Standards for the Protection of Skin Barrier Function.
Giménez-Arnau, Ana
2016-01-01
The skin is a vital organ, and through our skin we are in close contact with the entire environment. If we lose our skin we lose our life. The barrier function of the skin is mainly driven by the sophisticated epidermis in close relationship with the dermis. The epidermal epithelium is a mechanically, chemically, biologically and immunologically active barrier submitted to continuous turnover. The barrier function of the skin needs to be protected and restored. Its own physiology allows its recovery, but many times this is not sufficient. This chapter is focused on the standards to restore, treat and prevent barrier function disruption. These standards were developed from a scientific, academic and clinical point of view. There is a lack of standardized administrative recommendations. Still, there is a walk to do that will help to reduce the social and economic burden of diseases characterized by an abnormal skin barrier function. © 2016 S. Karger AG, Basel.
DEFF Research Database (Denmark)
2016-01-01
Renowned experts present the latest knowledge Although a very fragile structure, the skin barrier is probably one of the most important organs of the body. Inward/out it is responsible for body integrity and outward/in for keeping microbes, chemicals, and allergens from penetrating the skin. Since...... the role of barrier integrity in atopic dermatitis and the relationship to filaggrin mutations was discovered a decade ago, research focus has been on the skin barrier, and numerous new publications have become available. This book is an interdisciplinary update offering a wide range of information...... on the subject. It covers new basic research on skin markers, including results on filaggrin and on methods for the assessment of the barrier function. Biological variation and aspects of skin barrier function restoration are discussed as well. Further sections are dedicated to clinical implications of skin...
Hyperpigmentation; Hypopigmentation; Skin - abnormally light or dark ... Normal skin contains cells called melanocytes. These cells produce melanin , the substance that gives skin its color. Skin with ...
Directory of Open Access Journals (Sweden)
Naoko Goto-Inoue
Full Text Available Imaging mass spectrometry (IMS is a useful cutting edge technology used to investigate the distribution of biomolecules such as drugs and metabolites, as well as to identify molecular species in tissues and cells without labeling. To protect against excess water loss that is essential for survival in a terrestrial environment, mammalian skin possesses a competent permeability barrier in the stratum corneum (SC, the outermost layer of the epidermis. The key lipids constituting this barrier in the SC are the ceramides (Cers comprising of a heterogeneous molecular species. Alterations in Cer composition have been reported in several skin diseases that display abnormalities in the epidermal permeability barrier function. Not only the amounts of different Cers, but also their localizations are critical for the barrier function. We have employed our new imaging system, capable of high-lateral-resolution IMS with an atmospheric-pressure ionization source, to directly visualize the distribution of Cers. Moreover, we show an ichthyotic disease pathogenesis due to abnormal Cer metabolism in Dorfman-Chanarin syndrome, a neutral lipid storage disorder with ichthyosis in human skin, demonstrating that IMS is a novel diagnostic approach for assessing lipid abnormalities in clinical setting, as well as for investigating physiological roles of lipids in cells/tissues.
Antimicrobial Peptides, Infections and the Skin Barrier
DEFF Research Database (Denmark)
Clausen, Maja Lisa; Agner, Tove
2016-01-01
The skin serves as a strong barrier protecting us from invading pathogens and harmful organisms. An important part of this barrier comes from antimicrobial peptides (AMPs), which are small peptides expressed abundantly in the skin. AMPs are produced in the deeper layers of the epidermis and trans......The skin serves as a strong barrier protecting us from invading pathogens and harmful organisms. An important part of this barrier comes from antimicrobial peptides (AMPs), which are small peptides expressed abundantly in the skin. AMPs are produced in the deeper layers of the epidermis...
Skin Barrier Function and Allergens
DEFF Research Database (Denmark)
Engebretsen, Kristiane Aasen; Thyssen, Jacob Pontoppidan
2016-01-01
The skin is an important barrier protecting us from mechanical insults, microorganisms, chemicals and allergens, but, importantly, also reducing water loss. A common hallmark for many dermatoses is a compromised skin barrier function, and one could suspect an elevated risk of contact sensitization...... and skin barrier status. Psoriasis has traditionally been regarded a Th1-dominated disease, but the discovery of Th17 cells and IL-17 provides new and interesting information regarding the pathogenesis of the disease. Research suggests an inverse relationship between psoriasis and CA, possibly due......) and Th2 (AD) have been proposed as an explanation. Finally, there is convincing evidence that exposure to irritants increases the risk of CS, and patients with ICD are, therefore, at great risk of developing CA. Skin irritation leads to the release of IL-1 and TNF-α, which affects the function of antigen...
Directory of Open Access Journals (Sweden)
Tzu-Kai Lin
2015-06-01
Conclusion: An epidermis-derived cytokine cascade was observed following TCS-induced barrier disruption, which is similar to that from permeability barrier insults by acetone or tape stripping. The study suggests that concurrent application of skin care products during TCS treatment improves barrier homeostasis, and should become a standard practice to alleviate TCS-induced WD.
Penetration through the Skin Barrier
DEFF Research Database (Denmark)
Nielsen, Jesper Bo; Benfeldt, Eva; Holmgaard, Rikke
2016-01-01
The skin is a strong and flexible organ with barrier properties essential for maintaining homeostasis and thereby human life. Characterizing this barrier is the ability to prevent some chemicals from crossing the barrier while allowing others, including medicinal products, to pass at varying rates......-through diffusion cells) as well as in vivo methods (microdialysis and microperfusion). Then follows a discussion with examples of how different characteristics of the skin (age, site and integrity) and of the penetrants (size, solubility, ionization, logPow and vehicles) affect the kinetics of percutaneous...
Darlenski, Razvigor; Kazandjieva, Jana; Tsankov, Nikolai; Fluhr, Joachim W
2013-11-01
The aim of the study was to disclose interactions between epidermal barrier, skin irritation and sensitization in healthy and diseased skin. Transepidermal water loss (TEWL) and stratum corneum hydration (SCH) were assessed in adult patients with atopic dermatitis (AD), rosacea and healthy controls. A 4-h patch test with seven concentrations of sodium lauryl sulphate was performed to determine the irritant threshold (IT). Contact sensitization pattern was revealed by patch testing with European baseline series. Subjects with a lower IT had higher TEWL values and lower SCH. Subjects with positive allergic reactions had significantly lower IT. In AD, epidermal barrier deterioration was detected on both volar forearm and nasolabial fold, while in rosacea, impeded skin physiology parameters were observed on the facial skin only, suggesting that barrier impediment is restricted to the face in rosacea, in contrast with AD where the abnormal skin physiology is generalized. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Oh, Myoung Jin; Nam, Jin Ju; Lee, Eun Ok; Kim, Jin Wook; Park, Chang Seo
2016-10-01
Omega-hydroxyceramides (ω-OH-Cer) play a crucial role in maintaining the integrity of skin barrier. ω-OH-Cer are the primary lipid constituents of the corneocyte lipid envelope (CLE) covalently attached to the outer surface of the cornified envelope linked to involucrin to become bound form lipids in stratum corneum (SC). CLE becomes a hydrophobic impermeable layer of matured corneocyte preventing loss of natural moisturizing factor inside the corneocytes. More importantly, CLE may also play an important role in the formation of proper orientation of intercellular lipid lamellar structure by interdigitating with the intercellular lipids in a comb-like fashion. Abnormal barrier conditions associated with atopic dermatitis but also UVB-irradiated skins are known to have lowered level of bound lipids, especially ω-OH-Cer, which indicate that ω-OH-Cer play an important role in maintaining the integrity of skin barrier. In this study, protective effects of a novel synthetic C16 omega-hydroxyphytoceramides (ω-OH-phytoceramide) on skin barrier function were investigated. Epidermal barrier disruption was induced by UVB irradiation, tape-stripping in hairless mouse and human skin. Protective effect of damaged epidermis was evaluated using the measurement of transepidermal water loss and cohesion of SC. Increased keratinocyte differentiation was verified using cultured keratinocyte through western blot. Results clearly demonstrated that a synthetic C16 ω-OH-phytoceramide enhanced the integrity of SC and accelerated the recovery of damaged skin barrier function by stimulating differentiation process. In a conclusion, a synthetic C16 ω-OH-phytoceramide treatment improved epidermal homeostasis in several disrupted conditions.
Noninvasive evaluation of the barrier properties of the skin
Directory of Open Access Journals (Sweden)
Utz S.R.
2014-09-01
Full Text Available Skin as an organ of protection covers the body and accomplishes multiple defensive functions. The intact skin represents a barrier to the uncontrolled loss of water, proteins, and plasma components from the organism. Due to its complex structure, the epidermal barrier with its major component, stratum corneum, is the rate-limiting unit for the penetration of exogenous substances through the skin. The epidermal barrier is not a static structure. The permeability barrier status can be modified by different external and internal factors such as climate, physical stressors, and a number of skin and systemic diseases. Today, different non-invasive approaches are used to monitor the skin barrier physical properties in vivo. The quantification of parameters such as transepidermal water loss, stratum corneum hydration, and skin surface acidity is essential for the integral evaluation of the epidermal barrier status. This paper will allow the readership to get acquainted with the non-invasive, in vivo methods for the investigation of the skin barrier.
International Nuclear Information System (INIS)
Osburn, F.G.
1985-01-01
A skin barrier composition comprises a mixture of a copolymer resin of ethylene and vinyl acetate (EVA), and a water-insoluble dry tack-providing elastomer such as polyisobutylene. The composition after mixing and molding, is subjected to ionizing irradiation to form cross-linked polymer networks of the EVA. The compositions have exceptional properties for use as barrier sheets, rings, or strips in ostomy, wound drainage, and incontinence devices. (author)
Energy Technology Data Exchange (ETDEWEB)
Osburn, F G
1985-06-12
A skin barrier composition comprises a mixture of a copolymer resin of ethylene and vinyl acetate (EVA), and a water-insoluble dry tack-providing elastomer such as polyisobutylene. The composition after mixing and molding, is subjected to ionizing irradiation to form cross-linked polymer networks of the EVA. The compositions have exceptional properties for use as barrier sheets, rings, or strips in ostomy, wound drainage, and incontinence devices.
DEFF Research Database (Denmark)
Gruber, Robert; Sugarman, Jeffrey L; Crumrine, Debra
2015-01-01
were hyperkeratosis, hypergranulosis, mild T helper cell type 1-dominant lymphocytic inflammation, plugging of follicular orifices, striking absence of sebaceous glands, and hair shaft abnormalities in KP lesions but not in unaffected skin sites. Changes in barrier function and abnormal paracellular...... and tight junctions appeared normal, immunohistochemistry for claudin 1 showed no reduction in protein amounts, and molecular analysis of claudin 1 was unremarkable. Our findings suggest that absence of sebaceous glands is an early step in KP pathogenesis, resulting in downstream hair shaft and epithelial...
Del Rosso, James Q; Kircik, Leon H
2013-07-01
Atopic dermatitis (AD) may be considered the "poster disease" for exemplifying the significance of abnormalities of the epidermal barrier that occur predominantly within the stratum corneum (SC) and upper epidermis. Specifically, impairments of the SC permeability barrier, antimicrobial barrier, and immunologic barrier contribute markedly to the fundamental pathophysiology of AD. The multiple clinical sequelae associated with epidermal barrier impairments inherent to AD include dry skin, pruritus, increased skin sensitivity to irritants and allergens, eczematous skin changes, staphylococcal skin and anterior nares colonization, and increase in some cutaneous infections (ie, molluscum contagiosum). This article addresses the pathophysiology of AD with clinically relevant correlations, and discusses the scientific basis of a specially designed cleanser and moisturizer system that incorporates ceramide technology and filaggrin degradation products along with other "barrier-friendly" excipients.
An ex vivo human skin model for studying skin barrier repair.
Danso, Mogbekeloluwa O; Berkers, Tineke; Mieremet, Arnout; Hausil, Farzia; Bouwstra, Joke A
2015-01-01
In the studies described in this study, we introduce a novel ex vivo human skin barrier repair model. To develop this, we removed the upper layer of the skin, the stratum corneum (SC) by a reproducible cyanoacrylate stripping technique. After stripping the explants, they were cultured in vitro to allow the regeneration of the SC. We selected two culture temperatures 32 °C and 37 °C and a period of either 4 or 8 days. After 8 days of culture, the explant generated SC at a similar thickness compared to native human SC. At 37 °C, the early and late epidermal differentiation programmes were executed comparably to native human skin with the exception of the barrier protein involucrin. At 32 °C, early differentiation was delayed, but the terminal differentiation proteins were expressed as in stripped explants cultured at 37 °C. Regarding the barrier properties, the SC lateral lipid organization was mainly hexagonal in the regenerated SC, whereas the lipids in native human SC adopt a more dense orthorhombic organization. In addition, the ceramide levels were higher in the cultured explants at 32 °C and 37 °C than in native human SC. In conclusion, we selected the stripped ex vivo skin model cultured at 37 °C as a candidate model to study skin barrier repair because epidermal and SC characteristics mimic more closely the native human skin than the ex vivo skin model cultured at 32 °C. Potentially, this model can be used for testing formulations for skin barrier repair. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Döge, Nadine; Avetisyan, Araks; Hadam, Sabrina; Pfannes, Eva Katharina Barbosa; Rancan, Fiorenza; Blume-Peytavi, Ulrike; Vogt, Annika
2017-07-01
Topical dermatotherapy is intended to be used on diseased skin. Novel drug delivery systems even address differences between intact and diseased skin underlining the need for pre-clinical assessment of different states of barrier disruption. Herein, we studied how short-term incubation in culture media compared to incubation in humidified chambers affects human skin barrier function and viability. On both models we assessed different types and intensities of physical and chemical barrier disruption methods with regard to structural integrity, biophysical parameters and cytokine levels. Tissue degeneration and proliferative activity limited the use of tissue cultures to 48h. Viability is better preserved in cultured tissue. Tape-stripping (50×TS) and 4h sodium lauryl sulfate (SLS) pre-treatment were identified as highly reproducible and effective procedures for barrier disruption. Transepidermal water loss (TEWL) values reproducibly increased with the intensity of disruption while sebum content and skin surface pH were of limited value. Interleukin (IL)-6/8 and various chemokines and proteases were increased in tape-stripped skin which was more pronounced in SLS-treated skin tissue extracts. Thus, albeit limited to 48h, cultured full-thickness skin maintained several barrier characteristics and responded to different intensities of barrier disruption. Potentially, these models can be used to assess pre-clinically the efficacy and penetration of anti-inflammatory compounds. Copyright © 2016 Elsevier B.V. All rights reserved.
A study on the quantitative evaluation of skin barrier function
Maruyama, Tomomi; Kabetani, Yasuhiro; Kido, Michiko; Yamada, Kenji; Oikaze, Hirotoshi; Takechi, Yohei; Furuta, Tomotaka; Ishii, Shoichi; Katayama, Haruna; Jeong, Hieyong; Ohno, Yuko
2015-03-01
We propose a quantitative evaluation method of skin barrier function using Optical Coherence Microscopy system (OCM system) with coherency of near-infrared light. There are a lot of skin problems such as itching, irritation and so on. It has been recognized skin problems are caused by impairment of skin barrier function, which prevents damage from various external stimuli and loss of water. To evaluate skin barrier function, it is a common strategy that they observe skin surface and ask patients about their skin condition. The methods are subjective judgements and they are influenced by difference of experience of persons. Furthermore, microscopy has been used to observe inner structure of the skin in detail, and in vitro measurements like microscopy requires tissue sampling. On the other hand, it is necessary to assess objectively skin barrier function by quantitative evaluation method. In addition, non-invasive and nondestructive measuring method and examination changes over time are needed. Therefore, in vivo measurements are crucial for evaluating skin barrier function. In this study, we evaluate changes of stratum corneum structure which is important for evaluating skin barrier function by comparing water-penetrated skin with normal skin using a system with coherency of near-infrared light. Proposed method can obtain in vivo 3D images of inner structure of body tissue, which is non-invasive and non-destructive measuring method. We formulate changes of skin ultrastructure after water penetration. Finally, we evaluate the limit of performance of the OCM system in this work in order to discuss how to improve the OCM system.
Development of human skin equivalents to unravel the impaired skin barrier in atopic dermatitis skin
Eweje, M.O.
2016-01-01
The studies in this thesis describes the barrier defects in Atopic Dermatitis (AD) skin and various techniques to develop AD Human Skin Equivalents (HSEs) which can be used to better understand the role of several factors in the pathogenesis of AD skin. The results described show that Inflammation
Multiphoton STED and FRET in human skin: Resolving the skin barrier
DEFF Research Database (Denmark)
Antonescu, Irina; Dreier, Jes; Brewer, Jonathan R.
intercellular spaces. Characterization of the structural and dynamical processes occurring across the skin barrier is essential for understanding healthy and diseased skin and for designing successful transdermal drug delivery strategies. In this study we use Stimulated emission depletion (STED), two photon...
Matching the skin barrier to the skin type.
Thompson, Hyacinth; North, Jacqui; Davenport, Rebecca; Williams, Julia
Peristomal skin problems are thought to be common (Herlufsson et al, 2006; Williams et al, 2010), and can interfere with the security of stoma products. Stoma patients are reliant on the integrity of their peristomal skin to maintain a normal lifestyle. Bekkers et al (1996) highlighted that, if the peristomal skin becomes damaged, it not only affects the person physically, but also psychologically, ultimately prolonging rehabilitation and adaptation to the stoma. Therefore, it can be concluded that maintaining skin integrity is a basic and essential skill in ensuring good stoma management. This article explores the assessment of four stoma patients, highlighting the importance of matching their skin type with their skin barrier for optimum skin protection. The patients have kindly agreed for their case studies to be published as a means of informing others. All names have been changed in line with Nursing and Midwifery Council (2010) guidelines to maintain patient confidentiality. This article was originally presented at the World Council of Enterostomal Therapists' (WCET) annual conference in 2010, receiving first prize at poster presentations.
Penetration of radionuclides across skin barriers of animal skin models in vitro
International Nuclear Information System (INIS)
Koprda, V.; Harangozo, M.; Bohacik, L.; Kassai, Z.
1998-01-01
In this paper: (i) the time dependence of permeation of 137 Cs + , 60 Co 2+ , and 147 Pm 3+ from aqueous solution through animal skin model has been studied, (ii) the biologic structure mostly responsible for the barrier effect was selected and proved, (iii) the relative importance of the main diffusion pathways for 137 Cs + , 60 Co 2+ and 147 Pm 3+ (the diffusion across the intact skin and the diffusion through the hair channels) was assessed. All experiments were done using radioactive tracers. Experimental arrangement consisted of Franz-type vertical permeation cells used with fresh skin from abdominal region of 5 day old rats (5DR) of Wistar strain (Breeding Farm Dobra Voda, SK) and 9 day old rats (9DR), respectively. 5DR are still hairless, and 9DR are just short haired. The 5DR skin was used in full form (intact), and then with decreasing thickness of horny layer after the skin had been stripped with Scotch type (3M) 5-20 times respectively, or the skin was splitted under 60 degC hot water so that the whole epidermis was removed. The penetrated amounts of ions were found to be proportional to the time at least in the first 7 hours. The permeation resistance of the skin is proportional to the thickness of the horny layer, the principal barrier mostly restricting the flux of ions. The more the skin is stripped, the more enhanced is the penetration of ions. This corroborates the fact that stratum corneum represents the most important barrier function of the whole skin (of rats). The additional diffusion through channels along hairs (follicules) can be of important value also in case of human skin where hair density is many times lower than in the case of the animal models used
Could tight junctions regulate the barrier function of the aged skin?
Svoboda, Marek; Bílková, Zuzana; Muthný, Tomáš
2016-03-01
The skin is known to be the largest organ in human organism creating interface with outer environment. The skin provides protective barrier against pathogens, physical and chemical insults, and against uncontrolled loss of water. The barrier function was primarily attributed to the stratum corneum (SC) but recent studies confirmed that epidermal tight junctions (TJs) also play important role in maintaining barrier properties of the skin. Independent observations indicate that barrier function and its recovery is impaired in aged skin. However, trans-epidermal water loss (TEWL) values remains rather unchanged in elderly population. UV radiation as major factor of photoageing impairs TJ proteins, but TJs have great self-regenerative potential. Since it may be possible that TJs can compensate TEWL in elderly due to its regenerative and compensatory capabilities, important question remains to be answered: how are TJs regulated during skin ageing? This review provides an insight into TJs functioning as epidermal barrier and summarizes current knowledge about the impact of ageing on the barrier function of the skin and epidermal TJs. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Lehman, Paul A; Beatch, Kacie; Raney, Sam G; Franz, Thomas J
2017-01-01
A study was designed to assess barrier integrity simultaneously using separate compounds (probes) for polar and non-polar pathways through the skin, 3 H 2 O and 14 C-octanol, respectively; and to determine whether the two probe approach could better define barrier integrity. A 5-min dose of water containing 3 H 2 O and 14 C -octanol was applied to ex vivo human skin mounted in Franz diffusion cells. The receptor solution was sampled at 30 min, analyzed for 3 H and 14 C content, and the correlation between water and octanol absorption was determined by statistical tests suitable for non-normally distributed data. This study was conducted on skin from 37 donors with from 3 to 30 replicate skin sections per donor (a total of 426 sections). The correlation between 3 H 2 O and 14 C-octanol absorption was low (Pearson correlation coefficient = 0.3485). The 3 H 2 O absorption cutoff used in this study to select for a normal skin barrier rejected some sections in which 14 C-octanol absorption was within normal limits and accepted others in which 14 C-octanol absorption was abnormally high. The converse was true for 3 H 2 O absorption when the 14 C-octanol-based cutoff was used. The results of the 3 H 2 O test or of similar tests that primarily assess the permeability of polar pathways through the skin may not necessarily provide information relevant to the absorption of highly lipophilic compounds. Octanol, or another molecule that more closely matches the physicochemical attributes of the test compound, may characterize properties of the skin barrier that are more relevant to compounds of low water solubility.
LOCALIZATION OF PERMEABILITY BARRIERS IN THE FROG SKIN EPITHELIUM
Martinez-Palomo, A.; Erlij, D.; Bracho, H.
1971-01-01
Ruthenium red and colloidal lanthanum were used to determine the site of the structural barriers to diffusion within the intercellular spaces of frog skin epithelium. Electron micrographs show that occluding zonules located at the outer border of the stratum corneum and at the outer layer of the stratum granulosum are true tight junctions since they are impermeable to these tracers. Measurement of 140La uptake by the living skin shows that lanthanum moves across the external surface of the skin readily, into and out of a compartment that has a limited capacity and is bounded on its internal side by a barrier impermeable to lanthanum. Examination of these skins with the electron microscope suggests that the compartment is localized between the external membrane of the cells at the outer layer of the s. granulosum and at the outermost surface of the skin. These observations and other findings described in the literature indicate that the site of the external high resistance barrier of the frog skin is localized at the outer border of the s. granulosum. PMID:4329611
Ceramides and barrier function in healthy skin
DEFF Research Database (Denmark)
Jungerstedt, J; Hellgren, Lars; Drachmann, Tue
2010-01-01
Lipids in the stratum corneum are key components in the barrier function of the skin. Changes in lipid composition related to eczematous diseases are well known, but limited data are available on variations within healthy skin. The objective of the present study was to compare ceramide subgroups...... and ceramide/cholesterol ratios in young, old, male and female healthy skin. A total of 55 participants with healthy skin was included in the study. Lipid profiles were correlated with transepidermal water loss and with information on dry skin from a questionnaire including 16 people. No statistically...
Gruber, Robert; Sugarman, Jeffrey L.; Crumrine, Debra; Hupe, Melanie; Mauro, Theodora M.; Mauldin, Elizabeth A.; Thyssen, Jacob P.; Brandner, Johanna M.; Hennies, Hans-Christian; Schmuth, Matthias; Elias, Peter M.
2016-01-01
Although keratosis pilaris (KP) is common, its etiopathogenesis remains unknown. KP is associated clinically with ichthyosis vulgaris and atopic dermatitis and molecular genetically with filaggrin-null mutations. In 20 KP patients and 20 matched controls, we assessed the filaggrin and claudin 1 genotypes, the phenotypes by dermatoscopy, and the morphology by light and transmission electron microscopy. Thirty-five percent of KP patients displayed filaggrin mutations, demonstrating that filaggrin mutations only partially account for the KP phenotype. Major histologic and dermatoscopic findings of KP were hyperkeratosis, hypergranulosis, mild T helper cell type 1-dominant lymphocytic inflammation, plugging of follicular orifices, striking absence of sebaceous glands, and hair shaft abnormalities in KP lesions but not in unaffected skin sites. Changes in barrier function and abnormal paracellular permeability were found in both interfollicular and follicular stratum corneum of lesional KP, which correlated ultrastructurally with impaired extracellular lamellar bilayer maturation and organization. All these features were independent of filaggrin genotype. Moreover, ultrastructure of corneodesmosomes and tight junctions appeared normal, immunohistochemistry for claudin 1 showed no reduction in protein amounts, and molecular analysis of claudin 1 was unremarkable. Our findings suggest that absence of sebaceous glands is an early step in KP pathogenesis, resulting in downstream hair shaft and epithelial barrier abnormalities. PMID:25660180
The outcomes of barrier protection in periwound skin and stoma care.
Stephen-Haynes, Jackie
This article considers the anatomy and physiology of the skin,wound healing, excoriation, maceration, peristomal skin and the importance of periwound protection. The results of a 54-patient study of the use of barrier film forming skin protection in periwound skin are presented and a 10-patient healthy volunteer experimental evaluation. The results confirm the effectiveness of barrier protection in healthy skin in an experimental evaluation and a 54-patient study requiring periwound protection.
Directory of Open Access Journals (Sweden)
Hyosun Jang
2018-01-01
Full Text Available Radiation-induced skin injury can take the form of serious cutaneous damage and have specific characteristics. Asymptomatic periods are classified as the latent stage. The skin barrier plays a critical role in the modulation of skin permeability and hydration and protects the body against a harsh external environment. However, an analysis on skin barrier dysfunction against radiation exposure in the latent stage has not been conducted. Thus, we investigated whether the skin barrier is impaired by irradiation in the latent stage and aimed to identify the molecules involved in skin barrier dysfunction. We analyzed skin barrier function and its components in SKH1 mice that received 20 and 40 Gy local irradiation. Increased transepidermal water loss and skin pH were observed in the latent stage of the irradiated skin. Skin barrier components, such as structural proteins and lipid synthesis enzymes in keratinocyte, increased in the irradiated group. Interestingly, we noted sebaceous gland atrophy and increased serine protease and inflammatory cytokines in the irradiated skin during the latent period. This finding indicates that the main factor of skin barrier dysfunction in the latent stage of radiation-induced skin injury is sebaceous gland deficiency, which could be an intervention target for skin barrier impairment.
Skin barrier disruption by acetone: observations in a hairless mouse skin model
Rissmann, R.; Oudshoorn, M.H.M.; Hennink, W.E.; Ponec, M.; Bouwstra, J.A.
2009-01-01
To disrupt the barrier function of the skin, different in vivo methods have been established, e.g., by acetone wiping or tape-stripping. In this study, the acetone-induced barrier disruption of hairless mice was investigated in order to establish a reliable model to study beneficial, long-term
Trait Positive Affect Buffers the Effects of Acute Stress on Skin Barrier Recovery
Robles, Theodore F.; Brooks, Kathryn P.; Pressman, Sarah D.
2010-01-01
Objective This study examines the role of self-reported trait positive affect (PA) on skin barrier recovery after skin disruption, and whether the role of trait PA in wound healing is consistent with the direct effects model or the stress-buffering model of PA and health. Design Sixty healthy participants (mean age 22.7 ± 3.9 years) completed a self-report measure of trait positive and negative affect, underwent a “tape-stripping” procedure that disrupts normal skin barrier function, and were randomly assigned to a Stress (Trier Social Stress Test) or No Stress (reading task) condition. Main Outcome Measures Skin barrier recovery was assessed by measuring transepidermal water loss up to 2 hr after skin disruption. Results Multilevel modeling indicated that greater trait PA was related to faster skin barrier recovery (p < .05). The effects of PA on skin barrier recovery were independent of levels of trait NA. Conclusion These findings suggest that trait PA may influence skin barrier recovery following a brief stressor. In addition, these results provide additional evidence that trait PA can positively impact objective health outcomes. PMID:19450044
Egawa, Gyohei; Kabashima, Kenji
2016-08-01
Atopic dermatitis (AD) is the most common inflammatory skin disease in the industrialized world and has multiple causes. Over the past decade, data from both experimental models and patients have highlighted the primary pathogenic role of skin barrier deficiency in patients with AD. Increased access of environmental agents into the skin results in chronic inflammation and contributes to the systemic "atopic (allergic) march." In addition, persistent skin inflammation further attenuates skin barrier function, resulting in a positive feedback loop between the skin epithelium and the immune system that drives pathology. Understanding the mechanisms of skin barrier maintenance is essential for improving management of AD and limiting downstream atopic manifestations. In this article we review the latest developments in our understanding of the pathomechanisms of skin barrier deficiency, with a particular focus on the formation of the stratum corneum, the outermost layer of the skin, which contributes significantly to skin barrier function. Copyright © 2016 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.
Ceramides and barrier function in healthy skin
DEFF Research Database (Denmark)
Mutanu Jungersted, Jakob; Hellgren, Lars; Høgh, Julie Kaae
2010-01-01
Lipids in the stratum corneum are key components in the barrier function of the skin. Changes in lipid composition related to eczematous diseases are well known, but limited data are available on variations within healthy skin. The objective of the present study was to compare ceramide subgroups...... and ceramide/cholesterol ratios in young, old, male and female healthy skin. A total of 55 participants with healthy skin was included in the study. Lipid profiles were correlated with transepidermal water loss and with information on dry skin from a questionnaire including 16 people. No statistically...... significant differences were found between young and old skin for ceramide subgroups or ceramide/cholesterol ratios, and there was no statistically significant correlation between answers about dry skin and ceramide levels. Interestingly, a statistically significant higher ceramide/cholesterol ratio was found...
Composite of microgels and lipids as biofilm to restore skin barrier function
Oudshoorn, M.H.M.
2008-01-01
The mature epidermis is an effective barrier which prevents the body from dehydration and protects it against various environmental influences. If the natural barrier is immature or damaged, the skin barrier is impaired and desiccation occurs. Hence, the regeneration of impaired skin is an essential
Defective channels lead to an impaired skin barrier.
Blaydon, Diana C; Kelsell, David P
2014-10-15
Channels are integral membrane proteins that form a pore, allowing the passive movement of ions or molecules across a membrane (along a gradient), either between compartments within a cell, between intracellular and extracellular environments or between adjacent cells. The ability of cells to communicate with one another and with their environment is a crucial part of the normal physiology of a tissue that allows it to carry out its function. Cell communication is particularly important during keratinocyte differentiation and formation of the skin barrier. Keratinocytes in the skin epidermis undergo a programme of apoptosis-driven terminal differentiation, whereby proliferating keratinocytes in the basal (deepest) layer of the epidermis stop proliferating, exit the basal layer and move up through the spinous and granular layers of the epidermis to form the stratum corneum, the external barrier. Genes encoding different families of channel proteins have been found to harbour mutations linked to a variety of rare inherited monogenic skin diseases. In this Commentary, we discuss how human genetic findings in aquaporin (AQP) and transient receptor potential (TRP) channels reveal different mechanisms by which these channel proteins function to ensure the proper formation and maintenance of the skin barrier. © 2014. Published by The Company of Biologists Ltd.
Herbal medicines that benefit epidermal permeability barrier function
Directory of Open Access Journals (Sweden)
Lizhi Hu
2015-06-01
Full Text Available Epidermal permeability barrier function plays a critical role in regulating cutaneous functions. Hence, researchers have been searching for effective and affordable regimens to enhance epidermal permeability barrier function. In addition to topical stratum corneum lipids, peroxisome proliferator-activated receptor, and liver X receptor ligands, herbal medicines have been proven to benefit epidermal permeability barrier function in both normal and diseased skin, including atopic dermatitis, glucocorticoid-induced skin damage, and UVB-damaged skin. The potential mechanisms by which herbal medicines improve the permeability barrier include stimulation of epidermal differentiation, lipid production, antimicrobial peptide expression, and antioxidation. Therefore, utilization of herbal medicines could be a valuable alternative approach to enhance epidermal permeability barrier function in order to prevent and/or treat skin disorders associated with permeability barrier abnormalities.
Cost-effectiveness of a Ceramide-Infused Skin Barrier Versus a Standard Barrier
Berger, Ariel; Inglese, Gary; Skountrianos, George; Karlsmark, Tonny; Oguz, Mustafa
2018-01-01
PURPOSE: To assess the cost-effectiveness of a ceramide-infused skin barrier (CIB) versus other skin barriers (standard of care) among patients who have undergone ostomy creation. DESIGN: Cost-effectiveness analysis, based on a decision-analytic model that was estimated using data from the ADVOCATE (A Study Determining Variances in Ostomy Skin Conditions And The Economic Impact) trial, which investigated stoma-related healthcare costs over 12 weeks among patients who recently underwent fecal ostomy, and from other sources. SUBJECTS AND SETTING: Analysis was based on a hypothetical cohort of 1000 patients who recently underwent fecal ostomy; over a 1-year period, 500 patients were assumed to use CIB and 500 were assumed to use standard of care. METHODS: We adapted a previous economic model to estimate expected 1-year costs and outcomes among persons with a new ostomy assumed to use CIB versus standard of care. Outcomes of interest included peristomal skin complications (PSCs) (up to 2 during the 1-year period of interest) and quality-adjusted life days (QALDs); QALDs vary from 1, indicating a day of perfect health to 0, indicating a day with the lowest possible health (deceased). Subjects were assigned QALDs on a daily basis, with the value of the QALD on any given day based on whether the patient was experiencing a PSC. Costs included those related to skin barriers, ostomy accessories, and care of PSCs. The incremental cost-effectiveness of CIB versus standard of care was estimated as the incremental cost per PSC averted and QALD gained, respectively; net monetary benefit of CIB was also estimated. All analyses were run using the perspective of an Australian payer. RESULTS: On a per-patient basis, use of CIB was expected over a 1-year period to result in 0.16 fewer PSCs, an additional 0.35 QALDs, and a savings of A$180 (Australian dollars, US $137) in healthcare costs all versus standard of care. Management with CIB provided a net monetary benefit (calculated as
Effect of glove occlusion on the skin barrier
DEFF Research Database (Denmark)
Tiedemann, Daniel; Clausen, Maja Lisa; John, Swen Malthe
2016-01-01
that the negative effect of occlusion in itself is limited, and that only extensive and long-term occlusion will cause barrier impairment. However, studies investigating combined effect of occlusion and exposure to soaps/detergents indicate that occlusion significantly enhances the skin barrier damage caused...... by detergents/soaps in a dose-response fashion....
DEFF Research Database (Denmark)
Jungersted, J.M.; Høgh, Julie Kaae; Hellgren, Lars
2010-01-01
) was performed on the volar forearm and evaluated by trans-epidermal water loss (TEWL), erythema, and a cyanoacrylate skin sample was obtained for lipid analysis. We found no significant changes in response to SLS irritation as evaluated by TEWL and erythema, after treatment with alitretinoin for 2 months......Alitretinoin is a new drug for systemic treatment of chronic hand eczema. Previous functional tests of skin topically treated with retinoids have indicated impaired skin barrier function, but no data are available on barrier parameters after systemic alitretinoin treatment. To investigate...
Skin abnormality and hairloss: the reproductive endocrinological viewpoint
Directory of Open Access Journals (Sweden)
Ali Baziad
2004-12-01
Full Text Available Excessive androgen production may cause changes in female skin, such as hirsutism and acne. The administration of antiadrogenic hormone such as cyproteron acetate, may eliminate the hyperandrogenic effect on the skin. Hairloss may also caused either by hyper-androgenemia or by low estrogen level. The administration of either antiandrogen or estrogen may reduce hairloss. Virilization, which includes excessive growth of hair and clitoris enlargement, deepened voice, muscle hypertrophy and mammary hypoplasia are also associated with hyperandrogenemia. Antiandrogen treatment could eliminate these impacts of virilization. In contrast, cellulite was supected to be due to androgen deficiency, and the use of topical testosterone could eliminate it. It is concluded that skin and/or hairloss are associated with hormonal changes in women. The treatment with antiandrogenic hormones may reduce or cure these abnormalities. (Med J Indones 2004; 13: 258-63Keywords: Hirsutism, virilization, acne, cellulite, hairloss, androgen, estrogen
Oral intake of beet extract provides protection against skin barrier impairment in hairless mice.
Kawano, Ken-Ichi; Umemura, Kazuo
2013-05-01
The epidermis acts as a functional barrier against the external environment. Disturbances in the function of this barrier cause water loss and increase the chances of penetration by various irritable stimuli, leading to skin diseases such as dry skin, atopic dermatitis, and psoriasis. Ceramides are a critical natural element of the protective epidermal barrier. The aim of this study was to evaluate whether the oral intake of beet (Beta vulgaris) extract, a natural product rich in glucosylceramide (GlcCer), may prevent disturbance in skin barrier function. When HR-1 hairless mice were fed a special diet (HR-AD), transepidermal water loss (TEWL) from the dorsal skin increased, with a compensatory increase in water intake after 5 weeks. Mice fed with HR-AD had dry skin with erythema and showed increased scratching behaviour. Histological examinations revealed a remarkable increase in the thickness of the skin at 8 weeks. Supplemental addition of beet extract, which contained GlcCer at a final concentration of 0.1%, significantly prevented an increase TEWL, water intake, cumulative scratching time, and epidermal thickness at 8 weeks. These results indicate that oral intake of beet extract shows potential for preventing skin diseases associated with impaired skin barrier function. Copyright © 2012 John Wiley & Sons, Ltd.
Abnormal brain activation in excoriation (skin-picking) disorder
DEFF Research Database (Denmark)
Odlaug, Brian L.; Hampshire, Adam; Chamberlain, Samuel R
2016-01-01
Background: Excoriation (skin-picking) disorder (SPD) is a relatively common psychiatric condition whose neurobiological basis is unknown. Aims: To probe the function of fronto-striatal circuitry in SPD. Method: Eighteen participants with SPD and 15 matched healthy controls undertook an executive...... encompassing bilateral dorsal striatum (maximal in right caudate), bilateral anterior cingulate and right medial frontal regions. These abnormalities were, for the most part, outside the dorsal planning network typically activated by executive planning tasks. Conclusions: Abnormalities of neural regions...... involved in habit formation, action monitoring and inhibition appear involved in the pathophysiology of SPD. Implications exist for understanding the basis of excessive grooming and the relationship of SPD with putative obsessive-compulsive spectrum disorders....
Directory of Open Access Journals (Sweden)
Magdalena Boer
2016-02-01
Full Text Available The complex structure of human skin and its physicochemical properties turn it into an efficient outermost defence line against exogenous factors, and help maintain homeostasis of the human body. This role is played by the epidermal barrier with its major part – stratum corneum. The condition of the epidermal barrier depends on individual and environmental factors. The most important biophysical parameters characterizing the status of this barrier are the skin pH, epidermal hydration, transepidermal water loss and sebum excretion. The knowledge of biophysical skin processes may be useful for the implementation of prophylactic actions whose aim is to restore the barrier function.
Disturbed skin barrier in children with chronic kidney disease.
Wojtowicz-Prus, Elzbieta; Kilis-Pstrusinska, Katarzyna; Reich, Adam; Zachwieja, Katarzyna; Miklaszewska, Monika; Szczepanska, Maria; Szepietowski, Jacek C
2015-02-01
There are limited data on skin lesions in children with end-stage renal failure. The aim of the study was an evaluation of the skin barrier in children with different stages of chronic kidney disease (CKD). The prevalence of xerosis, its severity, as well as its link selected demographic factors, were examined. The study included 103 children: 72 with CKD stages 3-5 (38 on conservative treatment and 34 on dialysis) and 31 patients with primary monosymptomatic nocturnal enuresis as a control group. Initially, the study subjects described the localisation and severity of dry skin by themselves. Next, clinical evaluation of xerosis, non-invasive corneometric assessment of epidermis moisturising and the measurement of transepidermal water loss were performed. Most CKD children reported dry skin. The problem of xerosis was identified more frequently in patients on dialysis (67.6 %) than on conservative treatment (42.1 %) (p = 0.01). CKD patients divided according to skin dryness did not differ with regards to age, sex, initial kidney disease and CKD duration. Disturbed skin barrier is an important concern of children with CKD, intensifying as the disease progresses. This symptom occurs on early stages of CKD and it should be taken into consideration in the CKD management.
Han, Seung Hoon; Park, Ji Woong
2017-11-01
The presence of long-standing hyperglycemic conditions has been suggested to lead to many skin problems associated with an impaired skin barrier function. However, the relationship between impaired skin barrier status and altered peripheral nervous system function has not yet been determined. The purpose of this study was to investigate the water evaporation rate as a measure of the permeability barrier function of diabetic skin and its relationship to diabetic sensorimotor polyneuropathy (DSPN) and peripheral autonomic neuropathy (PAN) using well-controlled confounding variables.This case-control study included 42 participants with chronic diabetes and 43 matched healthy controls. The diabetic group underwent a nerve conduction study and sympathetic skin response (SSR) test to confirm the presence of DSPN and PAN, respectively. Different skin regions were analyzed using the noninvasive Tewameter instrument (Courage + Khazaka Electronic GmbH, Cologne, Germany). The impacts of PAN, DSPN, age, and diabetes duration on the values of transepidermal water loss (TEWL) were each analyzed and compared between the groups.Regardless of the presence of DSPN or PAN, the TEWL values as measured on the distal extremities were significantly lower in the diabetic group than in the control group. In the diabetic group, participants with abnormal SSR test results showed decreased TEWL values in the finger, sole, and first toe, as compared with participants with normal SSR test results. In the control group, age showed a negative correlation with the TEWL values with respect to some measured regions. However, in the diabetic group, there was no significant correlation between either patient age or diabetes duration and TEWL values.The presence of a long-term hyperglycemic state can reduce the permeability barrier function of the skin, a phenomenon that might be related to the presence of an impaired peripheral sympathetic nervous system, rather than peripheral sensorimotor
Szewczyk, Maria Teresa; Majewska, Grazyna; Cabral, Mary V; Hölzel-Piontek, Karin
2014-12-01
Peristomal skin problems are the most commonly experienced physical complication following ostomy surgery and often are caused by leakage or a poorly fitting skin barrier. A prospective, multicenter, observational evaluation of persons with a colostomy, ileostomy, or urostomy was conducted to assess the incidence of peristomal lesions and level of patient satisfaction with moldable skin barriers. Peristomal skin was assessed using the Studio Alterazoni Cutanee Stomale (SACS™) scale, and patients were asked to rate barrier application and usage variables. During a period of 12 months, and using convenience sampling, 561 patients from 90 centers in 3 countries were enrolled: 28 in Germany, 48 in Poland, and 14 in the United States. Participants included 277 new stoma patients (average time since surgery 0.3 months; average age 64.7 ± 12.86 years) who had a colostomy (174), ileostomy (72), or urostomy (10); and 284 patients with an existing stoma (average time since surgery 18.2 months; average age 66 ± 12.62 years) who had a colostomy (174), ileostomy (88), or urostomy (22) who experienced skin complications using a traditional skin barrier (ie, a solid or flexible barrier with precut opening or one requiring cutting an opening to accommodate the stoma). All patients were assessed at baseline and after 1 and 2 months. In the patients with a new stoma, 225 (90.4%) had intact skin at baseline, 239 (95.6%) had intact skin after 2 months, and 98% rated overall satisfaction with the barrier as good or excellent. In the patients with an existing stoma, intact skin was observed in 103 patients (39.5%) at baseline and 225 (86.2%) after 2 months, with 96.5% of patients rating overall satisfaction with the barrier as good or excellent. In this group, the proportion of patients who used accessory products (eg, belt, deodorants, powder) was 73% at baseline and 64.2% at the 2-month follow-up. The moldable skin barriers evaluated were effective in preventing and healing
Donnelly, Ryan F.; Mooney, Karen; McCrudden, Maelíosa T.C.; Vicente-Pérez, Eva M.; Belaid, Luc; González-Vázquez, Patricia; McElnay, James C.; Woolfson, A. David
2014-01-01
We describe, for the first time, quantification of in-skin swelling and fluid uptake by hydrogel-forming microneedle arrays (MN) and skin barrier recovery in human volunteers. Such MN, prepared from aqueous blends of hydrolysed poly(methylvinylether/maleicanhydride) (15% w/w) and the crosslinker poly(ethyleneglycol) 10,000 daltons (7.5% w/w), were inserted into the skin of human volunteers (n = 15) to depths of approximately 300 μm by gentle hand pressure. The MN swelled in skin, taking up skin interstitial fluid, such that their mass had increased by approximately 30% after 6 hours in skin. Importantly, however, skin barrier function recovered within 24 hours post microneedle removal, regardless of how long the MN had been in skin or how much their volume had increased with swelling. Further research on closure of MN-induced micropores is required, since transepidermal water loss measurements suggested micropore closure, while optical coherence tomography indicated that MN-induced micropores had not closed over, even 24 hours after MN had been removed. There were no complaints of skin reactions, adverse events or strong views against MN use by any of the volunteers. Only some minor erythema was noted after patch removal, although this always resolved within 48 hours and no adverse events were present on follow-up. PMID:24633895
Physiological and Molecular Effects of in vivo and ex vivo Mild Skin Barrier Disruption.
Pfannes, Eva K B; Weiss, Lina; Hadam, Sabrina; Gonnet, Jessica; Combardière, Béhazine; Blume-Peytavi, Ulrike; Vogt, Annika
2018-01-01
The success of topically applied treatments on skin relies on the efficacy of skin penetration. In order to increase particle or product penetration, mild skin barrier disruption methods can be used. We previously described cyanoacrylate skin surface stripping as an efficient method to open hair follicles, enhance particle penetration, and activate Langerhans cells. We conducted ex vivo and in vivo measurements on human skin to characterize the biological effect and quantify barrier disruption-related inflammation on a molecular level. Despite the known immunostimulatory effects, this barrier disruption and hair follicle opening method was well accepted and did not result in lasting changes of skin physiological parameters, cytokine production, or clinical side effects. Only in ex vivo human skin did we find a discrete increase in IP-10, TGF-β, IL-8, and GM-CSF mRNA. The data underline the safety profile of this method and demonstrate that the procedure per se does not cause substantial inflammation or skin damage, which is also of interest when applied to non-invasive sampling of biomarkers in clinical trials. © 2018 S. Karger AG, Basel.
Directory of Open Access Journals (Sweden)
Elisabeth Hahnel
2017-11-01
Full Text Available Abstract Background Geriatric patients are affected by a range of skin conditions and dermatological diseases, functional limitations and chronic diseases. Skin problems are highly prevalent in elderly populations. Aim of this study was to investigate possible associations between health, functional and cutaneous variables in aged long-term care residents. Methods This observational, cross-sectional, descriptive prevalence study was conducted in a random sample of 10 institutional long-term care facilities in Berlin. In total, n = 223 residents were included. Demographic and functional characteristics, xerosis cutis, incontinence associated dermatitis, pressure ulcers and skin tears were assessed. Stratum corneum hydration, transepidermal water loss, skin surface pH and skin temperature were measured. Data analysis was descriptive and explorative. To explore possible bivariate associations, a correlation matrix was created. The correlation matrix was also used to detect possible collinearity in the subsequent regression analyses. Results Mean age (n = 223 was 83.6 years, 67.7% were female. Most residents were affected by xerosis cutis (99.1%; 95% CI: 97.7% - 100.0%. The prevalence of pressure ulcers was 9.0% (95% CI: 5.0% - 13.0%, of incontinence associated dermatitis 35.4% (95% CI: 29.9% - 42.2% and of skin tears 6.3% (95% CI: 3.2% - 9.5%. Biophysical skin parameters were not associated with overall care dependency, but with age and skin dryness. In general, skin dryness and measured skin barrier parameters were associated between arms and legs indicating similar overall skin characteristics of the residents. Conclusion Prevalence of xerosis cutis, pressure ulcers and skin tears were high, indicating the load of these adverse skin conditions in this population. Only few associations of demographic characteristics, skin barrier impairments and the occurrence of dry skin, pressure ulcers, skin tears and incontinence-associated dermatitis
Hahnel, Elisabeth; Blume-Peytavi, Ulrike; Trojahn, Carina; Kottner, Jan
2017-11-13
Geriatric patients are affected by a range of skin conditions and dermatological diseases, functional limitations and chronic diseases. Skin problems are highly prevalent in elderly populations. Aim of this study was to investigate possible associations between health, functional and cutaneous variables in aged long-term care residents. This observational, cross-sectional, descriptive prevalence study was conducted in a random sample of 10 institutional long-term care facilities in Berlin. In total, n = 223 residents were included. Demographic and functional characteristics, xerosis cutis, incontinence associated dermatitis, pressure ulcers and skin tears were assessed. Stratum corneum hydration, transepidermal water loss, skin surface pH and skin temperature were measured. Data analysis was descriptive and explorative. To explore possible bivariate associations, a correlation matrix was created. The correlation matrix was also used to detect possible collinearity in the subsequent regression analyses. Mean age (n = 223) was 83.6 years, 67.7% were female. Most residents were affected by xerosis cutis (99.1%; 95% CI: 97.7% - 100.0%). The prevalence of pressure ulcers was 9.0% (95% CI: 5.0% - 13.0%), of incontinence associated dermatitis 35.4% (95% CI: 29.9% - 42.2%) and of skin tears 6.3% (95% CI: 3.2% - 9.5%). Biophysical skin parameters were not associated with overall care dependency, but with age and skin dryness. In general, skin dryness and measured skin barrier parameters were associated between arms and legs indicating similar overall skin characteristics of the residents. Prevalence of xerosis cutis, pressure ulcers and skin tears were high, indicating the load of these adverse skin conditions in this population. Only few associations of demographic characteristics, skin barrier impairments and the occurrence of dry skin, pressure ulcers, skin tears and incontinence-associated dermatitis have been detected, that might limit the diagnostic value of skin
Natural Oils for Skin-Barrier Repair: Ancient Compounds Now Backed by Modern Science.
Vaughn, Alexandra R; Clark, Ashley K; Sivamani, Raja K; Shi, Vivian Y
2018-02-01
Natural plant oils are commonly used as topical therapy worldwide. They are usually easily accessible and are relatively inexpensive options for skin care. Many natural oils possess specific compounds with antimicrobial, antioxidant, anti-inflammatory, and anti-itch properties, making them attractive alternative and complementary treatments for xerotic and inflammatory dermatoses associated with skin-barrier disruption. Unique characteristics of various oils are important when considering their use for topical skin care. Differing ratios of essential fatty acids are major determinants of the barrier repair benefits of natural oils. Oils with a higher linoleic acid to oleic acid ratio have better barrier repair potential, whereas oils with higher amounts of irritating oleic acid may be detrimental to skin-barrier function. Various extraction methods for oils exist, including cold pressing to make unrefined oils, heat and chemical distillation to make essential oils, and the addition of various chemicals to simulate a specific scent to make fragranced oils. The method of oil processing and refinement is an important component of selecting oil for skin care, and cold pressing is the preferred method of oil extraction as the heat- and chemical-free process preserves beneficial lipids and limits irritating byproducts. This review summarizes evidence on utility of natural plant-based oils in dermatology, particularly in repairing the natural skin-barrier function, with the focus on natural oils, including Olea europaea (olive oil), Helianthus annus (sunflower seed oil), Cocos nucifera (coconut oil), Simmondsia chinesis (jojoba oil), Avena sativa (oat oil), and Argania spinosa (argan oil).
Skin barrier properties in patients with recessive X-linked ichthyosis
DEFF Research Database (Denmark)
Johansen, J D; Ramsing, D; Vejlsgaard, G
1995-01-01
Patients with X-linked recessive ichthyosis (RXLI) were studied as a model of the effect of disturbed epidermal lipid composition on skin barrier function. Thirteen patients with RXLI and 15 age- and sex-matched controls were patch-tested with sodium lauryl sulphate (SLS) 0.5% for 24 h. Basal skin...
Singh, J; Gross, M; Sage, B; Davis, H T; Maibach, H I
2000-08-01
The effect of saline iontophoresis on skin barrier function and irritation was investigated in four ethnic groups (Caucasians, Hispanics, Blacks and Asians). Forty healthy human volunteers were recruited according to specific entry criteria. Ten subjects, five males and five females, were assigned to each ethnic group. Skin barrier function was examined after 4 hours of saline iontophoresis at a current density of 0.2 mA/cm(2) on a 6.5 cm(2) area in terms of the measured responses: transepidermal water loss (TEWL), skin capacitance, skin temperature and visual scores. There were significant differences in TEWL among the ethnic groups prior to patch application. TEWL at baseline in ethnic groups was in the rank order: Caucasian>Asian>Hispanic>Black. Iontophoresis was generally well tolerated, and skin barrier function was not irreversibly affected by iontophoresis in any group. There was no significant skin temperature change, compared to baseline, in any ethnic groups at any observation point. Edema was not observed. At patch removal, the erythema score was elevated in comparison to baseline in all ethnic groups; erythema resolved within 24 hours. Thus, saline iontophoresis produced reversible changes in skin barrier function and irritation in healthy human subjects.
Effects of industrial detergents on the barrier function of human skin
DEFF Research Database (Denmark)
Nielsen, G D; Nielsen, Jesper Bo; Andersen, Klaus Ejner
2000-01-01
Detergents are involved in the causation of contact dermatitis and in promoting percutaneous absorption of toxic chemicals, but limited information is available to allow an assessment of their relative effects on the skin barrier function. The effect of detergents on skin permeability to water...
Walker, Matthew T; Green, Jeremy E; Ferrie, Ryan P; Queener, Ashley M; Kaplan, Mark H; Cook-Mills, Joan M
2018-02-15
Mechanisms for the development of food allergy in neonates are unknown but clearly linked in patient populations to a genetic predisposition to skin barrier defects. Whether skin barrier defects contribute functionally to development of food allergy is unknown. The purpose of the study was to determine whether skin barrier mutations, which are primarily heterozygous in patient populations, contribute to the development of food allergy. Mice heterozygous for the filaggrin (Flg) ft and Tmem79 ma mutations were skin sensitized with environmental and food allergens. After sensitization, mice received oral challenge with food allergen, and then inflammation, inflammatory mediators, and anaphylaxis were measured. We define development of inflammation, inflammatory mediators, and food allergen-induced anaphylaxis in neonatal mice with skin barrier mutations after brief concurrent cutaneous exposure to food and environmental allergens. Moreover, neonates of allergic mothers have increased responses to suboptimal sensitization with food allergens. Importantly, responses to food allergens by these neonatal mice were dependent on genetic defects in skin barrier function and on exposure to environmental allergens. ST2 blockade during skin sensitization inhibited the development of anaphylaxis, antigen-specific IgE, and inflammatory mediators. Neonatal anaphylactic responses and antigen-specific IgE were also inhibited by oral pre-exposure to food allergen, but interestingly, this was blunted by concurrent pre-exposure of the skin to environmental allergen. These studies uncover mechanisms for food allergy sensitization and anaphylaxis in neonatal mice that are consistent with features of human early-life exposures and genetics in patients with clinical food allergy and demonstrate that changes in barrier function drive development of anaphylaxis to food allergen. Copyright © 2018 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.
Coal tar induces AHR-dependent skin barrier repair in atopic dermatitis
Bogaard, E.H. van den; Bergboer, J.G.M.; Vonk-Bergers, M.; Vlijmen-Willems, I.M. van; Hato, S.V.; Valk, P.G. van der; Schroder, J.M.; Joosten, I.; Zeeuwen, P.L.J.M.; Schalkwijk, J.
2013-01-01
Topical application of coal tar is one of the oldest therapies for atopic dermatitis (AD), a T helper 2 (Th2) lymphocyte-mediated skin disease associated with loss-of-function mutations in the skin barrier gene, filaggrin (FLG). Despite its longstanding clinical use and efficacy, the molecular
Assessment of skin barrier function in rosacea patients with a novel 1% metronidazole gel.
Draelos, Zoe D
2005-01-01
The skin of patients with rosacea is extremely sensitive and hyper-reactive to dietary, environmental, and topical factors. Accordingly, the management of rosacea involves not only choosing appropriate medication and treatment for daily skin care, but also avoiding known trigger factors. Recently, 1% metronidazole, a mainstay of topical rosacea therapy, was reformulated in a gel vehicle that contains hydrosolubilizing agents (HSA) niacinamide, beta cyclodextrin, and a low concentration of propylene glycol. It is designed to solubilize greater concentrations of metronidazole than is possible in water alone while reducing the potential for irritation and barrier disruption. A 2-week study was undertaken by the author to evaluate the effect of the new 1% metronidazole gel on the skin barrier in 25 women with mild to moderate rosacea. Statistically significant improvement in disease severity, erythema, desquamation, and skin irritation was noted by the investigator by the end of week 1, which continued throughout the study. After 2 weeks, subjects noted improvements in skin condition and rosacea. Results of noninvasive assessments showed no disruption of the skin barrier. Furthermore, there was an increasing trend in skin hydration that approached statistical significance.
Song, Ji Youn; Kang, Hyun A; Kim, Mi-Yeon; Park, Young Min; Kim, Hyung Ok
2004-03-01
Superficial chemical peeling and microdermabrasion have become increasingly popular methods for producing facial rejuvenation. However, there are few studies reporting the skin barrier function changes after these procedures. To evaluate objectively the degree of damage visually and the time needed for the skin barrier function to recover after glycolic acid peeling and aluminum oxide crystal microdermabrasion using noninvasive bioengineering methods. Superficial chemical peeling using 30%, 50%, and 70% glycolic acid and aluminum oxide crystal microdermabrasion were used on the volar forearm of 13 healthy women. The skin response was measured by a visual observation and using an evaporimeter, corneometer, and colorimeter before and after peeling at set time intervals. Both glycolic acid peeling and aluminum oxide crystal microdermabrasion induced significant damage to the skin barrier function immediately after the procedure, and the degree of damage was less severe after the aluminum oxide crystal microdermabrasion compared with glycolic acid peeling. The damaged skin barrier function had recovered within 24 hours after both procedures. The degree of erythema induction was less severe after the aluminum oxide crystal microdermabrasion compared with the glycolic acid peeling procedure. The degree of erythema induced after the glycolic acid peeling procedure was not proportional to the peeling solution concentration used. The erythema subsided within 1 day after the aluminum oxide crystal microdermabrasion procedure and within 4 days after the glycolic acid peeling procedure. These results suggest that the skin barrier function is damaged after the glycolic acid peeling and aluminum oxide crystal microdermabrasion procedure but recovers within 1 to 4 days. Therefore, repeating the superficial peeling procedure at 2-week intervals will allow sufficient time for the damaged skin to recover its barrier function.
Milne, Catherine T; Saucier, Darlene; Trevellini, Chenel; Smith, Juliet
2011-01-01
Peristomal skin alterations under ostomy barrier wafers are a commonly reported problem. While a number of interventions to manage this issue have been reported, the use of a topically applied cyanoacrylate has received little attention. This case series describes the use of a topical cyanoacrylate for the management of peristomal skin alterations in persons living with an ostomy. Using a convenience sample, the topical cyanoacrylate dressing was applied to 11 patients with peristomal skin disruption under ostomy wafers in acute care and outpatient settings. The causes of barrier function interruption were also addressed to enhance outcomes. Patients were assessed for wound discomfort using a Likert Scale, time to healing, and number of appliance changes. Patient satisfaction was also examined. Average reported discomfort levels were 9.5 out of 10 at the initial peristomal irritation assessment visit decreased to 3.5 at the first wafer change and were absent by the second wafer change. Wafers had increasing wear time between changes in both settings with acute care patients responding faster. Epidermal resurfacing occurred within 10.2 days in outpatients and within 7 days in acute care patients. Because of the skin sealant action of this dressing, immediate adherence of the wafer was reported at all pouch changes.
Lewis, E E L; Barrett, M R T; Freeman-Parry, L; Bojar, R A; Clench, M R
2018-04-01
Examination of the skin barrier repair/wound healing process using a living skin equivalent (LSE) model and matrix-assisted laser desorption/ionization-mass spectrometry imaging (MALDI-MSI) to identify lipids directly involved as potential biomarkers. These biomarkers may be used to determine whether an in vivo wound is going to heal for example if infected. An in vitro LSE model was wounded with a scalpel blade and assessed at day 4 post-wounding by histology and MALDI-MSI. Samples were sectioned at wound site and were either formalin-fixed paraffin-embedded (FFPE) for histology or snapped frozen (FF) for MSI analysis. The combination of using an in vitro wounded skin model with MSI allowed the identification of lipids involved in the skin barrier repair/wound healing process. The technique was able to highlight lipids directly in the wound site and distinguish differences in lipid distribution between the epidermis and wound site. This novel method of coupling an in vitro LSE with MSI allowed in-depth molecular analysis of the skin barrier repair/wound healing process. The technique allowed the identification of lipids directly involved in the skin barrier repair/wound healing process, indicating these biomarkers may be potentially be used within the clinic. These biomarkers will help to determine, which stage of the skin barrier repair/wound healing process the wound is in to provide the best treatment. © 2018 Society of Cosmetic Scientists and the Société Française de Cosmétologie.
DaSilva, Sonia C; Sahu, Ravi P; Konger, Raymond L; Perkins, Susan M; Kaplan, Mark H; Travers, Jeffrey B
2012-01-01
Atopic dermatitis (AD) is a pruritic, chronic inflammatory skin disease that affects 10-20% of children and 1-3% of adults worldwide. Recent studies have indicated that the ability of Th2 cytokines, such as interleukin-4 (IL-4) to regulate skin barrier function may be a predisposing factor for AD development. The present studies examined the ability of increased Th2 activity to affect cutaneous barrier function in vivo and epidermal thickening. Mice that express a constitutively active Signal Transducer and Activator of Transcription 6 (STAT6VT) have increased Th2 cells and a predisposition to allergic inflammation were used in these studies, they demonstrate that topical treatment with the irritant sodium lauryl sulfate (SLS) caused increased transepidermal water loss and epidermal thickening in STAT6VT mice over similarly treated wild-type mice. The proliferation marker Ki-67 was increased in the epidermis of STAT6VT compared to the wild-type mice. However, these differences do not appear to be linked to the addition of an irritant as control-treated STAT6VT skin also exhibited elevated Ki-67 levels, suggesting that the increased epidermal thickness in SLS-treated STAT6VT mice is primarily driven by epidermal cell hypertrophy rather than an increase in cellular proliferation. Our results suggest that an environment with increased Th2 cytokines results in abnormal responses to topical irritants.
Controlling the hydration of the skin though the application of occluding barrier creams.
Sparr, Emma; Millecamps, Danielle; Isoir, Muriel; Burnier, Véronique; Larsson, Åsa; Cabane, Bernard
2013-03-06
The skin is a barrier membrane that separates environments with profoundly different water contents. The barrier properties are assured by the outer layer of the skin, the stratum corneum (SC), which controls the transepidermal water loss. The SC acts as a responding membrane, since its hydration and permeability vary with the boundary condition, which is the activity of water at the outer surface of the skin. We show how this boundary condition can be changed by the application of a barrier cream that makes a film with a high resistance to the transport of water. We present a quantitative model that predicts hydration and water transport in SC that is covered by such a film. We also develop an experimental method for measuring the specific resistance to water transport of films made of occluding barrier creams. Finally, we combine the theoretical model with the measured properties of the barrier creams to predict how a film of cream changes the activity of water at the outer surface of the SC. Using the known variations of SC permeability and hydration with the water activity in its environment (i.e. the relative humidity), we can thus predict how a film of barrier cream changes SC hydration.
Effect of synthetic vernix biofilms on barrier recovery of damaged mouse skin.
Oudshoorn, Marion H M; Rissmann, Robert; van der Coelen, Dennis; Hennink, Wim E; Ponec, Maria; Bouwstra, Joke A
2009-08-01
The aim of this work was to investigate whether topical application of synthetic biofilms supports and accelerates the recovery of the murine skin barrier, disrupted by sequential tape stripping. Therefore, various biofilms were applied topically on disrupted mouse skin to determine which formulation could improve barrier function, as was observed previously for the natural biofilm vernix caseosa (VC). The biofilms [i.e. particles (synthetic corneocytes) embedded in a synthetic lipid matrix] mimic closely the physicochemical properties and structure of VC. Various formulations were prepared using different particle:lipid ratios, particles with different initial water content and uncoated or lipid-coated particles. It was observed that application of all tested formulations improved the skin barrier recovery rate and reduced crust formation and epidermal hyperproliferation. However, only one of the biofilms [i.e. B1; composed of uncoated particles with 50% (w/w) initial water content and particle:lipid ratio of 2:1] mimicked the effects of native VC most closely. This indicates the importance of the presence of individual components, i.e. barrier lipids and water, as well as the ratio of these components. Consequently, these observations suggest the potential use of this biofilm treatment clinically.
Effect of synthetic vernix biofilms on barrier recovery of damaged mouse skin
Oudshoorn, M.H.M.; Rissmann, R.; van der Coelen, D.; Hennink, W.E.; Ponec, M.; Bouwstra, J.A.
2009-01-01
The aim of this work was to investigate whether topical application of synthetic biofilms supports and accelerates the recovery of the murine skin barrier, disrupted by sequential tape stripping. Therefore, various biofilms were applied topically on disrupted mouse skin to determine which
Commonly Employed African Neonatal Skin Care Products Compromise Epidermal Function in Mice.
Man, Mao-Qiang; Sun, Richard; Man, George; Lee, Dale; Hill, Zelee; Elias, Peter M
2016-09-01
Neonatal mortality is much higher in the developing world than in developed countries. Infections are a major cause of neonatal death, particularly in preterm infants, in whom defective epidermal permeability barrier function facilitates transcutaneous pathogen invasion. The objective was to determine whether neonatal skin care products commonly used in Africa benefit or compromise epidermal functions in murine skin. After twice-daily treatment of 6- to 8-week-old hairless mice with each skin care product for 3 days, epidermal permeability barrier function, skin surface pH, stratum corneum hydration, and barrier recovery were measured using a multiprobe adapter system physiology monitor. For products showing some benefits in these initial tests, the epidermal permeability barrier homeostasis was assessed 1 and 5 hours after a single application to acutely disrupted skin. All of the skin care products compromised basal permeability barrier function and barrier repair kinetics. Moreover, after 3 days of treatment, most of the products also reduced stratum corneum hydration while elevating skin surface pH to abnormal levels. Some neonatal skin care products that are widely used in Africa perturb important epidermal functions, including permeability barrier homeostasis in mice. Should these products have similar effects on newborn human skin, they could cause a defective epidermal permeability barrier, which can increase body fluid loss, impair thermoregulation, and contribute to the high rates of neonatal morbidity and mortality seen in Africa. Accordingly, alternative products that enhance permeability barrier function should be identified, particularly for use in preterm infants. © 2016 Wiley Periodicals, Inc.
Skin Barrier Restoration and Moisturization Using Horse Oil-Loaded Dissolving Microneedle Patches.
Lee, Chisong; Eom, Younghyon Andrew; Yang, Huisuk; Jang, Mingyu; Jung, Sang Uk; Park, Ye Oak; Lee, Si Eun; Jung, Hyungil
2018-01-01
Horse oil (HO) has skin barrier restoration and skin-moisturizing effects. Although cream formulations have been used widely and safely, their limited penetration through the stratum corneum is a major obstacle to maximizing the cosmetic efficacy of HO. Therefore, we aimed to encapsulate HO in a cosmetic dissolving microneedle (DMN) for efficient transdermal delivery. To overcome these limitations of skin permeation, HO-loaded DMN (HO-DMN) patches were developed and evaluated for their efficacy and safety using in vitro and clinical studies. Despite the lipophilic nature of HO, the HO-DMN patches had a sharp shape and uniform array, with an average length and tip diameter of 388.36 ± 16.73 and 38.54 ± 5.29 µm, respectively. The mechanical strength of the HO-DMN patches was sufficient (fracture force of 0.29 ± 0.01 N), and they could successfully penetrate pig skin. During the 4-week clinical evaluation, HO-DMN patches caused significant improvements in skin and dermal density, skin elasticity, and moisturization. Additionally, a brief safety assessment showed that the HO-DMN patches induced negligible adverse events. The HO-DMNs are efficient, safe, and convenient for wide use in cosmetic applications for skin barrier restoration and moisturization. © 2018 S. Karger AG, Basel.
Barreira cutânea na dermatite atópica Skin barrier in atopic dermatitis
Directory of Open Access Journals (Sweden)
Flavia Alvim Sant'Anna Addor
2010-04-01
dynamically with the underlying epidermal layers. The skin barrier also plays a role in the inflammatory response through melanocyte activation, angiogenesis, and fibroplasia. The intensity of this response will essentially depend on the severity of the injury. Skin barrier abnormalities in atopic dermatitis are clinically observed by the presence of dry skin, a common and significant symptom which constitutes a diagnostic and monitoring parameter. The stratum corneum hydration level and transepidermal water loss are associated with the level of damage to the barrier, representing biophysical parameters. These parameters help doctors monitor patients in a less invasive and more sensitive manner.
den Otter, Wouter K.; Notman, R.; Anwar, J.; Noro, M.G.; Briels, Willem J.
2008-01-01
The dense lipid bilayers at the outer surface of the skin represent the primary barrier to molecules penetrating the human skin. One approach to overcome this barrier, with promising applications in administering medicinal drugs to the body, is to employ chemical permeability enhancers. How these
Skin barrier homeostasis in atopic dermatitis: feedback regulation of kallikrein activity.
Directory of Open Access Journals (Sweden)
Reiko J Tanaka
Full Text Available Atopic dermatitis (AD is a widely spread cutaneous chronic disease characterised by sensitive reactions (eg. eczema to normally innocuous elements. Although relatively little is understood about its underlying mechanisms due to its complexity, skin barrier dysfunction has been recognised as a key factor in the development of AD. Skin barrier homeostasis requires tight control of the activity of proteases, called kallikreins (KLKs, whose activity is regulated by a complex network of protein interactions that remains poorly understood despite its pathological importance. Characteristic symptoms of AD include the outbreak of inflammation triggered by external (eg. mechanical and chemical stimulus and the persistence and aggravation of inflammation even if the initial stimulus disappears. These characteristic symptoms, together with some experimental data, suggest the presence of positive feedback regulation for KLK activity by inflammatory signals. We developed simple mathematical models for the KLK activation system to study the effects of feedback loops and carried out bifurcation analysis to investigate the model behaviours corresponding to inflammation caused by external stimulus. The model analysis confirmed that the hypothesised core model mechanisms capture the essence of inflammation outbreak by a defective skin barrier. Our models predicted the outbreaks of inflammation at weaker stimulus and its longer persistence in AD patients compared to healthy control. We also proposed a novel quantitative indicator for inflammation level by applying principal component analysis to microarray data. The model analysis reproduced qualitative AD characteristics revealed by this indicator. Our results strongly implicate the presence and importance of feedback mechanisms in KLK activity regulation. We further proposed future experiments that may provide informative data to enhance the system-level understanding on the regulatory mechanisms of skin barrier
Skin barrier properties in patients with recessive X-linked ichthyosis
DEFF Research Database (Denmark)
Johansen, J D; Ramsing, D; Vejlsgaard, G
1995-01-01
increased in controls compared to ichthyosis patients, when evaluated by TEWL. When evaluated by erythema index a statistically significant increase in redness was found in controls, but not in ichthyosis patients. Electrical capacitance, reflecting skin hydration, was significantly reduced in RXLI patients......Patients with X-linked recessive ichthyosis (RXLI) were studied as a model of the effect of disturbed epidermal lipid composition on skin barrier function. Thirteen patients with RXLI and 15 age- and sex-matched controls were patch-tested with sodium lauryl sulphate (SLS) 0.5% for 24 h. Basal skin...... properties and skin response to SLS were studied by measurement of transepidermal water loss (TEWL), electrical capacitance and erythema index. No statistically significant difference in basal TEWL was found between the two groups. The skin response to SLS was found to be statistically significantly...
Directory of Open Access Journals (Sweden)
Zanardo V
2017-08-01
Full Text Available Vincenzo Zanardo,1 David Giarrizzo,2 Francesca Volpe,1 Lara Giliberti,1 Gianluca Straface1 1Division of Perinatal Medicine, Policlinico Abano Terme, Abano Terme, 2CALANTHA Physiology of Lactation Laboratory, Padua, Italy Abstract: Both appropriate hydration and skin surface pH are fundamental in preventing baby skin barrier damage during transition from intrauterine to extrauterine life. However, effects of topical moisturizers on neonatal stratum corneum temperature, pH, hydration, and elasticity have not been scientifically evaluated in vivo. We checked 31 full-term breastfeeding neonates by non-invasive bioengineering method, which is able to evaluate the basal skin barrier (left heel, and assessed at 6±1 hours after birth, and at 1 and 24 hours after emu oil-based topical treatment. The basal skin barrier of right heel (no oil exposure of each newborn was considered as control. We found that a single application of an emu oil-based lotion was effective in improving heel stratum corneum hydration, which increases both skin pH and elasticity without any effect on temperature. Further studies are needed to confirm long-term beneficial effects of this treatment in a very sensitive patient population. Keywords: skin barrier, neonate, emu oil-based lotion, topical treatment
Oji, Vinzenz; Eckl, Katja-Martina; Aufenvenne, Karin; Nätebus, Marc; Tarinski, Tatjana; Ackermann, Katharina; Seller, Natalia; Metze, Dieter; Nürnberg, Gudrun; Fölster-Holst, Regina; Schäfer-Korting, Monika; Hausser, Ingrid; Traupe, Heiko; Hennies, Hans Christian
2010-08-13
Generalized peeling skin disease is an autosomal-recessive ichthyosiform erythroderma characterized by lifelong patchy peeling of the skin. After genome-wide linkage analysis, we have identified a homozygous nonsense mutation in CDSN in a large consanguineous family with generalized peeling skin, pruritus, and food allergies, which leads to a complete loss of corneodesmosin. In contrast to hypotrichosis simplex, which can be associated with specific dominant CDSN mutations, peeling skin disease is characterized by a complete loss of CDSN expression. The skin phenotype is consistent with a recent murine Cdsn knockout model. Using three-dimensional human skin models, we demonstrate that lack of corneodesmosin causes an epidermal barrier defect supposed to account for the predisposition to atopic diseases, and we confirm the role of corneodesmosin as a decisive epidermal adhesion molecule. Therefore, peeling skin disease will represent a new model disorder for atopic diseases, similarly to Netherton syndrome and ichthyosis vulgaris in the recent past.
Kanti, Varvara; Günther, Malise; Stroux, Andrea; Sawatzky, Sabine; Henrich, Wolfgang; Abou-Dakn, Michael; Blume-Peytavi, Ulrike; Garcia Bartels, Natalie
2017-12-01
Skin care influences skin barrier function during the first postnatal weeks. Although the use of natural oils in preterms has been investigated, there are currently no data comparing the effect of sunflower oil to an emollient on barrier development in healthy term newborns. In a prospective, randomized clinical study, 50 healthy full-term newborns aged ≤72 h were randomly assigned to two groups: group baby lotion (L, n=22) and sunflower seed oil (SSO, n=24). The skin barrier function was evaluated in three anatomical areas (front, abdomen, and thigh) by noninvasive assessment of transepidermal water loss (TEWL), stratum corneum hydration (SCH), sebum, and skin pH at inclusion and after five weeks. In both groups, skin pH decreased and SCH increased statistically significantly in all measured areas at W5 compared to baseline. TEWL decreased statistically significantly on the forearm in both groups, on the upper leg in group L, and on the abdomen in group SSO. Both skin care regimes did not harm skin barrier function adaptation in healthy term neonates during the first five weeks of life. © 2017 Wiley Periodicals, Inc.
DEFF Research Database (Denmark)
Jungersted, J.M.; Høgh, Julie Kaae; Hellgren, Lars
2010-01-01
been damaged by either sodium lauryl sulfate (SLS) or tape stripping, respectively, was determined and compared with that of to non-occluded pre-damaged skin. Skin barrier function was assessed by measurements of trans-epidermal water loss (TEWL) and erythema. In study A, stratum corneum lipids were...
Stratum corneum lipids, skin barrier function and filaggrin mutations in patients with atopic eczema
DEFF Research Database (Denmark)
Høgh, Julie Kaae; Hellgren, Lars; Jungersted, JM
2010-01-01
chromatography. In addition, TEWL, erythema, skin hydration and pH were measured. In 27 of the 49 individuals, a 24-h irritation patch test with sodium lauryl sulphate was performed. For the analysis, both the AD group and the control group were stratified by FLG mutation status (FLGmut/FLGwt). Results......Background: Prior to the discovery of filaggrin (FLG) mutations, evidence for an impaired skin barrier in atopic dermatitis (AD) has been documented, and changes in ceramide profile, altered skin pH and increased trans-epidermal water loss (TEWL) in patients with AD have been reported. Until now......, no studies have analysed stratum corneum (SC) lipids combined with skin barrier parameters in subjects of known FLG genotype. Methods: A cohort of 49 German individuals genotyped for the most common FLG mutations (R501X, 2282del4) had SC samples taken for lipid analysis by high-performance thin layer...
Thiolated silicone oils as adhesive skin protectants for improved barrier function.
Partenhauser, A; Zupančič, O; Rohrer, J; Bonengel, S; Bernkop-Schnürch, A
2016-06-01
The purpose of this study was the evaluation of thiolated silicone oil as novel skin protectant exhibiting prolonged residence time, enhanced barrier function and reinforced occlusivity. Two silicone conjugates were synthesized with mercaptopropionic acid (MPA) and thioglycolic acid (TGA) as thiol ligands. Adhesion, protection against artificial urine and water vapour permeability with both a Payne cup set-up and transepidermal water loss (TEWL) measurements on porcine skin were assessed. Silicone thiomers showed pronounced substantivity on skin with 22.1 ± 6.3% and 39.2 ± 6.7% remaining silicone after 8 h for silicone-TGA and silicone-MPA, respectively, whereas unmodified silicone oil and dimethicone were no longer detectable. In particular, silicone-MPA provided a protective shield against artificial urine penetration with less than 25% leakage within 6 h. An up to 2.5-fold improved water vapour impermeability for silicone-MPA in comparison with unmodified control was discovered with the Payne cup model. In addition, for silicone-MPA a reduced TEWL by two-thirds corresponding to non-thiolated control was determined for up to 8 h. Thiolation of silicone oil leads to enhanced skin adhesiveness and barrier function, which is a major advantage compared to commonly used silicones and might thus be a promising treatment modality for various topical applications. © 2015 Society of Cosmetic Scientists and the Société Française de Cosmétologie.
Ion microbeam analysis. Application to the study of the skin barrier and its nano-toxicology
International Nuclear Information System (INIS)
Simon, M.
2009-12-01
This work is dedicated to the use of ion microbeam irradiation to the study of a complex biological tissue like skin. Up to now, it has been very difficult to detect and track metallic oxides and manufactured nano-particles in biological tissues, most particularly in skin. Thus, it is essential to precise the mechanisms involved in skin barrier function processes face to exogenous agents like nano-particles and to characterize them in biological models in vitro/in vivo. During my work, I have had the opportunity to combine quantitative methods of analysis with high resolution imagery techniques (confocal microscopy, transmission electron microscopy and ion beam analysis) in order to characterize: (i) the skin barrier function of an ex vivo pig ear skin model understanding the ion homeostasis behavior face to different chemical or physical stresses; (ii) the impact on viability, accumulation and intracellular distribution of nano-particles (Titanium Oxides) naked or functionalized with fluorescent dyes (FITC, Rhodamine)
Chaudhuri, R K; Bojanowski, K
2017-10-01
The study involved the synthesis of a novel derivative of caprylic acid - isosorbide dicaprylate (IDC) - and the evaluation of its potential in improving water homoeostasis and epidermal barrier function in human skin. The effect of IDC on gene expression was assayed in skin organotypic cultures by DNA microarrays. The results were then confirmed for a few key genes by quantitative PCR, immuno- and cytochemistry. Final validation of skin hydration properties was obtained by four separate clinical studies. Level of hydration was measured by corneometer either by using 2% IDC lotion alone vs placebo or in combination with 2% glycerol lotion vs 2% glycerol only. A direct comparison in skin hydration between 2% IDC and 2% glycerol lotions was also carried out. The epidermal barrier function improvement was assessed by determining changes in transepidermal water loss (TEWL) on the arms before and after treatment with 2% IDC lotion versus placebo. IDC was found to upregulate the expression of AQP3, CD44 and proteins involved in keratinocyte differentiation as well as the formation and function of stratum corneum. A direct comparison between 2% IDC versus 2% glycerol lotions revealed a three-fold advantage of IDC in providing skin hydration. Severely dry skin treated with 2% IDC in combination with 2% glycerol showed 133% improvement, whereas 35% improvement was observed with moderately dry human skin. Topical isosorbide dicaprylate favourably modulates genes involved in the maintenance of skin structure and function, resulting in superior clinical outcomes. By improving skin hydration and epidermal permeability barrier, it offers therapeutic applications in skin ageing. © 2017 Society of Cosmetic Scientists and the Société Française de Cosmétologie.
Yokoyama, Satoshi; Hiramoto, Keiichi; Koyama, Mayu; Ooi, Kazuya
2016-09-01
Alcohol is frequently used to induce chronic liver injury in laboratory animals. Alcohol causes oxidative stress in the liver and increases the expression of inflammatory mediators that cause hepatocellular damage. However, during chronic liver injury, it is unclear if/how these liver-derived factors affect distal tissues, such as the skin. The purpose of this study was to evaluate skin barrier function during chronic liver injury. Hairless mice were administered 5% or 10% ethanol for 8 weeks, and damages to the liver and skin were assessed using histological and protein-analysis methods, as well as by detecting inflammatory mediators in the plasma. After alcohol administration, the plasma concentration of the aspartate and alanine aminotransferases increased, while albumin levels decreased. In mice with alcohol-induced liver injury, transepidermal water loss was significantly increased, and skin hydration decreased concurrent with ceramide and type I collagen degradation. The plasma concentrations of [Formula: see text]/[Formula: see text] and tumor necrosis factor-alpha (TNF-α) were significantly increased in mice with induced liver injury. TNF receptor (TNFR) 2 expression was upregulated in the skin of alcohol-administered mice, while TNFR1 levels remained constant. Interestingly, the impairment of skin barrier function in mice administered with 10% ethanol was ameliorated by administering an anti-TNF-α antibody. We propose a novel mechanism whereby plasma TNF-α, via TNFR2 alone or with TNFR1, plays an important role in skin barrier function during chronic liver disease in these mouse models.
Kubota, Takahiro
2012-06-01
Skin roughness is a term commonly used in Japan to describe a poor skin condition related to a rough and dry skin surface that develops as a result of various damaging effects from the environment or skin inflammation. Recovery from skin roughness requires skin care for a long period, thus it is important to prevent development of such skin changes. PROTECT X2 contains agents used for a protective covering of the skin from frequent hand washing or use of alcohol-based disinfectants. These unique components are also thought to be effective to treat skin roughness of the dorsa of the hands and heels. In the present study, we evaluated the effectiveness of PROTECT X2 to increase skin surface hydration state, as well as enhance the barrier function of the stratum corneum of the dorsa of the hands and heels in elderly individuals. A total of 8 elderly subjects and their caretakers without any skin diseases participated in the study. They applied PROTECT X2 by themselves to the dorsum area of 1 hand and heel 3 to 5 times daily for 1 month, while the opposite sides were left untreated. We measured stratum corneum (SC) hydration and transepidermal water loss (TEWL) before beginning treatment, then 1 week and 1 month after the start of treatment to compare between the treated and untreated skin. SC hydration state after applications of PROTECT X2 was 1.5- to 3.0-fold higher than that of the untreated skin in the dorsa of both hands and heels, indicating that the moisturizing ingredients accompanied by water were replenished in those areas where the cream was applied. Also, TEWL in the dorsum of the hands was 17.0-27.9% lower on the treated side, indicating improvement in SC barrier function. On the basis of these findings, we concluded that PROTECT X2 enhances water-holding in the SC and aids the barrier function of the skin in the dorsum of the hands. In addition, we consider that this formulation is useful for not only protecting the hands from the effects of such agents
Prescott, Susan L; Larcombe, Danica-Lea; Logan, Alan C; West, Christina; Burks, Wesley; Caraballo, Luis; Levin, Michael; Etten, Eddie Van; Horwitz, Pierre; Kozyrskyj, Anita; Campbell, Dianne E
2017-01-01
Skin barrier structure and function is essential to human health. Hitherto unrecognized functions of epidermal keratinocytes show that the skin plays an important role in adapting whole-body physiology to changing environments, including the capacity to produce a wide variety of hormones, neurotransmitters and cytokine that can potentially influence whole-body states, and quite possibly, even emotions. Skin microbiota play an integral role in the maturation and homeostatic regulation of keratinocytes and host immune networks with systemic implications. As our primary interface with the external environment, the biodiversity of skin habitats is heavily influenced by the biodiversity of the ecosystems in which we reside. Thus, factors which alter the establishment and health of the skin microbiome have the potential to predispose to not only cutaneous disease, but also other inflammatory non-communicable diseases (NCDs). Indeed, disturbances of the stratum corneum have been noted in allergic diseases (eczema and food allergy), psoriasis, rosacea, acne vulgaris and with the skin aging process. The built environment, global biodiversity losses and declining nature relatedness are contributing to erosion of diversity at a micro-ecological level, including our own microbial habitats. This emphasises the importance of ecological perspectives in overcoming the factors that drive dysbiosis and the risk of inflammatory diseases across the life course.
van Smeden, Jeroen; Bouwstra, Joke A
2016-01-01
Human skin acts as a primary barrier between the body and its environment. Crucial for this skin barrier function is the lipid matrix in the outermost layer of the skin, the stratum corneum (SC). Two of its functions are (1) to prevent excessive water loss through the epidermis and (2) to avoid that compounds from the environment permeate into the viable epidermal and dermal layers and thereby provoke an immune response. The composition of the SC lipid matrix is dominated by three lipid classes: cholesterol, free fatty acids and ceramides. These lipids adopt a highly ordered, 3-dimensional structure of stacked densely packed lipid layers (lipid lamellae): the lateral and lamellar lipid organization. The way in which these lipids are ordered depends on the composition of the lipids. One very common skin disease in which the SC lipid barrier is affected is atopic dermatitis (AD). This review addresses the SC lipid composition and organization in healthy skin, and elaborates on how these parameters are changed in lesional and nonlesional skin of AD patients. Concerning the lipid composition, the changes in the three main lipid classes and the importance of the carbon chain lengths of the lipids are discussed. In addition, this review addresses how these changes in lipid composition induce changes in lipid organization and subsequently correlate with an impaired skin barrier function in both lesional and nonlesional skin of these patients. Furthermore, the effect of filaggrin and mutations in the filaggrin gene on the SC lipid composition is critically discussed. Also, the breakdown products of filaggrin, the natural moisturizing factor molecules and its relation to SC-pH is described. Finally, the paper discusses some major changes in epidermal lipid biosynthesis in patients with AD and other related skin diseases, and how inflammation has a deteriorating effect on the SC lipids and SC biosynthesis. The review ends with perspectives on future studies in relation to
Ohno, Yusuke
2017-01-01
The primary function of the skin is to act as a permeability barrier that prevents water loss from inside the body and external invasion such as by pathogens, harmful substances, and allergens. Lipids play a critical role in skin barrier formation by forming multi-lamellar structures in the stratum corneum, the outermost cell layer of the epidermis. Ceramide, the backbone of sphingolipids, accounts for more than 50% of the stratum corneum lipids. Acylceramides are epidermis-specific ceramide species essential for skin barrier formation. Decreases in acylceramide levels and changes in ceramide composition and chain-length are associated with such cutaneous disorders as ichthyosis, atopic dermatitis, and psoriasis. Acylceramide consists of a long-chain base and an amide-linked ultra-long-chain fatty acid (ULCFA, 28-36 carbon chain), which is ω-hydroxylated and esterified with linoleic acid. Although the molecular mechanism by which acylceramide is generated has not been fully understood for decades, we recently identified two genes, CYP4F22 and PNPLA1, involved in acylceramide synthesis and elucidated the entire biosynthetic pathway of acylceramide: the synthesis of ULCFA by ELOVL1 and ELOVL4, ω-hydroxylation of the ULCFA by CYP4F22, amide-bond formation with a long-chain base by CERS3, and transacylation of linoleic acid from triacylglycerol to ω-hydroxyceramide by PNPLA1 to generate acylceramide. CYP4F22 and PNPLA1 are the causative genes of ichthyosis. We demonstrated that mutations of CYP4F22 or PNPLA1 markedly reduced acylceramide production. Our recent findings provide important insights into the molecular mechanisms of skin barrier formation and of ichthyosis pathogenesis.
Draelos, Zoe D
2006-07-01
Acne vulgaris is a common skin disorder that affects many people every year, especially the teenaged population. People with acne find the condition especially difficult to manage because of the disease's chronicity and variability in response to treatment. Acne is the result of pores clogged with shed skin cells combined with sebum in the hair follicle. Successful treatment of acne is important because acne has the potential to result in lasting physical and emotional scarring. For many years, physicians have agreed that although cleansing is not effective on its own, effective cleansing is an important part of any acne treatment regimen. However, patients have not been satisfied with the types of cleansers available. In addition to containing dyes and perfumes that can irritate and exacerbate acne, these cleansers often are too harsh and can result in excessive drying of the skin, which leads to overcompensation by the oil glands and ultimately to more oil on the surface of the skin. This study examined the use of a daily facial cleanser formulated for normal to oily skin in subjects with mild facial acne. The cleanser was studied for 2 weeks in the absence of additional treatments to eliminate the confounding effects of various treatments. Subjects were monitored for skin barrier function through transepidermal water loss (TEWL) and corneometry, sebum level, and lesion counts. The results of the study indicate that the facial cleanser is gentle and does not damage the skin barrier or result in sebum overcompensation; additionally, the cleanser is effective at deep-pore cleansing, which may help to manage some acne-associated symptoms.
Gittler, Julia K.; Krueger, James G.; Guttman-Yassky, Emma
2014-01-01
Atopic dermatitis (AD), as well as irritant contact dermatitis (ICD) and allergic contact dermatitis (ACD), are common skin diseases. These diseases are characterized by skin inflammation mediated by activated innate immunity or acquired immune mechanisms. Although AD, ICD, and ACD can be encountered in pure forms by allergists and dermatologists, patients with AD often present with increased frequency of ICD and ACD. Although a disturbed barrier alone could potentiate immune reactivity in patients with AD through increased antigen penetration, additional immune mechanisms might explain the increased susceptibility of atopic patients to ICD and ACD. This review discusses cellular pathways associated with increased skin inflammation in all 3 conditions and presents mechanisms that might contribute to the increased rate of ICD and ACD in patients with AD. PMID:22939651
Robinson, Hayley; Ravikulan, Abhimati; Nater, Urs M; Skoluda, Nadine; Jarrett, Paul; Broadbent, Elizabeth
2017-07-01
Social support is known to reduce the negative effects of stress on health, but there is mixed evidence for the effects of social support on wound healing. This study aimed to investigate whether undergoing a task designed to promote social closeness with a fellow participant and being paired with that person during a tape-stripping procedure could reduce stress and improve skin barrier recovery compared to going through tape stripping alone. Seventy-two healthy adults were randomized to either a social closeness condition where participants completed a relationship-building task and tape stripping in pairs or a control condition where they completed tape stripping alone. Skin barrier recovery was measured using transepidermal water loss. Salivary cortisol and alpha-amylase were collected at four time points as markers of the endocrine and autonomic stress response. Social closeness had a beneficial effect on skin barrier recovery compared to the control condition, t(54) = 2.86, p = .006, r = .36. Social closeness significantly reduced self-reported stress. The effects of the intervention on skin barrier recovery were moderated by self-reported stress reduction (p = .035). There were no significant differences in cortisol between groups, but alpha-amylase increased significantly more from baseline to after tape stripping in the control group compared to the intervention group. This is the first study to show that social closeness with a person going through a similar unfamiliar procedure can positively influence wound healing. Future research needs to replicate these findings in other wound types and in clinical settings. (PsycINFO Database Record (c) 2017 APA, all rights reserved).
Lee, Woan-Ruoh; Shen, Shing-Chuan; Sung, Calvin T; Liu, Pei-Ying; Fang, Jia-You
2018-04-26
Most of the investigations into laser-assisted skin permeation have used the intact skin as the permeation barrier. Whether the laser is effective in improving cutaneous delivery via barrier-defective skin is still unclear. In this study, ablative (Er:YAG) and non-ablative (Er:glass) lasers were examined for the penetration of peptide and siRNA upon topical application on in vitro skin with a healthy or disrupted barrier. An enhanced peptide flux (6.9 fold) was detected after tape stripping of the pig stratum corneum (SC). A further increase of flux to 11.7 fold was obtained after Er:YAG laser irradiation of the SC-stripped skin. However, the application of Er:glass modality did not further raise the flux via the SC-stripped skin. A similar trend was observed in the case of psoriasiform skin. Conversely, the flux was enhanced 3.7 and 2.6 fold after treatment with the Er:YAG and the Er:glass laser on the atopic dermatitis (AD)-like skin. The 3-D skin structure captured by confocal microscopy proved the distribution of peptide and siRNA through the microchannels and into the surrounding tissue. The fractional laser was valid for ameliorating macromolecule permeation into barrier-disrupted skin although the enhancement level was lower than that of normal skin.
Enhanced barrier functions and anti-inflammatory effect of cultured coconut extract on human skin.
Kim, Soomin; Jang, Ji Eun; Kim, Jihee; Lee, Young In; Lee, Dong Won; Song, Seung Yong; Lee, Ju Hee
2017-08-01
Natural plant oils have been used as a translational alternative to modern medicine. Particularly, virgin coconut oil (VCO) has gained popularity because of its potential benefits in pharmaceutical, nutritional, and cosmetic applications. Cultured coconut extract (CCE) is an alternative end product of VCO, which undergoes a further bacterial fermentation process. This study aimed to investigate the effects of CCE on human skin. We analyzed the expression of skin barrier molecules and collagens after applying CCE on human explanted skin. To evaluate the anti-inflammatory properties of CCE, the expression of inflammatory markers was analyzed after ultraviolet B (UVB) irradiation. The CCE-treated group showed increased expression of cornified cell envelope components, which contribute to protective barrier functions of the stratum corneum. Further, the expression of inflammatory markers was lower in the CCE-treated group after exposure to UVB radiation. These results suggest an anti-inflammatory effect of CCE against UVB irradiation-induced inflammation. Additionally, the CCE-treated group showed increased collagen and hyaluronan synthase-3 expression. In our study, CCE showed a barrier-enhancing effect and anti-inflammatory properties against ex vivo UVB irradiation-induced inflammation. The promising effect of CCE may be attributed to its high levels of polyphenols and fatty acid components. Copyright © 2017 Elsevier Ltd. All rights reserved.
Human Skin Barrier Structure and Function Analyzed by Cryo-EM and Molecular Dynamics Simulation.
Lundborg, Magnus; Narangifard, Ali; Wennberg, Christian L; Lindahl, Erik; Daneholt, Bertil; Norlén, Lars
2018-04-24
In the present study we have analyzed the molecular structure and function of the human skin's permeability barrier using molecular dynamics simulation validated against cryo-electron microscopy data from near native skin. The skin's barrier capacity is located to an intercellular lipid structure embedding the cells of the superficial most layer of skin - the stratum corneum. According to the splayed bilayer model (Iwai et al., 2012) the lipid structure is organized as stacked bilayers of ceramides in a splayed chain conformation with cholesterol associated with the ceramide sphingoid moiety and free fatty acids associated with the ceramide fatty acid moiety. However, knowledge about the lipid structure's detailed molecular organization, and the roles of its different lipid constituents, remains circumstantial. Starting from a molecular dynamics model based on the splayed bilayer model, we have, by stepwise structural and compositional modifications, arrived at a thermodynamically stable molecular dynamics model expressing simulated electron microscopy patterns matching original cryo-electron microscopy patterns from skin extremely closely. Strikingly, the closer the individual molecular dynamics models' lipid composition was to that reported in human stratum corneum, the better was the match between the models' simulated electron microscopy patterns and the original cryo-electron microscopy patterns. Moreover, the closest-matching model's calculated water permeability and thermotropic behaviour were found compatible with that of human skin. The new model may facilitate more advanced physics-based skin permeability predictions of drugs and toxicants. The proposed procedure for molecular dynamics based analysis of cellular cryo-electron microscopy data might be applied to other biomolecular systems. Copyright © 2018. Published by Elsevier Inc.
Cangkrama, Michael; Darido, Charbel; Georgy, Smitha R; Partridge, Darren; Auden, Alana; Srivastava, Seema; Wilanowski, Tomasz; Jane, Stephen M
2016-07-01
The skin barrier is critical for mammalian survival in the terrestrial environment, affording protection against fluid loss, microbes, toxins, and UV exposure. Many genes indispensable for barrier formation in the embryo have been identified, but loss of these genes in adult mice does not induce barrier regression. We describe a complex regulatory network centered on two ancient gene families, the grainyhead-like (Grhl) transcription factors and the protein cross-linking enzymes (tissue transglutaminases [Tgms]), which are essential for skin permeability barrier maintenance in adult mice. Embryonic deletion of Grhl3 induces loss of Tgm1 expression, which disrupts the cornified envelope, thus preventing permeability barrier formation leading to neonatal death. However, gene deletion of Grhl3 in adult mice does not disrupt the preformed barrier, with cornified envelope integrity maintained by Grhl1 and Tgm5, which are up-regulated in response to postnatal loss of Grhl3. Concomitant deletion of both Grhl factors in adult mice induced loss of Tgm1 and Tgm5 expression, perturbation of the cornified envelope, and complete permeability barrier regression that was incompatible with life. These findings define the molecular safeguards for barrier function that accompany the transition from intrauterine to terrestrial life. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Sochorov?, Michaela; Sta?kov?, Kl?ra; Pullmannov?, Petra; Kov??ik, Andrej; Zbytovsk?, Jarmila; V?vrov?, Kate?ina
2017-01-01
Ceramide (Cer) release from glucosylceramides (GlcCer) is critical for the formation of the skin permeability barrier. Changes in ?-glucocerebrosidase (GlcCer?ase) activity lead to diminished Cer, GlcCer accumulation and structural defects in SC lipid lamellae; however, the molecular basis for this impairment is not clear. We investigated impaired GlcCer-to-Cer processing in human Cer membranes to determine the physicochemical properties responsible for the barrier defects. Minor impairment (...
Lipids and skin barrier function - a clinical perspective
DEFF Research Database (Denmark)
Jungersted, J.M.; Hellgren, Lars; Jemec, G.B.E.
2008-01-01
The stratum corneum (SC) protects us from dehydration and external dangers. Much is known about the morphology of the SC and penetration of drugs through it, but the data are mainly derived from in vitro and animal experiments. In contrast, only a few studies have the human SC lipids as their focus...... and in particular, the role of barrier function in the pathogenesis of skin disease and its subsequent treatment protocols. The 3 major lipids in the SC of importance are ceramides, free fatty acids, and cholesterol. Human studies comparing levels of the major SC lipids in patients with atopic dermatitis...
Godefroy, S; Peyre, M; Garcia, N; Muller, S; Sesardic, D; Partidos, C D
2005-08-01
The high accessibility of the skin and the presence of immunocompetent cells in the epidermis makes this surface an attractive route for needle-free administration of vaccines. However, the lining of the skin by the stratum corneum is a major obstacle to vaccine delivery. In this study we examined the effect of skin barrier disruption on the immune responses to the cross-reacting material CRM(197), a nontoxic mutant of diphtheria toxin (DTx) that is considered as a vaccine candidate. Application of CRM(197), together with cholera toxin (CT), onto the tape-stripped skin of mice elicited antibody responses that had anti-DTx neutralizing activity. Vaccine delivery onto mildly ablated skin or intact skin did not elicit any detectable anti-CRM(197) antibodies. Mice immunized with CRM(197) alone onto the tape-stripped skin mounted a vigorous antigen-specific proliferative response. In contrast, the induction of cellular immunity after CRM(197) deposition onto mildly ablated or intact skin was adjuvant dependent. Furthermore, epidermal cells were activated and underwent apoptosis that was more pronounced when the stratum corneum was removed by tape stripping. Overall, these findings highlight the potential for transcutaneous delivery of CRM(197) and establish a correlation between the degree of barrier disruption and levels of antigen-specific immune responses. Moreover, these results provide the first evidence that the development of a transcutaneous immunization strategy for diphtheria, based on simple and practical methods to disrupt the skin barrier, is feasible.
Natural considerations for skin of color.
Baumann, Leslie; Rodriguez, David; Taylor, Susan C; Wu, Jessica
2006-12-01
Changing US demographics indicate that dermatologists will treat an increasing number of individuals of color. Early research on cutaneous anatomy and physiology was performed mostly in white populations. However, new research is elucidating similarities and differences in skin of color and white skin with regard to skin barrier, pigmentation, and sensitivity. Two of the most important issues are skin lightening and brightening. Products for use on skin of color typically should be gentle because of the proclivity of more deeply pigmented skin to develop pigmentary abnormalities in response to skin irritation or trauma. Increasing patient interest in natural remedies has been matched by research on the use of natural ingredients in dermatology. The relative gentleness of many of these products, coupled with excellent efficacy, makes natural ingredients such as soy and licorice excellent choices in the treatment of disorders such as postinflammatory hyperpigmentation (PIH) and melasma. For daily skin care, ingredients such as oatmeal and feverfew are good choices for gentle cleansing and moisturizing of dry, sensitive, or ashy skin. Sun protection is an increasing concern due to rising rates of melanoma. Several botanical products are useful in augmenting photoprotection with conventional sunscreens.
Nanocrystal: a novel approach to overcome skin barriers for improved topical drug delivery.
Patel, Viral; Sharma, Om Prakash; Mehta, Tejal
2018-04-01
Skin is an important route of drug delivery for the treatment of various dermatological conditions. The advent of nanotechnology is paving the roadmaps for topical drug delivery by providing sustained release as well as maintaining a localized effect, outweighing the toxicity concern. Area covered: This review highlighted the morphology of skin, its barrier nature as well as drug penetration pathways after topical application of formulations. The existing methods to improve topical drug delivery, by infringing or permeating the skin barriers, are discussed. This context concretes the foundation to accentuate the need for the development of nanocrystal-based topical formulation. The mechanism of drug release, immediate as well as sustained release, after topical administration of drug nanocrystals is also elaborated. The special emphasis is given on the breakthrough achieved, in topical drug delivery using drug nanocrystals, so far in the plethora of literature, patents, and products, under clinical trial as well as in the market. Expert opinion: The current research on nanocrystals for topical drug delivery is highlighting the breakthroughs achieved so far. The output of these research envisages that topical nanocrystals based formulations can be a novel strategy for the drugs which are facing solubility, bioavailability and toxicity concerns.
Metabolic and redox barriers in the skin exposed to drugs and xenobiotics.
Korkina, Liudmila
2016-01-01
Growing exposure of human skin to environmental and occupational hazards, to numerous skin care/beauty products, and to topical drugs led to a biomedical concern regarding sustainability of cutaneous chemical defence that is essential for protection against intoxication. Since skin is the largest extra-hepatic drug/xenobiotic metabolising organ where redox-dependent metabolic pathways prevail, in this review, publications on metabolic processes leading to redox imbalance (oxidative stress) and its autocrine/endocrine impact to cutaneous drug/xenobiotic metabolism were scrutinised. Chemical and photo-chemical skin barriers contain metabolic and redox compartments: their protective and homeostatic functions. The review will examine the striking similarity of adaptive responses to exogenous chemical/photo-chemical stressors and endogenous toxins in cutaneous metabolic and redox system; the role(s) of xenobiotics/drugs and phase II enzymes in the endogenous antioxidant defence and maintenance of redox balance; redox regulation of interactions between metabolic and inflammatory responses in skin cells; skin diseases sharing metabolic and redox problems (contact dermatitis, lupus erythematosus, and vitiligo) Due to exceptional the redox dependence of cutaneous metabolic pathways and interaction of redox active metabolites/exogenous antioxidants with drug/xenobiotic metabolism, metabolic tests of topical xenobiotics/drugs should be combined with appropriate redox analyses and performed on 3D human skin models.
Momota, Yutaka; Shimada, Kenichiro; Gin, Azusa; Matsubara, Takako; Azakami, Daigo; Ishioka, Katsumi; Nakamura, Yuka; Sako, Toshinori
2016-10-01
A closed chamber evaporimeter is suitable for measuring transepidermal water loss (TEWL) in cats because of the compact device size, tolerance to sudden movement and short measuring time. TEWL is a representative parameter for skin barrier dysfunction, which is one of the clinical signs of atopic dermatitis in humans and dogs. Measurement of feline TEWL has been reported, but applicability of this parameter has not been validated. The aims of this study were to determine if tape stripping is a valid experimental model in cats for studying TEWL and to determine if a closed chambered system is a suitable measurement tool for cats. Ten clinically normal cats. In order to evaluate variation of the measured values, TEWL was measured at the right and left side of the three clipped regions (axillae, lateral thigh and groin). Subsequently, TEWL was measured using sequential tape stripping of the stratum corneum as a model of acute barrier disruption. The variations between both sides of the three regions showed no significant difference. Sequential tape stripping was associated with increasing values for TEWL. Feline TEWL was shown to reflect changes in the skin barrier in an experimental model using a closed chamber system and has the potential for evaluating skin barrier function in cats with skin diseases. © 2016 ESVD and ACVD.
Effects of glyceryl glucoside on AQP3 expression, barrier function and hydration of human skin.
Schrader, A; Siefken, W; Kueper, T; Breitenbach, U; Gatermann, C; Sperling, G; Biernoth, T; Scherner, C; Stäb, F; Wenck, H; Wittern, K-P; Blatt, T
2012-01-01
Aquaporins (AQPs) present in the epidermis are essential hydration-regulating elements controlling cellular water and glycerol transport. In this study, the potential of glyceryl glucoside [GG; alpha-D-glucopyranosyl-alpha-(1->2)-glycerol], an enhanced glycerol derivative, to increase the expression of AQP3 in vitro and ex vivo was evaluated. In vitro studies with real-time RT-PCR and FACS measurements were performed to test the induction by GG (3% w/v) of AQP3 mRNA and protein in cultured human keratinocytes. GG-containing formulations were applied topically to volunteer subjects and suction blister biopsies were analyzed to assess whether GG (5%) could penetrate the epidermis of intact skin, and subsequently upregulate AQP3 mRNA expression and improve barrier function. AQP3 mRNA and protein levels were significantly increased in cultured human keratinocytes. In the studies on volunteer subjects, GG significantly increased AQP3 mRNA levels in the skin and reduced transepidermal water loss compared with vehicle-controlled areas. GG promotes AQP3 mRNA and protein upregulation and improves skin barrier function, and may thus offer an effective treatment option for dehydrated skin. Copyright © 2012 S. Karger AG, Basel.
Akdeniz, Merve; Boeing, Heiner; Müller-Werdan, Ursula; Aykac, Volkan; Steffen, Annika; Schell, Mareike; Blume-Peytavi, Ulrike; Kottner, Jan
2018-04-03
Inadequate fluid intake is assumed to be a trigger of water-loss dehydration, which is a major health risk in aged and geriatric populations. Thus, there is a need to search for easy to use diagnostic tests to identify dehydration. Our overall aim was to investigate whether skin barrier parameters could be used for predicting fluid intake and/or hydration status in geriatric patients. An explorative observational comparative study was conducted in a geriatric hospital including patients aged 65 years and older. We measured 3-day fluid intake, skin barrier parameters, Overall Dry Skin Score, serum osmolality, cognitive and functional health, and medications. Forty patients were included (mean age 78.45 years and 65% women) with a mean fluid intake of 1,747 mL/day. 20% of the patients were dehydrated and 22.5% had an impending dehydration according to serum osmolality. Multivariate analysis suggested that skin surface pH and epidermal hydration at the face were associated with fluid intake. Serum osmolality was associated with epidermal hydration at the leg and skin surface pH at the face. Fluid intake was not correlated with serum osmolality. Diuretics were associated with high serum osmolality. Approximately half of the patients were diagnosed as being dehydrated according to osmolality, which is the current reference standard. However, there was no association with fluid intake, questioning the clinical relevance of this measure. Results indicate that single skin barrier parameters are poor markers for fluid intake or osmolality. Epidermal hydration might play a role but most probably in combination with other tests. © 2018 S. Karger AG, Basel.
Cha, Ho-Yeol; Ahn, Sang-Hyun; Cheon, Jin-Hong; Park, Sun-Young; Kim, Kibong
2017-07-12
Hataedock treatment is traditionally used for the purpose of preventing the future skin disease by feeding herbal extracts to the newborn in traditional Chinese and Korean medicine. This study investigated the preventive therapeutic effects of Hataedock (HTD) treatment for atopic dermatitis (AD) through skin barrier protection in Dermatophagoides farinae-induced NC/Nga mice. To the HTD treatment group, the extract of Coptis japonica Makino and Glycyrrhiza uralensis Fischer, which analyzed with High Performance Liquid Chromatography (HPLC)-fingerprint for quality consistency, was administered orally to the 3-week-old mice before inducing AD. After that, Dermatophagoides farinae was applied except the control group to induce AD-like skin lesions. We confirmed the effects of HTD on morphological changes, protection of skin barrier, regulation of Th2 differentiation, inflammation regulation and induction of apoptosis through histochemistry, immunohistochemistry, and Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay. HTD effectively reduced edema, angiogenesis and skin lesion. HTD also increased the levels of liver X receptor (LXR) and filaggrin but decreased the level of protein kinase C (PKC) (pprotection of skin barrier. Therefore, HTD may have potential applications for alternative and preventive treatment in the management of AD. Copyright © 2017 Elsevier Ireland Ltd. All rights reserved.
Danby, Simon G; AlEnezi, Tareq; Sultan, Amani; Lavender, Tina; Chittock, John; Brown, Kirsty; Cork, Michael J
2013-01-01
Natural oils are advocated and used throughout the world as part of neonatal skin care, but there is an absence of evidence to support this practice. The goal of the current study was to ascertain the effect of olive oil and sunflower seed oil on the biophysical properties of the skin. Nineteen adult volunteers with and without a history of atopic dermatitis were recruited into two randomized forearm-controlled mechanistic studies. The first cohort applied six drops of olive oil to one forearm twice daily for 5 weeks. The second cohort applied six drops of olive oil to one forearm and six drops of sunflower seed oil to the other twice daily for 4 weeks. The effect of the treatments was evaluated by determining stratum corneum integrity and cohesion, intercorneocyte cohesion, moisturization, skin-surface pH, and erythema. Topical application of olive oil for 4 weeks caused a significant reduction in stratum corneum integrity and induced mild erythema in volunteers with and without a history of atopic dermatitis. Sunflower seed oil preserved stratum corneum integrity, did not cause erythema, and improved hydration in the same volunteers. In contrast to sunflower seed oil, topical treatment with olive oil significantly damages the skin barrier, and therefore has the potential to promote the development of, and exacerbate existing, atopic dermatitis. The use of olive oil for the treatment of dry skin and infant massage should therefore be discouraged. These findings challenge the unfounded belief that all natural oils are beneficial for the skin and highlight the need for further research. © 2012 Wiley Periodicals, Inc.
Anti-Inflammatory and Skin Barrier Repair Effects of Topical Application of Some Plant Oils.
Lin, Tzu-Kai; Zhong, Lily; Santiago, Juan Luis
2017-12-27
Plant oils have been utilized for a variety of purposes throughout history, with their integration into foods, cosmetics, and pharmaceutical products. They are now being increasingly recognized for their effects on both skin diseases and the restoration of cutaneous homeostasis. This article briefly reviews the available data on biological influences of topical skin applications of some plant oils (olive oil, olive pomace oil, sunflower seed oil, coconut oil, safflower seed oil, argan oil, soybean oil, peanut oil, sesame oil, avocado oil, borage oil, jojoba oil, oat oil, pomegranate seed oil, almond oil, bitter apricot oil, rose hip oil, German chamomile oil, and shea butter). Thus, it focuses on the therapeutic benefits of these plant oils according to their anti-inflammatory and antioxidant effects on the skin, promotion of wound healing and repair of skin barrier.
Are barriers to physical activity similar for adults with and without abnormal glucose metabolism?
Hume, Clare; Dunstan, David; Salmon, Jo; Healy, Genevieve; Andrianopoulos, Nick; Owen, Neville
2010-01-01
The purpose of this study was to examine perceived barriers to physical activity among adults with and without abnormal glucose metabolism (AGM), and whether barriers varied according to physical activity status. The 1999 to 2000 Australian Diabetes, Obesity, and Lifestyle Study (AusDiab) was a population-based cross-sectional study among adults aged > or =25 years. AGM was identified through an oral glucose tolerance test. The previous week's physical activity and individual, social, and environmental barriers to physical activity were self-reported. Logistic regression analyses examined differences in barriers to physical activity between those with and without AGM, and for those with and without AGM who did and did not meet the minimum recommendation of 150 minutes/week of moderate-to-vigorous intensity physical activity. Of the 7088 participants (47.5 +/- 12.7 years; 46% male), 18.5% had AGM. Approximately 47.5% of those with AGM met the physical activity recommendation, compared to 54.7% of those without AGM (P barriers to physical activity included lack of time, other priorities, and being tired. Following adjustment for sociodemographic and behavioral factors, there were few differences in barriers to physical activity between those with and without AGM, even after stratifying according to physical activity. Adults with AGM report similar barriers to physical activity, as do those without AGM. Programs for those with AGM can therefore focus on the known generic adult-reported barriers to physical activity.
Buist, Harrie E; van de Sandt, Johannes J M; van Burgsteden, Johan A; de Heer, Cees
2005-10-01
The dermal route of exposure is important in worker exposure to biocidal products. Many biocidal active substances which are used on a daily basis may decrease the barrier function of the skin to a larger extent than current risk assessment practice addresses, due to possible skin effects of repeated exposure. The influence of repeated and single exposure to representative biocidal active substances on the skin barrier was investigated in vitro. The biocidal active substances selected were alkyldimethylbenzylammonium chloride (ADBAC), boric acid, deltamethrin, dimethyldidecylammonium chloride (DDAC), formaldehyde, permethrin, piperonyl butoxide, sodium bromide, and tebuconazole. Of these nine compounds, only the quaternary ammonium chlorides ADBAC and DDAC had a clear and consistent influence on skin permeability of the marker compounds tritiated water and [(14)C]propoxur. For these compounds, repeated exposure increased skin permeability more than single exposure. At high concentrations the difference between single and repeated exposure was quantitatively significant: repeated exposure to 300 mg/L ADBAC increased skin permeability two to threefold in comparison to single exposure. Therefore, single and repeated exposure to specific biocidal products may significantly increase skin permeability, especially when used undiluted.
Korinth, Gintautas; Lüersen, Lars; Schaller, Karl Heinz; Angerer, Jürgen; Drexler, Hans
2008-04-01
Aniline (ANI) and the human carcinogen o-toluidine (OT) are released at the workplace during the production and processing of rubber. Recently, we showed in rubber industry workers that a frequent use of skin barrier creams (SBC) increased the internal exposure of ANI and OT. In the present study, diffusion cells were used to investigate the effects of two SBC and one skin care cream (SCC) on percutaneous penetration of neat ANI and OT as well as of OT from a mixture with a workplace specific lubricant. The experiments were carried out with untreated and with skin creams treated human skin. A considerable percutaneous penetration enhancement of test compounds was observed for treated skin compared with untreated skin; the highest enhancement (mean factors 6.2-12.3) was found for SBC (based on oil in water emulsion) treated skin. The lowest penetration enhancement showed SCC treated skin (mean factors 4.2-9.7). The in vitro data support our findings in workers that the percutaneous absorption of aromatic amines significantly increases in presence of skin creams. The efficacy of skin creams to protect the percutaneous penetration of aromatic amines is not confirmed by our own experiments.
Directory of Open Access Journals (Sweden)
Yoshihiro Tokudome
2017-10-01
Full Text Available Purified glucosylceramide from beet extract (beet GlcCer and beet extract containing an equal amount of GlcCer were administered orally to ultra violet B (UVB-irradiated mice, and differences in the protective effects against skin barrier dysfunction caused by UVB irradiation were compared. In the beet GlcCer group, epidermal thickening and the decrease in stratum corneum (SC ceramide content caused by UVB irradiation were reduced. In the group that was orally administered beet extract containing glucosylceramide, effects similar to those in the beet GlcCer group were observed. Oral administration of beet GlcCer had no obvious effects against an increase in TEWL or decrease in SC water content after UVB irradiation, but there was improvement in the beet extract group. Oral administration of beet GlcCer is effective in improving skin barrier function in UVB-irradiated mice. Beet extract contains constituents other than GlcCer that are also effective in improving skin barrier function.
Daniels, R
2017-11-01
It is international consensus that the daily use of properly selected products for the maintenance therapy is a must in the adjuvant treatment of most chronic skin diseases. In a first step, the selection of an adequate product can be guided by the classical triangle of the dermal vehicles. However, modern skin care products use diverse excipients, e. g. emulsifiers and viscosity enhancers, to improve the galenical and haptic properties of the formulations. It is thus no longer sufficient to simply have knowledge about the oil and water content of a cream in order to make a proper selection. A very positive effect on the skin barrier can be achieved using biomimetic lipids which can be incorporated into the epidermal lipid barrier. The application of such products as a foam cream is the most convenient way especially favorable when inflamed or hardly accessible skin areas have to be treated.
Anti-Inflammatory and Skin Barrier Repair Effects of Topical Application of Some Plant Oils
Directory of Open Access Journals (Sweden)
Tzu-Kai Lin
2017-12-01
Full Text Available Plant oils have been utilized for a variety of purposes throughout history, with their integration into foods, cosmetics, and pharmaceutical products. They are now being increasingly recognized for their effects on both skin diseases and the restoration of cutaneous homeostasis. This article briefly reviews the available data on biological influences of topical skin applications of some plant oils (olive oil, olive pomace oil, sunflower seed oil, coconut oil, safflower seed oil, argan oil, soybean oil, peanut oil, sesame oil, avocado oil, borage oil, jojoba oil, oat oil, pomegranate seed oil, almond oil, bitter apricot oil, rose hip oil, German chamomile oil, and shea butter. Thus, it focuses on the therapeutic benefits of these plant oils according to their anti-inflammatory and antioxidant effects on the skin, promotion of wound healing and repair of skin barrier.
Ishii, Yuki; Sugimoto, Saho; Izawa, Naoki; Sone, Toshiro; Chiba, Katsuyoshi; Miyazaki, Kouji
2014-07-01
Recent studies have shown that some probiotics affect not only the gut but also the skin. However, the effects of probiotics on ultraviolet (UV)-induced skin damage are poorly understood. In this study, we aim to examine whether oral administration of live Bifidobacterium breve strain Yakult (BBY), a typical probiotic, can attenuate skin barrier perturbation caused by UV and reactive oxygen species (ROS) in hairless mice. The mice were orally supplemented with a vehicle only or BBY once a day for nine successive days. Mouse dorsal skin was irradiated with UV from days 6 to 9. The day after the final irradiation, the transepidermal water loss (TEWL), stratum corneum hydration, and oxidation-related factors of the skin were evaluated. We elucidated that BBY prevented the UV-induced increase in TEWL and decrease in stratum corneum hydration. In addition, BBY significantly suppressed the UV-induced increase in hydrogen peroxide levels, oxidation of proteins and lipids, and xanthine oxidase activity in the skin. Conversely, antioxidant capacity did not change regardless of whether BBY was administered or not. In parameters we evaluated, there was a positive correlation between the increase in TEWL and the oxidation levels of proteins and lipids. Our results suggest that oral administration of BBY attenuates UV-induced barrier perturbation and oxidative stress of the skin, and this antioxidative effect is not attributed to enhancement of antioxidant capacity but to the prevention of ROS generation.
Effects of UVA (320-400 nm) on the barrier characteristics of the skin
International Nuclear Information System (INIS)
McAuliffe, D.J.; Blank, I.H.
1991-01-01
The stratum corneum serves as the major barrier to the entrance of most molecules into the skin. In the studies presented here, the effects of UVA radiation (320-400 nm) on the barrier capacity of human stratum corneum were examined. Penetration of a homologous series of primary alcohols through unirradiated (control) and UVA-irradiated (test) human epidermis was determined in vitro. Permeability constants, kp, were calculated. Mean ratios of permeability constants for UVA-irradiated and unirradiated epidermis (mean kp test)/(mean kp control) ranged from 2.3 to 3.0 for methanol and from 2.2 to 2.5 for ethanol. These mean ratios were determined using different pieces of epidermis from the same piece of skin for test and control samples. When kp control and kp test were determined on the same piece of epidermis on successive days, the ratios (kp test/kp control) were similar to the mean ratios determined on different pieces of epidermis. For other primary alcohols, propanol, butanol, hexanol, and heptanol, UVA radiation did not alter their permeability constants significantly. Partition coefficients, Km, were determined for ethanol and heptanol using UVA-irradiated and unirradiated stratum corneum. For ethanol, irradiation resulted in a 1.5 to 2.6 times increase in Km. For heptanol, irradiation caused no change in Km. These results demonstrate that the barrier capacity of stratum corneum for small, polar, primary alcohols is diminished (permeability increases) and for higher molecular weight less polar alcohols, is unaffected by small doses of UVA radiation. This increased permeability of small polar alcohols through human skin may be due to enhanced partitioning into UVA-irradiated stratum corneum, which was not apparent for a higher molecular weight less polar alcohol
Angelova-Fischer, Irena; Dapic, Irena; Hoek, Anne-Karin; Jakasa, Ivone; Fischer, Tobias W.; Zillikens, Detlef; Kezic, Sanja
2014-01-01
Dermal exposure to alkaline agents may lead to skin barrier damage and irritant contact dermatitis. The objective of this study was to investigate the effects of cumulative exposure to 0.5% sodium lauryl sulphate (SLS) and 0.15% NaOH on the barrier function and natural moisturising factor (NMF)
White matter abnormalities in skin picking disorder
DEFF Research Database (Denmark)
Grant, Jon E; Odlaug, Brian Lawrence; Hampshire, Adam
2013-01-01
Skin picking disorder (SPD) is characterized by the repetitive and compulsive picking of skin, resulting in tissue damage. Neurocognitive findings in SPD implicate difficulty with response inhibition (suppression of pre-potent motor responses). This function is dependent on the integrity of the r......Skin picking disorder (SPD) is characterized by the repetitive and compulsive picking of skin, resulting in tissue damage. Neurocognitive findings in SPD implicate difficulty with response inhibition (suppression of pre-potent motor responses). This function is dependent on the integrity...... remarkably similar to those previously reported in trichotillomania. This study adds considerable support to the notion that-in addition to the phenomenological and comorbid overlap between SPD and trichotillomania-these disorders likely share overlapping neurobiology....
Skin fibroblasts from a D-deletion type retinoblastoma patient are abnormally X-ray sensitive
International Nuclear Information System (INIS)
Weichselbaum, R.R.; Nove, J.; Little, J.B.
1977-01-01
Retinoblastoma is a rare malignant eye tumour that appears either spontaneously or in genetically predisposed persons. The latter group is composed of persons who inherit the tumour with a dominant mode of transmission (the familial type) and those who have a deletion in the long arm of chromosome 13 referred to as the D-deletion type. When this deletion is present it is observed in many somatic cells and is often associated with structural defects. Survivors of the genetic forms of retinoblastoma have an increased risk of the development of cancers at other sites. A single genetic locus is unlikely to predispose many somatic cells to tumour formation unless a fundamental molecular defect, possibly related to DNA repair, is present. In order to investigate this hypothesis a study was made of the in vitro X-ray sensitivity of skin fibroblasts derived from three retinoblastoma patients, comprising a pair of twins with the familial type accompanied by no gross chromosome abnormalities, and a patient with the D-deletion type. It was found that fibroblasts derived from the D-deletion patient were significantly more radiosensitive than those from the other two patients. X-ray survival curves are shown. It is concluded that skin fibroblasts derived from a patient with the D-deletion variant of retinoblastoma are abnormally radiosensitive. Future investigations may indicate a specific defect in molecular repair of DNA that will explain the predisposition of these patients to the development of other tumours. (U.K.)
Buist, H.E.; Sandt, J.J.M. van de; Burgsteden, J.A. van; Heer, C. de
2005-01-01
The dermal route of exposure is important in worker exposure to biocidal products. Many biocidal active substances which are used on a daily basis may decrease the barrier function of the skin to a larger extent than current risk assessment practice addresses, due to possible skin effects of
Grond, Susanne; Radner, Franz P.W.; Eichmann, Thomas O.; Kolb, Dagmar; Grabner, Gernot F.; Wolinski, Heimo; Gruber, Robert; Hofer, Peter; Heier, Christoph; Schauer, Silvia; Rülicke, Thomas; Hoefler, Gerald; Schmuth, Matthias; Elias, Peter M.; Lass, Achim; Zechner, Rudolf; Haemmerle, Guenter
2017-01-01
Adipose triglyceride lipase (ATGL) and its coactivator comparative gene identification-58 (CGI-58) are limiting in cellular triglyceride catabolism. Although ATGL deficiency is compatible with normal skin development, mice globally lacking CGI-58 die postnatally and exhibit a severe epidermal permeability barrier defect, which may originate from epidermal and/or peripheral changes in lipid and energy metabolism. Here, we show that epidermis-specific disruption of CGI-58 is sufficient to provoke a defect in the formation of a functional corneocyte lipid envelope linked to impaired ω-O-acylceramide synthesis. As a result, epidermis-specific CGI-58-deficient mice show severe skin dysfunction, arguing for a tissue autonomous cause of disease development. Defective skin permeability barrier formation in global CGI-58-deficient mice could be reversed via transgenic restoration of CGI-58 expression in differentiated but not basal keratinocytes suggesting that CGI-58 is essential for lipid metabolism in suprabasal epidermal layers. The compatibility of ATGL deficiency with normal epidermal function indicated that CGI-58 may stimulate an epidermal triglyceride lipase beyond ATGL required for the adequate provision of fatty acids as a substrate for ω-O-acylceramide synthesis. Pharmacological inhibition of ATGL enzyme activity similarly reduced triglyceride-hydrolytic activities in wild-type and CGI-58 overexpressing epidermis implicating that CGI-58 participates in ω-O-acylceramide biogenesis independent of its role as a coactivator of epidermal triglyceride catabolism. PMID:27725204
Defects of filaggrin-like proteins in both lesional and nonlesional atopic skin.
Pellerin, Laurence; Henry, Julie; Hsu, Chiung-Yueh; Balica, Stéfana; Jean-Decoster, Catherine; Méchin, Marie-Claire; Hansmann, Britta; Rodriguez, Elke; Weindinger, Stefan; Schmitt, Anne-Marie; Serre, Guy; Paul, Carle; Simon, Michel
2013-04-01
Atopic dermatitis (AD) is a chronic inflammatory skin disease characterized by a disturbed epidermal barrier. In a subset of patients, this is explained by nonsense mutations in the gene encoding filaggrin (FLG). We sought to evaluate the respective role of FLG mutations and proinflammatory cytokines and to assess the expression of FLG, hornerin (HRNR), and FLG2, 2 FLG-like proteins, which are involved in epidermal barrier functions, in normal skin and both lesional and nonlesional skin of patients with AD. An FLG-genotyped cohort of 73 adults with AD and 73 aged-matched control subjects was analyzed by using immunohistochemistry and immunoblotting. Normal primary human keratinocytes were differentiated in either the absence or presence of IL-4, IL-13, and IL-25. Compared with control subjects, FLG, HRNR, and FLG2 were detected at significantly lower levels in the skin of patients with AD, irrespective of their FLG genotype. The reduction was greater in lesional compared with nonlesional skin. In addition, the proFLG/FLG ratio was found to be higher in the skin of wild-type patients than in control subjects. Cytokine treatment of keratinocytes induced a dramatic reduction in FLG, FLG2, and HRNR expression both at the mRNA and protein levels. The stratum corneum of lesional but also clinically unaffected skin of adults with AD is abnormal, with reduced expression of FLG and FLG-like proteins. In addition to nonsense mutations, proinflammatory cytokines and some defects in the proFLG processing can contribute to the FLG downregulation. Our study suggests that skin inflammation reduces the expression of FLG-like proteins, contributing to the AD-related epidermal barrier dysfunction. Copyright © 2013 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights reserved.
Falcone, D.; Uzunbajakava, N.E.; Varghese, B.; Aquino Santos, G.R. de; Richters, R.J.H.; Kerkhof, P.C.M. van de; Erp, P.E.J. van
2015-01-01
Skin barrier function, confined to the stratum corneum, is traditionally evaluated using established, noninvasive biophysical methods like transepidermal water loss, capacitance and conductance. However, these methods neither measure skin molecular composition nor its structure, hindering the actual
Directory of Open Access Journals (Sweden)
Jes Dreier
Full Text Available In this study we use the combination of super resolution optical microscopy and raster image correlation spectroscopy (RICS to study the mechanism of action of liposomes as transdermal drug delivery systems in human skin. Two different compositions of liposomes were applied to newly excised human skin, a POPC liposome and a more flexible liposome containing the surfactant sodium cholate. Stimulated emission depletion microscopy (STED images of intact skin and cryo-sections of skin treated with labeled liposomes were recorded displaying an optical resolution low enough to resolve the 100 nm liposomes in the skin. The images revealed that virtually none of the liposomes remained intact beneath the skin surface. RICS two color cross correlation diffusion measurements of double labeled liposomes confirmed these observations. Our results suggest that the liposomes do not act as carriers that transport their cargo directly through the skin barrier, but mainly burst and fuse with the outer lipid layers of the stratum corneum. It was also found that the flexible liposomes showed a greater delivery of the fluorophore into the stratum corneum, indicating that they functioned as chemical permeability enhancers.
Mori, T; Ishida, K; Mukumoto, S; Yamada, Y; Imokawa, G; Kabashima, K; Kobayashi, M; Bito, T; Nakamura, M; Ogasawara, K; Tokura, Y
2010-01-01
Background Two types of atopic dermatitis (AD) have been proposed, with different pathophysiological mechanisms underlying this seemingly heterogeneous disorder. The extrinsic type shows high IgE levels presumably as a consequence of skin barrier damage and feasible allergen permeation, whereas the intrinsic type exhibits normal IgE levels and is not mediated by allergen-specific IgE. Objectives To investigate the relationship between pruritus perception threshold and skin barrier function of patients with AD in a comparison between the extrinsic and intrinsic types. Methods Enrolled in this study were 32 patients with extrinsic AD, 17 with intrinsic AD and 24 healthy individuals. The barrier function of the stratum corneum was assessed by skin surface hydration and transepidermal water loss (TEWL), and pruritus perception was evaluated by the electric current perception threshold (CPT) of sensory nerves upon neuroselective transcutaneous electric stimulation. Results Skin surface hydration was significantly lower and TEWL was significantly higher in extrinsic AD than intrinsic AD or normal controls. Although there was no statistically significant difference in CPT among extrinsic AD, intrinsic AD and normal controls, CPT was significantly correlated with skin surface hydration and inversely with TEWL in intrinsic AD and normal controls, but not extrinsic AD. Finally, CPT was correlated with the visual analogue scale of itch in the nonlesional skin of patients with extrinsic but not intrinsic AD. Conclusions Patients with extrinsic AD have an impaired barrier, which increases the pre-existing pruritus but rather decreases sensitivity to external stimuli. In contrast, patients with intrinsic AD retain a normal barrier function and sensory reactivity to external pruritic stimuli.
Korponyai, Csilla; Szél, Edit; Behány, Zoltán; Varga, Erika; Mohos, Gábor; Dura, Ágnes; Dikstein, Shabtay; Kemény, Lajos; Erős, Gábor
2017-02-08
Glycerol and xylitol hydrate the skin and improve its barrier function over a short period. We studied the effects of glycerol and xylitol on the physiological properties and morphology of the skin after longer-term application. Twelve volunteers with dry skin were examined. Three areas on the arms were determined. Area 1 served as untreated control. The vehicle was applied to area 2, while area 3 was treated twice daily with a formulation containing glycerol (5%) and xylitol (5%) for 14 days. Transepidermal water loss (TEWL), hydration and biomechanical properties of the skin were monitored. Biopsies were taken for routine histology and immunohistochemistry for filaggrin and matrix metalloproteinase-1 (MMP-1). The polyols increased the skin hydration and protein quantity of filaggrin, elevated the interdigitation index, decreased the TEWL and improved the biomechanical properties of the skin, but did not change the protein expression of MMP-1. A combination of glycerol and xylitol can be useful additional therapy for dry skin.
NANODERM. Quality of skin as a barrier to ultra-fine particles
International Nuclear Information System (INIS)
Kiss, A.Z.; Kertesz, Zs.; Szikszai, Z.; Biro, T.; Czifra, G.; Toth, B.I.; Juhasz, I.; Kiss, B.; Hunyadi, J.
2007-01-01
ultra-fine particles on healthy skin. On the other hand, micronised titanium-dioxide particles are internalized by melanocytes and fibroblasts in cell culture. Particles disturb cell viability and proliferation as well as keratinocyte differentiation. Outlook Although this EU project has ended, there are still several questions to be answered. In view of the cellular effects, we are currently investigating the penetration of nanosized particles into skin with impaired barrier function. Long term exposure studies are also required
Systematic screening for skin, hair, and nail abnormalities in a large-scale knockout mouse program.
Directory of Open Access Journals (Sweden)
John P Sundberg
Full Text Available The International Knockout Mouse Consortium was formed in 2007 to inactivate ("knockout" all protein-coding genes in the mouse genome in embryonic stem cells. Production and characterization of these mice, now underway, has generated and phenotyped 3,100 strains with knockout alleles. Skin and adnexa diseases are best defined at the gross clinical level and by histopathology. Representative retired breeders had skin collected from the back, abdomen, eyelids, muzzle, ears, tail, and lower limbs including the nails. To date, 169 novel mutant lines were reviewed and of these, only one was found to have a relatively minor sebaceous gland abnormality associated with follicular dystrophy. The B6N(Cg-Far2tm2b(KOMPWtsi/2J strain, had lesions affecting sebaceous glands with what appeared to be a secondary follicular dystrophy. A second line, B6N(Cg-Ppp1r9btm1.1(KOMPVlcg/J, had follicular dystrophy limited to many but not all mystacial vibrissae in heterozygous but not homozygous mutant mice, suggesting that this was a nonspecific background lesion. We discuss potential reasons for the low frequency of skin and adnexal phenotypes in mice from this project in comparison to those seen in human Mendelian diseases, and suggest alternative approaches to identification of human disease-relevant models.
International Nuclear Information System (INIS)
Van der Paal, J; Verlackt, C C; Yusupov, M; Neyts, E C; Bogaerts, A
2015-01-01
While plasma treatment of skin diseases and wound healing has been proven highly effective, the underlying mechanisms, and more generally the effect of plasma radicals on skin tissue, are not yet completely understood. In this paper, we perform ReaxFF-based reactive molecular dynamics simulations to investigate the interaction of plasma generated OH radicals with a model system composed of free fatty acids, ceramides, and cholesterol molecules. This model system is an approximation of the upper layer of the skin (stratum corneum). All interaction mechanisms observed in our simulations are initiated by H-abstraction from one of the ceramides. This reaction, in turn, often starts a cascade of other reactions, which eventually lead to the formation of aldehydes, the dissociation of ceramides or the elimination of formaldehyde, and thus eventually to the degradation of the skin barrier function. (paper)
Blaak, Jürgen; Kaup, Olaf; Hoppe, Willi; Baron-Ruppert, Gabriele; Langheim, Heiko; Staib, Peter; Wohlfart, Rainer; Lüttje, Dieter; Schürer, Nanna
2015-08-01
The pH of the stratum corneum (SC) in the elderly is elevated and linked to impaired SC function. Therefore, this paper addresses the question of whether acidic skin care generates positive clinical, biophysical, and microbiological effects in aged skin. This study was performed to assess skin care effects in nursing home residents (aged 80-97 years). Visual, biophysical, and microbiological methods were used. Subjects were randomly assigned to 1 of 2 groups and treated over 7 weeks with skin care products adjusted to a pH of 4.0 (group A) or a pH of 6.0 (group B). Compared to baseline, SC integrity improved significantly in group A (p = 0.007), whereas there was no change in group B (p = 0.672). SC recovery 24 h after perturbation increased significantly in group A (p = 0.004) compared to baseline. The SC recovery in group B was not significant compared to baseline (p = 0.327). Long-term treatment with pH 4.0 skin care results in a significant improvement in epidermal barrier function compared to identical products with a pH of 6.0. In addition, effects on skin dryness and resident flora were demonstrated, but without significant differences, between the 2 groups. Based on these results, we recommend adjustment of skin care products for the elderly to a pH of 4.0 to maintain the health of aged skin. © 2015 S. Karger AG, Basel.
Kieć-Świcrczyńska, Marta; Chomiczewska-Skóra, Dorota; Świerczyńska-Machura, Dominika; Kręcisz, Beata
2014-01-01
Nurses are prone to develop hand eczema due to occupational exposure to irritants, including wet work. The aim of the study was to evaluate the impact of wet work on selected skin properties, reflecting epidermal barrier function--transepidermal water loss (TEWL) and stratum corneum hydration--and additionally skin viscoelasticity, in nurses. Study subjects included 90 nurses employed in hospital wards. Measurements were carried out within the dorsal aspect of the dominant hand, using a Cutometer MPA 580 equipped with Tewameter TM 300 and Corneometer CM 825 (Courage & Khazaka, Germany) probes. Examina- tions took place on hospital premises. Similar measurements were performed in the control group of females non-exposed to irritants. In the examined group of nurses, mean TEWL was 15.5 g/h/m2 and was higher than in the control group (12.99 g/h/m2). After rejecting the extreme results, the difference between the groups proved to be statistically significant (p hydration was lower in the examined group (37.915) compared with the control group (40.05), but the difference was not sta tistically significant. Also results of viscoelasticity assessment showed no significant differences between studied groups. The results of the assessment of skin biophysical properties show that wet work exerts a moderately adverse impact on skin condition. A higher TEWL value and a lower stratum corneum hydration in workers exposed to irritants reflect an adverse impact of these factors on the epidermal barrier function.
Connexins and pannexins in the integumentary system: the skin and appendages.
Faniku, Chrysovalantou; Wright, Catherine S; Martin, Patricia E
2015-08-01
The integumentary system comprises the skin and its appendages, which includes hair, nails, feathers, sebaceous and eccrine glands. In this review, we focus on the expression profile of connexins and pannexins throughout the integumentary system in mammals, birds and fish. We provide a picture of the complexity of the connexin/pannexin network illustrating functional importance of these proteins in maintaining the integrity of the epidermal barrier. The differential regulation and expression of connexins and pannexins during skin renewal, together with a number of epidermal, hair and nail abnormalities associated with mutations in connexins, emphasize that the correct balance of connexin and pannexin expression is critical for maintenance of the skin and its appendages with both channel and non-channel functions playing profound roles. Changes in connexin expression during both hair and feather regeneration provide suggestions of specialized communication compartments. Finally, we discuss the potential use of zebrafish as a model for connexin skin biology, where evidence mounts that differential connexin expression is involved in skin patterning and pigmentation.
International Nuclear Information System (INIS)
Squier, C.A.; Hall, B.K.
1985-01-01
The permeability of porcine skin and keratinized and nonkeratinized oral mucosa to tritium-labeled water and horseradish peroxidase (HRPO) was determined using perfusion chambers. Small blocks from each tissue were also incubated with HRPO and the extent of penetration visualized microscopically; this enabled measurements to be made of the thickness of the permeability barrier to this water-soluble tracer. Results obtained after inverting the oral mucosa in the chambers or adding metabolic inhibitors indicated that both compounds diffuse across the tissue. The permeability constants derived directly in the study showed that skin was less permeable than oral mucosa and that the floor of the mouth was significantly more permeable than all other regions. When these constants were normalized in terms of a standard permeability barrier thickness and the different tissues compared, the values obtained for skin were again less than those of the oral regions but, of these, the buccal mucosa was significantly higher. The difference in permeability between epidermis and keratinized oral epithelium may be due to differences in the volume density of membrane-coating granules known to exist between the tissues; differences between the oral mucosal regions may reflect differences in the nature of the intercellular barrier material
Facchini, Gustavo; Eberlin, Samara; Clerici, Stefano Piatto; Alves Pinheiro, Ana Lucia Tabarini; Costa, Adilson
2017-12-01
Unwanted side effects such as dryness, hypersensitivity, and cutaneous photosensitivity are challenge for adherence and therapeutical success for patients using treatments for inflammatory and allergic skin response. In this study, we compared the effects of two dermatological formulations, which are used in inflammatory and/or allergic skin conditions: dexchlorpheniramine maleate (DCP; 10 mg/g) and promethazine (PTZ; 20 mg/g). We evaluated both formulations for phototoxicity potential, skin irritation, anti-inflammatory and antihistaminic abilities, and skin barrier repair in vitro and ex vivo using the standard OECD test guideline n° 432, the ECVAM protocol n° 78, and cultured skin explants from a healthy patient. Ultraviolet A was chosen as exogenous agent to induce allergic and inflammatory response. Both PTZ and DCP promoted increases in interleukin-1 (IL-1) synthesis in response to ultraviolet A (UVA) radiation compared to control. However, the increase observed with PTZ was significantly greater than the DCP, indicating that the latter has a lower irritant potential. DCP also demonstrated a protective effect on UVA-induced leukotriene B4 and nuclear factor kappa B (NF-κB) synthesis. Conversely, PTZ demonstrates more robust UVA antihistaminic activity. Likewise, PTZ promoted a significantly greater increase in the production of involucrin and keratin 14, both associated with protective skin barrier property. In conclusion, these data suggest possible diverging UVA response mechanisms of DCP and PTZ, which gives greater insight into the contrasting photosensitizing potential between DCP and PTZ observed in the patients. © 2017 Wiley Periodicals, Inc.
Meckfessel, Matthew H; Brandt, Staci
2014-07-01
Ceramides (CERs) are epidermal lipids that are important for skin barrier function. Much research has been devoted to identifying the numerous CERs found in human skin and their function. Alterations in CER content are associated with a number of skin diseases such as atopic dermatitis. Newer formulations of skin-care products have incorporated CERs into their formulations with the goal of exogenously applying CERs to help skin barrier function. CERs are a complex class of molecules and because of their growing ubiquity in skin-care products, a clear understanding of their role in skin and use in skin-care products is essential for clinicians treating patients with skin diseases. This review provides an overview of the structure, function, and importance of skin CERs in diseased skin and how CERs are being used in skin-care products to improve or restore skin barrier function. Copyright © 2014 American Academy of Dermatology, Inc. Published by Mosby, Inc. All rights reserved.
Elentner, Andreas; Schmuth, Matthias; Yannoutsos, Nikolaos; Eichmann, Thomas O; Gruber, Robert; Radner, Franz P W; Hermann, Martin; Del Frari, Barbara; Dubrac, Sandrine
2018-01-01
The skin is in daily contact with environmental pollutants, but the long-term effects of such exposure remain underinvestigated. Many of these toxins bind and activate the pregnane X receptor (PXR), a ligand-activated transcription factor that regulates genes central to xenobiotic metabolism. The objective of this work was to investigate the effect of constitutive activation of PXR in the basal layer of the skin to mimic repeated skin exposure to noxious molecules. We designed a transgenic mouse model that overexpresses the human PXR gene linked to the herpes simplex VP16 domain under the control of the keratin 14 promoter. We show that transgenic mice display increased transepidermal water loss and elevated skin pH, abnormal stratum corneum lipids, focal epidermal hyperplasia, activated keratinocytes expressing more thymic stromal lymphopoietin, a T helper type 2/T helper type 17 skin immune response, and increased serum IgE. Furthermore, the cutaneous barrier dysfunction precedes development of the T helper type 2/T helper type 17 inflammation in transgenic mice, thereby mirroring the time course of atopic dermatitis development in humans. Moreover, further experiments suggest increased PXR signaling in the skin of patients with atopic dermatitis when compared with healthy skin. Thus, PXR activation by environmental pollutants may compromise epidermal barrier function and favor an immune response resembling atopic dermatitis. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Eriko Kage-Nakadai
Full Text Available In multicellular organisms, the surface barrier is essential for maintaining the internal environment. In mammals, the barrier is the stratum corneum. Fatty acid transport protein 4 (FATP4 is a key factor involved in forming the stratum corneum barrier. Mice lacking Fatp4 display early neonatal lethality with features such as tight, thick, and shiny skin, and a defective skin barrier. These symptoms are strikingly similar to those of a human skin disease called restrictive dermopathy. FATP4 is a member of the FATP family that possesses acyl-CoA synthetase activity for very long chain fatty acids. How Fatp4 contributes to skin barrier function, however, remains to be elucidated. In the present study, we characterized two Caenorhabditis elegans genes, acs-20 and acs-22, that are homologous to mammalian FATPs. Animals with mutant acs-20 exhibited defects in the cuticle barrier, which normally prevents the penetration of small molecules. acs-20 mutant animals also exhibited abnormalities in the cuticle structure, but not in epidermal cell fate or cell integrity. The acs-22 mutants rarely showed a barrier defect, whereas acs-20;acs-22 double mutants had severely disrupted barrier function. Moreover, the barrier defects of acs-20 and acs-20;acs-22 mutants were rescued by acs-20, acs-22, or human Fatp4 transgenes. We further demonstrated that the incorporation of exogenous very long chain fatty acids into sphingomyelin was reduced in acs-20 and acs-22 mutants. These findings indicate that C. elegans Fatp4 homologue(s have a crucial role in the surface barrier function and this model might be useful for studying the fundamental molecular mechanisms underlying human skin barrier and relevant diseases.
Notman, Rebecca; Anwar, Jamshed; Briels, W J; Noro, Massimo G; den Otter, Wouter K
2008-11-15
Transmembrane pore formation is central to many biological processes such as ion transport, cell fusion, and viral infection. Furthermore, pore formation in the ceramide bilayers of the stratum corneum may be an important mechanism by which penetration enhancers such as dimethylsulfoxide (DMSO) weaken the barrier function of the skin. We have used the potential of mean constraint force (PMCF) method to calculate the free energy of pore formation in ceramide bilayers in both the innate gel phase and in the DMSO-induced fluidized state. Our simulations show that the fluid phase bilayers form archetypal water-filled hydrophilic pores similar to those observed in phospholipid bilayers. In contrast, the rigid gel-phase bilayers develop hydrophobic pores. At the relatively small pore diameters studied here, the hydrophobic pores are empty rather than filled with bulk water, suggesting that they do not compromise the barrier function of ceramide membranes. A phenomenological analysis suggests that these vapor pores are stable, below a critical radius, because the penalty of creating water-vapor and tail-vapor interfaces is lower than that of directly exposing the strongly hydrophobic tails to water. The PMCF free energy profile of the vapor pore supports this analysis. The simulations indicate that high DMSO concentrations drastically impair the barrier function of the skin by strongly reducing the free energy required for pore opening.
Stratum corneum integrity as a predictor for peristomal skin problems in ostomates
DEFF Research Database (Denmark)
Nybaek, H; Lophaven, Søren Nymand; Karlsmark, T
2010-01-01
BACKGROUND: Peristomal skin problems are common, most often the result is disruption of the skin barrier and this may account for more than one in three visits to ostomy nurses. Therefore a specific assessment of individual risk factors relating to the skin barrier function would be of great...... interest. METHODS: Skin barrier integrity in ostomy patients with peristomal skin problems (PSP) was compared with that of ostomy patients with normal skin (controls) using transepidermal water loss (TEWL). Mechanical barrier disruption was determined by a tape stripping test and chemical barrier...
Directory of Open Access Journals (Sweden)
Antoine Berger
2018-01-01
Full Text Available Purpose: As many as 50% of patients with cancer develop acute skin reactions to some degree with radiotherapy. Proactive skin care is often recommended to minimise these skin reactions and maintain the integrity of the epidermal barrier; nevertheless, no consensual guidelines are systematically used. This multicentre, observational, prospective study evaluated the tolerability and benefit of supportive and barrier protective skin care products in preventing radiotherapy-induced skin reactions in 253 women initiating radiotherapy (exclusive or adjuvant for breast cancer. Methods: Patients received a kit of 5 commercially available skin care products before the first radiotherapy treatment. The following variables were assessed: cutaneous adverse events, investigator-assessed skin reactions (oedema, erythema, dryness, desquamation before and after radiotherapy course, investigator, and patient opinion on products benefit. Results were analysed by frequency of product use (heavy versus low. Results: Average age was 60 years (range: 34-85. Over 92% of patients reported good to excellent tolerance on irradiated skin for each product. During the 6-week radiotherapy period, we observed that heavy product users had less skin reactions than the low users, particularly within 10 days of radiotherapy initiation (8% versus 18%; p = .031. Positive physician’s opinion on product use was more frequent for high (66.6% versus low (32% users. Patient-assessed patient benefit index was generally >1, indicating relevant treatment benefit, with a tendency for better benefit in high versus low users. Conclusions: These results support recommendations to use skin care products to minimise the impact of secondary cutaneous reactions with radiotherapy cancer treatment.
Berger, Antoine; Regueiro, Carlos; Hijal, Tarek; Pasquier, David; De La Fuente, Cristina; Le Tinier, Florence; Coche-Dequeant, Bernard; Lartigau, Eric; Moyal, Dominique; Seité, Sophie; Bensadoun, René-Jean
2018-01-01
As many as 50% of patients with cancer develop acute skin reactions to some degree with radiotherapy. Proactive skin care is often recommended to minimise these skin reactions and maintain the integrity of the epidermal barrier; nevertheless, no consensual guidelines are systematically used. This multicentre, observational, prospective study evaluated the tolerability and benefit of supportive and barrier protective skin care products in preventing radiotherapy-induced skin reactions in 253 women initiating radiotherapy (exclusive or adjuvant) for breast cancer. Patients received a kit of 5 commercially available skin care products before the first radiotherapy treatment. The following variables were assessed: cutaneous adverse events, investigator-assessed skin reactions (oedema, erythema, dryness, desquamation) before and after radiotherapy course, investigator, and patient opinion on products benefit. Results were analysed by frequency of product use (heavy versus low). Average age was 60 years (range: 34-85). Over 92% of patients reported good to excellent tolerance on irradiated skin for each product. During the 6-week radiotherapy period, we observed that heavy product users had less skin reactions than the low users, particularly within 10 days of radiotherapy initiation (8% versus 18%; p = .031). Positive physician's opinion on product use was more frequent for high (66.6%) versus low (32%) users. Patient-assessed patient benefit index was generally >1, indicating relevant treatment benefit, with a tendency for better benefit in high versus low users. These results support recommendations to use skin care products to minimise the impact of secondary cutaneous reactions with radiotherapy cancer treatment.
Paré, Bastien; Gros-Louis, François
2017-07-26
Amyotrophic lateral sclerosis (ALS) is a neurodegenerative disease affecting motor neurons of the brain and spinal cord, leading to progressive paralysis and death. Interestingly, many skin changes have been reported in ALS patients, but never as yet fully explained. These observations could be due to the common embryonic origin of the skin and neural tissue known as the ectodermal germ layer. Following the first observation in ALS patients' skin by Dr Charcot in the 19th century, in the absence of bedsores unlike other bedridden patients, other morphological and molecular changes have been observed. Thus, the skin could be of interest in the study of ALS and other neurodegenerative diseases. This review summarizes skin changes reported in the literature over the years and discusses about a novel in vitro ALS tissue-engineered skin model, derived from patients, for the study of ALS.
Jordan, Laura
2016-11-01
Occupational irritant contact dermatitis (OICD) is a dif cult and hard to manage condition. It occurs more frequently in certain occupations where contact with harsh chemicals, use of alcohol-based disinfectants, and frequent hand washing heightens the risk. Treatment for OICD includes patient education in addition to physical, topical, and systemic therapies. To review the pathogenesis and treatment options for OICD and evaluate the ef cacy of a selective skin-care regimen involv- ing a hand protectant cream alone as well as combined with a repair cream and speci c cleanser. A single-center open study was performed comprising 42 healthy male and female adult volunteers prone to occupational irritant contact dermatitis due to frequent wet work or contact with detergents. Between day 0 and day 7, subjects applied a hand protectant cream as needed on both hands (at least twice daily). On days 7 to 14, subjects applied a hand protectant cream and cleanser as needed on both hands (at least twice daily) as well as a repair cream each evening. A diary log was given to each volunteer for application control and for a subjective evaluation of daily tolerability. In these subjects prone to occupational irritant contact dermatitis, the hand protectant cream applied during the initial 7-day period was effective in restoring the damaged skin barrier and improving the stratum corneum hydration. A regimen that combined the hand protectant and repair creams with a speci c cleanser during a further 7-day period allowed contin- ued improvement of skin hydration and additional clinical bene ts while respecting the skin barrier function. The results of this study support the use of a 3-step approach for patients who are at risk of repeated exposure to external irritants. J Drugs Dermatol. 2016;15(suppl 11):s81-85..
Xenobiotic metabolism in human skin and 3D human skin reconstructs: A review
Gibbs, S.; Sandt, J.J.M. van de; Merk, H.F.; Lockley, D.J.; Pendlington, R.U.; Pease, C.K.
2007-01-01
In this review, we discuss and compare studies of xenobiotic metabolism in both human skin and 3D human skin reconstructs. In comparison to the liver, the skin is a less studied organ in terms of characterising metabolic capability. While the skin forms the major protective barrier to environmental
Berardesca, Enzo; Mortillo, Susan; Cameli, Norma; Ardigo, Marco; Mariano, Maria
2018-05-10
Atopic dermatitis is a chronic, pruritic inflammatory skin disease that adversely affects quality of life. The current study evaluates the efficacy of a shower cream and a lotion, each with skin-identical lipids and emollients, in the treatment of atopic dry skin of subjects with a history of atopic condition. In all, 40 healthy females with clinically dry skin on the lower legs were enrolled in the study and underwent 4 weeks of daily use of the shower cream and 2 additional weeks of both the shower cream and the body lotion. Subjects were evaluated at day 0, week 4, and week 6. Skin barrier function was assessed by Tewameter ® , skin hydration by Corneometer ® , smoothness and desquamation by Visioscan ® , and stratum corneum architecture by reflectance confocal microscopy (RCM). The investigator assessed the degree of dryness, roughness, redness, cracks, tingling and itch, and subjective self-assessment evaluated the perception of skin soothing, smoothness, and softness. Skin barrier function and skin moisture maintenance were significantly improved using the shower cream. The lotion with physiological lipids, together with the shower cream, also improved skin barrier function and moisture. Both the shower cream and the body lotion reduced clinical dryness, roughness, redness, cracks, tingling and itch, according to the dermatologist, and increased soothing, smoothness, and softness, according to the subjects of the study. The combination of a shower cream and a lotion with physiological lipids efficiently restores skin barrier function and increases skin hydration, becoming an effective skin-care option for patients with atopic dry skin. © 2018 Wiley Periodicals, Inc.
Nanoscale alterations of corneocytes indicate skin disease
DEFF Research Database (Denmark)
Franz, J; Beutel, M; Gevers, K
2016-01-01
BACKGROUND: The skin barrier protects the organism against exogenous stressors and simultaneously prevents excessive water loss. While the delicate regulation of skin barrier is not completely understood, morphological and histological evaluation remain key features of clinical investigations. Here...... dermatitis, a common inflammatory skin condition. CONCLUSION: The presence of these corneocyte-nanostructures might be used as a diagnostic parameter for skin disorders - even in cases below a clinical threshold....
Inflammatory peeling skin syndrome caused a novel mutation in CDSN.
Telem, Dana Fuchs; Israeli, Shirli; Sarig, Ofer; Sprecher, Eli
2012-04-01
Generalized peeling skin syndrome (PSS) is a rare autosomal recessive dermatosis manifesting with continuous exfoliation of the stratum corneum. The inflammatory (type B) subtype of PSS was recently found to be caused by deleterious mutations in the CDSN gene encoding corneodesmosin, a major component of desmosomal junctions in the uppermost layers of the epidermis. In the present study, we assessed a 10-month-old baby, who presented with generalized superficial peeling of the skin. Using PCR amplification and direct sequencing, we identified the third PSS-associated mutation in CDSN, a homozygous 4 bp duplication in the second exon of the gene (c.164_167dup GCCT; p.Thr57ProfsX6). These data further support the notion that corneodesmosin deficiency impairs cell-cell adhesion in the upper epidermis, paving the way for an abnormal inflammatory response due to epidermal barrier disruption.
[A case of skin autograft for skin ulcers in ichthyosis].
Li, Shiwei; Yang, Xiaodong; Liu, Lijun; Tang, Xueyang
2017-10-28
Ichthyosis refers to a group of skin diseases characterized by abnormal keratinization of the epidermis, resulting in dryness, roughness and scale of the skin. A girl with ichthyosis, who presented with skin ulcers and infection of the right dorsal foot, was admitted to our department. An autologous razor-thin skin grafting procedure was performed to repair the skin ulcers after debridement and vacuum sealing drain. After 8 months of follow-up, both the donor and recipient site healed well and there were no newly formed ulcers or infections. Although the skin quality of ichthyosis is poor, the lesion area can still be used as donor or recipient cite.
... this page: //medlineplus.gov/ency/presentations/100100.htm Skin graft - series—Normal anatomy To use the sharing features ... entire body, and acts as a protective barrier. Skin grafts may be recommended for: Extensive wounds Burns Specific ...
Nanoscale alterations of corneocytes indicate skin disease
Franz, J.; Beutel, M.; Gevers, K.; Kramer, A.; Thyssen, J. P.; Kezic, S.; Riethmüller, C.
2016-01-01
The skin barrier protects the organism against exogenous stressors and simultaneously prevents excessive water loss. While the delicate regulation of skin barrier is not completely understood, morphological and histological evaluation remain key features of clinical investigations. Here, we extended
Ectodermal dysplasia-skin fragility syndrome: A rare case report
Directory of Open Access Journals (Sweden)
Subhash Kashyap
2015-01-01
Full Text Available Ectodermal dysplasia/skin fragility syndrome (ED-SFS is a newly described autosomal recessive disorder characterized by skin fragility and blistering, palmoplantar keratoderma, abnormal hair growth, nail dystrophy, and occasionally defective sweating. It results from mutations in the PKP1 gene encoding plakophilin 1 (PKP1, which is an important component of stratifying epithelial desmosomes and a nuclear component of many cell types. Only 12 cases of this rare genodermatosis have been reported so far. We present an unusual case of ED-SFS in a 12-year boy who was normal at birth but subsequently developed skin fragility, hair and nail deformities, abnormal dentition, palmoplantar keratoderma, and abnormal sweating but no systemic abnormality.
Devices for overcoming biological barriers: the use of physical forces to disrupt the barriers.
Mitragotri, Samir
2013-01-01
Overcoming biological barriers including skin, mucosal membranes, blood brain barrier as well as cell and nuclear membrane constitutes a key hurdle in the field of drug delivery. While these barriers serve the natural protective function in the body, they limit delivery of drugs into the body. A variety of methods have been developed to overcome these barriers including formulations, targeting peptides and device-based technologies. This review focuses on the use of physical methods including acoustic devices, electric devices, high-pressure devices, microneedles and optical devices for disrupting various barriers in the body including skin and other membranes. A summary of the working principles of these devices and their ability to enhance drug delivery is presented. Copyright © 2012. Published by Elsevier B.V.
Percutaneous penetration through slightly damaged skin
DEFF Research Database (Denmark)
Nielsen, Jesper B
2005-01-01
with human skin. A slight damage to the barrier integrity was induced by pre-treatment of the skin with sodium lauryl sulphate (SLS) before pesticide exposure. The experimental model with 3 h pre-treatment with SLS (0.1% or 0.3%) assured a significant but controlled damage to the barrier integrity, a damage...
Impact of chemical peeling combined with negative pressure on human skin.
Kim, S J; Kang, I J; Shin, M K; Jeong, K H; Baek, J H; Koh, J S; Lee, S J
2016-10-01
In vivo changes in skin barrier function after chemical peeling with alpha hydroxyacids (AHAs) have been previously reported. However, the additional effects of physical treatment with chemical agents on skin barrier function have not been adequately studied. This study measured the degree of acute skin damage and the time required for skin barrier repair using non-invasive bioengineering methods in vivo with human skin to investigate the additional effect of a 4% AHA chemical jet accelerated at supersonic velocities. Thirteen female subjects (average age: 29.54 ± 4.86 years) participated in this study. The faces of the subjects were divided into half according to the block randomization design and were then assigned to receive AHA peeling alone or AHA peeling combined with pneumatic pressure on each side of the face. Transepidermal water loss (TEWL), skin colour and skin blood flow were evaluated at baseline and at 30 min, 2, 5 and 7 days after treatment. The TEWL and skin blood flow were significantly increased after 30 min in chemodermabrasion compared with chemical peeling alone (P peeling alone (P < 0.05). Chemodermabrasion can temporarily impair skin barriers, but it is estimated that it can enhance the skin barrier function after 7 days compared to the use of a chemical agent alone. In addition, chemodermabrasion has a more effective impact in the dermis and relatively preserves the skin barrier. © 2016 Society of Cosmetic Scientists and the Société Française de Cosmétologie.
Chromium-induced skin damage among Taiwanese cement workers.
Chou, Tzu-Chieh; Wang, Po-Chih; Wu, Jyun-De; Sheu, Shiann-Cherng
2016-10-01
Little research has been done on the relationships between chromium exposure, skin barrier function, and other hygienic habits in cement workers. Our purpose was to investigate chromium-induced skin barrier disruption due to cement exposure among cement workers. One hundred and eight cement workers were recruited in this study. Urinary chromium concentration was used to characterize exposure levels. The biological exposure index was used to separate high and low chromium exposure. Transepidermal water loss (TEWL) was used to assess the skin barrier function. TEWL was significantly increased in workers with high chromium exposure levels than those with low chromium exposure levels (p = 0.048). A positive correlation was also found between urinary chromium concentration and TEWL (R = 0.28, p = 0.004). After adjusting for smoking status and glove use, a significant correlation between urinary chromium concentrations and TEWL remained. Moreover, workers who smoked and had a high chromium exposure had significantly increased TEWL compared to nonsmokers with low chromium exposure (p = 0.01). Skin barrier function of cement workers may have been disrupted by chromium in cement, and smoking might significantly enhance such skin barrier perturbation with chromium exposure. Decreased chromium skin exposure and smoking cessation should be encouraged at work. © The Author(s) 2015.
Skin absorption through atopic dermatitis skin
DEFF Research Database (Denmark)
Halling-Overgaard, A-S; Kezic, S; Jakasa, I
2017-01-01
Patients with atopic dermatitis have skin barrier impairment in both lesional and non-lesional skin. They are typically exposed to emollients daily and topical anti-inflammatory medicaments intermittently, hereby increasing the risk of developing contact allergy and systemic exposed to chemicals...... ingredients found in these topical preparations. We systematically searched for studies that investigated skin absorption of various penetrants, including medicaments, in atopic dermatitis patients, but also animals with experimentally induced dermatitis. We identified 40 articles, i.e. 11 human studies...... examining model penetrants, 26 human studies examining atopic dermatitis drugs and 3 animal studies. We conclude that atopic dermatitis patients have nearly two-fold increased skin absorption when compared to healthy controls. There is a need for well-designed epidemiological and dermato...
Water vapour loss measurements on human skin.
Valk, Petrus Gerardus Maria van der
1984-01-01
In this thesis, the results of a series of investigations into the barrier function of human skin are presented. In these investigations, the barrier function was assessed by water vapour loss measurements of the skin using a method based on gradient estimation.... Zie: Summary and conclusions
Notman, Rebecca; Anwar, Jamshed; Briels, W. J.; Noro, Massimo G.; den Otter, Wouter K.
2008-01-01
Transmembrane pore formation is central to many biological processes such as ion transport, cell fusion, and viral infection. Furthermore, pore formation in the ceramide bilayers of the stratum corneum may be an important mechanism by which penetration enhancers such as dimethylsulfoxide (DMSO) weaken the barrier function of the skin. We have used the potential of mean constraint force (PMCF) method to calculate the free energy of pore formation in ceramide bilayers in both the innate gel pha...
Energy Technology Data Exchange (ETDEWEB)
Lacroix, D
2001-07-01
In this work, we introduce a method to reduce the microscopic mean-field theory to a classical macroscopic dynamics at the initial stage of fusion reaction. We show that TDHF (Time-dependent Hartree-Fock) could be a useful tool to infer information on the fusion barrier as well as on one-body dissipation effect. We apply the reduction of information to the case of head-on reaction between a {sup 16}O and {sup 16,22,24,28}O in order to quantify the effect of neutron skin on fusion. We show that the precise determination of fusion barrier requires, in addition to the relative distance between center of mass, the introduction of an additional collective coordinate that explicitly breaks the neutron-proton symmetry. With this additional collective variable, we obtain a rather precise determination of the barrier position, height and diffuseness as well as one-body friction. (author)
Jager, Miranda Wilhelmina de
2006-01-01
The research outlined in this thesis was focused on the development of a skin barrier model, which can substitute for stratum corneum in diffusion studies. This so-called stratum corneum substitute (SCS) was prepared with reconstituted SC lipids (cholesterol, free fatty acids and ceramides) on a
Photodynamic therapy for skin field cancerization
DEFF Research Database (Denmark)
Braathen, L R; Morton, C A; Basset-Seguin, N
2012-01-01
in this area. With respect to the skin, this term is used to define the presence of multiple non-melanoma skin cancer, its precursors, actinic keratoses and dysplastic keratinocytes in sun exposed areas. The multiplicity of the lesions and the extent of the area influence the treatment decision. Providing...... paper the use of PDT for the treatment of field cancerized skin is reviewed and recommendations are given for its use.......Field cancerization is a term that describes the presence of genetic abnormalities in a tissue chronically exposed to a carcinogen. These abnormalities are responsible for the presence of multilocular clinical and sub-clinical cancerous lesions that explains the increased risks of multiple cancers...
Blaak, J; Dähnhardt, D; Dähnhardt-Pfeiffer, S; Bielfeldt, S; Wilhelm, K-P; Wohlfart, R; Staib, P
2017-06-01
Xerosis is a serious problem among the very old. It is a dermatological challenge caused by significant alterations in stratum corneum (SC) function and structure. Two negative changes in aged skin are (i) the enhanced skin surface pH and (ii) the altered SC lipid content, composition and ordering. Therefore, we investigated the way in which an acidic skin care product with different plant oils affects SC function, structure and lipid profile in older subjects with dry skin. Before and after a 3-week application period, different biophysical measurements were performed: transepidermal water loss, SC hydration and skin surface pH. In addition, the SC lipid matrix was evaluated by analysis of the intercellular lipid lamellae and the SC lipid profile. After treatment, a significant increase in lipid lamellae in the intercellular space of the SC was observed in the area treated with the test product compared to the untreated area. Furthermore, the ceramide level was found to be increased, although ceramides were not provided by the acidic test formulation. In summary, topical application of a pH 4.0 product containing plant oils improves epidermal barrier formation and SC lipid ordering and ratio in aged dry skin. © 2016 Society of Cosmetic Scientists and the Société Française de Cosmétologie.
Stratum corneum damage and ex vivo porcine skin water absorption - a pilot study
DEFF Research Database (Denmark)
Duch Lynggaard, C; Bang Knudsen, D; Jemec, G B E
2009-01-01
A simple ex vivo screening technique would be of interest for mass screening of substances for potential barrier disruptive qualities. Ex vivo water absorption as a marker of skin barrier integrity was studied on pig ear skin. Skin water absorption was quantified by weighing and weight changes were...... found to reflect prehydration barrier damage. It is suggested that this simple model may be elaborated to provide a rapid, economical screening tool for potential skin irritants....
Skin moisturization mechanisms: new data.
Bonté, F
2011-05-01
The main function of the skin is to protect the body against exogenous substances and excessive water loss. The skin barrier is located in the outermost layer of the skin, called the stratum corneum, which is composed of corneocytes, originating from the keratinocytes differentiation process, embedded in organized complex lipid domains. Moisturizing of the skin is recognized as the first anti-aging skin care. Skin moisturization is essential for its appearance, protection, complexion, softness and the reinforcement of its barrier properties against deleterious and exogenous environmental factors. The intrinsic water binding capacity of skin is not only due to the complex natural moisturizing factor present in corneocytes, but also to hyaluronic acid and a regulated water transport within the skin. Recent data shows that the water movements between the cells at the different levels of the epidermis are due to dedicated water and glycerol transport proteins named aquaporins. Their role in the skin moisturization is completed by corneodesmosomes and tight junctions. Water and pH are now shown to be of prime importance in the regulation of the epidermal enzymes linked to corneocytes desquamation and lipid synthesis. Furthermore, the level of moisturization of the skin is important in its protection against repeated exposure to various irritant agents or phenomena such as very frequent washing with strong tensioactive materials. Copyright © 2011 Elsevier Masson SAS. All rights reserved.
Heavy Cigarette Smokers in a Chinese Population Display a Compromised Permeability Barrier
Xin, Shujun; Ye, Li; Lv, Chengzhi; Elias, Peter M.
2016-01-01
Cigarette smoking is associated with various cutaneous disorders with defective permeability. Yet, whether cigarette smoking influences epidermal permeability barrier function is largely unknown. Here, we measured skin biophysical properties, including permeability barrier homeostasis, stratum corneum (SC) integrity, SC hydration, skin surface pH, and skin melanin/erythema index, in cigarette smokers. A total of 99 male volunteers were enrolled in this study. Smokers were categorized as light-to-moderate (hydration and skin melanin/erythema index on the dorsal hand, forehead, and cheek. Basal transepidermal water loss (TEWL) and barrier recovery rates were assessed on the forearm. A Skin-pH-Meter pH900 was used to measure skin surface pH. Our results showed that heavy cigarette smokers exhibited delayed barrier recovery after acute abrogation (1.02% ± 13.06 versus 16.48% ± 6.07), and barrier recovery rates correlated negatively with the number of daily cigarettes consumption (p = 0.0087). Changes in biophysical parameters in cigarette smokers varied with body sites. In conclusion, heavy cigarette smokers display compromised permeability barrier homeostasis, which could contribute, in part, to the increased prevalence of certain cutaneous disorders characterized by defective permeability. Thus, improving epidermal permeability barrier should be considered for heavy cigarette smokers. PMID:27437403
Micheli, Chiara; Palese, Alvisa; Canzan, Federica; Ambrosi, Elisa
2017-10-01
In the industrialized world, approximately 1-1.5% of the population has received treatments for skin lesions. In the 1990s, a polymeric barrier film called the No Sting Barrier Film (NSBF) was developed as an alternative to petrolatum-based ointments and zinc oxide formulas. To date, few studies have explored the effectiveness of NSBF in protecting skin integrity. To map the methods, fields and outcomes used to produce evidence on NSBF effectiveness. A scoping review was performed in 2015. A search strategy for identifying relevant studies was designed and performed. Systematic reviews, meta-analyses, randomized controlled trials, controlled clinical trials, and comparative studies for all types of interventions were included; research conducted in any clinical context was eligible for inclusion. Studies were selected by two reviewers; data extraction and analysis also was performed by two reviewers and disagreements were discussed. Six studies were included. NSBF's potential as a skin protector was investigated with respect to (a) chronic wounds (pressure ulcers or vascular leg ulcers); (b) urinary or fecal incontinence; and (c) post-mastectomy irradiation. The principal clinical outcomes investigated were, respectively: (a) wound healing, wound exudates and erythema control; (b) incidence of incontinence-associated dermatitis and skin reactions; and (c) intensity of pruritus and skin reactions. Pain and comfort were measured in all clinical applications. The main process outcomes investigated were: (a) ease of application, (b) application and removal time, and (c) costs. Zinc oxide and petroleum formulations were the most common comparison interventions in research on chronic ulcers and incontinence; sorbolene cream and topical corticosteroids were the most frequent comparisons in the context of post-mastectomy irradiation. NBSF may be used for peri-wound skin protection in patients with chronic wounds, with urinary or fecal incontinence and for women undergoing
Sakuma, Thais H; Maibach, Howard I
2012-01-01
Oily skin (seborrhea) is a common cosmetic problem that occurs when oversized sebaceous glands produce excessive amounts of sebum giving the appearance of shiny and greasy skin. This paper overviews the main concepts of sebaceous gland anatomy and physiology, including the biosynthesis, storage and release of sebum, as well as its relationship to skin hydration and water barrier function. We also address how skin oiliness may vary according to diet, age, gender, ethnicity and hot humid climates. The deeper understanding of this skin type provides the opportunity to better guide patients regarding skin care and also assist in the development of sebosuppressive agents. Copyright © 2012 S. Karger AG, Basel.
The important role of stratum corneum lipids for the cutaneous barrier function.
van Smeden, J; Janssens, M; Gooris, G S; Bouwstra, J A
2014-03-01
The skin protects the body from unwanted influences from the environment as well as excessive water loss. The barrier function of the skin is located in the stratum corneum (SC). The SC consists of corneocytes embedded in a lipid matrix. This lipid matrix is crucial for the lipid skin barrier function. This paper provides an overview of the reported SC lipid composition and organization mainly focusing on healthy and diseased human skin. In addition, an overview is provided on the data describing the relation between lipid modulations and the impaired skin barrier function. Finally, the use of in vitro lipid models for a better understanding of the relation between the lipid composition, lipid organization and skin lipid barrier is discussed. This article is part of a Special Issue entitled The Important Role of Lipids in the Epidermis and their Role in the Formation and Maintenance of the Cutaneous Barrier. This article is part of a Special Issue entitled The Important Role of Lipids in the Epidermis and their Role in the Formation and Maintenance of the Cutaneous Barrier. Guest Editors: Kenneth R. Feingold and Peter Elias. Copyright © 2013 Elsevier B.V. All rights reserved.
Lentiginosis, Deafness and Cardiac Abnormalities*
African Journals Online (AJOL)
1973-01-06
Jan 6, 1973 ... His height. mass. intelligence and genitalia were normal. The aSSOCiatIOn between deafness and disturbance of cardiac conduction and between pigmented skin lesions and cardiac abnormalities, has been well described. Should. ~I patient present with multiple lentigines and/or familial sensineural ...
Biogenic silica fibre promotes carcinogenesis in mouse skin.
Bhatt, T; Coombs, M; O'Neill, C
1984-10-15
Silica fibres derived from plants are common contaminants of human diet in certain regions of the world where oesophageal cancer reaches extremely high incidences. We show here that one of these types of fibre (derived from Phalaris canariensis L) promotes the occurrence of tumours in the skin of mice initiated with a polycyclic carcinogen. Three experiments are described. In the first, the grain which bears these fibres was added to the diet. This did not result in any abnormality in any part of the gastrointestinal tract, but there was a significant induction of tumours in the skin around the mouth and nose; these were the areas of the body surface which most frequently came into contact with the grain. In the second experiment, the mice were separated from the grain by an intervening wire gauze barrier; a similar number of tumours appeared on initiated mice treated in this way. In this case, contact now occurred most frequently on the dorsal surface, which was rubbed against the gauze barrier, and it was on this surface that the tumours appeared. No tumours appeared if the grain was removed. In the third experiment, pure fibres were isolated from the surface of the grain and boiled in strong nitric acid so as to remove any organic material. When these acid-cleaned fibres were applied to the initiated skin with light pressure, they promoted carcinogenesis in the same way as croton oil. In each experiment the majority of tumours produced were benign neoplasms, together with at least one squamous carcinoma. It seems possible that the size and shape of these fibres are the critical properties determining their promoting activity. Their mean diameter is 15 microns, their modal length close to 200 microns, and they are sharply pointed with a tip diameter of 0.5 micron.
Gonçalves, Giovana M; Brianezi, Gabrielli; Miot, Hélio Amante
2017-01-01
The pH of the skin is slightly acidic (4.6 to 5.8) which is important for appropriate antibacterial, antifungal, constitution of barrier function, as well as structuring and maturation of the stratum corneum. This study aimed to evaluate the pH of the main commercial moisturizers and liquid soaps in Brazil. Thus, pH of the products was quantified by pH meter in three measurements. A total of 38 moisturizers and six commercial liquid soaps were evaluated. Mean pH of 63% and 50% of the moisturizing and liquid soaps presented results above 5.5, disfavoring repair, function, and synthesis of dermal barrier.
Gonçalves, Giovana M; Brianezi, Gabrielli; Miot, Hélio Amante
2017-01-01
The pH of the skin is slightly acidic (4.6 to 5.8) which is important for appropriate antibacterial, antifungal, constitution of barrier function, as well as structuring and maturation of the stratum corneum. This study aimed to evaluate the pH of the main commercial moisturizers and liquid soaps in Brazil. Thus, pH of the products was quantified by pH meter in three measurements. A total of 38 moisturizers and six commercial liquid soaps were evaluated. Mean pH of 63% and 50% of the moisturizing and liquid soaps presented results above 5.5, disfavoring repair, function, and synthesis of dermal barrier. PMID:29166523
Structure and Function of Your Skin
... Name: Category: Share: Yes No, Keep Private Structure & Function of Your Skin Share | What It Looks Like . . . ... in the dermis. What It Does . . . The major function of skin is to provide a barrier between ...
DEFF Research Database (Denmark)
Tetens, Inge
related to a combination of flaxseed oil and vitamin E and maintenance of the skin permeability barrier function. The food constituent that is the subject of the health claim is a combination of flaxseed oil and vitamin E. The Panel considers that the combination of flaxseed oil and vitamin E...... be drawn from these studies for the scientific substantiation of the claim. The Panel concludes that a cause and effect relationship has not been established between the consumption of a combination of flaxseed oil and vitamin E and maintenance of the skin permeability barrier function...... is sufficiently characterised. The claimed effect is “contributes to maintain skin permeability barrier function”. The target population proposed by the applicant is healthy adults with dry and sensitive skin. Maintenance of the permeability barrier function of the skin is a beneficial physiological effect...
Electrochemical monitoring of native catalase activity in skin using skin covered oxygen electrode.
Nocchi, Sarah; Björklund, Sebastian; Svensson, Birgitta; Engblom, Johan; Ruzgas, Tautgirdas
2017-07-15
A skin covered oxygen electrode, SCOE, was constructed with the aim to study the enzyme catalase, which is part of the biological antioxidative system present in skin. The electrode was exposed to different concentrations of H 2 O 2 and the amperometric current response was recorded. The observed current is due to H 2 O 2 penetration through the outermost skin barrier (referred to as the stratum corneum, SC) and subsequent catalytic generation of O 2 by catalase present in the underlying viable epidermis and dermis. By tape-stripping the outermost skin layers we demonstrate that SC is a considerable diffusion barrier for H 2 O 2 penetration. Our experiments also indicate that skin contains a substantial amount of catalase, which is sufficient to detoxify H 2 O 2 that reaches the viable epidermis after exposure of skin to high concentrations of peroxide (0.5-1mM H 2 O 2 ). Further, we demonstrate that the catalase activity is reduced at acidic pH, as compared with the activity at pH 7.4. Finally, experiments with often used penetration enhancer thymol shows that this compound interferes with the catalase reaction. Health aspect of this is briefly discussed. Summarizing, the results of this work show that the SCOE can be utilized to study a broad spectrum of issues involving the function of skin catalase in particular, and the native biological antioxidative system in skin in general. Copyright © 2017 Elsevier B.V. All rights reserved.
[ROLE OF microRNA IN SKIN DEVELOPMENT AND WOUND HEALING].
Song, Zhifang; Liu, Dewu
2014-07-01
To review the role of microRNA (miRNA) in skin development and wound healing. The recent literature about miRNA in skin development and wound healing was reviewed and analyzed. miRNA extensively involved in the development of the skin, including epidermal cell proliferation, differentiation, aging and hair follicle development; miR-203 known as the "skin-specific miRNA" can directly inhibit the expression of p63 and promote the differentiation of the epidermis. Meanwhile, miRNA also involved in various stages of skin regeneration and wound healing. Abnormal expression of miRNA is closely related with abnormal wound healing. miRNA play an important role in maintaining normal skin physiology and skin regeneration. To explore their roles in the healing of skin wounds and their regulatory mechanism can provide a new target for the treatment, which has a potential value and broad prospects.
Energy Technology Data Exchange (ETDEWEB)
Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)
2014-11-14
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Gentle cleansing and moisturizing for patients with atopic dermatitis and sensitive skin.
Cheong, Wai Kwong
2009-01-01
Atopic dermatitis is a common condition characterized by pruritus, inflammation, and dryness of the skin. Inflammation disrupts the barrier function of the stratum corneum, predisposing the skin to be dry, and increases susceptibility to irritants and secondary bacterial infection. Sensitive skin is common, reported by 40-50% of women and 30% of men in the US, Europe, and Japan. Basic requirements in managing eczema and sensitive skin include effective cleansers that do not compromise skin barrier integrity, alleviation of skin dryness, and restoration of skin barrier function through the use of therapeutic moisturizers. The selection of a skin cleanser is therefore an important part of managing these conditions. Studies have reported clinical improvement with the use of soap-free cleansers in combination with topical treatments. While topical corticosteroids and immunosuppressive agents are mainstays of treatment for atopic dermatitis, therapeutic moisturizers are important adjuncts. Moisturizers improve skin hydration, reduce susceptibility to irritation, restore the integrity of the stratum corneum, and enhance the efficacy of topical corticosteroids.
Törmä, Hans; Lindberg, Magnus; Berne, Berit
2008-05-01
Detergents are skin irritants affecting keratinocytes. In this study, healthy volunteers were exposed to water (vehicle) and 1% sodium lauryl sulfate (SLS) under occlusive patch tests for 24 hours. The messenger RNA (mRNA) expression of keratinocyte differentiation markers and of enzymes involved in corneodesmosome degradation was examined in skin biopsies (n=8) during the repair phase (6 hours to 7 days postexposure) using real-time reverse-transcription PCR. It was found that the expression of involucrin was increased at 6 hours, but then rapidly normalized. The expression of transglutaminase 1 exhibited a twofold increase after 24 hours in the SLS-exposed skin. Profilaggrin was decreased after 6 hours. Later (4-7 days), the expression in SLS-exposed areas was >50% above than in control areas. An increased and altered immunofluorescence pattern of involucrin, transglutaminase 1, and filaggrin was also found (n=4). At 6 hours post-SLS exposure, the mRNA expression of kallikrein-7 (KLK-7) and kallikrein-5 (KLK-5) was decreased by 50 and 75%, respectively, as compared with control and water-exposed areas. Thereafter, the expression pattern of KLK-7 and KLK-5 was normalized. Changes in protein expression of KLK-5 were also found. In conclusion, SLS-induced skin barrier defects induce altered mRNA expression of keratinocyte differentiation markers and enzymes degrading corneodesmosomes.
Supplementation with Eskimo Skin Care improves skin elasticity in women. A pilot study.
Segger, Dörte; Matthies, Andreas; Saldeen, Tom
2008-01-01
To investigate the question of whether supplementation with an oral oil formulation rich in natural stable fish oil can alter skin elasticity, transepidermal water loss (TEWL), and skin roughness in healthy women. Twenty-four healthy women aged 40-60 years participated in a single-blind randomized trial for testing the effect of a proprietary oral supplement for skin nutrition (Eskimo Skin Care) on skin elasticity, TEWL, and skin roughness. Skin elasticity was measured by an optical cutometer, TEWL by a water-loss module based upon the vapour gradient principle, and skin roughness with a three-dimensional microtopography imaging system. Skin elasticity increased by 10% after 3 months of treatment with the supplement, a statistically significant increase in comparison with the control group (p=0.0298). There was a trend, though not statistically significant, towards a positive influence on the skin's barrier function. No effect on the skin roughness was observed. Eskimo Skin Care, an oral preparation rich in natural stable fish oil, can improve skin elasticity.
Selenoproteins are essential for proper keratinocyte function and skin development.
Directory of Open Access Journals (Sweden)
Aniruddha Sengupta
2010-08-01
Full Text Available Dietary selenium is known to protect skin against UV-induced damage and cancer and its topical application improves skin surface parameters in humans, while selenium deficiency compromises protective antioxidant enzymes in skin. Furthermore, skin and hair abnormalities in humans and rodents may be caused by selenium deficiency, which are overcome by dietary selenium supplementation. Most important biological functions of selenium are attributed to selenoproteins, proteins containing selenium in the form of the amino acid, selenocysteine (Sec. Sec insertion into proteins depends on Sec tRNA; thus, knocking out the Sec tRNA gene (Trsp ablates selenoprotein expression. We generated mice with targeted removal of selenoproteins in keratin 14 (K14 expressing cells and their differentiated descendents. The knockout progeny had a runt phenotype, developed skin abnormalities and experienced premature death. Lack of selenoproteins in epidermal cells led to the development of hyperplastic epidermis and aberrant hair follicle morphogenesis, accompanied by progressive alopecia after birth. Further analyses revealed that selenoproteins are essential antioxidants in skin and unveiled their role in keratinocyte growth and viability. This study links severe selenoprotein deficiency to abnormalities in skin and hair and provides genetic evidence for the role of these proteins in keratinocyte function and cutaneous development.
Personnel decontamination and preventive skin care
International Nuclear Information System (INIS)
Henning, Klaus; Gojowczyk, Peter
2010-01-01
Skin contamination arises from contact with contaminated aqueous solutions and from transmission of radioactively contaminated dirt particles. As long as the surface of the skin is neither inflamed nor showing any lesions, normally only a limited part of the top layer (epidermis), i.e. the upper layers of the stratum corneum, is contaminated. The intact horny layer has a barrier function protecting against the penetration of chemicals and dirt particles. The horny layer can be damaged by water, solvents, alkaline substances, and acids. In general, it is safe to say that the horny layer acts as a natural barrier to the penetration of liquid and particulate impurities into lower layers of the skin. As long as the horny layer is intact and free from lesions, the risk of incorporation can be considered low. When decontaminating and cleansing the skin, also in daily skin cleansing, care must be taken to prevent the acid protective layer and the horny layer from being compromised. Daily cleansing and cleansing for decontamination must be carried out with a mild, weakly acidic detergent. In addition, prevention should be achieved daily by applying a non-greasy skin lotion to protect the skin. Following a systematic regular regimen in skin cleansing and preventive skin care as well as a specific approach in skin decontamination and cleansing will avoid damage to the skin and remove any contamination incurred. This approach comprises a three-pronged concept, namely skin protection, cleansing and care. (orig.)
Rojo de la Vega, Montserrat; Krajisnik, Andrea; Zhang, Donna D; Wondrak, Georg T
2017-12-18
The transcription factor NRF2 (nuclear factor-E2-related factor 2) orchestrates major cellular defense mechanisms including phase-II detoxification, inflammatory signaling, DNA repair, and antioxidant response. Recent studies strongly suggest a protective role of NRF2-mediated gene expression in the suppression of cutaneous photodamage induced by solar UV (ultraviolet) radiation. The apocarotenoid bixin, a Food and Drug Administration (FDA)-approved natural food colorant (referred to as 'annatto') originates from the seeds of the achiote tree native to tropical America, consumed by humans since ancient times. Use of achiote preparations for skin protection against environmental insult and for enhanced wound healing has long been documented. We have recently reported that (i) bixin is a potent canonical activator of the NRF2-dependent cytoprotective response in human skin keratinocytes; that (ii) systemic administration of bixin activates NRF2 with protective effects against solar UV-induced skin damage; and that (iii) bixin-induced suppression of photodamage is observable in Nrf2 +/+ but not in Nrf2 -/- SKH-1 mice confirming the NRF2-dependence of bixin-induced antioxidant and anti-inflammatory effects. In addition, bixin displays molecular activities as sacrificial antioxidant, excited state quencher, PPAR (peroxisome proliferator-activated receptor) α/γ agonist, and TLR (Toll-like receptor) 4/NFκB (nuclear factor kappa-light-chain-enhancer of activated B cells) antagonist, all of which might be relevant to the enhancement of skin barrier function and environmental stress protection. Potential skin photoprotection and photochemoprevention benefits provided by topical application or dietary consumption of this ethno-pharmacologically validated phytochemical originating from the Americas deserves further preclinical and clinical examination.
Directory of Open Access Journals (Sweden)
Montserrat Rojo de la Vega
2017-12-01
Full Text Available The transcription factor NRF2 (nuclear factor-E2-related factor 2 orchestrates major cellular defense mechanisms including phase-II detoxification, inflammatory signaling, DNA repair, and antioxidant response. Recent studies strongly suggest a protective role of NRF2-mediated gene expression in the suppression of cutaneous photodamage induced by solar UV (ultraviolet radiation. The apocarotenoid bixin, a Food and Drug Administration (FDA-approved natural food colorant (referred to as ‘annatto’ originates from the seeds of the achiote tree native to tropical America, consumed by humans since ancient times. Use of achiote preparations for skin protection against environmental insult and for enhanced wound healing has long been documented. We have recently reported that (i bixin is a potent canonical activator of the NRF2-dependent cytoprotective response in human skin keratinocytes; that (ii systemic administration of bixin activates NRF2 with protective effects against solar UV-induced skin damage; and that (iii bixin-induced suppression of photodamage is observable in Nrf2+/+ but not in Nrf2−/− SKH-1 mice confirming the NRF2-dependence of bixin-induced antioxidant and anti-inflammatory effects. In addition, bixin displays molecular activities as sacrificial antioxidant, excited state quencher, PPAR (peroxisome proliferator-activated receptor α/γ agonist, and TLR (Toll-like receptor 4/NFκB (nuclear factor kappa-light-chain-enhancer of activated B cells antagonist, all of which might be relevant to the enhancement of skin barrier function and environmental stress protection. Potential skin photoprotection and photochemoprevention benefits provided by topical application or dietary consumption of this ethno-pharmacologically validated phytochemical originating from the Americas deserves further preclinical and clinical examination.
Protecting the radiation-damaged skin from friction: a mini review
International Nuclear Information System (INIS)
Herst, Patries M
2014-01-01
Radiation-induced skin reactions are an unavoidable side effect of external beam radiation therapy, particularly in areas prone to friction and excess moisture such as the axilla, head and neck region, perineum and skin folds. Clinical studies investigating interventions for preventing or managing these reactions have largely focussed on formulations with moisturising, anti-inflammatory, anti-microbial and wound healing properties. However, none of these interventions has emerged as a consistent candidate for best practice. Much less emphasis has been placed on evaluating ways to protect the radiation-damaged skin from friction and excess moisture. This mini review analyses the clinical evidence for barrier products that form a protective layer by adhering very closely to the skin folds and do not cause further trauma to the radiation-damaged skin upon removal. A database search identified only two types of barrier products that fitted these criteria and these were tested in two case series and six controlled clinical trials. Friction protection was most effective when the interventions were used from the start of treatment and continued for several weeks after completion of treatment. Soft silicone dressings (Mepilex Lite and Mepitel Film) and Cavilon No Sting Barrier Film, but not Cavilon Moisturizing Barrier Cream, decreased skin reaction severity, most likely due to differences in formulation and skin build-up properties. It seems that prophylactic use of friction protection of areas at risk could be a worthwhile addition to routine care of radiation-damaged skin
Kim, Dong Young; Park, Hyun Sun; Yoon, Hyun-Sun; Cho, Soyun
2015-10-01
Keloids and hypertrophic scars are prevalent and psychologically distressful dermatologic conditions. Various treatment modalities have been tried but without complete success by any one method. We evaluated the efficacy of a combination of intense pulsed light (IPL) device and intralesional corticosteroid injection for the treatment of keloids and hypertrophic scars with respect to the recovery of skin barrier function. Totally 52 Korean patients were treated by the combined treatment at 4-8-week intervals. Using digital photographs, changes in scar appearance were assessed with modified Vancouver Scar Scale (MVSS), physicians' global assessment (PGA) and patient's satisfaction score. In 12 patients, the stratum corneum (SC) barrier function was assessed by measuring transepidermal water loss (TEWL) and SC capacitance. Most scars demonstrated significant clinical improvement in MVSS, PGA and patient's satisfaction score after the combined therapy. A significant decrease of TEWL and elevation of SC capacitance were also documented after the treatment. The combination therapy (IPL + corticosteroid injection) not only improves the appearance of keloids and hypertrophic scars but also increases the recovery level of skin hydration status in terms of the skin barrier function.
Formation of a protection film on the human skin by microparticles
International Nuclear Information System (INIS)
Lademann, J; Schanzer, S; Richter, H; Knorr, F; Sterry, W; Patzelt, A; Antoniou, C
2008-01-01
Laser scanning microscopy and tape stripping, in combination with optical methods, were used to analyze the distribution and penetration of a barrier cream into the horny layer (stratum corneum) of the human skin under in vivo conditions. The barrier cream contained microparticles of 10 – 100 μm loaded with antioxidant substances. The cream was designed for protection of the skin surface against the destructive action of free radicals, produced by systemically applied chemotherapeutic agents reaching the skin surface via the sweat. Both methods were able to demonstrate that the barrier cream was distributed homogeneously on the skin surface forming a protection film. A penetration into deeper parts of the stratum corneum (SC) was not observed
Woo, Seon Wook; Rhim, Dong-Bin; Kim, Changhee; Hwang, Jae-Kwan
2015-03-01
The skin plays a key role in protecting the body from the environment and from water loss. Cornified envelope (CE) and natural moisturizing factor (NMF) are considered as the primary regulators of skin hydration and barrier function. The CE prevents loss of water from the body and is formed by cross-linking of several proteins. Among these proteins, filaggrin is an important protein because NMF is produced by the degradation of filaggrin. Proteases, including matriptase and prostasin, stimulate the generation of filaggrin from profilaggrin and caspase-14 plays a role in the degradation of filaggrin. This study elucidated the effects of an ethanol extract of Boesenbergia pandurata (Roxb.) Schltr., known as fingerroot, and its active compound panduratin A on CE formation and filaggrin processing in HaCaT, human epidermal keratinocytes. B. pandurata extract (BPE) and panduratin A significantly stimulated not only CE formation but also the expression of CE proteins, such as loricrin, involucrin, and transglutaminase, which were associated with PPARα expression. The mRNA and protein levels of filaggrin and filaggrin-related enzymes, such as matriptase, prostasin, and caspase-14 were also up-regulated by BPE and panduratin A treatment. These results suggest that BPE and panduratin A are potential nutraceuticals which can enhance skin hydration and barrier function based on their CE formation and filaggrin processing.
Tfayli, Ali; Bonnier, Franck; Farhane, Zeineb; Libong, Danielle; Byrne, Hugh J; Baillet-Guffroy, Arlette
2014-06-01
The use of animals for scientific research is increasingly restricted by legislation, increasing the demand for human skin models. These constructs present comparable bulk lipid content to human skin. However, their permeability is significantly higher, limiting their applicability as models of barrier function, although the molecular origins of this reduced barrier function remain unclear. This study analyses the stratum corneum (SC) of one such commercially available reconstructed skin model (RSM) compared with human SC by spectroscopic imaging and chromatographic profiling. Total lipid composition was compared by chromatographic analysis (HPLC). Raman spectroscopy was used to evaluate the conformational order, lateral packing and distribution of lipids in the surface and skin/RSM sections. Although HPLC indicates that all SC lipid classes are present, significant differences are observed in ceramide profiles. Raman imaging demonstrated that the RSM lipids are distributed in a non-continuous matrix, providing a better understanding of the limited barrier function. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Rheological and sensory properties of hydrophilic skin protection gels based on polyacrylates.
Kulawik-Pióro, Agnieszka; Kurpiewska, Joanna; Kułaszka, Agnieszka
2018-03-01
With the current increases in occupational skin diseases, literature data attesting the decreasing efficiency of barrier creams with respect to the manufacturer's declarations and legal regulations granting skin protection gels for employees, research is required to analyse and evaluate the recipes used for hydrophilic skin protection gels based on polyacrylates. This study investigated the rheological properties, pH and sensory perception of hydrophilic barrier gels based on polyacrylates. The acrylic acid derivatives used were good thickeners, and helped to form transparent gels of adequate durability. They could be used to create hydrophilic films on the surface of the skin to protect it against hydrophobic substances. A correlation was shown between the results of the rheological properties and the barrier properties of the gels. This confirms the possibility of monitoring the quality of the gels at the stage of recipe development. Polyacrylates are viable for use in industry to produce hydrophilic barrier creams suitable for skin protection.
Facial skin care products and cosmetics.
Draelos, Zoe Diana
2014-01-01
Facial skin care products and cosmetics can both aid or incite facial dermatoses. Properly selected skin care can create an environment for barrier repair aiding in the re-establishment of a healing biofilm and diminution of facial redness; however, skin care products that aggressively remove intercellular lipids or cause irritation must be eliminated before the red face will resolve. Cosmetics are an additive variable either aiding or challenging facial skin health. Copyright © 2014 Elsevier Inc. All rights reserved.
Skin changes in chronic kidney disease
Directory of Open Access Journals (Sweden)
Joanna M. Przepiórka-Kosińska
2017-04-01
Full Text Available Chronic kidney disease causes skin changes which may sometimes be the first sign of kidney failure. Specific skin changes include acquired perforating dermatosis, porphyria cutanea tarda, pseudoporphyria, calcinosis and nephrogenic systemic fibrosis. The majority of patients present with cutaneous manifestations which are classified as non-specific, including xerosis, pruritus, pigmentation disturbances, nail plate abnormalities, uraemic frost and gynaecomastia. Treatment improving kidney function (dialysis therapy or kidney transplantation also leads to the resolution of skin lesions.
Oji, Vinzenz; Eckl, Katja-Martina; Aufenvenne, Karin; Nätebus, Marc; Tarinski, Tatjana; Ackermann, Katharina; Seller, Natalia; Metze, Dieter; Nürnberg, Gudrun; Fölster-Holst, Regina; Schäfer-Korting, Monika; Hausser, Ingrid; Traupe, Heiko; Hennies, Hans Christian
2010-01-01
Generalized peeling skin disease is an autosomal-recessive ichthyosiform erythroderma characterized by lifelong patchy peeling of the skin. After genome-wide linkage analysis, we have identified a homozygous nonsense mutation in CDSN in a large consanguineous family with generalized peeling skin, pruritus, and food allergies, which leads to a complete loss of corneodesmosin. In contrast to hypotrichosis simplex, which can be associated with specific dominant CDSN mutations, peeling skin disea...
von Grote, Erika C; Palaniswarmy, Kiruthi; Meckfessel, Matthew H
2016-12-01
Occupational irritant contact dermatitis (ICD) affecting the hands is a common and difficult-to-manage condition. Occupations that necessitate contact with harsh chemicals, use of alcohol-based disinfectants, and frequent hand washing elevate the risk of ICD. Management strategies that do not adequately prevent accumulated damage and repair skin, can develop into chronic dermatoses which negatively impact work productivity and quality of life. A 2-step skin-care regimen (Excipial Daily Protection Hand Cream (EP) and Excipial Rapid Repair Hand Cream (ER), Galderma Laboratories, L.P.) has been developed as a daily-use management strategy to protect and repair vulnerable hands. The protective barrier cream is formulated with aluminum chlorohydrate and designed for pre-exposure application to enhance the skin's natural protective barrier and minimize excessive moisture while wearing protective gloves. The repair cream, a lipid-rich formulation, is intended for post-exposure application to rehydrate and facilitate the skin's natural healing process. The results of 3 clinical studies highlighted in this review demonstrate how the use of a 2-step skin-care regimen offers a greater protective effect against ICD than the use of barrier cream alone, and also how the formulation of the barrier cream used in these studies helps minimize the occlusion effect caused by gloves and does not interfere with the antibacterial efficacy of an alcohol-based hand sanitizer. This 2-step skin-care regimen is effectively designed to manage and minimize the risk of ICD development in a variety of patients and provides clinicians an additional tool for helping patients manage ICD. J Drugs Dermatol. 2016;15(12):1504-1510.
Directory of Open Access Journals (Sweden)
I. N. Zakharova
2014-01-01
Full Text Available Human skin is a complex organ in its structure. Numerous functions of the skin may be impaired in its pathology. Anatomical and physiological characteristics of the skin in children predispose to common diseases of the skin. Diaper dermatitis is one of the most common skin diseases during infancy and childhood. Diapered skin is exposed to friction and excessive hydration, has a higher pH than nondiapered skin, and is repeatedly soiled with feces that contains enzymes with high irritation potential for the skin. Diaper dermatitis may vary in clinical severity and course. Therapeutically, frequent diaper changes and adequate skin care are most important. Appropriate skin care can help to prevent the occurrence of diaper dermatitis and to speed up the healing of affected skin. This includes frequent diaper changes and aeration, gentle cleansing, and the use of a barrier cream. For the treatment of diaper dermatitis agents selected depending on the presence and severity of complications. For prevention and treatment of uncomplicated diaper dermatitis effective means of containing dexpantenol.
A case of linear nevus sebaceous syndrome showing abnormalities by head CT scan
International Nuclear Information System (INIS)
Matsuda, Yoshio; Kuraya, Kazue; Sumiyoshi, Minoru; Seki, Shuichiro; Murakami, Naoki
1982-01-01
A female baby weighing 2,702 g, who was delivered spontaneously after 37 weeks of gestation, showed linear nevus sebaceous syndrome with abnormalities on EEG and head CT scan. Immediately after birth, the baby showed abnormalities of the skin in the left half of the body, especially from the head to the face. At the same time, EEG showed a low voltage on the affected side, and head CT scan showed expansion of the lateral ventricle. Funduscopic findings showed retinochoroidal toxoplasmosis-like degeneration. This disease has been rarely reported. An early diagnosis is seemed to be important since the skin lesion per se was premalignant, and generalized abnormalities including those of the central nervous system occurred concurrently. (Chiba, N.)
McAfee, John L; Warren, Christine B; Prayson, Richard A
2017-08-01
Ultrastructural evaluation of skin biopsies has been utilized for diagnosis of mitochondrial disease. This study investigates how frequently skin biopsies reveal mitochondrial abnormalities, correlates skin and muscle biopsy findings, and describes clinical diagnoses rendered following the evaluation. A retrospective review of surgical pathology reports from 1990 to 2015 identified skin biopsies examined by electron microscopy for suspected metabolic disease. A total of 630 biopsies were included from 615 patients. Of these patients, 178 also underwent a muscle biopsy. Of the 630 skin biopsies, 75 (12%) showed ultrastructural abnormalities and 34 (5%) specifically showed mitochondrial abnormalities including increased size (n=27), reduced or abnormal cristae (n=23), dense matrices (n=20), and increased number (n=8). Additional findings included lysosomal abnormalities (n=13), lipid accumulation (n=2) or glycogen accumulation (n=1). Of the 34 patients with mitochondrial abnormalities on skin biopsy, 20 also had muscle biopsies performed and nine showed abnormalities suggestive of a mitochondrial disorder including absent cytochrome oxidase staining (n=2), increased subsarcolemmal NADH, SDH, or cytochrome oxidase staining (n=1), or ultrastructural findings including large mitochondrial size (n=5), abnormal mitochondrial structure (n=5), and increased mitochondrial number (n=4). The most common presenting symptoms were intellectual disability (n=13), seizures (n=12), encephalopathy (n=9), and gastrointestinal disturbances (n=9). At last known follow-up, 12 patients had a definitive diagnosis of a mitochondrial disorder. One patient each had Complex I deficiency, Complex III deficiency, Charcot-Marie-Tooth disease, pyruvate dehydrogenase deficiency, and Phelan-McDermid syndrome. Our results suggest that skin biopsy sometimes yields diagnostic clues suggestive of a mitochondrial cytopathy in cases with a negative muscle biopsy. Copyright © 2017 Elsevier Inc. All rights
Skin changes in chronic kidney disease
Joanna M. Przepiórka-Kosińska; Katarzyna M. Chyl-Surdacka; Joanna Bartosińska; Dorota Krasowska; Grażyna Chodorowska
2017-01-01
Chronic kidney disease causes skin changes which may sometimes be the first sign of kidney failure. Specific skin changes include acquired perforating dermatosis, porphyria cutanea tarda, pseudoporphyria, calcinosis and nephrogenic systemic fibrosis. The majority of patients present with cutaneous manifestations which are classified as non-specific, including xerosis, pruritus, pigmentation disturbances, nail plate abnormalities, uraemic frost and gynaecomastia. Treatment improving kidney fun...
Role of epidermis-type lipoxygenases for skin barrier function and adipocyte differentiation
DEFF Research Database (Denmark)
Fürstenberger, Gerhard; Epp, Nikolas; Eckl, Katja-Martina
2007-01-01
12R-lipoxygenase (12R-LOX) and epidermis-type LOX-3 (eLOX-3) are novel members of the multigene family of mammalian LOX. A considerable gap exists between the identification of these enzymes and their biologic function. Here, we present evidence that 12R-LOX and eLOX-3, acting in sequence, and eL...... evidence indicates that this ligand is an eLOX-3-derived product. In accordance with this data is the observation that forced expression of eLOX-3 enhances adipocyte differentiation.......LOX-3 in combination with another, not yet identified LOX are critically involved in terminal differentiation of keratinocytes and adipocytes, respectively. Mutational inactivation of 12R-LOX and/or eLOX-3 has been found to be associated with development of an inherited ichthyosiform skin disorder...... in humans and genetic ablation of 12R-LOX causes a severe impairment of the epidermal lipid barrier in mice leading to post-natal death of the animals. In preadipocytes, a LOX-dependent PPARgamma activating ligand is released into the cell supernatant early upon induction of differentiation and available...
Muizzuddin, Neelam; Ingrassia, Michael; Marenus, Kenneth D; Maes, Daniel H; Mammone, Thomas
2013-01-01
Human skin maintains an optimal permeability barrier function in a terrestrial environment that varies considerably in humidity. Cells cultured under hyperosmotic stress accumulate osmolytes including sorbitol. Epidermal keratinocytes experience similar high osmolality under dry environmental conditions because of increased transepidermal water loss (TEWL) and concomitant drying of the skin. This study was designed to determine if epidermal keratinocytes, in vitro, could be protected from high osmotic stress, with the exogenous addition of sorbitol. In addition, we evaluated the effect of a formulation containing topical sorbitol on skin barrier and moisturization of subjects living in arid and humid regions in summer as well as in winter. Results from in vitro experiments showed that 50 mM sorbitol protected epidermal keratinocytes from osmotic toxicity induced by sodium chloride. Clinical studies indicated that skin chronically exposed to hot, dry environment appeared to exhibit stronger skin barrier and a lower baseline TEWL. In addition, skin barrier was stronger in summer than in winter. Sorbitol exhibited significant improvement in both barrier repair and moisturization, especially in individuals subjected to arid environmental conditions.
The role of innate lymphoid cells in healthy and inflamed skin
DEFF Research Database (Denmark)
Bonefeld, Charlotte M.; Geisler, Carsten
2016-01-01
system. During the last years, it has become clear that innate lymphoid cells play a role in homeostasis and inflammation of the skin in humans and mice. In this review, we will discuss the role of innate lymphoid cells in healthy and inflamed skin with special focus on their role in atopic dermatitis.......The skin constitutes the interface between the organism and the environment, and it protects the body from harmful substances in the environment via physical, chemical and immunological barriers. The immunological barrier of the skin comprises both cells from the innate and the adaptive immune...
Xanes and SR-XRF Study of Skin as a Barrier to Ultra-Fine Nanocrystals of TiO2
International Nuclear Information System (INIS)
Kwiatek, W.M.; Lekki, J.; Stachura, Z.; Hanson, A.; Ablett, J.
2007-01-01
Nanocrystalline TiO 2 is commonly used in cosmetic industry as a photoprotective agent. With recent advances in nanomaterial processing, the size of TiO 2 crystals decreased into the nanometre regime. There is no satisfactory evidence that crystals of such small size are harmless to the human population. An EU project NANODERM has been launched where several techniques have been applied to investigate the possibility of particle penetration through the protective horny layer into vital skin regions. Skin biopsies of the animal and human skin have been collected after exposition to formulations containing TiO 2 nanocrystals. The Ti depth distributions were measured by electron and ion microscopy. The microscopy studies did not detect penetration into vital tissue of healthy skin what does not exclude a possibility that TiO 2 could penetrate pathological skin with lowered barrier efficiency. Due to literature the physical effect of the UV irradiation of the TiO 2 nanoparticle is the shift from 4 th to 3 rd oxidation state of the Ti. Titanium at 3 rd oxidation state interact with environment producing free radicals and Reactive Oxygen Species. In order to quantify the oxidation state shift, XANES experiments were carried out with commercially available TiO 2 nanocrystals (6 - 100 nm size), both in anatase and rutile phase. The samples were irradiated with X-rays with, and without accompanying UV illumination at the NSLS X27A beam line. The corresponding XANES spectra were registered and the absorption edge was compared in UV - illuminated and not illuminated spectra. A shift of about 1 eV in the absorption edge position of the rutile sample exposed to UVA light (365 nm, 20 mW/cm 2 ) has been measured and attributed to the changed electron configuration. However, the direction of the shift detected in measured samples was opposite to the expected. (author)
Skin prick test reactivity to aeroallergens by filaggrin mutation status
DEFF Research Database (Denmark)
Hougaard, M G; Johansen, J D; Linneberg, A
2014-01-01
BACKGROUND: Studies have shown that filaggrin gene (FLG) mutations are positively associated with sensitization to aero allergens. We hypothesized that FLG mutations would also have an effect on the mean size of positive skin prick test (SPT) reactions as well as the number of positive reactions....... OBJECTIVE: To investigate the effect of FLG mutations on the mean size and the number of positive SPT reactions, as well as the association with positive specific IgE. METHODS: A random sample of 3335 adults from the general population in Denmark was genotyped for the R501X and 2282del4 mutations in the FLG...... mutations alone are insufficient to cause secondary sensitization to allergens. The positive association seen in patients must be explained by a combination of further barrier abnormality caused by dermatitis as well as increased allergen exposure....
Confocal laser scanning microscopy to estimate nanoparticles' human skin penetration in vitro.
Zou, Ying; Celli, Anna; Zhu, Hanjiang; Elmahdy, Akram; Cao, Yachao; Hui, Xiaoying; Maibach, Howard
2017-01-01
With rapid development of nanotechnology, there is increasing interest in nanoparticle (NP) application and its safety and efficacy on human skin. In this study, we utilized confocal laser scanning microscopy to estimate NP skin penetration. Three different-sized polystyrene NPs marked with red fluorescence were applied to human skin, and Calcium Green 5N was used as a counterstain. Dimethyl sulfoxide (DMSO) and ethanol were used as alternative vehicles for NPs. Tape stripping was utilized as a barrier-damaged skin model. Skin biopsies dosed with NPs were incubated at 4°C or 37°C for 24 hours and imaged using confocal laser scanning microscopy. NPs were localized in the stratum corneum (SC) and hair follicles without penetrating the epidermis/dermis. Barrier alteration with tape stripping and change in incubation temperature did not induce deeper penetration. DMSO enhanced NP SC penetration but ethanol did not. Except with DMSO vehicle, these hydrolyzed polystyrene NPs did not penetrate intact or barrier-damaged human "viable" epidermis. For further clinical relevance, in vivo human skin studies and more sensitive analytic chemical methodology are suggested.
Stratum corneum hydration and skin surface pH in patients with atopic dermatitis.
Knor, Tanja; Meholjić-Fetahović, Ajša; Mehmedagić, Aida
2011-01-01
Atopic dermatitis (AD) is a chronically relapsing skin disease with genetic predisposition, which occurs most frequently in preschool children. It is considered that dryness and pruritus, which are always present in AD, are in correlation with degradation of the skin barrier function. Measurement of hydration and pH value of the stratum corneum is one of the noninvasive methods for evaluation of skin barrier function. The aim of the study was to assess skin barrier function by measuring stratum corneum hydration and skin surface pH of the skin with lesions, perilesional skin and uninvolved skin in AD patients, and skin in a healthy control group. Forty-two patients were included in the study: 21 young and adult AD patients and 21 age-matched healthy controls. Capacitance, which is correlated with hydration of stratum corneum and skin surface pH were measured on the forearm in the above areas by SM810/CM820/pH900 combined units (Courage AND Khazaka, Germany). The mean value of water capacitance measured in AD patients was 44.1 ± 11.6 AU (arbitrary units) on the lesions, 60.2 ± 12.4 AU on perilesional skin and 67.2 ± 8.8 AU on uninvolved skin. In healthy controls, the mean value was 74.1 ± 9.2 AU. The mean pH value measured in AD patients was 6.13 ± 0.52 on the lesions, 5.80 ± 0.41 on perilesional skin, and 5.54 ± 0.49 on uninvolved skin. In control group, the mean pH of the skin surface was 5.24 ± 0.40. The values of both parameters measured on lesional skin were significantly different (capacitance decreased and pH increased) from the values recorded on perilesional skin and uninvolved skin. The same held for the relation between perilesional and uninvolved skin. According to study results, the uninvolved skin of AD patients had significantly worse values of the measured parameters as compared with control group. The results of this study suggested the skin barrier function to be degraded in AD patients, which is specifically expressed in lesional skin.
The cutaneous citadel: a holistic view of skin and immunity.
Spellberg, B
2000-06-23
Human skin has 4 major functions: endogenous homeostasis (e.g. regulation of body temperature and fluid balance), metabolism (e.g. Vitamin D synthesis), sensory input, and to serve as a barrier to external threats (e.g. infection, mechanical injury, ultraviolet light). It is the latter function which concerns this review, for the skin's remarkable success in protecting the human body from the outside world is a major component of our immune system. The eminent pathologist, Virchow, whose work in the mid 19th century revolutionized many aspects of medical understanding, viewed the skin as an effective but inanimate barrier (1). However, recent technologies have elucidated a highly complex, dynamic interplay between the skin and other members of the immune system.
The Roles of Vitamin C in Skin Health.
Pullar, Juliet M; Carr, Anitra C; Vissers, Margreet C M
2017-08-12
The primary function of the skin is to act as a barrier against insults from the environment, and its unique structure reflects this. The skin is composed of two layers: the epidermal outer layer is highly cellular and provides the barrier function, and the inner dermal layer ensures strength and elasticity and gives nutritional support to the epidermis. Normal skin contains high concentrations of vitamin C, which supports important and well-known functions, stimulating collagen synthesis and assisting in antioxidant protection against UV-induced photodamage. This knowledge is often used as a rationale for the addition of vitamin C to topical applications, but the efficacy of such treatment, as opposed to optimising dietary vitamin C intake, is poorly understood. This review discusses the potential roles for vitamin C in skin health and summarises the in vitro and in vivo research to date. We compare the efficacy of nutritional intake of vitamin C versus topical application, identify the areas where lack of evidence limits our understanding of the potential benefits of vitamin C on skin health, and suggest which skin properties are most likely to benefit from improved nutritional vitamin C intake.
Human age and skin physiology shape diversity and abundance of Archaea on skin.
Moissl-Eichinger, Christine; Probst, Alexander J; Birarda, Giovanni; Auerbach, Anna; Koskinen, Kaisa; Wolf, Peter; Holman, Hoi-Ying N
2017-06-22
The human skin microbiome acts as an important barrier protecting our body from pathogens and other environmental influences. Recent investigations have provided evidence that Archaea are a constant but highly variable component of the human skin microbiome, yet factors that determine their abundance changes are unknown. Here, we tested the hypothesis that the abundance of archaea on human skin is influenced by human age and skin physiology by quantitative PCR of 51 different skin samples taken from human subjects of various age. Our results reveal that archaea are more abundant in human subjects either older than 60 years or younger than 12 years as compared to middle-aged human subjects. These results, together with results obtained from spectroscopy analysis, allowed us gain first insights into a potential link of lower sebum levels and lipid content and thus reduced skin moisture with an increase in archaeal signatures. Amplicon sequencing of selected samples revealed the prevalence of specific eury- and mainly thaumarchaeal taxa, represented by a core archaeome of the human skin.
Shah, D K; Khandavilli, S; Panchagnula, R
2008-09-01
Vehicles and permeation enhancers (PEs) used in transdermal drug delivery (TDD) of a drug can affect skin hydration, integrity and permeation of the solute administered. This investigation was designed to study the effect of the most commonly used vehicles and PEs on rat skin hydration, barrier function and permeation of an amphiphilic drug, imipramine hydrochloride (IMH). An array of well-established techniques were used to confirm the findings of the study. Thermogravimetric analysis (TGA) and Fourier transform infrared (FTIR) spectroscopy were used to determine changes in skin hydration. Alteration of the stratum corneum (SC) structure was investigated using FTIR studies. To monitor the barrier function alteration, transepidermal water loss (TEWL) measurement and permeation studies were performed. Our findings indicate that with hydration, there was an increase in the bound water content of the skin, and pseudoequilibrium of hydration (a drastic decrease in hydration rate) was achieved at around 12 h. Hydration increased the ratio between amide-I and amide-II peaks in FTIR and reduced the C-H stretching peak area. Both propylene glycol (PG) and ethanol (EtOH) dehydrated skin, with the latter showing a predominant effect. Furthermore, it was confirmed that PG and EtOH decreased the bound water content due to alteration in the protein domains and extraction of SC lipids, respectively. The effect of hydration on the SC was found to be similar to that reported for temperature. Permeation studies revealed that the dehydration caused by vehicles decreased IMH flux, whereas the flux was enhanced by PEs. The role of partition was predominant for the permeation of IMH through dehydrated skin. A synergistic effect was observed for PG and menthol in the enhancement of IMH. Further findings provided strong evidence that PG affects protein domains and EtOH extracts lipids from the bilayer. Both PG and EtOH, with or without PEs, increased TEWL. Initial TEWL was well
Contribution to the penetration of radionuclides across the skin
International Nuclear Information System (INIS)
Koprda, V.; Harangozo, M.; Kassai, Z.
2000-01-01
The human skin as well as the skin of animal species represent a strong barrier against the permeation of ionic forms of substances into an organism. Radionuclides of cesium, cobalt and actinides belong to frequent potential contaminants of human body at an accidental radioactive contamination. Regarding the actual composition of contaminating mixture of radionuclides the damage of an organism after internal contamination is proportional to the extent of penetrated amounts of radionuclides across the skin. In this paper: the time dependence of permeation of 137 Cs + , 60 Co 2+ , and 147 Pm 3+ from aqueous solution through animal skin model was studied, the biologic structure mostly responsible for the barrier effect was selected and proved, the relative importance of the main diffusion pathways for 137 Cs + , 60 Co 2+ and 147 Pm 3+ , the diffusion across the intact skin and the diffusion through the hair channels was assessed, the effect of isotopic carrier on the penetration process was studied, and the retarding capacities of different substances were researched. In all experiments the radioactive tracers were used. The experimental arrangement consisted of Franz-type vertical permeation cells. The well standardized animal skin models were chosen: fresh skin from abdominal region of 5 day old rats (5DR) of Wistar strain (Breeding Farm Dobra Voda, SK) and 9 day old rats (9DR), resp.. The skins of 5DR are still hairless, and 9DR are just short haired. The 5DR skin was used intact, and also with decreasing thickness of horny layer after it had been stripped with Scotch type (3M) 5-20 times respectively, or the skin had been splitted in 60degC hot water, whereby the whole epidermis was removed. Ions penetrated in vitro through the skin from donor solution (vehicle water) to receptor solution (phosphate buffered saline), were determined in aliquots sampled in 1,3,5,7 a 24 hours. The penetrated amounts of ions were found proportional to the time at least in the first 7
Wound-Healing Studies in Cornea and Skin: Parallels, Differences and Opportunities.
Bukowiecki, Anne; Hos, Deniz; Cursiefen, Claus; Eming, Sabine A
2017-06-12
The cornea and the skin are both organs that provide the outer barrier of the body. Both tissues have developed intrinsic mechanisms that protect the organism from a wide range of external threats, but at the same time also enable rapid restoration of tissue integrity and organ-specific function. The easy accessibility makes the skin an attractive model system to study tissue damage and repair. Findings from skin research have contributed to unravelling novel fundamental principles in regenerative biology and the repair of other epithelial-mesenchymal tissues, such as the cornea. Following barrier disruption, the influx of inflammatory cells, myofibroblast differentiation, extracellular matrix synthesis and scar formation present parallel repair mechanisms in cornea and skin wound healing. Yet, capillary sprouting, while pivotal in proper skin wound healing, is a process that is rather associated with pathological repair of the cornea. Understanding the parallels and differences of the cellular and molecular networks that coordinate the wound healing response in skin and cornea are likely of mutual importance for both organs with regard to the development of regenerative therapies and understanding of the disease pathologies that affect epithelial-mesenchymal interactions. Here, we review the principal events in corneal wound healing and the mechanisms to restore corneal transparency and barrier function. We also refer to skin repair mechanisms and their potential implications for regenerative processes in the cornea.
Confocal laser scanning microscopy to estimate nanoparticles’ human skin penetration in vitro
Elmahdy, Akram; Cao, Yachao; Hui, Xiaoying; Maibach, Howard
2017-01-01
Objective With rapid development of nanotechnology, there is increasing interest in nanoparticle (NP) application and its safety and efficacy on human skin. In this study, we utilized confocal laser scanning microscopy to estimate NP skin penetration. Methods Three different-sized polystyrene NPs marked with red fluorescence were applied to human skin, and Calcium Green 5N was used as a counterstain. Dimethyl sulfoxide (DMSO) and ethanol were used as alternative vehicles for NPs. Tape stripping was utilized as a barrier-damaged skin model. Skin biopsies dosed with NPs were incubated at 4°C or 37°C for 24 hours and imaged using confocal laser scanning microscopy. Results NPs were localized in the stratum corneum (SC) and hair follicles without penetrating the epidermis/dermis. Barrier alteration with tape stripping and change in incubation temperature did not induce deeper penetration. DMSO enhanced NP SC penetration but ethanol did not. Conclusion Except with DMSO vehicle, these hydrolyzed polystyrene NPs did not penetrate intact or barrier-damaged human “viable” epidermis. For further clinical relevance, in vivo human skin studies and more sensitive analytic chemical methodology are suggested. PMID:29184403
The menstrual cycle and the skin.
Raghunath, R S; Venables, Z C; Millington, G W M
2015-03-01
Perimenstrual exacerbations of dermatoses are commonly recognized, yet our knowledge of the underlying pathophysiological mechanisms remains imperfect. Research into the effects of oestrogen on the skin has provided evidence to suggest that oestrogen is associated with increases in skin thickness and dermal water content, improved barrier function, and enhanced wound healing. Research into the effects of progesterone suggests that the presence of various dermatoses correlates with peak levels of progesterone. Dermatoses that are exacerbated perimenstrually include acne, psoriasis, atopic eczema and irritant dermatitis, and possibly also erythema multiforme. Exacerbations occur at the peak levels of progesterone in the menstrual cycle. Underlying mechanisms include reduced immune and barrier functions as a result of cyclical fluctuations in oestrogen and/or progesterone. Autoimmune progesterone and oestrogen dermatitis are the best-characterized examples of perimenstrual cutaneous reactions to hormones produced during the menstrual cycle. In this review, we describe the current understanding of the menstrual cycle, and its effect on the skin and cutaneous disorders. © 2015 British Association of Dermatologists.
Energy Technology Data Exchange (ETDEWEB)
Graham, Peter H., E-mail: peter.graham@sesiahs.health.nsw.gov.au [Cancer Care Centre, St. George Hospital, Kogarah, New South Wales (Australia); Plant, Natalie; Graham, Jennifer L.; Browne, Lois [Cancer Care Centre, St. George Hospital, Kogarah, New South Wales (Australia); Borg, Martin [Department of Radiation Oncology, Royal Adelaide Hospital (Australia); Capp, Anne [Department of Radiation Oncology, Mater Hospital, Newcastle, New South Wales (Australia); Delaney, Geoff P. [Cancer Care Centre, Liverpool Hospital, Liverpool, New South Wales (Australia); Harvey, Jennifer [Mater Hospital, South Brisbane, Queensland (Australia); Kenny, Lisbeth [Royal Brisbane Hospital, Herston, Queensland (Australia); Francis, Michael [Andrew Love Cancer Centre, Geelong (Australia); Zissiadis, Yvonne [Department of Radiation Oncology, Royal Perth Hospital, Perth (Australia)
2013-05-01
Purpose: A previous, unblinded study demonstrated that an alcohol-free barrier film containing an acrylate terpolymer (ATP) was effective in reducing skin reactions compared with a 10% glycerine cream (sorbolene). The different appearances of these products precluded a blinded comparison. To test the acrylate terpolymer principle in a double-blinded manner required the use of an alternative cream formulation, a moisturizing durable barrier cream (MDBC); the study was conducted by the Trans Tasman Radiation Oncology Group (TROG) as protocol 04.01. Methods and Materials: A total of 333 patients were randomized; 1 patient was ineligible and 14 patients withdrew or had less than 7 weeks' observations, leaving 318 for analysis. The chest wall was divided into medial and lateral compartments, and patients were randomized to have MDBC applied daily to the medial or lateral compartment and sorbolene to the other compartment. Weekly observations, photographs, and symptom scores (pain and pruritus) were collected to week 12 or resolution of skin reactions if earlier. Skin dose was confirmed by centrally calibrated thermoluminescent dosimeters. Results: Rates of medial and lateral compartment Common Toxicity Criteria (CTC), version 3, greater than or equal to grade 3 skin reactions were 23% and 41%, but rates by skin care product were identical at 32%. There was no significant difference between MDBC and sorbolene in the primary endpoint of peak skin reactions or secondary endpoints of area-under-the-curve skin reaction scores. Conclusions: The MDBC did not reduce the peak skin reaction compared to sorbolene. It is possible that this is related to the difference in the formulation of the cream compared with the film formulation. Skin dosimetry verification and double blinding are essential for radiation skin care comparative studies.
International Nuclear Information System (INIS)
Graham, Peter H.; Plant, Natalie; Graham, Jennifer L.; Browne, Lois; Borg, Martin; Capp, Anne; Delaney, Geoff P.; Harvey, Jennifer; Kenny, Lisbeth; Francis, Michael; Zissiadis, Yvonne
2013-01-01
Purpose: A previous, unblinded study demonstrated that an alcohol-free barrier film containing an acrylate terpolymer (ATP) was effective in reducing skin reactions compared with a 10% glycerine cream (sorbolene). The different appearances of these products precluded a blinded comparison. To test the acrylate terpolymer principle in a double-blinded manner required the use of an alternative cream formulation, a moisturizing durable barrier cream (MDBC); the study was conducted by the Trans Tasman Radiation Oncology Group (TROG) as protocol 04.01. Methods and Materials: A total of 333 patients were randomized; 1 patient was ineligible and 14 patients withdrew or had less than 7 weeks' observations, leaving 318 for analysis. The chest wall was divided into medial and lateral compartments, and patients were randomized to have MDBC applied daily to the medial or lateral compartment and sorbolene to the other compartment. Weekly observations, photographs, and symptom scores (pain and pruritus) were collected to week 12 or resolution of skin reactions if earlier. Skin dose was confirmed by centrally calibrated thermoluminescent dosimeters. Results: Rates of medial and lateral compartment Common Toxicity Criteria (CTC), version 3, greater than or equal to grade 3 skin reactions were 23% and 41%, but rates by skin care product were identical at 32%. There was no significant difference between MDBC and sorbolene in the primary endpoint of peak skin reactions or secondary endpoints of area-under-the-curve skin reaction scores. Conclusions: The MDBC did not reduce the peak skin reaction compared to sorbolene. It is possible that this is related to the difference in the formulation of the cream compared with the film formulation. Skin dosimetry verification and double blinding are essential for radiation skin care comparative studies
Huang, Huey-Chun; Chang, Tsong-Min
2008-08-01
Stratum corneum intercellular lipids, such as ceramides, play an important role in the regulation of skin water barrier homeostasis and water-holding capacity. Aim To evaluate the potential water retention capacity of control emulsion and three oil-in-water (o/w) emulsions containing ceramide 1, ceramide 3, or both. Fifteen healthy Asian women (age, 20-30 years) with healthy skin, pretreated with sodium lauryl sulfate (SLS), applied the tested emulsions twice daily over a period of 28 days. Skin hydration and transepidermal water loss (TEWL) values were measured on the indicated days with a Corneometer(R)825 and a TEWAMETER TM210, respectively. The maximum increase in skin humidity was reached after 4 weeks, with values of 21.9 +/- 1.8% and 8.9 +/- 0.9% for emulsion C and control emulsion, respectively. The maximum decrease in TEWL was also reached after 4 weeks, with values of 36.7 +/- 4.7% and 5.1 +/- 0.8% for the same emulsions. It can be concluded that all the tested ceramide-containing emulsions improved skin barrier function when compared with untreated skin. There was some indication that ceramides 1 and 3 contained in emulsion C might exert a beneficial synergistic effect on skin biochemical properties, such as skin hydration and TEWL, and play a key role in the protection mechanism against SLS irritation.
Acral peeling skin syndrome: report of two cases.
García, Elena García; Carreño, Rosario Granados; Martínez González, Miguel A; Reyes, José Jiménez
2005-01-01
Peeling skin syndrome is a rare dermatosis characterized by spontaneous and painless peeling of the skin. The authors report two patients with history of spontaneous, asymptomatic, and noninflammatory peeling skin of the acral surfaces after soaking in water. On light microscopy, blisters were located in the mid layers of the stratum corneum, above the granular layer. Ultrastructural examination revealed increased intercellular lipids and abnormal, "moth-eaten," keratohyalin granules, but the authors were unable to determine whether the separation initiated within the horny cells or between adjacent cells. These patients represented a localized variant of peeling skin syndrome.
Estimating physiological skin parameters from hyperspectral signatures
Vyas, Saurabh; Banerjee, Amit; Burlina, Philippe
2013-05-01
We describe an approach for estimating human skin parameters, such as melanosome concentration, collagen concentration, oxygen saturation, and blood volume, using hyperspectral radiometric measurements (signatures) obtained from in vivo skin. We use a computational model based on Kubelka-Munk theory and the Fresnel equations. This model forward maps the skin parameters to a corresponding multiband reflectance spectra. Machine-learning-based regression is used to generate the inverse map, and hence estimate skin parameters from hyperspectral signatures. We test our methods using synthetic and in vivo skin signatures obtained in the visible through the short wave infrared domains from 24 patients of both genders and Caucasian, Asian, and African American ethnicities. Performance validation shows promising results: good agreement with the ground truth and well-established physiological precepts. These methods have potential use in the characterization of skin abnormalities and in minimally-invasive prescreening of malignant skin cancers.
Ashley, S E; Tan, H-T T; Vuillermin, P; Dharmage, S C; Tang, M L K; Koplin, J; Gurrin, L C; Lowe, A; Lodge, C; Ponsonby, A-L; Molloy, J; Martin, P; Matheson, M C; Saffery, R; Allen, K J; Ellis, J A; Martino, D
2017-09-01
A defective skin barrier is hypothesized to be an important route of sensitization to dietary antigens and may lead to food allergy in some children. Missense mutations in the serine peptidase inhibitor Kazal type 5 (SPINK5) skin barrier gene have previously been associated with allergic conditions. To determine whether genetic variants in and around SPINK5 are associated with IgE-mediated food allergy. We genotyped 71 "tag" single nucleotide polymorphisms (tag-SNPs) within a region spanning ~263 kb including SPINK5 (~61 kb) in n=722 (n=367 food-allergic, n=199 food-sensitized-tolerant and n=156 non-food-allergic controls) 12-month-old infants (discovery sample) phenotyped for food allergy with the gold standard oral food challenge. Transepidermal water loss (TEWL) measures were collected at 12 months from a subset (n=150) of these individuals. SNPs were tested for association with food allergy using the Cochran-Mantel-Haenszel test adjusting for ancestry strata. Association analyses were replicated in an independent sample group derived from four paediatric cohorts, total n=533 (n=203 food-allergic, n=330 non-food-allergic), mean age 2.5 years, with food allergy defined by either clinical history of reactivity, 95% positive predictive value (PPV) or challenge, corrected for ancestry by principal components. SPINK5 variant rs9325071 (A⟶G) was associated with challenge-proven food allergy in the discovery sample (P=.001, OR=2.95, CI=1.49-5.83). This association was further supported by replication (P=.007, OR=1.58, CI=1.13-2.20) and by meta-analysis (P=.0004, OR=1.65). Variant rs9325071 is associated with decreased SPINK5 gene expression in the skin in publicly available genotype-tissue expression data, and we generated preliminary evidence for association of this SNP with elevated TEWL also. We report, for the first time, association between SPINK5 variant rs9325071 and challenge-proven IgE-mediated food allergy. © 2017 EAACI and John Wiley and Sons A
Electrical measurement of the hydration state of the skin surface in vivo.
Tagami, H
2014-09-01
Healthy skin surface is smooth and soft, because it is covered by the properly hydrated stratum corneum (SC), an extremely thin and soft barrier membrane produced by the underlying normal epidermis. By contrast, the skin surfaces covering pathological lesions exhibit dry and scaly changes and the SC shows poor barrier function. The SC barrier function has been assessed in vivo by instrumentally measuring transepidermal water loss (TEWL). However, there was a lack of any appropriate method for evaluating the hydration state of the skin surface in vivo until 1980 when we reported the feasibility of employing high-frequency conductance or capacitance to evaluate it quickly and accurately. With such measurements, we can assess easily the moisturizing efficacy of various topical agents in vivo as well as the distribution pattern of water in the SC by combining it with a serial tape-stripping procedure of the skin surface. © 2014 The Author BJD © 2014 British Association of Dermatologists.
DFD-01 Reduces Transepidermal Water Loss and Improves Skin Hydration and Flexibility.
Jackson, J Mark; Grove, Gary L; Allenby, Kent; Houser, Tim
2017-12-01
In plaque psoriasis, the benefit of topical steroids is well established. The vehicle formulation of topical steroids may also provide benefit in addition to the effects of the steroid itself. DFD-01 (betamethasone dipropionate spray, 0.05%) is a formulation composed of a topical steroid in an emollient-like vehicle that enhances penetration to the target site of inflammation in the skin. The aim of this study was to assess the effect of DFD-01 and its vehicle on skin hydration and barrier function in compromised skin and to evaluate its effect on flexibility in healthy skin. Eighteen healthy white volunteers were enrolled in each of two studies. In Study 1, dry shaving of volar forearms created a compromised skin barrier, through which transepidermal water loss (TEWL) was measured using an evaporimeter. Capacitance, a measure of epidermal hydration, was also measured at baseline and at 1, 2 and 4 h after application of DFD-01 or its vehicle formulation. In Study 2, intact skin flexibility was tested with a cutometer before and at 1, 2 and 4 h after application of DFD-01 or vehicle. In Study 1, both DFD-01 and its vehicle were effective at reducing TEWL through the compromised stratum corneum. Capacitance measurements confirmed this finding; razor-chafed skin treated with either DFD-01 or vehicle exhibited levels of skin hydration similar to unshaved control skin. Study 2 found softening and greater flexibility of normal skin treated with either DFD-01 or vehicle compared with nontreated control skin samples. These tests suggest that the DFD-01 formulation and its vehicle are each effective at retaining moisture within a damaged skin barrier and for softening and increasing the flexibility of intact skin. Dr. Reddy's Laboratories.
Directory of Open Access Journals (Sweden)
Tao Wang
2015-09-01
Full Text Available Non-bullous congenital ichthyosiform erythroderma (NBCIE is a hereditary disorder of keratinization caused by pathogenic variants in genes encoding enzymes important to lipid processing and terminal keratinocyte differentiation. Impaired function of these enzymes can cause pathologic epidermal scaling, significantly reduced skin barrier function. In this study, we have performed a focused, genetic analysis of a probrand affected by NBCIE and extended this to his consanguineous parents. Targeted capture and next-generation sequencing was performed on NBCIE associated genes in the proband and his unaffected consanguineous parents. We identified a homozygous nonsense variant c.814C>T (p.Arg272* in ALOXE3 (NM_001165960.1 in the proband and discovered that his parents are both heterozygous carriers of the variant. The clinical manifestations of the proband’s skin were consistent with NBCIE, and detailed histopathological assessment revealed epidermal bulla formation and Majocchi’s granuloma. Infection with Trichophyton rubrum was confirmed by culture. The patient responded to oral terbinafine antifungal treatment. Decreased skin barrier function, such as that caused by hereditary disorders of keratinization, can increase the risk of severe cutaneous fungal infections and the formation of Majocchi’s granuloma and associated alopecia. Patients with NBCIE should be alerted to the possible predisposition for developing dermatophytoses and warrant close clinical follow-up.
Directory of Open Access Journals (Sweden)
Berna Aksoy
2013-06-01
Full Text Available All multicellular organisms protect themselves from external universe and microorganisms by innate immune sytem that is constitutively present. Skin innate immune system has several different components composed of epithelial barriers, humoral factors and cellular part. In this review information about skin innate immune system and its components are presented to the reader. Innate immunity, which wasn’t adequately interested in previously, is proven to provide a powerfull early protection system, control many infections before the acquired immunity starts and directs acquired immunity to develop optimally
Atopic dermatitis: immune deviation, barrier dysfunction, IgE autoreactivity and new therapies
Directory of Open Access Journals (Sweden)
Masutaka Furue
2017-07-01
Full Text Available Atopic dermatitis (AD is a chronic or chronically relapsing, eczematous, severely pruritic skin disorder mostly associated with IgE elevation and skin barrier dysfunction due to decreased filaggrin expression. The lesional skin of AD exhibits Th2- and Th22-deviated immune reactions that are progressive during disease chronicity. Th2 and Th22 cytokines further deteriorate the skin barrier by inhibiting filaggrin expression. Some IgEs are reactive to self-antigens. The IgE autoreactivity may precipitate the chronicity of AD. Upon activation of the ORAI1 calcium channel, atopic epidermis releases large amounts of thymic stromal lymphopoietin (TSLP, which initiates the Th2 and Th22 immune response. Th2-derived interleukin-31 and TSLP induce an itch sensation. Taken together, TSLP/Th2/Th22 pathway is a promising target for developing new therapeutics for AD. Enhancing filaggrin expression using ligands for the aryl hydrocarbon receptor may also be an adjunctive measure to restore the disrupted barrier function specifically for AD.
Directory of Open Access Journals (Sweden)
Joo Hyun Nam
2016-07-01
Conclusions: Our results suggest that T. terrestris extract may have a therapeutic potential for recovery of abnormal skin barrier pathologies in atopic dermatitis through modulating the activities of calcium ion channels, Orai1 and TRPV3. This is the first study to report the modulatory effect of a medicinal plant on the function of ion channels in skin barrier.
[Skin hydration and hydrating products].
Duplan, H; Nocera, T
2018-05-01
One of the skin's principal functions is to protect the body against its environment by maintaining an effective epidermal barrier, not only against external factors, but also to prevent water loss from the body. Indeed, water homeostasis is vital for the normal physiological functioning of skin. Hydration levels affect not only visible microscopic parameters such as the suppleness and softness of skin, but also molecular parameters, enzyme activities and cellular signalling within the epidermis. The body is continually losing some of its water, but this phenomenon is limited and the optimal hydration gradient in skin is ensured via a set of sophisticated regulatory processes that rely on the functional and dynamic properties of the uppermost level of the skin consisting of the stratum corneum. The present article brings together data recently acquired in the fields of skin hydration and the characterisation of dehydrated or dry skin, whether through study of the regulatory processes involved or as a result of changes in the techniques used for in situ measurement, and thus in optimisation of management. Copyright © 2018. Published by Elsevier Masson SAS.
Li, Shan; Ganguli-Indra, Gitali; Indra, Arup K
2016-05-01
Lipidomics is the large-scale profiling and characterization of lipid species in a biological system using mass spectrometry. The skin barrier is mainly comprised of corneocytes and a lipid-enriched extracellular matrix. The major skin lipids are ceramides, cholesterol and free fatty acids (FFA). Lipid compositions are altered in inflammatory skin disorders with disrupted skin barrier such as atopic dermatitis (AD). Here we discuss some of the recent applications of lipidomics in human skin biology and in inflammatory skin diseases such as AD, psoriasis and Netherton syndrome. We also review applications of lipidomics in human skin equivalent and in pre-clinical animal models of skin diseases to gain insight into the pathogenesis of the skin disease. Expert commentary: Skin lipidomics analysis could be a fast, reliable and noninvasive tool to characterize the skin lipid profile and to monitor the progression of inflammatory skin diseases such as AD.
Li, Zhengxiao; Hu, Lizhi; Elias, Peter M; Man, Mao-Qiang
2018-02-01
Sensitive skin is defined as a spectrum of unpleasant sensations in response to a variety of stimuli. However, only some skin care products provoke cutaneous symptoms in individuals with sensitive skin. Hence, it would be useful to identify products that could provoke cutaneous symptoms in individuals with sensitive skin. To assess whether vehicles, as well as certain branded skin care products, can alter epidermal function following topical applications to normal mouse skin. Following topical applications of individual vehicle or skin care product to C57BL/6J mice twice daily for 4 days, transepidermal water loss (TEWL) rates, stratum corneum (SC) hydration and skin surface pH were measured on treated versus untreated mouse skin with an MPA5 device and pH 900 pH meter. Our results show that all tested products induced abnormalities in epidermal functions of varying severity, including elevations in TEWL and skin surface pH, and reduced SC hydration. Our results suggest that mice can serve as a predictive model that could be used to evaluate the potential safety of skin care products in humans with sensitive skin. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Sicherer, Scott H; Leung, Donald Y M
2012-01-01
This review highlights some of the research advances in anaphylaxis; hypersensitivity reactions to foods, drugs, and insects; and allergic skin diseases that were reported in the Journal in 2011. Food allergy appears to be increasing in prevalence and carries a strong economic burden. Risk factors can include dietary ones, such as deficiency of vitamin D and timing of complementary foods, and genetic factors, such as filaggrin loss-of-function mutations. Novel mechanisms underlying food allergy include the role of invariant natural killer T cells and influences of dietary components, such as isoflavones. Among numerous preclinical and clinical treatment studies, promising observations include the efficacy of sublingual and oral immunotherapy, a Chinese herbal remedy showing promising in vitro results, the potential immunotherapeutic effects of having children ingest foods with baked-in milk if they tolerate it, and the use of anti-IgE with or without concomitant immunotherapy. Studies of allergic skin diseases, anaphylaxis, and hypersensitivity to drugs and insect venom are elucidating cellular mechanisms, improved diagnostics, and potential targets for future treatment. The role of skin barrier abnormalities, as well as the modulatory effects of the innate and adaptive immune responses, are major areas of investigation. Copyright © 2012 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights reserved.
Innate lymphoid cells and the skin
Salimi, Maryam; Ogg, Graham
2014-01-01
Innate lymphoid cells are an emerging family of effector cells that contribute to lymphoid organogenesis, metabolism, tissue remodelling and protection against infections. They maintain homeostatic immunity at barrier surfaces such as lung, skin and gut (Nature 464:1367?1371, 2010, Nat Rev Immunol 13: 145?149, 2013). Several human and mouse studies suggest a role for innate lymphoid cells in inflammatory skin conditions including atopic eczema and psoriasis. Here we review the innate lymphoid...
Mochizuki, H; Tadaki, H; Takami, S; Muramatsu, R; Hagiwara, S; Mizuno, T; Arakawa, H
2009-05-01
Atopic dermatitis is a disease of skin barrier dysfunction and outside stimuli can cross the skin barrier. To examine a new method for evaluating the outside to inside skin transparency with a colorimeter and yellow dyes. In study 1, a total of 28 volunteer subjects (24 normal and four with atopic dermatitis) participated. After provocation with yellow dye, the skin colour of all the subjects was measured using a colorimeter. The skin transparency index was calculated by the changes of the skin colour to yellow. Other variables of skin function, including transepidermal water loss (TEWL) and stratum corneum hydration, were also measured. In study 2, the skin transparency index was evaluated for a cohort of 38 patients with atopic dermatitis, 27 subjects with dry skin and 29 healthy controls. In study 1, the measurement of skin colour (b*) using tartrazine showed good results. There was a significant relationship between the skin transparency index with tartrazine and the atopic dermatitis score (P = 0.014). No other measurements of skin function, including the TEWL, were correlated. In study 2, the skin transparency index score obtained with tartrazine in the patients with atopic dermatitis was significantly higher than that of the controls and those with dry skin (P colorimeter and food dye, is noninvasive, safe and reliable for the evaluation of out-in skin transparency and can demonstrate the characteristic dysfunction in the skin barrier in patients with atopic dermatitis.
Investigation of skin cancer treatment efficiency by raman spectroscopy
Energy Technology Data Exchange (ETDEWEB)
Lee, M. S.; Kim, D. W. [Kyungpook National University, Taegu (Korea)
2000-04-01
From the successful perform of the molecular structures of various kinds of human skin cancer. We can predict the types of cancer when a small abnormal change change occurs on skin by raman spectrum. When we applied the cancer causing chemicals, bezopyrene, to nude mouse, it did not develop to cancer. But we had radiated UV light after developed to skin cancer in a few days. We can deduce the development of human skin cancer from the result of nude mouse skin cancer, because the two skin are structurally very similar to each other. From the results of own research we could conform the UV light is essential for the development of skin cancer. The results of own research can be directly apply to early detection and proper treatment of skin cancer in hospital. 32 refs., 40 figs., 16 tabs. (Author)
Ezerskaia, A.; Pereira, S. F.; Urbach, H. P.; Varghese, B.
2017-02-01
Skin barrier function relies on well balanced water and lipid system of stratum corneum. Optimal hydration and oiliness levels are indicators of skin health and integrity. We demonstrate an accurate and sensitive depth profiling of stratum corneum sebum and hydration levels using short wave infrared spectroscopy in the spectral range around 1720 nm. We demonstrate that short wave infrared spectroscopic technique combined with tape stripping can provide morequantitative and more reliable skin barrier function information in the low hydration regime, compared to conventional biophysical methods.
Tumors of the skin and soft tissues
Energy Technology Data Exchange (ETDEWEB)
Weller, R.E.
1991-10-01
The majority of the body surface is covered by the skin. Many internal disorders are reflected in the condition of the skin. One of the major functions of the skin is protection of the other organ systems from a variety of environmental insults. In this role, the skin itself is exposed to factors that can ultimately cause chronic diseases and cancer. Since it is relatively easy to recognize skin abnormalities, most skin cancers are brought to professional attention sooner than other types of cancer. However, due to the close resemblance between many skin neoplasms and noncancerous dermatologic disorders, these neoplasms may be mistreated for months or even years. In veterinary oncology, as in human medicine, most cancers can be effectively treated or cured following an accurate diagnosis. Once diagnosed, skin neoplasms should be aggressively treated. If causal factors are known, exposure to these factors should be limited through removal of the agent (for chemical carcinogens) or limiting exposure to the agent (for other carcinogens such as sunlight). 10 tabs. (MHB)
Epidemiology of "fragile skin": results from a survey of different skin types
Directory of Open Access Journals (Sweden)
Haftek M
2013-12-01
findings need to be confirmed through objective evaluation, the current survey demonstrated that "fragile skin" is perceived to occur in a substantial proportion of individuals from any given country, particularly in the age range of 15–34 years, regardless of skin type. Keywords: fragile skin, prevalence, skin barrier, skin type, survey
Confocal laser scanning microscopy to estimate nanoparticles’ human skin penetration in vitro
Directory of Open Access Journals (Sweden)
Zou Y
2017-10-01
Full Text Available Ying Zou,1,2,* Anna Celli,2,3,* Hanjiang Zhu,2,* Akram Elmahdy,2 Yachao Cao,2 Xiaoying Hui,2 Howard Maibach2 1Skin & Cosmetic Research Department, Shanghai Skin Disease Hospital, Shanghai, People’s Republic of China; 2Department of Dermatology, School of Medicine, University of California San Francisco, San Francisco, CA, USA; 3San Francisco Veterans Medical Center, San Francisco, CA, USA *These authors contributed equally to this work Objective: With rapid development of nanotechnology, there is increasing interest in nanoparticle (NP application and its safety and efficacy on human skin. In this study, we utilized confocal laser scanning microscopy to estimate NP skin penetration.Methods: Three different-sized polystyrene NPs marked with red fluorescence were applied to human skin, and Calcium Green 5N was used as a counterstain. Dimethyl sulfoxide (DMSO and ethanol were used as alternative vehicles for NPs. Tape stripping was utilized as a barrier-damaged skin model. Skin biopsies dosed with NPs were incubated at 4°C or 37°C for 24 hours and imaged using confocal laser scanning microscopy.Results: NPs were localized in the stratum corneum (SC and hair follicles without penetrating the epidermis/dermis. Barrier alteration with tape stripping and change in incubation temperature did not induce deeper penetration. DMSO enhanced NP SC penetration but ethanol did not.Conclusion: Except with DMSO vehicle, these hydrolyzed polystyrene NPs did not penetrate intact or barrier-damaged human “viable” epidermis. For further clinical relevance, in vivo human skin studies and more sensitive analytic chemical methodology are suggested. Keywords: nanoparticles, skin penetration, stratum corneum, confocal laser scanning microscopy, tape stripping
Directory of Open Access Journals (Sweden)
Shreeprasad Patankar
2017-01-01
Full Text Available Congenital buried penis (CBP is a rare condition characterized by penis with normal length obscured under penopubic and penoscrotal skin and subcutaneous tissue. Though rare, this condition causes great parental anxiety because of abnormal shape and appearance of penis, dribbling of urine and poor hygiene. Abnormal distal attachment of fundiform ligament on penile shaft, large, redundant preputial sac, and severe paucity of nonpigmented penile skin are important anatomical factors responsible for CBP. We here describe a different approach for degloving of penis and achieving penile skin cover using skin and fascial sheath of preputial sac. This method is simple and easy to learn, teach and reproduce.
Infrared imaging of skin lesions
McIntosh, Laura M.; Mansfield, James R.; Jackson, Michael; Crowson, A. Neil; Mantsch, Henry H.
2002-02-01
IR spectroscopy produces spectra in which detailed information concerning chemical structure is inherent. Numerous studies have demonstrated that the most useful IR methods for analysis of biological tissues are microscopic image-based techniques in which fine-scaled spatial and high-quality spectral information is integrated. Unlike traditional visible microscopic methods, the contrast in IR imaging is gained by differences in spectra and the spatial heterogeneity of biochemical components, not by the addition of stains. In order for IR imaging to be more broadly accepted, non-subjective data processing methods are being developed to extract the most out of the large spectral images that are acquired. This paper demonstrates data processing techniques that have been extremely useful in the analysis of normal and abnormal skin. Analysis of skin specimens is of particular clinical importance due to the difficulty in rendering a differential diagnosis. Unstained frozen skin sections were mapped using an IR microscope. Functional group mapping, clustering routines and linear discriminant analysis were used to process the data. Functional group mapping and clustering routines were useful in the initial interpretation of images and to research for trends in uncharacterized spectral images. LDA was useful for differentiating normal from abnormal tissue once a well- defined training spectral set was established. Representative spectroscopic images are shown that demonstrate the power of IR imaging.
Directory of Open Access Journals (Sweden)
Yira Bermudez
Full Text Available Chronic UV skin exposure leads to epidermal differentiation defects in humans that can be largely restored by pharmacological doses of nicotinic acid. Nicotinic acid has been identified as a ligand for the human G-protein-coupled receptors GPR109A and GPR109B that signal through G(i-mediated inhibition of adenylyl cyclase. We have examined the expression, cellular distribution, and functionality of GPR109A/B in human skin and skin derived epidermal cells.Nicotinic acid increases epidermal differentiation in photodamaged human skin as judged by the terminal differentiation markers caspase 14 and filaggrin. Both GPR109A and GPR109B genes are transcribed in human skin and in epidermal keratinocytes, but expression in dermal fibroblasts is below limits of detection. Receptor transcripts are greatly over-expressed in squamous cell cancers. Receptor protein in normal skin is prominent from the basal through granular layers of the epidermis, with cellular localization more dispersive in the basal layer but predominantly localized at the plasma membrane in more differentiated epidermal layers. In normal human primary and immortalized keratinocytes, nicotinic acid receptors show plasma membrane localization and functional G(i-mediated signaling. In contrast, in a squamous cell carcinoma derived cell line, receptor protein shows a more diffuse cellular localization and the receptors are nearly non-functional.The results of these studies justify future genetic and pharmacological intervention studies to define possible specific role(s of nicotinic acid receptors in human skin homeostasis.
DEFF Research Database (Denmark)
Jungersted, Jakob Mutanu; Høgh, Julie Kaae; Hellgren, Lars
2010-01-01
Occlusion of the skin is a risk factor for development of irritant contact dermatitis. Occlusion may, however, have a positive effect on skin healing. No consensus on the effect of occlusion has been reached.......Occlusion of the skin is a risk factor for development of irritant contact dermatitis. Occlusion may, however, have a positive effect on skin healing. No consensus on the effect of occlusion has been reached....
[Considerations on photoprotection and skin disorders].
Cestari, T Ferreira; de Oliveira, F Bazanella; Boza, J Catucci
2012-11-01
Excessive exposure to solar or artificial sources of UV radiation is deleterious to the skin and can cause or worsen several diseases. Detrimental effects of UV radiation exert an important role in the development of skin cancers, cause alterations on the immune response, and act as a trigger or aggravating factor for pigmentary disorders. A group of measures, including education, change of habits, use of physical barriers and sunscreens constitutes a significant part of the treatment of many skin disorders and are valuable preventive tools. This article summarizes the relevant studies addressing these issues, emphasizing the many aspects of photoprotection. Copyright © 2012 Elsevier Masson SAS. All rights reserved.
Considerations on photoprotection and skin disorders.
Cestari, T Ferreira; Oliveira, F Bazanella de; Boza, J Catucci
2012-12-01
Excessive exposure to solar or artificial sources of UV radiation is deleterious to the skin and can cause or worsen several diseases. Detrimental effects of UV radiation exert an important role in the development of skin cancers, cause alterations on the immune response, and act as a trigger or aggravating factor for pigmentary disorders. A group of measures, including education, change of habits, use of physical barriers and sunscreens constitutes a significant part of the treatment of many skin disorders and are valuable preventive tools. This article summarizes the relevant studies addressing these issues, emphasizing the many aspects of photoprotection. Copyright © 2012 Elsevier Masson SAS. All rights reserved.
Zhou, Xiaolong; Khan, Sikandar G; Tamura, Deborah; Ueda, Takahiro; Boyle, Jennifer; Compe, Emmanuel; Egly, Jean-Marc; DiGiovanna, John J; Kraemer, Kenneth H
2013-08-01
XPD (ERCC2) is a DNA helicase involved in nucleotide excision repair and in transcription as a structural bridge tying the transcription factor IIH (TFIIH) core with the cdk-activating kinase complex, which phosphorylates nuclear receptors. Mutations in XPD are associated with several different phenotypes, including trichothiodystrophy (TTD), with sulfur-deficient brittle hair, bone defects, and developmental abnormalities without skin cancer, xeroderma pigmentosum (XP), with pigmentary abnormalities and increased skin cancer, or XP/TTD with combined features, including skin cancer. We describe the varied clinical features and mutations in nine patients examined at the National Institutes of Health who were compound heterozygotes for XPD mutations but had different clinical phenotypes: four TTD, three XP, and two combined XP/TTD. We studied TFIIH-dependent transactivation by nuclear receptor for vitamin D (VDR) and thyroid in cells from these patients. The vitamin D stimulation ratio of CYP24 and osteopontin was associated with specific pairs of mutations (reduced in 5, elevated in 1) but not correlated with distinct clinical phenotypes. Thyroid receptor stimulation ratio for KLF9 was not significantly different from normal. XPD mutations frequently were associated with abnormal VDR stimulation in compound heterozygote patients with TTD, XP, or XP/TTD.
Effects of various vehicles on skin hydration in vivo.
Wiedersberg, S; Leopold, C S; Guy, R H
2009-01-01
The stratum corneum, the outermost layer of the skin, regulates the passive loss of water to the environment. Furthermore, it is well accepted that drug penetration is influenced by skin hydration, which may be manipulated by the application of moisturizing or oleaginous vehicles. Measurements of transepidermal water loss (TEWL), and of skin hydration using a corneometer, were used to assess the effect of different vehicles on stratum corneum barrier function in vivo in human volunteers. A microemulsion significantly increased skin hydration relative to a reference vehicle based on medium chain triglycerides; in contrast, Transcutol(R) lowered skin hydration. TEWL measurements confirmed these observations. Copyright 2009 S. Karger AG, Basel.
Yotsu, Rie Roselyne; Kouadio, Kouamé; Vagamon, Bamba; N'guessan, Konan; Akpa, Amari Jules; Yao, Aubin; Aké, Julien; Abbet Abbet, Rigobert; Tchamba Agbor Agbor, Barbine; Bedimo, Roger; Ishii, Norihisa; Fuller, L Claire; Hay, Roderick; Mitjà, Oriol; Drechsler, Henning; Asiedu, Kingsley
2018-05-01
Early detection of several skin-related neglected tropical diseases (skin NTDs)-including leprosy, Buruli ulcer, yaws, and scabies- may be achieved through school surveys, but such an approach has seldom been tested systematically on a large scale in endemic countries. Additionally, a better understanding of the spectrum of skin diseases and the at-risk populations to be encountered during such surveys is necessary to facilitate the process. We performed a school skin survey for selected NTDs and the spectrum of skin diseases, among primary schoolchildren aged 5 to 15 in Côte d'Ivoire, West Africa. This 2-phase survey took place in 49 schools from 16 villages in the Adzopé health district from November 2015 to January 2016. The first phase involved a rapid visual examination of the skin by local community healthcare workers (village nurses) to identify any skin abnormality. In a second phase, a specialized medical team including dermatologists performed a total skin examination of all screened students with any skin lesion and provided treatment where necessary. Of a total of 13,019 children, 3,504 screened positive for skin lesions and were listed for the next stage examination. The medical team examined 1,138 of these children. The overall prevalence of skin diseases was 25.6% (95% CI: 24.3-26.9%). The predominant diagnoses were fungal infections (n = 858, prevalence: 22.3%), followed by inflammatory skin diseases (n = 265, prevalence: 6.9%). Skin diseases were more common in boys and in children living along the main road with heavy traffic. One case of multi-bacillary type leprosy was detected early, along with 36 cases of scabies. Our survey was met with very good community acceptance. We carried out the first large-scale integrated, two-phase pediatric multi-skin NTD survey in rural Côte d'Ivoire, effectively reaching a large population. We found a high prevalence of skin diseases in children, but only limited number of skin NTDs. With the lessons learned
Cream or foam in pedal skin care: towards the ideal vehicle for urea used against dry skin.
Borelli, C; Bielfeldt, S; Borelli, S; Schaller, M; Korting, H C
2011-02-01
The aim of this study was to evaluate different urea-containing cosmetic preparations designed for foot care regarding skin occlusion. The primary aim was therefore to screen the short-term transepidermal water loss (TEWL) as a parameter for skin barrier function and skin occlusion and to characterize the relative role of the vehicle, i.e. cream or foam in the context of cosmetics containing urea in the 2-10% range addressing the cosmetic products urea 2% cream (GEHWOL FUSSKRAFT blau), petrolatum containing cream (GEHWOL med Schrundensalbe), urea 10% cream (GEHWOL med Lipidro-Crème), urea 10% foam (Allpresan Fuss Schaum) and vaseline (positive control) compared with an untreated area on the volar forearms of volunteers. Moreover, the short time (24 h) kinetics regarding the moisturizing effect of cream and foam formulations in diabetic patients were compared. The efficacy of a cream on reduction of skin thickness of hyperkeratotic skin in the heel region before and after a period of product application was also evaluated. In some of the trials, healthy individuals and in others, diabetic patients (type I and II) were enrolled. TEWL was determined before product application, as well as at given points of time thereafter. In this study, no excessive occlusion effects comparable with a blockage of the skin's natural water evaporation could be observed for any of the test products. To the extent to be expected, this was found neither for the cream products nor for the foam product. Slightly lowered TEWL values after application of the 10% urea cream can be interpreted as a beneficial effect in terms of an improved barrier function. Regarding skin moisture, the urea-containing cream formulation appeared equal or slightly superior to the foam formulation. The thickness of the horny layer was found reduced after application of 10 % urea-containing cream. At present it looks as if cream vehicles would still be vehicles of choice in general, when it comes to the
Alves, Ricardo N; Sundell, Kristina S; Anjos, Liliana; Sundh, Henrik; Harboe, Torstein; Norberg, Birgitta; Power, Deborah M
2018-06-01
To establish if the developmental changes in the primary barrier and osmoregulatory capacity of Atlantic halibut skin are modified during metamorphosis, histological, histochemical, gene expression and electrophysiological measurements were made. The morphology of the ocular and abocular skin started to diverge during the metamorphic climax and ocular skin appeared thicker and more stratified. Neutral mucins were the main glycoproteins produced by the goblet cells in skin during metamorphosis. Moreover, the number of goblet cells producing neutral mucins increased during metamorphosis and asymmetry in their abundance was observed between ocular and abocular skin. The increase in goblet cell number and their asymmetric abundance in skin was concomitant with the period that thyroid hormones (THs) increase and suggests that they may be under the control of these hormones. Several mucin transcripts were identified in metamorphosing halibut transcriptomes and Muc18 and Muc5AC were characteristic of the body skin. Na + , K + -ATPase positive (NKA) cells were observed in skin of all metamorphic stages but their number significantly decreased with the onset of metamorphosis. No asymmetry was observed between ocular and abocular skin in NKA cells. The morphological changes observed were linked to modified skin barrier function as revealed by modifications in its electrophysiological properties. However, the maturation of the skin functional characteristics preceded structural maturation and occurred at stage 8 prior to the metamorphic climax. Treatment of Atlantic halibut with the THs disrupter methimazole (MMI) affected the number of goblet cells producing neutral mucins and the NKA cells. The present study reveals that the asymmetric development of the skin in Atlantic halibut is TH sensitive and is associated with metamorphosis and that this barrier's functional properties mature earlier and are independent of metamorphosis.
Topical Nano and Microemulsions for Skin Delivery
Directory of Open Access Journals (Sweden)
Christofori M. R. R. Nastiti
2017-09-01
Full Text Available Nanosystems such as microemulsions (ME and nanoemulsions (NE offer considerable opportunities for targeted drug delivery to and via the skin. ME and NE are stable colloidal systems composed of oil and water, stabilised by a mixture of surfactants and cosurfactants, that have received particular interest as topical skin delivery systems. There is considerable scope to manipulate the formulation components and characteristics to achieve optimal bioavailability and minimal skin irritancy. This includes the incorporation of established chemical penetration enhancers to fluidize the stratum corneum lipid bilayers, thus reducing the primary skin barrier and increasing permeation. This review discusses nanosystems with utility in skin delivery and focuses on the composition and characterization of ME and NE for topical and transdermal delivery. The mechanism of skin delivery across the stratum corneum and via hair follicles is reviewed with particular focus on the influence of formulation.
Comfort and microbial barrier properties of garments worn next to the skin
Kopitar, D.; Rogina-Car, B.; Skenderi, Z.
2017-10-01
Compared with viscose fibre, modal fibre is characterized by some advantageous properties such as higher dry and wet tenacities, higher wet modulus, lower water retention capacity and lower level of swelling. Impact of different knitted fabric structure made of cotton and 97 % CMD/3 % EL fibres on thermo-physiological comfort and microbial barrier properties were investigated. All knitted fabrics have very good physiological properties. The microbial barrier permeability of knitted fabric after extreme contamination with bacterial spores in dry state showed that double jersey offered more effective microbial barrier than the single jersey knitted fabrics respectively the greater thickness of double jersey knitted fabric provide more difficult barrier to bacterial spores to pass. In wet state all knitted fabrics have more effective microbial barrier which could be explained by cellulose fibres swelling. In wet state 97 % CMD/3 % EL single jersey knitted fabric have more effective microbial barrier then cotton double and single jersey knitted fabrics.
Milani, Massimo; Sparavigna, Adele
2017-01-01
Moisturizing products are commonly used to improve hydration in skin dryness conditions. However, some topical hydrating products could have negative effects on skin barrier function. In addition, hydrating effects of moisturizers are not commonly evaluated up to 24 hours after a single application. Hyaluronic acid (HA) and glycerin are very well-known substances able to improve skin hydration. Centella asiatica extract (CAE) could exert lenitive, anti-inflammatory and reepithelialization actions. Furthermore, CAE could inhibit hyaluronidase enzyme activity, therefore prolonging the effect of HA. A fluid containing HA 1%, glycerin 5% and stem cells CAE has been recently developed (Jaluronius CS [JCS] fluid). To evaluate and compare the 24-hour effects of JCS fluid on skin hydration and on transepidermal water loss (TEWL) in healthy subjects in comparison with the control site. Twenty healthy women, mean age 40 years, were enrolled in an intra-subject (right vs left), randomized, assessor-blinded, controlled, 1-day trial. The primary end points were the skin hydration and TEWL, evaluated at the volar surface of the forearm and in standardized conditions (temperature- and humidity-controlled room: 23°C and 30% of humidity) using a corneometer and a vapometer device at baseline, 1, 8 and 24 hours after JCS fluid application. Measurements were performed by an operator blinded for the treatments. Skin hydration after 24 hours was significantly higher ( P =0.001; Mann-Whitney U test) in the JCS-treated area in comparison with the control site. JCS induced a significant ( P =0.0001) increase in skin hydration at each evaluation time (+59% after 1 hour, +48% after 8 hours and +29% after 24 hours) in comparison with both baseline ( P =0.0001) and non-treated control site ( P =0.001). TEWL after 24 hours was significantly lower ( P =0.049; Mann-Whitney U test) in the JCS-treated area in comparison with the control site (13±4 arbitrary units [AU] vs 16±6 AU). JCS fluid
Fatty acids are required for epidermal permeability barrier function.
Mao-Qiang, M; Elias, P M; Feingold, K R
1993-08-01
The permeability barrier is mediated by a mixture of ceramides, sterols, and free fatty acids arranged as extracellular lamellar bilayers in the stratum corneum. Whereas prior studies have shown that cholesterol and ceramides are required for normal barrier function, definitive evidence for the importance of nonessential fatty acids is not available. To determine whether epidermal fatty acid synthesis also is required for barrier homeostasis, we applied 5-(tetradecyloxy)-2-furancarboxylic acid (TOFA), an inhibitor of acetyl CoA carboxylase, after disruption of the barrier by acetone or tape stripping. TOFA inhibits epidermal fatty acid by approximately 50% and significantly delays barrier recovery. Moreover, coadministration of palmitate with TOFA normalizes barrier recovery, indicating that the delay is due to a deficiency in bulk fatty acids. Furthermore, TOFA treatment also delays the return of lipids to the stratum corneum and results in abnormalities in the structure of lamellar bodies, the organelle which delivers lipid to the stratum corneum. In addition, the organization of secreted lamellar body material into lamellar bilayers within the stratum corneum interstices is disrupted by TOFA treatment. Finally, these abnormalities in lamellar body and stratum corneum membrane structure are corrected by coapplication of palmitate with TOFA. These results demonstrate a requirement for bulk fatty acids in barrier homeostasis. Thus, inhibiting the epidermal synthesis of any of the three key lipids that form the extracellular, lipid-enriched membranes of the stratum corneum results in an impairment in barrier homeostasis.
International Nuclear Information System (INIS)
Wang Guoquan; Qian Jianjun; Wang Zuofa
2000-01-01
Objective: To observe the microcirculation changes in the patients with hand skin radiation damage caused by β rays. Methods: The XOX-1A type microcirculation microscope was used in observation of the microcirculation changes of fingernail, in 22 patients with III-IV degree hand skin radiation damage caused by β rays. Results: A series of abnormal signs were observed in all these patients and it was found that the microcirculation abnormality of the fingernail were the most clinical significant sign. Conclusion: The fingernail microcirculation changes can be used as an indicator for prognosis in the hand skin radiation damage patients
Diffusion of [2-14C]diazepam across hairless mouse skin and human skin
International Nuclear Information System (INIS)
Koch, R.L.; Palicharla, P.; Groves, M.J.
1987-01-01
The objectives of this study were to investigate the absorption of diazepam applied topically to the hairless mouse in vivo and to determine the diffusion of diazepam across isolated hairless mouse skin and human skin. [ 14 C]Diazepam was readily absorbed after topical administration to the intact hairless mouse, a total of 75.8% of the 14 C-label applied being recovered in urine and feces. Diazepam was found to diffuse across human and hairless mouse skin unchanged in experiments with twin-chambered diffusion cells. The variation in diffusion rate or the flux for both human and mouse tissues was greater among specimens than between duplicate or triplicate trials for a single specimen. Fluxes for mouse skin (stratum corneum, epidermis, and dermis) were greater than for human skin (stratum corneum and epidermis): 0.35-0.61 microgram/cm2/h for mouse skin vs 0.24-0.42 microgram/cm2/h for human skin. The permeability coefficients for mouse skin ranged from 1.4-2.4 X 10(-2)cm/h compared with 0.8-1.4 X 10(-2)cm/h for human skin. Although human stratum corneum is almost twice the thickness of that of the hairless mouse, the diffusion coefficients for human skin were 3-12 times greater (0.76-3.31 X 10(-6) cm2/h for human skin vs 0.12-0.27 X 10(-6) cm2/h for hairless mouse) because of a shorter lag time for diffusion across human skin. These differences between the diffusion coefficients and diffusion rates (or permeability coefficients) suggest that the presence of the dermis may present some barrier properties. In vitro the dermis may require complete saturation before the diazepam can be detected in the receiving chamber
Skin manifestations in a case of trisomy 16 mosaicism
DEFF Research Database (Denmark)
Ousager, Lilian Bomme; Brandrup, Flemming; Andersen, Charlotte Brasch
2006-01-01
We present a 48-year-old man with unilateral dermatological manifestations including hypertrichosis, telangiectasia, hyperkeratosis and hyperpigmentation. Additional findings included skeletal abnormalities and left-sided hearing loss. Skin biopsies showed changes characteristic of porokeratosis....
Symptomatic splenic hamartoma with renal, cutaneous, and hematological abnormalities
International Nuclear Information System (INIS)
Kassarjian, A.; Patenaude, Y.G.; Bernard, C.; Bell, L.
2001-01-01
Background. There is a rare association between splenic hamartomas and hematological abnormalities with, to our knowledge, only 24 reported cases in the English literature. Patients and methods. We report a case of a splenic hamartoma in a 14-year-old boy associated with membranoproliferative glomerulonephritis, multiple lobular capillary hemangiomas of the skin, hypertension, and anemia. Following imaging with ultrasonography, MRI, and nuclear scans, a hamartoma was suspected, but malignancy could not be excluded. The lesion was removed by partial splenectomy, and pathological examination confirmed the presence of a red pulp splenic hamartoma. Results. The renal, hematological, and dermatological abnormalities resolved following removal of the splenic hamartoma. This is the first reported case of a splenic hamartoma associated with renal, cutaneous, and hematological abnormalities and only the second reported case of a symptomatic splenic hamartoma treated by partial splenectomy. (orig.)
Symptomatic splenic hamartoma with renal, cutaneous, and hematological abnormalities
Energy Technology Data Exchange (ETDEWEB)
Kassarjian, A.; Patenaude, Y.G. [Dept. of Medical Imaging, Montreal Children' s Hospital, PQ (Canada); Bernard, C. [Dept. of Pathology, Montreal Children' s Hospital, PQ (Canada); Bell, L. [Dept. of Nephrology, Montreal Children' s Hospital, PQ (Canada)
2001-02-01
Background. There is a rare association between splenic hamartomas and hematological abnormalities with, to our knowledge, only 24 reported cases in the English literature. Patients and methods. We report a case of a splenic hamartoma in a 14-year-old boy associated with membranoproliferative glomerulonephritis, multiple lobular capillary hemangiomas of the skin, hypertension, and anemia. Following imaging with ultrasonography, MRI, and nuclear scans, a hamartoma was suspected, but malignancy could not be excluded. The lesion was removed by partial splenectomy, and pathological examination confirmed the presence of a red pulp splenic hamartoma. Results. The renal, hematological, and dermatological abnormalities resolved following removal of the splenic hamartoma. This is the first reported case of a splenic hamartoma associated with renal, cutaneous, and hematological abnormalities and only the second reported case of a symptomatic splenic hamartoma treated by partial splenectomy. (orig.)
Chemical peeling in ethnic skin: an update.
Salam, A; Dadzie, O E; Galadari, H
2013-10-01
With the growth of cosmetic dermatology worldwide, treatments that are effective against skin diseases and augment beauty without prolonged recovery periods, or exposing patients to the risks of surgery, are increasing in popularity. Chemical peels are a commonly used, fast, safe and effective clinic room treatment that may be used for cosmetic purposes, such as for fine lines and photoageing, but also as primary or adjunct therapies for acne, pigmentary disorders and scarring. Clinicians are faced with specific challenges when using peels on ethnic skin (skin of colour). The higher risk of postinflammatory dyschromias and abnormal scarring makes peels potentially disfiguring. Clinicians should therefore have a sound knowledge of the various peels available and their safety in ethnic skin. This article aims to review the background, classification, various preparations, indications, patient assessment and complications of using chemical peels in ethnic skin. © 2013 The Authors BJD © 2013 British Association of Dermatologists.
Skin test of radiosensitivity. Application to Fanconi anemia
International Nuclear Information System (INIS)
Dutreix, J.; Gluckman, E.
1983-01-01
A test of skin radiosensitivity is described. It is achieved by irradiating small skin fields (15 mm in diameter) with 50 kV X-rays. The radiosensitivity is evaluated from the skin reaction observed for a single acute dose of 8 and 10 Gy; it is considered increased if the reaction for 10 Gy exceeds the desquamation threshold, and scored according to the observed reaction. The test includes an evaluation of the cellular repair, assessed on the comparison of the reactions for single dose and split irradiation. The time of the reaction peak is also reported. Abnormal reactions have been observed on 4 out of 8 patients with Fanconi Anemia
Skin test of radiosensitivity. Application to Fanconi anemia
Energy Technology Data Exchange (ETDEWEB)
Dutreix, J. (Institut Gustave-Roussy, 94 - Villejuif (France)); Gluckman, E. (Centre Hayem, Hopital St.-Louis, 75 Paris (France))
1983-01-01
A test of skin radiosensitivity is described. It is achieved by irradiating small skin fields (15 mm in diameter) with 50 kV X-rays. The radiosensitivity is evaluated from the skin reaction observed for a single acute dose of 8 and 10 Gy; it is considered increased if the reaction for 10 Gy exceeds the desquamation threshold, and scored according to the observed reaction. The test includes an evaluation of the cellular repair, assessed on the comparison of the reactions for single dose and split irradiation. The time of the reaction peak is also reported. Abnormal reactions have been observed on 4 out of 8 patients with Fanconi Anemia.
Albèr, C; Buraczewska-Norin, I; Kocherbitov, V; Saleem, S; Lodén, M; Engblom, J
2014-10-01
The mammalian skin is a barrier that effectively separates the water-rich interior of the body from the normally dryer exterior. Changes in the external conditions, for example ambient humidity, have been shown to affect the skin barrier properties. The prime objective of this study was to evaluate the effect of water activity of a topical formulation on skin hydration and permeability. A second objective was to gain more understanding on how two commonly used humectants, urea and glycerol, affect skin barrier function in vivo. Simple aqueous formulations were applied under occlusion to the volar forearm of healthy volunteers. Following 4-h exposure, skin water loss (by transepidermal water loss measurements), skin hydration (by Corneometry) and skin permeability (by time to vasodilation due to benzyl nicotinate exposure) were monitored. The results demonstrate that a relatively small change in the water activity of a topical formulation is sufficient to induce considerable effects on stratum corneum hydration and permeability to exogenous substances. Exposing the skin to high water activity leads to increased skin hydration and also increased permeability. Furthermore, urea and glycerol promote skin hydration and permeability even at reduced water activity of the applied formulation. These results highlight the importance of considering the water activity in topically applied formulations and the potential benefit of using humectants. The results may impact formulation optimization in how to facilitate skin hydration and to modify skin permeability by temporarily open and close the skin barrier. © 2014 Society of Cosmetic Scientists and the Société Française de Cosmétologie.
Low uptake of silica nanoparticles in Caco-2 intestinal epithelial barriers
Ye, Dong; Bramini, Mattia; Hristov, Delyan R.; Wan, Sha; Salvati, Anna; Åberg, Christoffer; Dawson, Kenneth A.
2017-01-01
Cellular barriers, such as the skin, the lung epithelium or the intestinal epithelium, constitute one of the first obstacles facing nanomedicines or other nanoparticles entering organisms. It is thus important to assess the capacity of nanoparticles to enter and transport across such barriers. In
Lee, Woan-Ruoh; Shen, Shing-Chuan; Aljuffali, Ibrahim A; Li, Yi-Ching; Fang, Jia-You
2014-11-01
Alopecia usually cannot be cured because of the available drug therapy being unsatisfactory. To improve the efficiency of treatment, erbium-yttrium-aluminum-garnet (Er-YAG) laser treatment was conducted to facilitate skin permeation of antialopecia drugs such as minoxidil (MXD), diphencyprone (DPCP), and peptide. In vitro and in vivo percutaneous absorption experiments were carried out by using nude mouse skin and porcine skin as permeation barriers. Fluorescence and confocal microscopies were used to visualize distribution of permeants within the skin. Laser ablation at a depth of 6 and 10 μm enhanced MXD skin accumulation twofold to ninefold depending on the skin barriers selected. DPCP absorption showed less enhancement by laser irradiation as compared with MXD. An ablation depth of 10 μm could increase the peptide flux from zero to 4.99 and 0.33 μg cm(-2) h(-1) for nude mouse skin and porcine skin, respectively. The laser treatment also promoted drug uptake in the hair follicles, with DPCP demonstrating the greatest enhancement (sixfold compared with the control). The imaging of skin examined by microscopies provided evidence of follicular and intercellular delivery assisted by the Er-YAG laser. Besides the ablative effect of removing the stratum corneum, the laser may interact with sebum to break up the barrier function, increasing the skin delivery of antialopecia drugs. The minimally invasive, well-controlled approach of laser-mediated drug permeation offers a potential way to treat alopecia. This study's findings provide the basis for the first report on laser-assisted delivery of antialopecia drugs. © 2014 Wiley Periodicals, Inc. and the American Pharmacists Association.
Age-related percutaneous penetration part 1: skin factors.
Konda, S; Meier-Davis, S R; Cayme, B; Shudo, J; Maibach, H I
2012-05-01
Changes in the skin that occur in the elderly may put them at increased risk for altered percutaneous penetration from pharmacotherapy along with potential adverse effects. Skin factors that may have a role in age-related percutaneous penetration include blood flow, pH, skin thickness, hair and pore density, and the content and structure of proteins, glycosaminoglycans (GAGs), water, and lipids. Each factor is examined as a function of increasing age along with its potential impact on percutaneous penetration. Additionally, topical drugs that successfully overcome the barrier function of the skin can still fall victim to cutaneous metabolism, thereby producing metabolites that may have increased or decreased activity. This overview discusses the current data and highlights the importance of further studies to evaluate the impact of skin factors in age-related percutaneous penetration.
Denda, Mitsuhiro
2011-11-01
Previous studies have suggested that hexose molecules influence the stability of phospholipid bilayers. Therefore, the effects of topical application of all 12 stereoisomers of dextro-hexose on the epidermal barrier recovery rate after barrier disruption were evaluated. Immediately after tape stripping, 0.1 m aqueous solution of each hexose was applied on hairless mouse skin. Among the eight dextro-aldohexoses, topical application of altose, idose, mannose and talose accelerated the barrier recovery, while allose, galactose, glucose and gulose had no effect. Among the four dextro-ketohexoses, psicose, fructose, sorbose and tagatose all accelerated the barrier recovery. As the effects of hexoses on the barrier recovery rate appeared within 1 h, the mechanism is unlikely to be genomic. Instead, these hexoses may influence phase transition of the lipid bilayers of lamellar bodies and cell membrane, a crucial step in epidermal permeability barrier homeostasis. © 2011 John Wiley & Sons A/S.
Effects of air pollution on the skin: A review.
Puri, Poonam; Nandar, Shashi Kumar; Kathuria, Sushruta; Ramesh, V
2017-01-01
The increase in air pollution over the years has had major effects on the human skin. Various air pollutants such as ultraviolet radiation, polycyclic aromatic hydrocarbons, volatile organic compounds, oxides, particulate matter, ozone and cigarette smoke affect the skin as it is the outermost barrier. Air pollutants damage the skin by inducing oxidative stress. Although human skin acts as a biological shield against pro-oxidative chemicals and physical air pollutants, prolonged or repetitive exposure to high levels of these pollutants may have profound negative effects on the skin. Exposure to ultraviolet radiation has been associated with extrinsic skin aging and skin cancers. Cigarette smoke contributes to premature aging and an increase in the incidence of psoriasis, acne and skin cancers. It is also implicated in allergic skin conditions such as atopic dermatitis and eczema. Polyaromatic hydrocarbons are associated with extrinsic skin aging, pigmentation, cancers and acneiform eruptions. Volatile organic compounds have been associated with atopic dermatitis. Given the increasing levels of air pollution and its detrimental effects on the skin, it is advisable to use strategies to decrease air pollution.
Colwell, Janice C; Pittman, Joyce; Raizman, Rose; Salvadalena, Ginger
To compare ostomy-related costs and incidence of peristomal skin complications (PSCs) for ceramide-infused ostomy skin barriers and control skin barriers. The ADVOCATE trial is a multi-centered randomized controlled trial, and double-blinded international study with an adaptive design. The sample comprised 153 adults from 25 sites from the United States, Canada, and Europe. Participants were seen in hospital and outpatient care settings. Data were collected by investigators at each site during face-to-face visits and during telephone check-in calls between visits. Cost of care data were collected using a questionnaire developed specifically for the study. The peristomal skin was assessed using the Ostomy Skin Tool. Health-related quality of life was measured using the SF-12v2. Patient-reported outcomes were collected using a patient-centered study-specific questionnaire. Cost of care was analyzed via analysis of covariance comparing total cost of care for 12 weeks between the 2 groups. The incidence of PSC was analyzed via Barnard's exact test comparing the incidence of PSCs between the control and treatment groups. Tertiary outcomes were exploratory in nature and not statistically powered. Use of the ceramide-infused barrier significantly reduced stoma-related cost of care over a 12-week period, resulting in a $36.46 decrease in cost (14% relative decrease). The adjusted average costs were $223.73 in the treatment group and $260.19 in the control group (P = .017). The overall incidence of PSCs in the study was 47.7%; PSC incidence was 40.5% for the treatment group versus 55.4% for controls (P = .069, 95% confidence interval of the difference: -1.2 to 30.4). Significantly more participants using the ceramide-infused skin barrier were "very satisfied" with barrier performance (75% vs 55%; P = .033), prevention of leakage (63% vs 38%; P < .01), and prevention of itching (53% vs 31%; P = .016). General postoperative improvement in health-related quality of life was
Skin acceptability of a cosmetic moisturizer formulation in female subjects with sensitive skin
Directory of Open Access Journals (Sweden)
Nisbet SJ
2018-04-01
the exposed areas.Conclusion: This cosmetic moisturizer appears generally well tolerated and suitable for topical use in subjects with sensitive skin. Keywords: skin barrier, safety testing, sensitive skin, skin acceptability, irritation
Effect of contact barrier on electron transport in graphene.
Zhou, Yang-Bo; Han, Bing-Hong; Liao, Zhi-Min; Zhao, Qing; Xu, Jun; Yu, Da-Peng
2010-01-14
The influence of the barrier between metal electrodes and graphene on the electrical properties was studied on a two-electrode device. A classical barrier model was used to analyze the current-voltage characteristics. Primary parameters including barrier height and effective resistance were achieved. The electron transport properties under magnetic field were further investigated. An abnormal peak-valley-peak shape of voltage-magnetoresistance curve was observed. The underlying mechanisms were discussed under the consideration of the important influence of the contact barrier. Our results indicate electrical properties of graphene based devices are sensitive to the contact interface.
Directory of Open Access Journals (Sweden)
VijayKumar Patra
2018-05-01
Full Text Available The human skin is known to be inhabited by diverse microbes, including bacteria, fungi, viruses, archaea, and mites. This microbiome exerts a protective role against infections by promoting immune development and inhibiting pathogenic microbes to colonize skin. One of the factors having an intense effect on the skin and its resident microbes is ultraviolet-radiation (UV-R. UV-R can promote or inhibit the growth of microbes on the skin and modulate the immune system which can be either favorable or harmful. Among potential UV-R targets, skin resident memory T cells (TRM stand as well positioned immune cells at the forefront within the skin. Both CD4+ or CD8+ αβ TRM cells residing permanently in peripheral tissues have been shown to play prominent roles in providing accelerated and long-lived specific immunity, tissue homeostasis, wound repair. Nevertheless, their response upon UV-R exposure or signals from microbiome are poorly understood compared to resident TCRγδ cells. Skin TRM survive for long periods of time and are exposed to innumerable antigens during lifetime. The interplay of TRM with skin residing microbes may be crucial in pathophysiology of various diseases including psoriasis, atopic dermatitis and polymorphic light eruption. In this article, we share our perspective about how UV-R may directly shape the persistence, phenotype, specificity, and function of skin TRM; and moreover, whether UV-R alters barrier function, leading to microbial-specific skin TRM, disrupting the healthy balance between skin microbiome and skin immune cells, and resulting in chronic inflammation and diseased skin.
Linear scleroderma en coup de sabre including abnormal dental development
DEFF Research Database (Denmark)
Hørberg, M; Lauesen, S R; Daugaard-Jensen, J
2015-01-01
BACKGROUND: Linear scleroderma en coup de sabre (SCS) is a rare skin condition, where dense collagen is deposited in a localised groove of the head and neck area resembling the stroke of a sabre. The SCS may involve the oral cavity, but the severity and relation to this skin abnormality is unknow...... with a left-sided skin defect (SCS) and a left-sided local malformation in her dentition. It is possible that there is a developmental connection between these two left-sided defects, both with an ectodermal origin.......-UP: The patient has been regularly controlled and treated since she was first diagnosed. A surgical and orthodontic treatment was performed to ensure optimal occlusion, space and alveolar bone development. The present age of the patient is 14 years and 10 months. CONCLUSION: This case demonstrated a patient...
The ultrastructure and etiology of chronic radiotherapy damage in human skin
International Nuclear Information System (INIS)
Rudolph, R.; Arganese, T.; Woodward, M.
1982-01-01
Ulcerated and nonulcerated skin from 5 patients with chronic radiation skin damage was examined using electron microscopy. Noticeable fibroblast disorganization was seen, with swollen and degenerating mitochondria, multiple vacuoles, and dilated irregular rough endoplasmic reticulum. Unusual crystalline inclusions were seen in some fibroblasts. In the ulcerated skin, contractile fibroblasts (myofibroblasts) were seen in 2 of 4 specimens. Stroma showed dense collagen and prominent elastosis. The microvasculature in the radiation-damaged tissue showed occasional lumen occlusion and vacuolization of endothelial cells, without consistent abnormality. These data suggest that permanent damage to fibroblasts or fibroblast stem cells may play an important role in chronic radiation skin ulceration
Directory of Open Access Journals (Sweden)
Pasricha J
1991-01-01
Full Text Available A barrier function test has been designed to screen the protective capacity of a cream against the cauterizing effect of cashew nut shell oil (CNSO on the skin. The test consists of applying the barrier cream on a 5 cm circular area of skin on the back of a human volunteer and then at its centre applying a 1 cm sq Whatman no. 3 paper disc soaked in the CNSO for 15 minutes and looking for the evidence of cauterization reaction after 48 hours. Of the various creams containing a variety of paraffins, bees wax, polyethylene glycols, methyl cellulose gel, and petrolatum, only polyethylene glycol (PEG cream was found to afford adequate protection against cashew nut shell oil. Addition of 10% zinc oxide or 10% kaolin to the PEG cream did not seem to afford any additional protection. Castor oil already being used by the workers was found to be inferior to the PEG cream.
Jatana, Samreen; Palmer, Brian C; Phelan, Sarah J; Gelein, Robert; DeLouise, Lisa A
2017-04-14
Previous work has demonstrated size, surface charge and skin barrier dependent penetration of nanoparticles into the viable layers of mouse skin. The goal of this work was to characterize the tissue distribution and mechanism of transport of nanoparticles beyond skin, with and without Ultraviolet Radiation (UVR) induced skin barrier disruption. Atomic absorption spectroscopy (AAS), flow cytometry and confocal microscopy were used to examine the effect of UVR dose (180 and 360 mJ/cm 2 UVB) on the skin penetration and systemic distribution of quantum dot (QD) nanoparticles topically applied at different time-points post UVR using a hairless C57BL/6 mouse model. Results indicate that QDs can penetrate mouse skin, regardless of UVR exposure, as evidenced by the increased cadmium in the local lymph nodes of all QD treated mice. The average % recovery for all treatment groups was 69.68% with ~66.84% of the applied dose recovered from the skin (both epicutaneous and intracutaneous). An average of 0.024% of the applied dose was recovered from the lymph nodes across various treatment groups. When QDs are applied 4 days post UV irradiation, at the peak of the skin barrier defect and LC migration to the local lymph node, there is an increased cellular presence of QD in the lymph node; however, AAS analysis of local lymph nodes display no difference in cadmium levels due to UVR treatment. Our data suggests that Langerhans cells (LCs) can engulf QDs in skin, but transport to the lymph node may occur by both cellular (dendritic and macrophage) and non-cellular mechanisms. It is interesting that these specific nanoparticles were retained in skin similarly regardless of UVR barrier disruption, but the observed skin immune cell interaction with nanoparticles suggest a potential for immunomodulation, which we are currently examining in a murine model of skin allergy.
Directory of Open Access Journals (Sweden)
Vinayak K. Nahar
2013-01-01
Full Text Available There are slightly over one million workers in the landscape service industry in the US. These workers have potential for high levels of solar ultraviolet radiation exposure, increasing their risk of skin cancer. A cross-sectional sample of 109 landscapers completed a self-administered questionnaire based on Health Belief Model (HBM. The participants correctly answered 67.1% of the knowledge questions, 69.7% believed they were more likely than the average person to get skin cancer, and 87.2% perceived skin cancer as a severe disease. Participants believed that the use of wide-brimmed hats, long sleeved shirts/long pants, and sunscreen was beneficial but reported low usage of these and other sun protective strategies. The primary barriers to using sun protection were “I forget to wear it” and “it is too hot to wear.” Of the HBM variables, perceived benefits outweighing perceived barrier (, and self-efficacy (, were correlated with sun protection behaviors. The reasons for absence of the relationship between perceived skin cancer threat and sun protection behaviors could be lack of skin cancer knowledge and low rate of personal skin cancer history.
Optimization of PIXE-sensitivity for detection of Ti in thin human skin sections
International Nuclear Information System (INIS)
Pallon, Jan; Garmer, Mats; Auzelyte, Vaida; Elfman, Mikael; Kristiansson, Per; Malmqvist, Klas; Nilsson, Christer; Shariff, Asad; Wegden, Marie
2005-01-01
Modern sunscreens contain particles like TiO 2 having sizes of 25-70 nm and acting as a reflecting substance. For cosmetic reasons the particle size is minimized. Questions have been raised to what degree these nano particles penetrate the skin barrier, and how they do affect the human. The EU funded project 'Quality of skin as a barrier to ultra-fine particles' - NANODERM has started with the purpose to evaluate the possible risks of TiO 2 penetration into vital skin layers. The purpose of the work presented here was to find the optimal conditions for micro-PIXE analysis of Ti in thin skin sections. In the skin region where Ti is expected to be found, the naturally occurring major elements phosphorus, chlorine, sulphur and potassium have steep gradients and thus influence the X-ray background in a non-predictable manner. Based on experimental studies of Ti-exposed human skin sections using proton energies ranging from 1.8-2.55 MeV, the corresponding PIXE detection limits for Ti were calculated. The energy that was found to be the most favourable, 1.9 MeV, was then selected for future studies
Sethi, M; Lehmann, A R; Fawcett, H; Stefanini, M; Jaspers, N; Mullard, K; Turner, S; Robson, A; McGibbon, D; Sarkany, R; Fassihi, H
2013-12-01
Xeroderma pigmentosum (XP) is a rare autosomal recessive disorder of DNA repair. It is divided into eight complementation groups: XP-A to XP-G (classical XP) and XP variant (XP-V). Severe and prolonged sunburn reactions on minimal sun exposure have been considered a cardinal feature of classical XP. However, it has recently become clear that not all patients have abnormal sunburn reactions. To examine sunburn reactions in a cohort of patients with XP and correlate this to the complementation group. Sixty patients with XP attending the U.K. National XP Service from 2010 to 2012 were studied. Their history of burning after minimal sun exposure was assessed using a newly developed sunburn severity score. The age at which the first skin cancer was histologically diagnosed in each patient, and the presence of any neurological abnormality, was also recorded. Sunburn severity scores were abnormally high in patients with XP-A, XP-D, XP-F and XP-G compared with non-XP controls. There was no significant difference in sunburn score of patients with XP-C, XP-E and XP-V compared with controls (P > 0·05). Patients with XP-C, XP-E and XP-V were more likely to have skin cancer diagnosed at an earlier age than those with severe sunburn on minimal sun exposure. In addition, patients with XP with severe sunburn had an increased frequency of neurological abnormalities. Not all patients with XP have a history of severe and prolonged sunburn on minimal sun exposure. The normal sunburn response of patients with XP-C, XP-E and XP-V may relate to the preservation of transcription-coupled DNA repair in these groups. Those with a history of severe sunburn on minimal sun exposure developed their first skin cancer at an older age compared with patients with XP-C, XP-E and XP-V, but they had an increased frequency of neurological abnormalities. Physicians need to be aware that about half of all patients with XP will present without a history of abnormal sunburn. © 2013 British Association of
Skin Fungi from Colonization to Infection.
de Hoog, Sybren; Monod, Michel; Dawson, Tom; Boekhout, Teun; Mayser, Peter; Gräser, Yvonne
2017-07-01
Humans are exceptional among vertebrates in that their living tissue is directly exposed to the outside world. In the absence of protective scales, feathers, or fur, the skin has to be highly effective in defending the organism against the gamut of opportunistic fungi surrounding us. Most (sub)cutaneous infections enter the body by implantation through the skin barrier. On intact skin, two types of fungal expansion are noted: (A) colonization by commensals, i.e., growth enabled by conditions prevailing on the skin surface without degradation of tissue, and (B) infection by superficial pathogens that assimilate epidermal keratin and interact with the cellular immune system. In a response-damage framework, all fungi are potentially able to cause disease, as a balance between their natural predilection and the immune status of the host. For this reason, we will not attribute a fixed ecological term to each species, but rather describe them as growing in a commensal state (A) or in a pathogenic state (B).
Lee, Woan-Ruoh; Shen, Shing-Chuan; Al-Suwayeh, Saleh A; Li, Yi-Ching; Fang, Jia-You
2012-06-01
While laser skin resurfacing is expected to result in reduced barrier function and increased risk of drug absorption, the extent of the increment has not yet been systematically investigated. We aimed to establish the skin permeation profiles of tetracycline and sunscreens after exposure to the erbium:yttrium-aluminum-garnet (Er:YAG) laser during postoperative periods. Physiological and histopathological examinations were carried out for 5 days after laser treatment on nude mice. Percutaneous absorption of the permeants was determined by an in vitro Franz cell. Ablation depths varied in reaching the stratum corneum (10 μm, 2.5 J/cm²) to approach the epidermis (25 μm, 6.25 J/cm²) and upper dermis (40 μm, 10 J/cm²). Reepithelialization evaluated by transepidermal water loss was complete within 2-4 days and depended on the ablation depth. Epidermal hyperplasia was observed in the 40-μm-treated group. The laser was sufficient to disrupt the skin barrier and allow the transport of the permeants into and across the skin. The laser fluence was found to play an important role in modulating skin absorption. A 25-μm ablation depth increased tetracycline flux 84-fold. A much smaller enhancement (3.3-fold) was detected for tetracycline accumulation within the skin. The laser with different fluences produced enhancement of oxybenzone skin deposition of 3.4-6.4-fold relative to the untreated group. No penetration across the skin was shown regardless of whether titanium dioxide was applied to intact or laser-treated skin. However, laser resurfacing increased the skin deposition of titanium dioxide from 46 to 109-188 ng/g. Tetracycline absorption had recovered to the level of intact skin after 5 days, while more time was required for oxybenzone absorption. The in vivo skin accumulation and plasma concentration revealed that the laser could increase tetracycline absorption 2-3-fold. The experimental results indicated that clinicians should be cautious when determining the
Permeation of platinum and rhodium nanoparticles through intact and damaged human skin
International Nuclear Information System (INIS)
Mauro, Marcella; Crosera, Matteo; Bianco, Carlotta; Adami, Gianpiero; Montini, Tiziano; Fornasiero, Paolo; Jaganjac, Morana; Bovenzi, Massimo; Filon, Francesca Larese
2015-01-01
The aim of the study was to evaluate percutaneous penetration of platinum and rhodium nanoparticles (PtNPs: 5.8 ± 0.9 nm, RhNPs: 5.3 ± 1.9 nm) through human skin. Salts compounds of these metals are sensitizers and some also carcinogenic agents. In vitro permeation experiments were performed using Franz diffusion cells with intact and damaged skin. PtNPs and RhNPs, stabilized with polyvinylpyrrolidone, were synthesized by reduction of Na 2 PtC l6 and RhCl 3 ·3H 2 O respectively. Suspensions with a concentration of 2.0 g/L of PtNPs and RhNPs were dispersed separately in synthetic sweat at pH 4.5 and applied as donor phases to the outer surface of the skin for 24 h. Measurements of the content of the metals in the receiving solution and in the skin were performed subsequently. Rhodium skin permeation was demonstrated through damaged skin, with a permeation flux of 0.04 ± 0.04 μg cm −2 h −1 and a lag time of 7.9 ± 1.1 h, while no traces of platinum were found in receiving solutions. Platinum and rhodium skin-analysis showed significantly higher concentrations of the metals in damaged skin. Rh and Pt applied as NPs can penetrate the skin barrier and Rh can be found in receiving solutions. These experiments pointed out the need for skin contamination prevention, since even a minor injury to the skin barrier can significantly increase penetration
Permeation of platinum and rhodium nanoparticles through intact and damaged human skin
Energy Technology Data Exchange (ETDEWEB)
Mauro, Marcella [University of Trieste, Clinical Unit of Occupational Medicine, Department of Medical Sciences (Italy); Crosera, Matteo; Bianco, Carlotta; Adami, Gianpiero; Montini, Tiziano; Fornasiero, Paolo [University of Trieste, Department of Chemical and Pharmaceutical Sciences (Italy); Jaganjac, Morana [Rudjer Boskovic Institute, Laboratory for Oxidative Stress, Department of Molecular Medicine (Croatia); Bovenzi, Massimo; Filon, Francesca Larese, E-mail: larese@units.it [University of Trieste, Clinical Unit of Occupational Medicine, Department of Medical Sciences (Italy)
2015-06-15
The aim of the study was to evaluate percutaneous penetration of platinum and rhodium nanoparticles (PtNPs: 5.8 ± 0.9 nm, RhNPs: 5.3 ± 1.9 nm) through human skin. Salts compounds of these metals are sensitizers and some also carcinogenic agents. In vitro permeation experiments were performed using Franz diffusion cells with intact and damaged skin. PtNPs and RhNPs, stabilized with polyvinylpyrrolidone, were synthesized by reduction of Na{sub 2}PtC{sub l6} and RhCl{sub 3}·3H{sub 2}O respectively. Suspensions with a concentration of 2.0 g/L of PtNPs and RhNPs were dispersed separately in synthetic sweat at pH 4.5 and applied as donor phases to the outer surface of the skin for 24 h. Measurements of the content of the metals in the receiving solution and in the skin were performed subsequently. Rhodium skin permeation was demonstrated through damaged skin, with a permeation flux of 0.04 ± 0.04 μg cm{sup −2} h{sup −1} and a lag time of 7.9 ± 1.1 h, while no traces of platinum were found in receiving solutions. Platinum and rhodium skin-analysis showed significantly higher concentrations of the metals in damaged skin. Rh and Pt applied as NPs can penetrate the skin barrier and Rh can be found in receiving solutions. These experiments pointed out the need for skin contamination prevention, since even a minor injury to the skin barrier can significantly increase penetration.
Commensal–dendritic-cell interaction specifies a unique protective skin immune signature
Naik, Shruti; Bouladoux, Nicolas; Linehan, Jonathan L.; Han, Seong-Ji; Harrison, Oliver J.; Wilhelm, Christoph; Conlan, Sean; Himmelfarb, Sarah; Byrd, Allyson L.; Deming, Clayton; Quinones, Mariam; Brenchley, Jason M.; Kong, Heidi H.; Tussiwand, Roxanne; Murphy, Kenneth M.; Merad, Miriam; Segre, Julia A; Belkaid, Yasmine
2015-01-01
The skin represents the primary interface between the host and the environment. This organ is also home to trillions of microorganisms that play an important role in tissue homeostasis and local immunity1–4. Skin microbial communities are highly diverse and can be remodelled over time or in response to environmental challenges5–7. How, in the context of this complexity, individual commensal microorganisms may differentially modulate skin immunity and the consequences of these responses for tissue physiology remains unclear. Here we show that defined commensals dominantly affect skin immunity and identify the cellular mediators involved in this specification. In particular, colonization with Staphylococcus epidermidis induces IL-17A+ CD8+ T cells that home to the epidermis, enhance innate barrier immunity and limit pathogen invasion. Commensal-specific T-cell responses result from the coordinated action of skin-resident dendritic cell subsets and are not associated with inflammation, revealing that tissue-resident cells are poised to sense and respond to alterations in microbial communities. This interaction may represent an evolutionary means by which the skin immune system uses fluctuating commensal signals to calibrate barrier immunity and provide heterologous protection against invasive pathogens. These findings reveal that the skin immune landscape is a highly dynamic environment that can be rapidly and specifically remodelled by encounters with defined commensals, findings that have profound implications for our understanding of tissue-specific immunity and pathologies. PMID:25539086
Voegeli, R; Rawlings, A V; Seroul, P; Summers, B
2015-12-01
The aim of this exploratory study was to develop a novel colour mapping approach to visualize and interpret the complexity of facial skin hydration and barrier properties of four ethnic groups (Caucasians, Indians, Chinese and Black Africans) living in Pretoria, South Africa. We measured transepidermal water loss (TEWL) and skin capacitance on 30 pre-defined sites on the forehead, cheek, jaw and eye areas of sixteen women (four per ethnic group) and took digital images of their faces. Continuous colour maps were generated by interpolating between each measured value and superimposing the values on the digital images. The complexity of facial skin hydration and skin barrier properties is revealed by these measurements and visualized by the continuous colour maps of the digital images. Overall, the Caucasian subjects had the better barrier properties followed by the Black African subjects, Chinese subjects and Indian subjects. Nevertheless, the two more darkly pigmented ethnic groups had superior skin hydration properties. Subtle differences were seen when examining the different facial sites. There exists remarkable skin capacitance and TEWL gradients within short distances on selected areas of the face. These gradients are distinctive in the different ethnic groups. In contrast to other reports, we found that darkly pigmented skin does not always have a superior barrier function and differences in skin hydration values are complex on the different parts of the face among the different ethnic groups. © 2015 Society of Cosmetic Scientists and the Société Française de Cosmétologie.
Skin findings in Williams syndrome.
Kozel, Beth A; Bayliss, Susan J; Berk, David R; Waxler, Jessica L; Knutsen, Russell H; Danback, Joshua R; Pober, Barbara R
2014-09-01
Previous examination in a small number of individuals with Williams syndrome (also referred to as Williams-Beuren syndrome) has shown subtly softer skin and reduced deposition of elastin, an elastic matrix protein important in tissue recoil. No quantitative information about skin elasticity in individuals with Williams syndrome is available; nor has there been a complete report of dermatologic findings in this population. To fill this knowledge gap, 94 patients with Williams syndrome aged 7-50 years were recruited as part of the skin and vascular elasticity (WS-SAVE) study. They underwent either a clinical dermatologic assessment by trained dermatologists (2010 WSA family meeting) or measurement of biomechanical properties of the skin with the DermaLab™ suction cup (2012 WSA family meeting). Clinical assessment confirmed that soft skin is common in this population (83%), as is premature graying of the hair (80% of those 20 years or older), while wrinkles (92%), and abnormal scarring (33%) were detected in larger than expected proportions. Biomechanical studies detected statistically significant differences in dP (the pressure required to lift the skin), dT (the time required to raise the skin through a prescribed gradient), VE (viscoelasticity), and E (Young's modulus) relative to matched controls. The RT (retraction time) also trended longer but was not significant. The biomechanical differences noted in these patients did not correlate with the presence of vascular defects also attributable to elastin insufficiency (vascular stiffness, hypertension, and arterial stenosis) suggesting the presence of tissue specific modifiers that modulate the impact of elastin insufficiency in each tissue. © 2014 Wiley Periodicals, Inc.
Current drug therapies for rosacea: a chronic vascular and inflammatory skin disease.
Feldman, Steven R; Huang, William W; Huynh, Tu T
2014-06-01
Rosacea is a chronic skin disorder that presents with abnormal vascular and inflammatory conditions. Clinical manifestations include flushing, facial erythema, inflammatory papules and pustules, telangiectasias, edema, and watery or irritated eyes. To discuss the evolving pathophysiology of rosacea, factors involved in promoting the chronic vascular and inflammatory abnormalities seen in rosacea, and the available drug therapies for the condition. Chronic inflammation and vascular changes are believed to be underlying factors in the pathophysiology of rosacea. Aberrant cathelicidin expression, elevated kallikrein 5 (KLK5) proteolytic activity, and altered toll-like receptor 2 (TLR2) expression have been reported in rosacea skin leading to the production of proinflammatory cytokines. Until recently, drug therapies only targeted the inflammatory lesions (papules and pustules) and transient erythema associated with these inflammatory lesions of rosacea. Brimonidine tartrate gel 0.5% was recently approved for the treatment of persistent (nontransient) facial erythema of rosacea, acting primarily on the cutaneous vascular component of the disease. Rosacea is a chronic vascular and inflammatory skin disease. Understanding the role of factors that trigger the onset of rosacea symptoms and exacerbate the condition is crucial in treating this skin disease.
MicroRNAs in skin tissue engineering.
Miller, Kyle J; Brown, David A; Ibrahim, Mohamed M; Ramchal, Talisha D; Levinson, Howard
2015-07-01
35.2 million annual cases in the U.S. require clinical intervention for major skin loss. To meet this demand, the field of skin tissue engineering has grown rapidly over the past 40 years. Traditionally, skin tissue engineering relies on the "cell-scaffold-signal" approach, whereby isolated cells are formulated into a three-dimensional substrate matrix, or scaffold, and exposed to the proper molecular, physical, and/or electrical signals to encourage growth and differentiation. However, clinically available bioengineered skin equivalents (BSEs) suffer from a number of drawbacks, including time required to generate autologous BSEs, poor allogeneic BSE survival, and physical limitations such as mass transfer issues. Additionally, different types of skin wounds require different BSE designs. MicroRNA has recently emerged as a new and exciting field of RNA interference that can overcome the barriers of BSE design. MicroRNA can regulate cellular behavior, change the bioactive milieu of the skin, and be delivered to skin tissue in a number of ways. While it is still in its infancy, the use of microRNAs in skin tissue engineering offers the opportunity to both enhance and expand a field for which there is still a vast unmet clinical need. Here we give a review of skin tissue engineering, focusing on the important cellular processes, bioactive mediators, and scaffolds. We further discuss potential microRNA targets for each individual component, and we conclude with possible future applications. Copyright © 2015 Elsevier B.V. All rights reserved.
The effect of ceramide-containing skin care products on eczema resolution duration.
Draelos, Zoe Diana
2008-01-01
Eczema is a common dermatologic condition that affects children as well as adults and is related to a defective skin barrier, which is most commonly caused by damage to the intercellular lipids from improper selection of skin cleansers and moisturizers. A new concept in skin care is the incorporation of ceramides into therapeutic cleansers and moisturizers. Ceramides are important components of the intercellular lipids that are necessary to link the protein-rich corneocytes into a waterproof barrier that is capable of protecting the underlying skin tissues and regulating body homeostasis. This study evaluated the effect of both a multilamellar vesicular emulsion (MVE) ceramide-containing liquid cleanser and moisturizing cream plus fluocinonide cream 0.05% compared with a bar cleanser plus fluocinonide cream 0.05% in the treatment of mild to moderate eczema. The addition of an MVE ceramide-containing liquid cleanser and moisturizing cream to a high-potency corticosteroid enhanced the treatment outcome of mild to moderate eczema compared with the use of a bar cleanser and high-potency corticosteroid in reducing disease duration, time to disease clearance, and symptoms. Thus, skin care product selection can have an important clinical effect on the clearance of mild to moderate eczema.
Study of mast cell count in skin tags
Directory of Open Access Journals (Sweden)
Zaher Hesham
2007-01-01
Full Text Available Background: Skin tags or acrochordons are common tumors of middle-aged and elderly subjects. They consist of loose fibrous tissue and occur mainly on the neck and major flexures as small, soft, pedunculated protrusions. Objectives: The aim was to compare the mast cells count in skin tags to adjacent normal skin in diabetic and nondiabetic participants in an attempt to elucidate the possible role of mast cells in the pathogenesis of skin tags. Participants and Methods: Thirty participants with skin tags were divided into group I (15 nondiabetic participants and group II (15 diabetic participants. Three biopsies were obtained from each participant: a large skin tag, a small skin tag and adjacent normal skin. Mast cell count from all the obtained sections was carried out, and the mast cell density was expressed as the average mast cell count/high power field (HPF. Results: A statistically significant increase in mast cells count in skin tags in comparison to normal skin was detected in group I and group II. There was no statistically significant difference between mast cell counts in skin tags of both the groups. Conclusion: Both the mast cell mediators and hyperinsulinemia are capable of inducing fibroblast proliferation and epidermal hyperplasia that are the main pathologic abnormalities seen in all types of skin tags. However, the presence of mast cells in all examined skin tags regardless of diabetes and obesity may point to the possible crucial role of mast cells in the etiogenesis of skin tags through its interaction with fibroblasts and keratinocytes.
International Nuclear Information System (INIS)
Kertesz, Zs.; Szikszai, Z.; Kiss, A.Z.
2004-01-01
Complete text of publication follows. Micronised titanium-, zinc- or silicon-oxide is a widely used physical photoprotective agent as a component of various cosmetic products. Due to the small particle size (down to 15 nm) it is supposed, that the particles may pass through the uppermost horny skin layer, and penetrate into deeper vital skin layers. However, only a few experiments have been carried out on its penetration through the human epidermal barrier and its possible biological effects in vivo and in vitro, using the tape stripping method which has no lateral and limited depth resolution. A consortium consisting of 12 European universities and scientific institutes has been established under the leadership of the Fakultat fuer Physik und Geowissenchaft Universitat Leipzig, whose goal is to get quantitative information on the penetration of ultrafine particles in all strata of skin, on their penetration pathways as well as on their impact on human health [1]. The IBA group of the Atomki takes part in this project as a subcontractor of the Department of Dermatology, University of Debrecen, Hungary. Ion microscopy, electron microscopy and autoradiography are used to trace the penetration of the nanoparticles into the skin layers, molecular and cell-biological methods are applied to assess the skin response and activation of dermal cells. The IBA group of the Atomki takes part in WP3: Ion Microscopy Work Package together with five other nuclear microprobe laboratories. The participants provide quantitative elemental composition in all strata of skin with detection limits of about 1 μg/g and lateral resolution of 1-2 μm by applying various ion beam analytical techniques. Samples investigated by ion microscopy are 14-16 μm thick cryo-fixed freeze-dried sections of porcine and human skin. Since the sample preparation requires completely different treatment for ion microscopy than for conventional microscopy, the members of the IBA group, who already have
Granulomatous slack skin. Histopathology diagnosis preceding clinical manifestations by 12 years.
Goldsztajn, Karen O; Moritz Trope, Beatriz; Ribeiro Lenzi, Maria Elisa; Cuzzi, Tullia; Ramos-E-Silva, Marcia
2012-12-31
Granulomatous slack skin is a very rare subtype of T-cell cutaneous lymphoma, characterized by the slow development of cutaneous sagging, especially on flexural areas. Its behavior is indolent and the treatment, in the majority of cases, disappointing. We report a 54-year-old black patient with granulomatous slack skin, who at the beginning of the investigation showed intense xeroderma and generalized lymph node enlargement. The diagnosis was established based on histopathologic findings long before the disease's characteristic clinical presentation appeared. During the twelve years of follow-up, the clinical manifestation evolved to marked skin looseness, most predominant in flexural regions, illustrating the clinical hallmark of granulomatous slack skin, long after first histological abnormalities were observed.
The Use of Matriderm and Autologous Skin Graft in the Treatment of Full Thickness Skin Defects
Directory of Open Access Journals (Sweden)
Jang Hwan Min
2014-07-01
Full Text Available Background For patients with full thickness skin defects, autologous Split-thickness skin grafts (STSG are generally regarded as the mainstay of treatment. However, skin grafts have some limitations, including undesirable outcomes resulting from scars, poor elasticity, and limitations in joint movement due to contractures. In this study, we present outcomes of Matriderm grafts used for various skin tissue defects whether it improves on these drawbacks. Methods From January 2010 to March 2012, a retrospective review of patients who had undergone autologous STSG with Matriderm was performed. We assessed graft survival to evaluate the effectiveness of Matriderm. We also evaluated skin quality using a Cutometer, Corneometer, Tewameter, or Mexameter, approximately 12 months after surgery. Results A total of 31 patients underwent STSG with Matriderm during the study period. The success rate of skin grafting was 96.7%. The elasticity value of the portion on which Matriderm was applied was 0.765 (range, 0.635-0.800, the value of the trans-epidermal water loss (TEWL was 10.0 (range, 8.15-11.00 g/hr/m2, and the humidification value was 24.0 (range, 15.5-30.0. The levels of erythema and melanin were 352.0 arbitrary unit (AU (range, 299.25-402.75 AU and 211.0 AU (range, 158.25-297.00 AU, respectively. When comparing the values of elasticity and TEWL of the skin treated with Matriderm to the values of the surrounding skin, there was no statistically significant difference between the groups. Conclusions The results of this study demonstrate that a dermal substitute (Matriderm with STSG was adopted stably and with minimal complications. Furthermore, comparing Matriderm grafted skin to normal skin using Cutometer, Matriderm proved valuable in restoring skin elasticity and the skin barrier.
Kendall, Alexandra C; Kiezel-Tsugunova, Magdalena; Brownbridge, Luke C; Harwood, John L; Nicolaou, Anna
2017-09-01
Ceramides are important for skin health, with a multitude of species found in both dermis and epidermis. The epidermis contains linoleic acid-Ester-linked Omega-hydroxylated ceramides of 6-Hydroxy-sphingosine, Sphingosine and Phytosphingosine bases (CER[EOH], CER[EOS] and CER[EOP], respectively), that are crucial for the formation of the epidermal barrier, conferring protection from environmental factors and preventing trans-epidermal water loss. Furthermore, a large number of ceramides, derivatives of the same sphingoid bases and various fatty acids, are produced by dermal and epidermal cells and perform signalling roles in cell functions ranging from differentiation to apoptosis. Supplementation with the n-3 polyunsaturated fatty acids (PUFA) eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) have shown promise as therapeutic agents in a number of inflammatory skin conditions, altering the lipid profile of the skin and production of bioactive lipids such as the eicosanoids, docosanoids and endocannabinoids. In this study we wished to investigate whether EPA and DHA could also affect the ceramide profile in epidermis and dermis, and, in this way, contribute to formation of a robust lipid barrier and ceramide-mediated regulation of skin functions. Ex vivo skin explants were cultured for 6days, and supplemented with EPA or DHA (50μM). Liquid chromatography coupled to tandem mass spectrometry with electrospray ionisation was used to assess the prevalence of 321 individual ceramide species, and a number of sphingoid bases, phosphorylated sphingoid bases, and phosphorylated ceramides, within the dermis and epidermis. EPA augmented dermal production of members of the ceramide families containing Non-hydroxy fatty acids and Sphingosine or Dihydrosphingosine bases (CER[NS] and CER[NDS], respectively), while epidermal CER[EOH], CER[EOS] and CER[EOP] ceramides were not affected. DHA did not significantly affect ceramide production. Ceramide-1-phosphate levels in
Melatonin, mitochondria, and the skin.
Slominski, Andrzej T; Zmijewski, Michal A; Semak, Igor; Kim, Tae-Kang; Janjetovic, Zorica; Slominski, Radomir M; Zmijewski, Jaroslaw W
2017-11-01
The skin being a protective barrier between external and internal (body) environments has the sensory and adaptive capacity to maintain local and global body homeostasis in response to noxious factors. An important part of the skin response to stress is its ability for melatonin synthesis and subsequent metabolism through the indolic and kynuric pathways. Indeed, melatonin and its metabolites have emerged as indispensable for physiological skin functions and for effective protection of a cutaneous homeostasis from hostile environmental factors. Moreover, they attenuate the pathological processes including carcinogenesis and other hyperproliferative/inflammatory conditions. Interestingly, mitochondria appear to be a central hub of melatonin metabolism in the skin cells. Furthermore, substantial evidence has accumulated on the protective role of the melatonin against ultraviolet radiation and the attendant mitochondrial dysfunction. Melatonin and its metabolites appear to have a modulatory impact on mitochondrion redox and bioenergetic homeostasis, as well as the anti-apoptotic effects. Of note, some metabolites exhibit even greater impact than melatonin alone. Herein, we emphasize that melatonin-mitochondria axis would control integumental functions designed to protect local and perhaps global homeostasis. Given the phylogenetic origin and primordial actions of melatonin, we propose that the melatonin-related mitochondrial functions represent an evolutionary conserved mechanism involved in cellular adaptive response to skin injury and repair.
Simplifying Skin Disease Diagnosis with Topical Nanotechnology.
Yeo, David C; Xu, Chenjie
2018-05-01
A new study published in the journal Nature Biomedical Engineering 1 documents a novel diagnostic technology that exploits topically applied nanotechnology to detect skin tissue biomarkers for diagnosis. This concept is demonstrated by noninvasively imaging connective tissue growth factor (CTGF) mRNA in abnormal scar cells, whole tissue, and animal models. In this commentary, we highlight the main findings and discuss their implications. Successful implementation in the clinic could give rise to self-applied, biopsy-free diagnostic technology and significantly reduce healthcare burden. Crucially, noninvasive visualization of disease biomarkers, mobile device signal acquisition, and Internet-enabled transmission could significantly transform the diagnosis of skin disease and other superficial tissues.
Abnormal phenotype of cultured fibroblasts in human skin with chronic radiotherapy damage
International Nuclear Information System (INIS)
Delanian, S.; Martin, M.; Lefaix, J.-L.; Bravard, A.; Luccioni, C.
1998-01-01
Purpose: The pathophysiological aspects of radiation-induced fibrosis (RIF) have not been well characterized. We therefore cultured human fibroblasts from samples of skin with RIF to investigate the long-term effects of therapeutic irradiation. Materials and methods: Biopsies of normal and RIF skin were obtained from patients previously irradiated for cancer, without recurrence. Cells were extracted from dermis samples by the outgrowth technique, seeded as monolayers and cultured at confluence. Enzyme activities and proteins were assayed, RNA was isolated and Northern blot analysis was performed on surviving cells between passages 2 and 5. Results: RIF cell cultures displayed heterogeneous fibroblasts populations. The initial outgrowth consisted of one-third small cells that floated rapidly, one-third spindle-shaped cells migrating far from the explant to form islets and one-third large pleiomorphic cells. In subsequent subcultures, surviving cells exhibited either myofibroblastic characteristics with a normal proliferative capacity or senescent morphology with a reduced proliferative capacity. These RIF cells had a brief finite lifespan, with dramatically reduced growth rate during their initial outgrowth and the following passages. Study of the antioxidant metabolism showed that Mn superoxide dismutase and catalase activities were significantly weaker in surviving RIF cells than healthy fibroblasts. These exhausted RIF cells exhibited no overexpression of transforming growth factor β or tissue inhibitor of metalloproteinase. Conclusion: Irradiation may lead to apparently contradictory effects such as fibrosis and necrosis in clinical practice. In cell culture, we observed two main cellular phenotypes which may be related to both processes, i.e. myofibroblast-like cells and fibrocyte-like cells. These two phenotypes may represent two steps in the differentiation induced as a long-term effect of therapeutic irradiation of the skin. Cell culture probably
Huck, Volker; Gorzelanny, Christian; Thomas, Kai; Mess, Christian; Dimitrova, Valentina; Schwarz, Martin; Riemann, Iris; Niemeyer, Verena; Luger, Thomas A.; König, Karsten; Schneider, Stefan W.
2011-03-01
Increasing incidence of inflammatory skin diseases such as Atopic Dermatitis (AD) has been noted in the past years. According to recent estimations around 15% of newborn subjects are affected with a disease severity that requires medical treatment. Although its pathogenesis is multifactorial, recent reports indicate that an impaired physical skin barrier predispose for the development of AD. The major part of this barrier is formed by the stratum corneum (SC) wherein corneocytes are embedded in a complex matrix of proteins and lipids. Its components were synthesized in the stratum granulosum (SG) and secreted via lamellar bodies at the SC/SG interface. Within a clinical in vivo study we focused on the skin metabolism at the SC/SG interface in AD affected patients in comparison to healthy subjects. Measurement of fluorescence life-time of NADH provides access to the metabolic state of skin. Due to the application of a 5D intravital tomographic skin analysis we facilitate the non-invasive investigation of human epidermis in the longitudinal course of AD therapy. We could ascertain by blinded analysis of 40 skin areas of 20 patients in a three month follow-up that the metabolic status at the SC/SG interface was altered in AD compromised skin even in non-lesional, apparent healthy skin regions. This illustrates an impaired skin barrier formation even at non-affected skin of AD subjects appearing promotive for the development of acute skin inflammation. Therefore, our findings allow a deeper understanding of the individual disease development and the improved management of the therapeutic intervention in clinical application.
Kottner, Jan; Kanti, Varvara; Dobos, Gabor; Hahnel, Elisabeth; Lichterfeld-Kottner, Andrea; Richter, Claudia; Hillmann, Kathrin; Vogt, Annika; Blume-Peytavi, Ulrike
2017-01-01
Dry skin (xerosis cutis) is increasingly recognized as a relevant health problem in daily life and in health and nursing care. The use of bath additives such as oils is common to reduce dry skin, but empirical evidence supporting this practice is limited. The aim of this study was to investigate the effectiveness of using a bath oil additive in improving skin barrier function and ameliorating dry skin in comparison to non-oil containing skin cleansers for bathing or showering. Single centre randomized observer blind pragmatic parallel group trial. Outpatient/community care. Volunteers showing clinically mild to moderate dry skin recruited from the city of Berlin. Healthy children and adults were randomly assigned to use either a commercially available bath oil or to continue using their regular non-oil containing skin cleansers every other day over a study period of 28days. Skin barrier parameters and the severity of dry skin were assessed at baseline and at two follow-up visits at the study centre. Transepidermal water loss was the primary outcome. All sixty participants randomized completed the trial. Median age was 32.5 (IQR 8.3 to 69) years. At the end of study the mean transepidermal water loss in the intervention group was statistically significant lower compared to the control group (mean difference -1.9 (95% CI -3.1 to -0.8) g/m 2 /h). Stratum corneum hydration was statistically significantly higher in the intervention group at the end of the study. Skin surface pH and roughness were comparable in both groups and remained unchanged, while both groups showed a trend to improvement in dry skin symptoms CONCLUSIONS: This pragmatic trial provides empirical evidence that the regular use of the investigated bath oil is effective in improving the skin barrier function in children and adults with mild dry skin when used in routine skin care and supports its use as a basic element for the management of a broad spectrum of dry skin conditions. Clinical
Active agents in common skin care products.
Draelos, Zoe Diana
2010-02-01
Skin care products are numerous and perplexing, yet the majority fall into the moisturizer category. Moisturizers are substances designed to improve and maintain the skin barrier. They serve as a vehicle for the delivery of active ingredients that minimize facial lines of dehydration, deliver photoprotection, and provide antioxidant properties. Moisturizers are based on occlusive substances, such as petrolatum and dimethicone, and humectant substances, such as glycerin, with a variety of sunscreens and botanicals for added functionality and marketing impact. This article reviews these common active agents. The plethora of over-the-counter skin care products available for patient purchase is overwhelming, yet there is certain commonality among 80 percent of the formulations. The majority of the products are moisturizers with added ingredients to support marketing claims. Whether the product is a facial foundation, an antiaging night cream, a sunscreen, a topical antioxidant, or a skin-lightening serum, the formulation is basically a moisturizer. Sunscreen is the most biologically active antiaging ingredient in skin care products, but the antiinflammatory and antioxidant effects of botanicals possess tremendous marketing appeal.
Transient MRI abnormalities associated with partial status epilepticus: a case report
Energy Technology Data Exchange (ETDEWEB)
Amato, Carmelo; Elia, Maurizio; Musumeci, Sebastiano A; Bisceglie, Pierluigi; Moschini, Massimo
2001-04-01
We report the case of an 18-year-old woman who presented a long-lasting cluster of partial seizures, and MRI cortical abnormalities localized in the left parietal lobe. The MRI changes correlated with the site of the epileptogenic focus, and disappeared within 2 weeks. The recognition of these reversible MRI abnormalities, which are presumably due to a temporary alteration of blood-brain barrier in the epileptogenic zone with subsequent edema, and are not associated with any underlying organic conditions, is extremely useful in the medical management of the patient and allows to avoid other invasive diagnostic procedures.
Transient MRI abnormalities associated with partial status epilepticus: a case report
International Nuclear Information System (INIS)
Amato, Carmelo; Elia, Maurizio; Musumeci, Sebastiano A.; Bisceglie, Pierluigi; Moschini, Massimo
2001-01-01
We report the case of an 18-year-old woman who presented a long-lasting cluster of partial seizures, and MRI cortical abnormalities localized in the left parietal lobe. The MRI changes correlated with the site of the epileptogenic focus, and disappeared within 2 weeks. The recognition of these reversible MRI abnormalities, which are presumably due to a temporary alteration of blood-brain barrier in the epileptogenic zone with subsequent edema, and are not associated with any underlying organic conditions, is extremely useful in the medical management of the patient and allows to avoid other invasive diagnostic procedures
The Th17 Lineage: From Barrier Surfaces Homeostasis to Autoimmunity, Cancer, and HIV-1 Pathogenesis.
Wacleche, Vanessa Sue; Landay, Alan; Routy, Jean-Pierre; Ancuta, Petronela
2017-10-19
The T helper 17 (Th17) cells represent a subset of CD4+ T-cells with unique effector functions, developmental plasticity, and stem-cell features. Th17 cells bridge innate and adaptive immunity against fungal and bacterial infections at skin and mucosal barrier surfaces. Although Th17 cells have been extensively studied in the context of autoimmunity, their role in various other pathologies is underexplored and remains an area of open investigation. This review summarizes the history of Th17 cell discovery and the current knowledge relative to the beneficial role of Th17 cells in maintaining mucosal immunity homeostasis. We further discuss the concept of Th17 pathogenicity in the context of autoimmunity, cancer, and HIV infection, and we review the most recent discoveries on molecular mechanisms regulating HIV replication/persistence in pathogenic Th17 cells. Finally, we stress the need for novel fundamental research discovery-based Th17-specific therapeutic interventions to treat pathogenic conditions associated with Th17 abnormalities, including HIV infection.
DEFF Research Database (Denmark)
Dreier, Jes; Sørensen, Jens A; Brewer, Jonathan R
2016-01-01
In this study we use the combination of super resolution optical microscopy and raster image correlation spectroscopy (RICS) to study the mechanism of action of liposomes as transdermal drug delivery systems in human skin. Two different compositions of liposomes were applied to newly excised human...... skin, a POPC liposome and a more flexible liposome containing the surfactant sodium cholate. Stimulated emission depletion microscopy (STED) images of intact skin and cryo-sections of skin treated with labeled liposomes were recorded displaying an optical resolution low enough to resolve the 100 nm...... liposomes in the skin. The images revealed that virtually none of the liposomes remained intact beneath the skin surface. RICS two color cross correlation diffusion measurements of double labeled liposomes confirmed these observations. Our results suggest that the liposomes do not act as carriers...
Next generation human skin constructs as advanced tools for drug development.
Abaci, H E; Guo, Zongyou; Doucet, Yanne; Jacków, Joanna; Christiano, Angela
2017-11-01
Many diseases, as well as side effects of drugs, manifest themselves through skin symptoms. Skin is a complex tissue that hosts various specialized cell types and performs many roles including physical barrier, immune and sensory functions. Therefore, modeling skin in vitro presents technical challenges for tissue engineering. Since the first attempts at engineering human epidermis in 1970s, there has been a growing interest in generating full-thickness skin constructs mimicking physiological functions by incorporating various skin components, such as vasculature and melanocytes for pigmentation. Development of biomimetic in vitro human skin models with these physiological functions provides a new tool for drug discovery, disease modeling, regenerative medicine and basic research for skin biology. This goal, however, has long been delayed by the limited availability of different cell types, the challenges in establishing co-culture conditions, and the ability to recapitulate the 3D anatomy of the skin. Recent breakthroughs in induced pluripotent stem cell (iPSC) technology and microfabrication techniques such as 3D-printing have allowed for building more reliable and complex in vitro skin models for pharmaceutical screening. In this review, we focus on the current developments and prevailing challenges in generating skin constructs with vasculature, skin appendages such as hair follicles, pigmentation, immune response, innervation, and hypodermis. Furthermore, we discuss the promising advances that iPSC technology offers in order to generate in vitro models of genetic skin diseases, such as epidermolysis bullosa and psoriasis. We also discuss how future integration of the next generation human skin constructs onto microfluidic platforms along with other tissues could revolutionize the early stages of drug development by creating reliable evaluation of patient-specific effects of pharmaceutical agents. Impact statement Skin is a complex tissue that hosts various
Huck, Volker; Gorzelanny, Christian; Thomas, Kai; Niemeyer, Verena; Luger, Thomas A.; König, Karsten; Schneider, Stefan W.
2010-02-01
Atopic Dermatitis (AD) is an inflammatory disease of human skin. Its pathogenesis is still unknown; however, dysfunctions of the epidermal barrier and the immune response are regarded as key factors for the development of AD. In our study we applied intravital multiphoton tomography (5D-IVT), equipped with a spectral-FLIM module for in-vivo and ex-vivo analysis of human skin affected with AD. In addition to the morphologic skin analysis, FLIM technology gain access to the metabolic status of the epidermal cells referring to the NADH specific fluorescence lifetime. We evaluated a characteristic 5D-IVT skin pattern of AD in comparison to histological sections and detected a correlation with the disease activity measured by SCORAD. FLIM analysis revealed a shift of the mean fluorescence lifetime (taum) of NADH, indicating an altered metabolic activity. Within an ex-vivo approach we have investigated cryo-sections of human skin with or without barrier defects. Spectral-FLIM allows the detection of autofluorescent signals that reflect the pathophysiological conditions of the defect skin barrier. In our study the taum value was shown to be different between healthy and affected skin. Application of the 5D-IVT allows non-invasive in-vivo imaging of human skin with a penetration depth of 150 μm. We could show that affected skin could be distinguished from healthy skin by morphological criteria, by FLIM and by spectral-FLIM. Further studies will evaluate the application of the 5D-IVT technology as a diagnostic tool and to monitor the therapeutic efficacy.
Directory of Open Access Journals (Sweden)
Johan Agren
2010-01-01
Full Text Available Loss of water through the immature skin can lead to hypothermia and dehydration in preterm infants. The water and glycerol channel aquaglyceroporin-3 (AQP3 is abundant in fetal epidermis and might influence epidermal water handling and transepidermal water flux around birth. To investigate the role of AQP3 in immature skin, we measured in vivo transepidermal water transport and AQP3 expression in rat pups exposed to clinically relevant fluid homeostasis perturbations. Preterm (E18 rat pups were studied after antenatal corticosteroid exposure (ANS, and neonatal (P1 rat pups after an 18 h fast. Transepidermal water loss (TEWL and skin hydration were determined, AQP3 mRNA was quantified by RT-PCR, and in-situ hybridization and immunocytochemistry were applied to map AQP3 expression. ANS resulted in an improved skin barrier (lower TEWL and skin hydration, while AQP3 mRNA and protein increased. Fasting led to loss of barrier integrity along with an increase in skin hydration. These alterations were not paralleled by any changes in AQP3. To conclude, antenatal corticosteroids and early postnatal fluid restriction produce differential effects on skin barrier function and epidermal AQP3 expression in the rat. In perinatal rats, AQP3 does not directly determine net water transport through the skin.
International Nuclear Information System (INIS)
Han, S.R.
1988-01-01
The primary aim of this study was to develop non-invasive, physical means to quantitatively assess the epidermal turnover kinetics and barrier properties of the skin and relate these to the cutaneous irritation which results from ultraviolet light irradiation and mold thermal burns. After systematically injecting radiolabeled glycine, the appearance of radioactivity at the skin's surface indicated the transit time of radiolabeled cells through the skin. By plotting the data as the cumulative specific activity against time and then fitting them with a third order polynomial equation, it is possible to estimate the turnover time of the stratum corneum. The skin turnover was coordinated with non-invasive transepidermal water loss (TEWL) studies determined with an evaporimeter. In vitro diffusion studies of the permeability of hydrocortisone through UVB irradiated and thermally burned skin were also performed. The studies indicated that irritated skin offers a relatively low diffusional resistance to hydrocortisone. Depending on the severity of the trauma, the increases in hydrocortisone's permeability coefficient through irritated skin ranged from a low of about 2 times normal to a high of about 210 times normal. Trauma-induced changes in hydrocortisone permeability parallel changes in TEWL, proving that the barrier deficient state resulting from rapid epidermal turnover is a general phenomenon
Measurement of skin permeation/penetration of nanoparticles for their safety evaluation.
Kimura, Eriko; Kawano, Yuichiro; Todo, Hiroaki; Ikarashi, Yoshiaki; Sugibayashi, Kenji
2012-01-01
The aim of the present study was to quantitatively evaluate the skin permeation/penetration of nanomaterials and to consider their penetration pathway through skin. Firstly, penetration/permeation of a model fluorescent nanoparticle, Fluoresbrite®, was determined through intact rat skin and several damaged skins. Fluoresbrite® permeated through only needle-punctured skin. The permeation profiles of soluble high molecular compounds, fluorescein isothiocyanate-dextrans (FITC-dextrans, FDs), with different molecular weights were also measured for comparison. The effects of molecular sizes and different skin pretreatments on the skin barrier were determined on the skin penetration/permeation of Fluoresbrite® and FDs. Fluoresbrite® was not permeated the intact skin, but FDs were permeated the skin. The skin distribution of titanium dioxide and zinc oxide nanoparticles was also observed after topical application of commercial cosmetics. Nanoparticles in sunscreen cosmetics were easily distributed into the groove and hair follicles after their topical application, but seldom migrated from the groove or follicles to viable epidermis and dermis. The obtained results suggested that nanoparticles did not permeate intact skin, but permeated pore-created skin. No or little permeation was observed for these nanomaterials through the stratum corneum.
Sensorineural Deafness, Distinctive Facial Features and Abnormal Cranial Bones
Gad, Alona; Laurino, Mercy; Maravilla, Kenneth R.; Matsushita, Mark; Raskind, Wendy H.
2008-01-01
The Waardenburg syndromes (WS) account for approximately 2% of congenital sensorineural deafness. This heterogeneous group of diseases currently can be categorized into four major subtypes (WS types 1-4) on the basis of characteristic clinical features. Multiple genes have been implicated in WS, and mutations in some genes can cause more than one WS subtype. In addition to eye, hair and skin pigmentary abnormalities, dystopia canthorum and broad nasal bridge are seen in WS type 1. Mutations in the PAX3 gene are responsible for the condition in the majority of these patients. In addition, mutations in PAX3 have been found in WS type 3 that is distinguished by musculoskeletal abnormalities, and in a family with a rare subtype of WS, craniofacial-deafness-hand syndrome (CDHS), characterized by dysmorphic facial features, hand abnormalities, and absent or hypoplastic nasal and wrist bones. Here we describe a woman who shares some, but not all features of WS type 3 and CDHS, and who also has abnormal cranial bones. All sinuses were hypoplastic, and the cochlea were small. No sequence alteration in PAX3 was found. These observations broaden the clinical range of WS and suggest there may be genetic heterogeneity even within the CDHS subtype. PMID:18553554
Gratieri, Taís; Kalia, Yogeshvar N
2013-02-01
The architecture and composition of the stratum corneum make it a particularly effective barrier against the topical and transdermal delivery of hydrophilic molecules and ions. As a result, different strategies have been explored in order to expand the range of therapeutic agents that can be administered by this route. Iontophoresis involves the application of a small electric potential to increase transport into and across the skin. Since current flow is preferentially via transport pathways with at least some aqueous character, it is ideal for hydrosoluble molecules containing ionisable groups. Hence, the physicochemical properties that limit partitioning and passive diffusion through the intercellular lipid matrix are beneficial for electrically-assisted delivery. The presence of fixed ionisable groups in the skin (pI 4-4.5) means that application of the electric field results in a convective solvent flow (i.e., electroosmosis) in the direction of ion motion so as to neutralise membrane charge. Hence, under physiological conditions, cation electrotransport is due to both electromigration and electroosmosis-their relative contribution depends on the formulation conditions and the physicochemical properties of the permeant. Different mathematical models have been developed to provide a theoretical framework in order to explain iontophoretic transport kinetics. They usually involve solutions of the Nernst-Planck equation - using either the constant field (Goldman) or electroneutrality (Nernst) approximations - with or without terms for the convective solvent flow component. Investigations have also attempted to elucidate the nature of ion transport pathways and to explain the effect of current application on the electrical properties of the skin-more specifically, the stratum corneum. These studies have led to the development of different equivalent circuit models. These range from simple parallel arrangements of a resistor and a capacitor to the inclusion of the
Blue Rubber Bleb Nevus Syndrome Showing Vascular Skin Lesions Predominantly on the Face
Directory of Open Access Journals (Sweden)
Ayumi Korekawa
2015-07-01
Full Text Available An 81-year-old Japanese man presented with dark blue papules and nodules on his face. There were multiple soft papules and nodules, dark blue in color, compressive, and ranging in size from 2 to 10 mm. A few similar lesions were seen on the patient's right dorsal second toe and right buccal mucosa. There were no skin lesions on his trunk and upper limbs. The patient's past history did not include gastrointestinal bleeding or anemia. Histopathological examination showed dilated vascular spaces lined by the normal epithelium extending beneath the dermis and into the subcutaneous fat. Endoscopy of the gastrointestinal tract to check for colon involvement was not performed. X-ray images of the limbs revealed no abnormalities in the bones or joints. Laboratory investigations did not show anemia. Although we failed to confirm a diagnosis by endoscopy, the skin lesions, histopathological findings, lack of abnormal X-ray findings, and the presence of oral lesions as a part of gastrointestinal tract guided the diagnosis of blue rubber bleb nevus syndrome (BRBNS. Skin lesions of BRBNS occur predominantly on the trunk and upper limbs. However, the present case showed multiple skin lesions predominantly on the face. Therefore, it is important for clinicians to know about a possible atypical distribution of skin lesions in BRBNS.
BP180 dysfunction triggers spontaneous skin inflammation in mice.
Zhang, Yang; Hwang, Bin-Jin; Liu, Zhen; Li, Ning; Lough, Kendall; Williams, Scott E; Chen, Jinbo; Burette, Susan W; Diaz, Luis A; Su, Maureen A; Xiao, Shengxiang; Liu, Zhi
2018-06-04
BP180, also known as collagen XVII, is a hemidesmosomal component and plays a key role in maintaining skin dermal/epidermal adhesion. Dysfunction of BP180, either through genetic mutations in junctional epidermolysis bullosa (JEB) or autoantibody insult in bullous pemphigoid (BP), leads to subepidermal blistering accompanied by skin inflammation. However, whether BP180 is involved in skin inflammation remains unknown. To address this question, we generated a BP180-dysfunctional mouse strain and found that mice lacking functional BP180 (termed Δ NC16A ) developed spontaneous skin inflammatory disease, characterized by severe itch, defective skin barrier, infiltrating immune cells, elevated serum IgE levels, and increased expression of thymic stromal lymphopoietin (TSLP). Severe itch is independent of adaptive immunity and histamine, but dependent on increased expression of TSLP by keratinocytes. In addition, a high TSLP expression is detected in BP patients. Our data provide direct evidence showing that BP180 regulates skin inflammation independently of adaptive immunity, and BP180 dysfunction leads to a TSLP-mediated itch. The newly developed mouse strain could be a model for elucidation of disease mechanisms and development of novel therapeutic strategies for skin inflammation and BP180-related skin conditions.
Tfayli, Ali; Jamal, Dima; Vyumvuhore, Raoul; Manfait, Michel; Baillet-Guffroy, Arlette
2013-11-07
The stratum corneum is the outermost layer of the skin; its barrier function is highly dependent on the composition and the structure as well as the organization of lipids in its extracellular matrix. Ceramides, free fatty acids and cholesterol represent the major lipid classes present in this matrix. They play an important role in maintaining the normal hydration levels required for the normal physiological function. Despite the advancement in the understanding of the structure, composition and the function of the stratum corneum (SC), the concern of "dry skin" remains important in dermatology and care research. Most studies focus on the quantification of water in the skin using different techniques including Raman spectroscopy, while the studies that investigate the effect of hydration on the quality of the barrier function of the skin are limited. Raman spectroscopy provides structural, conformational and organizational information that could help elucidate the effect of hydration on the barrier function of the skin. In order to assess the effect of relative humidity on the lipid barrier function; we used Raman spectroscopy to follow-up the evolution of the conformation and the organization of three synthetic ceramides (CER) differing from each other by the nature of their polar heads (sphingosine, phytosphingosine and α hydroxyl sphingosine), CER 2, III and 5 respectively. CER III and 5 showed a more compact and ordered organization with stronger polar interactions at intermediate relative humidity values, while CER 2 showed opposite tendencies to those observed with CER III and 5.
Infant Skin Care Products: What Are the Issues?
Kuller, Joanne McManus
2016-10-01
Infant skin is susceptible to dryness and irritation from external factors, including topical skin care products not formulated for the infant's skin. This may increase the risk of contact dermatitis. Parents frequently express concern regarding potential harm from ingredients in skin care products and seek information. This is complicated by several skin care myths. The purpose of this literature review was to provide evidence-based information to educate parents on the use of products for preterm and term infants. Multiple searches using PubMed were conducted including the search terms "infant skin care," "infant products," "infant bath," "emollients," "diaper skin care," and "diaper wipes." Reference lists of comprehensive reviews were also scanned. Google searches were used to assess consumer information, product information, and regulatory guidelines. There is little scientific evidence to support safety of natural/organic products on infant skin. Raw materials originate from different sources, complicating testing and comparisons of ingredients. Research shows that cleansers formulated for infant skin do not weaken the skin barrier the way harsher soaps and detergents can. Oils with the lowest oleic acid content provide a lower risk of irritant contact dermatitis. Nurses must be informed about natural and organic products, preservatives, and fragrances and know the definition of commonly used marketing terms. Decisions regarding the use of infant products in preterm and term infants should be evidence based. More research is needed to support claims regarding the safety of products used on infant skin.
Kikuchi-Numagami, K; Suetake, T; Yanai, M; Takahashi, M; Tanaka, M; Tagami, H
2000-06-01
The skin of golfers' hands provides a suitable model to study the effect of chronic sun exposure, because one of their hands is exposed to the outer environment, especially sunlight, while the other one is always protected by a glove during play. Our purpose was to find out the influence of photodamage on the properties of the skin surface of middle-aged Japanese by using non-invasive methods. We measured hydration state, and water barrier function of the stratum corneum (SC) and the color of the skin of the dorsum of the hands. In a separate study, we evaluated the skin surface contour by using replicas taken from the skin in a slightly stretched or relaxed position. We found a significant decrease in hydration of the skin surface of the exposed skin as compared to that of the protected skin, whereas no such difference was found with transepidermal water loss, a parameter for water barrier function of the SC. Luminance of skin color was also reduced in the sun-exposed skin. Replica analysis revealed that large wrinkles developing in a relaxed position were more prominent on the exposed than on the protected skin, while fine furrows noted in a slightly stretched position were shallower on the former than the latter. The data obtained indicate that the chronically exposed skin of golfers' hands shows morphological and functional changes resulting from long time exposure to the outer environment especially sunlight. Furthermore, bioengineering non-invasive methods are found to be useful to detect early photodamage of the skin in a more quantitative fashion which is rather difficult to demonstrate clinically.
Psychological interventions in the management of common skin conditions
Directory of Open Access Journals (Sweden)
Philip D Shenefelt
2010-03-01
Full Text Available Philip D ShenefeltDepartment of Dermatology and Cutaneous Surgery, College of Medicine, University of South Florida, Tampa, Florida, USAAbstract: The nervous system and the skin develop next to each other in the embryo and remain intimately interconnected and interactive throughout life. The nervous system can influence skin conditions through psychoneuroimmunoendocrine mechanisms and through behaviors. Understanding the pathophysiology aids in selection of treatment plans for correcting the negative effects of the psyche on specific skin conditions. Medication options include standard psychotropic medications and alternative herbs and supplements. Other options include biofeedback, cognitive-behavioral methods, hypnosis, meditation, progressive relaxation, the placebo effect, and suggestion. When simple measures fail, combining medications with other therapeutic options may produce better results. Skin conditions that have strong psychophysiologic aspects may respond well to techniques such as biofeedback, cognitive-behavioral methods, hypnosis, meditation, or progressive relaxation that help to counteract stress. Treatment of primary psychiatric disorders that negatively influence skin conditions often results in improvement of those skin conditions. Abnormal conditions of the skin, hair, and nails can also influence the psyche negatively. Treatment of secondary psychiatric disorders such as anxiety or depression that are triggered or exacerbated by the appearance of these skin conditions or the associated discomfort may also be required.Keywords: psychodermatology, psychosomatic, psychocutaneous, skin disorders, treatment, standard, alternative, non-drug
Simpson, Eric; Dutronc, Yves
2011-07-01
Moisturizers result in an increase of skin hydration and restoration of the skin barrier function and play a prominent role in the longterm management of atopic dermatitis (AD). Cetaphil RestoradermTM Moisturizer (CRM) contains novel ingredients specifically designed for AD, and its effects on skin hydration, skin barrier function and signs of AD were assessed in four studies, three of which were evaluator-blinded, randomized and intra-individual comparison trials. A single application of CRM induced significantly greater hydration than the untreated control for at least 24 hours (P is less than 0.001). After the skin was disrupted with 0.5% sodium dodecyl sulfate (SDS), applications of CRM led to a more rapid restoration of skin barrier function and maintained significantly greater skin hydration compared to the untreated control (both P is less than 0.05). After four weeks of twice-daily CRM application among subjects with a history of AD, a significant decrease of itching/stinging scores compared to baseline was reported, as well as an improvement in the quality-of- life and a high level of satisfaction regarding the product. When CRM was used as an adjunctive treatment with topical steroid for four weeks among subjects with mild-to-moderate AD, a more rapid decrease of overall disease severity was observed on days 7, 14 and 21 by the blinded investigator (P is less than 0.05), compared to steroid treatment alone. In summary, CRM is suitable for the specific needs of patients with AD and can be used either alone for long-term management or in adjunction with traditional treatment for both short and long-term disease control.
Comparison of atmospheric microplasma and plasma jet irradiation for increasing of skin permeability
International Nuclear Information System (INIS)
Shimizu, K; Tran, N A; Hayashida, K; Blajan, M
2016-01-01
Atmospheric plasma is attracting interest for medical applications such as sterilization, treatment of cancer cells and blood coagulation. Application of atmospheric plasma in dermatology has potential as a novel tool for wound healing, skin rejuvenation and treatment of wrinkles. In this study, we investigated the enhancement of percutaneous absorption of dye as alternative agents of transdermal drugs. Hypodermic needles are often the only way to deliver large-molecule drugs into the dermis, although a safe transdermal drug delivery method that does not require needles would be desirable. We therefore explored the feasibility of using atmospheric microplasma irradiation to enhance percutaneous absorption of drugs, as an alternative delivery method to conventional hypodermic needles. Pig skin was used as a biological sample, exposed to atmospheric microplasma, and analyzed by attenuated total reflection-Fourier transform infrared spectroscopy. A tape stripping test, a representative method for evaluating skin barrier performance, was also conducted for comparison. Transepidermal water loss (TEWL) was measured and compared with and without atmospheric microplasma irradiation, to quantify water evaporation from the inner body through the skin barrier. The results show that the stratum corneum, the outermost skin layer, could be chemically and physically modified by atmospheric microplasma irradiation. Physical damage to the skin by microplasma irradiation and an atmospheric plasma jet was also assessed by observing the skin surface. The results suggest that atmospheric microplasma has the potential to enhance percutaneous absorption. (paper)
Mahler, V; Erfurt-Berge, C; Schiemann, S; Michael, S; Egloffstein, A; Kuss, O
2010-04-01
In occupational fields with exposure to grease, oil, metal particles, coal, black lead or soot, cleansing formulations containing abrasive bodies (e.g. refined walnut shell, corn, wood, plastic or pumice) are used. These may constitute an irritant per se. As an alternative, hydrogenated castor oil (also known as castor wax) beads have been developed as dirt-binding particles. A polar surface contributes to their mechanical cleaning effects in removal of oily grime. Standardized examination of the in vivo effects upon the skin barrier of castor wax beads in comparison with abrasive bodies and pure detergent. Three cleansing preparations - (i) detergent, (ii) detergent containing castor wax beads, (iii) detergent containing walnut shell powder - were each repetitively applied in vivo (four times daily for 3 weeks), mimicking workplace conditions, in 30 healthy volunteers (15 with and 15 without an atopic skin diathesis) and compared vs. (iv) no treatment. The treatment effects upon the skin barrier were monitored by repeated measurements of functional parameters [transepidermal water loss (TEWL), redness] and surface topography. After a 3-week treatment, a significant global treatment effect (P dirt and use of skin protection and skin care measures under real workplace conditions, this component may now be used and examined further in different occupations.
International guidelines for the in vivo assessment of skin properties in non-clinical settings
DEFF Research Database (Denmark)
du Plessis, Johan; Stefaniak, Aleksandr; Eloff, Fritz
2013-01-01
There is an emerging perspective that it is not sufficient to just assess skin exposure to physical and chemical stressors in workplaces, but that it is also important to assess the condition, i.e. skin barrier function of the exposed skin at the time of exposure. The workplace environment, repre......, representing a non-clinical environment, can be highly variable and difficult to control, thereby presenting unique measurement challenges not typically encountered in clinical settings....
Duan, Jingjing; Ishida, Marina; Aida, Kazuhiko; Tsuduki, Tsuyoshi; Zhang, Jin; Manabe, Yuki; Hirata, Takashi; Sugawara, Tatsuya
2016-09-21
Sphingolipids from marine sources have attracted more attention recently because of their distinctive structures and expected functions. In this study, the content and components of cerebroside from sea cucumber Stichopus japonicus were analyzed. The absorption of cerebroside from S. japonicus was investigated with an in vivo lipid absorption assay. The result revealed that S. japonicus is a rich source of cerebroside that contained considerable amounts of odd carbon chain sphingoid bases. The cumulative recoveries of d17:1- and d19:2-containing cerebrosides were 0.31 ± 0.16 and 0.32 ± 0.10%, respectively, for 24 h after administration. To the best of the authors' knowledge, this is the first work that shows sphingolipids from a marine source could be absorbed in vivo and incorporated into ceramides. In addition, dietary supplementation with sea cucumber cerebroside to hairless mouse improved the skin barrier function and increased short-chain fatty acids in cecal contents, which have shown beneficial effects on the host.
Abnormal lung function at preschool age asthma in adolescence?
Lajunen, Katariina; Kalliola, Satu; Kotaniemi-Syrjänen, Anne; Sarna, Seppo; Malmberg, L Pekka; Pelkonen, Anna S; Mäkelä, Mika J
2018-05-01
Asthma often begins early in childhood. However, the risk for persistence is challenging to evaluate. This longitudinal study relates lung function assessed with impulse oscillometry (IOS) in preschool children to asthma in adolescence. Lung function was measured with IOS in 255 children with asthma-like symptoms aged 4-7 years. Baseline measurements were followed by exercise challenge and bronchodilation tests. At age 12-16 years, 121 children participated in the follow-up visit, when lung function was assessed with spirometry, followed by a bronchodilation test. Asthma symptoms and medication were recorded by a questionnaire and atopy defined by skin prick tests. Abnormal baseline values in preschool IOS were significantly associated with low lung function, the need for asthma medication, and asthma symptoms in adolescence. Preschool abnormal R5 at baseline (z-score ≥1.645 SD) showed 9.2 odds ratio (95%CI 2.7;31.7) for abnormal FEV1/FVC, use of asthma medication in adolescence, and 9.9 odds ratio (95%CI 2.9;34.4) for asthma symptoms. Positive exercise challenge and modified asthma-predictive index at preschool age predicted asthma symptoms and the need for asthma medication, but not abnormal lung function at teenage. Abnormal preschool IOS is associated with asthma and poor lung function in adolescence and might be utilised for identification of asthma persistence. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.
Establishment and function of tissue-resident innate lymphoid cells in the skin
Directory of Open Access Journals (Sweden)
Jie Yang
2017-03-01
Full Text Available ABSTRACT Innate lymphoid cells (ILCs are a newly classified family of immune cells of the lymphoid lineage. While they could be found in both lymphoid organs and non-lymphoid tissues, ILCs are preferentially enriched in barrier tissues such as the skin, intestine, and lung where they could play important roles in maintenance of tissue integrity and function and protection against assaults of foreign agents. On the other hand, dysregulated activation of ILCs could contribute to tissue inflammatory diseases. In spite of recent progress towards understanding roles of ILCs in the health and disease, mechanisms regulating specific establishment, activation, and function of ILCs in barrier tissues are still poorly understood. We herein review the up-to-date understanding of tissue-specific relevance of ILCs. Particularly we will focus on resident ILCs of the skin, the outmost barrier tissue critical in protection against various foreign hazardous agents and maintenance of thermal and water balance. In addition, we will discuss remaining outstanding questions yet to be addressed.
Establishment and function of tissue-resident innate lymphoid cells in the skin.
Yang, Jie; Zhao, Luming; Xu, Ming; Xiong, Na
2017-07-01
Innate lymphoid cells (ILCs) are a newly classified family of immune cells of the lymphoid lineage. While they could be found in both lymphoid organs and non-lymphoid tissues, ILCs are preferentially enriched in barrier tissues such as the skin, intestine, and lung where they could play important roles in maintenance of tissue integrity and function and protection against assaults of foreign agents. On the other hand, dysregulated activation of ILCs could contribute to tissue inflammatory diseases. In spite of recent progress towards understanding roles of ILCs in the health and disease, mechanisms regulating specific establishment, activation, and function of ILCs in barrier tissues are still poorly understood. We herein review the up-to-date understanding of tissue-specific relevance of ILCs. Particularly we will focus on resident ILCs of the skin, the outmost barrier tissue critical in protection against various foreign hazardous agents and maintenance of thermal and water balance. In addition, we will discuss remaining outstanding questions yet to be addressed.
Alves, Ricardo N.; Sundell, Kristina S.; Anjos, Liliana; Sundh, Henrik; Harboe, Torstein; Norberg, Birgitta; Power, Deborah M.
2018-01-01
To establish if the developmental changes in the primary barrier and osmoregulatory capacity of Atlantic halibut skin are modified during metamorphosis, histological, histochemical, gene expression and electrophysiological measurements were made. The morphology of the ocular and abocular skin started to diverge during the metamorphic climax and ocular skin appeared thicker and more stratified. Neutral mucins were the main glycoproteins produced by the goblet cells in skin during metamorphosis. Moreover, the number of goblet cells producing neutral mucins increased during metamorphosis and asymmetry in their abundance was observed between ocular and abocular skin. The increase in goblet cell number and their asymmetric abundance in skin was concomitant with the period that thyroid hormones (THs) increase and suggests that they may be under the control of these hormones. Several mucin transcripts were identified in metamorphosing halibut transcriptomes and Muc18 and Muc5AC were characteristic of the body skin. Na+, K+-ATPase positive (NKA) cells were observed in skin of all metamorphic stages but their number significantly decreased with the onset of metamorphosis. No asymmetry was observed between ocular and abocular skin in NKA cells. The morphological changes observed were linked to modified skin barrier function as revealed by modifications in its electrophysiological properties. However, the maturation of the skin functional characteristics preceded structural maturation and occurred at stage 8 prior to the metamorphic climax. Treatment of Atlantic halibut with the THs disrupter methimazole (MMI) affected the number of goblet cells producing neutral mucins and the NKA cells. The present study reveals that the asymmetric development of the skin in Atlantic halibut is TH sensitive and is associated with metamorphosis and that this barrier’s functional properties mature earlier and are independent of metamorphosis.
Alves, Ricardo N.
2018-02-20
To establish if the developmental changes in the primary barrier and osmoregulatory capacity of Atlantic halibut skin are modified during metamorphosis, histological, histochemical, gene expression and electrophysiological measurements were made. The morphology of the ocular and abocular skin started to diverge during the metamorphic climax and ocular skin appeared thicker and more stratified. Neutral mucins were the main glycoproteins produced by the goblet cells in skin during metamorphosis. Moreover, the number of goblet cells producing neutral mucins increased during metamorphosis and asymmetry in their abundance was observed between ocular and abocular skin. The increase in goblet cell number and their asymmetric abundance in skin was concomitant with the period that thyroid hormones (THs) increase and suggests that they may be under the control of these hormones. Several mucin transcripts were identified in metamorphosing halibut transcriptomes and Muc18 and Muc5AC were characteristic of the body skin. Na+, K+-ATPase positive (NKA) cells were observed in skin of all metamorphic stages but their number significantly decreased with the onset of metamorphosis. No asymmetry was observed between ocular and abocular skin in NKA cells. The morphological changes observed were linked to modified skin barrier function as revealed by modifications in its electrophysiological properties. However, the maturation of the skin functional characteristics preceded structural maturation and occurred at stage 8 prior to the metamorphic climax. Treatment of Atlantic halibut with the THs disrupter methimazole (MMI) affected the number of goblet cells producing neutral mucins and the NKA cells. The present study reveals that the asymmetric development of the skin in Atlantic halibut is TH sensitive and is associated with metamorphosis and that this barrier’s functional properties mature earlier and are independent of metamorphosis.
Chimeric autologous/allogeneic constructs for skin regeneration.
Rasmussen, Cathy Ann; Tam, Joshua; Steiglitz, Barry M; Bauer, Rebecca L; Peters, Noel R; Wang, Ying; Anderson, R Rox; Allen-Hoffmann, B Lynn
2014-08-01
The ideal treatment for severe cutaneous injuries would eliminate the need for autografts and promote fully functional, aesthetically pleasing autologous skin regeneration. NIKS progenitor cell-based skin tissues have been developed to promote healing by providing barrier function and delivering wound healing factors. Independently, a device has recently been created to "copy" skin by harvesting full-thickness microscopic tissue columns (MTCs) in lieu of autografts traditionally harvested as sheets. We evaluated the feasibility of combining these two technologies by embedding MTCs in NIKS-based skin tissues to generate chimeric autologous/allogeneic constructs. Chimeric constructs have the potential to provide immediate wound coverage, eliminate painful donor site wounds, and promote restoration of a pigmented skin tissue possessing hair follicles, sweat glands, and sebaceous glands. After MTC insertion, chimeric constructs and controls were reintroduced into air-interface culture and maintained in vitro for several weeks. Tissue viability, proliferative capacity, and morphology were evaluated after long-term culture. Our results confirmed successful MTC insertion and integration, and demonstrated the feasibility of generating chimeric autologous/allogeneic constructs that preserved the viability, proliferative capacity, and structure of autologous pigmented skin. These feasibility studies established the proof-of-principle necessary to further develop chimeric autologous/allogeneic constructs for the treatment of complex skin defects. Reprint & Copyright © 2014 Association of Military Surgeons of the U.S.
Energy Technology Data Exchange (ETDEWEB)
J Torin Huzil; S Sivaloganathan; M Kohandel; M Foldvari
2011-12-31
The delivery of drugs through the skin provides a convenient route of administration that is often preferable to injection because it is noninvasive and can typically be self-administered. These two factors alone result in a significant reduction of medical complications and improvement in patient compliance. Unfortunately, a significant obstacle to dermal and transdermal drug delivery alike is the resilient barrier that the epidermal layers of the skin, primarily the stratum corneum, presents for the diffusion of exogenous chemical agents. Further advancement of transdermal drug delivery requires the development of novel delivery systems that are suitable for modern, macromolecular protein and nucleotide therapeutic agents. Significant effort has already been devoted to obtain a functional understanding of the physical barrier properties imparted by the epidermis, specifically the membrane structures of the stratum corneum. However, structural observations of membrane systems are often hindered by low resolutions, making it difficult to resolve the molecular mechanisms related to interactions between lipids found within the stratum corneum. Several models describing the molecular diffusion of drug molecules through the stratum corneum have now been postulated, where chemical permeation enhancers are thought to disrupt the underlying lipid structure, resulting in enhanced permeability. Recent investigations using biphasic vesicles also suggested a possibility for novel mechanisms involving the formation of complex polymorphic lipid phases. In this review, we discuss the advantages and limitations of permeation-enhancing strategies and how computational simulations, at the atomic scale, coupled with physical observations can provide insight into the mechanisms of diffusion through the stratum corneum.
DEFF Research Database (Denmark)
Jungersted, Jakob Mutanu; Høgh, Julie Kaae; Hellgren, Lars
2010-01-01
) was performed on the volar forearm and evaluated by trans-epidermal water loss (TEWL), erythema, and a cyanoacrylate skin sample was obtained for lipid analysis. We found no significant changes in response to SLS irritation as evaluated by TEWL and erythema, after treatment with alitretinoin for 2 months...
DEFF Research Database (Denmark)
Jungersted, JM; Hellgren, Lars; Drachmann, Tue
2010-01-01
Background and Objective: Lipids in the stratum corneum (SC) are of major importance for the skin barrier function. Many different methods have been used for the collection of SC for the analysis of SC lipids. The objective of the present study was to validate the cyanoacrylate method for the col......Background and Objective: Lipids in the stratum corneum (SC) are of major importance for the skin barrier function. Many different methods have been used for the collection of SC for the analysis of SC lipids. The objective of the present study was to validate the cyanoacrylate method...
Szikszai, Z.; Kertész, Zs.; Bodnár, E.; Borbíró, I.; Angyal, A.; Csedreki, L.; Furu, E.; Szoboszlai, Z.; Kiss, Á. Z.; Hunyadi, J.
2011-10-01
Skin penetration is one of the potential routes for nanoparticles to gain access into the human body. Ultrafine metal oxides, such as titanium dioxide and zinc oxide are widely used in cosmetic and health products like sunscreens. These oxides are potent UV filters and the particle size smaller than 200 nm makes the product more transparent compared to formulations containing coarser particles. The present study continues the work carried out in the frame of the NANODERM: “Quality of skin as a barrier to ultrafine particles” European project and complements our previous investigations on human skin with compromised barrier function. Atopic dermatitis (a type of eczema) is an inflammatory, chronically relapsing, non-contagious skin disease. It is very common in children but may occur at any age. The exact cause of atopic dermatitis is unknown, but is likely due to a combination of impaired barrier function together with a malfunction in the body's immune system. In this study, skin samples were obtained from two patients suffering from atopic dermatitis. Our results indicate that the ultrafine zinc oxide particles, in a hydrophobic basis gel with an application time of 2 days or 2 weeks, have penetrated deeply into the stratum corneum in these patients. On the other hand, penetration into the stratum spinosum was not observed even in the case of the longer application time.
Skin denervation and its clinical significance in late-stage chronic kidney disease.
Chao, Chi-Chao; Wu, Vin-Cent; Tan, Chun-Hsiang; Wang, Yi-Mei; Tseng, Ming-Tsung; Wu, Pei-Chen; Lin, Yea-Huey; Lin, Whei-Min; Wu, Kwan-Dun; Hsieh, Sung-Tsang
2011-02-01
To investigate the skin innervation and its clinical significance in late-stage chronic kidney disease (CKD). Case series. National Taiwan University Hospital, Taipei, Taiwan. Forty consecutive nondiabetic patients with late-stage CKD (14 female and 26 male; mean [SD] age, 60.7 [12.3] years), including 2 cases with stage 3 CKD, 6 with stage 4 CKD, and 32 with stage 5 CKD, ie, end-stage kidney disease. Clinical evaluation of neurological deficits, nerve conduction study, autonomic function tests, and a 3-mm-diameter skin biopsy specimen taken from the distal leg. Quantitation of epidermal innervation, parameters of nerve conduction study, R-R interval variability, and sympathetic skin response. Clinically, 21 patients (52.5%) were symptomatic with paresthesia over the limbs or autonomic symptoms. The intraepidermal nerve fiber (IENF) density was markedly reduced in patients with CKD compared with age- and sex-matched controls (mean [SD], 2.8 [2.0] vs 8.6 [2.8] fibers/mm; P Skin denervation was observed in 27 patients (67.5%). Fifteen patients (37.5%) had abnormalities on nerve conduction studies, and 29 patients (72.5%) had abnormal results on autonomic function tests. By analysis with multiple regression models, the IENF density was negatively correlated with the duration of renal disease (P = .02). Additionally, the R-R interval variability at rest was linearly correlated with the IENF density (P = .02) and the absence of sympathetic skin responses at the soles was associated with reduced IENF density (P = .03). Small-fiber sensory and autonomic neuropathies constitute the major form of neuropathy in late-stage CKD. Furthermore, skin denervation was associated with the duration of renal disease.
Chronologic and actinically induced aging in human facial skin
International Nuclear Information System (INIS)
Gilchrest, B.A.; Szabo, G.; Flynn, E.; Goldwyn, R.M.
1983-01-01
Clinical and histologic stigmata of aging are much more prominent in habitually sun-exposed skin than in sun-protected skin, but other possible manifestations of actinically induced aging are almost unexplored. We have examined the interrelation of chronologic and actinic aging using paired preauricular (sun-exposed) and postauricular (sun-protected) skin specimens. Keratinocyte cultures derived from sun-exposed skin consistently had a shorter in vitro lifespan but increased plating efficiency compared with cultures derived from adjacent sun-protected skin of the same individual, confirming a previous study of different paired body sites. Electron microscopic histologic sections revealed focal abnormalities of keratinocyte proliferation and alignment in vitro especially in those cultures derived from sun-exposed skin and decreased intercellular contact in stratified colonies at late passage, regardless of donor site. One-micron histologic sections of the original biopsy specimens revealed no striking site-related keratinocyte alterations, but sun-exposed specimens had fewer epidermal Langerhans cells (p less than 0.001), averaging approximately 50 percent the number in sun-protected skin, a possible exaggeration of the previously reported age-associated decrease in this cell population. These data suggest that sun exposure indeed accelerates aging by several criteria and that, regardless of mechanism, environmental factors may adversely affect the appearance and function of aging skin in ways amenable to experimental quantitation
Huang, Yuanshen; Wang, Yang; Yu, Jie; Gao, Min; Levings, Megan; Wei, Shencai; Zhang, Shengquan; Xu, Aie; Su, Mingwan; Dutz, Jan; Zhang, Xuejun; Zhou, Youwen
2012-01-01
Background Vitiligo is characterized by the death of melanocytes in the skin. This is associated with the presence of T cell infiltrates in the lesional borders. However, at present, there is no detailed and systematic characterization on whether additional cellular or molecular changes are present inside vitiligo lesions. Further, it is unknown if the normal appearing non-lesional skin of vitiligo patients is in fact normal. The purpose of this study is to systematically characterize the molecular and cellular characteristics of the lesional and non-lesional skin of vitiligo patients. Methods and Materials Paired lesional and non-lesional skin biopsies from twenty-three vitiligo patients and normal skin biopsies from sixteen healthy volunteers were obtained with informed consent. The following aspects were analyzed: (1) transcriptome changes present in vitiligo skin using DNA microarrays and qRT-PCR; (2) abnormal cellular infiltrates in vitiligo skin explant cultures using flow cytometry; and (3) distribution of the abnormal cellular infiltrates in vitiligo skin using immunofluorescence microscopy. Results Compared with normal skin, vitiligo lesional skin contained 17 genes (mostly melanocyte-specific genes) whose expression was decreased or absent. In contrast, the relative expression of 13 genes was up-regulated. The up-regulated genes point to aberrant activity of the innate immune system, especially natural killer cells in vitiligo. Strikingly, the markers of heightened innate immune responses were also found to be up-regulated in the non-lesional skin of vitiligo patients. Conclusions and Clinical Implications As the first systematic transcriptome characterization of the skin in vitiligo patients, this study revealed previously unknown molecular markers that strongly suggest aberrant innate immune activation in the microenvironment of vitiligo skin. Since these changes involve both lesional and non-lesional skin, our results suggest that therapies targeting
In vitro permeation of platinum through African and Caucasian skin.
Franken, A; Eloff, F C; du Plessis, J; Badenhorst, C J; Du Plessis, J L
2015-02-03
The majority of the South African workforce are Africans, therefore potential racial differences should be considered in risk and exposure assessments in the workplace. Literature suggests African skin to be a superior barrier against permeation and irritants. Previous in vitro studies on metals only included skin from Caucasian donors, whereas this study compared the permeation of platinum through African and Caucasian skin. A donor solution of 0.3 mg/ml of potassium tetrachloroplatinate (K₂PtCl₄) dissolved in synthetic sweat was applied to the vertical Franz diffusion cells with full thickness abdominal skin. Skin from three female African and three female Caucasian donors were included (n=21). The receptor solution was removed at various intervals during the 24 h experiment, and analysed with high resolution inductively coupled plasma-mass spectrometry (ICP-MS). Skin was digested and analysed by inductively coupled plasma-optical emission spectrometry (ICP-OES). Significantly higher permeation of platinum through intact African skin (p=0.044), as well as a significantly higher mass of platinum retention in African skin in comparison with Caucasian skin (p=0.002) occurred. Significant inter-donor variation was found in both racial groups (pskin and further investigation is necessary to explain the higher permeation through African skin. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Inhibitory effect of corn silk on skin pigmentation.
Choi, Sang Yoon; Lee, Yeonmi; Kim, Sung Soo; Ju, Hyun Min; Baek, Ji Hwoon; Park, Chul-Soo; Lee, Dong-Hyuk
2014-03-03
In this study, the inhibitory effect of corn silk on melanin production was evaluated. This study was performed to investigate the inhibitory effect of corn silk on melanin production in Melan-A cells by measuring melanin production and protein expression. The corn silk extract applied on Melan-A cells at a concentration of 100 ppm decreased melanin production by 37.2% without cytotoxicity. This was a better result than arbutin, a positive whitening agent, which exhibited a 26.8% melanin production inhibitory effect at the same concentration. The corn silk extract did not suppress tyrosinase activity but greatly reduced the expression of tyrosinase in Melan-A cells. In addition, corn silk extract was applied to the human face with hyperpigmentation, and skin color was measured to examine the degree of skin pigment reduction. The application of corn silk extract on faces with hyperpigmentation significantly reduced skin pigmentation without abnormal reactions. Based on the results above, corn silk has good prospects for use as a material for suppressing skin pigmentation.
Inhibitory Effect of Corn Silk on Skin Pigmentation
Directory of Open Access Journals (Sweden)
Sang Yoon Choi
2014-03-01
Full Text Available In this study, the inhibitory effect of corn silk on melanin production was evaluated. This study was performed to investigate the inhibitory effect of corn silk on melanin production in Melan-A cells by measuring melanin production and protein expression. The corn silk extract applied on Melan-A cells at a concentration of 100 ppm decreased melanin production by 37.2% without cytotoxicity. This was a better result than arbutin, a positive whitening agent, which exhibited a 26.8% melanin production inhibitory effect at the same concentration. The corn silk extract did not suppress tyrosinase activity but greatly reduced the expression of tyrosinase in Melan-A cells. In addition, corn silk extract was applied to the human face with hyperpigmentation, and skin color was measured to examine the degree of skin pigment reduction. The application of corn silk extract on faces with hyperpigmentation significantly reduced skin pigmentation without abnormal reactions. Based on the results above, corn silk has good prospects for use as a material for suppressing skin pigmentation.
DEFF Research Database (Denmark)
Esaki, Hitokazu; Ewald, David Adrian; Ungar, Benjamin
2015-01-01
are unknown. Objective : We sought to establish the genomic profile of the epidermal and dermal compartments of lesional and nonlesional AD skin compared with normal skin. Methods : Laser capture microdissection was performed to separate the epidermis and dermis of lesional and nonlesional skin from patients...... epidermal and dermal genomic signatures of lesional and nonlesional AD skin and normal skin compared with whole tissues. These data establish the utility of laser capture microdissection to separate different compartments and cellular subsets in patients with AD, allowing localization of key barrier...
Manne, Sharon; Lessin, Stuart
2006-10-01
Little is known about the level of engagement and correlates of sun protection and skin self-exam among individuals diagnosed with melanoma. Participants (N = 229) completed measures of skin self-exam and sun protection practice and knowledge and attitudes. Approximately eighty-four percent of patients reported engaging in skin self-examination at least once in the past year. Engagement in sun protection practices was moderate. Self-exam practice was associated with gender, physician recommendation about self-exam, and perceived benefits and barriers of self-exam. Sun protection was associated with gender, age, medical status and health care access, physician recommendation, knowledge, and a number of psychological factors. Behavioral interventions to improve skin surveillance and sun protection may benefit from an emphasis on physician education regarding self-exam and sun protection, education regarding the efficacy of sunscreen and the risks associated with sunbathing, reducing perceived barriers to self-exam and sun protection, and reducing reliance on social influences on sun protection practices.
Experimental skin carcinoma by UVB application
Directory of Open Access Journals (Sweden)
Andrada Iftode
2016-12-01
Full Text Available OBJECTIVES AND BACKGROUND The aim of this research study was to evaluate the harmful effects at skin level induced by concomitant and repeated exposure to three toxic agents: UVB radiation, DMBA and TPA. MATERIALS AND METHODS Experimental mice were divided in thw following groups (n=5 mice/group: group 1 – healthy mice, group 2 – mice exposed to UVB – radiation and topical administration of acetone and group 3 – mice exposed to UVB – radiation and topical application of DMBA and TPA solutions (phase I - double tumor initiation and phase II - tumor promotion. RESULTS Application of these compounds led to the development of skin papilloma and to significant changes in skin parameters. CONCLUSIONS The barrier function of the skin was degraded in UVB exposed mice. DMBA and TPA depended on carcinogens schedule and corelated with skin carcinoma. Graphical abstract: Schematic protocol of experimental skin carcinoma REFERENCES 1. Lee Ja, Ko Jh, Jung Bg, Kim Th, Hong Ji, Park Ys, Lee Bj. Fermented Prunus mume with Probiotics Inhibits 7,12- Dimethylbenz[a]anthracene and 12-OTetradecanoyl phorbol-13-acetate Induced Skin Carcinogenesis through Alleviation of Oxidative Stress. Asian Pac J Cancer Prev. 2013;14:2973-2978. 2. Firooz A, Sadr B, Babakoohi S, Sarraf-Yazdy M, Fanian F, Kazerouni-Timsar A, NassiriKashani M, Naghizadeh MM, Dowlati Y. Variation of Biophysical Parameters of the Skin with Age, Gender, and Body Region. Scientific World Journal. 2012; doi.org/10.1100/2012/386936 3. Gheorgheosu (Coricovac D, Borcan F, Balasz NI, Soica C, Simu G, Kemeny L, Dehelean CA. Evaluation of skin parameters in C57BL/6J mice exposed to chemical and environmental factors using non-invasive methods. J Agroalim Proc Technol. 2014;20:14-20.
p120-catenin mediates inflammatory responses in the skin
DEFF Research Database (Denmark)
Perez-Moreno, Mirna; Davis, Michael A; Wong, Ellen
2006-01-01
but no overt disruption in barrier function or intercellular adhesion. As the mice age, however, they display epidermal hyperplasia and chronic inflammation, typified by hair degeneration and loss of body fat. Using skin engraftments and anti-inflammatory drugs, we show that these features are not attributable...
Rash with DERMABOND PRINEO Skin Closure System Use in Bilateral Reduction Mammoplasty: A Case Series
R. W. Knackstedt; J. A. Dixon; P. J. O’Neill; F. A. Herrera
2015-01-01
Background. Bilateral reduction mammoplasty is a common plastic surgery procedure that can be complicated by unfavorable scar formation along incision sites. Surgical adhesives can be utilized as an alternative or as an adjunct to conventional suture closures to help achieve good wound tension and provide an adequate barrier with excellent cosmesis. The recently introduced DERMABOND PRINEO Skin Closure System Skin Closure System combines the skin adhesive 2-octyl cyanoacrylate with a self-ad...
Skin friction related behaviour of artificial turf systems.
Tay, Sock Peng; Fleming, Paul; Hu, Xiao; Forrester, Steph
2017-08-01
The occurrence of skin friction related injuries is an issue for artificial turf sports pitches and remains a barrier to their acceptance. The purpose of this study was to evaluate the current industry standard Securisport® Sports Surface Tester that measures skin surface related frictional behaviour of artificial turf. Little research has been published about the device and its efficacy, despite its widespread use as a standard FIFA test instrument. To achieve a range of frictional behaviours, several "third generation" (3G) carpet and infill combinations were investigated; friction time profiles throughout the Securisport rotations were assessed in combination with independent measurements of skin roughness before and after friction testing via 3D surface scanning. The results indicated that carpets without infill had greatest friction (coefficients of friction 0.97-1.20) while those completely filled with sand or rubber had similar and lower values independent of carpet type (coefficient of friction (COF) ≈0.57). Surface roughness of a silicone skin (s-skin) decreased after friction testing, with the largest change on sand infilled surfaces, indicating an "abrasive" polishing effect. The combined data show that the s-skin is damaged in a surface-specific manner, thus the Securisport COF values appear to be a poor measure of the potential for skin abrasion. It is proposed that the change in s-skin roughness improves assessment of the potential for skin damage when players slide on artificial turf.
Mini outbreak of Kaposi′s varicelliform eruption in skin ward: A study of five cases
Directory of Open Access Journals (Sweden)
Rao GRR
2007-01-01
Full Text Available Background: Kaposi`s varicelliform eruption (KVE represents widespread cutaneous herpes simplex virus (HSV infection in patients with preexisting dermatoses. Occasionally, this infection can present as a nosocomial infection in skin wards, if adequate bed-spacing and barrier nursing methods are not followed. We are reporting five cases of KVE; four cases acquired the infection in a makeshift ward after admission of the first case in May 2005, due to the renovation work of the regular skin ward. Aim: The purpose of this study is to create clinical awareness about this uncommon dermatologic entity and to stress upon the importance of bed-spacing and barrier nursing in skin wards. Methods: Five cases of KVE, three females and two males with different primary dermatoses (pemphigus foliaceus - one, pemphigus vulgaris - two, paraneoplastic pemphigus - one and toxic epidemal necrolysis - one were included in this study. Diagnosis was made clinically and supported with Tzanck smear and HSV serology. All the cases were treated with oral acyclovir. Results: Four out of five cases of KVE recovered with treatment, one case of extensive pemphigus vulgaris with KVE succumbed to death. Conclusion: Mini outbreaks of KVE can occur in skin wards with inadequate bed-spacing and overcrowding of patients. Therefore adequate bed-spacing, barrier nursing and isolation of suspected cases are mandatory to prevent such life-threatening infections.
Spin Transfer in Polymer Degradation of Abnormal Linkage
Yu, Tianrong; Tian, Chuanjin; Liu, Xizhe; Wang, Jia; Gao, Yang; Wang, Zhigang
2017-07-01
The degradation of polymer materials plays an important role in production and life. In this work, the degradation mechanism of poly-α-methylstyrene (PAMS) tetramers with abnormal linkage was investigated by using density functional theory (DFT). Calculated results indicate that the head-to-head and the tail-to-tail reactions needed to overcome the energy barriers are about 0.15 eV and about 1.26 eV, respectively. The broken C-C bond at the unsaturated end of the chain leads to the dissociation of alpha-methylstyrene (AMS) monomers one by one. Furthermore, the analyses of bond characteristics are in good agreement with the results of energy barriers. In addition, the spin population analysis presents an interesting net spin transfer process in depolymerization reactions. We hope that the current theoretical results provide useful help to understand the degradation mechanism of polymers.
Directory of Open Access Journals (Sweden)
Concepcion Parrado
2016-06-01
Full Text Available Healthier life styles include increased outdoors time practicing sports and walking. This means increased exposure to the sun, leading to higher risk of sunburn, photoaging and skin cancer. In addition to topical barrier products, oral supplementations of various botanicals endowed with antioxidant activity are emerging as novel method of photoprotection. Polypodium leucotomos extract (PL, commercial name Fernblock®, IFC Group, Spain is a powerful antioxidant due to its high content of phenolic compounds. PL is administered orally, with proven safety, and it can also be used topically. Its mechanisms include inhibition of the generation and release of reactive oxygen species (ROS by ultraviolet (UV light. It also prevents UV- and ROS-induced DNA damage with inhibition of AP1 and NF-κB and protection of natural antioxidant enzyme systems. At the cellular level, PL decreases cellular apoptosis and necrosis mediated UV and inhibits abnormal extracellular matrix remodeling. PL reduces inflammation, prevents immunosuppression, activates tumor suppressor p53 and inhibits UV-induced cyclooxygenase-2 (COX-2 enzyme expression. In agreement with increased p53 activity, PL decreased UV radiation-induced cell proliferation. PL also prevents common deletions mitochondrial DNA damage induced by UVA, and MMP-1 expression induced Visible Light and Infrared Radiation. These cellular and molecular effects are reflected in inhibitions of carcinogenesis and photoaging.
DEFF Research Database (Denmark)
Jungersted, Jakob Mutanu; Høgh, Julie Kaae; Hellegren, Lars I
2011-01-01
twice daily for one week with betamethasone, tacrolimus, emollient, or left untreated, respectively. After one week each area was challenged with a 24 h sodium lauryl sulphate patch test. The lipids were collected using the cyanoacrylate method and evaluated by high performance thin layer chromatography......The skin barrier, located in the stratum corneum, is influenced mainly by the lipid and protein composition of this layer. In eczematous diseases impairment of the skin barrier is thought to be of prime importance. Topical anti-inflammatory drugs and emollients are the most widely used eczema...
Directory of Open Access Journals (Sweden)
Gregory A. Raczniak
2016-02-01
Full Text Available Background: Community-acquired methicillin-resistant Staphylococcus aureus and methicillin-sensitive S. aureus infections are common to south-western Alaska and have been associated with traditional steambaths. More than a decade ago, recommendations were made to affected communities that included preventive skin care, cleaning methods for steambath surfaces, and the use of protective barriers while in steambaths to reduce the risk of S. aureus infection. Objective: A review of community medical data suggested that the number of skin infection clinical encounters has increased steadily over the last 3 years and we designed a public health investigation to seek root causes. Study design: Using a mixed methods approach with in-person surveys, a convenience sample (n=492 from 3 rural communities assessed the range of knowledge, attitudes and practices concerning skin infections, skin infection education messaging, prevention activities and home self-care of skin infections. Results: We described barriers to implementing previous recommendations and evaluated the acceptability of potential interventions. Prior public health messages appear to have been effective in reaching community members and appear to have been understood and accepted. We found no major misconceptions regarding what a boil was or how someone got one. Overall, respondents seemed concerned about boils as a health problem and reported that they were motivated to prevent boils. We identified current practices used to avoid skin infections, such as the disinfection of steambaths. We also identified barriers to engaging in protective behaviours, such as lack of access to laundry facilities. Conclusions: These findings can be used to help guide public health strategic planning and identify appropriate evidence-based interventions tailored to the specific needs of the region.
Microautoradiography of 14C-salicylic acid in the skin of guinea-pig
International Nuclear Information System (INIS)
Washitake, Mitsunori; Ozawa, Yasuo; Anmo, Toshio; Tanaka, Ichiro
1974-01-01
The concentration of salicylic acid in guinea-pig skin was examined by microautoradiography. The retention of salicylic acid in the stratum corneum was observed. It was considered that the rate of transfer of the drug into the stratum corneum was small and that the stratum corneum became the barrier for permeability of the skin. The distribution of salicylic acid in other parts of the skin was uniform and no retention of the drug in any special parts was observed. The plasma level showed less percutaneous absorption of the drug when it was applied as liquid paraffin solution than when it was applied as an aqueous solution. The amount of salicylic acid absorbed from damaged skin was extremely large and, in this case, disappearance of the drug from the skin was fast. (author)
Directory of Open Access Journals (Sweden)
David E Sanin
2015-05-01
Full Text Available The skin provides an important first line of defence and immunological barrier to invasive pathogens, but immune responses must also be regulated to maintain barrier function and ensure tolerance of skin surface commensal organisms. In schistosomiasis-endemic regions, populations can experience repeated percutaneous exposure to schistosome larvae, however little is known about how repeated exposure to pathogens affects immune regulation in the skin. Here, using a murine model of repeated infection with Schistosoma mansoni larvae, we show that the skin infection site becomes rich in regulatory IL-10, whilst in its absence, inflammation, neutrophil recruitment, and local lymphocyte proliferation is increased. Whilst CD4+ T cells are the primary cellular source of regulatory IL-10, they expressed none of the markers conventionally associated with T regulatory (Treg cells (i.e. FoxP3, Helios, Nrp1, CD223, or CD49b. Nevertheless, these IL-10+ CD4+ T cells in the skin from repeatedly infected mice are functionally suppressive as they reduced proliferation of responsive CD4+ T cells from the skin draining lymph node. Moreover, the skin of infected Rag-/- mice had impaired IL-10 production and increased neutrophil recruitment. Finally, we show that the mechanism behind IL-10 production by CD4+ T cells in the skin is due to a combination of an initial (day 1 response specific to skin commensal bacteria, and then over the following days schistosome-specific CD4+ T cell responses, which together contribute towards limiting inflammation and tissue damage following schistosome infection. We propose CD4+ T cells in the skin that do not express markers of conventional T regulatory cell populations have a significant role in immune regulation after repeated pathogen exposure and speculate that these cells may also help to maintain skin barrier function in the context of repeated percutaneous insult by other skin pathogens.
Döge, Nadine; Hönzke, Stefan; Schumacher, Fabian; Balzus, Benjamin; Colombo, Miriam; Hadam, Sabrina; Rancan, Fiorenza; Blume-Peytavi, Ulrike; Schäfer-Korting, Monika; Schindler, Anke; Rühl, Eckart; Skov, Per Stahl; Church, Martin K; Hedtrich, Sarah; Kleuser, Burkhard; Bodmeier, Roland; Vogt, Annika
2016-11-28
Understanding penetration not only in intact, but also in lesional skin with impaired skin barrier function is important, in order to explore the surplus value of nanoparticle-based drug delivery for anti-inflammatory dermatotherapy. Herein, short-term ex vivo cultures of (i) intact human skin, (ii) skin pretreated with tape-strippings and (iii) skin pre-exposed to sodium lauryl sulfate (SLS) were used to assess the penetration of dexamethasone (Dex). Intradermal microdialysis was utilized for up to 24h after drug application as commercial cream, nanocrystals or ethyl cellulose nanocarriers applied at the therapeutic concentration of 0.05%, respectively. In addition, Dex was assessed in culture media and extracts from stratum corneum, epidermis and dermis after 24h, and the results were compared to those in heat-separated split skin from studies in Franz diffusion cells. Providing fast drug release, nanocrystals significantly accelerated the penetration of Dex. In contrast to the application of cream and ethyl cellulose nanocarriers, Dex was already detectable in eluates after 6h when applying nanocrystals on intact skin. Disruption of the skin barrier further accelerated and enhanced the penetration. Encapsulation in ethyl cellulose nanocarriers delayed Dex penetration. Interestingly, for all formulations highly increased concentrations in the dialysate were observed in tape-stripped skin, whereas the extent of enhancement was less in SLS-exposed skin. The results were confirmed in tissue extracts and were in line with the predictions made by in vitro release studies and ex vivo Franz diffusion cell experiments. The use of 45kDa probes further enabled the collection of inflammatory cytokines. However, the estimation of glucocorticoid efficacy by Interleukin (IL)-6 and IL-8 analysis was limited due to the trauma induced by the probe insertion. Ex vivo intradermal microdialysis combined with culture media analysis provides an effective, skin-sparing method for
Weistenhöfer, W; Wacker, M; Bernet, F; Uter, W; Drexler, H
2015-04-01
Although there is poor scientific evidence that working with occlusive gloves is as damaging as wet work, prolonged glove occlusion is considered to be a risk factor for developing hand eczema similar to wet work. To assess the effects of wearing occlusive gloves during the whole working day, without exposure to any additional hazardous substances, on skin condition and skin barrier function. We investigated 323 employees of a semiconductor production company in Germany: 177 clean-room workers wearing occlusive gloves during the whole shift (exposed group) and 146 employees working in administration (control group). A standardized interview was performed, the skin condition of both hands was studied using the quantitative skin score HEROS, and transepidermal water loss (TEWL) and stratum corneum hydration were measured. There was no significant difference in skin condition between the two subgroups. Values for TEWL and corneometry were significantly higher in exposed participants (P gloves at least 30 min before the measurement. Hence, the effect of occlusion on skin barrier function seems to be transient. Prolonged wearing of occlusive gloves with clean hands and without exposure to additional hazardous substances does not seem to affect the skin negatively. © 2014 British Association of Dermatologists.
Liquid Crystal Gel Reduces Age Spots by Promoting Skin Turnover
Directory of Open Access Journals (Sweden)
Mina Musashi
2014-07-01
Full Text Available Studies have shown that liquid crystals structurally resembling the intercellular lipids in the stratum corneum can beneficially affect the skin when applied topically by stimulating the skin’s natural regenerative functions and accelerating epidermal turnover. In the present study, the effects of applying low concentrations of a liquid crystal gel of our own creation were evaluated using epidermal thickening in mouse skin as an assay for effective stimulation of epidermal turnover. A liquid crystal gel was also applied topically to human facial skin, and analysis was conducted using before-and-after photographs of age spots, measurements of L* values that reflect degree of skin pigmentation, single-layer samples of the stratum corneum obtained via tape-stripping, and measurements of trans-epidermal water loss that reflect the status of the skin’s barrier function. The results suggested that cost-effective creams containing as low as 5% liquid crystal gel might be effective and safely sold as skin care products targeting age spots and other problems relating to uneven skin pigmentation.
The impact of ultraviolet therapy on stratum corneum ceramides and barrier function
DEFF Research Database (Denmark)
Jungersted, Jakob Mutanu; Høgh, Julie Kaae; Hellgren, Lars
2011-01-01
therapy in dermatological patients on ceramides and skin barrier function.We found that UV light treatment does not change the ratio of important stratum corneum lipids, but we confirm earlier findings of decreased susceptibility to irritants after UV- therapy.......The ceramide profile as well as the barrier function is known to be deteriorated in atopic eczema and psoriasis, and ultraviolet (UV) light is known to improve the barrier function. The impact of UV light on ceramides, however, is not clarified.The aim of this study was to examine the effect of UV...
The impact of ultraviolet therapy on stratum corneum ceramides and barrier function
DEFF Research Database (Denmark)
Jungersted, Jakob Mutanu; Høgh, Julie Kaae; Hellgren, Lars
2011-01-01
therapy in dermatological patients on ceramides and skin barrier function. We found that UV light treatment does not change the ratio of important stratum corneum lipids, but we confirm earlier findings of decreased susceptibility to irritants after UV- therapy.......The ceramide profile as well as the barrier function is known to be deteriorated in atopic eczema and psoriasis, and ultraviolet (UV) light is known to improve the barrier function. The impact of UV light on ceramides, however, is not clarified. The aim of this study was to examine the effect of UV...
Abnormal mitochondrial respiration in failed human myocardium.
Sharov, V G; Todor, A V; Silverman, N; Goldstein, S; Sabbah, H N
2000-12-01
Chronic heart failure (HF) is associated with morphologic abnormalities of cardiac mitochondria including hyperplasia, reduced organelle size and compromised structural integrity. In this study, we examined whether functional abnormalities of mitochondrial respiration are also present in myocardium of patients with advanced HF. Mitochondrial respiration was examined using a Clark electrode in an oxygraph cell containing saponin-skinned muscle bundles obtained from myocardium of failed explanted human hearts due to ischemic (ICM, n=9) or idiopathic dilated (IDC, n=9) cardiomyopathy. Myocardial specimens from five normal donor hearts served as controls (CON). Basal respiratory rate, respiratory rate after addition of the substrates glutamate and malate (V(SUB)), state 3 respiration (after addition of ADP, V(ADP)) and respiration after the addition of atractyloside (V(AT)) were measured in scar-free muscle bundles obtained from the subendocardial (ENDO) and subepicardial (EPI) thirds of the left ventricular (LV) free wall, interventricular septum and right ventricular (RV) free wall. There were no differences in basal and substrate-supported respiration between CON and HF regardless of etiology. V(ADP)was significantly depressed both in ICM and IDC compared to CON in all the regions studied. The respiratory control ratio, V(ADP)/V(AT), was also significantly decreased in HF compared to CON. In both ICM and IDC, V(ADP)was significantly lower in ENDO compared to EPI. The results indicate that mitochondrial respiration is abnormal in the failing human heart. The findings support the concept of low myocardial energy production in HF via oxidative phosphorylation, an abnormality with a potentially impact on global cardiac performance. Copyright 2000 Academic Press.
Fur skin and fur garment trade between Europe and Asia
DEFF Research Database (Denmark)
Hansen, Henning Otte
2016-01-01
International trade and specialization with agricultural raw materials and processed products is often rather limited due to trade barriers, logistic problems and food security. This production of raw fur skin - which is also considered an agricultural product - mostly takes place in the Western...... hemisphere, and to a high degree in Europe, while processing and production of fur garments now more and more takes place in Asia. The objective of this paper is to analyze, quantify and explain trade patterns and international specialization within fur skin and fur garments focusing on Europa and Asia...... trade with fur skin products between Asia and Europe has increased remarkably during the recent decades. Europe accounts for a major share of world production and export of raw fur skin, and Asia accounts for the major part of the subsequent processing. This means that there is a significant export...
A fermented barley and soybean formula enhances skin hydration.
Lee, Sein; Kim, Jong-Eun; Suk, Sujin; Kwon, Oh Wook; Park, Gaeun; Lim, Tae-Gyu; Seo, Sang Gwon; Kim, Jong Rhan; Kim, Dae Eung; Lee, Miyeong; Chung, Dae Kyun; Jeon, Jong Eun; Cho, Dong Woon; Hurh, Byung Serk; Kim, Sun Yeou; Lee, Ki Won
2015-09-01
Skin hydration is one of the primary aims of beauty and anti-aging treatments. Barley (Hordeum vulgare) and soybean (Glycine max) are major food crops, but can also be used as ingredients for the maintenance of skin health. We developed a natural product-based skin treatment using a barley and soybean formula (BS) incorporating yeast fermentation, and evaluated its skin hydration effects as a dietary supplement in a clinical study. Participants ingested a placebo- (n = 33) or BS- (3 g/day) containing drink (n = 32) for 8 weeks. A significant increase in hydration in the BS group as compared to the placebo group was observed on the faces of subjects after 4 and 8 weeks, and on the forearm after 4 weeks. Decreases in stratum corneum (SC) thickness were also observed on the face and forearm. BS enhanced hyaluronan (HA) and skin barrier function in vitro and reduced Hyal2 expression in human dermal fibroblasts (HDF). BS also recovered ultraviolet (UV) B-induced downregulation of HA in HaCaT cells. These results suggest that BS has promising potential for development as a health functional food to enhance skin health.
Kowalczuk, Laura; Touchard, Elodie; Omri, Samy; Jonet, Laurent; Klein, Christophe; Valamanes, Fatemeh; Berdugo, Marianne; Bigey, Pascal; Massin, Pascale; Jeanny, Jean-Claude; Behar-Cohen, Francine
2011-01-01
Objective There are controversies regarding the pro-angiogenic activity of placental growth factor (PGF) in diabetic retinopathy (DR). For a better understanding of its role on the retina, we have evaluated the effect of a sustained PGF over-expression in rat ocular media, using ciliary muscle electrotransfer (ET) of a plasmid encoding rat PGF-1 (pVAX2-rPGF-1). Materials and Methods pVAX2-rPGF-1 ET in the ciliary muscle (200 V/cm) was achieved in non diabetic and diabetic rat eyes. Control eyes received saline or naked plasmid ET. Clinical follow up was carried out over three months using slit lamp examination and fluorescein angiography. After the control of rPGF-1 expression, PGF-induced effects on retinal vasculature and on the blood-external barrier were evaluated respectively by lectin and occludin staining on flat-mounts. Ocular structures were visualized through histological analysis. Results After fifteen days of rPGF-1 over-expression in normal eyes, tortuous and dilated capillaries were observed. At one month, microaneurysms and moderate vascular sprouts were detected in mid retinal periphery in vivo and on retinal flat-mounts. At later stages, retinal pigmented epithelial cells demonstrated morphological abnormalities and junction ruptures. In diabetic retinas, PGF expression rose between 2 and 5 months, and, one month after ET, rPGF-1 over-expression induced glial activation and proliferation. Conclusion This is the first demonstration that sustained intraocular PGF production induces vascular and retinal changes similar to those observed in the early stages of diabetic retinopathy. PGF and its receptor Flt-1 may therefore be looked upon as a potential regulatory target at this stage of the disease. PMID:21408222
Lefrandt, JD; Hoeven, JH; Roon, AM; Smit, AJ; Hoogenberg, K
Aims/hypothesis. A loss of sympathetic function could lead to changes in capillary fluid filtration in diabetic patients. We investigated whether a decreased sympathetically mediated vasomotion in the skin in diabetic patients with peripheral neuropathy is associated with an abnormal capillary
Bosteels, Jan; Weyers, Steven; Mol, Ben W. J.; D'Hooghe, Thomas
2014-01-01
The aim of this study was to assess the effects of any anti-adhesion barrier gel used after operative hysteroscopy for treating infertility associated with uterine cavity abnormalities. Gynecologists might use any barrier gel following operative hysteroscopy in infertile women for decreasing de novo
[Improvement of rosacea treatment based on the morphological and functional features of the skin].
Tsiskarishvili, N V; Katsitadze, A G; Tsiskarishvili, Ts I
2013-10-01
Rosacea - a widespread disease sometimes aleak with severe complications, mainly affecting the skin. Irrational and inadequate treatment leads to chronicity of diseases and psychosocial disadaptation of patients. Lately, a clear upward trend in the number of patients in whom in the process of complex treatment manifestations (with the varying degrees of severity) of impaired barrier function of the skin are observed and they need the protection and restoration of the damaged stratum corneum. In patients with rosacea in order to study the function of the facial skin's horny layer we used the skin analyzer BIA (bioimpedance analysis, which in duration of 6 seconds determines the moisture content, oiliness and the softness of the skin) and significant deviations from the norm (decrease in moisture content, fatness and increased roughness) was revealed. These changes were most clearly pronounced in patients with steroid rosacea. To restore the skin barrier the drug "Episofit A" (Laboratory of Evolutionary Dermatology, France) has been used (1-2 times a day for 6 weeks). Evaluation of treatment efficacy was conducted every 2 weeks by means of a scale from 0 to 5 for parameters of dryness, erythema, peeling and expression of subjective feelings. In accordance with received results, using of Episofit A emulsion, especially on the baсkground of long-term treatment with topical steroids, had a pronounced therapeutic effect. Thus, treatment of patients with consideration of morphological and functional features of facial skin, helps to improve the results traditional therapy, and the drug is highly effective means of the new direction in skin care - corneotherapy aimed to reconstruct and protect damaged stratum corneum.
Skin fragility syndrome in a cat with cholangiohepatitis and hepatic lipidosis.
Daniel, Alexandre G T; Lucas, Sílvia R R; Júnior, Archivaldo R; Monteiro, Paula R G; Ramos, Daniela; Pires, Carolina G; Sinhorini, Idércio L
2010-02-01
A case of acquired skin fragility syndrome associated with hepatic disease in a 9-year-old, spayed female, domestic shorthair cat is described. The cat was admitted to the veterinary hospital of the University of São Paulo (Brazil) with a 6-week history of vomiting, inappetence and weight loss. Remarkable signs were weakness, lethargy and profound jaundice that had been present for 10 days according to the owner. On completion of the physical examination, when the cat was gently manipulated for blood collection the thoracic limb and interscapular skin tore. Liver enzymes and bilirubin levels were all above the normal range. On histological examination of skin and liver, Masson's trichrome stain showed collagen fibre alteration and major hepatocyte abnormalities. Findings were consistent with feline skin fragility syndrome associated with cholangiohepatitis and hepatic lipidosis. Copyright 2009 ESFM and AAFP. Published by Elsevier Ltd. All rights reserved.
Skin Diseases: Skin Health and Skin Diseases
Skip Navigation Bar Home Current Issue Past Issues Skin Diseases Skin Health and Skin Diseases Past Issues / Fall 2008 Table of Contents ... acne to wrinkles Did you know that your skin is the largest organ of your body? It ...
The Th17 Lineage: From Barrier Surfaces Homeostasis to Autoimmunity, Cancer, and HIV-1 Pathogenesis
Directory of Open Access Journals (Sweden)
Vanessa Sue Wacleche
2017-10-01
Full Text Available The T helper 17 (Th17 cells represent a subset of CD4+ T-cells with unique effector functions, developmental plasticity, and stem-cell features. Th17 cells bridge innate and adaptive immunity against fungal and bacterial infections at skin and mucosal barrier surfaces. Although Th17 cells have been extensively studied in the context of autoimmunity, their role in various other pathologies is underexplored and remains an area of open investigation. This review summarizes the history of Th17 cell discovery and the current knowledge relative to the beneficial role of Th17 cells in maintaining mucosal immunity homeostasis. We further discuss the concept of Th17 pathogenicity in the context of autoimmunity, cancer, and HIV infection, and we review the most recent discoveries on molecular mechanisms regulating HIV replication/persistence in pathogenic Th17 cells. Finally, we stress the need for novel fundamental research discovery-based Th17-specific therapeutic interventions to treat pathogenic conditions associated with Th17 abnormalities, including HIV infection.
Sensitive skin at menopause; dew point and electrometric properties of the stratum corneum.
Paquet, F; Piérard-Franchimont, C; Fumal, I; Goffin, V; Paye, M; Piérard, G E
1998-01-12
A number of menopausal women experience skin sensitive to various environmental threats. Two panels of 15 menopausal women on or without HRT were compared. We studied the response of their stratum corneum to variations in environmental humidity, either in air or in response to an emollient. Environment dew point and electrometric measurements on the skin were recorded to search for correlations. Data show that the baseline stratum corneum hydration is influenced by the dew point. HRT improves the barrier function of the skin. The use of emollient further extends the improvement in the functional properties of skin in menopausal women. Both HRT and an emollient can counteract in part some of the deleterious effects of cold and dry weather.
Kasparian, Nadine A; Bränström, Richard; Chang, Yu-mei; Affleck, Paul; Aspinwall, Lisa G; Tibben, Aad; Azizi, Esther; Baron-Epel, Orna; Battistuzzi, Linda; Bruno, William; Chan, May; Cuellar, Francisco; Debniak, Tadeusz; Pjanova, Dace; Ertmanski, Slawomir; Figl, Adina; Gonzalez, Melinda; Hayward, Nicholas K; Hocevar, Marko; Kanetsky, Peter A; Leachman, Sancy; Bergman, Wilma; Heisele, Olita; Palmer, Jane; Peric, Barbara; Puig, Susana; Schadendorf, Dirk; Gruis, Nelleke A; Newton-Bishop, Julia; Brandberg, Yvonne
2012-10-01
To examine the frequency and correlates of skin examination behaviors in an international sample of individuals at varying risk of developing melanoma. A cross-sectional, web-based survey. Data were collected from the general population over a 20-month period on behalf of the Melanoma Genetics Consortium (GenoMEL). A total of 8178 adults from Northern (32%), Central (33%), and Southern (14%) Europe, Australia (13%), and the United States (8%). Self-reported frequency of skin self-examination (SSE) and clinical skin examination (CSE). After adjustment for age and sex, frequency of skin examination was higher in both Australia (odds ratio [OR]SSE=1.80 [99% CI, 1.49-2.18]; ORCSE=2.68 [99% CI, 2.23-3.23]) and the United States (ORSSE=2.28 [99% CI, 1.76-2.94]; ORCSE=3.39 [99% CI, 2.60-4.18]) than in the 3 European regions combined. Within Europe, participants from Southern Europe reported higher rates of SSE than those in Northern Europe (ORSSE=1.61 [99% CI, 1.31-1.97]), and frequency of CSE was higher in both Central (ORCSE=1.47 [99% CI, 1.22-1.78]) and Southern Europe (ORCSE=3.46 [99% CI, 2.78, 4.31]) than in Northern Europe. Skin examination behavior also varied according to melanoma history: participants with no history of melanoma reported the lowest levels of skin examination, while participants with a previous melanoma diagnosis reported the highest levels. After adjustment for region, and taking into account the role of age, sex, skin type, and mole count, engagement in SSE and CSE was associated with a range of psychosocial factors, including perceived risk of developing melanoma; perceived benefits of, and barriers to, skin examination; perceived confidence in one's ability to engage in screening; and social norms. In addition, among those with no history of melanoma, higher cancer-related worry was associated with greater frequency of SSE. Given the strong association between psychosocial factors and skin examination behaviors, particularly among people with
Kimura, Utako; Kinoshita, Ayako; Osawa, Aki; Negi, Osamu; Haruna, Kunitaka; Mizuno, Yuki; Suga, Yasushi
2012-05-01
Ablative fractional laser skin resurfacing (FLSR) has recently been used for the amelioration of acne scars, and previous studies have shown clinical effectiveness. Despite its extensive use, few studies have focused on the associated changes in biophysical properties of the epidermis. Herein, we evaluate transepidermal water loss, sebum levels, skin hydration, and skin elasticity, following FLSR treatments with an Er:YSGG laser device (Pearl FractionalTM, Cutera Inc., Brisbane, CA), employing non-invasive measurements. Five Japanese patients with facial acne scars underwent one FLSR session. Some acne scars appeared to become less obvious as a consequence of the treatment. All patients were aware of a feeling of skin tightness in treated areas. Objective measurements on the lower lateral angle of the eye and on the inner cheeks were evaluated at baseline and at 3 days, 1 week, and 4 weeks after FLSR. Transepidermal water loss showed a significant two-fold (100%) increase at day 3, but had returned to almost the baseline level at week 4 in both areas. Sebum secretion showed a 50% increase at day 3, but had returned to the baseline level after day 7. Skin hydration showed a significant decrease at day 3, but had returned to the baseline level by day 7, and showed significant improvement at the end of the study. Skin elasticity (R2) was still at baseline on day 3, but showed some improvement--an increase of at least 30%--at the end of the study. Based on our findings, we believe that FLSR should be performed no more than once a month to allow sufficient time for the damaged skin to recover its barrier function in most areas of the face.
Knackstedt, R W; Dixon, J A; O'Neill, P J; Herrera, F A
2015-01-01
Background. Bilateral reduction mammoplasty is a common plastic surgery procedure that can be complicated by unfavorable scar formation along incision sites. Surgical adhesives can be utilized as an alternative or as an adjunct to conventional suture closures to help achieve good wound tension and provide an adequate barrier with excellent cosmesis. The recently introduced DERMABOND PRINEO Skin Closure System Skin Closure System combines the skin adhesive 2-octyl cyanoacrylate with a self-adhering polyester-based mesh. Proposed benefits of wound closure with DERMABOND PRINEO Skin Closure System, used with or without sutures, include its watertight seal, easy removal, microbial barrier, even distribution of tension, and reduction in wound closure time. Although allergic reactions to 2-octyl cyanoacrylate have been reported, few allergic reactions to DERMABOND PRINEO Skin Closure System have been noted in the literature. This case series describes three patients who experienced an allergic reaction to DERMABOND PRINEO Skin Closure System after undergoing elective bilateral reduction mammoplasties at our institution to further explore this topic. Methods. Retrospective chart review of bilateral reduction mammoplasty patients who received DERMABOND PRINEO Skin Closure System dressing at our institution was performed. Results. Three patients were identified as having a rash in reaction to DERMABOND PRINEO Skin Closure System after bilateral reduction mammoplasty. All three patients required systemic steroid treatment to resolve the rash. One patient was identified as having a prior adhesive reaction. Conclusions. DERMABOND PRINEO Skin Closure System has demonstrated its efficacy in optimizing scar healing and appearance. However, as we demonstrate these three allergic reactions to DERMABOND PRINEO Skin Closure System, caution must be utilized in its usage, namely, in patients with a prior adhesive allergy and in sites where moisture or friction may be apparent.
Rash with DERMABOND PRINEO Skin Closure System Use in Bilateral Reduction Mammoplasty: A Case Series
Directory of Open Access Journals (Sweden)
R. W. Knackstedt
2015-01-01
Full Text Available Background. Bilateral reduction mammoplasty is a common plastic surgery procedure that can be complicated by unfavorable scar formation along incision sites. Surgical adhesives can be utilized as an alternative or as an adjunct to conventional suture closures to help achieve good wound tension and provide an adequate barrier with excellent cosmesis. The recently introduced DERMABOND PRINEO Skin Closure System Skin Closure System combines the skin adhesive 2-octyl cyanoacrylate with a self-adhering polyester-based mesh. Proposed benefits of wound closure with DERMABOND PRINEO Skin Closure System, used with or without sutures, include its watertight seal, easy removal, microbial barrier, even distribution of tension, and reduction in wound closure time. Although allergic reactions to 2-octyl cyanoacrylate have been reported, few allergic reactions to DERMABOND PRINEO Skin Closure System have been noted in the literature. This case series describes three patients who experienced an allergic reaction to DERMABOND PRINEO Skin Closure System after undergoing elective bilateral reduction mammoplasties at our institution to further explore this topic. Methods. Retrospective chart review of bilateral reduction mammoplasty patients who received DERMABOND PRINEO Skin Closure System dressing at our institution was performed. Results. Three patients were identified as having a rash in reaction to DERMABOND PRINEO Skin Closure System after bilateral reduction mammoplasty. All three patients required systemic steroid treatment to resolve the rash. One patient was identified as having a prior adhesive reaction. Conclusions. DERMABOND PRINEO Skin Closure System has demonstrated its efficacy in optimizing scar healing and appearance. However, as we demonstrate these three allergic reactions to DERMABOND PRINEO Skin Closure System, caution must be utilized in its usage, namely, in patients with a prior adhesive allergy and in sites where moisture or friction may
Microbial ecology of the skin in the era of metagenomics and molecular microbiology.
Hannigan, Geoffrey D; Grice, Elizabeth A
2013-12-01
The skin is the primary physical barrier between the body and the external environment and is also a substrate for the colonization of numerous microbes. Previously, dermatological microbiology research was dominated by culture-based techniques, but significant advances in genomic technologies have enabled the development of less-biased, culture-independent approaches to characterize skin microbial communities. These molecular microbiology approaches illustrate the great diversity of microbiota colonizing the skin and highlight unique features such as site specificity, temporal dynamics, and interpersonal variation. Disruptions in skin commensal microbiota are associated with the progression of many dermatological diseases. A greater understanding of how skin microbes interact with each other and with their host, and how we can therapeutically manipulate those interactions, will provide powerful tools for treating and preventing dermatological disease.
Microautoradiography of /sup 14/C-salicylic acid in the skin of guinea-pig
Energy Technology Data Exchange (ETDEWEB)
Washitake, M; Ozawa, Y; Anmo, T; Tanaka, I [Taisho Pharmaceutical Co. Ltd., Tokyo (Japan). Research Lab.
1974-07-01
The concentration of salicylic acid in guinea-pig skin was examined by microautoradiography. The retention of salicylic acid in the stratum corneum was observed. It was considered that the rate of transfer of the drug into the stratum corneum was small and that the stratum corneum became the barrier for permeability of the skin. The distribution of salicylic acid in other parts of the skin was uniform and no retention of the drug in any special parts was observed. The plasma level showed less percutaneous absorption of the drug when it was applied as liquid paraffin solution than when it was applied as an aqueous solution. The amount of salicylic acid absorbed from damaged skin was extremely large and, in this case, disappearance of the drug from the skin was fast.
In vitro techniques to assess the proficiency of skin care cosmetic formulations.
Roy, Amit; Sahu, Ram Kumar; Matlam, Munglu; Deshmukh, Vinay Kumar; Dwivedi, Jaya; Jha, Arvind Kumar
2013-07-01
Cosmetics comprising either natural or synthetic components are used almost regularly and universally in different forms to enhance the beauty. The utmost disclosure of human membrane to sunlight and environmental pollution results in the exhibition of free radical, that react with deoxyribonucleic acid, proteins and fatty acids, causation oxidative destruction dysfunction of the antioxidant system. In skin, the formation of reactive oxygen species leads to skin diseases, predominantly cutaneous malignancies, immunosuppression, wrinkles, aging, etc., The human organism fosters a barrier practice against the destructive action of free radicals, comprising mostly of vitamins, carotenoids and enzymes. Cosmetic products are the best option to reduce skin disorders such as hyper pigmentation, skin aging, skin wrinkling and rough skin texture, etc., Hence in this review, we conferred various in vitro methods that are used for the development of novel cosmetic formulation. There is an expanding fascinate employing in vitro techniques because they are less time consuming, more cost-effective and lessen the participation of human volunteers.
Fukagawa, Satoko; Haramizu, Satoshi; Sasaoka, Shun; Yasuda, Yuka; Tsujimura, Hisashi; Murase, Takatoshi
2017-09-01
Coffee polyphenols (CPPs), including chlorogenic acid, exert various physiological activities. The purpose of this study was to investigate the effects of CPPs on skin properties and microcirculatory function in humans. In this double-blind, placebo-controlled study, 49 female subjects with mildly xerotic skin received either a test beverage containing CPPs (270 mg/100 mL/day) or a placebo beverage for 8 weeks. The ingestion of CPPs significantly lowered the clinical scores for skin dryness, decreased transepidermal water loss, skin surface pH, and increased stratum corneum hydration and the responsiveness of skin blood flow during local warming. Moreover, the amounts of free fatty acids and lactic acid in the stratum corneum significantly increased after the ingestion of CPPs. These results suggest that an 8-week intake of CPPs improve skin permeability barrier function and hydration, with a concomitant improvement in microcirculatory function, leading to efficacy in the alleviation of mildly xerotic skin.
Skinware 2.0: A real-time middleware for robot skin
Directory of Open Access Journals (Sweden)
S. Youssefi
2015-12-01
Full Text Available Robot skins have emerged recently as products of research from various institutes worldwide. Each robot skin is designed with different applications in mind. As a result, they differ in many aspects from transduction technology and structure to communication protocols and timing requirements. These differences create a barrier for researchers interested in developing tactile processing algorithms for robots using the sense of touch; supporting multiple robot skin technologies is non-trivial and committing to a single technology is not as useful, especially as the field is still in its infancy. The Skinware middleware has been created to mitigate these issues by providing abstractions and real-time acquisition mechanisms. This article describes the second revision of Skinware, discussing the differences with respect to the first version.
Stansal, A; Khayat, K; Duchatelle, V; Tella, E; Gautier, V; Sfeir, D; Attal, R; Lazareth, I; Priollet, P
2018-02-01
A vascular cause is found in around 85% of leg ulcer patients, but non-vascular causes are also observed. Their diagnosis is based on a set of clinical arguments and skin biopsy with histological analysis. The aim of this study was to analyze the results of these biopsies and to find common criteria for ulcers whose skin biopsies had led to the diagnosis of a non-vascular ulcer. A retrospective study was carried out on the analysis of 143 skin biopsies of leg ulcers. The reasons for the biopsy were mainly atypical clinical signs and/or the lack of improvement in care after 6 months, as advocated by the French health authorities. The skin biopsies led to a diagnosis of non-vascular ulcer in 4.9% of cases (7/143), including skin cancer (n=5, 3.5%), cutaneous leishmaniasis (n=1, 0.7%) and Pyoderma gangrenosum (n=1, 0.7%). The univariate statistical analysis revealed that an elevated rim and abnormal excessive granulation tissue were significantly more frequently found in these ulcers. All patients with a positive skin biopsy had associated vascular involvement. This study found a 5% rate of non-vascular causes of ulcers, mainly skin cancer. Elevated rims and abnormal excessive granulation tissue were the unusual features most commonly found in these ulcers. All patients whose skin biopsy revealed a non-vascular cause had associated vascular involvement. This information confirms the need to perform a skin biopsy, even in the presence of a vascular disease. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Lademann, Jürgen; Knorr, Fanny; Patzelt, Alexa; Meinke, Martina C; Richter, Heike; Krutmann, Jean; Rühl, Eckart; Doucet, Olivier
2018-01-01
Airborne pollutants, such as nano-sized soot particles, are increasingly being released into the environment as a result of growing population densities and industrialization. They can absorb organic and metal compounds with potential biological activity, such as polycyclic aromatic hydrocarbons and airborne pollen allergens. Local and systemic toxicities may be induced in the skin if the particulates release their harmful components upon dermal contact. In the present study, skin pretreatments with serum and/or shield as barrier formulations prior to exposure and washing with a cleanser subsequent to exposure were evaluated as a protection and decontamination strategy using laser scanning microscopy. The results indicate that while the application of serum and a cleanser was insufficient for decontamination, the pretreatment with shield prior to nanoparticle exposure followed by washing led to the removal of a considerable amount of the carbon black particles. The combined application of serum and shield before the administration of carbon black particles and subsequent washing led to their elimination from the skin samples. The application of barrier-enhancing formulations in combination with a cleanser may reduce the penetration of harmful airborne particulates by preventing their adhesion to the skin and facilitating their removal by subsequent washing with the cleanser. © 2018 S. Karger AG, Basel.
Bignon, Cécile; Amigoni, Sonia; Guittard, Frédéric
2016-06-01
Due to their small size, nanoparticles possess unique properties such as high absorption or pollutant degradation, making them useful for skin protection against chemicals. By covalently grafting to a hydrophobically modified alkali-soluble emulsion (HASE), a thickening polymer, nanoparticles can be dispersed as gels in water at neutral pH. With this modification the potential aggregation and toxicity typical of nanoparticles are avoided. Once integrated into a cosmetic formula, these gels can be spread onto skin to afford protective barriers. This paper reports (1) the benefit of SiO2 nanoparticles grafted to a perfluorocarbon HASE polymer (HASE-F/SiO2) which is then integrated into a new formula and it is influence on the efficacy against the penetration of paraoxone, as well as (2) the stability of the barrier cream (BC) and (3) how the homogenous dispersion of nanoparticles maintains a high active surface area of SiO2 nanoparticles. The efficiency of the new active topical skin protectant was proved at different doses (5-27 mg cm-2), under occlusive conditions and validated on human skin. Therefore, the combination of the HASE-F polymer, nanoparticle grafting, and polyvinylpyrrolidone and glycerol formulation led to a very effective active BC.
Dyson, Judith; Cowdell, Fiona
2014-12-01
To develop and psychometrically test the Motivation and Self-Efficacy in Early Detection of Skin Lesions Index. Skin cancer is the most frequently diagnosed cancer worldwide. The primary strategy used to prevent skin cancer is promotion of sun avoidance and the use of sun protection. However, despite costly and extensive campaigns, cases of skin cancer continue to increase. If found and treated early, skin cancer is curable. Early detection is, therefore, very important. The study was conducted in 2013. Instrument Development. A literature review and a survey identified barriers (factors that hinder) and levers (factors that help) to skin self-examination. These were categorized according to a the Theoretical Domains Framework and this formed the basis of an instrument, which was tested for validity and reliability using confirmatory factor analysis and Cronbach's alpha respectively. A five-factor 20-item instrument was used that tested well for reliability and construct validity. Test-retest reliability was good for all items and domains. The five factors were: (i) Outcome expectancies; (ii) Intention; (iii) Self-efficacy; (iv) Social influences; (v) Memory. The Motivation and Self-Efficacy in Early Detection of Skin Lesions Index provides a reliable and valid method of assessing barriers and levers to skin self-examination. The next step is to design a theory-based intervention that can be tailored according to individual determinants to behaviour change identified by this instrument. © 2014 John Wiley & Sons Ltd.
Pakravan, Nafiseh; Mahmoudi, Elaheh; Hashemi, Seyed-Ali; Kamali, Jamal; Hajiaghayi, Reza; Rahimzadeh, Mitra; Mahmoodi, Vajiheh
2017-11-19
Natural ingredients have been always an interesting approach to prolong youthful appearance of skin. One of the natural compounds is Kombucha tea (KT), which has been mainly used as an energy drink in Asian countries for a long time. Previous reports indicated that it has pharmaceutical and favorable wound repairing effects. The beneficial properties of KT are thought to be mainly due to the presence of fermentation products such as flavonoids and other polyphenols with inhibition of hydrolytic and oxidative enzymes and anti-inflammatory effects. These properties prompted us to study the anti-aging potential of KT and investigate its effective fraction in aged mice, METHODS: Kombucha tea was fractionated into chloroform, butanol, and ethyl acetate, and flavonoid content was determined. Young and old mice were used as control. KT ethyl acetate fraction (KEAf), which had the highest flavonoid content, was intradermally administered to old mice. Administration of KEAf significantly increased the collagen content, NAD + /NADH level, and concomitantly improved skin connective tissue abnormalities in the aged skin. No sensitivity or irritation was observed. This finding suggested that KEAf can be a suitable candidate as a cosmetic product to improve aging-related skin abnormalities and regeneration of aged skin. © 2017 Wiley Periodicals, Inc.
Igoucheva, Olga; Alexeev, Vitali; Halabi, Carmen M; Adams, Sheila M; Stoilov, Ivan; Sasaki, Takako; Arita, Machiko; Donahue, Adele; Mecham, Robert P; Birk, David E; Chu, Mon-Li
2015-08-28
Fibulin-4 is an extracellular matrix protein essential for elastic fiber formation. Frameshift and missense mutations in the fibulin-4 gene (EFEMP2/FBLN4) cause autosomal recessive cutis laxa (ARCL) 1B, characterized by loose skin, aortic aneurysm, arterial tortuosity, lung emphysema, and skeletal abnormalities. Homozygous missense mutations in FBLN4 are a prevalent cause of ARCL 1B. Here we generated a knock-in mouse strain bearing a recurrent fibulin-4 E57K homozygous missense mutation. The mutant mice survived into adulthood and displayed abnormalities in multiple organ systems, including loose skin, bent forelimb, aortic aneurysm, tortuous artery, and pulmonary emphysema. Biochemical studies of dermal fibroblasts showed that fibulin-4 E57K mutant protein was produced but was prone to dimer formation and inefficiently secreted, thereby triggering an endoplasmic reticulum stress response. Immunohistochemistry detected a low level of fibulin-4 E57K protein in the knock-in skin along with altered expression of selected elastic fiber components. Processing of a precursor to mature lysyl oxidase, an enzyme involved in cross-linking of elastin and collagen, was compromised. The knock-in skin had a reduced level of desmosine, an elastin-specific cross-link compound, and ultrastructurally abnormal elastic fibers. Surprisingly, structurally aberrant collagen fibrils and altered organization into fibers were characteristics of the knock-in dermis and forelimb tendons. Type I collagen extracted from the knock-in skin had decreased amounts of covalent intermolecular cross-links, which could contribute to the collagen fibril abnormalities. Our studies provide the first evidence that fibulin-4 plays a role in regulating collagen fibril assembly and offer a preclinical platform for developing treatments for ARCL 1B. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Modern child skin care products as a basic treatment in atopic dermatitis
Directory of Open Access Journals (Sweden)
Shchegelskaya T.Yu.
2016-09-01
Full Text Available The aim of the proposed study is to demonstrate the benefits of using specialized cosmetic products as part of basic skin care for children with Atopic Dermatitis (AD. The epidermal barrier dysfunction is known to be the leading factor in pathogenesis of atopic dermatitis and it manifests as dry skin, imbalance in the composition of lipids of the stratum corneum and water-lipid mantle and alterations in the activity of proteases. Due to xerosis, the skin gets easily affected by allergens, irritants and pathogenic microorganisms, which triggers the "itch-scratch" cycle and can lead to AD exacerbation and significantly deteriorate the quality of life of the patient. The basic skin care using the moisturizing and soothing cosmetic products (emollients is acknowledged by all major Guidelines for treatment of AD as an important part of therapy. Significant improvements in skin status as well as the child's well-being can be achieved with use of this simple to understand skin care algorithm that includes proper skin cleansing, moisturizing and itch prevention.
Franz, Marcel; Spohn, Dorothee; Ritter, Alexander; Rolke, Roman; Miltner, Wolfgang H R; Weiss, Thomas
2012-08-01
Patients suffering from postherpetic neuralgia often complain about hypo- or hypersensation in the affected dermatome. The loss of thermal sensitivity has been demonstrated by quantitative sensory testing as being associated with small-fiber (Aδ- and C-fiber) deafferentation. We aimed to compare laser stimulation (radiant heat) to thermode stimulation (contact heat) with regard to their sensitivity and specificity to detect thermal sensory deficits related to small-fiber dysfunction in postherpetic neuralgia. We contrasted detection rate of laser stimuli with 5 thermal parameters (thresholds of cold/warm detection, cold/heat pain, and sensory limen) of quantitative sensory testing. Sixteen patients diagnosed with unilateral postherpetic neuralgia and 16 age- and gender-matched healthy control subjects were tested. Quantitative sensory testing and laser stimulation of tiny skin areas were performed in the neuralgia-affected skin and in the contralateral homologue of the neuralgia-free body side. Across the 5 thermal parameters of thermode stimulation, only one parameter (warm detection threshold) revealed sensory abnormalities (thermal hypoesthesia to warm stimuli) in the neuralgia-affected skin area of patients but not in the contralateral area, as compared to the control group. In contrast, patients perceived significantly less laser stimuli both in the affected skin and in the contralateral skin compared to controls. Overall, laser stimulation proved more sensitive and specific in detecting thermal sensory abnormalities in the neuralgia-affected skin, as well as in the control skin, than any single thermal parameter of thermode stimulation. Thus, laser stimulation of tiny skin areas might be a useful diagnostic tool for small-fiber dysfunction. Copyright © 2012 International Association for the Study of Pain. Published by Elsevier B.V. All rights reserved.
Sibin Melo, Katia C; Correia, Marcelo H; Svidzinski, Terezinha I E; Hernandes, Luzmarina
2018-05-01
The skin is an important gateway for Fusarium infection in humans. Our hypothesis is that metabolites produced by Fusarium oxysporum should change the barrier structure to permeate the skin. Male Wistar rats received a topical application of a solution (0.05 mg/mL) of Fusarium metabolites. The animals were euthanized 3, 6, 12, 24 h after and the skin was processed for immunostaining by laminin and E-cadherin to investigate whether the Fusarium metabolites can break the barrier of healthy skin. Other techniques were employed: H&E to study the morphology; metalloproteinase-9 (MMP-9), TUNEL, and PCNA immunostaining to evaluate the inflammation, cell death, and proliferation, respectively. There was an inflammatory response mainly centered in the dermis. Qualitatively, the skin of the experimental group showed reduced E-cadherin and laminin immunostaining at 3, 12, and 24 h. Higher intensity staining by TUNEL at 3 h, and PCNA at 6, 12, and 24 h. There was intense MMP-9 activity at 6, 12, and 24 h. None of analyses revealed any changes in the epidermis. It was concluded that the fraction was able to permeate the skin and act selectively in dermis, inducing inflammatory response, increasing MMP-9 immunostaining, inducing apoptosis, and reducing E-cadherin and laminin immunostaining. © 2018 APMIS. Published by John Wiley & Sons Ltd.
DEFF Research Database (Denmark)
Cramer, Stig Præstekær; Simonsen, Helle Juhl; Frederiksen, Jette Lautrup Battistini
2013-01-01
To investigate whether blood-brain barrier (BBB) permeability is disrupted in normal appearing white matter in MS patients, when compared to healthy controls and whether it is correlated with MS clinical characteristics.......To investigate whether blood-brain barrier (BBB) permeability is disrupted in normal appearing white matter in MS patients, when compared to healthy controls and whether it is correlated with MS clinical characteristics....
Kim, Byoung Soo; Kwon, Yang Woo; Kong, Jeong-Sik; Park, Gyu Tae; Gao, Ge; Han, Wonil; Kim, Moon-Bum; Lee, Hyungseok; Kim, Jae Ho; Cho, Dong-Woo
2018-06-01
3D cell-printing technique has been under spotlight as an appealing biofabrication platform due to its ability to precisely pattern living cells in pre-defined spatial locations. In skin tissue engineering, a major remaining challenge is to seek for a suitable source of bioink capable of supporting and stimulating printed cells for tissue development. However, current bioinks for skin printing rely on homogeneous biomaterials, which has several shortcomings such as insufficient mechanical properties and recapitulation of microenvironment. In this study, we investigated the capability of skin-derived extracellular matrix (S-dECM) bioink for 3D cell printing-based skin tissue engineering. S-dECM was for the first time formulated as a printable material and retained the major ECM compositions of skin as well as favorable growth factors and cytokines. This bioink was used to print a full thickness 3D human skin model. The matured 3D cell-printed skin tissue using S-dECM bioink was stabilized with minimal shrinkage, whereas the collagen-based skin tissue was significantly contracted during in vitro tissue culture. This physical stabilization and the tissue-specific microenvironment from our bioink improved epidermal organization, dermal ECM secretion, and barrier function. We further used this bioink to print 3D pre-vascularized skin patch able to promote in vivo wound healing. In vivo results revealed that endothelial progenitor cells (EPCs)-laden 3D-printed skin patch together with adipose-derived stem cells (ASCs) accelerates wound closure, re-epithelization, and neovascularization as well as blood flow. We envision that the results of this paper can provide an insightful step towards the next generation source for bioink manufacturing. Copyright © 2018 Elsevier Ltd. All rights reserved.
Ambient humidity and the skin: the impact of air humidity in healthy and diseased states.
Goad, N; Gawkrodger, D J
2016-08-01
Humidity, along with other climatic factors such as temperature and ultraviolet radiation, can have an important impact on the skin. Limited data suggest that external humidity influences the water content of the stratum corneum. An online literature search was conducted through Pub-Med using combinations of the following keywords: skin, skin disease, humidity, dermatoses, dermatitis, eczema, and mist. Publications included in this review were limited to (i) studies in humans or animals, (ii) publications showing relevance to the field of dermatology, (iii) studies published in English and (iv) publications discussing humidity as an independent influence on skin function. Studies examining environmental factors as composite influences on skin health are only included where the impact of humidity on the skin is also explored in isolation of other environmental factors. A formal systematic review was not feasible for this topic due to the heterogeneity of the available research. Epidemiological studies indicated an increase in eczema with low internal (indoors) humidity and an increase in eczema with external high humidity. Other studies suggest that symptoms of dry skin appear with low humidity internal air-conditioned environments. Murine studies determined that low humidity caused a number of changes in the skin, including the impairment of the desquamation process. Studies in humans demonstrated a reduction in transepidermal water loss (TEWL) (a measure of the integrity of the skin's barrier function) with low humidity, alterations in the water content in the stratum corneum, decreased skin elasticity and increased roughness. Intervention with a humidifying mist increased the water content of the stratum corneum. Conversely, there is some evidence that low humidity conditions can actually improve the barrier function of the skin. Ambient relative humidity has an impact on a range of parameters involved in skin health but the literature is inconclusive. Further
In vivo skin penetration of macromolecules in irritant contact dermatitis.
Abdel-Mottaleb, Mona M A; Lamprecht, Alf
2016-12-30
Recently, a selective preferential accumulation of polymeric nanoparticles (in the size range around 100nm) has been observed in the follicular system of dermatitis skin. The present investigation aimed at clearly investigating the effect of irritant contact dermatitis on the barrier permeability for colloidal systems below this size range, namely quantum dots and hydrophilic macromolecules. Irritant dermatitis was induced in mice and the penetrability of quantum dots (5nm) and hydrophilic dextran molecules has been tracked in both healthy and inflamed skin using confocal laser scanning microscopy. The selective accumulation of the quantum dots was clearly observed in inflamed skin while hydrophilic dextran behaved similarly in both healthy and inflamed skin. The therapeutic potential for the transdermal delivery of peptide drugs through inflamed skin has been also tested in rats. Results revealed that the transdermal permeation of insulin and calcitonin was not significantly enhanced in dermatitis compared to healthy skin. On the other side, permeation through stripped skin was significantly higher. However, the effect was limited and shorter compared to the SC injection where t min was 0.5h and 2h with a 70% and 46% reduction in blood glucose levels for the stripped skin and the SC injection respectively. Similarly, t min was 4h and 8h with area under the curve of 161±65% and 350±97% for the stripped skin and the SC injection respectively. In conclusion, the changes in skin permeability accompanied with skin inflammation did not affect its permeability to peptide drugs. Our findings also underline that experiments with the tape stripped skin model as a surrogate for inflamed skin can risk misleading conclusions due to significant difference of skin permeability between the tape stripped skin and inflamed skin. Copyright © 2016 Elsevier B.V. All rights reserved.
Epidermal hydration levels in rosacea patients improve after minocycline therapy.
LENUS (Irish Health Repository)
Ní Raghallaigh, S
2013-12-06
Patients with rosacea frequently report increased skin sensitivity, with features suggestive of an abnormal stratum corneum (SC) permeability barrier. Sebum, pH and hydration levels influence epidermal homeostasis. The correlation of the change in these parameters with clinically effective treatment has not been previously analysed.
Directory of Open Access Journals (Sweden)
Hinda Dabboue
2015-01-01
Full Text Available For most xenobiotics, the rates of percutaneous absorption are limited by diffusion through the horny layer of skin. However, percutaneous absorption of chemicals may seriously increase when the skin is damaged. The aim of this work was to develop an in vitro representative model of mechanically damaged skins. The epidermal barrier was examined following exposure to a razor, a rotating brush, and a microneedle system in comparison to tape-stripping which acted as a reference. Excised full-thickness skins were mounted on a diffusion chamber in order to evaluate the effect of injuries and to mimic physiological conditions. The transepidermal water loss (TEWL was greatly increased when the barrier function was compromised. Measurements were made for all the damaged biopsies and observed histologically by microscopy. On human and porcine skins, the tape-stripping application (0 to 40 times showed a proportional increase in TEWL which highlights the destruction of the stratum corneum. Similar results were obtained for all cosmetic instruments. This is reflected in our study by the nonsignificant difference of the mean TEWL scores between 30 strips and mechanical damage. For a specific appreciation, damaged skins were then selected to qualitatively evaluate the absorption of a chlorogenic acid solution using fluorescence microscopy.
Infrequent alterations of the P53 gene in rat skin cancers induced by ionising-radiation
International Nuclear Information System (INIS)
Jin, Y.; Burns, F.J.; Garte, S.J.; Hosselet, S.; New York Univ., NY
1996-01-01
Radiation carcinogenesis almost certainly involves multiple genetic alterations. Identification of such genetic alterations would provide information to help understand better the molecular mechanism or radiation carcinogenesis. The energy released by ionizing radiation has the potential to produce DNA strand breaks, major gene deletions or rearrangements, and other base damages. Alterations of the p53 gene, a common tumour suppressor gene altered in human cancers, were examined in radiation-induced rat skin cancers. Genomic DNA from a total of 33rat skin cancers induced by ionizing radiation was examined by Southern blot hybridization for abnormal restriction fragment patterns in the p53 gene. A abnormal p53 restriction pattern was found in one of 16 cancers induced by electron radiation and in one of nine cancers induced by neon ions. The genomic DNA from representative cancers, including the two with an abnormal restriction pattern was further examined by polymerase chain reaction amplification and direct sequencing in exons 5-8 of the p53 gene. The results showed that one restriction fragment length polymorphism (RFLP)-positive cancer induced by electron radiation had a partial gene deletion which was defined approximately between exons 2-8, while none of the other cancers showed sequence changes. Our results indicate that the alterations in the critical binding region of the p53 gene are infrequent in rat skin cancers induced by either electron or neon ion radiation. (Author)
Impacts of chemical enhancers on skin permeation and deposition of terbinafine.
Erdal, Meryem Sedef; Peköz, Ayca Yıldız; Aksu, Buket; Araman, Ahmet
2014-08-01
The addition of chemical enhancers into formulations is the most commonly employed approach to overcome the skin barrier. The objective of this work was to evaluate the effect of vehicle and chemical enhancers on the skin permeation and accumulation of terbinafine, an allylamine antifungal drug. Terbinafine (1% w/w) was formulated as a Carbopol 934 P gel formulation in presence and absence of three chemical enhancers, nerolidol, dl-limonene and urea. Terbinafine distribution and deposition in stratum corneum (SC) and skin following 8-h ex vivo permeation study was determined using a sequential tape stripping procedure. The conformational order of SC lipids was investigated by ATR-FTIR spectroscopy. Nerolidol containing gel formulation produced significantly higher enhancement in terbinafine permeation through skin and its skin accumulation was increased. ATR-FTIR results showed enhancer induced lipid bilayer disruption in SC. Urea resulted in enhanced permeation of terbinafine across the skin and a balanced distribution to the SC was achieved. But, dl-limonene could not minimize the accumulation of terbinafine in the upper SC. Nerolidol dramatically improved the skin permeation and deposition of terbinafine in the skin that might help to optimize targeting of the drug to the epidermal sites as required for both of superficial and deep cutaneous fungal infections.
Skin Cancer Concerns in People of Color: Risk Factors and Prevention
Gupta, Alpana K; Bharadwaj, Mausumi; Mehrotra, Ravi
2016-01-01
Background: Though people of color (POC) are less likely to become afflicted with skin cancer, they are much more likely to die from it due to delay in detection or presentation. Very often, skin cancer is diagnosed at a more advanced stage in POC, making treatment difficult. The purpose of this research was to improve awareness regarding skin cancers in people of color by providing recommendations to clinicians and the general public for early detection and photo protection preventive measures. Methods: Data on different types of skin cancers were presented to POC. Due to limited research, there are few resources providing insights for evaluating darkly pigmented lesions in POC. Diagnostic features for different types of skin cancers were recorded and various possible risk factors were considered. Results: This study provided directions for the prevention and early detection of skin cancer in POC based on a comprehensive review of available data. Conclusions: The increased morbidity and mortality rate associated with skin cancer in POC is due to lack of awareness, diagnosis at a more advanced stage and socioeconomic barriers hindering access to care. Raising public health concerns for skin cancer prevention strategies for all people, regardless of ethnic background and socioeconomic status, is the key to timely diagnosis and treatment. PMID:28125871
A first vascularized skin equivalent as an alternative to animal experimentation.
Groeber, Florian; Engelhardt, Lisa; Lange, Julia; Kurdyn, Szymon; Schmid, Freia F; Rücker, Christoph; Mielke, Stephan; Walles, Heike; Hansmann, Jan
2016-01-01
Tissue-engineered skin equivalents mimic key aspects of the human skin, and can thus be employed as wound coverage for large skin defects or as in vitro test systems as an alternative to animal models. However, current skin equivalents lack a functional vasculature limiting clinical and research applications. This study demonstrates the generation of a vascularized skin equivalent with a perfused vascular network by combining a biological vascularized scaffold (BioVaSc) based on a decellularized segment of a porcine jejunum and a tailored bioreactor system. Briefly, the BioVaSc was seeded with human fibroblasts, keratinocytes, and human microvascular endothelial cells. After 14 days at the air-liquid interface, hematoxylin & eosin and immunohistological staining revealed a specific histological architecture representative of the human dermis and epidermis including a papillary-like architecture at the dermal-epidermal-junction. The formation of the skin barrier was measured non-destructively using impedance spectroscopy. Additionally, endothelial cells lined the walls of the formed vessels that could be perfused with a physiological volume flow. Due to the presence of a complex in-vivo-like vasculature, the here shown skin equivalent has the potential for skin grafting and represents a sophisticated in vitro model for dermatological research.
Creation of Nepal's First Skin Bank: Challenges and Outcomes.
Cai, Lawrence; Long, Chao; Karki, Bishal; Nakarmi, Kiran; Iqbal, Adnan; Casertano, Michele; Anderson, Sara; Patell, James; Chang, James; Rai, Shankar Man
2017-11-01
In Nepal, burn trauma causes more than 55,000 injuries each year. Burn-related mortality is high in Nepal, in part due to lack of allograft, leading to high infection rates. To address this challenge, our collaboration between Kirtipur Hospital, America Nepal Medical Foundation, Stanford University, and ReSurge International established Nepal's first skin bank. We identified 3 major tasks to create a sustainable skin banking program: 1) identify and acquire the equipment and personnel needed to collect, process, store, and graft cadaveric skin for burn injuries; 2) develop safe donation protocols and documentation tools that remain feasible for low-resource settings; and 3) develop a long-term awareness program to educate the Nepali people on skin donation, a previously foreign concept. Kirtipur Hospital acquired the necessary equipment and materials for the skin bank through a combination of local and international fundraising efforts. Existing U.S. skin banking protocols were adapted for the Nepali setting and piloted on potential patients, donors, and physicians. For the first time in the hospital's history, patients with > 40% total body surface area burns were successfully treated with extensive allografts. It is feasible to create a skin bank in a country with no tradition of allograft skin use. Long-term sustainability now depends on spreading awareness and education in the Kathmandu Valley to overcome religious and cultural barriers that have hindered donor recruitment. Our low-cost and high-impact skin bank provides a model to expand this system to other hospitals both within Nepal and beyond.
Skin healing and scale regeneration in fed and unfed sea bream, Sparus auratus
Directory of Open Access Journals (Sweden)
Canario Adelino VM
2011-10-01
Full Text Available Abstract Background Fish scales are an important reservoir of calcium and phosphorus and together with the skin function as an integrated barrier against environmental changes and external aggressors. Histological studies have revealed that the skin and scales regenerate rapidly in fish when they are lost or damaged. In the present manuscript the histological and molecular changes underlying skin and scale regeneration in fed and fasted sea bream (Sparus auratus were studied using a microarray 3 and 7 days after scale removal to provide a comprehensive molecular understanding of the early stages of these processes. Results Histological analysis of skin/scales revealed 3 days after scale removal re-epithelisation and formation of the scale pocket had occurred and 53 and 109 genes showed significant up or down-regulation, respectively. Genes significantly up-regulated were involved in cell cycle regulation, cell proliferation and adhesion, immune response and antioxidant activities. 7 days after scale removal a thin regenerated scale was visible and only minor changes in gene expression occurred. In animals that were fasted to deplete mineral availability the expression profiles centred on maintaining energy homeostasis. The utilisation of fasting as a treatment emphasised the competing whole animal physiological requirements with regard to barrier repair, infection control and energy homeostasis. Conclusions The identification of numerous genes involved in the mitotic checkpoint and cell proliferation indicate that the experimental procedure may be useful for understanding cell proliferation and control in vertebrates within the context of the whole animal physiology. In response to skin damage genes of immune surveillance were up-regulated along with others involved in tissue regeneration required to rapidly re-establish barrier function. Additionally, candidate fish genes were identified that may be involved in cytoskeletal re
A UV-Independent Topical Small-Molecule Approach for Melanin Production in Human Skin
Directory of Open Access Journals (Sweden)
Nisma Mujahid
2017-06-01
Full Text Available The presence of dark melanin (eumelanin within human epidermis represents one of the strongest predictors of low skin cancer risk. Topical rescue of eumelanin synthesis, previously achieved in “redhaired” Mc1r-deficient mice, demonstrated significant protection against UV damage. However, application of a topical strategy for human skin pigmentation has not been achieved, largely due to the greater barrier function of human epidermis. Salt-inducible kinase (SIK has been demonstrated to regulate MITF, the master regulator of pigment gene expression, through its effects on CRTC and CREB activity. Here, we describe the development of small-molecule SIK inhibitors that were optimized for human skin penetration, resulting in MITF upregulation and induction of melanogenesis. When topically applied, pigment production was induced in Mc1r-deficient mice and normal human skin. These findings demonstrate a realistic pathway toward UV-independent topical modulation of human skin pigmentation, potentially impacting UV protection and skin cancer risk.
A UV-Independent Topical Small-Molecule Approach for Melanin Production in Human Skin.
Mujahid, Nisma; Liang, Yanke; Murakami, Ryo; Choi, Hwan Geun; Dobry, Allison S; Wang, Jinhua; Suita, Yusuke; Weng, Qing Yu; Allouche, Jennifer; Kemeny, Lajos V; Hermann, Andrea L; Roider, Elisabeth M; Gray, Nathanael S; Fisher, David E
2017-06-13
The presence of dark melanin (eumelanin) within human epidermis represents one of the strongest predictors of low skin cancer risk. Topical rescue of eumelanin synthesis, previously achieved in "redhaired" Mc1r-deficient mice, demonstrated significant protection against UV damage. However, application of a topical strategy for human skin pigmentation has not been achieved, largely due to the greater barrier function of human epidermis. Salt-inducible kinase (SIK) has been demonstrated to regulate MITF, the master regulator of pigment gene expression, through its effects on CRTC and CREB activity. Here, we describe the development of small-molecule SIK inhibitors that were optimized for human skin penetration, resulting in MITF upregulation and induction of melanogenesis. When topically applied, pigment production was induced in Mc1r-deficient mice and normal human skin. These findings demonstrate a realistic pathway toward UV-independent topical modulation of human skin pigmentation, potentially impacting UV protection and skin cancer risk. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Szczepanik, Marcin P; Wilkołek, Piotr M; Adamek, Łukasz R; Zając, Marcin; Gołyński, Marcin; Sitkowski, Wiesław; Taszkun, Iwona
2018-02-01
Evaluation of the severity of clinical signs of cats with allergic skin diseases has used two scoring systems: Scoring Feline Allergic Dermatitis (SCORFAD) and the Feline Extent and Severity Index (FeDESI). The integrity of the cutaneous barrier can also be evaluated by measuring skin hydration. A correlation between the clinical score and skin hydration has been observed in humans and dogs with atopic dermatitis (AD). To demonstrate a correlation between the clinical score and skin hydration of cats affected with presumed AD. European short hair cats (n = 18): 11 females and seven males with a confirmed diagnosis of AD. SCORFAD and FeDESI scores were calculated and the measurements of skin hydration were assessed from seven body sites using corneometry. The correlation between the SCORFAD and FeDESI systems and skin hydration of each site, and the average skin hydration was calculated. There was a positive correlation between the SCORFAD score and skin hydration for the axilla, thorax and forelimb; for FeDESI and axilla and lumbar sites. There was a negative correlation between the FeDESI and skin hydration for the pinna (r = -0.47). Measurements of skin hydration could be a useful tool for the evaluation of allergic cats. There is limited evidence of any useful correlation between clinical scoring systems and measurements of hydration. The pinna may be a suitable region for the assessment of skin barrier function in normal and allergic cats. © 2017 ESVD and ACVD.
Less skin irritation from alcohol-based disinfectant than from detergent used for hand disinfection
DEFF Research Database (Denmark)
Pedersen, L K; Held, E; Johansen, J D
2005-01-01
and forearms of 17 healthy volunteers. A control area was included. After 4 weeks an SLS patch was applied to each area. Irritant reactions were quantified with a visual score recording and measurements of transepidermal water loss (TEWL) and skin colour were performed on days 1, 5, 11, 38 and 40. RESULTS...... was found on the disinfectant-treated area compared with the control area and detergent area, and a similar trend was found for TEWL, although it was not statistically significant. CONCLUSION: Alcohol-based disinfectant caused less visible skin irritation and less skin barrier disruption than the use...
Proteomic profiling reveals candidate markers for arsenic-induced skin keratosis.
Guo, Zhiling; Hu, Qin; Tian, Jijing; Yan, Li; Jing, Chuanyong; Xie, Heidi Qunhui; Bao, Wenjun; Rice, Robert H; Zhao, Bin; Jiang, Guibin
2016-11-01
Proteomics technology is an attractive biomarker candidate discovery tool that can be applied to study large sets of biological molecules. To identify novel biomarkers and molecular targets in arsenic-induced skin lesions, we have determined the protein profile of arsenic-affected human epidermal stratum corneum by shotgun proteomics. Samples of palm and foot sole from healthy subjects were analyzed, demonstrating similar protein patterns in palm and sole. Samples were collected from the palms of subjects with arsenic keratosis (lesional and adjacent non-lesional samples) and arsenic-exposed subjects without lesions (normal). Samples from non-exposed healthy individuals served as controls. We found that three proteins in arsenic-exposed lesional epidermis were consistently distinguishably expressed from the unaffected epidermis. One of these proteins, the cadherin-like transmembrane glycoprotein, desmoglein 1 (DSG1) was suppressed. Down-regulation of DSG1 may lead to reduced cell-cell adhesion, resulting in abnormal epidermal differentiation. The expression of keratin 6c (KRT6C) and fatty acid binding protein 5 (FABP5) were significantly increased. FABP5 is an intracellular lipid chaperone that plays an essential role in fatty acid metabolism in human skin. This raises a possibility that overexpression of FABP5 may affect the proliferation or differentiation of keratinocytes by altering lipid metabolism. KRT6C is a constituent of the cytoskeleton that maintains epidermal integrity and cohesion. Abnormal expression of KRT6C may affect its structural role in the epidermis. Our findings suggest an important approach for future studies of arsenic-mediated toxicity and skin cancer, where certain proteins may represent useful biomarkers of early diagnoses in high-risk populations and hopefully new treatment targets. Further studies are required to understand the biological role of these markers in skin pathogenesis from arsenic exposure. Copyright © 2016 Elsevier Ltd
Market trends in baby skin care products and implications for clinical practice.
Gao, Xiang; Simpson, Eric L
2014-01-01
Although the U.S. pediatric skin care market is a $1.7 billion industry, little is known regarding the usage pattern of skin care products in very young children. We have begun to recognize that common over-the-counter skin care products may have positive or negative effects on skin barrier function. Thus, knowing what and how skin care products are used early in life is important. The goal of the current study was to better understand skin care product use in the United States using market research data. We found that the prevalence of use was greater than 50% for all skin care product categories and age groups. Premoistened cleansing wipes and cloths were the most frequently used product, followed by baby oil and lotion and body and baby powder. Baby bath and shampoo products were used at least five times per week per household, and caregivers generally preferred products that were fragrance-free and made for sensitive skin. Lower-income households reported a higher frequency of product use and were less likely to purchase fragrance-free products or ones that were made for sensitive skin. Our findings suggest that the prevalence of pediatric skin care product use is high and conflicts with current recommended skin care guidelines. Product use and preferences may also vary according to race and ethnicity and household income level. © 2014 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Mohadeseh Adeli
2016-07-01
structures and barriers associated with skin-to-skin contact.
International Nuclear Information System (INIS)
Verna, B.J.
1993-01-01
This article deals with problems associated with a thermal barrier material called Thermo-Lag 330. Typically in nuclear applications this material is used to provide either 1 hour (1/2 inch thick) or 3 hour (1 inch thick) barriers to prevent the spread of fires between redundant safety systems, and to protect cable trays and conduit. The article reviews concerns within the nuclear industry as to the proper handling of the material, how to interpret the data available on the material, the apparant conflicting assessments of the material when tested by different groups, etc. Research is ongoing on the suitability of the material, but the article points out that the manufacturer feels it should be installed by properly trained installers, the joints sealed with a grouting material, properly bundled to maintain its integrity, have a complete stress skin, and not be walked on after installation in order to function properly
Alkylglycerol Derivatives, a New Class of Skin Penetration Modulators
Directory of Open Access Journals (Sweden)
Sergio Alberto Bernal-Chávez
2017-01-01
Full Text Available The absorption modulating activity of two alkylglycerol derivatives (batyl and chimyl alcohol on skin barrier properties was evaluated. Biophysical tests such as transepidermal water loss (TEWL and attenuated total reflectance–Fourier transform infrared (ATR-FTIR spectroscopy, as well as in vitro skin permeation studies, were performed in order to determine the effect of these compounds as chemical absorption modulators. Four drugs were used as models: three NSAIDS (diclofenac, naproxen, and piroxicam and glycyrrhizic acid. The results showed that treatment of the skin with alkylglycerols caused (i a reduction on the amount of drug permeated; (ii a reduction in TEWL; and (iii changes in the ATR-FTIR peaks of stratum corneum lipids, indicative of a more ordered structure. All of these findings confirm that alkyl glycerols have an absorption retarding effect on the drugs tested. Such effects are expected to give rise to important applications in the pharmaceutical and cosmetic sectors, in cases where it is desirable for the drug to remain in the superficial layers of the skin to achieve a local effect.
Efficacy and Tolerability of a Facial Serum for Fine Lines, Wrinkles, and Photodamaged Skin
Mccall-Perez, Fred; Stephens, Thomas J.; Herndon, James H.
2011-01-01
Background: Dermatology visits for the prevention and treatment of aging skin are rapidly increasing. The clinical sequelae including wrinkling, pigmentary changes, roughness, laxity, and telangiectasia can all result in the appearance of aging skin, impacting quality of life. A facial serum was developed with ingredients associated with an improvement in the appearance of fine lines and wrinkles and increase in stratum corneum barrier function. Patients were instructed to use a gentle wash b...
In-vivo dynamic characterization of microneedle skin penetration using optical coherence tomography
Enfield, Joey; O'Connell, Marie-Louise; Lawlor, Kate; Jonathan, Enock; O'Mahony, Conor; Leahy, Martin
2010-07-01
The use of microneedles as a method of circumventing the barrier properties of the stratum corneum is receiving much attention. Although skin disruption technologies and subsequent transdermal diffusion rates are being extensively studied, no accurate data on depth and closure kinetics of microneedle-induced skin pores are available, primarily due to the cumbersome techniques currently required for skin analysis. We report on the first use of optical coherence tomography technology to image microneedle penetration in real time and in vivo. We show that optical coherence tomography (OCT) can be used to painlessly measure stratum corneum and epidermis thickness, as well as microneedle penetration depth after microneedle insertion. Since OCT is a real-time, in-vivo, nondestructive technique, we also analyze skin healing characteristics and present quantitative data on micropore closure rate. Two locations (the volar forearm and dorsal aspect of the fingertip) have been assessed as suitable candidates for microneedle administration. The results illustrate the applicability of OCT analysis as a tool for microneedle-related skin characterization.
Directory of Open Access Journals (Sweden)
Akhyani Maryam
2007-01-01
Full Text Available The ectodermal dysplasias are a heterogeneous group of disorders with primary defect in hair, teeth, nail and sweat gland function. Numerous types have been described and several classifications exist. Here, we present a patient with ectodermal dysplasia with alopecia, dysplastic nails, hypohidrosis, sensorineural deafness, palmoplantar keratoderma, abnormal teeth and dry skin. To our knowledge, combination of all these features in ectodermal dysplasia has not been reported in the past. The etiology is unknown, but consanguinity of parents points to an autosomal recessive inheritance.
DEFF Research Database (Denmark)
Fullerton, A; Gammelgaard, Bente; Avnstorp, C
1993-01-01
The amount of chromium found in human skin after in vitro application of cement suspensions on full-thickness human skin in diffusion cells was investigated. Cement suspensions made from ordinary Portland cement or Portland cement with the chromate reduced with added ferrous sulphate were used....... The cement suspensions were either applied on the skin surface under occlusion for 48 h or applied repeatedly every 24 h for 96 h. No statistically significant difference in chromium content of skin layers between skin exposed to ordinary Portland cement, skin exposed to cement with added ferrous sulphate...... and unexposed skin was observed, despite a more permeable skin barrier at the alkaline pH of the cement suspensions, i.e., pH 12.5. Increased chromium levels in epidermis and dermis were seen when ordinary Portland cement was applied as a suspension with added sodium sulphate (20%) on the skin surface for 96 h...
Polarization-Sensitive Hyperspectral Imaging in vivo: A Multimode Dermoscope for Skin Analysis
Vasefi, Fartash; MacKinnon, Nicholas; Saager, Rolf B.; Durkin, Anthony J.; Chave, Robert; Lindsley, Erik H.; Farkas, Daniel L.
2014-05-01
Attempts to understand the changes in the structure and physiology of human skin abnormalities by non-invasive optical imaging are aided by spectroscopic methods that quantify, at the molecular level, variations in tissue oxygenation and melanin distribution. However, current commercial and research systems to map hemoglobin and melanin do not correlate well with pathology for pigmented lesions or darker skin. We developed a multimode dermoscope that combines polarization and hyperspectral imaging with an efficient analytical model to map the distribution of specific skin bio-molecules. This corrects for the melanin-hemoglobin misestimation common to other systems, without resorting to complex and computationally intensive tissue optical models. For this system's proof of concept, human skin measurements on melanocytic nevus, vitiligo, and venous occlusion conditions were performed in volunteers. The resulting molecular distribution maps matched physiological and anatomical expectations, confirming a technologic approach that can be applied to next generation dermoscopes and having biological plausibility that is likely to appeal to dermatologists.
The rational design of biomimetic skin barrier lipid formulations using biophysical methods.
Bulsara, P A; Varlashkin, P; Dickens, J; Moore, D J; Rawlings, A V; Clarke, M J
2017-04-01
The focus of this communication was to study phospholipid-structured emulsions whose phase behaviour is modified with monoalkyl fatty amphiphiles. Ideally, these systems would mimic key physical and structural attributes observed in human stratum corneum (SC) so that they better alleviate xerotic skin conditions. Phosphatidylcholine-structured emulsions were prepared, and their phase behaviour modified with monoalkyl fatty amphiphiles. The effect of molecular volume, acyl chain length and head-group interactions was studied using a combination of physical methods. Water vapour transmission rate (WVTR) was used as a primary test to assess occlusive character. Changes in the vibrational modes observed in Fourier transform infrared (FTIR) spectroscopy and bilayer spacing measured by X-ray diffraction (XRD) were then applied to elucidate the lateral and lamellar microstructural characteristics in the systems. Water vapour transmission rate demonstrated that as the phosphatidylcholine acyl chain length increased from C14, to C18, to C22, there was a corresponding increase in occlusive character. The addition of monoalkyl fatty amphiphiles such as behenic acid, behenyl alcohol or cetostearyl alcohol to a base formulation incorporating dipalmitoyl and distearoylphosphatidylcholine (C18) was seen to further increase barrier characteristics of the emulsions. FTIR methods used to probe lipid-chain conformational ordering demonstrated that as phosphatidylcholine acyl chain lengths increased, there was a corresponding improvement in acyl chain ordering, with an increase in thermal transition temperatures. The addition of a monoalkyl fatty amphiphile resulted in conformational order and thermal transition temperature improvements trending towards those observed in stratum corneum. FTIR also demonstrated that systems containing behenic acid or behenyl alcohol exhibited features associated with orthorhombic character. X-ray diffraction data showed that addition of monoalkyl fatty
Factors of skin decontamination as derived from experimental studies
International Nuclear Information System (INIS)
Pratzel, H.G.
1992-01-01
The processes occuring during radioactive contamination of the skin are reminiscent of those observed in connection with skin penetration by drugs. Explained are the laws determining the penetration of substances through the skin surface, their spreading between the corneocystes into the deeper layers of the stratum corneum and their final concentrations, the decrease of which with the depth of the corneal layer can be described by an exponential curve. The extent to which the penetrating substances are transferred from the solvent to the corneal layer's lipid phase depends on their relative solubility. The intercellular lipid layer in the lower third of the stratum corneum creates the greatest obstacle to permeation through the skin. The lipid content in this part of the corneal layer is seen to be inversely proportional to the degree of natural barrier dysfunction and, thus, to permeation. For measurements of skin permeation, experiments were performed in young pigs using aqueous radioactive solutions. Part of the substances penetrated into the organism through the follicles, where the corneal layer is more permeable. In cases of very hairy skin the amount of substance deposited as a result of additional follicle penetration is seen to be higher. The greatest proportion of radioactivity by far is taken up into the stratum corneum, while only little is seen to reach the follicles and even less the deeper layers of the skin. Decontamination of the skin cannot be carried out for areas beyond the boundary of the corneal layer. (orig./HP) [de
Leite-Silva, Vânia R; Liu, David C; Sanchez, Washington Y; Studier, Hauke; Mohammed, Yousuf H; Holmes, Amy; Becker, Wolfgang; Grice, Jeffrey E; Benson, Heather Ae; Roberts, Michael S
2016-05-01
We assessed the effects of flexing and massage on human skin penetration and toxicity of topically applied coated and uncoated zinc oxide nanoparticles (˜75 nm) in vivo. Noninvasive multiphoton tomography with fluorescence lifetime imaging was used to evaluate the penetration of nanoparticles through the skin barrier and cellular apoptosis in the viable epidermis. All nanoparticles applied to skin with flexing and massage were retained in the stratum corneum or skin furrows. No significant penetration into the viable epidermis was seen and no cellular toxicity was detected. Exposure of normal in vivo human skin to these nanoparticles under common in-use conditions of flexing or massage is not associated with significant adverse events.
Hydroquinone neuropathy following use of skin bleaching creams: case report.
Karamagi, C; Owino, E; Katabira, E T
2001-04-01
A 30-year old black woman presented with gradual onset of weakness of the legs associated with burning sensation in the feet for two months. She had been using two hydroquinone based skin bleaching creams (MGC by M. G. C. International, MEKAKO by Anglo Fabrics BOLTON Ltd) for about four years. Her BP was 80/40 mm Hg supine with un-recordable diastolic pressure on standing. She had decreased power (Grade 3/5), loss of deep tendon reflexes and impairment of deep sensation in the lower limbs. A complete blood count, urinalysis, serum electrolytes, serum creatinine and uric acid were all normal. Oral GTT, VDRL and brucella tests were negative. Chest and abdominal radiographs did not show any abnormalities. A diagnosis of peripheral neuropathy with autonomic neuropathy possibly due to hydroquinone toxicity was made and she was advised to stop using hydroquinone based skin bleaching creams. Four months later she was asymptomatic, her BP was 120/80 mmHg supine and standing, and neurological examination was normal. The case raises the question of whether hydroquinone based skin bleaching creams could be a cause of peripheral neuropathy and underscores the need for research on hydroquinone based skin bleaching creams and neuropathy particularly in black women involved in the sale and/or use of skin bleaching creams.
Time-resolved fluorescence microscopy (FLIM) as an analytical tool in skin nanomedicine.
Alexiev, Ulrike; Volz, Pierre; Boreham, Alexander; Brodwolf, Robert
2017-07-01
The emerging field of nanomedicine provides new approaches for the diagnosis and treatment of diseases, for symptom relief, and for monitoring of disease progression. Topical application of drug-loaded nanoparticles for the treatment of skin disorders is a promising strategy to overcome the stratum corneum, the upper layer of the skin, which represents an effective physical and biochemical barrier. The understanding of drug penetration into skin and enhanced penetration into skin facilitated by nanocarriers requires analytical tools that ideally allow to visualize the skin, its morphology, the drug carriers, drugs, their transport across the skin and possible interactions, as well as effects of the nanocarriers within the different skin layers. Here, we review some recent developments in the field of fluorescence microscopy, namely Fluorescence Lifetime Imaging Microscopy (FLIM)), for improved characterization of nanocarriers, their interactions and penetration into skin. In particular, FLIM allows for the discrimination of target molecules, e.g. fluorescently tagged nanocarriers, against the autofluorescent tissue background and, due to the environmental sensitivity of the fluorescence lifetime, also offers insights into the local environment of the nanoparticle and its interactions with other biomolecules. Thus, FLIM shows the potential to overcome several limits of intensity based microscopy. Copyright © 2017 Elsevier B.V. All rights reserved.
Sabetkish, Nastaran; Sabetkish, Shabnam; Kajbafzadeh, Abdol-Mohammad
2018-01-26
To assess the role of high-barrier plastic wrap in reducing the number and size of polyps, as well as decreasing the inflammation and allergic reactions in exstrophy cases, and to compare the results with the application of low-barrier wrap. Eight patients with bladder exstrophy-epispadias complex (BEEC) that had used a low density polyethylene (LDPE) wrap for coverage of the exposed polypoid bladder in preoperative care management were referred. The main complaint of their parents was increase in size and number of polyps. After a period of 2 months using the same wrap and observing the increasing pattern in size of polyps, these patients were recommended to use a high-barrier wrap which is made of polyvinylidene chloride (PVdC), until closure. Patients were monitored for the number and size of polyps before and after the change of barriers. The incidence of para-exstrophy skin infection/inflammation and skin allergy were assessed. Biopsies were taken from the polyps to identify histopathological characteristics of the exposed polyps. The high barrier wrap was applied for a mean ± SD duration of 12±2.1 months. Polyps' size and number decreased after 12 months. No allergic reaction was detected in patients after the usage of PVdC; three patients suffered from low-grade skin allergy when LDPE was applied. Also, pre-malignant changes were observed in none of the patients in histopathological examination after the application of PVdC. Polyps' size and number and skin allergy may significantly decrease with the use of a high-barrier wrap. Certain PVdC wraps with more integrity and less evaporative permeability may be more "exstrophy-friendly". Copyright® by the International Brazilian Journal of Urology.
Assessing the in vivo impact of a gel sanitizer on the epidermal "barrier" dynamics
Henrique Silva; Sara Aguiar Silva; Hugo Ferreira; L. Monteiro Rodrigues
2015-01-01
Disease prevention and control depend on hand washing, in particular during epidemic surges (e.g. flu). The use of alcohol-based hand sanitizers is strongly recommended due to its high germicide effectiveness. However, its impact on skin physiology, especially on the barrier function, has not been determined, although most of the formulations include different humectants. This study evaluates the impact of a commercially available formulation on in vivo epidermal barrier dynamics. 13 young ad...
Tanaka, Akane; Jung, Kyungsook; Matsuda, Akira; Jang, Hyosun; Kajiwara, Naoki; Amagai, Yosuke; Oida, Kumiko; Ahn, Ginnae; Ohmori, Keitaro; Kang, Kyung-goo; Matsuda, Hiroshi
2013-03-01
Drinking water is an important nutrient for human health. The mineral ingredients included in drinking water may affect the physical condition of people. Various kinds of natural water are in circulation as bottled water in developed countries; however, its influence on clinical conditions of patients with certain diseases has not been fully evaluated. In this study, effects of the natural groundwater from Jeju Island on clinical symptoms and skin barrier function in atopic dermatitis (AD) were evaluated. NC/Tnd mice, a model for human AD, with moderate to severe dermatitis were used. Mice were given different natural groundwater or tap water for 8 weeks from 4 weeks of age. Clinical skin severity scores were recorded every week. Scratching analysis and measurement of transepidermal water loss were performed every other week. The pathological condition of the dorsal skin was evaluated histologically. Real-time polymerase chain reaction analysis was performed for cytokine expression in the affected skin. The epidermal hyperplasia and allergic inflammation were reduced in atopic mice supplied with Jeju groundwater when compared to those supplied with tap water or other kinds of natural groundwater. The increase in scratching behavior with the aggravation of clinical severity of dermatitis was favorably controlled. Moreover, transepidermal water loss that reflects skin barrier function was recovered. The early inflammation and hypersensitivity in the atopic skin was alleviated in mice supplied with Jeju groundwater, suggesting its profitable potential on the daily care of patients with skin troubles including AD. © 2013 Japanese Dermatological Association.
Hönzke, Stefan; Wallmeyer, Leonie; Ostrowski, Anja; Radbruch, Moritz; Mundhenk, Lars; Schäfer-Korting, Monika; Hedtrich, Sarah
2016-03-01
Atopic dermatitis is a chronic skin condition with complex etiology. It is characterized by skin barrier defects and T helper type 2 (Th2)-polarized inflammation. Although mutations in the filaggrin gene are known to be prominent genetic risk factors for the development of atopic dermatitis, the interdependency between these and an altered cytokine milieu is not fully understood. In this study, we evaluated the direct effects of filaggrin deficiency on the cornified envelope, tight junction proteins, and innate immune response, and report the effects of Th2 cytokines in normal and filaggrin-deficient skin equivalents. Supplementation with IL-4 and IL-13 led to distinct histologic changes and significantly increased skin surface pH, both of which were enhanced in filaggrin knockdown skin equivalents. We detected a compensatory up-regulation of involucrin and occludin in filaggrin-deficient skin that was dramatically disturbed when simultaneous inflammation occurred. Furthermore, we found that a lack of filaggrin triggered an up-regulation of human ?-defensin 2 via an unknown mechanism, which was abolished by Th2 cytokine supplementation. Taken together, these results indicate that defects in the epidermal barrier, skin permeability, and cutaneous innate immune response are not primarily linked to filaggrin deficiency but are rather secondarily induced by Th2 inflammation. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Praveen Anand
2017-09-01
Full Text Available BackgroundTrench foot, or non-freezing cold injury (NFCI, results from cold exposure of sufficient severity and duration above freezing point, with consequent sensory and vascular abnormalities which may persist for years. Based on observations of Trench foot in World War II, the condition was described as a vaso-neuropathy. While some reports have documented nerve damage after extreme cold exposure, sensory nerve fibres and vasculature have not been assessed with recent techniques in NFCI.ObjectiveTo assess patients with chronic sensory symptoms following cold exposure, in order to diagnose any underlying small fibre neuropathy, and provide insight into mechanisms of the persistent pain and cold hypersensitivity.MethodsThirty soldiers with cold exposure and persistent sensory symptoms (>4 months were assessed with quantitative sensory testing, nerve conduction studies, and skin biopsies. Immunohistochemistry was used to assess intraepidermal (IENF and subepidermal (SENF nerve fibres with a range of markers, including the pan-neuronal marker protein gene product 9.5 (PGP 9.5, regenerating fibres with growth-associated protein 43 (GAP43, and nociceptor fibres with transient receptor potential cation channel subfamily V member 1 (TRPV1, sensory neuron-specific receptor (SNSR, and calcitonin gene-related peptide (CGRP. von Willebrand factor (vWF, endothelial nitric oxide synthase (eNOS, and vascular endothelial growth factor (VEGF were used for assessing blood vessels, and transient receptor potential cation channel, subfamily A member 1 (TRPA1 and P2X purinoceptor 7 (P2X7 for keratinocytes, which regulate nociceptors via release of nerve growth factor.ResultsClinical examination showed pinprick sensation was abnormal in the feet of 20 patients (67%, and between 67 and 83% had abnormalities of thermal thresholds to the different modalities. 7 patients (23% showed reduced sensory action potential amplitude of plantar nerves. 27 patients (90% had
International Nuclear Information System (INIS)
Moeller, P.; Myers, W.D.
1984-01-01
The possibility of extending the model used by Moeller and Nix in 1980 to calculate nuclear masses and fission barriers for nuclei throughout the periodic system to include provision for the existence of a neutron skin is studied. The model gives excellent fit to masses and fission barriers and improves predictions of isotopic trends in charge radii
International Nuclear Information System (INIS)
Fieschi, C.; Pozzilli, C.; Bernardi, S.; Bozzao, L.; Lenzi, G.L.; Picozzi, P.; Iannotti, F.; Conforti, P.
1988-01-01
The purpose of the investigation was to elucidate the role of positron emission tomography using 68 Ga-EDTA in the study of blood-brain barrier abnormalities associated with multiple sclerosis. 14 refs.; 1 figure
Stratum corneum cytokines and skin irritation response to sodium lauryl sulfate.
De Jongh, Cindy M; Verberk, Maarten M; Withagen, Carien E T; Jacobs, John J L; Rustemeyer, Thomas; Kezic, Sanja
2006-06-01
Little is known about cytokines involved in chronic irritant contact dermatitis. Individual cytokine profiles might explain at least part of the differences in the individual response to irritation. Our objective was to investigate the relation between baseline stratum corneum (SC) cytokine levels and the skin response to a single and a repeated irritation test. This study also aimed to determine changes in SC cytokine levels after repeated irritation. Transepidermal water loss (TEWL) and erythema were measured in 20 volunteers after single 24-hr exposure to 1% sodium lauryl sulfate (SLS), and during and after repeated exposure to 0.1% SLS over a 3-week period. SC cytokine levels were measured from an unexposed skin site and from the repeatedly exposed site. Interleukin (IL)-1alpha decreased by 30% after repeated exposure, while IL-1RA increased 10-fold and IL-8 increased fourfold. Baseline IL-1RA and IL-8 values were predictors of TEWL and erythema after single exposure (r = 0.55-0.61). 6 subjects showed barrier recovery during repeated exposure. Baseline IL-1RA and IL-8 levels are likely to be indicators of higher skin irritability after single exposure to SLS. Barrier repair in some of the subjects might explain the lack of agreement between the TEWL response after single and repeated irritation.
International guidelines for the in vivo assessment of skin properties in non-clinical settings
DEFF Research Database (Denmark)
Stefaniak, Aleksandr B; Plessis, Johan du; John, Swen M
2013-01-01
position, skin health, time of day), exogenous (hand washing, barrier creams, soaps and detergents, occlusion), environmental (seasonality), and measurement (atmospheric conditions) factors; (ii) report pH measurements results as a difference or percent change (not absolute values) using a measure...
Kendall, Alexandra; Kiezel-Tsugunova, Magdalena; Brownbridge, Luke; Harwood, John L.; Nicolaou, Anna
2017-01-01
Ceramides are important for skin health, with a multitude of species found in both dermis and epidermis. The epidermis contains linoleic acid-Ester-linked Omega-hydroxylated ceramides of 6-Hydroxy-sphingosine, Sphingosine and Phytosphingosine bases (CER[EOH], CER[EOS] and CER[EOP], respectively), that are crucial for the formation of the epidermal barrier, conferring protection from environmental factors and preventing trans-epidermal water loss. Furthermore, a large number of ceramides, deri...
Shining Light on Skin Pigmentation: The Darker and the Brighter Side of Effects of UV Radiation†
Maddodi, Nityanand; Jayanthy, Ashika; Setaluri, Vijayasaradhi
2012-01-01
The term barrier function as applied to human skin often connotes the physical properties of this organ that provide protection from its surrounding environment. This term does not generally include skin pigmentation. However, skin pigmentation, which is the result of melanin produced in melanocytes residing the basal layer of the skin and exported to the keratinocytes in the upper layers, serves equally important protective function. Indeed, changes in skin pigmentation are often the most readily recognized indicators of exposure of skin to damaging agents, especially to natural and artificial radiation in the environment. Several recent studies have shed new light on a) the mechanisms of involved in selective effects of subcomponents of UV radiation on human skin pigmentation and b) the interactive influences between keratinocytes and melanocytes, acting as ‘epidermal melanin unit’, that manifest as changes in skin pigmentation in response to exposure to various forms of radiation. This article provides a concise review of our current understanding of the effects of the non-ionizing solar radiation, at cellular and molecular levels, on human skin pigmentation. PMID:22404235
Skin care practice in German nursing homes: a German-wide cross-sectional study.
Kottner, Jan; Rahn, Yasmin; Blume-Peytavi, Ulrike; Lahmann, Nils
2013-04-01
Due to anatomical and physiological changes in the course of aging and due to increased vulnerability, there are special skin care needs in elderly and care-dependent persons. Little is known about skin care practice in German long-term care facilities. The aim of the study was to gather epidemiological data about skin care practice in German nursing homes. In spring 2012 a German-wide cross sectional study was conducted in 47 nursing homes. Based on standardized data collection sheets. demographics and variables about methods and frequencies of skin cleansing and application of skin care products for 3 552 nursing home residents were collected and analyzed. The variables age, gender and level of care dependency was representative for the group of all German nursing home residents. More than 90% of investigated nursing home residents required skin care assistance. Washing body parts or the whole body were conducted most frequently (89.1%, 95% CI 88.0- 90.1). Skin care leave-on products were used in 91.7% (95% CI 90.7-92.6), whereas there were large variations between individuals. In total, more than 100 brands were used. Skin care practice in multimorbid care dependent persons shows large variations. How skin care products meet the special requirements of aged skin and whether they enhance the skin barrier function and prevent cuteneous skin damage is unknown. © The Authors • Journal compilation © Blackwell Verlag GmbH, Berlin.
Recent Advances in Skin Penetration Enhancers for Transdermal Gene and Drug Delivery.
Amjadi, Morteza; Mostaghaci, Babak; Sitti, Metin
2017-01-01
There is a growing interest in transdermal delivery systems because of their noninvasive, targeted, and on-demand delivery of gene and drugs. However, efficient penetration of therapeutic compounds into the skin is still challenging largely due to the impermeability of the outermost layer of the skin, known as stratum corneum. Recently, there have been major research activities to enhance the skin penetration depth of pharmacological agents. This article reviews recent advances in the development of various strategies for skin penetration enhancement. We show that approaches such as ultrasound waves, laser, and microneedle patches have successfully been employed to physically disrupt the stratum corneum structure for enhanced transdermal delivery. Rather than physical approaches, several non-physical route have also been utilized for efficient transdermal delivery across the skin barrier. Finally, we discuss some clinical applications of transdermal delivery systems for gene and drug delivery. This paper shows that transdermal delivery devices can potentially function for diverse healthcare and medical applications while further investigations are still necessary for more efficient skin penetration of gene and drugs. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Biohydrogels for the In Vitro Re-construction and In Situ Regeneration of Human Skin
Korkina, Liudmila; Kostyuk, Vladimir; Guerra, Liliana
Natural and synthetic biohydrogels are of great interest for the development of innovative medicinal and cosmetic products feasible for the treatment of numerous skin diseases and age-related changes in skin structure and function. Here, the characteristics of bio-resorbable hydrogels as scaffolds for the in vitro re-construction of temporary skin substitutes or full skin equivalents for further transplantation are reviewed. Another fast developing area of regenerative medicine is the in situ regeneration of human skin. The approach is mainly applicable to activate and facilitate the skin regeneration process and angiogenesis in chronic wounds with impaired healing. In this case, extracellular matrix resembling polymers are used to stimulate cell growth, adhesion, and movement. Better results could be achieved by activation of biocompatible hydrogels either with proteins (growth factors, adhesion molecules or/and cytokines) or with allogenic skin cells producing and releasing these molecules. Hydrogels are widely applied as carriers of low molecular weight substances with antioxidant, anti-inflammatory, anti-ageing, and wound healing action. Incorporation of these substances into hydrogels enhances their penetration through the skin barrier and prevents their destruction by oxidation. Potential roles of hydrogel-based products for modern dermatology and cosmetology are also discussed.
Experimental studies on the nature of sensitive skin.
Kligman, A M; Sadiq, Iqbal; Zhen, Yaxian; Crosby, Marilyn
2006-11-01
In the USA, Europe and Japan 40 to 50% of women report that they have sensitive skin, defined as abnormal sub-clinical sensory responses to drugs, cosmetics and toiletries in the absence of visible signs of irritation. Itching, burning, stinging and tightness are the commonest complaints, which mainly afflict women. Manufacturers of skin care products have made available a large variety of products which are designed for persons with sensitive skin. Such products are not required by regulatory agencies to submit evidence of safety and efficacy, allowing marketers to make claims that are often exaggerated, irrational and even preposterous. The consumer with self-assessed sensitive skin has no way of judging which products are likely to be most beneficial and least harmful. The marketplace is awash with products for which there is no evidence that the rosy claims have been substantiated by appropriate testing procedures. There is no internationally accepted consensus regarding the criteria which define sensitive skin. Many papers have been published in the last 15 years, mainly originating from industry, which express widely differing views regarding what constitutes sensitive skin. For some, any adverse reaction to a product topically applied to sensitive skin, including breakouts, redness, scaling etc., a panoply of adverse reactions which is virtually meaningless. Others include environmental factors as causative, including cold, dry wind, heat and high humidity, solar radiation, etc., which add to the manifest complexities of the subject. This is the first paper in a series which provides a comprehensive review of the subject, emphasizing the all too many controversies and confusions arising from the lack of a consensus regarding the identification, classification, epidemiology, prevalence and pathogenesis of sensitive skin. Sensitive skin is a biologic reality and not a psychological, fashionable fantasy on the part of impressionable women. There is an urgent
du Plessis, Johan; Stefaniak, Aleksandr; Eloff, Fritz; John, Swen; Agner, Tove; Chou, Tzu-Chieh; Nixon, Rosemary; Steiner, Markus; Franken, Anja; Kudla, Irena; Holness, Linn
2015-01-01
Background There is an emerging perspective that it is not sufficient to just assess skin exposure to physical and chemical stressors in workplaces, but that it is also important to assess the condition, i.e. skin barrier function of the exposed skin at the time of exposure. The workplace environment, representing a non-clinical environment, can be highly variable and difficult to control, thereby presenting unique measurement challenges not typically encountered in clinical settings. Methods An expert working group convened a workshop as part of the 5th International Conference on Occupational and Environmental Exposure of Skin to Chemicals (OEESC) to develop basic guidelines and best practices (based on existing clinical guidelines, published data, and own experiences) for the in vivo measurement of transepidermal water loss (TEWL) and skin hydration in non-clinical settings with specific reference to the workplace as a worst-case scenario. Results Key elements of these guidelines are: (i) to minimize or recognize, to the extent feasible, the influences of relevant endogenous-, exogenous-, environmental- and measurement/instrumentation-related factors; (ii) to measure TEWL with a closed-chamber type instrument; (iii) report results as a difference or percent change (rather than absolute values); and (iv) accurately report any notable deviations from this guidelines. Conclusion It is anticipated that these guidelines will promote consistent data reporting, which will facilitate inter-comparison of study results. PMID:23331328
Comprehensive outreach, prevention education, and skin cancer screening for Utah ski resorts.
Varedi, Amir; Secrest, Aaron M; Harding, Garrett; Maness, Lori; Branson, Donna; Smith, Kristi; Hull, Christopher M
2018-02-15
Outdoor recreation can lead to substantial sun exposure. Employees of outdoor recreation establishments with extended time outdoors have amplified cumulative exposure to ultraviolet (UV) radiation and an increased risk of skin cancer. The "Sun Safe on the Slopes" program was created by Huntsman Cancer Institute at the University of Utah and the Utah Cancer Action Network to address increased UV exposure and skin cancer risk with free skin cancer screenings, outreach, and prevention education to local ski resorts. Herein, we describe the processes and barriers to implementation of a ski resort skin screening and education program and our 5-year report of the experience and screening data. Nine free skin cancer screenings were held at Utah ski resorts between 2011 and 2016, resulting in the presumptive diagnosis of 38 skin cancers (9.6%) in 394 participants. Behavioral data collected from participants indicates suboptimal sun safety practices, including underuse of sunscreen and protective clothing. Ski resort employees who experience sun exposure during peak hours at high altitudes and UV reflection from the snow are at an increased risk of skin cancer. These data indicate a need for emphasis on sun safety education and screening and can serve as a model for future endeavors.
Trojahn, Carina; Dobos, Gabor; Lichterfeld, Andrea; Blume-Peytavi, Ulrike; Kottner, Jan
2015-01-01
Facial skin ageing is caused by intrinsic and extrinsic mechanisms. Intrinsic ageing is highly related to chronological age. Age related skin changes can be measured using clinical and biophysical methods. The aim of this study was to evaluate whether and how clinical characteristics and biophysical parameters are associated with each other with and without adjustment for chronological age. Twenty-four female subjects of three age groups were enrolled. Clinical assessments (global facial skin ageing, wrinkling, and sagging), and biophysical measurements (roughness, colour, skin elasticity, and barrier function) were conducted at both upper cheeks. Pearson's correlations and linear regression models adjusted for age were calculated. Most of the measured parameters were correlated with chronological age (e.g., association with wrinkle score, r = 0.901) and with each other (e.g., residual skin deformation and wrinkle score, r = 0.606). After statistical adjustment for age, only few associations remained (e.g., mean roughness (R z) and luminance (L *), β = −0.507, R 2 = 0.377). Chronological age as surrogate marker for intrinsic ageing has the most important influence on most facial skin ageing signs. Changes in skin elasticity, wrinkling, sagging, and yellowness seem to be caused by additional extrinsic ageing. PMID:25767806
Directory of Open Access Journals (Sweden)
Carina Trojahn
2015-01-01
Full Text Available Facial skin ageing is caused by intrinsic and extrinsic mechanisms. Intrinsic ageing is highly related to chronological age. Age related skin changes can be measured using clinical and biophysical methods. The aim of this study was to evaluate whether and how clinical characteristics and biophysical parameters are associated with each other with and without adjustment for chronological age. Twenty-four female subjects of three age groups were enrolled. Clinical assessments (global facial skin ageing, wrinkling, and sagging, and biophysical measurements (roughness, colour, skin elasticity, and barrier function were conducted at both upper cheeks. Pearson’s correlations and linear regression models adjusted for age were calculated. Most of the measured parameters were correlated with chronological age (e.g., association with wrinkle score, r=0.901 and with each other (e.g., residual skin deformation and wrinkle score, r=0.606. After statistical adjustment for age, only few associations remained (e.g., mean roughness (Rz and luminance (L*, β=-0.507, R2=0.377. Chronological age as surrogate marker for intrinsic ageing has the most important influence on most facial skin ageing signs. Changes in skin elasticity, wrinkling, sagging, and yellowness seem to be caused by additional extrinsic ageing.
Directory of Open Access Journals (Sweden)
Chen CY
2017-06-01
Full Text Available Chuanyu Chen, Peijun You Department of Anesthesiology, Shandong Jining No 1 People’s Hospital, Jining, Shandong, People’s Republic of China Purpose: Barrier properties of the skin and physicochemical properties of drugs are the main factors for the delivery of local anesthetic molecules. The present work evaluates the anesthetic efficacy of drug-loaded nanocarrier (NC systems for the delivery of local anesthetic drug, ropivacaine (RVC. Methods: In this study, transcriptional transactivator peptide (TAT-decorated RVC-loaded NCs (TAT-RVC/NCs were successfully fabricated. Physicochemical properties of NCs were determined in terms of particle size, zeta potential, drug encapsulation efficiency, drug-loading capacity, stability, and in vitro drug release. The skin permeation of NCs was examined using a Franz diffusion cell mounted with depilated mouse skin in vitro, and in vivo anesthetic effect was evaluated in mice. Results: The results showed that TAT-RVC/NCs have a mean diameter of 133.2 nm and high drug-loading capacity of 81.7%. From the in vitro skin permeation results, it was observed that transdermal flux of TAT-RVC/NCs was higher than that of RVC-loaded NCs (RVC/NCs and RVC injection. The evaluation of in vivo anesthetic effect illustrated that TAT-RVC/NCs can enhance the transdermal delivery of RVC by reducing the pain threshold in mice. Conclusion: These results indicate that TAT-decorated NCs systems are useful for overcoming the barrier function of the skin, decreasing the dosage of RVC and enhancing the anesthetic effect. Therefore, TAT-decorated NCs can be used as an effective transdermal delivery system for local anesthesia. Keywords: local anesthetic system, ropivacaine, transcriptional transactivator peptide, nanocarriers, skin delivery
Langerhans cell precursors acquire RANK/CD265 in prenatal human skin.
Schöppl, Alice; Botta, Albert; Prior, Marion; Akgün, Johnnie; Schuster, Christopher; Elbe-Bürger, Adelheid
2015-01-01
The skin is the first barrier against foreign pathogens and the prenatal formation of a strong network of various innate and adaptive cells is required to protect the newborn from perinatal infections. While many studies about the immune system in healthy and diseased adult human skin exist, our knowledge about the cutaneous prenatal/developing immune system and especially about the phenotype and function of antigen-presenting cells such as epidermal Langerhans cells (LCs) in human skin is still scarce. It has been shown previously that LCs in healthy adult human skin express receptor activator of NF-κB (RANK), an important molecule prolonging their survival. In this study, we investigated at which developmental stage LCs acquire this important molecule. Immunofluorescence double-labeling of cryostat sections revealed that LC precursors in prenatal human skin either do not yet [10-11 weeks of estimated gestational age (EGA)] or only faintly (13-15 weeks EGA) express RANK. LCs express RANK at levels comparable to adult LCs by the end of the second trimester. Comparable with adult skin, dermal antigen-presenting cells at no gestational age express this marker. These findings indicate that epidermal leukocytes gradually acquire RANK during gestation - a phenomenon previously observed also for other markers on LCs in prenatal human skin. Copyright © 2015 The Authors. Published by Elsevier GmbH.. All rights reserved.
The 500 Dalton rule for the skin penetration of chemical compounds and drugs
Bos, J. D.; Meinardi, M. M.
2000-01-01
Human skin has unique properties of which functioning as a physicochemical barrier is one of the most apparent. The human integument is able to resist the penetration of many molecules. However, especially smaller molecules can surpass transcutaneously. They are able to go by the corneal layer,
The moisturizing effects of glycolipid biosurfactants, mannosylerythritol lipids, on human skin.
Yamamoto, Shuhei; Morita, Tomotake; Fukuoka, Tokuma; Imura, Tomohiro; Yanagidani, Shusaku; Sogabe, Atsushi; Kitamoto, Dai; Kitagawa, Masaru
2012-01-01
Glycolipid biosurfactants, such as mannosylerythritol lipids (MELs), are produced by different yeasts belonging to the genus Pseudozyma and have been attracting much attention as new cosmetic ingredients owing to their unique liquid-crystal-forming and moisturizing properties. In this study, the effects of different MEL derivatives on the skin were evaluated in detail using a three-dimensional cultured human skin model and an in vivo human study. The skin cells were cultured and treated with sodium dodecyl sulfate (SDS), and the effects of different lipids on the SDS-damaged cells were evaluated on the basis of cell viability. Most MEL derivatives efficiently recovered the viability of the cells and showed high recovery rates (over 80%) comparable with that of natural ceramide. It is interesting that the recovery rate with MEL-A prepared from olive oil was significantly higher than that of MEL-A prepared from soybean oil. The water retention properties of MEL-B were further investigated on human forearm skin in a preliminary study. Compared with the control, the aqueous solution of MEL-B (5 wt%) was estimated to considerably increase the stratum corneum water content in the skin. Moreover, perspiration on the skin surface was clearly suppressed by treatment with the MEL-B solution. These results suggest that MELs are likely to exhibit a high moisturizing action, by assisting the barrier function of the skin. Accordingly, the yeast glycolipids have a strong potential as a new ingredient for skin care products.
Directory of Open Access Journals (Sweden)
Oudejans LCJ
2017-08-01
Full Text Available Linda CJ Oudejans,1 Marieke Niesters,1 Michael Brines,2 Albert Dahan,1 Monique van Velzen1 1Department of Anesthesiology, Leiden University Medical Center, Leiden, the Netherlands; 2Araim Pharmaceuticals, Inc., Tarrytown, NY, USA Abstract: Small fiber pathology with concomitant chronic neuropathic pain is a common complication of sarcoidosis. The gold standard of diagnosis of small fiber neuropathy (SFN is the quantification of small nerve fibers in skin biopsies in combination with patient history and psychophysical tests; a new technique is the quantification of small nerve fibers in the cornea using cornea confocal microscopy (CCM. Here, we studied small fiber morphology in sarcoidosis patients with neuropathic pain using skin biopsies, CCM, and quantitative sensory testing (QST. Our aim was to construct specific phenotypes of neuropathic pain in sarcoidosis. Fifty-eight patients with a confirmed diagnosis of sarcoidosis and with moderate-to-severe neuropathic pain were tested. Decreased intraepidermal nerve fiber density (IENFD from skin biopsies was found in 28% of patients, and CCM abnormalities were observed in 45% of patients. There was no correlation between CCM and IENFD abnormalities. Eighty-three percent of patients had abnormal thermal detection thresholds, a sign of small fiber dysfunction. Based on the presence or absence of abnormalities in IENFD and CCM, four distinct phenotypes were identified with a distinct homogeneous pattern of somatosensory symptoms. We argue that these distinct phenotypes have a similar mechanistic construct with specific phenotype-specific treatment options. Additionally, our data suggest the presence of patients with length- and nonlength-dependent SFN within this population of sarcoidosis patients. Keywords: chronic pain, sarcoidosis, small fiber neuropathy
Concise Review: Wnt Signaling Pathways in Skin Development and Epidermal Stem Cells.
Veltri, Anthony; Lang, Christopher; Lien, Wen-Hui
2018-01-01
Mammalian skin and its appendages constitute the integumentary system forming a barrier between the organism and its environment. During development, skin epidermal cells divide rapidly and stratify into a multilayered epithelium, as well as invaginate downward in the underlying mesenchyme to form hair follicles (HFs). In postnatal skin, the interfollicular epidermal (IFE) cells continuously proliferate and differentiate while HFs undergo cycles of regeneration. Epidermal regeneration is fueled by epidermal stem cells (SCs) located in the basal layer of the IFE and the outer layer of the bulge in the HF. Epidermal development and SC behavior are mainly regulated by various extrinsic cues, among which Wnt-dependent signaling pathways play crucial roles. This review not only summarizes the current knowledge of Wnt signaling pathways in the regulation of skin development and governance of SCs during tissue homeostasis, but also discusses the potential crosstalk of Wnt signaling with other pathways involved in these processes. Stem Cells 2018;36:22-35. © 2017 AlphaMed Press.
Hung, Chi-Feng; Chen, Wei-Yu; Hsu, Ching-Yun; Aljuffali, Ibrahim A; Shih, Hui-Chi; Fang, Jia-You
2015-08-01
Photoaging is recognized as the factor damaging skin-barrier function. The aim of this study was to examine the impact of ultraviolet (UV) irradiation on the cutaneous penetration of soft nanoparticles, including nanostructured lipid carriers (NLCs) and poly(lactic-co-glycolic acid) polymer nanoparticles (PNs). In vitro cutaneous permeation of retinoic acid (RA) carried by nanoparticles was evaluated. In vivo nude mouse skin distribution of topically applied nanoparticles was observed by fluorescence and confocal microscopies. The association of nanoparticles with cultured keratinocytes was measured by flow cytometry and fluorescence microscopy. The average diameter and surface charge were 236nm and -32mV for NLCs, and 207nm and -12mV for PNs. The ultrastructural images of skin demonstrated that the application of UV produced a loss of Odland bodies and desmosomes, the organelles regulating skin-barrier function. UVA exposure increased skin deposition of RA regardless of nanoparticle formulation. UVB did not alter RA deposition from nanoparticles as compared to the non-treated group. Exposure to UVA promoted RA delivery into hair follicles from NLCs and PNs by 4.2- and 4.9-fold, respectively. The in vivo skin distribution also showed a large accumulation of Nile red-loaded nanoparticles in follicles after UVA treatment. The soft nanoparticles were observed deep in the dermis. PNs with higher lipophilicity showed a greater association with keratinocytes compared to NLCs. The cell association of PNs was increased by UVA application, whereas the association between NLCs and keratinocytes was reduced two times by UVA. It was concluded that both follicles and intercellular spaces were the main pathways for nanoparticle diffusion into photodamaged skin. Copyright © 2015 Elsevier B.V. All rights reserved.
Feeling Abnormal: Simulation of Deviancy in Abnormal and Exceptionality Courses.
Fernald, Charles D.
1980-01-01
Describes activity in which student in abnormal psychology and psychology of exceptional children classes personally experience being judged abnormal. The experience allows the students to remember relevant research, become sensitized to the feelings of individuals classified as deviant, and use caution in classifying individuals as abnormal.…
Meinke, Martina C.; Richter, Heike; Kleemann, Anke; Lademann, Juergen; Tscherch, Kathrin; Rohn, Sascha; Schempp, Christoph M.
2015-05-01
Atopic dermatitis (AD) is a multifactorial inflammatory skin disease that affects both children and adults in an increasing manner. The treatment of AD often reduces subjective skin parameters, such as itching, dryness, and tension, but the inflammation cannot be cured. Laser scanning microscopy was used to investigate the skin surface, epidermal, and dermal characteristics of dry and atopic skin before and after treatment with an ointment rich in hyperforin, which is known for its anti-inflammatory effects. The results were compared to subjective parameters and transepidermal water loss, stratum corneum moisture, and stratum corneum lipids. Using biophysical methods, in particular laser scanning microscopy, it was found that atopic skin has distinct features compared to healthy skin. Treatment with a hyperforin-rich ointment resulted in an improvement of the stratum corneum moisture, skin surface dryness, skin lipids, and the subjective skin parameters, indicating that the barrier is stabilized and improved by the ointment. But in contrast to the improved skin surface, the inflammation in the deeper epidermis/dermis often continues to exist. This could be clearly shown by the reflectance confocal microscopy (RCM) measurements. Therefore, RCM measurements could be used to investigate the progress in treatment of atopic dermatitis.
Skin bioavailability of dietary vitamin E, carotenoids, polyphenols, vitamin C, zinc and selenium.
Richelle, Myriam; Sabatier, Magalie; Steiling, Heike; Williamson, Gary
2006-08-01
Dietary bioactive compounds (vitamin E, carotenoids, polyphenols, vitamin C, Se and Zn) have beneficial effects on skin health. The classical route of administration of active compounds is by topical application direct to the skin, and manufacturers have substantial experience of formulating ingredients in this field. However, the use of functional foods and oral supplements for improving skin condition is increasing. For oral consumption, some dietary components could have an indirect effect on the skin via, for example, secondary messengers. However, in the case of the dietary bioactive compounds considered here, we assume that they must pass down the gastrointestinal tract, cross the intestinal barrier, reach the blood circulation, and then be distributed to the different tissues of the body including the skin. The advantages of this route of administration are that the dietary bioactive compounds are metabolized and then presented to the entire tissue, potentially in an active form. Also, the blood continuously replenishes the skin with these bioactive compounds, which can then be distributed to all skin compartments (i.e. epidermis, dermis, subcutaneous fat and also to sebum). Where known, the distribution and mechanisms of transport of dietary bioactive compounds in skin are presented. Even for compounds that have been studied well in other organs, information on skin is relatively sparse. Gaps in knowledge are identified and suggestions made for future research.
Directory of Open Access Journals (Sweden)
Tanaka M
2016-11-01
Full Text Available Miyuki Tanaka,1 Yuki Yamamoto,2 Eriko Misawa,1 Kazumi Nabeshima,1 Marie Saito,1 Koji Yamauchi,1 Fumiaki Abe,1 Fukumi Furukawa2 1Functional Food Ingredients Department, Food Ingredients & Technology Institute, Morinaga Milk Industry Co., Ltd., Zama, Kanagawa, 2Department of Dermatology, Wakayama Medical University, Kimiidera, Wakayama, Japan Background/objective: Recently, it was confirmed that the daily oral intake of plant sterols of Aloe vera gel (Aloe sterol significantly increases the skin barrier function, moisture, and elasticity in photoprotected skin. This study aimed to investigate whether Aloe sterol intake affected skin conditions following sunlight exposure in Japanese men. Methods: We performed a 12-week, randomized, double-blind, placebo-controlled study to evaluate the effects of oral Aloe sterol supplementation on skin conditions in 48 apparently healthy men (age range: 30–59 years; average: 45 years. The subjects were instructed to expose the measurement position of the arms to the sunlight outdoors every day for 12 weeks. The skin parameters were measured at 0 (baseline, 4, 8, and 12 weeks. Results: Depending on the time for the revelation of the sunlight, the b* value and melanin index increased and the skin moisture decreased. After taking an Aloe sterol tablet daily for 12 weeks, the skin elasticity index (R2, R5, and R7 levels were significantly higher than the baseline value. There were no differences between the groups in these skin elasticity values. In the subgroup analysis of subjects aged <46 years, the change in the R5 and R7 was significantly higher in the Aloe group than in the placebo group at 8 weeks (P=0.0412 and P=0.0410, respectively. There was a difference in the quantity of sun exposure between each subject, and an additional clinical study that standardizes the amount of ultraviolet rays is warranted. No Aloe sterol intake-dependent harmful phenomenon was observed during the intake period
Magnusson, Skuli; Baldursson, Baldur Tumi; Kjartansson, Hilmar; Rolfsson, Ottar; Sigurjonsson, Gudmundur Fertram
2017-03-01
Improvised explosive devices and new directed energy weapons are changing warfare injuries from penetrating wounds to large surface area thermal and blast injuries. Acellular fish skin is used for tissue repair and during manufacturing subjected to gentle processing compared to biologic materials derived from mammals. This is due to the absence of viral and prion disease transmission risk, preserving natural structure and composition of the fish skin graft. The aim of this study was to assess properties of acellular fish skin relevant for severe battlefield injuries and to compare those properties with those of dehydrated human amnion/chorion membrane. We evaluated cell ingrowth capabilities of the biological materials with microscopy techniques. Bacterial barrier properties were tested with a 2-chamber model. The microstructure of the acellular fish skin is highly porous, whereas the microstructure of dehydrated human amnion/chorion membrane is mostly nonporous. The fish skin grafts show superior ability to support 3-dimensional ingrowth of cells compared to dehydrated human amnion/chorion membrane (p fish skin is a bacterial barrier for 24 to 48 hours. The unique biomechanical properties of the acellular fish skin graft make it ideal to be used as a conformal cover for severe trauma and burn wounds in the battlefield. Reprint & Copyright © 2017 Association of Military Surgeons of the U.S.
Directory of Open Access Journals (Sweden)
Florian Labarrade
2018-01-01
Full Text Available The significance of Coenzyme Q10 (CoQ10 as an anti-oxidant barrier of the skin, as well as a key component in anti-aging strategies for skin care products, has been firmly established. Biosynthesis of CoQ10 in the mitochondria is well known, but there is only limited information on the non-mitochondrial synthesis of CoQ10 in the skin. Recent findings in zebrafish identified that a tumor suppressor, Ubiad1, is also a key enzyme in the non-mitochondrial synthesis of CoQ10. The purpose of this study was to investigate expression of Ubiad1 in human skin, and its implication in the skin’s cutaneous response to oxidative stress. We observed Ubiad1 localization in the epidermis, particularly a subcellular localization in the Golgi apparatus. Ubiad1 modulation by a pentapeptide was associated with an observed reduction in ROS/RNS stresses (−44%/−19% respectively, lipid peroxidation (−25% and preservation of membrane fluidity under stress conditions. Electron microscopy of keratinocytes revealed a significant degree of stimulation of the Golgi complex, as well as significantly improved mitochondrial morphology. Given the importance of CoQ10 in mitigating the visible signs of skin aging, our findings identify Ubiad1 as an essential component of the defensive barriers of the epidermis.
Ultrasound detection and identification of cosmetic fillers in the skin
DEFF Research Database (Denmark)
Wortsman, X.; Wortsman, J.; Orlandi, C.
2012-01-01
Background While the incidence of cosmetic filler injections is rising world-wide, neither exact details of the procedure nor the agent used are always reported or remembered by the patients. Thus, although complications are reportedly rare, availability of a precise diagnostic tool to detect...... cutaneous filler deposits could help clarify the association between the procedure and the underlying pathology. Objectives The aim of this study was to evaluate cutaneous sonography in the detection and identification of cosmetic fillers deposits and, describe dermatological abnormalities found associated...... with the presence of those agents. Methods We used ultrasound in a porcine skin model to determine the sonographic characteristics of commonly available filler agents, and subsequently applied the analysis to detect and identify cosmetic fillers among patients referred for skin disorders. Results Fillers...
Genetic Algorithm for Opto-thermal Skin Hydration Depth Profiling Measurements
Cui, Y.; Xiao, Perry; Imhof, R. E.
2013-09-01
Stratum corneum is the outermost skin layer, and the water content in stratum corneum plays a key role in skin cosmetic properties as well as skin barrier functions. However, to measure the water content, especially the water concentration depth profile, within stratum corneum is very difficult. Opto-thermal emission radiometry, or OTTER, is a promising technique that can be used for such measurements. In this paper, a study on stratum corneum hydration depth profiling by using a genetic algorithm (GA) is presented. The pros and cons of a GA compared against other inverse algorithms such as neural networks, maximum entropy, conjugate gradient, and singular value decomposition will be discussed first. Then, it will be shown how to use existing knowledge to optimize a GA for analyzing the opto-thermal signals. Finally, these latest GA results on hydration depth profiling of stratum corneum under different conditions, as well as on the penetration profiles of externally applied solvents, will be shown.
Muenyi, Clarisse S.; Carrion, Sandra Leon; Jones, Lynn A.; Kennedy, Lawrence H.; Slominski, Andrzej T.
2014-01-01
Background: Development of the epidermal permeability barrier (EPB) is essential for neonatal life. Defects in this barrier are found in many skin diseases such as atopic dermatitis. Objective: We investigated the effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) on the development and function of the EPB. Methods: Timed-pregnant C57BL/6J mice were gavaged with corn oil or TCDD (10 μg/kg body weight) on gestation day 12. Embryos were harvested on embryonic day (E) 15, E16, E17, and postnatal day (PND) 1. Results: A skin permeability assay showed that TCDD accelerated the development of the EPB, beginning at E15. This was accompanied by a significant decrease in transepidermal water loss (TEWL), enhanced stratification, and formation of the stratum corneum (SC). The levels of several ceramides were significantly increased at E15 and E16. PND1 histology revealed TCDD-induced acanthosis and epidermal hyperkeratosis. This was accompanied by disrupted epidermal tight junction (TJ) function, with increased dye leakage at the terminal claudin-1–staining TJs of the stratum granulosum. Because the animals did not have enhanced rates of TEWL, a commonly observed phenotype in animals with TJ defects, we performed tape-stripping. Removal of most of the SC resulted in a significant increase in TEWL in TCDD-exposed PND1 pups compared with their control group. Conclusions: These findings demonstrate that in utero exposure to TCDD accelerates the formation of an abnormal EPB with leaky TJs, warranting further study of environmental exposures, epithelial TJ integrity, and atopic disease. Citation: Muenyi CS, Leon Carrion S, Jones LA, Kennedy LH, Slominski AT, Sutter CH, Sutter TR. 2014. Effects of in utero exposure of C57BL/6J mice to 2,3,7,8-tetrachlorodibenzo-p-dioxin on epidermal permeability barrier development and function. Environ Health Perspect 122:1052–1058; http://dx.doi.org/10.1289/ehp.1308045 PMID:24904982
Directory of Open Access Journals (Sweden)
ZHANG Yuanyuan
2016-12-01
Full Text Available The incidence of non-alcoholic fatty liver disease (NAFLD has been increasing year by year in China. Intestinal mucosa is the largest organ for bacterial storage, and intestinal mucosal barrier includes biological barrier, mechanical barrier, immunological barrier, and chemical barrier. This article investigates the important role of intestinal mucosal barrier function in the pathogenesis of NAFLD. As for the intestinal biological barrier, abnormalities in gut microbiota occur earlier than obesity and other metabolic disorders; small intestinal bacterial overgrowth may affect energy metabolism, promote insulin resistance, and get involved in the pathogenesis of NAFLD; regulation of gut microbiota has a certain clinical effect in the treatment of NAFLD. Intestinal mechanical barrier impairment increases the mucosal permeability and is associated with intestinal dysbacteriosis. The changes in intestinal immunological barrier may be associated with obesity, metabolic disorders, and liver inflammation. The changes in intestinal chemical barrier can inhibit the synthesis and secretion of very low-density lipoprotein and low-density lipoprotein in hepatocytes and may result in triglyceride deposition in the liver. It is pointed out that the research on intestinal mucosal barrier function provides promising prospects for the prevention and treatment of NAFLD.
International Nuclear Information System (INIS)
Yin, Lei; Morita, Akimichi; Tsuji, Takuo
2002-01-01
Functional integrity of normal skin is dependent on the balance between the biosynthesis and degradation of extracellular matrix, primarily composed of collagen, elastin and proteoglycans. In our previous studies, we found that tobacco smoke extracts decreased expressions of type I and III procollagen and induced matrix metalloproteinase-1 (MMP-1) and MMP-3 in the cultured skin fibroblasts. We here further investigated the effects of tobacco smoke extracts or ultraviolet A (UVA) treatments on the expression of tropoelastin (soluble elastin protein), and versican and decorin (proteoglycans) in cultured skin fibroblasts. The mRNA of tropoelastin increased by tobacco smoke extracts or UVA irradiation. Versican was markedly shown to decrease after these treatments by using western blotting and the mRNA of versican V0 also significantly decreased. UVA treatment did not show remarkable change in decorin protein, but resulted in marked decrease of decorin D1 mRNA. In contrast to UVA irradiation, the treatments of tobacco smoke extracts resulted in significant increase in decorin, while mRNA of decorin D1 decreased as compared to the control. MMP-7 increased after the treatment of tobacco smoke extracts or UVA. These results indicated that common molecular features might underlie the skin premature aging induced by tobacco smoke extracts and UVA, including abnormal regulation of extracellular matrix deposition through elevated MMPs, reduced collagen production, abnormal tropoelastin accumulation, and altered proteoglycans. (author)
Energy Technology Data Exchange (ETDEWEB)
Yin, Lei; Morita, Akimichi; Tsuji, Takuo [Nagoya City Univ. (Japan). Medical School
2002-02-01
Functional integrity of normal skin is dependent on the balance between the biosynthesis and degradation of extracellular matrix, primarily composed of collagen, elastin and proteoglycans. In our previous studies, we found that tobacco smoke extracts decreased expressions of type I and III procollagen and induced matrix metalloproteinase-1 (MMP-1) and MMP-3 in the cultured skin fibroblasts. We here further investigated the effects of tobacco smoke extracts or ultraviolet A (UVA) treatments on the expression of tropoelastin (soluble elastin protein), and versican and decorin (proteoglycans) in cultured skin fibroblasts. The mRNA of tropoelastin increased by tobacco smoke extracts or UVA irradiation. Versican was markedly shown to decrease after these treatments by using western blotting and the mRNA of versican V0 also significantly decreased. UVA treatment did not show remarkable change in decorin protein, but resulted in marked decrease of decorin D1 mRNA. In contrast to UVA irradiation, the treatments of tobacco smoke extracts resulted in significant increase in decorin, while mRNA of decorin D1 decreased as compared to the control. MMP-7 increased after the treatment of tobacco smoke extracts or UVA. These results indicated that common molecular features might underlie the skin premature aging induced by tobacco smoke extracts and UVA, including abnormal regulation of extracellular matrix deposition through elevated MMPs, reduced collagen production, abnormal tropoelastin accumulation, and altered proteoglycans. (author)
Directory of Open Access Journals (Sweden)
Teerawan Rattanapak
Full Text Available Delivery of vaccines into the skin provides many advantages over traditional parenteral vaccination and is a promising approach due to the abundance of antigen presenting cells (APC residing in the skin including Langerhans cells (LC and dermal dendritic cells (DDC. However, the main obstacle for transcutaneous immunization (TCI is the effective delivery of the vaccine through the stratum corneum (SC barrier to the APC in the deeper skin layers. This study therefore utilized microneedles (MN and a lipid-based colloidal delivery system (cubosomes as a synergistic approach for the delivery of vaccines to APC in the skin. The process of vaccine uptake and recruitment by specific types of skin APC was investigated in real-time over 4 hours in B6.Cg-Tg (Itgax-EYFP 1 Mnz/J mice by two-photon microscopy. Incorporation of the vaccine into a particulate delivery system and the use of MN preferentially increased vaccine antigen uptake by a highly motile subpopulation of skin APC known as CD207⁺ DC. No uptake of antigen or any response to immunisation by LC could be detected.
Shining light on skin pigmentation: the darker and the brighter side of effects of UV radiation.
Maddodi, Nityanand; Jayanthy, Ashika; Setaluri, Vijayasaradhi
2012-01-01
The term barrier function as applied to human skin often connotes the physical properties of this organ that provides protection from its surrounding environment. This term does not generally include skin pigmentation. However, skin pigmentation, which is the result of melanin produced in melanocytes residing in the basal layer of the skin and exported to the keratinocytes in the upper layers, serves equally important protective function. Indeed, changes in skin pigmentation are often the most readily recognized indicators of exposure of skin to damaging agents, especially to natural and artificial radiation in the environment. Several recent studies have shed new light on (1) the mechanisms involved in selective effects of subcomponents of UV radiation on human skin pigmentation and (2) the interactive influences between keratinocytes and melanocytes, acting as "epidermal melanin unit," that manifest as changes in skin pigmentation in response to exposure to various forms of radiation. This article provides a concise review of our current understanding of the effects of the nonionizing solar radiation, at cellular and molecular levels, on human skin pigmentation. © 2012 Wiley Periodicals, Inc. Photochemistry and Photobiology © 2012 The American Society of Photobiology.
International Nuclear Information System (INIS)
Lindberg, M.; Sagstroem, S.R.; Roomans, G.M.; Forslind, B.
1989-01-01
The effect of sodium lauryl sulphate (SLS), a common ingredient of detergents, on the penetration of nickel through the stratum corneum in the guinea-pig skin model was studied with energy dispersive X-ray microanalysis (EDX) to evaluate the barrier-damaging properties of this common detergent. The EDX technique allows a simultaneous determination of physiologically important elements, e.g., Na, Mg, P, Cl, K, Ca and S in addition to Ni at each point of measurement in epidermal cell strata. Our results show that SLS reduces the barrier function to Ni-ion penetration of the stratum corneum. In addition we have shown that EDX allows analysis of the influence of different factors involved in nickel penetration through the skin by giving data on the physiological effects on the epidermal cells caused by the applied substances
Molecular mechanisms of green tea polyphenols with protective effects against skin photoaging.
Roh, Eunmiri; Kim, Jong-Eun; Kwon, Jung Yeon; Park, Jun Seong; Bode, Ann M; Dong, Zigang; Lee, Ki Won
2017-05-24
Whereas green tea has historically been consumed in high quantities in Northeast Asia, its popularity is also increasing in many Western countries. Green tea is an abundant source of plant polyphenols exhibiting numerous effects that are potentially beneficial for human health. Accumulating evidence suggests that green tea polyphenols confer protective effects on the skin against ultraviolet (UV) irradiation-induced acceleration of skin aging, involving antimelanogenic, antiwrinkle, antioxidant, and anti-inflammatory effects as well as prevention of immunosuppression. Melanin pigmentation in the skin is a major defense mechanism against UV irradiation, but pigmentation abnormalities such as melasma, freckles, senile lentigines, and other forms of melanin hyperpigmentation can also cause serious health and aesthetic issues. Furthermore, UV irradiation initiates the degradation of fibrillar collagen and elastic fibers, promoting the process of skin aging through deep wrinkle formation and loss of tissue elasticity. UV irradiation-induced formation of free radicals also contributes to accelerated photoaging. Additionally, immunosuppression caused by UV irradiation plays an important role in photoaging and skin carcinogenesis. In this review, we summarize the current literature regarding the antimelanogenic, antiwrinkle, antioxidant, and immunosuppression preventive mechanisms of green tea polyphenols that have been demonstrated to protect against UV irradiation-stimulated skin photoaging, and gauge the quality of evidence supporting the need for clinical studies using green tea polyphenols as anti-photoaging agents in novel cosmeceuticals.
Self-reported skin concerns: An epidemiological study of community-dwelling older people.
Cowdell, Fiona; Dyson, Judith; Long, Judith; Macleod, Una
2018-03-25
To identify the frequency and impact of self-reported skin concerns in community-dwelling older people. Globally, the population is getting older and it is essential to develop effective interventions to promote healthy ageing. Skin change with age is inevitable and renders this often neglected organ more vulnerable to damage and breakdown; this can be costly to individuals and society. Maintenance of skin health in older people presents a health challenge that has yet to be fully understood or addressed. Cross-sectional, self-reported questionnaire survey in England. Patients registered with participating general practices (n = 3), aged ≥70 years, living in their own homes and able to give informed consent (n = 3,359) were sent a letter of invitation to a free health and care assessment, and 1116 responded. When asked "do you have any concerns about your skin?", 16.5% (n = 183) said yes. Of this group, the most common concerns were dry skin 80.7% (n = 146), itching 56.9% (n = 103) and aged appearance 61% (n = 113). Itch, dry skin and inflammation were rated as most bothersome. There was a significant association between the dry skin and itch χ 2 (1) = 6.9, p < .05. Many community-dwelling older people suffer from skin concerns predominantly dry skin and itching that is often bothersome. Skin health assessment is often absent in routine consultations with community-dwelling older people. Dry, itchy skin is prevalent and can be simply managed with low-cost interventions. This has the potential to reduce suffering and maintain or improve skin barrier function. Nurses and other health professionals should therefore routinely assess and advise on skin health care for this population. © 2018 John Wiley & Sons Ltd.
Seasonal changes in epidermal ceramides are linked to impaired barrier function in acne patients.
Pappas, Apostolos; Kendall, Alexandra C; Brownbridge, Luke C; Batchvarova, Nikoleta; Nicolaou, Anna
2018-01-21
Acne skin demonstrates increased transepidermal water loss (TEWL) compared with healthy skin, which may be due, in part, to altered ceramide (CER) levels. We analysed ceramides in the stratum corneum of healthy and acne skin, and studied seasonal variation over the course of a year. Using ultraperformance liquid chromatography with electrospray ionisation and tandem mass spectrometry (UPLC/ESI-MS/MS), we identified 283 ceramides. Acne-affected skin demonstrated overall lower levels of ceramides, with notable reductions in CER[NH] and CER[AH] ceramides, as well as the acylceramides CER[EOS] and CER[EOH]; these differences were more apparent in the winter months. Lower ceramide levels reflected an increase in TEWL in acne, compared with healthy skin, which partly resolves in the summer. Individual ceramide species with 18-carbon 6-hydroxysphingosine (H) bases (including CER[N(24)H(18)], CER[N(26)H(18)], CER[A(24)H(18)], CER[A(26)H(18)]) were significantly reduced in acne skin, suggesting that CER[NH] and CER[AH] species may be particularly important in a healthy skin barrier. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Anti-ageing effects of a new synthetic sphingolipid (K6EAA-L12) on aged murine skin.
Jung, Minyoung; Lee, Sanghoon; Park, Hwa-young; Youm, Jong-Kyung; Jeong, Sekyoo; Bae, Jonghwan; Kwon, Mi Jung; Park, Byeong Deog; Lee, Seung Hun; Choi, Eung Ho
2011-04-01
Recently, we reported on the anti-ageing effects of K6PC-5. This compound induced keratinocyte differentiation and fibroblast proliferation by increasing sphingosine-1 phosphate synthesis. We performed this study to confirm the anti-ageing effects of new synthetic products (the K6EAA series) derived from K6PC-5 through an amino group induction. Cellular responses such as differentiation, proliferation and calcium mobilization were investigated using cultured human keratinocytes and fibroblasts. Also, we measured the expressions of collagen mRNA and protein using real time RT-PCR and ELISA, respectively. The K6EAA-L12 product, selected by in vitro screening, was evaluated for anti-ageing effects on intrinsically and extrinsically (photo) aged models of hairless mice. In the intrinsically aged murine skin, K6EAA-L12 showed anti-ageing effects by activating collagen synthesis, eventually causing dermal thickening. Also, in the photo-aged skin, the dermal collagen density and dermal thickness were increased. In photo-aged murine skin, K6EAA-L12 increased stratum corneum integrity by increasing corneodesmosome density and improved the barrier recovery rate. However, there were no changes in the expressions of epidermal differentiation maker proteins. In conclusion, topical K6EAA-L12, a new synthetic K6PC-5 derivative, improves intrinsically and extrinsically (photo) aged skin by increasing the collagen density and improving the skin barrier function. © 2011 John Wiley & Sons A/S.
Influence of proton-skin thickness on the {{\\alpha }} decays of heavy nuclei
Seif, W. M.; Abdurrahman, A.
2018-01-01
We investigate the effect of proton-skin thickness on the α decay process. We consider 188 neutron-deficient nuclei belonging to the isotopic chains from Te (Z = 52) to Pb (Z = 82). The calculations of the half-life are carried out in the framework of the preformed cluster model, with the Wentzel-Kramers-Brillouin penetration probability and assault frequency. It is shown that the proton-skin thickness ({\\varDelta }{{p}}) of the daughter nucleus gives rise to a total α- daughter nucleus interaction potential of relatively wide deep internal pocket and a thinner Coulomb barrier of less height. This increases the penetration probability but decreases the assault frequency. The overall impact of the proton-skin thickness appears as a decrease in the decay half-life. The proton-skin thickness decreases the stability of the nucleus. The half-lives of the proton-skinned isotopes along the isotopic chain decrease exponentially with increasing the proton-skin thickness, whereas the {Q}α -value increases with {\\varDelta }{{p}}. α-decay manifests itself as the second favorite decay mode of neutron-deficient nuclei, next to the {β }+-decay and before proton-decay. It is indicated as main, competing, and minor decay mode, at 21%, 7%, and 57%, respectively, of the investigated nuclei.
Retinoic Acid-Induced Epidermal Transdifferentiation in Skin
Directory of Open Access Journals (Sweden)
Yoshihiro Akimoto
2014-06-01
Full Text Available Retinoids function as important regulatory signaling molecules during development, acting in cellular growth and differentiation both during embryogenesis and in the adult animal. In 1953, Fell and Mellanby first found that excess vitamin A can induce transdifferentiation of chick embryonic epidermis to a mucous epithelium (Fell, H.B.; Mellanby, E. Metaplasia produced in cultures of chick ectoderm by high vitamin A. J. Physiol. 1953, 119, 470–488. However, the molecular mechanism of this transdifferentiation process was unknown for a long time. Recent studies demonstrated that Gbx1, a divergent homeobox gene, is one of the target genes of all-trans retinoic acid (ATRA for this transdifferentiation. Furthermore, it was found that ATRA can induce the epidermal transdifferentiation into a mucosal epithelium in mammalian embryonic skin, as well as in chick embryonic skin. In the mammalian embryonic skin, the co-expression of Tgm2 and Gbx1 in the epidermis and an increase in TGF-β2 expression elicited by ATRA in the dermis are required for the mucosal transdifferentiation, which occurs through epithelial-mesenchymal interaction. Not only does retinoic acid (RA play an important role in mucosal transdifferentiation, periderm desquamation, and barrier formation in the developing mammalian skin, but it is also involved in hair follicle downgrowth and bending by its effect on the Wnt/β-catenin pathway and on members of the Runx, Fox, and Sox transcription factor families.
van den Broek, Lenie J; Bergers, Lambert I J C; Reijnders, Christianne M A; Gibbs, Susan
2017-06-01
Understanding the healthy and diseased state of skin is important in many areas of basic and applied research. Although the field of skin tissue engineering has advanced greatly over the last years, current in vitro skin models still do not mimic the complexity of the human skin. Skin-on-chip and induced pluripotent stem cells (iPSC) might be key technologies to improve in vitro skin models. This review summarizes the state of the art of in vitro skin models with regard to cell sources (primary, cell line, iPSC) and microfluidic devices. It can be concluded that iPSC have the potential to be differentiated into many kinds of immunologically matched cells and skin-on-chip technology might lead to more physiologically relevant skin models due to the controlled environment, possible exchange of immune cells, and an increased barrier function. Therefore the combination of iPSC and skin-on-chip is expected to lead to superior healthy and diseased in vitro skin models.
Workplace barriers encountered by employed persons with systemic sclerosis.
Poole, Janet L; Anwar, Sahar; Mendelson, Cindy; Allaire, Saralynn
2016-01-01
Systemic sclerosis (SSc) is an auto-immune connective tissue disease characterized by fibrosis of skin, blood vessels, and internal organs that results in significant disability. To identify the work barriers faced by people with systemic sclerosis (SSc) in maintaining employment. Thirty-six people with SSc who were working more than 8 hours per week completed the Work Experience Survey, which contains lists of potential work barriers, including the ability to travel to and from work; get around at work; perform essential job functions, including physical, cognitive, and task-related activities; work with others; and manage work conditions. Thirty-three participants completed and returned the questionnaires, most of whom were female, and working full time and in professional careers. Principal disease symptoms included fatigue, Raynaud's phenomenon, esophageal involvement, and leg or hand/wrist pain. All participants reported some barriers with a mean of 18 barriers per participant. At least three quarters of participants cited outside temperature (82%), cold temperatures inside the workplace (76%), and household work (76%), as barriers. The next most common barriers were using both hands (64%), arranging and taking part in social activities (64%), being able to provide self-care (61%) and working 8 hours (58%). Participants reported a wide range of barriers, from cold temperatures, to physical job, fatigue related, and non-workplace demands, in maintaining the worker role. The barriers reflect the disease symptoms they reported. Identifying workplace barriers facilitates the creation of job accommodations or adaptations that will allow people with SSc to continue working.
Stelton, Susan; Zulkowski, Karen; Ayello, Elizabeth A
2015-06-01
All persons with an ostomy are at risk for development of peristomal skin problems. This is true regardless of the person's nation of residence, type of stoma, or supplies available for stoma care. There are measures that can be taken to lessen the potential for peristomal skin problems. These measures include preoperative stoma site marking, preoperative education, appropriate pouch/barrier fitting, and pouch maintenance. The 2014 World Council of Enterostomal Therapists International Ostomy Guideline includes recommendations that can be implemented to prevent situations that may lead to peristomal skin complications.
Skin fragility syndrome in a cat with feline infectious peritonitis and hepatic lipidosis.
Trotman, Tara K; Mauldin, Elizabeth; Hoffmann, Vickie; Del Piero, Fabio; Hess, Rebecka S
2007-10-01
A 6-year-old spayed female domestic shorthair cat with a 3-week history of inappetence, weight loss, and hiding was examined. A palpable abdominal fluid wave, dehydration, and a small tear on the left flank were noted during initial examination. When the cat was gently restrained for blood sampling, the skin on the dorsal neck tore, leaving a 15 cm x 7 cm flap of skin. Clinicopathological abnormalities included nonregenerative anaemia, hypoalbuminaemia, increased globulin concentration, and mildly elevated aspartate aminotransferase and alkaline phosphatase activities. Abdominal fluid was viscous and had a total protein of 5.3 g dL(-1) with 316 cells microL(-1), consistent with a modified transudate. Cytology of the abdominal fluid revealed 86% nondegenerate neutrophils, 13% macrophages, and 1% small lymphocytes. Histopathological evaluation and indirect immunohistochemistry confirmed a diagnosis of feline infectious peritonitis, hepatic lipidosis and feline skin fragility syndrome. Feline skin fragility syndrome has not previously been reported in association with feline infectious peritonitis (FIP). Its inclusion as a clinical sign associated with FIP may facilitate a diagnosis.
El sol: ¿enemigo de nuestra piel? The sun: enemy of our skin?
Directory of Open Access Journals (Sweden)
Moraima Mora Ochoa
Full Text Available Actualmente existe una elevada mortalidad y morbilidad por cáncer de piel, lo cual representa un grave problema que va en aumento; por tal razón, en el presente estudio se revisó la bibliografía especializada sobre algunos aspectos de interés, tales como: interacción de las radiaciones solares sobre esta parte del organismo, efectos beneficiosos y perjudiciales, respuestas cutáneas normales y anormales, relación entre el cáncer de piel y las radiaciones ultravioletas, así como medidas de protección solar, las cuales permitirán mantener una piel sana y saludable.Currently, there is a high mortality and morbidity due to skin cancer, which represents an increasingly serious problem. Therefore, this study reviewed the specialized literature on some aspects of interest such as interaction of solar radiations on this part of the body, beneficial and harmful effects, normal and abnormal skin responses, relationship between skin cancer and ultraviolet radiations, as well as sun protection measures, which will allow us to maintain a healthy skin.
DEFF Research Database (Denmark)
Simonsen, A B; Johansen, J D; Deleuran, M
2017-01-01
BACKGROUND: Whether children with atopic dermatitis have an altered risk of contact allergy than children without atopic dermatitis is frequently debated and studies have been conflicting. Theoretically, the impaired skin barrier in AD facilitates the penetration of potential allergens and several...... authors have highlighted the risk of underestimating and overlooking contact allergy in children with atopic dermatitis. OBJECTIVE: To determine the prevalence of contact allergy in Danish children with atopic dermatitis and explore the problem of unacknowledged allergies maintaining or aggravating...... one contact allergy that was relevant to the current skin symptoms. The risk of contact allergy was significantly correlated to the severity of atopic dermatitis. Metals and components of topical skin care products were the most frequent sensitizers. CONCLUSION: Patch testing is relevant...
Carley, Alexandra; Stratman, Erik
2015-01-01
Farmers have substantial sun exposure and increased skin cancer risk but poor sun protection practices. There are few studies regarding the underlying factors that contribute to inadequate skin cancer prevention practices in the farming population, and minimal data to guide skin cancer awareness and educational interventions for this population. The purpose of this study was to assess skin cancer knowledge, sun protection behaviors and barriers, health care information sources, and the impact of skin cancer screening among midwestern farmers and nonfarmers. Individuals attending a free skin cancer screening during 2011 Wisconsin Farm Technology Days were surveyed for self-reported sun protection use, extent of sun exposure, and skin cancer and sun protection beliefs and knowledge. A total of 476 individuals participated in the study, including 194 farmers. Although farmers identified sun protection benefits, few reported optimal practices, with only 23% of farmers reporting sunscreen use always or frequently when out in the sun for 15 minutes or more. Common barriers to sun protection included discomfort with wearing long pants and long shirts, forgetfulness with sunscreen use, and inconvenience with wearing wide-brimmed hats. Higher knowledge scores in farmers were associated with better sun protection. Farmers utilized different sources of health care information compared with nonfarmers, including farm magazines and newspapers, radio, and farm organizations. Providers should consider the unique characteristics of the farming population to provide skin cancer prevention education that is tailored to the needs of this population, such as reminders for sunscreen use and resources for sun-protective hats that do not interfere with work. Among individuals without prior history of skin cancer, 34% of farmers and 22% of nonfarmers (P = .0127) were referred for additional evaluation due to identification of a concerning lesion at the screening event. Thus, farmers may
Directory of Open Access Journals (Sweden)
Lalita Subedi
2017-01-01
Full Text Available The skin is the outermost protective barrier between the internal and external environments in humans. Chronic exposure to ultraviolet (UV radiation is a major cause of skin aging. UVB radiation penetrates the skin and induces ROS production that activates three major skin aging cascades: matrix metalloproteinase- (MMP- 1-mediated aging; MAPK-AP-1/NF-κB-TNF-α/IL-6, iNOS, and COX-2-mediated inflammation-induced aging; and p53-Bax-cleaved caspase-3-cytochrome C-mediated apoptosis-induced aging. These mechanisms are collectively responsible for the wrinkling and photoaging characteristic of UVB-induced skin aging. There is an urgent requirement for a treatment that not only controls these pathways to prevent skin aging but also avoids the adverse effects often encountered when applying bioactive compounds in concentrated doses. In this study, we investigated the efficacy of genetically modified normal edible rice (NR that produces the antiaging compound resveratrol (R as a treatment for skin aging. This resveratrol-enriched rice (RR overcomes the drawbacks of R and enhances its antiaging potential by controlling the abovementioned three major pathways of skin aging. RR does not exhibit the toxicity of R alone and promisingly downregulates the pathways underlying UVB-ROS-induced skin aging. These findings advocate the use of RR as a nutraceutical for antiaging purposes.
Reversible voltage dependent transition of abnormal and normal bipolar resistive switching.
Wang, Guangyu; Li, Chen; Chen, Yan; Xia, Yidong; Wu, Di; Xu, Qingyu
2016-11-14
Clear understanding the mechanism of resistive switching is the important prerequisite for the realization of high performance nonvolatile resistive random access memory. In this paper, binary metal oxide MoO x layer sandwiched by ITO and Pt electrodes was taken as a model system, reversible transition of abnormal and normal bipolar resistive switching (BRS) in dependence on the maximum voltage was observed. At room temperature, below a critical maximum voltage of 2.6 V, butterfly shaped I-V curves of abnormal BRS has been observed with low resistance state (LRS) to high resistance state (HRS) transition in both polarities and always LRS at zero field. Above 2.6 V, normal BRS was observed, and HRS to LRS transition happened with increasing negative voltage applied. Temperature dependent I-V measurements showed that the critical maximum voltage increased with decreasing temperature, suggesting the thermal activated motion of oxygen vacancies. Abnormal BRS has been explained by the partial compensation of electric field from the induced dipoles opposite to the applied voltage, which has been demonstrated by the clear amplitude-voltage and phase-voltage hysteresis loops observed by piezoelectric force microscopy. The normal BRS was due to the barrier modification at Pt/MoO x interface by the accumulation and depletion of oxygen vacancies.
Energy Technology Data Exchange (ETDEWEB)
Alves, Vinicius M. [Laboratory of Molecular Modeling and Design, Faculty of Pharmacy, Federal University of Goiás, Goiânia, GO 74605-220 (Brazil); Laboratory for Molecular Modeling, Division of Chemical Biology and Medicinal Chemistry, Eshelman School of Pharmacy, University of North Carolina, Chapel Hill, NC 27599 (United States); Muratov, Eugene [Laboratory for Molecular Modeling, Division of Chemical Biology and Medicinal Chemistry, Eshelman School of Pharmacy, University of North Carolina, Chapel Hill, NC 27599 (United States); Laboratory of Theoretical Chemistry, A.V. Bogatsky Physical–Chemical Institute NAS of Ukraine, Odessa 65080 (Ukraine); Fourches, Denis [Laboratory for Molecular Modeling, Division of Chemical Biology and Medicinal Chemistry, Eshelman School of Pharmacy, University of North Carolina, Chapel Hill, NC 27599 (United States); Strickland, Judy; Kleinstreuer, Nicole [ILS/Contractor supporting the NTP Interagency Center for the Evaluation of Alternative Toxicological Methods (NICEATM), P.O. Box 13501, Research Triangle Park, NC 27709 (United States); Andrade, Carolina H. [Laboratory of Molecular Modeling and Design, Faculty of Pharmacy, Federal University of Goiás, Goiânia, GO 74605-220 (Brazil); Tropsha, Alexander, E-mail: alex_tropsha@unc.edu [Laboratory for Molecular Modeling, Division of Chemical Biology and Medicinal Chemistry, Eshelman School of Pharmacy, University of North Carolina, Chapel Hill, NC 27599 (United States)
2015-04-15
Skin permeability is widely considered to be mechanistically implicated in chemically-induced skin sensitization. Although many chemicals have been identified as skin sensitizers, there have been very few reports analyzing the relationships between molecular structure and skin permeability of sensitizers and non-sensitizers. The goals of this study were to: (i) compile, curate, and integrate the largest publicly available dataset of chemicals studied for their skin permeability; (ii) develop and rigorously validate QSAR models to predict skin permeability; and (iii) explore the complex relationships between skin sensitization and skin permeability. Based on the largest publicly available dataset compiled in this study, we found no overall correlation between skin permeability and skin sensitization. In addition, cross-species correlation coefficient between human and rodent permeability data was found to be as low as R{sup 2} = 0.44. Human skin permeability models based on the random forest method have been developed and validated using OECD-compliant QSAR modeling workflow. Their external accuracy was high (Q{sup 2}{sub ext} = 0.73 for 63% of external compounds inside the applicability domain). The extended analysis using both experimentally-measured and QSAR-imputed data still confirmed the absence of any overall concordance between skin permeability and skin sensitization. This observation suggests that chemical modifications that affect skin permeability should not be presumed a priori to modulate the sensitization potential of chemicals. The models reported herein as well as those developed in the companion paper on skin sensitization suggest that it may be possible to rationally design compounds with the desired high skin permeability but low sensitization potential. - Highlights: • It was compiled the largest publicly-available skin permeability dataset. • Predictive QSAR models were developed for skin permeability. • No concordance between skin
International Nuclear Information System (INIS)
Alves, Vinicius M.; Muratov, Eugene; Fourches, Denis; Strickland, Judy; Kleinstreuer, Nicole; Andrade, Carolina H.; Tropsha, Alexander
2015-01-01
Skin permeability is widely considered to be mechanistically implicated in chemically-induced skin sensitization. Although many chemicals have been identified as skin sensitizers, there have been very few reports analyzing the relationships between molecular structure and skin permeability of sensitizers and non-sensitizers. The goals of this study were to: (i) compile, curate, and integrate the largest publicly available dataset of chemicals studied for their skin permeability; (ii) develop and rigorously validate QSAR models to predict skin permeability; and (iii) explore the complex relationships between skin sensitization and skin permeability. Based on the largest publicly available dataset compiled in this study, we found no overall correlation between skin permeability and skin sensitization. In addition, cross-species correlation coefficient between human and rodent permeability data was found to be as low as R 2 = 0.44. Human skin permeability models based on the random forest method have been developed and validated using OECD-compliant QSAR modeling workflow. Their external accuracy was high (Q 2 ext = 0.73 for 63% of external compounds inside the applicability domain). The extended analysis using both experimentally-measured and QSAR-imputed data still confirmed the absence of any overall concordance between skin permeability and skin sensitization. This observation suggests that chemical modifications that affect skin permeability should not be presumed a priori to modulate the sensitization potential of chemicals. The models reported herein as well as those developed in the companion paper on skin sensitization suggest that it may be possible to rationally design compounds with the desired high skin permeability but low sensitization potential. - Highlights: • It was compiled the largest publicly-available skin permeability dataset. • Predictive QSAR models were developed for skin permeability. • No concordance between skin sensitization and
Gad, Alona; Laurino, Mercy; Maravilla, Kenneth R; Matsushita, Mark; Raskind, Wendy H
2008-07-15
The Waardenburg syndromes (WS) account for approximately 2% of congenital sensorineural deafness. This heterogeneous group of diseases currently can be categorized into four major subtypes (WS types 1-4) on the basis of characteristic clinical features. Multiple genes have been implicated in WS, and mutations in some genes can cause more than one WS subtype. In addition to eye, hair, and skin pigmentary abnormalities, dystopia canthorum and broad nasal bridge are seen in WS type 1. Mutations in the PAX3 gene are responsible for the condition in the majority of these patients. In addition, mutations in PAX3 have been found in WS type 3 that is distinguished by musculoskeletal abnormalities, and in a family with a rare subtype of WS, craniofacial-deafness-hand syndrome (CDHS), characterized by dysmorphic facial features, hand abnormalities, and absent or hypoplastic nasal and wrist bones. Here we describe a woman who shares some, but not all features of WS type 3 and CDHS, and who also has abnormal cranial bones. All sinuses were hypoplastic, and the cochlea were small. No sequence alteration in PAX3 was found. These observations broaden the clinical range of WS and suggest there may be genetic heterogeneity even within the CDHS subtype. 2008 Wiley-Liss, Inc.
Mechanoregulation of Wound Healing and Skin Homeostasis
Directory of Open Access Journals (Sweden)
Joanna Rosińczuk
2016-01-01
Full Text Available Basic and clinical studies on mechanobiology of cells and tissues point to the importance of mechanical forces in the process of skin regeneration and wound healing. These studies result in the development of new therapies that use mechanical force which supports effective healing. A better understanding of mechanobiology will make it possible to develop biomaterials with appropriate physical and chemical properties used to treat poorly healing wounds. In addition, it will make it possible to design devices precisely controlling wound mechanics and to individualize a therapy depending on the type, size, and anatomical location of the wound in specific patients, which will increase the clinical efficiency of the therapy. Linking mechanobiology with the science of biomaterials and nanotechnology will enable in the near future precise interference in abnormal cell signaling responsible for the proliferation, differentiation, cell death, and restoration of the biological balance. The objective of this study is to point to the importance of mechanobiology in regeneration of skin damage and wound healing. The study describes the influence of rigidity of extracellular matrix and special restrictions on cell physiology. The study also defines how and what mechanical changes influence tissue regeneration and wound healing. The influence of mechanical signals in the process of proliferation, differentiation, and skin regeneration is tagged in the study.
The distribution of free calcium ions in the cholesteatoma epithelium
DEFF Research Database (Denmark)
Svane-Knudsen, Viggo; Rasmussen, Gurli; Ottosen, Peter D
2005-01-01
The distribution of free calcium ions in normal skin and cholesteatoma epithelium was investigated using the oxalate precipitation method. In agreement with previous observations, we could demonstrate a calcium ion gradient in normal epidermis where the cells in stratum basale and spinosum reside...... appeared where oblong accumulations of free calcium ions were found basally in the stratum. These findings provide evidence that fluctuations in epidermal calcium in cholesteatoma epithelium may underlie the abnormal desquamation, may contribute to the formation of an abnormal permeability barrier and may...
Rasmussen, Cathy A; Allen-Hoffmann, B Lynn
2012-04-01
For patients suffering from catastrophic burns, few treatment options are available. Chimeric coculture of patient-derived autologous cells with a "carrier" cell source of allogeneic keratinocytes has been proposed as a means to address the complex clinical problem of severe skin loss. Currently, autologous keratinocytes are harvested, cultured, and expanded to form graftable epidermal sheets. However, epidermal sheets are thin, are extremely fragile, and do not possess barrier function, which only develops as skin stratifies and matures. Grafting is typically delayed for up to 4 weeks to propagate a sufficient quantity of the patient's cells for application to wound sites. Fully stratified chimeric bioengineered skin substitutes could not only provide immediate wound coverage and restore barrier function, but would simultaneously deliver autologous keratinocytes to wounds. The ideal allogeneic cell source for this application would be an abundant supply of clinically evaluated, nontumorigenic, pathogen-free, human keratinocytes. To evaluate this potential cell-based therapy, mixed populations of a green fluorescent protein-labeled neonatal human keratinocyte cell line (NIKS) and unlabeled primary keratinocytes were used to model the allogeneic and autologous components of chimeric monolayer and organotypic cultures. Relatively few autologous keratinocytes may be required to produce fully stratified chimeric skin substitute tissue substantially composed of autologous keratinocyte-derived regions. The need for few autologous cells interspersed within an allogeneic "carrier" cell population may decrease cell expansion time, reducing the time to patient application. This study provides proof of concept for utilizing NIKS keratinocytes as the allogeneic carrier for the generation of bioengineered chimeric skin substitute tissues capable of providing immediate wound coverage while simultaneously supplying autologous human cells for tissue regeneration.
Claudins 1, 2, 3, 4, 5 and 7 in solar keratosis and squamocellular carcinoma of the skin
Hintsala, Hanna-Riikka; Siponen, Maria; Haapasaari, Kirsi-Maria; Karihtala, Peeter; Soini, Ylermi
2013-01-01
Claudins are tight junction proteins regulating the paracellular permeability of cell layers. We investigated the expression of claudins 1, 2, 3, 4, 5 and 7 in a sample set consisting of a total of 93 cases representing normal skin, actinic keratoses and squamous cell carcinomas of the skin. There were several changes found in claudin expression. Claudin 1 appeared to be progressively decreased in solar keratosis and skin squamous cell carcinomas compared to normal skin while expression of claudin 2 was increased. With claudins 3 and 5 occasional immunoreactivity was found in squamous cell carcinomas. Claudins 4 and 7 were variably expressed in skin neoplasia compared to normal skin. According to the results expression of claudins 1 and 2 change in parallel with the severity of the epidermal preneoplastic and neoplastic lesions thus probably influencing the disturbed epithelial polarity characteristic of these lesions. Claudin 1 under- and claudin 2 overexpression also lead to a leakier epithelial barrier function of the skin with a resulting damage to skin epithelial resistance. Other claudins investigated in this study did not show progressive changes even though occasional overexpression of them was found in skin squamous cell carcinoma. PMID:24294371
Igawa, Satomi; Kishibe, Mari; Honma, Masaru; Murakami, Masamoto; Mizuno, Yuki; Suga, Yasushi; Seishima, Mariko; Ohguchi, Yuka; Akiyama, Masashi; Hirose, Kenji; Ishida-Yamamoto, Akemi; Iizuka, Hajime
2013-10-01
Atopic dermatitis (AD), Netherton syndrome (NS) and peeling skin syndrome type B (PSS) may show some clinical phenotypic overlap. Corneodesmosomes are crucial for maintaining stratum corneum integrity and the components' localization can be visualized by immunostaining tape-stripped corneocytes. In normal skin, they are detected at the cell periphery. To determine whether AD, NS, PSS and ichthyosis vulgaris (IV) have differences in the corneodesmosomal components' distribution and corneocytes surface areas. Corneocytes were tape-stripped from a control group (n=12) and a disease group (37 AD cases, 3 IV cases, 4 NS cases, and 3 PSS cases), and analyzed with immunofluorescent microscopy. The distribution patterns of corneodesmosomal components: desmoglein 1, corneodesmosin, and desmocollin 1 were classified into four types: peripheral, sparse diffuse, dense diffuse and partial diffuse. Corneocyte surface areas were also measured. The corneodesmosome staining patterns were abnormal in the disease group. Other than in the 3 PSS cases, all three components showed similar patterns in each category. In lesional AD skin, the dense diffuse pattern was prominent. A high rate of the partial diffuse pattern, loss of linear cell-cell contacts, and irregular stripping manners were unique to NS. Only in PSS was corneodesmosin staining virtually absent. The corneocyte surface areas correlated significantly with the rate of combined sparse and dense diffuse patterns of desmoglein 1. This method may be used to assess abnormally differentiated corneocytes in AD and other diseases tested. In PSS samples, tape stripping analysis may serve as a non-invasive diagnostic test. Copyright © 2013 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.
International Nuclear Information System (INIS)
Neep, Michael J.; Steffens, Tom; Owen, Rebecca; McPhail, Steven M.
2014-01-01
Radiographer abnormality detection systems that highlight abnormalities on trauma radiographs ('red dot' system) have been operating for more than 30 years. Recently, a number of pitfalls have been identified. These limitations initiated the evolution of a radiographer commenting system, whereby a radiographer provides a brief description of abnormalities identified in emergency healthcare settings. This study investigated radiographers' participation in abnormality detection systems, their perceptions of benefits, barriers and enablers to radiographer commenting, and perceptions of potential radiographer image interpretation services for emergency settings. A cross-sectional survey was implemented. Participants included radiographers from four metropolitan hospitals in Queensland, Australia. Conventional descriptive statistics, histograms and thematic analysis were undertaken. Seventy-three surveys were completed and included in the analysis (68% response rate); 30 (41%) of respondents reported participating in abnormality detection in 20% or less of examinations, and 26(36%) reported participating in 80% or more of examinations. Five overarching perceived benefits of radiographer commenting were identified: assisting multidisciplinary teams, patient care, radiographer ability, professional benefits and quality of imaging. Frequently reported perceived barriers included 'difficulty accessing image interpretation education', 'lack of time' and 'low confidence in interpreting radiographs'. Perceived enablers included 'access to image interpretation education' and 'support from radiologist colleagues'. A range of factors are likely to contribute to the successful implementation of radiographer commenting in addition to abnormality detection in emergency settings. Effective image interpretation education amenable to completion by radiographers would likely prove valuable in preparing radiographers for participation in abnormality detection and commenting systems in
Skin transplant; Skin autografting; FTSG; STSG; Split thickness skin graft; Full thickness skin graft ... donor site. Most people who are having a skin graft have a split-thickness skin graft. This takes ...
Abnormal pigmentation within cutaneous scars: A complication of wound healing
Directory of Open Access Journals (Sweden)
Sarah Chadwick
2012-01-01
Full Text Available Abnormally pigmented scars are an undesirable consequence of cutaneous wound healing and are a complication every single individual worldwide is at risk of. They present a challenge for clinicians, as there are currently no definitive treatment options available, and render scars much more noticeable making them highly distressing for patients. Despite extensive research into both wound healing and the pigment cell, there remains a scarcity of knowledge surrounding the repigmentation of cutaneous scars. Pigment production is complex and under the control of many extrinsic and intrinsic factors and patterns of scar repigmentation are unpredictable. This article gives an overview of human skin pigmentation, repigmentation following wounding and current treatment options.
Sarcoptes scabiei mites modulate gene expression in human skin equivalents.
Directory of Open Access Journals (Sweden)
Marjorie S Morgan
Full Text Available The ectoparasitic mite, Sarcoptes scabiei that burrows in the epidermis of mammalian skin has a long co-evolution with its hosts. Phenotypic studies show that the mites have the ability to modulate cytokine secretion and expression of cell adhesion molecules in cells of the skin and other cells of the innate and adaptive immune systems that may assist the mites to survive in the skin. The purpose of this study was to identify genes in keratinocytes and fibroblasts in human skin equivalents (HSEs that changed expression in response to the burrowing of live scabies mites. Overall, of the more than 25,800 genes measured, 189 genes were up-regulated >2-fold in response to scabies mite burrowing while 152 genes were down-regulated to the same degree. HSEs differentially expressed large numbers of genes that were related to host protective responses including those involved in immune response, defense response, cytokine activity, taxis, response to other organisms, and cell adhesion. Genes for the expression of interleukin-1α (IL-1α precursor, IL-1β, granulocyte/macrophage-colony stimulating factor (GM-CSF precursor, and G-CSF precursor were up-regulated 2.8- to 7.4-fold, paralleling cytokine secretion profiles. A large number of genes involved in epithelium development and keratinization were also differentially expressed in response to live scabies mites. Thus, these skin cells are directly responding as expected in an inflammatory response to products of the mites and the disruption of the skin's protective barrier caused by burrowing. This suggests that in vivo the interplay among these skin cells and other cell types, including Langerhans cells, dendritic cells, lymphocytes and endothelial cells, is responsible for depressing the host's protective response allowing these mites to survive in the skin.
Skin Diseases: Cross-section of human skin
Skip Navigation Bar Home Current Issue Past Issues Skin Diseases Cross-section of human skin Past Issues / Fall 2008 Table of Contents For ... Logical Images, Inc. I n the areas of skin health and skin diseases, the NIH's National Institute ...
Directory of Open Access Journals (Sweden)
Inyoung Choi
2017-06-01
Full Text Available Biopolymer films based on apple skin powder (ASP and carboxymethylcellulose (CMC were developed with the addition of apple skin extract (ASE and tartaric acid (TA. ASP/CMC composite films were prepared by mixing CMC with ASP solution using a microfluidization technique to reduce particle size. Then, various concentrations of ASE and TA were incorporated into the film solution as an antioxidant and an antimicrobial agent, respectively. Fourier transform infrared (FTIR, optical, mechanical, water barrier, and solubility properties of the developed films were then evaluated to determine the effects of ASE and TA on physicochemical properties. The films were also analyzed for antioxidant effect on 2,2-diphenyl-1-picrylhydrazyl radical scavenging activity and antimicrobial activities against Listeria monocytogenes, Staphylococcus aureus, Salmonella enterica, and Shigella flexneri. From the results, the ASP/CMC film containing ASE and TA was revealed to enhance the mechanical, water barrier, and solubility properties. Moreover, it showed the additional antioxidant and antimicrobial properties for application as an active packaging film.
Alves, Vinicius M.; Muratov, Eugene; Fourches, Denis; Strickland, Judy; Kleinstreuer, Nicole; Andrade, Carolina H.; Tropsha, Alexander
2015-01-01
Skin permeability is widely considered to be mechanistically implicated in chemically-induced skin sensitization. Although many chemicals have been identified as skin sensitizers, there have been very few reports analyzing the relationships between molecular structure and skin permeability of sensitizers and non-sensitizers. The goals of this study were to: (i) compile, curate, and integrate the largest publicly available dataset of chemicals studied for their skin permeability; (ii) develop and rigorously validate QSAR models to predict skin permeability; and (iii) explore the complex relationships between skin sensitization and skin permeability. Based on the largest publicly available dataset compiled in this study, we found no overall correlation between skin permeability and skin sensitization. In addition, cross-species correlation coefficient between human and rodent permeability data was found to be as low as R2=0.44. Human skin permeability models based on the random forest method have been developed and validated using OECD-compliant QSAR modeling workflow. Their external accuracy was high (Q2ext = 0.73 for 63% of external compounds inside the applicability domain). The extended analysis using both experimentally-measured and QSAR-imputed data still confirmed the absence of any overall concordance between skin permeability and skin sensitization. This observation suggests that chemical modifications that affect skin permeability should not be presumed a priori to modulate the sensitization potential of chemicals. The models reported herein as well as those developed in the companion paper on skin sensitization suggest that it may be possible to rationally design compounds with the desired high skin permeability but low sensitization potential. PMID:25560673
International Nuclear Information System (INIS)
Kersey, J.H.; Kruger, J.; Song, C.; Kloster, B.
1980-01-01
Current studies were designed to provide long-term survival of allogeneic skin and bone marrow in mice preconditioned with various combinations of cyclophosphamide (CY) and/or total lymphoid irradiation (TLI). Long-term skin graft and bone marrow survival was obtained across the major histocompatibility barrier (BALB/c into C57BL/6) using pregrafting conditioning with either fractionated TLI or the combination of CY with a single dose of TLI. CY alone and a single dose of TLI alone were relatively ineffective as regrafting immunosuppressive combinations. Allogeneic bone marrow was required for long-term skin graft survival with either conditioning regimen. Allogeneic marrow transplantation resulted in somewhat more deaths than syngeneic transplantation with both CY + TLI and fractionated TLI
Anisotropy barrier reduction in fast-relaxing Mn12 single-molecule magnets
Hill, Stephen; Murugesu, Muralee; Christou, George
2009-11-01
An angle-swept high-frequency electron paramagnetic resonance (HFEPR) technique is described that facilitates efficient in situ alignment of single-crystal samples containing low-symmetry magnetic species such as single-molecule magnets (SMMs). This cavity-based technique involves recording HFEPR spectra at fixed frequency and field, while sweeping the applied field orientation. The method is applied to the study of a low-symmetry Jahn-Teller variant of the extensively studied spin S=10 Mn12 SMMs (e.g., Mn12 -acetate). The low-symmetry complex also exhibits SMM behavior, but with a significantly reduced effective barrier to magnetization reversal (Ueff≈43K) and, hence, faster relaxation at low temperature in comparison with the higher-symmetry species. Mn12 complexes that crystallize in lower symmetry structures exhibit a tendency for one or more of the Jahn-Teller axes associated with the MnIII atoms to be abnormally oriented, which is believed to be the cause of the faster relaxation. An extensive multi-high-frequency angle-swept and field-swept electron paramagnetic resonance study of [Mn12O12(O2CCH2But)16(H2O)4]ṡCH2Cl2ṡMeNO2 is presented in order to examine the influence of the abnormally oriented Jahn-Teller axis on the effective barrier to magnetization reversal. The reduction in the axial anisotropy, D , is found to be insufficient to account for the nearly 40% reduction in Ueff . However, the reduced symmetry of the Mn12 core gives rise to a very significant second-order transverse (rhombic) zero-field-splitting anisotropy, E≈D/6 . This, in turn, causes a significant mixing of spin projection states well below the top of the classical anisotropy barrier. Thus, magnetic quantum tunneling is the dominant factor contributing to the effective barrier reduction in fast relaxing Mn12 SMMs.
Friends or Foes? Host defense (antimicrobial) peptides and proteins in human skin diseases.
Niyonsaba, François; Kiatsurayanon, Chanisa; Chieosilapatham, Panjit; Ogawa, Hideoki
2017-11-01
Host defense peptides/proteins (HDPs), also known as antimicrobial peptides/proteins (AMPs), are key molecules in the cutaneous innate immune system. AMPs/HDPs historically exhibit broad-spectrum killing activity against bacteria, enveloped viruses, fungi and several parasites. Recently, AMPs/HDPs were shown to have important biological functions, including inducing cell proliferation, migration and differentiation; regulating inflammatory responses; controlling the production of various cytokines/chemokines; promoting wound healing; and improving skin barrier function. Despite the fact that AMPs/HDPs protect our body, several studies have hypothesized that these molecules actively contribute to the pathogenesis of various skin diseases. For example, AMPs/HDPs play crucial roles in the pathological processes of psoriasis, atopic dermatitis, rosacea, acne vulgaris, systemic lupus erythematosus and systemic sclerosis. Thus, AMPs/HDPs may be a double-edged sword, promoting cutaneous immunity while simultaneously initiating the pathogenesis of some skin disorders. This review will describe the most common skin-derived AMPs/HDPs (defensins, cathelicidins, S100 proteins, ribonucleases and dermcidin) and discuss the biology and both the positive and negative aspects of these AMPs/HDPs in skin inflammatory/infectious diseases. Understanding the regulation, functions and mechanisms of AMPs/HDPs may offer new therapeutic opportunities in the treatment of various skin disorders. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
The wow factor as a determinant of funding for disorders of the skin.
Ryan, Terence J
2015-01-01
As people live beyond 100 years, there is an extended period of impaired quality of life for the increasing numbers of individuals with skin disorders. There is also a growing work force of fit elderly individuals who are able to provide low technology skin care and who can teach self-help if well instructed. The International Society of Dermatology's sub-committee Skin Care for All: Community Dermatology seeks to bring together those who care for skin diseases and those who manage wounds, burns, lymphoedema and neglected tropical diseases affecting the skin for the purpose of skin care. Their focus is the repair of four functions: barrier, thermoregulation, sensory perception and communication. The curriculum includes low cost self-help and the restoration of absent skin. The care expectation is one of technical proficiency integrated with kindness and altruism. The concept is attracting wide attention but needs to develop compelling and persuasive arguments ("wow factors") regarding why it should be funded. There is probably no greater wow factor than tracing the path of a severely injured patient from the battlefield through the course of immediate first aid by paramedics to the surgeon in the frontline tent who can almost guarantee survival. Seeing these disfigured persons winning trophies at the Olympic Games has garnered the admiration of millions of viewers.
The wow factor as a determinant of funding for disorders of the skin
Institute of Scientific and Technical Information of China (English)
Terence J Ryan
2015-01-01
As people live beyond 100 years, there is an extended period of impaired quality of life for the increasing numbers of individuals with skin disorders. There is also a growing work force of fit elderly individuals who are able to provide low technology skin care and who can teach self-help if well instructed. The International Society of Dermatology’s sub-committee Skin Care for All: Community Dermatology seeks to bring together those who care for skin diseases and those who manage wounds, burns, lymphoedema and neglected tropical diseases affecting the skin for the purpose of skin care. Their focus is the repair of four functions: barrier, thermoregulation, sensory perception and communication. The curriculum includes low cost self-help and the restoration of absent skin. The care expectation is one of technical proficiency integrated with kindness and altruism. The concept is attracting wide attention but needs to develop compelling and persuasive arguments (“wow factors”) regarding why it should be funded. There is probably no greater wow factor than tracing the path of a severely injured patient from the battlefield through the course of immediate first aid by paramedics to the surgeon in the frontline tent who can almost guarantee survival. Seeing these disfigured persons winning trophies at the Olympic Games has garnered the admiration of millions of viewers.
Pan, Tai-Long; Wang, Pei-Wen; Aljuffali, Ibrahim A; Hung, Yi-Yun; Lin, Chwan-Fwu; Fang, Jia-You
2014-03-01
The toxicity of phthalates is an important concern in the fields of environmental health and toxicology. Dermal exposure via skin care products, soil, and dust is a main route for phthalate delivery. We had explored the effect of topically-applied phthalates on skin absorption and toxicity. Immunohistology, functional proteomics, and Western blotting were employed as methodologies for validating phthalate toxicity. Among 5 phthalates tested, di(2-ethylhexyl)phthalate (DEHP) showed the highest skin reservoir. Only diethyl phthalate (DEP) and dibutyl phthalate (DBP) could penetrate across skin. Strat-M(®) membrane could be used as permeation barrier for predicting phthalate penetration through skin. The accumulation of DEHP in hair follicles was ∼15nmol/cm(2), which was significantly greater than DBP and DEP. DBP induced apoptosis of keratinocytes and fibroblasts via caspase-3 activation. This result was confirmed by downregulation of 14-3-3 and immunohistology of TUNEL. On the other hand, the HSP60 overexpression and immunostaining of COX-2 suggested inflammatory response induced by DEP and DEHP. The proteomic profiling verified the role of calcium homeostasis on skin inflammation. Some proteins investigated in this study can be sensitive biomarkers for dermal toxicity of phthalates. These included HSPs, 14-3-3, and cytokeratin. This work provided novel platforms for examining phthalate toxicity on skin. Copyright © 2013 Elsevier Ltd. All rights reserved.
Universal in vivo Textural Model for Human Skin based on Optical Coherence Tomograms.
Adabi, Saba; Hosseinzadeh, Matin; Noei, Shahryar; Conforto, Silvia; Daveluy, Steven; Clayton, Anne; Mehregan, Darius; Nasiriavanaki, Mohammadreza
2017-12-20
Currently, diagnosis of skin diseases is based primarily on the visual pattern recognition skills and expertise of the physician observing the lesion. Even though dermatologists are trained to recognize patterns of morphology, it is still a subjective visual assessment. Tools for automated pattern recognition can provide objective information to support clinical decision-making. Noninvasive skin imaging techniques provide complementary information to the clinician. In recent years, optical coherence tomography (OCT) has become a powerful skin imaging technique. According to specific functional needs, skin architecture varies across different parts of the body, as do the textural characteristics in OCT images. There is, therefore, a critical need to systematically analyze OCT images from different body sites, to identify their significant qualitative and quantitative differences. Sixty-three optical and textural features extracted from OCT images of healthy and diseased skin are analyzed and, in conjunction with decision-theoretic approaches, used to create computational models of the diseases. We demonstrate that these models provide objective information to the clinician to assist in the diagnosis of abnormalities of cutaneous microstructure, and hence, aid in the determination of treatment. Specifically, we demonstrate the performance of this methodology on differentiating basal cell carcinoma (BCC) and squamous cell carcinoma (SCC) from healthy tissue.
Evaluation of skin absorption of drugs from topical and transdermal formulations
Directory of Open Access Journals (Sweden)
André Luís Morais Ruela
Full Text Available ABSTRACT The skin barrier function has been attributed to the stratum corneum and represents a major challenge in clinical practice pertaining to cutaneous administration of drugs. Despite this, a large number of bioactive compounds have been successfully administered via cutaneous administration because of advances in the design of topical and transdermal formulations. In vitro and in vivo evaluations of these novel drug delivery systems are necessary to characterize their quality and efficacy. This review covers the most well-known methods for assessing the cutaneous absorption of drugs as an auxiliary tool for pharmaceutical formulation scientists in the design of drug delivery systems. In vitro methods as skin permeation assays using Franz-type diffusion cells, cutaneous retention and tape-stripping methods to study the cutaneous penetration of drugs, and in vivo evaluations as pre-clinical pharmacokinetic studies in animal models are discussed. Alternative approaches to cutaneous microdialysis are also covered. Recent advances in research on skin absorption of drugs and the effect of skin absorption enhancers, as investigated using confocal laser scanning microscopy, Raman confocal microscopy, and attenuated total reflectance Fourier-transform infrared spectroscopy, are reviewed.
Role of airway epithelial barrier dysfunction in pathogenesis of asthma.
Gon, Yasuhiro; Hashimoto, Shu
2018-01-01
Bronchial asthma is characterized by persistent cough, increased sputum, and repeated wheezing. The pathophysiology underlying these symptoms is the hyper-responsiveness of the airway along with chronic airway inflammation. Repeated injury, repair, and regeneration of the airway epithelium following exposure to environmental factors and inflammation results in histological changes and functional abnormalities in the airway mucosal epithelium; such changes are believed to have a significant association with the pathophysiology of asthma. Damage to the barrier functions of the airway epithelium enhances mucosal permeability of foreign substances in the airway epithelium of patients with asthma. Thus, epithelial barrier fragility is closely involved in releasing epithelial cytokines (e.g., TSLP, IL-25, and IL-33) because of the activation of airway epithelial cells, dendritic cells, and innate group 2 innate lymphoid cells (ILC2). Functional abnormalities of the airway epithelial cells along with the activation of dendritic cells, Th2 cells, and ILC2 form a single immunopathological unit that is considered to cause allergic airway inflammation. Here we use the latest published literature to discuss the potential pathological mechanisms regarding the onset and progressive severity of asthma with regard to the disruption of the airway epithelial function. Copyright © 2017 Japanese Society of Allergology. Production and hosting by Elsevier B.V. All rights reserved.
Kangaroo mother care: a systematic review of barriers and enablers.
Chan, Grace J; Labar, Amy S; Wall, Stephen; Atun, Rifat
2016-02-01
To investigate factors influencing the adoption of kangaroo mother care in different contexts. We searched PubMed, Embase, Scopus, Web of Science and the World Health Organization's regional databases, for studies on "kangaroo mother care" or "kangaroo care" or "skin-to-skin care" from 1 January 1960 to 19 August 2015, without language restrictions. We included programmatic reports and hand-searched references of published reviews and articles. Two independent reviewers screened articles and extracted data on carers, health system characteristics and contextual factors. We developed a conceptual model to analyse the integration of kangaroo mother care in health systems. We screened 2875 studies and included 112 studies that contained qualitative data on implementation. Kangaroo mother care was applied in different ways in different contexts. The studies show that there are several barriers to implementing kangaroo mother care, including the need for time, social support, medical care and family acceptance. Barriers within health systems included organization, financing and service delivery. In the broad context, cultural norms influenced perceptions and the success of adoption. Kangaroo mother care is a complex intervention that is behaviour driven and includes multiple elements. Success of implementation requires high user engagement and stakeholder involvement. Future research includes designing and testing models of specific interventions to improve uptake.
Blood-CNS Barrier Impairment in ALS Patients versus an Animal Model
Directory of Open Access Journals (Sweden)
Svitlana eGarbuzova-Davis
2014-02-01
Full Text Available Amyotrophic lateral sclerosis (ALS is a severe neurodegenerative disease with a compli-cated and poorly understood pathogenesis. Recently, alterations in the blood-Central Nervous System barrier (B-CNS-B have been recognized as a key factor possibly aggravating motor neuron damage. The majority of findings on ALS microvascular pathology have been deter-mined in mutant SOD1 rodent models, identifying barrier damage during disease develop-ment which might similarly occur in familial ALS patients carrying the SOD1 mutation. However, our knowledge of B-CNS-B competence in sporadic ALS (SALS has been limited. We recently showed structural and functional impairment in postmortem gray and white mat-ter microvessels of medulla and spinal cord tissue from SALS patients, suggesting pervasive barrier damage. Although numerous signs of barrier impairment (endothelial cell degenera-tion, capillary leakage, perivascular edema, downregulation of tight junction proteins, and microhemorrhages are indicated in both mutant SOD1 animal models of ALS and SALS pa-tients, other pathogenic barrier alterations have as yet only been identified in SALS patients. Pericyte degeneration, perivascular collagen IV expansion, and white matter capillary abnor-malities in SALS patients are significant barrier related pathologies yet to be noted in ALS SOD1 animal models. In the current review, these important differences in blood-CNS barrier damage between ALS patients and animal models, which may signify altered barrier transport mechanisms, are discussed. Understanding discrepancies in barrier condition between ALS patients and animal models may be crucial for developing effective therapies.
Directory of Open Access Journals (Sweden)
Shun Kitaba
2011-01-01
Full Text Available We report four adult cases of atopic dermatitis (AD complicated by Sjogren's syndrome (SS. The patients fulfilled diagnostic criteria for AD and SS. All cases showed persistent itchy dry skin and eczematous lesions complicated by sicca symptoms including dry eyes and dry mouth with moderate joint pain. One case manifested annular erythema and another manifested widespread discoid erythema. To investigate the underlying cause of dry skin in these cases, sweating function was evaluated using a quantitative sudomotor axon reflex test (QSART in which the axon reflex is stimulated by acetylcholine iontophoresis. The sweating latency time was significantly prolonged in eczematous skin of AD and AD/SS compared to normal controls. Axon reflex (AXR sweat volume was also significantly reduced in AD (normal and eczematous skin and AD/SS (normal and eczema compared to normal control. In contrast, the direct sweat volume of lesional or non-lesional AD skin induced by direct stimulation with acetylcholine was only slightly reduced compared to that in normal controls, but not in SS and lesional skin of AD/SS patients. These results suggest that the impaired sweat response in AD is attributable to an abnormal sudomotor axon reflex, which is accelerated and modulated when complicated by SS resulting in dry skin in the present cases.
Spiritual and religious aspects of skin and skin disorders
Directory of Open Access Journals (Sweden)
Shenefelt PD
2014-08-01
Full Text Available Philip D Shenefelt,1 Debrah A Shenefelt2 1Dermatology and Cutaneous Surgery, University of South Florida, Tampa, 2Congregation Or Ahavah, Lutz, FL, USA Abstract: Skin and skin disorders have had spiritual aspects since ancient times. Skin, hair, and nails are visible to self and others, and touchable by self and others. The skin is a major sensory organ. Skin also expresses emotions detectable by others through pallor, coldness, "goose bumps", redness, warmth, or sweating. Spiritual and religious significances of skin are revealed through how much of the skin has been and continues to be covered with what types of coverings, scalp and beard hair cutting, shaving and styling, skin, nail, and hair coloring and decorating, tattooing, and intentional scarring of skin. Persons with visible skin disorders have often been stigmatized or even treated as outcasts. Shamans and other spiritual and religious healers have brought about healing of skin disorders through spiritual means. Spiritual and religious interactions with various skin disorders such as psoriasis, leprosy, and vitiligo are discussed. Religious aspects of skin and skin diseases are evaluated for several major religions, with a special focus on Judaism, both conventional and kabbalistic. Keywords: skin, skin disorders, spiritual, religious
Energy Technology Data Exchange (ETDEWEB)
Neubeck, Claere von [German Cancer Consortium DKTK partner site Dresden, OncoRay - National Center for Radiation Research in Oncology, Faculty of Medicine and University Hospital Carl Gustav Carus, Technische Universität Dresden, Fetscherstrasse 74, 01307 Dresden (Germany); German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany); Geniza, Matthew J. [Molecular and Cellular Biology Program, Oregon State University, Corvallis OR 97331 (United States); Kauer, Paula M.; Robinson, R. Joe; Chrisler, William B. [Health Impacts and Exposure Science, Pacific Northwest National Laboratory, Richland WA 99352 (United States); Sowa, Marianne B., E-mail: marianne.sowa@pnnl.gov [Health Impacts and Exposure Science, Pacific Northwest National Laboratory, Richland WA 99352 (United States)
2015-05-15
Highlights: • Low doses of high LET radiation influence skin homeostasis. • Effects on proliferation and differentiation profiles are LET dependent. • Skin barrier function is not compromised following low dose exposure. - Abstract: Outside the protection of Earth's atmosphere, astronauts are exposed to low doses of high linear energy transfer (LET) radiation. Future NASA plans for deep space missions or a permanent settlement on the moon are limited by the health risks associated with space radiation exposures. There is a paucity of direct epidemiological data for low dose exposures to space radiation-relevant high LET ions. Health risk models are used to estimate the risk for such exposures, though these models are based on high dose experiments. There is increasing evidence, however, that low and high dose exposures result in different signaling events at the molecular level, and may involve different response mechanisms. Further, despite their low abundance, high LET particles have been identified as the major contributor to health risk during manned space flight. The human skin is exposed in every external radiation scenario, making it an ideal epithelial tissue model in which to study radiation induced effects. Here, we exposed an in vitro three dimensional (3-D) human organotypic skin tissue model to low doses of high LET oxygen (O), silicon (Si) and iron (Fe) ions. We measured proliferation and differentiation profiles in the skin tissue and examined the integrity of the skin's barrier function. We discuss the role of secondary particles in changing the proportion of cells receiving a radiation dose, emphasizing the possible impact on radiation-induced health issues in astronauts.
Boonchai, Waranya; Sathaworawong, Angkana; Wongpraparut, Chanisada; Wanitphakdeedecha, Rungsima
2015-10-01
Ablative fractional skin resurfacing has become popular and proven to be useful in treating scars, photoaging and wrinkles. Although post-inflammatory hyperpigmentation (PIH) is the most common complication especially in dark-skinned patients like Asian. Several modalities have been used to overcome the PIH. To determine the sensitization potential of sunscreen applied immediately after ablative fractional skin resurfacing. Sixty volunteers were recruited. Of these 30 subjects were from previous ablative fractional skin resurfacing study who applied broad-spectrum sunscreen containing anti-inflammatory agent starting on the first day after resurfacing and another 30 non-resurfacing subjects had applied the same sunscreen on the intact skin. All subjects were patch/photopatch tested for sensitization study by using modified human repeated insult patch test (HRIPT). There were significantly higher sensitization rate of UV-filter, octocrylene and the sunscreen in resurfacing group than in non-resurfacing group. Early application of sunscreen after ablative fractional skin resurfacing has increased the incidence of sensitization potential of sunscreen. The sunscreen is recommended to start using from D3 after fractional ablative skin resurfacing to ensure the complete recovery of skin barrier and minimize the risk of sensitization.
Skin Redox Balance Maintenance: The Need for an Nrf2-Activator Delivery System
Directory of Open Access Journals (Sweden)
Maya Ben-Yehuda Greenwald
2016-01-01
Full Text Available The skin, being the largest organ of the body, functions as a barrier between our body and the environment. It is consistently exposed to various exogenous and endogenous stressors (e.g., air pollutants, ionizing and non-ionizing irradiation, toxins, mitochondrial metabolism, enzyme activity, inflammatory process, etc. producing reactive oxygen species (ROS and physical damage (e.g., wounds, sunburns also resulting in reactive oxygen species production. Although skin is equipped with an array of defense mechanisms to counteract reactive oxygen species, augmented exposure and continued reactive oxygen species might result in excessive oxidative stress leading to many skin disorders including inflammatory diseases, pigmenting disorders and some types of cutaneous malignancy. The nuclear factor erythroid 2-related factor 2 (Nrf2 is an emerging regulator of cellular resistance and of defensive enzymes such as the phase II enzymes. Induction of the Keap1–Nrf2 pathway may have a beneficial effect in the treatment of a large number of skin disorders by stimulating an endogenous defense mechanism. However, prolonged and enhanced activation of this pathway is detrimental and, thus, limits the therapeutic potential of Keap1–Nrf2 modulators. Here, we review the consequences of oxidative stress to the skin, and the defense mechanisms that skin is equipped with. We describe the challenges of maintaining skin redox balance and its impact on skin status and function. Finally, we suggest a novel strategy for maintenance of skin redox homeostasis by modulating the Keap1–Nrf2 pathway using nanotechnology-based delivery systems.
A seminar on gardens for the health of the skin.
Ryan, Terence J; Matts, Paul J; Snyder, Brad; Orr, Vanya
2014-05-01
This is a report on a seminar held on January 12, 2013, at the Regional Dermatology Training Centre in Tanzania, sponsored by the International Society of Dermatology as part of its Taskforce Program for Skin Care for All: Community Dermatology. There were four themes: (i) Gardens attached to health centers increase their attractiveness and result in increased attendance and, thus, increase the utilization of effective skin care interventions. Literature on the positive effect of greenery surrounding health centers on health and the environment is reviewed. (ii) Adding an expert on agriculture to the staff of health centers in Rwanda has provided nutrition and safe medicines. (iii) In southern India, these interventions are channeled through the empowerment of tribal women in an area noted for anxiety due to unemployment in the tea and forestry industry. The gardens are used for teaching about nutrition and herbal medicines, and the women are further attracted by childcare facilities. (iv) Measuring barrier function defects gives early warning of malnutrition of the skin after damage by trauma or by ultraviolet radiation. Higher cost research techniques may help to provide the science required to produce its evidence base. In conclusion, Gardens for health should be adopted as policy by skin care providers. © 2014 The International Society of Dermatology.
Bernard, Quentin; Jaulhac, Benoit; Boulanger, Nathalie
2014-05-01
The skin is a critical barrier between hosts and pathogens in arthropod-borne diseases. It harbors many resident cells and specific immune cells to arrest or limit infections by secreting inflammatory molecules or by directly killing pathogens. However, some pathogens are able to use specific skin cells and arthropod saliva for their initial development, to hide from the host immune system, and to establish persistent infection in the vertebrate host. A better understanding of the initial mechanisms taking place in the skin should allow the development of new strategies to fight these vector-borne pathogens that are spread worldwide and are of major medical importance.
Analysis of skin permeation-enhancing mechanism of iontophoresis using hydrodynamic pore theory.
Manabe, E; Numajiri, S; Sugibayashi, K; Morimoto, Y
2000-05-15
The effects of constant DC iontophoresis (0-1.5 mA/0.966 cm(2)) on the permeation of three hydrophilic compounds, antipyrine (ANP, M.W. 188.23), sucrose (SR, M.W. 342.30) and 1-kestose (KT, M.W. 506.73), through excised hairless rat skin were evaluated using hydrodynamic pore theory. The electro-osmotic flow caused by iontophoresis was measured using deuterium oxide (D(2)O). The penetration-enhancing mechanism of iontophoresis was found to increase solvent flow through electro-osmosis and pore enlargement and/or new pore production in the skin barrier, together with enhancement of electrochemical potential difference across the skin. These effects were closely related to the strength of the current applied. The electro-osmotic flow of D(2)O (J(D(2)O)) greatly enhanced the skin permeation clearance of all hydrophilic penetrants (CL(drug)). Pore production was classified into reversible and irreversible processes, which resulted from lower (0-0.5 mA/0.966 cm(2)) and higher (0.5-1. 5 mA/0.966 cm(2)) currents, respectively. Thus, the enhancing effects of iontophoresis on skin permeation of nonionic hydrophilic compounds can be explained by increase in pore size and higher solvent flow.
Del Rosso, James Q.
2013-01-01
This article reviews background on proteases and their functions, their physiological significance in skin, and the potential implications of incorporating specific proteases and protease blends into dermatological products, including skin care formulations. The history of protease blend formulations used in wound model studies and for other disorders is reviewed. In vitro data with use of a specific 3-protease blend with evaluation of the impact on various skin proteins and peptides is also ...
International Nuclear Information System (INIS)
Rieth, K.G.; Comite, F.; Shawker, T.H.; Cutler, G.B. Jr.
1984-01-01
In a random series of 97 children referred to the National Institutes of Health with a presumptive diagnosis of precocious puberty, eight girls were found to have features of the McCune-Albright syndrome, including fibrous dysplasia of bone and/or skin lesions resembling cafe au lait spots. Radiographic evaluation of these patients included computed tomography of the head and pelvic ultrasound. The pituitary glands were suspicious for abnormality in five of the eight girls. Seven girls underwent pelvic ultrasound, and in all of them the ovaries were considered to be abnormal for their chronological age; in addition, two had functional ovarian cysts. The role of diagnostic radiological studies in the diagnosis of this syndrome is discussed
Directory of Open Access Journals (Sweden)
K. E. Kotliar
2016-01-01
Full Text Available Background: Abnormalities of microvasculature could be an early marker of diabetic complications. Therefore, its non-invasive assessment in diabetic patient seems highly relevant. Aim: To assess microcirculation in the skin and retina of patients with diabetes mellitus using optical diagnostic techniques: laser Doppler flowmetry (LDF and Retinal Vessel Analyser (RVA. Materials and methods: Cutaneous microcirculation rhythms were analyzed in 18 patients with type 2 diabetes mellitus and 16 healthy volunteers in the MONIKI (Moscow, Russia. Microcirculation in the dorsal hand and foot skin was assessed by LDF for 2 minutes. The amplitude and frequencies of perfusion oscillations corresponding to the rhythms of various etiologies were computed by Waveletanalysis. Retinal vasomotions and their changes were studied in 33 type 1 diabetic patients compared to 33 healthy volunteers in the Aachen University of Applied Sciences (Germany. Original recordings made by the RVA were used for the analysis with a Fourier transformation, cross-correlation and autocorrelation. Results: There was no significant difference in the hand skin microcirculation rhythms assessed by LDF between patients with diabetes mellitus and healthy volunteers, whereas in the lower extremities, statistically significant differences were found in the amplitude of high-frequency oscillations corresponding to the range of the heart rhythm. These results correlate well with the results of the optical assessment of retinal vasculature, where statistically significant differences in the amplitude of high frequency oscillations corresponding to the heart rate were found. In type 1 diabetic patients the periodicity of venous pulsation was higher than in the control healthy group. Conclusion: Both dynamic analysis of the pulsations and vasomotions of retinal vessels assessed by RVA and analysis of the rhythms of blood circulation in the skin of the lower extremities measured by LDF revealed