscoi1b‐1 knockout mutants to show that OsCOI1b mainly affects leaf senescence under senescence‐promoting conditions. oscoi1b‐1 mutants stayed green during dark‐induced and natural senescence, with substantial retention of chlorophylls and photosyn-thetic capacity. Furthermore, several senescence‐associated genes were downregulated in oscoi1b‐1 mutants, including homologs of Arabidopsis thaliana ETHYLENE INSENSITIVE 3 and ORESARA 1, important regulators of leaf senescence. These results suggest that crosstalk between JA signaling and ethylene signaling affects leaf senescence. The Arabidopsis coi1‐1 plants containing 35S:OsCOI1a or 35S:OsCOI1b rescued the delayed leaf senescence during dark incubation, sug-gesting that both OsCOI1a and OsCOI1b are required for promoting leaf senescence in rice. oscoi1b‐1 mutants showed significant decreases in spikelet fertility and grain weight, leading to severe reduction of grain yield, indicating that OsCOI1‐mediated JA signaling affects spikelet fertility and grain filling.

  11. Verdivurdering av SAS AB


    Gangås, Silje Garberg


    Formålet med denne mastergradsavhandlingen har vært å beregne den teoretiske verdien på det børsnoterte selskapet SAS AB og på bakgrunn av denne gi en handlingsanbefaling på selskapets aksje. Forskningsspørsmålet for oppgaven er utledet som følger: ”Hva er verdien av SAS AB?” SAS AB er inne i en fundamental omstillingsprosses hvor den nye strategien, 4XNG, ble presentert og påbegynt november 2012. Omstillingsprosessen innebærer blant annet en omfattende omstrukturering i organisasjonen ...

  12. Study of external dynamic flap loads on a 6 percent B-1B model (United States)

    Seiner, John M.; Manning, James C.; Capone, Francis J.; Pendergraft, Odis C., Jr.


    The origin of dynamic pressure loads on external divergent engine nozzle flaps of the B-1B aircraft was investigated in the NASA/LaRC 16 foot transonic tunnel using a 6 percent full span model with powered engine nacelles. External flap dynamic loads and afterbody drag associated with flap removal were measured using this model. Both dry and max. A/B power nozzles were evaluated in this study. As a result of this study, the principal mechanisms responsible for high dynamic external flap loads were determined along with performance penalty associated with flap removal.

  13. Analysis list: ARID1B [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available ARID1B Liver + hg19 ...

  14. Bis(1-adamantylammonium hexafluoridogermanate

    Directory of Open Access Journals (Sweden)

    Liying Cheng


    Full Text Available The title compound, (C10H18N2[GeF6], was obtained hydrothermally from an aqueous solution of GeO2, H3BO3, NiCl2, adamantylammonium chloride, butanol and hydrofluoric acid. The structure consists of discrete bis(1-adamantylammonium cations lying on crystallographic mirror planes and hexafluoridogermanate anions disordered about sites of 2/m point symmetry. In the latter, the Ge atom lies on the site of 2/m symmetry, one F atom lies on the mirror plane and two further F atoms are included in general positions with 50% site occupancy. The cations and anions lie in layers with N—H...F hydrogen bonds formed between them.

  15. Inhibition of bromophenols against PTP1B and anti-hyperglycemic effect of Rhodomela confervoides extract in diabetic rats

    Institute of Scientific and Technical Information of China (English)

    SHI DaYong; XU Feng; HE Juan; LI Jing; FAN Xiao; HAN LiJun


    Protein tyrosine phosphatase 1B (PTP1B) plays an important role as s negative regulator in insulin signaling pathways.PTP1B is an effective target for the treatment of type 2 diabetes mellitus.Four bromophenol derivatives from red algae Rhodomela confervoides,2,2',3,3'-tetrabromo-4,4',5,5"-tetra-hydroxydiphenyl methane (1),3-bormo-4,5-bis(2,3-dibromo-4,5-dihydroxybenzyl) pyrocatechol (2),bis(2,3-dibromo-4,5-dihydroxybenzyl) ether (3) and 2,2",3-tribromo-3",4,4",5-tetrahydroxy-6"-ethyloxy-methyldiphenylmethane (4) showed significant inhibitory activity against PTP1B (IC50 were 2.4,1.7,1.5 and 0.84 μmol/L,respectively) as potential therapeutical agents for the treatment of type 2 diabetes mellitus.The anti-hyperglycemic effects of the ethanol extracts from R.confervoides on streptozoto-cin-induced diabetes (STZ-diabetes) in male Wistar rats fed with high fat diet were investigated.The STZ-diabetic rats treated with medium-dose and high-dose alga extracts showed remarkable reductions in fasting blood glucose (FBG) as compared with the STZ-diabetic control.The results indicate that the in vivo anti-hyperglycemic activity of the R.confervoides extracts can be partially attributed to the in-hibitory actions against PTP1B of the bromophenol derivatives and that may be of clinical importance in improving the management of type 2 diabetes mellitus.

  16. Characterization of hERG1a and hERG1b potassium channels-a possible role for hERG1b in the I (Kr) current

    DEFF Research Database (Denmark)

    Larsen, Anders Peter; Olesen, Søren-Peter; Grunnet, Morten;


    I (Kr) is the fast component of the delayed rectifier potassium currents responsible for the repolarization of the cardiac muscle. The molecular correlate underlying the I (Kr) current has been identified as the hERG1 channel. Recently, two splice variants of the hERG1 alpha-subunit, hERG1a and hERG......1b, have been shown to be co-expressed in human cardiomyocytes. In this paper, we present the electrophysiological characterization of hERG1a, hERG1b, and co-expressed hERG1a/b channels in a mammalian expression system using the whole-cell patch clamp technique. We also quantified the messenger RNA...... (mRNA) levels of hERG1a and hERG1b in human cardiac tissue, and based on the expressed ratios, we evaluated the resulting currents in Xenopus laevis oocytes. Compared to hERG1a channels, activation was faster for both hERG1b and hERG1a/b channels. The deactivation kinetics was greatly accelerated in...


    Gevorkian, Goar; Gonzalez-Noriega, Alfonso; Acero, Gonzalo; Ordoñez, Jorge; Michalak, Colette; Munguia, Maria Elena; Govezensky, Tzipe; Cribbs, David H.; Manoutcharian, Karen


    Extracellular and intraneuronal formation of amyloid-beta aggregates have been demonstrated to be involved in the pathogenesis of Alzheimer’s disease. However, the precise mechanism of amyloid-beta neurotoxicity is not completely understood. Previous studies suggest that binding of amyloid-beta to a number of targets have deleterious effects on cellular functions. In the present study we have shown for the first time that amyloid-beta 1-42 bound to a peptide comprising the microtubule binding domain of the heavy chain of microtubule-associated protein 1B by the screening of a human brain cDNA library expressed on M13 phage. This interaction may explain, in part, the loss of neuronal cytoskeletal integrity, impairment of microtubule-dependent transport and synaptic dysfunction observed previously in Alzheimer’s disease. PMID:18079022

  18. MAN1B1 deficiency: an unexpected CDG-II.

    Directory of Open Access Journals (Sweden)

    Daisy Rymen

    Full Text Available Congenital disorders of glycosylation (CDG are a group of rare metabolic diseases, due to impaired protein and lipid glycosylation. In the present study, exome sequencing was used to identify MAN1B1 as the culprit gene in an unsolved CDG-II patient. Subsequently, 6 additional cases with MAN1B1-CDG were found. All individuals presented slight facial dysmorphism, psychomotor retardation and truncal obesity. Generally, MAN1B1 is believed to be an ER resident alpha-1,2-mannosidase acting as a key factor in glycoprotein quality control by targeting misfolded proteins for ER-associated degradation (ERAD. However, recent studies indicated a Golgi localization of the endogenous MAN1B1, suggesting a more complex role for MAN1B1 in quality control. We were able to confirm that MAN1B1 is indeed localized to the Golgi complex instead of the ER. Furthermore, we observed an altered Golgi morphology in all patients' cells, with marked dilatation and fragmentation. We hypothesize that part of the phenotype is associated to this Golgi disruption. In conclusion, we linked mutations in MAN1B1 to a Golgi glycosylation disorder. Additionally, our results support the recent findings on MAN1B1 localization. However, more work is needed to pinpoint the exact function of MAN1B1 in glycoprotein quality control, and to understand the pathophysiology of its deficiency.

  19. IL1B induced Smad 7 negatively regulates gastrin expression.

    Directory of Open Access Journals (Sweden)

    Dipanjana Datta De

    Full Text Available BACKGROUND: Helicobacter pylori elicited IL1B is one of the various modulators responsible for perturbation of acid secretion in gut. We have earlier reported that IL1B activated NFkB downregulates gastrin, a major modulator of acid secretion. However, we hypothesized that regulation of gastrin by IL1B would depend on the cell's ability to integrate inputs from multiple signaling pathways to generate appropriate biological response. PRINCIPAL FINDING: In this study, we report that IL1B induces Smad 7 expression by about 4.5 fold in gastric carcinoma cell line, AGS. Smad 7 resulted in transcriptional repression of gastrin promoter by about 6.5 fold when co-transfected with Smad 7 expression vector and gastrin-promoter luciferase in AGS cells. IL1B inhibited phosphorylation of Smad 3 and subsequently interfered with nuclear translocation of the positive Smad complex, thus occluding it off the gastrin promoter. IL1B promoter polymorphisms (-511T/-31C IL1B are known to be associated with H. pylori associated gastro-duodenal ulcer. We observed that IL1B expressed from -31T promoter driven IL1B cDNA elicited 3.5 fold more Smad 7 than that expressed from the IL1B-31C variant in AGS cells. This differential activation of Smad 7 by IL1B promoter variants translated into differential downregulation of gastrin expression. We further analyzed Smad 7, NFkB, IL1B and gastrin expression in antral gut biopsy samples of patients with H. pylori associated duodenal ulcer and normal individuals. We observed that individuals with duodenal ulcer had significantly lower levels of IL1B, Smad 7, NFkB and corresponding higher level of gastrin expression. CONCLUSION: Pro-inflammatory cytokine IL1B repress gastrin expression by activating Smad 7 and subsequent inhibition of nuclear localization of Smad 3/4 complex. Polymorphic promoter variants of IL1B gene can modulate the IL1B expression which resulted in differential activation Smad 7 and consequent repression of

  20. Protein Tyrosine Phosphatase 1B Inhibitors from Plantago asiatica

    Institute of Scientific and Technical Information of China (English)

    CUI Long; LEE Hyun-sun; AHN Jong-seog; YUAN Guang-xin; SUN Ya-nan


    Objective To identify the active compounds for protein tyrosine phosphatase 1B (PTP1B) from the seeds of Plantago asiatica. Methods Bioassay-guided fractionation resulted in the isolation of iridoid glucosides (1-5) with PTP1B inhibitory activity. Results Five compounds were identified as desacetylhookerioside (1), melittoside (2), geniposidic acid (3), 10-O-acetyl-geniposidic acid (4), and alpinoside (5). Conclusion Isolated compounds 3-5 inhibit PTP1B with IC50 values ranged from (16.3 ± 1.1) to (19.8 ± 1.2) μmol/L.

  1. Clicked bis-PEG-peptide conjugates for studying calmodulin-Kv7.2 channel binding


    Bonache de Marcos, María Ángeles; Alaimo, Alessandro; Malo, Covadonga; Millet, Oscar; Villarroel, Alvaro; González-Muñiz, Rosario


    The recombinant Kv7.2 calmodulin (CaM) binding site (Q2AB CaMBD) shows a high tendency to aggregate, thus complicating biochemical and structural studies. To facilitate these studies we have conceived bis-PEG-peptide CaMBD-mimetics linking helices A and B in single, easy to handle molecules. Short PEG chains were selected as spacers between the two peptide molecules, and a Cu(i)-catalyzed cycloaddition (CuAAC) protocol was used to assemble the final bis-PEG-peptide conjugate, by the convenien...

  2. Aldo-Keto Reductases 1B in Endocrinology and Metabolism. (United States)

    Pastel, Emilie; Pointud, Jean-Christophe; Volat, Fanny; Martinez, Antoine; Lefrançois-Martinez, Anne-Marie


    The aldose reductase (AR; human AKR1B1/mouse Akr1b3) has been the focus of many research because of its role in diabetic complications. The starting point of these alterations is the massive entry of glucose in polyol pathway where it is converted into sorbitol by this enzyme. However, the issue of AR function in non-diabetic condition remains unresolved. AR-like enzymes (AKR1B10, Akr1b7, and Akr1b8) are highly related isoforms often co-expressed with bona fide AR, making functional analysis of one or the other isoform a challenging task. AKR1B/Akr1b members share at least 65% protein identity and the general ability to reduce many redundant substrates such as aldehydes provided from lipid peroxidation, steroids and their by-products, and xenobiotics in vitro. Based on these properties, AKR1B/Akr1b are generally considered as detoxifying enzymes. Considering that divergences should be more informative than similarities to help understanding their physiological functions, we chose to review specific hallmarks of each human/mouse isoforms by focusing on tissue distribution and specific mechanisms of gene regulation. Indeed, although the AR shows ubiquitous expression, AR-like proteins exhibit tissue-specific patterns of expression. We focused on three organs where certain isoforms are enriched, the adrenal gland, enterohepatic, and adipose tissues and tried to connect recent enzymatic and regulation data with endocrine and metabolic functions of these organs. We presented recent mouse models showing unsuspected physiological functions in the regulation of glucido-lipidic metabolism and adipose tissue homeostasis. Beyond the widely accepted idea that AKR1B/Akr1b are detoxification enzymes, these recent reports provide growing evidences that they are able to modify or generate signal molecules. This conceptually shifts this class of enzymes from unenviable status of scavenger to upper class of messengers.

  3. The over-expression of two transcription factors, ABS5/bHLH30 and ABS7/MYB101, leads to upwardly curly leaves.

    Directory of Open Access Journals (Sweden)

    Rui An

    Full Text Available Proper leaf development is essential for plant growth and development, and leaf morphogenesis is under the control of intricate networks of genetic and environmental cues. We are interested in dissecting these regulatory circuits genetically and report here the isolation of two Arabidopsis dominant mutants, abnormal shoot5-1D (abs5-1D and abs7-1D identified through activation tagging screens. Both abs5-1D and abs7-1D display an intriguing upwardly curly leaf phenotype. Molecular cloning showed that the elevated expression of a bHLH transcription factor ABS5/T5L1/bHLH30 or a MYB transcription factor ABS7/MYB101 is the cause for the abnormal leaf phenotypes found in abs5-1D or abs7-1D, respectively. Protoplast transient expression assays confirmed that both ABS5/T5L1 and ABS7/MYB101 are targeted to the nucleus. Interestingly, the expression domains of auxin response reporter DR5::GUS were abnormal in leaves of abs5-1D and ABS5/T5L1 over-expression lines. Moreover, cotyledon venation analysis showed that more areoles and free-ending veins are formed in abs5-1D. We found that the epidermis-specific expressions of ABS5/T5L1 or ABS7/MYB101 driven by the Arabidopsis Meristem Layer 1 promoter (PAtML1 were sufficient to recapitulate the curly leaf phenotype of abs5-1D or abs7-1D. In addition, PAtML1::ABS5 lines exhibited similar changes in DR5::GUS expression patterns as those found in 35S-driven ABS5/T5L1 over-expression lines. Our work demonstrated that enhanced expressions of two transcription factors, ABS5/T5L1 and ABS7/MYB101, are able to alter leaf lamina development and reinforce the notion that leaf epidermis plays critical roles in regulating plant organ morphogenesis.

  4. Aldo-Keto Reductases 1B in Adrenal Cortex Physiology. (United States)

    Pastel, Emilie; Pointud, Jean-Christophe; Martinez, Antoine; Lefrançois-Martinez, A Marie


    Aldose reductase (AKR1B) proteins are monomeric enzymes, belonging to the aldo-keto reductase (AKR) superfamily. They perform oxidoreduction of carbonyl groups from a wide variety of substrates, such as aliphatic and aromatic aldehydes or ketones. Due to the involvement of human aldose reductases in pathologies, such as diabetic complications and cancer, AKR1B subgroup enzymatic properties have been extensively characterized. However, the issue of AKR1B function in non-pathologic conditions remains poorly resolved. Adrenal activities generated large amount of harmful aldehydes from lipid peroxidation and steroidogenesis, including 4-hydroxynonenal (4-HNE) and isocaproaldehyde (4-methylpentanal), which can both be reduced by AKR1B proteins. More recently, some AKR1B isoforms have been shown to be endowed with prostaglandin F synthase (PGFS) activity, suggesting that, in addition to possible scavenger function, they could instigate paracrine signals. Interestingly, the adrenal gland is one of the major sites for human and murine AKR1B expression, suggesting that their detoxifying/signaling activity could be specifically required for the correct handling of adrenal function. Moreover, chronic effects of ACTH result in a coordinated regulation of genes encoding the steroidogenic enzymes and some AKR1B isoforms. This review presents the molecular mechanisms accounting for the adrenal-specific expression of some AKR1B genes. Using data from recent mouse genetic models, we will try to connect their enzymatic properties and regulation with adrenal functions.

  5. Protein tyrosine phosphatase 1B inhibitors isolated from Artemisia roxburghiana. (United States)

    Shah, Muhammad Raza; Ishtiaq; Hizbullah, Syed Muhammad; Habtemariam, Solomon; Zarrelli, Armando; Muhammad, Akhtar; Collina, Simona; Khan, Inamulllah


    Artemisia roxburghiana is used in traditional medicine for treating various diseases including diabetes. The present study was designed to evaluate the antidiabetic potential of active constituents by using protein tyrosine phosphatase 1B (PTP1B) as a validated target for management of diabetes. Various compounds were isolated as active principles from the crude methanolic extract of aerial parts of A. roxburghiana. All compounds were screened for PTP1B inhibitory activity. Molecular docking simulations were performed to investigate the mechanism behind PTP1B inhibition of the isolated compound and positive control, ursolic acid. Betulinic acid, betulin and taraxeryl acetate were the active PTP1B principles with IC50 values 3.49 ± 0.02, 4.17 ± 0.03 and 87.52 ± 0.03 µM, respectively. Molecular docking studies showed significant molecular interactions of the triterpene inhibitors with Gly220, Cys215, Gly218 and Asp48 inside the active site of PTP1B. The antidiabetic activity of A. roxburghiana could be attributed due to PTP1B inhibition by its triterpene constituents, betulin, betulinic acid and taraxeryl acetate. Computational insights of this study revealed that the C-3 and C-17 positions of the compounds needs extensive optimization for the development of new lead compounds. PMID:26118418

  6. Synthesis and protein tyrosine phosphatase 1B inhibition activities of two new synthetic bromophenols and their methoxy derivatives (United States)

    Cui, Yongchao; Shi, Dayong; Hu, Zhiqiang


    3-bromo-4,5-bis(2,3-dibromo-4,5-dihydroxybenzyl)-1,2-benzenediol ( 1) is a natural bromophenol isolated from the red algae Rhodomela confervoides that exhibits significant inhibition against protein tyrosine phosphatase 1B (PTP1B). Based on its activity, we synthesized two new synthetic bromophenols and their methoxy derivatives from vanillin using the structure of natural bromophenol 1 as a scaffold. The structures of these bromophenols were elucidated from 1H NMR, 13C NMR, and high resolution electron ionization mass spectrometry as 2,3-dibromo-1-(2'-bromo-6'-(3″,4″-dimethoxybenzyl)-3',4'-dimethoxybenzyl)-4,5-dimethoxybenzene ( 2), 2,3-dibromo-1-(2'-bromo-6'-(2″-bromo-4″,5″-dimethoxybenzyl)-3',4'-dimethoxybenzyl)-4,5-dimethoxybenzene ( 3), 3,4-dibromo-5-(2'-bromo-6'-(2″-bromo-4″,5″-dihydroxybenzyl)-3',4'-dihydroxybenzyl)pyrocatechol ( 4) and 3,4-dibromo-5-(2'-bromo-6'-(3″,4″-dihydroxybenzyl)-3',4'-dihydroxybenzyl)pyrocatechol ( 5). PTP1B inhibition activities of these compounds were evaluated using a colorimetric assay, and compounds 3 and 4 demonstrated interesting activity against PTP1B.

  7. A cytotoxic study of eugenol and its ortho dimer (bis-eugenol)

    Energy Technology Data Exchange (ETDEWEB)

    Kashiwagi, Yasushi [Meikai Univ., Sakado, Saitama (Japan). School of Dentistry


    Eugenol is widely used not only as a dental material such as pulp capping material, provisional cement, root canal sealer, and impression paste, but also as a perfume ingredients. Eugenol has antioxidant, bactericidal, and sedative activities, inhibits and non-enzymatic peroxidation. It was previously reported that eugenol exhibited the cytotoxic activity toward pulp cells and gingial fibroblasts and also that the cytotoxic activity was predominantly performed by radicals derived from the oxidation of eugenol. This study was based on the hypothesis that the toxicity of eugenol may be greately reduced if the radicalization of eugenol was diminished by the dimerization of eugenol. Thus, bis-eugenol, the dimer of eugenol, was synthesized to characterize the effect of this eugenol-related compound. The cytotoxic activity of bis-eugenol against human gingival fibroblasts (HGF cell) or human submandibular gland cancer cells (HSG cell) was studied in the presence or absence of light irradiation (visible or ultraviolet light), and compared with that of eugenol. The cytotoxic activity of eugenol was significantly greater than that of bis-eugenol. The cytotoxic activity of irradiated eugenol, but not that of irradiated bis-eugenol, was significantly higher than that of the non-irradiated counterpart. Bis-eugenol at a relatively low concentration declined the phototoxic activity of irradiation on living cells. Also, the generation of reactive oxygen in HSG cells in the ab-sence or the presence of irradiated bis-eugenol or eugenol was evaluated by an ACAS laser cytometry, and the results indicated that eugenol, but not bis-eugenol, generated reactive oxygen in the cells. The DPPH-radical scavenging activity of bis-eugenol was larger than that of eugenol. Furthermore, eugenol had a positive apoptosis-inducing effect on HSG cells. The structure-activity relationships of eugenol-related compounds showed that the nature of the substituent at the ortho or para-position of eugenol

  8. TES/Aura L1B Spectra Limb V002 (United States)

    National Aeronautics and Space Administration — The L1B Limb granule consists of radiometrically calibrated spectra & associated NESR, observed at 0.025 cm-1 resolution for an entire Global Survey &...

  9. ABS 497 ASH Tutorial/Uoptutorial




    ABS 497 Week 1 Assignment Community Change ABS 497 Week 1 DQ 1 Fabian's Story ABS 497 Week 1 DQ 2 Doug's Story ABS 497 Week 2 DQ 1 Parenting Styles ABS 497 Week 2 DQ 2 Ethnicity and Learning Theory ABS 497 Week 3 DQ 1 Suicide ABS 497 Week 3 DQ 2 Development Theories ABS 497 Week 3 Assignment communication PowerPoint Presentation ABS 497 Week 4 DQ 1 Leadership Theories ABS 497 Week 4 DQ 2 Problems of Adolescence ABS 497 Week 5 DQ Macro Social Systems...

  10. Modeling the vibrational spectrum of 4,4'-diphenylmethane- bis(methyl)carbamate (United States)

    Shundalau, M. B.; Pitsevich, G. A.; Ksenofontov, M. A.; Umreiko, D. S.


    We present results of ab initio calculations of the structure and vibrational IR spectrum for 4,4'-diphenylmethane-bis(methyl)carbamate (DPMC). Calculations were carried out in the HF/6-311G approximation with subsequent force-field scaling. The calculated characteristics of the vibrational spectrum of DPMC show satisfactory agreement with experimental values, which permits them to be used in spectral and structural analysis

  11. Aldo-keto reductases 1B in adrenal cortex physiology

    Directory of Open Access Journals (Sweden)

    Emilie PASTEL


    Full Text Available Aldose reductase proteins are cytosolic monomeric enzymes, belonging to the aldo-keto reductase (AKR superfamily. They perform oxidoreduction of carbonyl groups from a wide variety of substrates such as aliphatic and aromatic aldehydes or ketones. The Aldose reductase subgroup (AKR1B is one of the most characterized because of its involvement in human diseases such as diabetic complications resulting from the ability of its human archetype AKR1B1 to reduce glucose into sorbitol. However the issue of AKR1B function in non pathologic condition remains poorly resolved. Adrenal steroidogenesis is strongly associated with high production of endogenous harmful lipid aldehyde by-products including isocaproaldehyde (4-methylpentanal derived from cholesterol side chain cleavage (the first step of steroid synthesis and 4-hydroxynonenal (4- HNE that can both be reduced by AKR1B proteins. More recently, some AKR1B isoforms have been shown to be endowed with prostaglandin F synthase activity, suggesting that in addition to possible scavenger function, they could instigate paracrine signals. Interestingly, previous studies have established that the adrenal gland is one of the major site for human and murine AKR1B expression suggesting that their detoxifying/signaling activity could be specifically required for the correct handling of adrenal function. Moreover chronic effects of ACTH result in a coordinated regulation of genes encoding the steroidogenic enzymes and some AKR1B isoforms.This review presents the molecular mechanisms accounting for the adrenal specific expression of some AKR1B genes. Using data from recent mouse genetic models, we will try to connect their enzymatic properties and regulation with adrenal functions.

  12. PTP1B inhibitors from stems of Angelica keiskei (Ashitaba). (United States)

    Li, Jin-Long; Gao, Li-Xin; Meng, Fan-Wang; Tang, Chun-Lan; Zhang, Ru-Jun; Li, Jing-Ya; Luo, Cheng; Li, Jia; Zhao, Wei-Min


    Three new chalcones, xanthoangelols K-M (1-3), together with 19 known compounds were isolated from the stems of Angelica keiskei Koidzumi, a well-known rejuvenated and anti-diabetic plant originated from Japan. The structures of compounds 1-3 were elucidated on the basis of spectroscopic data and Mosher's method. All compounds were evaluated for their inhibitory activity against protein tyrosine phosphatase 1B (PTP1B). Among them, six chalcones, xanthoangelol K (1), xanthoangelol (4), xanthoangelol F (5), 4-hydroxyderricin (6), xanthoangelol D (7), xanthoangelol E (8), and a coumarin, methoxsalen (17), showed strong PTP1B inhibitory effect with IC50 values of 0.82, 1.97, 1.67, 2.47, 3.97, 1.43, and 2.53μg/mL, respectively. A kinetic study revealed that compound 1 inhibited PTP1B with characteristics typical of a competitive inhibitor. Molecular docking simulations elucidated that ring B of 1 may anchor in a pocket of PTP1B and the molecule is stabilized by hydrogen bonds with Arg47, Asp48, and π-π interaction with Phe182 of PTP1B.

  13. Association of transcription factor gene LMX1B with autism.

    Directory of Open Access Journals (Sweden)

    Ismail Thanseem

    Full Text Available Multiple lines of evidence suggest a serotoninergic dysfunction in autism. The role of LMX1B in the development and maintenance of serotoninergic neurons is well known. In order to examine the role, if any, of LMX1B with autism pathophysiology, a trio-based SNP association study using 252 family samples from the AGRE was performed. Using pair-wise tagging method, 24 SNPs were selected from the HapMap data, based on their location and minor allele frequency. Two SNPs (rs10732392 and rs12336217 showed moderate association with autism with p values 0.018 and 0.022 respectively in transmission disequilibrium test. The haplotype AGCGTG also showed significant association (p = 0.008. Further, LMX1B mRNA expressions were studied in the postmortem brain tissues of autism subjects and healthy controls samples. LMX1B transcripts was found to be significantly lower in the anterior cingulate gyrus region of autism patients compared with controls (p = 0.049. Our study suggests a possible role of LMX1B in the pathophysiology of autism. Based on previous reports, it is likely to be mediated through a seretoninergic mechanism. This is the first report on the association of LMX1B with autism, though it should be viewed with some caution considering the modest associations we report.

  14. Association of transcription factor gene LMX1B with autism. (United States)

    Thanseem, Ismail; Nakamura, Kazuhiko; Anitha, Ayyappan; Suda, Shiro; Yamada, Kazuo; Iwayama, Yoshimi; Toyota, Tomoko; Tsujii, Masatsugu; Iwata, Yasuhide; Suzuki, Katsuaki; Matsuzaki, Hideo; Iwata, Keiko; Sugiyama, Toshiro; Yoshikawa, Takeo; Mori, Norio


    Multiple lines of evidence suggest a serotoninergic dysfunction in autism. The role of LMX1B in the development and maintenance of serotoninergic neurons is well known. In order to examine the role, if any, of LMX1B with autism pathophysiology, a trio-based SNP association study using 252 family samples from the AGRE was performed. Using pair-wise tagging method, 24 SNPs were selected from the HapMap data, based on their location and minor allele frequency. Two SNPs (rs10732392 and rs12336217) showed moderate association with autism with p values 0.018 and 0.022 respectively in transmission disequilibrium test. The haplotype AGCGTG also showed significant association (p = 0.008). Further, LMX1B mRNA expressions were studied in the postmortem brain tissues of autism subjects and healthy controls samples. LMX1B transcripts was found to be significantly lower in the anterior cingulate gyrus region of autism patients compared with controls (p = 0.049). Our study suggests a possible role of LMX1B in the pathophysiology of autism. Based on previous reports, it is likely to be mediated through a seretoninergic mechanism. This is the first report on the association of LMX1B with autism, though it should be viewed with some caution considering the modest associations we report.

  15. Organic anion transporter 3- and organic anion transporting polypeptides 1B1- and 1B3-mediated transport of catalposide

    Directory of Open Access Journals (Sweden)

    Jeong HU


    Full Text Available Hyeon-Uk Jeong,1 Mihwa Kwon,2 Yongnam Lee,3 Ji Seok Yoo,3 Dae Hee Shin,3 Im-Sook Song,2 Hye Suk Lee1 1College of Pharmacy, The Catholic University of Korea, Bucheon 420-743, Korea; 2College of Pharmacy and Research Institute of Pharmaceutical Sciences, Kyungpook National University, Daegu 702-701, Korea; 3Central R&D Institute, Yungjin Pharm Co., Ltd., Suwon 443-270, Korea Abstract: We investigated the in vitro transport characteristics of catalposide in HEK293 cells overexpressing organic anion transporter 1 (OAT1, OAT3, organic anion transporting polypeptide 1B1 (OATP1B1, OATP1B3, organic cation transporter 1 (OCT1, OCT2, P-glycoprotein (P-gp, and breast cancer resistance protein (BCRP. The transport mechanism of catalposide was investigated in HEK293 and LLC-PK1 cells overexpressing the relevant transporters. The uptake of catalposide was 319-, 13.6-, and 9.3-fold greater in HEK293 cells overexpressing OAT3, OATP1B1, and OATP1B3 transporters, respectively, than in HEK293 control cells. The increased uptake of catalposide via the OAT3, OATP1B1, and OATP1B3 transporters was decreased to basal levels in the presence of representative inhibitors such as probenecid, furosemide, and cimetidine (for OAT3 and cyclosporin A, gemfibrozil, and rifampin (for OATP1B1 and OATP1B3. The concentration-dependent OAT3-mediated uptake of catalposide revealed the following kinetic parameters: Michaelis constant (Km =41.5 µM, maximum uptake rate (Vmax =46.2 pmol/minute, and intrinsic clearance (CLint =1.11 µL/minute. OATP1B1- and OATP1B3-mediated catalposide uptake also showed concentration dependency, with low CLint values of 0.035 and 0.034 µL/minute, respectively. However, the OCT1, OCT2, OAT1, P-gp, and BCRP transporters were apparently not involved in the uptake of catalposide into cells. In addition, catalposide inhibited the transport activities of OAT3, OATP1B1, and OATP1B3 with half-maximal inhibitory concentration values of 83, 200, and 235 µ

  16. The AB Staff Plan

    CERN Document Server

    Boillot, J; Delahaye, J P; Myers, S; CERN. Geneva. AB Department


    The present report summarises the staff plan of the newly created Accelerators and Beams (AB) Division following the restructuring of the Accelerator Sector and covering the period 2003 to 2010. It underlines the refocusing of the staff on priority work, especially the LHC Project and is coherent with the recently adopted CERN Long Term Plan (LTP). It compares the requested and available manpower (both staff and industrial support) for each Project, Programme and Activity (PPA) split in work packages and highlights the missing manpower for each category of personnel.

  17. AB Manpower Plan 2007

    CERN Document Server

    Myers, Stephen


    The present exercise is not as such a "manpower plan" but a purely budgetary comparison of known plus requested resources with the known commitments over the period 2007-2012. From a purely budgetary point of view, AB will have the capacity to maintain all those recently hired staff who fulfill the criteria for long term employment at CERN. Following this budgetary exercise, AB proposes to perform a CERN-wide staff work plan so as to compare the manpower available to the quantity of work to be done in the totality of the work-packages. If there is a significant mismatch between these two quantities then we propose the following measures which would create personnel economies and allow us to redress the mismatch by increased recruitment: a new job severance scheme; CERN restructuring; use of the new CERN-ITER agreement; more flexibility in transfers from Materials to Personnel budgets. Failing this a re-examination of possible closure of lower priority facilities may be needed.

  18. ABS 497 ASH Tutorial Course/Uoptutorial




    For More Course Tutorials Visit   ABS 497 Week 1 Assignment Community Change ABS 497 Week 1 DQ 1 Fabian's Story ABS 497 Week 1 DQ 2 Doug's Story ABS 497 Week 2 DQ 1 Parenting Styles ABS 497 Week 2 DQ 2 Ethnicity and Learning Theory ABS 497 Week 3 DQ 1 Suicide ABS 497 Week 3 DQ 2 Development Theories ABS 497 Week 3 Assignment communication PowerPoint Presentation ABS 497 Week 4 DQ 1 Leadership Theories ABS 497 Week 4 ...

  19. Oncolytic Replication of E1b-Deleted Adenoviruses

    Directory of Open Access Journals (Sweden)

    Pei-Hsin Cheng


    Full Text Available Various viruses have been studied and developed for oncolytic virotherapies. In virotherapy, a relatively small amount of viruses used in an intratumoral injection preferentially replicate in and lyse cancer cells, leading to the release of amplified viral particles that spread the infection to the surrounding tumor cells and reduce the tumor mass. Adenoviruses (Ads are most commonly used for oncolytic virotherapy due to their infection efficacy, high titer production, safety, easy genetic modification, and well-studied replication characteristics. Ads with deletion of E1b55K preferentially replicate in and destroy cancer cells and have been used in multiple clinical trials. H101, one of the E1b55K-deleted Ads, has been used for the treatment of late-stage cancers as the first approved virotherapy agent. However, the mechanism of selective replication of E1b-deleted Ads in cancer cells is still not well characterized. This review will focus on three potential molecular mechanisms of oncolytic replication of E1b55K-deleted Ads. These mechanisms are based upon the functions of the viral E1B55K protein that are associated with p53 inhibition, late viralmRNAexport, and cell cycle disruption.

  20. LMX1B Mutations Cause Hereditary FSGS without Extrarenal Involvement (United States)

    Boyer, Olivia; Woerner, Stéphanie; Yang, Fan; Oakeley, Edward J.; Linghu, Bolan; Gribouval, Olivier; Tête, Marie-Josèphe; Duca, José S.; Klickstein, Lloyd; Damask, Amy J.; Szustakowski, Joseph D.; Heibel, Françoise; Matignon, Marie; Baudouin, Véronique; Chantrel, François; Champigneulle, Jacqueline; Martin, Laurent; Nitschké, Patrick; Gubler, Marie-Claire; Johnson, Keith J.; Chibout, Salah-Dine


    LMX1B encodes a homeodomain-containing transcription factor that is essential during development. Mutations in LMX1B cause nail-patella syndrome, characterized by dysplasia of the patellae, nails, and elbows and FSGS with specific ultrastructural lesions of the glomerular basement membrane (GBM). By linkage analysis and exome sequencing, we unexpectedly identified an LMX1B mutation segregating with disease in a pedigree of five patients with autosomal dominant FSGS but without either extrarenal features or ultrastructural abnormalities of the GBM suggestive of nail-patella–like renal disease. Subsequently, we screened 73 additional unrelated families with FSGS and found mutations involving the same amino acid (R246) in 2 families. An LMX1B in silico homology model suggested that the mutated residue plays an important role in strengthening the interaction between the LMX1B homeodomain and DNA; both identified mutations would be expected to diminish such interactions. In summary, these results suggest that isolated FSGS could result from mutations in genes that are also involved in syndromic forms of FSGS. This highlights the need to include these genes in all diagnostic approaches to FSGS that involve next-generation sequencing. PMID:23687361

  1. Synthesis, characterization, and reactivity of furan- and thiophene-functionalized bis(n-heterocyclic carbene) complexes of iron(II)

    KAUST Repository

    Rieb, Julia


    The synthesis of iron(II) complexes bearing new heteroatom-functionalized methylene-bridged bis(N-heterocyclic carbene) ligands is reported. All complexes are characterized by single-crystal X-ray diffraction (SC-XRD), nuclear magnetic resonance (NMR) spectroscopy, and elemental analysis. Tetrakis(acetonitrile)-cis-[bis(o-imidazol-2-ylidenefuran)methane]iron(II) hexafluorophosphate (2a) and tetrakis(acetonitrile)-cis-[bis(o-imidazol-2-ylidenethiophene)methane]iron(II) hexafluorophosphate (2b) were obtained by aminolysis of [Fe{N(SiMe3)2}2(THF)] with furan- and thiophene-functionalized bis(imidazolium) salts 1a and 1b in acetonitrile. The SC-XRD structures of 2a and 2b show coordination of the bis(carbene) ligand in a bidentate fashion instead of a possible tetradentate coordination. The four other coordination sites of these distorted octahedral complexes are occupied by acetonitrile ligands. Crystallization of 2a in an acetone solution by the slow diffusion of Et2O led to the formation of cisdiacetonitriledi[ bis(o-imidazol-2-ylidenefuran)methane]iron(II) hexafluorophosphate (3a) with two bis(carbene) ligands coordinated in a bidentate manner and two cis-positioned acetonitrile molecules. Compounds 2a and 2b are the first reported iron(II) carbene complexes with four coordination sites occupied by solvent molecules, and it was demonstrated that those solvent ligands can undergo ligand-exchange reactions.

  2. Contractile 5-HT1B receptors in human cerebral arteries

    DEFF Research Database (Denmark)

    Nilsson, T; Longmore, J; Shaw, D;


    immunocytochemistry with antibodies selective for human 5-HT1B and human 5-HT1D receptors and also studied the contractile effects of a range of 5-HT receptor agonists and antagonists in HCA. 2 Immunocytochemistry of cerebral arteries showed dense 5-HT1B receptor immunoreactivity (but no 5-HT1D receptor......1 The cerebrovascular receptor(s) that mediates 5-hydroxytryptamine (5-HT)-induced vasoconstriction in human cerebral arteries (HCA)has proven difficult to characterize, yet these are essential in migraine. We have examined 5-HT receptor subtype distribution in cerebral blood vessels by...... immunoreactivity) within the smooth muscle wall of the HCA. The endothelial cell layer was well preserved and weak 5-HT1B receptor immunoreactivity was present. 3 Pharmacological experiments on HCA with intact endothelium showed that 5-carboxamidotryptamine was significantly more potent than alpha-methyl-5-HT, 2...

  3. Targeting of Ly9 (CD229) Disrupts Marginal Zone and B1 B Cell Homeostasis and Antibody Responses. (United States)

    Cuenca, Marta; Romero, Xavier; Sintes, Jordi; Terhorst, Cox; Engel, Pablo


    Marginal zone (MZ) and B1 B cells have the capacity to respond to foreign Ags more rapidly than conventional B cells, providing early immune responses to blood-borne pathogens. Ly9 (CD229, SLAMF3), a member of the signaling lymphocytic activation molecule family receptors, has been implicated in the development and function of innate T lymphocytes. In this article, we provide evidence that in Ly9-deficient mice splenic transitional 1, MZ, and B1a B cells are markedly expanded, whereas development of B lymphocytes in bone marrow is unaltered. Consistent with an increased number of these B cell subsets, we detected elevated levels of IgG3 natural Abs and a striking increase of T-independent type II Abs after immunization with 2,4,6-trinitrophenyl-Ficoll in the serum of Ly9-deficient mice. The notion that Ly9 could be a negative regulator of innate-like B cell responses was supported by the observation that administering an mAb directed against Ly9 to wild-type mice selectively eliminated splenic MZ B cells and significantly reduced the numbers of B1 and transitional 1 B cells. In addition, Ly9 mAb dramatically diminished in vivo humoral responses and caused a selective downregulation of the CD19/CD21/CD81 complex on B cells and concomitantly an impaired B cell survival and activation in an Fc-independent manner. We conclude that altered signaling caused by the absence of Ly9 or induced by anti-Ly9 may negatively regulate development and function of innate-like B cells by modulating B cell activation thresholds. The results suggest that Ly9 could serve as a novel target for the treatment of B cell-related diseases.

  4. 18 CFR 1b.18 - Right to submit statements. (United States)


    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Right to submit... COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES RULES RELATING TO INVESTIGATIONS § 1b.18 Right to submit statements. Any person may, at any time during the course of an investigation, submit documents,...

  5. PTP1B targets the endosomal sorting machinery

    DEFF Research Database (Denmark)

    Stuible, Matthew; Abella, Jasmine V; Feldhammer, Matthew;


    STAM2 specifically suppressed Akt activation, and a phosphorylation-deficient STAM2 mutant displayed prolonged localization on endosomes following EGF stimulation. These results reveal a novel link between the dephosphorylation and endocytic machinery and suggest that PTP1B can affect RTK signaling...

  6. Nascent bipolar outflows associated with the first hydrostatic core candidates Barnard 1b-N and 1b-S

    CERN Document Server

    Gerin, M; Fuente, A; Cernicharo, J; Commerçon, B; Marcelino, N


    In the theory of star formation, the first hydrostatic core (FHSC) phase is a critical step in which a condensed object emerges from a prestellar core. This step lasts about one thousand years, a very short time compared with the lifetime of prestellar cores, and therefore is hard to detect unambiguously. We present IRAM Plateau de Bure observations of the Barnard 1b dense molecular core, combining detections of H2CO and CH3OH spectral lines and dust continuum at 2.3" resolution (~ 500 AU). The two compact cores B1b-N and B1b-S are detected in the dust continuum at 2mm, with fluxes that agree with their spectral energy distribution. Molecular outflows associated with both cores are detected. They are inclined relative to the direction of the magnetic field, in agreement with predictions of collapse in turbulent and magnetized gas with a ratio of mass to magnetic flux somewhat higher than the critical value, \\mu ~ 2 - 7. The outflow associated with B1b-S presents sharp spatial structures, with ejection velocit...

  7. Preparation and reactivity towards hydrazines of bis(cyanamide) and bis(cyanoguanidine) complexes of the iron triad. (United States)

    Albertin, Gabriele; Antoniutti, Stefano; Caia, Alfonso; Castro, Jesús


    Bis(diethylcyanamide) [Fe(N≡CNEt2)2L4](BPh4)2 1a and bis(cyanoguanidine) [Fe{N≡CN(H)C(NH2)=NH}2L4](BPh4)2 1b [L = P(OEt)3] complexes were prepared by allowing iron(II) chloride to react first with an excess of P(OEt)3 and then of the appropriate cyanamide, followed by addition of an excess of NaBPh4. Instead, bis(complexes) of ruthenium and osmium [M(N≡CNEt2)2L4](BPh4)2 2a, 3a and [M{N≡CN(H)C(NH2)=NH}2L4](BPh4)2 2b, 3b (M = Ru 2, Os 3) were prepared by reacting hydrides MH2L4 first with either triflic acid HOTf or methyltriflate MeOTf and then with an excess of the appropriate cyanamide. Hydride-diethylcyanamide [MH(N≡CNEt2)L4]BPh4 4a, 5a and hydride-cyanoguanidine complexes [MH{N≡CN(H)C(NH2)=NH}L4](BPh4)2 4b, 5b (M = Ru 4, Os 5) were also obtained by reacting MH2L4 first with one equivalent of HOTf or MeOTf and then with the appropriate cyanamide. Treatment of bis(cyanamide) and bis(cyanoguanidine) complexes 1-3 with hydrazines RNHNH2 afforded hydrazinecarboximidamide derivatives [M{η(2)-N(H)=C(NEt2)N(R)NH2}L4](BPh4)2 6a-12a and [M{η(2)-N(H)=C[N=C(NH2)2]N(R)NH2}L4](BPh4)2 6b-12b (M = Fe 6-8, Ru 9, 10, Os 11, 12; R = H 6, 9, 11, Me 7, 10, 12, Ph 8). A reaction path involving nucleophilic attack by hydrazine on the cyanamide carbon atom is proposed. All the complexes were characterised by spectroscopy and X-ray crystal structure determination of [Os{η(2)-NH=C[N=C(NH2)2]N(CH3)NH2}{P(OEt)3}4](BPh4)2 12b. PMID:24691705

  8. Cyclopolymerization-derived block-copolymers of 4,4-bis(octyloxymethyl)-1,6-heptadiyne with 4,4- dipropargyl malonodinitrile for use in photovoltaics

    DEFF Research Database (Denmark)

    Sudheendran, Mavila; Horecha, Marta; Kiriy, Anton;


    The synthesis of AB-type block copolymers of 4,4-bis(octyloxymethyl)-1,6-heptadiyne (M1) and dipropargyl malonodinitrile (M2) via metathesis-based cyclopolymerization using well-defined molybdenum- and ruthenium-based initiators is described. While backbiting reactions were observed in the case w...... and fluorescence spectroscopy and used for the construction of a photovoltaic device....

  9. abs417ashcoursesTutorial /uophelp




    For more course tutorials visit     ABS 417 Week 1 DQ 1 ( The Power of Many )    ABS 417 Week 1 DQ 2 ( Social Change Model )    ABS 417 Week 2 DQ 1 ( Empowerment, Disempowerment and Social Change )   ABS 417 Week 2 DQ 2 ( Non-Profit vs. For-Profit Organizations )    ABS 417 Week 2 Assignment ( Reflection Paper )    ABS 417 Week 3 DQ 1 ( Social Problems )  &nb...

  10. Performance and Applications of L1B2 Ultrasonic Motors


    Gal Peled; Roman Yasinov; Nir Karasikov


    Piezoelectric ultrasonic motors offer important advantages for motion applications where high speed is coupled with high precision. The advances made in the recent decades in the field of ultrasonic motor based motion solutions allow the construction of complete motion platforms in the fields of semiconductors, aerospace and electro-optics. Among the various motor designs, the L1B2 motor type has been successful in industrial applications, offering high precision, effective control and operat...

  11. Lithostratigraphy from downhole logs in Hole AND-1B, Antarctica (United States)

    Williams, Trevor; Morin, Roger H.; Jarrard, Richard D.; Jackolski, Chris L.; Henrys, Stuart A.; Niessen, Frank; Magens, Diana; Kuhn, Gerhard; Monien, Donata; Powell, Ross D.


    The ANDRILL (Antarctic Drilling Project) McMurdo Ice Shelf (MIS) project drilled 1285 m of sediment in Hole AND–1B, representing the past 12 m.y. of glacial history. Downhole geophysical logs were acquired to a depth of 1018 mbsf (meters below seafloor), and are complementary to data acquired from the core. The natural gamma radiation (NGR) and magnetic susceptibility logs are particularly useful for understanding lithological and paleoenvironmental change at ANDRILL McMurdo Ice Shelf Hole AND–1B. NGR logs cover the entire interval from the seafloor to 1018 mbsf, and magnetic susceptibility and other logs covered the open hole intervals between 692 and 1018 and 237–342 mbsf. In the upper part of AND–1B, clear alternations between low and high NGR values distinguish between diatomite (lacking minerals containing naturally radioactive K, U, and Th) and diamictite (containing K-bearing clays, K-feldspar, mica, and heavy minerals). In the lower open hole logged section, NGR and magnetic susceptibility can also distinguish claystones (rich in K-bearing clay minerals, relatively low in magnetite) and diamictites (relatively high in magnetite). Sandstones can be distinguished by their high resistivity values in AND–1B. On the basis of these three downhole logs, diamictite, claystones, and sandstones can be predicted correctly for 74% of the 692–1018 mbsf interval. The logs were then used to predict facies for the 6% of this interval that was unrecovered by coring. Given the understanding of the physical property characteristics of different facies, it is also possible to identify subtle changes in lithology from the physical properties and help refine parts of the lithostratigraphy, for example, the varying terrigenous content of diatomites and the transitions from subice diamictite to open-water diatomite.

  12. Pharmacophore modeling for protein tyrosine phosphatase 1B inhibitors. (United States)

    Bharatham, Kavitha; Bharatham, Nagakumar; Lee, Keun Woo


    A three dimensional chemical feature based pharmacophore model was developed for the inhibitors of protein tyrosine phosphatase 1B (PTP1B) using the CATALYST software, which would provide useful knowledge for performing virtual screening to identify new inhibitors targeted toward type II diabetes and obesity. A dataset of 27 inhibitors, with diverse structural properties, and activities ranging from 0.026 to 600 microM, was selected as a training set. Hypol, the most reliable quantitative four featured pharmacophore hypothesis, was generated from a training set composed of compounds with two H-bond acceptors, one hydrophobic aromatic and one ring aromatic features. It has a correlation coefficient, RMSD and cost difference (null cost-total cost) of 0.946, 0.840 and 65.731, respectively. The best hypothesis (Hypol) was validated using four different methods. Firstly, a cross validation was performed by randomizing the data using the Cat-Scramble technique. The results confirmed that the pharmacophore models generated from the training set were valid. Secondly, a test set of 281 molecules was scored, with a correlation of 0.882 obtained between the experimental and predicted activities. Hypol performed well in correctly discriminating the active and inactive molecules. Thirdly, the model was investigated by mapping on two PTP1B inhibitors identified by different pharmaceutical companies. The Hypol model correctly predicted these compounds as being highly active. Finally, docking simulations were performed on few compounds to substantiate the role of the pharmacophore features at the binding site of the protein by analyzing their binding conformations. These multiple validation approaches provided confidence in the utility of this pharmacophore model as a 3D query for virtual screening to retrieve new chemical entities showing potential as potent PTP1B inhibitors.

  13. Trisodium scandium bis(orthoborate

    Directory of Open Access Journals (Sweden)

    Kunpeng Wang


    Full Text Available Single crystals of trisodium scandium bis(orthoborate, Na3Sc(BO32, have been obtained by spontaneous crystallization from an Na2O–Sc2O3–B2O3 melt. The crystal structure features a three-dimensional framework composed of planar [BO3]3− groups and distorted ScO6 octahedra with Na atoms in the cavities. The Sc atom occupies a special position (Wyckoff position 2b, site symmetry -1 and of the two Na atoms, one occupies a special position (Wyckoff position 2c, site symmetry -1.

  14. Opstellen Aaltjes Beheersing Strategie (ABS)

    NARCIS (Netherlands)

    Beers, van T.G.


    Dit artikel gaat dieper in op het opstellen van een Aaltjes Beheersing Strategie (ABS): inventarisatie, preventie, vruchtwisseling en aanvullende maatregelen. Per onderdeel worden aandachtspunten genoemd en er worden tips gegeven.

  15. Novel bis-arylalkylamines as myeloperoxidase inhibitors

    DEFF Research Database (Denmark)

    Aldib, Iyas; Gelbcke, Michel; Soubhye, Jalal;


    Human myeloperoxidase (MPO) plays an important role in innate immunity but also aggravates tissue damage by oxidation of biomolecules at sites of inflammation. As a result from a recent high-throughput virtual screening approach for MPO inhibitors, bis-2,2'-[(dihydro-1,3(2H,4H) pyrimidinediyl)bis...

  16. Bis(1,3-dithiole) Compounds

    DEFF Research Database (Denmark)

    Andersen, Jan Rud; Engler, E. M.; Green, D. C.;


    There is described the preparation of bis-1,3-dithiole compounds (I) which are key synthetic precursors for the preparation of new polymeric metal bis(dithiolene) (i.e., II) and tetrathiafulvalene compounds (i.e., III): (Image Omitted)...

  17. Data of evolutionary structure change: 1B6DA-1QLRC [Confc[Archive

    Lifescience Database Archive (English)


  18. Data of evolutionary structure change: 1B6DB-1QLRA [Confc[Archive

    Lifescience Database Archive (English)


  19. (Acetonitrile[bis(2-pyridylmethylamine]bis(perchloratocopper(II

    Directory of Open Access Journals (Sweden)

    Ray J. Butcher


    Full Text Available In the title compound, [Cu(ClO42(C12H13N3(C2H3N], the CuII atom is six-coordinate in a Jahn–Teller distorted octahedral geometry, with coordination by the tridentate chelating ligand, an acetonitrile molecule, and two axial perchlorate anions. The tridentate ligand bis(2-pyridylmethylamine chelates meridionally and equatorially while an acetonitrile molecule is coordinated at the fourth equatorial site. The two perchlorate anions are disordered with site occupancy factors of 0.72/0.28. The amine H is involved in intramolecular hydrogen bonding to the perchlorate O atoms and there are extensive but weak intermolecular C—H...O interactions.

  20. Plutonium disposition study phase 1b final report

    International Nuclear Information System (INIS)

    This report provides the results of the Westinghouse activities performed as part of the Plutonium Disposition Study Phase 1b. These activities, which took place from May 16, 1993 to September 15, 1993, build upon the work completed in Phase 1a, which concluded on May 15, 1993. In Phase 1a, three Plutonium Disposal Reactor (PDR) options were developed for the disposal of excess weapons grade plutonium from returned and dismantled nuclear weapons. This report documents the results of several tasks that were performed to further knowledge in specific areas leading up to Phase 2 of the PDR Study. The Westinghouse activities for Phase 1b are summarized as follows: (1) resolved technical issues concerning reactor physics including equilibrium cycle calculations, use of gadolinium, moderator temperature coefficient, and others as documented in Section 2.0; (2) analyzed large Westinghouse commercial plants for plutonium disposal; (3) reactor safety issues including the steam line break were resolved, and are included in Section 2.0; (4) several tasks related to the PDR Fuel Cycle were examined; (5) cost and deployment options were examined to determine optimal configuration for both plutonium disposal and tritium production; (6) response to questions from DOE and National Academy of Scientists (NAS) reviewers concerning the PDR Phase 1a report are included in Appendix A

  1. Down-regulated expression of the protein-tyrosine phosphatase 1B (PTP1B) is associated with aggressive clinicopathologic features and poor prognosis in hepatocellular carcinoma

    International Nuclear Information System (INIS)

    Highlights: ► PTP1B protein showed decreased expression in 67.79% of the HCC patients. ► Low PTP1B expression predicts poor prognosis of HCC. ► Low PTP1B expression is correlated with expansion of OV6+ tumor-initiating cells. ► Down-regulation of PTP1B is associated with activation of Wnt/β-Catenin signaling. -- Abstract: The protein-tyrosine phosphatase 1B (PTP1B) is a classical non-transmembrane protein tyrosine phosphatase that plays a key role in metabolic signaling and can exert both tumor suppressing and tumor promoting effects in different cancers depending on the substrate involved and the cellular context. However, the expression level and function of PTP1B in hepatocellular carcinoma (HCC) remain unclear. In this study, PTP1B expression was detected by immunohistochemistry in normal liver tissue (n = 16) and hepatocellular carcinoma (n = 169). The correlations between PTP1B expression level and clinicopathologic features and patient survival were also analyzed. One hundred and eleven of 169 HCC patients (65.7%) had negative or low PTP1B expression in tumorous tissues, whereas normal tissues always expressed strong PTP1B. Decreased PTP1B expression was significantly associated with aggressive clinicopathologic features and poor prognosis. Immunohistochemistry also showed that low PTP1B expression level was correlated with high percentage of OV6+ tumor-initiating cells (T-ICs) and high frequency of nuclear β-Catenin expression in HCC specimens. Our findings demonstrate for the first time that the loss of inhibitory effect of PTP1B may contribute to progression and invasion of HCC through activation of Wnt/β-Catenin signaling and expansion of liver T-ICs. PTP1B may serve as a valuable prognostic biomarker and potential therapeutic target in HCC.

  2. N-type calcium channel/syntaxin/SNAP-25 complex probed by antibodies to II-III intracellular loop of the α1B subunit

    International Nuclear Information System (INIS)

    Neuronal voltage-dependent calcium channels are integral components of cellular excitation and neurosecretion. In addition to mediating the entry of calcium across the plasma membrane, both N-type and P/Q-type voltage-dependent calcium channels have been shown to form stable complexes with synaptic vesicle and presynaptic membrane proteins, indicating a structural role for the voltage-dependent calcium channels in secretion. Recently, detailed structural analyses of N-type calcium channels have identified residues amino acids 718-963 as the site in the rat α1B subunit that mediates binding to syntaxin, synaptosome-associated protein of 25andpuncsp; omitted000 mol. wt and synaptotagmin [Sheng et al. (1996) Nature 379, 451-454]. The purpose of this study was to employ site-directed antibodies to target domains within and outside of the interaction site on the rat α1B to probe potential binding sites for syntaxin/SNAP-25/synaptotagmin.Our results demonstrate that both antibodies employed in this study have access to their epitopes on the α1B as evidenced by equivalent immunoprecipitation of native [125I]omega-conotoxin GVIA-labeled α1B protein from CHAPS-solubilized preparations. The N-type voltage-dependent calcium channel immunoprecipitated by Ab CW14, the antibody directed to a domain outside of the synprint site, is associated with syntaxin and SNAP-25 with the recovery of these proteins, increasing in parallel to the recovery of α1B. However, when we used the antibody raised to an epitope within the synprint site (Ab CW8) to immunoprecipitate N-type calcium channels, the α1B was depleted of more than 65% of syntaxin and 80% of SNAP-25 when compared to the recovery of these proteins using Ab CW14. This is the first report of a defined epitope on the α1B subunit II-III loop (amino acids 863-875) whose perturbation by a site-directed antibody influences the dissociation of SNAP-25 and syntaxin. (Copyright (c) 1999 Elsevier Science B.V., Amsterdam. All rights

  3. A functional polymorphism in the IL1B gene promoter, IL1B -31C>T, is not associated with cerebral malaria in Thailand


    Tangpukdee Noppadon; Hananantachai Hathairad; Patarapotikul Jintana; Doi Akihiro; Naka Izumi; Ohashi Jun; Looareesuwan Sornchai; Tokunaga Katsushi


    Abstract Background IL-1β and IL-1RA levels are higher in the serum of cerebral malaria patients than in patients with mild malaria. Recently, the level of IL1B expression was reported to be influenced by a polymorphism in the promoter of IL1, IL1B -31C>T. Methods To examine whether polymorphisms in IL1B and IL1RA influence the susceptibility to cerebral malaria, IL1B -31C>T, IL1B 3953C>T, and IL1RA variable number of tandem repeat (VNTR) were analysed in 312 Thai patients with malaria (109 c...

  4. Data of evolutionary structure change: 1B7QA-2G4QA [Confc[Archive

    Lifescience Database Archive (English)


  5. Interferon β-1b-neutralizing antibodies 5 years after clinically isolated syndrome

    DEFF Research Database (Denmark)

    Hartung, H-P; Freedman, M S; Polman, C H;


    To determine the frequency and consequences of neutralizing antibodies (NAbs) in patients with a first event suggestive of multiple sclerosis (MS) treated with interferon β-1b (IFNβ-1b).......To determine the frequency and consequences of neutralizing antibodies (NAbs) in patients with a first event suggestive of multiple sclerosis (MS) treated with interferon β-1b (IFNβ-1b)....

  6. 40 CFR Table 1b to Subpart Dddd of... - Add-on Control Systems Compliance Options (United States)


    ... 40 Protection of Environment 12 2010-07-01 2010-07-01 true Add-on Control Systems Compliance Options 1B Table 1B to Subpart DDDD of Part 63 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY.... 63, Subpt. DDDD, Table 1B Table 1B to Subpart DDDD of Part 63—Add-on Control Systems...

  7. Microtubule-associated protein 1B (MAP1B)-deficient neurons show structural presynaptic deficiencies in vitro and altered presynaptic physiology. (United States)

    Bodaleo, Felipe J; Montenegro-Venegas, Carolina; Henríquez, Daniel R; Court, Felipe A; Gonzalez-Billault, Christian


    Microtubule-associated protein 1B (MAP1B) is expressed predominantly during the early stages of development of the nervous system, where it regulates processes such as axonal guidance and elongation. Nevertheless, MAP1B expression in the brain persists in adult stages, where it participates in the regulation of the structure and physiology of dendritic spines in glutamatergic synapses. Moreover, MAP1B expression is also found in presynaptic synaptosomal preparations. In this work, we describe a presynaptic phenotype in mature neurons derived from MAP1B knockout (MAP1B KO) mice. Mature neurons express MAP1B, and its deficiency does not alter the expression levels of a subgroup of other synaptic proteins. MAP1B KO neurons display a decrease in the density of presynaptic and postsynaptic terminals, which involves a reduction in the density of synaptic contacts, and an increased proportion of orphan presynaptic terminals. Accordingly, MAP1B KO neurons present altered synaptic vesicle fusion events, as shown by FM4-64 release assay, and a decrease in the density of both synaptic vesicles and dense core vesicles at presynaptic terminals. Finally, an increased proportion of excitatory immature symmetrical synaptic contacts in MAP1B KO neurons was detected. Altogether these results suggest a novel role for MAP1B in presynaptic structure and physiology regulation in vitro. PMID:27425640

  8. Monochromator development at 4W1B beamline of BSRF (United States)

    Xie, Yaning; Yan, Y.; Hu, T. D.; Liu, T.; Xian, D. C.


    The 4W1B is a X-ray monochromator beamline for XAFS at BSRF. During the upgrading phase, we have redesigned the monochromator to improve the performance of the beamline. It is a goniometer based, fixed exit double crystal monochromator. A mechanical linkage is employed to adjust the distance between the surfaces of the two crystals as the Bragg angle is changed to keep the outgoing beam direction constant. The whole mechanism is driven by only one stepping motor. The testing result shows that over the scanning range of 5-30°, the shift of outgoing beam position is less then 70 μm in the vertical direction. The basic principle, the mechanical realization, and the error analysis are discussed in detail. The performance and the testing results are also presented in this paper.

  9. Monochromator development at 4W1B beamiline of BSRF

    Institute of Scientific and Technical Information of China (English)

    YaningXie; Y.Yan; T.D.Hu; T.Liu; D.C.Xian


    The 4W1B is a X-ary monochromator beamline for XAFS at BSRF.During the upgrading phase,we have redsigned the monochromator to improve the performnce of beamline.It is a goniometer based,fixed exit double crystal monochromator.A mechanical linkage is employed to adjust the distance between the surfaces of the two crystals as the Bragg angle is changed to keep the outgoing beam direction constant.The whole mechanism is driven by only one stepping motor.The testing result shows that over the scanning range of 5-30°,the shift of outgoing beam position is less then 70μm in the vertical direction.The basic principle,the mechanical realization,and the error analysis are discussed in detail.The performance and the testing results are also presented in this paper.2001 Elsevier Science B.V.All rights reserved.

  10. Performance and Applications of L1B2 Ultrasonic Motors

    Directory of Open Access Journals (Sweden)

    Gal Peled


    Full Text Available Piezoelectric ultrasonic motors offer important advantages for motion applications where high speed is coupled with high precision. The advances made in the recent decades in the field of ultrasonic motor based motion solutions allow the construction of complete motion platforms in the fields of semiconductors, aerospace and electro-optics. Among the various motor designs, the L1B2 motor type has been successful in industrial applications, offering high precision, effective control and operational robustness. This paper reviews the design of high precision motion solutions based on L1B2 ultrasonic motors—from the basic motor structure to the complete motion solution architecture, including motor drive and control, material considerations and performance envelope. The performance is demonstrated, via constructed motion stages, to exhibit fast move and settle, a repeatability window of tens of nanometers, lifetime into the tens of millions of operational cycles, and compatibility with clean room and aerospace environments. Example stages and modules for semiconductor, aerospace, electro-optical and biomedical applications are presented. The described semiconductor and aerospace solutions are powered by Nanomotion HR type motors, driven by a sine wave up to 80 V/mm rms, having a driving frequency of 39.6 kHz, providing a maximum force up to 4 N per driving element (at 5 W power consumption per element and a maximum linear velocity above 300 mm/s. The described electro-optical modules are powered by small Nanomotion Edge motors driven by voltages up to 11 V AC, providing stall forces up to 0.35 N (power consumption up to 0.75 W and maximum linear velocity above 200 mm/s.


    Directory of Open Access Journals (Sweden)

    Sambhaji P. Vartale, Nilesh K. Halikar and Yogesh D. Pawar


    Full Text Available 2-Amino-3-cyano quinoline (1 and bis (methylthio methylene malononitrile (2 were refluxed in N,N-dimethyl formamide (DMF in presence of catalytic amount of anhydrous potassium carbonate to afforded 3, 11-dicyano-4-imino-2-methylthio -4H-pyrimido [1, 2-a] quinoline (3. The latter were further reacted with different substituted hydrazino. Afforded to 3-amino-11- cyano-4-imino pyrazolo [4, 5-e]-4H-pyrimido [2, 1-b] quinoline and their 2-substuited derivatives (4a-j. All these newly synthesized compounds were characterized by elemental analysis and spectral data, and screened for their antimicrobial activities.

  12. Synthesis, characterization, ab initio calculations, thermal behaviour and thermodynamics of some oxovanadium(IV) complexes involving O,O- and ,-donor moieties

    Indian Academy of Sciences (India)

    Mozaffar Asadi; Mohammad Hadi Ghatee; Susan Torabi; Khosro Mohammadi; Fatemeh Moosavi


    Some oxovanadium(IV) complexes, namely bis(1,1,1-trifluro-2,4-pentanedionato-,') oxovanadium (IV), [VO(tfac)2(H2O)], bis(1-phenyl-2,4-pentanedionato-,')oxovanadium(IV), [VO(phac)2(H2O)], bis(1,3-diphenyl-2,4-pentanedionato-,')oxovanadium(IV), [VO(dphac)2 (H2O)], of the type [VO(O4)] and bis(pyrolidineaniline)oxovanadium(IV), [VO(pyran)2(H2O)], bis(-hydroxypyrolidineaniline) oxovanadium(IV), [VO(-hydroxypyran)2(H2O)], bis(-methoxypyrolidineaniline)oxovanadium(IV), [VO(-MeOpyran)2 (H2O)], bis(-chloropyrolidineaniline)oxovanadium(IV), [VO(-chloropyran)2(H2O)], bis(-bromopyrolidineaniline)oxovanadium(IV), [VO(-bromopyran)2(H2O)], bis(-cyano pyrolidineaniline)oxovanadium(IV), [VO(-cyanopyran)2(H2O)], and bis(pyrolidinebenzylamine)oxovanadium(IV), [VO(pyrbz)2(H2O)], of the type [VO(N4)] were synthesized and characterized by IR, UV-Vis, mass spectrometry, elemental analysis, magnetic moment and thermogravimetry in order to evaluate their thermal stability and thermal decomposition pathways. The number of steps and, in particular, the starting temperature of decomposition of these complexes depends on the equatorial ligand. Also, formation constants of the complexes have been determined by UV-Vis absorption spectroscopy through titration of the ligands with the metal ions at constant ionic strength (0.1 M NaClO4) and at 25°C. According to the thermodynamic studies, as the steric character of the ligand increases, the complexation tendency to VO(IV) center decreases. Also, the ab initio calculations were carried out to determine the structural and the geometrical properties of the complexes.

  13. Protein tyrosine phosphatase 1B (PTP1B)-inhibiting constituents from the leaves of Syzygium polyanthum. (United States)

    Saifudin, Azis; Tanaka, Ken; Kadota, Shigetoshi; Tezuka, Yasuhiro


    A methanol extract of the leaves of Syzygium polyanthum (Wight) Walp. afforded four new acylbenzene derivatives (1-4) together with seven known compounds (5-11). The structures of 1-11 were elucidated by extensive spectroscopic methods and comparison with the literature data. The new compounds 1-3 and a known compound, campest-4-en-3-one (10), exhibited a significant protein tyrosine phosphatase 1B inhibitory activity with IC₅₀ values of 13.1 ± 0.1, 5.77 ± 0.15, 4.01 ± 0.26, and 10.4 ± 0.5 µM, respectively. The inhibitory potency of the new compounds 2 and 3 was comparable to that of a positive control RK-682 (IC₅₀, 5.51 ± 0.04 µM). PMID:22763740

  14. Organic anion transporting polypeptides OATP1B1 and OATP1B3 and their genetic variants influence the pharmacokinetics and pharmacodynamics of raloxifene

    Directory of Open Access Journals (Sweden)

    Trdan Lušin Tina


    Full Text Available Abstract Background Raloxifene, a selective estrogen receptor modulator, exhibits quite large and unexplained interindividual variability in pharmacokinetics and pharmacodynamics. The aim of this study was to determine the role of organic-anion transporting polypeptides OATP1B1 and OATP1B3 and their genetic variants in the pharmacokinetics and pharmacodynamics of raloxifene. Methods To test the role of OATP1B1 and OATP1B3 transporters on hepatic uptake of raloxifene and its metabolites an in vitro model of Chinese Hamster Ovary cells expressing OATP1B1 or OATP1B3 was employed. The influence of OATP1B1 and OATP1B3 genetic variants on in vivo pharmacokinetics and pharmacodynamics was evaluated in 53 osteoporotic postmenopausal women treated with raloxifene. Results Our in vitro results showed that raloxifene and two of the three metabolites, raloxifene-4'-β-glucuronide (M2 and raloxifene-6,4'-diglucuronide (M3, interact with OATP1B1 and OATP1B3. Higher M3 and total raloxifene serum concentrations in patients correlated with lower serum levels of bone resorption marker, serum C-terminal telopeptide fragments of type I collagen, indicating a higher antiresorptive effect of raloxifene. Higher concentrations of M2 correlated with higher increase of lumbar spine bone mineral density supporting the raloxifene vertebral fracture specific protection effect. Finally, raloxifene, M3 and total raloxifene serum concentrations were significantly higher in patients with SLCO1B1 c.388A > G polymorphism and *1b haplotype implicating a considerable genetic effect on pharmacokinetics and pharmacodynamics of raloxifene. Conclusions These findings indicate that SLCO1B1 c.388A > G polymorphism could play an important role in pharmacokinetics and pharmacodynamics of raloxifene.

  15. Mauserbestände von Kolbenenten Netta rufina aus Zentral- und Südwesteuropa am Ismaninger Speichersee: Entwicklung bis 2008 und saisonale Dynamik


    Köhler, Peter; Köhler, Ursula; von Krosigk, Eberhard; Hense, Burkhard


    Die Sommermaxima der Kolbenenten am „Ismaninger Speichersee mit Fischteichen“, Bayern, sind von 1967 bis 1997 langsam von etwa 750 auf über 2.500 gestiegen. Das entsprach etwa der Größenordnung und dem Trend der Brutbestände im südlichen Mitteleuropa und Teilen Frankreichs. Ab 1998 kletterten die Maxima rasch auf mehr als 13.500 im Jahr 2003. Dieses hohe Niveau blieb unter Schwankungen bis 2008 mit immer noch 11.500 Ind. erhalten (Allzeit-Maximum: 16.093 Ind. am 30.07....

  16. Paresev 1-B in flight with tow cable (United States)


    The Paresev 1-B tested the concept of a paraglider, designed to enable a Gemini capsule to fly to a controlled ground landing. This would remove the need to make an ocean splashdown at the end of a spaceflight. Once the paraglider was deployed, the Gemini crew could use it to steer toward a touchdown point and to land on three retractable skids. Because the paraglider represented an unproved technology, approval was given to build a simple test vehicle to try out the concept. The paraglider research vehicle, or Paresev, was built of steel tubing, with a fabric paraglider. The Paresev was unpowered, so it had to be towed aloft either by ground vehicles or aircraft, such as a biplane or a light aircraft. The Paresev was a demanding aircraft to fly. Milt Thompson said that he found it more difficult to handle than the later lifting bodies. Due to technical and cost problems, the Gemini spacecraft never used the paraglider, and all missions made ocean splashdowns.

  17. Identification of the GTPase-activating protein DEP domain containing 1B (DEPDC1B) as a transcriptional target of Pitx2


    Wu, Di; Zhu, Xiaoxi; Jimenez-Cowell, Kevin; Mold, Alexander J.; Sollecito, Christopher C.; Lombana, Nicholas; Jiao, Meng; Wei, Qize


    Pitx2 is a bicoid-related homeobox transcription factor implicated in regulating left-right patterning and organogenesis. However, only a limited number of Pitx2 downstream target genes have been identified and characterized. Here we demonstrate that Pitx2 is a transcriptional repressor of DEP domain containing 1B (DEPDC1B). The first intron of the human and mouse DEP domain containing 1B genes contains multiple consensus DNA-binding sites for Pitx2. Chromatin immunoprecipitation assays revea...

  18. Growth factor independence 1b (gfi1b is important for the maturation of erythroid cells and the regulation of embryonic globin expression.

    Directory of Open Access Journals (Sweden)

    Lothar Vassen

    Full Text Available Growth factor independence 1b (GFI1B is a DNA binding repressor of transcription with vital functions in hematopoiesis. Gfi1b-null embryos die at midgestation very likely due to defects in erythro- and megakaryopoiesis. To analyze the full functionality of Gfi1b, we used conditionally deficient mice that harbor floxed Gfi1b alleles and inducible (Mx-Cre, Cre-ERT or erythroid specific (EpoR-Cre Cre expressing transgenes. In contrast to the germline knockout, EpoR-Cre mediated erythroid specific ablation of Gfi1b allows full gestation, but causes perinatal lethality with very few mice surviving to adulthood. Both the embryonic deletion of Gfi1b by EpoR-Cre and the deletion in adult mice by Mx-Cre or Cre-ERT leads to reduced numbers of erythroid precursors, perturbed and delayed erythroid maturation, anemia and extramedullary erythropoiesis. Global expression analyses showed that the Hba-x, Hbb-bh1 and Hbb-y embryonic globin genes were upregulated in Gfi1b deficient TER119+ fetal liver cells over the gestation period from day 12.5-17.5 p.c. and an increased level of Hbb-bh1 and Hbb-y embryonic globin gene expression was even maintained in adult Gfi1b deficient mice. While the expression of Bcl11a, a regulator of embryonic globin expression was not affected by Gfi1b deficiency, the expression of Gata1 was reduced and the expression of Sox6, also involved in globin switch, was almost entirely lost when Gfi1b was absent. These findings establish Gfi1b as a regulator of embryonic globin expression and embryonic and adult erythroid maturation.

  19. Briefwechsel uber die Partikel "bis" (An Exchange of Letters about the Particle "bis"). (United States)

    Ludwig, Horst; Holschuh, Albrecht


    A discussion, in the form of an animated letter exchange, argues that, contrary to most current grammatical descriptions, the German particle "bis" should not be viewed as a preposition governing the accusative case. Rather, it is demonstrated that "bis" most often occurs as a proclitic adverb. (16 references) (JTC)

  20. Pregnancy and pregnancy outcome in hepatitis C type 1b.

    LENUS (Irish Health Repository)

    Jabeen, T


    A large cohort of rhesus-negative women in Ireland were inadvertently infected with hepatitis C virus following exposure to contaminated anti-D immunoglobulin in 1977-8. This major iatrogenic episode was discovered in 1994. We studied 36 women who had been infected after their first pregnancy, and compared them to an age- and parity-matched control group of rhesus-positive women. The presence of hepatitis C antibody was confirmed in all 36 by enzyme-linked immunosorbent assay and by recombinant immunoblot assay, while 26 (72%) of the cohort were HCV-RNA-positive (type 1b) on PCR testing. In the 20 years post-infection, all members of the study group had at least one pregnancy, and mean parity was 3.5. They had a total of 100 pregnancies and 85 of these went to term. There were four premature births, one being a twin pregnancy, and 11 spontaneous miscarriages. One miscarriage occurred in the pregnancy following HCV infection. There were two neonatal deaths due to severe congenital abnormalities in the PCR-positive women. Of the children born to HCV-RNA positive mothers, only one (2.3%) tested positive for the virus. Significant portal fibrosis on liver biopsy was confined to HCV-RNA-positive mothers apart from one single exception in the antibody-positive HCV-RNA-negative group. Comparison with the control group showed no increase in spontaneous miscarriage rate, and no significant difference in obstetric complications; birth weights were similar for the two groups.

  1. Protein tyrosine phosphatase 1B (PTP1B) inhibitors from Morinda citrifolia (Noni) and their insulin mimetic activity. (United States)

    Nguyen, Phi-Hung; Yang, Jun-Li; Uddin, Mohammad N; Park, So-Lim; Lim, Seong-Il; Jung, Da-Woon; Williams, Darren R; Oh, Won-Keun


    As part of our ongoing search for new antidiabetic agents from medicinal plants, we found that a methanol extract of Morinda citrifolia showed potential stimulatory effects on glucose uptake in 3T3-L1 adipocyte cells. Bioassay-guided fractionation of this active extract yielded two new lignans (1 and 2) and three new neolignans (9, 10, and 14), as well as 10 known compounds (3-8, 11-13, and 15). The absolute configurations of compounds 9, 10, and 14 were determined by ECD spectra analysis. Compounds 3, 6, 7, and 15 showed inhibitory effects on PTP1B enzyme with IC50 values of 21.86 ± 0.48, 15.01 ± 0.20, 16.82 ± 0.42, and 4.12 ± 0.09 μM, respectively. Furthermore, compounds 3, 6, 7, and 15 showed strong stimulatory effects on 2-NBDG uptake in 3T3-L1 adipocyte cells. This study indicated the potential of compounds 3, 6, 7, and 15 as lead molecules for antidiabetic agents.

  2. Crystalline Complexes of 2,2'-Bis(9-hydroxy-9-fluorenyl)biphenyl Host with Oligofunctional and Conjugate Functional Group Guests


    Weber, Edwin


    Abstract Four crystalline inclusion compounds of the 2,2'-bis(9-hydroxy-9-fluorenyl)biphenyl host 1, containing diethylene glycol (1:1) (1a), bis(2-aminoethyl)amine (1:1) (1b), methacrylic acid (1:1) (1c) and 2-cyclopenten-1-one (1:2) (1d), have been studied by X-ray diffraction analysis from single crystals. Departure from the expectation, the multifunctional and conjugate functional guest molecules, potentially being able to offer multiple H donor-/acceptorships or other modes of...

  3. Isolation of modulators of the liver-specific organic anion-transporting polypeptides (OATPs) 1B1 and 1B3 from Rollinia emarginata Schlecht (Annonaceae). (United States)

    Roth, Megan; Araya, Juan J; Timmermann, Barbara N; Hagenbuch, Bruno


    Organic anion-transporting polypeptides 1B1 and 1B3 (OATP1B1 and OATP1B3) are liver-specific transporters that mediate the uptake of a broad range of drugs into hepatocytes, including statins, antibiotics, and many anticancer drugs. Compounds that alter transport by one or both of these OATPs could potentially be used to target drugs to hepatocytes or improve the bioavailability of drugs that are cleared by the liver. In this study, we applied a bioassay-guided isolation approach to identify such compounds from the organic extract of Rollinia emarginata Schlecht (Annonaceae). Fractions of the plant extract were screened for effects on OATP1B1- and OATP1B3-mediated transport of the model substrates estradiol-17β-glucuronide and estrone-3-sulfate. We isolated three compounds, ursolic acid, oleanolic acid, and 8-trans-p-coumaroyloxy-α-terpineol, which inhibited estradiol-17β-glucuronide uptake by OATP1B1 but not OATP1B3. In addition, a rare compound, quercetin 3-O-α-l-arabinopyranosyl(1→2) α-L-rhamnopyranoside, was identified that had distinct effects on each OATP. OATP1B1 was strongly inhibited, as was OATP1B3-mediated transport of estradiol-17β-glucuronide. However, OATP1B3-mediated uptake of estrone-3-sulfate was stimulated 4- to 5-fold. Kinetic analysis of this stimulation revealed that the apparent affinity for estrone-3-sulfate was increased (decreased K(m)), whereas the maximal rate of transport (V(max)) was significantly reduced. These results demonstrate a mechanism through which the hepatic uptake of drug OATP substrates could be stimulated.

  4. Nostocyclopeptide-M1: a potent, nontoxic inhibitor of the hepatocyte drug transporters OATP1B3 and OATP1B1. (United States)

    Herfindal, Lars; Myhren, Lene; Kleppe, Rune; Krakstad, Camilla; Selheim, Frode; Jokela, Jouni; Sivonen, Kaarina; Døskeland, Stein O


    We have isolated a novel cyanobacterial cyclic peptide (nostocyclopeptide M1; Ncp-M1) that blocks the hepatotoxic action of microcystin (MC) and nodularin (Nod). We show here that Ncp-M1 is nontoxic to primary hepatocytes in long-term culture. Ncp-M1 does not affect any known intracellular targets or pathways involved in MC action, like protein phosphatases, CaM-KII, or ROS-dependent cell death effectors. In support of this conclusion Ncp-M1 had no protective effect when microinjected into cells. Rather, the antitoxin effect was solely due to blocked hepatocyte uptake of MC and Nod. The hepatic uptake of MC and Nod is mainly via the closely related organic anion transporters OATP1B1 and OATP1B3, which also mediate hepatic transport of endogenous metabolites and hormones as well as drugs. OATP1B3 is also expressed in some aggressive cancers, where it confers apoptosis resistance. We show that Ncp-M1 inhibits transport through OATP1B3 and OATP1B1 expressed in HEK293 cells. The Ncp-M1 molecule has several nonproteinogenic amino acids and an imino bond, which hamper its synthesis. Moreover, a cyclic all L-amino acid heptapeptide analogue of Ncp-M1 also inhibits the OATP1B1/1B3 transporters, and with higher OATP1B3 preference than Ncp-M1 itself. The nontoxic Ncp-M1 and its synthetic cyclic peptide analogues thus provide new tools to probe the role of OATB1B1/1B3 mediated drug and metabolite transport in liver and cancer cells. They can also serve as scaffolds to design new, exopeptidase resistant OATP1B3-specific modulators.

  5. Equity valuation : Atlas Copco AB


    Santos, Ricardo Manuel Castro Lopes Alba


    This Dissertation presents a literature review of some of the most appraised theories on equity valuation models. A thoughtful analysis is made, presenting the main advantages and restrictions of each model and setting the path for a discussion about improvements to be made on this field of study. A practical implementation follows, proposing a fair value estimation of Atlas Copco AB shares. Atlas Copco is a Swedish-based capital goods company, operating across four differen...

  6. Data of evolutionary structure change: 1B9IA-2FNIA [Confc[Archive

    Lifescience Database Archive (English)


  7. Data of evolutionary structure change: 1B06A-2GDSB [Confc[Archive

    Lifescience Database Archive (English)


  8. Data of evolutionary structure change: 1B2KA-2EQLA [Confc[Archive

    Lifescience Database Archive (English)


  9. Data of evolutionary structure change: 1B5ZB-2EQLA [Confc[Archive

    Lifescience Database Archive (English)


  10. An Lmx1b-miR135a2 regulatory circuit modulates Wnt1/Wnt signaling and determines the size of the midbrain dopaminergic progenitor pool.

    Directory of Open Access Journals (Sweden)

    Angela Anderegg

    Full Text Available MicroRNAs regulate gene expression in diverse physiological scenarios. Their role in the control of morphogen related signaling pathways has been less studied, particularly in the context of embryonic Central Nervous System (CNS development. Here, we uncover a role for microRNAs in limiting the spatiotemporal range of morphogen expression and function. Wnt1 is a key morphogen in the embryonic midbrain, and directs proliferation, survival, patterning and neurogenesis. We reveal an autoregulatory negative feedback loop between the transcription factor Lmx1b and a newly characterized microRNA, miR135a2, which modulates the extent of Wnt1/Wnt signaling and the size of the dopamine progenitor domain. Conditional gain of function studies reveal that Lmx1b promotes Wnt1/Wnt signaling, and thereby increases midbrain size and dopamine progenitor allocation. Conditional removal of Lmx1b has the opposite effect, in that expansion of the dopamine progenitor domain is severely compromised. Next, we provide evidence that microRNAs are involved in restricting dopamine progenitor allocation. Conditional loss of Dicer1 in embryonic stem cells (ESCs results in expanded Lmx1a/b+ progenitors. In contrast, forced elevation of miR135a2 during an early window in vivo phenocopies the Lmx1b conditional knockout. When En1::Cre, but not Shh::Cre or Nes::Cre, is used for recombination, the expansion of Lmx1a/b+ progenitors is selectively reduced. Bioinformatics and luciferase assay data suggests that miR135a2 targets Lmx1b and many genes in the Wnt signaling pathway, including Ccnd1, Gsk3b, and Tcf7l2. Consistent with this, we demonstrate that this mutant displays reductions in the size of the Lmx1b/Wnt1 domain and range of canonical Wnt signaling. We posit that microRNA modulation of the Lmx1b/Wnt axis in the early midbrain/isthmus could determine midbrain size and allocation of dopamine progenitors. Since canonical Wnt activity has recently been recognized as a key

  11. Thermonuclear Reflect AB-Reactor

    CERN Document Server

    Bolonkin, Alexander


    The author offers a new kind of thermonuclear reflect reactor. The remarkable feature of this new reactor is a three net AB reflector, which confines the high temperature plasma. The plasma loses part of its energy when it contacts with the net but this loss can be compensated by an additional permanent plasma heating. When the plasma is rarefied (has a small density), the heat flow to the AB reflector is not large and the temperature in the triple reflector net is lower than 2000 - 3000 K. This offered AB-reactor has significantly less power then the currently contemplated power reactors with magnetic or inertial confinement (hundreds-thousands of kW, not millions of kW). But it is enough for many vehicles and ships and particularly valuable for tunnelers, subs and space apparatus, where air to burn chemical fuel is at a premium or simply not available. The author has made a number of innovations in this reactor, researched its theory, developed methods of computation, made a sample computation of typical pr...

  12. AB Levitator and Electricity Storage

    CERN Document Server

    Bolonkin, A


    The author researched this new idea - support of flight by any aerial vehicles at significant altitude solely by the magnetic field of the planet. It is shown that current technology allows humans to create a light propulsion (AB engine) which does not depend on air, water or ground terrain. Simultaniosly, this revolutionary thruster is a device for the storage of electricity which is extracted and is replenished (during braking) from/into the storage with 100 percent efficiency. The relative weight ratio of this engine is 0.01 - 0.1 (from thrust). For some types of AB engine (toroidal form) the thrust easily may be changed in any direction without turning of engine. The author computed many projects using different versions of offered AB engine: small device for levitation-flight of a human (including flight from Earth to Outer Space), fly VTOL car (track), big VTOL aircrat, suspended low altitude stationary satellite, powerful Space Shuttle-like booster for travel to the Moon and Mars without spending energ...

  13. Expanding the phenotypic spectrum of ARID1B-mediated disorders and identification of altered cell-cycle dynamics due to ARID1B haploinsufficiency

    DEFF Research Database (Denmark)

    Sim, J. C. H.; White, S. M.; Fitzpatrick, E.;


    patient-derived and ARID1B knockdown fibroblasts after serum starvation demonstrated delayed cell cycle re-entry associated with reduced cell number in the S-1 phase. Based on the patient's distinctive phenotype, we ascertained four additional patients and identified heterozygous de novo ARID1B frameshift...

  14. Four and a Half LIM Domains 1b (Fhl1b) Is Essential for Regulating the Liver versus Pancreas Fate Decision and for β-Cell Regeneration. (United States)

    Xu, Jin; Cui, Jiaxi; Del Campo, Aranzazu; Shin, Chong Hyun


    The liver and pancreas originate from overlapping embryonic regions, and single-cell lineage tracing in zebrafish has shown that Bone morphogenetic protein 2b (Bmp2b) signaling is essential for determining the fate of bipotential hepatopancreatic progenitors towards the liver or pancreas. Despite its pivotal role, the gene regulatory networks functioning downstream of Bmp2b signaling in this process are poorly understood. We have identified four and a half LIM domains 1b (fhl1b), which is primarily expressed in the prospective liver anlage, as a novel target of Bmp2b signaling. fhl1b depletion compromised liver specification and enhanced induction of pancreatic cells from endodermal progenitors. Conversely, overexpression of fhl1b favored liver specification and inhibited induction of pancreatic cells. By single-cell lineage tracing, we showed that fhl1b depletion led lateral endodermal cells, destined to become liver cells, to become pancreatic cells. Reversely, when fhl1b was overexpressed, medially located endodermal cells, fated to differentiate into pancreatic and intestinal cells, contributed to the liver by directly or indirectly modulating the discrete levels of pdx1 expression in endodermal progenitors. Moreover, loss of fhl1b increased the regenerative capacity of β-cells by increasing pdx1 and neurod expression in the hepatopancreatic ductal system. Altogether, these data reveal novel and critical functions of Fhl1b in the hepatic versus pancreatic fate decision and in β-cell regeneration. PMID:26845333

  15. Four and a Half LIM Domains 1b (Fhl1b Is Essential for Regulating the Liver versus Pancreas Fate Decision and for β-Cell Regeneration.

    Directory of Open Access Journals (Sweden)

    Jin Xu


    Full Text Available The liver and pancreas originate from overlapping embryonic regions, and single-cell lineage tracing in zebrafish has shown that Bone morphogenetic protein 2b (Bmp2b signaling is essential for determining the fate of bipotential hepatopancreatic progenitors towards the liver or pancreas. Despite its pivotal role, the gene regulatory networks functioning downstream of Bmp2b signaling in this process are poorly understood. We have identified four and a half LIM domains 1b (fhl1b, which is primarily expressed in the prospective liver anlage, as a novel target of Bmp2b signaling. fhl1b depletion compromised liver specification and enhanced induction of pancreatic cells from endodermal progenitors. Conversely, overexpression of fhl1b favored liver specification and inhibited induction of pancreatic cells. By single-cell lineage tracing, we showed that fhl1b depletion led lateral endodermal cells, destined to become liver cells, to become pancreatic cells. Reversely, when fhl1b was overexpressed, medially located endodermal cells, fated to differentiate into pancreatic and intestinal cells, contributed to the liver by directly or indirectly modulating the discrete levels of pdx1 expression in endodermal progenitors. Moreover, loss of fhl1b increased the regenerative capacity of β-cells by increasing pdx1 and neurod expression in the hepatopancreatic ductal system. Altogether, these data reveal novel and critical functions of Fhl1b in the hepatic versus pancreatic fate decision and in β-cell regeneration.

  16. Survival, but not maturation, is affected in neutrophil progenitors from GSD-1b patients

    NARCIS (Netherlands)

    Visser, Gepke; de Jager, Wilco; Verhagen, Liesbeth P.; Smit, G. Peter A.; Wijburg, Frits A.; Prakken, Berent J.; Coffer, Paul J.; Buitenhuis, Miranda


    Glycogen storage disease type 1b (GSD 1b) is caused by mutations in the Glucose-6-phosphate transporter and is characterized by impaired glucose homeostasis. In addition, GSD-1b is associated with chronic neutropenia resulting in recurrent infections and inflammatory bowel disease. It is unclear whe

  17. 76 FR 62455 - Announcement of Updated Funding Availability for H-1B Technical Skills Training Grants (United States)


    ... Employment and Training Administration Announcement of Updated Funding Availability for H-1B Technical Skills... Federal Register announcing the availability of $240 million for the H-1B Technical Skills Training Grants... available and encouraging additional applicants to apply for the H-1B Technical Skills Training...

  18. Data of evolutionary structure change: 1CG8A-2DN1B [Confc[Archive

    Lifescience Database Archive (English)

    Full Text Available equence>FSGFE-----ACNEQ ure> ----- HH> B 2DN1B FGDLSTPDAVMGNPK re>G HHHH HH...ence>VNLQA-FTPVT >HH - HHH> 2DN1 B 2DN1B HHFGKEFTPPV ...>HHHGGG HHH> ATOM 1931 CA HIS B 116 17.758 39.

  19. Deletion of Protein Tyrosine Phosphatase 1B (PTP1B Enhances Endothelial Cyclooxygenase 2 Expression and Protects Mice from Type 1 Diabetes-Induced Endothelial Dysfunction.

    Directory of Open Access Journals (Sweden)

    David J Herren

    Full Text Available Protein tyrosine phosphatase 1B (PTP1B dephosphorylates receptors tyrosine kinase and acts as a molecular brake on insulin signaling pathway. Conditions of metabolic dysfunction increase PTP1B, when deletion of PTP1B protects against metabolic disorders by increasing insulin signaling. Although vascular insulin signaling contributes to the control of glucose disposal, little is known regarding the direct role of PTP1B in the control of endothelial function. We hypothesized that metabolic dysfunctions increase PTP1B expression in endothelial cells and that PTP1B deletion prevents endothelial dysfunction in situation of diminished insulin secretion. Type I diabetes (T1DM was induced in wild-type (WT and PTP1B-deficient mice (KO with streptozotocin (STZ injection. After 28 days of T1DM, KO mice exhibited a similar reduction in body weight and plasma insulin levels and a comparable increase in glycemia (WT: 384 ± 20 vs. Ko: 432 ± 29 mg/dL, cholesterol and triglycerides, as WT mice. T1DM increased PTP1B expression and impaired endothelial NO-dependent relaxation, in mouse aorta. PTP1B deletion did not affect baseline endothelial function, but preserved endothelium-dependent relaxation, in T1DM mice. NO synthase inhibition with L-NAME abolished endothelial relaxation in control and T1DM WT mice, whereas L-NAME and the cyclooxygenases inhibitor indomethacin were required to abolish endothelium relaxation in T1DM KO mice. PTP1B deletion increased COX-2 expression and PGI2 levels, in mouse aorta and plasma respectively, in T1DM mice. In parallel, simulation of diabetic conditions increased PTP1B expression and knockdown of PTP1B increased COX-2 but not COX-1 expression, in primary human aortic endothelial cells. Taken together these data indicate that deletion of PTP1B protected endothelial function by compensating the reduction in NO bioavailability by increasing COX-2-mediated release of the vasodilator prostanoid PGI2, in T1DM mice.

  20. Proteasomal degradation of human CYP1B1: effect of the Asn453Ser polymorphism on the post-translational regulation of CYP1B1 expression. (United States)

    Bandiera, Silvio; Weidlich, Simone; Harth, Volker; Broede, Peter; Ko, Yun; Friedberg, Thomas


    Allelic variations in CYP1B1 are reported to modulate the incidence of several types of cancer. To provide a mechanistic basis for this association, we investigated the impact of nonsilent allelic changes on the intracellular levels and post-translational regulation of CYP1B1 protein. When transiently expressed in COS-1 cells, either in the presence or absence of recombinant cytochrome P450 reductase, the cellular level of the CYP1B1.4 allelic variant (containing a Ser at the amino acid position 453; Ser453) was 2-fold lower compared with the other four allelic CYP1B1 proteins (containing Asn453), as analyzed by both immunoblotting and ethoxyresorufin O-deethylase activity. This difference was caused by post-translational regulation; as in the presence of cycloheximide, the rate of degradation of immunodetectable and enzymatically active CYP1B1.4 was distinctly faster than that of CYP1B1.1. Pulse-chase analysis revealed that the half-life of CYP1B1.4 was a mere 1.6 h compared with 4.8 h for CYP1B1.1. The presence of the proteasome inhibitor MG132 [N-benzoyloxycarbonyl (Z)-Leu-Leuleucinal] increased the stability not only of immunodetectable CYP1B1, but also--unexpectedly given the size of the proteasome access channel--increased the stability of enzymatically active CYP1B1. The data presented herein also demonstrate that CYP1B1 is targeted for its polymorphism-dependent degradation by polyubiquitination but not phosphorylation. Our results importantly provide a mechanism to explain the recently reported lower incidence of endometrial cancer in individuals carrying the CYP1B1*4 compared with the CYP1B1*1 haplo-type. In addition, the mechanistic paradigms revealed herein may explain the strong overexpression of CYP1B1 in tumors compared with nondiseased tissues. PMID:15486049

  1. A facile microwave assisted one-pot synthesis of novel 1-methylhexahydroquinazolin-5(6H-ones and bis-1-methylhexahydroquinazolin-5(6H-ones

    Directory of Open Access Journals (Sweden)

    Madhusudhan Saha


    Full Text Available Novel hexahydroquinazolin-5(6H-ones 3a-j have been synthesized in good yields by the reaction of enaminones 2a-b with primary amines and formaldehyde under the influence microwaves. Enaminones 2a-b have also been reacted with diamines and formaldehyde under similar conditions resulting in hitherto unreported bis- hexahydroquinazolin-5(6H-ones 4a-d and 5a-d. The structures of the molecules have been established with the help of spectral and analytical data.

  2. Interference of kallikrein 1b26 (klk1b26 translation by microRNA specifically expressed in female mouse submandibular glands: an additional mechanism for sexual dimorphism of klk1b26 protein in the glands

    Directory of Open Access Journals (Sweden)

    Kurihara Kinji


    Full Text Available Abstract Background Mouse kallikrein 1b26 (klk1b26 protein is more abundant in male submandibular glands (SMGs than in female ones. This sexual dimorphism has been thought to be due to increased mRNA synthesis stimulated by androgen. However, the klk1b26 protein level in female SMG is far less than that expected from the mRNA level, suggesting an additional mechanism for down-regulation of klk1b26 expression in female SMGs. Methods We examined the effects of small non-coding RNAs in mouse SMGs on in vitro translation of klk1b26 using a reticulocyte lysate system and reverse transcription (RT-PCR for klk1b26 mRNA. Statistical analyses were performed with a computer package (Microsoft Excel. Results The microRNA (miRNA preparation from female SMGs, but not male SMGs, interfered with the in vitro translation of the klk1b26 protein and inhibited the RT-PCR for klk1b26 mRNA with forward primers targeting its 5'-terminal region (between the 15th and 40th nucleotide from the 5'-terminal. The miRNA preparation from castrated mouse SMGs showed the inhibitory effect on the klk1b26 translation, but that from a 5α-dihydrotestosterone-treated female mouse SMGs did not. Synthetic miRNAs (miR-325 and miR-1497a, which have partial complementarity with klk1b26 mRNA at its 5'-terminal region (15th to 40th nucleotide position from the 5'-terminal, also interfered with the in vitro klk1b26 translation. When the female miRNA preparation was incubated with a 30-nucleotide-long single-strand oligoDNA (named [15th-44th]ssDNA, whose sequence corresponded to the 15th to 44th position from the 5'-terminal of klk1b26 mRNA prior to the addition into the in vitro translation system, the inhibitory effect of the miRNA preparation on klk1b26 translation disappeared, while [15th-44th]ssDNA itself had no effect on the translation. Preincubation of the miRNA preparation with another single-strand DNA ([169th-198th]ssDNA, whose sequence corresponded with 169th to 198th position

  3. Preparation, crystal structure and luminescent properties of the (6,3) type network supramolecular lanthanide picrate complexes with 2,2'-[(1,2-naphthalene)bis(oxy)]bis[N-(phenylmethyl)]acetamide

    International Nuclear Information System (INIS)

    Solid complexes of lanthanide picrates with a new podand-type ligand, 2,2'-[(1,2-naphthalene)bis(oxy)]bis[N-(phenylmethyl)]acetamide (L) have been prepared and characterized by elemental analysis, conductivity measurements, IR and electronic spectroscopies. The crystal and molecular structures of the coordination polymer {[Eu2L3(Pic)6].(CHCl3)3.(H2O)0.5}n have been determined by single-crystal X-ray diffraction, and the structure displays a two-dimensional honeycomb-like framework in the ab plane, which can be regarded as a (6,3) topological network with europium atoms acting as 'three-connected' centers. Furthermore, the coordination layers are linked by the intermolecular hydrogen bonds to form a three-dimensional (3-D) netlike supermolecule. Under excitation, Eu complex exhibited characteristic emissions. The lowest triplet state energy level of the ligand indicates that the triplet state energy level of the ligand matches better to the resonance level of Eu(III) than Tb(III) ion. - Graphical abstract: The (6,3) type network supramolecular luminescent lanthanide picrate complexes {Ln2L3(Pic)6}n (L=2,2'-[(1,2-naphthalene)bis(oxy)]bis[N-(phenylmethyl)]acetamide) displaying a two-dimensional honeycomb-like framework have been designed and prepared.

  4. Mutations in STX1B, encoding a presynaptic protein, cause fever-associated epilepsy syndromes

    DEFF Research Database (Denmark)

    Schubert, J.; Siekierska, A.; Langlois, M.;


    Febrile seizures affect 2-4% of all children(1) and have a strong genetic component(2). Recurrent mutations in three main genes (SCN1A, SCN1B and GABRG2)(3-5) have been identified that cause febrile seizures with or without epilepsy. Here we report the identification of mutations in STX1B, encoding....... Wild-type human syntaxin-1B but not a mutated protein rescued the effects of stx1b knockdown in zebrafish. Our results thus implicate STX1B and the presynaptic release machinery in fever-associated epilepsy syndromes....

  5. CYP1B1 expression, a potential risk factor for breast cancer

    Energy Technology Data Exchange (ETDEWEB)

    Goth-Goldstein, Regine; Erdmann, Christine A.; Russell, Marion


    CYP1B1 expression in non-tumor breast tissue from breast cancer patients and cancer-free individuals was determined to test the hypothesis that high CYP1B1 expression is a risk factor for breast cancer. Large interindividual variations in CYP1B1 expression were found with CYP1B1 levels notably higher in breast cancer patients than cancer-free individuals. The results indicate that CYP1B1 might play a role in breast cancer either through increased PAH activation or through metabolism of endogenous estrogen to a carcinogenic derivative.

  6. A novel role for protein tyrosine phosphatase 1B as a positive regulator of neuroinflammation


    Song, Gyun Jee; Jung, Myungsu; Kim, Jong-Heon; Park, Hana; Rahman, Md. Habibur; Zhang, Sheng; Zhang, Zhong-Yin; Park, Dong Ho; Kook, Hyun; Lee, In-Kyu; Suk, Kyoungho


    Background Protein tyrosine phosphatase 1B (PTP1B) is a member of the non-transmembrane phosphotyrosine phosphatase family. Recently, PTP1B has been proposed to be a novel target of anti-cancer and anti-diabetic drugs. However, the role of PTP1B in the central nervous system is not clearly understood. Therefore, in this study, we sought to define PTP1B’s role in brain inflammation. Methods PTP1B messenger RNA (mRNA) and protein expression levels were examined in mouse brain and microglial cel...

  7. 40 CFR 721.1187 - Bis(imidoethylene) benzene. (United States)


    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Bis(imidoethylene) benzene. 721.1187... Substances § 721.1187 Bis(imidoethylene) benzene. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance bis(imidoethylene)benzene (PMN P-93-1447) is subject to...

  8. The potential of transferrin-pendant-type polyethyleneglycol liposomes encapsulating decahydrodecaborate-1B (GB-10) as 1B-carriers for boron neutron capture therapy

    International Nuclear Information System (INIS)

    Purpose: To evaluate GB-10-encapsulating transferrin (TF)-pendant-type polyethyleneglycol (PEG) liposomes as tumor-targeting 1B-carriers for boron neutron capture therapy. Methods and Materials: A free mercaptoundecahydrododecaborate-1B (BSH) or decahydrodecaborate-1B (GB-10) solution, bare liposomes, PEG liposomes, or TF-PEG liposomes were injected into SCC VII tumor-bearing mice, and 1B concentrations in the tumors and normal tissues were measured by γ-ray spectrometry. Meanwhile, tumor-bearing mice were continuously given 5-bromo-2'-deoxyuridine (BrdU) to label all intratumor proliferating cells, then injected with these 1B-carriers containing BSH or GB-10 in the same manner. Right after thermal neutron irradiation, the response of quiescent (Q) cells was assessed in terms of the micronucleus frequency using immunofluorescence staining for BrdU. The frequency in the total tumor cells was determined from the BrdU nontreated tumors. Results: Transferrin-PEG liposomes showed a prolonged retention in blood circulation, low uptake by reticuloendothelial system, and the most enhanced accumulation of 1B in solid tumors. In general, the enhancing effects were significantly greater in total cells than Q cells. In both cells, the enhancing effects of GB-10-containing 1B-carriers were significantly greater than BSH-containing 1B-carriers, whether loaded in free solution or liposomes. In both cells, whether BSH or GB-10 was employed, the greatest enhancing effect was observed with TF-PEG liposomes followed in decreasing order by PEG liposomes, bare liposomes, and free BSH or GB-10 solution. In Q cells, the decrease was remarkable between PEG and bare liposomes. Conclusions: In terms of biodistribution characteristics and tumor cell-killing effect as a whole, including Q cells, GB-10 TF-PEG liposomes were regarded as promising 1B-carriers

  9. Differential epigenetic and transcriptional response of the skeletal muscle carnitine palmitoyltransferase 1B (CPT1B) gene to lipid exposure with obesity. (United States)

    Maples, Jill M; Brault, Jeffrey J; Witczak, Carol A; Park, Sanghee; Hubal, Monica J; Weber, Todd M; Houmard, Joseph A; Shewchuk, Brian M


    The ability to increase fatty acid oxidation (FAO) in response to dietary lipid is impaired in the skeletal muscle of obese individuals, which is associated with a failure to coordinately upregulate genes involved with FAO. While the molecular mechanisms contributing to this metabolic inflexibility are not evident, a possible candidate is carnitine palmitoyltransferase-1B (CPT1B), which is a rate-limiting step in FAO. The present study was undertaken to determine if the differential response of skeletal muscle CPT1B gene transcription to lipid between lean and severely obese subjects is linked to epigenetic modifications (DNA methylation and histone acetylation) that impact transcriptional activation. In primary human skeletal muscle cultures the expression of CPT1B was blunted in severely obese women compared with their lean counterparts in response to lipid, which was accompanied by changes in CpG methylation, H3/H4 histone acetylation, and peroxisome proliferator-activated receptor-δ and hepatocyte nuclear factor 4α transcription factor occupancy at the CPT1B promoter. Methylation of specific CpG sites in the CPT1B promoter that correlated with CPT1B transcript level blocked the binding of the transcription factor upstream stimulatory factor, suggesting a potential causal mechanism. These findings indicate that epigenetic modifications may play important roles in the regulation of CPT1B in response to a physiologically relevant lipid mixture in human skeletal muscle, a major site of fatty acid catabolism, and that differential DNA methylation may underlie the depressed expression of CPT1B in response to lipid, contributing to the metabolic inflexibility associated with severe obesity. PMID:26058865

  10. Pancreatic Protein Tyrosine Phosphatase 1B Deficiency Exacerbates Acute Pancreatitis in Mice. (United States)

    Bettaieb, Ahmed; Koike, Shinichiro; Chahed, Samah; Bachaalany, Santana; Griffey, Stephen; Sastre, Juan; Haj, Fawaz G


    Acute pancreatitis (AP) is a common and devastating gastrointestinal disorder that causes significant morbidity. The disease starts as local inflammation in the pancreas that may progress to systemic inflammation and complications. Protein tyrosine phosphatase 1B (PTP1B) is implicated in inflammatory signaling, but its significance in AP remains unclear. To investigate whether PTP1B may have a role in AP, we used pancreas PTP1B knockout (panc-PTP1B KO) mice and determined the effects of pancreatic PTP1B deficiency on cerulein- and arginine-induced acute pancreatitis. We report that PTP1B protein expression was increased in the early phase of AP in mice and rats. In addition, histological analyses of pancreas samples revealed enhanced features of AP in cerulein-treated panc-PTP1B KO mice compared with controls. Moreover, cerulein- and arginine-induced serum amylase and lipase were significantly higher in panc-PTP1B KO mice compared with controls. Similarly, pancreatic mRNA and serum concentrations of the inflammatory cytokines IL-1B, IL-6, and tumor necrosis factor-α were increased in panc-PTP1B KO mice compared with controls. Furthermore, panc-PTP1B KO mice exhibited enhanced cerulein- and arginine-induced NF-κB inflammatory response accompanied with increased mitogen-activated protein kinases activation and elevated endoplasmic reticulum stress. Notably, these effects were recapitulated in acinar cells treated with a pharmacological inhibitor of PTP1B. These findings reveal a novel role for pancreatic PTP1B in cerulein- and arginine-induced acute pancreatitis. PMID:27461362

  11. ABS: Sequence alignment by scanning

    KAUST Repository

    Bonny, Mohamed Talal


    Sequence alignment is an essential tool in almost any computational biology research. It processes large database sequences and considered to be high consumers of computation time. Heuristic algorithms are used to get approximate but fast results. We introduce fast alignment algorithm, called Alignment By Scanning (ABS), to provide an approximate alignment of two DNA sequences. We compare our algorithm with the well-known alignment algorithms, the FASTA (which is heuristic) and the \\'Needleman-Wunsch\\' (which is optimal). The proposed algorithm achieves up to 76% enhancement in alignment score when it is compared with the FASTA Algorithm. The evaluations are conducted using different lengths of DNA sequences. © 2011 IEEE.

  12. AP calculus AB/BC

    CERN Document Server

    Schwartz, Stu


    All Access for the AP® Calculus AB & BC Exams Book + Web + Mobile Everything you need to prepare for the Advanced Placement® exam, in a study system built around you! There are many different ways to prepare for an Advanced Placement® exam. What's best for you depends on how much time you have to study and how comfortable you are with the subject matter. To score your highest, you need a system that can be customized to fit you: your schedule, your learning style, and your current level of knowledge. This book, and the free online tools that come with it, will help you personalize your AP® Cal

  13. Theoretical Studies on the Ground State and Excited State of 2,4'- (Ethylene)-bis-8-hydroxyquinoline

    Institute of Scientific and Technical Information of China (English)

    Hui-xue Li; Su-juan Pan; Xiao-feng Wang; Tai Xiao


    2,7'-(Ethylene)-bis-8-hydroxyquinoline was optimized with DFT/B3LYP and ab initio HF methods, so ion- ization potential and electron affinity could be determined. Absorption spectrum was calculated by ZINDO and TD-DFT. CIS method was used to calculate the S1 excited states of the compound and afterwards the emission spectrum was computed. When the solvent effect was taken into account, the computed results show encouraging agreement with known experimental data. The results of analyzing the relationship between the energies and absorption spectra indicate that the ability to transporting electrons is strengthened compared with 8-hydroxyquinoline and that absorption and emission spectra are red-shifted. The intramolecular reor- ganization energy of tris(2,7'-(ethylene)-bis-8-hydroxyquinoline)-aluminum implies its electron transporting property is worse than tris(8-hydroxyquinoline)-aluminurn. The predicted maximum emission wavelength is red-shifted compared with tris(8-hydroxyquinoline)-aluminum.

  14. Detection of genes regulated by Lmx1b during limb dorsalization. (United States)

    Feenstra, Jennifer M; Kanaya, Kohei; Pira, Charmaine U; Hoffman, Sarah E; Eppey, Richard J; Oberg, Kerby C


    Lmx1b is a homeodomain transcription factor that regulates dorsal identity during limb development. Lmx1b knockout (KO) mice develop distal ventral-ventral limbs. Although induction of Lmx1b is linked to Wnt7a expression in the dorsal limb ectoderm, the downstream targets of Lmx1b that accomplish limb dorsalization are unknown. To identify genes targeted by Lmx1b, we compared gene arrays from Lmx1b KO and wild type mouse limbs during limb dorsalization, i.e., 11.5, 12.5, and 13.5 days post coitum. We identified 54 target genes that were differentially expressed in all three stages. Several skeletal targets, including Emx2, Matrilin1 and Matrilin4, demonstrated a loss of scapular expression in the Lmx1b KO mice, supporting a role for Lmx1b in scapula development. Furthermore, the relative abundance of extracellular matrix-related soft tissue targets regulated by Lmx1b, such as collagens and proteoglycans, suggests a mechanism that includes changes in the extracellular matrix composition to accomplish limb dorsalization. Our study provides the most comprehensive characterization of genes regulated by Lmx1b during limb development to-date and provides targets for further investigation. PMID:22417325

  15. Characteristics of stably expressed human dopamine D1a and D1b receptors: atypical behavior of the dopamine D1b receptor

    DEFF Research Database (Denmark)

    Pedersen, U B; Norby, B; Jensen, Anders A.;


    Human dopamine D1a and D1b receptors were stably expressed in Baby Hamster Kidney (BHK) or Chinese Hamster Ovary (CHO) cells. [3H]SCH23390 saturation experiments indicated the presence of only a single binding site in the D1a expressing cell line with a Kd of 0.5 nM. In D1b expressing cell lines...

  16. Microwave Study of Recycled ABS Resins

    Institute of Scientific and Technical Information of China (English)

    A; M; Hasna


    This article provides a review of the research unde rt aken in order to determine the suitability of utilizing microwave technology in the production of Recycled ABS Acrylonitrile Butadiene Styrene resin for mouldin gs. The experimental investigation determined the suitability of the existing re cycled ABS material, the mould material used with respect to performance and lon gevity, potential commercial plant and equipment, end mould compression. Introduction Frequency Characterization of ABS The first ...

  17. abs497ashcoursesTutorial /uophelp




    For more course tutorials visit       I.        ABS 497 Week 1 Assignment Community Change   II.        ABS 497 Week 1 DQ 1 Fabian's Story III.        ABS 497 Week 1 DQ 2 Doug's Story IV.        ABS 497 Week 2 DQ 1 Parenting Styles   V.      &nb...

  18. Solvent-free Thia-Michael Addition Reactions Using 3-[Bis(alkylthio)methylene]pentane-2,4-diones as Efficient and Odorless Thiol Equivalents

    Institute of Scientific and Technical Information of China (English)

    LIN Chun; ZHAO Xiao-Liang; OUYANG Yan; YU Hai-Feng; DONG De-Wen


    3-[Bis(alkylthio)methylene]pentane-2,4-diones (1a and 1b) have been investigated as nonthiolic and odorless thiol equivalents for thia-Michael addition reactions under solvent-free conditions. Promoted by HCl (aq.), the cleavage of compounds 1 took place, and the in-situ generated thiols underwent facile conjugate addition to α,β-unsaturated carbonyl compounds 2 affording the corresponding β-keto sulfides 3 in high yields.

  19. Discovery of a novel competitive inhibitor of PTP1B by high-throughput screening

    Institute of Scientific and Technical Information of China (English)

    Lei SHI; Hai-ping YU; Yue-yang ZHOU; Jun-qin DU; Qiang SHEN; Jing-ya LI; Jia LI


    Aim: The aim of the present study was to discover novel protein tyrosine phos-phatase 1B (PTP1B) inhibitors. We expressed and purified the human PTP1B catalytic domain and set up a molecular level high-throughput screening (HTS) assay to screen a set of 48 000 pure compounds. Results: HTS was finished with an averaged Z' factor of 0.63, and LGH00081, a competitive inhibitor of PTP1B with novel structure and relatively good selectivity for receptor-type protein ty-rosine phosphatases, was identified. Conclusion: We established a molecular level assay which is useful for the screening of PTP1B inhibitors with therapeutic potential. The novel competitive PTP1B inhibitor LGH00081 offers a good start for structure modification and cellular functional activity study.

  20. Halogen-free bis(imidazolium)/bis(ammonium)-di[bis(salicylato)borate] ionic liquids as energy-efficient and environmentally friendly lubricant additives. (United States)

    Gusain, Rashi; Gupta, Piyush; Saran, Sandeep; Khatri, Om P


    Bis(imidazolium)- and bis(ammonium)-di[bis(salicylato)borate] ionic liquids with variable alkyl chain and cyclic ring structures, were synthesized and then evaluated them as potential lubricant additives. The copper strip test results revealed noncorrosive properties of these ionic liquids. Introduction of halogen content in bis(imidazolium) ionic liquid by replacement of bis(salicylato)borate (BScB) anion with hexafluorophosphate (PF6(-)), severely corroded the copper strip. Thermogravimetric results showed that bis(imidazolium) ionic liquids exhibited higher thermal stability than bis(ammonium) ionic liquids owing to compact structure provided by imidazolium rings, higher intermolecular interactions, smaller free volume and low steric hindrance. The lubrication properties of these ionic liquids as additives to synthetic lubricant poly(ethylene) glycol (PEG 200) were evaluated for steel balls. Results showed that bis(ammonium)- and bis(imidazolium)-(BScB)2 ionic liquids as additives significantly reduced both friction coefficient and wear of PEG 200. The structure of cations, particularly the variation in substituted alkyl chain length monitored the degree of reduction in friction and wear. The excellent lubrication properties were attributed to the formation of adsorbed tribo-thin film and tribochemical product during the tribo-contact. Being halogen-, phosphorus-, and sulfur-free, these ionic liquids (a) protects contact surfaces from tribo-corrosive events, (b) reduces the friction and wear, and (c) keep environment green and clean.

  1. In vivo and in vitro CYP1B mRNA expression in channel catfish. (United States)

    Willett, Kristine L; Ganesan, Shobana; Patel, Monali; Metzger, Christine; Quiniou, Sylvie; Waldbieser, Geoff; Scheffler, Brian


    Our goal was to study the induction of CYP1B mRNA expression in channel catfish (Ictalurus punctatus). CYP1B belongs to the cytochrome P450 superfamily of genes, is involved in the oxidation of endogenous and exogenous compounds, and could potentially be a useful biomarker in fish for exposure to AhR ligands. The full-length catfish CYP1B cDNA is 2417 nt to the polyA tail and encodes a putative protein of 536 amino acids. It has 67% amino acid similarity to carp and zebrafish CYP1B and 68% similarity to carp CYP1B2. Male channel catfish were collected from three Mississippi Delta sites: Lake Roebuck, Itta Bena; Bee Lake, Thornton; and Sunflower River, Indianola. Total RNA was isolated from wild-caught catfish gill, blood, gonad and liver tissues. Quantitative real-time reverse transcriptase PCR was used to determine relative induction of CYP1B in wild catfish compared to laboratory control and BaP-exposed catfish (20mg/kg i.p. after 4 days). BaP exposure significantly induced CYP1B message in blood, gonad, and liver of laboratory catfish. In these same tissues of wild catfish from sites with relatively low sediment contaminants, CYP1B message was not statistically increased relative to laboratory control catfish. CYP1B transcript abundance was higher in gills compared to other tissues in both laboratory and wild catfish. When primary cultured gill cells were treated with increasing concentrations of BaP, TCDD, and PCBs 77, 126 and 169, CYP1B mRNA was induced more than 10-fold while PCB153 and 4,4'DDT did not cause significant CYP1B induction. Our results suggest that catfish CYP1B is induced by the classic AhR ligands. PMID:16697458

  2. The Role of PTP1B O-GlcNAcylation in Hepatic Insulin Resistance


    Yun Zhao; Zhuqi Tang; Aiguo Shen; Tao Tao; Chunhua Wan; Xiaohui Zhu; Jieru Huang; Wanlu Zhang; Nana Xia; Suxin Wang; Shiwei Cui; Dongmei Zhang


    Protein tyrosine phosphatase 1B (PTP1B), which can directly dephosphorylate both the insulin receptor and insulin receptor substrate 1 (IRS-1), thereby terminating insulin signaling, reportedly plays an important role in insulin resistance. Accumulating evidence has demonstrated that O-GlcNAc modification regulates functions of several important components of insulin signal pathway. In this study, we identified that PTP1B is modified by O-GlcNAcylation at three O-GlcNAc sites (Ser104, Ser201...

  3. ABS test equipment design%ABS 测试设备设计

    Institute of Scientific and Technical Information of China (English)



      This article simply introduces the structure and operating principle of ABS. and a new equipment for ABS signal testing is designed and put into use.%  简要介绍了 ABS 的组成及其工作原理,并结合自身情况,设计了测试 ABS 信号的设备,并投入使用。

  4. Ab-Initio Molecular Dynamics

    CERN Document Server

    Kühne, Thomas D


    Computer simulations and molecular dynamics in particular, is a very powerful method to provide detailed and essentially exact informations of classical many-body problems. With the advent of \\textit{ab-initio} molecular dynamics, where the forces are computed on-the-fly by accurate electronic structure calculations, the scope of either method has been greatly extended. This new approach, which unifies Newton's and Schr\\"odinger's equations, allows for complex simulations without relying on any adjustable parameter. This review is intended to outline the basic principles as well as a survey of the field. Beginning with the derivation of Born-Oppenheimer molecular dynamics, the Car-Parrinello method as well as novel hybrid scheme that unifies best of either approach are discussed. The predictive power is demonstrated by a series of applications ranging from insulators to semiconductors and even metals in condensed phases.

  5. Water molecule network and active site flexibility of apo protein tyrosine phosphatase 1B

    DEFF Research Database (Denmark)

    Pedersen, A.K.; Peters, Günther H.J.; Møller, K.B.;


    Protein tyrosine phosphatase 1B (PTP1B) plays a key role as a negative regulator of insulin and leptin signalling and is therefore considered to be an important molecular target for the treatment of type 2 diabetes and obesity. Detailed structural information about the structure of PTP1B, including...... the conformation and flexibility of active-site residues as well as the water-molecule network, is a key issue in understanding ligand binding and enzyme kinetics and in structure-based drug design. A 1.95 Angstrom apo PTP1B structure has been obtained, showing four highly coordinated water molecules...

  6. Yersinia pestis Requires Host Rab1b for Survival in Macrophages.

    Directory of Open Access Journals (Sweden)

    Michael G Connor


    Full Text Available Yersinia pestis is a facultative intracellular pathogen that causes the disease known as plague. During infection of macrophages Y. pestis actively evades the normal phagosomal maturation pathway to establish a replicative niche within the cell. However, the mechanisms used by Y. pestis to subvert killing by the macrophage are unknown. Host Rab GTPases are central mediators of vesicular trafficking and are commonly targeted by bacterial pathogens to alter phagosome maturation and killing by macrophages. Here we demonstrate for the first time that host Rab1b is required for Y. pestis to effectively evade killing by macrophages. We also show that Rab1b is specifically recruited to the Yersinia containing vacuole (YCV and that Y. pestis is unable to subvert YCV acidification when Rab1b expression is knocked down in macrophages. Furthermore, Rab1b knockdown also altered the frequency of association between the YCV with the lysosomal marker Lamp1, suggesting that Rab1b recruitment to the YCV directly inhibits phagosome maturation. Finally, we show that Rab1b knockdown also impacts the pH of the Legionella pneumophila containing vacuole, another pathogen that recruits Rab1b to its vacuole. Together these data identify a novel role for Rab1b in the subversion of phagosome maturation by intracellular pathogens and suggest that recruitment of Rab1b to the pathogen containing vacuole may be a conserved mechanism to control vacuole pH.

  7. miR-200b mediates post-transcriptional repression of ZFHX1B

    DEFF Research Database (Denmark)

    Christoffersen, Nanna Rønbjerg; Silahtaroglu, Asli; Ørom, Ulf Lupo Andersson;


    of E-cadherin. We show that Zfhx1b and miR-200b are regionally coexpressed in the adult mouse brain and that miR-200b represses the expression of Zfhx1b via multiple sequence elements present in the 3'-untranslated region. Overexpression of miR-200b leads to repression of endogenous ZFHX1B......, and inhibition of miR-200b relieves the repression of ZFHX1B. In accordance with these findings, miR-200b regulates the activity of the E-cadherin promoter....

  8. The ING1b tumor suppressor facilitates nucleotide excision repair by promoting chromatin accessibility to XPA

    International Nuclear Information System (INIS)

    ING1b is the most studied ING family protein and perhaps the most ubiquitously and abundantly expressed. This protein is involved in the regulation of various biological functions ranging from senescence, cell cycle arrest, apoptosis, to DNA repair. ING1b is upregulated by UV irradiation and enhances the removal of bulky nucleic acid photoproducts. In this study, we provide evidence that ING1b mediates nucleotide excision repair by facilitating the access to damaged nucleosomal DNA. We demonstrate that ING1b is not recruited to UV-induced DNA lesions but enhances nucleotide excision repair only in XPC-proficient cells, implying an essential role in early steps of the 'access, repair, restore' model. We also find that ING1b alters histone acetylation dynamics upon exposure to UV radiation and induces chromatin relaxation in microccocal nuclease digestion assay, revealing that ING1b may allow better access to nucleotide excision repair machinery. More importantly, ING1b associates with chromatin in a UV-inducible manner and facilitates DNA access to nucleotide excision repair factor XPA. Furthermore, depletion of the endogenous ING1b results to the sensitization of cells at S-phase to UV irradiation. Taken together, these observations establish a role of ING1b acting as a chromatin accessibility factor for DNA damage recognition proteins upon genotoxic injury

  9. SUMOylation of the ING1b tumor suppressor regulates gene transcription

    DEFF Research Database (Denmark)

    Satpathy, Shankha; Guérillon, Claire; Kim, Tae-Sun;


    The INhibitor of Growth (ING) proteins are encoded as multiple isoforms in five ING genes (ING1 -5) and act as type II tumor suppressors. They are growth inhibitory when overexpressed and are frequently mislocalized or downregulated in several forms of cancer. ING1 and ING2 are stoichiometric mem......1b E195A), we further demonstrate that ING1b SUMOylation regulates the binding of ING1b to the ISG15 and DGCR8 promoters, consequently regulating ISG15 and DGCR8 transcription. These results suggest a role for ING1b SUMOylation in the regulation of gene transcription....

  10. Plectin isoform 1b mediates mitochondrion-intermediate filament network linkage and controls organelle shape. (United States)

    Winter, Lilli; Abrahamsberg, Christina; Wiche, Gerhard


    Plectin is a versatile intermediate filament (IF)-bound cytolinker protein with a variety of differentially spliced isoforms accounting for its multiple functions. One particular isoform, plectin 1b (P1b), remains associated with mitochondria after biochemical fractionation of fibroblasts and cells expressing exogenous P1b. Here, we determined that P1b is inserted into the outer mitochondrial membrane with the exon 1b-encoded N-terminal sequence serving as a mitochondrial targeting and anchoring signal. To study P1b-related mitochondrial functions, we generated mice that selectively lack this isoform but express all others. In primary fibroblasts and myoblasts derived from these mice, we observe a substantial elongation of mitochondrial networks, whereas other mitochondrial properties remain largely unaffected. Normal morphology of mitochondria could be restored by isoform-specific overexpression of P1b in P1b-deficient as well as plectin-null cells. We propose a model where P1b both forms a mitochondrial signaling platform and affects organelle shape and network formation by tethering mitochondria to IFs.

  11. Ultrasound Biomicroscopy Comparison of Ab Interno and Ab Externo Intraocular Lens Scleral Fixation. (United States)

    Horiguchi, Lie; Garcia, Patricia Novita; Malavazzi, Gustavo Ricci; Allemann, Norma; Gomes, Rachel L R


    Purpose. To compare ab interno and ab externo scleral fixation of posterior chamber intraocular lenses (PCIOL) using ultrasound biomicroscopy (UBM). Methods. Randomized patients underwent ab externo or ab interno scleral fixation of a PCIOL. Ultrasound biomicroscopy was performed 3 to 6 months postoperatively, to determine PCIOL centration, IOL distance to the iris at 12, 3, 6, and 9 hours, and haptics placement in relation to the ciliary sulcus. Results. Fifteen patients were enrolled in the study. The ab externo technique was used in 7 eyes (46.6%) and the ab interno in 8 eyes (53.3%). In the ab externo technique, 14 haptics were located: 4 (28.57%) in the ciliary sulcus; 2 (14.28%) anterior to the sulcus; and 8 (57.14%) posterior to the sulcus, 6 in the ciliary body and 2 posterior to the ciliary body. In the ab interno group, 4 haptics (25.0%) were in the ciliary sulcus, 2 (12.50%) anterior to the sulcus, and 10 (75.0%) posterior to the sulcus, 4 in the ciliary body and 6 posterior to the ciliary body. Conclusions. Ab externo and ab interno scleral fixation techniques presented similar results in haptic placement. Ab externo technique presented higher vertical tilt when compared to the ab interno.

  12. Ultrasound Biomicroscopy Comparison of Ab Interno and Ab Externo Intraocular Lens Scleral Fixation

    Directory of Open Access Journals (Sweden)

    Lie Horiguchi


    Full Text Available Purpose. To compare ab interno and ab externo scleral fixation of posterior chamber intraocular lenses (PCIOL using ultrasound biomicroscopy (UBM. Methods. Randomized patients underwent ab externo or ab interno scleral fixation of a PCIOL. Ultrasound biomicroscopy was performed 3 to 6 months postoperatively, to determine PCIOL centration, IOL distance to the iris at 12, 3, 6, and 9 hours, and haptics placement in relation to the ciliary sulcus. Results. Fifteen patients were enrolled in the study. The ab externo technique was used in 7 eyes (46.6% and the ab interno in 8 eyes (53.3%. In the ab externo technique, 14 haptics were located: 4 (28.57% in the ciliary sulcus; 2 (14.28% anterior to the sulcus; and 8 (57.14% posterior to the sulcus, 6 in the ciliary body and 2 posterior to the ciliary body. In the ab interno group, 4 haptics (25.0% were in the ciliary sulcus, 2 (12.50% anterior to the sulcus, and 10 (75.0% posterior to the sulcus, 4 in the ciliary body and 6 posterior to the ciliary body. Conclusions. Ab externo and ab interno scleral fixation techniques presented similar results in haptic placement. Ab externo technique presented higher vertical tilt when compared to the ab interno.

  13. Ultrasound Biomicroscopy Comparison of Ab Interno and Ab Externo Intraocular Lens Scleral Fixation (United States)

    Horiguchi, Lie; Garcia, Patricia Novita; Malavazzi, Gustavo Ricci; Allemann, Norma


    Purpose. To compare ab interno and ab externo scleral fixation of posterior chamber intraocular lenses (PCIOL) using ultrasound biomicroscopy (UBM). Methods. Randomized patients underwent ab externo or ab interno scleral fixation of a PCIOL. Ultrasound biomicroscopy was performed 3 to 6 months postoperatively, to determine PCIOL centration, IOL distance to the iris at 12, 3, 6, and 9 hours, and haptics placement in relation to the ciliary sulcus. Results. Fifteen patients were enrolled in the study. The ab externo technique was used in 7 eyes (46.6%) and the ab interno in 8 eyes (53.3%). In the ab externo technique, 14 haptics were located: 4 (28.57%) in the ciliary sulcus; 2 (14.28%) anterior to the sulcus; and 8 (57.14%) posterior to the sulcus, 6 in the ciliary body and 2 posterior to the ciliary body. In the ab interno group, 4 haptics (25.0%) were in the ciliary sulcus, 2 (12.50%) anterior to the sulcus, and 10 (75.0%) posterior to the sulcus, 4 in the ciliary body and 6 posterior to the ciliary body. Conclusions. Ab externo and ab interno scleral fixation techniques presented similar results in haptic placement. Ab externo technique presented higher vertical tilt when compared to the ab interno. PMID:27293878

  14. Hnf1b controls pancreas morphogenesis and the generation of Ngn3+ endocrine progenitors. (United States)

    De Vas, Matias G; Kopp, Janel L; Heliot, Claire; Sander, Maike; Cereghini, Silvia; Haumaitre, Cécile


    Heterozygous mutations in the human HNF1B gene are associated with maturity-onset diabetes of the young type 5 (MODY5) and pancreas hypoplasia. In mouse, Hnf1b heterozygous mutants do not exhibit any phenotype, whereas the homozygous deletion in the entire epiblast leads to pancreas agenesis associated with abnormal gut regionalization. Here, we examine the specific role of Hnf1b during pancreas development, using constitutive and inducible conditional inactivation approaches at key developmental stages. Hnf1b early deletion leads to a reduced pool of pancreatic multipotent progenitor cells (MPCs) due to decreased proliferation and increased apoptosis. Lack of Hnf1b either during the first or the secondary transitions is associated with cystic ducts. Ductal cells exhibit aberrant polarity and decreased expression of several cystic disease genes, some of which we identified as novel Hnf1b targets. Notably, we show that Glis3, a transcription factor involved in duct morphogenesis and endocrine cell development, is downstream Hnf1b. In addition, a loss and abnormal differentiation of acinar cells are observed. Strikingly, inactivation of Hnf1b at different time points results in the absence of Ngn3(+) endocrine precursors throughout embryogenesis. We further show that Hnf1b occupies novel Ngn3 putative regulatory sequences in vivo. Thus, Hnf1b plays a crucial role in the regulatory networks that control pancreatic MPC expansion, acinar cell identity, duct morphogenesis and generation of endocrine precursors. Our results uncover an unappreciated requirement of Hnf1b in endocrine cell specification and suggest a mechanistic explanation of diabetes onset in individuals with MODY5.


    Directory of Open Access Journals (Sweden)

    Partha Pratim Kaishap* and Chandrajit Dohutia


    Full Text Available ABSTRACT: Indole ring system is the most important heterocycle available in natural compounds. Owing to great structural diversity, the indole ring system has become an important structural requirement in many pharmaceutical agents. Indole has been widely identified as a privileged structure or pharmacophore, with its presence in over 3000 natural isolates which are known to possess broad spectrum of biological activities and pharmaceutical applications. The bis (indolyl methane derivatives are found to be very active compounds in pharmacy field. They are found in cruciferous plants and are known to promote beneficial oestrogen metabolism and induce apoptosis in human cancer cells. In recent years, a lots of bis (indolyl methane derivatives have been synthesized and found to possess promising biological activities including anticancer, antimicrobial, antifungal, analgesic, anti-inflammatory, anthelmintic, cardiovascular activities. In the present review several synthetic schemes of these compounds are discussed involving non-toxic catalyst and providing high yields.

  16. Bridged bis-BODIPYs: their synthesis, structures and properties. (United States)

    Kesavan, Praseetha E; Das, Sudipta; Lone, Mohsin Y; Jha, Prakash C; Mori, Shigeki; Gupta, Iti


    A series of bis-BODIPYs 1-6 bridged via thiophene, furan, N-alkylcarbazole, triphenyl-amine, para- and meta-phenylene groups have been synthesized and characterized by various spectroscopic techniques. The change in the spectroscopic properties of bis-BODIPYs upon varying the size of spacers was studied. X-ray crystal structures of three bis-BODIPYs containing triphenylamine, para- and meta-phenylene bridges were solved. Intermolecular C(H)π and ππ stacking interactions were observed in solid state structures of three bis-BODIPYs. The dihedral angles between the spacer unit and two boron-dipyrrin units were lower in all three compounds as compared to their corresponding monomers. This suggests increased interactions between the two boron-dipyrrin units in molecules which are in turn reflected in the anodic shifts in their reduction potentials. DFT studies indicated effective electronic interactions between spacers and two boron dipyrrin units in all the bis-BODIPYs. The calculated HOMO-LUMO gap was found to be lower for bis-BODIPY having bulky carbazole spacers and higher for bis-BODIPY having smaller furan spacers. Changing the spacer size clearly affected the spectroscopic properties of the bis-BODIPYs and red shifted absorption and emission maxima were observed for bis-BODIPYs with furan and thiophene spacers as compared to bis-BODIPYs with phenylene or bulky aromatic spacers. PMID:26373792

  17. [N,N-Bis(diphenylphosphinoisopropylamine]dibromidonickel(II

    Directory of Open Access Journals (Sweden)


    Full Text Available The title compound, [NiBr2(C27H27NP2], was synthesized by the reaction of NiBr2(dme (dme is 1,2-dimethoxyethane with N,N-bis(diphenylphosphinoisopropylamine in methanol/tetrahydrofuran. The nickel(II center is coordinated by two P atoms of the chelating PNP ligand, Ph2PN(iPrPPh2, and two bromide ions in a distorted square-planar geometry.

  18. Synthesis, Characterization and Properties of Bis{oxo-bis[heteroaromatic carboxylatodibenzyltin(Ⅳ)]} and Crystal Structure of Bis{oxo-bis[2-furylcarboxylatodibenzyltin(Ⅳ)]}

    Institute of Scientific and Technical Information of China (English)


    A series of bis{oxo-bis[heteroaromatic carboxylatodibenzyltin(Ⅳ)]} complexes {[(PhCH2)2Sn*(O2CR)]2O}2[where R=2-furyl, 2-(2-furyl)vinyl, 2-(5-tert-butyl)furyl, 2-thiophenyl, 2-pyridinyl, 3-pyridinyl, 4-pyridinyl, 3-indolyl, 3-indolylmethyl, 3-indolylpropyl] was synthesized by the reactions of heteroaromatic carboxylic acids with dibenzyltin(Ⅳ) oxide. All the complexes were characterized by elemental analysis, IR, and NMR spectra. The complexes were tested against two human tumour cell lines: MCF-7 and WiDr. The results show that they have higher activities in vitro. The crystal structure of bis{oxo-bis[2-furylcarboxylatodibenzyltin(Ⅳ)]}(1) was determined by X-ray diffraction. The crystal belongs to monoclinic space group P21/n, a=1.6641(2) nm, b=1.25073(18) nm, c=1.7193(3) nm, β=101.951(2)°, Z=2, R1=0.0446, wR2=0.1100. Complex 1 is of a centrosymmetric dimer structure with a four-membered central endo-cyclic Sn2O2 unit in which the bridged oxygen atoms are tri-coordinated. Each bridged oxygen atom also connects with an exo-cyclic tin atom. The tin atoms are six-coordinated and have a coordination geometry of a distorted octahedron. The exo-cyclic tin atoms are five-coordinated and have a coordination geometry of a monocapped trigonal bipyramid with a very similarly distorted mode. Four carboxylate ligands are divided into two types. The two of the four carboxylate ligands are bidentate and bridged to each pair of exo- and endo-cyclic tin atoms by using both the oxygen atoms. The other two are monodentate and bridged to each pair of exo- and endo-cyclic tin atoms but each utilizes one O atom only.

  19. PTP1B inhibition suggests a therapeutic strategy for Rett syndrome. (United States)

    Krishnan, Navasona; Krishnan, Keerthi; Connors, Christopher R; Choy, Meng S; Page, Rebecca; Peti, Wolfgang; Van Aelst, Linda; Shea, Stephen D; Tonks, Nicholas K


    The X-linked neurological disorder Rett syndrome (RTT) presents with autistic features and is caused primarily by mutations in a transcriptional regulator, methyl CpG-binding protein 2 (MECP2). Current treatment options for RTT are limited to alleviating some neurological symptoms; hence, more effective therapeutic strategies are needed. We identified the protein tyrosine phosphatase PTP1B as a therapeutic candidate for treatment of RTT. We demonstrated that the PTPN1 gene, which encodes PTP1B, was a target of MECP2 and that disruption of MECP2 function was associated with increased levels of PTP1B in RTT models. Pharmacological inhibition of PTP1B ameliorated the effects of MECP2 disruption in mouse models of RTT, including improved survival in young male (Mecp2-/y) mice and improved behavior in female heterozygous (Mecp2-/+) mice. We demonstrated that PTP1B was a negative regulator of tyrosine phosphorylation of the tyrosine kinase TRKB, the receptor for brain-derived neurotrophic factor (BDNF). Therefore, the elevated PTP1B that accompanies disruption of MECP2 function in RTT represents a barrier to BDNF signaling. Inhibition of PTP1B led to increased tyrosine phosphorylation of TRKB in the brain, which would augment BDNF signaling. This study presents PTP1B as a mechanism-based therapeutic target for RTT, validating a unique strategy for treating the disease by modifying signal transduction pathways with small-molecule drugs.

  20. Influence of polymorphic OATP1B-type carriers on the disposition of docetaxel

    NARCIS (Netherlands)

    A.J.M. de Graan (Anne-Joy); C.S. Lancaster (Cynthia); A. Obaidat (Amanda); B. Hagenbuch (Bruno); L. Elens (Laure); L.E. Friberg (Lena); P. de Bruijn (Peter); S. Hu (Shuiying); A.A. Gibson; G.H. Bruun (G.); T.J. Corydon (T.); T.S. Mikkelsen; A.L. Walker (Aisha); G. Du (Guoqing); W.J. Loos (Walter); R.H.N. van Schaik (Ron); S.D. Baker (Sharyn); A.H.J. Mathijssen (Ron); A. Sparreboom (Alex)


    textabstractPurpose: Docetaxel is extensively metabolized by CYP3A4 in the liver but mechanisms by which the drug is taken up into hepatocytes remain poorly understood. We hypothesized that (i) liver uptake of docetaxel is mediated by the polymorphic solute carriers OATP1B1 and OATP1B3 and (ii) inhe

  1. Temporal lobe epilepsy and GEFS+ phenotypes associated with SCN1B mutations. (United States)

    Scheffer, Ingrid E; Harkin, Louise A; Grinton, Bronwyn E; Dibbens, Leanne M; Turner, Samantha J; Zielinski, Marta A; Xu, Ruwei; Jackson, Graeme; Adams, Judith; Connellan, Mary; Petrou, Steven; Wellard, R Mark; Briellmann, Regula S; Wallace, Robyn H; Mulley, John C; Berkovic, Samuel F


    SCN1B, the gene encoding the sodium channel beta 1 subunit, was the first gene identified for generalized epilepsy with febrile seizures plus (GEFS+). Only three families have been published with SCN1B mutations. Here, we present four new families with SCN1B mutations and characterize the associated phenotypes. Analysis of SCN1B was performed on 402 individuals with various epilepsy syndromes. Four probands with missense mutations were identified. Detailed electroclinical phenotyping was performed on all available affected family members including quantitative MR imaging in those with temporal lobe epilepsy (TLE). Two new families with the original C121W SCN1B mutation were identified; novel mutations R85C and R85H were each found in one family. The following phenotypes occurred in the six families with SCN1B missense mutations: 22 febrile seizures, 20 febrile seizures plus, five TLE, three other GEFS+ phenotypes, two unclassified and ten unaffected individuals. All individuals with confirmed TLE had the C121W mutation; two underwent temporal lobectomy (one with hippocampal sclerosis and one without) and both are seizure free. We confirm the role of SCN1B in GEFS+ and show that the GEFS+ spectrum may include TLE alone. TLE with an SCN1B mutation is not a contraindication to epilepsy surgery. PMID:17020904

  2. Myelin protein zero gene mutated in Charcot-Marie-Tooth type 1B patients

    Energy Technology Data Exchange (ETDEWEB)

    Su, Ying; Li, Lanying; Lepercq, J.; Lebo, R.V. (Univ. of California, San Francisco, CA (United States)); Brooks, D.G.; Ravetch, J.V. (Sloan-Kettering Institute, New York, NY (United States)); Trofatter, J.A. (Massachusetts General Hospital, Boston, MA (United States))


    The autosomal dominant of Charcot-Marie-Tooth disease (CMT), whose gene is type 1B (CMT1B), has slow nerve conduction with demyelinated Schwann cells. In this study the abundant peripheral myelin protein zero (MPZ) gene, MPZ, was mapped 130 kb centromeric to the Fc receptor immunoglobulin gene cluster in band 1q22, and a major MPZ point mutation was found to cosegregate with CMT1B in one large CMT1B family. The MPZ point mutation in 18 of 18 related CMT1B pedigree 1 patients converts a positively charged lysine in codon 96 to a negatively charged glutamate. The same MPZ locus cosegregates with the CMT1B disease gene in a second CMT1B family [total multipoint logarithm of odds (lod) = 11.4 at [theta] = 0.00] with a splice junction mutation. Both mutations occur in MPZ protein regions otherwise conserved identically in human, rat, and cow since these species diverged 100 million years ago. MPZ protein, expressed exclusively in myelinated peripheral nerve Schwann cells, constitutes >50% of myelin protein. These mutations are anticipated to disrupt homophilic MPZ binding and result in CMT1B peripheral nerve demyelination.

  3. Down-regulation of OATP1B proteins correlates with hyperbilirubinemia in advanced cholestasis

    NARCIS (Netherlands)

    Sticova, E.; Lodererova, A.; Steeg, E. van de; Frankova, S.; Kollar, M.; Lanska, V.; Kotalova, R.; Dedic, T.; Schinkel, A.H.; Jirsa, M.


    Aim: Organic anion-transporting polypeptides OATP1B1 and OATP1B3 are sinusoidal membrane transporters mediating liver uptake of a wide range of substrates including conjugated and unconjugated bilirubin, xenobiotics and drugs. Absence of OATP1Bs in the liver causes Rotor syndrome. Our aim was to cor

  4. Extending the Impact of RAC1b Overexpression to Follicular Thyroid Carcinomas (United States)

    Faria, Márcia; Capinha, Liliana; Simões-Pereira, Joana; Bugalho, Maria João; Silva, Ana Luísa


    RAC1b is a hyperactive variant of the small GTPase RAC1 known to be a relevant molecular player in different cancers. Previous studies from our group lead to the evidence that its overexpression in papillary thyroid carcinoma (PTC) is associated with an unfavorable prognosis. In the present study, we intended to extend the analysis of RAC1b expression to thyroid follicular neoplasms and to seek for clinical correlations. RAC1b expression levels were determined by RT-qPCR in thyroid follicular tumor samples comprising 23 follicular thyroid carcinomas (FTCs) and 33 follicular thyroid adenomas (FTAs). RAC1b was found to be overexpressed in 33% of carcinomas while no RAC1b overexpression was documented among follicular adenomas. Patients with a diagnosis of FTC were divided into two groups based on longitudinal evolution and final outcome. RAC1b overexpression was significantly associated with both the presence of distant metastases (P = 0.01) and poorer clinical outcome (P = 0.01) suggesting that, similarly to that previously found in PTCs, RAC1b overexpression in FTCs is also associated with worse outcomes. Furthermore, the absence of RAC1b overexpression in follicular adenomas hints its potential as a molecular marker likely to contribute, in conjunction with other putative markers, to the preoperative differential diagnosis of thyroid follicular lesions. PMID:27127508

  5. Extending the Impact of RAC1b Overexpression to Follicular Thyroid Carcinomas

    Directory of Open Access Journals (Sweden)

    Márcia Faria


    Full Text Available RAC1b is a hyperactive variant of the small GTPase RAC1 known to be a relevant molecular player in different cancers. Previous studies from our group lead to the evidence that its overexpression in papillary thyroid carcinoma (PTC is associated with an unfavorable prognosis. In the present study, we intended to extend the analysis of RAC1b expression to thyroid follicular neoplasms and to seek for clinical correlations. RAC1b expression levels were determined by RT-qPCR in thyroid follicular tumor samples comprising 23 follicular thyroid carcinomas (FTCs and 33 follicular thyroid adenomas (FTAs. RAC1b was found to be overexpressed in 33% of carcinomas while no RAC1b overexpression was documented among follicular adenomas. Patients with a diagnosis of FTC were divided into two groups based on longitudinal evolution and final outcome. RAC1b overexpression was significantly associated with both the presence of distant metastases (P = 0.01 and poorer clinical outcome (P = 0.01 suggesting that, similarly to that previously found in PTCs, RAC1b overexpression in FTCs is also associated with worse outcomes. Furthermore, the absence of RAC1b overexpression in follicular adenomas hints its potential as a molecular marker likely to contribute, in conjunction with other putative markers, to the preoperative differential diagnosis of thyroid follicular lesions.

  6. Data of evolutionary structure change: 1B99C-2AZ1D [Confc[Archive

    Lifescience Database Archive (English)

    Full Text Available GSDS--VESAN >E --HHHHH> ATOM 316...>D 2AZ1D HGSDHEDEGANE >E HHH...pdbID>1B99 C 1B99C EELLT-EVKPN ...> - > ATOM 3319 CA GLU C 141 17.330 5.755...DChain>2AZ1D DELVDWDRDAS re>GG EEGGHcture

  7. Data of evolutionary structure change: 1B7QA-2G4NF [Confc[Archive

    Lifescience Database Archive (English)

    Full Text Available 1B7QA-2G4NF 1B7Q 2G4N A F KVFERCELARTLKRLGMDGYRGISLALWMCLAKWESGYN... HHHH - GGGG -- EVID>EVID> 0 2G4N F 2G4NF VQNND...tation> 1.5742559432983398 3.2563140392303467 EVI...D> 1 2G4N F 2G4NF

  8. Data of evolutionary structure change: 1B5XA-2G4NF [Confc[Archive

    Lifescience Database Archive (English)

    Full Text Available 1B5XA-2G4NF 1B5X 2G4N A F KVFERCELARTLKRLGMDGYRGISLANWMCLAKWESGYN...G HHHH -GGGG -- EVID>EVID> 0 2G4N F 2G4NF ELKDL...242798 2.054610013961792 4.014041900634766 ...EVID> 1 2G4N F 2G4NF

  9. Data of evolutionary structure change: 1B7OA-2G4NF [Confc[Archive

    Lifescience Database Archive (English)

    Full Text Available 1B7OA-2G4NF 1B7O 2G4N A F KVFERCELARTLKRLGMDGYRGISLANWMCLAKWESQYN... HHHH - GGGG -- EVID>EVID> 0 2G4N F 2G4NF IVQNN...on> 0.7017530202865601 1.3242100477218628 EVID> 1 2G4N F 2G4NF <

  10. Data of evolutionary structure change: 1B06A-1UNFX [Confc[Archive

    Lifescience Database Archive (English)


  11. Data of evolutionary structure change: 1B5WA-2G4NF [Confc[Archive

    Lifescience Database Archive (English)

    Full Text Available 1B5WA-2G4NF 1B5W 2G4N A F KVFERCELARTLKRLGMDGYRGISLANWMCLAKWESGYN...G HHHH -GGGG -- EVID>EVID> 0 2G4N F 2G4NF ELKDL...18 2.079693078994751 4.073005199432373 EVID>...EVID> 1 2G4N F 2G4NF

  12. Data of evolutionary structure change: 1B7NA-2G4NF [Confc[Archive

    Lifescience Database Archive (English)

    Full Text Available 1B7NA-2G4NF 1B7N 2G4N A F KVFERCELARTLKRLGMDGYRGISLANWMCLAKWLSGYN... HHHH - GGGG -- EVID>EVID> 0 2G4N F 2G4NF IVQNN...n> 0.6914700269699097 1.3510249853134155 EVID> 1 2G4N F 2G4NF

  13. Data of evolutionary structure change: 1B06D-1UNFX [Confc[Archive

    Lifescience Database Archive (English)


  14. Data of evolutionary structure change: 1B1ZA-2NTSA [Confc[Archive

    Lifescience Database Archive (English)


  15. Data of evolutionary structure change: 1B1ZC-2NTSA [Confc[Archive

    Lifescience Database Archive (English)


  16. Data of evolutionary structure change: 1B1ZD-2NTSA [Confc[Archive

    Lifescience Database Archive (English)


  17. Data of evolutionary structure change: 1B1ZB-2NTSA [Confc[Archive

    Lifescience Database Archive (English)


  18. The histone demethylase Jarid1b is required for hematopoietic stem cell self-renewal

    DEFF Research Database (Denmark)

    Stewart, Morag H; Albert, Mareike; Sroczynska, Patrycja;


    Jarid1b/KDM5b is a histone demethylase that regulates self-renewal and differentiation in stem cells and cancer, however its function in hematopoiesis is unclear. Here, we find that Jarid1b is highly expressed in primitive hematopoietic compartments and is overexpressed in acute myeloid leukemias...

  19. The Phosphate Exporter xpr1b Is Required for Differentiation of Tissue-Resident Macrophages

    Directory of Open Access Journals (Sweden)

    Ana M. Meireles


    Full Text Available Phosphate concentration is tightly regulated at the cellular and organismal levels. The first metazoan phosphate exporter, XPR1, was recently identified, but its in vivo function remains unknown. In a genetic screen, we identified a mutation in a zebrafish ortholog of human XPR1, xpr1b. xpr1b mutants lack microglia, the specialized macrophages that reside in the brain, and also displayed an osteopetrotic phenotype characteristic of defects in osteoclast function. Transgenic expression studies indicated that xpr1b acts autonomously in developing macrophages. xpr1b mutants display no gross developmental defects that may arise from phosphate imbalance. We constructed a targeted mutation of xpr1a, a duplicate of xpr1b in the zebrafish genome, to determine whether Xpr1a and Xpr1b have redundant functions. Single mutants for xpr1a were viable, and double mutants for xpr1b;xpr1a were similar to xpr1b single mutants. Our genetic analysis reveals a specific role for the phosphate exporter Xpr1 in the differentiation of tissue macrophages.

  20. Structural basis for inhibition of the protein tyrosine phosphatase 1B by phosphotyrosine peptide mimetics

    NARCIS (Netherlands)

    Groves, M R; Yao, Z J; Roller, P P; Burke, T R; Barford, D


    Protein tyrosine phosphatases regulate diverse cellular processes and represent important targets for therapeutic intervention in a number of diseases. The crystal structures of protein tyrosine phosphatase 1B (PTP1B) in complex with small molecule inhibitors based upon two classes of phosphotyrosin

  1. Jarid1b targets genes regulating development and is involved in neural differentiation

    DEFF Research Database (Denmark)

    Schmitz, Sandra U; Albert, Mareike; Malatesta, Martina;


    to transcription start sites of genes encoding developmental regulators, of which more than half are also bound by Polycomb group proteins. Virtually all Jarid1b target genes are associated with H3K4me3 and depletion of Jarid1b in ESCs leads to a global increase of H3K4me3 levels. During neural differentiation...

  2. Molecular dynamics simulations of interaction between protein-tyrosine phosphatase 1B and a bidentate inhibitor

    Institute of Scientific and Technical Information of China (English)

    Gui-xia LIU; Jin-zhi TAN; Chun-ying NIU; Jian-hua SHEN; Xiao-min LUO; Xu SHEN; Kai-xian CHEN; Hua-liang JIANG


    Aim: To investigate the dynamic properties of protein-tyrosine phosphatase (PTP)1B and reveal the structural factors responsible for the high inhibitory potency and selectivity of the inhibitor SNA for PTP1B. Methods: We performed molecular dynamics (MD) simulations using a long time-scale for both PTP1B and PTP1B complexed with the inhibitor SNA, the most potent and selective PTP1B inhibitor reported to date. The trajectories were analyzed by using principal component analysis. Results: Trajectory analyses showed that upon binding the ligand, the flexibility of the entire PTP1B molecule decreases. The most notable change is the movement of the WPD-loop. Our simulation results also indicated that electrostatic interactions contribute more to PTP1B-SNA complex conformation than the van der Waals interactions, and that Lys41, Arg47, and Asp48 play important roles in determining the conformation of the inhibitor SNA and in the potency and selectivity of the inhibitor. Of these, Arg47 contributed most. These results were in agreement with previous experimental results. Conclusion: The information presented here suggests that potent and selective PTP1B inhibitors can be designed by targeting the surface residues, for example the region containing Lys41,Arg47, and Asp48, instead of the second phosphate binding site (besides the active phosphate binding site).

  3. Analyzing the role of AP-1B in polarized sorting from recycling endosomes in epithelial cells. (United States)

    Fölsch, Heike


    Epithelial cells polarize their plasma membrane into apical and basolateral domains where the apical membrane faces the luminal side of an organ and the basolateral membrane is in contact with neighboring cells and the basement membrane. To maintain this polarity, newly synthesized and internalized cargos must be sorted to their correct target domain. Over the last ten years, recycling endosomes have emerged as an important sorting station at which proteins destined for the apical membrane are segregated from those destined for the basolateral membrane. Essential for basolateral sorting from recycling endosomes is the tissue-specific adaptor complex AP-1B. This chapter describes experimental protocols to analyze the AP-1B function in epithelial cells including the analysis of protein sorting in LLC-PK1 cells lines, immunoprecipitation of cargo proteins after chemical crosslinking to AP-1B, and radioactive pulse-chase experiments in MDCK cells depleted of the AP-1B subunit μ1B.

  4. Wave-of-Advance Models of the Diffusion of the Y Chromosome Haplogroup R1b1b2 in Europe


    Per Sjödin; Olivier François


    Whether or not the spread of agriculture in Europe was accompanied by movements of people is a long-standing question in archeology and anthropology, which has been frequently addressed with the help of population genetic data. Estimates on dates of expansion and geographic origins obtained from genetic data are however sensitive to the calibration of mutation rates and to the mathematical models used to perform inference. For instance, recent data on the Y chromosome haplogroup R1b1b2 (M269)...

  5. Identifying and structurally characterizing CD1b in Aotus nancymaae owl monkeys. (United States)

    Castillo, Fabio; Guerrero, Carlos; Trujillo, Esperanza; Delgado, Gabriela; Martinez, Pilar; Salazar, Luz M; Barato, Paola; Patarroyo, Manuel E; Parra-López, Carlos


    This study reports the molecular characterization and tissue expression of the non-human Aotus nancymaae primate CD1b isoform in the search for an experimental animal model to be used in evaluating the role of non-peptide antigen-presentation molecules in the immune response to infectious agents. CD1b expression on the surface of A. nancymaae peripheral blood monocyte-derived dendritic cells, shown by flow cytometry, was made possible by using human CD1b isoform antibodies. Studying the expression of CD1b-encoded transcripts revealed this molecule's broad distribution in several tissues. The A. nancymaae CD1b transcript-encoded amino-acid sequence showed 95.5% identity with the human sequence. Such high sequence homology was reflected in the identical structural conservation of how pockets A', C' and F' and tunnel T' conforming the antigen's binding site are organized, the similar arrangement of those amino-acids interacting with the T-cell receptor (TCR) during antigen presentation, and the conservation of YQNI-motif sequence in the cytoplasmatic tail (responsible for the molecule's intracellular trafficking in humans). Comparing the structure of human CD1a and CD1b and mouse CD1d proteins with CD1b structure in A. nancymaae obtained by minimization revealed that changes in the latter molecule's alpha1 and alpha2 domains imposed a narrowing of the antigen-binding groove in A. nancymaae CD1b. The high structural similarity between A. nancymaae CD1b and that from humans presented in this study leads to A. nancymaae being proposed as a suitable experimental animal model for analyzing CD1b in vivo, mainly in bacterial and parasite infections such as tuberculosis and malaria, respectively.

  6. Maternal BIS Sensitivity, Overprotective Parenting, and Children's Internalizing Behaviors. (United States)

    Kiel, Elizabeth J; Maack, Danielle J


    Although sensitivity to the Behavioral Inhibition System within Gray's (1970) reinforcement sensitivity theory relates to individuals' own depressive and anxious symptomatology, less is known about how parental BIS sensitivity relates to early indicators of internalizing problems in young children. Moreover, the extent to which this parental characteristic relates to parenting behavior, and children's internalizing problems above and beyond parenting, remains unknown. The current study assessed maternal BIS sensitivity, overprotective parenting, and toddlers' internalizing behaviors in a sample of 91 mothers while controlling for mothers' own internalizing symptomatology. Heightened BIS sensitivity related to both overprotective parenting and internalizing behaviors. Overprotective parenting partially mediated the relation between BIS sensitivity and children's internalizing behaviors, although BIS sensitivity maintained a marginal relation to internalizing behaviors. Maternal BIS sensitivity and toddler internalizing behaviors may represent a shared disposition towards inhibition that is somewhat accounted for by overprotective parenting. PMID:22904590

  7. Multiwavelength Observations of AB Doradus

    CERN Document Server

    Slee, O B; Johnston-Hollitt, M; Budding, E


    We have observed the bright, magnetically active multiple star AB Doradus in a multiwavelength campaign centring around two large facility allocations in November 2006 and January, 2007. Our observations have covered at least three large flares. These flares were observed to produce significant hardening of the X-ray spectra during their very initial stages. We monitored flare-related effects using the Suzaku X-ray satellite and the Australia Telescope Compact Array at 3.6 and 6 cm. Observations at 11 and 21 cm were also included, but they were compromised by interference. From our multiwavelength coverage we find that the observed effects can be mainly associated with a large active region near longitude zero. The second major X-ray and microwave flare of Jan 8, 2007 was observed with a favourable geometry that allowed its initial high-energy impulsive phase to be observed in the higher frequency range of Suzaku's XIS detectors. The fractional circular polarisation was measured for the complete runs, for 25 ...

  8. GINGA Observations of AB Doradus (United States)

    Vilhu, O.; Tsuru, T.; Collier Cameron, A.

    We report GINGA observations of the pre main sequence star AB Doradus (HD 36705), performed during 8 - 12 January, 1990. Some rotational modulation might be present. four X-ray flares were detected. Three of these events were similar to the EINSTEIN HRI-flare (Vilhu and Linsky, 1987), with decay times around 25 min. The last flare had long rise and decay times (100 min), resembling the EXOSAT flares observed by Collier Cameron (1988). The mean flare spectrum can be fitted by a thermal bremstrahlung with temperature 5.0 keV, or by a power-law model with photon index 2.2. The 3 upper limit of the Iron line equivalent width in the flare spectrum is 1 keV, weaker than predicted by thermal models. This Iron line anomaly was first discussed in the case of UX Ari by Tsuru et. al. (1989). However, normal equivalent widths can be derived from several EXOSAT spectra of active cool stars (Pallavicini and Tagliaferri, 1990). We discuss the possibility that the continuum from non-thermal electrons (producing also the microwave emission) could occasionally lower the apparent equivalent width. The mechanism works for reasonably low magnetic field strengths and electon power-law indexes. However, a large population of non-thermal electrons is needed (comparable to the thermal one). Stronger magnetic fields could explain the radio emission with less electrons, but then the non-thermal X-ray continuum remains small.

  9. Applying experimental constraints to a one-dimensional model for BiS2 superconductivity (United States)

    Griffith, M. A.; Foyevtsova, K.; Continentino, M. A.; Martins, G. B.


    Recent ARPES measurements [Sugimoto et al., Phys. Rev. B 92 (2015) 041113] have confirmed the one-dimensional character of the electronic structure of CeO0.5 F0.5 BiS2, a representative of BiS2-based superconductors. In addition, several members of this family present sizable increase in the superconducting transition temperature Tc under application of hydrostatic pressure. Motivated by these two results, we propose an effective one-dimensional three-orbital model, whose kinetic energy part, obtained through ab initio calculations, is supplemented by pair-scattering terms, which are treated at the mean-field level. We solve the gap equations self-consistently and then systematically probe which combination of pair-scattering terms gives results consistent with experiment, namely, a superconducting dome with a maximum Tc at the right chemical potential and a sizable increase in Tc when the magnitude of the hoppings is increased. For these constraints to be satisfied multi-gap superconductivity is required, in agreement with experiments, and one of the hoppings has a dominant influence over the increase of Tc with pressure.

  10. Vibrational spectra, normal coordinate analysis, and conformation of bis(ɑ-cyanoacetylacetonato)Cu(II) (United States)

    Gandomi, Farzad; Vakili, Mohammad; Tayyari, Sayyed Faramarz


    Ab initio calculations, Natural Bond Orbital (NBO) and Atoms-in-Molecules (AIM) analyses, and Fourier transform Raman (3200-350 cm-1) and infrared (4000-200 cm-1) spectral measurements have been made for bis(α-cyanoacetylacetonato)Cu(II), Cu(CNacac)2. The molecular structure and vibrational spectra of Cu(CNacac)2 is compared with those of bis(acetylacetonato)Cu(II), Cu(acac)2. The molecular electronic energies and the equilibrium geometries for all theoretically possible conformations are calculated. A normal coordinate analysis of the vibrational modes has been computed for the most stable conformation of Cu(CNacac)2, D2h symmetry. A complete assignment of the observed band frequencies has been proposed. The metal-O bond strength was investigated by geometry calculations, NBO, AIM, and spectroscopic results to realize the effect of cyano substitution at α-position. All theoretical and vibrational spectroscopic studies confirm stronger metal-ligand bond in Cu(CNacac)2 than that in Cu(acac)2.

  11. Collective rotation from ab initio theory

    CERN Document Server

    Caprio, M A; Vary, J P; Smith, R


    Through ab initio approaches in nuclear theory, we may now seek to quantitatively understand the wealth of nuclear collective phenomena starting from the underlying internucleon interactions. No-core configuration interaction (NCCI) calculations for p-shell nuclei give rise to rotational bands, as evidenced by rotational patterns for excitation energies, electromagnetic moments, and electromagnetic transitions. In this review, NCCI calculations of 7-9Be are used to illustrate and explore ab initio rotational structure, and the resulting predictions for rotational band properties are compared with experiment. We highlight the robustness of ab initio rotational predictions across different choices for the internucleon interaction.

  12. AP calculus AB & BC crash course

    CERN Document Server

    Rosebush, J


    AP Calculus AB & BC Crash Course - Gets You a Higher Advanced Placement Score in Less Time Crash Course is perfect for the time-crunched student, the last-minute studier, or anyone who wants a refresher on the subject. AP Calculus AB & BC Crash Course gives you: Targeted, Focused Review - Study Only What You Need to Know Crash Course is based on an in-depth analysis of the AP Calculus AB & BC course description outline and actual AP test questions. It covers only the information tested on the exams, so you can make the most of your valuable study time. Written by experienced math teachers, our

  13. Imidazo[2,1-b]benzothiazoles. II. Synthesis and antiinflammatory activity of some imidazo[2,1-b]benzothiazoles. (United States)

    El-Shorbagi, A N; Sakai, S; el-Gendy, M A; Omar, N; Farag, H H


    3-[2-[p-(Un)substituted phenyl]imidazo [2,1-b]benzothiazol-3- yl]propionic acid derivatives (2a--e) were prepared via the interaction of the corresponding 2-[p-(un)substituted phenyl]imidazo[2,1-b]benzothiazoles (1a--e) with acrylic acid in the presence of acetic anhydride and acetic acid. Esterification of 2a--e produced methyl esters (3a--e). Upon the interaction of 3a with m-chloroperbenzoic acid, the S-dioxide (4a) was obtained. Compound 5a was prepared from 4a by alkaline hydrolysis. Vilsmeier formylation for 1a--e produced novel [2-[p-(un)substituted phenyl]imidazo[2,1-b]benzothiazol-3- yl]formaldehyde derivatives (6a--e). Derivatives 6a--e reacted with ethyl bromoacetate to give ethyl 3-hydroxy-3-[2-[p-(un)substituted phenyl]imidazo[2,1-b]benzothiazol- 3-yl]propionate esters (7a--e). Compound dl-7a was resolved with l-(+)-tartaric acid. Compounds 2a--e showed weak or no activity in the carrageein-induced paw edema assay. Compound 4a significantly inhibited the leakage of pontamine-sky blue dye into the peritoneal cavity of mice, in the capillary permeability inhibition assay. Compound 5a inhibited the writhing by 62% in the acetic acid-induced writhing assay.

  14. Sulfone-stabilized carbanions for the reversible covalent capture of a posttranslationally-generated cysteine oxoform found in protein tyrosine phosphatase 1B (PTP1B). (United States)

    Parsons, Zachary D; Ruddraraju, Kasi Viswanatharaju; Santo, Nicholas; Gates, Kent S


    Redox regulation of protein tyrosine phosphatase 1B (PTP1B) involves oxidative conversion of the active site cysteine thiolate into an electrophilic sulfenyl amide residue. Reduction of the sulfenyl amide by biological thiols regenerates the native cysteine residue. Here we explored fundamental chemical reactions that may enable covalent capture of the sulfenyl amide residue in oxidized PTP1B. Various sulfone-containing carbon acids were found to react readily with a model peptide sulfenyl amide via attack of the sulfonyl carbanion on the electrophilic sulfur center in the sulfenyl amide. Both the products and the rates of these reactions were characterized. The results suggest that capture of a peptide sulfenyl amide residue by sulfone-stabilized carbanions can slow, but not completely prevent, thiol-mediated generation of the corresponding cysteine-containing peptide. Sulfone-containing carbon acids may be useful components in the construction of agents that knock down PTP1B activity in cells via transient covalent capture of the sulfenyl amide oxoform generated during insulin signaling processes. PMID:27132865

  15. Drug-drug interactions between rosuvastatin and oral antidiabetic drugs occurring at the level of oatp1b1s

    NARCIS (Netherlands)

    Steeg, E. van de; Greupink, R.; Schreurs, M.; Nooijen, I.H.G.; Verhoeck, K.C.M.; Hanemaaijer, R.; Ripken, D.; Monshouwer, M.; Vlaming, M.L.H.; DeGroot, J.; Verwei, M.; Russel, F.G.M.; Huisman, M.T.; Wortelboer, H.M.


    Organic anion-transporting polypeptide 1B1 (OATP1B1) is an important hepatic uptake transporter, of which the polymorphic variant OATP1B1*15 (Asn130Asp and Val174Ala) has been associated with decreased transport activity. Rosuvastatin is an OATP1B1 substrate and often concomitantly prescribed with o

  16. Ibuprofen Inhibits Colitis-Induced Overexpression of TumorRelated Rac1b

    Directory of Open Access Journals (Sweden)

    Paulo Matos


    Full Text Available The serrated pathway to colorectal tumor formation involves oncogenic mutations in the BRAF gene, which are sufficient for initiation of hyperplastic growth but not for tumor progression. A previous analysis of colorectal tumors revealed that overexpression of splice variant Rac1b occurs in around 80% of tumors with mutant BRAF and both events proved to cooperate in tumor cell survival. Here, we provide evidence for increased expression of Rac1b in patients with inflamed human colonic mucosa as well as following experimentally induced colitis in mice. The increase of Rac1b in the mouse model was specifically prevented by the nonsteroidal anti-inflammatory drug ibuprofen, which also inhibited Rac1b expression in cultured HT29 colorectal tumor cells through a cyclooxygenase inhibition–independent mechanism. Accordingly, the presence of ibuprofen led to a reduction of HT29 cell survival in vitro and inhibited Rac1b-dependent tumor growth of HT29 xenografts. Together, our results suggest that stromal cues, namely, inflammation, can trigger changes in Rac1b expression in the colon and identify ibuprofen as a highly specific and efficient inhibitor of Rac1b overexpression in colorectal tumors. Our data suggest that the use of ibuprofen may be beneficial in the treatment of patients with serrated colorectal tumors or with inflammatory colon syndromes.

  17. The arginine vasopressin V1b receptor gene and prosociality: Mediation role of emotional empathy. (United States)

    Wu, Nan; Shang, Siyuan; Su, Yanjie


    The vasopressin V1b receptor (AVPR1B) gene has been shown to be closely associated with bipolar disorder and depression. However, whether it relates to positive social outcomes, such as empathy and prosocial behavior, remains unknown. This study explored the possible role of the AVPR1B gene rs28373064 in empathy and prosociality. A total of 256 men, who were genetically unrelated, non-clinical ethnic Han Chinese college students, participated in the study. Prosociality was tested by measuring the prosocial tendencies of cognitive and emotional empathy using the Interpersonal Reactivity Index (IRI). The single nucleotide polymorphism (SNP), rs28373064, was genotyped using a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis. The results suggest that the AVPR1B gene rs28373064 is linked to emotional empathy and prosociality. The mediation analysis indicated that the effect of the AVPR1B gene on prosociality might be mediated by emotional empathy. This study demonstrated the link between the AVPR1B gene and prosociality and provided evidence that emotional empathy might mediate the relation between the AVPR1B gene and prosociality.

  18. Protein Tyrosine Phosphatase-1B Negatively Impacts Host Defense against Pseudomonas aeruginosa Infection. (United States)

    Yue, Lei; Xie, Zhongping; Li, Hua; Pang, Zheng; Junkins, Robert D; Tremblay, Michel L; Chen, Xiaochun; Lin, Tong-Jun


    Pseudomonas aeruginosa is a major opportunistic pathogen in immune-compromised individuals. Mechanisms governing immune responses to P. aeruginosa infection remain incompletely defined. Herein, we demonstrate that protein tyrosine phosphatase-1B (PTP1B) is a critical negative regulator in P. aeruginosa infection. PTP1B-deficient mice display greatly enhanced bacterial clearance and reduced disease scores, which are accompanied by increased neutrophil infiltration and cytokine production. Interestingly, PTP1B deficiency mainly up-regulates the production of interferon-stimulated response elements-regulated cytokines and chemokines, including chemokine ligand 5 (regulated on activation normal T cell expressed and secreted), CXCL10 (interferon γ-inducible protein 10), and interferon-β production. Further studies reveal that PTP1B deficiency leads to increased interferon regulatory factor 7 (IRF7) expression and activation. These findings demonstrate a novel regulatory mechanism of the immune response to P. aeruginosa infection through PTP1B-IRF7 interaction. This novel PTP1B-IRF7-interferon-stimulated response elements pathway may have broader implications in Toll-like receptor-mediated innate immunity. PMID:27105736

  19. Rrp1b, a new candidate susceptibility gene for breast cancer progression and metastasis.

    Directory of Open Access Journals (Sweden)

    Nigel P S Crawford


    Full Text Available A novel candidate metastasis modifier, ribosomal RNA processing 1 homolog B (Rrp1b, was identified through two independent approaches. First, yeast two-hybrid, immunoprecipitation, and functional assays demonstrated a physical and functional interaction between Rrp1b and the previous identified metastasis modifier Sipa1. In parallel, using mouse and human metastasis gene expression data it was observed that extracellular matrix (ECM genes are common components of metastasis predictive signatures, suggesting that ECM genes are either important markers or causal factors in metastasis. To investigate the relationship between ECM genes and poor prognosis in breast cancer, expression quantitative trait locus analysis of polyoma middle-T transgene-induced mammary tumor was performed. ECM gene expression was found to be consistently associated with Rrp1b expression. In vitro expression of Rrp1b significantly altered ECM gene expression, tumor growth, and dissemination in metastasis assays. Furthermore, a gene signature induced by ectopic expression of Rrp1b in tumor cells predicted survival in a human breast cancer gene expression dataset. Finally, constitutional polymorphism within RRP1B was found to be significantly associated with tumor progression in two independent breast cancer cohorts. These data suggest that RRP1B may be a novel susceptibility gene for breast cancer progression and metastasis.

  20. The Role of PTP1B O-GlcNAcylation in Hepatic Insulin Resistance

    Directory of Open Access Journals (Sweden)

    Yun Zhao


    Full Text Available Protein tyrosine phosphatase 1B (PTP1B, which can directly dephosphorylate both the insulin receptor and insulin receptor substrate 1 (IRS-1, thereby terminating insulin signaling, reportedly plays an important role in insulin resistance. Accumulating evidence has demonstrated that O-GlcNAc modification regulates functions of several important components of insulin signal pathway. In this study, we identified that PTP1B is modified by O-GlcNAcylation at three O-GlcNAc sites (Ser104, Ser201, and Ser386. Palmitate acid (PA impaired the insulin signaling, indicated by decreased phosphorylation of both serine/threonine-protein kinase B (Akt and glycogen synthase kinase 3 beta (GSK3β following insulin administration, and upregulated PTP1B O-GlcNAcylation in HepG2 cells. Compared with the wild-type, intervention PTP1B O-GlcNAcylation by site-directed gene mutation inhibited PTP1B phosphatase activity, resulted in a higher level of phosphorylated Akt and GSK3β, recovered insulin sensitivity, and improved lipid deposition in HepG2 cells. Taken together, our research showed that O-GlcNAcylation of PTP1B can influence insulin signal transduction by modulating its own phosphatase activity, which participates in the process of hepatic insulin resistance.

  1. Pathogenesis-Related Protein 1b1 (PR1b1) Is a Major Tomato Fruit Protein Responsive to Chilling Temperature and Upregulated in High Polyamine Transgenic Genotypes (United States)

    Fatima, Tahira; Topuz, Muhamet; Bernadec, Anne; Sicher, Richard; Handa, Avtar K.; Mattoo, Autar K.


    Plants execute an array of mechanisms in response to stress which include upregulation of defense-related proteins and changes in specific metabolites. Polyamines – putrescine (Put), spermidine (Spd), and spermine (Spm) – are metabolites commonly found associated with abiotic stresses such as chilling stress. We have generated two transgenic tomato lines (556HO and 579HO) that express yeast S-adenosylmethionine decarboxylase and specifically accumulate Spd and Spm in fruits in comparison to fruits from control (556AZ) plants (Mehta et al., 2002). Tomato fruits undergo chilling injury at temperatures below 13°C. The high Spd and Spm tomato together with the control azygous line were utilized to address role(s) of polyamines in chilling-injury signaling. Exposure to chilling temperature (2°C) led to several-fold increase in the Put content in all the lines. Upon re-warming of the fruits at 20°C, the levels of Spd and Spm increased further in the fruit of the two transgenic lines, the higher levels remaining stable for 15 days after re-warming as compared to the fruit from the control line. Profiling their steady state proteins before and after re-warming highlighted a protein of ∼14 kD. Using proteomics approach, protein sequencing and immunoblotting, the ∼14-kD protein was identified as the pathogenesis related protein 1b1 (PR1b1). The PR1b1 protein accumulated transiently in the control fruit whose level was barely detectable at d 15 post-warming while in the fruit from both the 556HO and 579HO transgenic lines PR1b1 abundance increased and remained stable till d 15 post warming. PR1b1 gene transcripts were found low in the control fruit with a visible accumulation only on d 15 post warming; however, in both the transgenic lines it accumulated and increased soon after rewarming being several-fold higher on day 2 while in 556HO line this increase continued until d 6 than the control fruit. The chilling-induced increase in PR1b1 protein seems independent

  2. A P387L variant in protein tyrosine phosphatase-1B (PTP-1B) is associated with type 2 diabetes and impaired serine phosphorylation of PTP-1B in vitro

    DEFF Research Database (Denmark)

    Echwald, Søren M; Riis, Helle Bach; Vestergaard, Henrik;


    In the present study, we tested the hypothesis that variability in the protein tyrosine phosphatase-1B (PTP-1B) gene is associated with type 2 diabetes. Using single-strand conformational polymorphism analysis, we examined cDNA of PTP-1B from 56 insulin-resistant patients with type 2 diabetes...... as well as cDNA from 56 obese patients. Four silent variants, (NT CGA-->CGG) R199R, (NT CCC-->CCT) P303P, 3'UTR+104insG, and 3'UTR+86T-->G, and one missense variant, P387L, were found. Subsequent analysis on genomic DNA revealed two intron variants, IVS9+57C-->T and IVS9+58G-->A, and two missense variants...... frequency 0.5%, CI 0.1-1.1), showing a significant association to type 2 diabetes (P = 0.036). In vitro, p34 cell division cycle (p34(cdc2)) kinase-directed incorporation of [gamma-(32)P]ATP was reduced in a mutant peptide compared with native peptide (387P: 100% vs. 387L: 28.4 +/- 5.8%; P = 0...

  3. Regulation of brown fat adipogenesis by protein tyrosine phosphatase 1B.

    Directory of Open Access Journals (Sweden)

    Kosuke Matsuo

    Full Text Available Protein-tyrosine phosphatase 1B (PTP1B is a physiological regulator of insulin signaling and energy balance, but its role in brown fat adipogenesis requires additional investigation.To precisely determine the role of PTP1B in adipogenesis, we established preadipocyte cell lines from wild type and PTP1B knockout (KO mice. In addition, we reconstituted KO cells with wild type, substrate-trapping (D/A and sumoylation-resistant (K/R PTP1B mutants, then characterized differentiation and signaling in these cells. KO, D/A- and WT-reconstituted cells fully differentiated into mature adipocytes with KO and D/A cells exhibiting a trend for enhanced differentiation. In contrast, K/R cells exhibited marked attenuation in differentiation and lipid accumulation compared with WT cells. Expression of adipogenic markers PPARγ, C/EBPα, C/EBPδ, and PGC1α mirrored the differentiation pattern. In addition, the differentiation deficit in K/R cells could be reversed completely by the PPARγ activator troglitazone. PTP1B deficiency enhanced insulin receptor (IR and insulin receptor substrate 1 (IRS1 tyrosyl phosphorylation, while K/R cells exhibited attenuated insulin-induced IR and IRS1 phosphorylation and glucose uptake compared with WT cells. In addition, substrate-trapping studies revealed that IRS1 is a substrate for PTP1B in brown adipocytes. Moreover, KO, D/A and K/R cells exhibited elevated AMPK and ACC phosphorylation compared with WT cells.These data indicate that PTP1B is a modulator of brown fat adipogenesis and suggest that adipocyte differentiation requires regulated expression of PTP1B.

  4. 40 CFR 721.5760 - Phenol, 4,4′-[methylene-bis (oxy-2,1-ethanediylthio)]bis-. (United States)


    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Phenol, 4,4â²- bis-. 721.5760 Section... Substances § 721.5760 Phenol, 4,4′- bis-. (a) Chemical substances and significant new uses subject to reporting. (1) The chemical substance phenol, 4,4′- bis- (PMN P-87-1760) is subject to reporting under...

  5. Synthesis and Structure of Bis-(o-vanillin)di-pyridine Nickel(Ⅱ)-pyridine Dihydrate

    Institute of Scientific and Technical Information of China (English)

    孙命; 王瑾玲; 段月琴; 缪方明; 翁林红; 冷雪冰


    The structure of the complex bis-(o-vanillin)di-pyridine nickel(Ⅱ)([ Ni X-ray analysis.The crystal data are as follows: Monoclinic,P21/n,a=12.273(1),b=17.4700.674mm-1,F(000)=1328,final R=0.0428,Rw=0.1228 for 4528 observable reflections with I≥2σ(Ⅰ).The Nickel(Ⅱ)atom in the complex has a slightly distorted octahedral coordination geometr y and is six-coordinated by four O atoms from two O-Vanillin ligands and two N atoms from two pyridines.In the crystal,the Ni(Ⅱ)-complex and water molecules are linked through a network of hydrogen bonds.

  6. Current Perspectives on Interferon Beta-1b for the Treatment of Multiple Sclerosis


    Marziniak, Martin; Meuth, Sven


    Interferon (IFN) beta-1b was the first disease-modifying therapy to be approved for the treatment of multiple sclerosis (MS), and over 21 years of follow-up data demonstrate its efficacy and long-term safety profile. Following recent regulatory approvals in the USA and European Union, IFN beta-1b is now one of the seven disease-modifying therapies [intramuscular IFN beta-1a; subcutaneous (SC) IFN beta-1a; IFN beta-1b SC; glatiramer acetate SC; oral dimethyl fumarate; oral teriflunomide; and i...

  7. Otx2 Requires Lmx1b to Control the Development of Mesodiencephalic Dopaminergic Neurons (United States)

    Sherf, Orna; Nashelsky Zolotov, Limor; Liser, Keren; Tilleman, Hadas; Jovanovic, Vukasin M.; Zega, Ksenija; Jukic, Marin M.; Brodski, Claude


    Studying the development of mesodiencephalic dopaminergic (mdDA) neurons provides an important basis for better understanding dopamine-associated brain functions and disorders and is critical for establishing cell replacement therapy for Parkinson’s disease. The transcription factors Otx2 and Lmx1b play a key role in the development of mdDA neurons. However, little is known about the genes downstream of Otx2 and Lmx1b in the pathways controlling the formation of mdDA neurons in vivo. Here we report on our investigation of Lmx1b as downstream target of Otx2 in the formation of mdDA neurons. Mouse mutants expressing Otx2 under the control of the En1 promoter (En1+/Otx2) showed increased Otx2 expression in the mid-hindbrain region, resulting in upregulation of Lmx1b and expansion of mdDA neurons there. In contrast, Lmx1b-/- mice showed decreased expression of Otx2 and impairments in several aspects of mdDA neuronal formation. To study the functional interaction between Otx2 and Lmx1b, we generated compound mutants in which Otx2 expression was restored in mice lacking Lmx1b (En1+/Otx2;Lmx1b-/-). In these animals Otx2 was not sufficient to rescue any of the aberrations in the formation of mdDA neurons caused by the loss of Lmx1b, but rescued the loss of ocular motor neurons. Gene expression studies in Lmx1b-/- embryos indicated that in these mutants Wnt1, En1 and Fgf8 expression are induced but subsequently lost in the mdDA precursor domain and the mid-hindbrain organizer in a specific, spatio-temporal manner. In summary, we demonstrate that Otx2 critically depends on Lmx1b for the formation of mdDA neurons, but not for the generation of ocular motor neurons. Moreover, our data suggest that Lmx1b precisely maintains the expression pattern of Wnt1, Fgf8 and En1, which are essential for mid-hindbrain organizer function and the formation of mdDA neurons. PMID:26444681

  8. Otx2 Requires Lmx1b to Control the Development of Mesodiencephalic Dopaminergic Neurons.

    Directory of Open Access Journals (Sweden)

    Orna Sherf

    Full Text Available Studying the development of mesodiencephalic dopaminergic (mdDA neurons provides an important basis for better understanding dopamine-associated brain functions and disorders and is critical for establishing cell replacement therapy for Parkinson's disease. The transcription factors Otx2 and Lmx1b play a key role in the development of mdDA neurons. However, little is known about the genes downstream of Otx2 and Lmx1b in the pathways controlling the formation of mdDA neurons in vivo. Here we report on our investigation of Lmx1b as downstream target of Otx2 in the formation of mdDA neurons. Mouse mutants expressing Otx2 under the control of the En1 promoter (En1+/Otx2 showed increased Otx2 expression in the mid-hindbrain region, resulting in upregulation of Lmx1b and expansion of mdDA neurons there. In contrast, Lmx1b-/- mice showed decreased expression of Otx2 and impairments in several aspects of mdDA neuronal formation. To study the functional interaction between Otx2 and Lmx1b, we generated compound mutants in which Otx2 expression was restored in mice lacking Lmx1b (En1+/Otx2;Lmx1b-/-. In these animals Otx2 was not sufficient to rescue any of the aberrations in the formation of mdDA neurons caused by the loss of Lmx1b, but rescued the loss of ocular motor neurons. Gene expression studies in Lmx1b-/- embryos indicated that in these mutants Wnt1, En1 and Fgf8 expression are induced but subsequently lost in the mdDA precursor domain and the mid-hindbrain organizer in a specific, spatio-temporal manner. In summary, we demonstrate that Otx2 critically depends on Lmx1b for the formation of mdDA neurons, but not for the generation of ocular motor neurons. Moreover, our data suggest that Lmx1b precisely maintains the expression pattern of Wnt1, Fgf8 and En1, which are essential for mid-hindbrain organizer function and the formation of mdDA neurons.

  9. Fragile X mental retardation protein interactions with the microtubule associated protein 1B RNA


    Menon, Lakshmi; Mader, Samantha Ann; Mihailescu, Mihaela-Rita


    Fragile X mental retardation syndrome, the most common form of inherited mental retardation, is caused by the absence of the fragile X mental retardation protein (FMRP). FMRP has been shown to use its arginine–glycine–glycine (RGG) box to bind to a subset of RNA targets that form a G quadruplex structure. We performed a detailed analysis of the interactions between the FMRP RGG box and the microtubule associated protein 1B (MAP1B) mRNA, a relevant in vivo FMRP target. We show that MAP1B RNA f...

  10. Experimental studies and ab initio calculations on characteristics of the C state of SF2 radical

    International Nuclear Information System (INIS)

    SF2 radicals were generated by a pulsed dc discharge in the mixture gas beam of SF2 and Ar. The (2+1) resonance-enhanced multiphoton ionization (REMPI) excitation spectroscopy of SF2 radical was obtained between 325 and 365 nm. The SF+ ion signals were also observed in the same wavelength range. The analysis shows that the spectrum can be assigned as the two-photon resonant excitation of SF2 radical (B-tilde1 B1 and (C-tilde1 A1 states). And also, ab initio calculations suggest that the C-tilde state is a bonding state with Rydberg characteristic. The potential energy surfaces (PESs) of SF2 and SF2+ by ab initio calculations suggest that SF+ ions originate from dissociation processes of excited SF2+ ions. (author)


    Lifescience Database Archive (English)

    Full Text Available DREDR1ATRD29AB S000152 23-June-2006 (last modified) kehi Related to responsiveness ...dependent in the ABA-responsive expression of the rd29A in Arabidopsis; DRE; drought; water stress; oxidativ

  12. Reference: DREDR1ATRD29AB [PLACE

    Lifescience Database Archive (English)

    Full Text Available ization and expression of two Arabidopsis DREB2 genes encoding DRE-binding proteins...DREDR1ATRD29AB Nakashima K, Shinwari ZK, Sakuma Y, Seki M, Miura S, Shinozaki K, Yamaguchi-Shinozaki K Organ

  13. Poly[bis[μ-1,4-bis(imidazol-1-ylmethylbenzene]dichloridocadmium(II

    Directory of Open Access Journals (Sweden)

    Xinliang Hu


    Full Text Available The title compound, [CdCl2(C14H14N42]n, has a slightly distorted octahedral coordination geometry, formed by four N atoms from 1,4-bis(imidazol-1-ylmethylbenzene ligands and two Cl atoms, giving a two-dimensional network. The Cd atom lies on a centre of inversion.

  14. Bis-spirolabdane Diterpenoids from Leonotis nepetaefolia


    Li, Jun; Fronczek, Frank R.; Ferreira, Daneel; Burandt, Charles L.; Setola, Vincent; Roth, Bryan L.; Zjawiony, Jordan K.


    Ten new bis-spirolabdane diterpenoids, leonepetaefolins A–E (1, 3, 5, 7, 9) and 15-epi-leonepetaefolins A-E (2, 4, 6, 8, 10), together with eight known labdane diterpenoids (11–18) as well as two known flavonoids apigenin and cirsiliol, were isolated from the leaves of Leonotis nepetaefolia. The structures of the new compounds were determined on the basis of 1D-and 2D-NMR experiments including 1H, 13C, DEPT, 1H-1H COSY, HSQC, HMBC, and NOESY. The absolute configuration of an epimeric mixture ...

  15. A General Scheme for Formalizing Defaults Using the Predicate ab(I,S)

    Institute of Scientific and Technical Information of China (English)

    SHEN Yidong


    In common sense reasoning two typical types of defaultsare encountered. One is of the form "All birds can fly except b1,b2,..., and bm (m1)", and the other "All birds can fly,but there exist exceptions". The first type of defaults is readilyformalized but the other, as some researchers have noticed, is difficultto deal with. This paper establishes a general scheme for formalizing defaults of the two types, the key to which is the introduction of atwo-argument predicate ab (I, S) to represent exceptional objects.

  16. Detection of the urban heat island in Beijing using HJ-1B satellite imagery

    Institute of Scientific and Technical Information of China (English)


    Satellite images are used extensively in studying the urban heat island(UHI) phenomenon.We evaluated the suitability of thermal infrared(TIR) data from the HJ-1B satellite for detecting UHI using a case study in Beijing.Two modified algorithms for retrieving the land surface temperature(LST) from HJ-1B data were tested.The results were compared with LST images derived from a Landsat TM thermal band and the MODIS LST output.The spatial pattern of UHI generated using HJ-1B data matched well with that produced using TM and MODIS data.Of the two algorithms,the mono-window algorithm performed better but further tests are necessary.With more frequent coverage than TM and higher spatial resolution than MODIS,the HJ-1B TIR data present a unique opportunity to study thermal environments in cities in China and neighboring countries.

  17. Interleukin 1B Variant -1473G/C (rs1143623) Influences Triglyceride and Interleukin 6 Metabolism


    Delgado-Lista, Javier; Garcia-Rios, Antonio; Perez-Martinez, Pablo; Solivera, Juan; Yubero-Serrano, Elena M; Fuentes, Francisco; Parnell, Laurence D.; Jian SHEN; Gomez, Purificacion; Jimenez-Gomez, Yolanda; Gomez-Luna, Maria J.; Marin, Carmen; Belisle, Sarah E; Rodriguez-Cantalejo, Fernando; Meydani, Simin N.


    Healthy young male carriers of the minor allele of IL1B -1473G/C have exaggerated lipid and inflammatory postprandial responses, which could help unravel these relationships during the postprandial state.

  18. Protein Tyrosine Phosphatase 1B Inhibitors from the Roots of Cudrania tricuspidata

    Directory of Open Access Journals (Sweden)

    Tran Hong Quang


    Full Text Available A chemical investigation of the methanol extract from the roots of Cudrania tricuspidata resulted in the isolation of 16 compounds, including prenylated xanthones 1–9 and flavonoids 10–16. Their structures were identified by NMR spectroscopy and mass spectrometry and comparisons with published data. Compounds 1–9 and 13–16 significantly inhibited PTP1B activity in a dose dependent manner, with IC50 values ranging from 1.9–13.6 μM. Prenylated xanthones showed stronger PTP1B inhibitory effects than the flavonoids, suggesting that they may be promising targets for the future discovery of novel PTP1B inhibitors. Furthermore, kinetic analyses indicated that compounds 1 and 13 inhibited PTP1B in a noncompetitive manner; therefore, they may be potential lead compounds in the development of anti-obesity and -diabetic agents.

  19. MISR Level 1B1 Local Mode Radiance Data V002 (United States)

    National Aeronautics and Space Administration — This is the Local Mode Level 1B1 Product containing the DNs radiometrically scaled to radiances with no geometric resampling (Suggested Usage: The MISR Instrument...

  20. GLAS/ICESat L1B Global Waveform-based Range Corrections Data V033 (United States)

    National Aeronautics and Space Administration — The level 1B waveform parameterization data will contain waveform-based range corrections and surface characteristics at the full 40 per second resolution. Data...

  1. SAGE III Meteor-3M L1B Solar Event Transmission Data (Native) V004 (United States)

    National Aeronautics and Space Administration — Level 1B pixel group transmission profiles for a single solar event (Suggested Usage: Vertical transmission profiles for input into an inversion algorithm)

  2. SAGE III Meteor-3M L1B Solar Event Transmission Data (Native) V003 (United States)

    National Aeronautics and Space Administration — Level 1B pixel group transmission profiles for a single solar event (Suggested Usage: Vertical transmission profiles for input into an inversion algorithm)

  3. The new powder diffractometer D1B of the Institut Laue Langevin (United States)

    Puente Orench, I.; Clergeau, J. F.; Martínez, S.; Olmos, M.; Fabelo, O.; Campo, J.


    D1B is a medium resolution high flux powder diffractometer located at the Institut Laue Langevin, ILL. D1B a suitable instrument for studying a large variety of polycrystalline materials. D1B runs since 1998 as a CRG (collaborating research group) instrument, being exploited by the CNRS (Centre National de la Recherche Scientifique, France) and CSIC (Consejo Superior de Investigaciones Cientificas, Spain). In 2008 the Spanish CRG started an updating program which included a new detector and a radial oscillating collimator (ROC). The detector, which has a sensitive height of 100mm, covers an angular range of 128°. Its 1280 gold wires provide a neutron detection point every 0.1°. The ROC is made of 198 gadolinium- based absorbing collimation blades, regular placed every 0.67°. Here the present characteristics of D1B are reviewed and the different experimental performances will be presented.

  4. Data of evolutionary structure change: 1B0FA-1O37A [Confc[Archive

    Lifescience Database Archive (English)

    Full Text Available -GYDPV >EEE - > ATOM 556 CA ARG ...ntryIDChain>1O37A KSIVHPSYNSN >EEEEE ...> 1B0FA LGRNR-GIASV > - ...KSSGTSYPDV > > ATOM 1849 CA THR ...tryIDChain> AHCYK----SGIQV >GGG ---- EEE>

  5. Dark Matter and Neutrino Masses from Global $U(1)_{B-L}$ Symmetry Breaking

    CERN Document Server

    Lindner, Manfred; Schwetz, Thomas


    We present a scenario were neutrino masses and Dark Matter are related due to a global $U(1)_{B-L}$ symmetry. Specifically we consider neutrino mass generation via the Zee{Babu two-loop mecha- nism, augmented by a scalar singlet whose VEV breaks the global $U(1)_{B-L}$ symmetry. In order to obtain a Dark Matter candidate we introduce two Standard Model singlet fermions. They form a pseudo-Dirac particle and are stable because of a remnant $Z_2$ symmetry. Hence, in this model the stability of Dark Matter follows from the global $U(1)_{B-L}$ symmetry. We discuss the Dark Matter phenomenology of the model, and compare it to similar models based on gauged $U(1)_{B-L}$. We argue that in contrast to the gauged versions, the model based on the global symmetry does not suffer from sever constraints from Z' searches.

  6. Nature of Pi1B pulsations as inferred from ground and satellite observations (United States)

    Lessard, M. R.; Lund, E. J.; Jones, S. L.; Arnoldy, R. L.; Posch, J. L.; Engebretson, M. J.; Hayashi, K.


    The occurrence of Pi1B pulsations is well-documented, including the fact that these pulsations can be observed both on the ground and at geosynchronous orbit at substorm onset, although information about their propagation characteristics has been lacking. In this paper, data are presented from FAST, GOES 9 and various ground stations that show the simultaneous observations of Pi1B pulsations in association with an onset. While the data at GOES 9 show that the pulsations are compressional in nature, data from FAST show the presence of shear mode waves, implying that Pi1B mode conversion of some type must take place in the region between geosynchronous orbit and FAST altitudes. An additional point is that Pi1B pulsations apparently propagate through auroral phenomena routinely, begging the question of what role they may play.

  7. Trafficking of α1B-adrenergic receptor mediated by inverse agonist in living cells

    Institute of Scientific and Technical Information of China (English)

    MingXU; Ying-huaGUAN; NingXU; Zhang-yiLIANG; Shu-yiWang; YaoSONG; Chi-deHAN; Xin-shengZHAO; You-yiZHANG


    AIM The project is aimed at understanding the action of inverse agonist at single molecule level and capturing the real time picture of molecular behavior of α1B-adrenergic receptor (AR) mediated by inverse agonist in living cells by single molecule detection (SMD). METHODS The location and distribution of α1B-AR was detected by laser confocal and whole cell 3H-prazosin binding assay. Dynamic imaging of BODIPY-FL-labeled prazosin (Praz), specific antagonist of (1-AR, was observed in α1B-AR stably expressed human embryonic kidney 293 (HEK293) living cells. The detection of real-time dynamic behaviors of AR was achieved by using fluorescence-labeled AR and its ligand combined with SMD techniques. RESULTS α1B-AR was predominantly distributed on the cell surface and 8.2% of the total receptors were located in cytosol.

  8. Injectable interferon beta-1b for the treatment of relapsing forms of multiple sclerosis

    Directory of Open Access Journals (Sweden)

    Slobodan M Jankovic


    Full Text Available Slobodan M JankovicPharmacology Department, Medical Faculty, University of Kragujevac, Kragujevac, SerbiaAbstract: Multiple sclerosis (MS is chronic inflammatory and demyelinating disease with either a progressive (10%–15% or relapsing-remitting (85%–90% course. The pathological hallmarks of MS are lesions of both white and grey matter in the central nervous system. The onset of the disease is usually around 30 years of age. The patients experience an acute focal neurologic dysfunction which is not characteristic, followed by partial or complete recovery. Acute episodes of neurologic dysfunction with diverse signs and symptoms will then recur throughout the life of a patient, with periods of partial or complete remission and clinical stability in between. Currently, there are several therapeutic options for MS with disease-modifying properties. Immunomodulatory therapy with interferon beta-1b (IFN-β1b or -1a, glatiramer and natalizumab shows similar efficacy; in a resistant or intolerant patient, the most recently approved therapeutic option is mitoxantrone. IFN-β1b in patients with MS binds to specific receptors on surface of immune cells, changing the expression of several genes and leading to a decrease in quantity of cell-associated adhesion molecules, inhibition of major histocompatibility complex class II expression and reduction in inflammatory cells migration into the central nervous system. After 2 years of treatment, IFN-β1b reduces the risk of development of clinically defined MS from 45% (with placebo to 28% (with IFN-β1b. It also reduces relapses for 34% (1.31 exacerbations annually with placebo and 0.9 with higher dose of IFN-β1b and makes 31% more patients relapse-free. In secondary-progressive disease annual rate of progression is 3% lower with IFN-β1b. In recommended doses IFN-β1b causes the following frequent adverse effects: injection site reactions (redness, discoloration, inflammation, pain, necrosis and non

  9. Plant compounds that induce polychlorinated biphenyl biodegradation by Arthrobacter sp. strain B1B.


    Gilbert, E S; Crowley, D. E.


    Plant compounds that induced Arthrobacter sp. strain B1B to cometabolize polychlorinated biphenyls (PCBs) were identified by a screening assay based on the formation of a 4,4'-dichlorobiphenyl ring fission product. A chemical component of spearmint (Mentha spicata), l-carvone, induced Arthrobacter sp. strain B1B to cometabolize Aroclor 1242, resulting in significant degradation of 26 peaks in the mixture, including selected tetra- and pentachlorobiphenyls. Evidence for PCB biodegradation incl...

  10. Bidirectional regulation of emotional memory by 5-HT1B receptors involves hippocampal p11. (United States)

    Eriksson, T M; Alvarsson, A; Stan, T L; Zhang, X; Hascup, K N; Hascup, E R; Kehr, J; Gerhardt, G A; Warner-Schmidt, J; Arango-Lievano, M; Kaplitt, M G; Ogren, S O; Greengard, P; Svenningsson, P


    Cognitive impairments are common in depression and involve dysfunctional serotonin neurotransmission. The 5-HT1B receptor (5-HT(1B)R) regulates serotonin transmission, via presynaptic receptors, but can also affect transmitter release at heterosynaptic sites. This study aimed at investigating the roles of the 5-HT(1B)R, and its adapter protein p11, in emotional memory and object recognition memory processes by the use of p11 knockout (p11KO) mice, a genetic model for aspects of depression-related states. 5-HT(1B)R agonist treatment induced an impairing effect on emotional memory in wild type (WT) mice. In comparison, p11KO mice displayed reduced long-term emotional memory performance. Unexpectedly, 5-HT(1B)R agonist stimulation enhanced memory in p11KO mice, and this atypical switch was reversed after hippocampal adeno-associated virus mediated gene transfer of p11. Notably, 5-HT(1B)R stimulation increased glutamatergic neurotransmission in the hippocampus in p11KO mice, but not in WT mice, as measured by both pre- and postsynaptic criteria. Magnetic resonance spectroscopy demonstrated global hippocampal reductions of inhibitory GABA, which may contribute to the memory enhancement and potentiation of pre- and post-synaptic measures of glutamate transmission by a 5-HT(1B)R agonist in p11KO mice. It is concluded that the level of hippocampal p11 determines the directionality of 5-HT(1B)R action on emotional memory processing and modulates hippocampal functionality. These results emphasize the importance of using relevant disease models when evaluating the role of serotonin neurotransmission in cognitive deficits related to psychiatric disorders.

  11. Unit 1b: A General Approach to the Teaching of Architecture

    DEFF Research Database (Denmark)

    Toft, Anne Elisabeth


    The chapter presents the overall academic aims of the teaching at Unit 1b and how these were implemented in the curriculum for 2009/2010. The section includes considerations about learning targets, method, discourse, pedagogy and didactics.......The chapter presents the overall academic aims of the teaching at Unit 1b and how these were implemented in the curriculum for 2009/2010. The section includes considerations about learning targets, method, discourse, pedagogy and didactics....

  12. Role of CYP1B1 in PAH-DNA adduct formation and breast cancer risk

    Energy Technology Data Exchange (ETDEWEB)

    Goth-Goldstein, Regine; Russell, Marion L.; Muller, A.P.; Caleffi, M.; Eschiletti, J.; Graudenz, M.; Sohn, Michael D.


    This study investigated the hypothesis that increased exposure to polycyclic aromatic hydrocarbons (PAHs) increases breast cancer risk. PAHs are products of incomplete burning of organic matter and are present in cigarette smoke, ambient air, drinking water, and diet. PAHs require metabolic transformation to bind to DNA, causing DNA adducts, which can lead to mutations and are thought to be an important pre-cancer marker. In breast tissue, PAHs appear to be metabolized to their cancer-causing form primarily by the cytochrome P450 enzyme CYP1B1. Because the genotoxic impact of PAH depends on their metabolism, we hypothesized that high CYP1B1 enzyme levels result in increased formation of PAH-DNA adducts in breast tissue, leading to increased development of breast cancer. We have investigated molecular mechanisms of the relationship between PAH exposure, CYP1B1 expression and breast cancer risk in a clinic-based case-control study. We collected histologically normal breast tissue from 56 women (43 cases and 13 controls) undergoing breast surgery and analyzed these specimens for CYP1B1 genotype, PAH-DNA adducts and CYP1B1 gene expression. We did not detect any difference in aromatic DNA adduct levels of cases and controls, only between smokers and non-smokers. CYP1B1 transcript levels were slightly lower in controls than cases, but the difference was not statistically significant. We found no correlation between the levels of CYP1B1 expression and DNA adducts. If CYP1B1 has any role in breast cancer etiology it might be through its metabolism of estrogen rather than its metabolism of PAHs. However, due to the lack of statistical power these results should be interpreted with caution.

  13. Identification of a hemerythrin-like domain in a P1B-type transport ATPase† (United States)

    Traverso, Matthew E.; Subramanian, Poorna; Davydov, Roman; Hoffman, Brian M.; Stemmler, Timothy L.; Rosenzweig, Amy C.


    The P1B-type ATPases couple the energy of ATP hydrolysis to metal ion translocation across cell membranes. Important for prokaryotic metal resistance and essential metal distribution in eukaryotes, P1B-ATPases are divided into subclasses on the basis of their metal substrate specificities. Sequence analysis of putative P1B-5-ATPases, for which the substrate has not been identified, led to the discovery of a C-terminal soluble domain homologous to hemerythrin (Hr) proteins and domains. The Hr domain from the Acidothermus cellulolyticus P1B-5-ATPase was cloned, expressed, and purified (P1B-5-Hr). P1B-5-Hr binds two iron ions per monomer and adopts a predominantly helical fold. Optical absorption features of the iron-loaded and azide-treated protein are consistent with features observed for other Hr proteins. Autooxidation to the met form is very rapid, as reported for other prokaryotic Hr domains. The presence of a diiron center was confirmed by electron paramagnetic resonance (EPR) and X-ray absorption spectroscopic (XAS) data. The occurrence of a Hr-like domain in a P-type ATPase is unprecedented and suggests new regulatory mechanisms as well as an expanded function for Hr proteins in biology. PMID:20672819

  14. SMC1B is present in mammalian somatic cells and interacts with mitotic cohesin proteins. (United States)

    Mannini, Linda; Cucco, Francesco; Quarantotti, Valentina; Amato, Clelia; Tinti, Mara; Tana, Luigi; Frattini, Annalisa; Delia, Domenico; Krantz, Ian D; Jessberger, Rolf; Musio, Antonio


    Cohesin is an evolutionarily conserved protein complex that plays a role in many biological processes: it ensures faithful chromosome segregation, regulates gene expression and preserves genome stability. In mammalian cells, the mitotic cohesin complex consists of two structural maintenance of chromosome proteins, SMC1A and SMC3, the kleisin protein RAD21 and a fourth subunit either STAG1 or STAG2. Meiotic paralogs in mammals were reported for SMC1A, RAD21 and STAG1/STAG2 and are called SMC1B, REC8 and STAG3 respectively. It is believed that SMC1B is only a meiotic-specific cohesin member, required for sister chromatid pairing and for preventing telomere shortening. Here we show that SMC1B is also expressed in somatic mammalian cells and is a member of a mitotic cohesin complex. In addition, SMC1B safeguards genome stability following irradiation whereas its ablation has no effect on chromosome segregation. Finally, unexpectedly SMC1B depletion impairs gene transcription, particularly at genes mapping to clusters such as HOX and PCDHB. Genome-wide analyses show that cluster genes changing in expression are enriched for cohesin-SMC1B binding.

  15. Stearic Acid Serves as a Potent Inhibitor of Protein Tyrosine Phosphatase 1B

    Directory of Open Access Journals (Sweden)

    Ayako Tsuchiya


    Full Text Available Background/Aims: Free fatty acids (FFAs are implicated in diverse signal transduction pathways. The present study investigated the effects of the saturated FFA stearic acid on protein tyrosine phosphatase 1B (PTP1B activity, Akt activity, and glucose uptake into cells relevant to insulin signal. Methods: PTP1B activity was assayed under the cell-free conditions. Phosphorylation of insulin receptor and Akt and glucose uptake into cells were monitored in differentiated 3T3-L1-GLUT4myc adipocytes. Results: In the cell-free PTP1B assay, stearic acid suppressed PTP1B activity in a concentration (1-30 µM-dependent manner. For 3T3-L1-GLUT4myc adipocytes insulin phosphorylated insulin receptor at Tyr1185 and Akt at Thr308 and Ser473 in a concentration (100 fM-100 nM-dependent manner and stimulated glucose uptake into cells in a concentration (0.1-100 nM-dependent manner. Stearic acid (30 µM significantly increased insulin-induced phosphorylation of insulin receptor at Tyr1185, but insulin-induced phosphorylation of Akt was not significantly enhanced. Stearic acid (30 µM by itself promoted glucose uptake into adipocytes. Conclusion: The results of the present study indicate that stearic acid serves as a potent PTP1B inhibitor, possibly causing an enhancement in the insulin receptor signaling to stimulate glucose uptake into adipocytes.

  16. Uroplakin 1b is critical in urinary tract development and urothelial differentiation and homeostasis. (United States)

    Carpenter, Ashley R; Becknell, M Brian; Ching, Christina B; Cuaresma, Edward J; Chen, Xi; Hains, David S; McHugh, Kirk M


    Proper development and maintenance of urothelium is critical to its function. Uroplakins are expressed in developing and mature urothelium where they establish plaques associated with the permeability barrier. Their precise functional role in development and disease is unknown. Here, we disrupted Upk1b in vivo where its loss resulted in urothelial plaque disruption in the bladder and kidney. Upk1b(RFP/RFP) bladder urothelium appeared dysplastic with expansion of the progenitor cell markers, Krt14 and Krt5, increased Shh expression, and loss of terminal differentiation markers Krt20 and uroplakins. Upk1b(RFP/RFP) renal urothelium became stratified with altered cellular composition. Upk1b(RFP/RFP) mice developed age-dependent progressive hydronephrosis. Interestingly, 16% of Upk1b(RFP/RFP) mice possessed unilateral duplex kidneys. Our study expands the role of uroplakins, mechanistically links plaque formation to urinary tract development and function, and provides a tantalizing connection between congenital anomalies of the kidney and urinary tract along with functional deficits observed in a variety of urinary tract diseases. Thus, kidney and bladder urothelium are regionally distinct and remain highly plastic, capable of expansion through tissue-specific progenitor populations. Furthermore, Upk1b plays a previously unknown role in early kidney development representing a novel genetic target for congenital anomalies of the kidney and urinary tract. PMID:26880456

  17. Functional properties of Claramine: a novel PTP1B inhibitor and insulin-mimetic compound. (United States)

    Qin, Zhaohong; Pandey, Nihar R; Zhou, Xun; Stewart, Chloe A; Hari, Aswin; Huang, Hua; Stewart, Alexandre F R; Brunel, Jean Michel; Chen, Hsiao-Huei


    Protein tyrosine phosphatase 1B (PTP1B) inhibits insulin signaling, interfering with its control of glucose homeostasis and metabolism. PTP1B activity is elevated in obesity and type 2 diabetes and is a major cause of insulin resistance. Trodusquemine (MSI-1436) is a "first-in-class" highly selective inhibitor of PTP1B that can cross the blood-brain barrier to suppress feeding and promote insulin sensitivity and glycemic control. Trodusquemine is a naturally occurring cholestane that can be purified from the liver of the dogfish shark, Squalus acanthias, but it can also be manufactured synthetically by a fairly laborious process that requires several weeks. Here, we tested a novel easily and rapidly (2 days) synthesized polyaminosteroid derivative (Claramine) containing a spermino group similar to Trodusquemine for its ability to inhibit PTP1B. Like Trodusquemine, Claramine displayed selective inhibition of PTP1B but not its closest related phosphatase TC-PTP. In cultured neuronal cells, Claramine and Trodusquemine both activated key components of insulin signaling, with increased phosphorylation of insulin receptor-β (IRβ), Akt and GSK3β. Intraperitoneal administration of Claramine or Trodusquemine effectively restored glycemic control in diabetic mice as determined by glucose and insulin tolerance tests. A single intraperitoneal dose of Claramine, like an equivalent dose of Trodusquemine, suppressed feeding and caused weight loss without increasing energy expenditure. In summary, Claramine is an alternative more easily manufactured compound for the treatment of type II diabetes. PMID:25623533

  18. One pot synthesis of bis-silicon-bridged stilbene derivatives

    Institute of Scientific and Technical Information of China (English)


    Bis-silicon-bridged stilbene derivatives were synthesized in a modified procedure that combined the preparation of bis[2-(silyl)phenyl]acetylene and its intrmolecular reductive cyclization in one pot. The results indicated that the one pot approach produced target products in a comparable yield to that of the two-step method reported previously.

  19. Bis-perfluoroalkylation of aromatic compounds with sodium perfluoroalkanesulfinates

    Institute of Scientific and Technical Information of China (English)

    LIU, Jin-Tao(刘金涛); LU, He-Jun(吕贺军)


    Bis-perfluoroalkylation of aromatic compounds such as dimethoxybenzenes (2,4,6), anisole (8), pyridine (10) and quinoline (13) was accomplished by reaction with excess sodium perfluoroalkanesulfinates, RFSO2Na (1), in the presence of Mn(OAc)3·2H2O under mild conditions. The reaction provides a facile method for the synthesis of bis-perfluoroalkylated aromatic compounds.

  20. Convenient Synthesis of Bis(oxazoline) Dicarboxylate Derivatives

    Institute of Scientific and Technical Information of China (English)

    Bin FU; Da Ming DU; Qing XIA


    The synthesis of bis(oxazoline) dicarboxylate derivatives was investigated.Diethyl-aminosulfur trifluoride(DAST)was used as a convenient cyclization reagent in the synthesis of bis(oxazoline)dicarboxylate derivatives,which can not be obtained by the general method using MsCl and Et3N as dehydrating cyclization reagent.

  1. Synthesis, spectral and structural properties of bis-imidazoline selones

    Indian Academy of Sciences (India)

    Arruri Sathyanarayana; Katam Srinivas; Anindita Mandal; Saswati Gharami; Ganesan Prabusankar


    New biphenyl derivatives of bis-imidazoline selones were synthesized in good yield and characterized by multinuclear (1D and 2D) NMR and UV-vis studies. The solid state structures of bis-imidazoline selones were further confirmed by single crystal X ray diffraction technique.

  2. Accelerated optical holographic recording using bis-DNO

    DEFF Research Database (Denmark)

    Rasmussen, Palle H.; Ramanujam, P.S.; Hvilsted, Søren;


    The design, synthesis and optical holographic recording properties of bis-DNO are reported. Bis-DNO is composed of two identical azobenzene oligoornithine segments (DNO) connected via a dipeptide linker. The two segments were assembled in a parallel fashion at the two amino groups of the dipeptid...

  3. A bis-calixarene from olefin metathesis

    Directory of Open Access Journals (Sweden)

    Shimelis T. Hailu


    Full Text Available A ring-closing olefin metathesis reaction of tetrakis(allyloxycalix[4]arene gave the bis calixarene, (15E,40E,60E-65,74-bis(prop-2-en-1-yloxy-13,18,38,43,58,63-hexaoxadodecacyclo[,36.111,45.151,55.05,57.07,12.019,24.026,64.032,37.044,49.168,72]tetraheptaconta-1,3,5(57,7,9,11,15,19(24,20,22,26,28,30(64,32,34,36,40,44(49,45,47,51,53,55(65,60,68,70,72(74-heptacosaene, C74H68O8. It is a cage formed from two calix[4]arene units joined by butenyl groups at three of the O atoms on the narrow rim. The fourth O atom on each calixarene unit is joined with an allyl group. Each of the calix[4]arene units has a flattened cone conformation in which the allyloxy-substituted aryl group and the opposite aryl group are close together and almost parallel [dihedral angle between planes = 1.09 (11°], and the other two aryl groups are splayed outward [dihedral angle between planes = 79.53 (11°]. No guest molecule (e.g. solvent was observed within the cage. The alkene C atoms of one of the links between the calixarene moieties are disordered over two orientations with occupancies of 0.533 (9 and 0.467 (9.

  4. Analysis of CYP1B1 in pediatric and adult glaucoma and other ocular phenotypes (United States)

    Reis, Linda M.; Tyler, Rebecca C.; Weh, Eric; Hendee, Kathryn E.; Kariminejad, Ariana; Abdul-Rahman, Omar; Ben-Omran, Tawfeg; Manning, Melanie A.; McCarty, Catherine A.; Kitchner, Terrie E.; Costakos, Deborah


    Purpose The CYP1B1 gene encodes an enzyme that is a member of the cytochrome P450 superfamily. Mutations in CYP1B1 have been mainly reported in recessive pediatric ocular phenotypes, such as primary congenital glaucoma (PCG) and congenital glaucoma with anterior segment dysgenesis (CG with ASD), with some likely pathogenic variants also identified in families affected with adult-onset primary open angle glaucoma (POAG). Methods We examined CYP1B1 in 158 pediatric patients affected with PCG (eight), CG with ASD (22), CG with other developmental ocular disorders (11), juvenile glaucoma with or without additional ocular anomalies (26), and ASD or other developmental ocular conditions without glaucoma (91); in addition, a large cohort of adult patients with POAG (193) and POAG-negative controls (288) was examined. Results Recessive pathogenic variants in CYP1B1 were identified in two PCG pedigrees, three cases with CG and ASD, and two families with CG and other ocular defects, such as sclerocornea in one patient and microphthalmia in another individual; neither sclerocornea nor microphthalmia has been previously associated with CYP1B1. Most of the identified causative mutations are new occurrences of previously reported pathogenic alleles with two novel variants identified: a c.1325delC, p.(Pro442Glnfs*15) frameshift allele in a family with PCG and a c.157G>A, p.(Gly53Ser) variant identified in a proband with CG, Peters anomaly, and microphthalmia. Analysis of the family history in the CYP1B1-positive families revealed POAG in confirmed or presumed heterozygous relatives in one family with PCG and two families with ASD/CG; POAG was associated with the c.1064_1076del, p.(Arg355Hisfs*69) allele in two of these pedigrees. Screening of an unrelated POAG cohort identified the same c.1064_1076del heterozygous allele in one individual with sporadic POAG but not in age- and ethnicity-matched POAG-negative individuals. Overall, there was no significant enrichment for mutant

  5. Seasonally Changing Cryptochrome 1b Expression in the Retinal Ganglion Cells of a Migrating Passerine Bird.

    Directory of Open Access Journals (Sweden)

    Christine Nießner

    Full Text Available Cryptochromes, blue-light absorbing proteins involved in the circadian clock, have been proposed to be the receptor molecules of the avian magnetic compass. In birds, several cryptochromes occur: Cryptochrome 2, Cryptochrome 4 and two splice products of Cryptochrome 1, Cry1a and Cry1b. With an antibody not distinguishing between the two splice products, Cryptochrome 1 had been detected in the retinal ganglion cells of garden warblers during migration. A recent study located Cry1a in the outer segments of UV/V-cones in the retina of domestic chickens and European robins, another migratory species. Here we report the presence of cryptochrome 1b (eCry1b in retinal ganglion cells and displaced ganglion cells of European Robins, Erithacus rubecula. Immuno-histochemistry at the light microscopic and electron microscopic level showed eCry1b in the cell plasma, free in the cytosol as well as bound to membranes. This is supported by immuno-blotting. However, this applies only to robins in the migratory state. After the end of the migratory phase, the amount of eCry1b was markedly reduced and hardly detectable. In robins, the amount of eCry1b in the retinal ganglion cells varies with season: it appears to be strongly expressed only during the migratory period when the birds show nocturnal migratory restlessness. Since the avian magnetic compass does not seem to be restricted to the migratory phase, this seasonal variation makes a role of eCry1b in magnetoreception rather unlikely. Rather, it could be involved in physiological processes controlling migratory restlessness and thus enabling birds to perform their nocturnal flights.

  6. Ultrafine carbon particles down-regulate CYP1B1 expression in human monocytes

    Directory of Open Access Journals (Sweden)

    Ziegler-Heitbrock Loems


    Full Text Available Abstract Background Cytochrome P450 monoxygenases play an important role in the defence against inhaled toxic compounds and in metabolizing a wide range of xenobiotics and environmental contaminants. In ambient aerosol the ultrafine particle fraction which penetrates deeply into the lungs is considered to be a major factor for adverse health effects. The cells mainly affected by inhaled particles are lung epithelial cells and cells of the monocyte/macrophage lineage. Results In this study we have analyzed the effect of a mixture of fine TiO2 and ultrafine carbon black Printex 90 particles (P90 on the expression of cytochrome P450 1B1 (CYP1B1 in human monocytes, macrophages, bronchial epithelial cells and epithelial cell lines. CYP1B1 expression is strongly down-regulated by P90 in monocytes with a maximum after P90 treatment for 3 h while fine and ultrafine TiO2 had no effect. CYP1B1 was down-regulated up to 130-fold and in addition CYP1A1 mRNA was decreased 13-fold. In vitro generated monocyte-derived macrophages (MDM, epithelial cell lines, and primary bronchial epithelial cells also showed reduced CYP1B1 mRNA levels. Benzo[a]pyrene (BaP is inducing CYB1B1 but ultrafine P90 can still down-regulate gene expression at 0.1 μM of BaP. The P90-induced reduction of CYP1B1 was also demonstrated at the protein level using Western blot analysis. Conclusion These data suggest that the P90-induced reduction of CYP gene expression may interfere with the activation and/or detoxification capabilities of inhaled toxic compounds.

  7. Upstream ORF affects MYCN translation depending on exon 1b alternative splicing

    Directory of Open Access Journals (Sweden)

    Tutrone Giovani


    Full Text Available Abstract Background The MYCN gene is transcribed into two major mRNAs: one full-length (MYCN and one exon 1b-spliced (MYCNΔ1b mRNA. But nothing is known about their respective ability to translate the MYCN protein. Methods Plasmids were prepared to enable translation from the upstream (uORF and major ORF of the two MYCN transcripts. Translation was studied after transfection in neuroblastoma SH-EP cell line. Impact of the upstream AUG on translation was evaluated after directed mutagenesis. Functional study with the two MYCN mRNAs was conducted by a cell viability assay. Existence of a new protein encoded by the MYCNΔ1b uORF was explored by designing a rabbit polyclonal antibody against a specific epitope of this protein. Results Both are translated, but higher levels of protein were seen with MYCNΔ1b mRNA. An upstream ORF was shown to have positive cis-regulatory activity on translation from MYCN but not from MYCNΔ1b mRNA. In transfected SH-EP neuroblastoma cells, high MYCN dosage obtained with MYCNΔ1b mRNA translation induces an antiapoptotic effect after serum deprivation that was not observed with low MYCN expression obtained with MYCN mRNA. Here, we showed that MYCNOT: MYCN Overlap Transcript, a new protein of unknown function is translated from the upstream AUG of MYCNΔ1b mRNA. Conclusions Existence of upstream ORF in MYCN transcripts leads to a new level of MYCN regulation. The resulting MYCN dosage has a weak but significant anti-apoptotic activity after intrinsic apoptosis induction.

  8. Myelin protein zero gene sequencing diagnoses Charcot-Marie-Tooth Type 1B disease

    Energy Technology Data Exchange (ETDEWEB)

    Su, Y.; Zhang, H.; Madrid, R. [Univ. of California, San Francisco, CA (United States)] [and others


    Charcot-Marie-Tooth disease (CMT), the most common genetic neuropathy, affects about 1 in 2600 people in Norway and is found worldwide. CMT Type 1 (CMT1) has slow nerve conduction with demyelinated Schwann cells. Autosomal dominant CMT Type 1B (CMT1B) results from mutations in the myelin protein zero gene which directs the synthesis of more than half of all Schwann cell protein. This gene was mapped to the chromosome 1q22-1q23.1 borderline by fluorescence in situ hybridization. The first 7 of 7 reported CMT1B mutations are unique. Thus the most effective means to identify CMT1B mutations in at-risk family members and fetuses is to sequence the entire coding sequence in dominant or sporadic CMT patients without the CMT1A duplication. Of the 19 primers used in 16 pars to uniquely amplify the entire MPZ coding sequence, 6 primer pairs were used to amplify and sequence the 6 exons. The DyeDeoxy Terminator cycle sequencing method used with four different color fluorescent lables was superior to manual sequencing because it sequences more bases unambiguously from extracted genomic DNA samples within 24 hours. This protocol was used to test 28 CMT and Dejerine-Sottas patients without CMT1A gene duplication. Sequencing MPZ gene-specific amplified fragments identified 9 polymorphic sites within the 6 exons that encode the 248 amino acid MPZ protein. The large number of major CMT1B mutations identified by single strand sequencing are being verified by reverse strand sequencing and when possible, by restriction enzyme analysis. This protocol can be used to distringuish CMT1B patients from othre CMT phenotypes and to determine the CMT1B status of relatives both presymptomatically and prenatally.

  9. Hypoglycemic effect of Astragalus polysaccharide and its effect on PTP1B

    Institute of Scientific and Technical Information of China (English)

    Yong WU; Jing-ping OU-YANG; Ke WU; Ya WANG; Yun-feng ZHOU; Chong-yuan WEN


    Aim: To examine the effects ofAstragalus polysaccharide (APS), a component of an aqueous extract of Astragalus membranaceus roots, on protein tyrosine phosphatase 1B (PTP1B), a negative regulator of insulin-receptor (IR) signal transduction, and its potential role in the amelioration of insulin resistance.Methods: Ten-week-old fat-fed streptozotocin (STZ)-treated rats, an animal model of type Ⅱ diabetes mellitus (TIIDM), were treated with APS (400 mg/kg po) for 5 weeks. Insulin sensitivity was identified by the insulin-tolerance test. Further analyses on the possible changes in insulin signaling occurring in skeletal muscle and liver were performed by immunoprecipitation or Western blotting. PTP1B activity was measured by an assay kit. Results: The diabetic rats responded to APS with a significant decrease in body weight, plasma glucose, and improved insulin sensitivity. The activity and expression of PTP1B were elevated in the skeletal muscle and liver of TIIDM rats. Thus the insulin signaling in target tissues was diminished. APS reduced both PTP1B protein level and activity in the muscle,but not in the liver of TIIDM rats. Insulin-induced tyrosine phosphorylation of the IR β-subunit and insulin receptor substrate-1 (IRS-1) were increased in the muscle,but not in the liver of APS-treated TIIDM rats. There was no change in the activity or expression of PTP1B in APS-treated normal rats, and blood insulin levels did not change in TIIDM rats after treatment with APS. Conclusion: APS enables insulin-sensitizing and hypoglycemic activity at least in part by decreasing the elevated expression and activity of PTP1B in the skeletal muscles of TIIDM rats.

  10. Upstream ORF affects MYCN translation depending on exon 1b alternative splicing

    International Nuclear Information System (INIS)

    The MYCN gene is transcribed into two major mRNAs: one full-length (MYCN) and one exon 1b-spliced (MYCNΔ1b) mRNA. But nothing is known about their respective ability to translate the MYCN protein. Plasmids were prepared to enable translation from the upstream (uORF) and major ORF of the two MYCN transcripts. Translation was studied after transfection in neuroblastoma SH-EP cell line. Impact of the upstream AUG on translation was evaluated after directed mutagenesis. Functional study with the two MYCN mRNAs was conducted by a cell viability assay. Existence of a new protein encoded by the MYCNΔ1b uORF was explored by designing a rabbit polyclonal antibody against a specific epitope of this protein. Both are translated, but higher levels of protein were seen with MYCNΔ1b mRNA. An upstream ORF was shown to have positive cis-regulatory activity on translation from MYCN but not from MYCNΔ1b mRNA. In transfected SH-EP neuroblastoma cells, high MYCN dosage obtained with MYCNΔ1b mRNA translation induces an antiapoptotic effect after serum deprivation that was not observed with low MYCN expression obtained with MYCN mRNA. Here, we showed that MYCNOT: MYCN Overlap Transcript, a new protein of unknown function is translated from the upstream AUG of MYCNΔ1b mRNA. Existence of upstream ORF in MYCN transcripts leads to a new level of MYCN regulation. The resulting MYCN dosage has a weak but significant anti-apoptotic activity after intrinsic apoptosis induction

  11. Flame retardancy mechanisms of bisphenol A bis(diphenyl phosphate) in combination with zinc borate in bisphenol A polycarbonate/acrylonitrile-butadiene-styrene blends

    International Nuclear Information System (INIS)

    Bisphenol A polycarbonate/acrylonitrile-butadiene-styrene (PC/ABS) with and without bisphenol A bis(diphenyl phosphate) (BDP) and 5 wt.% zinc borate (Znb) were investigated. The pyrolysis was studied by thermogravimetry (TG), TG-FTIR and NMR, the fire behaviour with a cone calorimeter applying different heat fluxes, LOI and UL 94. Fire residues were examined with NMR. BDP affects the decomposition of PC/ABS and acts as a flame retardant in the gas and condensed phases. The addition of Znb results in an additional hydrolysis of PC. The fire behaviour is similar to PC/ABS, aside from a slightly increased LOI and a reduced peak heat release rate, both caused by borates improving the barrier properties of the char. In PC/ABS + BDP + Znb, the addition of Znb yields a borate network and amorphous phosphates. Znb also reacts with BDP to form alpha-zinc phosphate and borophosphates that suppress the original flame retardancy mechanisms of BDP. The inorganic-organic residue formed provides more effective flame retardancy, in particular at low irradiation in the cone calorimeter, and a clear synergy in LOI, whereas for more developed fires BDP + Znb become less effective than BDP in PC/ABS with respect to the total heat evolved.

  12. Bis(μ-bis{[4-(2-pyridylpyrimidin-2-yl]sulfanyl}methanedisilver(I bis(perchlorate

    Directory of Open Access Journals (Sweden)

    Hai-Bin Zhu


    Full Text Available In the macrocyclic centrosymmetric dinuclear complex, [Ag2(C19H14N6S22](ClO42, the AgI atom, bis{[4-(2-pyridylpyrimidin-2-yl]sulfanyl}methane (2-bppt ligand and perchlorate anion each lie on a twofold rotation axis. The 2-bppt ligand chelates two four-coordinated AgI atoms through its two bipyridine-like arms. The O atoms of the perchlorate anion are disordered each over two positions of equal occupancy. Adjacent complex molecules are linked by π–π interactions between the pyridine and pyrimidine rings [centroid–centroid distance = 3.663 (8 Å].

  13. TD-DFT Study on the Electronic Spectrum Properties of 2,7'-(Ethylene)-bis-8-hydroxyquinoline and Its Derivatives

    Institute of Scientific and Technical Information of China (English)

    LI Zhi-Feng; ZHU Yuan-Cheng; YUAN Kun; KANG Jing-Wan


    The structures of 2,7'-(ethylene)-bis-8-hydroxyquinoline and its derivatives were optimized at the ground states using ab initio HF and B3LYP methods. At the same time, the molecular structures of the first singlet excited state for 2,7'-(ethylene)-bis-8-hydroxyquinoline and its derivatives were optimized by CIS/6-31G(d). The absorption and emission spectra based on the above structures were obtained by the time-dependent density functional theory (TD-DFT) by the B3LYP method with the 6-31G(d) basis set. The calculated results of luminescence originate from the electronic transition from the hydroxphenol ring of 8-hydroxyquinoline A to the pyridine ring of 8-hydroxyquinoline B. Their luminescence wave bands can be tuned by different substituents on the ligand of 8-hydroxyquinoline.

  14. The radioresistance kinase TLK1B protects the cells by promoting repair of double strand breaks

    Directory of Open Access Journals (Sweden)

    De Benedetti Arrigo


    Full Text Available Abstract Background The mammalian protein kinase TLK1 is a homologue of Tousled, a gene involved in flower development in Arabidopsis thaliana. The function of TLK1 is not well known, although knockout of the gene in Drosophila or expression of a dominant negative mutant in mouse cells causes loss of nuclear divisions and missegregation of chromosomes probably, due to alterations in chromatin remodeling capacity. Overexpression of TLK1B, a spliced variant of the TLK1 mRNA, in a model mouse cell line increases it's resistance to ionizing radiation (IR or the radiomimetic drug doxorubicin, also likely due to changes in chromatin remodeling. TLK1B is translationally regulated by the availability of the translation factor eIF4E, and its synthesis is activated by IR. The reason for this mechanism of regulation is likely to provide a rapid means of promoting repair of DSBs. TLK1B specifically phosphorylates histone H3 and Asf1, likely resulting in changes in chromatin structure, particularly at double strand breaks (DSB sites. Results In this work, we provide several lines of evidence that TLK1B protects the cells from IR by facilitating the repair of DSBs. First, the pattern of phosphorylation and dephosphorylation of H2AX and H3 indicated that cells overexpressing TLK1B return to pre-IR steady state much more rapidly than controls. Second, the repair of episomes damaged with DSBs was much more rapid in cells overexpressing TLK1B. This was also true for repair of genomic damage. Lastly, we demonstrate with an in vitro repair system that the addition of recombinant TLK1B promotes repair of a linearized plasmid incubated with nuclear extract. In addition, TLK1B in this in vitro system promotes the assembly of chromatin as shown by the formation of more highly supercoiled topomers of the plasmid. Conclusion In this work, we provide evidence that TLK1B promotes the repair of DSBs, likely as a consequence of a change in chromatin remodeling capacity that


    Adefurin, Abiodun; Ghimire, Laxmi V.; Kohli, Utkarsh; Muszkat, Mordechai; Sofowora, Gbenga G.; Li, Chun; Levinson, Rebecca T.; Paranjape, Sachin Y.; Stein, C. Michael; Kurnik, Daniel


    α1B- adrenergic receptors contribute to vasoconstriction in humans. We tested the hypothesis that variation in the ADRA1B gene contributes to interindividual variability and ethnic differences in adrenergic vasoconstriction. We measured dorsal hand vein responses to increasing doses of phenylephrine in 64 Caucasians and 41 African-Americans and genotyped 34 ADRA1B variants. We validated findings in another model of catecholamine-induced vasoconstriction, the increase in mean arterial pressure (ΔMAP) during a cold pressor test (CPT). One ADRA1B variant, rs10070745, present in 14 African-American heterozygotes but not in Caucasians, was associated with a lower phenylephrine ED50 (geometric mean [95% CI], 144 [69–299] ng/ml) compared to 27 African-American non-carriers (208 [130–334] ng/ml; P=0.015) and contributed to the ethnic differences in ED50. The same variant was also associated with a greater ΔMAP during CPT (P=0.008). In conclusion, ADRA1B rs10070745 was significantly associated with vasoconstrictor responses after adrenergic stimulation and contributed to the ethnic difference in phenylephrine sensitivity. PMID:27089938

  16. Arabidopsis DREB1B in transgenic Salvia miltiorrhiza increased tolerance to drought stress without stunting growth. (United States)

    Wei, Tao; Deng, Kejun; Gao, Yonghong; Liu, Yu; Yang, Meiling; Zhang, Lipeng; Zheng, Xuelian; Wang, Chunguo; Song, Wenqin; Chen, Chengbin; Zhang, Yong


    Multiple stress response genes are controlled by transcription factors in a coordinated manner; therefore, these factors can be used for molecular plant breeding. CBF1/DREB1B, a known stress-inducible gene, was isolated from Arabidopsis thaliana and introduced into Salvia miltiorrhiza under the control of the CaMV35S or RD29A promoter. Under drought stress, relative water content, chlorophyll content, and the net photosynthetic rate were observed to be higher in the transgenic lines than in the wild type (WT). Moreover, O2(-) and H2O2 accumulation was observed to be lower in the transgenic lines. Additional analyses revealed that the AtDREB1B transgenic plants generally displayed lesser malondialdehyde (MDA) but higher superoxide dismutase (SOD), catalase (CAT), and peroxidase (POD) activities than the WT under drought stress. Quantitative real-time polymerase chain reaction of a subset of genes involved in photosynthesis, stress response, carbohydrate metabolism, and cell protection further verified that AtDREB1B could enhance tolerance to drought by activating different downstream DREB/CBF genes in the transgenic plants. Furthermore, no growth inhibition was detected in transgenic S. miltiorrhiza plants that expressed AtDREB1B driven by either the constitutive CaMV35S promoter or the stress-inducible RD29A promoter. Together, these results suggest that AtDREB1B is a good candidate gene for increasing drought tolerance in transgenic S. miltiorrhiza. PMID:27002402

  17. Lmx1b controls peptide phenotypes in serotonergic and dopaminergic neurons

    Institute of Scientific and Technical Information of China (English)

    Rui Yan; Tianwen Huang; Zhiqin Xie; Guannan Xia; Hui Qian; Xiaolin Zhao; Leping Cheng


    Serotonin (5-HT) neurons synthesize a variety of peptides.How these peptides are controlled during development remains unclear.It has been reported that the co-localization of peptides and 5-HT varies by species.In contrast to the situations in the rostral 5-HT neurons of human and rat brains,several peptides do not coexist with 5-HT in the rostral 5-HT neurons of mouse brain.In this study,we found that the peptide substance P and peptide genes,including those encoding peptides thyrotropin-releasing hormone,enkephalin,and calcitonin gene-related peptide,were expressed in the caudal 5-HT neurons of mouse brain; these findings are in line with observations in rat and monkey 5-HT neurons.We also revealed that these peptides/peptide genes partially overlapped with the transcription factor Lmx1b that specifies the 5-HT cell fate.Furthermore,we found that the peptide cholecystokinin was expressed in developing dopaminergic neurons and greatly overlapped with Lmx1b that specifies the dopaminergic cell fate.By examining the phenotype of Lmx1b deletion mice,we found that Lmx1b was required for the expression of above peptides expressed in 5-HT or dopaminergic neurons.Together,our results indicate that Lmx1b,a key transcription factor for the specification of 5-HT and dopaminergic transmitter phenotypes during embryogenesis,determines some peptide phenotypes in these neurons as well.

  18. E1B and E4 oncoproteins of adenovirus antagonize the effect of apoptosis inducing factor

    Energy Technology Data Exchange (ETDEWEB)

    Turner, Roberta L. [Department of Microbiology and Immunology, Wake Forest School of Medicine, Winston-Salem, NC 27157 (United States); Wilkinson, John C., E-mail: [Department of Biochemistry, Wake Forest School of Medicine, Winston-Salem, NC 27157 (United States); Ornelles, David A., E-mail: [Department of Microbiology and Immunology, Wake Forest School of Medicine, Winston-Salem, NC 27157 (United States)


    Adenovirus inundates the productively infected cell with linear, double-stranded DNA and an abundance of single-stranded DNA. The cellular response to this stimulus is antagonized by the adenoviral E1B and E4 early genes. A mutant group C adenovirus that fails to express the E1B-55K and E4ORF3 genes is unable to suppress the DNA-damage response. Cells infected with this double-mutant virus display significant morphological heterogeneity at late times of infection and frequently contain fragmented nuclei. Nuclear fragmentation was due to the translocation of apoptosis inducing factor (AIF) from the mitochondria into the nucleus. The release of AIF was dependent on active poly(ADP-ribose) polymerase-1 (PARP-1), which appeared to be activated by viral DNA replication. Nuclear fragmentation did not occur in AIF-deficient cells or in cells treated with a PARP-1 inhibitor. The E1B-55K or E4ORF3 proteins independently prevented nuclear fragmentation subsequent to PARP-1 activation, possibly by altering the intracellular distribution of PAR-modified proteins. - Highlights: • E1B-55K or E4orf3 prevents nuclear fragmentation. • Nuclear fragmentation requires AIF and PARP-1 activity. • Adenovirus DNA replication activates PARP-1. • E1B-55K or E4orf3 proteins alter the distribution of PAR.

  19. Organic anion transporting polypeptide-1B1 haplotypes in Chinese patients

    Institute of Scientific and Technical Information of China (English)

    Lin-yong XU; Hong-hao ZHOU; Zhen-qiu SUN; Yi-jing HE; Wei ZHANG; Sheng Deng; Qing LI; Wei-xia ZHANG; Zhao-qian LIU; Dan WANG; Yuan-fei HUANG


    Aim: To detect 388G>A and 521T>C variant alleles in the organic anion transporting polypeptide- 1B 1 (OATP 1B 1, encoding gene SLCOIB1) gene. Methods:One hundred and eleven healthy volunteers were screened for OATPIB 1 alleles in our study. PCR-restriction fragment length polymorphism was used to identify the 388G>A polymorphism and a 1-step tetra-primer method was developed for the determination of 521T>C mutation. Results: The frequencies of the 388G>A and 521T>C variant alleles in the Chinese population were 73.4%and 14.0%,respectively. The frequencies of the SLCO1BI*lb and *15 haplotypes were 59.9% and 14.0%, respectively. Conclusion: The SLCO1B1*1b and SLCO1B1*15 variants are relatively common in the Chinese population. Their frequencies are similar to that in the Japanese, but significantly different from that in Caucasians and blacks.

  20. Redox regulation of protein tyrosine phosphatase 1B involves a sulphenyl-amide intermediate. (United States)

    Salmeen, Annette; Andersen, Jannik N; Myers, Michael P; Meng, Tzu-Ching; Hinks, John A; Tonks, Nicholas K; Barford, David


    The second messenger hydrogen peroxide is required for optimal activation of numerous signal transduction pathways, particularly those mediated by protein tyrosine kinases. One mechanism by which hydrogen peroxide regulates cellular processes is the transient inhibition of protein tyrosine phosphatases through the reversible oxidization of their catalytic cysteine, which suppresses protein dephosphorylation. Here we describe a structural analysis of the redox-dependent regulation of protein tyrosine phosphatase 1B (PTP1B), which is reversibly inhibited by oxidation after cells are stimulated with insulin and epidermal growth factor. The sulphenic acid intermediate produced in response to PTP1B oxidation is rapidly converted into a previously unknown sulphenyl-amide species, in which the sulphur atom of the catalytic cysteine is covalently linked to the main chain nitrogen of an adjacent residue. Oxidation of PTP1B to the sulphenyl-amide form is accompanied by large conformational changes in the catalytic site that inhibit substrate binding. We propose that this unusual protein modification both protects the active-site cysteine residue of PTP1B from irreversible oxidation to sulphonic acid and permits redox regulation of the enzyme by promoting its reversible reduction by thiols.

  1. Adherence to interferon β-1b treatment in patients with multiple sclerosis in Spain.

    Directory of Open Access Journals (Sweden)

    Oscar Fernández

    Full Text Available BACKGROUND: Adherence to interferon β-1b (INFβ-1b therapy is essential to maximize the beneficial effects of treatment in multiple sclerosis (MS. For that reason, the main objectives of this study are to assess adherence to INFβ-1b in patients suffering from MS in Spain, and to identify the factors responsible for adherence in routine clinical practice. METHODOLOGY/PRINCIPAL FINDINGS: This was an observational, retrospective, cross-sectional study including 120 Spanish patients with MS under INFβ-1b treatment. Therapeutic adherence was assessed with Morisky-Green test and with the percentage of doses received. The proportion of adherent patients assessed by Morisky-Green test was 68.3%, being indicative of poor adherence. Nevertheless, the percentage of doses received, which was based on the number of injected medication, was 94.3%. The main reason for missing INFβ-1b injections was forgetting some of the administrations (64%. Therefore, interventions that diminish forgetfulness might have a positive effect in the proportion of adherent patients and in the percentage of doses received. In addition, age and comorbidities had a significant effect in the number of doses injected per month, and should be considered in the management of adherence in MS patients. CONCLUSION/SIGNIFICANCE: Among all the available methods for assessing adherence, the overall consumption of the intended dose has to be considered when addressing adherence.

  2. Molybdenum (VI) Bis(imidoaryl) Complexes Containing the Bis (amonimethyl)aryl 'Pincer' Ligand

    NARCIS (Netherlands)

    Koten, G. van; Brandts, J.A.M.; Gossage, R.A.; Boersma, J.; Spek, A.L.


    The synthesis and characterization of new, five-coordinate molybdenum bis(imido) chloride complexes [MoCl(NCN)(N-t-Bu)2] (2) and [MoCl(2-C,N-NCN)(NAr)2] (3) and the methylated derivative [Mo(2-C,N-NCN)(Me)(NAr)2] (5) (NCN = [C6H3(CH2NMe2)2-2,6]-, Ar = C6H3-i-Pr2-2,6) are reported. Compounds 3 and 5

  3. Involvement of endocrine system in a patient affected by glycogen storage disease 1b: speculation on the role of autoimmunity. (United States)

    Melis, Daniela; Della Casa, Roberto; Balivo, Francesca; Minopoli, Giorgia; Rossi, Alessandro; Salerno, Mariacarolina; Andria, Generoso; Parenti, Giancarlo


    Glycogen storage disease type 1b (GSD1b) is an inherited metabolic defect of glycogenolysis and gluconeogenesis due to mutations of the SLC37A4 gene and to defective transport of glucose-6-phosphate. The clinical presentation of GSD1b is characterized by hepatomegaly, failure to thrive, fasting hypoglycemia, and dyslipidemia. Patients affected by GSD1b also show neutropenia and/or neutrophil dysfunction that cause increased susceptibility to recurrent bacterial infections. GSD1b patients are also at risk for inflammatory bowel disease. Occasional reports suggesting an increased risk of autoimmune disorders in GSD1b patients, have been published. These complications affect the clinical outcome of the patients. Here we describe the occurrence of autoimmune endocrine disorders including thyroiditis and growth hormone deficiency, in a patient affected by GSD1b. This case further supports the association between GSD1b and autoimmune diseases.

  4. A bis-calixarene from olefin metathesis (United States)

    Hailu, Shimelis T.; Butcher, Ray J.; Hudrlik, Paul F.; Hudrlik, Anne M.


    A ring-closing olefin metathesis reaction of tetra­kis­(all­yl­oxy)calix[4]arene gave the bis­ calixarene, (15E,40E,60E)-65,74-bis­(prop-2-en-1-yl­oxy)-13,18,38,43,58,63-hexa­oxado­deca­cyclo­[,36.111,45.151,55.05,57.07,12.019,24.026,64.032,37.044,49.168,72]tetra­hepta­conta-1,3,5(57),7,9,11,15,19(24),20,22,26,28,30(64),32,34,36,40,44(49),45,47,51,53,55(65),60,68,70,72(74)-hepta­cosa­ene, C74H68O8. It is a cage formed from two calix[4]arene units joined by butenyl groups at three of the O atoms on the narrow rim. The fourth O atom on each calixarene unit is joined with an allyl group. Each of the calix[4]arene units has a flattened cone conformation in which the all­yloxy-substituted aryl group and the opposite aryl group are close together and almost parallel [dihedral angle between planes = 1.09 (11)°], and the other two aryl groups are splayed outward [dihedral angle between planes = 79.53 (11)°]. No guest mol­ecule (e.g. solvent) was observed within the cage. The alkene C atoms of one of the links between the calixarene moieties are disordered over two orientations with occupancies of 0.533 (9) and 0.467 (9). PMID:22719604

  5. A bis-calixarene from olefin metathesis. (United States)

    Hailu, Shimelis T; Butcher, Ray J; Hudrlik, Paul F; Hudrlik, Anne M


    A ring-closing olefin metathesis reaction of tetra-kis-(all-yl-oxy)calix[4]arene gave the bis- calixarene, (15E,40E,60E)-65,74-bis-(prop-2-en-1-yl-oxy)-13,18,38,43,58,63-hexa-oxado-deca-cyclo-[,36).1(11,45).1(51,55).0(5,57).0(7,12).0(19,24).0(26,64).0(32,37).0(44,49).1(68,72)]tetra-hepta-conta-1,3,5(57),7,9,11,15,19(24),20,22,26,28,30(64),32,34,36,40,44(49),45,47,51,53,55(65),60,68,70,72(74)-hepta-cosa-ene, C(74)H(68)O(8). It is a cage formed from two calix[4]arene units joined by butenyl groups at three of the O atoms on the narrow rim. The fourth O atom on each calixarene unit is joined with an allyl group. Each of the calix[4]arene units has a flattened cone conformation in which the all-yloxy-substituted aryl group and the opposite aryl group are close together and almost parallel [dihedral angle between planes = 1.09 (11)°], and the other two aryl groups are splayed outward [dihedral angle between planes = 79.53 (11)°]. No guest mol-ecule (e.g. solvent) was observed within the cage. The alkene C atoms of one of the links between the calixarene moieties are disordered over two orientations with occupancies of 0.533 (9) and 0.467 (9).

  6. HATS-1b: The First Transiting Planet Discovered by the HATSouth Survey

    CERN Document Server

    Penev, K; Bayliss, D; Jordán, A; Mohler, M; Zhou, G; Suc, V; Rabus, M; Hartman, J D; Mancini, L; Béky, B; Csubry, Z; Buchhave, L; Henning, T; Nikolov, N; Csák, B; Brahm, R; Espinoza, N; Conroy, P; Noyes, R W; Sasselov, D D; Schmidt, B; Wright, D J; Tinney, C G; Addison, B C; Lázár, J; Papp, I; Sári, P


    We report the discovery of HATS-1b, a transiting extrasolar planet orbiting the moderately bright V=12.05 G dwarf star GSC 6652-00186, and the first planet discovered by HATSouth, a global network of autonomous wide-field telescopes. HATS-1b has a period P~3.4465 d, mass Mp~1.86MJ, and radius Rp~1.30RJ. The host star has a mass of 0.99Msun, and radius of 1.04Rsun. The discovery light curve of HATS-1b has near continuous coverage over several multi-day periods, demonstrating the power of using a global network of telescopes to discover transiting planets.

  7. N-Terminal methionine processing by the zinc-activated Plasmodium falciparum methionine aminopeptidase 1b. (United States)

    Calcagno, Sarah; Klein, Christian D


    The methionine aminopeptidase 1b from Plasmodium falciparum (PfMetAP 1b) was cloned, expressed in Escherichia coli and characterized. Surprisingly, and in contrast to other methionine aminopeptidases (MetAPs) that require heavy-metal cofactors such as cobalt, the enzyme is reliably activated by zinc ions. Immobilization of the enzyme is possible by His-tag metal chelation to iminodiacetic acid-agarose and by covalent binding to chloroacetamido-hexyl-agarose. The covalently immobilized enzyme shows long-term stability, allowing a continuous, heterogenous processing of N-terminal methionines, for example, in recombinant proteins. Activation by zinc, instead of cobalt as for other MetAPs, avoids the introduction of heavy metals with toxicological liabilities and oxidative potential into biotechnological processes. The PfMetAP 1b therefore represents a useful tool for the enzymatic, posttranslational processing of recombinant proteins. PMID:27023914

  8. Interaction between the glutamate transporter GLT1b and the synaptic PDZ domain protein PICK1

    DEFF Research Database (Denmark)

    Bassan, Merav; Liu, Hongguang; Madsen, Kenneth L;


    Synaptic plasticity is implemented by the interaction of glutamate receptors with PDZ domain proteins. Glutamate transporters provide the only known mechanism of clearance of glutamate from excitatory synapses, and GLT1 is the major glutamate transporter. We show here that GLT1 interacts with the......Synaptic plasticity is implemented by the interaction of glutamate receptors with PDZ domain proteins. Glutamate transporters provide the only known mechanism of clearance of glutamate from excitatory synapses, and GLT1 is the major glutamate transporter. We show here that GLT1 interacts...... expressing PICK1 and GLT1b. In addition, expression of GLT1b in COS7 cells changed the distribution of PICK1, bringing it to the surface. GLT1b and PICK1 co-localized with each other and with synaptic markers in hippocampal neurons in culture. Phorbol ester, an activator of protein kinase C (PKC), a known...

  9. Cytokines and adhesion molecules in multiple sclerosis patients treated with interferon-beta1b

    DEFF Research Database (Denmark)

    Jensen, Jakob; Krakauer, Martin; Sellebjerg, Finn


    Multiple sclerosis (MS), an inflammatory, demyelinating disease of the central nervous system (CNS), is thought to be caused by a T cell-mediated attack on CNS myelin and axons. Recombinant interferon (IFN)-beta is an established treatment of multiple sclerosis, and is known to reduce the number...... of disease relapses and the development of irreversible symptoms and signs of disease. The mechanism of action of IFN-beta treatment is, however, not completely understood. Previous studies have suggested major effects on mononuclear cell cytokine production and T cell migration, but results have been...... initiated on de novo treatment with IFN-beta1b. We found only minor associations between the different changes induced by IFN-beta1b-treatment. Our findings are consistent with changes in T cell expression of CD49d/VLA-4 and induction of sVCAM-1 as important effects of treatment with IFN-beta1b in multiple...

  10. Distorted Wave Effects of the 1b3g Orbital in Ethylene

    Institute of Scientific and Technical Information of China (English)

    邓景康; 李桂琴; 黄建东; 王芳; 宁传刚; 卢杰; 何垚; 王晓东; 张亦安; 高虹; 王岩; 郑延友


    We study the unexpected distorted wave effects of the 1b3g orbital in ethylene using a high resolution binary (e, 2e) electron momentum spectrometer, at an impact energy of 800 eV plus the binding energy (8 - 22 eV) with symmetric non-coplanar kinematics. The experimental momentum profile of the 1bag orbital is obtained and compared with the data previously measured at an impact energy of 1200eV plus the binding energy. Also, the experimental momentum profles of the 1b3g orbital are compared with the theoretical momentum distributions calculated by using Hartree-Fock and density functional theory methods. The experimental momentum profiles of the 1b3g orbital of ethylene at different impact energies show that the cross section of the orbital below the momentum p~l a.u. is higher for lower impact energies.

  11. Ab initio valence calculations in chemistry

    CERN Document Server

    Cook, D B


    Ab Initio Valence Calculations in Chemistry describes the theory and practice of ab initio valence calculations in chemistry and applies the ideas to a specific example, linear BeH2. Topics covered include the Schrödinger equation and the orbital approximation to atomic orbitals; molecular orbital and valence bond methods; practical molecular wave functions; and molecular integrals. Open shell systems, molecular symmetry, and localized descriptions of electronic structure are also discussed. This book is comprised of 13 chapters and begins by introducing the reader to the use of the Schrödinge

  12. Characteristic Height Growth Pattern in Patients with Pseudohypoparathyroidism: Comparison between Type 1a and Type 1b


    Kinoshita, Kaori; Minagawa, Masanori; Anzai, Michiko; Sato, Yumiko; Kazukawa, Itsuro; Shimohashi, Kyoko; Ota, Setsuo; Kohno, Yoichi


    Pseudohypoparathyroidism (PHP) is a metabolic disorder characterized by organ resistance to the action of parathyroid hormone. PHP type 1 is subclassified into two apparent disorders, type 1a (PHP1a) and type 1b (PHP1b). Patients with PHP1a show Albright hereditary osteodystrophy including short stature. Patients with PHP1b have no such skeletal defects, however, literature regarding the growth of PHP1b is not currently available. We evaluated growth charts of PHP patients, including four PHP...

  13. Microstructure and magnetic properties of bulk magnets Nd_(14-x)Fe_(76+x)Co_3Zr_1B_6(x=0,0.5,1) prepared by spark plasma sintering

    Institute of Scientific and Technical Information of China (English)

    马毅龙; 刘颖; 李军; 杜慧龙; 高静


    Melt-spun ribbons with nominal composition of Nd14-xFe76+xCo3Zr1B6(x=0,0.5,1) were consolidated into isotropic bulk magnets by spark plasma sintering method.It was found that the Nd content and sintering temperature had significant influence on the density and magnetic properties of the sintered magnets.Homogeneous microstructure and fine grain(50-100 nm) were obtained when sintering below 700 ℃,and the initial magnetization curve showed that the coercivity was controlled by the pinning mechanism.However,ab...

  14. Protein 4.1B contributes to the organization of peripheral myelinated axons.

    Directory of Open Access Journals (Sweden)

    Carmen Cifuentes-Diaz

    Full Text Available Neurons are characterized by extremely long axons. This exceptional cell shape is likely to depend on multiple factors including interactions between the cytoskeleton and membrane proteins. In many cell types, members of the protein 4.1 family play an important role in tethering the cortical actin-spectrin cytoskeleton to the plasma membrane. Protein 4.1B is localized in myelinated axons, enriched in paranodal and juxtaparanodal regions, and also all along the internodes, but not at nodes of Ranvier where are localized the voltage-dependent sodium channels responsible for action potential propagation. To shed light on the role of protein 4.1B in the general organization of myelinated peripheral axons, we studied 4.1B knockout mice. These mice displayed a mildly impaired gait and motility. Whereas nodes were unaffected, the distribution of Caspr/paranodin, which anchors 4.1B to the membrane, was disorganized in paranodal regions and its levels were decreased. In juxtaparanodes, the enrichment of Caspr2, which also interacts with 4.1B, and of the associated TAG-1 and Kv1.1, was absent in mutant mice, whereas their levels were unaltered. Ultrastructural abnormalities were observed both at paranodes and juxtaparanodes. Axon calibers were slightly diminished in phrenic nerves and preterminal motor axons were dysmorphic in skeletal muscle. βII spectrin enrichment was decreased along the axolemma. Electrophysiological recordings at 3 post-natal weeks showed the occurrence of spontaneous and evoked repetitive activity indicating neuronal hyperexcitability, without change in conduction velocity. Thus, our results show that in myelinated axons 4.1B contributes to the stabilization of membrane proteins at paranodes, to the clustering of juxtaparanodal proteins, and to the regulation of the internodal axon caliber.

  15. MELCOR 1.8.2 assessment: Aerosol experiments ABCOVE AB5, AB6, AB7, and LACE LA2

    Energy Technology Data Exchange (ETDEWEB)

    Souto, F.J.; Haskin, F.E. [Univ. of New Mexico, Albuquerque, NM (United States). Dept. of Chemical and Nuclear Engineering; Kmetyk, L.N. [Sandia National Labs., Albuquerque, NM (United States)


    The MELCOR computer code has been used to model four of the large-scale aerosol behavior experiments conducted in the Containment System Test Facility (CSTF) vessel. Tests AB5, AB6 and AB7 of the ABCOVE program simulate the dry aerosol conditions during a hypothetical severe accident in an LMFBR. Test LA2 of the LACE program simulates aerosol behavior in a condensing steam environment during a postulated severe accident in an LWR with failure to isolate the containment. The comparison of code results to experimental data show that MELCOR is able to correctly predict most of the thermal-hydraulic results in the four tests. MELCOR predicts reasonably well the dry aerosol behavior of the ABCOVE tests, but significant disagreements are found in the aerosol behavior modelling for the LA2 experiment. These results tend to support some of the concerns about the MELCOR modelling of steam condensation onto aerosols expressed in previous works. During these analyses, a limitation in the MELCOR input was detected for the specification of the aerosol parameters for more than one component. A Latin Hypercube Sampling (LHS) sensitivity study of the aerosol dynamic constants is presented for test AB6. The study shows the importance of the aerosol shape factors in the aerosol deposition behavior, and reveals that MELCOR input/output processing is highly labor intensive for uncertainty and sensitivity analyses based on LHS.

  16. Mono- and bis-thiazolium salts have potent antimalarial activity. (United States)

    Hamzé, Abdallah; Rubi, Eric; Arnal, Pascal; Boisbrun, Michel; Carcel, Carole; Salom-Roig, Xavier; Maynadier, Marjorie; Wein, Sharon; Vial, Henri; Calas, Michèle


    Three new series comprising 24 novel cationic choline analogues and consisting of mono- or bis (N or C-5-duplicated) thiazolium salts have been synthesized. Bis-thiazolium salts showed potent antimalarial activity (much superior to monothiazoliums). Among them, bis-thiazolium salts 12 and 13 exhibited IC(50) values of 2.25 nM and 0.65 nM, respectively, against P. falciparum in vitro. These compounds also demonstrated good in vivo activity (ED(50)

  17. Protein Tyrosine Phosphatase 1B Inhibitors from the Roots of Cudrania tricuspidata


    Tran Hong Quang; Nguyen Thi Thanh Ngan; Chi-Su Yoon; Kwang-Ho Cho; Dae Gill Kang; Ho Sub Lee; Youn-Chul Kim; Hyuncheol Oh


    A chemical investigation of the methanol extract from the roots of Cudrania tricuspidata resulted in the isolation of 16 compounds, including prenylated xanthones 1–9 and flavonoids 10–16. Their structures were identified by NMR spectroscopy and mass spectrometry and comparisons with published data. Compounds 1–9 and 13–16 significantly inhibited PTP1B activity in a dose dependent manner, with IC50 values ranging from 1.9–13.6 μM. Prenylated xanthones showed stronger PTP1B inhibitory effects...

  18. A novel protein tyrosine phosphatase 1B inhibitor from Tinospora sinensis


    Prasoon Gupta; Upasana Sharma; Gupta, Praveen K.; Rakesh Maurya


    Bioassay-directed fractionation led to the identification of a new compound, 4-hydroxy-heptadec-6-enoic acid ethyl ester (1) together with three known compounds (2-4) from Tinospora sinensis. The structure of 1 was determined by analysis of spectroscopic data. The isolated compounds were evaluated for their protein tyrosine phosphatase 1B (PTP1B) inhibitory activity. Compounds 1 and 2 displayed significant inhibitory activity with IC 50 values 61.1 and 74.2 μM, respectively

  19. Potent water extracts of Indonesian medicinal plants against PTP1B


    Azis Saifudin; Tepy Usia; Subehan AbLallo; Hiroyuki Morita; Ken Tanaka; Yasuhiro Tezuka


    Objective: To examine the potent of water as a solvent agent in the preparation of traditional herbal medicine. Methods: Water extracts of 18 plants were prepared through reflux and examined (25 μg/mL) to evaluate their possibility for inhibiting protein tyrosine phosphatase 1B (PTP1B). The determination of IC50 values was performed for the samples possessing more than 80% inhibition. Meanwhile, those exhibiting IC50 values more than 7.0 μg/mL were further profiled for their chemical const...

  20. Enzymes of the AKR1B and AKR1C subfamilies and uterine diseases

    Directory of Open Access Journals (Sweden)

    Tea eLanisnik Rizner


    Full Text Available Endometrial and cervical cancers, uterine myoma, and endometriosis are very common uterine diseases. Worldwide, more than 800,000 women are affected annually by gynecological cancers, as a result of which, more than 360,000 die. During their reproductive age, about 70% of women develop uterine myomas, 10% to 15% suffer from endometriosis, and 35% to 50% from infertility associated with endometriosis. Uterine diseases are associated with aberrant inflammatory responses and concomitant increased production of prostaglandins (PG. They are also related to decreased differentiation, due to low levels of protective progesterone and retinoic acid, and to enhanced proliferation, due to high local concentrations of estrogens. The pathogenesis of these diseases can thus be attributed to disturbed PG, estrogen and retinoid metabolism and actions. Five human members of the aldo-keto reductase 1B (AKR1B and 1C (AKR1C superfamilies, i.e., AKR1B1, AKR1B10, AKR1C1, AKR1C2 and AKR1C3, have roles in these processes and can thus be implicated in uterine diseases. AKR1B1 and AKR1C3 catalyze the formation of PGF2alpha which stimulates cell proliferation. AKR1C3 converts PGD2 to 9alpha,11beta-PGF2, and thus counteracts the formation of 15deoxy-PGJ2, which can activate pro-apoptotic peroxisome-proliferator-activated receptor beta. AKR1B10 catalyzes the reduction of retinal to retinol, and in thus lessens the formation of retinoic acid, with potential pro-differentiating actions. The AKR1C1-AKR1C3 enzymes also act as 17-keto- and 20-ketosteroid reductases to varying extents, and are implicated in increased estradiol and decreased progesterone levels. This review comprises a short introduction to uterine diseases, followed by an overview of the current literature on the AKR1B and AKR1C expression in the uterus and in uterine diseases. The potential implications of the AKR1B and AKR1C enzymes and their pathophysiologies are then discussed, followed by conclusions and

  1. The capsular polysaccharide Vi from Salmonella Typhi is a B1b antigen


    Marshall, Jennifer L.; Flores-Langarica, Adriana; Kingsley, Robert A.; Hitchcock, Jessica R; Ross, Ewan A.; Lopez-Macias, Constantino; Lakey, Jeremy; Martin, Laura B; Toellner, Kai-michael; MacLennan, Calman A.; MacLennan, Ian C; Henderson, Ian R.; Dougan, Gordon; Cunningham, Adam F.


    Vaccination with purified capsular polysaccharide Vi antigen from Salmonella Typhi can protect against typhoid fever, although the mechanism for its efficacy is not clearly established. Here, we have characterised the B cell response to this vaccine in wild-type and T cell-deficient mice. We show that immunization with Typhim Vi rapidly induces proliferation in B1b peritoneal cells, but not in B1a cells or marginal zone (MZ) B cells. This induction of B1b proliferation is concomitant with the...

  2. Thermal conductivity of A1B3C26 ternary compounds and their solid solutions

    International Nuclear Information System (INIS)

    Thermal conductivity of ternary compounds A1B3C26 and solid solutions CuGaxIn1-xS2, CuGaxIn1-xSe2, CuInS2xSe2(1-x), was studied by the absolute and relative methods in the temperature range of 300-550 K. Interrelation between thermal conductivity and tetragonal distortion of the ternary compounds A1B3C26 was established. It is shown that concentrational dependence of thermal conductivity for the solid solutions has the minimum near equimolar compositions

  3. Entwicklung des schweizerischen Arbeitsmarkts 1992 bis 2008


    Roland Aeppli


    Die kräftige Zunahme der Beschäftigung in den letzten drei Jahren war nicht breit abgestützt. Das Beschäftigungswachstum war massgeblich durch einen ausserordentlich starken Anstieg in einzelnen Branchen beeinflusst, die – mit Ausnahme «moderner» Dienstleistungen – zum staatlichen oder staatsnahen Sektor gehören. Dagegen nahm die Beschäftigung im sekundären Sektor und in den eher «traditionellen» (privaten) Dienstleistungsbranchen längerfristig gesehen ab. Vom Beschäftigungszuwachs profitiert...

  4. Anthrax lethal toxin induced lysosomal membrane permeabilization and cytosolic cathepsin release is Nlrp1b/Nalp1b-dependent.

    Directory of Open Access Journals (Sweden)

    Kathleen M Averette

    Full Text Available NOD-like receptors (NLRs are a group of cytoplasmic molecules that recognize microbial invasion or 'danger signals'. Activation of NLRs can induce rapid caspase-1 dependent cell death termed pyroptosis, or a caspase-1 independent cell death termed pyronecrosis. Bacillus anthracis lethal toxin (LT, is recognized by a subset of alleles of the NLR protein Nlrp1b, resulting in pyroptotic cell death of macrophages and dendritic cells. Here we show that LT induces lysosomal membrane permeabilization (LMP. The presentation of LMP requires expression of an LT-responsive allele of Nlrp1b, and is blocked by proteasome inhibitors and heat shock, both of which prevent LT-mediated pyroptosis. Further the lysosomal protease cathepsin B is released into the cell cytosol and cathepsin inhibitors block LT-mediated cell death. These data reveal a role for lysosomal membrane permeabilization in the cellular response to bacterial pathogens and demonstrate a shared requirement for cytosolic relocalization of cathepsins in pyroptosis and pyronecrosis.

  5. Deletion of SNURF / SNRPN U1B and U1B* upstream exons in a child with developmental delay and excessive weight

    Indian Academy of Sciences (India)



    Prader–Willi syndrome is a rare syndrome characterized by hypotonia, developmental delay and excessive appetite. This syndrome is caused by the loss of function of paternally-expressed genes located in an imprinting centre in 15q11-q13. Here, we report the case of a patient who was referred to us with Prader–Willi syndrome-like symptoms including obesity and developmental delay. Examination of this patient revealed that he was a carrier of a paternally inherited deletion that affected the U1B and U1B* upstream exons of the SNURF–SNRNP gene within the 15q11-q13 imprinted region. Mutations localized within this genomic region have not been previously reported in Prader–Willi syndrome patients. It is possible that disruption of upstream exons of SNURF–SNRNP could contribute to Prader–Willi phenotype by disrupting brain-specific alternative transcripts, although, case reports from further patients with a comparable phenotype are required

  6. An elderly-onset limb girdle muscular dystrophy type 1B (LGMD1B) with pseudo-hypertrophy of paraspinal muscles. (United States)

    Furuta, Mitsuru; Sumi-Akamaru, Hisae; Takahashi, Masanori P; Hayashi, Yukiko K; Nishino, Ichizo; Mochizuki, Hideki


    Mutations in LMNA, encoding A-type lamins, lead to diverse disorders, collectively called "laminopathies," which affect the striated muscle, cardiac muscle, adipose tissue, skin, peripheral nerve, and premature aging. We describe a patient with limb-girdle muscular dystrophy type 1B (LGMD1B) carrying a heterozygous p.Arg377His mutation in LMNA, in whom skeletal muscle symptom onset was at the age of 65 years. Her weakness started at the erector spinae muscles, which showed marked pseudo-hypertrophy even at the age of 72 years. Her first episode of syncope was at 44 years; however, aberrant cardiac conduction was not revealed until 60 years. The p.Arg377His mutation has been previously reported in several familial LMNA-associated myopathies, most of which showed muscle weakness before the 6th decade. This is the first report of pseudo-hypertrophy of paravertebral muscles in LMNA-associated myopathies. The pseudo-hypertrophy of paravertebral muscles and the elderly-onset of muscle weakness make this case unique and reportable.

  7. o-Nitroaryl-bis(5-methylfur-2-ylmethanes as Versatile Synthons for the Synthesis of Nitrogen-Containing Heterocycles

    Directory of Open Access Journals (Sweden)

    Andrey V. Gutnov


    Full Text Available 2-Nitroaryldifurylmethanes 1a and 1b, readily available by condensation of 2-nitrobenzaldehyde and 6-nitroveratraldehyde with 2-methylfuran, were transformed into indole, cinnoline and benzothiazine-3,1 derivatives. The reduction of 2-nitroaryldifurylmethanes gave the corresponding anilines 2a,b or indole 3 depending on the reaction conditions. A plausible mechanism for the last reaction involving intramolecular heterocyclic addition between a nitroso-group and a furan ring is proposed. Diazotisation of the amine 2b gave a cinnoline derivative - a product of intramolecular oxidative furan ring opening. Treatment of isothiocyanates 7a,b with perchloric acid resulted in a new rearrangement with furan ring migration leading to the 4-Hbenzothiazine-3,1 derivatives.

  8. Ab interno trabeculectomy: A comprehensive review

    Directory of Open Access Journals (Sweden)

    Ting Ting Liu


    Full Text Available PURPOSE To summarize the original literature on ab interno trabeculectomy with the Trabectome system and to review its efficacy and safety in the treatment of glaucoma. METHOD A literature search in PubMed was performed on ab interno trabeculectomy with the Trabectome system, and clinical relevant information was reviewed and summarized. RESULTS Ab interno trabeculectomy with the Trabectome system on average lowered intraocular pressure (IOP to the mid-teens, and decreased the number of required glaucoma medications. Greater preoperative IOP correlated to a greater percent reduction in IOP. The success rates varied among studies, and the definition of success differed by authors. Intraoperative blood reflux was found in nearly all cases. Incidences of early hypotony and IOP spikes were low. No cases of endophthalmitis, wound leak, aqueous misdirection, choroidal hemorrhage or effusions, and irreversible visual acuity decrease (≥2 Snellen lines have been reported. Available studies had a significant amount of data overlap. Only limited data on long-term results was available. There was no randomized controlled trial to date. CONCLUSIONS Ab interno trabeculectomy with the Trabectome system is an effective and safe surgical approach for patients with various types of open angle glaucoma. On average, the procedure at least in the short term lowers IOP to the mid teens regardless of preoperative IOP with or without the aid of topical medications.

  9. Reference: DREDR1ATRD29AB [PLACE

    Lifescience Database Archive (English)

    Full Text Available DREDR1ATRD29AB Narusaka Y, Nakashima K, Shinwari ZK, Sakuma Y, Furihata T, Abe H, N... ABA-dependent expression of Arabidopsis rd29A gene in response to dehydration and high-salinity stresses. Plant J. 34: 137-148 (2003) PubMed: 12694590; ...

  10. Relationship between genetic polymorphisms of ALDH2 and ADH1B and esophageal cancer risk:A meta-analysis

    Institute of Scientific and Technical Information of China (English)

    Akira; Yokoyama; Tetsuji; Yokoyama


    AIM:To evaluate the contribution of alcohol dehydrogenase-1B(ADH1B)and aldehyde dehydrogenase-2 (ALDH2)polymorphisms to the risk of esophageal cancer.METHODS:Nineteen articles were included by searching MEDLINE,EMBASE and the Chinese Biomedical Database,13 on ADH1B and 18 on ALDH2.We performed a meta-analysis of case-control studies including 13 studies on ADH1B(cases/controls:2390/7100)and 18 studies on ALDH2(2631/6030).RESULTS:The crude odds ratio[OR(95%confidence interval)]was 2.91(2.04-4.14)for ADH1B*1/...

  11. HF diets increase hypothalamic PTP1B and induce leptin resistance through both leptin-dependent and -independent mechanisms


    White, Christy L.; Whittington, Amy; Barnes, Maria J.; Wang, Zhong; Bray, George A; Morrison, Christopher D.


    Protein tyrosine phosphatase 1B (PTP1B) contributes to leptin resistance by inhibiting intracellular leptin receptor signaling. Mice with whole body or neuron-specific deletion of PTP1B are hypersensitive to leptin and resistant to diet-induced obesity. Here we report a significant increase in PTP1B protein levels in the mediobasal hypothalamus (P = 0.003) and a concomitant reduction in leptin sensitivity following 28 days of high-fat (HF) feeding in rats. A significant increase in PTP1B mRNA...

  12. Data of evolutionary structure change: 1C4XA-2OG1B [Confc[Archive

    Lifescience Database Archive (English)

    Full Text Available 1C4XA-2OG1B 1C4X 2OG1 A B ---TVEIIEKRFPSGT---LASHALVAGDPQSPAVVLLH...EEEEEEE HHHHHHHHHHHHH 0 1C4X... A 1C4XA FPSGT---LASHA ...645107269287 4.700198173522949 1 1C4X... A 1C4XA

  13. Functions of OATP1a/1b transporters in vivo: insights from mouse models

    NARCIS (Netherlands)

    Steeg, E. van de; Lusuf, D.; Schinkel, A.H.


    Organic anion-transporting polypeptides (OATPs) are a superfamily of uptake transporters that mediate the cellular uptake of a broad range of endogenous and exogenous compounds. Of these OATP transporters, members of the 1A and 1B subfamilies have broad substrate specificities. Because they are main

  14. Archaeal remains dominate marine organic matter from the early Albian oceanic anoxic event 1b

    DEFF Research Database (Denmark)

    Kuypers, M.M.M.; Blokker, P.; Hopmans, E.C.;


    The sources for both soluble and insoluble organic matter of the early Albian (∼112 Myr) oceanic anoxic event (OAE) 1b black shales of the Ocean Drilling Program (ODP) site 1049C (North Atlantic Ocean off the coast of Florida) and the Ravel section of the Southeast France Basin (SEFB) were determ...

  15. Haploinsufficiency of the STX1B gene is associated with myoclonic astatic epilepsy

    NARCIS (Netherlands)

    Vlaskamp, Danique R.M.; Rump, Patrick; Callenbach, Petra M.C.; Vos, Yvonne J.; Sikkema-Raddatz, Birgit; van Ravenswaaij-Arts, Conny M.A.; Brouwer, Oebele F.


    We describe an 18-year-old male patient with myoclonic astatic epilepsy (MAE), moderate to severe intellectual disability, behavioural problems, several dysmorphisms and a 1.2-Mb de novo deletion on chromosome 16p11.2. This deletion results in haploinsufficiency of STX1B and other genes. Recently, v

  16. Insertional Mutagenesis Identifies a STAT3/Arid1b/β-catenin Pathway Driving Neurofibroma Initiation

    Directory of Open Access Journals (Sweden)

    Jianqiang Wu


    Full Text Available To identify genes and signaling pathways that initiate Neurofibromatosis type 1 (NF1 neurofibromas, we used unbiased insertional mutagenesis screening, mouse models, and molecular analyses. We mapped an Nf1-Stat3-Arid1b/β-catenin pathway that becomes active in the context of Nf1 loss. Genetic deletion of Stat3 in Schwann cell progenitors (SCPs and Schwann cells (SCs prevents neurofibroma formation, decreasing SCP self-renewal and β-catenin activity. β-catenin expression rescues effects of Stat3 loss in SCPs. Importantly, P-STAT3 and β-catenin expression correlate in human neurofibromas. Mechanistically, P-Stat3 represses Gsk3β and the SWI/SNF gene Arid1b to increase β-catenin. Knockdown of Arid1b or Gsk3β in Stat3fl/fl;Nf1fl/fl;DhhCre SCPs rescues neurofibroma formation after in vivo transplantation. Stat3 represses Arid1b through histone modification in a Brg1-dependent manner, indicating that epigenetic modification plays a role in early tumorigenesis. Our data map a neural tumorigenesis pathway and support testing JAK/STAT and Wnt/β-catenin pathway inhibitors in neurofibroma therapeutic trials.

  17. Insertional Mutagenesis Identifies a STAT3/Arid1b/β-catenin Pathway Driving Neurofibroma Initiation. (United States)

    Wu, Jianqiang; Keng, Vincent W; Patmore, Deanna M; Kendall, Jed J; Patel, Ami V; Jousma, Edwin; Jessen, Walter J; Choi, Kwangmin; Tschida, Barbara R; Silverstein, Kevin A T; Fan, Danhua; Schwartz, Eric B; Fuchs, James R; Zou, Yuanshu; Kim, Mi-Ok; Dombi, Eva; Levy, David E; Huang, Gang; Cancelas, Jose A; Stemmer-Rachamimov, Anat O; Spinner, Robert J; Largaespada, David A; Ratner, Nancy


    To identify genes and signaling pathways that initiate Neurofibromatosis type 1 (NF1) neurofibromas, we used unbiased insertional mutagenesis screening, mouse models, and molecular analyses. We mapped an Nf1-Stat3-Arid1b/β-catenin pathway that becomes active in the context of Nf1 loss. Genetic deletion of Stat3 in Schwann cell progenitors (SCPs) and Schwann cells (SCs) prevents neurofibroma formation, decreasing SCP self-renewal and β-catenin activity. β-catenin expression rescues effects of Stat3 loss in SCPs. Importantly, P-STAT3 and β-catenin expression correlate in human neurofibromas. Mechanistically, P-Stat3 represses Gsk3β and the SWI/SNF gene Arid1b to increase β-catenin. Knockdown of Arid1b or Gsk3β in Stat3(fl/fl);Nf1(fl/fl);DhhCre SCPs rescues neurofibroma formation after in vivo transplantation. Stat3 represses Arid1b through histone modification in a Brg1-dependent manner, indicating that epigenetic modification plays a role in early tumorigenesis. Our data map a neural tumorigenesis pathway and support testing JAK/STAT and Wnt/β-catenin pathway inhibitors in neurofibroma therapeutic trials. PMID:26904939

  18. Mirror Advanced Reactor Study (MARS). Final report. Volume 1-B. Commercial fusion electric plant

    Energy Technology Data Exchange (ETDEWEB)

    Donohue, M.L.; Price, M.E. (eds.)


    Volume 1-B contains the following chapters: (1) blanket and reflector; (2) central cell shield; (3) central cell structure; (4) heat transport and energy conversion; (5) tritium systems; (6) cryogenics; (7) maintenance; (8) safety; (9) radioactivity, activation, and waste disposal; (10) instrumentation and control; (11) balance of plant; (12) plant startup and operation; (13) plant availability; (14) plant construction; and (15) economic analysis.

  19. Brevenal inhibits pacific ciguatoxin-1B-induced neurosecretion from bovine chromaffin cells.

    Directory of Open Access Journals (Sweden)

    César Mattei

    Full Text Available Ciguatoxins and brevetoxins are neurotoxic cyclic polyether compounds produced by dinoflagellates, which are responsible for ciguatera and neurotoxic shellfish poisoning (NSP respectively. Recently, brevenal, a natural compound was found to specifically inhibit brevetoxin action and to have a beneficial effect in NSP. Considering that brevetoxin and ciguatoxin specifically activate voltage-sensitive Na+ channels through the same binding site, brevenal has therefore a good potential for the treatment of ciguatera. Pacific ciguatoxin-1B (P-CTX-1B activates voltage-sensitive Na+ channels and promotes an increase in neurotransmitter release believed to underpin the symptoms associated with ciguatera. However, the mechanism through which slow Na+ influx promotes neurosecretion is not fully understood. In the present study, we used chromaffin cells as a model to reconstitute the sequence of events culminating in ciguatoxin-evoked neurosecretion. We show that P-CTX-1B induces a tetrodotoxin-sensitive rise in intracellular Na+, closely followed by an increase in cytosolic Ca2+ responsible for promoting SNARE-dependent catecholamine secretion. Our results reveal that brevenal and beta-naphtoyl-brevetoxin prevent P-CTX-1B secretagogue activity without affecting nicotine or barium-induced catecholamine secretion. Brevenal is therefore a potent inhibitor of ciguatoxin-induced neurotoxic effect and a potential treatment for ciguatera.

  20. 2D numerical comparison of trailing edge flaps - UpWind WP1B3

    DEFF Research Database (Denmark)

    Buhl, Thomas; Andersen, Peter Bjørn; Barlas, T.K.

    This report covers the investigations and comparisons of trailing edge flaps carried out by Delft and Risø. The work is a part of the W1B3 work package of the UpWind EU-project. This report covers only 2D test cases with simple control of the trailing edge flap with the objective of keeping CL co...

  1. Interaction of CPCCOEt with a chimeric mGlu1b and calcium sensing receptor

    DEFF Research Database (Denmark)

    Bräuner-Osborne, H; Jensen, Anders A.; Krogsgaard-Larsen, P


    7-Hydroxyiminocyclopropan[b]chromen-1a-carboxylic acid ethyl ester (CPCCOEt) has previously been shown to be a selective non-competitive antagonist at the metabotropic glutamate (mGlu) receptor subtype 1. In this study we have tested the effect of CPCCOEt on mGlu1b, the calcium sensing receptor (...

  2. Data of evolutionary structure change: 1B0FA-1O3AA [Confc[Archive

    Lifescience Database Archive (English)

    Full Text Available YDPV >EEE - > ATOM 556 CA ARG A ...ryIDChain>1O3AA KSIVHPSYNSN cture>EEEEE ucture...bChain> 1B0FA LGRNR-GIASV > - ...ence>TKSSGTSYPDV > > ATOM 1849 C...A AHCYK----SGIQV >GGG ---- EEEe>

  3. Data of evolutionary structure change: 1B1GA-1AK8A [Confc[Archive

    Lifescience Database Archive (English)

    Full Text Available entryIDChain>1B1GA KEGDP-NQLSK > - EEE...> A 1AK8A FDKDGDGTITT H ...A LFEEL---DKNGD >HHHHH--- ...entryIDChain>1AK8A LQDMINEVDADGN ...>HHHHH > ATOM 722 CA LEU A 48 3.325 7.917 -3.325 1.00 0

  4. Johnston Atoll Site 1B-P 6/29/2000 28-29M (United States)

    US Fish and Wildlife Service, Department of the Interior — One-meter-square (1 meter x 1 meter) benthic substrate at Johnston Atoll, site 1B-P (16 47.147N, 169 27.695W), between 28 and 29 meters along a permanent transect.

  5. Johnston Atoll Site 1B-P 6/29/2000 14-15M (United States)

    US Fish and Wildlife Service, Department of the Interior — One-meter-square (1 meter x 1 meter) benthic substrate at Johnston Atoll, site 1B-P (16 47.147N, 169 27.695W), between 14 and 15 meters along a permanent transect.

  6. The capsular polysaccharide Vi from Salmonella Typhi is a B1b antigen (United States)

    Marshall, Jennifer L.; Flores-Langarica, Adriana; Kingsley, Robert A.; Hitchcock, Jessica R.; Ross, Ewan A.; Lopez-Macias, Constantino; Lakey, Jeremy; Martin, Laura B.; Toellner, Kai-Michael; MacLennan, Calman A.; MacLennan, Ian C; Henderson, Ian R.; Dougan, Gordon; Cunningham, Adam F.


    Vaccination with purified capsular polysaccharide Vi antigen from Salmonella Typhi can protect against typhoid fever, although the mechanism for its efficacy is not clearly established. Here, we have characterised the B cell response to this vaccine in wild-type and T cell-deficient mice. We show that immunization with Typhim Vi rapidly induces proliferation in B1b peritoneal cells, but not in B1a cells or marginal zone (MZ) B cells. This induction of B1b proliferation is concomitant with the detection of splenic Vi-specific antibody secreting cells and protective antibody and Rag1-deficient B1b cell chimeras generated by adoptive transfer induced specific antibody after Vi immunization. Furthermore, antibody derived from peritoneal B cells is sufficient to confer protection against Salmonella that express Vi antigen. Expression of Vi by Salmonella during infection did not inhibit the development of early antibody responses to non-Vi antigens. Despite this, the protection conferred by immunization of mice with porin proteins from Salmonella, which induce antibody-mediated protection, was reduced after infection with Vi-expressing Salmonella, although protection was not totally abrogated. This work therefore suggests that in mice, B1b cells contribute to the protection induced by Vi antigen and targeting non-Vi antigens as sub-unit vaccines may offer an attractive strategy to augment current Vi-based vaccine strategies. PMID:23162127

  7. A complex selection signature at the human AVPR1B gene

    Directory of Open Access Journals (Sweden)

    Cagliani Rachele


    Full Text Available Abstract Background The vasopressin receptor type 1b (AVPR1B is mainly expressed by pituitary corticotropes and it mediates the stimulatory effects of AVP on ACTH release; common AVPR1B haplotypes have been involved in mood and anxiety disorders in humans, while rodents lacking a functional receptor gene display behavioral defects and altered stress responses. Results Here we have analyzed the two exons of the gene and the data we present suggest that AVPR1B has been subjected to natural selection in humans. In particular, analysis of exon 2 strongly suggests the action of balancing selection in African populations and Europeans: the region displays high nucleotide diversity, an excess of intermediate-frequency alleles, a higher level of within-species diversity compared to interspecific divergence and a genealogy with common haplotypes separated by deep branches. This relatively unambiguous situation coexists with unusual features across exon 1, raising the possibility that a nonsynonymous variant (Gly191Arg in this region has been subjected to directional selection. Conclusion Although the underlying selective pressure(s remains to be identified, we consider this to be among the first documented examples of a gene involved in mood disorders and subjected to natural selection in humans; this observation might add support to the long-debated idea that depression/low mood might have played an adaptive role during human evolution.

  8. Human CRISP-3 binds serum alpha(1)B-glycoprotein across species

    DEFF Research Database (Denmark)

    Udby, Lene; Johnsen, Anders H; Borregaard, Niels


    CRISP-3 was previously shown to be bound to alpha(1)B-glycoprotein (A1BG) in human serum/plasma. All mammalian sera are supposed to contain A1BG, although its presence in rodent sera is not well-documented. Since animal sera are often used to supplement buffers in experiments, in particular such...

  9. Mirror Advanced Reactor Study (MARS). Final report. Volume 1-B. Commercial fusion electric plant

    International Nuclear Information System (INIS)

    Volume 1-B contains the following chapters: (1) blanket and reflector; (2) central cell shield; (3) central cell structure; (4) heat transport and energy conversion; (5) tritium systems; (6) cryogenics; (7) maintenance; (8) safety; (9) radioactivity, activation, and waste disposal; (10) instrumentation and control; (11) balance of plant; (12) plant startup and operation; (13) plant availability; (14) plant construction; and (15) economic analysis

  10. Lmx-1b and Wnt-7a expression in axolotl limb during development and regeneration. (United States)

    Shimokawa, Takashi; Yasutaka, Satoru; Kominami, Rieko; Shinohara, Harumichi


    Axolotls (Ambystoma mexicanum) have the ability to regenerate amputated limbs throughout their life span. During limb regeneration as well as development, undifferentiated cells in the blastema acquire positional information to reproduce the original pattern along three cardinal limb axes: anteroposterior, proximodistal and dorsoventral. In the present study, we attempted to understand the molecular mechanism involved in patterning of axolotl limb development and regeneration along the dorsoventral (DV) axis. We cloned axolotl Lmx-1b and Wnt-7a, and investigated the expression pattern of these genes in developing and regenerating limbs. In axolotl, unlike in amniotes, Wnt-7a was expressed in a diffuse manner throughout both developing limb bud and regenerating limb blastema. Lmx-1b expression was observed at the dorsal mesenchyme in the developing and regenerating limbs. On the basis of the expression patterns of Lmx-1b and Wnt-7a, it was difficult to identify the interaction between these two genes as reported in amniotes in previous studies. Possibly, with regard to Lmx-1b expression, a Wnt-7a-independent mechanism may exist in axolotl limb development and regeneration.

  11. Johnston Atoll Site 1B-P 6/29/2000 16-17M (United States)

    US Fish and Wildlife Service, Department of the Interior — One-meter-square (1 meter x 1 meter) benthic substrate at Johnston Atoll, site 1B-P (16 47.147N, 169 27.695W), between 16 and 17 meters along a permanent transect.

  12. Johnston Atoll Site 1B-P 6/29/2000 5-6M (United States)

    US Fish and Wildlife Service, Department of the Interior — One-meter-square (1 meter x 1 meter) benthic substrate at Johnston Atoll, site 1B-P (16 47.147N, 169 27.695W), between 5 and 6 meters along a permanent transect.

  13. 20 CFR 655.736 - What are H-1B-dependent employers and willful violators? (United States)


    ... Internal Revenue Service (IRS) in regulations located at 26 CFR 1.414(b)-1(a), (c)-2 and (m)-5. Guidance on... Fashion Models, and Requirements for Employers Seeking To Employ Nonimmigrants on H-1b1 and E-3 Visas in... status? Any group treated as a single employer under the Internal Revenue Code (IRC) at 26 U.S.C....

  14. The Flammability of ABS/PET/APP Mixtures with Different Synergic Agents%不同协效剂对APP膨胀阻燃ABS/PET合金的影响

    Institute of Scientific and Technical Information of China (English)

    赵国栋; 潘治梁; 蔡绪福


    ABS/PET/APP mixtures with different synergic agents (SA) were prepared for investigating the effect of SA (2, 2' - bis ( 2 - oxazoline) (BOZ), thermoplastic phenolic resins (TPPF), manganese dioxide, montmorillonite (MMT), zinc borate, 4A Zeolite,zinc oxide (ZnO), and attapulgite on the flame retardancy of mixtures, and the thermal degradation and charring of ABS/PET/APP was analyzed. It was concluded that a novel intumescent flame retardant containing APP ( acid source and a blowing agent) and PET (carbon source) was obtained because APP mainly catalyzed PET to degrade into charring in ABS/PET/APP mixture on heating. The flammability of ABS/PET/APP mixtures with different SA was measured by the limited oxygen index (LOI) and UL-94 tests. Except for ABS/PET/APP/attapulgite mixture, ABS/PET/APP mixtures with other SA all passed the V-0 rating in UL-94 tests, the LOI of which was improved compare with ABS/PET/APP mixture. Thermo-oxidative degradation behaviors of mixtures were analyzed by thermal gravimetric analyzer (TGA), which showed an increasing char yield of ABS/PET/APP mixtures due to the addition of SA. And scanning electron microcopy (SEM) showed the denser carbon layer formation on the surface of ABS/PET/APP mixtures with SA ( except for attapulgite) after burning.%研究了8种协效剂(双噁唑啉、热塑性酚醛树脂、二氧化锰、蒙脱土、硼酸锌、4A分子筛、氧化锌和凹凸棒)对APP膨胀阻燃ABS/PET合金的影响,并探讨了ABS/PET/APP体系的降解成炭行为.研究表明,APP主要促进了PET分解成炭从而与其成为一种新型膨胀阻燃体系.通过氧指数(LOI)和UL-94标准测试燃烧性能,除凹凸棒外,其它7种协效剂均提高了ABS/PET/APP体系的氧指数,并使其通过V-0级测试;热失重分析(TGA)表明,ABS/PET/APP/协效剂体系具有更高的成炭率;通过扫描电子显微镜(SEM)对炭层表面进行观察,除凹凸棒体系外,其它7种协效剂体系的炭层表面均具有更好的致密性.

  15. Preclinical pharmacology and pharmacokinetics of AZD3783, a selective 5-hydroxytryptamine 1B receptor antagonist. (United States)

    Zhang, Minli; Zhou, Diansong; Wang, Yi; Maier, Donna L; Widzowski, Daniel V; Sobotka-Briner, Cynthia D; Brockel, Becky J; Potts, William M; Shenvi, Ashok B; Bernstein, Peter R; Pierson, M Edward


    The preclinical pharmacology and pharmacokinetic properties of (2R)-6-methoxy-8-(4-methylpiperazin-1-yl)-N-(4-morpholin-4-ylphenyl)chromane-2-carboxamide (AZD3783), a potent 5-hydroxytryptamine 1B (5-HT(1B)) receptor antagonist, were characterized as part of translational pharmacokinetic/pharmacodynamic hypothesis testing in human clinical trials. The affinity of AZD3783 to the 5-HT(1B) receptor was measured in vitro by using membrane preparations containing recombinant human or guinea pig 5-HT(1B) receptors and in native guinea pig brain tissue. In vivo antagonist potency of AZD3783 for the 5HT(1B) receptor was investigated by measuring the blockade of 5-HT(1B) agonist-induced guinea pig hypothermia. The anxiolytic-like potency was assessed using the suppression of separation-induced vocalization in guinea pig pups. The affinity of AZD3783 for human and guinea pig 5-HT(1B) receptor (K(i), 12.5 and 11.1 nM, respectively) was similar to unbound plasma EC(50) values for guinea pig receptor occupancy (11 nM) and reduction of agonist-induced hypothermia (18 nM) in guinea pig. Active doses of AZD3783 in the hypothermia assay were similar to doses that reduced separation-induced vocalization in guinea pig pups. AZD3783 demonstrated favorable pharmacokinetic properties. The predicted pharmacokinetic parameters (total plasma clearance, 6.5 ml/min/kg; steady-state volume of distribution, 6.4 l/kg) were within 2-fold of the values observed in healthy male volunteers after a single 20-mg oral dose. This investigation presents a direct link between AZD3783 in vitro affinity and in vivo receptor occupancy to preclinical disease model efficacy. Together with predicted human pharmacokinetic properties, we have provided a model for the quantitative translational pharmacology of AZD3783 that increases confidence in the optimal human receptor occupancy required for antidepressant and anxiolytic effects in patients. PMID:21825000

  16. Preclinical pharmacology and pharmacokinetics of AZD3783, a selective 5-hydroxytryptamine 1B receptor antagonist. (United States)

    Zhang, Minli; Zhou, Diansong; Wang, Yi; Maier, Donna L; Widzowski, Daniel V; Sobotka-Briner, Cynthia D; Brockel, Becky J; Potts, William M; Shenvi, Ashok B; Bernstein, Peter R; Pierson, M Edward


    The preclinical pharmacology and pharmacokinetic properties of (2R)-6-methoxy-8-(4-methylpiperazin-1-yl)-N-(4-morpholin-4-ylphenyl)chromane-2-carboxamide (AZD3783), a potent 5-hydroxytryptamine 1B (5-HT(1B)) receptor antagonist, were characterized as part of translational pharmacokinetic/pharmacodynamic hypothesis testing in human clinical trials. The affinity of AZD3783 to the 5-HT(1B) receptor was measured in vitro by using membrane preparations containing recombinant human or guinea pig 5-HT(1B) receptors and in native guinea pig brain tissue. In vivo antagonist potency of AZD3783 for the 5HT(1B) receptor was investigated by measuring the blockade of 5-HT(1B) agonist-induced guinea pig hypothermia. The anxiolytic-like potency was assessed using the suppression of separation-induced vocalization in guinea pig pups. The affinity of AZD3783 for human and guinea pig 5-HT(1B) receptor (K(i), 12.5 and 11.1 nM, respectively) was similar to unbound plasma EC(50) values for guinea pig receptor occupancy (11 nM) and reduction of agonist-induced hypothermia (18 nM) in guinea pig. Active doses of AZD3783 in the hypothermia assay were similar to doses that reduced separation-induced vocalization in guinea pig pups. AZD3783 demonstrated favorable pharmacokinetic properties. The predicted pharmacokinetic parameters (total plasma clearance, 6.5 ml/min/kg; steady-state volume of distribution, 6.4 l/kg) were within 2-fold of the values observed in healthy male volunteers after a single 20-mg oral dose. This investigation presents a direct link between AZD3783 in vitro affinity and in vivo receptor occupancy to preclinical disease model efficacy. Together with predicted human pharmacokinetic properties, we have provided a model for the quantitative translational pharmacology of AZD3783 that increases confidence in the optimal human receptor occupancy required for antidepressant and anxiolytic effects in patients.

  17. The Polycomb protein and E3 ubiquitin ligase Ring1B harbors an IRES in its highly conserved 5' UTR.

    Directory of Open Access Journals (Sweden)

    Erwin Boutsma

    Full Text Available Ring1B is an essential member of the highly conserved Polycomb group proteins, which orchestrate developmental processes, cell growth and stem cell fate by modifying local chromatin structure. Ring1B was found to be the E3 ligase that monoubiquitinates histone H2A, which adds a new level of chromatin modification to Polycomb group proteins. Here we report that Ring1B belongs to the exclusive group of proteins that for their translation depend on a stable 5' UTR sequence in their mRNA known as an Internal Ribosome Entry Site (IRES. In cell transfection assays the Ring1B IRES confers significantly higher expression levels of Ring1B than a Ring1B cDNA without the IRES. Also, dual luciferase assays show strong activity of the Ring1B IRES. Although our findings indicate Ring1B can be translated under conditions where cap-dependent translation is impaired, we found the Ring1B IRES to be cap-dependent. This raises the possibility that translational control of Ring1B is a multi-layered process and that translation of Ring1B needs to be maintained under varying conditions, which is in line with its essential role as an E3 ligase for monoubiquitination of histone H2A in the PRC1 Polycomb protein complex.

  18. Spatial-Temporal Study of Rab1b Dynamics and Function at the ER-Golgi Interface. (United States)

    Martinez, Hernán; García, Iris A; Sampieri, Luciana; Alvarez, Cecilia


    The GTPase Rab1b is involved in ER to Golgi transport, with multiple Rab1b effectors (located at ERES, VTCs and the Golgi complex) being required for its function. In this study, we performed live-cell dual-expression studies to analyze the dynamics of Rab1b and some effectors located at the ERES-Golgi interface. Rab1b occupied widely distributed mobile punctate and tubular structures, displaying a transient overlaps with its effectors and showing that these overlaps occurred at the same time in spatially distinct steps of ER to Golgi transport. In addition, we assessed Rab1b dynamics during cargo sorting by analyzing the concentration at ERES of a Golgi protein (SialT2-CFP) during Brefeldin A washout (BFA WO). Rab1b was associated to most of the ERES structures, but at different times during BFA WO, and recurrently SialT2-CFP was sorted in the ERES-Rab1b positive structures. Furthermore, we reveal for first time that Rab1b localization time at ERES depended on GBF1, a Rab1b effector that acts as the guanine nucleotide exchange factor of Arf1, and that Rab1b membrane association/dissociation dynamics at ERES was dependent on the GBF1 membrane association and activity, which strongly suggests that GBF1 activity modulates Rab1b membrane cycling dynamic.

  19. Spatial-Temporal Study of Rab1b Dynamics and Function at the ER-Golgi Interface (United States)

    Martinez, Hernán; García, Iris A.; Sampieri, Luciana


    The GTPase Rab1b is involved in ER to Golgi transport, with multiple Rab1b effectors (located at ERES, VTCs and the Golgi complex) being required for its function. In this study, we performed live-cell dual-expression studies to analyze the dynamics of Rab1b and some effectors located at the ERES-Golgi interface. Rab1b occupied widely distributed mobile punctate and tubular structures, displaying a transient overlaps with its effectors and showing that these overlaps occurred at the same time in spatially distinct steps of ER to Golgi transport. In addition, we assessed Rab1b dynamics during cargo sorting by analyzing the concentration at ERES of a Golgi protein (SialT2-CFP) during Brefeldin A washout (BFA WO). Rab1b was associated to most of the ERES structures, but at different times during BFA WO, and recurrently SialT2-CFP was sorted in the ERES-Rab1b positive structures. Furthermore, we reveal for first time that Rab1b localization time at ERES depended on GBF1, a Rab1b effector that acts as the guanine nucleotide exchange factor of Arf1, and that Rab1b membrane association/dissociation dynamics at ERES was dependent on the GBF1 membrane association and activity, which strongly suggests that GBF1 activity modulates Rab1b membrane cycling dynamic. PMID:27500526

  20. Potent water extracts of Indonesian medicinal plants against PTP1B

    Institute of Scientific and Technical Information of China (English)

    Azis Saifudin; Tepy Usia; Subehan AbLallo; Hiroyuki Morita; Ken Tanaka; Yasuhiro Tezuka


    Objective: To examine the potent of water as a solvent agent in the preparation of traditional herbal medicine. Methods: Water extracts of 18 plants were prepared through reflux and examined (25 mg/mL) to evaluate their possibility for inhibiting protein tyrosine phosphatase 1B (PTP1B). The determination of IC50 values was performed for the samples possessing more than 80% inhibition. Meanwhile, those exhibiting IC50 values more than 7.0 mg/mL were further profiled for their chemical constituents through nuclear magnetic resonance (NMR) measurement. Results: About 44% (8) of the examined samples showed more than 80% inhibition against PTP1B. The water extracts of Elephantopus scaber, Helicteres isora aerial parts, Elaeocarpus grandiflorus (E. grandiflorus) fruits, Melaleuca leucadendron leaves, and Quercus infectoria gum had IC50 values ranging from 2.05 to 6.90 mg/mL. Meanwhile, Andropogon nardus and Centella asiatica were at the area of d 3.0–4.0 ppm. Further, the 13C NMR observation of samples possessing the most intensive signals in their proton NMR Cinnamomum burmannii and E. grandiflorus showed the peaks at the area of d 60–90 ppm as the supportive evidence for sugar group signals. Intriguingly, a disaccharide from E. grandiflorus could be an active inhibitor towards PTB1B. Conclusions: In contrast to the mainstream solvents currently used in modern herbal manufactures especially Jamu medicine in Indonesia, pure-water-extracted materials should be reconsidered and could be reemerged for future studies and for the manufacture of herbal medicines. In addition, the activity of Jamu components should be confirmed that their antidiabetes and antiobesity activities could be through the inhibition of PTP1B.

  1. SLCO1B1 Variants and Angiotensin Converting Enzyme Inhibitor (Enalapril) -Induced Cough: a Pharmacogenetic Study (United States)

    Luo, Jian-Quan; He, Fa-Zhong; Wang, Zhen-Min; Sun, Ning-Ling; Wang, Lu-Yan; Tang, Gen-Fu; Liu, Mou-Ze; Li, Qing; Chen, Xiao-Ping; Liu, Zhao-Qian; Zhou, Hong-Hao; Zhang, Wei


    Clinical observations suggest that incidence of cough in Chinese taking angiotensin converting enzyme inhibitors is much higher than other racial groups. Cough is the most common adverse reaction of enalapril. We investigate whether SLCO1B1 genetic polymorphisms, previously reported to be important determinants of inter-individual variability in enalapril pharmacokinetics, are associated with the enalapril-induced cough. A cohort of 450 patients with essential hypertension taking 10 mg enalapril maleate were genotyped for the functional SLCO1B1 variants, 388A > G (Asn130Asp, rs2306283) and 521T > C (Val174Ala, rs4149056). The primary endpoint was cough, which was recorded when participants were bothered by cough and respiratory symptoms during enalapril treatment without an identifiable cause. SLCO1B1 521C allele conferred a 2-fold relative risk of enalapril-induced cough (95% confidence interval [CI] = 1.34–3.04, P = 6.2 × 10−4), and haplotype analysis suggested the relative risk of cough was 6.94-fold (95% CI = 1.30–37.07, P = 0.020) in SLCO1B1*15/*15 carriers. Furthermore, there was strong evidence for a gene-dose effect (percent with cough in those with 0, 1, or 2 copy of the 521C allele: 28.2%, 42.5%, and 71.4%, trend P = 6.6 × 10−4). Our study highlights, for the first time, SLCO1B1 variants are strongly associated with an increased risk of enalapril-induced cough. The findings will be useful to provide pharmacogenetic markers for enalapril treatment. PMID:26607661


    Institute of Scientific and Technical Information of China (English)

    Min-qiang Yu; Zhi-ping Zhou; De-yue Yan


    This work deals with the kinetics of co-condensation polymerization of AB2 and AB monomers, giving expressions of the two-dimensional molecular weight distribution function and the number/weight average molecular weights of the resulting copolymers. The two-dimensional molecular weight distribution depends on two indices, n and l, which are the respective numbers of AB2 and AB units in a copolymer species. The evolution of the two-dimensional weight and z distributions during the co-condensation polymerization has been evaluated systematically. Finally, the two-dimensional distribution was transformed into a one-dimensional molecular weight distribution with only one variable (the molecular weight of the products instead of the degree of polymerization). The calculated results show that the highly branched copolymer has a very broad molecular weight distribution when the co-condensation polymerization approaches completion.

  3. On the Strain Rate Sensitivity of Abs and Abs Plus Fused Deposition Modeling Parts (United States)

    Vairis, A.; Petousis, M.; Vidakis, N.; Savvakis, K.


    In this work the effect of strain rate on the tensile strength of fused deposition modeling parts built with Acrylonitrile-butadiene-styrene (ABS) and ABS plus material is presented. ASTM D638-02a specimens were built with ABS and ABS plus and they were tested on a Schenck Trebel Co. tensile test machine at three different test speeds, equal, lower, and higher to the test speed required by the ASTM D638-02a standard. The experimental tensile strength results were compared and evaluated. The fracture surfaces of selected specimens were examined with a scanning electron microscope, to determine failure mode of the filament strands. It was found that, as the test speed increases, specimens develop higher tensile strength and have higher elastic modulus. Specimens tested in the highest speed of the experiment had on average about 10% higher elastic modulus and developed on average about 11% higher tensile strength.

  4. High pressure synthesis of BiS2

    DEFF Research Database (Denmark)

    Søndergaard-Pedersen, Simone; Nielsen, Morten Bormann; Bremholm, Martin

    crystal structures and electrical properties.1,2 Up until now, the most sulfur rich phase in the Bi-S phase diagram was Bi2S3.3 For BiS2 the Bi atoms have anisotropic charge distribution and more complex structures are expected when comparing the layered structures of transition metal dichalcogenides....... The possibilities of using high pressure synthesis to discover new phases in the Bi-S binary system were investigated as early as the 1960’s.4 The research led to discovery of a compound with BiS2 stoichiometry, but no structure solution of BiS2 was reported. A reason behind making this new phase is to study...... the physical properties since the related compound Bi2S3 is known to be a thermoelectric material.5 In this research the BiS2 compound was synthesized by a high pressure and high temperature method using a multi-anvil large volume press and the structure was solved by single crystal diffraction. The structure...

  5. Leaching behaviour of the Swedish KBS-glasses ABS 39 and ABS 41

    International Nuclear Information System (INIS)

    The planned Swedish KBS glass corrosion investigation program comprises experiments with inactive glasses containing simulated waste, prolonged in-situ tests, the characterization of corrosion products, immiscibility studies, and corrosion experiments with hot glass. This presentation gives a short description of the entire program. It focuses thereafter on some recent leaching results with the inactive KBS glass qualities ABS 39 and ABS 41, which were leached in a manner similar to the PNL MCC-1 test procedure. 5 figures, 9 tables

  6. Thermomechanical properties of ABS/PA AND ABS/PC blends


    GUINAULT, Alain; Sollogoub, Cyrille


    International audience The significant increase of Waste Electric and Electronic Equipment (WEEE) has led to an important research in upgrading recycled engineering plastics by means of a blending technique. Classical twin-screw extrusion is compared to a new blending technique, where two polymers are combined together and then flow in several static mixers. This technique allows to obtain different morphologies of compatibilized ABS/PA or ABS/PC blends and the aim of this work is to evalu...

  7. 40 CFR 721.8100 - Potassium N,N-bis (hydroxy-ethyl) cocoamine oxide phosphate, and potassium N,N-bis (hy-droxy... (United States)


    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Potassium N,N-bis (hydroxy-ethyl) cocoamine oxide phosphate, and potassium N,N-bis (hy-droxy-ethyl) tal-lo-wa-mine oxide phos-phate. 721.8100... Substances § 721.8100 Potassium N,N-bis (hydroxy-ethyl) cocoamine oxide phosphate, and potassium N,N-bis...

  8. Increased expression of 5-HT(1B) receptors by Herpes simplex virus gene transfer in septal neurons: New in vitro and in vivo models to study 5-HT(1B) receptor function. (United States)

    Riegert, Céline; Rothmaier, Anna Katharina; Leemhuis, Jost; Sexton, Timothy J; Neumaier, John F; Cassel, Jean-Christophe; Jackisch, Rolf


    Serotonergic modulation of acetylcholine (ACh) release after neuron-specific increase of the expression of 5-HT(1B) receptors by gene transfer was studied in vitro and in vivo. The increased expression of the 5-HT(1B) receptor in vitro was induced by treating rat primary fetal septal cell cultures for 3 days with a viral vector inducing the expression of green fluorescent protein (GFP) vector alone, or, in addition, of 5-HT(1B) receptors (HA1B/GFP vector). The transfection resulted in a high number of GFP-positive cells, part of which being immunopositive for choline acetyltransferase. In HA1B/GFP-cultures (vs. GFP-cultures), electrically evoked ACh release was significantly more sensitive to the inhibitory action of the 5-HT(1B) agonist CP-93,129. Increased expression of the 5-HT(1B) receptor in vivo was induced by stereotaxic injections of the vectors into the rat septal region. Three days later, electrically evoked release of ACh in hippocampal slices of HA1B/GFP-treated rats was lower than in their GFP-treated counterparts, showing a higher inhibitory efficacy of endogenous 5-HT on cholinergic terminals after transfection. Moreover, CP-93,129 had a higher inhibitory potency. In conclusion, the HA1B/GFP vector reveals a useful tool to induce a targeted increase of 5-HT(1B) heteroreceptors on cholinergic neurons in selected CNS regions, which provides interesting perspectives for functional approaches at more integrated levels.

  9. Co-existing Intermolecular Halogen Bonding and Hydrogen Bonding in the Compound Trans-5,10-bis(1-bromodifluoroacetyl-1-ethoxycarbonyl-methylidene)thianthrene

    Institute of Scientific and Technical Information of China (English)

    ZHU Shi-Fa祝诗发; ZHU Shi-Zheng朱士正; LIAO Yuan-Xi廖远熹; HUANG Chao-Feng黄超峰; LI Zhan-Ting黎占亭


    Trans-5,10-bis(1-bromodifluoroacetyl-1-ethoxycarbonyl-methylidene)thianthrene (1b) was prepared from the reaction of BrCF2COC(N2)CO2Et with thianthrene. X-ray single crystal diffraction analysis showed that the intermolecular halogen bonding and hydrogen bonding coexisted in this compound. The bromine atom acted as an electron acceptor in the halogen bond and an electron donor in the hydrogen bond. It is the first example that the bromine atom acted as such a dual role in the hydrogen and halogen bond.

  10. High diversity and no significant selection signal of human ADH1B gene in Tibet

    Directory of Open Access Journals (Sweden)

    Lu Yan


    Full Text Available Abstract Background ADH1B is one of the most studied human genes with many polymorphic sites. One of the single nucleotide polymorphism (SNP, rs1229984, coding for the Arg48His substitution, have been associated with many serious diseases including alcoholism and cancers of the digestive system. The derived allele, ADH1B*48His, reaches high frequency only in East Asia and Southwest Asia, and is highly associated with agriculture. Micro-evolutionary study has defined seven haplogroups for ADH1B based on seven SNPs encompassing the gene. Three of those haplogroups, H5, H6, and H7, contain the ADH1B*48His allele. H5 occurs in Southwest Asia and the other two are found in East Asia. H7 is derived from H6 by the derived allele of rs3811801. The H7 haplotype has been shown to have undergone significant positive selection in Han Chinese, Hmong, Koreans, Japanese, Khazak, Mongols, and so on. Methods In the present study, we tested whether Tibetans also showed evidence for selection by typing 23 SNPs in the region covering the ADH1B gene in 1,175 individuals from 12 Tibetan populations representing all districts of the Tibet Autonomous Region. Multiple statistics were estimated to examine the gene diversities and positive selection signals among the Tibetans and other populations in East Asia. Results The larger Tibetan populations (Qamdo, Lhasa, Nagqu, Nyingchi, Shannan, and Shigatse comprised mostly farmers, have around 12% of H7, and 2% of H6. The smaller populations, living on hunting or recently switched to farming, have lower H7 frequencies (Tingri 9%, Gongbo 8%, Monba and Sherpa 6%. Luoba (2% and Deng (0% have even lower frequencies. Long-range haplotype analyses revealed very weak signals of positive selection for H7 among Tibetans. Interestingly, the haplotype diversity of H7 is higher in Tibetans than in any other populations studied, indicating a longer diversification history for that haplogroup in Tibetans. Network analysis on the long

  11. Genetics Home Reference: GM2-gangliosidosis, AB variant (United States)

    ... of GM2-gangliosidosis, AB variant: Genetic Testing Registry: Tay-Sachs disease, variant AB These resources from MedlinePlus offer ... AB variant Activator Deficiency/GM2 Gangliosidosis Activator-deficient Tay-Sachs disease GM2 Activator Deficiency Disease GM2 gangliosidosis, type ...

  12. Investigation of high level of AsAb, EmAb in fertility female serum infected by chlamydia trachomatis

    International Nuclear Information System (INIS)

    Objective: To investigate the mechanism of chlamydia trachomatis. AsAb, EmAb in female fertility. Methods: LPS antigen of chlamydia in reproduction tract of fertility female was detected by monoclonal antibody and immunology chromatography; the content of AsAb, EmAb in serum of fertility female was detected by ELISA. Results: Infections rate of chlamydia trachomatis in fertility female was higher than that in the control AsAb, EmAb in serum of the fertility patients who were infected with chlamydia trachomatis showed a significant difference from that in the control group. Conclusion: The level of AsAb, EmAb increases in patients who have been infected with chlamydia trachomatis and these cytokines is involved in the course of female fertility

  13. Minimal gauged U(1) B-L model with spontaneous R parity violation. (United States)

    Barger, Vernon; Pérez, Pavel Fileviez; Spinner, Sogee


    We study the minimal gauged U(1) B-L supersymmetric model and show that it provides an attractive theory for spontaneous R-parity violation. Both U(1) B-L and R parity are broken by the vacuum expectation value of the right-handed sneutrino (proportional to the soft supersymmetry masses), thereby linking the B-L and soft SUSY scales. In this context we find a consistent mechanism for generating neutrino masses and a realistic mass spectrum, all without extending the Higgs sector of the minimal supersymmetry standard model. We discuss the most relevant collider signals and the connection between the Z' gauge boson and R-parity violation. PMID:19518859

  14. Intrinsic fluorescence spectra characteristics of vitamin B1, B2, and B6 (United States)

    Yang, Hui; Xiao, Xue; Zhao, Xuesong; Hu, Lan; Lv, Caofang; Yin, Zhangkun


    This paper presents the intrinsic fluorescence characteristics of vitamin B1, B2 and B6 measured with 3D fluorescence Spectrophotometer. Three strong fluorescence areas of vitamin B2 locate at λex/λem=270/525nm, 370/525nm and 450/525nm, one fluorescence areas of vitamin B1 locates at λex/λem=370/460nm, two fluorescence areas of vitamin B6 locates at λex/λem=250/370nm and 325/370nm were found. The influence of pH of solution to the fluorescence profile was also discussed. Using the PARAFAC algorithm, 10 vitamin B1, B2 and B6 mixed solutions were successfully decomposed, and the emission profiles, excitation profiles, central wavelengths and the concentration of the three components were retrieved precisely through about 5 iteration times.

  15. Estructura molecular y cristalina del bis (bis(dietilamino glioximato níquel (II

    Directory of Open Access Journals (Sweden)

    Luis Alejandro Nuvan


    Full Text Available Ni(CioH2lN4022- monoclínico, grupo espacial P2i/a, a = 15.760 (2, b = 11.793 (3, c = 7.297 (1 A°, j3 = 99.10 (1°, V = 1339.0 (7 A°3, Z = 2 , De = 1.28 Mg M " \\ M = 765 M " ' . La estructura fue resuelta por el método del átomo pesado y afinada por mínimos cuadrados, utilizando la matriz completa, hasta obtener una concordancia R = 0.068 para todas las reflexiones observadas. El átomo de níquel está localizado en un centro de inversión y presenta una coordinación cuadrado planar. El complejo Bis (Bis (Dietilamino Glioximato Níquel (II es casi planar y el desplazamiento de los grupos etil con respecto al plano es producido por efectos estéricos. Las moléculas planares se apilan a lo largo de c, las normales a los planos forman con este eje un ángulo de 41.53 . Existen interacciones axiales entre el níquel y los grupos amino de las moléculas adyacentes de la columna.

  16. Synthesis, properties and supramolecular structure of di(aqua)bis(ethylenediamine)nickel(II) bis(4-nitrobenzoate)

    Indian Academy of Sciences (India)

    Bikshandarkoil R Srinivasan; Gayatri K Rane


    The reaction of the sodium salt of 4-nitrobenzoic acid (4-nbaH) with [Ni(H2O)6]Cl2 or [Ni(en)3]Cl2.2H2O (en is ethylenediamine) results in the formation of the known octahedral compound [Ni(H2O)4(1-4-nba)2].2H2O (4-nba = 4-nitrobenzoate) 1 or the title compound di(aqua)bis(ethylenediamine) nickel(II) bis(4-nitrobenzoate) 2 respectively. Compounds 1 and 2 were characterized by elemental analysis, infrared spectra, DSC thermograms, weight loss studies and the structure of 2 was determined. Both 1 and 2 can be thermally decomposed to green NiO. The title compound [Ni(H2O)2(en)2](4-nba)2 2 crystallizes in the centrosymmetric monoclinic space group 21/ with the Ni(II) situated on an inversion center. The crystal structure of 2 consists of a hexacoordinated Ni(II) complex cation and an uncoordinated 4-nba anion. In the octahedral complex cation, the central metal is linked to two symmetry related bidentate en ligands and two water molecules. In the crystal structure, the cations and anions are linked by three varieties of hydrogen bonding interactions. A comparative study of seven nickel 4-nitrobenzoate compounds is described.

  17. Ab initio mass tensor molecular dynamics


    Tsuchida, Eiji


    Mass tensor molecular dynamics was first introduced by Bennett [J. Comput. Phys. 19, 267 (1975)] for efficient sampling of phase space through the use of generalized atomic masses. Here, we show how to apply this method to ab initio molecular dynamics simulations with minimal computational overhead. Test calculations on liquid water show a threefold reduction in computational effort without making the fixed geometry approximation. We also present a simple recipe for estimating the optimal ato...

  18. Reciprocity Theorems for Ab Initio Force Calculations

    CERN Document Server

    Wei, C; Mele, E J; Rappe, A M; Lewis, Steven P.; Rappe, Andrew M.


    We present a method for calculating ab initio interatomic forces which scales quadratically with the size of the system and provides a physically transparent representation of the force in terms of the spatial variation of the electronic charge density. The method is based on a reciprocity theorem for evaluating an effective potential acting on a charged ion in the core of each atom. We illustrate the method with calculations for diatomic molecules.

  19. A Cadmium-transporting P1B-type ATPase in Yeast Saccharomyces cerevisiae*


    Adle, David J.; Sinani, Devis; Kim, Heejeong; Lee, Jaekwon


    Detoxification and homeostatic acquisition of metal ions are vital for all living organisms. We have identified PCA1 in yeast Saccharomyces cerevisiae as an overexpression suppressor of copper toxicity. PCA1 possesses signatures of a P1B-type heavy metal-transporting ATPase that is widely distributed from bacteria to humans. Copper resistance conferred by PCA1 is not dependent on catalytic activity, but it appears that a cysteine-rich region located in the N terminus sequesters copper. Unexpe...

  20. Free Fatty Acids Inhibit Protein Tyrosine Phosphatase 1B and Activate Akt

    Directory of Open Access Journals (Sweden)

    Eisuke Shibata


    Full Text Available Background/Aims: Accumulating evidence has suggested that free fatty acids (FFAs interact with protein kinases and protein phosphatases. The present study examined the effect of FFAs on protein phosphatases and Akt. Methods: Activities of protein phosphatase 1 (PP1, protein phosphatase 2A (PP2A, and protein tyrosine phosphatase 1B (PTP1B were assayed under the cell-free conditions. Phosphorylation of Akt was monitored in MSTO-211H human malignant pleural mesothelioma cells without and with knocking-down phosphatidylinositol 3 kinase (PI3K or 3-phosphoinositide-dependent protein kinase-1 (PDK1. Results: In the cell-free assay, unsaturated FFAs (uFFAs such as oleic, linoleic and linolenic acid and saturated FFAs (sFFAs such as stearic, palmitic, myristic, and behenic acid markedly reduced PTP1B activity, with the potential for uFFAs greater than that for sFFAs. All the investigated sFFAs inhibited PP2A activity, but otherwise no inhibition was obtained with uFFAs. Both uFFAs and sFFAs had no effect on PP1 activity. Oleic acid phosphorylated Akt both on Thr308 and Ser473, while stearic acid phosphorylated Akt on Thr308 alone. The effects of oleic and stearic acid on Akt phosphorylation were abrogated by the PI3K inhibitor wortmannin or the PDK1 inhibitor BX912 and also by knocking-down PI3K or PDK1. Conclusion: The results of the present study indicate that uFFAs and sFFAs could activate Akt through a pathway along a PI3K/PDK1/Akt axis in association with PTP1B inhibition.

  1. Antimicrobial Resistance of Shigella flexneri Serotype 1b Isolates in China.

    Directory of Open Access Journals (Sweden)

    Xianyan Cui

    Full Text Available Shigella flexneri serotype 1b is among the most prominent serotypes in developing countries, followed by serotype 2a. However, only limited data is available on the global phenotypic and genotypic characteristics of S. flexneri 1b. In the present study, 40 S. flexneri 1b isolates from different regions of China were confirmed by serotyping and biochemical characterization. Antimicrobial susceptibility testing showed that 85% of these isolates were multidrug-resistant strains and antibiotic susceptibility profiles varied between geographical locations. Strains from Yunnan were far more resistant than those from Xinjiang, while only one strain from Shanghai was resistant to ceftazidime and aztreonam. Fifteen cephalosporin resistant isolates were identified in this study. ESBL genes (blaSHV, blaTEM, blaOXA, and blaCTX-M and ampC genes (blaMOX, blaFOX, blaMIR(ACT-1, blaDHA, blaCIT and blaACC were subsequently detected among the 15 isolates. The results showed that these strains were positive only for blaTEM, blaOXA, blaCTX-M, intI1, and intI2. Furthermore, pulsed-field gel electrophoresis (PFGE analysis showed that the 40 isolates formed different profiles, and the PFGE patterns of Xinjiang isolates were distinct from Yunnan and Shanghai isolates by one obvious, large, missing band. In summary, similarities in resistance patterns were observed in strains with the same PFGE pattern. Overall, the results supported the need for more prudent selection and use of antibiotics in China. We suggest that antibiotic susceptibility testing should be performed at the start of an outbreak, and antibiotic use should be restricted to severe Shigella cases, based on resistance pattern variations observed in different regions. The data obtained in the current study might help to develop a strategy for the treatment of infections caused by S. flexneri 1b in China.

  2. Potent water extracts of Indonesian medicinal plants against PTP1B

    Directory of Open Access Journals (Sweden)

    Azis Saifudin


    Conclusions: In contrast to the mainstream solvents currently used in modern herbal manufactures especially Jamu medicine in Indonesia, pure-water-extracted materials should be reconsidered and could be reemerged for future studies and for the manufacture of herbal medicines. In addition, the activity of Jamu components should be confirmed that their antidiabetes and antiobesity activities could be through the inhibition of PTP1B.

  3. Geochemical variations detected with continuous XRF measurements on ANDRILL AND-1B core - preliminary results


    Helling, D.; Kuhn, Gerhard


    Antarctica and especially its ice sheets play a major role in both the global ocean current system andclimate. The ANDRILL (Antarctic Geological Drilling) MIS deep drilling project (McMurdo Sound, NE Ross Ice Shelf, drilled core AND-1B during austral summer 2006/2007) is located in a flexural moat basin filled with glaciomarine, terrigenous, volcanic, and biogenic sediments (Horgan et al., 2005). This basin contains a well-preserved outstanding record of paleoclimate history. During the drill...

  4. Melatonin receptor 1 B polymorphisms associated with the risk of gestational diabetes mellitus

    Directory of Open Access Journals (Sweden)

    Yang Jae-Hyug


    Full Text Available Abstract Backgrounds Two SNPs in melatonin receptor 1B gene, rs10830963 and rs1387153 showed significant associations with fasting plasma glucose levels and the risk of Type 2 Diabetes Mellitus (T2DM in previous studies. Since T2DM and gestational diabetes mellitus (GDM share similar characteristics, we suspected that the two genetic polymorphisms in MTNR1B may be associated with GDM, and conducted association studies between the polymorphisms and the disease. Furthermore, we also examined genetic effects of the two polymorphisms with various diabetes-related phenotypes. Methods A total of 1,918 subjects (928 GDM patients and 990 controls were used for the study. Two MTNR1B polymorphisms were genotyped using TaqMan assay. The allele distributions of SNPs were evaluated by x2 models calculating odds ratios (ORs, 95% confidence intervals (CIs, and corresponding P values. Multiple regressions were used for association analyses of GDM-related traits. Finally, conditional analyses were also performed. Results We found significant associations between the two genetic variants and GDM, rs10830963, with a corrected P value of 0.0001, and rs1387153, with the corrected P value of 0.0008. In addition, we also found that the two SNPs were associated with various phenotypes such as homeostasis model assessment of beta-cell function and fasting glucose levels. Further conditional analyses results suggested that rs10830963 might be more likely functional in case/control analysis, although not clear in GDM-related phenotype analyses. Conclusion There have been studies that found associations between genetic variants of other genes and GDM, this is the first study that found significant associations between SNPs of MTNR1B and GDM. The genetic effects of two SNPs identified in this study would be helpful in understanding the insight of GDM and other diabetes-related disorders.

  5. Cardioembolic stroke related to limb-girdle muscular dystrophy 1B


    Chen, Chih-Hao; Tang, Sung-Chun; Su, Yi-Ning; Yang, Chih-Chao; Jeng, Jiann-Shing


    Background Cardioembolic stroke is an under-recognized complication in patients with limb-girdle muscular dystrophy 1B. Here we present a young stroke patient who had a novel lamin A/C gene (LMNA) mutation. Case presentation This is a 39-year-old man who had slowly progressive proximal muscle weakness and cardiac arrhythmia since adolescent and a family history of similar manifestation. He sustained acute ischemic stroke in the left middle cerebral artery territory. Intravenous recombinant ti...

  6. Der Einfluss der selektiven Serotonin 1 B/D-Agonisten auf die Thrombozyten- und Erythrozytenfunktion


    Heuel, T. (Thomas)


    Der Einfluss von selektiven und unselektiven Serotonin 1 B/D Agonisten auf die Thrombozyten und Erythrozytenfunktion wurde in einer einfachblinden, placebokontrollierten Studie an 20 Probanden untersucht. Getestet wurden 2,5 mg Zolmitriptan, 100 mg Sumatriptan, 2 mg Ergotamintartrat und 1000 mg Acetylsalicylsäure. Hierbei zeigte sich nach Einnahme von Placebo, Sumatriptan und Zolmitriptan keine signifikante Änderung der Plättchenreaktivität (PR) oder Erythrozytenaggregation (ER). Nach Einnahm...

  7. Polymorphisms in alcohol metabolism genes ADH1B and ALDH2, alcohol consumption and colorectal cancer.

    Directory of Open Access Journals (Sweden)

    Marta Crous-Bou

    Full Text Available BACKGROUND: Colorectal cancer (CRC is a leading cause of cancer death worldwide. Epidemiological risk factors for CRC included alcohol intake, which is mainly metabolized to acetaldehyde by alcohol dehydrogenase and further oxidized to acetate by aldehyde dehydrogenase; consequently, the role of genes in the alcohol metabolism pathways is of particular interest. The aim of this study is to analyze the association between SNPs in ADH1B and ALDH2 genes and CRC risk, and also the main effect of alcohol consumption on CRC risk in the study population. METHODOLOGY/PRINCIPAL FINDINGS: SNPs from ADH1B and ALDH2 genes, included in alcohol metabolism pathway, were genotyped in 1694 CRC cases and 1851 matched controls from the Molecular Epidemiology of Colorectal Cancer study. Information on clinicopathological characteristics, lifestyle and dietary habits were also obtained. Logistic regression and association analysis were conducted. A positive association between alcohol consumption and CRC risk was observed in male participants from the Molecular Epidemiology of Colorectal Cancer study (MECC study (OR = 1.47; 95%CI = 1.18-1.81. Moreover, the SNPs rs1229984 in ADH1B gene was found to be associated with CRC risk: under the recessive model, the OR was 1.75 for A/A genotype (95%CI = 1.21-2.52; p-value = 0.0025. A path analysis based on structural equation modeling showed a direct effect of ADH1B gene polymorphisms on colorectal carcinogenesis and also an indirect effect mediated through alcohol consumption. CONCLUSIONS/SIGNIFICANCE: Genetic polymorphisms in the alcohol metabolism pathways have a potential role in colorectal carcinogenesis, probably due to the differences in the ethanol metabolism and acetaldehyde oxidation of these enzyme variants.

  8. Polymorphisms in Alcohol Metabolism Genes ADH1B and ALDH2, Alcohol Consumption and Colorectal Cancer (United States)

    Crous-Bou, Marta; Rennert, Gad; Cuadras, Daniel; Salazar, Ramon; Cordero, David; Saltz Rennert, Hedy; Lejbkowicz, Flavio; Kopelovich, Levy; Monroe Lipkin, Steven; Bernard Gruber, Stephen; Moreno, Victor


    Background Colorectal cancer (CRC) is a leading cause of cancer death worldwide. Epidemiological risk factors for CRC included alcohol intake, which is mainly metabolized to acetaldehyde by alcohol dehydrogenase and further oxidized to acetate by aldehyde dehydrogenase; consequently, the role of genes in the alcohol metabolism pathways is of particular interest. The aim of this study is to analyze the association between SNPs in ADH1B and ALDH2 genes and CRC risk, and also the main effect of alcohol consumption on CRC risk in the study population. Methodology/Principal Findings SNPs from ADH1B and ALDH2 genes, included in alcohol metabolism pathway, were genotyped in 1694 CRC cases and 1851 matched controls from the Molecular Epidemiology of Colorectal Cancer study. Information on clinicopathological characteristics, lifestyle and dietary habits were also obtained. Logistic regression and association analysis were conducted. A positive association between alcohol consumption and CRC risk was observed in male participants from the Molecular Epidemiology of Colorectal Cancer study (MECC) study (OR = 1.47; 95%CI = 1.18-1.81). Moreover, the SNPs rs1229984 in ADH1B gene was found to be associated with CRC risk: under the recessive model, the OR was 1.75 for A/A genotype (95%CI = 1.21-2.52; p-value = 0.0025). A path analysis based on structural equation modeling showed a direct effect of ADH1B gene polymorphisms on colorectal carcinogenesis and also an indirect effect mediated through alcohol consumption. Conclusions/Significance Genetic polymorphisms in the alcohol metabolism pathways have a potential role in colorectal carcinogenesis, probably due to the differences in the ethanol metabolism and acetaldehyde oxidation of these enzyme variants. PMID:24282520

  9. Ab interno trabeculectomy: patient selection and perspectives (United States)

    Vinod, Kateki; Gedde, Steven J


    Ab interno trabeculectomy is one among several recently introduced minimally invasive glaucoma surgeries that avoid a conjunctival incision and full-thickness sclerostomy involved in traditional glaucoma surgery. Ablation of the trabecular meshwork and inner wall of Schlemm’s canal is performed in an arcuate fashion via a clear corneal incision, alone or in combination with phacoemulsification cataract surgery. Intraocular pressure reduction following ab interno trabeculectomy is limited by resistance in distal outflow pathways and generally stabilizes in the mid-to-high teens. Relief of medication burden has been demonstrated by some studies. A very low rate of complications, most commonly transient hyphema and intraocular pressure elevations in the immediate postoperative period, have been reported. However, available data are derived from small retrospective and prospective case series. Randomized, controlled trials are needed to better elucidate the potential merits of ab interno trabeculectomy in the combined setting versus phacoemulsification cataract surgery alone and to compare it with other minimally invasive glaucoma surgeries. PMID:27574396

  10. Highly scalable Ab initio genomic motif identification

    KAUST Repository

    Marchand, Benoît


    We present results of scaling an ab initio motif family identification system, Dragon Motif Finder (DMF), to 65,536 processor cores of IBM Blue Gene/P. DMF seeks groups of mutually similar polynucleotide patterns within a set of genomic sequences and builds various motif families from them. Such information is of relevance to many problems in life sciences. Prior attempts to scale such ab initio motif-finding algorithms achieved limited success. We solve the scalability issues using a combination of mixed-mode MPI-OpenMP parallel programming, master-slave work assignment, multi-level workload distribution, multi-level MPI collectives, and serial optimizations. While the scalability of our algorithm was excellent (94% parallel efficiency on 65,536 cores relative to 256 cores on a modest-size problem), the final speedup with respect to the original serial code exceeded 250,000 when serial optimizations are included. This enabled us to carry out many large-scale ab initio motiffinding simulations in a few hours while the original serial code would have needed decades of execution time. Copyright 2011 ACM.

  11. Phylogeographic reconstruction of HIV type 1B in Montenegro and the Balkan region. (United States)

    Ciccozzi, Massimo; Lai, Alessia; Ebranati, Erika; Gabanelli, Elena; Galli, Massimo; Mugosa, Boban; Vratnica, Zoran; Vujoševic, Danijela; Lauševic, Dragan; Ciotti, Marco; Cella, Eleonora; Lo Presti, Alessandra; Zehender, Gianguglielmo


    Human immunodeficiency virus (HIV) is one of the most genetically variable human viruses as it is characterized by high rates of mutation, viral replication, and recombination. Phylodynamics is a powerful means of describing the behavior of an infection as a combination of evolutionary and ecological processes. Only a few studies of HIV-1 molecular epidemiology have so far been carried out in the Balkans. In this study, we used Bayesian methods to reconstruct the phylogeography and phylodynamics of HIV-1B in Montenegro and some other Balkan countries on the basis of pol gene sequences retrieved from a public database. The phylogenetic analysis showed that 43% of the isolates grouped in accordance with their geographic area, whereas the majority were interspersed in the tree, thus confirming the multiple introductions of HIV-1B in the Balkans. The Bayesian phylogeographic analysis suggested that HIV-1B entered the Balkans in the early 1970s probably through Greece and other Mediterranean tourist/travel destinations (such as Slovenia). Other Balkan countries, such as Bulgaria and Serbia, may have played an important role in spreading the infection to the entire Eastern Mediterranean area, and possibly to Northeast Europe. This suggests that the Balkans may have played a role as a "gateway" between Western and Eastern Europe. PMID:22364163

  12. Significance of 1B and 2B domains in modulating elastic properties of lamin A (United States)

    Bera, Manindra; Ainavarapu, Sri Rama Koti; Sengupta, Kaushik


    Nuclear lamins are type V intermediate filament proteins which form an elastic meshwork underlying the inner nuclear membrane. Lamins directly contribute to maintain the nuclear shape and elasticity. More than 400 mutations have been reported in lamin A that are involved in diseases known as laminopathies. These mutations are scattered mainly in the lamin rod domain along with some in its C-terminal domain. The contribution of the rod domain towards the elasticity of lamin A molecule was hitherto unknown. Here, we have elucidated the significance of the 1B and 2B domains of the rod in modulating the elastic behavior of lamin A by single-molecule force spectroscopy. In addition, we have also studied the network forming capacity of these domains and their corresponding viscoelastic behavior. We have shown that the 1B domain has the ability to form a lamin-like network and resists larger deformation. However at the single-molecular level, both the domains have comparable mechanical properties. The self-assembly of the 1B domain contributes to the elasticity of the lamin A network. PMID:27301336

  13. The thermal emission of the exoplanets WASP-1b and WASP-2b

    CERN Document Server

    Wheatley, Peter J; Harrington, Joseph; Fortney, Jonathan J; Simpson, James M; Anderson, David R; Smith, Alexis M S; Aigrain, Suzanne; Clarkson, William I; Gillon, Michael; Haswell, Carole A; Hebb, Leslie; Hébrard, Guillaume; Hellier, Coel; Hodgkin, Simon T; Horne, Keith D; Kane, Stephen R; Maxted, Pierre F L; Norton, Andrew J; Pollacco, Don L; Pont, Frederic; Skillen, Ian; Smalley, Barry; Street, Rachel A; Udry, Stephane; West, Richard G; Wilson, David M


    We present a comparative study of the thermal emission of the transiting exoplanets WASP-1b and WASP-2b using the Spitzer Space Telescope. The two planets have very similar masses but suffer different levels of irradiation and are predicted to fall either side of a sharp transition between planets with and without hot stratospheres. WASP-1b is one of the most highly irradiated planets studied to date. We measure planet/star contrast ratios in all four of the IRAC bands for both planets (3.6-8.0um), and our results indicate the presence of a strong temperature inversion in the atmosphere of WASP-1b, particularly apparent at 8um, and no inversion in WASP-2b. In both cases the measured eclipse depths favor models in which incident energy is not redistributed efficiently from the day side to the night side of the planet. We fit the Spitzer light curves simultaneously with the best available radial velocity curves and transit photometry in order to provide updated measurements of system parameters. We do not find ...

  14. A de novo microdeletion involving PAFAH1B (LIS1 related to lissencephaly phenotype

    Directory of Open Access Journals (Sweden)

    Keiko Shimojima


    Full Text Available Lissencephaly is a type of the congenital malformation of the brain. Due to the impairments of neuronal migration, patients show absence of brain convolution manifesting smooth brain surfaces. One of the human genes responsible for lissencephaly is the platelet-activating factor acetylhydrolase 1b gene (PAFAH1B; also known as LIS1 located on 17p13.3. Patients with heterozygous deletion of this chromosomal region exhibit lissencephaly. Recently, we encountered a male patient who showed typical lissencephaly. Using a microarray analysis, we identified a 1.3 Mb submicroscopic deletion in 17p13.3. This deletion included PAFAH1B. Both of the parents showed no deletion in this region. Therefore, this was determined to be derived from de novo origin. After obtaining the written informed consent, skin fibroblasts were provided from this patient and disease-specific induced pluripotent stem (iPS cells were generated and used for medical research (Shimojima K, Okumura A, Hayashi M, Kondo T, Inoue H, and Yamamoto T. CHCHD2 is down-regulated in neuronal cells differentiated from iPS cells derived from patients with lissencephaly. Genomics, in press.

  15. Variant alleles of the CYP1B1 gene are associated with colorectal cancer susceptibility

    International Nuclear Information System (INIS)

    CYP1B1 is a P450 enzyme which is involved in the activation of pro-carcinogens to carcinogens as well as sex hormone metabolism. Because differences in the activity of the enzyme have been correlated with variant alleles of single nucleotide polymorphisms (SNPs), it represents an attractive candidate gene for studies into colorectal cancer susceptibility. We genotyped 597 cancer patients and 597controls for three CYP1B1 SNPs, which have previously been shown to be associated with altered enzymatic activity. Using the three SNPs, eight different haplotypes were constructed. The haplotype frequencies were estimated in cases and controls and then compared. The odds ratio for each tumour type, associated with each haplotype was estimated, with reference to the most common haplotype observed in the controls. The three SNPs rs10012, rs1056827 and rs1056836 alone did not provide any significant evidence of association with colorectal cancer risk. Haplotypes of rs1056827 and rs10012 or rs1056827 and rs1056836 revealed an association with colorectal cancer which was significantly stronger in the homozygous carriers. One haplotype was under represented in the colorectal cancer patient group compared to the control population suggesting a protective effect. Genetic variants within the CYP1B1 that are associated with altered function appear to influence susceptibility to a colorectal cancer in Poland. Three haplotypes were associated with altered cancer risk; one conferred protection and two were associated with an increased risk of disease. These observations should be confirmed in other populations

  16. Hoxb1b controls oriented cell division, cell shape and microtubule dynamics in neural tube morphogenesis. (United States)

    Zigman, Mihaela; Laumann-Lipp, Nico; Titus, Tom; Postlethwait, John; Moens, Cecilia B


    Hox genes are classically ascribed to function in patterning the anterior-posterior axis of bilaterian animals; however, their role in directing molecular mechanisms underlying morphogenesis at the cellular level remains largely unstudied. We unveil a non-classical role for the zebrafish hoxb1b gene, which shares ancestral functions with mammalian Hoxa1, in controlling progenitor cell shape and oriented cell division during zebrafish anterior hindbrain neural tube morphogenesis. This is likely distinct from its role in cell fate acquisition and segment boundary formation. We show that, without affecting major components of apico-basal or planar cell polarity, Hoxb1b regulates mitotic spindle rotation during the oriented neural keel symmetric mitoses that are required for normal neural tube lumen formation in the zebrafish. This function correlates with a non-cell-autonomous requirement for Hoxb1b in regulating microtubule plus-end dynamics in progenitor cells in interphase. We propose that Hox genes can influence global tissue morphogenesis by control of microtubule dynamics in individual cells in vivo.

  17. [Validation of HJ-1B thermal infrared channels onboard radiometric calibration based on spectral response differences]. (United States)

    Liu, Li; Fu, Qiao-yan; Shi, Ting-ting; Wang, Ai-chun; Zhang, Xue-wen


    Since HJ-1B was launched, 7 sets of blackbody data have been used to calculate onboard calibration coefficients, but the research work on the validation of coefficients is rare. According to the onboard calibration principle, calibration coefficients of HJ-1B thermal infrared channel on Sep 14th, 2009 were calculated with the half-width, moments and look-up table methods. MODIS was selected for the reference sensor, and algorithms of spectral match were improved between the HJ-1B thermal infrared channel and MODIS 31, 32 channels based on the spectral response divergence. The relationship of top of atmosphere (TOA) radiance between the remote sensors was calculated, based on which the surface leaving brightness temperature was calculated by Planck function to validate the brightness temperature calculated through the onboard calibration coefficients. The equivalent brightness temperature calculated by spectral response divergence method is 285.97 K, and the inversion brightness temperature calculated by half-width, moments and look-up table methods is 288.77, 274.52 and 285.97 K respectively. The difference between the inversion brightness temperature and the equivalent brightness temperature is 2.8, -11.46 and 0.02 K, respectively, which demonstrate that onboard calibration coefficients calculated by the look-up table method has better precision and feasibility.

  18. Forced expression of Hnf1b/Foxa3 promotes hepatic fate of embryonic stem cells. (United States)

    Yahoo, Neda; Pournasr, Behshad; Rostamzadeh, Jalal; Hakhamaneshi, Mohammad Saeed; Ebadifar, Asghar; Fathi, Fardin; Baharvand, Hossein


    Embryonic stem (ES) cell-derived hepatocytes have the potential to be used for basic research, regenerative medicine, and drug discovery. Recent reports demonstrated that in addition to conventional differentiation inducers such as chemical compounds and cytokines, overexpression of lineage-specific transcription factors could induce ES cells to differentiate to a hepatic fate. Here, we hypothesized that lentivirus-mediated inducible expression of hepatic lineage transcription factors could enhance mouse ES cells to hepatocyte-like cells. We screened the effects of candidate transcription factors Hnf1b, Hnf1a, Hnf4a, Foxa1, Foxa3 and Hex, and determined that the combination of Hnf1b/Foxa3 promoted expression of several hepatic lineage-specific markers and proteins, in addition to glycogen storage, ICG uptake, and secretion of albumin and urea. The differentiated cells were engraftable and expressed albumin when transplanted into a carbon tetrachloride-injured mouse model. These results demonstrated the crucial role of Hnf1b and Foxa3 in hepatogenesis in vitro and provided a valuable tool for the efficient differentiation of HLCs from ES cells. PMID:27107701

  19. Minimal Flavor Violation in the Minimal $U(1)_{B-L}$ Model and Resonant Leptogenesis

    CERN Document Server

    Okada, Nobuchika; Yamada, Toshifumi


    We investigate the resonant leptogenesis scenario in the minimally $U(1)_{B-L}$ extended standard model with minimal flavor violation. In our model, the $U(1)_{B-L}$ gauge symmetry is broken at the TeV scale and standard model singlet neutrinos gain Majorana masses of order TeV. In addition, we introduce a flavor symmetry on the singlet neutrinos at a scale higher than TeV. The flavor symmetry is explicitly broken by the neutrino Dirac Yukawa coupling, which induces splittings in the singlet neutrino Majorana masses at lower scales through renormalization group evolutions. We call this setup "minimal flavor violation". The mass-splittings are proportional to the tiny Dirac Yukawa coupling, and hence they automatically enhance the CP asymmetry parameter necessary for the resonant leptogenesis mechanism. In this paper, we calculate the baryon number yield by solving the Boltzmann equations, including the effects of $U(1)_{B-L}$ gauge boson that also has TeV scale mass and causes washing-out of the singlet neutr...

  20. Interstitial 6q25 microdeletion syndrome: ARID1B is the key gene. (United States)

    Ronzoni, Luisa; Tagliaferri, Francesco; Tucci, Arianna; Baccarin, Marco; Esposito, Susanna; Milani, Donatella


    Interstitial deletions of the long arm of chromosome 6 are rare. Clinically, these deletions are considered to be part of a unique microdeletion syndrome associated with intellectual disability and speech impairment, typical dysmorphic features, structural anomalies of the brain, microcephaly, and non-specific multiple organ anomalies. The critical region for the interstitial 6q microdeletion phenotype was mapped to 6q24-6q25, particularly the 6q25.3 region containing the genes ARID1B and ZDHHC14. It has been hypothesized that haploinsufficiency of these genes impairs normal development of the brain and is responsible for the phenotype. This case report describes a girl presenting with typical features of 6q microdeletion syndrome, including global developmental delay, speech impairment, distinct dysmorphic features, dysgenesis of the corpus callosum, common limb anomalies, and hearing loss. Chromosome analysis by array-CGH revealed a small interstitial 6q deletion spanning approximately 1.1 Mb of DNA and containing only one coding gene, ARID1B. We suggest that ARID1B is the key gene behind 6q microdeletion syndrome, and we discuss its possible role in the phenotypic manifestations. © 2016 Wiley Periodicals, Inc. PMID:26754677

  1. Construction and in vitro Study of an E1B-Defective Adenovirus

    Institute of Scientific and Technical Information of China (English)

    Xue Feng; Joshua Mallam Nock; Zhu Hua-bin; Dong Chang-yuan; Qi Yi-peng


    An E1B-defective adenovirus named r1/Ad was constructed by homologous recombination. The construction, selection and propagation of recombinant virus was done in the human embryonic kidney 293 cells (HEK293). The in vitro study demonstrated that the recombinant virus has the ability to replicate in and lyse some p53-deficient human tumor cells such as the human glioblastoma tumor cells (U251) and human bladder tumer cells (EJ) but not in the normal cells with functional p53 such as the human fibroblast cells (MRC-5). Also, based on the cytopathic effect (CPE), it was demonstrated that the U251 cells were more sensitive to the infection of r1/Ad than that of EJ cells under identical conditions. In this paper, it was found that r1/Ad could be very useful in studying the in vitro selective replication of E1B-defective adenovirus. This may help to determine the safety of using any E1B-defective adenoviruses in cancer gene therapy.

  2. Evaluation of LLTR Series II tests A-1A and A-1B test results

    International Nuclear Information System (INIS)

    The standard methodology, with minor modifications provides conservative yet realistic predictions of leaksite and other sodium system pressures in the LLTR Series II vessel and piping. The good agreement between predicted and measured pressures indicates that the TRANSWRAP/RELAP modeling developed from the Series I tests is applicable to larger scale units prototypical of the Clinch River steam generator design. Calculated sodium system pressures are sensitive to several modeling parameters including rupture disc modeling, acoustic velocity in the test vessel, and flow rate from the rupture tube. The acoustic velocity which produced best agreement with leaksite pressures was calculated based on the shroud diameter and shroud wall thickness. The corresponding rupture tube discharge coefficient was that of the standard design methodology developed from Series I testing. As found in Series I testing, the Series II data suggests that the leading edge of the flow in the relief line is two phase for a single, doubled-ended guillotine tube rupture. The steam generator shroud acts as if it is relatively transparent to the transmission of radial pressures to the vessel wall. Slightly lower sodium system maximum pressures measured during Test A-1b compared to Test A-1a are attributed to premature failure (failure at a lower pressure) of the rupture disc in contact with the sodium for test A-1b. The delay in failure of the second disc in Test A-1b, which was successfully modeled with TRANSWRAP, is attributed to the limited energy in the nitrogen injection

  3. Protein tyrosine phosphatase 1B deficiency ameliorates murine experimental colitis via the expansion of myeloid-derived suppressor cells.

    Directory of Open Access Journals (Sweden)

    Jing Zhang

    Full Text Available Protein tyrosine phosphatase 1B (PTP1B is a key molecule in modulating low-degree inflammatory conditions such as diabetes. The role of PTP1B in other chronic inflammations, however, remains unknown. Here, we report that PTP1B deficiency ameliorates Dextran Sulfate Sodium (DSS-induced murine experimental colitis via expanding CD11b(+Gr-1(+ myeloid-derived suppressor cells (MDSCs. Employing DSS-induced murine experimental colitis as inflammatory animal model, we found that, compared with wild-type littermates, PTP1B-null mice demonstrated greater resistance to DSS-induced colitis, as reflected by slower weight-loss, greater survival rates and decreased PMN and macrophage infiltration into the colon. The evidence collectively also demonstrated that the resistance of PTP1B-null mice to DSS-induced colitis is based on the expansion of MDSCs. First, PTP1B-null mice exhibited a greater frequency of MDSCs in the bone marrow (BM, peripheral blood and spleen when compared with wild-type littermates. Second, PTP1B levels in BM leukocytes were significantly decreased after cells were induced into MDSCs by IL-6 and GM-CSF, and the MDSC induction occurred more rapidly in PTP1B-null mice than in wild-type littermates, suggesting PTP1B as a negative regulator of MDSCs. Third, the adoptive transfer of MDSCs into mice with DSS-colitis significantly attenuated colitis, which accompanies with a decreased serum IL-17 level. Finally, PTP1B deficiency increased the frequency of MDSCs from BM cells likely through enhancing the activities of signal transducer and activator of transcription 3 (STAT3 and Janus kinase 2 (JAK2. In conclusion, our study provides the first evidences that PTP1B deficiency ameliorates murine experimental colitis via expanding MDSCs.

  4. Influence of ADH1B polymorphism on alcohol use and its subjective effects in a Jewish population. (United States)

    Carr, Lucinda G; Foroud, Tatiana; Stewart, Trent; Castelluccio, Peter; Edenberg, Howard J; Li, Ting-Kai


    Class I alcohol dehydrogenases (ADHs) are the principal enzymes responsible for ethanol metabolism in humans. Genetic polymorphism at the ADH1B locus (old nomenclature ADH2) results in isozymes with quite different catalytic properties. The frequency of the ADH1B*2 allele varies among ethnic groups. ADH1B*2 is most often observed in Asian populations, and has been shown to be protective against alcoholism. The Jewish population has a higher frequency of the ADH1B*2 allele and lower rates of alcohol-related problems as compared to other Caucasian populations. Thus, it would be of interest to determine whether the ADH1B*2 allele is associated with alcohol consumption and its subjective effects in this group. Four groups of Jewish subjects (male and female college-age samples, and male and female general samples) were recruited from the same region of the United States. All subjects completed a questionnaire to delineate alcohol consumption and its subjective consequences. Genotype at the ADH1B locus was determined for each participant. ADH1B*2 allele frequencies were similar for the Jewish college-age and general population samples. Men in both the college-age and general population in the ADH1B*2 group reported more unpleasant reactions following alcohol consumption than men in the ADH1B*1 group. Men in the general population in the ADH1B*2 group drank alcohol less frequently than men who were homozygous ADH1B*1; there was a similar trend among the women. The ADH1B polymorphism is associated with unpleasant reactions after alcohol consumption, and frequency of alcohol consumption in these Jewish samples. PMID:12244546

  5. Cytochrome P450 1B1 Contributes to the Development of Atherosclerosis and Hypertension in Apolipoprotein E-Deficient Mice. (United States)

    Song, Chi Young; Ghafoor, Khuzema; Ghafoor, Hafiz U; Khan, Nayaab S; Thirunavukkarasu, Shyamala; Jennings, Brett L; Estes, Anne M; Zaidi, Sahar; Bridges, Dave; Tso, Patrick; Gonzalez, Frank J; Malik, Kafait U


    Cytochrome P450 (CYP) 1B1 contributes to vascular smooth muscle cell growth and hypertension in male mice. This study was conducted to determine the contribution of CYP1B1 to the development of atherosclerosis and hypertension and associated pathogenesis in 8-week-old male apolipoprotein E-deficient (ApoE(-/-)/Cyp1b1(+/+)), and ApoE- and CYP1B1-deficient (ApoE(-/-)/Cyp1b1(-/-)) mice fed a normal or atherogenic diet for 12 weeks. A separate group of ApoE(-/-)/Cyp1b1(+/+) mice on an atherogenic diet was injected every third day with the CYP1B1 inhibitor, 2,3',4,5'-tetramethoxystilbene (300 μg/kg), or its vehicle, dimethyl sulfoxide (30 μL, IP); systolic blood pressure was measured by the tail cuff method. After 12 weeks, mice were euthanized, blood collected for lipid analysis, and aortas harvested for measuring lesions and remodeling, and for infiltration of inflammatory cells by histological and immunohistochemical analysis, respectively, and for reactive oxygen species production. Blood pressure, areas of lipids and collagen deposition, elastin breaks, infiltration of macrophages and T lymphocytes, reactive oxygen species generation in the aorta, and plasma lipid levels were increased in ApoE(-/-)/Cyp1b1(+/+) mice on an atherogenic diet; these changes were minimized in mice given 2,3',4,5'-tetramethoxystilbene, and in ApoE(-/-)/Cyp1b1(-/-) mice on an atherogenic diet; absorption/production of lipids remained unaltered in these mice. These data suggest that aortic lesions, hypertension, and associated pathogenesis in ApoE(-/-)/Cyp1b1(+/+) mice on an atherogenic diet are most likely dependent on CYP1B1-generated oxidative stress and increased plasma lipid levels independent of blood pressure and absorption of lipids. CYP1B1 could serve as a novel target for developing drugs to treat atherosclerosis and hypertension caused by hypercholesterolemia.

  6. Cystamine and cysteamine increase brain levels of BDNF in Huntington disease via HSJ1b and transglutaminase


    Borrell-Pagès, Maria; Canals, Josep M.; Cordelières, Fabrice P; Parker, J. Alex; Pineda, José R.; Grange, Ghislaine; Bryson, Elzbieta A.; Guillermier, Martine; Hirsch, Etienne; Hantraye, Philippe; Cheetham, Michael E.; Néri, Christian; Alberch, Jordi; Brouillet, Emmanuel; Saudou, Frédéric


    There is no treatment for the neurodegenerative disorder Huntington disease (HD). Cystamine is a candidate drug; however, the mechanisms by which it operates remain unclear. We show here that cystamine increases levels of the heat shock DnaJ-containing protein 1b (HSJ1b) that are low in HD patients. HSJ1b inhibits polyQ-huntingtin–induced death of striatal neurons and neuronal dysfunction in Caenorhabditis elegans. This neuroprotective effect involves stimulation of the secretory pathway thro...

  7. A novel and facile synthesis of 3-(2-benzofuroyl- and 3,6-bis(2-benzofuroylcarbazole derivatives

    Directory of Open Access Journals (Sweden)

    Wentao Gao


    Full Text Available A facile synthesis of hitherto unreported 3-(2-benzofuroylcarbazoles 3a–k, 3,6-bis(2-benzofuroylcarbazoles 5a–k, and naphtho[2,1-b]furoylcarbazoles 3l and 5l is described. The synthesis mainly relies on the ultrasound-assisted Rap–Stoermer reaction of 3-chloroacetyl- (1 or 3,6-dichloroacetyl-9-ethyl-9H-carbazole (4 with various salicylaldehydes 2a–k as well as 2-hydroxy-1-naphthaldehyde (2l in CH3CN with the presence of PEG-400 as catalyst. The procedure offers easy access to benzofuroylcarbazoles in short reaction times and the products are obtained in moderate to good yields.

  8. Regulation of T Cell Receptor Signaling by DENND1B in TH2 Cells and Allergic Disease. (United States)

    Yang, Chiao-Wen; Hojer, Caroline D; Zhou, Meijuan; Wu, Xiumin; Wuster, Arthur; Lee, Wyne P; Yaspan, Brian L; Chan, Andrew C


    The DENN domain is an evolutionary conserved protein module found in all eukaryotes and serves as an exchange factor for Rab-GTPases to regulate diverse cellular functions. Variants in DENND1B are associated with development of childhood asthma and other immune disorders. To understand how DENND1B may contribute to human disease, Dennd1b(-/-) mice were generated and exhibit hyper-allergic responses following antigen challenge. Dennd1b(-/-) TH2, but not other TH cells, exhibit delayed receptor-induced T cell receptor (TCR) downmodulation, enhanced TCR signaling, and increased production of effector cytokines. As DENND1B interacts with AP-2 and Rab35, TH2 cells deficient in AP-2 or Rab35 also exhibit enhanced TCR-mediated effector functions. Moreover, human TH2 cells carrying asthma-associated DENND1B variants express less DENND1B and phenocopy Dennd1b(-/-) TH2 cells. These results provide a molecular basis for how DENND1B, a previously unrecognized regulator of TCR downmodulation in TH2 cells, contributes to asthma pathogenesis and how DENN-domain-containing proteins may contribute to other human disorders.

  9. 1H-2,3-Dihydroperimidine Derivatives: A New Class of Potent Protein Tyrosine Phosphatase 1B Inhibitors

    Directory of Open Access Journals (Sweden)

    Wen-Long Wang


    Full Text Available A series of 1H-2,3-dihydroperimidine derivatives was designed, synthesized, and evaluated as a new class of inhibitors of protein tyrosine phosphatase 1B (PTP1B with IC50 values in the micromolar range. Compounds 46 and 49 showed submicromolar inhibitory activity against PTP1B, and good selectivity (3.48-fold and 2.10-fold respectively over T-cell protein tyrosine phosphatases (TCPTP. These results have provided novel lead compounds for the design of inhibitors of PTP1B as well as other PTPs.

  10. Ion irradiation induced structural modifications of Fe{sub 81}Mo{sub 8}Cu{sub 1}B{sub 10} NANOPERM-type alloy

    Energy Technology Data Exchange (ETDEWEB)

    Miglierini, Marcel [Institute of Nuclear and Physical Engineering, Faculty of Electrical Engineering and Information Technology, Slovak University of Technology, Bratislava (Slovakia); Department of Nuclear Reactors, Faculty of Nuclear Sciences and Physical Engineering, Czech Technical University, Prague (Czech Republic); Hasiak, Mariusz [Department of Mechanics and Materials Science, Wroclaw University of Technology (Poland)


    Structural modifications and their impact upon magnetic properties are studied in amorphous NANOPERM-type {sup 57}Fe{sub 81}Mo{sub 10}Cu{sub 1}B{sub 10} metallic glass exposed to irradiation with 130 keV N{sup +} ions to the total fluencies of up to 2.5 x 10{sup 17} ions/cm{sup 2}. Using surface sensitive technique of Moessbauer spectrometry, traces of crystalline phases are found already in the as-quenched state after the sample production. On the air side of the ribbons, bcc-Fe dominates whereas on the opposite wheel side, also a presence of Fe{sub 3}O{sub 4} is unveiled. The amount of surface crystallization is higher on the wheel side of the ribbons. After ion irradiation, mostly the air side is affected because it was facing the incident ions. Gradual formation of iron nitrides is observed with increasing ion fluence. Though the radiation damage exhibits itself only at this side of the ribbons, its influence upon bulk magnetic properties is clearly identified by the help of magnetic measurements. Hysteresis loops exhibit changes in their shape as well as coercive field. Along with the formation of magnetic crystalline phases (bcc-Fe and nitrides), they are caused by structural rearrangement which takes place also inside the amorphous residual phase. Structural modifications are confirmed via evolution of hyperfine magnetic fields with ion fluence. Structural modification of the {sup 57}Fe{sub 81}Mo{sub 10}Cu{sub 1}B{sub 10} alloy caused by ion irradiation as demonstrated by microstructural (Moessbauer spectrometry (a,b)) and macroscopic (hysteresis loops (c,d)) measurements. As-quenched (a,c) and 2.5 x 10{sup 17} N{sup +}/cm{sup 2} irradiated (b,d) alloys are compared. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  11. Apoptosis and survivability of human dental pulp cells under exposure to Bis-GMA

    Directory of Open Access Journals (Sweden)

    Junya Yano


    Full Text Available OBJECTIVE: In the present study, we examined whether 2, 2-bis [4-(2-hydroxy-3-methacryloxypropoxy phenyl] propane (Bis-GMA has effects on LSC2 cells, human dental pulp cell line. MATERIAL AND METHODS: The viability, cell cycle, and morphology of LSC2 cells were analyzed after exposure to several different concentrations of Bis-GMA. The recovery of viability of Bis-GMA exposed cells was also analyzed in the condition without Bis-GMA. Further, penetration of Bis-GMA to dentin disc was examined using isocratic high-performance liquid chromatography. RESULTS: There was a concentration-dependent decrease in cell proliferation and an increase in cell number in the sub-G1 population after exposure to Bis-GMA. Furthermore, the cells showed typical characteristics of apoptotic cells after the exposure to high concentration of Bis-GMA. In contrast, cells exposed to lower concentrations of Bis-GMA recovered their viability after being cultured without Bis-GMA. We also found that Bis-GMA is capable of penetrating 1-mm-thick dentin discs, though the penetrated concentration was lower than that showing cytotoxicity. CONCLUSION: These results suggest that Bis-GMA has cytotoxic effects, though dental pulp exposed to lower concentrations is able to recover their viability when Bis-GMA is removed.

  12. Structures of potassium, sodium and lithium bis(oxalato)borate salts from powder diffraction data

    International Nuclear Information System (INIS)

    The crystal structures of the alkali-metal bis(oxalato)borate salts A[B(C2O4)2] (A = K, Na, Li) have been determined ab initio using powder diffraction data obtained from a laboratory diffractometer. The K compound crystallizes in the orthorhombic space group Cmcm and its structure has been solved by direct methods applied to the integrated intensities from full pattern decomposition. The Na compound is isostructural with the K salt, while the crystal structure of the highly hydroscopic Li compound differs from the other two. It has an orthorhombic lattice, space group Pnma, and its structure was solved by the global optimization method using a parallel tempering approach. In the K and Na structures the metal ions and complex borate ions form chains with m2m symmetry. Metal-oxygen bonding between the chains links them into a layer and then a framework with square tunnels. The coordination number of both K and Na is eight. The Li compound also contains chains that have.m. symmetry and are bound together into a three-dimensional framework. The coordination polyhedron of the Li atom is a square pyramid with Li lying in its base. This square pyramidal coordination leads to its high reactivity with moisture to give Li[B(C2O4)2]H2O with lithium in six coordination. (orig.)

  13. TNFα increases hypothalamic PTP1B activity via the NFκB pathway in rat hypothalamic organotypic cultures. (United States)

    Ito, Yoshihiro; Banno, Ryoichi; Hagimoto, Shigeru; Ozawa, Yoshiharu; Arima, Hiroshi; Oiso, Yutaka


    In obesity, levels of tumor necrosis-factor α (TNFα) are well known to be elevated in adipose tissues or serum, and a high-fat diet (HFD) reportedly increases TNFα expression in the hypothalamus. The expression levels of hypothalamic protein tyrosine phosphatase 1B (PTP1B), a negative regulator of leptin and insulin signaling, are also elevated by HFD, and several lines of evidence support a relationship between TNFα and PTP1B. It remains unclear however how TNFα acts locally in the hypothalamus to regulate hypothalamic PTP1B expression and activity. In this study, we examined whether TNFα can regulate PTP1B expression and activity using rat hypothalamic organotypic cultures. Incubation of cultures with TNFα resulted in increases in mRNA expression, protein levels and activity of PTP1B in a dose- and time-dependent manner, respectively compared with controls. TNFα-induced PTP1B protein levels were not influenced by co-incubation with the sodium channel blocker tetrodotoxin, indicating that the action of TNFα is independent of action potentials. TNFα also increased phosphorylation of p65, a subunit of nuclear factor-κB (NFκB), in a dose- and time-dependent manner. While incubation with inhibitors of NFκB did not affect basal levels of either p65 phosphorylation or PTP1B expression, it markedly suppressed both TNFα-induced p65 phosphorylation and PTP1B expression to almost basal levels. These data suggest that TNFα acts on the hypothalamus to increase hypothalamic PTP1B expression and activity via the NFκB pathway, and that TNFα-mediated induction of NFκB in the hypothalamus may cause leptin and insulin resistance in the hypothalamus by increasing hypothalamic PTP1B activity. PMID:22166493

  14. Bis(2-{[bis(dimethylaminomethylidene]amino-κN}benzenesulfonato-κNcopper(II

    Directory of Open Access Journals (Sweden)

    Adam Neuba


    Full Text Available The molecular structure of the title compound, [Cu(C11H16N3O3S2], shows the CuII atom with a distorted square-planar coordination geometry from the N2O2 donor set of the two chelating 2-{[bis(dimethylaminomethylidene]amino}benzenesulfonate ligands. The CuII atom lies 0.065 (1 Å above the N2O2 plane and the Cu—O [2 × 1.945 (2 Å] and Cu—N bond lengths [1.968 (3 and 1.962 (3 Å] lie in expected ranges. The two aromatic ring planes make a dihedral angle of 85.48 (1°.

  15. catena-Poly[[[diaquacadmium(II]-bis[μ-3,5-bis(isonicotinamidobenzoato

    Directory of Open Access Journals (Sweden)

    Dai-Zhi Kuang


    Full Text Available The title compound, {[Cd(C19H13N4O42(H2O2]·4H2O}n or {[Cd(BBA2(H2O2]·4H2O}n, where BBA is 3,5-bis(isonicotinamidobenzoate, is isotypic with its Mn isologue [Chen et al. (2009. J. Coord. Chem. 62, 2421–2428]. The cation sits on a twofold axis and is six-coordinated in a slightly distorted octahedral geometry; the polyhedra are linked into zigzag chains, which are further connected by N—H...O, O—H...O and O—H...N hydrogen bonds as well as π–π interactions [centroid-centroid distance of 3.639 (2 Å], giving a three-dimensional supramolecular framework.

  16. Synthesis and biological study of novel methylene-bis-benzofuranyl-

    Directory of Open Access Journals (Sweden)

    Sanjeeva R. Cherkupally


    Full Text Available A series of novel methylene-bis-[1,5]-benzothiazepines 4 and methylene-bis-benzofuranyl-[1,5]-benzothiazepines 5 were prepared by the reaction of methylene-bis-chalcones 3 with 2-aminothiophenolfollowed by the condensation with -bromoacetophenone. The structures of the synthesized compounds wereconfirmed by their IR, 1H, 13C NMR and Mass spectral analyses. All the synthesized compounds were tested fortheir antimicrobial activity against Gram-positive, Gram-negative bacteria and fungi. Among the synthesizedcompounds, the compounds 4f, 4g, 5f and 5g were found to be the most active against Bacillus subtilis, Bacillussphaericus, Staphylococcus aureus, Klebsiella aerogenes and Chromobacterium violaceum. Similarly thesecompounds showed potent antifungal effect against Candida albicans, Aspergillus fumigatus, Trichophytonrubrum, and Trichophyton mentagrophytes. It is interesting to note that the compounds with heterocyclic ringsubstituents at the 4th position of benzothiazepine system displayed notable antibacterial activity, almost equalto that of streptomycin and penicillin.

  17. In vitro study of vitamins B1, B2 and B6 adsorption on zeolite

    Directory of Open Access Journals (Sweden)

    Basić Zorica


    Full Text Available Background/Aim. Zeolites are the hydratised alumosilicates of alcali and earthalcali cations, which have a long three-dimensional crystal structure. Preparations on the basis of zeolites are used for adsorption of organic and nonorganic toxic substances and they, also, find more and more use in veterinary and human medicine and pharmacy. The aim of this study was to evaluate the possibilities of zeolite to adsorb vitamins B1, B2 and B6 in acid and neutral solutions, as well as the characteristics of the process (saturability, reversibility and competitivness. Methods. The specific and sensitive HPLC method with fluorescent detector was used for determination of vitamins B1, B2 and B6. Analyte separation and detection were carried out by applying the reverse-phase method on column C18. An in vitro experiment was done by testing the influence of pH value (2 and 7, concentration of vitamin solution (1, 2 and 5 mg/L, the lenght of contact with zeolite (10-180 min and cation competitiveness on the exchange capacity, which is achieved by media and zeolite contact, as well as a possible vitamins desorption through changing pH value of the solution at 37°C. Jon competitiveness was examined by adding commercial feed mixture (grower with a defined content of the examined vitamines in zeolite solutions the pH = 2 and pH = 7. Results. Vitamins B1, B2 and B6 were stable in both pH=2 and pH = 7 solutions at 37°C, in the defined time intervals. In acid solution concentrations of vitamins significantly declined in the first 10 min, with no significant decline in further 30 min for all the three concentrations testch. In neutral solution, after the addition of 1% zeolite, decrease in vitamins concentrations was slightly lower than in acid solution, but also significant in the first 10 min of the contact with zeolite. It was found that zeolite, which adsorbed vitamins in acid solution, transferred in the neutral one released a significant quantity of adsorbed

  18. Massive Expansion of Marine Archaea During The Early Albian Oceanic Anoxic Event 1B (United States)

    Kuypers, M. M.; Kuypers, M. M.; Blokker, P.; Erbacher, J.; Kinkel, H.; Pancost, R. D.; Pancost, R. D.; Schouten, S.; Sinninghe Damsté, J. S.


    Oceanic anoxic events (OAEs), periods of globally enhanced burial of organic matter (OM) in the marine realm, played an important role in the mid-Cretaceous `greenhouse climate' by effectively reducing atmospheric carbon dioxide concentrations. It is generally believed that these OAEs were caused either by decreased remineralisation or increased production of phytoplanktonic OM. Here we show that enhanced organic carbon (OC) burial during the early Albian OAE1b (~112 My) was caused by a different process. Combined biogeochemical and stable carbon isotopic analyses indicate that black shales from this period contain up to 80% of OC derived from archaea. Archaea-derived isoprenoidal tetraether membrane lipids and free and macromolecularly bound isoprenoid alkanes are abundantly present in these black shales. More specifically the presence of certain ether lipids (cyclic biphytane tetraethers) indicates representatives of the pelagic archaea. To the best of our knowledge this is the earliest fossil evidence for marine planktonic archaea, extending their geological record by more than 60 million years. The diversity of archaeal lipids recovered from the OAE1b black shales suggests that they derive from a multitude of archaeal species. However, the specific 13C enrichment of all such lipids indicates a common `heavy' (13C-rich) carbon source for the archaea and/or a common pathway of carbon-fixation with a reduced 13C fractionation effect compared to the Calvin cycle used by algae, cyanobacteria and higher plants. The large differences (up to 12%) in 13C/12C ratios between the algal biomarkers and the much more abundant archaeal molecular fossils suggest that the latter were not living heterotrophically on photoautotrophic biomass. It seems likely that the archaea present during OAE1b used a chemical energy source (possibly ammonium) for carbon fixation since photoautotrophy within the domain of the Archaea is restricted to only a few species from hypersaline

  19. Short-Term Dynamic and Local Epidemiological Trends in the South American HIV-1B Epidemic (United States)

    Junqueira, Dennis Maletich; de Medeiros, Rubia Marília; Gräf, Tiago; Almeida, Sabrina Esteves de Matos


    The human displacement and sexual behavior are the main factors driving the HIV-1 pandemic to the current profile. The intrinsic structure of the HIV transmission among different individuals has valuable importance for the understanding of the epidemic and for the public health response. The aim of this study was to characterize the HIV-1 subtype B (HIV-1B) epidemic in South America through the identification of transmission links and infer trends about geographical patterns and median time of transmission between individuals. Sequences of the protease and reverse transcriptase coding regions from 4,810 individuals were selected from GenBank. Maximum likelihood phylogenies were inferred and submitted to ClusterPicker to identify transmission links. Bayesian analyses were applied only for clusters including ≥5 dated samples in order to estimate the median maximum inter-transmission interval. This study analyzed sequences sampled from 12 South American countries, from individuals of different exposure categories, under different antiretroviral profiles, and from a wide period of time (1989–2013). Continentally, Brazil, Argentina and Venezuela were revealed important sites for the spread of HIV-1B among countries inside South America. Of note, from all the clusters identified about 70% of the HIV-1B infections are primarily occurring among individuals living in the same geographic region. In addition, these transmissions seem to occur early after the infection of an individual, taking in average 2.39 years (95% CI 1.48–3.30) to succeed. Homosexual/Bisexual individuals transmit the virus as quickly as almost half time of that estimated for the general population sampled here. Public health services can be broadly benefitted from this kind of information whether to focus on specific programs of response to the epidemic whether as guiding of prevention campaigns to specific risk groups. PMID:27258369

  20. TC-PTP and PTP1B: Regulating JAK-STAT signaling, controlling lymphoid malignancies. (United States)

    Pike, Kelly A; Tremblay, Michel L


    Lymphoid malignancies are characterized by an accumulation of genetic lesions that act co-operatively to perturb signaling pathways and alter gene expression programs. The Janus kinases (JAK)-signal transducers and activators of transcription (STATs) pathway is one such pathway that is frequently mutated in leukemia and lymphoma. In response to cytokines and growth factors, a cascade of reversible tyrosine phosphorylation events propagates the JAK-STAT pathway from the cell surface to the nucleus. Activated STAT family members then play a fundamental role in establishing the transcriptional landscape of the cell. In leukemia and lymphoma, somatic mutations have been identified in JAK and STAT family members, as well as, negative regulators of the pathway. Most recently, inactivating mutations in the protein tyrosine phosphatase (PTP) genes PTPN1 (PTP1B) and PTPN2 (TC-PTP) were sequenced in B cell lymphoma and T cell acute lymphoblastic leukemia (T-ALL) respectively. The loss of PTP1B and TC-PTP phosphatase activity is associated with an increase in cytokine sensitivity, elevated JAK-STAT signaling, and changes in gene expression. As inactivation mutations in PTPN1 and PTPN2 are restricted to distinct subsets of leukemia and lymphoma, a future challenge will be to identify in which cellular contexts do they contributing to the initiation or maintenance of leukemogenesis or lymphomagenesis. As well, the molecular mechanisms by which PTP1B and TC-PTP loss co-operates with other genetic aberrations will need to be elucidated to design more effective therapeutic strategies. PMID:26817397

  1. Short-Term Dynamic and Local Epidemiological Trends in the South American HIV-1B Epidemic. (United States)

    Junqueira, Dennis Maletich; de Medeiros, Rubia Marília; Gräf, Tiago; Almeida, Sabrina Esteves de Matos


    The human displacement and sexual behavior are the main factors driving the HIV-1 pandemic to the current profile. The intrinsic structure of the HIV transmission among different individuals has valuable importance for the understanding of the epidemic and for the public health response. The aim of this study was to characterize the HIV-1 subtype B (HIV-1B) epidemic in South America through the identification of transmission links and infer trends about geographical patterns and median time of transmission between individuals. Sequences of the protease and reverse transcriptase coding regions from 4,810 individuals were selected from GenBank. Maximum likelihood phylogenies were inferred and submitted to ClusterPicker to identify transmission links. Bayesian analyses were applied only for clusters including ≥5 dated samples in order to estimate the median maximum inter-transmission interval. This study analyzed sequences sampled from 12 South American countries, from individuals of different exposure categories, under different antiretroviral profiles, and from a wide period of time (1989-2013). Continentally, Brazil, Argentina and Venezuela were revealed important sites for the spread of HIV-1B among countries inside South America. Of note, from all the clusters identified about 70% of the HIV-1B infections are primarily occurring among individuals living in the same geographic region. In addition, these transmissions seem to occur early after the infection of an individual, taking in average 2.39 years (95% CI 1.48-3.30) to succeed. Homosexual/Bisexual individuals transmit the virus as quickly as almost half time of that estimated for the general population sampled here. Public health services can be broadly benefitted from this kind of information whether to focus on specific programs of response to the epidemic whether as guiding of prevention campaigns to specific risk groups. PMID:27258369

  2. Short-Term Dynamic and Local Epidemiological Trends in the South American HIV-1B Epidemic. (United States)

    Junqueira, Dennis Maletich; de Medeiros, Rubia Marília; Gräf, Tiago; Almeida, Sabrina Esteves de Matos


    The human displacement and sexual behavior are the main factors driving the HIV-1 pandemic to the current profile. The intrinsic structure of the HIV transmission among different individuals has valuable importance for the understanding of the epidemic and for the public health response. The aim of this study was to characterize the HIV-1 subtype B (HIV-1B) epidemic in South America through the identification of transmission links and infer trends about geographical patterns and median time of transmission between individuals. Sequences of the protease and reverse transcriptase coding regions from 4,810 individuals were selected from GenBank. Maximum likelihood phylogenies were inferred and submitted to ClusterPicker to identify transmission links. Bayesian analyses were applied only for clusters including ≥5 dated samples in order to estimate the median maximum inter-transmission interval. This study analyzed sequences sampled from 12 South American countries, from individuals of different exposure categories, under different antiretroviral profiles, and from a wide period of time (1989-2013). Continentally, Brazil, Argentina and Venezuela were revealed important sites for the spread of HIV-1B among countries inside South America. Of note, from all the clusters identified about 70% of the HIV-1B infections are primarily occurring among individuals living in the same geographic region. In addition, these transmissions seem to occur early after the infection of an individual, taking in average 2.39 years (95% CI 1.48-3.30) to succeed. Homosexual/Bisexual individuals transmit the virus as quickly as almost half time of that estimated for the general population sampled here. Public health services can be broadly benefitted from this kind of information whether to focus on specific programs of response to the epidemic whether as guiding of prevention campaigns to specific risk groups.

  3. Reduced inflammatory response in cigarette smoke exposed Mrp1/Mdr1a/1b deficient mice

    Directory of Open Access Journals (Sweden)

    Postma Dirkje S


    Full Text Available Abstract Background Tobacco smoke is the principal risk factor for chronic obstructive pulmonary disease (COPD, though the mechanisms of its toxicity are still unclear. The ABC transporters multidrug resistance-associated protein 1 (MRP1 and P-glycoprotein (P-gp/MDR1 extrude a wide variety of toxic substances across cellular membranes and are highly expressed in bronchial epithelium. Their impaired function may contribute to COPD development by diminished detoxification of noxious compounds in cigarette smoke. Methods We examined whether triple knock-out (TKO mice lacking the genes for Mrp1 and Mdr1a/1b are more susceptible to develop COPD features than their wild-type (WT littermates. TKO and WT mice (six per group were exposed to 2 cigarettes twice daily by nose-only exposure or room air for 6 months. Inflammatory infiltrates were analyzed in lung sections, cytokines and chemokines in whole lung homogenates, emphysema by mean linear intercept. Multiple linear regression analysis with an interaction term was used to establish the statistical significances of differences. Results TKO mice had lower levels of interleukin (IL-7, KC (mouse IL-8, IL-12p70, IL-17, TNF-alpha, G-CSF, GM-CSF and MIP-1-alpha than WT mice independent of smoke exposure (P P P Conclusion Mrp1/Mdr1a/1b knock-out mice have a reduced inflammatory response to cigarette smoke. In addition, the expression levels of several cytokines and chemokines were also lower in lungs of Mrp1/Mdr1a/1b knock-out mice independent of smoke exposure. Further studies are required to determine whether dysfunction of MRP1 and/or P-gp contribute to the pathogenesis of COPD.

  4. Identification of protein tyrosine phosphatase 1B and casein as substrates for 124-v-Mos

    Directory of Open Access Journals (Sweden)

    Stabel Silvia


    Full Text Available Abstract Background The mos proto-oncogene encodes a cytoplasmic serine/threonine-specific protein kinase with crucial function during meiotic cell division in vertebrates. Based on oncogenic amino acid substitutions the viral derivative, 124-v-Mos, displays constitutive protein kinase activity and functions independent of unknown upstream effectors of mos protein kinase. We have utilized this property of 124-v-Mos and screened for novel mos substrates in immunocomplex kinase assays in vitro. Results We generated recombinant 124-v-Mos using the baculovirus expression system in Spodoptera frugiperda cells and demonstrated constitutive kinase activity by the ability of 124-v-Mos to auto-phosphorylate and to phosphorylate vimentin, a known substrate of c-Mos. Using this approach we analyzed a panel of acidic and basic substrates in immunocomplex protein kinase assays and identified novel in vitro substrates for 124-v-Mos, the protein tyrosine phosphatase 1B (PTP1B, alpha-casein and beta-casein. We controlled mos-specific phosphorylation of PTP1B and casein in comparative assays using a synthetic kinase-inactive 124-v-Mos mutant and further, tryptic digests of mos-phosphorylated beta-casein identified a phosphopeptide specifically targeted by wild-type 124-v-Mos. Two-dimensional phosphoamino acid analyses showed that 124-v-mos targets serine and threonine residues for phosphorylation in casein at a 1:1 ratio but auto-phosphorylation occurs predominantly on serine residues. Conclusion The mos substrates identified in this study represent a basis to approach the identification of the mos-consensus phosphorylation motif, important for the development of specific inhibitors of the Mos protein kinase.

  5. The light chain 1 subunit of the microtubule-associated protein 1B (MAP1B is responsible for Tiam1 binding and Rac1 activation in neuronal cells.

    Directory of Open Access Journals (Sweden)

    Daniel R Henríquez

    Full Text Available Microtubule-associated protein 1B (MAP1B is a neuronal protein involved in the stabilization of microtubules both in the axon and somatodendritic compartments. Acute, genetic inactivation of MAP1B leads to delayed axonal outgrowth, most likely due to changes in the post-translational modification of tubulin subunits, which enhances microtubule polymerization. Furthermore, MAP1B deficiency is accompanied by abnormal actin microfilament polymerization and dramatic changes in the activity of small GTPases controlling the actin cytoskeleton. In this work, we showed that MAP1B interacts with a guanine exchange factor, termed Tiam1, which specifically activates Rac1. These proteins co-segregated in neurons, and interact in both heterologous expression systems and primary neurons. We dissected the molecular domains involved in the MAP1B-Tiam1 interaction, and demonstrated that pleckstrin homology (PH domains in Tiam1 are responsible for MAP1B binding. Interestingly, only the light chain 1 (LC1 of MAP1B was able to interact with Tiam1. Moreover, it was able to increase the activity of the small GTPase, Rac1. These results suggest that the interaction between Tiam1 and MAP1B, is produced by the binding of LC1 with PH domains in Tiam1. The formation of such a complex impacts on the activation levels of Rac1 confirming a novel function of MAP1B related with the control of small GTPases. These results also support the idea of cross-talk between cytoskeleton compartments inside neuronal cells.

  6. Synthesis,Characterization and Properties of Bis{oxo—bis[heteroaromatic carboxylatodibenzyltin(Ⅳ)]}and Crystal Structure of Bis{oxo—bis[2—furylcarboxylatodibenzyltin(Ⅳ)]}

    Institute of Scientific and Technical Information of China (English)

    YINHan-dong; WANGChuan-hua; WANGYong; MAChun-lin


    A series of bis{oxo-bis[heteroaromatic carboxylatodibenzyltin(Ⅳ)]}complexes {[(PhCH2)2Sn·(O2CR)]2O}2[where R=2-furyl,2-(2-furyl)vinyl.2-(5-tert-butyl)furyl.2-thiophenyl,2-pyridinyl,2-pyridinyl,3-pyridinyl,4-pyridinyl,3-indolyl,3-indolylmethyl,3-indolylpropyl]was synthesizde by the reactions of heteroaromatic carboxylic acids with dibenzyltin(Ⅳ) oxide.All the complexes were characterized by elemental analysis,IR,and NMR spectra.The complexes were tested against two human tumour cell lines:MCF-7 and WiDr.The results show that they have higher activities in vitro.The crystal structure of bis{oxo-bis[2-furylcarboxylatodibenzyltin(Ⅳ)]}(1)was determined by X-ray diffraction.The crystal structure of bis{ox-bis [2-furylcarboxylatodibenzyltin(Ⅳ)]}(1) was determined by X-ray diffraction.The crystal belongs to monoclinic space group P21/n,a=1.6641(2)nm,b=1.25073(18)nm,c=1.7193(3)nm,β=101.951(2)°,Z=2.R1=0.0446,ωR2=0.1100,Complex 1 is of a centrosymmetric dimer structre with a four-membered central endo-cyclic Sn2O2 unit in which the bridged oxygen atoms are tri-coordinated.Each bridgde oxygen atom also connects with an exo-cyclic tin atom.The tin atoms are six-coordinated and have a coordination geometry of a monocapped trigonal bipyramid with a very similarly distorted mode.Four carboxylate ligands are divided into two types.The two of the four carboxylate ligands are bidentate and bridged to each pair of exoeach pair of exo-and endo-cyclic tin atoms but each utilized one O atom only.

  7. 汽车ABS/ASR/ACC集成化系统%Integrated ABS/ASR/ACC System for the Car

    Institute of Scientific and Technical Information of China (English)

    刘昭度; 卢江; 时开斌; 安巍


    叙述了ACC系统和ABS/ASR系统在改善汽车高速行驶主动安全性方面的功用,阐述了ACC系统是ABS/ASR系统功能的延伸、逻辑的发展及它们之间的内在联系,指出了在ABS/ASR的基础上只需增加测距装置和添加巡航控制子程序,就可方便地实现ABS/ASR/ACC集成化系统,并给出了集成化系统的控制框图和控制方法,论述了ABS/ASR/ACC集成化系统比孤立的ABS/ASR和ACC系统的优越性.%The individual functions of ACC and ABS/ASR are described in the improvements of active safety while the road vehicles travel at a high speed. Being a logic extension of and many inherent connections with ABS/BSR, ACC is easily integrated with ABS/ASR to form an integrated system by adding the headway distance*$-detecting device to the existing ABS/ASR system and expanding the ABS/ASR software. The algorithm flowcharts and control methods of the ABS/ASR/ACC are given. The advantages of the ABS/ASR/ACC system compared with those using the stand alone systems ABS, ASR and ACC are mentioned in details.

  8. 2-Isobutyl-6-(4-methoxyphenylimidazo[2,1-b][1,3,4]thiadiazole

    Directory of Open Access Journals (Sweden)

    Hoong-Kun Fun


    Full Text Available In the title compound, C15H17N3OS, the dihedral angle between the statistically planar imidazo[2,1-b][1,3,4]thiadiazole fused-ring system (r.m.s. deviation = 0.002 Å and the methyoxbenzene ring is 4.52 (6°. In the crystal, molecules are arranged into columns and stacked down the a axis. The crystal structure is stabilized by weak C—H...π and π–π interactions [centroid–centroid separations = 3.6053 (8 and 3.7088 (7 Å].

  9. Four Years of Real-Time GRB Followup by BOOTES-1B (2005–2008

    Directory of Open Access Journals (Sweden)

    Martin Jelínek


    Full Text Available Four years of BOOTES-1B GRB follow-up history are summarised for the first time in the form of a table. The successfully followed events are described case by case. Further, the data are used to show the GRB trigger rate in Spain on a per-year basis, resulting in an estimate of 18 triggers and about 51 hours of telescope time per year for real-time triggers. These numbers grow to about 22 triggers and 77 hours per year if we include also the GRBs observable within 2 hours after the trigger.

  10. Overview of BioCreAtIvE task 1B: normalized gene lists


    Hirschman, Lynette; Colosimo, Marc; Morgan, Alexander; Yeh, Alexander


    Background Our goal in BioCreAtIve has been to assess the state of the art in text mining, with emphasis on applications that reflect real biological applications, e.g., the curation process for model organism databases. This paper summarizes the BioCreAtIvE task 1B, the "Normalized Gene List" task, which was inspired by the gene list supplied for each curated paper in a model organism database. The task was to produce the correct list of unique gene identifiers for the genes and gene product...

  11. Sterile neutrino portal to Dark Matter I: The $U(1)_{B-L}$ case


    Escudero, Miguel; Rius, Nuria; Sanz, Verónica


    In this paper we explore the possibility that the sterile neutrino and Dark Matter sectors in the Universe have a common origin. We study the consequences of this assumption in the simple case of coupling the dark sector to the Standard Model via a global $U(1)_{B-L}$, broken down spontaneously by a dark scalar. This dark scalar provides masses to the dark fermions and communicates with the Higgs via a Higgs portal coupling. We find an interesting interplay between Dark Matter annihilation to...



    Parle Milind; Gaikwad Uday


    Obsessive compulsive disorder (OCD) is characterized by intrusive thoughts followed by repetitive behaviors. Serotonin-related genes found in OCD include those required for coding of 5-HT transporter and 5-HT receptors (5-HT2A, 5-HT2B, 5-HT2C and 5-HT1B). Marble-burying behavior of mice is a well-accepted paradigm to screen anti-compulsive activity. The aim of this study was to evaluate the effect of leuprolide alone and it’s combination with sumatriptan or ondansetron on marble-burying behav...

  13. Four Years of Realtime GRB Followup by BOOTES-1B (2005-2008)

    CERN Document Server

    Jelinek, Martin; Postigo, Antonio de Ugarte; Kubanek, Petr; Guziy, Sergei; Gorosabel, Javier; Cunniffe, Ronan; Vitek, Stanislav; Hudec, Rene; Reglero, Victor; Sabau-Graziati, Lola


    Four years of BOOTES-1B GRB follow-up history are summarised for the first time in the form of a table. The successfully followed events are described case by case. Further, the data are used to show the GRB trigger rate in Spain on a per-year basis, resulting in an estimate of 18 triggers and about 51 h of telescope time per year for real time triggers. These numbers grow to about 22 triggers and 77 h per year if we include also the GRBs observable within 2 hours after the trigger.

  14. Nail-patella syndrome—a novel mutation in the LMX1B gene


    Nair, Rajesh R.; Unni, Vavullipathy N.; Indu, Kadevalappil N.; Nampoothiri, Sheela; Mathew, Anil; Kurian, George; Vimala, Avadaiammal


    Nail-patella syndrome (NPS) is an autosomal-dominant pleiotropic disorder characterized by dyplasia of finger nails, skeletal anomalies and frequently renal disease. In the reported case, genetic analysis revealed a new missense mutation in the homeodomain of LMX1B, presumed to abolish DNA binding (c.725T>C, p.Val242Ala). A missense mutation at codon 725 was identified, where thymine was replaced by cytosine which led to the replacement of valine by alanine at position 242. It was not detecte...

  15. HJ-1A And HJ-1B Small Satellite Constellation For Environment And Disaster Monitoring

    Institute of Scientific and Technical Information of China (English)

    Bai Zhaoguang


    @@ HJ-1A and HJ-1B small satellites were launched atop a LM-2C/SMA on September 6, 2008 from Taiyuan Satellite Launch Center. The satellites began to transmit back images from September 8 and the constellation formed on October 13. After 5 months of orbit testing and operationevaluation, China's first optical satelliteconstellation passed its performancereview and was delivered to the Ministryof Civil Affairs and the Ministry ofEnvironmental Protection by ChinaAerospace Science and Technology Corporation and China Satellite Launch6 Tracking Control General.

  16. 弛豫铁电体Pb(B_1B_2)O_3和钛酸铅固溶体的相稳定性

    Institute of Scientific and Technical Information of China (English)

    罗豪甦; 许桂生; 徐海清; 齐振一; 仲维卓; 殷之文


    弛豫铁电体Pb(B1B2 )O3 和PbTiO3 能够形成具有复合钙钛矿结构的二元固溶体Pb(B1B2 )O3 PbTiO3 。到目前为止 ,已经发现了多种这类二元固溶体单晶 (如PMN PT、PZN PT和PSN PT等 )不仅具有良好的介电性能 ,而且具有良好的压电性能。和普通压电陶瓷PZT相比较 ,弛豫铁电单晶的纵向机电耦合系数k3 3 要大得多 ,可以达到 90 %以上。由于缺少这类二元固溶体单晶的高温相图 ,这类单晶的生长比较困难。我们通过对几种具有复合钙钛矿结构的二元固溶体体系 ,进行差热分析 (DTA)和热重分析 (TG) ,分析了固溶体的相关系和相稳定性。并用粉末X射线衍射谱 (XRD)分析了固溶体的结构 ,以便确定相应的单晶生长方法。研究结果表明 ,A(B1B2 )O3 PbTiO3 二元固溶体体系的结果比较复杂 ,体系中除了具有钙钛结构的铁电相之外 ,还有多种焦绿石相 ,而且不同的弛豫铁电体形成的固溶体其相稳定性的差异较大。其中PMN PT固溶体的相稳定性较高。研究结果表明 ,PMN PT固溶体的液相线和固相线比较接近 ,晶体生长中的分凝现象较小 ,可以看作为同成分熔化的化合物 ,故可...

  17. Ab Initio Molecular Dynamics: A Virtual Laboratory


    Hobbi Mobarhan, Milad


    In this thesis, we perform ab initio molecular dynamics (MD) simulations at the Hartree-Fock level, where the forces are computed on-the-fly using the Born-Oppenheimer approximation. The theory behind the Hartree-Fock method is discussed in detail and an implementation of this method based on Gaussian basis functions is explained. We also demonstrate how to calculate the analytic energy derivatives needed for obtaining the forces acting on the nuclei. Hartree-Fock calculations on the ground s...

  18. Asiakassuhdehallinnan kehityssuunnitelma : Case: Oy Combi Cool Ab


    Puikkonen, Touko


    Tässä insinöörityössä tutustuttiin Oy Combi Cool Ab:n asiakassuhdehallintaan ja siinä havaittuihin puutteisiin ja kehitystarpeisiin. Työn tarkoituksena oli luoda yritykselle ajan tasalla oleva asiakasrekisteri ja sen pohjalta kehittää asiakassuhdehallintaa etenkin myynnin, oston ja johdon henkilöstön tarpeita ajatellen muovaamalla siitä henkilöstön myynti- ja asiakaspalvelutyöskentelyä tehostava toimiva kokonaisuus. Combi Cool on vuonna 1985 perustettu kylmäalan tukkuliike, joka on vajaan 30 ...

  19. Ab Initio Study on Hypothetical Silver Nitride

    Institute of Scientific and Technical Information of China (English)

    DELIGOZ Engin; COLAKOGLU Kemal; CIFTCI Yasemin Oztekin


    We perform the ab initio calculations based on norm-conserving pseudopotentials and density functional theory to investigate the structural, elastic, and thermodynamical properties for silver nitride (AgN) compound that is a member of the 4d transition metal group and has not been synthesized yet. The obtained results are compared with the other available theoretical data, and the agreement is, generally, quite good. We also present the pressure-dependent behaviour of some mechanical and thermodynamical properties for the same compounds.

  20. Testing Distributed ABS System with Fault Injection (United States)

    Trawczyński, Dawid; Sosnowski, Janusz; Gawkowski, Piotr

    The paper deals with the problem of adapting software implemented fault injection technique (SWIFI) to evaluate dependability of reactive microcontroller systems. We present an original methodology of disturbing controller operation and analyzing fault effects taking into account reactions of the controlled object and the impact of the system environment. Faults can be injected randomly (in space and time) or targeted at the most sensitive elements of the controller to check it at high stresses. This approach allows identifying rarely encountered problems, usually missed in classical approaches. The developed methodology has been used successfully to verify dependability of ABS system. Experimental results are commented in the paper.

  1. Ab initio structure determination of new compound Ba 3(BO 3)(PO 4) (United States)

    Ma, H. W.; Liang, J. K.; Wu, L.; Liu, G. Y.; Rao, G. H.; Chen, X. L.


    The crystal structure of new compound Ba3BPO7 was determined by ab initio method from high-resolution conventional X-ray powder diffraction data. The Rietveld refinement converged to Rp=5.92%, Rwp=8.87%, Rexp=5.00% with the following details: Hexagonal, space group P63mc, a=5.4898 (1) Å, c=14.7551(1) Å, Z=2. The basic unit of the structure is the [BaO10]-[BO3]-[PO4] polar polyhedra-chain composed of Ba1-B-P-O cluster. These chains, running along c-axis, stack in a HCP mode to build the whole structure with triangular prism channels. The channels are parallel to c-axis too, in which Ba2 and Ba3 are located.

  2. Implication of protein tyrosine phosphatase 1B in MCF-7 cell proliferation and resistance to 4-OH tamoxifen

    Energy Technology Data Exchange (ETDEWEB)

    Blanquart, Christophe; Karouri, Salah-Eddine [Institut Cochin, Universite Paris Descartes, CNRS (UMR 8104), Paris (France); Inserm, U567, Paris (France); Issad, Tarik, E-mail: [Institut Cochin, Universite Paris Descartes, CNRS (UMR 8104), Paris (France); Inserm, U567, Paris (France)


    The protein tyrosine phosphatase 1B (PTP1B) and the T-cell protein tyrosine phosphatase (TC-PTP) were initially thought to be mainly anti-oncogenic. However, overexpression of PTP1B and TC-PTP has been observed in human tumors, and recent studies have demonstrated that PTP1B contributes to the appearance of breast tumors by modulating ERK pathway. In the present work, we observed that decreasing the expression of TC-PTP or PTP1B in MCF-7 cells using siRNA reduced cell proliferation without affecting cell death. This reduction in proliferation was associated with decreased ERK phosphorylation. Moreover, selection of tamoxifen-resistant MCF-7 cells, by long-term culture in presence of 4-OH tamoxifen, resulted in cells that display overexpression of PTP1B and TC-PTP, and concomitant increase in ERK and STAT3 phosphorylation. siRNA experiments showed that PTP1B, but not TC-PTP, is necessary for resistance to 4-OH tamoxifen. Therefore, our work indicates that PTP1B could be a relevant therapeutic target for treatment of tamoxifen-resistant breast cancers.

  3. 76 FR 39254 - Airworthiness Directives; Schweizer Aircraft Corporation (Schweizer) Model 269A, A-1, B, C, C-1... (United States)


    ... Regulatory Policies and Procedures (44 FR 11034, February 26, 1979), (3) Will not affect intrastate aviation... Corporation (Schweizer) Model 269A, A-1, B, C, C-1, and TH-55 Series Helicopters AGENCY: Federal Aviation... reviewed Schweizer Service Bulletins No. B-295 for Model 269A, A-1, B, and C helicopters, and No....

  4. Macrosomia, obesity, and macrocephaly as first clinical presentation of PHP1b caused by STX16 deletion. (United States)

    de Lange, Iris M; Verrijn Stuart, Annemarie A; van der Luijt, Rob B; Ploos van Amstel, Hans Kristian; van Haelst, Mieke M


    Pseudohypoparathyroidism (PHP) is a genetic disorder with resistance to parathyroid hormone (PTH) as most important feature. Main subtypes of the disease are pseudohypoparathyroidism 1b (PHP1b) and pseudohypoparathyroidism 1a (PHP1a). PHP1b is characterized by PTH resistance of the renal cortex due to reduced activity of the stimulatory G protein α subunit (Gsα) of the PTH receptor. In addition to resistance to PTH, PHP1a patients also lack sensitivity for other hormones that signal their actions through G protein-coupled receptors and display physical features of Albright hereditary osteodystrophy (AHO), which is not classically seen in PHP1b patients. PHP1a is caused by heterozygous loss-of-function mutations in maternally inherited GNAS exons 1-13, which encode Gsα. PHP1b is often caused by deletion of the STX16 gene, which is thought to have an important role in controlling the methylation and thus imprinting at part of the GNAS locus. Here we present a patient with PHP1b caused by the previously described recurrent 3-kb STX16 deletion. The patient's first symptoms were macrosomia, early onset obesity, and macrocephaly. Since this is an atypical but previously described rare presentation of PHP1b, we reemphasize STX16 deletions and PHP1b as a rare cause for early onset obesity and macrosomia. © 2016 Wiley Periodicals, Inc. PMID:27338644

  5. Complete Genome Sequence of Bovine Viral Diarrhea Virus-1 Strain Egy/Ismailia/2014, Subtype 1b


    Soltan, Mohamed A.; Wilkes, Rebecca P.; Elsheery, Mohamed N.; Elhaig, Mahmoud M.; Riley, Matthew C.; Melissa A. Kennedy


    Here, we report the complete genome sequence of bovine viral diarrhea virus-1b (BVDV-1b), strain Egy/Ismailia/2014. The virus genome is composed of 12,217 nucleotides organized as one open reading frame encoding 3,898 amino acids. This report will assist efforts in diagnostics, studying molecular epidemiology, and control of BVDV in Egypt.

  6. Complete Genome Sequence of Bovine Viral Diarrhea Virus-1 Strain Egy/Ismailia/2014, Subtype 1b. (United States)

    Soltan, Mohamed A; Wilkes, Rebecca P; Elsheery, Mohamed N; Elhaig, Mahmoud M; Riley, Matthew C; Kennedy, Melissa A


    Here, we report the complete genome sequence of bovine viral diarrhea virus-1b (BVDV-1b), strain Egy/Ismailia/2014. The virus genome is composed of 12,217 nucleotides organized as one open reading frame encoding 3,898 amino acids. This report will assist efforts in diagnostics, studying molecular epidemiology, and control of BVDV in Egypt. PMID:26701085

  7. Corpus callosum abnormalities, intellectual disability, speech impairment, and autism in patients with haploinsufficiency of ARID1B

    DEFF Research Database (Denmark)

    Hansen, Christina Halgren; Kjaergaard, S; Bak, M;


    Corpus callosum abnormalities, intellectual disability, speech impairment, and autism in patients with haploinsufficiency of ARID1B. Corpus callosum abnormalities are common brain malformations with a wide clinical spectrum ranging from severe intellectual disability to normal cognitive function...... of corpus callosum (CC), intellectual disability, severe speech impairment, and autism. The chromosome 6 breakpoint truncated ARID1B which was also truncated in a recently published translocation patient with a similar phenotype. Quantitative polymerase chain reaction (Q-PCR) data showed that a primer set...... with various sized deletions encompassing ARID1B confirms that haploinsufficiency of ARID1B is associated with CC abnormalities, intellectual disability, severe speech impairment, and autism. Our findings emphasize that ARID1B is important in human brain development and function in general...

  8. Nature's knockout: the Mel1b receptor is not necessary for reproductive and circadian responses to melatonin in Siberian hamsters. (United States)

    Weaver, D R; Liu, C; Reppert, S M


    The pineal hormone melatonin regulates seasonal reproduction and influences the timing of circadian rhythms. The Mel1a and Mel1b receptors are the high-affinity melatonin receptors present in mammals. Unexpectedly, the Mel1b receptor gene of the Siberian hamster, Phodopus sungorus, cannot encode a functional receptor; two nonsense mutations are present within the coding region. Southern blot analysis indicates that this is a single copy gene. The Mel1b receptor gene is nonfunctional in outbred populations of P. sungorus and Phodopus campbelli. Siberian hamsters lacking a functional Mel1b receptor nevertheless show seasonal reproductive and circadian responses to melatonin, indicating that the Mel1b receptor is not necessary for these responses. These data support the hypothesis that the Mel1a receptor, which does encode a functional receptor in this species, mediates reproductive and circadian responses to melatonin.

  9. Single Nucleotide Polymorphisms in IL1B and the Risk of Acute Coronary Syndrome: A Danish Case-Cohort Study

    DEFF Research Database (Denmark)

    Stegger, Jakob Gerhard; Schmidt, Erik Berg; Tjonneland, Anne;


    Background: Interleukin-1B (IL-1B) is a key pro-inflammatory cytokine that has been associated with the development of atherosclerosis and myocardial infarction. However, the prospective associations between functional single nucleotide polymorphisms (SNPs) in IL1B and incident acute coronary...... and 234 women). All cases were validated by review of medical records, and information on covariates was collected by study technicians. The study was conducted according to a case-cohort study design including ACS cases and a sex-stratified sub cohort of 1663 participants drawn randomly from the entire...... IL1B haplotypes and risk factors, respectively. Conclusions/Significance: Genetic variation in the promoter region of IL1B may not be associated with incident ACS in men or women above the age of 50 years....

  10. Discovery of novel, high potent, ABC type PTP1B inhibitors with TCPTP selectivity and cellular activity. (United States)

    Liu, Peihong; Du, Yongli; Song, Lianhua; Shen, Jingkang; Li, Qunyi


    Protein tyrosine phosphatase 1B (PTP1B) as a key negative regulator of both insulin and leptin receptor pathways has been an attractive therapeutic target for the treatment of type 2 diabetes mellitus (T2DM) and obesity. With the goal of enhancing potency and selectivity of the PTP1B inhibitors, a series of methyl salicylate derivatives as ABC type PTP1B inhibitors (P1-P7) were discovered. More importantly, compound P6 exhibited high potent inhibitory activity (IC50 = 50 nM) for PTP1B with 15-fold selectivity over T-cell PTPase (TCPTP). Further studies on cellular activities revealed that compound P6 could enhance insulin-mediated insulin receptor β (IRβ) phosphorylation and insulin-stimulated glucose uptake. PMID:27123900

  11. Investigating the Impact of Asp181 Point Mutations on Interactions between PTP1B and Phosphotyrosine Substrate (United States)

    Liu, Mengyuan; Wang, Lushan; Sun, Xun; Zhao, Xian


    Protein tyrosine phosphatase 1B (PTP1B) is a key negative regulator of insulin and leptin signaling, which suggests that it is an attractive therapeutic target in type II diabetes and obesity. The aim of this research is to explore residues which interact with phosphotyrosine substrate can be affected by D181 point mutations and lead to increased substrate binding. To achieve this goal, molecular dynamics simulations were performed on wild type (WT) and two mutated PTP1B/substrate complexes. The cross-correlation and principal component analyses show that point mutations can affect the motions of some residues in the active site of PTP1B. Moreover, the hydrogen bond and energy decomposition analyses indicate that apart from residue 181, point mutations have influence on the interactions of substrate with several residues in the active site of PTP1B.

  12. Synthesis and structure of bis(diethyldithiocarbamato)nitridotechnetium(v): a technetium-nitrogen triple bond

    International Nuclear Information System (INIS)

    The compound bis(diethyldithiocarbamato)nitridotechnetium(V), (dtc)2TcN, has been prepared by the reduction of ammonium pertechnetate with hydrazine followed by reaction with sodium diethyldithiocarbamate. The crystal structure of (dtc)2TcN has been determined by single-crystal X-ray diffraction methods at 17 deg. C. Crystals are monoclinic, space group P21/c, Z = 4, a = 14.823 (1), b = 9.159(1), c = 12.865(1) A, β = 107.98(1) deg. Diffractometry has provided significant Bragg intensities for 2152 independent reflections and the structure has been refined by full-matrix least-squares methods to R 0.042. The compound, which is isostructural with the rhenium analogue, consists of discrete (dtc) 2TcN molecules, each containing a terminal N3- group. The technetium atom has a distorted square-pyramidal environment with the nitrogen atom in the apical position and four sulphur atoms forming the base

  13. Citric acid production in Yarrowia lipolytica SWJ-1b yeast when grown on waste cooking oil. (United States)

    Liu, Xiaoyan; Lv, Jinshun; Xu, Jiaxing; Zhang, Tong; Deng, Yuanfang; He, Jianlong


    In this study, citric acid was produced from waste cooking oil by Yarrowia lipolytica SWJ-1b. To get the maximal yield of citric acid, the compositions of the medium for citric acid production were optimized, and our results showed that extra nitrogen and magnesium rather than vitamin B1 and phosphate were needed for CA accumulation when using waste cooking oil. The results also indicated that the optimal initial concentration of the waste cooking oil in the medium for citric acid production was 80.0 g/l, and the ideal inoculation size was 1 × 10(7) cells/l of medium. We also reported that during 10-l fermentation, 31.7 g/l of citric acid, 6.5 g/l of isocitric acid, 5.9 g/l of biomass, and 42.1 g/100.0 g cell dry weight of lipid were attained from 80.0 g/l of waste cooking oil within 336 h. At the end of the fermentation, 94.6 % of the waste cooking oil was utilized by the cells of Y. lipolytica SWJ-1b, and the yield of citric acid was 0.4 g/g waste cooking oil, which suggested that waste cooking oil was a suitable carbon resource for citric acid production.

  14. α1B-Adrenoceptors mediate adrenergically-induced renal vasoconstrictions in rats with renal impairment

    Institute of Scientific and Technical Information of China (English)

    Md Abdul Hye KHAN; Munavvar Abdul SATTAR; Nor Azizan ABDULLAH; Edward James JOHNS


    Aim: This study examined whether α1B-adrenoceptors are involved in mediating adrenergically-induced renal vasoconstrictor responses in rats with pathophysi-ological and normal physiological states. Methods: Male Wistar Kyoto and spon-taneously hypertensive rats were induced with acute renal failure or experimental early diabetic nephropathy by cisplatin or streptozotocin, respectively. Cisplatin-induced renal failure was confirmed by impaired renal function and pronounced tubular damage. Experimental early diabetic nephropathy was confirmed by hyperglycemia, changes in physiological parameters, and renal function. The hemodynamic study was conducted on anesthetized rats after 7 d of cisplatin (renal failure) and 4 weeks of streptozotocin (experimental early diabetic nephropathy). Results: In the rats with renal failure and experimental early dia-betic nephropathy, there were marked reductions in their baseline renal blood flow (P0.05) in the renal failure and experimental early diabetic nephropathy rats, respectively, as compared to their non-renal failure and non-diabetic nephropathy controls. In the rats with renal impairment, chloroethylclonidine caused either accentuation or attenuation (all P0.05). Conclusion: This study demonstrated the presence of functional α1B-adrenoceptors that mediated the adrenergically-induced renal vaso-constrictions in rats with renal impairment, but not in rats with normal renal function.

  15. A detection of the secondary eclipse of Qatar-1b in the Ks-band

    CERN Document Server

    Cruz, Patricia; Lillo-Box, Jorge; Diaz, Marcos; Birkby, Jayne; López-Morales, Mercedes; Fortney, Jonathan J


    Qatar-1b is a close-orbiting hot-Jupiter ($R_p\\simeq 1.18$ $R_J$, $M_p\\simeq 1.33$ $M_J$) around a metal-rich K-dwarf, with orbital separation and period of 0.023 AU and 1.42 days, respectively. We have observed the secondary eclipse of this exoplanet in the Ks-band with the objective of deriving a brightness temperature for the planet and providing further constraints to the orbital configuration of the system. We obtained near-infrared photometric data from the ground by using the OMEGA2000 instrument at the 3.5 m telescope at Calar Alto (Spain), in staring mode, with the telescope defocused. We have used Principal Component Analysis (PCA) to identify correlated systematic trends in the data. A Markov chain Monte Carlo analysis was performed in order to model the correlated systematics and fit for the secondary eclipse of Qatar-1b using the occultation model by Mandel & Agol (2002). We measured a secondary eclipse depth of $0.196\\%^{+0.071\\%}_{-0.051\\%}$, which indicates a brightness temperature in the ...

  16. Adenovirus E1A/E1B Transformed Amniotic Fluid Cells Support Human Cytomegalovirus Replication

    Directory of Open Access Journals (Sweden)

    Natascha Krömmelbein


    Full Text Available The human cytomegalovirus (HCMV replicates to high titers in primary human fibroblast cell cultures. A variety of primary human cells and some tumor-derived cell lines do also support permissive HCMV replication, yet at low levels. Cell lines established by transfection of the transforming functions of adenoviruses have been notoriously resistant to HCMV replication and progeny production. Here, we provide first-time evidence that a permanent cell line immortalized by adenovirus type 5 E1A and E1B (CAP is supporting the full HCMV replication cycle and is releasing infectious progeny. The CAP cell line had previously been established from amniotic fluid cells which were likely derived from membranes of the developing fetus. These cells can be grown under serum-free conditions. HCMV efficiently penetrated CAP cells, expressed its immediate-early proteins and dispersed restrictive PML-bodies. Viral DNA replication was initiated and viral progeny became detectable by electron microscopy in CAP cells. Furthermore, infectious virus was released from CAP cells, yet to lower levels compared to fibroblasts. Subviral dense bodies were also secreted from CAP cells. The results show that E1A/E1B expression in transformed cells is not generally repressive to HCMV replication and that CAP cells may be a good substrate for dense body based vaccine production.

  17. ASTER L1B satellite data applied to geothermal in Cuba

    Directory of Open Access Journals (Sweden)

    V. González-Acosta


    Full Text Available The 83 ASTER L1B thermal channels of Cuban territorial scenes, from 2000 to 2008 years, selected and processed with geothermal aims showed almost 50% of cloudy coverage. The vortex coordinated as well as other data from such metadata facilitated completing the designed database. From a preliminary mosaic with the images existent these were subsequently processed in order to obtain temperature images. Such images were then integrated into another mosaic with a suitable reclassification resulting in 11 classes with 3°C each. This allowed delimitating those anomalous zones where the greater distribution of pixels oscillated from 25°C to 37°C, and the cloudy coverage temperature aroused up to 20°C approximately. In the resulting temperature map, 69 polygons were a priori delimitated and categorized, as for their perspective and the temperature value above 40°C. These polygons were later overlapped to Google Earth images with the aim to identify those from anthropogenic origins. Finally it was obtained an estimation of the temperature value of the surface coverage of the national territory as well as the understanding of that the eastern zone is the most perspective. This is an experimental application, using satellite images ASTER L1B with geothermic purpose.


    Directory of Open Access Journals (Sweden)

    Parle Milind


    Full Text Available Obsessive compulsive disorder (OCD is characterized by intrusive thoughts followed by repetitive behaviors. Serotonin-related genes found in OCD include those required for coding of 5-HT transporter and 5-HT receptors (5-HT2A, 5-HT2B, 5-HT2C and 5-HT1B. Marble-burying behavior of mice is a well-accepted paradigm to screen anti-compulsive activity. The aim of this study was to evaluate the effect of leuprolide alone and it’s combination with sumatriptan or ondansetron on marble-burying behavior of mice. Leuprolide (100, 200 & 300 µg kg-1s.c. dose-dependently showed anti-compulsive effect, causing statistically significant inhibition of marble-burying behavior of mice. The prior treatment with 5HT1B/1D/1F agonist, sumatriptan (0.1 mg kg-1 s.c. potentiated the inhibitory effect of leuprolide (LHRH agonist on marble burying behavior of mice. Furthermore, prior treatment with 5HT3 antagonist, ondansetron (2 mg kg-1 s.c. did not affect the inhibitory effect of leuprolide (200 µg kg-1s.c. on marble burying behavior of mice.

  19. Efficient cell culture system for hepatitis C virus genotype 1a and 1b

    DEFF Research Database (Denmark)


    The present inventors developed hepatitis C virus 1a/2a and 1b/2a intergenotypic recombinants in which the JFH1 structural genes (Core, E1 and E2), p7 and NS2 were replaced by the corresponding genes of the genotype Ia reference strain H77C or TN or the corresponding genes of the genotype Ib...... reference strain J4. Sequence analysis of recovered 1a/2a and 1b/2a recombinants from 2 serial passages and subsequent reverse genetic studies revealed adaptive mutations in e.g. p7, NS2 and/or NS3. In addition, the inventors demonstrate the possibility of using adaptive mutations identified for one HCV...... be utilized e.g. in vaccine development and immunological prophylaxis. The inventors in addition demonstrate the use of the developed systems for screening of antiviral substances in vitro and functional studies of the virus, e.g. identification of receptors required for HCV entry...

  20. Interaction between genetic polymorphism of cytochrome P450-1B1 and environmental pollutants in breast cancer risk. (United States)

    Saintot, M; Malaveille, C; Hautefeuille, A; Gerber, M


    Cytochrome P450 1B1 (CYP1B1) is implicated in the activation of potentially carcinogenic xenobiotics and oestrogens. The polymorphism of the CYP1B1 gene at codon 432 (Val-->Leu) is associated with change in catalytic function. In a case-series study of breast cancer patients, we investigated the interaction between this polymorphism and environmental exposure. The women carrying the Val CYP1B1 allele and who had lived near to a waste incinerator for more than 10 years had a higher risk of breast cancer than those never exposed with the Leu/Leu genotype (odds ratio of interactions (ORi)=3.26, 95% confidence interval (CI) 1.20-8.84). Also, the Val CYP1B1 allele increased the susceptibility to breast cancer for women exposed during their life to agricultural products used in farming (ORi = 2.18, 95% CI 1.10-4.32). These xenobiotics, mainly organochlorine hydrocarbons, are known to bind to the aromatic hydrocarbon receptor (AhR), and to induce the expression of CYP1B1 enzyme. The excess risk for exposed women with a Val CYP1B1 homo/heterozygous genotype could result from a higher exposure to activated metabolites of pesticides or dioxin-like substances. Also, a higher induction of CYP1B1 enzyme by xenobiotics could increase the formation of genotoxic catechol-oestrogens among exposed women carrying the Val CYP1B1 allele. Our results suggested that the Val CYP1B1 allele increases the susceptibility to breast cancer in women exposed to waste incinerator or agricultural pollutants. PMID:15075793

  1. Association of Single Nucleotide Polymorphisms in CYP1B1 and COMT Genes with Breast Cancer Susceptibility in Indian Women

    Directory of Open Access Journals (Sweden)

    Sharawan Yadav


    Full Text Available Cytochrome P450 1B1 (CYP1B1 and catechol-$O$-methyltransferase (COMT enzymes play critical roles in estrogen metabolism. Alterations in the catalytic activity of CYP1B1 and COMT enzymes have been found associated with altered breast cancer risk in postmenopausal women in many populations. The substitution of leucine (Leu to valine (Val at codon 432 increases the catalytic activity of CYP1B1, however, substitution of Val to methionine (Met at codon 158 decreases the catalytic activity of COMT. The present study was performed to evaluate the associations of CYP1B1 Leu432Val and/or COMT Val158Met polymorphisms with total, premenopausal and postmenopausal breast cancer risks in Indian women. COMT and CYP1B1 polymorphisms in controls and breast cancer patients were analyzed employing polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP followed by gel electrophoresis. Although CYP1B1 and COMT genotypes did not exhibit statistically significant association with breast cancer risks when analyzed individually, COMT wild type (Val158Val in combination with CYP1B1 heterozygous variant (Leu432Val [OR: 0.21; 95% CI (0.05–0.82, p value; 0.021] and COMT heterozygous variant (Val158Met in combination with CYP1B1 wild type (Leu432Leu [OR: 0.29; 95% CI (0.08–0.96, p value; 0.042] showed significant protective association with premenopausal breast cancer risk. The results demonstrate that CYP1B1 wild type in combination with COMT heterozygous or their inverse combination offer protection against breast cancer in premenopausal Indian women.

  2. Hydrazonoyl Chlorides as Precursors for Synthesis of Novel Bis-Pyrrole Derivatives


    Nabila Abdelshafy Kheder


    A convenient synthesis of some novel bis-pyrrole derivatives via hydrazonoyl halides is described. Antimicrobial evaluation of some selected examples of the synthesized products was carried out. The bis-pyrrole derivative having chloro substituents showed good activity against all of the used microbes. The molecular docking of the bis-pyrrole derivatives was performed by the Molecular Operating Environment (MOE) program.

  3. 40 CFR 721.10096 - Benzene, 1,4-bis (methoxymethyl)-. (United States)


    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Benzene, 1,4-bis (methoxymethyl)-. 721... Substances § 721.10096 Benzene, 1,4-bis (methoxymethyl)-. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as benzene, 1,4-bis (methoxymethyl)- (PMN...

  4. 40 CFR 721.3340 - Ethanol, 2,2′-(hexylamino)bis-. (United States)


    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Ethanol, 2,2â²-(hexylamino)bis-. 721... Substances § 721.3340 Ethanol, 2,2′-(hexylamino)bis-. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as ethanol, 2,2′-(hexylamino)bis- (PMN...

  5. Microwave assisted synthesis of bis and tris(ω -bromoacetophenones): versatile precursors for novel bis(imidazo[1,2- a]pyridines), bis(imidazo[1,2- a]pyrimidines) and their tris-analogs


    Shaaban, Mohamed R.


    Background α-Bromination of the side chain of aromatic ketones using NBS in the presence of p-toluenesulfonic acid (p-TsOH) in acetonitrile is very common. However, regioselective bromination of bis and tris(ω -bromoacetophenones) with NBS in the presence of p-TsOH in acetonitrile under microwave irradiation is quite novel. The bis- and tris(ω -bromoacetophenones) are used in synthesis of bis and tris(heterocycles). bis(heterocycles) have received a great deal of attention, because many biolo...

  6. Quantum phases of AB 2 fermionic chains (United States)

    Murcia-Correa, L. S.; Franco, R.; Silva-Valencia, J.


    A fermionic chain is a one-dimensional system with fermions that interact locally and can jump between sites in the lattice, in particular an AB n chain type, where A and B are sites that exhibit a difference in energy level of Δ and site B is repeated n-times, such that the unit cell has n +1 sites. A limit case of this model, called the ionic Hubbard model (n = 1), has been widely studied due to its interesting physics and applications. In this paper, we study the ground state of an AB 2 chain, which describes the material R 4[Pt 2(P 2O5H2)4X] · nH 2 O. Specifically, we consider a filling with two electrons per unit cell, and using the density matrix renormalization group method we found that the system exhibits the band insulator and Mott correlated insulator phases, as well as an intermediate phase between them. For couplings of Δ = 2,10 and 20, we estimate the critical points that separate these phases through the structure factor and the energy gap in the sector of charge and spin, finding that the position of the critical point rises as a function of Δ.

  7. Biosorption of Acid Blue 290 (AB 290) and Acid Blue 324 (AB 324) dyes on Spirogyra rhizopus

    International Nuclear Information System (INIS)

    In this study, the biosorption of Acid Blue 290 and Acid Blue 324 on Spirogyra rhizopus, a green algae growing on fresh water, was studied with respect to initial pH, temperature, initial dye concentration and biosorbent concentration. The optimum initial pH and temperature values for AB 290 and AB 324 biosorption were found to be 2.0, 30 deg. C and 3.0, 25 deg. C, respectively. It was observed that the adsorbed AB 290 and AB 324 amounts increased with increasing the initial dye concentration up to 1500 and 750 mg/L, respectively. The Langmuir, Freundlich, Redlich-Peterson and Koble-Corrigan isotherm models were applied to the experimental equilibrium data and the isotherm constants were determined by using Polymath 4.1 software. The monolayer coverage capacities of S. rhizopus for AB 290 and AB 324 dyes were found as 1356.6 mg/g and 367.0 mg/g, respectively. The intraparticle diffusion model and the pseudo-second order kinetic model were applied to the experimental data in order to describe the removal mechanism of these acidic dyes by S. rhizopus. The pseudo-second order kinetic model described very well the biosorption kinetics of AB 290 and AB 324 dyes. Thermodynamic studies showed that the biosorption of AB 290 and AB 324 on S. rhizopus was exothermic in nature

  8. Workshop on automated beam steering and shaping (ABS). Proceedings

    International Nuclear Information System (INIS)

    A workshop on Automated Beam Steering and Shaping (ABS) was held at CERN in December 1998. This was the first workshop dedicated to this subject. The workshop had two major goals: to review the present status of ABS algorithms and systems around the world and to create a worldwide ABS community. These proceedings contain summary reports from all sessions, contributions from several presentations held at the workshop, and a complete set of abstracts for all presentations. (orig.)

  9. The Effects of Dwarfing Genes (Rht-B1b,Rht-D1b,and Rht8) with Different Sensitivity to GA3 on the Coleoptile Length and Plant Height of Wheat

    Institute of Scientific and Technical Information of China (English)

    TANG Na; JIANG Ying; HE Bei-ru; HU Yin-gang


    Understanding the effects of wheat dwarfing genes on the coleoptile length and plant height is crucial for the proper utilization of dwarfing genes in the improvement of wheat yield.Molecular marker analysis combined with pedigree information were used to classify wheat cultivars widely planted in major wheat growing regions in China into different categories based on the dwarfing genes they carried.The effects of the dwarfing genes with different sensitivity to gibberellins (GA3) on the coleoptile length and plant height were analyzed.Screening of 129 cultivars by molecular marker analysis revealed that 58 genotypes of wheat contained the dwarfing gene Rht-B1b,24 genotypes of wheat contained Rht-D1b gene and 73 genotypes of wheat possessed Rht8 gene.In addition,among these 129 cultivars,35 genotypes of wheat cultivars contained both Rht-B1b and Rht8 genes and 16 genotypes of wheat cultivars contained both Rht-D1b and Rht8 genes.Wheat cultivars with the dwarfing genes Rht-B1b or Rht-D1b were insensitive to GA3,while the cultivars with the dwarfing gene Rht8 were sensitive to GA3.Most of the wheat genotypes containing combination of Rht8 gene with either Rht-B1b or Rht-Dlb gene were insensitive to GA3.The plant height was reduced by 24.6,30.4,28.2,and 32.2%,respectively,for the wheat cultivars containing Rht-B1b,Rht-D1b,Rht-B1b+Rht8,and Rht-D1b+Rht8 genes.The plant height was reduced by 14.3% for the wheat cultivar containing GA3-sensitive gene Rht8.The coleoptile length was shortened by 25.4,31.3,28.4 and 31.3%,respectively,in the wheat cultivars containing Rht-B1b,Rht-D1b,Rht-B1b+Rht8 and Rht-D1b+Rht8 genes,while the coleoptile length was shortened only by 6.2% for the wheat cultivar containing Rht8 gene.We conclude that GA3-insensitive dwarfing genes (Rht-B1b and Rht-D1b)are not suitable for the wheat improvement in dryland because these two genes have eflfect on reducing both plant height and coleoptile length.In contrast,GA3-sensitive dwarfing gene (Rht8) is a

  10. 2,6-Bis(9-ethyl-9H-carbazolylmethylenecyclohexanone

    Directory of Open Access Journals (Sweden)

    Abdullah M. Asiri


    Full Text Available The title compound, 2,6-bis(ethyl-9-ethyl-9H-carbazolylmethylenecyclohexanone has been synthesized by condensation of 9-ethylcarbazole-3-aldehyde and cyclohexanone in ethanol in the presence of pyridine. The structure of this new compound was confirmed by elemental analysis, IR, 1H NMR, 13C NMR and EI-MS spectral analysis.


    Directory of Open Access Journals (Sweden)

    Roger Cabrera-Paredes


    Full Text Available El presente artículo explica como la “Reincidencia vulnera el  Non bis in ídem”; empezamos con la “Introducción” que comprende los antecedentes, la formulación del problema y la justificación de esta investigación. Continuamos con las “Bases Teóricas”, la misma que comprende el sentido de los principios penales, el principio “Non bis in Idem”, la Reincidencia y la Problemática de la Reincidencia como vulneración del Principio Non bis in ídem. En la “Metodología”, encontramos la tipología y metodología de la investigación. En los “Resultados”,  están los análisis y la decisión final de las entrevistas y encuestas a Docentes y abogados especializados en el tema y al personal de Juzgados, Fiscalías y abogados, respectivamente, del Distrito Judicial de Iquitos de la Provincia de Maynas, región Loreto. En la “Discusión”, explicamos que la Reincidencia debe desaparecer porque va en contra del principio Non bis in ídem, colocando en las “Conclusiones” nuestra posición.

  12. Preparation of ferrocenyl imidazolines using bis(triphenyl)oxodiphosphonium trifluoromethanesulfonate

    Institute of Scientific and Technical Information of China (English)

    WANG XueQiang; XIA JiBao; DAI XiaoYang; YOU ShuLi


    An efficient synthesis of ferrocenyl imidazolines starting from ferrocenyl carboxylic acids has been developed.Bis(triphenyl)oxodiphosphonium trifluoromethanesulfonate was used to convert smoothly ferrocenyl carboxylic amides bearing an amine side chain,derived from ferrocenyl carboxylic acids and 1,2-diamines,to their corresponding ferrocenyl imidazolines.

  13. Preparation of ferrocenyl imidazolines using bis(triphenyl)oxodiphosphonium trifluoromethanesulfonate

    Institute of Scientific and Technical Information of China (English)


    An efficient synthesis of ferrocenyl imidazolines starting from ferrocenyl carboxylic acids has been developed. Bis(triphenyl)oxodiphosphonium trifluoromethanesulfonate was used to convert smoothly ferrocenyl carboxylic amides bearing an amine side chain, derived from ferrocenyl carboxylic acids and 1,2-diamines, to their corresponding ferrocenyl imidazolines.

  14. 3,5-Bis(2-hydroxybenzylidenepiperidin-4-one

    Directory of Open Access Journals (Sweden)

    Yum Eryanti


    Full Text Available The title compound, 3,5-bis(2-hydroxybenzylidenepiperidin-4-one (3, was prepared via reaction of 2-hydroxybenzaldehyde (1 and 4-piperidone (2 under microwave irradiation in the presence of 10% NaOH solution. The compound was fully characterized from its UV, IR, NMR and MS data.

  15. Electronic states of 1,4-bis(phenylethynyl)benzene

    DEFF Research Database (Denmark)

    Nguyen, Duy Duc; Jones, Nykola; Hoffmann, Søren Vrønning;


    The electronic transitions of 1,4-bis(phenylethynyl)benzene (BPEB) were investigated by UV synchrotron radiation linear dichroism (SRLD) spectroscopy in the range 25,000 – 58,000 cm–1 (400 – 170 nm) on molecular samples aligned in stretched polyethylene. The investigation was supported by variable...

  16. Multifunctional switches based on bis-imidazole derivative

    Indian Academy of Sciences (India)

    Abdullah M A Asiri; Gameel A Baghaffar; Khadija O Badahdah; Abdullah G M Al-Sehemi; Salman A Khan; Abeer A Bukhari


    multifunctional bis-imidazole derived from piperonal was prepared and found to have photo, thermo, solvato and peiezochromism with colour changes from pale green to deep blue. The multifunctionality colour changes and stability of the coloured species make the derivative candidates for various applications such as optical data storage. The photochromic properties and performance were found to be affected remarkably upon changing the solvent.

  17. A New Bis-iridoid Glucoside from Mussaenda incana

    Institute of Scientific and Technical Information of China (English)

    Biswanath DINDA; Sudhan DEBNATH; Santanu MAJUMDER; Shiho ARIMA; Nariko SATO; Yoshihiro HARIGAYA


    A new bis-iridoid glucoside, incaside 1 was isolated along with known iridoid, 6-0veratroylcatalposide from the stem-bark of Mussaenda incana. The structure of the new iridoid was established mainly on the basis of the spectroscopic (including 2D NMR) and chemical studies of its octaacetate 1a.

  18. Bacillus thuringiensis Cry34Ab1/Cry35Ab1 interactions with western corn rootworm midgut membrane binding sites.

    Directory of Open Access Journals (Sweden)

    Huarong Li

    Full Text Available BACKGROUND: Bacillus thuringiensis (Bt Cry34Ab1/Cry35Ab1 are binary insecticidal proteins that are co-expressed in transgenic corn hybrids for control of western corn rootworm, Diabrotica virgifera virgifera LeConte. Bt crystal (Cry proteins with limited potential for field-relevant cross-resistance are used in combination, along with non-transgenic corn refuges, as a strategy to delay development of resistant rootworm populations. Differences in insect midgut membrane binding site interactions are one line of evidence that Bt protein mechanisms of action differ and that the probability of receptor-mediated cross-resistance is low. METHODOLOGY/PRINCIPAL FINDINGS: Binding site interactions were investigated between Cry34Ab1/Cry35Ab1 and coleopteran active insecticidal proteins Cry3Aa, Cry6Aa, and Cry8Ba on western corn rootworm midgut brush border membrane vesicles (BBMV. Competitive binding of radio-labeled proteins to western corn rootworm BBMV was used as a measure of shared binding sites. Our work shows that (125I-Cry35Ab1 binds to rootworm BBMV, Cry34Ab1 enhances (125I-Cry35Ab1 specific binding, and that (125I-Cry35Ab1 with or without unlabeled Cry34Ab1 does not share binding sites with Cry3Aa, Cry6Aa, or Cry8Ba. Two primary lines of evidence presented here support the lack of shared binding sites between Cry34Ab1/Cry35Ab1 and the aforementioned proteins: 1 No competitive binding to rootworm BBMV was observed for competitor proteins when used in excess with (125I-Cry35Ab1 alone or combined with unlabeled Cry34Ab1, and 2 No competitive binding to rootworm BBMV was observed for unlabeled Cry34Ab1 and Cry35Ab1, or a combination of the two, when used in excess with (125I-Cry3Aa, or (125I-Cry8Ba. CONCLUSIONS/SIGNIFICANCE: Combining two or more insecticidal proteins active against the same target pest is one tactic to delay the onset of resistance to either protein. We conclude that Cry34Ab1/Cry35Ab1 are compatible with Cry3Aa, Cry6Aa, or Cry8Ba

  19. Review of Terra MODIS thermal emissive band L1B radiometric performance (United States)

    Moeller, Chris; Menzel, W. P.; Quinn, Greg


    The MODerate-resolution Imaging Spectroradiometer (MODIS) on NASA's Earth Observing System Terra satellite, launched into orbit on 18 December 1999, will have a "first light" 15th anniversary on 24 February 2015. For nearly 15 years the MODIS instrument has provided radiances in all spectral bands. Though some detectors have fallen below SNR thresholds, the vast majority of spectral bands continue to provide high quality L1B measurements for use in L2 science algorithms supporting global climate research. Radiometric accuracy of the Terra MODIS thermal emissive bands (TEBs) in the C6 L1B product has been assessed using various approaches over the nearly 15 year Terra MODIS data record, including comparisons with instruments on the ground, in aircraft under-flights, and on other satellites. All of these approaches contribute to the understanding of the Terra MODIS radiometric L1B performance. Early in the lifetime of Terra, ground-based measurements and NASA ER-2 aircraft under-flights revealed that TEBs in the infrared window ("window" bands) are well calibrated and performing within accuracy specifications. The ER-2 under-flights also suggested that many atmospheric bands may be performing outside of specification, especially LWIR CO2 sensitive bands that are subject to optical crosstalk, although analysis uncertainties are larger for atmospheric bands. Beginning in 2007, MetOp-A IASI observations were used to evaluate Terra MODIS TEB performance through Simultaneous Nadir Overpass (SNO) comparisons. These inter-satellite comparisons largely affirm the early aircraft and ground-based evaluations, showing that all Terra MODIS window bands have small biases, minimal trending, and minor detector and mirror side striping over the 2007-2013 timeframe. Most atmospheric bands are performing satisfactorily near to specification; however, biases, striping and trending are large and significantly out of specification in the water vapor sensitive band 27 and ozone sensitive

  20. Pseudohypoaldosteronism type 1 due to novel variants of SCNN1B gene (United States)

    Nobel, Yael R; Lodish, Maya B; Raygada, Margarita; Del Rivero, Jaydira; Faucz, Fabio R; Abraham, Smita B; Lyssikatos, Charalampos; Belyavskaya, Elena; Stratakis, Constantine A


    Summary Autosomal recessive pseudohypoaldosteronism type 1 (PHA1) is a rare disorder characterized by sodium wasting, failure to thrive, hyperkalemia, hypovolemia and metabolic acidosis. It is due to mutations in the amiloride-sensitive epithelial sodium channel (ENaC) and is characterized by diminished response to aldosterone. Patients may present with life-threatening hyperkalemia, which must be recognized and appropriately treated. A 32-year-old female was referred to the National Institutes of Health (NIH) for evaluation of hyperkalemia and muscle pain. Her condition started in the second week of life, when she was brought to an outside hospital lethargic and unresponsive. At that time, she was hypovolemic, hyperkalemic and acidotic, and was eventually treated with sodium bicarbonate and potassium chelation. At the time of the presentation to the NIH, her laboratory evaluation revealed serum potassium 5.1 mmol/l (reference range: 3.4–5.1 mmol/l), aldosterone 2800 ng/dl (reference range: ≤21 ng/dl) and plasma renin activity 90 ng/ml/h (reference range: 0.6–4.3 ng/ml per h). Diagnosis of PHA1 was suspected. Sequencing of the SCNN1B gene, which codes for ENaC, revealed that the patient is a compound heterozygote for two novel variants (c.1288delC and c.1466+1 G>A), confirming the suspected diagnosis of PHA1. In conclusion, we report a patient with novel variants of the SCNN1B gene causing PHA1 with persistent, symptomatic hyperkalemia. Learning points PHA1 is a rare genetic condition, causing functional abnormalities of the amiloride-sensitive ENaC.PHA1 was caused by previously unreported SCNN1B gene mutations (c.1288delC and c.1466+1 G>A).Early recognition of this condition and adherence to symptomatic therapy is important, as the electrolyte abnormalities found may lead to severe dehydration, cardiac arrhythmias and even death.High doses of sodium polystyrene sulfonate, sodium chloride and sodium bicarbonate are required for symptomatic

  1. A short Gfi-1B isoform controls erythroid differentiation by recruiting the LSD1-corest complex through the dimethylation of its SNAG domain

    NARCIS (Netherlands)

    B. Laurent (Benoît); V. Randrianarison-Huetz (Voahangy); E. Frisan (Emilie); C. Andrieu-Soler (Charlotte); E. Soler (Eric); M. Fontenay (Michaela); I. Dusanter-Fourt (Isabelle); D. Dumenil (Dominique)


    textabstractGfi-1B is a transcriptional repressor essential for the regulation of erythropoiesis and megakaryopoiesis. Here we identify Gfi-1B p32, a Gfi-1B isoform, as essential for erythroid differentiation. Gfi-1B p32 is generated by alternative splicing and lacks the two first zinc finger domain

  2. Characterization of the Very Low Mass Secondary in the GJ 660.1AB System

    CERN Document Server

    Aganze, Christian; Faherty, Jacqueline K; Choban, Caleb; Escala, Ivanna; Lopez, Mike A; Jin, Yuhui; Tamiya, Tomoki; Tallis, Melisa; Rockward, Willie


    We present spectroscopic analysis of the low mass binary star system GJ 660.1AB, a pair of nearby M dwarfs for which we have obtained separated near-infrared spectra (0.9-2.5 $\\mu$m) with the SpeX spectrograph. The spectrum of GJ 660.1B is distinctly peculiar, with a triangular-shaped 1.7 $\\mu$m peak that initially suggests it to be a low surface gravity, young brown dwarf. However, we rule out this hypothesis and determine instead that this companion is a mild subdwarf (d/sdM7) based on the subsolar metallicity of the primary, [Fe/H] = $-$0.63$\\pm$0.06. Comparison of the near-infrared spectrum of GJ 660.1B to two sets of spectral models yields conflicting results, with a common effective temperature T$_{eff}$ = 2550-2650 K, but alternately low surface gravity ($\\log{g}$ = 4.4$\\pm$0.5 cgs) and very low metallicity ([M/H] = $-$0.96$^{+0.19}_{-0.24}$), or high surface gravity ($\\log{g}$ = 5.0-5.5) and slightly subsolar metallicity ([M/H] =$-$0.20$^{+0.13}_{-0.19}$). We conjecture that insufficient condensate op...

  3. Localisation of the Putative Magnetoreceptive Protein Cryptochrome 1b in the Retinae of Migratory Birds and Homing Pigeons (United States)

    Bolte, Petra; Bleibaum, Florian; Einwich, Angelika; Günther, Anja; Liedvogel, Miriam; Heyers, Dominik; Depping, Anne; Wöhlbrand, Lars; Rabus, Ralf; Janssen‐Bienhold, Ulrike; Mouritsen, Henrik


    Cryptochromes are ubiquitously expressed in various animal tissues including the retina. Some cryptochromes are involved in regulating circadian activity. Cryptochrome proteins have also been suggested to mediate the primary mechanism in light-dependent magnetic compass orientation in birds. Cryptochrome 1b (Cry1b) exhibits a unique carboxy terminus exclusively found in birds so far, which might be indicative for a specialised function. Cryptochrome 1a (Cry1a) is so far the only cryptochrome protein that has been localised to specific cell types within the retina of migratory birds. Here we show that Cry1b, an alternative splice variant of Cry1a, is also expressed in the retina of migratory birds, but it is primarily located in other cell types than Cry1a. This could suggest different functions for the two splice products. Using diagnostic bird-specific antibodies (that allow for a precise discrimination between both proteins), we show that Cry1b protein is found in the retinae of migratory European robins (Erithacus rubecula), migratory Northern Wheatears (Oenanthe oenanthe) and pigeons (Columba livia). In all three species, retinal Cry1b is localised in cell types which have been discussed as potentially well suited locations for magnetoreception: Cry1b is observed in the cytosol of ganglion cells, displaced ganglion cells, and in photoreceptor inner segments. The cytosolic rather than nucleic location of Cry1b in the retina reported here speaks against a circadian clock regulatory function of Cry1b and it allows for the possible involvement of Cry1b in a radical-pair-based magnetoreception mechanism. PMID:26953791

  4. Localisation of the Putative Magnetoreceptive Protein Cryptochrome 1b in the Retinae of Migratory Birds and Homing Pigeons.

    Directory of Open Access Journals (Sweden)

    Petra Bolte

    Full Text Available Cryptochromes are ubiquitously expressed in various animal tissues including the retina. Some cryptochromes are involved in regulating circadian activity. Cryptochrome proteins have also been suggested to mediate the primary mechanism in light-dependent magnetic compass orientation in birds. Cryptochrome 1b (Cry1b exhibits a unique carboxy terminus exclusively found in birds so far, which might be indicative for a specialised function. Cryptochrome 1a (Cry1a is so far the only cryptochrome protein that has been localised to specific cell types within the retina of migratory birds. Here we show that Cry1b, an alternative splice variant of Cry1a, is also expressed in the retina of migratory birds, but it is primarily located in other cell types than Cry1a. This could suggest different functions for the two splice products. Using diagnostic bird-specific antibodies (that allow for a precise discrimination between both proteins, we show that Cry1b protein is found in the retinae of migratory European robins (Erithacus rubecula, migratory Northern Wheatears (Oenanthe oenanthe and pigeons (Columba livia. In all three species, retinal Cry1b is localised in cell types which have been discussed as potentially well suited locations for magnetoreception: Cry1b is observed in the cytosol of ganglion cells, displaced ganglion cells, and in photoreceptor inner segments. The cytosolic rather than nucleic location of Cry1b in the retina reported here speaks against a circadian clock regulatory function of Cry1b and it allows for the possible involvement of Cry1b in a radical-pair-based magnetoreception mechanism.

  5. Localisation of the Putative Magnetoreceptive Protein Cryptochrome 1b in the Retinae of Migratory Birds and Homing Pigeons. (United States)

    Bolte, Petra; Bleibaum, Florian; Einwich, Angelika; Günther, Anja; Liedvogel, Miriam; Heyers, Dominik; Depping, Anne; Wöhlbrand, Lars; Rabus, Ralf; Janssen-Bienhold, Ulrike; Mouritsen, Henrik


    Cryptochromes are ubiquitously expressed in various animal tissues including the retina. Some cryptochromes are involved in regulating circadian activity. Cryptochrome proteins have also been suggested to mediate the primary mechanism in light-dependent magnetic compass orientation in birds. Cryptochrome 1b (Cry1b) exhibits a unique carboxy terminus exclusively found in birds so far, which might be indicative for a specialised function. Cryptochrome 1a (Cry1a) is so far the only cryptochrome protein that has been localised to specific cell types within the retina of migratory birds. Here we show that Cry1b, an alternative splice variant of Cry1a, is also expressed in the retina of migratory birds, but it is primarily located in other cell types than Cry1a. This could suggest different functions for the two splice products. Using diagnostic bird-specific antibodies (that allow for a precise discrimination between both proteins), we show that Cry1b protein is found in the retinae of migratory European robins (Erithacus rubecula), migratory Northern Wheatears (Oenanthe oenanthe) and pigeons (Columba livia). In all three species, retinal Cry1b is localised in cell types which have been discussed as potentially well suited locations for magnetoreception: Cry1b is observed in the cytosol of ganglion cells, displaced ganglion cells, and in photoreceptor inner segments. The cytosolic rather than nucleic location of Cry1b in the retina reported here speaks against a circadian clock regulatory function of Cry1b and it allows for the possible involvement of Cry1b in a radical-pair-based magnetoreception mechanism.

  6. Studies on bioactive bis-1,3,5-triazinyl dithiocarbamates

    Directory of Open Access Journals (Sweden)

    V. H. SHAH


    Full Text Available The compounds bis(4,6-dichloro/bis[(p-methoxyphenylamino]-1,3,5--triazin-2-yl1,2-hydrazine-1,2-dicarbodithioate/1,4-phenylenebis(carbamodithio­ate/(1,1’-biphenyl-4,4’-diylbis(carbamodithioate/(sulphonyldi-4,1-phenylene-bis(carbamodithioate/1,2-ethanediylbis(carbamothioate 4a–j were synthe­sized by two different methods. In the first method (A for the preparation of 4a–e, 2,4,6-tri­chloro-1,3,5-triazine 1 was condensed with diammonium 1,2-hy­drazine-1,2-di­carbo­dithioate/1,4-phenylenebis(carbamodithioate/(1,1’-biphenyl-4,4’diyl­bis(carba­mo­di­thioate/(sulphonyl-di-4,1-phenylene-bis(carbamodithioate/1,2-etha­nediylbis(car­bamodithioate 3a–e to afford 4a–e which undergo reaction with p-me­thoxyaniline to afford 4f–j. In the second method (B of preparation, 1 was condensed with p-me­thoxyaniline to yield 2 followed by the action of 3a–e to yield 4a–j. The structure of the newly synthesized compounds 4a–j was esta­blished on the basis of elemental analyses, as well as IR and 1H-NMR spec­tro­scopy. The antimicrobial activities of compounds 4a–j were determined by the cup‑plate method against gram-positive bacteria, gram-negative bacteria and fungi. All the synthesized compounds showed significant antimicrobial activity.

  7. Higgs portal dark matter in the minimal gauged $U(1)_{B-L}$ model

    CERN Document Server

    Okada, Nobuchika


    We propose a scenario of the right-handed neutrino dark matter in the context of the minimal gauged $U(1)_{B-L}$ model by introducing an additional parity which ensures the stability of dark matter particle. The annihilation of this right-handed neutrino takes place dominantly through the s-channel Higgs boson exchange, so that this model can be called Higgs portal dark matter model. We show that the thermal relic abundance of the right-handed neutrino dark matter with help of Higgs resonance can match the observed dark matter abundance. In addition we estimate the cross section with nucleon and show that the next generation direct dark matter search experiments can explore this model.

  8. Application of MOS-1b/MESSR data to flood monitoring of Dongting Lake

    Institute of Scientific and Technical Information of China (English)


    Taking Dongting Lake district as the studying area and utilizing multi-temporal MOS-1b/MESSR data as remote sensing info source, by the combination operation and ratio transform processing and the image, spectrum and histogram comparison of the MESSR image data of all bands for the flood season and dry season with the ERDAS IMAGINE system, a classification model was established, which can be used to acquire the spatial distributing information of water bodies. Meanwhile a water depth index model was derived and built, and then a model for detecting the depth of water body based on the non-linear recursive analysis was presented. By the overlay analysis of the classification thematic images based on the model for extracting flood information, the flooding area and distributing information were acquired.

  9. Efficient cell culture system for hepatitis C virus genotype 1a and 1b

    DEFF Research Database (Denmark)


    reference strain J4. Sequence analysis of recovered 1a/2a and 1b/2a recombinants from 2 serial passages and subsequent reverse genetic studies revealed adaptive mutations in e.g. p7, NS2 and/or NS3. In addition, the inventors demonstrate the possibility of using adaptive mutations identified for one HCV...... isolate in generating efficient cell culture systems for other isolates by transfer of mutations across isolates, subtypes or major genotypes. Furthermore neutralization studies showed that viruses of e.g. genotype 1 were efficiently neutralized by genotype Ia, 4a and 5a serum, an effect that could be...... utilized e.g. in vaccine development and immunological prophylaxis. The inventors in addition demonstrate the use of the developed systems for screening of antiviral substances in vitro and functional studies of the virus, e.g. identification of receptors required for HCV entry...

  10. Synthesis and Antibacterial Activities of Novel Imidazo[2,1-b]-1,3,4-thiadiazoles

    Directory of Open Access Journals (Sweden)

    Kamal F. M. Atta


    Full Text Available 2-Amino-5-(2-aryl-2H-1,2,3-triazol-4-yl-1,3,4-thiadiazoles 2-4 have been synthesized by the reaction of 2-aryl-2H-1,2,3-triazole-4-carboxylic acids 1 with thiosemicarbazide. Their reaction with phenacyl (p-substituted phenacyl bromides led to formation of the respective 6-aryl-2-(2-aryl-2H-1,2,3-triazol-4-ylimidazo[2,1-b]-1,3,4-thiadiazoles 5. Reactivity of the latter fused ring towards reaction with different electrophilic reagents afforded the corresponding 5-substituted derivatives 6-8. The structure of the above compounds was confirmed from their spectral characteristics. Some of these compounds were found to possess slight to moderate activity against the microorganisms Staphylococcus aureus, Candida albicans, Pseudomonas aeruginosa, and Escherichia coli.

  11. VLT transit and occultation photometry for the bloated planet CoRoT-1b

    CERN Document Server

    Gillon, M; Triaud, A H M J; Barman, T; Hebb, L; Montalban, J; Maxted, P F L; Queloz, D; Deleuil, M; Magain, P


    We present VLT eclipse photometry for the giant planet CoRoT-1b. We observed a transit in the R-band filter and an occultation in a narrow filter centered on 2.09 microns. Our analysis of this new photometry and published radial velocities, in combination with stellar-evolutionary modeling, leads to a planetary mass and radius of 1.07 (+0.13,-0.18) M_Jup and 1.45 (+0.07,-0.13) R_Jup, confirming the very low density previously deduced from CoRoT photometry. The large occultation depth that we measure at 2.09 microns (0.278 (+0.043,-0.066) %) is consistent with thermal emission and is better reproduced by an atmospheric model with no redistribution of the absorbed stellar flux to the night side of the planet.

  12. Diphoton resonances in a U (1 )B -L extension of the minimal supersymmetric standard model (United States)

    Lazarides, G.; Shafi, Q.


    Inspired by the 750 GeV diphoton state recently reported by ATLAS and CMS, we propose a U (1 )B-L extension of the MSSM which predicts the existence of four spin zero resonance states that are degenerate in mass in the supersymmetric limit. Vectorlike fields, a gauge singlet field, as well as the MSSM Higgsinos are prevented from acquiring arbitrary large masses by a U (1 ) R symmetry. Indeed, these masses can be considerably lighter than the Z' gauge boson mass. Depending on kinematics, the resonance states could decay into right-handed neutrinos and sneutrinos, and/or MSSM Higgs fields and Higgsinos with total decay widths in the multi-GeV range.

  13. Diphoton Resonances in U(1)_{B-L} Extension of MSSM

    CERN Document Server

    Lazarides, G


    Inspired by the 750 GeV diphoton state recently reported by ATLAS and CMS, we propose a U(1)_{B-L} extension of the MSSM which predicts the existence of four spin zero resonance states that are degenerate in mass in the supersymmetric limit. Vector-like fields, a gauge singlet field, as well as the MSSM Higgsinos are prevented from acquiring arbitrary large masses by a U(1) R-symmetry. Indeed, these masses can be considerably lighter than the Z' gauge boson mass. Depending on kinematics the resonance states could decay into right handed neutrinos and sneutrinos, and/or MSSM Higgs fields and Higgsinos with total decay widths in the multi-GeV range.

  14. The Mock LISA Data Challenges: from Challenge 1B to Challenge 3

    International Nuclear Information System (INIS)

    The Mock LISA Data Challenges are a programme to demonstrate and encourage the development of LISA data-analysis capabilities, tools and techniques. At the time of this workshop, three rounds of challenges had been completed, and the next was about to start. In this paper we provide a critical analysis of the entries to the latest completed round, Challenge 1B. The entries confirm the consolidation of a range of data-analysis techniques for galactic and massive-black-hole binaries, and they include the first convincing examples of detection and parameter estimation of extreme-mass-ratio inspiral sources. In this paper we also introduce the next round, Challenge 3. Its data sets feature more realistic waveform models (e.g., galactic binaries may now chirp, and massive-black-hole binaries may precess due to spin interactions), as well as new source classes (bursts from cosmic strings, isotropic stochastic backgrounds) and more complicated nonsymmetric instrument noise

  15. The Mock LISA Data Challenges: from Challenge 1B to Challenge 3

    CERN Document Server

    Babak, Stanislav; Benacquista, Matthew J; Cornish, Neil J; Crowder, Jeff; Larson, Shane L; Plagnol, Eric; Porter, Edward K; Vallisneri, Michele; Vecchio, Alberto; Arnaud, Keith; Barack, Leor; Błaut, Arkadiusz; Cutler, Curt; Fairhurst, Stephen; Gair, Jonathan; Gong, Xuefei; Harry, Ian; Khurana, Deepak; Królak, Andrzej; Mandel, Ilya; Prix, Reinhard; Sathyaprakash, B S; Savov, Pavlin; Shang, Yu; Trias, Miquel; Veitch, John; Wang, Yan; Wen, Linqing; Whelan, John T


    The Mock LISA Data Challenges are a programme to demonstrate and encourage the development of LISA data-analysis capabilities, tools and techniques. At the time of this workshop, three rounds of challenges had been completed, and the next was about to start. In this article we provide a critical analysis of entries to the latest completed round, Challenge 1B. The entries confirm the consolidation of a range of data-analysis techniques for Galactic and massive--black-hole binaries, and they include the first convincing examples of detection and parameter estimation of extreme--mass-ratio inspiral sources. In this article we also introduce the next round, Challenge 3. Its data sets feature more realistic waveform models (e.g., Galactic binaries may now chirp, and massive--black-hole binaries may precess due to spin interactions), as well as new source classes (bursts from cosmic strings, isotropic stochastic backgrounds) and more complicated nonsymmetric instrument noise.

  16. Sterile neutrino portal to Dark Matter I: The $U(1)_{B-L}$ case

    CERN Document Server

    Escudero, Miguel; Sanz, Verónica


    In this paper we explore the possibility that the sterile neutrino and Dark Matter sectors in the Universe have a common origin. We study the consequences of this assumption in the simple case of coupling the dark sector to the Standard Model via a global $U(1)_{B-L}$, broken down spontaneously by a dark scalar. This dark scalar provides masses to the dark fermions and communicates with the Higgs via a Higgs portal coupling. We find an interesting interplay between Dark Matter annihilation to dark scalars - the CP-even that mixes with the Higgs and the CP-odd which becomes a Goldstone boson, the Majoron - and heavy neutrinos, as well as collider probes via the coupling to the Higgs. Dark Matter annihilation into sterile neutrinos and its subsequent decay to gauge bosons and charged leptons or neutrinos produce unusual signatures for indirect searches.

  17. Neutrino Mass and Dark Matter from Gauged $U(1)_{B-L}$ Breaking

    CERN Document Server

    Kanemura, Shinya; Sugiyama, Hiroaki


    We propose a new model where the Dirac mass term for neutrinos, the Majorana mass term for right-handed neutrinos, and the other new fermion masses arise via the spontaneous breakdown of the $U(1)_{B-L}$ gauge symmetry. The anomaly-free condition gives four sets of assignment of the B-L charge to new particles, and three of these sets have an associated global $U(1)_{DM}$ symmetry which stabilizes dark matter candidates. The dark matter candidates contribute to generating the Dirac mass term for neutrinos at the one-loop level. Consequently, tiny neutrino masses are generated at the two-loop level via a Type-I-Seesaw-like mechanism. We show that this model can satisfy current bounds from neutrino oscillation data, the lepton flavor violation, the relic abundance of the dark matter, and the direct search for the dark matter. This model would be tested at future collider experiments and dark matter experiments.

  18. The stability of R-parity in supersymmetric models extended by U(1)B-L

    International Nuclear Information System (INIS)

    We perform a study of the stability of R-parity-conserving vacua of a constrained version of the minimal supersymmetric standard model with a gauged U(1)B-L which can conserve R-parity. Using the homotopy continuation method we find all the extrema of the tree-level potential, which are then used as starting point for the analysis of the loop-corrected potential. While we find that a majority of the points in the parameter space preserve R-parity, we also find that a significant portion of points which naively have phenomenologically acceptable vacua which conserve R-parity, actually have deeper vacua which break R-parity through sneutrino VEVs. We investigate under what conditions the deeper R-parity-violating vacua appear. We find that while previous exploratory work was broadly correct in some of its qualitative conclusions, we disagree in detail.

  19. A NASTRAN investigation of simulated projectile damage effects on a UH-1B tail boom model (United States)

    Futterer, A. T.


    A NASTRAN model of a UH-1B tail boom that had been designed for another project was used to investigate the effect on structural integrity of simulated projectile damage. Elements representing skin, and sections of stringers, longerons and bulkheads were systematically deleted to represent projectile damage. The structure was loaded in a manner to represent the flight loads that would be imposed on the tail boom at a 130 knot cruise. The deflection of four points on the rear of the tail boom relative to the position of these points for the unloaded, undamaged condition of the tail boom was used as a measure of the loss of structural rigidity. The same procedure was then used with the material properties of the aluminum alloys replaced with the material properties of T300/5208 high strength graphite/epoxy fibrous composite material, (0, + or - 45, 90)s for the skin and (0, + or - 45)s for the longerons, stringers, and bulk heads.

  20. HNF-1B specifically regulates the transcription of the γa-subunit of the Na+/K+-ATPase

    International Nuclear Information System (INIS)

    Research highlights: → Defects in HNF-1B transcription factor affect Mg2+ handling in the distal kidney. → γa- and γb- subunits of the Na+/K+-ATPase colocalize in the distal convoluted tubule of the nephron. → HNF-1B specifically activates γa expression. → HNF-1B mutants have a dominant negative effect on wild type HNF-1B activity. → Defective transcription of γa may promote renal Mg2+ wasting. -- Abstract: Hepatocyte nuclear factor-1B (HNF-1B) is a transcription factor involved in embryonic development and tissue-specific gene expression in several organs, including the kidney. Recently heterozygous mutations in the HNF1B gene have been identified in patients with hypomagnesemia due to renal Mg2+ wasting. Interestingly, ChIP-chip data revealed HNF-1B binding sites in the FXYD2 gene, encoding the γ-subunit of the Na+/K+-ATPase. The γ-subunit has been described as one of the molecular players in the renal Mg2+ reabsorption in the distal convoluted tubule (DCT). Of note, the FXYD2 gene can be alternatively transcribed into two main variants, namely γa and γb. In the present study, we demonstrated via two different reporter gene assays that HNF-1B specifically acts as an activator of the γa-subunit, whereas the γb-subunit expression was not affected. Moreover, the HNF-1B mutations H69fsdelAC, H324S325fsdelCA, Y352finsA and K156E, previously identified in patients with hypomagnesemia, prevented transcription activation of γa-subunit via a dominant negative effect on wild type HNF1-B. By immunohistochemistry, it was shown that the γa- and γb-subunits colocalize at the basolateral membrane of the DCT segment of mouse kidney. On the basis of these data, we suggest that abnormalities involving the HNF-1B gene may impair the relative abundance of γa and γb, thus affecting the transcellular Mg2+ reabsorption in the DCT.

  1. The 4.1B cytoskeletal protein regulates the domain organization and sheath thickness of myelinated axons


    Einheber, Steven; Maurel, Patrice; Meng, Xiaosong; Rubin, Marina; Lam, Isabel; Mohandas, Narla; An, Xiuli; Shrager, Peter; Kissil, Joseph; Salzer, James L.


    Myelinated axons are organized into specialized domains critical to their function in saltatory conduction, i.e. nodes, paranodes, juxtaparanodes, and internodes. Here, we describe the distribution and role of the 4.1B protein in this organization. 4.1B is expressed by neurons, and at lower levels by Schwann cells, which also robustly express 4.1G. Immunofluorescence and immuno-EM demonstrates 4.1B is expressed subjacent to the axon membrane in all domains except the nodes. Mice deficient in ...

  2. Biological activity and binding site characteristics of the PA1b Entomotoxin on insects from different orders


    Gressent, Frederic; Duport, Marie-Gabrielle; Rahioui, Isabelle; Pauchet, Yannick; Bolland, Patrice; Specty, Olivier; Rahbé, Yves


    The aim of this work was to investigate both the biological activity of an entomotoxin, the pea albumin 1b (PA1b), and the presence or absence of its binding site within an array of insect species. The data obtained showed that insect sensitivity was not related to its taxonomic position. Moreover, PA1b was not toxic to several tested microorganisms. However, the binding site was found to be conserved among very different insects, displaying similar thermodynamic constants regardless of the i...

  3. The AP-1A and AP-1B clathrin adaptor complexes define biochemically and functionally distinct membrane domains


    Fölsch, Heike; Pypaert, Marc; Maday, Sandra; Pelletier, Laurence; Mellman, Ira


    Most epithelial cells contain two AP-1 clathrin adaptor complexes. AP-1A is ubiquitously expressed and involved in transport between the TGN and endosomes. AP-1B is expressed only in epithelia and mediates the polarized targeting of membrane proteins to the basolateral surface. Both AP-1 complexes are heterotetramers and differ only in their 50-kD μ1A or μ1B subunits. Here, we show that AP-1A and AP-1B, together with their respective cargoes, define physically and functionally distinct membra...


    International Nuclear Information System (INIS)

    We report Spitzer/IRAC photometry of the transiting giant exoplanet HAT-P-1b during its secondary eclipse. This planet lies near the postulated boundary between the pM and pL-class of hot Jupiters, and is important as a test of models for temperature inversions in hot Jupiter atmospheres. We derive eclipse depths for HAT-P-1b, in units of the stellar flux, that are: 0.080% ± 0.008% [3.6 μm], 0.135% ± 0.022% [4.5 μm], 0.203% ± 0.031% [5.8 μm], and 0.238% ± 0.040% [8.0 μm]. These values are best fit using an atmosphere with a modest temperature inversion, intermediate between the archetype inverted atmosphere (HD 209458b) and a model without an inversion. The observations also suggest that this planet is radiating a large fraction of the available stellar irradiance on its dayside, with little available for redistribution by circulation. This planet has sometimes been speculated to be inflated by tidal dissipation, based on its large radius in discovery observations, and on a non-zero orbital eccentricity allowed by the radial velocity data. The timing of the secondary eclipse is very sensitive to orbital eccentricity, and we find that the central phase of the eclipse is 0.4999 ± 0.0005. The difference between the expected and observed phase indicates that the orbit is close to circular, with a 3σ limit of |e cos ω| < 0.002.

  5. Singularities of Type-Q ABS Equations

    Directory of Open Access Journals (Sweden)

    James Atkinson


    Full Text Available The type-Q equations lie on the top level of the hierarchy introduced by Adler, Bobenko and Suris (ABS in their classification of discrete counterparts of KdV-type integrable partial differential equations. We ask what singularities are possible in the solutions of these equations, and examine the relationship between the singularities and the principal integrability feature of multidimensional consistency. These questions are considered in the global setting and therefore extend previous considerations of singularities which have been local. What emerges are some simple geometric criteria that determine the allowed singularities, and the interesting discovery that generically the presence of singularities leads to a breakdown in the global consistency of such systems despite their local consistency property. This failure to be globally consistent is quantified by introducing a natural notion of monodromy for isolated singularities.

  6. Ab initio alpha-alpha scattering

    CERN Document Server

    Elhatisari, Serdar; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A; Luu, Thomas; Meißner, Ulf-G


    Processes involving alpha particles and alpha-like nuclei comprise a major part of stellar nucleosynthesis and hypothesized mechanisms for thermonuclear supernovae. In an effort towards understanding alpha processes from first principles, we describe in this letter the first ab initio calculation of alpha-alpha scattering. We use lattice effective field theory to describe the low-energy interactions of nucleons and apply a technique called the adiabatic projection method to reduce the eight-body system to an effective two-cluster system. We find good agreement between lattice results and experimental phase shifts for S-wave and D-wave scattering. The computational scaling with particle number suggests that alpha processes involving heavier nuclei are also within reach in the near future.

  7. Ab initio molar volumes and Gaussian radii. (United States)

    Parsons, Drew F; Ninham, Barry W


    Ab initio molar volumes are calculated and used to derive radii for ions and neutral molecules using a spatially diffuse model of the electron distribution with Gaussian spread. The Gaussian radii obtained can be used for computation of nonelectrostatic ion-ion dispersion forces that underlie Hofmeister specific ion effects. Equivalent hard-sphere radii are also derived, and these are in reasonable agreement with crystalline ionic radii. The Born electrostatic self-energy is derived for a Gaussian model of the electronic charge distribution. It is shown that the ionic volumes used in electrostatic calculations of strongly hydrated cosmotropic ions ought best to include the first hydration shell. Ionic volumes for weakly hydrated chaotropic metal cations should exclude electron overlap (in electrostatic calculations). Spherical radii are calculated as well as nonisotropic ellipsoidal radii for nonspherical ions, via their nonisotropic static polarizability tensors. PMID:19140766

  8. Ab Initio Path to Heavy Nuclei

    CERN Document Server

    Binder, Sven; Calci, Angelo; Roth, Robert


    We present the first ab initio calculations of nuclear ground states up into the domain of heavy nuclei, spanning the range from 16-O to 132-Sn based on two- plus three-nucleon interactions derived within chiral effective field theory. We employ the similarity renormalization group for preparing the Hamiltonian and use coupled-cluster theory to solve the many-body problem for nuclei with closed sub-shells. Through an analysis of theoretical uncertainties resulting from various truncations in this framework, we identify and eliminate the technical hurdles that previously inhibited the step beyond medium-mass nuclei, allowing for reliable validations of nuclear Hamiltonians in the heavy regime. Following this path we show that chiral Hamiltonians qualitatively reproduce the systematics of nuclear ground-state energies up to the neutron-rich Sn isotopes.

  9. Ab initio alpha-alpha scattering (United States)

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A.; Luu, Thomas; Meißner, Ulf-G.


    Processes such as the scattering of alpha particles (4He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei—nuclei with even and equal numbers of protons and neutrons—is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the ‘adiabatic projection method’ to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  10. Ablation dynamics in laser sclerotomy ab externo (United States)

    Brinkmann, Ralf; Droege, Gerit; Mohrenstecher, Dirk; Scheu, M.; Birngruber, Reginald


    Laser sclerostomy ab externo with flashlamp excited mid-IR laser systems emitting in the 2-3 micrometer spectral range is in phase II clinical trials. Although acutely high success rates were achieved, the restenosis rate after several months is about 40%. Laser pulses of several hundreds of microseconds, known to induce thermo-mechanical explosive evaporation were used for this procedure. We investigated the ablation dynamics in tissue and the cavitation bubble dynamics in water by means of an Er:YAG laser system to estimate the extent of mechanical damage zones in the sclera and in the anterior chamber, which may contribute to the clinical failure. We found substantial mechanical tissue deformation during the ablation process caused by the cavitation effects. Stress waves up to several bar generated by explosive evaporization were measured. The fast mechanical stretching and collapsing of the scleral tissue induced by cavitation resulted in tissue dissection as could be proved by flash photography and histology. The observed high restenosis might be a result of a subsequent enhanced wound healing process. Early fistula occlusions due to iris adherences, observed in about 20% of the clinical cases may be attributed to intraocular trauma induced by vapor bubble expansion through the anterior chamber after scleral perforation. An automatic feedback system minimizing adverse effects by steering and terminating the laser process during scleral fistulization is demonstrated. Moreover, a new approach in laser sclerostomy ab externo is presented using a cw-IR laser diode system emitting at the 1.94 micrometer mid-IR water absorption peak. This system was used in vitro and showed smaller damage zones compared to the pulsed laser radiation.

  11. Ab initio alpha-alpha scattering. (United States)

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A; Luu, Thomas; Meißner, Ulf-G


    Processes such as the scattering of alpha particles ((4)He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei--nuclei with even and equal numbers of protons and neutrons--is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the 'adiabatic projection method' to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  12. Synthesis of fluorinated dimethacrylate monomer and its application in preparing Bis-GMA free dental resin. (United States)

    Yin, Mei; Guo, Sen; Liu, Fang; He, Jingwei


    With the aim to reduce human exposure to Bis-phenol A derivatives, a novel fluorinated dimethacrylate monomer FUDMA was synthesized and mixed with triethyleneglycol dimethacrylate (TEGDMA) to prepare 2,2-bis[4-(2-hydroxy-3-methacryloy- loxypropyl)phenyl]propane (Bis-GMA) free dental resin system. Physicochemical properties, such as double bond conversion (DC), polymerization shrinkage (VS), water sorption (WS) and solubility (SL), flexural strength (FS) and modulus (FM), and fracture energy of FUDMA/TEGDMA resin system were investigated. Bis-GMA/TEGDMA resin system was used as a control. The results showed that, compared with Bis-GMA/TEGDMA resin system, FUDMA/TEGDMA had advantages like higher DC, lower VS, and higher fracture energy, but had no disadvantages. Therefore, FUDMA/TEGDMA resin system had better comprehensive physicochemical properties than Bis-GMA/TEGDMA resin system, and FUDMA had potential to be used as a substitute for Bis-GMA.

  13. Direct interaction and functional coupling between human 5-HT6 receptor and the light chain 1 subunit of the microtubule-associated protein 1B (MAP1B-LC1.

    Directory of Open Access Journals (Sweden)

    Soon-Hee Kim

    Full Text Available Serotonin (5-HT receptors of type 6 (5-HT6R play important roles in mood, psychosis, and eating disorders. Recently, a growing number of studies support the use of 5-HT6R-targeting compounds as promising drug candidates for treating cognitive dysfunction associated with Alzheimer's disease. However, the mechanistic linkage between 5-HT6R and such functions remains poorly understood. By using yeast two-hybrid, GST pull-down, and co-immunoprecipitation assays, here we show that human 5-HT6R interacts with the light chain 1 (LC1 subunit of MAP1B protein (MAP1B-LC1, a classical microtubule-associated protein highly expressed in the brain. Functionally, we have found that expression of MAP1B-LC1 regulates serotonin signaling in a receptor subtype-specific manner, specifically controlling the activities of 5-HT6R, but not those of 5-HT4R and 5-HT7R. In addition, we have demonstrated that MAP1B-LC1 increases the surface expression of 5-HT6R and decreases its endocytosis, suggesting that MAP1B-LC1 is involved in the desensitization and trafficking of 5-HT6R via a direct interaction. Together, we suggest that signal transduction pathways downstream of 5-HT6R are regulated by MAP1B, which might play a role in 5-HT6R-mediated signaling in the brain.

  14. Crystal structure of bis[4-(4-chlorobenzylpyridine-κN]bis(thiocyanato-κNzinc

    Directory of Open Access Journals (Sweden)

    Julia Werner


    Full Text Available In the crystal structure of the title compound, [Zn(NCS2(C12H10ClN2], the Zn2+ cation is N-coordinated by two terminally bonded thiocyante anions and by two 4-(4-chlorobenzylpyridine ligands within a slightly distorted tetrahedron. The asymmetric unit consists of half of the discrete complex, the central Zn2+ cation of which is located on a twofold rotation axis. The discrete complexes are linked into layers via a weak intermolecular hydrogen-bonding interaction, with a H...Cl distance of 2.85 Å and a C—H...Cl angle of 151°. These layers extend parallel to the ab plane and are held together by dispersion forces only.

  15. Macrocyclic and lantern complexes of palladium(II) with bis(amidopyridine) ligands: synthesis, structure, and host-guest chemistry. (United States)

    Yue, Nancy L S; Eisler, Dana J; Jennings, Michael C; Puddephatt, Richard J


    The reactions of [PdCl2(NCPh)2] in a 1:1 ratio with the bis(amidopyridine) ligands LL=C6H3(5-R)(1,3-CONH-3-C5H4N)2 with R=H (1a) or R=t-Bu (1b) give the corresponding neutral dipalladium(II) macrocycles trans,trans-[Pd2Cl4(mu-LL)2], 2a and 2b, which crystallize from dimethylformamide with one or two solvent molecules as macrocycle guests. The reaction of [PdCl2(NCPh)2] with LL in a 1:2 ratio gave the cationic lantern complex [Pd2(mu-LL)4]Cl4, 3c (LL=1b), and the reaction in the presence of AgO2CCF3 gave the corresponding trifluoroacetate salts [Pd2(mu-LL)4](CF3CO2)4, 3a (LL=1a) and 3b (LL=1b). These lantern complexes exhibit a remarkable host-guest chemistry, as they can encapsulate cations, anions, and water molecules by interaction of the guest with either the electrophilic NH or the nucleophilic C=O substituents of the amide groups, which can be directed toward the center of the lantern through easy conformational change. The structures of several of these host-guest complexes were determined, and it was found that the cavity size and shape vary according to the ligand conformation, with Pd...Pd separations in the range from 9.45 to 11.95 A. Supramolecular ordering of the lanterns was observed in the solid state, through either hydrogen bonding or secondary bonding to the cationic palladium(II) centers. The selective inclusion by the lantern complexes of alkali metal ions in the sequence Na+ > K+ > Li+ was observed by ESI-MS.

  16. Identification and Characterization of Two Novel RNA Editing Sites in grin1b Transcripts of Embryonic Danio rerio

    Directory of Open Access Journals (Sweden)

    Pedro Pozo


    Full Text Available Discovering RNA editing sites in model organisms provides an insight into their adaptations in addition to finding potential sites for the regulation of neural activity and the basis of integrated models of metazoan editing with a variety of applications, including potential clinical treatments of neural dysregulation. The zebrafish, Danio rerio, is an important vertebrate model system. We focused on the grin1b gene of zebrafish due to its important function in the nervous tissue as a glutamate receptor. Using a comparative sequence-based approach, we located possible RNA editing events within the grin1b transcript. Surprisingly, sequence analysis also revealed a new editing site which was not predicted by the comparative approach. We here report the discovery of two novel RNA editing events in grin1b transcripts of embryonic zebrafish. The frequency of these editing events and their locations within the grin1b transcript are also described.

  17. Expression of a truncated Hmga1b gene induces gigantism, lipomatosis and B-cell lymphomas in mice. (United States)

    Fedele, Monica; Visone, Rosa; De Martino, Ivana; Palmieri, Dario; Valentino, Teresa; Esposito, Francesco; Klein-Szanto, Andres; Arra, Claudio; Ciarmiello, Andrea; Croce, Carlo M; Fusco, Alfredo


    HMGA1 gene rearrangements have been frequently described in human lipomas. In vitro studies suggest that HMGA1 proteins have a negative role in the control of adipocyte cell growth, and that HMGA1 gene truncation acts in a dominant-negative fashion. Therefore, to define better the role of the HMGA1 alterations in the generation of human lipomas, we generated mice carrying an Hmga1b truncated (Hmga1b/T) gene. These mice develop a giant phenotype together with a drastic expansion of the retroperitoneal and subcutaneous white adipose tissue. We show that the activation of the E2F pathway likely accounts, at least in part, for this phenotype. Interestingly, the Hmga1b/T mice also develop B-cell lymphomas similar to that occurring in Hmga1-knockout mice, supporting a dominant-negative role of the Hmga1b/T mutant also in vivo.

  18. MAP1B binds to the NMDA receptor subunit NR3A and affects NR3A protein concentrations

    DEFF Research Database (Denmark)

    Eriksson, Maria; Samuelsson, Helena; Björklund, Stefan;


    protein interaction between NR3A and microtubule associated-protein (MAP) 1B, which both are localized to dendritic shafts and filopodia. NR3A protein levels were increased in MAP1B deficient (-/-) mice, with a corresponding decrease in NR1 levels, but the fraction of filopodia immunoreactive for NR3A was...... equal in cells from -/- and wild type (WT) mice. NR3A has previously been shown to interact with another member of the MAP1 family, MAP1S. We showed that MAP1S binds to microtubules in a similar manner as MAP1B, and suggest that MAP1S and MAP1B both are involved in regulating trafficking of NR3A...

  19. SAGE III Meteor-3M L1B Solar Event Transmission Data (HDF-EOS) V003 (United States)

    National Aeronautics and Space Administration — Level 1B pixel group transmission profiles for a single solar event (Suggested Usage: Vertical transmission profiles for input into an inversion algorithm)

  20. SAGE III Meteor-3M L1B Solar Event Transmission Data (HDF-EOS) V004 (United States)

    National Aeronautics and Space Administration — Level 1B pixel group transmission profiles for a single solar event (Suggested Usage: Vertical transmission profiles for input into an inversion algorithm)

  1. GLAS/ICESat L1B Global Waveform-based Range Corrections Data (HDF5) V033 (United States)

    National Aeronautics and Space Administration — The level 1B waveform parameterization data will contain waveform-based range corrections and surface characteristics at the full 40 per second resolution. Data...

  2. Pretreatment AKR1B10 expression predicts the risk of hepatocellular carcinoma development after hepatitis C virus eradication (United States)

    Murata, Ayato; Genda, Takuya; Ichida, Takafumi; Amano, Nozomi; Sato, Sho; Tsuzura, Hironori; Sato, Shunsuke; Narita, Yutaka; Kanemitsu, Yoshio; Shimada, Yuji; Hirano, Katsuharu; Iijima, Katsuyori; Wada, Ryo; Nagahara, Akihito; Watanabe, Sumio


    AIM To clarify the association between aldo-keto reductase family 1 member B10 (AKR1B10) expression and hepatocarcinogenesis after hepatitis C virus eradication. METHODS In this study, we enrolled 303 chronic hepatitis C patients who had achieved sustained virological response (SVR) through interferon-based antiviral therapy. Pretreatment AKR1B10 expression in the liver was immunohistochemically assessed and quantified as a percentage of positive staining area by using image-analysis software. A multivariate Cox analysis was used to estimate the hazard ratios (HRs) of AKR1B10 expression for hepatocellular carcinoma (HCC) development after achieving SVR. The cumulative incidences of HCC development were evaluated using Kaplan-Meier analysis and the log-rank test. RESULTS Of the 303 chronic hepatitis C patients, 153 (50.5%) showed scarce hepatic AKR1B10 expression, quantified as 0%, which was similar to the expression in control normal liver tissues. However, the remaining 150 patients (49.5%) exhibited various degrees of AKR1B10 expression in the liver, with a maximal AKR1B10 expression of 73%. During the median follow-up time of 3.6 years (range 1.0-10.0 years), 8/303 patients developed HCC. Multivariate analysis revealed that only high AKR1B10 expression (≥ 8%) was an independent risk factor for HCC development (HR = 15.4, 95%CI: 1.8-132.5, P = 0.012). The 5-year cumulative incidences of HCC development were 13.7% and 0.5% in patients with high and low AKR1B10 expression, respectively (P < 0.001). During the follow-up period after viral eradication, patients expressing high levels of AKR1B10 expressed markedly higher levels of alanine aminotransferase and α-fetoprotein than did patients exhibiting low AKR1B10 expression. CONCLUSION Chronic hepatitis C patients expressing high levels of hepatic AKR1B10 had an increased risk of HCC development even after SVR. PMID:27672277

  3. Ectodomains of the LDL receptor-related proteins LRP1b and LRP4 have anchorage independent functions in vivo.

    Directory of Open Access Journals (Sweden)

    Martin F Dietrich

    Full Text Available BACKGROUND: The low-density lipoprotein (LDL receptor gene family is a highly conserved group of membrane receptors with diverse functions in developmental processes, lipoprotein trafficking, and cell signaling. The low-density lipoprotein (LDL receptor-related protein 1b (LRP1B was reported to be deleted in several types of human malignancies, including non-small cell lung cancer. Our group has previously reported that a distal extracellular truncation of murine Lrp1b that is predicted to secrete the entire intact extracellular domain (ECD is fully viable with no apparent phenotype. METHODS AND PRINCIPAL FINDINGS: Here, we have used a gene targeting approach to create two mouse lines carrying internally rearranged exons of Lrp1b that are predicted to truncate the protein closer to the N-terminus and to prevent normal trafficking through the secretary pathway. Both mutations result in early embryonic lethality, but, as expected from the restricted expression pattern of LRP1b in vivo, loss of Lrp1b does not cause cellular lethality as homozygous Lrp1b-deficient blastocysts can be propagated normally in culture. This is similar to findings for another LDL receptor family member, Lrp4. We provide in vitro evidence that Lrp4 undergoes regulated intramembraneous processing through metalloproteases and gamma-secretase cleavage. We further demonstrate negative regulation of the Wnt signaling pathway by the soluble extracellular domain. CONCLUSIONS AND SIGNIFICANCE: Our results underline a crucial role for Lrp1b in development. The expression in mice of truncated alleles of Lrp1b and Lrp4 with deletions of the transmembrane and intracellular domains leads to release of the extracellular domain into the extracellular space, which is sufficient to confer viability. In contrast, null mutations are embryonically (Lrp1b or perinatally (Lrp4 lethal. These findings suggest that the extracellular domains of both proteins may function as a scavenger for

  4. Dicty_cDB: FCL-AB06 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available FCL (Link to library) FCL-AB06 (Link to dictyBase) - - - Contig-U15603-1 FCL-AB06P ...(Link to Original site) FCL-AB06F 694 FCL-AB06Z 573 FCL-AB06P 1267 - - Show FCL-AB06 Library FCL (Link to library) Clone ID FCL-...3-1 Original site URL Representative seq. ID FCL-AB06P (Link to Original site) Representative DNA sequence >FCL-AB06 (FCL-AB06Q) /CSM/FCL/FCL-...AB/FCL-AB06Q.Seq.d/ CAATTTTATCGGAACCATCAATTCATGCAGGTTCTGTATTTAGTATTAATTTAACCAAAT CTAGACA

  5. Childhood adversity moderates the effect of ADH1B on risk for alcohol-related phenotypes in Jewish Israeli drinkers


    Meyers, Jacquelyn L; Shmulewitz, Dvora; Wall, Melanie M.; Keyes, Katherine M; Aharonovich, Efrat; Spivak, Baruch; Weizman, Abraham; Frisch, Amos; Edenberg, Howard J.; Gelernter, Joel; Grant, Bridget F.; Hasin, Deborah


    Childhood adversity and genetic variant ADH1B-rs1229984 have each been shown to influence heavy alcohol consumption and disorders. However, little is known about how these factors jointly influence these outcomes. We assessed the main and additive interactive effects of childhood adversity (abuse, neglect, parental divorce) and the ADH1B-rs1229984 on the quantitative phenotypes “maximum drinks in a day” (Maxdrinks) and DSM-Alcohol Use Disorder (AUD) severity, adjusting for demographic variabl...

  6. Circulating Levels of IL-1B+IL-6 Cause ER Stress and Dysfunction in Islets From Prediabetic Male Mice


    O'Neill, Christina M.; Lu, Christine; Corbin, Kathryn L.; Sharma, Poonam R.; Dula, Stacey B.; Carter, Jeffrey D.; Ramadan, James W.; Xin, Wenjun; Lee, Jae K.; Nunemaker, Craig S.


    Elevated levels of circulating proinflammatory cytokines are associated with obesity and increased risk of type 2 diabetes, but the mechanism is unknown. We tested whether proinflammatory cytokines IL-1B+IL-6 at low picogram per milliliter concentrations (consistent with serum levels) could directly trigger pancreatic islet dysfunction. Overnight exposure to IL-1B+IL-6 in islets isolated from normal mice and humans disrupted glucose-stimulated intracellular calcium responses; cytokine-induced...

  7. Rapid screening of antineoplastic candidates for the human organic anion transporter OATP1B3 substrates using fluorescent probes


    Yamaguchi, Hiroaki; KOBAYASHI, Minako; Okada, Masahiro; Takeuchi, Toshiko; Unno, Michiaki; ABE, Takaaki; Goto, Junichi; Hishinuma, Takanori; Mano, Nariyasu


    A rapid screening system has been established to extract novel candidates that exhibit potent inhibition of the transport of fluorescent substrate by organic anion transporting polypeptide (OATP) 1B3. OATP1B3 is abundantly expressed in solid digestive organ cancers. Thus, the identification of new substrates leads to novel strategies for effective cancer chemotherapy with minimal adverse effects. We used an automated image acquisition and analysis system (IN Cell Analyzer 1000) to visualize ...

  8. A tandem segmental duplication (TSD) in the green revolution gene Rht-D1b region underlies plant height variation (United States)

    Semi-dwarfing genes Rht-B1b (Rht1) and Rht-D1b (Rht2), known as the “Green revolution” genes, have made a significant contribution to wheat production worldwide. Rht-D1c (Rht10) carried by Chinese wheat line Aibian 1 is an allele at the Rht-D1 locus. It has the strongest effect among all dwarfing...

  9. Leptin induces CYP1B1 expression in MCF-7 cells through ligand-independent activation of the ERα pathway

    Energy Technology Data Exchange (ETDEWEB)

    Khanal, Tilak; Kim, Hyung Gyun; Do, Minh Truong; Choi, Jae Ho; Won, Seong Su [Department of Toxicology, College of Pharmacy, Chungnam National University, Daejeon (Korea, Republic of); Kang, Wonku [College of Pharmacy, Yeungnam University, Gyeongsan (Korea, Republic of); Chung, Young Chul [Department of Food Science and Culinary, International University of Korea, Jinju (Korea, Republic of); Jeong, Tae Cheon, E-mail: [College of Pharmacy, Yeungnam University, Gyeongsan (Korea, Republic of); Jeong, Hye Gwang, E-mail: [Department of Toxicology, College of Pharmacy, Chungnam National University, Daejeon (Korea, Republic of)


    Leptin, a hormone with multiple biological actions, is produced predominantly by adipose tissue. Among its functions, leptin can stimulate tumour cell growth. Oestrogen receptor α (ERα), which plays an essential role in breast cancer development, can be transcriptionally activated in a ligand-independent manner. In this study, we investigated the effect of leptin on CYP1B1 expression and its mechanism in breast cancer cells. Leptin induced CYP1B1 protein, messenger RNA expression and promoter activity in ERα-positive MCF-7 cells but not in ERα-negative MDA-MB-231 cells. Additionally, leptin increased 4-hydroxyoestradiol in MCF-7 cells. Also, ERα knockdown by siRNA significantly blocked the induction of CYP1B1 expression by leptin, indicating that leptin induced CYP1B1 expression via an ERα-dependent mechanism. Transient transfection with CYP1B1 deletion promoter constructs revealed that the oestrogen response element (ERE) plays important role in the up-regulation of CYP1B1 by leptin. Furthermore, leptin stimulated phosphorylation of ERα at serine residues 118 and 167 and increased ERE-luciferase activity, indicating that leptin induced CYP1B1 expression by ERα activation. Finally, we found that leptin activated ERK and Akt signalling pathways, which are upstream kinases related to ERα phosphorylation induced by leptin. Taken together, our results indicate that leptin-induced CYP1B1 expression is mediated by ligand-independent activation of the ERα pathway as a result of the activation of ERK and Akt in MCF-7 cells. - Highlights: • Leptin increased 4-hydroxyoestradiol in MCF-7 breast cancer cells. • Leptin activated ERK and Akt kinases related to ERα phosphorylation. • Leptin induces phosphorylation of ERα at serine residues 118 and 167. • Leptin induces ERE-luciferase activity.

  10. Interaction of soft wheat Triticum aestivum L. gene ph1b with the Aegilops speltoides Tausch. genotype

    Energy Technology Data Exchange (ETDEWEB)

    Lapochkina, I.F. [Agricultural Research Institute of Central Non-Chernozem Region, Moscow (Russian Federation)


    It is demonstrated that genotypes of Aegilops speltoides and the phi1b mutant have an additive effect on the level of homeologous chromosome pairing in their F{sub 1} hybrids (2n = 28, ABDS). The contribution of gene ph1b to the total pairing level is 16% and that of the Ae. speltoides genotype is 42%. 9 refs., 1 fig., 2 tabs.

  11. Kopplung von Dichtefunktional- und ab-initio-Methoden


    Goll, Erich


    Im Rahmen der Doktorarbeit wurde untersucht, inwieweit die Kopplung von Dichtefunktionalmethoden und ab-initio-Korrelationsmethoden der Quantenchemie eine Verbesserung bezüglich beider Grenzmethoden erbringt. Die Kopplung erfolgt durch eine Aufspaltung des interelektronischen Hamiltonoperators (abstoßende Coulombwechselwirkung). Die kurzreichweitige Wechselwirkung wird mit Dichtefunktionaltheorie behandelt, die langreichweitige mit Hilfe von ab-initio-Methoden. Diese Aufteilung soll dazu dien...

  12. A Case of Laptop Computer-Induced Erythema Ab Igne

    Directory of Open Access Journals (Sweden)

    Nurettin Özgür Doğan


    Full Text Available Erythema ab igne, also known as toasted skin syndrome, is a skin reaction characterized by reticulate erythema, brown pigmentation, and telangiectasia. In some cases, epidermal atrophy and scaling are also identified. The condition is usually caused by prolonged exposure to a source of heat or infrared radiation. Here, we report a case of erythema ab igne associated with laptop computer use.

  13. ABS, MBS and CDO compared : An empirical analysis

    NARCIS (Netherlands)

    Vink, D.; Thibeault, A.


    The capital market in which the asset-backed securities are issued and traded is composed of three main categories: ABS, MBS and CDOs. We were able to examine a total number of 3,951 loans (worth €730.25 billion) of which 1,129 (worth €208.94 billion) have been classified as ABS. MBS issues represen

  14. ABS, MBS and CDO pricing comparisons : An empirical analysis

    NARCIS (Netherlands)

    Vink, D.; Thibeault, A.


    The capital market in which asset-backed securities are issued and traded is composed of three main categories: ABS, MBS and CDOs. The authors examined a total of 3,466 loans (worth €548.51 billion) of which 1,102 (worth €163.90 billion) have been classified as ABS. MBS issues represent 1,782 issues

  15. Cytochrome P450 1b1 in polycyclic aromatic hydrocarbon (PAH)-induced skin carcinogenesis: Tumorigenicity of individual PAHs and coal-tar extract, DNA adduction and expression of select genes in the Cyp1b1 knockout mouse

    Energy Technology Data Exchange (ETDEWEB)

    Siddens, Lisbeth K. [Department of Environmental and Molecular Toxicology, Oregon State University, Corvallis, OR 97331 (United States); Superfund Research Center, Oregon State University, Corvallis, OR 97331 (United States); Bunde, Kristi L. [College of Veterinary Medicine, Oregon State University, Corvallis, OR 97331 (United States); Harper, Tod A. [Department of Environmental and Molecular Toxicology, Oregon State University, Corvallis, OR 97331 (United States); Linus Pauling Institute, Oregon State University, Corvallis, OR 97331 (United States); Environmental Health Sciences Center, Oregon State University, Corvallis, OR 97331 (United States); McQuistan, Tammie J. [Superfund Research Center, Oregon State University, Corvallis, OR 97331 (United States); Linus Pauling Institute, Oregon State University, Corvallis, OR 97331 (United States); Löhr, Christiane V. [Environmental Health Sciences Center, Oregon State University, Corvallis, OR 97331 (United States); College of Veterinary Medicine, Oregon State University, Corvallis, OR 97331 (United States); Bramer, Lisa M. [Applied Statistics and Computational Modeling, Pacific Northwest National Laboratory, Richland, WA 99352 (United States); Waters, Katrina M. [Superfund Research Center, Oregon State University, Corvallis, OR 97331 (United States); Biological Sciences Division, Pacific Northwest National Laboratory, Richland, WA 99352 (United States); Tilton, Susan C. [Department of Environmental and Molecular Toxicology, Oregon State University, Corvallis, OR 97331 (United States); Superfund Research Center, Oregon State University, Corvallis, OR 97331 (United States); Krueger, Sharon K. [Department of Environmental and Molecular Toxicology, Oregon State University, Corvallis, OR 97331 (United States); Superfund Research Center, Oregon State University, Corvallis, OR 97331 (United States); Linus Pauling Institute, Oregon State University, Corvallis, OR 97331 (United States); and others


    FVB/N mice wild-type, heterozygous or null for Cyp 1b1 were used in a two-stage skin tumor study comparing PAH, benzo[a]pyrene (BaP), dibenzo[def,p]chrysene (DBC), and coal tar extract (CTE, SRM 1597a). Following 20 weeks of promotion with TPA the Cyp 1b1 null mice, initiated with DBC, exhibited reductions in incidence, multiplicity, and progression. None of these effects were observed with BaP or CTE. The mechanism of Cyp 1b1-dependent alteration of DBC skin carcinogenesis was further investigated by determining expression of select genes in skin from DBC-treated mice 2, 4 and 8 h post-initiation. A significant reduction in levels of Cyp 1a1, Nqo1 at 8 h and Akr 1c14 mRNA was observed in Cyp 1b1 null (but not wt or het) mice, whereas no impact was observed in Gst a1, Nqo 1 at 2 and 4 h or Akr 1c19 at any time point. Cyp 1b1 mRNA was not elevated by DBC. The major covalent DNA adducts, dibenzo[def,p]chrysene-(±)-11,12-dihydrodiol-cis and trans-13,14-epoxide-deoxyadenosine (DBCDE-dA) were quantified by UHPLC-MS/MS 8 h post-initiation. Loss of Cyp1 b1 expression reduced DBCDE-dA adducts in the skin but not to a statistically significant degree. The ratio of cis- to trans-DBCDE-dA adducts was higher in the skin than other target tissues such as the spleen, lung and liver (oral dosing). These results document that Cyp 1b1 plays a significant role in bioactivation and carcinogenesis of DBC in a two-stage mouse skin tumor model and that loss of Cyp 1b1 has little impact on tumor response with BaP or CTE as initiators. - Highlights: • Cyp1b1 null mice exhibit lower skin cancer sensitivity to DBC but not BaP or CTE. • Cyp1b1 expression impacts expression of other PAH metabolizing enzymes. • cis/trans-DBCDE-dA ratio significantly higher in the skin than the spleen, lung or liver • Potency of DBC and CTE in mouse skin is higher than predicted by RPFs.

  16. Cloning and characterization of human RTVP-1b, a novel splice variant of RTVP-1 in glioma cells

    International Nuclear Information System (INIS)

    Here, we report the cloning and characterization of RTVP-1b, a novel splice variant of human RTVP-1, which was isolated from the U87 glioma cell line. Sequence analysis revealed that RTVP-1b contains an additional 71 base exon between exons 2 and 3 that is missing in RTVP-1, leading to a frame-shift and a different putative protein. The deduced protein was 237 amino acids in length, sharing the N-terminal 141 amino acids with RTVP-1. RT-PCR analysis demonstrated that RTVP-1b was expressed in a wide range of tissues and that its expression was different from that of RTVP-1. In contrast, RTVP-1 and RTVP-1b showed similar patterns of expression in astrocytic tumors; highly expressed in glioblastomas as compared to normal brains, low-grade astrocytomas and anaplastic oligodendrogliomas. Overexpression of RTVP-1b increased glioma cell proliferation but did not affect cell migration. Our results suggest that RTVP-1b represents a potential prognostic marker and therapeutic target in gliomas

  17. Impact of Chronic Hepatitis C Virus Genotype 1b Infection on Triglyceride Concentration in Serum Lipoprotein Fractions

    Directory of Open Access Journals (Sweden)

    Tomohisa Nagano


    Full Text Available Reduced low-density lipoprotein (LDL cholesterol level is a characteristic feature of dyslipidemia in chronic hepatitis C virus (HCV infection. However, abnormality in serum triglyceride (TG has not been fully investigated. To clarify the impact of HCV genotype 1b (G1b infection and advanced fibrosis on serum TG profiles, TG concentrations in lipoprotein fractions were examined in fasting sera from 185 subjects with active or cleared HCV infection by high-performance liquid chromatography. Serum lipoproteins were fractionated into four classes: chylomicron, very low-density lipoprotein (VLDL, LDL, and high-density lipoprotein (HDL. Then, the significance of HCV G1b infection on TG levels in each lipoprotein fraction was determined using multiple regression models. We found that active HCV G1b infection was positively associated with high HDL-TG levels and low VLDL-TG levels, independent of other factors included in the regression model. In VLDL sub-fractions, active HCV infection was only found to be associated with low levels of large VLDL-TG. Similarly, advanced liver fibrosis in chronic HCV G1b infection was associated with high levels of LDL-TG, HDL-TG, and small VLDL-TG, independent of other clinical factors. These findings indicate that active HCV G1b infection and advanced fibrosis are closely associated with abnormal serum TG profiles.

  18. Ahcyl2 upregulates NBCe1-B via multiple serine residues of the PEST domain-mediated association (United States)

    Park, Pil Whan; Ahn, Jeong Yeal


    Inositol-1,4,5-triphosphate [IP3] receptors binding protein released with IP3 (IRBIT) was previously reported as an activator of NBCe1-B. Recent studies have characterized IRBIT homologue S-Adenosylhomocysteine hydrolase-like 2 (AHCYL2). AHCYL2 is highly homologous to IRBIT (88%) and heteromerizes with IRBIT. The two important domains in the N-terminus of AHCYL2 are a PEST domain and a coiled-coil domain which are highly comparable to those in IRBIT. Therefore, in this study, we tried to identify the role of those domains in mouse AHCYL2 (Ahcyl2), and we succeeded in identifying PEST domain of Ahcyl2 as a regulation region for NBCe1-B activity. Site directed mutagenesis and coimmunoprecipitation assay showed that NBCe1-B binds to the N-terminal Ahcyl2-PEST domain, and its binding is determined by the phosphorylation of 4 critical serine residues (Ser151, Ser154, Ser157, and Ser160) in Ahcyl2 PEST domain. Also we revealed that 4 critical serine residues in Ahcyl2 PEST domain are indispensable for the activation of NBCe1-B using measurement of intracellular pH experiment. Thus, these results suggested that the NBCe1-B is interacted with 4 critical serine residues in Ahcyl2 PEST domain, which play an important role in intracellular pH regulation through NBCe1-B.

  19. Synthesis and Analgesic Effects of μ-TRTX-Hhn1b on Models of Inflammatory and Neuropathic Pain

    Directory of Open Access Journals (Sweden)

    Yu Liu


    Full Text Available μ-TRTX-Hhn1b (HNTX-IV is a 35-amino acid peptide isolated from the venom of the spider, Ornithoctonus hainana. It inhibits voltage-gated sodium channel Nav1.7, which has been considered as a therapeutic target for pain. The goal of the present study is to elucidate the analgesic effects of synthetic μ-TRTX-Hhn1b on animal models of pain. The peptide was first synthesized and then successfully refolded/oxidized. The synthetic peptide had the same inhibitory effect on human Nav1.7 current transiently expressed in HEK 293 cells as the native toxin. Furthermore, the analgesic potentials of the synthetic peptide were examined on models of inflammatory pain and neuropathic pain. μ-TRTX-Hhn1b produced an efficient reversal of acute nociceptive pain in the abdominal constriction model, and significantly reduced the pain scores over the 40-min period in the formalin model. The efficiency of μ-TRTX-Hhn1b on both models was equivalent to that of morphine. In the spinal nerve model, the reversal effect of μ-TRTX-Hhn1b on allodynia was longer and higher than mexiletine. These results demonstrated that μ-TRTX-Hhn1b efficiently alleviated acute inflammatory pain and chronic neuropathic pain in animals and provided an attractive template for further clinical analgesic drug design.

  20. In Silico Approach for SAR Analysis of the Predicted Model of DEPDC1B: A Novel Target for Oral Cancer. (United States)

    Ahuja, Palak; Singh, Kailash


    With the incidence rate of oral carcinogenesis increasing in the Southeast-Asian countries, due to increase in the consumption of tobacco and betel quid as well as infection from human papillomavirus, specifically type 16, it becomes crucial to predict the transition of premalignant lesion to cancerous tissue at an initial stage in order to control the process of oncogenesis. DEPDC1B, downregulated in the presence of E2 protein, was recently found to be overexpressed in oral cancer, which can possibly be explained by the disruption of the E2 open reading frame upon the integration of viral genome into the host genome. DEPDC1B mediates its effect by directly interacting with Rac1 protein, which is known to regulate important cell signaling pathways. Therefore, DEPDC1B can be a potential biomarker as well as a therapeutic target for diagnosing and curing the disease. However, the lack of 3D model of the structure makes the utilization of DEPDC1B as a therapeutic target difficult. The present study focuses on the prediction of a suitable 3D model of the protein as well as the analysis of protein-protein interaction between DEPDC1B and Rac1 protein using PatchDock web server along with the identification of allosteric or regulatory sites of DEPDC1B. PMID:27034663